Datasets:

tharindu

/

patents

like 0

the present invention provides a dispenser for folded sheets having an overfill prevention device , which effectively prevents the dispenser from being overfilled with folded sheet material . the result of the present invention is that a maintainer of the dispenser will have a difficult time overfilling the dispenser .

reference will now be made in detail to embodiments of the invention , examples of which are illustrated in the drawings . each example is provided by way of explanation of the invention , and not as a limitation of the invention . for example , features illustrated or described as part of one embodiment can be used with another embodiment to yield still a further embodiment . it is intended that the present invention include these and other modifications and variations to the embodiments and examples described herein as coming within the scope and spirit of the invention . to gain a better understanding of the present invention , attention is directed to the figures of the present specification in general . a dispenser 10 is configured to dispense an individual sheet from a stack of folded individual sheets . the dispenser of the present invention is particularly suitable for dispensing paper towels , tissues and other similar products that are available as individual folded sheets from a stack . it should also be appreciated that a dispenser 10 according to the invention is not limited in its overall shape , size or configuration shown in the figures . it should be understood that these particular dispenser shown in the figure is illustrated merely as an example of embodiments of a dispenser that may incorporate the unique features of the present invention . as is shown in fig1 , the dispenser 10 includes a mounting frame 20 adapted to hold a stack of folded sheets ( not shown in fig1 ). the mounting frame 20 has a bottom portion 21 and a top portion 22 , with a bottom panel 29 optionally having a dispensing opening 30 located at or near the bottom portion 21 of the mounting frame 20 . the bottom panel 29 may be a separate component from the mounting frame 20 and joined to the mounting frame 20 using suitable means , such as adhesives , welding or mechanical fasteners . alternatively , the bottom panel 29 may be formed integrally with the mounting plate 20 , such that the mounting plate 20 and bottom panel 29 are one single piece . the mounting frame 20 also includes a back panel 24 , and may have two side walls 27 and 28 . the bottom panel 29 along with the back panel 24 and side walls 27 and 28 , if present , create a storage space 26 that allows the mounting frame 20 to hold the stack of folded articles . the mounting frame 20 is typically mounted to a support surface , such as a wall or the like , which serves to hold the dispenser 10 on the support surface . as such , the back panel 24 may be provided with various mounting means , such as pre - formed holes 25 , as is shown in fig1 , which mechanical fasteners may be used to fasten the mounting frame to the support surface . other suitable mounting means may also be used . referring to both fig1 and 5 , the dispenser 10 further has a cover 40 which is movably attached to the mounting frame 20 . the cover may have side panels 47 , a front panel and interior surface 44 and an exterior surface 42 . as shown in fig1 and 5 , the cover 40 may be attached to the back part of the mounting frame 20 , for example to the bottom panel 29 or the side walls 27 , 28 , and is movable from a closed position , in which the interior storage space 26 of the dispenser , including the stack of folded sheets cannot be accessed other than through the dispensing opening 30 , to an open position , where easy access is provided to the internal storage space 26 for loading additional folded sheets into the storage space . in its closed position , the cover 40 defines a front panel 48 of the dispenser 10 . the cover 40 is pivotally mounted to the stationary part of the mounting frame 20 by a pivotal mounting mechanism 32 located on the mounting frame 20 with a complementary pivot mounting mechanism 50 located on the inside of the cover 20 , in particular on the side panels 47 of the cover 20 . as an example shown in fig1 and 5 , the mounting mechanism 32 is an opening in the bottom panel 29 of the mounting frame 20 and the complementary mounting mechanism 50 on the cover is projection which is sized and shaped to fit into the opening of the mounting mechanism . it should be appreciated that any number of conventional pivotal arrangements are known and may be utilized to pivotally mount the cover 40 to the mounting frame 20 so long as the cover 40 may be easily moved out of the way to access the interior storage space 26 of the dispenser 10 . in addition , the cover 40 may be releasably locked to the mounting frame 20 by any conventional locking device 46 and a complementary lock receiver 34 present on the mounting frame . it should be appreciated that the locking device may be keyed or unkeyed , and that the main purpose of the locking device is to retain the cover 40 in a closed position . as is stated above , the dispenser 10 includes at least one dispensing opening 30 . the dispensing opening 30 is how a user accesses folded sheets 12 and how the folded sheets 12 are dispensed from the internal storage space 26 . in the illustrated embodiment shown in fig1 , the dispensing opening 30 is defined in the bottom panel 29 of the mounting frame . this is not a limitation of the invention . for example , the dispensing opening 30 could also be defined in a bottom portion or panel member of the cover 40 . the dispensing opening 30 may be disposed in any convenient location for a user to pull and dispense the individual folded sheets 12 from the internal storage space 26 . typically , the dispensing opening 30 is located at or near the bottom portion of the mounting frame and will be generally be located in the bottom panel 29 of the mounting frame 20 . a dispenser 10 according to the invention includes an overfill prevention device 60 . the overfill prevention device 60 is configured to be located at or near the top portion of the mounting frame 20 and serves to prevent a service technician from overfilling or stuffing the dispenser with folded sheets 12 to the point where operation of the dispenser is compromised . generally speaking , the overfill prevention device 60 is actuated by movement of the cover 40 . with the cover 40 closed , as the stack of sheets 12 is depleted , the overfill prevention device automatically moves to a position so as to reduce the internal storage space 26 within the mounting frame 20 . when the cover 24 is opened for refilling the stack , the overfill prevention device 60 is engaged and the available space for refilling the stack is restricted . when the cover 40 is subsequently closed after refilling the supply of stacked sheets 12 , the overfill prevention device 60 is disengaged and any compressive forces acting on the stack of sheets 12 is relieved . referring particularly to fig2 - 4 , 6 - 8 , an embodiment of the overfill prevention device 60 is shown . the overfill prevention device 60 has a bracket 62 and a locking element 72 . the bracket 62 has a first section 64 which is pivotally connected to a housing 61 and an opposite second section 66 . in addition , the bracket 62 has a lower portion 67 which is adapted to contact the stack of folded sheets 12 in the dispenser 10 and the upper portion 68 which is adapted to be engaged with the locking element . the bracket 62 is adapted to contact a stack of folded sheets 12 in the second section 66 along the lower portion 67 of the bracket 62 , when the dispenser 10 is filled with a stack of folded sheets 12 . as is stated above , the bracket 62 is pivotally connected to the housing . as a result , the second section 66 of the bracket 62 is free to rotate in an arc 65 about the pivotally connected first section 64 , when the locking element 72 is not engaging the bracket 62 , as will be discussed below . this rotation of the bracket 62 results in the bracket 62 having a filling position , shown in fig6 and a dispensing position , shown in fig8 . the pivotal connection of the bracket 62 to the housing 61 may be achieved through any convention pivotal connection means . as is shown in fig4 , the pivot connection is an axle 69 extending from the first section 64 of the bracket 62 . a complementary slot 88 , which is adapted to accept the axle 69 of the bracket is located on the housing 61 such that the axle 69 will fit into the slot 88 and that the bracket 62 will rotate in an arc 65 , show in fig6 , about the pivotal connection created by the axle i 69 and the slot 88 . other conventional pivot connection may be used , other than the one exemplified in the drawings without departing from the scope of the present invention . for example , the bracket could contain the slot and the housing could contain the axle . by having the bracket 62 pivotally connected to the housing 61 , the second section 66 of the bracket 62 is free to move in an arc 65 about the pivotal connection . this will allow the bracket 62 to rotate from the position shown in fig6 to the position shown in fig8 , when the cover 40 is closed , which is described in more detail below . the locking element 72 is adapted to engage the bracket 62 and serves to hold the bracket 62 in the filling position when the cover 40 of the dispenser 10 is open . in addition , the locking element 72 also releases the bracket 62 when the cover of the dispenser 40 is closed . the locking element 72 will engage the upper portion 68 of the bracket 62 , as is shown in fig6 and holds the bracket 62 in place , preventing the bracket 62 from being moved by the technician filling the dispenser 10 . this will be described in more detail below . the locking element 72 may be a plate 73 as is shown in fig5 , 6 and 7 . generally , the locking element 72 will have a first end 78 and an opposite second end 79 . in addition the locking element 72 is connected to the housing 61 of the overfill prevention device 60 with a pivot connection at or near the first end 78 . as is shown in fig4 , the pivot connection is an axle 76 extending from the first end 78 of the locking element . a complementary slot 86 , which is adapted to accept the axle is located on the housing 61 such that the axle 76 will fit into the slot 86 such that the locking element 72 will rotate in an arc 75 , show in fig6 , about the pivot connection . other conventional pivot connections may be used , other than the one exemplified in the drawings without departing from the scope of the present invention . for example , the locking element could contain the slot and the housing could contain the axle . by having the locking element 72 pivotally connected to the housing 61 , the opposite second end 79 of the locking element 72 is free to move in an arc 75 about the pivot connection . this will allow the locking element 72 to move out of the way of the bracket 62 when the cover 40 is closed so that the bracket 62 can rotate in the arc 65 , which is described in more detail below . the overfill prevention device 60 further has a housing 61 . as described above , the housing 61 serves as pivotal connection points for both the bracket 62 and the locking element 72 . as shown in the drawings , the housing 61 is a separate element from the mounting frame 20 ; however , the housing 61 could be integral with the mounting frame 20 , such that the mounting frame 20 and housing 61 are a single continuous piece . when the housing 61 is a separate element , the housing will generally be provided with a mounting means 81 , which will allow a mechanical fastener to attach the housing 61 to the mounting frame 20 . additionally , the housing 61 serves to protect both the bracket 62 and the locking element 72 from tampering by a technician loading a stack of folded sheets 12 into the dispenser 10 to override the overfill prevention device . referring to fig5 , the inside surface 44 of the cover 40 has at least one projection 84 extending away from the inside surface 44 of the cover 40 . the projection ( s ) 84 on the inside surface 44 of the cover 40 are adapted to engage the locking element 72 , thereby causing the locking element 72 to disengage from contact with the upper portion 68 of the bracket 62 . the projections on the inside of the cover may be integral with the cover ( not shown ) or may be a separate elements which is held to the inside surface 44 via a suitable fastening means 85 . as shown in fig5 , the fastening means 85 is a mechanical fastener ; however other suitable fastening means , such as adhesive attachment , welding or other similar fastening means may be used . further , the size and shape of the projections 84 are not critical to the present invention ; so long as the projections 84 on the inside cover 44 will contact the locking element 72 and disengage the locking element 72 from the upper portion 68 of the bracket 62 , as the cover of the dispenser is closed . the projections can be cylindrical , cuboidal or other similar shapes , for example . the housing 61 of the overfill prevention device 60 further has at least one opening 82 . the opening ( s ) 82 allow the projections 84 on the inside surface 44 of the cover 40 to contact and engage the locking element 72 through the housing 61 . the housing will generally have a top surface 91 , side surfaces 92 and a front face 93 . typically , the openings will be in the front face 93 of the housing . the front face 93 of the housing 61 is the side of the housing 61 that faces away from the mounting frame 20 . typically , the openings 82 in the housing should be positioned in the housing such that the projections 84 will line up with the openings 84 , allowing the projections 84 to contact the locking element 72 as the cover 40 of the dispenser 10 is closed . the size of the opening should be such that the projections 84 easily enter through the opening 82 , but not so large as to allow an adult human finger to fit through the openings 82 . by keeping the openings 82 to smaller than an adult human finger , it is more difficult for a technician to use their finger to override the overfill prevention device 60 . generally , at least one dimension of the opening 82 , such as the diameter or width will be less than 7 mm , more generally less than 5 mm . in addition to the opening 82 , the housing 61 may further have secondary openings 83 therein to confuse a technician that is trying to override the overfill prevention device . the secondary openings 83 are generally positioned such that the locking element 72 cannot be contacted with a probe . the locking element 72 may further optionally have one or more legs 74 , extending from the second end 79 of the locking element 74 . the legs 74 may serve to extend the locking element 74 into the opening 82 so that the projections will easily contact the locking element 72 as the cover 40 is closed . the legs 74 further provide additional weight to the locking element , allowing the locking element to be positioned in the filling position . the bracket 62 will generally have an l shape , a triangular shape or a arc shape . when an l - shape , as is shown in fig3 and 4 , the bracket can have additional features such as supports 70 . the supports 70 help provide structural rigidity to the bracket 62 . no matter what the shape of the bracket 62 , the bracket 62 may be provided with one or more slots 63 which are positioned on the bracket 62 at a location which corresponds with the openings 82 in the housing 61 . the slots 63 facilitate the bracket 62 moving from the filling position , shown in fig6 , to the dispensing position , shown in fig8 . the slots 63 allow the bracket 62 to move from the filling position to the dispensing position around the projections 84 on the inside surface 44 of the cover 40 as the cover is being closed . it is noted that the slots 63 are optional , but depending on the location of the openings 82 in the housing 61 , the slots could be required . that is , the lower on the front face 93 the opening 82 , the more likely the slots 63 will be needed on the bracket 62 . in the present invention , there are typically at least two projections 84 located on the inner surface 44 of the cover 20 , at least two complementary openings in the housing 61 and there are at least two legs 74 of the locking element . typically , there will be two of each . having a single projection , opening or leg could cause the overfill prevention device to not properly work if the projection was damaged . in addition , having two or more of each of these elements allows the force being applied by the projections to be more evenly distributed to the locking element . in the overfill prevention device , the locking element 72 and the bracket 62 are positioned in the filling position , shown in fig6 , by the force of gravity . that is , the natural state for both the bracket 62 and the locking element are in the positions shown in fig6 , even when the dispenser is empty ( i . e ., does not contain a stack of folded sheet ) or the dispenser is less than full ( i . e ., contains less than a full stack of folded sheets . it is noted that both the locking element 72 and the bracket 62 could be biased into the position shown in fig6 , by using mechanical means such as a spring , without departing from the scope of the present invention . however , given that the force of gravity is sufficient , it is preferred that no biasing mean is used . to gain a better understanding of the operation of the overfill prevention device 60 of the present invention , attention is directed to fig6 - 8 . fig6 shows the overfill prevention device 60 in the filling position . in this position , gravity or another biasing force causes both the bracket 62 and the locking element 72 in the position shown in fig6 . in this position , the locking element 72 engages the upper portion 68 of the bracket 68 . this retains the bracket in the position shown in fig6 , such that the lower portion 67 of the bracket 62 limits the number of folded sheets that can be in the stack 12 . generally , the technician will compress the stack 12 so that the maximum number of folded sheets can be loaded into the dispenser 10 . this will result in an upward force 100 being placed on the bracket 62 due to the compression of the folded sheets . this upward force 100 will cause the upper portion 68 of the bracket 62 to apply an upward force onto the locking element 72 . since the locking element 72 is essentially perpendicular to the upper portion 68 , the locking element 72 is unable to rotate out of the way of the bracket 62 . once no additional folded sheets can be added to the stack 12 , the technician will generally close the cover 40 . as the technician closes the cover 40 , the projections 84 on the inner surface 44 of the cover , will move through the opening 82 in the housing 61 . in this regard attention is directed to fig7 . as the projections 84 move through the opening 82 , the projection 84 will contact the locking element 72 . as the cover 40 is continued to be closed by the technician , the locking element 72 is caused to move in an arc 75 about the pivot point 76 . as the locking element 72 clears the upper portion 68 of the bracket 62 , the bracket 62 becomes free from the locking element 72 and the force 100 exerted by the compressed stack of folded sheets 12 cause the bracket 62 to move in the arc 65 about the pivot point 69 . the bracket 62 will move in the arc 65 to a position similar to that shown in fig8 . it is noted that the actual distance the bracket 62 will move is dependent on the force exerted by the stack of folded sheets 12 . it is noted that the stack of folded sheets 12 ′ shown in fig8 is in a less compressed state that the stack shown in fig6 or 7 . applicants also noted that it is not necessary for the bracket 62 to move . if the stack of folded sheets is not compressed , or is only slightly compressed before the cover 40 is closed , it is possible that the bracket could remain in the position shown in fig6 . if the bracket 62 does move to the position shown in fig8 , as the individual sheets are removed from the dispenser and the stack becomes shorter , the bracket 62 will return to the position shown in fig6 . it is noted that the locking element 72 will remain in a position shown in fig8 or will return to a position such that the locking element 72 will contact the projection 84 , until the cover 40 is again opened . once the cover is open , the locking element will return to the position shown in fig6 , provided that a sufficient number of folded sheets are removed from the dispenser . if only a few sheets have been removed , the locking element would remain in the position shown in fig8 . typically , the components of the folded sheet dispenser of the present invention as described above may be formed of any suitable material , including metal , plastic , and so forth . the construction of such dispensers is well known to those skilled in the art and need not be described in great detail herein . the advantages of the present invention is that the overfill prevention device is a simple , low cost and effective way to prevent the technician servicing the folded sheet dispenser from overfilling the dispenser . further , the overfill prevention device of the present invention is functional without the need for biasing elements , that can cause problems and add complexity for prior art overfill prevention devices . although the present invention has been described with reference to various embodiments , those skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention . as such , it is intended that the foregoing detailed description be regarded as illustrative rather than limiting and that it is the appended claims , including all equivalents thereof , which are intended to define the scope of the invention .

US-201113274957-A

a computer - assisted method for quantitative characterization and treatment of ventricular fibrillation includes acquiring a time series of a ventricular fibrillation signal using a probe from a patient experiencing vf , subtracting the mean from the time series of the vf signal , calculating a cumulative vf signal after the mean is subtracted from the time series of the vf signal , segmenting the cumulative vf signal by a plurality of sampling boxes , calculating the root - mean - square of the cumulative vf signal as a function of the sampling box size , extracting an exponent of the root - mean - square of the cumulative vf signal as a function of the sampling box size , applying electrical defibrillation to the patient if the exponent is below a predetermined value , and applying cardiopulmonary resuscitation to the patient if the exponent is above a predetermined value .

referring to fig1 , a vf evaluation system 100 includes an analyzer 110 and a probe 120 that can be attached to a patient 10 . the probe 120 can include a sensor , a transducer , or an electrode ( e . g . in a holter monitor ) configured to measure vf signals from the patient 10 . an example of the vf signals is the surface ecg signal . other examples of the vf signals can include blood pressure and sensing signals obtained by a pulse oximeter . the probe 120 can send the vf signals to the analyzer 110 , often in analog form . the analyzer 110 can include an analog - to - digital ( a / d ) converter for digitizing the vf signals . the analyzer 110 also includes a computer processor 112 that is configured to process and analyze the vf signals after the vf signals are digitized by the a / d converter . a pre - stored algorithm in the analyzer 110 can rapidly analyze the vf signals , and provide guidance to defibrillation treatments , as described in more detail below . the analyzer 110 can also include necessary input / output devices , and a display 115 for displaying the vf signals and the results of the analysis of the vf signals . in some embodiments , referring to fig2 , a time series of a vf signal is recorded using the vf evaluation system 100 from the patient 10 suffering from ventricular fibrillation ( step 210 ). the vf signal can be acquired using the probe 120 in the vf evaluation system 100 ( fig1 ). the vf signal can for example be a surface ecg signal . fig3 a illustrates two exemplified vf signals : a non - shockable vf signal waveform ( s 0 ) and a shockable vf waveform ( s 1 ). a non - shockable vf waveform is a persisted vf or asystole after defibrillation . as a reference for data analysis , a sinusoidal wave having a similar oscillation frequency is also shown in fig3 a . in our analysis , it is conceptualized that vf signals are generated by multiple interacting systems within the heart in a complex but nonrandom process . analytical methods from the field of nonlinear dynamics are adopted to describe the underlying structure of non periodic but deterministic data series . specifically , the vf signals are analyzed using detrended fluctuation analysis ( dfa ) by the analyzer 110 ( fig1 ). the dfa is a scaling analysis method that aims to reveal the correlation properties of a signal . the advantages of the dfa method are that it can detect long - range correlations embedded in seemingly nonstationary waveforms , while also avoiding spurious correlations of non - stationary artifact . in the analysis by the analyzer 110 ( fig1 ), a mean value of the vf signal is calculated and subtracted from the time series of the vf signal ( step 220 ). the cumulative value of the time series of the mean - subtracted vf signal is calculated to produce a cumulative vf signal ( step 230 ). a sampling box size is selected . the time series of cumulative vf signal is segmented into a plurality of sampling boxes having the selected box size ( step 240 ). in the present application , the term “ sampling box ” or “ box ” refers to an interval that is used to segment a period in a vf signal . a trend line is computed in the plurality of sampling boxes having the selected box size ( step 250 ). for example , a trend line in a sampling box can be a linear line with the least square fit to the vf waveform in that sampling box . the trend line is then subtracted from the cumulative vf signal in the sampling box to produce a detrended cumulative vf signal ( step 250 ). a root - mean - square value is then computed for the detrended cumulative vf signal in each of sampling boxes ( step 260 ). the sampling box size is then varied to a different value ( step 270 ). root - mean - square values are computed for the detrended cumulative vf signal in each of the sampling boxes having the new box size ( step 270 ). the steps 220 - 260 are repeated to produce root - mean - square values of the detrended cumulative vf signal as a function of sampling box size , as shown ( e . g . s 0 and s 1 ) in fig3 a . the root - mean - square values of the detrended cumulative vf signal ( i . e . the dfa curves ) can be plotted as a function of sampling box size in a logarithmic scale . referring to fig3 b , the shockable vf signal ( s 1 ) results in lower dfa values over a range of sampling box sizes . the non - shockable vf signal ( s 0 ) has higher dfa values . thus higher dfa values appear to correlate with non - shockable vf signals in late vf . the sampling box sizes are in unit of sampling points . in the data show in fig3 a and 3b , for example , the vf signal can be sampled at 200 points per second resulting in 2000 sampling points in 10 seconds . the dfa values can be plotted in a range of about 5 to 500 sampling points in fig3 b . two regions are identified in the dfa curves ( step 280 ). the sinusoidal wave has lower root - mean - square values and exhibits a crossover between a first region with smaller box sizes and a second region with larger box sizes . the second region can have box size ranging from about 60 sampling points to 250 sampling points . in accordance to the present invention , referring back to fig2 , a slope α2 is extracted from in the second region of the dfa curves ( step 290 ). a slope α1 ( or exponent dfaα1 ) is extracted from in the first region of the dfa curves . in our analysis , dfaα2 is found to be lower than the dfaα1 . the slope α2 approaches zero at large box sizes for sinusoidal waveforms . the crossover point is the crossover point corresponds to a sampling box size of about 80 . since the data are plotted in a logarithmic scale , the slope in the data represents the exponent , thus the scaling properties , of the dfa curves as a function of the sampling box size ( i . e . with the sampling box size as the base of the exponent ). the slopes al and α2 are also referred to as the exponent dfaα1 and dfaα2 . the dfa curves of vf signals s 1 and s 0 exhibit linear trends having similar slope as the sinusoidal wave in the first region . in the second region , the dfa curve of non - shockable vf signal s 0 has a higher slope α2 than the dfa curve of shockable vf signal s 1 , while both of which are higher than the slope α2 for the sinusoidal wave . thus higher slope in the second region of the dfa curve appears to correlate with non - shockable vf signals in late vf . the electrocardiogram recorded from the surface of the body represents the superposition of the electrical fields generated by different volume elements of the heart . thus the patterns in the vf signal are likely related to the underlying organization of the myocardial electrical activities . the presently disclosed analysis has identified several different vf phases ranging from large periodic waveforms in the early vf to infrequent episodic electric activities within a segment of myocardium failing to conduct to adjacent segments . it is observed that the second slope α2 is related to the vf conditions in a patient . it is observed that in early vf , few large periodic waveforms render the surface ecg similar to a sinusoidal wave , characterized by a low slope α2 . in late vf , the waveforms break and degenerate into small infrequent electric activities , resulting in higher slope α2 . in other words , the slope α2 increases as vf worsens over time . the slope α2 or dfaα2 can therefore be used to help medical personnel rapidly quantify the organization property of vf signals in an emergency response to a patient suffering vf . the mechanism of the previously described observations is validated with clinical data . fig4 a shows the time evolution of the second slope α2 ( exponent dfaα2 ) in the root - mean - square of cumulative detrended vf signals obtained from six vf patients . the vf signals are surface ecg signals collected by holter sensors from the patients in a 10 min period , provided by physionet ( a resource for biomedical research and development sponsored by the national institute of biomedical imaging and bioengineering and the national institute of general medical sciences in the national institutes of health ). the second slope α2 ( exponent dfaα2 ) is calculated for each 10 - second period and averaged every one minute in the entire 10 minute period . fig4 a shows the average second slope α2 ( dfaα2 ) and their standard deviations in the ten 1 - min periods . the average second slope α2 ( dfaα2 ) appears to increase over time as vf worsens , which suggests that the dfaα2 is an indicator ( e . g . “ a bio - marker ”) for the worsening of vf , which is consistent with the conceptualized mechanism described above . the time effects of the second slope α2 ( dfaα2 ) are also examined by correlation analysis , as shown in fig4 b , which shows a positive correlation ( p & lt ; 0 . 001 ) between the exponent dfaα2 and time with r squared = 0 . 392 . by using anova , dfaα1 ( p = 0 . 022 ), and dfa α2 ( p & lt ; 0 . 001 ) show significant time - related effects . in accordance to the present invention , referring back to fig2 , the exponent dfa α2 is compared to a predetermined threshold value ( step 300 ). for example , the threshold value can for example be about 0 . 38 . if the exponent dfa α2 is higher than the threshold value ( as shown by s 0 in fig3 a and 3b ), the vf is determined to be late stage ; defribrillation alone cannot terminate vf . cpr is applied to the patient to re - perfuse the patient &# 39 ; s heart ( step 310 ). optionally , the vf signal is monitored and analyzed in real time during the application of cpr , which may show a decrease in the exponent dfa α2 . electrical defibrillation can subsequently be applied to the patient ( step 320 ). if the exponent dfa α2 is lower than the threshold value ( as shown by s 1 in fig3 a and 3b ), the vf is determined to be early stage . electrical defibrillation can be immediately applied to the patient ( step 330 ). in some embodiments , referring to fig5 , cpr is initially applied to a patient experiencing vf ( step 510 ). as an advantage of the presently disclosed system and methods , a vf signal can be acquired non - invasively from the patient during cpr without interfering with the cpr ( step 520 ). the vf signal can be analyzed by the analyzer 110 ( fig1 ) in real time . a mean value of the vf signal is calculated and subtracted from the vf signal ( step 530 ). the cumulative value of the mean - subtracted vf signal is calculated to produce a cumulative vf signal ( step 540 ). a sampling box size is selected . the cumulative vf signal is segmented into a plurality of sampling boxes having the selected box size ( step 550 ). a trend line is computed in the plurality of sampling boxes having the selected box size ( step 560 ). for example , a trend line in a sampling box can be a linear line with the least square fit to the vf waveform in that sampling box . the trend line is then subtracted from the cumulative vf signal in the sampling box to produce a detrended cumulative vf signal ( step 560 ). a root - mean - square value is then computed for the detrended cumulative vf signal in each of sampling boxes ( step 570 ). the sampling box size is then varied to a different value . root - mean - square values are computed for the detrended cumulative vf signal in each of the sampling boxes having the new box size ( step 580 ). the steps 530 - 570 are repeated to produce root - mean - square values of the detrended cumulative vf signal as a function of sampling box size ( step 580 ). the sampling size is varied . the root - mean - square of the detrended cumulative vf signal ( i . e . the dfa curve ) is calculated as a function of sampling box sizes ( step 580 ). two regions having different exponents are identified in the dfa curve ( step 590 ), and the exponents calculated in the two regions ( step 600 ). the second exponent dfa α2 is monitored during the cpr treatment ( step 610 ). if the dfa α2 is found to decrease by more than a predetermined magnitude ( e . g . a decrease of 0 . 1 or 0 . 2 in dfa α2 ), electrical defibrillation can be applied to the patient ( step 620 ). alternatively , the overall magnitude of the detrended root - mean - square curve can be monitored ( step 610 ). if the dfa curve drops in value as a function of the sampling box sizes in the second region , as observed from a display ( 115 , fig1 ) by a medical personnel , electrical defibrillation is applied to the patient ( step 620 ). in this case , it is optional to calculate the exponent of the dfa signal ( i . e . step 590 - 610 can be skipped ). by plotting the dfa curve in real time , cpr can thus be guided not only by a calculated value for the exponent dfa α2 , but also the overall shape of the dfa curve . if the dfa curve decreases in its positive slope and ( i . e . becomes flatter ) in response to the cpr , the likelihood of success for electrical defibrillation is higher . thus , the dfa curve can help emergency medical personnel more easily visualize and determine the state of vf , which leads to a more correct and faster decision on whether the patients should be defibrillated . the disclosed system and methods can include one or more of the following advantages . the systems and methods described in the present application can rapidly and quantitatively distinguish early stage and the late stage of ventricular fibrillation , which can provide timely guidance to the medical personnel on the most effective treatments to patients suffering from ventricular fibrillation . specifically , the disclosed methods can help medical personnel to determine when cpr is needed , and whether to apply electrical defibrillation in accordance to the stage of the vf . the disclosed systems and methods are non - invasive , and can be conveniently applied in oohca . the disclosed systems and methods do not interfere with the cpr treatment , and can thus be applied in conjunction with cpr to increase the rate of successful defibrillation in ventricular fibrillation cardiac arrest . it should be understood that the above described systems and methods are compatible to with different configurations and variations without deviating from the spirit of the present invention . for example , vf signals are not limited to surface ecg waveforms . moreover , the vf signals can be analyzed in different scaling analyses that can extract exponent versus sampling box size . the vf fluctuations can be characterized by two of more regions each characterized by different exponent . the values for the exponents , the crossover point , and the range for the sampling box sizes can differ from the examples used in the present specification and drawings . furthermore , different detrending techniques can be used ; the trends in sampling boxes can be determined using different approaches .

US-82928610-A

apparatus is provided for treating a condition of a subject , including an energy transmitter , which is configured to be positioned outside a body of the subject in a vicinity of a site selected from the group consisting of : a sphenopalatine ganglion , a greater palatine nerve , a lesser palatine nerve , a sphenopalatine nerve , a communicating branch between a maxillary nerve and an spg , an otic ganglion , an afferent fiber going into the otic ganglion , an efferent fiber going out of the otic ganglion , an infraorbital nerve , a vidian nerve , a greater superficial petrosal nerve , and a lesser deep petrosal nerve . a control unit is configured to drive the energy transmitter to transmit energy to the site , and configure the energy to stimulate the site . other embodiments are also described .

fig1 is a schematic illustration of a neural stimulation system 20 , in accordance with an embodiment of the present invention . system 20 typically comprises an implantable neural stimulator 30 , an oral element 32 , and an external control unit 34 . stimulator 30 comprises an elongated support element 36 , one or more electrodes 38 fixed to the support element in a vicinity of a distal end thereof , and circuitry 40 coupled to the support element in a vicinity of a proximal end thereof . circuitry 40 typically comprises a wireless coupling element ( which typically comprises a coil ), and additional elements , such as one or more rectifiers , capacitors , amplifiers , or filters . one or more leads ( not shown in fig1 ), which pass along , through , or around support element 36 , couple electrodes 38 to circuitry 40 . alternatively , the leads function as the support element , i . e ., the support element does not comprise any structural elements in addition to the leads . further alternatively , the leads provide a substantial portion of the structural support of the support element , and the balance of the structural support is provided by other elements . for example , support element 36 may comprise the leads and a flexible sleeve surrounding the leads ; the leads supply most of the structural support of the support element , while the sleeve allows smooth passage of the leads through the greater palatine canal . circuitry 40 is shown schematically in fig1 ; several more detailed configurations of the circuitry are described hereinbelow with reference to fig3 a - b , 4 a - b , and 5 a - d . stimulator 30 is adapted to be passed through a greater palatine foramen 42 of a hard palate 50 of an oral cavity 52 of a subject into a greater palatine canal 54 , such that electrodes 38 are brought into a vicinity of a sphenopalatine ganglion ( spg ) 56 . for some applications , the entire stimulator is contained within greater palatine canal 54 , while for other applications , at least a portion of the circuitry and / or the support element are positioned submucosally in the oral cavity . for clarity of illustration , the greater and lesser palatine nerves , and the greater and less palatine arteries are not shown in the figures . during an implantation procedure , stimulator 30 is typically passed through greater palatine foramen 42 posterior to the greater palatine nerve and artery , which are manipulated into an anterior position within the canal . for some applications , electrodes 38 apply a monophasic waveform to spg 56 , while for other applications , electrodes 38 apply a biphasic waveform . alternatively or additionally , waveforms and / or stimulation techniques may be used that are described in one or more of the patent applications incorporated by reference hereinbelow , or waveforms and / or stimulation techniques may be used that are known in the art of neural stimulation . for some applications , the distal end of support element 36 comprises a surgical punch 60 , which is adapted to be passed through mucosa 58 and greater palatine foramen 42 without requiring a prior surgical incision in the mucosa , i . e ., without requiring the use of a surgical knife or other tool . circuitry 40 is sufficiently small so as to be able to pass through the punch incision without requiring the incision to be surgically enlarged . for some applications , stimulator 30 comprises a locking element , such as in a vicinity of the proximal end thereof , which is adapted to hold the stimulator in place after insertion . for some applications , the locking element comprises a screw , which is adapted to couple the stimulator to the palate or the alveolar process of the maxilla . alternatively or additionally , the locking element comprises a bonding agent , which is adapted to bond the stimulator to the palate , the alveolar process of the maxilla , or an internal surface of greater palatine canal 54 . reference is made to fig2 , which is a schematic cross - sectional illustration of a spring - loaded locking element 62 engaging greater palatine canal 54 , in accordance with an embodiment of the present invention . locking element 62 applies lateral pressure on the interior surface of a portion of greater palatine canal 54 in a vicinity of foramen 42 , thereby locking elongated support element 36 in place in the canal . locking element 62 is configured so as to not interfere with a descending palatine artery 64 or a greater palatine nerve 66 , both of which pass through greater palatine canal 54 . for some applications , support element 36 has a length of between about 1 . 8 and about 3 cm , such as between about 2 . 6 cm and about 3 cm , e . g ., between about 2 . 6 and about 3 cm , such as about 2 . 8 cm , and has a curvature that follows that of the greater palatine canal . for some applications , support element 36 has a diameter at its widest portion of between about 1 and about 4 mm . for some applications , support element 36 comprises a tube . for some applications , support element 36 is semi - rigid ( i . e ., it generally keeps its original shape during a placement procedure ). for example , support element 36 may be sufficiently rigid to enable insertion of the support element into a body of the subject by pushing from a vicinity of a proximal end of the support element . for some applications , support element 36 and electrodes 38 together are similar to conventional concentric needle electrodes , such as medtronic , inc . needle electrode model dcn50 , or oxford instruments plc . needle electrode models x53153 , x53155 , x53156 , x53158 , or x53159 . each of electrodes 38 typically comprises a suitable conductive material , for example , a physiologically - acceptable material such as silver , iridium , platinum , a platinum iridium alloy , titanium , nitinol , or a nickel - chrome alloy . for some applications , each of the electrodes has a surface area of between about 1 and about 8 mm 2 , such as about 2 . 653 or about 6 . 123 mm 2 . for some applications , electrodes 38 are recessed within support element 36 , while for other applications the electrodes are flush with the surface of the support element , or protrude therefrom . electrodes 38 are insulated from one another with a physiologically - acceptable material such as polyethylene , polyurethane , or a co - polymer of either of these . for some applications , the electrodes are spiral in shape , for better contact , and may have a hook shaped distal end for hooking into or near the spg . alternatively or additionally , the electrodes may comprise simple wire electrodes , spring - loaded “ crocodile ” electrodes , or adhesive probes , as appropriate . for some applications , the electrodes are coated with a biocompatible material configured to enhance the surface area of the electrodes , thereby increasing the capacitance and reducing the resistance of the electrodes . for example , the material may comprise a platinum / iridium alloy , and / or may be applied with a sputtering process , such as commercially available from johnson matthey plc , advanced metals technology division ( london , uk ). optionally , support element 36 comprises one or more marks ( not shown ) that indicate the depth of insertion of stimulator 30 into greater palatine canal 54 . alternatively or additionally , for some applications support element 36 comprises a stopper ( not shown ) in a vicinity of the marks , that mechanically prevents insertion of the support element into the canal beyond a certain depth . reference is made to fig3 a - b , 4 a - b , and 5 a - d , which are schematic illustrations of several configurations of stimulator 30 , in accordance with respective embodiments of the present invention . in these embodiments , stimulator 30 comprises a circuit module 41 , which comprises circuitry 40 coupled to a printed circuit board . circuit module 41 has a generally flat shape , typically with a thickness of less than about 2 mm , such as less than about 1 . 2 mm , e . g ., about 1 . 05 mm . for some applications , one or more layers of coating are applied to circuit module 41 , such as in order to provide a conforming , thin , smooth , watertight , biocompatible , and / or mechanically - protective surface . for example , a first , innermost coating may comprise an inert biocompatible polymer , such as parylene c , having a thickness of between about 10 and about 15 microns . a second watertight mineral - based sealant , such as al 2 o 3 , sio 2 , or si 2 n 3 , may be applied over the innermost coating by sputtering . the thickness of the watertight sealant is typically between about 1 and about 2 microns . a third , outermost coating of an inert biocompatible polymer , such as parylene c , having a thickness of between about 10 and about 15 microns , may be applied over the watertight sealant . fig3 a and 3b are schematic illustrations of a laterally displaced configuration of stimulator 30 , in accordance with an embodiment of the present invention . fig3 a shows stimulator 30 in an unfolded position . circuit module 41 has a generally flat shape , and may be generally elliptical , as shown in fig3 a , or may have another shape , such as rectangular . prior to insertion in greater palatine canal 54 , support element 36 is folded at a fold 44 at an angle α approximately equal to the angle between greater palatine canal 54 and hard palate 50 in a vicinity of foramen 42 . during an implantation procedure , ( a ) a submucosal surface on the hard palate is prepared , such as by raising a mucosal flap , by creating a mucosal opening using a retractor , and / or by preparing a submucosal pocket using a tool which has generally the same shape and dimensions as circuit module 41 , ( b ) support element 36 is inserted into greater palatine canal 54 , ( c ) circuit module 41 is placed against the exposed lower surface of hard palate 50 , and ( d ) mucosa 58 is closed over circuit module 41 and the portion of support element that protrudes from greater palatine canal 54 . for implantation procedures during which a mucosal flap is raised , an approximately 3 cm incision is typically required to raise the mucosal flap . for some applications , the circuit module is coupled to the hard palate , such as by using at least one nail or screw ( coupling not shown ). typically , the distal portion of support element 36 beyond fold 44 has a length l 1 of between about 26 and about 30 mm , e . g ., about 28 mm , and the entire stimulator 30 in an unfolded position , including circuit module 41 , has a length l 2 of between about 40 and about 44 mm , e . g ., about 42 mm . fig4 a and 4b are schematic illustrations of out - of - plane configurations of stimulator 30 , in accordance with respective embodiments of the present invention . in these configurations , a proximal end 46 of support element 36 is coupled directly to circuit module 41 , such that an angle β between support element 36 and the surface of circuit module 41 is approximately equal to the angle between greater palatine canal 54 and hard palate 50 in a vicinity of foramen 42 . as in the configuration shown in fig3 a and 3b , circuit module 41 has a generally flat shape , and may be generally elliptical , or may have another shape , such as rectangular . in the configuration shown in fig4 a , proximal end 46 of support element 36 is coupled to circuit module 41 in a vicinity of a center of the surface of the circuit module . for some applications , the circuit module is coupled to the support element such that the longer axis or side of the circuit module is oriented in an anterior - posterior direction . alternatively , the longer axis or side of the circuit module is oriented in a left - right direction , or in another direction . typically , support element 36 has a length of between about 26 and about 30 mm , e . g ., about 28 mm . in the configuration shown in fig4 b , proximal end 46 is coupled to circuit module in a vicinity of an edge of the surface of the circuit module . the support element may be coupled to any point on the edge , e . g ., in a vicinity of an end of a major axis or a minor axis of the circuit module . for some applications , proximal end 46 of support element 36 is coupled to circuit module 41 at a location between the center of the circuit module and the edge of the circuit module . for some applications , the circuit module is coupled to the support element such that the circuit module extends in an anterior direction , in a posterior direction , towards the center of the mouth , or towards the maxillary bone . for example , when the circuit module extends in a posterior direction or towards the center of the mouth , the circuit module is less likely to interfere with branches of the greater palatine nerve or greater palatine artery that extend in an anterior direction from greater palatine foramen 42 . for some applications , circuit module 41 is generally kidney - shaped . during an implantation procedure , ( a ) a submucosal surface on the hard palate is prepared , such as by raising a mucosal flap , by creating a mucosal opening using a retractor , and / or by preparing a submucosal pocket using a tool which has generally the same shape and dimensions as circuit module 41 , ( b ) support element 36 is inserted into greater palatine canal 54 , ( c ) circuit module 41 is placed against the exposed lower surface of hard palate 50 , and ( d ) mucosa 58 is closed over circuit module 41 . for implantation procedures during which a mucosal flap is raised , an approximately 7 mm incision is typically required to raise the mucosal flap . for some applications , the circuit module is coupled to the hard palate , such as by using at least one nail or screw ( coupling not shown ). fig5 a - d are schematic illustrations of a longitudinally - oriented configuration of stimulator 30 , in accordance with an embodiment of the present invention . in this configuration , a proximal end 46 of support element 36 is coupled to circuit module 41 . circuit module 41 has a generally flat shape , and may be generally elliptical , as shown in fig5 a , or may have another shape , such as rectangular . as shown in fig5 b - d , a proximal portion 48 of support element 36 which protrudes from greater palatine canal 54 is sufficiently flexible to follow the contour of the palate and alveolar process . during an implantation procedure , ( a ) a submucosal surface on the hard palate is prepared , such as by raising a mucosal flap , by creating a mucosal opening using a retractor , and / or by preparing a submucosal pocket using a tool which has generally the same shape and dimensions as circuit module 41 , ( b ) support element 36 is inserted into greater palatine canal 54 , ( c ) circuit module 41 is placed against an alveolar process 68 of the maxilla , and ( d ) mucosa 58 is closed over circuit module 41 . for implantation procedures during which a mucosal flap is raised , an approximately 5 mm incision is typically required to raise the mucosal flap . for some applications , the circuit module is coupled to the alveolar process , such as by using at least one nail or screw ( coupling not shown ). reference is made to fig6 a - d , which are schematic illustrations of variable - length support elements 36 , in accordance with respective embodiments of the present invention . in these embodiments , the length of support element 36 is adjustable during the implantation procedure , in order to accommodate differing lengths of greater palatine canal 54 . it is noted that the variation in the length of the greater palatine canal in adults is generally less than +/− 2 mm , so the length of support elements 36 in these embodiment need only vary by a relatively small percentage . in the configuration shown in fig6 a , support element 36 is configured to allow telescopic coupling of a portion 80 of the support element . electrode leads 84 pass through support element 36 , including portion 80 . the leads have sufficient slack so as to not interfere with the expansion and contraction of telescopic portion 80 . in the configuration shown in fig6 b , a portion of support element 36 is shaped so as to define one or more accordion pleats 82 . accordion pleats 82 are typically biased such that they are generally extended when in a relaxed position . electrode leads 84 pass through support element 36 , including the accordion portion . the leads have sufficient slack so as to not interfere with the expansion and contraction of accordion pleats 82 . for some applications , support element 36 comprises a sleeve 88 , which surrounds accordion pleats 82 . the sleeve typically has a length no greater than the length of support element 36 when the support element is in its most contracted position , i . e ., the sleeve surrounds only a portion of the non - accordion - pleated portion of the electrode leads . such a length allows the total length of the support element to vary without being constrained by the length of the sleeve . sleeve 88 typically comprises a flexible , biocompatible material , such as silicone . sleeve 88 typically has a length less than 28 mm , e . g ., less than 26 mm . alternatively , for some applications , electrode leads 84 are accordion - pleated , in which case the electrode leads serve as support element 36 . in the configuration shown in fig6 c , electrode leads 84 are helically wound , so as to form a spring 86 . the spring is typically biased so as to have an expanded resting position . for some applications , support element 36 comprises sleeve 88 , which surrounds spring 86 . the sleeve typically has a length no greater than the length of support element 36 when the support element is in its most contracted position , i . e ., the sleeve surrounds only a portion of the non - helically - wound portion of the electrode leads . such a length allows the total length of the support element to vary without being constrained by the length of the sleeve . in the configuration in fig6 d , electrode leads 84 are shaped to as to define at least one omega - shaped portion 90 . portion 90 is typically biased so as to have extended resting positions . for some applications , support element 36 comprises sleeve 88 , as described above with reference to fig6 b and 6c . reference is made to fig7 a - b , which are schematic illustration of oral element 32 , in accordance with respective embodiments of the present invention . oral element 32 is adapted to be placed in oral cavity 52 in a vicinity of implanted circuitry 40 of stimulator 30 , e . g ., in a vicinity of or in contact with the roof of the oral cavity . oral element 32 typically comprises a power source 72 , such as a rechargeable or disposable battery , circuitry 73 , and at least one wireless coupling element 74 . depending on the specific application , wireless coupling element 74 transmits energy and / or data to circuitry 40 , as described hereinbelow . for some applications , wireless coupling element 74 comprises a relatively large coil or a plurality of smaller coils , which may increase the likelihood that at least some portion of the generated magnetic field achieves good wireless coupling with implanted circuitry 40 of stimulator 30 , even if oral element 32 is not precisely positioned or aligned with respect to stimulator 30 , or if oral element 32 moves slightly after it has been placed against the roof of the oral cavity . for some applications in which wireless coupling element 74 comprises a plurality of coils , the coils are oriented with respect to one another such that the respective axes of the coils are not parallel with one another . for example , the coils may be oriented such that two or three of the axes are approximately orthogonal with one another . in the embodiment shown in fig7 a , oral element 32 is adapted to be temporarily placed in oral cavity 52 , without mechanically coupling the oral element to a surface of the oral cavity . for some applications , oral element 32 is coupled to an oral appliance , as described hereinbelow with reference to fig8 . in the embodiment shown in fig7 b , oral element 32 is adapted to be fixed to the roof of oral cavity 52 , such as by using one or more screws 70 , nails , or other surgical fastening devices . fig8 is a schematic illustration of oral element 32 coupled to an oral appliance 92 , in accordance with an embodiment of the present invention . oral appliance 92 , which is typically shaped generally similarly to an orthodontic retainer , is configured to hold the oral element in a vicinity of or in contact with the roof of the oral cavity in a vicinity of implanted circuitry 40 of stimulator 30 . the use of oral appliance 92 , rather than mechanical coupling of oral element 32 to the roof of the oral cavity , generally reduces the likelihood of contamination . for some applications , oral appliance 92 is generally soft or semi - flexible , while for other applications , the oral appliance is generally rigid . for some applications , oral element 32 does not comprise power source 72 . instead , power is provided by a power source located outside of the oral cavity . for example , the oral appliance may be coupled by a cable to an external driver comprising a power source . for some applications , the driver is coupled to a headset or necklace worn by the subject . the driver or a separate external control unit , instead of oral element 32 , comprises all or a portion of circuitry 73 . for some applications , the driver is coupled to external control unit 34 , while for other applications , the driver comprises external control unit 34 . alternatively , oral element 32 is wirelessly coupled to external control unit 34 , which may or may not be coupled to the external driver . reference is again made to fig5 b - d . in the embodiment of the present invention shown in fig5 b , oral element 32 is configured to be coupled to a molar 98 or other tooth of the subject . for example , the oral element may comprise a clip or adhesive . typically , the oral element is configured to be removably coupled to the tooth . for example , the oral element may be coupled to the tooth only during applications of stimulation by stimulator 30 , and removed between applications of stimulation . in the embodiment shown in fig5 c , oral element 32 is configured to be coupled to gingiva 99 covering alveolar process 68 , and , optionally , to one or more teeth . for some applications , the oral element 32 is coupled to gingival 99 using a clamp 101 . alternatively or additionally , the oral element is adapted to be held in place by the subject biting down on the element . in the embodiment shown in fig5 d , oral element 32 comprises a capsule 200 , which , for some applications , comprises power source 72 and circuitry 73 . oral element 32 further comprises an elongated connecting element 202 , which couples capsule 200 to wireless coupling element 74 . capsule 200 is configured to be placed and held between alveolar process 68 and the inner surface of a cheek 204 . for some applications , capsule 200 is generally cylindrical , similar in shape and size to a conventional dental cotton roll . optionally , the capsule comprises a soft coating . oral element 32 is configured such that wireless coupling element 74 is positioned on the lingual side of the teeth . for some applications , connecting element 202 passes over the occlusal surface of one or more teeth , as shown in fig5 d , while for other applications , connecting element 202 passes around the distal surface of the most distal molar ( configuration not shown ). alternatively , connecting element 202 serves as wireless coupling element 74 . for some applications , capsule 200 does not comprise power source 72 . instead , power is provided by a power source located outside of the oral cavity . for example , the capsule may be coupled by a cable to an external driver comprising a power source . for some applications , the driver is coupled to a headset or necklace worn by the subject . the driver or a separate external control unit , instead of capsule 200 , comprises all or a portion of circuitry 73 . for some applications , the driver is coupled to external control unit 34 , while for other applications , the driver comprises external control unit 34 . in an embodiment of the present invention , system 20 comprises a nasal element instead of or in addition to oral element 32 ( configuration not shown ). the nasal element is adapted to be inserted into a nostril of the subject , e . g ., into the nasal vestibule . the nasal element comprises at least one wireless coupling element 74 that is wirelessly coupled to transmit / receiver 40 of stimulator 30 , for transmitting / receiving power and / or data to / from the stimulator . in this embodiment , circuitry 40 of stimulator 30 is not necessarily positioned at the proximal end of the stimulator . for some applications , circuitry 40 of stimulator 30 comprises a wireless coupling element . wireless coupling element 74 of oral element 32 is adapted to wirelessly transmit energy and / or data to the wireless coupling element of circuitry 40 , and / or to wirelessly receive data form the wireless coupling element of circuitry 40 . for these applications , each of the wireless coupling elements typically comprises at least one coil . for some applications , the wireless coupling elements are wirelessly coupled to one another using induction , such as when the wireless coupling elements are positioned in close proximity to one another . alternatively , the wireless coupling elements are wirelessly coupled to one another using rf energy , such as when the wireless coupling elements are positioned at a greater distance from each other . further alternatively , the wireless coupling elements are wirelessly coupled to one another using another form of energy , such as ultrasound energy , in which case the wireless coupling elements comprises ultrasound transducers , e . g ., piezoelectric transducers . “ transducer element ,” as used in the present application including the claims , means an element adapted to wirelessly transmit and / or receive energy and / or data , including a coil , a piezoelectric transducer , and other wireless transducers known in the art . in an embodiment of the present invention , oral element 32 does not comprise wireless coupling element 74 . instead , power source 72 of the oral element is coupled to circuitry 40 using a wire that passes through mucosa 58 . the techniques of this embodiment are generally more energy - efficient than wireless energy / data transfer techniques . as a result , the battery of power source 72 of oral element 32 may need to be replaced or recharged less frequently , or not at all . for some applications , oral element 32 is adapted to be implanted in a tooth of the subject . for some applications , the implanted oral element comprises a wireless communication element for external wireless communication , such as of data . for some applications , power source 72 comprises a rechargeable or a replaceable battery . reference is made to fig9 , which is a schematic illustration of a contact - based energy transmission configuration of stimulation system 20 , in accordance with an embodiment of the present invention . in this embodiment , a proximal end of support element 36 of stimulator 30 comprises a contact 94 that protrudes slightly from mucosa 58 . oral element 32 comprises a contact 96 , which is brought into physical contact with contact 94 for transmitting power and / or data to / from circuitry 40 . contact 94 of stimulator 30 is typically in sealed contact with mucosa 58 , in a similar manner to pacemaker leads . for some applications , contact 94 is typically semi - spherical in shape , as shown in fig9 . alternatively , contact 94 is generally flat or concave in shape . the use of the contact - based techniques of this embodiment does not require alignment of oral element 32 with circuitry 40 . in addition , the contact - based techniques of this embodiment result in a uniform , predictable transfer of energy , and are generally more energy - efficient than wireless energy / data transfer techniques . as a result , the battery of power source 72 of oral element 32 may need to be replaced or recharged less frequently , or not at all . fig1 is a schematic illustration of a configuration of contact 94 , in accordance with an embodiment of the present invention . in this embodiment , contact 94 comprises positive and negative terminals 95 and 96 , each of which is coupled to a respective lead 84 . for some applications , support element 36 , at a portion thereof which passes through mucosa 58 , comprises a matrix 97 , which is adapted to promote mucosal tissue growth therein . the growth of mucosal tissue in the matrix generally reduces the likelihood of infection , and helps hold contact 94 in place . for some applications , contact 94 and / or matrix 97 is coated with an antiseptic substance , such as an antibacterial substance , to reduce the likelihood of infection passing from the oral cavity through the mucosa . reference is made to fig1 a , which is a schematic illustration of energy and data transmission paths between components of system 20 , in accordance with an embodiment of the present invention . typically , wireless coupling element 74 of oral element 32 is adapted to wirelessly transmit energy to circuitry 40 of stimulator 30 , for powering the stimulator , as symbolically indicated by an arrow 100 . the close proximity of the wireless coupling elements of oral element 32 and stimulator 30 generally allows the use of relatively low energy levels and / or a small receiving element in circuitry 40 , e . g ., a small coil or piezoelectric transducer . in an embodiment of the present invention , the energy transmitted to circuitry 40 of stimulator 30 does not include the stimulation waveform to be applied using electrodes 38 . instead , energy is typically transferred using a continuous wave ( i . e ., electromagnetic energy of constant amplitude and frequency ). circuitry 40 of stimulator 30 is configured to generate the stimulation waveform applied by electrodes 38 . alternatively , the energy is transferred using a quasi - continuous wave , which encodes data , which data is used by circuitry to generate the stimulation waveform applied by electrodes 38 . the techniques of this embodiment may be employed , for example , with the configurations of stimulation system 20 described hereinabove with reference to fig1 and / or 8 , and / or hereinbelow with reference to fig1 - 14 and / or 15 . the transfer of energy only , in accordance with this embodiment , generally allows complete control of the waveform delivered by electrodes 38 , because the generation of the waveform is independent of the wireless coupling of oral element 32 and circuitry 40 of stimulator 30 . furthermore , for some applications , circuitry 40 generates a bipolar waveform , which typically reduces the total accumulated charge in the tissue , thus improving safety and electrode life span . for some applications , wireless coupling element 74 of oral element 32 is additionally configured to transmit and / or receive data to / from circuitry 40 of stimulator 30 , as indicated by an arrow 102 . such data typically includes stimulation control signals , parameters , and / or feedback information . such data is typically transmitted only periodically , rather than constantly during stimulation . circuitry 40 of stimulator 30 configures at least a portion of the stimulation parameters based on the received information . for these applications , circuitry 40 of stimulator 30 is configured to generate the stimulation waveform applied by electrodes 38 , based on the configured parameters . for some applications , wireless coupling element 74 of oral element 32 ( either the same wireless coupling element used for transmitting and receiving data to and from circuitry 40 of stimulator 30 , or a separate wireless coupling element ) is adapted to wirelessly relay the data to and receive data from external control unit 34 ( as indicated by an arrow 104 ), which also comprises a wireless coupling element 106 . typically , but not necessarily , substantive processing and generation of the data is performed exclusively by external control unit 34 , rather than by oral element 32 . for some applications , wireless coupling element 74 combines the data and the energy transmitted to circuitry 40 of stimulator 30 into a single signal , such as by modulating the data onto the carrier frequency of the transmitted energy , in which case circuitry 40 demodulates the received signal to obtain the data . alternatively , wireless coupling element 74 transmits the data and the energy in separate signals . alternatively , for some applications , circuitry 40 of stimulator 30 is configured to transmit and / or receive all or a portion of the data directly to / from external control unit 34 ( as indicated by an arrow 108 ), bypassing oral element 32 , such as by using a vhf signal . for some applications in which the energy is transferred using a continuous wave , the energy is transferred from outside the body of the subject , e . g ., from a vicinity of the cheek or ear of the subject , rather than from oral element 32 . this is possible because the continuous wave generally has low peak power levels . for these applications , system 20 typically does not comprise oral element 32 . in an embodiment of the present invention , circuitry 73 of oral element 32 generates the stimulation waveform , and wirelessly transmits the waveform to circuitry 40 of stimulator 30 . for these applications , circuitry 40 of stimulator 30 is generally passive , and simply relays the received waveform to electrodes 38 with minimal or no processing . circuitry 40 typically comprises a simple circuit , including one or more rectifiers and capacitors . the techniques of this embodiment may be employed , for example , with the configurations of stimulation system 20 described hereinabove with reference to fig1 , 8 , and / or 9 . for some applications , system 20 is configured to perform a calibration procedure in which the absolute energy level of the applied waveform is determined , and adjusted appropriately to achieve a desired stimulation level . such calibration compensates for the patient - to - patient variability in energy transfer , caused , for example , by differences in placement and / or orientation of oral element 32 or circuitry 40 of stimulator 40 , and / or inter - patient anatomical differences , e . g ., thickness of the mucosa . reference is made to fig1 b , which is a schematic illustration of energy and data transmission paths between components of system 20 , in accordance with an embodiment of the present invention . except as described hereinbelow , this embodiment is similar to the embodiment described hereinabove with reference to fig1 a . in this embodiment , system 20 additionally comprises an external driver 110 , which comprises power source 72 and circuitry 73 . oral element 32 comprises wireless coupling element 74 , but typically does not comprise power source 72 or circuitry 73 ( the oral element and / or the wireless coupling element may comprise minimal circuitry , such as one or more rectifiers or capacitors ). oral element 32 is electrically coupled to external driver 110 by an elongated flexible coupling element 112 , which comprises one or more wires . driver 110 is typically adapted to be physically coupled to a body of the subject , such as by being coupled to headset or a necklace . driver 110 typically comprises a wireless coupling element 114 , which the driver uses to wirelessly relay data to and receive data from external control unit 34 ( as indicated by an arrow 116 ). for example , the data may be transmitted using the bluetooth protocol or another wireless communication protocol , or using an infrared signal . alternatively , driver 110 is coupled to external control unit 34 by one or more wires ( configuration not shown ). reference is made to fig1 , which is a schematic illustration of a neural stimulation system 120 , in accordance with an embodiment of the present invention . except as noted hereinbelow , elements of system 120 are the same as corresponding elements of system 20 having the same reference numerals . system 120 comprises implantable neural stimulator 30 and external control unit 34 . stimulator 30 comprises elongated support element 36 , one or more electrodes 38 fixed to the support element in the vicinity of the distal end thereof , and an implantable submucosal antenna 122 coupled to the support element in a vicinity of the proximal end thereof . submucosal antenna 122 is adapted to be implanted in the roof of oral cavity 52 between oral mucosa 58 and a palate , e . g ., hard palate 50 and / or a soft palate 134 , and to generally conform to the shape of the palate . fig1 is a schematic illustration of implantable submucosal antenna 122 , in accordance with an embodiment of the present invention . submucosal antenna 122 comprises a thin , flexible sheet 124 , which comprises at least one coil 126 . sheet 124 comprises a flexible biocompatible material , such as silicone . reference is made to fig1 a , which is a schematic illustration of energy and data transmission paths between components of system 120 , in accordance with an embodiment of the present invention . system 120 typically lacks oral element 32 of system 20 . instead , external control 34 unit is adapted to transmit power , typically using rf energy , directly to submucosal antenna 122 , for powering stimulator 30 , as indicated by an arrow 140 , and to transmit and / or receive data directly to / from the submucosal antenna , as indicated by an arrow 142 . such data typically includes stimulation control signals , parameters , and / or feedback information . such data is typically transmitted only periodically , rather than constantly during stimulation . circuitry 40 of stimulator 30 is configured to generate the stimulation waveform applied by electrodes 38 , based on the configured parameters . for some applications , wireless coupling element 106 combines the data and the energy into a single signal , such as by modulating the data onto the carrier frequency of the transmitted energy , in which case submucosal antenna 122 demodulates the received signal to obtain the data . alternatively , wireless coupling element 106 transmits the data and the energy in separate signals . alternatively , for some applications , stimulator 30 additionally comprises a wireless coupling element 144 , to / from which external control unit 34 transmits and / or receives data , such as by using a vhf signal . typically , external control unit 34 is adapted to be placed in a vicinity of a head of the subject , such as in a vicinity of an ear of the subject . for some applications , external control unit 34 is adapted to be coupled to the ear . for example , the control unit may comprise or be integrated into a wired or wireless headset , such as a cellular phone headset . reference is made to fig1 b , which is a schematic illustration of energy and data transmission paths between components of system 120 , in accordance with an embodiment of the present invention . except as described hereinbelow , this embodiment is similar to the embodiment described hereinabove with reference to fig1 a . in this embodiment , system 120 additionally comprises external driver 110 , which comprises power source 72 , circuitry 73 , and at least one wireless coupling element 128 . driver 110 is typically adapted to be worn by the subject , such as by being coupled to headset or a necklace . driver 110 is adapted to use wireless coupling element 128 to transmit power , typically using rf energy , directly to submucosal antenna 122 , for powering stimulator 30 , as indicated by an arrow 140 , and to transmit and / or receive data directly to / from the submucosal antenna , as indicated by an arrow 142 . driver 110 typically uses wireless coupling element 128 , or a separate wireless coupling element ( not shown ), to wirelessly relay data to and receive data from external control unit 34 ( as indicated by an arrow 130 ). for example , the data may be transmitted using the bluetooth protocol or another wireless communication protocol , or using an infrared signal . alternatively , driver 110 is coupled to external control unit 34 by one or more wires ( configuration not shown ). reference is made to fig1 , which is a schematic illustration of a configuration of stimulator 30 for use in stimulation system 120 , described hereinabove with reference to fig1 - 14 , in accordance with an embodiment of the present invention . in this embodiment , instead of submucosal antenna 122 , system 120 comprises a coil antenna 160 , at least a portion of which is coiled around at least a portion 162 of support element 36 . alternatively , coil antenna 160 is an integral part of portion 162 . for some applications , coil antenna 160 comprises ferrite . for some applications , a sleeve is placed around all or a portion of coil antenna 160 and / or support element 36 ( configuration not shown ). typically , the distal end of support element 36 comprises surgical punch 60 , described hereinabove with reference to fig1 . for some applications , coil antenna 160 comprises a plurality of coils arranged in various orientations , which generally improves wireless coupling with wireless coupling element 106 of external control unit 34 . for example , the plurality of coils may comprise two or three coils oriented approximately orthogonally to one another . in the configuration shown in fig1 , support element 36 and coil antenna 160 are typically adapted to be contained entirely within greater palatine canal 54 . reference is made to fig1 , which is a schematic illustration of a configuration of electrodes 38 , in accordance with an embodiment of the present invention . in this embodiment , electrodes 38 comprise at least one ( e . g ., exactly one ) cathode 150 , and at least one ( e . g ., exactly one ) anode 152 . cathode 150 is typically located closer to a distal tip 154 of support element 36 than is anode 152 . typically , a length l 1 of anode 152 is greater than a length l 2 of cathode 150 , such as at least 200 % of length l 2 . a closest distance d 1 between cathode 150 and anode 152 is typically greater than a closest distance d 2 between any portion of cathode 150 and any portion of spg 56 . in an embodiment of the present invention , a method for implanting stimulator 30 in greater palatine canal 54 comprises placing the stimulator in a bore of a needle having a sharp distal tip , passing the needle through mucosa 58 and greater palatine foramen 42 , into canal 54 , and withdrawing the needle , thereby leaving the stimulator implanted in the canal . alternatively , the needle is first passed into canal 54 , and stimulator 30 is subsequently introduced into the bore of the needle . the needle is typically passed through mucosa 58 without requiring a prior surgical incision in the mucosa , i . e ., without requiring the use of a surgical knife or other tool . alternatively , prior to insertion of the needle into the canal , a submucosal surface on the hard palate is prepared , such as by raising a mucosal flap , and / or by creating a mucosal opening using a retractor . reference is made to fig1 a - c , which are schematic illustrations of an array 190 of electrodes 38 , in accordance with an embodiment of the present invention . in this embodiment , stimulator 30 of system 20 or 120 comprises array 190 , which typically comprises between about 8 and about 32 electrodes 38 , such as about 32 electrodes . fig1 a shows array 190 in a flat , unrolled position . typically , the array is organized in rows and columns , for example , between about 2 and about 8 rows , e . g ., 8 rows , and between about 2 and about 4 columns , e . g ., 4 columns . fig1 b shows array 190 encircling support element 36 ( only a single column of electrodes 38 is visible in the figure ). ( for the sake of illustration , support element 36 is visible between electrodes 38 in fig1 b ; in actual applications , a portion of the support element may be concealed by structural elements of array 190 .) fig1 c is a cross - sectional top - view of one row of electrodes 38 . for some applications , array 190 is fabricated on a flat substrate 192 ( fig1 a ), which is wrapped around support element 36 ( fig1 b ). for some applications , substrate 192 extends longitudinally along all or a portion of the length of support element 36 , electrodes 38 are positioned in a distal region of the substrate , and circuitry of stimulator 30 , such as circuitry 40 , amplifier , and / or filters , is affixed to the substrate , e . g ., in a proximal region of the substrate . for other applications , stimulator 30 does not comprise substrate 192 , and electrodes 38 are coupled directly to , or are integral with , support element 36 . it is noted that although stimulator 30 is generally shown in the figures as comprising array 150 of electrodes 38 , this is for the sake of illustration only ; embodiments described and shown herein may use the electrode configuration described hereinabove with reference to fig1 ; electrode configurations described in u . s . patent application ser . no . 10 / 783 , 113 , such as with reference to fig1 , 13 , or 14 thereof ; electrode configurations described in the other patent applications incorporated by reference hereinbelow ; or electrode configurations known in the art of neural stimulation . in an embodiment of the present invention , stimulator 30 comprises a plurality of electrodes , at least a portion of which are adapted to be separately activatable . system 20 or 120 is adapted to use a calibration algorithm to activate , during a plurality of calibration periods , respective different sets of one or more of electrodes 38 , in order to determine which set &# 39 ; s activation causes a level of stimulation of the spg closest to a desired level . for example , the desired level may be the maximum level that can be achieved for a given set of stimulation parameters . for some applications , the algorithm is alternatively or additionally used for setting a level of one or more stimulation parameters . system 20 or 120 typically uses the algorithm to determine the optimum set of electrodes after stimulator 30 has been implanted , so as to obviate the need to adjust the location of the stimulator after it has been implanted . alternatively or additionally , the position of stimulator 30 is adjusted responsively to information derived using the algorithm . for some applications , during post - calibration ( i . e ., therapeutic ) stimulation , the system activates different sets of electrodes at different times , such as in order to vary the level of stimulation applied to the spg . in an embodiment of the present invention , the level of stimulation of the spg is determined by receiving feedback directly from the spg , or from other neural tissue in a vicinity of the spg , i . e ., by using at least a portion of electrodes 38 to directly measure a level of stimulation of the spg or the other neural tissue at or in a vicinity of the site ( s ) of the stimulation by the electrodes . for some applications , the at least a portion of electrodes 38 measure an electrical field of nervous tissue of the spg or the other neural tissue induced by the electrical stimulation of the spg . typically , the signal generated by the sensed field is filtered to remove any artifacts in the signal generated by the stimulation applied by electrodes 38 . for some applications , the same set of one or more electrodes applies stimulation and measures the achieved stimulation of the spg , by measuring the level of stimulation of the spg or the other neural tissue . for other applications , a first set of one or more electrodes applies the stimulation , and a second set of one or more electrodes measures the achieved stimulation . typically , the second set of electrodes is located in a vicinity of the first set of electrodes , and / or adjacent to the first set of electrodes in array 190 . alternatively or additionally , for some applications , the level of stimulation of the spg is determined by assessing an indirect physiological parameter of the subject related to the level of spg stimulation , such as cerebral blood flow ( cbf ) and / or bbb permeability . for some applications , assessment techniques described hereinbelow are used . for some applications , a healthcare worker enters the values of the indirect physiological parameter into system 20 , while for other applications , a device for measuring the indirect physiological parameters is coupled to system 20 , and communicates the parameters to the system . for some applications , system 20 is configured to select the desired set of electrodes 38 . alternatively or additionally , system 20 comprises an output unit , such as a display , which presents the results of the calibration algorithm to a healthcare worker , who selects the desired set of electrodes . in an embodiment of the present invention , stimulator 30 is autonomically powered , such as by utilizing temperature differentials within the subject , e . g ., using techniques described in the above - mentioned u . s . pat . nos . 6 , 470 , 212 to weijand et al . and 6 , 640 , 137 to macdonald , mutatis mutandis , or other techniques known in the art for generating energy from biological processes for powering an implanted medical device . for some applications , circuitry 40 of stimulator 30 does not comprise a wireless coupling element , or the wireless coupling element is used only for data transmission , rather than for wirelessly receiving energy . in the latter case , data is typically transmitted from and / or to external control unit 34 . in an embodiment of the present invention , electrodes 38 are located in a vicinity of a proximal end of support element 36 , such that the electrodes apply electrical stimulation to greater palatine nerve 66 in a vicinity of the proximal opening of greater palatine foramen 42 . for example , a closest distance between the electrodes and the proximal opening of the greater palatine foramen may be less than 10 mm , e . g ., less than 5 mm . for some applications , upon implantation of stimulator 30 , electrodes 38 are contained entirely within greater palatine canal 54 , while for other applications , all or a portion of the electrodes are located submucosally outside of the canal and the foramen . although electrodes 38 have been described as being applied to an spg of the subject , for some applications the electrodes are applied to another mts of the subject , as defined hereinabove . for some of these applications , electrodes 38 are passed through the greater palatine canal to the mts , while for other applications the electrodes are passed through only a portion of the greater palatine canal , or are advanced to the mts by another route . fig1 a schematic pictorial view of a stimulation system 500 , for stimulation of a sphenopalatine ganglion ( spg ) system , as defined hereinabove , and / or at least one other appropriate “ modulation target site ” ( mts ), as defined hereinabove , such as spg 56 , in accordance with an embodiment of the present invention . stimulation system 500 comprises a support element 510 , which typically , but not necessarily , is generally rigid ( i . e ., it generally keeps its original shape during a placement procedure ). a distal end 512 of support element 510 comprises one or more electrodes 514 . for some applications , electrodes 514 are recessed within support element 510 , as shown in the figure , while for other applications the electrodes are flush with the surface of the support element , or protrude therefrom . alternatively , the electrodes are configured as shown in fig1 and 14 of u . s . patent application ser . no . 10 / 783 , 113 . support element 510 is adapted to be inserted into a vicinity of an mts or an spg system of the subject , as defined hereinbelow , via a greater palatine canal in a roof of an oral cavity of the subject . typically , support element 510 is substantially straight . support element 510 typically comprises one or more marks 516 that indicate the point at which the support element has been sufficiently inserted into the greater palatine canal . alternatively or additionally , support element 510 comprises a stopper ( not shown ) in a vicinity of marks 516 , that mechanically prevents further insertion of the support element into the canal . stimulation system 500 further comprises a semi - flexible oral appliance 518 , which is physically coupled to support element 510 by flexible leads 520 . oral appliance 518 comprises a neurostimulator 522 , which is electrically coupled to electrodes 514 via leads 520 . an upper surface 524 of oral appliance 518 is shaped to fit closely to the roof of the oral cavity , and is adapted to be coupled thereto . for example , oral appliance 518 may be shaped generally similarly to an orthodontic retainer . neurostimulator 522 is typically battery - powered , and configurable to drive electrodes 514 to stimulate the mts or spg system . for some applications , the subject himself activates neurostimulator 522 . stimulation system 500 is typically adapted to remain in the oral cavity for between several hours and about two days . in an embodiment of the present invention , a stimulation system for application to a subject comprises an elongated support element having a length of between about 1 . 8 cm and about 4 cm , such as a length of between about 1 . 8 cm and about 3 cm . the support element comprises one or more electrodes fixed thereto in a vicinity of a distal end thereof . the stimulation system further comprises a control unit , coupled to the support element in a vicinity of a proximal end thereof . the control unit typically comprises a battery , and is adapted to drive the electrodes to apply an electrical current to tissue of the subject , such as the spg system and / or at least one mts . the control unit typically configures the current to have a pulse frequency of between about 10 hz and about 50 hz , an amplitude of between about 0 . 2 v and about 10 v , a pulse width of between about 50 microseconds and about 5 milliseconds , and , in alternation , on periods of between about 1 second and about 2 minutes , and off periods of between about 1 second and about 2 minutes . ( together , the on and off periods define a duty cycle .) for example , the control unit may drive the electrodes to apply the current having on periods of between about 60 seconds and about 105 seconds , and off periods of between about 30 seconds and 90 seconds , e . g ., on periods of about 90 seconds , and off periods of about 60 seconds . for some applications , the support element is semi - rigid . for example , the support element and the electrodes together may be similar to conventional concentric needle electrodes , such as medtronic , inc . needle electrode model dcn50 , or oxford instruments plc . needle electrode models x53153 , x53155 , x53156 , x53158 , or x53159 . for some applications , the stimulation system comprises an oral appliance , coupled to the support element , and shaped so as to define a surface that fits closely to a roof of an oral cavity . for example , the oral appliance may be similar to oral appliance 518 , described hereinabove with reference to fig1 . for some applications , the control unit has a volume , including the battery , of less than about 3 cm 3 . in an embodiment of the present invention , a stimulation system for application to a subject comprises an elongated support element having a length of between about 1 . 8 cm and about 4 cm , such as a length of between about 1 . 8 cm and about 3 cm . the support element comprises one or more electrodes fixed thereto in a vicinity of a distal end thereof , and a receiver , fixed to the support element in a vicinity of the proximal end thereof . the stimulation system further comprises a control unit , adapted to be coupled to the receiver . the control unit is adapted to drive the electrodes via the receiver to apply an electrical current to tissue of the subject , such as the spg system and / or at least one mts . the control unit typically configures the current to have a pulse frequency of between about 10 hz and about 50 hz , an amplitude of between about 0 . 2 v and about 10 v , a pulse width of between about 50 microseconds and about 5 milliseconds , and , in alternation , on periods of between about 1 second and about 2 minutes , and off periods of between about 1 second and about 2 minutes . ( together , the on and off periods define a duty cycle .) for example , the control unit may drive the electrodes to apply the current having on periods of between about 60 seconds and about 105 seconds , and off periods of between about 30 seconds and 90 seconds , e . g ., on periods of about 90 seconds , and off periods of about 60 seconds . for some applications , the receiver comprises an electrical contact site , and the control unit is adapted to be coupled to the receiver by being brought into physical contact with the electrical contact site . for example , the control unit may be brought into physical contact by positioning the control unit inside an oral cavity of the subject . for some applications , the stimulation system comprises an oral appliance , adapted to be fixed to the control unit , and shaped so as to define a surface that fits closely to a roof of an oral cavity . for example , the oral appliance may be similar to oral appliance 518 , described hereinabove with reference to fig1 . alternatively , the receiver comprises a transducer , and the control unit comprises a wireless transmitter , which is adapted to couple the control unit to the receiver via wireless electromagnetic communication with the transducer . typically , the transducer comprises a coil . for some applications , the control unit is adapted to be positioned outside of a head of the subject . alternatively , the control unit is adapted to be placed in the oral cavity , such as by being fixed to an oral appliance . for some applications , the receiver has a volume of less than about 0 . 8 cm 3 , such as less than about 0 . 15 cm 3 . for some applications , stimulator 30 is implanted using techniques described in a us patent application filed may 11 , 2005 , entitled , “ surgical tools and techniques for stimulation ,” which is assigned to the assignee of the present application and is incorporated herein by reference . in the present patent application , “ spg system ” means the spg and associated neuroanatomical structures , including neural tracts originating in or reaching the spg , including outgoing and incoming parasympathetic and sympathetic tracts , which tracts include preganglionic fibers of the spg ( e . g ., fibers contained within the vidian nerve ) and postganglionic fibers of the spg ( fibers that travel anterogradely from the spg toward the brain vascular bed , including the retro - orbital branches of the spg , which are fibers that connect the spg with orbital neural structures ). in an embodiment of the present invention , during placement of electrodes 38 at an mts , as defined hereinabove , at least one physiological indicator of cerebral blood flow ( cbf ) is observed or measured concurrently with or after placement . for some applications , optimization of placement of electrodes 38 onto the appropriate neural structure is performed by activating the stimulator , and generally simultaneously monitoring cbf while manipulating the electrodes , and / or adjusting at least one parameter of the applied stimulation , so as to increase or decrease cbf , as appropriate . alternatively or additionally , this technique is used to verify the placement of electrodes 38 after implantation , and / or to select which combination of electrodes to use , such as by using the feedback algorithm described hereinabove . alternatively or additionally , a similar optimization process is performed , either during or after placement of electrodes 38 , to determine parameters of the applied current so as to achieve a desired effect , e . g ., on cbf or bbb permeability , as indicated by cbf . physiological indicators of cbf include , but are not limited to , the following : a measure of vasodilation of blood vessels of the eye , determined by unaided visual inspection or by using an instrument , e . g ., an instrument comprising machine vision functionality ; transcranial doppler ultrasonography measurements ; a measure of forehead perfusion , measured , for example , using laser doppler perfusion imaging ( ldi ) and / or using a temperature sensor ; and / or near infrared spectroscopy ( nirs ) measurements . other appropriate measurements indicative of cbf for use with these embodiments of the present invention will be apparent to those skilled in the art , having read the disclosure of the present patent application . for some applications , one or more of the devices described hereinbelow with reference to fig1 - 21 are used for assessing a physiological indicator of cbf . fig1 is a schematic illustration of a vasodilation measurement instrument 230 , in accordance with an embodiment of the present invention . instrument 230 comprises an image sensor 234 ( e . g ., a ccd or cmos sensor , or another camera ) and processing circuitry 238 , in order to provide machine vision functionality . image sensor 234 is directed towards an eye 232 of the subject . the instrument measures the ratio of red to white in the sclera of eye 232 , or another indication of vasodilation . fig2 is a schematic illustration of a laser doppler perfusion ( ldi ) device 270 , in accordance with an embodiment of the present invention . ldi device 270 comprises a laser source 271 , a scanner 272 , and a computer 281 . scanner 272 is positioned near a forehead 241 of the subject for measuring forehead perfusion . fig2 is a schematic illustration of a thermometer 280 , in accordance with an embodiment of the present invention . thermometer 280 is positioned touching a forehead 241 of the subject for measuring forehead perfusion . fig2 is a schematic illustration of a transcranial doppler ultrasonography device 284 , in accordance with an embodiment of the present invention . transcranial doppler ultrasonography device 284 is positioned touching a head 288 of the subject for measuring cbf . for some applications , the measurement device , such as those described hereinabove with reference to fig1 - 21 , comprises an output unit 236 , such as a numeric display , tone generator , color display , or other output device , for outputting a signal indicative of the measured physiological parameter . alternatively or additionally , instrument 230 is coupled to an internal or external control unit of system 20 or 120 , and communicates the signal directly to the control unit . in an embodiment of the present invention , during placement of electrodes 38 at an mts , as defined hereinabove , penetration of a systemically administered dye into an eye of the subject is observed or measured concurrently with or after placement , as an indication of a level of increased permeability of the bbb . for example , the dye may include fluorescein dye . for some applications , optimization of placement of electrodes 38 onto the appropriate neural structure is performed by activating the stimulator , and generally simultaneously monitoring the penetration of the dye while manipulating the electrodes , and / or adjusting at least one parameter of the applied stimulation , so as to increase or decrease permeability of the bbb , as appropriate . alternatively or additionally , this technique is used to verify the placement of electrodes 38 after implantation , and / or to select which combination of electrodes to use , such as by using the feedback algorithm described hereinabove . alternatively or additionally , a similar optimization process is performed , either during or after placement of electrodes 38 , to determine parameters of the applied current so as to achieve a desired effect , e . g ., on cbf or bbb permeability , as indicated by bbb permeability . in an embodiment of the present invention , one or more of the above - described cbf - based assessment techniques are used by a healthcare worker after implantation to assess ( a ) whether electrodes 38 retain appropriate placement and contact with the mts , and / or ( b ) whether parameters of the applied current ( e . g ., magnitude , frequency , duration , scheduling ) continue to achieve the desired effect , e . g ., on cbf or bbb permeability . for example , such an assessment may be performed periodically during post - implantation follow - up care . in an embodiment of the present invention , the cbf - based assessment techniques described hereinabove are used to assist in determining the effective dosage and / or other parameters for presenting odorants to an air passage of the patient , as described in u . s . patent application ser . no . 10 / 512 , 780 , filed oct . 25 , 2004 , which is assigned to the assignee of the present application and is incorporated herein by reference . in an embodiment of the present invention , chemical stimulation of at least one mts is achieved by presenting chemicals , for example in a liquid or gaseous state , to an air passage of the subject , such as a nasal cavity or a throat , or in a vicinity thereof . the temporal profile and other quantitative characteristics of such chemical modulation are believed by the present inventors to have a mechanism of action that has a neuroanatomical basis overlapping with that of the electrical modulation of the mts . for some applications , chemical - presentation techniques described herein are practiced in combination with techniques described in u . s . patent application ser . no . 10 / 512 , 780 , filed oct . 25 , 2004 , and / or u . s . patent application ser . no . 10 / 952 , 536 , filed sep . 27 , 2005 , both of which are assigned to the assignee of the present patent application and are incorporated herein by reference . in these chemical - presentation applications , an extent to which the chemical has achieved the desired effect ( e . g ., increased permeability of the bbb , or increased or decreased cbf ) is determined by monitoring real - time changes in cbf , and adjusting the dose of the chemical responsive thereto . chemicals that may increase or decrease cerebral blood flow and / or the permeability of the blood - brain barrier ( e . g ., via modulation of spg - related fibers ), include , but are not limited to , propionic acid , cyclohexanone , amyl acetate , acetic acid , citric acid , carbon dioxide , sodium chloride , ammonia , menthol , alcohol , nicotine , piperine , gingerol , zingerone , allyl isothiocyanate , cinnamaldehyde , cuminaldehyde , 2 - propenyl / 2 - phenylethyl isothiocyanate , thymol , and eucalyptol . the chemicals reach the appropriate neural structures and induce vasodilatation , vasoconstriction and / or cerebrovascular permeability changes . in an embodiments of the present invention , chemical stimulation is applied to at least one mts , using ( a ) a nasal applicator adapted to deliver the stimulating chemical to an upper region of the nasal cavity , or ( b ) a transpalatine applicator inserted via the greater palatine canal . in some embodiments of the present invention , stimulation of at least one mts is achieved by applying a neuroexcitatory agent to the mts . suitable neuroexcitatory agents include , but are not limited to , acetylcholine and urocholine . for some applications , the mts is stimulated by applying a neuroinhibitory agent , such as atropine , hexamethonium , or a local anesthetic ( e . g ., lidocaine ). in these agent - application embodiments , an extent to which the agent has achieved the desired effect ( e . g ., increased permeability of the bbb , or increased or decreased cbf ) is determined by monitoring real - time changes in cbf , and adjusting the dose of the agent responsive thereto . in an embodiment of the present invention , stimulation of the mts is achieved by applying mechanical stimulation to the mts , e . g ., vibration . an extent to which the mechanical stimulation has achieved the desired effect ( e . g ., increased permeability of the bbb , or increased or decreased cbf ) is determined by monitoring real - time changes in cbf , and adjusting the extent of the mechanical stimulation ( e . g ., magnitude , frequency , or duration ) responsive thereto . it is also to be appreciated that whereas some embodiments of the present invention are described with respect to implanting the electrical stimulator , for some applications the stimulator is temporarily inserted into the subject , and techniques described herein are used to optimize the temporary placement of the stimulator . in an embodiment of the present invention , bilateral stimulation is applied , in which a first electrode is applied to a first mts , and a second electrode is applied to a second mts . such bilateral stimulation may be applied using techniques described in u . s . provisional patent application 60 / 604 , 037 , filed aug . 23 , 2004 , which is assigned to the assignee of the present application and is incorporated herein by reference , and / or in pct patent application pct / il2005 / 000912 , filed aug . 23 , 2005 ,” entitled , “ concurrent bilateral spg modulation ,” which is assigned to the assignee of the present application and is incorporated herein by reference . fig2 a is a schematic illustration of a nasal magnetic induction device 400 , in accordance with an embodiment of the present invention . nasal magnetic induction device 400 generates a magnetic field in the vicinity of an mts . the magnetic field induces an electric current in the mts , which temporarily depolarizes neurons therein , thereby electrically stimulating the mts . nasal magnetic induction device 400 typically comprises a wire coil 410 adapted to be insertable into the nasal cavity , and a control unit 412 coupled to the coil . as appropriate , the coil may be compressed during insertion and expand at the target site , or it may be retracted during insertion within a supporting element 414 of device 400 , and released when at the target site . typically , coil 410 has a diameter d of between about 3 mm and about 12 mm , and comprises between about 4 and about 30 loops of wire . the wire typically has a diameter of between about 50 micrometers and about 200 micrometers . upon activation , the control unit generates a pulsed electric current in the coil . because of the close proximity of the coil to an mts , e . g ., an spg , the control unit typically outputs power sufficient to stimulate the spg but generally insufficient to substantially stimulate surrounding peripheral or brain tissue . for some applications , the nasal magnetic induction device further comprises a cooling element ( e . g ., a thermoelectric cooling element , a liquid cooling mechanism , or an air cooling mechanism ), which is adapted to prevent excessive heating of the coil . fig2 b is a schematic illustration of a nasal magnetic induction device 420 , in accordance with an embodiment of the present invention . nasal magnetic induction device 420 is similar to nasal magnetic induction device 400 , described hereinabove with reference to fig2 a , except that nasal magnetic induction device 420 comprises a figure - eight - shaped wire coil 430 , which may , for example , enhance focusing of the induced field . alternatively , nasal magnetic induction device 420 comprises a 4 - leaf - shaped wire coil , such as described in the above - cited article to roth b j et al . fig2 a and 24b are schematic illustrations of an external magnetic induction device 440 , in accordance with an embodiment of the present invention . external magnetic induction device 440 comprises ( a ) one or more ( typically two ) magnetic coils 450 adapted to be placed in a vicinity of a temporomandibular joint 452 of a subject , in a vicinity of an mts , e . g ., an spg , and ( b ) a control unit 454 coupled to the coils . typically , each coil 450 has a diameter of between about 30 mm and about 120 mm , and comprises between about 4 and about 30 loops of wire . in an embodiment of the present invention , an external magnetic induction device comprises a coil adapted to be placed partially or completely around a head of the subject ( not necessarily in the configuration shown in fig2 a and 24b ), and a control unit coupled to the coil . typically , the coil has a diameter of between about 3 cm and about 12 cm , and comprises between about 4 and about 30 loops of wire . the coil is configured to focus the generated magnetic field on at least one mts , e . g ., the spg . in some embodiments of the present invention , techniques described herein are practiced in combination with techniques described in one or more of the references cited in the background of the invention section hereinabove and / or in combination with techniques described in one or more of the patent applications cited hereinabove . the scope of the present invention includes embodiments described in the following patent applications , which are assigned to the assignee of the present patent application and are incorporated herein by reference . in an embodiment of the present invention , techniques and apparatus described in one or more of the following applications are combined with techniques and apparatus described herein : u . s . provisional patent application 60 / 203 , 172 , filed may 8 , 2000 , entitled , “ method and apparatus for stimulating the sphenopalatine ganglion to modify properties of the bbb and cerebral blood flow ” u . s . patent application ser . no . 10 / 258 , 714 , filed oct . 25 , 2002 , entitled , “ method and apparatus for stimulating the sphenopalatine ganglion to modify properties of the bbb and cerebral blood flow ,” or the above - referenced pct publication wo 01 / 85094 u . s . provisional patent application 60 / 364 , 451 , filed mar . 15 , 2002 , entitled , “ applications of stimulating the sphenopalatine ganglion ( spg )” u . s . provisional patent application 60 / 368 , 657 , filed mar . 28 , 2002 , entitled , “ spg stimulation ” u . s . provisional patent application 60 / 376 , 048 , filed apr . 25 , 2002 , entitled , “ methods and apparatus for modifying properties of the bbb and cerebral circulation by using the neuroexcitatory and / or neuroinhibitory effects of odorants on nerves in the head ” u . s . provisional patent application 60 / 388 , 931 , filed jun . 14 , 2002 , entitled “ methods and systems for management of alzheimer &# 39 ; s disease ,” pct patent application pct / il03 / 000508 , filed jun . 13 , 2003 , claiming priority therefrom , and u . s . patent application ser . no . 10 / 518 , 322 , filed dec . 14 , 2004 in the national stage thereof u . s . provisional patent application 60 / 400 , 167 , filed jul . 31 , 2002 , entitled , “ delivering compounds to the brain by modifying properties of the bbb and cerebral circulation ” u . s . provisional patent application 60 / 426 , 180 , filed nov . 14 , 2002 , entitled , “ surgical tools and techniques for sphenopalatine ganglion stimulation ,” pct patent application pct / il03 / 000966 , filed nov . 13 , 2003 , which claims priority therefrom , and u . s . patent application ser . no . 10 / 535 , 024 , filed may 11 , 2005 in the national stage thereof u . s . provisional patent application 60 / 426 , 182 , filed nov . 14 , 2002 , and corresponding pct patent application pct / il03 / 000967 , which claims priority therefrom , filed nov . 13 , 2003 , entitled , “ stimulation circuitry and control of electronic medical device ,” and a us patent application filed may 11 , 2005 in the national stage thereof u . s . patent application ser . no . 10 / 294 , 310 , filed nov . 14 , 2002 , entitled , “ spg stimulation for treating eye pathologies ,” and pct patent application pct / il03 / 000965 , filed nov . 13 , 2003 , claiming priority therefrom pct patent application pct / il03 / 000631 , filed jul . 31 , 2003 , entitled , “ delivering compounds to the brain by modifying properties of the bbb and cerebral circulation ,” and a us patent application filed jan . 31 , 2005 in the national stage thereof u . s . pat . no . 6 , 853 , 858 to shalev u . s . patent application ser . no . 10 / 783 , 113 , filed feb . 20 , 2004 , entitled , “ stimulation for acute conditions ” u . s . provisional patent application 60 / 426 , 181 , filed nov . 14 , 2002 , entitled , “ stimulation for treating ear pathologies ,” pct patent application pct / il03 / 000963 , filed nov . 13 , 2003 , which claims priority therefrom , and a us patent application filed may 11 , 2005 in the national stage thereof u . s . provisional patent application 60 / 448 , 807 , filed feb . 20 , 2003 , entitled , “ stimulation for treating autoimmune - related disorders of the cns ” u . s . provisional patent application 60 / 461 , 232 to gross et al ., filed apr . 8 , 2003 , entitled , “ treating abnormal conditions of the mind and body by modifying properties of the blood - brain barrier and cephalic blood flow ” pct patent application pct / il03 / 00338 to shalev , filed apr . 25 , 2003 , entitled , “ methods and apparatus for modifying properties of the bbb and cerebral circulation by using the neuroexcitatory and / or neuroinhibitory effects of odorants on nerves in the head ,” and u . s . patent application ser . no . 10 / 512 , 780 , filed oct . 25 , 2004 in the national stage thereof u . s . provisional patent application 60 / 506 , 165 , filed sep . 26 , 2003 , entitled , “ diagnostic applications of stimulation ” u . s . patent application ser . no . 10 / 678 , 730 , filed oct . 2 , 2003 , entitled , “ targeted release of nitric oxide in the brain circulation for opening the bbb ,” and pct patent application pct / il04 / 000911 , filed oct . 3 , 2004 , claiming priority therefrom pct patent application pct / il04 / 000897 , filed sep . 26 , 2004 , entitled , “ stimulation for treating and diagnosing conditions ” u . s . provisional patent application 60 / 604 , 037 , filed aug . 23 , 2004 , entitled , “ concurrent bilateral spg modulation ” pct patent application pct / il2005 / 000912 , filed aug . 23 , 2005 , entitled , “ concurrent bilateral spg modulation ” u . s . patent application ser . no . 10 / 952 , 536 , filed sep . 27 , 2004 , entitled , “ stimulation for treating and diagnosing conditions ” u . s . provisional patent application 60 / 709 , 734 , filed aug . 19 , 2005 , entitled , “ stimulation for treating brain events and other conditions ” in an embodiment of the present invention , system 20 and / or 120 comprises circuitry described in one or more of the above - mentioned applications . as used in the present application , the bbb comprises the tight junctions opposing the passage of most ions and large molecular weight compounds between the blood and brain tissue . it will be appreciated by persons skilled in the art that the present invention is not limited to what has been particularly shown and described hereinabove . rather , the scope of the present invention includes both combinations and subcombinations of the various features described hereinabove , as well as variations and modifications thereof that are not in the prior art , which would occur to persons skilled in the art upon reading the foregoing description . for example , elements which are shown in a figure to be housed within one integral unit may , for some applications , be disposed in a plurality of distinct units . similarly , apparatus for communication and power transmission which are shown to be coupled in a wireless fashion may , alternatively , be coupled in a wired fashion , and apparatus for communication and power transmission which are shown to be coupled in a wired fashion may , alternatively , be coupled in a wireless fashion .

US-98340911-A

an endoscope and camera are described with which a display observed through the optics in the endoscope is rotated to a desired orientation using an accelerometer . the accelerometer generates a signal indicative of the local vertical and is used in the particular embodiment to rotate a ccd image sensor aligned with the optical axis of the endoscope so as to maintain a desired orientation of a display of the image on a monitor .

fig1 schematically shows an endoscope 10 . the endoscope includes a shaft 11 that contains elements that are conventionally provided . an image - forwarding system such as a series of lenses or a coherent fiber optic bundle , a light guide , and instrument channels are examples . they are not shown in detail because it is not necessary for an understanding of this invention . the image forwarding system has a central optical axis 12 . the endoscope may be permanently or releasably attached to a fitting 13 . the fitting is releasably attachable to a frame 14 . the frame 14 itself has a lateral axis 15 which is horizontal when the frame is in its upright position , and an upright axis 16 which is vertical in the gravitational field when the frame is in its upright position . axes 15 and 16 are normal to each other . as shown in fig1 - 3 , fitting 13 carries two prongs 17 , 18 that respectively are plugged into receptacles 19 , 20 in frame 14 . prong 17 is the culmination of the image path through the endoscope . it may be directly in line with it , or may be offset with the use of prisms , mirrors or other means to displace the optical axis 12 laterally . when the endoscope is properly fitted to the frame , the image is conducted into the frame , as will be seen . this is an example of a construction wherein the endoscope cannot be rotated relative to the frame in which the camera is mounted . if the image is to be maintained &# 34 ; upright &# 34 ;, then the camera must itself be rotated . prong 18 receives light for illumination from a source not shown , but which may be transmitted to it through a fiber optic cable that may be part of cable 21 , connected to the frame . if preferred , a separate light cable can be provided and attached to the frame as appropriate . this prong arrangement assures correct alignment of the endoscope relative to the frame . a ccd chip 22 ( sometimes called a &# 34 ; camera &# 34 ;) is rotatably mounted to the frame . its center point 23 is located on the optical axis of the optical system . the camera is rotatable around the optical axis , relative to the optical system and to the frame . the camera has its own lateral axis 24 and upright axis 25 . an accelerometer 30 is also rotatably mounted to the frame , and is intended to rotate with the camera . most conveniently , the accelerometer is directly bonded to the ccd . both are rotatively journaled to the frame . when they are bonded together , a single bearing 31 can serve to journal both of them . the accelerometer is capable of sensitively responding to variations in the components of gravitational force to which it is exposed . integrated accelerometers of the type used in air bags are suitable for this purpose . analog devices adxl - 05 , which includes a micro - machined silicon cantilever suspended between two electrodes , is an example of an appropriate accelerometer . an ac signal can be imposed on the two electrodes , and the detected proximity of the cantilever to the two electrodes will provide for a servo signal respective to off - vertical orientation . here it will be noted that the endoscope when in use will have freedom to tilt in all directions , so that the accelerometer will often be responding to a component of vertical gravitational force which is considerably less than its maximum value . for example , when the optical axis is depressed 60 degrees , the vertical component of gravity to which the accelerometer refers while keeping the image upright is much less than maximum gravity force . it is an advantage of this device , which a pendulum does not share , that it can respond properly over a large angular range in which the vertical component of gravity is quite small . a bi - directional servo motor 35 is drivingly connected to the camera and to the accelerometer by a gear train 36 . it responds to the signal from a servo control 37 to rotate the camera and the accelerometer so the accelerometer will produce a maximum signal . that is , the largest signal relative to signals which would be generated by rotating the accelerometer in either direction . the servo control generates its signal in response to accelerator output . the camera provides its signal to a video display 40 through leads in cable 21 . this display will ordinarily be placed on a shelf or be held by a bracket on a wall or a ceiling . its screen 42 has an upright axis 43 and a lateral axis 44 . these axes will generally be viewed as vertical and horizontal . if the camera is maintained upright , then the display axes will coincide with the camera axes . it will now be seen that rotating the ccd to maintain its axes in a nominally horizontal and vertical alignment will provide the same orientation to the image on the screen whatever the position of the endoscope may be . as a consequence , the surgeon will remain spatially oriented relative to the operating site . he need not exert efforts to orient himself relative to an image that rotates on the display . as a further advantage , this arrangement displays the full area of the field available from the camera . the aspect ratio of the screen and of the camera are the same . if the image were rotated , corners and some of the edges of the screen would be blank . possibly important information from the corners of the camera could be lost . this invention does not suffer this risk . this invention is not to be limited by the embodiment shown in the drawings and described in the description , which is given by way of example and not of limitation , but only in accordance with the scope of the appended claims .

US-87079297-A

an infusion device comprising a fluid reservoir for containing a therapeutic fluid ; and a transcutaneous access tool fluidly coupled to the fluid reservoir for delivering the therapeutic fluid subcutaneously and for introducing a monitoring test strip subcutaneously , and methods of use thereof .

a fluid delivery device , consistent with embodiments of the present disclosure , may be used to deliver a therapeutic fluid ( e . g . a liquid medicine ) to a patient via a transcutaneous access tool , such as a needle / trocar and / or a cannula . a transcutaneous access tool insertion mechanism may be used to deploy the transcutaneous access tool , for example , by inserting and retracting a needle / trocar in a single , uninterrupted motion . the insertion mechanism may also provide an increasing insertion force as the needle / trocar moves in the insertion direction . the fluid delivery device may also include a clutch mechanism to facilitate filling a reservoir and engagement of a drive mechanism for driving fluid out of the reservoir . in certain embodiments , the fluid delivery device may comprise an ambulatory insulin infusion device . in other embodiments , a fluid delivery device may be used to deliver a therapeutic fluid to a patient with integrated monitoring , such as continuous glucose monitoring ( cgm ). in these embodiments , the fluid deliver device may include a transcutaneous access tool configured to introduce a monitoring test strip through the skin of the patient , for example , using one or more needles , cannulas and / or trocars . referring to fig1 - 6 , one embodiment of a fluid delivery device 100 is shown and described . in the exemplary embodiment , the fluid delivery device 100 is used to subcutaneously deliver a fluid , such as a liquid medicine ( e . g . insulin ), to a person or an animal . those skilled in the art will recognize that the fluid delivery device 100 may be used to deliver other types of fluids . the fluid delivery device 100 may be used to deliver fluids in a controlled manner , for example , according to fluid delivery profiles accomplishing bolus requirements , continuous infusion and variable flow rate delivery . according to one embodiment , the fluid delivery device 100 may include one or more batteries 110 for providing a power source , a fluid reservoir 130 for holding a fluid , a fluid drive mechanism 150 for driving the fluid out of the reservoir 130 , a fluid passage mechanism 170 for receiving the fluid from the reservoir 130 and passing the fluid to a destination via a transcutaneous access tool 172 , and a transcutaneous access tool insertion mechanism 180 for deploying the transcutaneous access tool 172 . the fluid delivery device 100 may include a circuit board 101 with control circuitry for controlling the device and a chassis 102 that provides mechanical and / or electrical connections between components of the fluid deliver device 100 . the fluid delivery device 100 may also include a housing 104 to enclose the circuit board 101 , the chassis 102 , and the components 110 , 130 , 150 , 170 , 180 . the fluid delivery device 100 may also include integrated monitoring such as continuous glucose monitoring ( cgm ). a monitor test strip 120 coupled to a monitor ( not shown ) in the device 100 may be introduced by the transcutaneous access tool 172 subcutaneously . one example of the monitor test strip is a cgm test strip ( such as the type available from nova biomedical ) which may be understood as a glucose sensor configured to test for a concentration level of glucose in the blood of a patient . the fluid delivery device 100 may be configured to receive data from the monitoring test strip concerning a glucose level of the patient , and determining an output of insulin from the reservoir based on the glucose level . the transcutaneous access tool 172 includes an introducer trocar or needle 174 at least partially positioned within a lumen 175 of a cannula 176 ( e . g ., a soft flexible cannula ), which is capable of passing the fluid into the patient . in particular , the introducer needle / trocar 174 may initially penetrate the skin such that both the introducer needle / trocar 174 and the cannula 176 are introduced ( inserted ) into the patient , and the introducer needle / trocar 174 may then be retracted within the cannula 176 such that the cannula 176 remains inserted . a fluid path , such as tubing 178 , fluidly couples the reservoir 130 to the lumen 175 of cannula 176 of the transcutaneous access tool 172 . the transcutaneous access tool 172 may also be used to introduce a monitoring test strip subcutaneously into the patient for monitoring purposes , as described in greater detail below . the transcutaneous access tool insertion mechanism 180 is coupled to the transcutaneous access tool 172 to deploy the transcutaneous access tool 172 , for example , by inserting the needle / trocar 174 and cannula 176 through the skin of a patient and retracting the needle / trocar 174 . in the illustrated embodiment , the insertion mechanism 180 includes a spring - biased linkage mechanism 182 and sliding members 184 , 186 coupled to the needle / trocar 174 and cannula 176 , respectively , for moving the needle / trocar 174 and cannula 176 in the insertion direction and for moving the needle / trocar 174 in the retraction direction . in a single , uninterrupted motion , the spring - biased linkage mechanism 182 moves from a pre - deployment position ( fig1 ) with both needle / trocar 174 and cannula 176 retracted ( fig2 ) to an intermediate position ( fig3 ) with both needle / trocar 174 and cannula 176 inserted ( fig4 ) to a post - deployment position ( fig5 ) with the needle / trocar 174 retracted and the cannula 176 inserted ( fig6 ). one embodiment of the spring - biased linkage mechanism 182 includes a helical torsion spring 181 and first and second linkages 183 a , 183 b coupled between the torsion spring 181 and the first sliding member 184 . energy stored in the torsion spring 181 applies a force to the linkages 183 a , 183 b , which applies a force to the first sliding member 184 to move the first sliding member 184 in both the insertion direction and in the retraction direction . in the pre - deployment position ( fig1 ), the torsion spring 181 is loaded and the sliding members 184 , 186 are locked and prevented from moving . when the sliding members 184 , 186 are released , the energy stored in the torsion spring 181 causes the first linkage 183 a to rotate ( e . g ., clockwise as shown ), which applies a force to the first sliding member 184 through the second linkage 183 b causing the first sliding member 184 with the needle / trocar 174 to move ( with the second sliding member 186 ) in the insertion direction . in the intermediate position ( fig3 ), the linkages 183 a , 183 b are fully extended with the needle / trocar 174 and cannula 176 being inserted , the second sliding member 186 is locked , and the remaining energy stored in the torsion spring 181 causes the first linkage 183 a to continue to rotate , which applies an opposite force to the first sliding member 184 through the second linkage 183 b causing the first sliding member 184 with the needle / trocar 174 to move in the retraction direction to the post - deployment position ( fig5 ). in the illustrated embodiment , the second sliding member 186 is locked against retraction by one or more latches 187 . thus , in the foregoing manner , the continuous uninterrupted clockwise rotation of first linkage 183 a via the energy of torsion spring 181 provides the transcutaneous access tool insertion mechanism 180 with the ability to insert and retract the needle / trocar 174 in a single , uninterrupted motion . the spring - biased linkage mechanism 182 allows a single spring and motion to achieve both the insertion and retraction and has a relatively small size . the spring - biased linkage mechanism 182 also reduces the static stresses caused by locking and holding back the sliding members 184 , 186 and provides a smoother and more comfortable needle / trocar insertion because of the way the linkages 183 a , 183 b vector the forces applied to the sliding members 184 , 186 . the static forces on the sliding members 184 , 186 are relatively small in the pre - deployment position when the linkages 183 a , 183 b are fully retracted . when the deployment starts and the linkages 183 a , 183 b start to become extended , the insertion forces increase because the force vectors increase in the insertion direction as the linkages extend 183 a , 183 b until a maximum insertion force is reached at the fully extended , intermediate position . by gradually increasing the insertion forces , the needle / trocar insertion and retraction is smoother , quieter and less painful . another embodiment of an insertion mechanism 280 is shown in greater detail in fig7 - 10 . the sliding members 284 , 286 are slidably received in a frame 290 and moved by a spring - biased linkage mechanism 282 including torsion spring 281 and linkages 283 a , 283 b . in this embodiment , a cam finger 292 ( e . g ., extending from the frame 290 ) engages beneath one or both of the sliding members 284 , 286 to lock the sliding members in the retracted or pre - deployment position ( fig7 ). in this pre - deployment position , the cam finger 292 is held against the sliding members 284 , 286 by a release bar 296 , which may be moved ( rotated ) to allow the cam finger 292 to move and release the sliding members 284 , 286 ( fig8 ). the cam finger 292 may be biased in a downward direction and / or the second sliding member 286 may include a cam surface 287 to help facilitate movement along the cam finger 292 over locking mechanism 293 upon actuation . the release bar 296 includes a lever 297 for pivoting the release bar 296 between an engaged position against the cam finger 292 ( fig7 ) and a disengaged position releasing the cam finger 292 ( fig8 ). the release bar 296 may be biased toward the disengaged position and held against the cam finger 292 in the engaged position until the lever 297 is released allowing the release bar 296 to move to the disengaged position . in the illustrated embodiment , the lever 297 engages a rotating surface 257 of a drive wheel 256 of the fluid drive mechanism 150 such that the lever 297 is held in the engaged position for part of the rotation and is released at a certain point during the rotation ( e . g ., when a flat portion of the rotating surface 257 allows the lever 297 to move ). as shown in fig9 and 10 , the cam finger 292 may also be used to lock the second sliding member 286 in the insertion position . a locking portion 288 of the second sliding member 286 engages a locking portion 293 of the cam finger 292 when the linkage mechanism 282 is fully extended in the intermediate position and prevents the second sliding member 286 from retracting such that the cannula remains inserted . as discussed above , the second sliding member 286 may also be locked by one or more latches ( not shown ) extending from a top of the frame 290 . according to one embodiment , as shown in fig1 - 17 , the cannula 176 providing the transcutaneous access for delivery the fluid may also be used to introduce the monitor test strip 120 . in this embodiment , the cannula 176 includes a first lumen 175 for receiving the needle / trocar 174 and a second lumen 177 for receiving the test strip 120 . as shown , the first lumen 175 has a circular ( cylindrical ) profile and the second lumen 177 has a rectangular profile . the cannula 176 may also include one or more windows 179 a , 179 b providing access to one or more sensors 122 a , 122 b on the test strip 120 . as shown , the plurality of windows 179 a , 179 b of the cannula 176 may be arranged on a same side of the sidewall of cannula 176 , with the first window 179 a arranged at a distance from the distal end tip of the cannula 176 which is less than the distance of the second window 179 b from the distal end tip of the cannula 176 . to insert the test strip 120 into second lumen 177 , the test strip 120 passes into second lumen 177 at the head 178 of the cannula 176 and extends to the window ( s ) 179 a , 179 b . thus , at least one window 179 a , 179 b exposes a sensor 122 a , 122 b of the monitoring test strip 120 . in the example embodiment , two windows 179 a , 179 b are provided with the window 179 a closest to the tip of the cannula 176 providing access to the main sensor area and the window 179 b farthest from the tip providing a reference . although a specific shape and configuration of a bi - lumen cannula is shown , other configurations of a cannula with first and second lumens may also be used to both deliver a therapeutic fluid and introduce a test strip subcutaneously . according to another embodiment , as shown in fig1 - 28 , a fluid delivery device 300 may include a transcutaneous access tool 372 with a first cannula 376 for delivering fluid and a second cannula 377 for introducing a test strip 320 . the first cannula 376 receives a first needle / trocar 374 ( shown as a circular needle ) to facilitate insertion of the first cannula 376 and the second cannula 377 receives a second needle / trocar 375 ( shown as a semi - circular trocar ) to facilitate insertion of the second cannula 377 . the fluid deliver device 300 includes an insertion mechanism 380 , similar to the first described embodiment above , but with sliding members 384 , 386 coupled to both the needle 374 and the trocar 375 and both cannulas 376 , 377 . the insertion mechanism 380 inserts the second cannula 377 and the trocar 375 and then retracts the trocar 375 in the same manner as described above . the test strip 320 remains inserted after the trocar 375 is retracted . thus , both the first needle / trocar 374 and the second needle / trocar 375 may be introduced into the patient simultaneously , particularly to reduce the pain of sequential insertions . similar to the above described embodiment , first cannula 376 includes a circular ( cylindrical ) lumen 376 a . as shown in greater detail in fig2 - 26 , the second cannula 377 includes a semi - circular ( d - shaped ) lumen 377 a to allow the monitor strip to sit relatively flat within the cannula 377 . the second cannula 377 also includes one or more windows 379 a , 379 b providing access to one or more sensors 320 a , 320 b on the test strip 320 ( see fig2 and 23 ). as shown , similar to the prior embodiment , the plurality of windows 379 a , 379 b , of the cannula 377 may be arranged on a same side of the sidewall of the cannula 377 , with the first window 379 a arranged at a distance from the distal end tip of the cannula 377 which is less than the distance of the second window 379 b from the distal end tip of the cannula 377 . thus , at least one window 379 a , 379 b exposes a sensor 320 a , 320 b of the monitoring test strip 320 . in the example embodiment , two windows 379 a , 379 b are provided with the window 379 a closest to the tip of the cannula 377 providing access to the main sensor area and the window 379 b farthest from the tip providing a reference . as shown in greater detail in fig2 and 28 , the trocar 375 has a shape corresponding to the d - shaped lumen 377 a to allow the trocar 375 to be retracted leaving the test strip 320 inserted ( see fig2 ). as shown , the trocar includes a planar side surface 373 which corresponds to a planar test strip 320 such that , when assembled , the planar test strip 320 may be located adjacent the planar side surface 373 of the trocar 375 in the second cannula 377 . according to another embodiment , as shown in fig2 - 37 , a fluid delivery device 400 may include a transcutaneous access tool 472 with a cannula 476 for delivering fluid and a needle or trocar 475 ( shown as a semi - circular trocar ) for introducing a test strip 420 . the cannula 476 receives a needle / trocar 474 ( shown as circular needle ) to facilitate insertion of the cannula 476 and the trocar 475 is inserted with the test strip 420 . the fluid deliver device 400 includes an insertion mechanism 480 , similar to the first described embodiment above , but with sliding members 484 , 486 coupled to both the needle 474 and the trocar 475 . the insertion mechanism 480 inserts the trocar 475 ( fig3 and 32 ) and then retracts the trocar 475 ( fig3 and 34 ) in the same manner as the needle / trocar described above . the test strip 420 remains inserted after the trocar 475 is retracted ( fig3 ). in contrast to the prior embodiment , the needle / trocar 475 introduces the monitoring test strip 420 subcutaneously solely ( i . e . without the monitoring test strip 420 being introduced with a cannula ). the trocar 475 is shown in greater detail in fig3 . the second sliding member 486 is shown in greater detail in fig3 . in this embodiment , the second sliding member 486 is designed to capture the cannula 476 and to receive and allow the trocar 475 to pass through . accordingly , various embodiments of the fluid delivery device may use the transcutaneous access tool both to deliver fluid and to introduce a test strip subcutaneously to provide integrated monitoring . while the principles of the invention have been described herein , it is to be understood by those skilled in the art that this description is made only by way of example and not as a limitation as to the scope of the invention . other embodiments are contemplated within the scope of the present invention in addition to the exemplary embodiments shown and described herein . modifications and substitutions by one of ordinary skill in the art are considered to be within the scope of the present invention , which is not to be limited except by the following claims .

US-201313854463-A

a game board represents various aspects of team sports including opportunities to acquire teams and team players involved in baseball , football , hockey and basketball . the board has a rectangular playing path with successive spaces having indicia of specific professional sports teams , and special bonus and penalty cards . a chance device determines the movement of selected player pieces to given spaces . the players can buy the teams designated on the spaces and buy team players when the pieces land in a specific buy space . when a player piece lands on a team space owned by another player , various payments are required . the payments increase with the number of team players owned and the number of teams owned which have a common color designation . stacks of cards related to bonus and penalty spaces provide various monetary awards , fines and directions .

as shown in fig1 a game board 10 includes a rectangular playing path having forty successive spaces distributed along four sides of the board . space 12 at the lower left hand corner is the start position which also indicates a home plate , as in a baseball game . player pieces 14 , in the form of various sports equipment as shown in fig3 are selected by respective players of the game and initially positioned on the start space . each time the pieces pass this space , the players collect $ 500 of play money 16 , as shown in fig4 . the players each receive $ 100 , 000 at the beginning of the game in various denominations . a person chosen to be the commissioner holds the balance of the money and collects and pays various fines , purchases and awards . a roll of the dice 18 , of fig2 determines the number of spaces moved by the player pieces . the successive spaces along the left side include space 20 which indicates the 76ers basketball team , having a purchase price of $ 2 , 000 , and an orange colored border . as will be seen , monetary advantages accrue to the owner of a group of teams having the same color designation . there are five groups of four teams with the same color , each group including a baseball , football , basketball and hockey team , which are distributed so that the five group colors are each represented once on each side of the board . thus , continuing on the left side , an intermediate space 22 indicates taxes -- pay $ 250 , which must be paid to the commissioner who acts as a banker . the next space 24 indicates the tigers baseball team having a red border , which may be purchased for $ 5 , 000 , if not already owned by another player . each time a player piece is moved after a throw of the dice , the player must follow the directions on the board , such as paying a fee , or he may purchase the team on which the piece lands . when another player owns that team , various penalties must be paid as will be further explained . the next intermediate space 26 indicates air line fare -- pay $ 1 , 000 , which is again paid to the commissioner . space 28 indicates the rams football team , having a blue border and price of $ 10 , 000 , while space 30 indicates the rangers hockey team , with a green border and price of $ 7 , 500 . the next space 32 indicates subway fares -- pay $ 50 , and space 34 indicates the red sox baseball team , having a purple border and a price of $ 3 , 000 . the next space 36 indicates a bonus card . three stacks of cards and spaces 38 , 40 , 42 for bonus , team bonus and penalty are arranged in the middle of the board . these cards are picked in accordance with the spaces on which the player pieces land . there are 28 bonus cards , 24 penalty cards and 9 team bonus cards , the numbers of which are merely exemplary . the bonus cards include various awards such as football leading passer -- collect $ 1 , 000 , hockey leading goal tender -- collect $ 500 , baseball golden glove award -- collect $ 250 , basketball -- most assists -- collect $ 750 , baseball -- won most valuable player -- collect $ 1 , 500 etc . also included are four cards for each respective sport awarding one free player , indicating the player became free agent . this feature will be explained more fully hereinafter , as will be the team bonus cards . various penalty cards provide such fines as football team finished last -- fined $ 1 , 000 for each player owned , hockey -- cross checking -- fined $ 150 , baseball pitcher threw bean ball -- fined $ 500 , basket - ball -- goal tending -- fined $ 250 , and go to penalty box -- roll 7 to go out . the penalty box 44 is the next space at the corner . when a player piece lands on this space , the piece remains there until the player rolls a seven on the dice . he can then move the piece to the out portion of the box and move out on the next turn . continuing along the top row is space 46 indicating the kings hockey team having a blue border and a price of $ 4 , 000 , space 48 indicating taxi service -- pay $ 150 , and space 50 indicating abc television station -- price $ 500 . the player landing on this space may purchase the station if not already owned by another player . thereafter other players landing on that space must pay the owner $ 500 . in addition , there are two other television stations on the next two sides of the board . if the same player owns two stations , he collects $ 1 , 200 from the others landing on these spaces , and $ 2 , 500 if he owns all three stations . corresponding tv station cards are provided to the purchasers to show ownership and instructions on the back give the fees to be collected for various numbers of stations owned . the next space 52 indicates the pistons basketball team with a price of $ 1 , 000 and a red border . space 54 indicates a penalty card which the player must pick from the top of the penalty card stack 42 . the used bonus and penalty cards are left face up . when all cards are used , the stacks are mixed and restarted . the next space 56 is the bruins hockey team priced at $ 2 , 000 and having a purple border , followed by another bonus space 58 . space 60 is the phillies baseball team at a price of $ 6 , 500 with an orange border , followed by space 62 indicating the jets football team with a price of $ 15 , 000 and a green border . the next corner space 64 indicates a team bonus card , which is taken from stack 40 only when the player owns one or more full teams . examples of these are baseball -- won world series -- collect $ 70 , 000 , football -- won super bowl -- collect $ 100 , 000 , hockey -- won stanley cup -- collect $ 40 , 000 , basketball -- won playoffs -- collect $ 5 , 000 and super bonus for each team owned -- collect $ 100 , 000 for each full team . the purchase of team players and full teams will be discussed hereinafter . space 66 along the right side indicates another penalty card selected from stack 42 . space 68 indicates the dodgers baseball team having a price of $ 8 , 000 and a blue border , and space 70 indicates the celtics basketball team with a cost of $ 1 , 000 and a purple border . space 72 indicates cbs television station having a price of $ 500 , space 74 indicates the red wings hockey team having a cost of $ 2 , 500 and a red border , and space 76 indicates the commissioner &# 39 ; s office -- pay $ 500 . space 78 is the knicks basketball team priced at $ 5 , 000 and having a green border , space 80 is the eagles football team with a price of $ 9 , 000 and an orange border , and space 82 is another bonus card selected from stack 38 . the next corner space 84 indicates buy players and teams -- 2 players or less -- price $ 500 each . this space permits the players whose pieces land there to buy one or two team players for a team that is owned . as shown in fig5 the team players 86 are in the form of small football , hockey , baseball and basketball figures . a full football team requires eleven team players , a full hockey team has six players , a full baseball team has nine players , and a full basketball team includes five players . upon purchase of the last team player to complete a team , the individual player figures may be traded in for a full team marker 88 , as shown in fig6 for the various team sports . when player pieces land on team spaces owned by another player , the various penalties paid to the owner increase with the number of teams of the same color and number of team players owned . each team space is represented by a team card held by the owner . the backs of the cards include the various payments to be made to the owner as follows . jets -- bonus $ 1000 ( with no team players ), 1 player -- $ 2 , 000 , 2 -- $ 2 , 500 , 3 -- $ 3 , 000 , 4 -- $ 3 , 500 , 5 -- $ 4 , 000 , 6 -- $ 4 , 500 , 7 -- $ 5 , 000 , 8 -- $ 6 , 000 , 9 -- $ 7 , 000 , 10 -- $ 8 , 000 , and full team -- $ 25 , 000 . mets -- bonus $ 900 , 1 player -- $ 1 , 800 , 2 -- $ 2 , 300 , 3 -- $ 2 , 800 , 4 -- $ 3 , 300 , 5 -- $ 3 , 800 , 6 -- $ 4 , 300 , 7 -- $ 4 , 800 , 8 -- $ 5 , 300 , and full team $ 15 , 000 . rangers -- bonus $ 800 , 1 -- $ 1 , 600 , 2 -- $ 2 , 100 , 3 -- $ 2 , 600 , 4 -- $ 3 , 100 , 5 -- $ 3 , 600 , full team -- $ 10 , 000 . knicks -- bonus $ 700 , 1 -- $ 1 , 400 , 2 -- $ 1 , 900 , 3 -- $ 2 , 400 , 4 -- $ 2 , 900 , full team -- $ 7 , 000 . rams -- bonus $ 900 , 1 player -- $ 1 , 800 , 2 -- $ 2 , 300 , 3 -- $ 2 , 800 , 4 -- $ 3 , 300 , 5 -- $ 3 , 800 , 6 -- $ 4 , 300 , 7 -- $ 4 , 800 , 8 -- $ 5 , 300 , 9 -- $ 5 , 800 , 10 -- $ 6 , 300 , and full team $ 15 , 000 . dodgers -- bonus $ 800 , 1 -- $ 1 , 600 , 2 -- $ 2 , 100 , 3 -- $ 2 , 600 , 4 -- $ 3 , 100 , 5 -- $ 3 , 600 , 6 -- $ 4 , 100 , 7 -- $ 4 , 600 , 8 -- $ 5 , 100 , full team $ 10 , 000 . kings -- bonus $ 700 , 1 -- $ 1 , 400 , 2 -- $ 1 , 900 , 3 -- $ 2 , 400 , 4 -- $ 2 , 900 , 5 -- $ 3 , 400 , full team -- $ 7 , 000 . lakers -- bonus -- $ 600 , 1 -- $ 1 , 200 , 2 -- $ 1 , 700 , 3 -- $ 2 , 200 , 4 -- $ 2 , 700 , full team -- $ 5 , 000 . eagles -- bonus $ 800 , 1 -- $ 1 , 600 , 2 -- $ 2 , 100 , 3 -- $ 2 , 600 , 4 -- $ 3 , 100 , 5 -- $ 3 , 600 , 6 -- $ 4 , 100 , 7 -- $ 4 , 600 , 8 -- $ 5 , 100 , 9 -- $ 5 , 600 , 10 -- $ 6 , 100 , full team $ 10 , 000 . phillies -- bonus $ 700 , 1 -- $ 1 , 400 , 2 -- $ 1 , 900 , 3 -- $ 2 , 400 , 4 -- $ 2 , 900 , 5 -- $ 3 , 400 , 6 -- $ 3 , 900 , 7 -- $ 4 , 400 , 8 -- $ 4 , 900 , full team $ 7 , 000 . flyers -- bonus $ 600 , 1 -- $ 1 , 200 , 2 -- $ 1 , 700 , 3 -- $ 2 , 200 , 4 -- $ 2 , 700 , 5 -- $ 3 , 200 , full team $ 5 , 000 . 76ers -- bonus $ 500 , 1 -- $ 1 , 000 , 2 -- $ 1 , 500 , 3 -- $ 2 , 000 , 4 -- $ 2 , 500 , full team -- $ 4 , 000 . lions -- bonus $ 700 , 1 -- $ 1 , 400 , 2 -- $ 1 , 900 , 3 -- $ 2 , 400 , 4 -- $ 2 , 900 , 5 -- $ 3 , 400 , 6 -- $ 3 , 900 , 7 -- $ 4 , 400 , 8 -- $ 4 , 900 , 9 -- $ 5 , 400 , 10 -- $ 5 , 900 , full team $ 9000 . tigers -- bonus $ 600 -- 1 -- $ 1 , 200 , 2 -- $ 1 , 700 , 3 -- $ 2 , 200 , 4 -- $ 2 , 700 , 5 -- $ 3 , 200 , 6 -- $ 3 , 700 , 7 -- $ 4 , 200 , 8 -- $ 4 , 700 , full team $ 7 , 000 . red wings -- bonus $ 500 , 1 -- $ 1 , 000 , 2 -- $ 1 , 500 , 3 -- $ 2 , 000 , 4 -- $ 2 , 500 , 5 -- $ 3 , 000 , full team -- $ 6 , 000 . pistons -- bonus $ 400 , 1 -- $ 800 , 2 -- $ 1 , 300 , 3 -- $ 1 , 800 , 4 -- $ 2 , 300 , full team -- $ 4 , 000 . patriots -- bonus $ 600 , 1 -- $ 1 , 200 , 2 -- $ 1 , 700 , 3 -- $ 2 , 200 , 4 -- $ 2 , 700 , 5 -- $ 3 , 200 , 6 -- $ 3 , 700 , 7 -- $ 4 , 200 , 8 -- $ 4 , 700 , 9 -- $ 5 , 200 , 10 -- $ 5 , 700 , full team $ 8 , 000 . red sox -- bonus $ 500 , 1 -- $ 1 , 000 , 2 -- $ 1 , 500 , 3 -- $ 2 , 000 , 4 -- $ 2 , 500 , 5 -- $ 3 , 000 , 6 -- $ 3 , 500 , 7 -- $ 4 , 000 , 8 -- $ 4 , 500 , full team $ 6 , 000 . bruins -- bonus $ 400 , 1 -- $ 800 , 2 -- $ 1 , 300 , 3 -- $ 1 , 800 , 4 -- $ 2 , 300 , 5 -- $ 2 , 800 , full team $ 5 , 000 . celtics -- bonus $ 300 , 1 -- $ 600 , 2 -- $ 1 , 100 , 3 -- $ 1 , 600 , 4 -- $ 2 , 100 , full team -- $ 4 , 000 . these various sums are multiplied by two , three or four times if the owner also owns two , three or four teams of the same color set . the previously mentioned bonus cards awarding a free player can be used by an owner of any team to obtain an additional team player for the particular sport indicated on the card . the card may be kept until the person buys a team involved in that sport . continuing on the bottom side of the board , the next space 90 indicates the lions football team having a price of $ 7 , 000 and a red colored border . space 92 indicates an award wherein the commissioner &# 39 ; s office pays $ 100 . space 94 is another television station , nbc , which can be purchased for $ 500 , or the owner must be paid the sums noted on the corresponding card . the next space 96 indicates a hot dog stand and requires a payment to the commissioner of $ 100 . the following spaces 98 , 100 , 102 and 104 are respectively the lakers basketball team at a price of $ 2 , 500 and blue border , the flyers hockey team at $ 4 , 000 with an orange border , the patriots football team for $ 5 , 000 and a purple border , and the mets baseball team at $ 12 , 000 and a green border . the last space 106 is another penalty card . the player pieces continue around the board in the order originally chosen . this is preferably determined before the start of the game by numbers on the tossed dice . as many as eight persons may play , limited only by the number of player pieces , as shown in fig3 which represent various sports items such as an ice skate shoe , a hockey puck , a baseball , a bat , a basketball , a baseball glove , a hockey stick and a football . these pieces are preferably of plastic and about 11 / 4 inches in height . the various team player figures and full team marker are also preferably of plastic and may be about three - fourths inches in height . as noted , the commissioner pays and collects awards , bonuses and penalties not associated with those required by player pieces landing on teams or television stations owned by other players . when a player needs money , he may auction off any of the cards he owns to the highest bidder . if there are no buyers , the commissioner &# 39 ; s office must buy the cards at one half the original price . team players are also sold back to the commissioner for half price . the winner of the game may be the person having the most money after a given time limit , or when one player has no money left or one player accumulates all of the money . while only one specific embodiment has been fully illustrated and described , it is apparent that many variations may be made in the particular configuration and rules of the game without departing from the scope of the invention as set forth in the appended claims .

US-67132176-A

methods for the identification , production and use of staphylokinase derivatives characterized by a reduced immunogenicity after administration in patients . the derivatives of the invention are obtained by preparing a dna fragment comprising at least the part of the coding sequence of staphylokinase that provides for its biological activity ; performing in vitro site - directed mutagenesis on the dna fragment to replace one or more codons for wild - type amino acids by a codon for another amino acid ; cloning the mutated dna fragment in a suitable vector ; transforming or transfecting a suitable host cell with the vector ; culturing the host cell under conditions suitable for expressing the dna fragment ; and purifying the expressed staphylokinase derivative to homogeneity . preferably the dna fragment is a 453 bp ecori - hindiii fragment of the plasmid pmex602sakb , , the in vitro site - directed mutagenesis is performed by spliced overlap extension polymerase chain reaction and the mutated dna fragment is expressed in e . coli strain tg1 or wk6 . the invention also relates to pharmaceutical compositions comprising at least one of the staphylokinase derivatives according to the invention together with a suitable excipient , for treatment of arterial thrombosis .

in the above and the following the terms “ derivatives ”, “ mutants ” and “ variants ” are used interchangeably . the present invention will be demonstrated in more detail in the following examples , that are however not intended to be limiting to the scope of the invention . based on the present invention other variants and improvements will be obvious for the person skilled in the art . thus random mutagenesis is likely to generate alternative mutants with reduced immunogenicity and possibly increased functional activity , whereas deletions or substitution with other amino acids may yield additional variants with reduced immunogenicity . the epitope specificity of a panel of 15 murine mabs ( 22 ) raised against wild - type sakstar was determ ined by real - time biospecific int eraction analysis ( bia ) with the biacore instrument ( pharmacia , biosensor ab , uppsala , sweden ). the mabs were immobilized on the surface of the sensor chip cm5 with the amine coupling kit ( pharmacia biosensor ab ) as recommended by the manufacturer ( 25 ). immobilization was performed from protein solutions at a concentration of 20 μg / ml in 10 mmol / l sodium acetate at ph 5 . 0 at a flow rate of 5 μl / min during 6 minutes . this resulted in covalent attachment of 5 , 000 to 10 , 000 resonance unit ( ru ) of antibody ( corresponding to 0 . 035 to 0 . 07 pmol / mm 2 ) . the sakstar solutions were passed by continuous flow at 20 ° c . past the sensor surface . at least four concentrations of each analyte ( range , 50 nmol / l to 50 μmol / l ) in 10 mmol / l hepes , 3 . 4 mmol / l edta , 0 . 15 mol / l nacl , and 0 . 005 % surfactant p20 , ph 7 . 2 , were injected at a flow rate of 5 μl / min during 6 minutes in the association phase . then sample was replaced by buffer , also at a flow rate of 5 μl / min during 6 minutes . after each cycle , the surface of the sensor chip was regenerated by injection of 5 μl of 15 mmol / l hcl . apparent association ( k ass ) and apparent dissociation ( k diss ) rate constants were derived from the sensorgrams as described in detail elsewhere ( 26 ), and association equilibrium constants ( k a ) calculated as their ratio . determination of the equilibrium association constants for the binding of wild - type and variant sakstar to insolubilized mabs ( table 1 ) yielded apparent association constants of 10 7 to 10 8 ( mol / l ) − 1 , which are one to two orders of magnitude lower than the apparent association constants previously obtained for the binding of these mabs to insolubilized wild - type sakstar ( 22 ). if the mabs instead of the sakstar variants are insolubilized , avidity effects of the bivalent mabs are indeed avoided . the present values are indeed in better agreement with known association constants of mabs , and therefore this “ reversed ” procedure was used throughout the present invention . in the tables the column indicated with “ variant ” states the various staphylokinase derivatives which are identified by listing between brackets the substituted amino acids in single letter symbols followed by their position number in the mature staphylokinase sequence and by the substituting amino acids in single letter symbol ; the column “ exp .” indicates expression levels in mg / l , and the column “ spec . act .” indicates the specific activity in home units as defined in example 2 . indications “ 17g11 ”, “ 26a2 ” etc . refer to monoclonal antibodies binding to the indicated epitopes i , ii and iii ( 22 ). epitope i is recognized by the antibody cluster 17g11 , 26a2 , 30a2 , 2b12 and 3g10 , whereas epitope ii is recognized by the antibody cluster 18f12 , 14h5 , 28h4 , 32b2 and 7f10 , and epitope iii by the antibody cluster 7h11 , 25e1 , 40c8 , 24c4 and 1a10 . human plasma “ pool ” indicates a plasma pool from initially 16 and subsequently 10 patients immunized by treatment with sakstar , “ subpool b ” indicates a plasma pool from three patients that absorbed less than 50 % of the induced antibodies with sakstar ( k35a , e38a , k74a , e75a , r77a ) and “ subpool c ” indicates a plasma pool from 3 patients that absorbed & gt ; 90 % of the induced antibodies with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( 22 ). in tables 6 , 7 and 8 an additional pool of plasma from 40 patients immunized by treatment with sakstar ( pool 40 ) was also used . construction , epitope mapping with murine monoclonal antibodies and absorption with pooled plasma of immunized patients , of “ alanine - to - wild - type ” reversal variants of “ charged - cluster - to - alanine ” mutants of staphylokinase as stated above , wild - type staphylokinase ( sakstar variant ( 9 )) contains three non - overlapping immunodorninant epitopes , two of which can be eliminated by specific site - directed substitution of clusters of two ( k35a , e38a or e80a , d82a ) or three ( k74a , e75a , r77a ) charged amino acids with ala ( 22 ). the combination mutants sakstar ( k35a , e38a , k74a , e75a , r77a ) in which lys35 , glu38 , lys74 , glu75 and arg77 , and sakstar ( k74a , e75a , r77a , e80a , d82a ) in which lys74 , glu75 , arg77 , glu80 and asp82 were substituted with ala ( previously identified as sakstar . m3 . 8 and sakstar . m8 . 9 , respectively ( 22 )), were found to have a reduced reactivity with murine monoclonal antibodies against two of the three immunodominant epitopes and to absorb on average only 2 / 3 of the neutralizing antibodies elicited in 16 patients by treatment with wild - type sakstar ( 22 ). these mutants also induced less antibody formation than wild - type sakstar in experimental thrombolysis models in rabbits and baboons , and in patients with peripheral arterial occlusion ( 22 ). however , their specific activities were reduced to approximately 50 % of that of wild - type sakstar , which would be of some concern with respect to the clinical use of these compounds . in an effort to improve the activity and stability without loss of the reduced antibody recognition , the effect of a systematic reversal of one or more of these substituted amino acids to the wild - type residues was studied . fourteen new mutants were constructed , purified and characterized in terms of specific activity , reactivity with the panel of murine monoclonal antibodies , and absorption of antibodies from plasma of patients treated with wild - type sakstar ( table 1 ). the present example thus focusses on reversal from alanine to the wild - type residue of one or more of the seven amino acids of sakstar listed above i . e . k35 , e38 , k74 , e75 , r77 , e80 and d82 . the source of all reagents used in the present study has previously been reported ( 22 ). restriction enzymes were purchased from pharmacia ( uppsala , sweden ) or boehringer mannheim ( mannheim , germany ). t4 dna ligase , klenow fragment of e . coli dna polymerase i and alkaline phosphatase were obtained from boehringer mannheim . enzyme reactions were performed using the conditions suggested by the suppliers . plasmid dna was isolated using a qiagen - purification protocol ( provided by westburg , leusden , the netherlands ). pmex . 602sakb ( i . e . pmex . sakstar ) was constructed as described elsewhere ( 23 ). sakstar , sakstar ( k35a , e38a ), sakstar ( k74a , e75a , r77a ), sakstar ( e80a , d82a ), sakstar ( k35a , e38a , k74a , e75a , r77a ) and sakstar ( k74a , e75a , r77a , e80a , d82a ) were produced and purified as described elsewhere ( 22 ). transformations of e . coli were performed utilizing the calcium phosphate procedure . dna sequencing was performed using the dideoxy chain termination reaction method and the automated laser fluorescent a . l . f .™ ( pharmacia ). the chromogenic substrate ( s2403 ) l - pyroglutamyl - l - phenylalanyl - l - lysine - p - nitroanaline hydrochloride was purchased from chromogenix ( belgium ). 125 i - labeled fibrinogen was purchased from amersham ( uk ). all other methods used in the present example have been previously described ( 22 , 27 ). the plasmids encoding sakstar ( k35a , e38a , k74a , e75a ), sakstar ( e38a , e75a , r77a ), sakstar ( e38a , e75a ), sakstar ( k35a , e75a , r77a ), sakstar ( k35a , e75a ), sakstar ( e80a ), sakstar ( d82a ), sakstar ( e75a , d82a ), sakstar ( k74a ) and sakstar ( e75a ) were constructed by the spliced overlap extension polymerase chain reaction ( soe - pcr ) ( 24 ), using vent dna polymerase ( new england biolabs , leusden , the netherlands ), and available or generated sakstar variants as template . two fragments were amplified by pcr , the first one starting from the 5 ′ end of the staphylokinase gene with primer 5 ′- caggaaacagaattcaggag - 3 ′ ( seq id no : 1 ) to the region to be mutagenized ( forward primer ), the second one from the same region ( backward primer ) to the 3 ′ end of the sraphylokinase gene with primer 5 ′- caaaacagccaagcttcattcattcagc - 3 ′ ( seq id no : 2 ). the forward and backward primers shared an overlap of around 24 bp ( primers not shown ) the two purified fragments were then assembled together in a new primeness pcr using taq polymerase ( boehringer mannheim ). after 7 cycles ( 1 min at 94 ° c ., 1 min at 70 ° c . ), the extended product was reamplified by adding the 5 ′ and 3 ′ end primers ( see above ) to the pcr reaction and by cycling 25 times ( 1 min at 94 ° c , 1 min 55 ° c , 1 min at 72 ° c .). the final product was purified , digested with ecori and hindiii and cloned into the corresponding sites of pmex602sakb . the plasmid encoding sakstar ( e38a , k74a , e75a , r77a ) was assembled by digestion of pmex602sakb and pmex . sakstar ( k35a , e38a , k74a , e75a , r77a ) with bpm i which cuts between the codons for k35 and e38 of sakstar , and ligation of the required fragments . the plasmid encoding sakstar ( k35a , k74a , e75a , r77a ) was constructed by digestion of pmex . sakstar ( k35a , e38a , k74a , e75a , r77a ) and pmex . sakstar ( k74a , e75a , r77a ) with bpm i and religation of the required fragments . the plasmids encoding sakstar ( k35a , e38a , e75a , r77a ) and sakstar ( k35a , e38a , k74a , r77a ) were constructed by two pcr using pmex . sakstar ( k35a , e38a , k74a , e75a , r77a ) as template , followed by restriction ligation and recloning into pmex602sakb . the sakstar variants were expressed and purified , as described below , from transformed e . coli wk6 grown either in lb medium [ sakstar ( e38a , k74a , e75a , r77a ), sakstar ( k74a ), sakstar ( e75a ) and sakstar ( e75a , d82a )], or in terrific broth ( tb ) ( 28 ) medium [ sakstar ( k35a , k74a , e75a , r77a ), sakstar ( k35a , e38a , e75a , r77a ), sakstar ( k35a , e38a , k74a , r77a ), sakstar ( k35a , e38a , e75a ), sakstar ( e38a , e75a , r77a ), sakstar ( e38a , e75a ), sakstar ( k35a , e75a , r77a ), sakstar ( k35a , e75a ), sakstar ( e80a ), and sakstar ( d82a )]. for derivatives produced in lb medium , a 20 ml aliquot of an overnight saturated culture was used to inoculate a 2 l volume of lb medium containing 100 μg / ml ampicillin . after 3 hours incubation at 37 ° c ., iptg ( 200 μmol / l ) was added to induce expression from the tac promoter . the production phase was allowed to proceed for 4 hours , after which the cells were pelleted by centrifugation at 4 , 000 rpm for 20 min , resuspended in 1 / 20 volume ( 100 ml ) of 0 . 01 mol / l phosphate buffer ph 6 . 5 and disrupted by sonication at 0 ° c . cell debris were removed by centrifugation for 20 min at 20 , 000 rpm and the supernatant , containing the cytosolic soluble protein fraction , was stored at − 20 ° c . until purification . for the derivatives produced in tb medium , a 4 ml aliquot of an overnight saturated culture in lb medium was used to inoculate a 2 l culture in terrific broth containing 100 μg / ml ampicillin . the culture was grown with vigorous aeration for 20 hours at 30 ° c . the cells were pelleted by centrifugation , resuspended in 1 / 10 volume ( 200 ml ) of 0 . 01 mol / l phosphate buffer ph 6 . 5 and disrupted by sonication at 0 ° c . the suspension was then centrifuged for 20 min at 20 , 000 rpm and the supernatant was stored at − 20 ° c . until purification . cleared cell lysates containing the sakstar variants were subjected to chromatography on a 1 . 6 × 6 cm column of sp - sephadex , followed by chromatography on a 1 . 6 × 5 cm column of q - sepharose [ variants sakstar ( e38a , k74a , e75a , r77a ), sakstar ( k35a , k74a , e75a , r77a ), sakstar ( k35a , e38a , e75a , r77a ), sakstar ( k35a , e38a , k74a , r77a ) and sakstar ( k35a , e38a , k74a , e75a )] or by chromatography on a 1 . 6 × 6 cm column of phenyl - sepharose [ variants sakstar ( e35a , e38a , r77a ), sakstar ( e38a , e75a ), sakstar ( k35a , e75a , r77a ), sakstar ( k35a , e75a ), sakstar ( k74a ), sakstar ( e75a ), sakstar ( e80a ), sakstar ( d82a ) and sakstar ( e75a , d82a )]. the sakstar containing fractions , localized by sds - gel electrophoresis , were pooled for further analysis . protein concentrations were determined according to bradford ( 29 ). the specific activities of sakstar solutions were determined with a chromogenic substrate assay carried out in microtiter plates using a mixture of 80 μl sakstar solution and 100 μl glu - plasminogen solution prepared as described elsewhere ( 30 ) ( final concentration 0 . 5 μmol / l ). after incubation for 30 min at 37 ° c ., generated plasmin was quantitated by addition of 20 μl s2403 ( final concentration 1 mmol / l ) and measurement of the absorption at 405 nm . the activity was expressed in home units ( hu ) by comparison with an in - house standard ( lot stan5 ) which was assigned an activity of 100 , 000 hu ( 100 khu ) per mg , protein as determined by amino acid composition ( 7 ). sds - page was performed with the phast system ™ ( pharmacia , uppsala , sweden ) using , 10 - 15 % gradient gels and coomassie brilliant blue staining . reduction of the samples was performed by heating at 100 ° c . for 3 min in the presence of 1 % sds and 1 % dithioerythritol . the specific activities of the different sakstar mutants determined with the chromogenic substrate assay are summarized in table 1 . in agreement with previous observations ( 22 ), sakstar ( k74a , e75a , r77a ) did not react with 4 of the 5 mabs recognizing epitope i , whereas sakstar ( k35a , e38a ) did not react with 3 of the 5 and sakstar ( e80a , d82a ) not with 4 of the 5 mabs recognizing epitope iii . these reduced reactivities were additive in sakstar ( k35a , e38a , k74a , e75a , r77a ) and in sakstar ( k74a , e75a , r77a , e80a , d82a ). the reduced reactivity of sakstar ( k74a , e75a , r77a ) was fully maintained in sakstar ( k35a , e38a , k74a , e75a ) and in sakstar ( k35a , e75a , r77a ), largely in sakstar ( k35a , e38a , e75a , r77a ), sakstar ( e38a , e75a , r77a ), sakstar ( e38a , e75a ) and sakstar ( e75a ), but much less in sakstar ( k35a , e38a , k74a , r77a ) and sakstar ( k74a ), indicating that e75 is the main contributor to the binding of the 4 mabs recognizing epitope i of sakstar . however , surprisingly , binding of epitope i antibodies to sakstar ( e75a , d82a ) was normal in two independent preparations from expression plasmids with confirmed dna sequences . the reduced reactivity of the 3 mabs of epitope iii with sakstar ( k35a , e38a ) required both k35 and e38 , as demonstrated with sakstar ( e38a , k74a , e75a , r77a ) and sakstar ( k35a , k74a , e75a , r77a ), with sakstar ( e38a , e75a ) and sakstar ( k35a , e75a ) and with sakstar ( e38a , e75a , r77a ) and sakstar ( k35a , e75a , r77a ). the reduced reactivity of the 4 mabs of cluster mi with sakstar ( e80a , d82a ) was maintained in sakstar ( d82a ) but not in sakstar ( e80a ). absorption of antibodies , elicited in patients by treatment with wild - type sakstar plasma samples from 16 patients with acute myocardial infarction , obtained several weeks after treatment with sakstar ( 4 , 31 ) were used . the staphylokinase - neutralizing activity in these samples was determined as follows . increasing concentrations of wild - type or variant sakstar ( 50 μl volumes containing 0 . 2 to 1000 μg / ml ) were added to a mixture of 300 μl citrated human plasma and 50 μl buffer or test plasma , immediately followed by addition of 100 μl of a mixture containing thrombin ( 50 nih units / ml ) and cacl 2 ( 25 mmol / l ). the plasma clot lysis time was measured and plotted against the concentration of sakstar moiety . from this curve the concentration of staphylokinase moiety that produced complete clot lysis in 20 min was determined . the neutralizing activity titer was determined as the difference between the test plasma and buffer values and was expressed in μg per ml test plasma . the results of the individual patients have been reported elsewhere ( 22 ). for the present invention , three plasma pools were made , one from 10 patients from whom sufficient residual plasma was available , one from three patients that absorbed less than 50 % of the antibodies with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( subpool b ) and one from three patients that absorbed & gt ; 90 % of the antibodies with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( subpool c ). these plasma pools were diluted ( 1 / 30 to 1 / 200 ) until their binding to sakstar substituted chips in the biacore instrument amounted to approximately 2000 ru . from this dilution a calibration curve for antibody binding was constructed using further serial two - fold dilutions . the plasma pools were absorbed for 10 min with 100 nmol / l of the sakstar variants , and residual binding to immobilized sakstar was determined . residual binding was expressed in percent of unabsorbed plasma , using the calibration curve . the results are summarized in table 1 . whereas wild - type sakstar absorbed more than 95 % of the binding antibodies from pooled plasma of the 10 patients , incomplete absorption (& lt ; 60 %) was observed with sakstar ( k74a , e75a , r77a ), sakstar ( k35a , e38a , k74a , e75a , r77a ), sakstar ( e38a , k74a , e75a , r77a ), sakstar ( k35a , k74a , e75a , r77a ), sakstar ( k35a , e38a , k74a , r77a ), sakstar ( k35a , e38a , k74a , e75a ), sakstar ( k74a ) and sakstar ( k74a , e75a , r77a , e80a , d82a ) but absorption was nearly complete with sakstar ( k35a , e38a ), sakstar ( k35a , e38a , e75a , r77a ), sakstar ( e38a , e75a , r77a ), sakstar ( e38a , e75a ), sakstar ( k35a , e75a , r77a ), sakstar ( k35a , e75a ), sakstar ( e75a ), sakstar ( e80a , d82a ), sakstar ( e80a ), sakstar ( d82a ) and sakstar ( e75a , d82a ). these results , surprisingly , demonstrate that approximately 40 % of the antibodies elicited in patients by treatment with wild - type sakstar depend on k74 for their binding ( table 1 ). absorption with pooled plasma from 3 patients from which & lt ; 50 % of the antibodies were absorbed with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( subpool b ) confirmed the predominant role of k74 for antibody recognition . as expected , absorption with pooled plasma from 3 patients from which & gt ; 95 % of the antibodies were absorbed with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( subpool c ) was nearly complete with all variants tested . comparative thrombolytic efficacy and immunogenicity of sakstar ( k74a , e75a , r77a ) and sakstar ( k74a ) versus sakstar in patients with peripheral arterial occlusion a 12 to 24 l culture ( in 2 l batches ) of the variants sakstar ( k74a , e75a , r77a ), or of sakstar ( k74a ) was grown and iptg - induced in lb medium supplemented with 100 μg / ml ampicillin , pelleted , resuspended , disrupted by sonication and cleared as described above . the compounds were purified by chromatography on a 5 × 20 cm column of sp - sephadex , a 5 × 10 cm column of q - sepharose and / or a 5 × 13 cm column of phenyl - sepharose using buffer systems described elsewhere ( 22 , 23 ). the materials were then gel filtered on sterilized superdex 75 to further reduce their endotoxin content . the sakstar variant containing fractions were pooled , the protein concentration was adjusted to 1 mg ,/ ml and the material sterilized by filtration through a 0 . 22 μm lylillipore filter . the methodology used to determine the biological properties of the final material required for use in vivo is described above and elsewhere ( 22 ). staphylokinase - neutralizing activity in plasma was determined as described above . quantitation of antigen - specific igg and igm antibodies was performed using enzyme - linked immunosorbent assays in polystyrene microtiter plates essentialy as described previously ( 22 ). in the igg assays , dilution curves of affinospecific anti - sakstar igg antibodies were included on each plate . these antibodies were isolated from plasma obtained from 3 patients , after thrombolytic therapy with wild - type sakstar , by chromatography on protein a - sepharose and on insolubilized sakstar , and elution of bound antibodies with 0 . 1 mol / l glycine - hcl , ph 2 . 8 . the purity of the igg preparation was confirmed by sodium dodecylsulfate polyacrylarnide gel electrophoresis . in the igm assays , titers defined as the plasma dilution giving an absorbancy at 492 nm equivalent to that of a 1 / 640 dilution of pooled plasma were determined and compared with the titer of baseline samples before treatment ( median value 1 / 410 , interquartile range 1 / 120 - 1 / 700 ). wild - type sakstar or the variants sakstar ( k74a ) or sakstar ( k74a , e75a , r77a ) were administered intra - arterially at or in the proximal end of the occlusive thrombus as a bolus of 2 mg followed by an infusion of 1 mg / hr ( reduced overnight in some patients to 0 . 5 mg / hr ) in groups of 6 to 12 patients with angiographically documented occlusion of a peripheral artery or bypass graft of less than 120 days duration . patients were studied after giving informed consent , and the protocol was approved by the human studies committee of the university of leuven . inclusion and exclusion criteria , conjunctive antithrombotic treatment ( including continuous intravenous heparin ) and the study protocol were essentially as previously described ( 22 ). relevant baseline characteristics of the individual patients are shown in table 2 . the majority of pao were at the femoropopliteal level . two iliac stent and 8 graft occlusions were included . eight patients presented with incapacitating claudication , 5 with chronic ischemic rest pain , 7 with subacute ischemia and 7 with acute ischemia . one patient ( poe ) who had 2 years previously been treated with sakstar was included in the sakstar ( k74a ) group . this patient was not included in the statistical analyses . table 2 also summarizes the individual treatment and outcome . intra - arterial infusion , at a dose of 6 . 0 to 25 mg and a duration of 4 . 0 to 23 hrs , induced complete recanalization in 24 patients and partial recanalization in 3 . complementary endovascular procedures ( mainly pta ) were performed in 17 patients and complementary reconstructive vascular surgery following thrombolysis in 3 . no patient underwent major amputation . early recurrence of thrombosis after the end of the angiographic procedure occurred in 4 patients . bleeding complications were absent or limited to mild to moderate hematoma formation at the angiographic puncture sites except for 5 patients who required transfusion ( data not shown ). intracranial or visceral hemorrhage was not observed . circulating , fibrinogen , plasminogen and α 2 - antiplasmin levels remained essentially unchanged during infusion of the sakstar moieties ( data not shown ), confirming absolute fibrin specificity of staphylokinase at the dosages used . significant in vivo fibrin digestion occurred as evidenced by elevation of fibrin fragment d - dimer levels . intra - arterial heparin therapy prolonged aptt levels to a variable extent ( data not shown ). antibody - related sakstar -, sakstar ( k74a )- and sakstar ( k74a , e75a , r77a )- neutralizing , activity and anti - sakstar , anti - sakstar ( k74a ) and anti - sakstar ( k74a , e75a , r77a ) igg , were low at baseline and during the first week after the infusion ( fig2 ). from the second week on , neutralizing activity levels increased to reach median values at 3 to 4 weeks of 20 μg sakstar ( k74a ) and 2 . 4 μg sakstar ( k74a , e75a , r77a ) neutralized per ml plasma in the patients treated with sakstar ( k74a ) and sakstar ( k74a , e75a , r77a ), respectively , which is significantly lower than the median value of 93 μg wild - type sakstar neutralized per ml in the patients treated with sakstar ( p = 0 . 024 for differences between the three groups by kruskal - wallis analysis and p = 0 . 01 and p = 0 . 036 , respectively , for variants vs wild - type by mann - whitney rank sum test ). the levels of anti - sakstar ( k74a ) and of anti - sakstar ( k74a , e75a , r77a ) igg increased to median values at 3 to 4 weeks of 270 and 82 μg / ml plasma in patients treated with sakstar ( k74a ) and sakstar ( k74a , e75a , r77a ) respectively , which is significantly lower than the median value of 1800 μg anti - sakstar per ml plasma in the patients treated with sakstar (( p = 0 . 024 for differences between the three groups by kruskal - wallis analysis and p = 0 . 007 and 0 . 05 , respectively , for variants versus wild - type by mann - whitney rank sum test ). the titers of anti - sakstar ( k74a ) and of anti - sakstar ( k74a , e75a , r77a ) igm increased from median baseline values of 1 / 460 and 1 / 410 to median values at 1 week of 1 / 510 and 1 / 450 in patients treated with sakstar ( k74a ) and sakstar ( k74a , e75a , r77a ), respectively , which was not significantly different from the median values of 1 / 320 at baseline and 1 / 640 at week 1 in patients treated with sakstar . corresponding values at 2 weeks were 1 / 590 and 1550 in patients given sakstar ( k74a ) and sakstar ( k74a , e75a , r77a ), not significantly different from 1 / 930 with sakstar ( data not shown ). the antibodies induced by treatment with sakstar were completely absorbed by sakstar but incompletely by sakstar ( k74a ) and by sakstar ( k74a , e75a , r77a ) confirming the immunogenicity of the k74 , e75 , r77 epitope and the dominant role of k74 in the binding of antibodies directed against this epitope . the antibodies induced by treatment with sakstar ( k74a ) or sakstar ( k74a , e75a , r77a ) were completely absorbed by sakstar , by sakstar ( k74a ) and by sakstar ( k74a , e75a , r77a ), indicating that immunization was not due to neoepitopes generated by substitution of lys74 with ala , but to epitopes different from the k74 , e75 , r77 epitope . thus , this example illustrates that staphylokinase variants with reduced antibody induction but intact thrombolytic potency can be generated . the present experience in 26 patients treated with sakstar ( n = 9 ), sakstar ( k74a ) ( n = 11 ) and sakstar ( k74a , e75a , r77a ) ( n = 6 ) combined with previous experience in 14 patients with sakstar ( n = 7 ) and sakstar ( k35a , e38a , k74a , e75a , r77a ) ( n = 7 ) ( 31 ) and in 24 patients with sakstar ( 32 ), and with subsequent non - randomized experience in patients with sakstar ( n = 30 ) with sakstar ( k74a ) ( n = 12 ) and with sakstar ( k74a , e75a , r77a ) ( n = 7 ) ( data not shown ), allows an initial estimation of the prevalence of immunization by intra - arterial treatment with sakstar or variants with an altered k74 , e75 , r77 epitope [ sakstar ( k74a ), sakstar ( k74a , e75a , r77a ) and sakstar ( k35a , e38a , k74a , e75a , r77a )]. neutralizing activity data after 2 to 4 weeks , available in 70 patients with peripheral arterial occlusion given intra - arterial sakstar , revealed that 56 patients ( 80 percent ) had levels & gt ; 5 μg compound neutralized per ml plasma . of the patients given sakstar ( k74a ), sakstar ( k74a , e75a , r77a ) or sakstar ( k74a , e75a , k74a , e75a , r77a ), 27 of the 43 ( 63 percent ) had neutralizing activity levels of & gt ; 5 μg compound per ml plasma . this difference is statistically significant ( p = 0 . 05 by fisher &# 39 ; s exact test ) indicating that the k74 , e75 , r77 epitope is a major determinant of antibody induction . however , the residual prevalence of specific immunocompetence against sakstar ( k74a ) indicates that additional mutagenesis to further reduce the immunogenicity of sakstar variants for clinical use , would be desirable . construction , epitope mapping with murine monoclonal antibodies and absorption with pooled plasma of immunized patients , of alanine - substitution mutants of staphylokinase site - directed mutagenesis was applied to residues other than “ charged amino acids ” in order to identify i ) additional residues belonging to epitopes i and iii identified with the panel of murine mabs and ii ) amino acids determining absorption to antiserum from immunized patients . since functional epitopes generally comprise more than one amino acid residue critical for antibody binding , identification of additional residues in these epitopes could lead to the construction of new combination derivatives displaying a lower antigenic profile , while keeping the specific activity and the temperature stability of wild - type staphylokinase . in this example , the construction and characterization of sakstar variants in which one or at most two amino acids ( adjacent or in close vicinity ) were substituted with alanine is described . the mutants described under this example are listed in table 3 . these variants were expressed in e . coli , purified and characterized in terms of specific activity , reactivity with the panel of murine monoclonal antibodies , and absorption of antibodies from plasma of patients treated with wild - type sakstar . the source of all reagents used in the present study has previously been reported ( 22 ), or is specified below . the template vector for mutagenesis , pmex602sakb ( i . e . pmex . sakstar ), has been described elsewhere ( 23 ). restriction and modification enzymes were purchased from new england biolabs ( leusden , the netherlands ), boehringer mannheim ( mannheim , germany ) or pharmacia ( uppsala , sweden ). the enzymatic reactions were performed according to the supplier recommendation . the mutagenic oligonucleotides and primers were obtained from eurogentec ( seraing , belgium ). plasmid dna was isolated using a purification kit from qiagen ( hilden , germany ) or the bio 101 rpm kit ( vista , calif . ), as recommended . transformation - competent e . coli cells were prepared by the well - known calcium phosphate procedure . nucleotide sequence determination was performed on double strand plasmid dna with the dideoxy chain termination method , using the t7 sequencing kit ( pharmacia , uppsala , sweden ). polymerase chain reactions ( pcr ) were performed using taq polymerase from boehringer mannheim ( mannheim , germany ) or vent polymerase ( new england biolabs , leusden , the netherlands ). the recombinant dna methods required to construct the variants described in this example are well established ( 22 , 27 ). the variants sakstar ( y17a , f18a ), sakstar ( f104a ), sakstar ( f111a ), sakstar ( y9a ), sakstar ( y91a ), sakstar ( y92a ), sakstar ( i87a ), sakstar ( i106a ) and sakstar ( i120a ) were constructed with the chameleon double - stranded site - directed mutagenesis kit from stratagene ( la jolla , usa ), using the pmex . sakstar vector as template , and following instructions of the supplier . the mutagenic oligonucleotides ( not shown ) were used in combination with the selection - primer ly34 5 ′ caaaacagccgagcttcattcattcagc ( seq id no : 3 ), which destroys the unique hindiii site located 3 ′ to the staphylokinase encoding gene in pmex . sakstar and allows to counter - select the non - mutant progeny by hindiii digestion . the deletion of the hindiii site was in most cases correlated with the presence of the desired mutation introduced by the mutagenic oligonucleotide . the variant sakstar ( i133a ), was constructed by perforning a polymerase chain reaction on the pmex . sakstar plasmid using the primer 818a located at the 5 ′ end of the sakstar gene ( 5 ′ caggaaacagaattcaggag ) ( seq id no : 1 ) and the mutagenic primer ly58 ( 5 ′ ttcagcatgctgcagttatttcttttctgcaacaaccttgg ) ( seq id no : 4 ). the amplified product ( 30 cycles : 30 sec at 94 ° c ., 30 sec at 50 ° c ., 30 sec at 72 ° c .) was purified , digested with ecori and psti , and ligated into the corresponding sites of pmexsakstar . the variants sakstar ( i128a ), sakstar ( l127a ) and sakstar ( n126v ) were constructed by performing a polymerase chain reaction using the primer 818a located at the 5 ′ end of the sakstar gene and mutagenic primers ( not shown ). the amplified product ( 30 cycles : 1 sec at 94 ° c ., 1 sec at 50 ° c ., 10 sec at 72 ° c .) was purified , digested with ecori and styi , and ligated into the corresponding sites of pmexsakstar . the variant sakstar ( f125a ) was constructed by performing two consecutive pcr reactions ( 30 cycles : : 30 sec at 94 ° c ., 30 sec at 50 ° c ., 30 sec at 72 ° c .). in the first reaction , a fragment of pmex . sakstar was amplified with the primers 818a and a mutagenic primer . this amplified fragment was then used as template in a second pcr reaction with a mutagenic primer in order to further elongate the fragment downstream of the styi site present in the sakstar gene ( corresponding to amino acids 130 - 131 of sakstar ). the resulting product was digested with ecori and styi , and ligated into the corresponding sites of pmexsakstar . the plasmids encoding all the other variants listed in table 3 were constructed by direct pcr or by the spliced overlap extension polymerase chain reaction ( soe - pcr )( 24 ) using pmex . sakstar or available plasmnids encoding sakstar variants as template . two fragments were amplified by pcr ( 30 cycles : 1 sec at 94 ° c , 1 sec at 50 ° c ., 10 sec at 72 ° c . ), the first one starting from the 5 ′ end ( primer 818a ) of the staphylokinase gene to the region to be mutagenized ( forward primer ), the second one from this same region ( backward primer ) to the 3 ′ end of the gene with primer 818d ( 5 ′ caaacagccaagcttcattcattcagc ) ( seq id no : 5 ). the forward and backward primers shared an overlap of around 24 bp ( primers not shown ). the two purified fragments were then assembled together in a second pcr reaction with the external primers 818a and 818d ( 30 cycles : 1 sec at 94 ° c ., 1 sec at 50 ° c ., 10 sec at 72 ° c .). the amplified product from this final reaction was purified , digested with ecori and hindiii and ligated into the corresponding site of pmex . sakstar . for each construction , the sequence of the variant was confirmed by sequencing the entire sakstar coding region . the sakstar variants were expressed and purified , as described below , from transformed e . coli grown in terrific broth ( tb ) medium ( 28 ). a 2 to 4 ml aliquot of an overnight saturated culture in lb medium was used to inoculate a 1 to 2 l culture in terrific broth supplemented with 100 μg / ml ampicillin . the culture was incubated with vigorous aeration and at 30 ° c . after about 16 hours incubation , iptg ( 200 μmol / l ) was added to the culture to induce expression from the tac promoter . after 3 hours induction , the cells were pelleted by centrifugation at 4 , 000 rpm for 20 min , resuspended in 1 / 10 volume of 0 . 01 mol / l phosphate buffer ph 6 - 6 . 5 and disrupted by sonication at 0 ° c . the suspension was centrifuged for 20 min at 20 , 000 rpm and the supematant was stored at 4 ° c . or at − 20 ° c . until purification . the material was purified essentially as described above ( example 2 ): cleared cell lysates containing the sakstar variants were subjected to chromatography on a 1 . 6 × 5 cm column of sp - sephadex , followed by chromatography on a 1 . 6 × 8 cm column of phenyl - sepharose . the sakstar containing fractions , localized by sds - gel electrophoresis , were pooled for further analysis . protein concentrations were determined according to bradford ( 29 ). sds - page was performed with the phast system ™ ( pharmacia , uppsala , sweden ) using 10 - 15 % gradient gels and coomassie brillant blue staining , and the specific activities of sakstar solutions were determined with a chromogenic substrate assay carried out in microtiter plates ( as described in example 2 ). the specific activity of the different sakstar variants are summarized in table 3 . the methodology used to determine the reactivity of the sakstar variants with a panel of murine monoclonal antibodies was described in example 1 above . the results are summarized in table 3 ( the layout of this table corresponds to the layout of table 1 , as described in example 1 ). apparent association constants at least 10 - fold lower than those of wild - type staphylokinase were considered as significant and are indicated in bold type in the table . in order to obtain a comprehensive inventory of the properties of ala - substitution variants of the sakstar molecule , 67 plasmids encoding variants with substitution of a single or two adjacent amino acids with ala were constructed , expressed and purified . together with the 35 charged residue to ala - substitution variants previously described ( 22 , and example 2 ), this analysis covers all residues in sakstar except gly , ala and pro , as illustrated in fig3 . eight of the variants could not be obtained in purified form , primarily as a result of low expression levels , 11 variants were inactive , 56 had a reduced specific activity , and 27 had a maintained or increased specific activity (≧ 100 khu / mg ). the yields of purified material from cultures of expressed plasmids were 16 mg / l ( median , 10 to 90 percentile range 4 to 41 mg / l ). sds polyacrylamide gel electrophoresis consistently showed one main band with m r ≈ 16 , 000 , usually representing ≧ 95 % of total protein ( not shown ). substitution of k35 , n95 , s103 or k135 with ala yielded variants with specific activities of ≧ 200 ku / mg . substitution of w66 , y73 or e75 with ala reduced the reactivity of the variants with ≧ 3 antibodies of epitope cluster i , of h43 or v45 with ala that with 3 antibodies from epitope cluster ii and of v32 , k35 , d82 and k130 with ala that with ≧ 3 antibodies of epitope cluster iii . for the present example , the three plasma pools , as described in example 2 were used . the methodology used to evaluate the absorption with wild - type staphylokinase and with sakstar variants , of antibodies elicited in patients treated with sakstar , is described in detail in example 2 . the results are summnarized in table 3 . whereas wild - type sakstar and most of the variants analyzed in this example absorbed more than 95 % of the binding antibodies from pooled plasma of the 10 patients , incomplete absorption (& lt ; 60 %) was observed with sakstar ( y73a ), and with sakstar ( k74a ). the predominant role of lys74 for antibody recognition has been demonstrated previously ( see example 2 ). the present results indicate that tyr73 participates to the same major epitope as lys74 , or , alternatively , that substitution at tyr73 may indirectly induce a structural modification of the “ k74 - epitope ”. absorption with pooled plasma from 3 patients from which & gt ; 95 % of the antibodies were absorbed with sakstar ( k35a , e38a , k74a , e75a , r77a ) ( subpool c , see example 2 ) was nearly complete with most variants tested . construction , epitope mapping with murine monoclonal antibodies and absorption with pooled plasma of immunized patients , of staphylokinase variants with substitution of s34 , g36 and / or h43 the natural variant sak42d differs from sakstar in three amino acids and corresponds to sakstar ( s34g , g36r , h43r ). sak42d is characterized by reduced reactivity with some murine antibodies of epitope clusters ii and iii and a slightly reduced absorption of antibodies from plasma of patients treated with sakstar ( table 4 ). mutagenesis of these residues in sakstar revealed that the reduced reactivity with epitope cluster in and with immunized patient plasma could be ascribed to the g36r substitution , the h43r substitution mediated the reduced reactivity with epitope cluster ii but had no effect on the reactivity with immunized patient plasma , whereas the s34a substitution had no effect . the g36r substitution could be combined with the k74r but not with the k74a substitution , without significant reduction of the specific activity ( table 4 ). construction , epitope mapping with murine monoclonal antibodies and absorption with pooled plasma of immunized patients , of staphylokinase variants with substitution of k35 , e65 , y73 , k74 , e80 + d82 , n95 , k130 , v132 and / or k135 based on the results of the alanine - substitution analysis in example 4 , k35 , n95 and k135 were selected for further analysis because sakstar ( k35a ), sakstar ( n95a ) and sakstar ( k135a ) had a two - fold increased specific activity , y73 and k74 because sakstar ( y73a ) and sakstar ( k74a ) had a markedly reduced reactivity with antibodies from epitope cluster i and diminished absorption of antibodies from plasma of patients immunized by treatment with sakstar , and k35 , e80 + d82 , k130 and v132 because sakstar ( k35a ), sakstar ( e80a , d82a ), sakstar ( k130a ) and sakstar ( v132a ) had a reduced reactivity with antibodies from epitope cluster iii . in an effort to maximize the activity / antigenicity ratio , these amino acids were substituted with other amino acids than ala . as summarized in table 5 , substitution of k35 with a , e or q revealed that sakstar ( k35a ) had the most interesting properties , substitution of y73 with f , h , l , s or w did not rescue the marked reduction in specific activity , and k74 confirmed its key role in binding of antibodies from immunized patient plasma , the best specific activity / antigenicity ratios being obtained with sakstar ( k74q ) and sakstar ( k74r ). sakstar ( e80a , d82a ) was preferred over the single residue variants sakstar ( e80a ) or sakstar ( d82a ) because of its somewhat lower reactivity with immunized patient plasma . sakstar ( n95a ) could not be further improved by substitution of n95 with e , g , k or r and it was unable to confer its increased specific activity to variants containing k74a or k135r . finally sakstar ( k130a ) was outperformed in terms of specific activity by sakstar ( k130t ) and sakstar ( v132a ) by sakstar ( v132r ). construction , epitope mapping with murine monoclonal antibodies and absorption with pooled plasma of immunized patients of combination variants of sakstar ( k130t , k135r ) and sakstar ( e80a , d82a , k130t , k135r ) with k35a , g36r , e65x , k74x and selected other amino acids in the present and the following examples an additional plasma pool was made from 40 patients obtained several weeks after treatment with sakstar ( pool 40 ). the original pool from 10 patients is further identified as pool 10 . the absorption of staphylokinase - specific antibodies was quantified as described above and elsewhere ( 22 ). the sakstar ( k130t , k135r ) variant was taken as a template for additive mutagenesis because of its high specific activity with a moderate reduction of binding to antibodies of epitope cluster iii and absorption of antibodies from immunized patient plasma ( table 6 ). addition of g36r , k74r , or k74q or both to the template did not markedly reduce the specific activity , reduced the reactivity with monoclonal antibodies against epitope cluster iii ( g36r substitution ) and decreased the absorption of antibodies from immunized patient plasma ( k74r or k74q substitution ). combination of e65a or e65q with k74q in the sakstar ( k130t , k135r ) template reduced the absorption of antibodies from pool 10 and pool 40 to around 50 and 60 percent respectively , without markedly reducing the specific activity . addition substitution of selected amino acids in the sakstar ( e65q , k74q , k130t , k135r ) template did not further reduce the antibody absorption from pool 10 or pool 40 . surprisingly , the substitution of k136 with a and the addition of k in position 137 resulted in a marked increase in specific activity , as measured in the chromogenic substrate assay . combination of the sakstar ( e80a , d82a ) and sakstar ,( k130t , k135r ) templates , did not affect the specific activity and had a reduced reactivity with epitope cluster iii antibodies ( table 7 ). therefore the sakstar ( e80a , d82a , k130t , k135r ) template was selected for further mutagenesis . addition of k74r and even more of k74q drastically reduced the reactivity with immunized patient plasma . finally , addition of e65d or of k35a or e65s to the sakstar ( k74r , e80a , d82a , k130t , k135r ) or sakstar ( k74q , e80a , d82a , k130t , k135r ) templates yielded variants with intact specific activity which only bound ≦ 45 of the antibodies of pooled immunized patient plasma and less than 15 percent of the subpool reacting for more than 50 percent with the k74 , e75 , r77 epitope . characterization of selected variants of staphylokinase with intact specific activity and less than 50 % adsorption of pooled sakstar specific human antibodies elicited in patients by treatment with wild - type sakstar twenty three of the variants constructed and characterized in the above examples combined the properties of a residual specific activity of ≧ 100 khu / mg and ≦ 50 percent absorption with the pool of antisera obtained from 10 patients treated with wild - type sakstar . the results are summarized in table 8 . results obtained with subpool b and subpool c and with the pool of 40 patients treated with wild - type sakstar are included . sakstar ( k74q , e80a , d82a , k130t , k135r ), sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ), sakstar ( k35a , e65d , k74q , e80a , d82a , k130t , k135r ) and sakstar ( e65q , k74q , n95a , e118a , k130a , k135r , k136a ,+ 137k ) were selected for further characterization . the fibrinolytic and fibrinogenolytic properties of the sakstar variants were determined as previously described . dose - and time - dependent lysis of 125 i - fibrin labeled human plasma clots submerged in human plasma was obtained with the selected variants ( table 9 ). spontaneous clot lysis during the experimental period was ≦ 5 % ( not shown ). equi - effective concentrations of test compound ( causing 50 % clot lysis in 2 hrs ; c 50 ), determined graphically from plots of clot lysis at 2 hrs versus the concentration of plasminogen activator ( not shown ), ranged from 0 . 11 ± 0 . 01 to 0 . 24 ± 0 . 04 μg / ml at which the residual fibrinogen levels ranges between 92 ± 30 and 97 ± 30 percent of baseline ( table 9 ). the concentrations of compound causing 50 % fibrinogen degradation in 2 hrs in human plasma in the absence of fibrin were determined graphically from dose - response curves ( not shown ). these values ( mean ± sd of 3 independent experiments ) ranged from 14 ± 3 . 2 to 29 ± 3 . 1 μg / ml ( table 9 ). surprisingly the very high specific activity of sakstar ( e65q , k74q , n95a , e118a , k130a , k135r , k136a ,+ 137k ) in the chromogenic assay was not associated with an increased thrombolytic potency in a plasma milieu . the temperature stability of preparations of sakstar ( k74q , e80a , d82a , k130t , k135r ), sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) and sakstar ( k35a , e65d , k74q , e80a , d82a , k130t , k135r ), dissolved to a concentration of 1 . 0 mg / ml in 0 . 15 mol / l nacl , 0 . 01 mol / l phosphate buffer , ph 7 . 5 at various temperatures is illustrated in fig4 . at temperatures up to 37 ° c ., all compounds remained fully active for up at least three days . at 56 ° c . and 70 ° c . the three variants were however less stable than wild - type sakstar . the pharmacokinetic parameters of the disposition of sakstar variants from blood were evaluated in groups of 4 hamsters following intravenous bolus injection of 100 μg / kg sakstar variant . sakstar - related antigen was assayed using the elisa described elsewhere . the elisa was calibrated against each of the sakstar variants to be quantitated . pharmacokinetic parameters included : initial half - life ( in min ), t1 / 2α = ln2 / α ; terminal half - life ( in min ), t1 / 2β = ln2 / β ; volume of the central ( plasma ) compartment ( in ml ), v c = dose /( a + b ); area under the curve ( in μg . min . ml − 1 ), auc = a / α + b / β ; and plasma clearance ( in ml . min − 1 ), clp = dose / auc ( 33 ). the disposition rate of staphylokinase - related antigen from blood following bolus injection of 100 μg / kg of the selected sakstar variants in groups of 4 hamsters could adequately be described by a sum of two exponential terms by graphical curve peeling ( results not shown ), from which the pharmacokinetic parameters summarized in table 10 were derived . the pharmacokinetic parameters of the mutants were not markedly different from those of wild type sakstar . initial plasma half - lives ( t1 / 2 ( α )) ranged between 2 . 0 and 3 . 2 min and plasma clearances ( clp ) between 1 . 6 and 4 . 1 ml / min . comparative thrombolytic efficacy and immunogenicity of sakstar ( k74q , e80a , d82a , k130t , k135r ) and sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) versus sakstar in patients with peripheral arterial occlusion eighteen liter cultures ( in 2 l batches ) of the variants sakstar ( k74q , e80a , d82a , k130t , k135r ) and sakstar ( e65d , k74r , esoa , d82a , k130t , k135r ) were grown for 20 hours in terrific broth medium ( 28 ), supplemented with 100 μg / ml ampicillin and induced with iptg during the last 3 hours . the cells were pelleted , resuspended in 1 / 10 volume of 0 . 01 mol / l phosphate buffer , ph 6 . 0 , disrupted by sonication and cleared by centrifugation . the compounds were purified by chromatography on a 10 × 7 cm column of sp - sepharose , equilibrated with 0 . 01 mol / l phosphate buffer , ph 6 . 0 and eluted with a 1 mol / l nacl gradient ( 3 column volumes ). the fractions containing sakstar variant were pooled , solid nacl was added to a concentration of 2 . 5 mol / l and the material was chromatographed on a 10 × 20 cm column of phenyl - sepharose followed by stepwise elution with 0 . 01 mol / l phosphate buffer , ph 6 . 0 . the materials were desalted on a 10 × 45 cm column of sephadex g25 , concentrated by application on a 5 × 10 cm column of sp - sepharose with stepwise elution with 1 . 0 mol / l nacl and finally gel filtered on a 6 × 60 cm column of superdex 75 equilibrated with 0 . 15 m nacl , 0 . 01 mol / l phosphate buffer , ph 7 . 5 to further reduce their endotoxin content . the sakstar variant containing fractions were pooled , the protein concentration was adjusted to 1 mg / ml and the material sterilized by filtration through a 0 . 22 μm millipore filter . the methodology used to determine specific activity , endotoxin contamination , bacterial sterility and toxicity in mice is described above and elsewhere ( 22 ). the purity of the preparation was evaluated by sds gel electrophoresis on 10 % gels to which 40 μg of compound was applied . out of culture volumes of 18 liters of sakstar variant , 840 mg of sakstar ( k74q , e80a , d82a , k130t , k135r ) with a specific activity of 140 khu / mg and 800 mg sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) with a specific activity of 150 were purified . the endotoxin content was & lt ; 0 . 1 and 0 . 26 iu / mg . gel filtration on hplc revealed a single main symmetrical peak in the chromatographic range of the column , representing & gt ; 98 % of the eluted material ( total area under the curve ) ( not shown ). sds gel electrophoresis of 40 μg samples revealed single main components ( not shown ). preparations sterilized by filtration proved to be sterile on 3 day testing as described elsewhere ( 22 ). intravenous bolus injection of sakstar variants in groups of 5 mice ( 3 mg / kg body weight ), did not provoke any acute reaction , nor reduced weight gain within 8 days , in comparison with mice given an equal amount of saline ( not shown ). wild - type sakstar or the variants sakstar ( k74q , e80a , d82a , k130t , k135r ) or sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) were administered intra - arterially at or in the proximal end of the occlusive thrombus as a bolus of 2 mg followed by an infusion of 1 mg / hr ( reduced overnight in some patients to 0 . 5 mg / hr ) in groups of 15 , 6 and 6 patients respectively with angiographically documented occlusion of a peripheral artery or bypass graft of less than 30 days duration . patients were studied after giving informed consent , and the protocol was approved by the human studies committee of the university of leuven . inclusion and exclusion criteria , conjunctive antithrombotic treatment ( including continuous intravenous heparin ) and the study protocol were essentially as previously described ( 22 ). relevant baseline characteristics of the individual patients and results of treatment and outcome are shown in table 11 . intra - arterial infusion , at a dose of 3 . 5 to 27 mg and a duration of 2 to 44 hrs , induced complete recanalization in 22 patients and partial recanalization in 5 . complementary endovascular procedures ( mainly pta ) were performed in 13 patients and complementary reconstructive vascular surgery following thrombolysis in 5 . one patient underwent major amputation . bleeding complications were usually absent or limited to mild to moderate hematoma formation at the angiographic puncture sites ( data not shown ). one patient , given wild - type sakstar suffered a non - fatal intracranial bleeding , one ( bue ) a retroperitoneal hematoma and two ( man and stro ) a gastro - intestinal bleeding . circulating fibrinogen , plasminogen and a 2 - antiplasmin levels remained unchanged during infusion of the sakstar moieties ( data not shown ), reflecting absolute fibrin specificity of these agents at the dosages used ( data not shown ). significant in vivo fibrin digestion occurred as evidenced by elevation of fibrin fragment d - dimer levels . intra - arterial heparin therapy prolonged aptt levels to a variable extent ( data not shown ). staphylokinase - neutralizing activity in plasma and antigen - specific igg antibodies were quantitated essentialy as described above and elsewhere ( 22 ). antibody - related sakstar -, sakstar ( k74q , e80a , d82a , k130t , k135r )- and sakstar ( e65d , k74r , e80a , d82a , k130t , k135r )- neutralizing activity and anti - sakstar , anti - sakstar ( k74q , e80a , d82a , k130t , k135r ) and anti - sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) igg , were low at baseline and during the first week after the infusion ( fig5 ). from the second week on , neutralizing activity levels increased to reach median values at 3 to 4 weeks of 9 μg sakstar ( k74q , e80a , d82a , k130t , k135r ) and 0 . 5 μg sakstar ( e65d , k74r , e80a , d82a , k130t , k135 ) neutralized per ml plasma in the patients treated with the corresponding moieties , respectively , as compared to median value of 24 μg wild - type sakstar neutralized per ml in the 15 patients treated with sakstar . the levels of anti sakstar ( k74q , e80a , d82a , k130t , k135r ) and of anti sakstar ( e65d , k74r , e70a , k130t , k135r ) igg increased to median values at 3 to 4 weeks of 420 and 30 μg / ml plasma in patients treated with the corresponding moieties , respectively , as compared to a median value of 590 μanti - sakstar per ml plasma in the patients treated with sakstar ( fig5 ). the prevalence of immunization , defined as neutralizing activities in plasma after 2 to 4 weeks exceeding 5 μg / ml was 3 of 6 patients ( 50 percent ) with sakstar ( k74q , e80a , d82a , k130t , k135r ), 1 of 6 patients ( 17 percent ) with sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ), as compared to 56 of 70 patients ( 80 percent ) with sakstar . this difference is statistically highly significant ( p = 0 . 01 by 2 × 3 chi square analysis ). the sntibodies induced by treatment with sakstar were completely absorbed by sakstar but incompletely by sakstar ( k74q , e80a , d82a , k130t , k135r ) and by sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) ( table 12 ). antibodics induced by treatment with sakstar ( k74q , e80a , d82a , k130t , k135r ), detectable in 4 of the 6 patients , were completely (≧ 90 percent ) absorbed by sakstar , by sakstar ( k74q , e80a , d82a , k130t , k135r ) and by sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ), indicating that immunization was not due to neoepitopes generated by substitution of wild - type amino acids . antibodies induced by treatment with sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) detectable in one patient ( urb ) were completely absorbed with sakstar ( k74q , e80a , d82a , k130t , k135r ) and with sakstar ( e65d , k74q , e80a , d82a , k130t , k135r ) but incompletely ( 85 %) with wild - type sakstar , suggesting that a small fraction of the induced antibodies might be directed against a neoepitope in the variant used for infusion . site - directed mutagenesis was applied to substitute exposed amino acids with single cysteine residues in order to construct i ) homodimeric forms of staphylokinase , upon formation of an intermolecular disulfide bridge , and ii ) polyethylene glycol - conjugated molecules ( peg - derivatives ). the aim for this study is twofold : first , the clearance can be reduced by increasing the size of the injected molecule ( via dimerization or conjugation with large molecule such as peg ) and second , peg - derivatives have also been shown to induce a reduced immunoreactivity in animal models ( for review , see ref . 34 ). in both cases , a prolonged half - life in vivo could help to reduce the pharmacological dosis of straphylokinase in patients . this reduction could be accompanied with a reduced immunogenic reaction against the thrombolytic agent . in this example , the construction and characterization of two sakstar variants in which one single amino acid was substituted with cysteine is described . the mutants described under this example are listed in table 13 . these variants were expressed in e . coli , purified and characterized to some extent in terms of specific activity , fibrinolytic properties in human plasma in vitro and pharmacokinetic properties following bolus injection in hamsters . the source of all reagents used in the present study has previously been reported ( 22 ), or is specified below . the template vector for mutagenesis , pmex602sakb ( i . e . pmex . sakstar ), has been described elsewhere ( 23 ). restriction and modification enzymes were purchased from new england biolabs ( leusden , the netherlands ), boehringer mannheim ( mannheim , germany ) or pharmacia ( uppsala , sweden ). the enzymatic reactions were performed according to the supplier recommendation . the mutagenic oligonucleotides and primers were obtained from eurogentec ( seraing , belgium ). plasmid dna was isolated using a purification kit from qiagen ( hilden , germany ), as recommended . transformation - competent e . coli cells were prepared by the well - known calcium phosphate procedure . nucleotide sequence determination was performed on double strand plasmid dna with the dideoxy chain termination method , using the t7 sequencing kit ( pharmacia , uppsala , sweden ). polymerase chain reactions ( pcr ) were performed using taq polymerase from boehringer mannheim ( mannheim , germany ). the recombinant dna methods required to construct the variants described in this example are well established ( 22 , 27 ). the variants sakstar ( k102c ) and sakstar ( k109c ), were constructed by the spliced overlap extension polymerase chain reaction ( soe - pcr ) ( 24 ) using pmex . sakstar encoding sakstar as template . two fragments were amplified by pcr ( 30 cycles : 1 sec at 94 ° c ., 1 sec at 50 ° c ., 10 sec at 72 ° c . ), the first one starting from the 5 ′ end ( primer 818a ) of the staphylokinase gene to the region to be mutagenized ( forward primer ), the second one from this same region ( backward primer ) to the 3 ′ end of the gene with primer 818d ( 5 ′ caaacagccaagcttcattcattcagc ) ( seq id no : 5 ). the forward and backward primers shared an overlap of around 24 bp ( for the construction of k102c : tat gat aag aat tgc aaa aaa gaa gaa ( backward ) ( seq id no : 6 ) and ttc ttc ttt ttt gca att ctt atc ata ( seq id no : 7 ) ( forward ), for the construction of k109c : aaa aag aag aaa cgt gct ctt tcc cta ( backward ) ( seq id no : 8 ) and tag gga aag agc aco ttt ctt ctt ttt ( forward ) ( seq id no : 9 ). the two purified fragments were then assembled together in a second pcr reaction with the external primers 818a and 818d ( 30 cycles : 1 sec at 94 ° c ., 1 sec at 50 ° c ., 10 sec at 72 ° c .). the amplified product from this final reaction was purified , digested with ecori and hindhiii and ligated into the corresponding site of pmex . sakstar . for each construction , the sequence of the variant was confirmed by sequencing the entire sakstar coding region . the sakstar variants were expressed and purified , as described below , from transformed e . coli grown in terrific broth ( tb ) medium ( 28 ). a 2 to 4 ml aliquot of an overnight saturated culture in lb medium was used to inoculate a 1 to 2 l culture in terrific broth supplemented with 100 μg / ml ampicillin . the culture was incubated with vigorous aeration and at 30 ° c . after about 16 hours incubation , iptg ( 200 μmol / l ) was added to the culture to induce expression from the tac promoter . after 3 hours induction , the cells were pelleted by centrifugation at 4 , 000 rpm for 20 min , resuspended in 1 / 10 volume of 0 . 01 mol / l phosphate buffer ph 6 - 6 . 5 and disrupted by sonication at 0 ° c . the suspension was centrifuged for 20 min at 20 , 000 rpm and the supernatant was stored at 4 ° c , or at − 20 ° c . until purification . the material was purified essentially as described above ( example 2 ): cleared cell lysates containing the sakstar variants were subjected to chromatography on a 1 . 6 × 5 cm column of sp - sephadex , followed by chromatography on a 1 . 6 × 8 cm column of phenyl - sepharose . the sakstar containing fractions , localized by sds - gel electrophoresis , were pooled for further analysis . protein concentrations were determined according to bradford ( 29 ). sds - page was performed with the phast system ™ ( pharmacia , uppsala , sweden ) using 10 - 15 % gradient gels and coomassie brillant blue staining , and the specific activities of sakstar solutions were determined with a chromogenic substrate assay carried out in microtiter plates ( as described in example 2 ). the specific activity of the different sakstar variants are summarized in table 13 . mutant sakstar ( k102c ) was essentially monomeric as visualized by sds - page and coomassie brillant blue staining . its specific activity was comparable to that of wild - type staphylokinase . in contrast , sakstar ( k109c ) showed a propensity to form dimers (& gt ; 60 %). this resulted in a markedly increased specific activity in the plasminogen - coupled chromogenic substrate assay ( see table 13 ). upon reduction with dithiothreitol ( dtt ) ( 20 - fold molar excess during 1 . 5 hour at 37 ° c .) and alkylation with iodoacetamide ( 100 - fold molar excess during 1 hour at 37 ° c . ), the k109c dimer is converted into a stable monomer and its resulting specific activity is within the expected range towards wild - type staphylokinase ( table 13 ). this results confirms that formation of homodimers is the unique determinant for this large increase in specific activity . dimeric sakstar ( k109c ) was separated from monomeric sakstar ( k109c ) by chromatography on source s ( pharmacia ) ( 5 × 50mm ). loading buffer was 10 mm phosphate , ph 6 . 0 and dimeric sakstar ( k109c ) was eluted by a salt gradient ( up to 1 m ) in the same buffer . the dimeric sakstar ( k109c ) (& gt ; 95 % pure ) containing fractions , localized by sds - gel electrophoresis , were pooled for further analysis . the thiol group of the cysteine mutant sakstar ( k102c ) was targeted for coupling with an activated polyethylene glycol , opss - peg ( shearwater polymers europe , enschede , the netherlands ). opss - peg is a 5 kda peg molecule carrying a single activated thiol group at one end that react specifically at slightly alkaline ph with free thiols . modification of sakstar ( k102c ) was achieved by incubating the molecule ( 100 μm ) with a three - fold excess of ss - peg in a 5 mm phosphate , ph 7 . 9 solution at room temperature . the extent of the reaction was monitored by following the release of 2 - thiopyridone from opss - peg at 412 nm . after reaction ( about 15 min ), the excess of opss - peg was removed by purifying the derivatized sakstar ( k102c - peg ) on a 1 . 6 × 5 cm column of sp - sephadex as described above ( see example 2 ). the sakstar ( k102c - peg ) containing fractions , localized by optical density at 280 nm , were pooled for further analysis . sds - page analysis and coomassie blue staining confirmed that peg crosslinking on sakstar ( k102c ) was quantitative . as shown in table 13 , the specific activity of the peg - derivative was only marginally affected when compared to that of wild - type staphylokinase . the fibrinolytic and fibrinogenolytic properties of sakstar variants were determined as previously described . dose - and time - dependent lysis of 125 i - fibrin labeled human plasma clots submerged in human plasma was obtained with four molecules : sakstar ( k109c ) as dimer and as monomer ( after reduction and alkylation with iodoacetamide ), the monomeric sakstar ( k102c ) and the peg - derivatized sakstar ( k102c ). spontaneous clot lysis during the experimental period was ≦ 5 % ( not shown ). equi - effective concentrations of test compound ( causing 50 % clot lysis in 2 hrs ; c 50 ), determined graphically from plots of clot lysis at 2 hrs versus the concentration of plasminogen activator ( not shown ), were comparable to that of sakstar , for monomeric sakstar ( k109c ) and sakstar ( k102c ) ( table 13 ). however , it was observed that the c 50 for clot lysis by dimeric sakstar ( k109c ) was only 0 . 12 μg / ml , which is approximately three fold lower than for wild - type staphylokinase . in contrast , a c 50 of 0 . 60 μg / ml was measured for sakstar ( k102c - peg ), which is only two - fold higher than for wild - type staphylokinase . thus , dimerization of sakstar via disulfide bridges or increasing the size of the molecule via peg - derivatization does not preclude the fibrinolytic activity of staphlokinase . while a peg - molecule appears to reduce the diffusion and therefore fibrinolytic potency of the derivatized staphylokinase within a fibrin clot , dimerization of staphlokinase results in a synergistic fibrinolytic effect on human fibrin clots . pharmacokinetic properties of dimeric sakstar ( k109c ) and sakstar ( k102c - peg ) following bolus injection in hamsters the pharmacokinetic parameters of the disposition of dimeric sakstar ( k109c ) and sakstar ( k102c ) from blood were evaluated in groups of 4 hamsters following intravenous bolus injection of 100 μg / kg sakstar variant . sakstar - related antigen was assayed using the elisa described elsewhere . the elisa was calibrated against each of the sakstar variants to be quantitated . pharmacokinetic parameters included : inital half - life ( in min ), t1 / 2α = ln2 / α ; terminal half - life ( in min ), t1 / 2β = ln2 / β ; volume of the central ( plasma ) compartment ( in ml ), v c = dose /( a + b ); area under the curve ( in μg . min . ml − 1 ). auc = a / α + b / β ; and plasma clearance ( in ml . min − 1 ), clp = dose / auc ( 32 ). the disposition rate of stapphylokinase - related antigen from blood following bolus injection of 100 μg / kg of the selected sakstar variants in groups of 4 hamsters could adequately be described by a sum of two exponential terms by graphical curve peeling ( results not shown ), from which the pharmacokinetic parameters t1 / 2α and clp , summarized in table 13 were derived . the pharmacokinetic parameters of dimeric sakstar ( k109c ) and sakstar ( k102c - peg ) were markedly different from those of wild type sakstar . initial plasma half - lives ( t1 / 2 ( α )) were 3 . 6 and 3 . 0 min and plasma clearances ( clp ) were 0 . 52 and 0 . 32 ml / min , for dimeric sakstar ( k109c ) and sakstar ( k102c - peg ), respectively . these results may be due to the increase of the stokes radius of sakstar as a result of the dimerization or crosslinking with peg . according to size - eclusion chromatography on superdex50 by hplc , dimeric sakstar ( k109c ) and sakstar ( k102c - peg ) have apparent molecular weights of 33 kda and 40 kda , respectively . in summary , the present experience illustrates that staphylokinase variants with markedly reduced antibody induction but intact thrombolytic potency can be generated . to our knowledge , this observation constitutes the first case in which a heterologous protein , with the use of protein engineering techniques , is rendered significantly less immunogenic in man without reducing its biological activity . the present invention was inititated by the observation that certain “ clustered charge - to - alanine ” substitution variants of recombinant staphylokinase ( sakstar variant ( 9 )) had a reduced reactivity with antibodies induced by treatment with wild type sakstar ( 3 , 4 ) and induced less antibodies than wild type sakstar in patients with peripheral arterial occlusion ( 22 , 32 , 35 ). in an effort to optimize the specific activity versus antigenicity radio , a comprehensive mutagenesis study , comprising the construction and expression of over 250 plasmids encoding sakstar variants , and the purification of the translation products was undertaken . the sakstar variants were characterized in terms of specific activity , affinity towards a panel of murine monoclonal antibodies and absorption of sakstar specific antibodies from pooled plasma of 10 patients treated with wild type sakstar and of two subpools of 3 patients each which reacted strongly ( subpool b ) or poorly ( subpool c ) with the immunodominant epitope k74 , e75 , r77 . in a later phase , an additional pool of 40 patients treated with wild - type sakstar was also used for absorption studies . the values obtained with both pools were in good agreement . linear regression analysis yielded residues for site - directed mutagenesis were selected in three ways : 1 ) a comprehensive analysis of variants with 1 or 2 adjacent amino acids substituted with ala : 2 ) analysis of the differential reactivity of the two natural variants sakstar and sak42d ( which corresponds to sakstar ( s34g , g36r , h43r ) and 3 ) surface exposure of the residues as derived from the three dimensional structure . from these analyses , sakstar ( k35a ), sakstar ( n95a ) and sakstar ( s103a ) emerged with specific activities ≧ 200 ku / mg . sakstar ( w66a ), sakstar ( y73a ) and sakstar ( e75a ) with reduced reactivity with ≧ 3 of the 5 antibodies of epitope cluster i , sakstar ( h43a ) and sakstar ( v45a ) with 3 antibodies of epitope cluster ii , and sakstar ( v32a ), sakstar ( k35a ), sakstar ( d82a ) and sakstar ( k130a ) and ≧ 3 of the 5 antibodies of epitope cluster iii . however , only sakstar ( y73a ) and sakstar ( k74a ) reduced the antibody binding from pooled immunized patient plasma by ≧ 30 percent . analysis of the differential reactivity of sakstar and sak42d revealed that the reduced reactivity with antibodies of epitope cluster iii and with immunized patient plasma could be ascribed to the g36r substitution . in addition e65 and k135 of sakstar were targeted because of their location , in the three - dimensional structure ( 36 ), in the close vicinity of the immunodominant k74 , e75 , r77 epitope . substitution of k35 with other amino acids than ala did not improve the specific activity over that of sakstar ( k35a ), and substitution of y73 with other residues did not rescue the impaired specific activity . sakstar ( e80a , d82a ) had an intact specific activity and a somewhat lower reactivity with immunized patient plasma , and the increased specific activity of sakstar ( n95a ) could not be conferred to variants containing k74a or k135r . sakstar ( k130a ) was outperformed in terms of specific activity by sakstar ( k130t ). k74 confirmed its key role in binding of antibodies from immunized patient plasma in the absence of a markedly reduced reactivity with the murine monoclonal antibodies ( 22 ), the best specific activity / antigenicity ratios being obtained with sakstar ( k74q ) and sakstar ( k74r ). the sakstar ( k130t , k135r ) variant was taken as a template for additive mutagenesis because of its high specific activity with a moderate reduction of binding to antibodies of epitope cluster iii and of absorption of antibodies from immunized patient plasma ( table 6 ). addition of g36r , k74r or both to the template did not affect the specific activity , but reduced the reactivity with monoclonal antibodies against epitope cluster iii ( g36r substitution ) and decreased the absorption of antibodies from immunized patient plasma ( k74r substitution ). addition of e80a and / or d82a to the sakstar ( k130t , k135r ) template did not affect the specific activity and was selected as a template for further mutagenesis because of its reduced reactivity with epitope cluster iii antibodies ( table 7 ). addition of k74r and even more of k74q drastically reduced the reactivity with immunized patient plasma . finally , addition of e65d or e65q to the sakstar ( k74r , e80a , d82a , k130t , k135r ) template yielded variants with intact specific activity which only bound 1 / 3 of the antibodies of pooled immunized patient plasma , only about 10 to 30 percent of the antibodies from plasma of patients with a high concentration of antibodies directed towards the immunodominant k74 , e75 , r77 ( subpool b ) and only about 60 percent of the antibodies from plasma of patients with a very low concentration of antibodies directed against this immunodominant epitope ( subpool c ). based on this analysis , sakstar ( k74q , e80a , d82a , k130t , k135r ), and sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) were selected for further analysis . the fibrinolytic potency and the fibrin - selectivity of these selected mutants in a plasma milieu was indistinguishable from that of wild type sakstar . the temperature stability of the mutants was still acceptable with no significant loss of activity upon incubation at 37 ° c . for 3 days , although at 56 ° and 70 ° c ., they were more rapidly inactivated than wild - type sakstar . the pharmacokinetics of the sakstar variants following intravenous bolus injection in hamsters did not reveal major differences with wild type sakstar except for a possibly somewhat higher plasma clearance . in conclusion , the two variants of sakstar which emerged from the present site directed mutagenesis program are characterized by an intact or slightly increased specific activity , maintained thrombolytic potency and fibrin - selectivity in a human plasma milieu , acceptable although slightly reduced temperature stability and a markedly reduced reactivity with anti - sakstar antibodies in pooled immunized patient plasma . in view of the previously found correlation between reduced antigenicity and reduced immunogenicity of certain “ charged - cluster - to - alanine ” variants investigation of immunogenicity associated with their use for thrombolytic therapy in man appeared warranted . highly purified , sterilized preparations of sakstar ( k74q , e80a , d82a , k130t , k135r ) and sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) were produced and found to contain low endotoxin levels , and to be devoid of acute toxicity in mice following intravenous bolus injection at a dose of 3 mg / kg . intra - arterial administration of wild - type sakstar . sakstar ( k74q , e80a , d82a , k130t , k135r ) or sakstar ( e65d , k74r , e80a , d82a , k130t , k135r ) as a bolus of 2 mg followed by an infusion of 1 mg / hr in 6 patients with angiographically documented occlusion of a peripheral artery or bypass graft each , resulted in complete recanalization in 10 patients and partial recanalization in 2 , without measurable systemic plasminogen activation . following administration of wild - type or variant sakstar , neutralizing antibody titers and specific igg levels remained low for one week . from the second or third week onwards , an increase of sakstar - neutralizing activity to ≧ 5 μg / ml plasma was observed in the 3 of the 6 patients given sakstar ( k74q , e80a , d82a , k130t , k135r ), and in only 1 of the 6 patients given sakstar ( e65d , k74r , e80a , d82a , k130t , k135 ). this immunization rate with the variants is significantly lower than the immunization rate of 80 % observed in 70 patients treated with sakstar ( p = 0 . 01 by 2 × 3 chi square analysis ). the antibodies induced by treatment with the sakstar variants were completely absorbed by sakstar , and by the respective variants in all but one patient with measurable neutralizing antibody levels , indicating that immunization was not due to neoepitopes generated by substitution but to residual epitopes in the sakstar template . 1 . lack c h : staphylokinase : an activator of plasma protease . nature 161 : 559 , 1948 . 2 . lewis j h , ferguson j h : a proteolytic enzyme system of the blood . iii . activation of dog serum profibrinolysin by staphylokinase . am j physiol 166 : 594 , 1951 . 4 . vanderschueren s , barrios l , kerdsinchai p , van den heuvel p , hermans l , vrolix m , de man f , benit e , muyldermans l , collen d , van de werf f : a randomized trial of recombinant staphylokinase versus alteplase for coronary artery patency in acute myocardial infarction . circulation 92 : 2044 - 2049 , 1995 . 5 . sako t , sawaki s , sakurai t , ito s , yoshizawa y , kondo i : cloning and expression of the staphylokinase gene of staphylococcus aureus in escherichia coli . molec gen genet 190 : 271 - 277 , 1983 . 6 . behnke d , gerlach d : cloning and expression in escherichia coli , bacillus subtilis , and streptococcus sanguis of a gene for staphylokinase — a bacterial plasminogen activator . molec gen genet 210 : 528 - 534 , 1987 . 7 . collen d , silence k , demarsin e , de mol m , lijnen h r : isolation and characterization of natural and recombinant staphylokinase . fibrinolysis 6 : 203 - 213 , 1992 . 8 . sako t , tsuchida n : nucleotide sequence of the staphylokinase gene from staphylococcus aureus . nucleic acids res 11 : 7679 - 7693 , 1983 . 9 . collen d , zhao za , holvoet p , marynen p : primary structure and gene structure of staphylokinase . fibrinolysis 6 : 226 - 231 , 1992 . 10 . sakai m , watanuki m , matsuo o : mechanism of fibrin - specific fibrinolysis by staphylokinase : participation of α 2 - plasmin inhibitor . biochem biophys res comm 162 : 830 - 837 , 1989 . 11 . matsuo o , okada k , fukao h , tomioka y , ueshima s , watanuki m , sakai m : thrombolytic properties of staphylokinase . blood 76 : 925 - 929 , 1990 . 12 . lijnen h r , van hoef b , de cock f , okada k , ueshima s , matsuo o , collen d : on the mechanism of fibrin - specific plasminogen activation by staphylokinase . j biol chem 266 : 11826 - 11832 , 1991 . 13 . lijnen h r , van hoef b , matsuo o , collen d : on the molecular interactions between plasminogen - staphylokinase , α 2 - antiplasmin and fibrin . biochim biophys acta 1118 : 144 - 148 , 1992 . 14 . silence k , collen d , lijnen h r : interaction between staphylokinase , plasmin ( ogen ) and α 2 - antiplasmin . recycling of staphylokinase after neutralization of the plasmin - staphylokinase complex by α 2 - antiplasmin . j biol chem 268 : 9811 - 9816 , 1993 . 15 . silence k , collen d , lijnen h r : regulation by α 2 - antiplasmin and fibrin of the activation of plasminogen with recombinant staphylokinase in plasma . blood 82 : 1175 - 1183 , 1993 . 16 . sakharoy d v , lijnen h r ,. rijken d c . interactions between staphylokinase , plasmin ( ogen ), and fibrin . j biol chem 271 : 27912 - 27918 , 1996 . 17 . schlott b , gührs k h , hartmann m , roccker a , collen d . staphylokinase requires nh 2 - terminal proteolysis for plasminogen activation . j biol chem ( in press ). 18 . collen d , de cock f , vanlinthout i , declerck p j , lijnen h r , stassen j m . comparative thrombolytic and immunogenic properties of staphylokinase and streptokinase . fibrinolysis 6 : 232 - 242 , 1992 . 19 . collen d , de cock f , stassen j m . comparative immunogenicity and thrombolytic properties toward arterial and venous thrombi of streptokinase and recombinant staphylokinase in baboons . circulation 87 : 996 - 1006 , 1993 . 20 . white h : thrombolytic treatment for recurrent myocardial infarction . br med j 302 : 429 - 430 , 1991 . 21 . gase a , hartmann m , gührs k h , rocker a , collen d , behnke d , schlott b : functional significance of nh 2 - and cooh - terminal regions of staphylokinase in plasminogen activation . thromb haemost 76 : 755 - 760 , 1996 . 22 . ep 95200023 . 0 ( jan . 6 , 1995 ) and u . s . pat . no . 08 / 499 , 092 ( jul . 6 , 1995 ). 23 . schlott b , hartmann m , gührs k h , birch - hirschfeid e , pohl h d , vanderschueren s , van de werf f , michoel a , collen d , behnke d : high yield production and purification of recombinant staphylokinase for thrombolytic therapy . bio / technology 12 : 185 - 189 , 1994 . 24 . horton r m , hunt h d , ho s n , pullen j k , pease l r . engineering hybrid genes without the use of restriction enzymes : gene splicing by overlap extension . gene 77 : 61 - 68 , 1989 . 25 . biacore system manual , 5 - 2 , pharmacia biosensor a b , uppsala , sweden . 26 . karlsson r , michaelsson a , mattsson l : kinetic analysis of monoclonal antibody - antigen interactions with a new biosensor based analytical system . j immunol methods 145 : 229 - 240 , 1991 . 27 . sambrook j , fritsch e f , maniatis t : molecular cloning : a laboratory mannual . 2 nd ed . cold spring harbor , n . y . cold spring harbor laboratory press , 1989 . 28 . tartof k d , hobbs c a : improved media for growing plasmid and cosmid clones . bethesda res lab focus 9 : 12 , 1987 29 . bradford m m : a rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein - dye binding . anal biochem 72 : 248 , 1976 . 30 . deutsch d g , mertz e t : plasminogen : purification from human plasma by affinity chromatography . science 170 : 1095 - 1096 , 1970 . 31 . collen d , moreau h , stockx l , vanderschueren s . recombinant staphylokinase variant with altered immunoreactivity . ii . thrombolytic properties and antibody induction . circulation 94 : 207 - 216 , 1996 . 32 . vanderschueren s , stockx l , wilms g , lacroix h , verhaeghe r , vermylen j , collen d : thrombolytic therapy of peripheral arterial occlusion with recombinant staphylokinase . circulation 92 : 2050 - 2057 , 1995 . 33 . gibaldi m , perrier d . pharmacokinetics , marcel dekker , new york , n . y ., 1983 , 45 - 111 . 34 . inada y , furukawa m , sasaki h , kodera y , hiroto m , nishimura h , matsushima a biomedical and biotechnological applications of peg - and pm - modified proteins , tibtech 13 : 86 - 91 , 1995 . 35 . collen d , bernaerts r , declerck p , de cock f , demarsin e , jenne s , laroche y , lijnen h r , silence k , verstreken m . recombinant staphylokinase variants with altered immunoreactivity . i . construction and characterization . circulation 94 : 197 - 206 , 1996 . 36 . rabijns a , de bondt h l , de ranter c . three - dimensional structure of staphylokinase , a plasminogen activator with therapeutic potential . nature struct biol 4 : 357 - 360 , 1997 .

US-2001898-A

a coupling for a blender comprises first and second clutches . the first clutch is connected to a blender motor and is adapted to be rotatably driven by operation of the motor . the second clutch is connected to a rotatable cutter assembly inside a blender jar . the first and second clutches each comprise a plurality of teeth , and each tooth comprises a drive face . each drive face has a negative draft .

turning first to fig1 there is shown a blender 10 that includes a blender jar 11 and blender motor housing 12 that are shown in dotted lines . mounted within the blender jar 11 is a rotatable cutter assembly 15 . the rotatable cutter assembly 15 is connected via a shaft ( not shown ) to a clutch 14 . the clutch 14 is adapted to engage the clutch 13 that is mounted onto a drive shaft ( not shown ) that is rotated by a motor within the motor housing 12 . fig2 through 4 illustrate a clutch 20 that is the same as the clutches 13 and 14 shown in fig1 . the clutch 20 is made up of a circular plate 22 that has four teeth 21 protruding upwardly from the plane defined by the face of the plate . the center of the plate 22 is an internally threaded portion 23 that will attach the clutch 20 to a drive shaft attached to a blender motor or a shaft attached to a blender cutter assembly . of course , any type of attachment design may be used to attach the clutch 20 to a shaft on a blender . the internally threaded portion 23 is preferred because it securely holds the clutch 20 in place yet still allows the clutch to be replaced by unscrewing it . each tooth 21 has a drive face 30 and a trailing support portion 31 . the drive face 30 is adapted to engage a reciprocal drive face on a second clutch that is mounted on either the blender jar or the blender motor housing . the drive face 30 is typically flat in order to fully engage a reciprocal drive face on a reciprocal clutch . alternatively , there may be slight serrations on a drive face to better encourage gripping when the reciprocal drive faces are engaged . the trailing support portion 31 angles downwardly from the side of the tooth opposite the drive face 30 . the trailing support portion 31 offers support and integrity to the tooth . in a preferred embodiment , the angle of taper of the trailing support portion 31 is approximately 40 °. the tooth 21 is approximately 0 . 5 cm in height and the thickness of the plate 22 is approximately 2 mm . in this preferred embodiment , the clutch 20 is made of cast aluminum . other metals , composites , coatings and rubber may alternatively be used . cast aluminum is preferred , because it is durable and because it is relatively easy to machine . also , if a user of a blender tries to place a jar upon a moving clutch and a motor housing , then a substantial noise is created by the aluminum contact , which will discourage this type of abuse . this is a useful safety warning . also , the use of a durable metal such as cast aluminum makes the clutch 20 more resistant to wear than other common materials such as rubber . as seen most clearly in fig4 the drive face 30 of the teeth 21 has a negative draft . that is , the portion of the drive face 30 furthest from the plate 22 extends out further than the base of the drive face adjacent the plate . said another way , the drive face 30 forms an acute angle with the horizontal plane of the plate 22 . the negative draft allows the reciprocal teeth in a pair of clutch plates to effectively lock in place upon rotation . this negative draft tightly engages the two clutches so that they are not easily separated . when attached in operation to a blender motor housing and to a bottom of a blender jar , this negative draft means that the blender jar will be better held in place . the most favorable draft is within the range of 1 ° to 10 ° from perpendicular to the horizontal plane of the plate 22 . preferably , the draft is approximately 5 ° as shown in fig4 . as shown , each tooth 21 has substantially the same negative draft , but there may be variations in the drafts depending on engineering design requirements . if there is too much negative draft , then the blender may be difficult to remove from the blender base . in addition to a greater stability , the negative draft can allow a designer to have the blender perform at a higher rpm with less fear of a blender jar becoming accidentally disengaged . in the preferred embodiment shown in the attached figures , there are only four teeth 21 on the clutch 20 that are oriented on the clutch about 90 ° from adjacent teeth . this relative few number of teeth allows play between the teeth and a more simple alignment upon placing the blender jar onto the blender base . accordingly , four teeth are preferred , but are not necessary — fewer or more may be used . while the invention has been described with reference to specific embodiments thereof , it will be understood that numerous variations , modifications and additional embodiments are possible , and accordingly , all such variations , modifications , and embodiments are to be regarded as being within the spirit and scope of the invention .

US-81962501-A

an oral airway includes an elongate tubular member having a distal and a proximal end , the oral airway being configured to place the distal end in a supraglottic position when operatively placed within the hypopharynx of a patient . a temperature sensor is operatively associated with the elongate tubular member to detect a core temperature of a patient with the distal end of the oral airway operatively placed in a superglottic position within the hypopharynx of the patient .

the invention will now be described with reference to the drawings ; however , the position of a conventional oral airway is first briefly discussed . fig1 shows a simplified anatomical illustration of a patient &# 39 ; s head , including the oral airway defined by the mouth 1 , the oral cavity 2 , the tongue 3 , and the epiglottis 4 , the trachea 5 , the esophagus 6 and the hypopharynx 7 . a conventional oral airway 10 is positioned within the patient &# 39 ; s oral airway , with the distal end 11 ending well above the glottis so that no structure is provided to prevent the collapse of soft tissue structures t in the hypopharynx . fig2 , 4 a and 4 b relate to one embodiment of the perilaryngeal oral airway according to the present invention . note that in fig2 like elements are denoted with like reference numerals with reference to the patient &# 39 ; s oral airway . referring to fig4 a and 4b , the perilaryngeal oral airway 100 includes a curved hollow , tubular longitudinally extending body member 110 . the curvature of the body member preferably , but not necessarily , is between 100 ° and 140 °. the body member 110 includes a flanged proximal end portion 120 for location at the mouth of the patient ( see fig2 ). the body member 110 further includes a distal end portion 130 for insertion into the mouth and pharynx of the patient . in the first embodiment , the distal end portion 130 of the body member 110 is divided so as to form a pair of elongated extension walls 140 and 141 which are operative to seat deep in the patient &# 39 ; s hypopharynx and surround the patient &# 39 ; s epiglottis and glottis ( see fig2 and 3 ), thereby to hold the patient &# 39 ; s soft tissue away from the patient &# 39 ; s air channel opening . a u - shaped or v - shaped opening or notch 150 is formed in the distal end portion 130 of the body member 110 so as to form the two elongated extension walls 140 and 141 and into which the epiglottis and glottis are positioned . the elongated extension walls 140 and 141 at the distal end portion preferably , but not necessarily , expand outward laterally to allow for sufficient space in which to accommodate the epiglottis and glottis within the u - shaped or v - shaped opening 150 . the extreme distal ends 160 and 161 of the elongated extension walls 140 and 141 , respectively , may be angled inwardly slightly , thereby providing a smooth contour . the purpose of the inwardly angled extreme distal ends is to allow the ends to be safely inserted past the tonsillar pillars at the back of the patient &# 39 ; s mouth . by forming the inwardly - shaped surface , the slightly narrower most distal end can push up against very large tonsils and move them laterally to the sides as the perilaryngeal oral airway is inserted . the elongated lateral extension walls 140 and 141 are preferably , but not necessarily , formed to be relatively flexible and soft so that there is at least some “ give ” as the perilaryngeal oral airway is inserted into the patient . the particular firmness of the walls must strike a balance between the need to hold the hypopharyngeal and perilaryngeal structures away from the glottis , the need to move the soft tonsillar and oro - pharyngeal structures to the side as the oral airway is inserted , and the desire for the oral airway to be able to bend inwardly when inserted through the back of the patient &# 39 ; s mouth . likewise , the body member 110 of the perilaryngeal oral airway 100 is preferably , but not necessarily , of sufficient softness and pliability to bend during insertion and to accommodate different angles once it is successfully inserted into the patient , since a given patient &# 39 ; s head and neck may be slightly flexed or extended to provide optimal positioning for mask ventilation . the most proximal end portion 120 of the oral airway is much harder than the distal end portion 130 in order to prevent occlusion by the patient biting down thereon . fig5 a and 5b show a further embodiment of the perilaryngeal oral airway according to the present invention wherein the distal end portion 230 is modified in comparison to the oral airway of the previous embodiment . note that like elements are denoted with like reference numerals , but preceded by the reference number “ 2 ”. in particular , in this embodiment , the distal end portion 230 has a “ filled - in ” distal posterior wall 235 in order to better hold tissue away from the larynx . the anterior wall includes a notched portion 250 as in the previous embodiment . the body member 210 of the oral airway preferably , but not necessarily , is of sufficient softness and pliability to bend during insertion and to accommodate different angles once successfully inserted into the patient . fig6 a and 6b illustrate a still further embodiment of the perilaryngeal oral airway according to the present invention . again , like elements are denoted with like reference numerals , but preceded by the number “ 3 ”. in particular , holes or fenestrations 385 may be formed through the distal anterior wall of the body member 310 of the oral airway in order to provide ventilation should the distal end portion 330 be positioned directly over the glottic opening of the patient , as might occur if the practitioner has selected too large of an oral airway for a particular patient , or where the patient has an abnormally high ( rostrally ) placed glottic opening . moreover , holes 380 and 381 may be formed through the anterior surface of the elongated extension walls 340 and 341 , respectively , and which function to allow ventilation should the oral airway be situated at an abnormal angle such that one of the elongated extension walls covers the glottis . still further , additional air holes or fenestrations 390 may be formed through the posterior wall 395 of the body member 310 of the oral airway at the region of curvature which is adapted to be positioned at the back of the oropharynx and which allows passage of air through the nasal passages of the patient and into the oral airway per se . of course , while the holes and fenestrations are shown in connection with the first embodiment of the present invention which includes the elongated extension walls 340 and 341 , the holes or fenestrations may likewise be used with the second embodiment which includes the filled - in distal posterior wall . of course , the holes can be dispensed with entirely in both the first and second embodiments if desired . referring to fig3 the anterior and posterior u - or v - shaped grooves or notches receive an endotracheal tube e . when a patient is presently intubated with the endotracheal tube e , the body member 110 can receive a proximal end of the endotracheal tube and be axially inserted into the mouth and pharynx of a patient over the endotracheal tube and seated as illustrated in fig3 . when intubation is no longer required , the endotracheal tube e can be removed and body member 110 is properly seated to retain the surrounding soft tissue and maintain an oral airway as may be necessary . fig7 shows yet a further embodiment which includes an inflatable cuff 415 placed just above the distally positioned anterior notch 450 . fig7 a further includes a plurality of bars 452 forming a grate over the leading opening 454 . again , like elements are denoted with like reference numerals , but preceded with the number “ 4 ”. the grate or bars 452 cause the epiglottis to slide into abutment with an anterior portion of the end portion 430 of the body member 410 . as discussed below with reference to fig1 , the bars are rigid enough to support the epiglottis but flexible enough to allow an endotracheal tube to be inserted therebetween . the cuff 415 is designed to be inflatable using a pilot tube 416 which includes a self - sealing proximal valve ( not shown ). upon inflation , the more distally positioned inflated cuff of the present invention is located within the hypopharynx and thereby allows the perilaryngeal oral airway of the present invention to be held in place without external means and avoids the airway leakage which can occur at the base of the tonsillar pillars and soft palate when using the conventional cuffed oro - pharyngeal airway . as shown in fig8 in order to allow the cuffed airway 400 to be attached to an anesthesia circuit or other airway circuit , an adapter 425 is inserted into the flanged proximal end portion 420 of the oral airway . in the embodiment of fig7 and 8 , the adapter 425 is placed inside the flanged proximal end portion 420 of the oral airway 400 and held in by means of friction . however , many other mechanisms ( e . g ., luer - lock , notched , snap , etc .) may be utilized to retain the adapter 425 in the proximal end 420 of the oral airway . alternatively , the adapter may be made so as to fit over the end of the perilaryngeal oral airway and still accomplish the desired purpose . of course , the proximal end piece for permitting attachment to an anesthesia circuit or other airway circuit may be molded into the oral airway itself . with respect to all of the above - discussed embodiments , the actual lumen or hollow portion of the perilaryngeal oral airway of the present invention may be dome - shaped ( convex ) at the posterior wall of the body member at least through the portion which is operative to be positioned within the patient &# 39 ; s mouth in order to better approximate the anatomy of the oral passageway . moreover , as an alternative , the oral airway may terminate in the hypopharynx ( below the base of the tongue ) but still end above the epiglottis , so that it would function to hold soft tissues away from the air passageway . a further embodiment of this particular alternative might have both the anterior and posterior notch absent since it could terminate just above the epiglottis . fig9 , 11 , 14 and 15 relate to another embodiment of the perilaryngeal oral airway according to the present invention . note that in fig1 and 15 as well as fig1 , like elements are denoted with like reference numerals with reference to the patient &# 39 ; s oral airway . the embodiment of the perilaryngeal oral airway illustrated in fig9 will be referred to herein as the grated oral airway or the grated pla 510 . the grated pla 510 consists of an elongate tubular member 512 having a proximal end 514 and a distal end 516 . attached to the distal end 516 of the elongate tubular member 512 is a wedge - shaped housing 520 . the wedge - shaped housing 520 has an anterior wall 522 , a posterior wall 524 and sidewalls 526 , 528 extending therebetween . the anterior wall abuts an anterior portion of a patient &# 39 ; s hypopharynx and the posterior position abuts a posterior portion of patient &# 39 ; s hypopharynx when seated as illustrated in fig1 - 16 . as best viewed in fig1 , the anterior and posterior walls 522 , 524 form an enlarged proximal portion 530 of the wedge - shaped housing which tapers to a smaller distal portion 532 . the housing is sized to seat deep in the patient &# 39 ; s hypopharynx . the leading opening 534 separates the anterior and posterior walls from the distal end of the housing and extends from the distal end of the posterior wall 524 to a recess in the anterior wall at 536 . in this manner , the opening 534 is inclined between the distal end of the posterior wall and the recess 536 in the anterior wall . a grate 537 covers the leading opening , with the grate being inclined between the posterior and the anterior walls . in the embodiment illustrated in fig9 the grate comprises a plurality of parallel bars 538 separated by a plurality of gaps 540 extending between the posterior wall 524 and anterior wall 522 . the grated pla 510 including the elongate tubular member and the wedge - shaped housing 520 may be integrally formed in a single manufacturing step from polyvinyl chloride or another suitable thermoplastic . in the preferred embodiment , however , the wedge - shaped housing is manufactured in two pieces divided substantially along the line 10 — 10 of fig9 . referring to fig1 , internal supports 542 are integrally formed with each position of the housing and define circular orifices 544 that receive the distal end of the elongate tubular member 512 therein . the elongate tubular member is heat staked , sonic welded or otherwise permanently bonded to the housing . in the embodiments illustrated in fig9 - 18 , the tubular member is shown as having a round cross - section , although the tubular member may have a number of cross - sectional configurations including oval , square or rectangular , provided the elongate tubular member includes a hollow lumen . the tubular member can be slightly contoured as illustrated in fig9 or straight . the tubular member is preferably made of a material such as polyvinyl chloride or other thermoplastic that is substantially axially rigid yet radially flexible so that when inserted within the mouth , oral cavity and pharynx of a patient , it may follow the anatomical contours . it is also preferably sufficiently flexible so that a surgeon operating on the oral cavity or pharynx with the grated pla in place can axially deflect the tubular member out of the operating theater . the tubular member further is radially robust to not kink during insertion or manipulation . as illustrated in fig1 , the tubular member may include wire reinforcing 546 wound into its wall . the wedge - shaped housing 520 further includes an inflatable cuff 548 that surrounds the wedge - shaped housing 520 radially about the enlarged proximal portion 530 of the wedge - shaped housing 520 . as illustrated in fig9 and 10 , the inflatable cuff 548 extends both proximal and distal of the largest effective diameter of the enlarged proximal portion 530 . alternatively , the inflatable cuff 548 may be located on the tubular member proximate the proximal end of the wedge - shaped housing 520 as illustrated with the embodiment of fig7 . a pilot tube 550 extends from the cuff along the elongate tubular member so as to be able to extend out of the mouth of a patient and terminates at its proximal end with a self - sealing proximal valve 552 . with the cuff in its uninflated state , it closely envelops the exterior surface of the wedge - shaped housing 520 . when in its inflated state , as illustrated in fig1 , the cuff extends radially sufficiently to fully occlude the surrounding pharynx or hypopharynx so as to enable a practitioner to apply positive pressure ventilation . the grated pla 510 preferably further includes a temperature sensor 554 shown mounted to the anterior wall 522 of the wedge - shaped housing 520 in fig9 . alternatively , the temperature sensor 554 can be located on one of the sidewalls 526 , 528 , the posterior wall 524 or even on the inflatable cuff 548 . the temperature sensor 554 is connected to a lead 556 which extends along the length of the elongate tubular member 512 coupling to an external display or monitor ( not shown ). at the proximal end 514 of the elongate tubular member is a bite block 560 having a flanged end 561 . the bite block 560 can be integrally formed from a thickened side of the tubular member 512 or be a more rigid plastic or metal collar that is slid over the proximal end 514 and held in place by friction or an adhesive . in addition , an adaptor 562 may be placed inside the flanged end 561 of the bite block 560 and may be permanently affixed or releasably held in place by means of friction or other mechanisms such as a luer - lock , notch , snap or the like . it may also be integrally formed with the bite block 560 in a single manufacturing step . fig1 illustrates an alternate embodiment of the wedge - shaped housing referred to herein as the hinged grated pla 566 . this embodiment is identical to that described above with regard to fig9 and 10 except the grate 568 is attached only to the anterior wall 522 by a hinge 570 . by virtue of the hinge , the grate 568 can be pivoted open as illustrated in fig1 . as illustrated in fig1 , the hinged grate 572 has a plurality of vertically extending bars 572 . alternatively , as illustrated in fig1 , the hinged grate can be a solid flap with a plurality of holes 574 therein . although not shown , the grate could also be a solid flap as opposed to a perforated grate . the hinge 570 can be a separate structure joining the grate 568 onto the anterior wall 522 or a living hinge , under which circumstances the anterior wall 522 and the grate 568 are integrally formed in a single manufacturing step . fig1 is a simplified anatomical cross - section of a patient &# 39 ; s head and neck with the various anatomic features indicated by the same references numbers used with fig1 . additional relevant anatomic features include the vocal chords 8 and the glottis or larynx generally indicated at 9 . the various cartilage and muscular tissue comprising the glottis or larynx , with the exception of the vocal chords 8 , has been eliminated for the sake of clarity . in use , the wedge - shaped housing 520 of the grated pla 510 is axially inserted in the mouth 1 of a patient and the elongated tubular member 512 bends to conform to the anatomical contours of the oral cavity 2 , pharynx 7 a , hypopharynx 7 so that the wedge - shaped housing 520 rests within the hypopharynx as illustrated in fig1 . the housing is made of a material that is flexible and soft to provide some give as it is inserted into a patient so as to prevent damage to the soft tissue of the pharynx and hypopharynx . however , the housing is sufficiently rigid to prevent its collapse by this same tissue as it is inserted into and seated within a patient . likewise , the grate must be of sufficient rigidity to separate these tissues and to allow the epiglottis to ride up it . the grate 537 is inclined so that as the grate encounters the epiglottis 4 , the epiglottis rides up the grate and comes to rest abutting the anterior wall 522 of the wedge - shaped housing 520 . more particularly , as viewed in fig1 , the epiglottis abuts the inflatable cuff 548 . the axial insertion of the wedge - shaped housing is intended to be arrested by the sidewalls of the enlarged proximal portion 530 coming into abutment with the aryepiglottic folds 576 as illustrated in fig1 . as illustrated in fig1 - 16 , with the grated pla 510 or the hinged grated pla 566 properly seated , the epiglottis abuts the anterior wall of the wedge - shaped housing and the leading opening 534 is adjacent to the vocal chords 8 and the glottis or larynx 9 . in addition , the distal end of the housing may abut the tissue 578 dividing the trachea 5 and esophagus 6 . in this manner , all the soft tissue surrounding the hypopharynx an larynx is held back from the leading opening 534 and an unobstructed airway is provided to the trachea 5 for unassisted patient breathing . the pla illustrated in fig1 can also be used to provide respiratory assist or anesthesia of a patient . in this application , once the pla is seated as illustrated in fig1 , the inflatable cuff 548 is inflated so as to form a seal in the patient &# 39 ; s hypopharynx 7 . in fact , the cuff is shown so inflated in fig1 . a principle advantage of placing the cuff at the enlarged portion of the housing is less air is required to inflate it to occlude the pharynx . also , by having the cuff on the housing as it inflates it further serves to spread tissue and keep the airway formed by the pla open . a respiratory circuit or anesthesia circuit ( not shown ), as conditions require , is attached to the distal end of the elongate tubular member by the adaptor 14 . the grated pla 510 is also intended to allow blind intubation of a patient with an endotracheal tube 580 having an inflatable cuff 582 or to insert some other instrument into the trachea of a patient . referring to fig1 , the bars 538 of the grate 537 are flexible enough so that an endotracheal tube can be inserted into a gap 540 between adjacent bars and deform the bars as shown at 584 in fig1 to extend axially therebetween . referring to fig1 , the distal end 516 of the tubular member 512 is received with in the housing so that as the endotracheal tube 574 is axially advanced through the bars 538 of the grate 537 , it is directed anteriorly into the trachea 5 of a patient . in this manner , a patient may be reliably blindly intubated with a high degree of confidence that the endotracheal tube will be properly seated in the trachea . fig1 illustrates the hinged grate embodiment 566 of the wedge - shaped housing 520 being used to intubate a patient with a endotracheal tube 580 . in this embodiment , as the endotracheal tube 580 is axially advanced into contact with the hinged grate 568 it pivots the hinged grate open anteriorly so that the endotracheal tube 580 can extend into the patient &# 39 ; s trachea 5 as illustrated .

US-14538902-A

an aquatic exercise apparatus and method therefor comprised of two flotation devices connected by a plurality of tube members that can be easily and inexpensively adjusted by length and angle , allowing a person to swim by cranking two flotation devices while kicking his or her feet . preferably , pvc tubes and pvc elbows are used so that the overall length of the aquatic exercise device and the length between a first handle and a second handle can be easily and inexpensively adjusted by substituting pvc tubes of different lengths and pvc elbows of different angles . in this way , swimmers of different sizes can use the same aquatic exercise apparatus by adjusting it to their preference . additionally , a single swimmer can adjust the aquatic swimming apparatus in order to focus on different muscle groups .

referring to fig1 a , 2 , 3 and 3 a , reference number 10 refers generally to the aquatic exercise apparatus of the present invention . the aquatic exercise apparatus 10 generally comprises a first flotation device 12 and a second flotation device 14 , each having a density less than water . the first flotation device 12 and the second flotation device 14 can be in the shape of a pyramid 13 ( shown in fig1 a , 1 b , 2 , 3 , and 4 ), a propeller 15 ( shown in fig3 a and 4a ), a cross 17 ( shown in fig4 b ) or any other shape so long as the flotation device has a density less than water . referring now to fig1 a , 2 , 3 , and 3 a , the aquatic exercise apparatus 10 further comprises a first handle 16 and a second handle 18 . the first handle 16 and the second handle 18 are dimensioned to be grasped by a swimmer 20 ( shown in fig3 and 3 a ). a plurality of tube members 22 , preferably made of polyvinyl chloride ( pvc ) are used to couple the first flotation device 12 and the second flotation device 14 to the first handle 16 and the second handle 18 and to one another so that the first handle 16 and the second handle 18 and the tube members 22 are disposed of between the first flotation device 12 and the second flotation device 14 . while , in the preferred embodiment , the aquatic exercise apparatus 10 comprises a plurality of pvc tube members 22 , it should be clearly understood that substantial benefit could be derived from an alternative embodiment of the present invention in which an alternative material is used , so long as it is readily available in different lengths in order to permit a person to couple together tubes members 22 of different lengths in order to adjust the width of the aquatic exercise apparatus 10 . preferably , the aquatic exercise apparatus comprises a plurality of coupling elbows 24 dimensioned to couple the plurality of tube members 22 to the first handle 16 and the second handle 18 and to other tube members 22 . in one embodiment of the aquatic exercise apparatus 10 , shown in fig1 , the aquatic exercise apparatus 10 comprises a first pvc tube 26 having a first end 28 dimensioned to mate with the first flotation device 12 . preferably , the first end 28 of the first pvc tube 26 is inserted into an aperture 25 ( shown in fig4 a ) defined by the first flotation device 12 , although it should be clearly understood that substantial benefit could be derived from an alternative embodiment of the present invention , in which the first pvc tube 26 is coupled in some other way to the first flotation device 12 , such as by coupling to a protruding peg 27 ( shown in fig4 and 4 b ). in a similar fashion , a second pvc tube 32 is coupled to a second flotation device 14 . preferably , the second end 30 of the first pvc tube 26 is coupled to one end of a first pvc elbow 34 . one end of a third pvc tube 36 is coupled to the other end of the first pvc elbow 34 . similarly , a second pvc elbow 38 is coupled to one end of a fourth pvc tube 40 . the other end of the third pvc tube 36 is coupled to one end of a third pvc elbow 42 . similarly , the other end of the fourth pvc tube 40 is coupled to one end of a fourth pvc elbow 44 . a fifth pvc tube 46 is coupled to the other end of the third pvc elbow 42 . similarly , a sixth pvc tube 48 is coupled to the other end of the fourth pvc elbow 44 . the fifth pvc tube 46 is inserted into a first pvc gripping tube 50 having a diameter greater than the fifth pvc tube 46 so that the first pvc gripping tube 50 is dimensioned to rotate around and relative to the fifth pvc tube 46 . the first pvc gripping tube 50 is preferably what forms the first handle 16 . similarly , the sixth pvc tube 48 is inserted into a second pvc gripping tube 52 having a diameter greater than the sixth pvc tube 48 so that the second pvc gripping tube 52 is dimensioned to rotate around and relative to the sixth pvc tube 48 . the second pvc gripping tube 52 is preferably what forms the second handle 18 . the other end of the fifth pvc tube 46 is coupled to one end of a fifth pvc elbow 54 . similarly , the other end of the sixth pvc tube 48 is couple to one end of a sixth pvc elbow 56 . a first end of a seventh pvc tube 58 is coupled to the other end of the fifth pvc elbow 54 and a second end of the seventh pvc tube 58 is coupled to the other end of the sixth pvc elbow 56 . by using these plurality of pvc tubes and pvc elbows , a person is able to easily assemble and disassemble the aquatic exercise apparatus 10 , as well as adjust the distance both between the first handle 16 and the second handle 18 as well as the distance between the first flotation device 12 and the second flotation device 14 by using pvc tubes and elbows of varying lengths and angles . the availability and diversity of pvc allows one to easily assemble and modify the aquatic exercise apparatus 10 . using pvc elbows of less than 90 degrees for example , as shown in fig2 , allows a person to widen the distance between the first handle 16 and the second handle 18 without altering any of the lengths of any of the pvc tubes . referring now to fig1 b , an alternative embodiment of the aquatic exercise apparatus 10 , hereinafter 10 a , is shown . the aquatic exercise apparatus 10 a is essentially the same as the aquatic exercise apparatus 10 , except that two less pvc tubes 22 and two less pvc elbows 24 are used to couple the first flotation device 12 to the second flotation device 14 . this is a simpler , smaller version , which illustrates the versatility that using pvc tubes and elbows provides when assembling and modifying the aquatic exercise apparatus 10 . referring now to fig1 a , a relatively wider version of the aquatic exercise apparatus 10 is shown . the first pvc tube 26 and the second pvc tube 32 are relatively longer than other pvc tubes in order to increase the overall width of the aquatic exercise apparatus 10 by increasing the distance between the first flotation device 12 and the second flotation device 14 . referring now to fig5 and 6 , preferably the first handle 16 and the second handle 18 are constructed by using two pvc tubes 22 , one being inserted to another having a greater diameter . the interior pvc tube 22 preferably has a smaller diameter and a greater length than the exterior pvc tube 22 ( shown in fig5 as the first pvc tube gripping member 50 ). in this way , the exterior tube 22 can be grasped by a person 20 and rotated about the interior tube 22 in order to allow a swimmer 20 to crank the aquatic exercise apparatus 10 in the water and initiate movement . while , in the preferred embodiment , the first handle 16 and the second handle 18 are comprised of an interior pvc tube 22 and an exterior pvc tube 22 , it should be clearly understood that substantial benefit could be derived from an alternative configuration of the aquatic exercise apparatus 10 of the present invention in which the first handle 16 and the second handle 18 are comprised of another material , so long as the rest of the plurality of tube members are interchangeable in order to permit easy adjustment of the aquatic exercise apparatus 10 . in order to make use of the aquatic exercise apparatus 10 , a person preferably couples pvc tubes 22 to a first flotation device 12 and a second flotation device 14 , using pvc elbows 24 to couple the sections together in order to create a crank that can be used to propel a swimmer 20 forward in water when the swimmer 20 cranks the aquatic exercise apparatus 10 while kicking his or her feet . it should be clearly understood that it is within the spirit and scope of this invention that the tube members 22 may be fixedly coupled together ( for example with glue ) to create increased stability . adjustment would then be accomplished by simply sawing off the pvc tube members 22 and replacing them . it is because of the availability of pvc and other plastics that may be used , that the aquatic exercise apparatus can be easily and inexpensively adjusted . while the invention has been particularly shown and described with reference to preferred embodiments thereof , it will be understood by those skilled in the art that the foregoing and other changes in form and details may be made therein without departing from the spirit and scope of the invention .

US-81625804-A

this application is directed to a stent delivery system for introducing a flexible , generally cylindrical , self - expandable stent . the system comprises a catheter having distal and proximal ends , the catheter defining at least one lumen extending therethrough and having at least three longitudinally displaced openings or sets of openings extending from a lumen to the surface of the catheter ; a stent which comprises a generally cylindrical , expandable structure having proximal and distal ends and a flexible member extending proximally from the proximal end of the structure , the stent being wound circumferentially around the catheter , and having restraining members holding each of the proximal and distal ends of the stent to the catheter , and one or more restraining members holding at least a portion of the flexible member to the catheter surface ; and one or two release wires positioned in and extending longitudinally through at least one lumen , the release wires cooperating with the restraining members so that as the release wire or wires are withdrawn proximally , the proximal and distal end sections of the stent are released in such a manner that coils of the stent unwind .

this invention is directed to a temporary stent and a stent delivery system wherein said stent is releasably held to the distal portion of a catheter . prior to release the stent is wound over a small diameter catheter where its profile is reduced , and once the stent is released from the catheter , the stent assumes a pre - fabricated diameter by unwinding , reaching a larger diameter profile . the proximal end of the stent continues as a straight , flexible member that extends proximally alongside , i . e ., along the outer surface of , the delivery catheter to a point outside the patient &# 39 ; s body . these and other features of the invention may be appreciated better by reference to the drawings . according to fig1 a coiled stent 1 has distal section 2 with ball 3 and proximal section 4 with an angulation area 5 . extending from angulation area 5 is flexible stent wire 6 . in fig2 to 4 , the stent delivery system is in its pre - release condition where the coiled stent 1 is affixed to delivery or introducing catheter 11 at the distal and proximal sections 2 , 4 of stent 1 . the proximal stent wire 6 of the stent is affixed to the catheter surface by a third restraining means 9 to keep the proximal stent wire 6 somewhat coextensive with delivery catheter 11 . it is within the scope of the invention that stent 1 when mounted on the delivery catheter can be more tightly wound at distal section 2 . stent 1 can be releasably affixed to the outer surface 10 of catheter 11 by use of several different methods known in the art . preferably the affixation consists of loop locking mechanisms 15 that extend over a respective portion , that is , one or more coils , of stent 1 through an opening 16 in the outer surface 10 of catheter 11 to be restrained by one or more restraining means or wires 20 within one or more lumens within catheter 11 . also , restraining means 9 , which may be the same as or different from locking mechanism 15 , extends over stent wire 6 through an opening 17 . such restraining means or locking mechanisms are discussed in more detail below . it is also within the scope of the invention that other locking or restraining means could be employed to affix stent 1 to catheter 11 . for example , a system such as is shown in u . s . pat . no . 4 , 913 , 141 , or in co - pending , commonly assigned u . s . patent applications ser . no . 07 / 781 , 174 , filed dec . 11 , 1991 , ser . no . 07 / 805 , 737 , filed dec . 10 , 1991 , ser . no . 07 / 827 , 031 , filed jan ., 24 , 1992 , and ser . no . 08 / 009 , 470 , filed jan . 27 , 1993 , all of which are incorporated herein by reference , could be employed as well . lumen 12 may also serve as a passageway for any other device , such as a guidewire 18 , that may be inserted therein . it is within the scope of the invention that catheter 11 may comprise only one lumen or even three or more lumens , as may be required . it is preferable that catheter 11 comprise two lumens , wherein release wire 20 would extend longitudinally within one lumen and a working channel for guidewire or angiography or stent removal would extend longitudinally within another lumen . as shown in fig2 first distal section 2 , next proximal section 4 , and then stent wire 6 will be released as release wire 20 is drawn proximally . if there are two or even three separate release wires , one for each of distal section 2 , proximal section 4 , and / or stent wire 6 , respectively , the order of release could be altered or both stent sections , or the stent wire and both stent sections , could be released simultaneously . in another embodiment of the invention where distal section 2 is more closely wound , stent 1 is sequentially released from catheter 11 , as shown in fig6 to 9 of co - pending , commonly assigned u . s . patent application ser . no . 08 / 009 , 470 , filed jan . 27 , 1993 , incorporated herein by reference . preferably the distal section 2 of stent 1 is released and then the proximal section 4 is released . in a stent having a distal closely wound pitch , after release of distal section 2 of stent 1 , stent 1 starts to open , i . e ., unwind , from the distal end in the proximal direction . contact of the stent wire with the inner wall of a blood vessel ( not shown ) would form a groove in the vessel wall with a pitch corresponding to that of the loosely wound stent . however , because the rotating stent increases in diameter , its length decreases slightly in the direction of the proximal portion of the stent , and the tight winding of the end of the stent disappears . the middle section of the released stent 1 should be positioned in substantially the same place , if not the identical place , as the middle of the released stent , assuming the catheter doesn &# 39 ; t move during the stent release . at the very least with this configuration it should be possible to reliably predict where the middle of the released stent will be located . the unwound , released stent 1 shown in fig1 has a longitudinal length approximately 55 to 110 %, preferably from about 60 to 95 %, of the length of the wound , pre - release stent shown in fig2 and 4 . this relationship will vary dependent upon many factors , such as the tightness of the coils , the stent material , the body tube diameter prior to the stent deployment , and the stent diameter . as mentioned above , distal section 2 may be more closely wound , although stent 1 as released expands to uniform winding . for example , if the winding of released stent 1 might consist of 15 coils per inch of length , the compressed winding at distal section 2 , especially in a temporary stent , could consist of 20 to 45 coils per inch . it is within the scope of the invention that the tightness , i . e ., the distance between the coils , of the coils as well as the length of the closely wound coil sections could be adjusted dependent upon the particular application intended . by the appropriate combination of wound and more tightly wound coils , one skilled in the art should be able to easily achieve situations wherein the intravessel released stent 1 will have substantially the same length as that of the originally unwound fabricated stent before mounting on the catheter . as shown in fig4 the outer surface 10 may have a groove or grooves 19 corresponding to wound stent 1 . the groove or grooves 19 are preferably sufficiently deep that the outer diameter of the wound stent is substantially similar to the outer diameter of catheter 11 . this arrangement has the advantage of reducing the profile of the delivery system and keeping the differential tightness of the coil pitches during stent insertion into a corporal lumen . the stent delivery system of the invention is introduced into a patient &# 39 ; s body through an appropriate external opening . when the stent is a coronary stent , a guiding catheter of appropriate length is threaded distally through the opening to the origin of the coronary artery , and then a guidewire is advanced distally through the guiding catheter to a desired location . then , the delivery system of the invention is advanced distally along the guide wire until the stent is situated at the location where dilation or support is desired . as would be appreciated by those skilled in the art , the respective positions of the tip of the guidewire and the stent would be discernible due to appropriate radiopaque markings or features . when the stent is at its desired location , the stent delivery system and stent wire extends proximally to a point outside the patient &# 39 ; s body . after the release wire or wires are pulled proximally , the stent and stent wire are released from the delivery catheter . preferably the delivery catheter is then retracted along the guidewire , with care being taken not to interfere with the stent wire , and then the guidewire is withdrawn . optionally ( 1 ) the guide wire is withdrawn before the delivery catheter is withdrawn or ( 2 ) the guidewire is left in place until the stent is removed . to withdraw the stent a guiding catheter is advanced distally along the stent wire to the origin of the coronary artery . through this catheter an angioplasty guidewire is advanced past the site where the stent is located . over this guidewire and the stent wire , or over only the stent wire , another small diameter catheter is threaded and advanced to a point adjacent the proximal end of the stent , this catheter preferably having a radiopaque marker at its distal end to facilitate locating the catheter distal tip relative to the proximal portion of the stent . then the stent wire is pulled proximally while the catheter is held in position so that the stent , by rotating , is advanced to the extraction catheter and the coils become sufficiently straightened into the lumen of the catheter , and at the same time the helical part of the stent uncoils in the artery in its own indentations in the arterial wall . during this process of the uncoiling of the arterial part of the stent and its being pulled as a straight wire in the catheter there is no or only minimal trauma to the vessel wall . this process continues till the stent coils are completely removed through the catheter out of the patient &# 39 ; s body . once the stent is pulled into or through the catheter , the small diameter catheter can be withdrawn . at this point , the delivery catheter and an angioplasty wire are left in place . if balloon dilatation or further stenting is required , these can be easily performed over the wire . the procedure of stent removal could be done without a guiding catheter , by use of a small lumen catheter which is threaded only over the stent wire , or over a stent wire and a guidewire . when the catheter reaches the same position as before , the stent will uncoil as it is pulled as a straight wire into the catheter as described above . however , at the end of the procedure only the small lumen catheter , with or without a guidewire , will be in the coronary artery . another possibility is threading the small lumen catheter over the stent wire first to the stent location , threading an angioplasty wire through the catheter , advancing the wire distal to the stent , and removing the stent as described before . the advantage of using the guidewire is the safety of stent removal having an angioplasty wire across the lesion in the event of coronary vessel closure . the delivery catheter itself could be comprised of any polymeric material suitable for such catheters . useful materials include polyethylene , polyurethane , polypropylene , and co - polymers therewith . the catheter may be comprised of material having differing longitudinal flexibility so that the proximal portion of the catheter is stiffer than the distal tip , enabling easy insertion of the catheter into tortuous vessels . preferably catheter 11 has a decreased diameter in the area where stent 1 is mounted , to enable the delivery system to have a lower profile at that point , comparable to the diameter of the remainder of the catheter 11 . also , catheter 11 preferably has grooves on its outer surface that correspond to the coils of wound stent 1 . likewise , the release wires useful herein can be comprised of any physiologically acceptable polymer or metal suitable for such purpose . stainless steel wires are especially useful in this regard . also , the distal portion of the release wire can be less stiff than its proximal portion to ensure a flexible tip . this can be accomplished by reducing the diameter of the release wire at its distal end or heat - treating this part of the release wire until it becomes completely or partially annealed . the catheters useful according to the invention must have at least one lumen suitable for release means , which lumen has three or more openings or sets of openings extending to the exterior surface of the catheter to permit interaction with fixation members . at each fixation point there may be 1 or 2 openings , dependent upon the release means employed . the catheter may comprise a single , concentric , longitudinally extending lumen , or it may comprise one or more eccentric , longitudinally extending lumens . in the cross - sectional view of fig3 catheter 11 comprises main lumen 12 and side lumen 13 , which contains release wire 20 . catheter 11 could instead comprise a single lumen 12 , which could be eccentric or concentric within catheter 11 . also , the release wire - containing lumen could contain more than one release wire 20 , possibly two or even three release wires if desired . it is within the scope of the invention that the delivery catheter may be of the &# 34 ; monorail &# 34 ; type , where the catheter has a shortened lumen at the distal end of the delivery catheter . the shortened lumen &# 34 ; tracks &# 34 ; the guidewire while the release wire or wires extend through a separate , full length lumen . the shortened lumen would extend from at or near the distal end of the delivery catheter to a point proximal to the proximal end of the mounted stent . the same kind of catheter can be used to remove the temporary stent . in some embodiments of the invention , especially the biliary stent or the removable or permanent vascular stent , a middle restraining means is advantageous . however , in some applications , when the stent is closely wound even at its maximum , released diameter , the middle restraining means release mechanism does not function well because it can be caught between two closely wound loops . it was found that a novel arrangement employing a bioabsorbable ( or biosorbable ) wire straining member is quite effective in overcoming this problem of the loops of the stent which press the middle restraining means and may prevent it from &# 34 ; jumping up ,&# 34 ; that is , away from the catheter surface . according to the embodiment of the invention set forth in fig1 and 20 of commonly assigned , co - pending u . s . patent application ser . no . 08 / 009 , 470 , filed jan . 27 , 1993 , incorporated herein by reference , a release wire extends through a side lumen where it intersects a biosorbable restraining member , which cooperates with the release wire to restrain a portion of the stent . the restraining member can be configured in some different ways , mostly that the restraining means is completely disconnected from the delivery catheter after stent recoiling . as shown in fig1 of application ser . no . 08 / 009 , 470 , the restraining member encompasses a portion of the stent , so that when the release wire is withdrawn proximally to release the restraining member and the portion of the stent , the restraining member remains with the portion of the stent or , if the loop were at the distal or proximal portion of the stent , the restraining member may disengage from the stent or stay with it . alternatively , as shown in fig2 of application ser . no . 08 / 009 , 470 , the restraining member is configured so that the respective ends of the restraining member are engaged by the release wire . therefore , when the release wire is pulled proximally , the ends of the restraining member are disengaged from the release wire , such that the stent member is also disengaged and the stent unwinds . the restraining member may then dissociate from the stent . the restraining members described above comprise non - toxic , physiologically acceptable material that is preferably biosorbable . therefore , whether the arrangement of fig1 or fig2 is employed , the restraining member will be absorbed by or passed through the body . suitable materials are well known to those skilled in the art and would include other materials presently useful for other medical applications , including , but not limited to , the materials used in absorbable sutures such as homo - and copolymers of glycolic acid . see , for example , the materials disclosed in kirk - othmer , encyclopedia of chemical technology , 2d ed ., vol . 22 , pages 433 et seq ., incorporated herein by reference . examples of such materials are dexon ™ plus and dexon ™ &# 34 ; s &# 34 ;, available from david + beck , inc . of puerto rico . the stent delivery systems described herein are intended to be useful for the stents shown as well as other expandable stents . a preferred stent , such as that shown here , is described in detail in co - pending u . s . patent applications ser . no . 07 / 781 , 174 , filed oct . 31 , 1991 , and ser . no . 07 / 827 , 031 , filed jan . 24 , 1992 , both of which are incorporated herein by reference . more specifically , the preferred stent comprises a spatial spiral ( helix ) wound of wire of a material tolerated by the human body and which , furthermore , is not corroded or otherwise attacked by body fluids . such a material , also known as a physiologically or medically acceptable material , could be one or more of several materials known for this purpose . especially useful here are metals such as stainless steel , gold - plated medical grade stainless steel , stainless steel coated with silicone , bicarbon , or polytetrafluoroethylene , such as teflon ®, tantalum , titanium , superelastic alloy such as nickel - titanium ( ni -- ti ) alloys ( commercially available as nitinol or tinel ), a shape memory polymer , such as are described in u . s . pat . no . 5 , 163 , 952 , incorporated herein by reference , or bioabsorbable polymer material such as a saccharide or other biocompatible , non - toxic polymer taught by u . s . pat . no . 5 , 141 , 516 , incorporated herein by reference . the stent may be coated with an antithrombotic agent , such as , for example , low molecular weight heparin , to prevent thrombosis . the wire typically has a diameter of from about 0 . 1 to 1 . 0 mm , preferably from about 0 . 15 to 0 . 60 mm . also , a strip of ellipsoidal , rectangular , rectangular with step , or s - shape wire is suitable for stent production . the preferred stent useful herein has thickened regions at the distal end and , optionally , the proximal end of the stent . in the text above reference is made to &# 34 ; ball 3 &# 34 ;; however , each ball 3 can be spherical or non - spherical , so long as the &# 34 ; ball &# 34 ; functions as described . optionally the angulation area 5 may comprise a ball 5a ( not shown ). for example , in the embodiment shown in fig1 and 2 , the ball 3 ( or 5a ) could merely be a non - spherical thickened area , such as an egg , cone , or tear - drop shape , or a concentric ball or a ball directed towards the stent central segment or a functionally equivalent loop , hole , or hook , or wire curvature that would cooperate with loop 15 to restrain an end of the stent . the ball 3 ( or 5a ) may be flattened on its outer and / or inner surface to facilitate the stent being in better contact with the outer surface of the catheter , to enable the mounted profile to be narrower . the proximal section 4 of stent 1 comprises a flexible wire 6 that extends proximally . flexible wire 6 is preferably formed as part of stent 1 when stent 1 is manufactured . for example , flexible wire 6 could comprise a thin wire of polymer , stainless steel , or nitinol that is drawn as the stent 1 is formed . alternatively , flexible wire 6 can be formed separately from stent 1 and then attached to stent 1 by chemical or mechanical means . chemical means would include bonding , gluing , melting , or soldering . mechanical means would include attachment means such as a small clamp or snap or locking arrangement , for example , where the end of the stent is threaded through a hole in flexible wire 6 before a ball 5a is formed . flexible wire 6 must be made from a physiologically compatible material that may be the same as , or may differ from , the material of stent 1 . further , flexible wire 6 must be of cross - sectional shape and diameter such that it is strong enough to remove the stent 1 but sufficiently flexible for insertion into , and removal from , body passages . further , flexible wire 6 should be at least 50 cm , preferably from 50 to 300 cm in length , dependent upon the application , to extend toward an opening or to outside the patient &# 39 ; s body . the outer diameter and length of the stent will vary according to the intended use . for peripheral or coronary use , the outer diameter of the unwound stent will typically be from about 4 to 40 french ( from about 1 . 7 to 13 . 3 mm ), and the length of the stent can vary from about 0 . 5 to 15 cm . it is also within the scope of the invention that the stent may comprise two spirals connected by a wire , the spirals and wire preferably being a continuous wire , or welding at respective distal and proximal ends . a special property of nickel - titanium alloy ( nitinol ) can be used for the production of the stent . nickel - titanium alloy can have superelasticity at temperatures in the neighborhood of body temperature ( 37 ° c .). the term &# 34 ; superelasticity &# 34 ; is used to describe the property of certain alloys to return to their original shape upon unloading after substantial deformation . superelastic alloys can be strained up to eight times more than ordinary spring materials without being plastically deformed . such superelasticity would enable one to compress the stent to a very small diameter over the delivery catheter without plastic deformation . another aspect of the invention concerns the stent removal system set forth in fig5 to 8 . a stent removal system 29 comprises a catheter 30 with at least two lumens 31 which extend lengthwise through catheter 30 . a snare 32 consists of distal section 33 , which is continuous with proximally extending sections 34 . sections 34 each extend through respective lumens 31 through and proximal to the proximal portion ( not shown ) of catheter 30 . a stent such as stent 40 is removed by advancing the stent removal system 29 through a vessel 38 to a position proximal to the proximal end of stent 40 , preferably through a guiding or second catheter 35 or other appropriate lumen - containing vehicle . there may optionally be a small space or clearance 37 between catheter 30 and guiding catheter 35 . the stent removal system 29 is advanced to the extent that the stent removal system as shown in fig5 is in position such that the distal end 33 is slightly distal of the proximal end 41 of stent 40 . then , the stent removal system 29 is torqued , preferably about one - half turn in the direction opposite to the direction of the stent winding , to engage the ball 42 on stent 40 . next , the snare wires 34 are pulled slowly , but firmly , in the proximal direction to cause the ball 42 of stent 40 to pass against the distal section 43 of catheter 30 . preferably the distal section 33 of snare 32 engages ball 42 to hold it adjacent the distal surface of stent 30 as shown in fig6 . as guiding catheter 35 is held stable , stent 30 and snare wire 34 are pulled in the proximal direction , whereupon stent 40 is pulled into guiding catheter 35 and straightens as it is pulled proximally . in an alternative embodiment , the snare may be of different or configuration sufficient to engage the proximal end of stent 40 . for example , the snare could be a single wire 45 having at its distal end a hook 46 or similar configuration that would engage ball 42 . then , as the snare is pulled distally , the hook would engage ball 42 and pull stent 40 proximally to remove it through the guiding catheter . in the case of a single wire snare such as that described here , the catheter 30 need only have one lumen for the snare wire , although it may have other lumens for other purposes . the preceding specific embodiments are illustrative of the practice of the invention . it is to be understood , however , that other expedients known to those skilled in the art or disclosed herein , may be employed without departing from the spirit of the invention or the scope of the appended claims .

US-13624998-A

a system that facilitates water conservation and energy savings for a residential dwelling or home is provided . the system will increase the efficiency with which water is consumed by implementing a reclamation system for reusing water for selected tasks . energy savings are enabled by utilizing unique insulating materials that allow the climate of the interior of a home to be controlled in a more affordable manner as less fuel / energy is required to heat / cool the home &# 39 ; s interior .

the following detailed description is of the best currently contemplated modes of carrying out exemplary embodiments of the invention . the description is not to be taken in a limiting sense , but is made merely for the purpose of illustrating the general principles of the invention , since the scope of the invention is best defined by the appended claims . broadly , an embodiment of the present invention provides a system for managing water use and the climate of a home . the system integrates a plumbing based cold water and fire system and a plumbing waste system that reclaims water and enables a user to recycle that water for particular tasks and an insulation system for a home that enables a user to use much less fuel to heat / cool the home . the plumbing based cold water and fire system is also connected to the fire protection system as described in u . s . pat . no . 6 , 044 , 911 to haase which is hereby incorporated by reference . referring to fig1 , a schematic of the plumbing waste system is displayed . reclaimed - water from sinks and showers is fed into the system via 10 . an open ball valve 16 controls the flow of water to the bypass to the sewer 12 . a closed ball valve 18 controls the flow of water from 10 to the wl - 55 26 . the wl - 55 26 is a water reclamation system . closed ball valve 18 regulates the flow of water to supply toilets 22 . a check valve 18 enables fresh water to pass through open ball valve 16 and fresh water bypass 24 for the toilets . water to the drain to the sewer 30 is regulated by a closed ball valve 18 . the water - reclamation system treats the reclaimed water and purifies it so that it can be used for more than flushing toilets . the treated reclaimed water can be used to water plants . fig2 is a schematic of a house with installed elements for regulating the heat in the house . the solar panels 46 are used in conjunction with the solar thermal heat exchanger 44 and the heat exchanger 42 to provide heat to the house . a pump 38 is connected to a boiler 36 to deliver a steady supply of water to the boiler 36 . the bypass 34 is also connected to the pump 38 . fig3 is a schematic of a side of the building illustrating a wall , floor and a roof . the foundation 62 extends below the finish grade 60 . the insulation and exterior wall assembly 58 may include any exterior siding such as a stucco system 56 . the insulation system completely wraps the house on the outside of the framing . the insulation is installed under the concrete floor of the slab , or the basement of the house if applicable . the insulation is also used to cover the top of the house , including the attic . the insulating material is made from expanded mylar coated polystyrene . this method of insulation completely envelopes the house , and eliminates all thermal bridging . thermal bridging is a result of the way conventional homes are insulated . in a conventional home , insulation is put between the studs and roof joists before the exterior siding is put on . in conventional insulation the insulation is put between the top floor ceiling joist which leaves the attic area cold . the trouble with this method is that the wood joist contacts the outside siding and cold comes through the wood into the home . the insulation method of the invention prevents the wood joist from coming into contact with the cold . additionally , since the insulation is attached to the outside of the framing , a different stud size can be used for the construction . the studs required with this new type of insulation coupled with the insulation technique are typically 2 ′. times . 4 ″ studs in an exemplary embodiment of the invention . the conventional practices primarily utilize 2 ″. times . 6 ″ studs to fit the insulation in . fig4 illustrates the layout 64 of a house in an exemplary embodiment of the invention . the house features a bedroom 66 , a bath 68 , a master bedroom 70 , the kitchen 72 , a living room 74 , a utility room 76 , a toilet 78 , another bath 80 , a bathroom sink 82 , a kitchen dish washer 84 , a kitchen sink 86 , a washer 88 , a reclamation water tank 90 and discharge to the garden 92 . the utilization of expanded polystyrene ( eps ), in various thicknesses , with mylar facing in lieu of traditional building wrap materials , constitutes a unique way to construct an energy efficient building envelope . eps material itself cannot be claimed , but the unique method and my copyrighted reports from sandia national laboratories and los alamos national laboratories show the uniqueness of the “ results ” of this methodology . in essence , by limiting thermal bridging the required energy for heating and cooling this home has been reduced . the significant reduction in energy requirements allows for a much smaller more efficient renewable energy source that is now affordable for the average person . imagine a styrofoam cup in your hand and someone is pouring boiling hot coffee into the cup . it does not adversely affect your hand . so current architecture would benefit from being wrapped in expanded polystyrene . the extreme heat of the desert southwest would not have as bad an effect on the building . it would be stopped from entering the building through thermal bridging . utilizing the scientific data supplied by the manufacturer of the eps , and having this data confirmed by sandia national laboratories and los alamos national laboratories , in conjunction with certain heating calculation software programs , this type of construction reduces energy requirements by a minimum of 50 %. in some cases it has reduced energy requirements by 75 %. the research home located at 4636 piedras street in farmington n . mex . is a good example . another example is a home located at 503 skyline in elephant butte n . mex . computer designed heating system , which when used in conjunction with our building design , requires less energy allowing for the installation of solar thermal panels which utilize the suns radiant energy to heat fluids such as glycol , which when pumped through a heat exchanger assembly , gives off heat for domestic hot water usage such as , but not limited to , bathing , showering , laundry , etc . due to the architectural design , the capabilities of the solar thermal system , include primary radiant floor heating , utilizing the same solar thermal panels ( see diagram ). utilization of solar thermal heating panels for domestic / radiant primary heating / cooling systems make this type of system extremely affordable . the benefits of this real green building system will reduce costly infrastructure for new sub - divisions by at least 50 % for every municipality where they are utilized . the system eliminates the need for fire hydrants , fire stations and more importantly fire department personnel . the system will reduces personnel costs to each municipality by at least 50 % in the fire services category . personnel costs and retirement benefits cost will be greatly reduced . the usage of this system will reduce water infrastructure costs to the municipality by at least 50 %. water storage capacities will be cut significantly . millions of dollars in taxpayer monies will be saved . the usage of this system will make photo - voltaic energy producing systems affordable for every persons new home by lowering the energy needs by at least 50 %. the living environment of each building created using this system will be healthier than a standard building . these buildings will cut health care costs from sick building syndrome significantly . an internal controlled healthy environment will result in lower health care costs . it should be understood , of course , that the foregoing relates to exemplary embodiments of the invention and that modifications may be made without departing from to spirit and scope of the invention as set forth in the following claims .

US-201313834783-A

an irrigation controller modifies sophisticated irrigation protocols using an extremely simple user control . in one aspect of a particularly preferred class of embodiments , the user control includes a simple &# 34 ; more / less &# 34 ; adjustment . in another aspect of preferred embodiments , the controller automatically determines appropriate irrigation amounts , start times , durations , and frequencies . such automatic determination may advantageously be based in part on the more / less adjustment , and in part on an external signal , such as that transmitted by a radio transmitter .

referring first to fig1 a method 1 of controlling irrigation to an irrigated area generally comprises the following steps : providing an irrigation controller which controls at least one irrigation control valve 10 ; receiving a signal from a distal signal source to establish a preliminary irrigation schedule 20 ; applying the preliminary irrigation schedule to the irrigated area 30 ; examining the irrigated area to determine the effect of the preliminary schedule 40 ; operating a more / less adjustment to modify the preliminary schedule 50 ; and returning to step 40 . there is a vast range of irrigation controllers suitable for step 10 . it is contemplated , for example , that appropriate controllers may operate anywhere from a single zone to as many as a dozen or more zones . in turn , each zone may have one or more valves . suitable irrigation controllers would generally be located in a garage or other protected area , but may also be distributed , such as throughout a large field . such controllers would generally be powered from line current , such as household current , but may also be battery powered , or have a battery backup . the signal used in step 20 to establish a preliminary irrigation schedule may be transmitted and received using any viable means . radio waves are particularly advantageous , since they travel large distances at relatively low cost . in particularly preferred embodiments , the signal is carried on an existing carrier wave , such as a carrier wave transmitted by an am or fm radio broadcasting station . in other embodiments , the signal could be carried on a tv or computer cable , or over a telephone line . the signal could be received by any suitable receiver , such as a telephone , radio or a pager - type receiver . the content of the signal is contemplated to include whatever data may be helpful in establishing an appropriate watering protocol . thus , for example , the signal may include raw data such as temperature , wind , solar radiation and humidity . alternatively , or in addition , the signal may include calculated data such as an estimated evapo - transpiration rate . it is considered extremely advantageous , but not necessary , for the signal to include some sort of geographic locator , so that a receiving controller may extract data which is relatively specific to its particular locale . still further , it is contemplated that the signal may include a plant identifier , so that a receiving controller may adapt a particular watering protocol to a particular plant or type of plant . in a particularly preferred embodiment , the signal includes a series of geographic locator ( gl ) and estimated evapo - transpiration rate ( et ) pairs , in the format ; gl1 - et1 , gl2 - et2 , gl3 - et3 . as mentioned above , the geographic locator may advantageously comprise a five or nine digit zip code , but may also reflect some other zoning system which is more agriculturally oriented than zip codes . the signal may even intermix different types of geographic locators . the evapo - transpiration rate may be calculated as a function of many different parameters , including temperature , solar radiation , humidity and wind , and preferred formulas for such calculations are set forth in various publications , including pair , claude h ., hinz , walter w . reid , crawford , and frost , kenneth r ., sprinkler irrigation , ( irrigation association , 1975 ). it is contemplated that the preliminary irrigation schedule of step 30 can be established using only very limited information . thus , for example , a typical homeowner user may install a controller as described herein by connecting wires from the controller to valve control units , which in turn operate sprinklers in various zones throughout his yard . the homeowner may then use a keypad on the controller to input various codes , such as a geographic locator code , a plant code , a soil type code or even a drainage code . the geographic locator code may well comprise 5 or more digits , while the other codes may advantageously comprise only two or even one digits . the code ( s ) entered may be taken from a printed manual supplied with the controller , or from some other source such as an internet website , or provided by a telephone operator . in less preferred embodiments , the preliminary irrigation schedule may even be set by default , so that no input codes are required at all . of course , where the input codes are zone specific , the user may find it desirable to input different codes for different zones . thus , for zone 1 a user may enter a code of &# 34 ; 01 &# 34 ; for established grass , and a code of &# 34 ; 5 &# 34 ; for moderate drainage , while for zone 2 the user may enter a code of &# 34 ; 40 &# 34 ; for citrus , and a code of &# 34 ; 7 &# 34 ; for relatively high drainage , and for zone 3 the user may enter a code of &# 34 ; 02 &# 34 ; for newly planted grass , and a code of &# 34 ; 5 &# 34 ; for moderate drainage . other coding schemes are also contemplated , including the use of letters , and the use of a leading digit or digits to designate the type of code . for example , 01xxxxx could be used for geographic locator codes , 02xx for plant codes , and 03xx for soil type code or drainage code . in this scheme , the &# 34 ; x &# 34 ; would be limited to numbers 1 - 9 . in establishing a preliminary irrigation schedule , the controller would preferably combine whatever geographic locator , plant type , soil type , slope or other codes are available with data from the external signal . this information would then be used to produce a series of on / off times for each zone . some zones may even have multiple on / off times , so that a high runoff zone may not be watered for more than 2 or 3 minutes at a time . in step 30 the preliminary irrigation schedule is applied to the irrigated area . this is generally contemplated to be carried out in the usual manner , with the irrigation controller operating various solenoids which in turn operate valves upstream of watering devices . the watering devices may be sprinkler heads , drip irrigation heads , misting heads , punctured drip irrigation lines , or any other of myriad watering apparatus , or combinations thereof . signals from the irrigation controller to the solenoids are generally contemplated to be carried along wires in the usual manner , although in some instances the signals can be carried by metallic pipes , by radio wave , or in some other manner . in step 40 the zone or zones are examined to determine the effect of the preliminary watering schedule . the examination is preferably visual , but may be accomplished by any other suitable means , such as using a soil moisture sensor which may be inserted into one or more sites in the soil of a zone . the examination is preferably carried out after step 3 has been ongoing for a substantial period of time , such as several days or weeks of watering using the preliminary schedule . this provides a good baseline from which reasonable decisions regarding changes in the irrigation schedule can be made . alternatively , however , inspection can take place after or even during a single watering . after one or more inspections ( step 40 ), it is contemplated that the user will desire to modify the preliminary schedule for one or more zones . in accordance with preferred embodiments , this can be accomplished by making a simple more / less adjustment for each such zone ( step 50 ). for example , it may be desirable to increase the watering of zone 4 relative to the then - existing watering schedule . to accomplish this the user might press a button to access zone 4 , and then press a &# 34 ; more &# 34 ; button once . to increase the watering of zone 4 relative to the then - existing watering schedule yet further , the user might press the &# 34 ; more &# 34 ; button one or more additional times . obviously reduction in watering could be accomplished by pressing a &# 34 ; less &# 34 ; button , and either increase or decrease in other zones could be accomplished in an analogous manner . the actual strategy by which an irrigation controller modifies the watering schedule for one or more zones as disclosed herein may vary among different embodiments of the controllers . it may be , for example , that each pressing of the &# 34 ; more &# 34 ; button increases the watering of that zone by 5 %, and that each pressing of the &# 34 ; less &# 34 ; button decreases the watering of that zone by 5 %. depending on the previously inputted codes for type of plant , drainage and so forth , that change may be reflected in an across the board change in all watering durations , and / or perhaps in the addition or subtraction of an entire watering day . it is important to understand that the more / less adjustments contemplated herein may only indirectly control the amount of water provided to a zone . this is because contemplated irrigation controller advantageously determine irrigation schedules based upon one or more algorithms involving many input parameters . this is to be distinguished from a typical irrigation controller in which the user inputted parameters , such as start time , stop time and duration , directly control the irrigation schedule . by way of example , a user employing an indirectly controlled irrigation controller according the inventive subject matter herein may conclude that zone 4 needs more water . by pushing the more button for zone 4 , the user tells the system to increase the watering of zone 4 , but not how to do so . the system may respond by adding a fraction of a minute to the watering across several days , or by adding an entire minute to the watering on a particular day . in contrast , the same user employing a directly controlled irrigation controller would likely instruct the controller exactly when to increase watering , such as by altering a specific start time , stop time or duration . it is also important to understand that the term &# 34 ; duration &# 34 ; is used herein in a broad sense to encompass duration both by time and by quantity . thus , it is contemplated that a controller according to the present inventive subject matter may operate a valve to provide water to a particular zone for a &# 34 ; duration &# 34 ; of three minutes , or for a &# 34 ; duration &# 34 ; sufficient to deposit 1000 gallons . turning to fig2 an irrigation controller 100 according to the present invention generally includes a microprocessor based central processing unit 110 , an onboard memory 120 , a manual input device 130 , a signal receiving device 132 , a display screen 140 , a plurality of electrical connectors 150 for connecting with solenoids ( not shown ), and a power supply 160 . each of these components by itself is well known in the electronics industry , with the exception of the programming of the microprocessor in accordance with the functionality set forth herein . there are hundreds of suitable chips which can be used for this purpose . at present , experimental versions have been made using the phillips 87c52 chip , and it is contemplated that such chip would be satisfactory for production models . it is also contemplated that a flow meter can be employed to provide local input parameters to assist in determining watering schedules . in one possible embodiment , a protocol such as that depicted in fig3 can be used . in step 61 of this particular example , it is contemplated that an installer , gardener , homeowner or other user would input data corresponding to landscape area serviced by each station ( i . e ., each zone ) in a watering system . of course , the data need not be perfectly accurate , but can be estimated . moreover , here , as in all other data entry steps , a user may either enter numeric data , or may enter data by selecting from choices provided by the system . in step 62 , the user inputs data corresponding to watering unit per landscape area per unit of time . a typical value , for example , may be 0 . 25 inches per day . in step 63 , the system multiplies the landscape area by the watering unit to arrive at designated water amount for each station in the system . of course , steps 61 , 62 and 63 could be modified to receive many different types of data , in many different formats . these steps could also be merged together by having the user enter a single default number , which would correspond in some manner to the designated water amount . such a system is exemplified in the discussion of fig4 . steps 61 , 62 and 63 could even be eliminated altogether , for example , by having the system use default watering parameters such as x minutes per day , or y gallons per day . in step 64 the system determines one or more start times for watering , and determines any adjustments which may be made to the designated water amount for each of the stations . the start time ( s ) may vary from day to day , so that some days may have no start time at all for one or more of the stations , and some days may have multiple start times for one or more of the stations . this flexibility allows the system to compensate for various parameters conditions such as those discussed elsewhere herein , including local weather conditions derived from local sensors , et data received from a distally generated signal source , internally stored historical et data , and user input such as from a more / less adjustment . in step 65 , water is applied to each of the stations ( preferably in sequence ) until data received from a flow or other appropriate metering device indicates that the designated water amount for that station has been applied . a system such as that charted in fig3 may also be used to control watering based upon a monthly or other water allotment . in effect , the watering allotment is just another piece of data used by the system to determine watering schedules and amounts , and the water allotment may or may not be completely determinative of the total amount of water provided . in the flow diagram of fig4 for example , is an alternative flow diagram illustrating various steps in the use of a flow meter to set watering times based in part on a water budget allotment . here , it is contemplated that a water district may provide a resident or business with a given allotment of water for a given time period . in step 71 , a user inputs a total monthly allotment for the irrigation area covered by the system . in step 72 , either the system uses a default number or the user enters number for one or more of the stations controlled by the system , which number informs the system of the relative amount of water to be given to the various stations . in step 73 , the controller determines the flow characteristics of each station , such as by causing each valve to open for a period of time , and obtaining flow data from a flow meter . in step 74 , the controller uses the data obtained in steps 71 - 73 , possibly along with other relevant data from local or distal data sources , to determine appropriate start times , designated watering amounts and so forth for each of the stations . one such input parameter , of course , may result from a more / less adjustment , which in this case would modify the relative amount of water delivered to the various stations , as opposed to the absolute amount . in step 75 , water is applied to each of the stations ( preferably in sequence ) until data received from a flow or other appropriate metering device indicates that the designated water amount for that station has been applied . in still other embodiments it is contemplated to include one or more overrides in the controller . for example , there may be a master override which prevents all watering in one or more zones . such an override may be useful during system maintenance or malfunction . another override may be available for selecting a subset of days which are appropriate for watering , or to preclude watering on certain days . such an override may be useful for preventing watering on days that grass is to be cut , or on days that games are to be played on a lawn . thus , specific embodiments and applications of methods of controlling irrigation have been disclosed . it should be apparent , however , to those skilled in the art that many more modifications besides those already described are possible without departing from the inventive concepts herein . for example , the more / less adjustment might affect all controlled valves at once , or might be limited to a subset of the controlled valves with additional more / less adjustments being provided for each subset . similarly , it is possible to utilize various types of more / less controls such as buttons , sliders , rotating knobs , touch screens , and similar devices , which affects more or less water , and / or some other watering parameter such as frequency or duration . the inventive subject matter , therefore , is not to be restricted except in the spirit of the appended claims .

US-8260398-A

an exercise device including a pedal crank and a hand crank separately drivingly connected to a flywheel provided with a braking mechanism remotely controllable to vary the amount of braking , in response to operation of switches located on the hand crank in a location making removal of the hand from the hand crank unnecessary to operation of the switches . the switches also control selection of various displays of information concerning the exercise being performed .

referring now to the drawings , in fig1 an exemplary exercise apparatus 10 , shown in simplified form , includes a flywheel 12 rotatably supported by a frame ( not shown ). a pedal crank 14 is mounted rotatably on the frame and connected drivingly to the flywheel 12 by an endless chain and sprocket arrangement including a unidirectional clutch 16 . preferably , the flywheel is driven at a higher angular velocity than the pedal crank 14 , for example , 2 - 1 / 2 times as fast . a rotatably mounted hand crank 18 is fixedly connected to an upper sheave 20 . a pair of crank handles 22 and 24 , shown simplified in fig1 are pivotally mounted upon the eccentric shafts of the hand crank 18 , so that the crank handles 22 and 24 may be grasped firmly by the user of the apparatus 10 while the hand crank 18 is operated to rotate the upper sheave 20 . a lower sheave 26 is rotatably mounted coaxially alongside the flywheel 12 . a second unidirectional clutch 28 connects the lower sheave 26 drivingly to the flywheel . both of the unidirectional clutches are arranged so as to drive the flywheel 12 in the direction indicated by the arrow 30 . the upper sheave 20 is connected drivingly to the lower sheave 26 by , for example , a flexible endless loop v - belt 32 whose tension is adjusted to be within a required range by an adjustable idler pulley 34 . a brake band 36 is disposed circumferentially around a suitable peripheral surface of the flywheel 12 . a first end of the brake band 36 is fixedly anchored as at 38 , while the other end of the brake band is connected , through a tension spring 40 , to a tension adjuster 42 including a threaded rod 44 and a tension nut ( not shown ) rotated by a motor included in the tension adjuster 42 to adjust the tension in the spring 40 . a strain gauge 45 is mounted on the brake band 36 and provides an electrically perceptible indication of the amount of tension in that end of the brake band . as will be explained subsequently , the amount of tension in the brake band 36 is useful in determining the amount of frictional resistance to rotation of the flywheel 12 which is being created at any particular time by the brake band 36 riding on the peripheral surface of the flywheel 12 . the electrical signal provided by the strain gauge 45 is conducted to a control unit 46 which includes a digital microprocessor 48 of a suitably programmable type . for example , the z - 80 microprocessor has been found to be suitable for the purpose of this invention . a force detecting device 56 provides an electrical signal indicative of the amount of force being applied through the v - belt 32 to turn the flywheel 12 against the resistance of its own inertia and the frictional force applied by the brake band 36 . the force measuring device 56 may , for example , include an idler pulley 50 carried on a pivot arm 52 biased toward the y - belt 32 by a tension spring 54 of suitable strength . application of tension to the v - belt 32 by forward rotation of the hand crank 18 moves the pulley 50 and rotates a shaft on which the pivot arm 52 is mounted , thus adjusting a potentiometer , for example , to provide an electrically observable indication of the force exerted through the hand crank 18 . the rate of rotation of the flywheel 12 may be detected by the use of a non - contact pulse generator 58 such as a hall effect device electrically connected in the well known manner to provide an electrically observable signal in response to passage of a magnet 60 with each rotation of the flywheel 12 . the electrical signal information from the force measuring device 56 and the hall effect device 58 are provided as inputs at terminals of the control unit 46 . where necessary the signals will be converted to digital form by appropriate analog - to - digital converters and the resulting digital equivalent will be provided to the microprocessor 48 . the actual total frictional resistance being overcome at any time can be calculated with reasonable accuracy by the microprocessor 48 , on the basis of the coefficient of friction , the tension detected by the strain gauge 45 , and the angular speed of the flywheel 12 as determined using the signals provided by the pulse generator 58 . it will be appreciated that other braking devices such as disc brakes or electromagnetic dynamic brakes might also be used to resist rotation of the cranks 14 and 18 . referring now also to fig2 and 3 , a pair of push - button operated , normally - open , momentary closure switches 66 and 68 are mounted on the crank handle 24 in a position to be pushed conveniently by the thumb of a person exercising using the exercise apparatus 10 , without loosening a grasp on the handle 22 . a pair of slip rings 70 and 72 are provided on an eccentric shaft 74 of the hand crank 18 on which the crank handle 24 is rotatably mounted . a brush 76 connects the switch 66 to the slip ring 72 , and a brush 78 connects the switch 68 to the slip ring 72 . a brush 80 connects the common voltage side of each of the switches 66 and 68 to the slip ring 70 , which is connected electrically with the hand crank 18 , assuming that the hand crank 18 is of a conductive material . an insulated conductor 82 electrically connects the slip ring 72 with a slip ring 84 , both of the slip rings 72 and 84 being electrically insulated from the hand crank 18 . a brush 86 provides an electrical connection between the slip ring 84 and a conductor 88 connected to a terminal 90 of the control unit 46 . a slip ring 92 mounted on the central shaft 85 of the hand crank 18 is connected electrically with the control unit through a brush 94 connected electrically with a terminal 96 of the control unit 46 . alternatively , additional slip rings and brushes could be provided and duplicates of the switches 66 and 68 could be provided on the crank handle 22 , or one of the switches 66 and 68 could be located on each of the crank handles 22 and 24 , although the preferred embodiment is described above . a diode 98 is connected in series between the brush 76 and the switch 66 , while a diode 100 is connected in opposite polarity between the brush set 78 and the switch 68 . an alternating voltage is provided at terminal 90 of the control unit 46 , but the diodes 98 and 100 , respectively , make only pulsating direct current voltage available , with opposite polarities , across the switches 66 and 68 . closing the switch 66 thus provides a complete circuit as to current in one direction through the conductor 88 and back to the control unit 46 at terminal 96 , while closure of the switch 68 permits passage of current in the opposite direction . the microprocessor 48 is programmed appropriately so that current in the first direction , passed when switch 66 is closed , provides an enabling signal to a motor controller 102 connected electrically to the tension adjuster 42 , to increase the amount of tension in the brake band 36 . conversely , closure of the switch 68 , providing an electrical current in the opposite direction to the control unit 46 , produces a response from the microprocessor 48 enabling the motor controller 102 so as to cause the tension adjuster 42 to reduce the tension in the brake band 36 . preferably , the microprocessor 48 is programmed to require either the switch 66 or the switch 68 to be pressed for a predetermined amount of time before the motor controller 102 will cause an adjustment in the tension in the brake band 36 , so that undesired change of the tension in the brake band 36 will not occur in response to electronic noise or inadvertent closure of one of the switches 66 and 68 independently . when both of the switches 66 and 68 are closed simultaneously , a circuit is provided for the alternating current from terminal 90 to pass in both directions through the conductor 88 . the control unit microprocessor is programmed not to adjust the tension in the brake band 36 in response to ac current . a display panel 104 is connected electrically to the control unit 46 by a multi - conductor cable 106 . the display panel 104 includes display devices , for example liquid crystal display units , capable of displaying dot - matrix numerical and alphabetical characters . a multi - digit display field 108 is provided to indicate the total force required to rotate the flywheel 12 against the resistance provided by the frictional contact between the brake band 36 and the flywheel 12 . the microprocessor 48 may be appropriately programmed to provide an indication of force in some arbitrary scale of units bearing a linear relationship to the amount of frictional resistance provided by the brake band 36 , as calculated by the microprocessor 48 . a multi - digit time display field 110 is provided to indicate the amount of time during which exercise has been conducted , once the entire apparatus 10 has been electrically energized . a third numerical display field 112 is used to provide indications of various values computed by the microprocessor 48 in response to inputs to the control unit 46 from various sensors . the descriptive name of each value shown in the numerical display field 112 is shown in a similar electronically generated alphabetical title display field 114 on the display unit 104 to identify the value shown in the display field 112 . the desired individual one of the several possible values to be displayed may be chosen by simultaneously closing both of the switches 66 and 68 to provide an alternating current circuit from terminal 90 to terminal 96 of the control unit 46 . the microprocessor 46 is appropriately programmed to cycle through the list of available data for display , while the appropriate values are also provided by the microprocessor 48 via the cable 106 to the display field 112 , in response to the alternating current provided when both of the switches 66 and 68 are closed . thus , it is possible to indicate and display such information as the total work performed during the exercise , or the user &# 39 ; s heart rate ( made available as an input to the microprocessor 48 by a heart rate sensor 118 of a known type capable of providing an electrical output signal ). similarly , the information available from the strain gauge 45 , the speed indicating pulse generator 58 , and the force detector 56 , together with a time signal generated internally by the microprocessor 48 , may be used to calculate speed , distance , arm output , and leg output data for display in the display field 112 . the terms and expressions which have been employed in the foregoing specification are used therein as terms of description and not of limitation , and there is no intention , in the use of such terms and expressions , of excluding equivalents of the features shown and described or portions thereof , it being recognized that the scope of the invention is defined and limited only by the claims which follow .

US-85771886-A

a quick - release alignment handle system is provided including a quick release alignment handle with an attachable , releasable locking mechanism for attaching the handle to a tibial tray trial component of a surgical instrument system for implanting artificial knees .

referring to fig7 a screw type device of the prior art is illustrated . the handle 100 includes a universal 101 and a thumb screw 102 located on the distal end 103 of the alignment handle 100 . the tray trial 105 comprises a threaded portion 107 and a hole 106 for receiving the universal 101 . in use , the alignment handle ( or tray trial ) is held in one hand while a second hand is used to insert the universal 101 into the hole 106 and screw the thumb screw 102 into the threaded portion 107 . referring now to fig1 - 3 , a quick release system of one embodiment of the present invention is illustrated . the system includes an alignment handle 10 and a tibial tray trial 20 . an alignment handle 10 is illustrated having a handle end 12 and a connecting end 11 . the alignment handle 10 includes a release button 15 slidable in a direction from the connecting end to the handle end , i . e ., posterior to anterior , and visa versa , and spring - biased in an anterior to posterior direction . the button 15 is coupled to a sliding bolt 14 which is captive , i . e ., contained within the alignment handle 10 . the bolt 14 is spring - loaded in a direction from anterior to posterior with spring 39 . the connecting end 11 of the alignment handle 10 comprises an opening 16 arranged to received a mating portion 22 on the tibial tray trial 20 . the connecting end 11 further comprises a mechanical lock portion 17 posterior of said opening 16 , arranged to coupled and lock with the mating portion 22 of the tibial tray trial 20 . the bolt 14 extends to the connecting end 11 , through the opening 16 and through a hole 18 in the mechanical locking portion 17 . when the release button 15 is retracted in a proximal direction , the bolt 14 is retracted to a position anterior of the opening 16 , allowing the opening 16 to receive the mating portion 22 of the trial 20 . the tibial tray trial 20 comprises a plate portion 21 , a mating portion 22 , a rim 23 around the outer circumference of the plate 21 , and a punch guide opening 24 formed in the tibial tray trial plate 21 . the mating portion 22 includes a hole 25 for receiving the bolt 14 of the alignment handle 10 . the plate 21 includes a slot 29 for receiving the mechanical locking portion 17 of the alignment handle 10 . in use , a user controls the attachment and detachment of the alignment handle 10 using the release button 15 . the release button 15 is pulled in an anterior direction which retracts the bolt 14 into the alignment handle 10 . the mechanical locking portion 17 fits into the slot 29 of the trial 20 and the mating portion 22 fits within the opening 16 at the proximal end 11 of the alignment handle 10 . the user may then release the release button 15 and the spring bias of the bolt 14 moves the bolt 14 proximally through the hole 25 in the mating portion 22 and into the hole 18 in the mechanical locking portion 17 at the proximal end 11 of the alignment handle 10 . alignment handle 10 further comprises holes 19 for receiving alignment rods ( not shown ) used to check alignment of the tibial tray with the femur . as described previously , tibial surface is cut so that the tibial tray trial 20 will rest on a flat surface . then ; the tibial tray trial 20 is used as a template to select the appropriate size tibial prosthesis for implantation . the alignment handle 10 is used to manipulate the tray trial . various sizes of tray trials are attached and removed from the alignment handle to select a trial closely matching the tibial plateau . at any time during the procedure the surgeon may use the alignment handle 10 to place the tray trial 20 on or remove it from the tibia . the surgeon may do this with one hand leaving the other hand free . once the size is selected , the trial is placed to rest on the bone . a tibial trial insert ( not shown ) is inserted within the rim 23 of tray trial 20 . the insert is used to determine the tibial implant thickness and provide a surface with which a femoral trial , indicative of the implant , will interact . various trial inserts are tried to select the one of an appropriate thickness . alignment rods may be inserted into the holes 19 and used to check the alignment of the tray 20 with the femoral portion of the implant . the surgeon may then remove the alignment handle , replace the patella portion and check the alignment and movement of the trials . once it has been determined that the trial is appropriately sized and fitted and has been appropriately placed on the tibia , the alignment handle 10 and trial insert are removed . the surgeon will also remove the femoral trial and attach a punch guide to the tray trial . in order to prepare the tibia for the tibial implant , a punch or reaming device is then inserted through a punch guide ( not shown ) which is placed over the punch guide opening 24 . referring now to fig4 - 6 , an alternative embodiment of the present invention is illustrated . the system comprises an alignment handle 110 and a tibial tray trial 120 . the alignment handle 110 is illustrated having a handle end 112 and a connecting end 111 . the alignment handle 110 includes a release button 115 slidable in a direction from the connecting end to the handle end , i . e ., posterior to anterior , and visa versa . the button 115 is coupled to a sliding bolt 114 which is captive , i . e ., contained within the alignment handle 110 . the bolt 114 is spring - loaded in a direction from anterior to posterior with spring 139 . the connecting end 111 of the handle 110 comprises connecting bolts 136 having cylindrical heads 137 on the end of the bolts 136 . the heads 137 have a greater circumference than the circumference of the bolts 136 . the tibial tray trial 120 comprises a plate portion 122 , a rim 124 around the outer circumference of the plate 122 , a mating portion 123 of the rim 124 . the mating portion 123 includes a hole 126 for receiving a sliding bolt 114 of the handle 110 and openings 128 for receiving connecting bolts 136 of the handle 110 . openings 126 , 128 extend through the rim 124 of the mating portion 123 . openings 128 each include a first portion on one transverse side of the opening 128 having a first radius and a second portion on the opposite transverse side having a second radius smaller than the first radius . the bolt 114 extends from the connecting end 111 when the button 115 is extended , and retracts into the handle end 112 when the button 115 is retracted . the bolts 136 are slid into openings 128 , the first radii of the openings 128 being large enough to accommodate the larger circumference of heads 137 of the bolts 136 which , when , inserted into the openings 128 , extend beyond rim 124 . the handle 110 is then moved in a direction towards the second portion of the opening 128 into a locked position . the second radii are too small to permit passage of the larger circumference heads 137 but large enough to receive the smaller circumference bolts 136 . in use , a user controls the attachment and detachment of the handle 110 to the tray trial 120 , using the release button 115 . the release button 115 is pulled in an anterior direction which retracts the bolt 114 into the handle 110 . the heads 137 of the bolts 136 on the distal end 111 of the handle 110 are inserted into openings 128 and moved to the locked position as described above . the bolt 114 is aligned with the opening 126 when the handle 110 is in the second or locked position . thus , when the user releases the release button 131 , the spring 139 causes the bolt 114 to move through the hole 126 in the mating portion 123 . the locked bolt 114 prevents side to side movement of the handle 110 and the heads 137 prevent the bolts 136 from pulling out of holes 128 . the quick - release and locking mechanism of the second embodiment is used in a manner similar to that described above with respect to the first embodiment . although the present invention is described with respect to particular embodiments , and uses , numerous variations or equivalents are possible without taking away from the spirit or the scope of the claimed invention .

US-57674595-A

in a preferred embodiment of the invention , a clamp - on plastic arcuate element of c - shaped cross - section is provided for snapping - onto an upper portion of a tennis racket head frame , and continuous with and fused to substantially opposite ends of the arcuate element is a correspondingly arcuate semi - rigid substantially flexible lever element biased normally to a predetermined position in an open state away from the upper - most part of the tennis racket and arcuate element at a predetermined distance substantially less than a diameter of a tennis ball such that when the arcuate element is mounted on the tennis racket head frame the tennis racket by a person holding the handle thereof may be used as a pick - up device for retrieving tennis balls without any need of bending over or flexing the back , the arcuate base member also defining a substantially c - shaped pair of flanges as a part of an upper - most part of the arcuate element opposite the pick - up lever for anchoring the lever in a recessed lock - down position when in a closed state not in use as a pick - up device .

fig1 through 5 illustrate a common typical embodiment of the present invention , as a tennis racket head - snap - on integral unit 15 including a preshaped typically plastic mounting base 16 shaped to fit the semi - circular shape of the racket head frame at an upper end thereof , and shaped to fit clampingly around the body of the frame by virtue of what in transverse cross - sections of fig2 , and 4 appears as a c - shape . the mounting base 16 includes slits 17a , 17b at one terminal end and 17c , 17d at an opposite terminal end , such that the elongated clamping lever structure 18 may be and is threaded through , downwardly through 17a , and back outwardly to exterior space by virtue of 17b and inwardly through 17d and outwardly through 17c . the element 18 includes a bend at each of 18a and 18b preferably , thereby defining opposite ends 18c and 18d , the end 18c having flanges 18e and 18f of downwardly curved concave arcuate shape ; these bends and shapes are functional , the bends 18a and 18b being such that when the element 18 is not locked into a closed position shown best in fig2 locked between lips 19a and 19b within recess 19c , in the non - locked state the bends cause the central portion of the element 18 to assume an outwardly biased position and state as indicated by 18g in phantom in fig2 . the flange 18e serves to prevent the element 18 from twisting in a counter - clockwise direction in the views of fig1 - 3 which would be clockwise in fig4 view , and flange 18f serves to prevent twisting in a clockwise direction in fig1 - 3 or counter - clockwise direction in fig4 views , respectively . when pressing the element into a locked position of fig2 for the element 18 , there would be a tendency for the element to twist ; by virtue of the flange 18e , the central portion of the element 18 at the locked position of fig2 is thereby spring - biased outwardly , and whenever the central portion of the element 18 is pressed outwardly beyond the non - biased position 18g of fig2 the element being pressed outwardly whenever a tennis ball is wedged between the element 18 and the support base 16 ( mounting base ), the flange 18f causes the central portion of the element 18 to be biased inwardly toward the position 18g of fig2 . the mounting base accordingly mounts the element 18 for movement in directions 20 and also forms recess space 21 into which a tennis racket head &# 39 ; s upper portion may be snapped retainably . fig3 illustrates in cross - sectional transverse view along line 3 -- 3 of fig1 embodiment , the cut - out portion 22a provided for easy insertion of a person &# 39 ; s finger , similarly the position 22b would be for alternate insertion of a finger , such that the central portion of the element 18 may be wedged outwardly from the locked state and position illustrated in each of fig1 and fig2 . fig4 in cross - section transversly along lines 4 -- 4 of fig1 shows the position of the element 18 as it extends between slits 17a and 17b beneath the intermediate strip ( between slits 17a and 17b ) 23 which is a part of the mounting base 16 . in this view , also the flanges 18e and 18f are visible , arced along the outer curved surface of the mounting base 16 . fig5 illustrates the element 18 in an unmounted state , for purposes of better illustrating the overall shape of this lever structure . fig6 illustrates an alternate embodiment which would correspond substantially to that of fig1 through 5 except that the locking lips or flanges of the mounting base are on the upper - most surface defining recess 24 into which is locked an element 18 &# 39 ; which may be unlocked to flip outwardly in either direction of the racket upper frame and the mounting base ; the flanges would be altered such that opposite flanges would bias the element 18 &# 39 ; toward the central locked position shown in this as shown in fig6 for the mounting base 16 &# 39 ; defining the snap - in recess 21 &# 39 ; for receiving the upper end portion of a tennis racket head frame . fig7 a , and 7 and 8 and 9 and 9a all illustrate varying views of a common embodiment , fig7 a being an in - part view as taken along lines 7a -- 7a , fig8 an in - part top - cross - sectional view along lines 8 -- 8 , and fig9 a a transverse in - part cross - sectional and in - part elevation axial view along lines 9a -- 9a , for the embodiment shown in elevation plan side view in fig7 . in this embodiment of the invention , the pick - up mechanism is mounted on , integral with the frame - handle structure itself , pivoting in the same upward direction as for the fig1 embodiment . accordingly there is disclosed a tennis racket head frame structure 25a , neck structure 25b , elongated handle - lever structure 25c , and the terminal end handle structure 25d , with regard to different integral portions of the overall tennis racket structure . further is the handle total general structure 25e shown best in fig7 and 8 , as it would appear in a typical embodiment thereof . lever shaft 26 extends through a channel in the neck structure 25b , the handle - lever structure 25c , terminal end handle structure 25d , into a female gear recess of total general structure 25e at one end of the shaft , and into the clamping structure element 28 -- recess of the neck structure 25b at the other opposite end of the shaft 26 . at the handle end , male gear of bevel - shape and annular shape is mounted around the end of the shaft 26 such that gear teeth thereof are engageable with female gear teeth 39 of the total general structure 25e when the total general structure 25e is moved in a slipping manner axially in direction 42 such that gears ( gear teeth ) engage after the wedge - angled portions 37 are forceably slipped from a wedged pushed - in position on the typically plastic ( semi - resilient , for example ) such as teflon , as shown in the wedged non - engaged gear position in fig8 . the stepped abuttment face 35 spaced from the stepped abuttment face 36 becomes engaged when the total general structure 25e is forceably moved in direction 42 thereby preventing the total general structure 25e from slipping beyond and possibly off - of the central channel structure around which it is mounted . the plastic member 38 preferably is annular , extending around and mounted on the racket terminal end handle structure 25d , within a notched - out recess . the pin 41 typically centers the gear 40 , and the teeth 39 are angularly inclined to mesh with the beveled gear teeth of gear 40 preferably . the shaft 26 as shown in fig7 and 9a has an eccentric seating and wedge disk 27 mounted thereon with the lever structure 28 mounted within recess 37 of fig7 a and such that the lever structure 28 is always biased downwardly against the surface of the disk 27 as shown in fig9 and 9a . for fig9 a , and with reference to fig8 when the fig8 total general structure 25e is pulled axially outwardly to engage the gear teeth discussed above , and thereafter is rotated such that the disk as viewed in fig9 a moves in a clockwise direction as shown by the arrow of that fig9 a , with the result that the lever structure 28 is pressed upwardly to the fig9 illustrated position with the element lever structure 28 resting in a stable seated position at which the lever structure will remain open in the position shown in phantom in fig7 until thereafter the total general structure is rotated in an opposite direction back to the position shown in fig9 a by rotation of the disk in the direction as illustrated in fig9 . for the different embodiment of fig9 b , 10 , 11 and 12 , the racket neck 25b &# 39 ; and handle - lever structure , and channel therethrough and the shaft 26 &# 39 ; substantially correspond to the preceeding embodiment , except having , in elevation plan view , push - button 25e &# 39 ; for rotation of the shaft 26 &# 39 ; by pushing downwardly on the push - button 25e &# 39 ; as with thumb pressure , for example , such that the lever structure 31 &# 39 ; is movable upward in the direction shown from its downwardly biased position of fig9 b as the mounted disk 27 &# 39 ; becomes rotated counter - clockwise as viewed in fig9 b , against biasing action of spring ( spiral ) element 32 &# 39 ; mounted at one end in disk aperture 33 and at an opposite end in recess 34 of the neck structure 25b &# 39 ;, the lever structure 31 &# 39 ; being mounted within a outer circumscribing surface aperture of the disk 27 &# 39 ;. in a preferred embodiment of this particular racket embodiment of the invention , the side - wardly opening lever structure as shown best in fig1 and 11 , is seated within a recess seat 30 , and fig1 illustrates in phantom the ball 30 &# 39 ; wedged between the seat 30 and the outwardly - forced lever structure positioned as position 31 &# 34 ;, thus movable in directions 46 , but biased in direction 47 . preferably the lever structure is wedge locked ( detachably ) by wedge element 43 typically , such that finger pressure on lever push - button 25e &# 39 ; forceably lifts the lever structure to the 31 &# 34 ; position and state for receipt wedgeably of a tennis ball 30 &# 39 ;. the lever structure 31 &# 39 ; is mounted on the disk 27 &# 39 ; within the recess 32 &# 39 ; of the neck structure 25b &# 39 ;. fig1 , 13a , and 13b illustrate an alternate embodiment to but substantially the same as that of fig1 in which the mounting structure 16 &# 34 ; is preformed with a recess groove formed by gradually heightened side projections or lips as shown in the fig1 a illustration as lips 19b &# 39 ; and 19a &# 39 ; defining seat 19c &# 39 ; for element 18 &# 34 ; and snap - in recess 21 &# 34 ;, with the element 18 &# 34 ; being integrally fused at each of opposite ends to the mounting structure 16 &# 34 ; at fusion points such as fusion point 48 , movable in the direction indicated by the arrow to the phantom illustrated position , and as shown in fig1 b locks between the high lips ( at that position ) 19b &# 39 ; and 19a &# 39 ;, with the aperture 22 being preferably ( as shown ) adjacent the locking flanges thereby making the finger - unlocking of the element 18 &# 34 ; easier -- less force being required at this point since there would be no opportunity for the element 18 &# 39 ; to bend before unlocking from its wedged position . fig1 illustrates an alternate embodiment to that of fig1 and 13 , differing only basically in that the lever structure 18 &# 39 ;&# 34 ; includes a fused portion 49 fusing with the mounting base 16 &# 39 ;&# 34 ; which forms a snap - on recess 21 &# 39 ;&# 34 ;, such that the lever structure 18 &# 39 ;&# 34 ; is always biased toward a predetermined position and state as might be desired , there being not shown locking structure which is optional as in the other embodiments . however , locking structure is desired normally to prevent the possibility of the lever structure from becoming opened in its state of being , during tennis play of a game , such that the playing of the game would be interfered with . it is within the scope of the present invention to make such variations and modifications and substitution of equivalents as would be apparent to a person of ordinary skill .

US-58539575-A

a method of treating a body fluid which is to be infused so as to inactivate any enveloped viruses in said fluid comprises mixing the body fluid with an effective amount of a photosensitizing agent which will bind to the viruses and / or virus infected cells and photosensitize them , and then exposing the resulting mixture to visible light to excite and inactivate the viruses . an apparatus for use in the method includes at least one container which contains an effective amount of the photosensitizing agent and which has at least one wall which is permeable to visible light . a number of photosensitizing agents which can be used in the method also are disclosed .

in fig1 herein a schematic diagram is shown of a system 10 for use with the method of the present invention . it is the system of u . s . pat . no . 4 , 321 , 919 , supra . as shown schematically in fig1 blood may initially be withdrawn from the human subject , as at 11 . typically the blood is withdrawn via a donor needle , which may be placed in the right antecubital vein . in the system 10 of fig1 it is assumed that the processing of blood is conducted on a continuous basis from 11 to a final return of the blood to the subject at 12 . the return at 12 is via a recipient needle positioned in the left antecubital vein . where the method is continuous a typical blood flow is in range of from about 10 to 75 ml / min . with a preferred range being from about 40 to 50 ml / min . the desired flow rates are produced by a pump 13 , which is positioned in the extracorporeal blood flow stream generally indicated as 14 . anti - coagulants are preferably injected into the extracorporeal blood flow stream at 15 , close to the point of blood withdrawal . such anti - coagulants can comprise solutions of acid , citrate and dextrose and / or heparin , or of other known anti - coagulant compositions . an occluded vein sensor 16 is preferably provided in stream 14 to prevent or inhibit the generation or continued existence of bubbles in the blood flow stream . in the preferred mode of practicing the continuous mode of the method of the present invention , the photosensitizing agent is added to the blood after it leaves the human . thus , as shown in the system 10 of fig1 the agent may be added to the flowing blood downstream of pump 13 , and just upstream of where the blood enters the irradiation station 17 . the photosensitizing agent is usually first dissolved in an isotonic solution , which thereafter is directly injected into the flowing blood stream , as at 18 . the agent is injected at a rate which takes into account the blood flow rate and achieves a concentration of the agent in the blood in the desired range as the blood passes through the irradiation station 17 . it will be appreciated that the photosensitizing agent may not need to be directly introduced by injection into the extracorporeal blood stream 14 . it also might be possible to obtain the desired concentration of the agent by orally or otherwise administering the compound directly to the patient . alternate modes of administration of the photosensitizing agents are within the scope of this invention and the doses appropriate therefor will be apparent to those skilled in the art . the introduction of the photosensitizing agents to the extracorporeal stream is preferred because it makes it possible to achieve more exact concentration levels ; and to avoid or minimize possible side effects and the like , which can occur from administration of any drug directly to the body system . at irradiation station 17 , which consists of an irradiation chamber 19 and radiation source 20 , the blood containing the desired concentration of dissolved photosensitizing agent , is subjected to visible light and preferably visible light having the bulk of its spectral components in the preferred orange to green range for the activation of the particular photosensitive agent being employed in the treatment being conducted . the irradiation station 19 is constructed so as not to block radiation in the desired portion of the visible light spectrum and to present the body fluid from being overheated and damaged . in fig2 a schematic view appears of an irradiation station 17 of a type suitable for use with the invention . the preferred station 17 consists of a blood treatment or irradiation chamber 19 , having an inlet 21 and an outlet 22 , enabling blood flow through the chamber , and a spaced source 20 of visible light . the chamber 19 can take various forms , with the principal requirement that it have at least one wall 23 which is substantially transparent to visible light . the chamber ( or at least wall 23 ) therefore can be comprised of various substantially visible light transparent plastics , such as polyvinyl chloride and the like . in the irradiation chamber 19 , the body fluid to be treated flows through a flow passage which is of relatively thin cross - section e . g ., about 2 mm thick . the total surface area of the flow passage in the chamber 19 is calculated to provide the blood contained therein with the desired radiation dose level from the visible light source 20 . especially preferred is an apparatus consisting of a plurality of fluorescent tubes with concentric jackets spaced from the tubes to form the flow passages for the body fluid to be irradiated . the visible light source can comprise commercially available lamps , numerous types of which are known in the art . by way of example , source 20 can comprise a single incandescent or fluorescent lamp or multiple lamps which preferably emit visible light in the orange to green spectrum , i . e ., between about 5000 to about 6500 angstroms , which is preferred when a merocyanine dye is the photosensitizing agent being employed in the method of the invention . with the continuous flow rates utilized in accordance with one aspect of the invention , such a source will provide the desired amount of absorbed energy in the flowing blood for practicing the method of the invention . the blood flow from irradiation station 17 proceeds as shown in fig1 via outlet 22 back to the subject at 12 . optionally , however , prior to returning the treated blood to the patient , it may be heat exchanged so as to adjust its temperature to that of the patient &# 39 ; s circulating blood . heat exchange may be necessary whenever the treated blood , by consequences of its treatment , has attained a temperature substantially at variance with that of the patient . regardless of which photosensitizing agent is employed in the invention or at what rate it is administered the burden placed upon the body &# 39 ; s organ system can be further alleviated , by utilizing in conjunction with the present system , a continuous centrifuge ( or other filtration system ), which device can be used to separate photosensitizing agents . the preferred embodiment of the apparatus of the invention which is used when whole blood is collected , treated to inactivate viruses and stored to be later administered to the donor or another human is shown in fig3 and 4 . the apparatus as seen in fig3 comprises a first container 24 , which is provided with collection tubing 25 and a needle 26 ; an irradiation chamber 27 comprising a flat , plastic envelope 28 with a continuous flow passage 30 ; a storage container 31 ; and tubing 32 which connects the first container 24 , the irradiation chamber 27 and the storage container 31 into a closed system . the body fluid can be transferred from the container 24 to the irradiation chamber 27 where it is exposed to visible light and maintained at a safe temperature e . g ., by a water bath . it is then transferred to the storage container 31 . the body fluid can be transferred through the system by squeezing the first container 24 and / or by use of a tubing pump ( not shown ). alternatively , the novel apparatus may take the form of a single container , containing the photosensitizing agent , in which the body fluid can be collected , treated with visible light and stored . in the apparatus of fig3 an effective amount of anticoagulant liquid 33 containing the photosensitizing agent represented by dots 34 is already in the first container 24 . of course , the agent 34 may be added to the apparatus at any time prior to treatment of the blood or blood products with the visible light . the apparatus and its contents are preferably agitated to bring the agent into contact with the viruses in the body fluids before treating the mixture with visible light to inactivate the viruses . if the body fluid is blood it can then be divided into its various components either before or after addition of the photosensitizing agent and / or exposure to visible light . any excess photosensitizing agent can , if desired , be removed any time after the light exposure by conventional means . in those embodiments of the inventions in which the product containing the viruses to be inactivated is not blood collected directly from a donor , the photosensitizing agent may be added to the product immediately prior to light exposure . for example , when the product is a cell - free blood product , it is first dissolved or suspended in an aqueous medium ; when the product is blood cells they are first suspended in a physiological medium and when the product is bone marrow or blood cells , it is preferred to suspend it in deuterium oxide ( d 2 o ) because the presence of d 2 o shortens the illumination time required , presumably by extending the half life of singlet oxygen . the photosensitizing agent is then added to the solution or suspension and the resulting mixture stirred or otherwise agitated to bring the agent into contact with the viruses or virus infected cells . the mixture is then exposed to visible light of a suitable wavelength . in an aqueous environment the preferred excitation spectrum peaks are at 510 and 535 nm and in an organic phase , the spectrum is redshifted to 565 nm . after completion of the photosensitization step the excess agent may be separated by centrifugation . if desired , undesired components such as plasma proteins , can be separated from the mixture by precipitation with solvents or salt , solvent extractions , or by chromatographic means . representative of the specific agents that can be used are the following : ## str2 ## the photosensitizing agent is employed in an amount which is effective under the conditions of use to accomplish the inactivation of the viruses which may be present . some of the agents , of course , are more active than others and can be used in smaller amounts . the toxicity of the preferred merocyanine dyes is very low . therefore , it is not essential that they be completely removed from the treated body fluid , blood , blood product or bone marrow before administration to a patient . the merocyanine , mc 540 , is normally used with light of suitable wavelength n an amount of about 10 micrograms to about 25 micrograms per milliliter of body fluid and a more active merocyanine derivative , mc 540a , is used in an amount of about 5 micrograms to about 10 micrograms per milliliter under comparable conditions . the effective wavelengths of visible light that can be used vary greatly ; however , it is generally desired that the light be of a wavelength in the green to orange range when the agent is a merocyanine dye . it appears that blue light and dark red light is not particularly effective with the preferred merocyanine dyes . ( 1 ) suspensions of friend virus , friend virus - transformed cells , herpes simplex , cytomegalovirus , htlv - i and htlv - i infected cells are rapidly inactivated by mc 540 - mediated photosensitization . ( 2 ) the same treatment protocol does not affect mature blood cells and normal pluripotent hematopoietic stem cells in mouse and man . ( 3 ) photosensitized plasma clots normally , suggesting that at least some clotting factors are still intact . ( 4 ) the small amounts of dye that are transferred with photosensitized bone marrow cells are not toxic to mice ( i . e ., about 100 , 000 times less than the ld 10 of the compound in mice ). the simultaneous exposure to mc 540 or mc 540a and visible light kills human and murine leukemia , lymphoma , and neuroblastoma cells very rapidly , but normal pluripotent hematopoietic stem cells and mature blood cells very slowly . this differential sensitivity to mc 540 - mediated photolysis can be used to purge simulated autologous remission marrow grafts ( mixtures of normal marrow cells and tumor cells ) of residual tumor cells . these findings have obvious implications for the treatment of patients with leukemia or disseminated solid tumors . such patients could benefit from a treatment regimen that combines very intensive ( i . e ., marrow - ablative ) chemo - and / or radiotherapy with a bone marrow transplant . ( the very intensive chemo - or radiotherapy has a better chance of eradicating the tumor . the bone marrow transplant rescues the patient from this otherwise lethal therapy .) however , most patients are currently ineligible for this therapeutic modality because they lack compatible marrow donors or because their age predisposes them to develop severe forms of graft - versus - host disease even if the marrow graft originated from an hla - identical allogeneic donor . autotransplantation of the patient &# 39 ; s own cryopreserved remission marrow obviates the need for matched donors and virtually eliminates graft - versus - host reactions . however , autotransplantation of remission marrow carries a significant risk of reinfusing occult tumor cells unless the tumor cells are removed or killed by a suitable extracorporeal purging procedure . based on knowledge acquired about the molecular mechanisms that control a cell &# 39 ; s affinity for mc 540 , we hypothesized that mc 540 should also react with enveloped ( i . e ., lipid - containing ) viruses . we tested this hypothesis with a transplantable mouse leukemia virus ( the friend erythroleukemia virus complex ), the human t cell leukemia virus , htlv - i , herpes simplex 1 and cytomegalovirus . friend virus was obtained from cell - free supernatants of cultured erythroleukemia cells or as a cell - free extract of spleen or bone marrow cells from infected animals . simultaneous exposure to mc 540 ( 15 ug / ml ) and light ( 40 j / cm 2 ) reduced the virus titer by ≧ 4 logs regardless of the origin of the virus preparation . animals that were injected with photosensitized virus preparations developed neither splenomegaly nor polycythemia , nor leukemia . virus - infected spleen cells , bone marrow cells , and cultured friend erythroleukemia cells were inactivated at about the same rate as cell - free virus preparations . by contrast , bone marrow grafts that were subjected to the same treatment with mc 540 and light were still capable of rescuing lethally irradiated recipients . htlv - i was also susceptible to mc 540 - mediated photosensitization . the amount of virus that could be sedimented by centrifugation was reduced 5 - fold after treatment with mc 540 and light . the remaining 80 % of the virus were probably lysed . the small fraction that was sedimented was visibly stained by mc 540 . it is conceivable that the sedimented virus fraction , although not lysed , had sustained enough photodynamic damages to make it noninfectious . for example , when the virus is herpes simplex 1 the order of magnitude reduction may be as high as 90 . an analog of mc 540 which we have labeled mc 540b ( see structural formula below ) reduces illumination times about 6 - fold when used in equimolar concentrations . ## str3 ## merocyanine - mediated photolysis of tumor cells and viruses appears to be primarily mediated by singlet oxygen . an additional 2 - fold reduction in illumination time can therefore be achieved by performing the photosensitization step in the presence of deuterium oxide ( d 2 o ). unlike heat or high doses of ionizing irradiation , mc 540 - mediated photolysis is more selective in its toxicity . most mature leukocytes and primitive hematopoietic progenitor cells are highly resistant to mc 540 - mediated photolysis and the ability of plasma to clot is not impaired . dye mediated photosensitization may be the preferred antiviral treatment in situations where critical components are temperature or radiation sensitive . the acute systemic toxicity of mc 540 is low . the amount of dye that is injected with a typical mouse bone marrow graft is more than 100 , 000 times less than the ld 10 in the same species . when cultured f4 - 6 erythroleukemia cells , spleen or marrow cells from diseased animals , cell - free extracts of cultured cells , spleen cells , or marrow cells , or cell - free supernatants of f - 6 cultures were injected into healthy b6d2f1 mice , the spleen weights increased from 70 mg to about 2 g within two weeks . the animals became polycythemic and , eventually , died . when cell suspensions , cell - free extracts , or culture supernatants were photosensitized and exposed to light prior to injection , spleen weights remained normal , hematocrits remained normal , and the animals survived . normal pluripotent hematopoietic stem cells ( as determined by the ability of photosensitized marrow cells to rescue lethally irradiated syngeneic hosts ) were spared by the photosensitization treatment . virus preparations that were exposed to dye or light alone caused splenomegaly , polycythemia , and death . a series of experiments thus showed that mc 540 - mediated photolysis inactivates cell - free friend virus , intracellular friend virus , and friend virus - infected cells . experiments with human herpes simplex virus type 1 ( hsv - 1 ), and human t - cell leukemia virus type i ( htlv - i ) produced similar results . herpes simplex - 1 was extremely susceptible to mc 540 mediated photolysis . a limiting dilution plaque forming assay on vero cells indicated a ≧ 5 log reduction ( limit of detection ) of the virus titer after only 5 min . of illumination . the standard illumination protocol calls for 90 min . of illumination . it is thus conceivable that we can reduce the titer by 90 log . with human cytomegalovirus we observed a more than 7 log reduction in 15 minutes . infectivity assays for htlv - i have , unfortunately , not yet been developed . we therefore used reverse transcriptase activity as an indicator of virus destruction . photosensitized and untreated aliquots of the same virus suspension were pelleted on a sucrose cushion . the pellet of the treated aliquot was about 5 times smaller and visibly red . its reverse transcriptase content was reduced by more than 80 % ( table 1 ). the balance of the enzyme activity was recovered in the supernatant . more than 80 % of the original virus mass was apparently damaged so extensively ( virtually &# 34 ; dissolved &# 34 ;) that it was no longer pelletable by a two hour spin at 100 , 000 × g . if the photosensitization of enveloped viruses bears any resemblance to the photosensitization of cells , it is reasonable to speculate that the pelletable material was also photodamaged and perhaps no longer infective . table 1______________________________________htlv - i , reverse transcriptase activity______________________________________ ( 1 ) no dye , no light 194 , 268 cpm ( 2 ) mc 540 , no light 208 , 548 cpm ( 3 ) no dye , light 90 min 158 , 016 cpm ( 4 ) mc 540 , light 90 min 37 , 848 cpm______________________________________ the acute systemic toxicity of mc 540 was determined by injecting groups of 10 baf1 mice intravenously with graded scale and fitted with a least square regression line to determine ld 10 and ld 50 ( table 2 ). it should be pointed out that mc 540 is not more toxic than the fluorescent dyes that are commonly used for the angiography of the retina . necropsies showed that the probable cause of death after high doses of mc 540 was the formation of large emboli of precipitated dye in major blood vessel ( i . e ., we killed the mice by exceeding the solubility of the dye in plasma ). table 2______________________________________acute toxicity of mc 540______________________________________ld . sub . 10 ( mouse ) 55 mg / kgld . sub . 50 ( mouse ) 84 mg / kginjected with photosensitized marrow graft 0 . 0004 mg / kgfor comparisonld . sub . 50 ( mouse ) fluorescein 300 mg / kgld . sub . 50 ( mouse ) indocyanine green 70 mg / kg______________________________________ red blood cells ( concentration 1 . 2 × 10 9 / ml ) containing herpes simplex - 1 and 15 ug / ml of mc 540 and 25 ug / ml of mc 540 , respectively , were exposed to visible light from an illumination cell ( 15 mm ). after 15 minutes of mc 540 mediated photosensitization no live virus was detected in the mixture containing 25 mg / ml of mc 540 . similar results were noted after 70 minutes in the mixture containing 15 ug / ml of the mc 540 . it will be readily understood by those skilled in the art that the foregoing description has been for purposes of illustration only and that a number of changes may be made without departing from the scope of the invention . for example , the containers of the novel apparatus may take a wide variety of shapes and forms . in addition to being shaped like conventional blood bags , they can also be elongated tubes or other shapes . further , the agent need not be physically in the containers as long as it can be added thereto before or after the addition of the body fluid , preferably without opening the system to the outside . therefore , it is intended that the invention not be limited except by the claims .

US-2415087-A

an arrangement for belts used in flag - tag games includes a new and improved belt buckle which allows for convenient adjustment of belt lengths , as well as a secure and easily adjustable coupling of the two ends of the belt . this is accomplished by providing the belt buckle with an arrangement of slots and struts around which the belt is looped and through which the belt is trained so as to frictionally retain the belt on the buckle while determining the length of the belt . in order to attach the flags to the belt , two suction cup embodiments are employed in which the first fitting having a suction cup with an outward opening is received within a second fitting having a suction cup with an outward opening . in order to facilitate the reliable coupling , one of the cups has a vent so that air is expelled when the cups are coupled . another embodiment of a coupling for attaching a flag to the belt utilizes a flag with an enlarged end portion which is forced through a rigid loop on the belt when pulled to detach the flag from the belt .

referring now to fig1 there is shown a first embodiment of a belt 10 , in accordance with the present invention , which is used in play flag tag games wherein at least one flag 12 is detachably mounted to the belt by a coupling 16 . the belt 10 has an elongated web portion 20 having a first end portion 22 and a second end portion 24 , which are joined by a buckle 26 . the belt 10 is preferably made of a plastic material such as polyethylene terafilate , reinforced polyvinyl chloride ( pvc ) or vinyl resins including pvc . in the embodiment of fig1 - 5 , the belt has four ribs 27 extending along the outside surface 28 thereof with the inside surface 29 being smooth . referring now mainly to fig2 - 5 , the buckle 26 includes a first end 30 and a second 31 joined by a middle section 32 . the belt buckle 26 has a first slot 35 , a second slot 36 , a third slot 37 , a fourth slot 38 , a fifth slot 39 , a sixth slot 40 and a seventh slot 41 . separating the slots 35 - 41 are first strut 42 , second strut 43 , third strut 44 , a fourth strut 45 and a fifth strut 46 . adjacent the first end 30 of the buckle 26 , there is a land 55 and adjacent the second end 31 there is a land 56 which has a hole 57 therethrough for hanging the belt 10 on a wall hook , or the like . a central land 58 is disposed between the slots 35 and 36 and has a stud 59 projecting therefrom which has a head 60 . the head 60 is used to secure the end 24 of the belt 10 to the first land 60 by passing through an aperture 62 in the first end of the belt . a rim 64 extends around the periphery of the belt buckle 26 . as is seen in fig3 and 5 , the end 24 of the belt 10 is passed through the first slot 35 either prior to or after anchoring the end with the belt with the head 60 of the stud 59 . the end 22 of the belt is then attached to the belt buckle 26 . this is done so that a substantial length of the belt 10 may be accumulated on the belt buckle 26 , if the length of the belt is such that in order for it to fit on the player , the free end 22 of the belt will dangle loosely from the buckle . in order to accumulate a substantial portion of the belt &# 39 ; s length on the buckle , it is threaded back and forth through the buckle as is seen in fig5 . as is seen in fig4 the free end 22 of the belt 10 is initially threaded through the second slot 36 , passed over the head 60 of the stud 59 . depending on the waist size of the wearer , the end 22 of the belt 10 may then be passed out through the seventh slot 41 or may be passed through the second slot 37 . the belt 10 can then loop around the strut 45 , passed through the third slot 38 and then over itelf and through the fourth slot 39 . if there is still excessive length in the belt 10 , the belt can then be looped around the strut 44 and passed through the fifth slot 40 before again being passed over itself and inserted through the sixth slot 41 in the belt buckle 26 . consequently , the belt buckle 26 can accumulate about one foot of belt length thereon and thus keep the end 22 of the belt from dangling if the player has a relatively narrow waist . for larger players , the belt need not be threaded through all of the slots and the end of the belt can rather be inserted through a loop or other fitting such as the bracket 70 shown in fig1 which has a couple of inwardly projecting pins 71 an 72 beneath which the free end 22 of the belt can be retained . by having the belt buckle retained to the end 24 on the middle land 58 by the stud with the head 60 , the buckle 26 can be pivoted adjacent its ends 30 and 31 so as to alternatively expose the back side of the buckle in order to facilitate ease of inserting the belt 10 through the slots 36 - 41 . referring now to fig6 - 9 , there is shown a first embodiment of a suction coupling 100 for coupling at least one of the flags 12 to the belt 10 . the suction coupling 100 includes a slider support 102 which receives the web 20 of the belt 10 through a slot 104 . the slot 104 has a sufficient width to receive a relatively thick , one inch width belt or a relatively thin but wider belt , which extra width is accommodated by the bends 106 and 108 in the slot 104 . projecting at an oblique angle ∝ with respect to the slider support 102 is a first suction cup 110 which is unitary with and molded from the same material as the slider support . by orienting the opening 112 of the suction cup 110 outwardly or away from the slider support 102 , the expense of making the coupling , which is attached to the belt 10 , is greatly reduced . this is because there is no need to weld the cup 110 to the slider 102 , which was necessary in the prior art suction cup couplings . the suction cup 110 has a cylindrical side wall 114 which is relatively thin and a base 116 . the cup 110 and mounting slider 102 form a first portion of the suction coupling 100 . the second portion of the suction coupling 100 is the attachment comprised of a suction cup 120 and a flag attachment buckle 122 which is attached to the suction cup 120 by a stem 124 . suction cup 120 has a cylindrical wall 126 which is relatively flexible base 128 . as is seen in fig8 the suction cup 120 has an outer diameter d 1 which complements the inner diameter d 2 of the suction cup 110 . consequently , the suction cup 120 is snugly received within the suction cup 110 . in order to facilitate easy insertion of the suction cup 120 into the suction cup 110 , an air hole 130 is formed in one or both of the bases 128 or 116 , of the suction cups 120 and 110 . when the suction cups are inserted and pressed together , air trapped within the confines thereof vents through the air hole 130 as the suction cups are axially slid together . when the suction cups are pulled apart by yanking on one of the flags 12 or 14 attached to the buckle 122 , there is audible report or “ pop ” as the suction cup 120 rapidly disengages from the suction cup 110 . as is seen in fig7 in order to enhance the pop , the buckle 122 is also offset at an angle θ from the suction cup 120 . this increases friction between the walls 126 and 114 when the 12 flag attached to the buckle 122 is yanked , thus increasing the force and , therefore , the loudness of the sonic pop . further to this point , by having the flag attachment buckle 122 offset by both angle θ and angle α with respect to the slider support 102 , the flag 12 extends at a double oblique angle with respect to the belt which results in a louder “ pop ” when the suction cups 110 and 120 separate . when the slider support 102 is on the belt 10 as is shown in fig1 with the slots 136 and 138 of the attachment buckle 102 extending at 90 ° as is seen when comparing fig6 and 7 , there are twisting and bending forces on the suction coupling 16 which result in an increased separation force and in the louder “ pop .” referring now to fig9 there is shown suction coupling 100 ′ in accordance with a second embodiment of the couplings 16 attaching the flags 12 to the belt 10 . the second suction coupling 110 ′ is substantially identical to the first suction coupling 100 , but includes a projection 152 in the suction cup 110 ′ which is received in a socket 154 in the suction cup 120 ′. referring now to fig1 , there is shown a second embodiment of the invention which uses a belt wherein at least one flag 212 or 214 is detachably mounted thereon by a suction coupling 216 or optionally , by a second type of coupling 218 to be further discussed hereinafter . the belt 210 has an elongated web portion 220 having the first end free end portion 222 and a second end portion 224 which are joined by a buckle 226 . the belt 210 is preferably made of a plastic material such as polyethylene terephthalate , reinforced polyvinyl chloride ( pvc ), or vinyl resins including pvc . referring now to fig1 and 12 , where the front and back views of the buckle 226 are shown . the buckle includes a first end 228 and a second end 230 joined by a mid - section 232 . a pair of slots 234 and 236 are disposed proximate the first end 228 and are separated by an intermediate strut 238 . an open slot 240 is positioned outboard the pair of slots 234 and 236 and is separated therefrom by a strut 242 . the open slot 240 has its ends defined by lips 244 and 246 , which define recesses 248 and 250 therebehind and are spaced by an opening 252 . at its second end 230 , the buckle 226 has a single slot 256 which is separated from an end slot 258 by a strut 260 . the single slot 256 has a pair of teeth 262 therein with rounded ends which oppose a pair of indentations 264 in the strut 260 . the second open slot 258 is similar to the first open slot 240 in that it has lips 266 and 268 that are separated by a space 270 and which define recesses 272 and 274 thereunder . as is seen in fig1 , the buckle 226 has a row of conical projections 276 thereon which are pointed for engagement with the web 20 ( fig1 ) of the belt 210 . the buckle 226 also has an aperture 278 therethrough which receives a hook ( not shown ) for hanging the belt 220 . referring now to fig1 , it is seen that the first end of the belt 210 is formed into a loop 280 by inserting the tapered leading edge 282 of the second free end 224 of the belt through a slit 284 adjacent the tapered free edge 286 of first end 222 . the loop is formed around the strut 238 with the web 220 of the belt passing through the slots 234 and 236 . by adjusting the length of the loop 280 so as to accumulate either more or less of the web 220 of the belt 210 , the length of the belt is selected . in order to attach the second end 224 of the belt 210 to buckle 226 , second end 282 is first passed through the single slot 256 at the second end 230 of the buckle from the underneath or backside of the buckle . the leading edge 282 of the web 220 is then passed through the slot 236 of the pair of slots 234 and 236 from the front side of the buckle over the loop 280 . the web 220 is then inserted in the open slot 252 at the first end 228 of the buckle 226 and then passed back over belt portion 288 and the mid - portion 232 buckle and inserted through the second open slot 258 at the second end 230 of the buckle . if there is substantial length of the second end portion 224 , it is simply tucked behind the web 220 of the belt . when the web 220 of the belt 210 is inserted through the single slot 256 and pulled so as to be slightly tensioned about the wearer &# 39 ; s waist , the frustoconical projections 276 on the rear face of the buckle 226 bite into the web to help restrain the web . the portion of the web 288 formed when the end 224 is passed through the slot 236 is tensioned when the second end 224 is pulled tight . this causes the teeth 262 to press into the web 220 and firmly fix the length of the belt 210 . the end 224 is then passed through the open slot 40 and again pulled tight to flatten the belt portion 288 , as is shown in fig1 . finally , the end portion 224 is folded over the portion 288 and passed through the second open slot 258 and tensioned . if the end portion 224 is excessively long , then it can be tucked beneath the web 220 of the belt 210 . referring now to fig1 - 18 , there is shown a second embodiment of structure for attaching the flags 312 to the belt 210 , which is considerably less expensive than the embodiments of fig6 - 9 . in this embodiment , a buckle 360 having slots 362 and 364 therein for receiving the web 320 of the belt 210 has a relatively rigid loop 366 . the relatively rigid loop 366 has a selected fixed diameter d 4 which is less than the width d 5 of the flag 312 . the flag 312 has a tapered leading edge 370 which is passed through the loop 366 to attach the flag 312 to the belt 210 . the flag 312 has a trailing end 372 which includes a tapered trailing edge 374 having a pair of slits 376 which extend laterally inward from the edges of the flag 312 . behind the slits 376 is a slot 378 in the flag 312 through which the tapered trailing edge 374 is inserted so that the slits hold this trailing end 372 in a loop 379 . as is seen in fig1 , the trailing end 372 of the flag 312 is enlarged by the loop 379 in order to hold the flag in the loop 366 of the buckle 360 . as is seen in fig1 and 16 , the flag 312 is pulled through the loop 366 of the buckle until the loop 379 of the flag engages the loop 366 of the buckle . as is seen in fig1 , when tension is applied to the flag 212 , the enlarged portion formed by the loop 379 is squeezed so as to slide through the loop 366 and free the flag 212 from the belt 210 . while this approach does not provide for the “ pop ” of the suction coupling of fig6 - 9 , it does provide a relatively inexpensive flag - tag arrangement . from the foregoing description , one skilled in the art can easily ascertain the essential characteristics of this invention and , without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions .

US-22383398-A

a tobacco composition includes a tobacco extract and an edible carrier . the composition allows tobacco to be enjoyed orally .

the composition can vary , but includes ( i ) some form of tobacco or source of components characteristic of tobacco ( hereinafter referred to as a &# 34 ; tobacco component &# 34 ;), and ( ii ) a carrier for holding the tobacco component in order to allow the tobacco component to be inserted to the mouth of a human being . in particular , the composition is most preferably an aqueous extract of tobacco . the tobacco component can vary . the tobacco component can include finely divided tobacco material ( i . e ., tobacco powder or fines , particularly from tobacco laminae ). the tobacco component most preferably includes a tobacco extract ( e . g ., tobacco components extracted from a tobacco material using a solvent such as water ). if desired , combinations of various forms of tobacco ( e . g ., a mixture of finely divided tobacco laminae and a spray dried tobacco extract ) can be employed . if desired , the tobacco component can be in a highly processed form ( e . g ., the tobacco components can be heat treated , or subjected to reaction conditions in the presence of sugars and / or amino acids ). the tobacco preferably is entirely in the form of an extract , and most preferably in the form of a tobacco extract having a relatively high water solubility . as such , water soluble tobacco extracts are particularly preferred . tobacco extracts are preferred because of the absence of significant amounts of water insoluble components , such as the biomass of tobacco ( e . g ., water insoluble cellulosics , lipids and proteins ). the tobacco component can be obtained from one type of tobacco or a blend of two or more types of tobacco . the type of tobacco can include flue - cured , burley , maryland or oriental tobaccos , the rare or specialty tobaccos ( e . g ., such as those set forth in u . s . pat . no . 4 , 819 , 668 to shelar et al . ), and blends thereof . certain useful tobaccos include ( i ) those designated by the u . s . d . a . as type 35 ( one sucker ), type 36 ( green river ) or type 37 ( virginia sun cured ), ( ii ) a cultivar known as nicotiana rustica ; ( iii ) upper stalk leaves of commercial lines of flue - cured tobacco designated by the u . s . d . a . as types 11 - 14 ; and ( iv ) upper stalk leaves of commercial lines of burley tobacco designated by the u . s . d . a . as type 31 . the tobacco can be provided in a finely divided or powder form by milling or grinding techniques , and be screened as necessary to provide particles of a desirably small size . the tobacco component can be provided in the form of a tobacco essential oil , a spray dried tobacco extract , a freeze dried tobacco extract , a tobacco aroma oil , a tobacco essence , or a tobacco oleoresin . exemplary tobacco extracts are provided using techniques as described in u . s . pat . nos . 4 , 967 , 771 to fagg et al . ; 5 , 099 , 862 to white et al . ; 5 , 131 , 414 to munoz et al . ; 4 , 986 , 286 to roberts et al . ; 5 , 005 , 593 to fagg ; 5 , 038 , 802 to white et al . ; 5 , 197 , 494 to kramer ; 5 , 060 , 669 to white et al . ; 5 , 159 , 942 to brinkley et al . ; 5 , 074 , 319 to white et al . ; european patent application no . 338 , 831 ; and u . s . patent application ser . no . 07 / 733 , 477 , filed jul . 22 , 1991 . tobacco extracts incorporate numerous components of tobacco , and as such , are a form of tobacco . components characteristic of tobacco include carboxylic acids , amino acids , lactones , esters , amides , imides , anhydrides , aldehydes , carbohydrates ( e . g ., sugars ), nitriles , ketones , alcohols , phenols , pydrines , pyrroles , indoles , pyrazines , ethers , saturated aliphatics , unsaturated aliphatics , aromatics , salts including inorganic ions , and the like . particularly desirable are flavorful forms of tobacco including many of the alkaloids , sugars , and essential oil components of tobacco . the carrier can vary . the carrier often provides a significant amount of the weight of the composition which is ultimately intended to be inserted into the mouth of a human being , and of provides a majority of the weight of the composition which is ultimately intended to be inserted into the mouth of the human being . the carrier provides body , desirable form and size , integrity , mouthfeel , and firmness to the composition . preferably , the carrier provides for a composition which has a rigid character , and has a time - release dissolvable character in order that flavor and satisfaction of the tobacco composition can release the desired amount of the material efficiently and effectively once inserted into the mouth of a human being . preferably , the carrier provides for a composition having a character such that components of the tobacco component can gradually penetrate the skin of the mouth of the human being , and hence enter the circulatory system of that human being . the carrier also provides for a composition having a character such that components of the tobacco component gradually are released into saliva in order that the tobacco component can be ingested by the human being . that is , although the carrier can have a chewy character , the resulting composition most preferably has a character such that it can be chewed or otherwise broken or dispersed into smaller pieces which can be ingested readily . the carrier can be of a form such that the composition can allow for incorporation of the tobacco component , provide appealing color , provide no undesirable off - taste , provide pleasant aroma , provide release of tobacco component desired , provide a desirable mouthfeel , are palatable , can be swallowed , and provide for satisfaction to the user . exemplary carriers can include powdered or granular materials , and can include a mixture of components . preferred carriers are water soluble and water dispersible materials . exemplary carriers comprise starch - based materials , including fines of grains such as rice . gelatin or food gums can be used . certain preferred carriers can be characterized as digestible by human beings , and as such , carriers such as processed rice material are much preferred over cellulose based materials . the absorbency of the carrier is high in that it will usually hold 2 to 10 times its weight in the tobacco composition , sufficient to pick up large amounts of the tobacco and hold the tobacco sufficiently , without resulting in leaking or transferal of the tobacco to any significant degree to dry material in contact with the resulting composition of tobacco and carrier . the relative amounts of tobacco component and carrier can vary . typically , the amount of tobacco component to carrier ranges from about 1 percent to about 90 percent , preferably about 5 percent to about 75 percent , on a dry weight basis . the carrier most preferably maintains its original volume after the tobacco component is provided in intimate contact therewith and is provided in an essentially dry form . the amount of tobacco component within the composition can vary . factors depend upon the type of tobacco , the manner or form in which the tobacco is provided and processed , the desired form of the composition of the tobacco which is applied to the carrier , organoleptic characteristics ( e . g ., flavor and impact ) of the tobacco , and chemical make - up of the tobacco . typically , the amount of tobacco ( e . g ., in form of water soluble extract ) is at least about 100 mg , often at least about 300 mg ; but typically does not exceed about 1000 mg , and often does not exceed about 600 mg . the composition can include at least one other ingredient . such other ingredient can be an optional ingredient . exemplary other components , ingredients or additives include pigments , binding agents ( e . g ., starches , alginates or carrageenans ), flavoring agents , odorants , perfumes , time release agents ( e . g ., gelatins or microcrystalline cellulosics ), antibacterial agents , antioxidants , fungistatic agents , humectants ( e . g ., glycerine and propylene glycol ), moisturizers , inorganic fillers ( e . g ., calcium carbonate , aluminum oxide or magnesium oxide ), organic fillers ( e . g ., microcrystalline oxide or magnesium oxide ), organic fillers ( e . g ., microcrystalline cellulose , such as is available as ac - di - sol or avicel ), and the like . the amount the optional ingredient can range from 0 to about 50 percent , based on the dry weight of the carrier . exemplary flavoring agents include sugars , cocoa , licorice , and the artificial and natural flavors used in flavoring tobacco products . see , leffingwell et al ., tobacco flavoring smoking products ( 1972 ). water ( e . g ., moisture ) also can be incorporated into the composition by addition to the composition or by incorporation into the tobacco component . the moisture content of the composition can vary and can be determined by experimentation . in many instances , the moisture content of the composition is less than 15 weight percent , often is less than about 10 percent , and is frequently less than 5 weight percent , based on the weight of the composition prior to use . the manner in which the various components of the composition are contacted with one another can vary . in one aspect , the tobacco components are dissolved or dispersed in a suitable solvent ( e . g ., water ), and the carrier is contacted with the resulting solution or slurry . as such , components of the solution or slurry are mixed with ( i . e ., incorporated into ) the carrier ( e . g ., gelatin ) as the carrier becomes homogenized with the tobacco composition . the resulting mixture of solvent , tobacco component and carrier then are subjected to conditions sufficient to remove significant amounts of solvent therefrom . for example , a carrier which has been contacted with a liquid solution of dispersion of tobacco is removed from the solution or dispersion , and solvent is evaporated from that carrier . as such , a composition having uniform and consistent incorporation of finely divided tobacco component is provided . such a composition has a jelly - like character . in another aspect , the tobacco components and carrier components can be blended together in a dry form , and compressed to the form of a pill or other suitable shape of relatively high density . the density of the composition preferably is relatively high in pill form . normally , the dry carrier exhibits a density above about 1 g / cm 3 , and typically between about 1 and about 2 g / cm 3 . for a carrier in the form of a gel , the density is 1 to 2 g / cm 3 . the composition exhibits certain desirable characteristics . such compositions provide for a controlled release of tobacco component to the mouth and circulatory system of the human being , provide a desirable flavor which can be tasted and enjoyed , provide tobacco satisfaction without smoking tobacco , and allow for easy use and re - use as desired by the human being . such compositions provide a controlled amount of tobacco component having desired flavor characteristics , preferably having a very limited amount of water insoluble tobacco biomass ( e . g ., less than about 10 percent of the tobacco component is provided by tobacco biomass ), have a carrier which provides little if any off - taste and hence provides for the desirable flavor associated with tobacco component , and provides the user with the option not to expectorate any portion of the tobacco component during use of the composition . as such , preferred tobacco compositions of the present invention have tobacco flavor and tobacco release characteristics such that the user does not have to expectorate at all during use of such compositions . the following examples are provided in order to further illustrate the invention but should not be construed as limiting the scope thereof . unless otherwise noted , all parts and percentages are by weight . a blend of flue - cured , burley and oriental tobaccos in dust form ( e . g ., finely divided tobacco laminae and stem ) is extracted with water in a stainless steel tank at a concentration of about 1 pound of tobacco per gallon of water . the extraction is performed at ambient temperature while mechanically agitating the mixture . the mixture is centrifuged to remove un - extracted tobacco pulp and provide a liquid extract . the liquid extract is concentrated to a solids concentration of about 30 percent dissolved solids using a thin film evaporator . the concentrated aqueous extract is spray dried to provide a spray dried powder . the concentrated aqueous extract is continuously pumped to an anhydro size no . 1 spray dryer . the dried powder is collected at the outlet of the dryer . the inlet temperature of the spray dryer is about 215 ° c ., and the outlet temperature is about 82 ° c . the spray dried extract has a nicotine content of about 3 percent , a total sugars content of about 13 percent , and a moisture content of about 6 percent . a solution is provided by dissolving 0 . 6 g of the spray dried extract in 40 g of water . into the solution is added 7 . 1 g knox unflavored gelatin available from knox gelatin inc ., englewood cliffs , n . j . 07632 , and 1 g golden light brown sugar from savannah foods & amp ; industries inc ., savannah , ga . 31402 . the mixture is heated on a hot plate to evaporate water to the point where it is very thick . the composition , upon cooling , has a rubbery character gel an overall moisture content of about 10 percent . the composition is cut into pieces of about 1 g or less weight and used as follows : the tobacco composition is placed in the mouth of the user at either the side of the cheek , or in the buccal cavity in the region thereof between the lower front teeth and below the lower lip . the composition provides good tobacco taste and satisfaction to the user . the user experiences a low amount of saliva forming in his / her mouth , as the tobacco components released from the composition can be readily swallowed . the composition is palatable , and no gritty or fibery material is released into the user &# 39 ; s mouth . as a result , the user is not required to expectorate during use of the composition . the composition normally lasts for about 20 to about 60 minutes , at which point the composition has totally dissolved . a tobacco composition is provided generally as described in example 1 . however , solution is heated to evaporate more than 90 percent of the water , at which point about 10 percent is added back . the mixture then is heated on high in a microwave oven for 3 to 5 minutes to provide a composition which has a dried , foamed or puffed character . the composition has an overall moisture content of about 10 percent . the spray dried tobacco extract described in example 1 is mixed with powdered white sugar in equal amounts . the mixed is pressed using 10000 pounds force using a carver laboratory hydraulic press into cylindrical pellets of 0 . 76 cm diameter and 0 . 51 cm thickness . each pellet or tablet weighs about 0 . 3 g . the tablet as used has a density of 1 . 3 g / cm 3 . tablets are provided as described in example 3 . however , the mixture which is compressed using 5000 pounds force includes 3 parts of the spray dried tobacco extract , 2 parts white sugar and 5 parts ground puffed rice fines . the tablet has 0 . 81 cm diameter by 0 . 49 cm thickness with density of 1 . 12 g / cm 3 . the tablet is brown in appearance and has a smooth surface character . the tablet is placed in the mouth of the user and is allowed to dissolve , during which time the dissolved portion of the tablet is swallowed . each tablet lasts about 10 to about 30 minutes . during use , the user experiences good tobacco taste and satisfaction . a tobacco composition is provided as described in example 4 . the tobacco composition , which weighs about 0 . 3 g , is placed in a sintilation vial in 20 ml of deionized water at about 72 ° f . after specified times , 1 ml aliquots are withdrawn from the vial after gentle swirling and placed in gas chromatography autosampler vials . after each ml aliquot is removed , 1 ml of deionized water is added back to maintain the liquid volume at about 20 ml . each aliquot is placed in a hewlet packard hp 7575a autosampler and analyzed using an hp 5890a gas chromatograph having a db 1701 , 60 m column of 0 . 32 mm i . d . and 10 microns thickness , and having a mass selective detector . the aliquots are analyzed for nicotine over specified times . the amount of nicotine present in each aliquot at various times is set forth in table i . table i______________________________________time nicotine concentration ( hours ) ( milligrams / microliter ) ______________________________________0 0 0 . 5 0 . 371 0 . 372 0 . 363 0 . 334 0 . 505 0 . 406 0 . 437 0 . 3524 0 . 50______________________________________ a tobacco composition is provided as described in example 3 . the tobacco composition , which weighs about 0 . 3 g , is analyzed as described in example 5 . the amount of nicotine present in each aliquot at various times is set forth in table ii . table ii______________________________________time nicotine concentration ( hours ) ( milligrams / microliter ) ______________________________________0 0 0 . 5 0 . 601 0 . 522 1 . 383 0 . 804 1 . 625 0 . 836 1 . 107 1 . 3424 1 . 04______________________________________ a tobacco composition is provided essentially as described in example 3 . however , 3 parts spray dried extract is mixed with 7 parts white sugar and compressed into a pill or tablet 0 . 80 cm diameter by 0 . 39 cm thick . a compression force of 5000 lbs . is used to provide such tablets , and the tablets have a density of 1 . 4 g / cm 3 . the tobacco composition , which weighs about 0 . 3 g , is analyzed as described in example 5 . the amount of nicotine present in each aliquot at various times is set forth in table iii . table iii______________________________________time nicotine concentration ( hours ) ( milligrams / microliter ) ______________________________________0 0 0 . 5 0 . 481 0 . 362 0 . 953 0 . 264 0 . 655 0 . 346 0 . 397 0 . 3324 0 . 32______________________________________ a tobacco composition is provided essentially as described in example 3 . however , 1 part spray dried extract is mixed with 9 parts white sugar and compressed into a pill or tablet 0 . 80 cm diameter by 0 . 39 cm thick . a compression force of 5000 lbs . is used to provide such tablets , and the tablets have a density of 1 . 4 g / cm 3 . the tobacco composition , which weighs about 0 . 3 g is analyzed as described in example 5 . the amount of nicotine present in each aliquot at various times is set forth in table iv . table iv______________________________________time nicotine concentration ( hours ) ( milligrams / microliter ) ______________________________________0 0 0 . 5 0 . 231 0 . 222 0 . 193 0 . 094 0 . 075 0 . 086 0 . 097 0 . 1424 0 . 12______________________________________ a tobacco composition is provided essentially as described in example 3 . however , 1 part spray dried extract is mixed with 2 parts white sugar and 1 part microcrystalline cellulose available as avicel ph101 , and compressed into a pill or tablet 0 . 76 cm diameter by 0 . 51 cm thick . a compression force of 5000 lbs . is used to provide such tablets , and the tablets have a density of about 1 . 3 g / cm 3 . the tobacco composition , which weighs about 0 . 3 g , is analyzed as described in example 5 . the amount of nicotine present in each aliquot at various times is set forth in table v . table v______________________________________time nicotine concentration ( hours ) ( milligrams / microliter ) ______________________________________0 0 0 . 5 0 . 351 0 . 312 0 . 363 0 . 394 0 . 705 0 . 366 0 . 637 0 . 5224 0 . 57______________________________________ the data in tables i and v indicate that tobacco components are released into liquid water over time . typically , for preferred samples of the types described in examples 5 through 9 , the amount of nicotine released after 1 hour as measured using the technique described is greater than about 0 . 2 milligrams per microliter but is less than about 0 . 7 milligrams per microliter .

US-9735093-A

a low - cost contour cuff for surgical tourniquet systems comprises : a sheath containing an inflatable bladder , the sheath having an arcuate shape , an outer surface and a centerline equidistant between first and second side edges ; a securing strap non - releasably attached to the outer surface and formed of substantially inextensible material having a shape that is predetermined and substantially flat , wherein the strap includes a bending portion near a first strap end and a fastening portion near a second strap end , and wherein the bending portion is adapted to allow twisting of the bending portion out of the substantially flat shape to facilitate positioning of the fastening portion into any of a plurality of positions in the substantially flat shape ; and fastening means for releasably attaching the fastening portion of the securing strap to the outer surface whenever the sheath is curved into a position for surrounding a limb .

fig1 shows the preferred embodiment in a surgical application and depicts contour tourniquet cuff 10 secured circumferentially around a tapered patient limb 12 . fig2 depicts contour cuff 10 secured circumferentially around a substantially cylindrically shaped patient limb 14 . referring to fig1 , the inflatable portion of contour tourniquet cuff 10 completely encircles patient limb 12 and is inflated by a source of pressurized gas to a pressure that will occlude the flow of arterial blood in patient limb 12 distal to cuff 10 . cuff port 15 is comprised of port inlet 16 and tubing 18 and provides a gas tight pneumatic passageway to the inflatable portion of cuff 10 . tubing 18 is made from flexible thermoplastic tubing and is permanently bonded to port inlet 16 . tubing 18 is fitted with a suitable connector ( not shown ) to permit attachment to a tourniquet instrument such as that described by mcewen et al . in u . s . patent application ser . no . 11 / 122 , 600 , for the inflation of cuff 10 . tubing 18 has a length at least equal to the maximum width of cuff 10 and allows cuff 10 to be used inside a sterile surgical field . in the preferred embodiment shown , cuff 10 is a single port cuff , where cuff port 15 provides a single pneumatic passageway to the inflatable portion of cuff 10 . those skilled in the art will appreciate that the features described in the preferred embodiment may also be applied to tourniquet cuffs having more than one port , such as those described by u . s . pat . no . 4 , 469 , 099 , no . 4 , 479 , 494 , and no . 5 , 254 , 087 . as shown in fig3 and 4 cuff 10 has a substantially arcuate shape with the width of the cuff reduced near the end edges . the arcuate shape of cuff 10 and the degree to which the width near the end edges is reduced are predetermined to allow cuff 10 to be applied to limbs with a predetermined range of tapers such that cuff 10 remains substantially in contact with the limb along its width around the circumference of the limb . when cuff 10 is correctly applied to a patient limb as shown in fig1 and 2 , the side edge of cuff 10 with the greater radius is proximal and the side edge with the lesser radius is distal on the limb . as shown in fig1 and 2 , cuff 10 is secured around the limb by securing straps 20 and 22 . securing straps 20 and 22 are non - releasably attached to a non - inflating region of cuff 10 near an end edge . securing straps 20 and 22 have fastening portions which releasably engage with the outer surface of cuff 10 and bending portions which permit the fastening portions to be positioned such that they can completely engage the outer surface within the side edges of cuff 10 . in the preferred embodiment the outer surface of cuff 10 and the fastening portions of securing straps 20 and 22 are formed from velcro ® materials . the outer surface of cuff 10 is a loop type material and the fastening portions of securing straps 20 and 22 are formed from hook type material . limb 14 shown in fig2 , has a substantially cylindrical shape and has been selected to represent a limb with the minimum amount of taper to which cuff 10 can be applied . as shown in fig2 , the bending portions of securing straps 20 and 22 twist to permit the fastening portions to move towards the proximal side edge of the cuff so that they may completely engage the outer surface of cuff 10 and maintain their substantially flat shape . limb 12 shown in fig1 has a substantially tapered shape and has been selected to represent a limb with the maximum amount of taper to which cuff 10 can be applied . as shown in fig1 , the bending portions of securing straps 20 and 22 twist to permit the fastening portions to move towards the distal side edge of the cuff so that they may completely engage the outer surface of cuff 10 . when cuff 10 is properly secured around a limb the fastening portions of securing straps 20 and 22 are completely engaged within the side edges of the cuff . the materials comprising the outer surface of cuff 10 and the fastening portions of securing straps 20 and 22 have contrasting colors . in the preferred embodiment , the outer surface of cuff 10 is colored black and the fastening portions of securing straps 20 and 22 are colored white . the contrasting colors provide a user of cuff 10 with a visual indication that the securing straps have been correctly positioned within the side edges of the cuff . when the securing straps are correctly positioned the outer surface of the cuff will be clearly visible completely around the perimeter of the ends of the securing straps . as described below , cuff 10 is constructed of materials that are appropriate for a single - use sterile disposable tourniquet cuff . to permit cuff 10 to be used in a sterile surgical field , cuff 10 is sterilized at time of manufacture by exposure to a sterilizing agent within a sterilizing process determined to be safe and effective . to prevent deterioration of the cuff , and to maintain the integrity of the pneumatic passageways within cuff 10 , a sterilization agent and process that will not harm the materials or components of cuff 10 is selected by the manufacturer . in the preferred embodiment cuff 10 is sterilized by exposure to gamma radiation or electron beam radiation . the cost of materials and labor are important considerations in the manufacture of tourniquet cuffs intended for a single use and then disposal . to minimize the cost of materials and assembly of cuff 10 , materials are selected which are not intended to withstand exposure to subsequent sterilization and cleaning processes . the subsequent sterilization or cleaning of cuff 10 by agents and processes commonly used in health care facilities , such as ethylene oxide gas sterilization , hydrogen peroxide gas sterilization , high temperature and pressure steam sterilization , sterilization by other chemical agents , and pasteurization , are all capable of adversely affecting the integrity of the materials and pneumatic passageways of cuff 10 . fig3 is an exploded view of the individual components that are joined together as described below to form cuff 10 . for clarity , cuff tubing 18 is not shown in fig3 . to reduce manufacturing equipment and labor costs it is desirable to manufacture cuff 10 in a single dielectric welding operation . this requires that the thermoplastic polymers comprising the components of cuff 10 be prevented from welding at selected surfaces as described below . top sheet 24 forms the outer surface of cuff 10 and is a flexible knit loop nylon material ( for example , 200 series loop material , aplix inc ., charlotte , n . c . 28241 ) adapted for secure engagement with the hook material of the fastening portions of securing straps 20 and 22 and secondary fastener 26 . it will be appreciated that top sheet 24 may be made from other types of flexible sheet materials to which velcro ® materials have been permanently attached and that the sheet material may not be completely covered by the velcro ® material . for example top sheet 24 may be comprised of a woven nylon fabric with nylon loop material bonded to the fabric only in predetermined areas for engagement with the fastening portions of securing straps 20 and 22 . securing straps 20 and 22 are formed from substantially flat flexible inextensible materials , such as the nylon hook material that is commonly used in hook and loop velcro ® fastening applications . as described above , securing straps 20 and 22 have a fastening portion and a bending portion . the bending portion of securing strap 20 and 22 has a width less than the width of the fastening portion , the reduced width of the bending portion allows the bending portion to twist out of its substantially flat shape to facilitate positioning of the fastening portion . it will be appreciated that the fastening portion and bending portion of securing straps 20 and 22 may be comprised of different materials that are permanently joined together to form the securing strap , for example the bending portion may be comprised of a material that is substantially more flexible than the material comprising the fastening portion . for further example , securing straps 20 and 22 could be comprised of a bending portion formed from a segment of grosgrain ribbon which is permanently joined to a fastening portion formed from a segment of nylon hook material . as described above the material comprising the fastening portion of securing straps 20 and 22 is a contrasting color to the material comprising top sheet 24 . secondary fastener 26 is comprised of hook material similar to the hook material that forms the fastening portions of securing straps 20 and 22 . secondary fastener 26 is attached to the outer surface of bottom sheet 30 and engages with the loop material of top sheet 24 . secondary fastener 26 facilitates cuff application and alignment by providing a means for maintaining cuff 10 in position around patient limb 12 while securing straps 20 and 22 are positioned and engaged . the additional fastening surface area provided by secondary fastener 26 allows the length of securing straps to be reduced from what otherwise would be required to maintain cuff 10 secured around a limb and thereby increases the range of limb tapers to which cuff 10 can be applied . secondary fastener 26 also helps improve the stability of cuff 10 on the limb by resisting lateral movement of the overlapped cuff end . bottom sheet 30 and middle sheet 32 are made of a flexible woven nylon cloth , coated on one surface with a thermoplastic polymer ( for example , 70 denier nylon cloth coated with thermoplastic polyurethane 0 . 004 ″ thick ). the thermoplastic polymer coating prevents the passage of gas through bottom sheet 30 and middle sheet 32 and allows bottom sheet 30 to be welded to middle sheet 32 in selected areas to form an inflatable bladder 34 as shown in cross - section in fig5 . in the preferred embodiment the thermoplastic coating on bottom sheet 30 and middle sheet 32 is polyurethane , but it will be appreciated by those skilled in the art that other thermoplastic polymers may be used as coatings on bottom sheet 30 and middle sheet 32 providing they can be joined with sufficient strength to maintain the integrity of cuff 10 when inflated . tie strap 36 is a soft fabric polymer coated ribbon material ( grosgrain ⅝ ″ wide , dynatex textiles inc ., toronto , ontario , canada ) that is shown in fig3 positioned between middle sheet 32 and bottom sheet 30 at an end edge of cuff 10 . tie strap 36 is secured to bottom sheet 30 and middle sheet 32 by welds and provides a means for the user to align and pull cuff 10 snug around the limb . when cuff 10 has been secured around a limb the ends of tie strap 36 are tied together to help maintain the overlapping portion of the cuff in alignment around the limb by preventing the cuff from twisting , telescoping and rolling on the limb when inflated . it will be apparent that tie strap 36 may also be positioned between top sheet 24 and middle sheet 32 near an end edge of cuff 10 and secured by stitching at the side edges of cuff 10 . as shown in fig4 and in cross - section in fig5 , port inlet 16 has a right angle configuration and has a flange for bonding with middle sheet 32 . port inlet 16 is made of a thermoplastic polymer that is compatible with and can be welded to the thermoplastic coating of middle sheet 32 to form a gas - tight seal . port mask 38 is interposed between port inlet 16 and bottom sheet 30 . in the preferred embodiment , port mask 38 is formed from the same material as bottom sheet 30 . to permit the cost effective manufacture of cuff 10 it is desirable to form the welds joining middle sheet 32 to bottom sheet 30 and port inlet 16 in a single dielectric welding operation . to prevent port inlet 16 from bonding to bottom sheet 30 during the dielectric welding operation port mask 38 is placed below port inlet 16 such that the polyurethane coated surface of port mask 38 is facing the polyurethane surface of bottom sheet 30 and the nylon cloth surface is facing port inlet 16 . during the welding operation , port mask 38 bonds to bottom sheet 30 in the region of the weld area joining the flange of port inlet 16 to middle sheet 32 and forms port mask weld 40 as shown in the cross - section of cuff 10 depicted in fig5 . port mask weld 40 secures port mask 38 within inflatable bladder 34 preventing it from interfering with the inflation and deflation of inflatable bladder 34 . the nylon fabric surface of port mask 38 is not compatible with the material comprising port inlet 16 and thereby prevents port inlet 16 from bonding to the top surface of port mask 38 during the welding operation . fig4 is a top view of the preferred embodiment laid flat and shows the areas where middle sheet 32 is welded to bottom sheet 30 and port inlet 16 . port inlet 16 is welded to middle sheet 32 at port weld 42 . middle sheet 32 is also welded to bottom sheet 30 at bladder perimeter weld 44 , non - inflating region weld 46 , and flute welds 48 . top sheet 24 is secured to middle sheet 32 and bottom sheet 30 by stitching 49 around the perimeter of top sheet 24 as shown in fig5 . bladder perimeter weld 44 defines inflatable bladder 34 of cuff 10 which is shown in cross - section in fig5 . bladder 34 has distal and proximal side edges ; the proximal side edge of bladder 34 has a greater radius than the distal side edge of bladder 34 . in the preferred embodiment bladder perimeter weld 44 has a greater width along the distal side edge of bladder 34 than it has along the proximal side edge of bladder 34 . the increased width of the bladder perimeter weld along the distal edge of bladder 34 acts to stiffen the edge of the cuff and thereby help improve the cuff &# 39 ; s roll stability when inflated . only the width of the bladder weld along the distal edge is increased as inflated cuffs tend to roll only distally down the limb . by increasing the width of the bladder weld only along one side edge in the preferred embodiment the width of the inflatable bladder is maximized for a given overall cuff width . prior art cylindrical cuffs that are substantially rectangular in shape do not have defined proximal and distal side edges ; their orientation when applied to a limb is not predetermined by their shape . wide bladder welds in prior art cuffs to improve stability must be made along both side edges of the bladder as the cuff may be applied in either orientation , thereby reducing the maximum possible bladder width for a given cuff width . middle sheet 32 and bottom sheet 30 are joined together by several flute welds 48 ; these welds are perpendicular to the side edges of cuff 10 and extend radially towards the centerline of cuff 10 . flute welds 48 act in place of a stiffing element to constrain inflatable bladder 34 of cuff 10 when inflated . flute welds 48 prevent relative lateral movement between selected areas of bottom sheet 30 and top sheet 24 reducing the tendency of cuff 10 to roll along the longitudinal axis of the limb . the perimeter of non - inflating region weld 46 shown in fig4 , defines a non - inflating region near an end edge of cuff 10 . secondary fastener 26 is attached to the outer surface of bottom sheet 30 by stitching around its perimeter within the non - inflating region . securing straps 20 and 22 are attached to the outer surface of top sheet 24 within the non - inflating region also by stitching . the stitching attaching securing straps 20 and 22 passes through the material of secondary fastener 26 which helps to distribute the loads at the attachment points of securing straps 20 and 22 across the end edge of cuff 10 . as shown in fig4 , securing straps 20 and 22 are attached near the bending portion to the outer surface of top sheet 24 such that they are substantially parallel to the center line of cuff 10 . securing strap 20 is attached between the centerline and the proximal side edge of the cuff . securing strap 22 is attached between the centerline and the distal side edge of the cuff . as described above the bending portions of securing straps 20 and 22 allow the fastening portions to be placed in positions other than those substantially parallel to the center line of cuff 10 . it will be apparent that securing straps 20 and 22 , and secondary fastener 26 may be attached by other mechanical fastening means or by welding or adhesives . it will also be apparent that bladder 34 could be extended eliminating non - inflating region weld 46 and the non - inflating region of the cuff . cuff 10 includes a label 50 , shown in fig3 and 4 . label 50 has printed marks to indicate to a user of cuff 10 : that cuff 10 is intended for a single use ; the proximal and distal side edges of cuff 10 ; the area of top sheet 24 that secondary fastener 26 and securing straps 20 and 22 are to be completely engaged with . label 50 is comprised of printed tyvek label material with a thermally activated adhesive backing . label 50 is die cut to match the shape of cuff 10 near an end edge and adhered to top sheet 24 near an end edge as shown in fig3 and 4 . the tyvek material of label 50 does not engage with the hook materials of secondary fastener 26 and securing straps 20 and 22 . label 50 acts as a barrier , preventing secondary fastener 26 and securing straps 20 and 22 from engaging with the loop material of top sheet 24 in the region covered by label 50 . to insure that inflatable bladder 34 completely encircles a limb when secondary fastener 26 and securing straps 20 and 22 are completely engaged with top sheet 24 , the length of label 50 is selected in the preferred embodiment to be substantially equivalent to or greater than the length of the non - inflating region of cuff 10 to which securing straps 20 and 22 and secondary fastener 26 are fixed . label 50 also acts to stiffen the end edge of cuff 10 and helps prevent the end edge from curling as cuff 10 is pulled snug around a limb by tension on tie strap 36 . the preferred embodiment is substantially comprised of top sheet 24 , middle sheet 32 and bottom sheet 30 . it will be apparent that top sheet 24 may be coated with a thermoplastic coating compatible with the coating on bottom sheet 30 and that middle sheet 32 may be eliminated and an inflatable bladder formed between top sheet 24 and bottom sheet 30 . this would also eliminate the need for stitching 49 securing top sheet 24 to middle sheet 32 and bottom sheet 30 . in the preferred embodiment flute welds 48 help improve the roll stability of cuff 10 when inflated on a limb by preventing middle sheet 32 from moving laterally with respect to bottom sheet 30 at selected locations . it will be apparent that flute welds 48 could be replaced by other means to help prevent roll , such as a stiffening sheet made from a thermoplastic material less flexible than middle sheet 32 and having an arcuate shape . a stiffening sheet may be interposed between top sheet 24 and middle sheet 32 or be interposed between middle sheet 32 and bottom sheet 30 within the perimeter of inflatable bladder 34 . to further improve stability , the stiffening sheet may be bonded to the inner surface of middle sheet 32 such as described in u . s . patent application ser . no . 11 / 304 , 363 . the embodiment illustrated is not intended to be exhaustive or limit the invention to the precise form disclosed . it is chosen and described in order to explain the principles of the invention and its application and practical use , and thereby enable others skilled in the art to utilize the invention .

US-201313932093-A

a femoral intramedullary rod has a thin or reduced proximal segment so as to provide room for the use of femoral hip screws . use of the rod for femoral shaft fixation permits subsequent independent treatment of an ipsilateral femoral hip fracture as an isolated injury , regardless of whether initially detected . different rod embodiments are formed by the omission of different proximal portions of the rod . it is in such portions that the femoral screws may be placed to set hip fractures . the rod is cannulated for installation over a guide wire . internal rod threads , below the thin proximal segment in some embodiments , are used for initial installation of the rod with a driving member screwed into such threads . without driving forces on the thin proximal segment , such segment can be made even thinner . once the rod is seated , hip screws may be installed if there is a detected hip fracture . subsequent to healing , the femoral screws and interlocking screws may be removed . a hollow reamer sized for clearance over the intramedullary rod may be placed down over the top of the rod to cut away any bony tissue ingrown into the proximal end . thereafter , the rod is extracted with a suitable extraction device .

the following description sets forth numerous details both as to structural embodiments in accordance with the subject invention and present methodology . however , those of ordinary skill in the art will appreciate various broader aspects to the subject invention , taken from the following detailed description thereof , and which aspects are not expressly limited to the precise embodiments illustrated herewith or discussed herein . the present invention is intended to encompass all such variations , modifications , and the like as would be understood by those of ordinary skill in the art from the following . broadly speaking , present fig1 - 4 ( including fig4 a - 4g ) illustrate a first exemplary embodiment of an intramedullary rod in accordance with the subject invention . more specifically , fig1 - 3 illustrate one preferred installation of such rod in the femur generally 20 of a given patient . the anatomy of femur 20 is discussed in some detail in the background portion of this specification , and familiarity with such discussion will be hereafter presumed . fig1 is a generally anterior somewhat isometric view of a right femur 20 of the human skeleton , with an exemplary first embodiment of an intramedullary rod generally 36 in accordance with the subject invention illustrated in dotted line therein ( fig1 and 3 ). fig2 is a top view of the fig1 illustration , as seen from the view line 2 -- 2 indicated therein . fig3 is a fully anterior view of the illustration of fig1 as seen from the view line 3 -- 3 indicated therein . fig4 a , 4b , and 4c , illustrate respectively a side view ( looking in the medial direction of the human skeleton right femur ), an anterior view , and a posterior view of the first embodiment generally 36 of an exemplary intramedullary rod in accordance with the subject invention . as shown , rod 36 primarily comprises an elongated shaft 38 having a relatively thin proximal segment generally 40 , which segment 40 is situated so as to be received in a femoral hip region with the shaft 38 distal thereto . as a result , space is provided in the femoral hip region for the independent introduction of femoral hip screws , such as exemplary screws 42 , 44 , and 46 . such hip screws are well known to those of ordinary skill in the art , without additional detailed description . in addition , particular details of such screws form no particular aspects of the subject invention , other than their useful combination with present embodiments of intramedullary rods and present methodology incorporating same and such femoral hip screws . also , implantation rods , screws , and the like are typically formed of stainless steel or similar , all of which is well known to those of ordinary skill without further discussion . fig1 through 3 very clearly illustrate the considerable advantage of the present invention , which is to permit the independent use of femoral hip screws for treatment of an ipsilateral femoral hip ( or neck ) fracture in combination with use of an intramedullary rod for treatment of a femoral shaft fracture . fig1 and 3 illustrate in dotted line and in partial cutaway ( fig1 ) the placement of rod 36 into femur 20 via an enlarged opening such as 48 formed in the proximal end 24 of such femur . for the sake of clarity , exemplary fracture patterns are primarily discussed in the background of the subject specification , rather than illustrated throughout the figures . however , representative fracture line 50 of present fig3 illustrates a femoral shaft fracture in an approximately medial shaft position , while representative fracture line 52 ( fig1 and 2 ) illustrates an exemplary femoral hip region fracture . more specifically , hip fracture 52 is generally transverse across the neck region 30 . fig1 through 3 provide a very clear illustration of utilizating present exemplary femoral intramedullary rod 36 for the biomechanically stable anatomic reduction of the femoral shaft fracture 50 while facilitating the independent treatment of the ipsilateral femoral hip fracture 52 ( through the use of hip screws 42 , 44 , and 46 ). various hip screw patterns may be practiced in accordance with the subject invention . the representative triangular pattern of three screws at different placements and angles is one example of a particularly strong and stable arrangement . other known arrangements of multiple lag screws or the like may be practiced in conjunction with the subject invention . fig2 in particular illustrates the femoral hip screw passageway advantageously provided in the proximal shaft segment generally 40 by the use of a relatively reduced cross - sectional area region 54 . as best seen in fig1 a , and 5b in a preferred embodiment the passageway is defined through at least a 180 degrees of the circumference of the proximal shaft segment at least up to the longitudinal centerline of the shaft segment and elongated in the longitudinal direction which allows for independent and variable positioning of the hip screws through an angular range defined by the elongated passageway . in the illustrated example of present fig1 through 4 , such region is situated in a relatively posterior position relative to the receiving femur 20 , which means that the femoral hip screw passageway established thereby resides in a generally anterior position relative to such femur . further embodiments of the subject invention as discussed disclose the structural arrangements for accommodating still further femoral hip screw placements . as discussed in the background of the specification , the location and nature of the hip fracture to be treated can substantially dictate the desired location or placement for hip pins , as well as the number of hip pins or screws to be used . the anterior position of the hip pins illustrated in present fig1 through 3 is one very typical ( i . e ., frequently encountered ) placement . however , such placement would completely interfere with a conventional intramedullary rod having a substantially larger or solid proximal region with no femoral hip screw passageway formed therethrough . the passageway established through practice of the subject invention is entirely different from interlocking screw holes as utilized in some reconstructive type intramedullary rods , which holes have a preset location and angle ( such as towards the hip ), and which rods have the difficulty of targeting and penetrating the holes with the hip screws , while also properly seating the screws in relation to the hip fracture . present fig1 through 4 illustrate additional exemplary aspects of the subject invention aside from the femoral hip screw passageway provided thereby . for example , the full length of rod 36 may be cannulated ( i . e ., hollow ), so as to define an inside diameter 56 along its length . with such arrangement , intramedullary rod 36 is useful with a guide wire , well known to those of ordinary skill in the art for establishing an initial pathway for either insertion of an intramedullary rod or a reaming device to further prepare for insertion of a rod . reaming techniques are likewise known to those of ordinary skill in the art , without discussion of additional details herewith . another feature which may be practiced is the use of a tapered tip end generally 58 by which rod 36 is further aided in penetration of the medullary canal generally 60 of femur 20 . the use of larger or stiffer nails , particularly when involving reaming operations , can include some degree of reaming of cortical bone 62 ( the generally harder or dense rim of bone annularly along the length of femur shaft 26 ). fig1 through 4 further illustrate optional use of interlocking screw holes , by which an intramedullary rod may further anatomically reduce and / or stabilize a fractured femur . while different numbers and placements of such interlocking screw holes may be practiced in various embodiments , the present exemplary embodiment 36 illustrates a pair of relatively proximal interlocking screw holes 64 and 66 located respective predetermined distal distances from proximal end 68 of rod 36 . devices in accordance with the subject invention for targeting such relatively proximal interlocking screw holes 64 and 66 are discussed in greater detail below , such as with reference to present fig1 through 15 . similarly , relatively distal interlocking screw holes represented by holes 70 and 72 may be provided , likewise at known or predetermined distal distances from proximal end 68 of rod 36 . present fig3 also represents practice of the present invention without use of interlocking screw holes . fig1 through 4 represent another feature which may be optionally practiced , which is that the proximal region generally 40 of rod 36 may have a relatively larger outside diameter than the remainder of the rod , particularly the elongated shaft 38 thereof . in larger rods , such as 12 to 13 millimeters outside diameter or larger , a single outside diameter may be practiced . however , with smaller outside diameters for the elongated shaft , the slightly larger outside diameter proximal shaft segment 40 helps to accommodate additional features of the subject invention preferably being practiced herewith . fig4 d and 4e particularly illustrate some of the above - referenced attributes of the subject invention in the area of proximal shaft segment generally 40 thereof . generally speaking , by way of clarification , such proximal shaft segment 40 comprises all portions of rod 36 proximal to the enlarged diameter point approximately 74 . the elongated shaft 38 comprises all portions of rod 36 distal to such outside diameter change point 74 . the same approximate location in other embodiments constitutes the break point between the elongated shaft and the proximal shaft segment , regardless of whether any change in outside diameter takes place . more specifically , fig4 d and 4e respectively illustrate ( in enlargement ) the proximal end region 40 of an anterior view and a side view ( looking in the medial direction of the human skeletal right femur ) of the first exemplary embodiment 36 of present fig1 through 4 . while the drawings are not intended as being precisely drawn to scale , they do reflect preferred relative relationships and dimensions among the variously illustrated exemplary components . for example , in an exemplary rod 36 , the overall length thereof from distal tip end 58 to proximal end 68 thereof may be about 400 millimeters . in such embodiment , the distance from the most proximal interlocking screw hole 64 to the proximal end 68 may be about 70 millimeters in one preferred embodiment . as represented particularly in present fig3 such an arrangement ( and proper seating thereof ) results in proximal shaft segment 40 covering ( i . e ., occupying ) substantially all of the femoral hip region ( i . e ., all portions of the femur even with and proximal to the lesser trochanter generally 34 ). with such an arrangement , a considerable femoral hip screw passageway generally 76 ( see fig4 e ) is provided . those of ordinary skill in the art will appreciate and understand that even embodiments of rod 36 may have different specific dimensional characteristics . for example , the overall length of rod 36 may generally fall in a range of from about 300 millimeters to about 500 millimeters , and even fall outside such range for specific embodiments ( if necessary to meet a given patient &# 39 ; s needs ). enlarged views of present fig4 d and 4e represent still further present features which may be practiced in accordance with given embodiments of the subject invention . for example , fig4 d provides a partial cutaway view adjacent proximal end 68 , which represents connection means generally 78 for selectively interconnecting rod 36 with drive components and extraction components for alternate installation and withdrawal , respectively , of rod 36 relative to a receiving femur 20 . more particularly , such connection means 78 may comprise internal diameter threads generally 80 formed in at least a portion of the proximal cannulated shaft segment 40 . as represented in present fig4 d , such threads are formed on the proximal side of the relatively reduced region 54 of rod 36 . in such an arrangement , whenever a driving means is coupled with connection means 78 , axial rod installation forces may be transmitted through the relatively reduced cross - sectional area region 54 . likewise , axial withdrawal of rod 36 may be obtained through connection of a withdrawal device with connection means 78 . fig4 e more particularly illustrates registration means generally 82 which may be associated with proximal end 68 of rod 36 , and by which the rotational alignment of rod 36 , and hence of the interlocking screw holes 64 , 66 , 70 , and 72 thereof , may be determined , with use of proper instrumentation ( such as that presently disclosed herewith in accordance with the subject invention ). more specifically , a transverse notch 84 may be provided in proximal end 68 , and have a predetermined rotational relationship with reference to the interlocking screw holes , so that location of notch 84 determines ( in part ) the location of such screw holes . the remaining information necessary to determine the location of such screw holes may be provided in the form of respective predetermined distal distances of such screw holes from proximal end 68 , as referenced above . fig4 f illustrates a top view of the exemplary embodiment of present fig4 e , as seen from the view line 4f -- 4f indicated therein . hence , such top view fig4 f more fully illustrates both the annular nature of an exemplary cannulated rod and the substantially two part nature of slot 84 across proximal end 68 . utilizing solid line and dotted line illustrations , various outside and inside diameters of the first exemplary embodiment of rod 36 are represented . generally speaking , the outside diameter 86 of proximal shaft segment generally 40 may fall generally in a range of from about 10 millimeters to about 16 millimeters , and in the lower aspects of such range generally has a slightly larger outside diameter than that of the elongated shaft 38 . the slightly smaller outside diameter of such shaft 38 is represented by the dotted line circle 88 . dotted line 90 represents the inside diameter of the elongated shaft 38 . see also fig4 d and 4e . as represented in such fig4 d and 4e , the inside diameter 92 throughout much of the proximal shaft segment 40 is the smallest inside diameter in rod 36 . as a result , a relative shoulder 94 is formed at the intersection with threaded proximal inside diameter 96 . such shoulder 94 further aids in providing suitable connection means 78 for receipt of axial installation forces . in one exemplary embodiment having , for example , an outside proximal segment diameter 86 of 14 millimeters , the inside diameter 92 may be about 5 millimeters , while the threaded portion inside diameter 96 is centered on 10 millimeters . in such embodiment , the inside diameter 90 of elongated shaft 38 may be enlarged from diameter 92 to about 9 millimeters , while the outside diameter of elongated shaft 38 may be about 12 millimeters . other specific dimensions may be practiced , as well as other relative relationships between the respective diameters . the figures , particularly fig4 d and 4e , further represent that , in a cannulated embodiment , the relatively reduced cross - sectional area 54 is generally constant throughout its designated region . also , due to the cannulation , an annular region is defined , with the cross - sectional area 54 occupying a predetermined angular portion thereof . as shown by fig4 d and 4e , with such annular region being generally coaxial with the outside diameter 86 of the proximal shaft segment 40 , the angular portion of such exemplary embodiment preferably occupies generally about 180 degrees of the annular region . with such an arrangement , the strength of the relatively thin proximal segment or relatively reduced cross - sectional area region 54 , is adequate to transmit axial drive forces therethrough to elongated shaft 38 . in various embodiments of the subject invention , such angular portion may fall more generally in a range of from about 120 degrees to about 240 degrees of the overall annular region . as the angular portion becomes smaller , particularly as it nears 120 degrees , other connection means are preferred , primarily so as to provide for the transmission of axial drive forces to elongated shaft 38 , without requiring axial load bearing on the relatively thin proximal segment . fig4 g illustrates still further several different alternative aspects of several specific features for practice in accordance with the subject invention . more specifically , fig4 g illustrates a cross - sectional view of the intramedullary rod shaft 38 of the exemplary embodiment of present fig4 a , taken along the sectional line 4g -- 4g indicated therein . respective outside and inside diameters 88 and 90 of such rod portion are represented . in addition , a lengthwise slot generally 98 is represented , and may be provided along most of the length of elongated shaft 38 for the purpose of relatively increasing flexibility thereof . such slotted shaft 98 is entirely an optional feature . shaft 38 is otherwise a generally cylindrical shaft , as represented by dotted lines 99 in fig4 g . other exemplary cross - sectional shapes may be practiced in accordance with this invention , as discussed in greater detail below . fig5 a illustrates a side view ( looking in the medial direction of the human skeletal right femur ) of a second exemplary embodiment generally 100 of an intramedullary rod in accordance with the subject invention . such rod 100 may again have primarily an elongated shaft 38 , a cannulated inside diameter 56 throughout its length , and optional interlocking screw holes 64 , 66 , 70 , and 72 . however , present fig5 a represents several alternative features different from those illustrated in present fig1 through 4 . first , a substantially straight line 102 ( an imaginary line ) is shown as a point of reference to illustrate that rod 100 may be generally provided with a radius of curvature , primarily in the elongated shaft 38 thereof . such radius of curvature may generally fall in a range of from about 1 meter to about 3 meters , and more preferably from about 1 . 1 to about 1 . 5 meters , so as to match the known natural curvature of a patient &# 39 ; s femur . in addition , for those embodiments which make use of a rod radius of curvature , an intended rotational relationship is established relative to the femur , thereby establishing the intended relative position ( for example , posterior , anterior , or the like ) of the relatively thin proximal segment provided . present fig1 through 4 represent no particular radius of curvature , but such may be practiced so that the resulting relatively reduced cross - sectional area region 54 is always intended to be in a relatively posterior location to provide a relatively anterior passageway for femoral hip screws 42 , 44 , and 46 . present fig5 a is similar to present fig1 through 4 in that it shows a relatively intended posterior location of a relatively reduced cross - sectional area region or thin proximal segment 104 thereof . such relatively thin proximal segment 104 results in the creation of a complementary femoral hip screw passageway 106 . in other words , present fig5 b illustrates a cross - sectional view in the proximal region of the exemplary embodiment 100 of present fig5 a , taken along the sectional line 5b -- 5b indicated therein , and representing an angular portion 104 of only approximately 120 degrees of the complete annular region defined between cannulated inner diameter 56 and proximal shaft segment outside diameter 86 . as shown , such arrangement creates a substantial complementary passageway 106 covering an angular portion of approximately 240 degrees of the total available annular region . as a result , it is preferred for embodiments such as fig5 a that the connection means generally 78 include internal diameter threads formed in both a proximal side 108 relative thin proximal segment 104 and a relative distal side 110 thereof . with such an arrangement , a threaded driving means may be connected down through proximal region 108 , passageway 106 , and threadably seated into the relative distal side threads 110 . with such a resulting arrangement , axial rod installation forces ( in the direction of arrow 112 ) are not transmitted through the relatively reduced cross - sectional area region or thin proximal segment 104 . instead , forces are more directly applied to rod shaft 38 . by providing such a form of connection means generally 78 , the relatively thin proximal segment 104 is able to be made even relatively thinner in relation to the full outside diameter 86 in such proximal shaft segment . those of ordinary skill in the art should understand and appreciate that further embodiments of the subject invention may provide the relatively thin proximal segment 104 in a relatively anterior location , given the intended orientation of the intramedullary rod relative to a receiving femur , so that femoral hip screws may be received in a relatively posterior position . the same alternative positioning arrangement may be practiced , for example , in conjunction with the exemplary embodiment of rod 36 of present fig1 through 4 , and is in fact so represented in present fig6 a and 6b . more specifically , present fig6 a and 6b respectively illustrate ( in enlargement ) the proximal shaft segment 40 of an anterior view and a side view ( looking in the medial direction of a human skeletal right femur ) of a third exemplary embodiment generally 114 of an intramedullary rod in accordance with the subject invention . those of ordinary skill in the art will readily appreciate that fig6 a and 6b constitute in essence the reverse image of present fig4 d and 4e , and vice versa . hence , like reference characters are utilized so as to eliminate the need for lengthy detailed discussion . rather , an anterior position for relatively thin proximal segment generally 116 is illustrated in place of the relatively thin proximal segment 54 of present fig4 d and 4e . likewise , present fig6 b illustrates a relatively posterior location for a femoral hip screw passageway 118 of exemplary embodiment 114 , in place of the generally anterior passageway 76 of present fig4 e . remaining present features of fig6 a and 6b correspond with previously discussed features of present fig4 d and 4e , and are marked with reference characters accordingly . present fig7 a illustrates a side view ( in the medial direction of a human skeletal right femur ) of yet a fourth exemplary embodiment of an intramedullary rod generally 120 in accordance with the subject invention . the distinctive feature primarily represented by such figure relates to yet a further exemplary embodiment of a relatively thin proximal segment or relatively reduced cross - sectional region generally 122 thereof . the arrangement is further illustrated by fig7 b , representing a cross - sectional view in the proximal region of the exemplary embodiment 120 of present fig7 a , taken along the sectional line 7b -- 7b indicated therein . as shown by fig7 b , the relatively reduced cross - sectional area actually occupies what may be described as a partially annular position , i . e ., two distinct angular portions 124 and 126 of the full annular region defined between proximal shaft segment diameter 86 and inside diameter 56 thereof . similar to the construction of present fig5 a , respective threaded regions 108 and 110 are provided proximally and distally to the relatively thin proximal segment 122 so as to comprise threaded connection means for rod 120 . at the same time , it will be further apparent to those of ordinary skill in the art from viewing both present fig7 a and 7b that a substantial femoral hip screw passageway generally 128 is formed between the opposing annular segments 124 and 126 . in general , each such annular segment 124 and 126 comprise about 120 degrees angular coverage of the full annular region available between proximal shaft segment outside diameter 86 and cannulation inside diameter 56 thereof . the segments 124 and 126 may fall in more of a range generally comprising from about 1 / 4 to about 1 / 3 each of the full annular region . fig8 a illustrates ( in enlargement ) a side view of a proximal end portion of yet a further exemplary embodiment of an intramedullary rod generally 130 in accordance with the subject invention . primarily , the rod 130 differs from previously illustrated embodiments in that the relatively reduced cross - sectional area or relatively thin proximal segment thereof generally 132 occupies a central or center post position . in a cannulated embodiment , such center post arrangement 132 includes respective outside and inside diameters 134 and 136 . fig8 b illustrates a cross - sectional view in the proximal region of such exemplary embodiment generally 130 of present fig8 a , taken along the sectional line 8b -- 8b indicated therein . a still further embodiment of exemplary connection means generally 78 is shown by the specific configuration of proximal end inside diameter threads generally 138 formed in a portion of the rod adjacent to proximal end 68 thereof . as shown , such threads 138 have a substantially larger inside diameter than the cannulation inside diameter generally 140 in the relatively thin proximal segment 132 , resulting in a substantial interior shoulder 142 between such respective inside diameters . other present features may be practiced , such as registration or alignment proximal end slot 84 ( as represented ), or a given radius of curvature for rod 38 ( represented generally by present fig5 a ), or the use of interlocking screw holes along the rod , as represented by present fig4 a . certain features may be utilized in still further capacities and locations , such as the relatively moved exemplary illustration of alignment slot 84 shown in the cross - sectional view of present fig8 b . all such variations and different combinations , as would be understood by those of ordinary skill in the art , are intended to come within the spirit and scope of the present invention by virtue of present reference thereto . fig9 a illustrates a side view ( in the medial direction of a human skeletal right femur ) of a general illustration of an exemplary intramedullary rod generally 144 in accordance with the subject invention , and representative of present optionally used variations in the shaft section thereof . with the exception primarily of the specific shape of the shaft cross - sectional area thereof , the features of exemplary rod 144 are generally about the same as those of exemplary rod 36 of present fig4 a . fig9 b more fully illustrates the differences between embodiments 36 and 144 , by representing a cross - sectional view of the shaft 146 which has an outside diameter 148 which may broadly be referred to as being fluted . two opposing flutes or depressions generally 150 and 152 are represented , and contrast with a generally cylindrical inside diameter 154 . however , in some embodiments , it may be practiced that the inside diameter 154 is formed , such as with cold rolling , or the like so that the inside diameter 154 actually matches the shape of the outside diameter 148 . in addition to the cylindrical , slotted , and fluted embodiments discussed above , still further cross - sectional shaft shapes may be practiced . for example , present fig9 c and 9d illustrate respective alternative cross - sectional rod shaft embodiments 156 and 158 which may be practiced in place of the exemplary embodiment of present fig9 b . moreover , such features may be utilized in combination with other present exemplary proximal end portions and other features of the exemplary intramedullary rods disclosed herewith . more specifically , fig9 c represents an outside diameter 160 which is fluted ( including three flutes generally 162 , 164 , and 166 ), and a generally circular inside diameter 168 . again , inside diameter 168 may alternatively be formed in the same shape as outside diameter 160 . the fig9 d embodiment illustrates an outside diameter generally 170 having fluting comprising a total of four separate flutes generally 172 , 174 , 176 , and 178 . a relatively cylindrical inside diameter 180 may be practiced , or other shapes may be utilized , particularly those matching the outside diameter generally 170 . in the embodiments discussed above , the proximal shaft segment of each respective embodiment is preferably integrally formed with its corresponding elongated shaft , in axial alignment therewith . present fig1 a , 10b , and 10c illustrate a sixth rod embodiment generally 182 in which the proximal shaft segment generally 184 and the elongated shaft generally 186 comprise respective , axially matably members which may be joined together with joining means generally 188 in accordance with the present invention . more specifically , fig1 a illustrates a partial side view ( in the medial direction of a human skeletal right femur ) of the exemplary rod 182 , particularly having interchangeable features for the proximal end portion 184 thereof . fig1 b illustrates an enlarged cross - sectional view of such proximal end portion generally 184 of the embodiment of fig1 a . fig1 c specifically represents a cross - sectional view of an exemplary joining means feature ( for example , a locking bolt ) as used in the exemplary embodiment of present fig1 b , taken along the sectional line 10c -- 10c indicated therein . the enlarged view of present fig1 b illustrates how the joining means generally 188 may axially join the respective proximal shaft segment generally 184 and the elongated shaft 186 in mated axial arrangement . as shown by alternately directed diagonal lines , the respective members 184 and 186 are preferably telescopically related to one another and held together , for example by such as a plurality of locking bolts 190 . fig1 b and 10c are representative of preferred exemplary set screws , such as so - called &# 34 ; prevailing - torque &# 34 ; locking fasteners . as shown in fig1 c , the threaded shaft 192 may have deformed threads or otherwise contoured thread profiles so as to , in essence , jam into place for a very secure fit . other forms of locking fasteners , set screws , lock nuts , pins , or other forms of joining means may be practiced . for example , the members 184 and 186 may be threadably joined together or brought together with matably aligned splines , or other forms of actual joining , so long as a connection of adequate strength is provided . those of ordinary skill in the art will appreciate that the purpose of an embodiment such as fig1 a , 10b , and 10c is to permit the use of a particular proximal shaft segment with a predetermined selected shape for the relatively reduced cross - sectional area region thereof , so as to provide a treating physician with a selected location for the femoral hip screw passageway customized for the femoral neck or hip fracture treatment of a given patient . the illustration of present fig1 a represents use of a cannulated embodiment having a cannulation inside diameter 194 , relatively proximal interlocking screw holes 196 and 198 , and a generally posteriorly located relatively thin proximal segment 200 . from the foregoing discussion , it will be understood that such arrangement results in a generally anterior femoral hip screw passageway 202 . it will be apparent that the predetermined selected shape and location of such passageway may be selected by providing a relatively reduced cross - sectional area of predetermined shape as occupying one of a posterior , anterior , central , or partially annular position , as discussed in the embodiments of fig1 through 9 . still further , other alternative arrangements may be practiced , including configurations different from those expressly illustrated . for example , different angular portions of the annular region for relatively thin proximal segment 200 may be practiced , as in the above embodiments . also , different rotational alignments may be practiced . for example , in fig7 a , the femoral hip screw passageway 128 is aligned with the direction of interlocking screw holes 64 , 66 , 70 , and 72 . the annular segments 124 and 126 could be in positions rotated therefrom , such as by 90 degrees , so that the passageway 128 is instead transverse to the interlocking screw holes . other relatively axially rotated arrangements could be practiced , either in the modular embodiment of present fig1 a through 10c , or in an integral embodiment , and all such modifications and variations are intended to be covered by the present invention . fig1 a through 11e represent a still further aspect of certain &# 34 ; modular &# 34 ; features which may be practiced in accordance with the subject invention . more specifically , fig1 a illustrates ( in enlargement of a proximal portion generally 204 ) a side view ( in the medial direction of a human skeletal right femur ) of a seventh exemplary embodiment of an intramedullary rod generally 206 in accordance with the subject invention , particularly having modular components , with the selected addition of which converts the intramedullary rod 206 from one type proximal end to another type proximal end . fig1 b , 11c , and 11d illustrate respectively a side view ( in the medial direction of a human skeletal right femur ), an anterior view , and a bottom view of a modular component generally 208 in accordance with this aspect of the subject invention . fig1 a represents a generally posterior relatively thin proximal segment generally 210 , similar to the exemplary constructions of present fig1 e , 9a , and 10a . as illustrated , the modular element 208 has a contour which is complementary to that of the femoral hip screw passageway defined by relatively thin proximal segment 210 . so configured , modular element 208 fills in the femoral hip screw passageway whenever attached to such proximal shaft segment 204 . fig1 e illustrates a cross - sectional view of an exemplary locking bolt ( i . e ., modular element attachment means ) such as may be used in the exemplary embodiment of present fig1 a , taken the sectional line 11e -- 11e indicated therein , for attaching modular element 208 to the proximal shaft segment 204 . the locking bolt 212 may include threaded shaft segment 214 of a prevailing torque type ( see fig1 c and related discussion ) which deforms or jams in the attachment screw holes 214 . those of ordinary skill in the art will understand that such attachment is done prior to implantation of intramedullary rod 206 , which may further have cannulation inside diameter 216 , threaded connection means 218 , a registration slot 220 , an interlocking screw hole 222 , and other features of other embodiments herewith . various such combinations may be practiced in conjunction with use of a modular component 208 , and such component may take on different shapes so as to fill differently shaped femoral hip screw passageways . in addition to the attachment means screw holes 224 formed in modular element 208 , partial screw hole openings 226 may be formed therein , as follows . certain standard &# 34 ; recon &# 34 ; intramedullary rods or nails include femoral hip screw holes placed at specific angles therein , for the upwardly angled seating of hip screws , similar to the seating of hip screws represented in present fig1 through 3 . therein , such screws 42 , 44 , and 46 enter from a generally lateral side and proceed at approximately a 45 degree angle from the proximal direction , upwardly through the femoral neck and into the femoral head . the exemplary embodiment of present fig1 a through 11e represent such &# 34 ; recon &# 34 ; type holes formed by respective hole components 226 of the modular component 208 and hole portions 228 formed in relatively thin proximal segment 210 . those of ordinary skill in the art will understand that other combinations and placements of such openings may be provided in accordance with such modular component embodiment of the subject invention , and others . likewise , various features such as countersunk screw heads and the like , as would be apparent to those of ordinary skill in the art , may be practiced with the foregoing embodiment . the foregoing description relates primarily to specific examples and variations of intramedullary rods which may be practiced in accordance with the subject invention . the remainder of this description primarily relates to various devices for use with the subject intramedullary rods , resulting in various treatment systems and methods in accordance with this invention , including installation and withdrawal devices and methodology . for example , one treatment system in accordance with the subject invention for the treatment of ipsilateral fracture patterns of the femoral hip and shaft may include a femoral intramedullary rod ( such as one of the above - described embodiments ), driving means for installation of such rod in a receiving femur , a plurality of interlocking screws for securing the rod , interlocking screw guide means for alignment of such interlocking screws during seating thereof , and at least one femoral hip screw for seating in the passageway defined therefor with the intramedullary rod in accordance with this invention . the following discussion with reference to present fig1 - 19 discusses such arrangement , and others , as well as present methodology . more specifically , fig1 illustrates various alternative driving arrangements for installing an intramedullary rod in accordance with the present invention , while fig1 illustrates exemplary interlocking screw guide means of the present invention . fig1 shows a cross - sectional detail of a portion of such interlocking screw guide means , while fig1 shows an exploded representation of the entire guide means . fig1 represents an exemplary 90 degree drive for use in practicing the present invention , while fig1 illustrates one alternative embodiment of a portion of the fig1 device . fig1 illustrates yet another alternative to portions of the features of fig1 , so as to provide an alignment guide for seating of the femoral hip screws , while fig1 represents various features and methodology for the ultimate withdrawal of an intramedullary rod from a healed femur . those of ordinary skill in the art will appreciate that the following devices and methodology may be practiced with any of the foregoing , and other , embodiments of the present intramedullary rod . for purposes of example only , an intramedullary rod proximal shaft segment generally 230 is shown in fig1 , similar to the embodiment of present fig1 and 4a . briefly , such proximal shaft segment 230 has a relatively thin proximal segment 232 which includes connection means generally 234 comprising cannulation inside diameter threads 236 , and which shaft segment 230 is connected with an elongated shaft 238 distally therefrom ( partially shown ), and which further includes a single representative interlocking screw hole 240 . a further threaded element 242 may be provided for axially connecting with rod connection means threads 236 via threads 244 . member 242 comprises , in essence , a modular component for the additional connection thereto of other removably operative devices , which may variously connect to threads 246 thereof ( having a relatively larger outside diameter ) or proximal threads 248 thereof ( having a relatively smaller outside diameter and also having a stop hex coupling 250 or similar integrally formed at the base thereof ). as further shown by fig1 , various alternative driving means generally 252 and 254 may be removably operatively associated with the rod proximal end connection thread means 236 ( such as via member 242 ) for selectively driving the intramedullary rod shaft 238 to a desired predetermined depth into a receiving fractured femur , with the result that the rod proximal shaft segment 230 is received in the femoral hip region . in one embodiment , the driving means 252 may comprise a threaded hammer block 255 for use with a free - hand hammer ( not shown ). such hammer block 255 has a cannulation passageway 256 , which mates with a similar cannulation passageway 258 of extension member 242 . an internal diameter thread connection 260 ( or some other equivalent means ) may be provided for connecting hammer block 255 to the extension member 242 . in such position , a fully cannulated device is provided so that the intramedullary rod may be seated over a guide wire , in accordance with general installation procedures with which those of ordinary skill in the art are familiar , without additional detailed discussion thereof . the alternative embodiment of present driving means 254 represents a threaded slide hammer means generally 262 and attached handle generally 264 . such arrangement also makes use of a cannulation passageway generally 266 along its full length so that the rod may be driven over the guide wire , or possibly over reaming guides , or other similar devices . the threaded slide hammer means includes a mass 268 which may be manipulated for alternate travel along the axial direction of double - headed arrow 270 . the threaded slide hammer means 262 further includes a drive type member 272 , relatively similar to hammer block 255 , and against which mass 268 is axially moved for striking the intramedullary rod shaft 238 in a distal direction . those of ordinary skill in the art will appreciate from the illustration of present fig1 the various threaded couplings which may be practiced , including the coupling between members 272 and axial support shaft 274 , as well as the locking nut coupling 276 which may be used in conjunction with handle 264 . an upper stop member 278 may be formed in a fixed position along shaft 274 . use of handle 264 facilitates driving of the rod shaft 238 , while also permitting to a certain extent the rotational manipulation thereof . variations to these arrangements may be practiced , as will be understood by those of ordinary skill in the art . those of ordinary skill in the art are already familiar with various guide wire and reaming techniques which may be practiced as part of installation procedures for conventional intramedullary rods . one advantage of the present intramedullary rod is that it may be utilized with such procedures already familiar to many practicing orthopedic physicians . another present advantage is the additional use of equipment disclosed herewith , such as the interlocking screw guide means of present fig1 , which further simplifies operations , as discussed hereinafter . in general , once an intramedullary rod is seated , interlocking screws ( if used ) are put in place . present fig1 through 15 illustrate interlocking screw guide means generally 280 in accordance with the subject invention , for the targeting and alignment of relatively proximal interlocking screw holes 240 and 282 . fig1 illustrates an isometric view of an assembled proximal screw hole targeting apparatus generally 280 in accordance with the subject invention , particularly adapted for use with present intramedullary rods , while fig1 illustrates an isometric exploded view of such exemplary apparatus 280 . in general , interlocking screw holes 240 and 282 are situated a predetermined or known distal distance ( respectively ) from proximal end 284 ( fig1 ) of the intramedullary rod . in addition , as discussed above with reference to various of the figures , a registration means slot 286 or other form of alignment may be utilized for indicating the relative rotational position of screw holes 240 and 282 . those of ordinary skill in the art will understand ( such as from exemplary fig1 and 3 ) that the proximal end 284 of the intramedullary rod remains close to the outer surface of the femur , so that access may be had to registration slot 286 . the dotted continuation line 288 shown throughout fig1 represents desired interconnection of the elements comprising interlocking screw guide means 280 , as discussed in detail hereinafter . such interlocking screw guide means 280 may variously comprise a combination of different respective devices and elements , such as rotational position control arm means generally 290 , securement means generally 292 , selectively operable clamping means generally 294 , and targeting arm means generally 296 . more specifically , the rotational position control arm means generally 290 may in one exemplary embodiment comprise a member which is removably operatively associated with the rod proximal end registration means 286 and which extends generally laterally therefrom via a lateral extension arm 298 . when so extended , arm 298 is in rotational alignment with the rod relatively proximal interlocking screw hole or holes 240 and 282 . a pair of tabs 300 or other correspondingly mating elements , may be provided for use in conjunction with registration slot 286 . as shown , an annular member 302 may be telescopically seated onto proximal end 284 , with the tabs 300 received in the corresponding slot arrangements 286 . a cannulation inside diameter 304 is again provided in means 290 , particularly shown by the inside diameter of annular member 302 . as shown by fig1 and 15 , the securement means 292 may comprise a locking nut 306 , which also has a cannulation inside diameter 308 . it is with such locking nut 306 that the control arm means 290 are removably secured to the intramedullary rod proximal end connection thread means 236 . it will be understood by those of ordinary skill in the art that the extension member 242 , in essence , forms part of such rod proximal structure to and with which mounting of the various further devices in accordance with the subject invention may be practiced . the threads along inside diameter 308 of locking nut 306 are in fact received about the threaded portion 246 of such extension member 242 , as clearly represented in present fig1 and 15 . annular member 302 of control arm means 290 in fact is received about the relatively smooth outside diameter portion 310 of such extension member 242 . still further , the interlocking screw guide means 280 may include selectively operable clamping means generally 294 , which are movably supported ( preferably slidably ) on the lateral extension or extension arm 298 of control arm means 290 . see fig1 and 15 . fig1 is in fact an enlarged cross - sectional view of specific clamping means features in accordance with the exemplary embodiment of present fig1 , taken along the sectional line 14 -- 14 indicated therein . with such an arrangement , the clamping means 294 may be selectively clamped on lateral arm 298 at a selected distance radially outward from the central longitudinal axis 312 of the intramedullary rod . operatively , the purpose of such arrangement is to permit the position of targeting arm means generally 296 to be moved so as to match the size of a patient &# 39 ; s leg into which the intramedullary rod is associated with the receiving femur . still further , such targeting arm means generally 296 may be variously secured to the clamping means 294 for movement therewith and extending therebelow for parallel alignment thereby with the central longitudinal axis 312 of the intramedullary rod . such targeting arm means has at least one relatively proximal interlocking screw target hole 314 located a predetermined distance distal to clamping means 294 . such target hole 314 becomes aligned with the intramedullary rod relatively proximal interlocking screw hole 240 by virtue of the present arrangement , so that such hole 240 may be targeted for drilling through the femur and subsequently securing an interlocking screw in such hole 240 . the same alignment approach permits additional target hole 316 to become aligned with corresponding additional interlocking screw hole 282 of the intramedullary rod . more particularly , the control arm means lateral extension arm 298 has a predetermined cross - sectional shape ( see fig1 ) defined at least in part by at least one guide surface . the clamping means generally 294 includes one clamping surface to be selectively and correspondingly matched with such extension arm guide surface , and being movable relative to such matched guide surface so that the clamping means can be selectively engaged in a given position slidably along the extension arm ( along the direction of double - headed arrow 318 of present fig1 ). as stated , it is such arrangement which permits the overall targeting apparatus to be custom fitted to the leg size of a given patient . the targeting arm means 296 may be integrally associated with the clamping means 294 ( as represented by present fig1 ), or may otherwise be attached thereto . looking to all fig1 through 15 , clamping means 294 may be provided in the form of a clamp plate housing generally 320 which is slidably and removably received about the lateral extension arm 298 , and which may be integrally associated with the targeting arm means 296 . further , a clamp plate 322 may be provided movably residing between the lateral extension arm 298 and an inside surface 324 of clamp plate housing 320 . a clamp plate bolt 326 with capture member 328 may be threadably received through the clamp plate housing 320 and positioned so as to selectively drive the clamp plate 322 into clamping engagement with the lateral extension arm 298 . by way of specific example , the lateral extension arm 298 is shown to have a cross - sectional shape utilizing six different guide surfaces comprising substantially a rectangle ( in this example ) with two bevelled edges 330 and 332 respectively connecting a first guide surface 334 of such rectangle to the two adjacent guide surfaces 336 and 338 thereof . a lower surface 340 completes the rectangle , all of which surfaces are surrounded and enclosed by clamp plate housing 320 . while clamping surfaces may be provided for correspondingly matching with such six guide surfaces , not all such surfaces may actually need to be brought into engagement or contact in order for clamping to be effected . for example , as shown in present fig1 , the clamp plate housing 320 provides three internal surfaces ( unreferenced ) for contacting guide surfaces 336 , 338 , and 340 , respectively . at the same time , the clamp plate provides surfaces ( unreferenced ) for respective contact with guide surfaces 330 and 332 , though a gap is preferably maintained between guide surface 334 and the clamp plate in order to accommodate the end of clamp screw 326 and its securement ring or element 328 . those of ordinary skill in the art will appreciate that different embodiments of such clamping arrangements may be practiced in accordance with the subject invention , in keeping with the broader teachings herewith . those of ordinary skill in the art will appreciate that the interlocking screw guide means generally 280 discussed above , as well as the different embodiments of present exemplary driving means 252 and 254 , may be removably associated with intramedullary rod embodiments in accordance with this invention . such operative connection and subsequent removal thereof permits overall alternative accompanying devices to be utilized . for example , fig1 illustrates a side elevational view , with partial cutaway , of a further example of a present rotational positional control arm generally 342 , in accordance with the subject invention and providing a 90 degree drive feature . more specifically , a threaded coupling 344 may be provided for mating with internal diameter threads 236 of a given intramedullary rod , while projecting tabs 346 and 348 may interface with registration slots 286 of the intramedullary rod . the purpose of such registration coupling is to ensure a fixed position of coupling element 350 so that torque may be applied to member 344 via 90 degree bevelled drive gear arrangement generally 352 and elongated drive coupling 354 . in other words , as is well understood by those of ordinary skill in the art , drive power or rotational force applied to drive connection 356 will be translated into drive force about the longitudinal axis of coupling 344 . a hex drive of 356 or similar may be utilized . again , a cannulation inside diameter 358 may be provided throughout the device for use with a nail insertion guide rod . in other words , cannulation inside diameter 358 extends throughout device 352 from the top side 360 thereof to the distal most portion 362 thereof . in addition , a portion of the cannulation inside diameter 358 may include thread connections 363 for receiving a slide hammer driving means such as means 254 , or a hammer block connection 252 , preferably coupled through or with an element such as extension member 242 . with the foregoing arrangement , rotational alignment of the intramedullary rod may be practiced with mechanical advantage , during the driving phase . those of ordinary skill in the art will appreciate that such device 342 may be utilized and then removed from the intramedullary rod , so as to permit additional or alternative devices to be applied thereto . fig1 represents still further alternative devices in accordance with the subject invention , illustrating an isometric exploded view of an alternative embodiment of a laterally extending clamp plate support generally 364 for use in place of means 290 of fig1 and 15 . with such device , a different extension member 366 is provided with only one set of proximal screw threads 368 and distal threads 370 , which may couple with threads ( not shown ) within the intramedullary rod proximal end 284 thereof . other connection means may be practiced in given embodiments . hence , as representatively shown in fig1 , the proximal end inside diameter 372 of the intramedullary rod may be alternatively made smooth bored rather than threaded . the annular member generally 374 may include projecting tabs 376 and 378 for registration and coupling with slots 286 , in the fashion as discussed above in conjunction with other embodiments of the subject invention . similarly , a locking nut 380 may be provided for securing device 364 to the intramedullary rod , and cannulation inside diameters 382 may be provided throughout the arrangement , as before with other devices . in addition , a further threaded connection 384 may be provided for receipt of driving means generally 386 direct therewith , and at an angle offset from the central axis 386 of the intramedullary rod . lateral extension arm 388 may again be utilized with a clamping means 294 ( not shown ) in the same fashion as described above with reference to present fig1 through 15 . the arrangement of present fig1 through 15 may be utilized with still further alternative features in accordance with the subject invention . for example , fig1 illustrates an isometric view of a further exemplary embodiment in accordance with this invention , illustrating features alternative to some of those of present fig1 , and particularly representing a neck or hip screw placement guide arm generally 390 for use with intramedullary rods in accordance with the subject invention . the intramedullary rod arrangement of fig1 is substantially reiterated in fig1 , and represents that an imaginary plane 392 may be shown in relation to relatively thin proximal segment 232 of the intramedullary rod . such imaginary plane 392 represents the dividing plane between such relatively thin proximal segment 232 and the complementary femoral hip screw passageway provided thereby . while certain features discussed above may be utilized for targeting interlocking screw holes 240 and 282 , the features of present fig1 may be utilized for targeting or guiding femoral hip screws into the passageway formed therefor with the subject invention . more particularly , the femoral hip screw placement guide means 390 in accordance with the subject invention may include an arm 394 which is integrally formed with or operatively associated with clamping means 294 , similar to the fashion in which depending arm 296 was so associated . however , rather than providing target holes 314 and 316 as in fig1 and 15 , arm 394 has a relatively reduced size ( i . e ., width ) and is specifically positioned relative clamping means 294 so as to provide a guide surface 396 which is coplanar to imaginary plane 392 . therefore , a treating physician utilizing the arrangement of fig1 , may utilize clamp bolt 326 for sliding clamping means 294 inwardly along arrow 318 towards the central axis 312 of the intramedullary rod , until the surface 398 of guide arm 394 is brought into contact with or proximity with the outside of a patient &# 39 ; s leg . thereafter , the treating physician may drill along and adjacent to the side 396 of arm 394 , thereby drilling on the passageway - side of imaginary plane 392 so as to seat femoral hip screws in the passageway defined therefor by relatively thin proximal segment 232 . it will be further understood by those of ordinary skill in the art that , if desired , various indicia or markings may be applied to surface 400 of guide arm 394 , so that axial depth along central axis 312 may be indicated in addition to indication of the imaginary plane 392 . however , even without such indicia , the treating orthopedic physician will be very familiar with the axial position of the femur as to where the screws ( such as exemplary screws 42 , 44 , and 46 of present fig1 through 3 ) are to be seated . it is only the planar guidance which would be otherwise missing without practice of the present fig1 features and methodology in accordance with the subject invention . lastly , fig1 illustrates an isometric exploded view of a proximal end over - reamer generally 402 which may be practiced during extraction or withdrawal of intramedullary rods in accordance with the present invention , and further illustrates elongated slide hammer removal features generally 404 which may also be practiced in accordance with the subject invention during extraction . the extraction over - reamer means generally 402 of present fig1 is provided for cutting bony growth from around the intramedullary rod reduced cross - sectional area 232 for removal of the intramedullary rod from a patient &# 39 ; s healed femur . such extraction over - reamer means generally 402 may comprise a generally cylindrical annular cutting member 406 , shown in broken illustration in present fig1 . such annular cutting member is sized to fit over the intramedullary rod proximal end 284 and to slide therealong over proximal shaft segment 230 . distally located saw teeth 408 are provided for cutting into the bones , while a proximally located drive coupling 410 permits rotational driving of the saw teeth . the hexdrive arrangement 410 may be power driven or mechanically coupled to a manual arrangement . in terms of withdrawal methodology in accordance with the subject invention , once any sort of interlocking screws or femoral hip screws are removed , the extraction over - reamer means generally 402 may be utilized to cut the proximal shaft segment 230 free from any bony growth around relatively proximal segment 232 . thereafter , rod removal means generally 412 may be utilized , such as including a slide hammer device 404 and hook 414 and eye 416 connection operatively associated with a threadable member 418 for direct attachment via threads 420 and 236 to the intramedullary rod proximal end 284 . of course , different connection means 234 for such rod may be practiced , and connection element 418 would be modified accordingly . a hex coupling 422 may be provided to facilitate driving connection of member 418 , as will be well understood by those or ordinary skill in the art . once member 418 is seated , hook 414 may be secured thereto , and slide hammer element 424 may be axially moved along the direction of double - headed arrow 426 for axial extraction of the intramedullary rod . as will be understood by those of ordinary skill in the art , a handle device generally 426 may be provided as well as a fixed element 428 against which slide hammer 424 may strike . a shaft 430 is provided for movement of such slide hammer element 424 , and may be threadably coupled via threads 432 and 434 to the hook connection member 414 . it will be further understood by those of ordinary skill in the art that alternatives may be practiced . for example , the hook portion 414 may be associated with the member 418 , and the eye portion 416 associated with the threadable coupling 434 . those of ordinary skill in the art will further understand and appreciate from the totality of the foregoing disclosure , that the various alternative features and components shown and discussed in conjunction with fig1 through 19 , may be practiced in accordance with various installation and withdrawal metholodologies , all of which combinations are intended to come within the spirit and the scope of the present , without rediscussion thereof . such alternative methodologies are intended to include the use of different intramedullary rod embodiments practiced in accordance with the invention . in addition to the foregoing , different embodiments such as including different numbers and placements of interlocking screws , or use of different femoral hip screws and neck screws , may be practiced . likewise , it is to be fully understood by those of ordinary skill in the art that the foregoing structures and methodologies may be practiced for the treatment of various types and degrees of combination shaft and hip ( or neck ) ipsilateral fractures , without further detailed discussion of such different fracture types and degrees , as alluded to above in the background and summary portions of the subject specification . it should be further understood by those of ordinary skill in the art that the foregoing presently preferred embodiments are exemplary only , and that the attendant description thereof is likewise by way of words of example rather than words of limitation , and their use does not preclude inclusion of such modifications , variations , and / or additions to the present invention ( either apparatus or methodology ) as would be readily apparent to one of ordinary skill in the art , the scope of the present invention being set forth in the appended claims .

US-98229192-A

gaseous nitric oxide can be delivered to a mammal for prophylactic or therapeutic purposes using a composition capable of delivering no , comprising a compound capable of forming a reversible bond or association with no . methods for the manufacture and use of said composition are disclosed .

experiments performed by the present inventors indicate that the administration of inhaled no is not a sufficient treatment in cases of pulmonary embolism . there are also numerous other conditions , where the administration of no could be optimised , in order to improve the efficacy , reduce side effects or to achieve other beneficial effects . the inventors performed experiments using gaseous no dissolved in physiological saline , given as an injection of up to 5 ml per kg body weight . surprisingly , no or only a very small increase of exhaled no could be detected . similarly , no changes in blood circulation were to be seen . this indicates that no is rapidly decomposed or otherwise inactivated when infused in saline , or that it does not reach the lungs or the systemic vessels . this is supported by the observation of significant formation of methemoglobin ( see fig1 ) during infusion of no in saline . methemoglobin formation is an undesirable effect , since it decreases the oxygen - carrying capacity of blood . the inventors then set out to find alternative and improved compositions for the administration of gaseous no . it was highly surprising that no could be formulated as lipid emulsion for intravenous administration , and that this formulation made it possible for the no to reach the lungs . experiments indicate that an infusion already of 0 . 1 to 0 . 5 ml / kg body weight results in clearly distinguishable increases in expired no , in animals given l - name to inhibit the endogenous no production . the results also indicated that the infusion of no in a lipid emulsion protected the animals against the lethal effects of pulmonary embolism in no - synthesis inhibited animals . it is contemplated that the no infusion exerts vasodilatory effects in the pulmonary circulation , and / or mild vasodilatory effect on systemic circulation , and inhibits thrombocyte aggregation , or a combination of these effects . a surprising observation was that very little or no methemoglobin was formed during infusion of no in a lipid emulsion ( see fig1 ). further experiments , using other hydroxyl containing compounds ( see below ) indicated a favourably low or absent formation of methemoglobin . the inventors then tested different compounds as carriers for gaseous no . first , glycerol , a component of the lipid emulsion , was tested . glycerol was surprisingly shown to act as a selective no carrier . further , other low molecular weight carbohydrates and their derivatives were tested . analogs of glycerol , amino acids and polyethylene glycol were also tested . the results are presented below , in the experimental section , table 1 . consequently , the present invention makes available a composition for the delivery of gaseous nitric oxide ( no ), comprising a compound capable of forming a reversible bond or association with no . such compounds have been identified and appear to be selective no carriers . without wishing to be bound by any theory , the inventors suggest that no molecules become associated to these compounds when they are brought in contact in a substantially oxygen - free environment , and that the presence of at least one hydroxyl group is material for the association . preliminary experiments indicate that the no release mechanism is non - enzymatic , as judged from its release profile at different temperatures . said compound , capable of forming a reversible bond or association with no , is preferably a water miscible organic compound , presenting at least one hydroxyl group . according to one embodiment , said compound is a carbohydrate compound . according to another embodiment , said compound is a monosaccharide or a derivate thereof . preferably , said compound is chosen among glucose , fructose , galactose , ribose . e . g . glucose can advantageously be used in the form of commercially available carbohydrate solutions for infusion , such as but not limited to ringer - glucose ( baxter ), glucose solutions for infusion ( manufactured by baxter , braun , fresenius kabi etc .). according to another embodiment , said compound is a monosaccharide alcohol , preferably chosen among sorbitol and mannitol . e . g . mannitol can advantageously be used in the form of commercially available solutions for infusion , such as but not limited to mannitol baxter viaflo ® ( baxter ) and mannitol ( fresenius kabi ). according to another embodiment , said compound is a modified monosaccharide , e . g . a compound chosen among fucose , 2 - deoxy - ribose , and 1 - o - methyl - ribose . according to yet another embodiment , said compound is a disaccharide or a higher carbohydrate polymer of a monosaccharide or derivate thereof , and preferably a disaccharide or higher polysaccharide of glucose , fructose , galactose , ribose , sorbitol , mannitol , fucose , 2 - deoxy - ribose , and 1 - o - methyl - ribose , or one of sucrose , lactobionic acid , insulin , dextran , and fucoidan . based on the positive results obtained with mannitol and dextran , it is apparent that different formulations of carbohydrates , presently used as blood substituents and infusion solutions , fall within the scope of the present invention . non - limiting examples include commercially available products such as macrodex ® and rheomacrodex ® ( meda ), ringer - dextran ® ( braun ), haes - steril , hyperhaes , and voluven ® ( fresenius kabi ) and hemohes ® ( braun ). according to another embodiment , said compound is an alcohol or a derivate thereof . according to this embodiment , said compound is a monohydric alcohol , e . g . an alcohol chosen among 1 - propanol , 2 - propanol , sorbitol , and mannitol . according to another embodiment , said compound is a dihydric alcohol , e . g . 1 , 2 - propanediol or 1 , 3 - propanediol . according to yet another embodiment , said compound is a trihydric alcohol , e . g . glycerol . according to yet another embodiment , said compound is a polymer of alcohol molecules or derivates thereof , e . g . polyethylene glycol of different molecular weight . preliminary studies with peg 400 have exhibited positive results . according to another embodiment , said compound is a modified amino acid , peptide , polypeptide or protein . preferably , and based on the current understanding of the mechanism of association between the compound and no , said compound is a modified amino acid where the primary amino group has been substituted to a secondary amino group . one example is n - acetyl - cysteine . it is presently unclear if no reacts with a thiol or another part of the molecule . it is however suggested that peptides , polypeptides or proteins that have been acetylated or otherwise conjugated , thus hiding the primary amine structure , can be used in the present invention . according to another embodiment , said compound is albumin . thus , according to the invention , albumin based blood substituents , such as but not limited to commercially available plasma substitutes and plasma protein infusion solutions , can be used . examples include albumin infusion solutions ( manufactured by baxter , behring , octapharma etc .). according to another embodiment , said composition is a lipid emulsion , such as emulsions and solutions for intravenous nutrition , here exemplified by intralipid ® ( fresenius kabi ). other suitable emulsions are clinoleic ® ( baxter ), omegaven ®, smoflipid ® and structolipid ® ( fresenius kabi ), and vasolipid ® ( braun ) and equivalent products . the composition according to the invention is preferably formulated for topical , rectal , vaginal , intrauterine , intraurethral , intraurethral , intravesical , intra - or transcervical , intrauterine , laparoscopic , intrasurgical , nasal , ocular , sublingual , buccal , oral , enteral , intravenous , intraarterial , intratracheal , intramuscular or subcutaneous administration . according to a preferred embodiment , the composition according to the invention contains substantially no oxygen . further , according to another preferred embodiment , said composition capable of delivering gaseous no is an injectable aqueous formulation containing gaseous no substantially in the absence of oxygen . further , the present invention makes available a method for the treatment , alleviation or prevention of insufficient perfusion in an organ or organs in a human or animal patient , wherein a composition , capable of delivering no is given intravenously to said patient . insufficient perfusion includes states of insufficient perfusion of various etiology , in tissues or organs , including but not limited to transplanted tissues or organs , including organs or tissues intended for transplantation . according to an embodiment of the invention , said insufficient perfusion is insufficient perfusion of a section or sections of a lung , due to pulmonary embolism . pulmonary embolism includes pulmonary embolism of various etiology , including but not limited to pulmonary thromboembolism and pulmonary gas embolism . other indications , where the inventive composition is used either alone , or in combination with one or more pharmaceutical agents , acute pulmonary vasoconstriction of different genesis , pulmonary embolism , pulmonary hypertension of different genesis , including primary hypertension and secondary hypertension , systemic hypertension of different genesis , acute heart failure , acidosis , inflammation of the lung , adult respiratory distress syndrome , acute pulmonary edema , acute mountain sickness , asthma , hypoxia of different genesis , inflammation of different genesis , wound healing , and conditions where smooth muscle relaxation is needed . the composition may also be used in situations where controlled hypotension is desired , e . g . controlled hypotension during neurosurgery . the inventive composition is also preferably used alone , or in combination with one or more pharmaceutical agents , to act as an inhibitor of thrombocyte aggregation and coagulation , e . g . in combination with vasodilatation . the inventive composition is also used as an adjunct to other pharmaceutically active agents , in order to increase their uptake , e . g . to increase the systemic uptake of topically administered systemic drugs ; as an addition to injections , where increased local circulation is desired ; as an adjunct to anti - tumor drugs and / or in conjunction with irradiation therapy , where a vasodilatory effect may increase the anti - tumor effects of the treatment . according to an embodiment of this use , said insufficient perfusion in an organ or organs is insufficient perfusion of a section or sections of a lung , due to pulmonary embolism . pulmonary embolism includes pulmonary embolism of various etiology , including but not limited to pulmonary thromboembolism and pulmonary gas embolism . pulmonary hypertension , e . g . of the newborn , or primary or idiopathic pulmonary hypertension or pulmonary hypertension secondary to another disease or hypoxia can also be treated by means of the invention . thus , the present invention makes available first and second medical uses of the compounds identified above . in general terms , the invention makes available the use of a compound capable of forming a reversible bond or association with no , for the manufacture of a pharmaceutical formulation for the treatment of a condition where the administration of no is beneficial . in the above first or second medical use , said compound is chosen among glucose , fructose , galactose , ribose , sorbitol , mannitol , fucose , 2 - deoxy - ribose , 1 - o - methyl - ribose , sucrose , lactobionic acid , insulin , dextran , fucoidan , 1 - propanol , 2 - propanol , 1 , 2 - propanediol , 1 , 3 - propanediol , glycerol , polyethylene glycol , n - acetyl - cysteine , albumin , and derivatives thereof . according to the invention , said condition is chosen among inflammation , acute pulmonary vasoconstriction of different genesis , pulmonary embolism , pulmonary hypertension of different genesis , including primary hypertension and secondary hypertension , systemic hypertension of different genesis , acute heart failure , acidosis , inflammation of the lung , adult respiratory distress syndrome , acute pulmonary edema , acute mountain sickness , asthma , hypoxia of different genesis , inflammation of different genesis , wound healing , and conditions where smooth muscle relaxation is needed . in the above , a pharmaceutical formulation is one of a plaster or bandage , a gel , a cream , an ointment , a solution , a suppository for topical , rectal or vaginal administration ; a solution , for drop wise addition or for forming an aerosol for nasal or ocular administration ; a solution , emulsion , drops , capsules or tablets for oral or enteral administration ; an injectable solution or emulsion for intravenous , intraarterial , intratracheal , intramuscular or subcutaneous administration . the present invention also makes available a method for the manufacture of a composition capable of delivering gaseous no , wherein a aqueous solution , suitable for topical , rectal , vaginal , intraurethral , intravesical , nasal , ocular , sublingual , buccal , oral , enteral , intravenous , intraarterial , intratracheal , intramuscular or subcutaneous administration , is de - oxygenized until substantially free from oxygen , and then purged with pure no gas until a desired no concentration is reached . in the method according to the invention , said compound capable of forming a spontaneously reversible association with no is preferably a water miscible organic compound , presenting at least one hydroxyl group . according to one embodiment , said compound is a carbohydrate compound . according to another embodiment , said compound is a monosaccharide or a derivate thereof . preferably , said compound is chosen among glucose , fructose , galactose , ribose . according to another embodiment , said compound is a monosaccharide alcohol , preferably chosen among sorbitol and mannitol . according to another embodiment , said compound is a modified monosaccharide , e . g . a compound chosen among fucose , 2 - deoxy - ribose , and 1 - o - methyl - ribose . according to yet another embodiment , said compound is a disaccharide or a higher carbohydrate polymer of a monosaccharide or derivate thereof , and preferably a disaccharide or higher polysaccharide of glucose , fructose , galactose , ribose , sorbitol , mannitol , fucose , 2 - deoxy - ribose , and 1 - o - methyl - ribose , or one of sucrose , lactobionic acid , insulin , dextran , and fucoidan . as noted above , based on the positive results obtained with mannitol and dextran , it is apparent that different formulations of carbohydrates , presently used as blood substituents and infusion solutions , fall within the scope of the present invention . non - limiting examples include macrodex ® and rheomacrodex ® ( meda ), ringer - dextran ® ( braun ), haes - steril , hyperhaes , and voluven ® ( fresenius kabi ) and hemohes ® ( braun ). according to another embodiment , said compound is an alcohol or a derivate thereof . according to this embodiment , said compound is a monohydric alcohol , e . g . an alcohol chosen among 1 - propanol , 2 - propanol , sorbitol , and mannitol . according to another embodiment , said compound is a dihydric alcohol , e . g . 1 , 2 propanediol or 1 , 3 - propanediol . according to yet another embodiment , said compound is a trihydric alcohol , e . g . glycerol . according to yet another embodiment , said compound is a polymer of alcohol molecules or derivates thereof , e . g . polyethylene glycol of different molecular weight . preliminary studies with peg 400 have exhibited positive results . according to another embodiment , said compound is a modified amino acid , peptide , polypeptide or protein . preferably , and based on the current understanding of the mechanism of association between the compound and no , said compound is a modified amino acid where the primary amino group has been substituted to a secondary amino group . one example is n - acetyl - cysteine . as stated above , it is presently unclear if no reacts with a thiol or another part of the molecule . it is however suggested that peptides , polypeptides or proteins that have been acetylated or otherwise conjugated , thus hiding the primary amine structure , can be used in the present invention . according to another embodiment , said compound is albumin . thus , according to the invention , albumin based blood substituents , such as but not limited to commercially available plasma substitutes and plasma protein infusion solutions , can be used . examples include albumin infusion solutions ( manufactured by baxter , behring , octapharma etc .). according to another embodiment , said composition is a lipid emulsion , such as emulsions and solutions for intravenous nutrition , here exemplified by intralipid ® ( fresenius kabi ). other suitable emulsions are clinoleic ® ( baxter ), omegaven ®, smoflipid ® and structolipid ® ( fresenius kabi ), and vasolipid ® ( braun ) and equivalent products . the present invention also makes available a no - saturated , substantially oxygen - free and physiologically acceptable composition , obtainable by a method as described above . the composition according to the invention is preferably formulated as a plaster or bandage , a gel , a cream , an ointment , a solution , a suppository for topical , rectal , vaginal , intraurethral , or intravesical administration . it is preferably formulated as a solution , for drop wise addition or for forming an aerosol for nasal or ocular administration . it is preferably formulated as a solution , emulsion , drops , capsules or tablets for oral or enteral administration . it is preferably formulated as an injectable solution or emulsion for intravenous , intraarterial , intratracheal , intramuscular or subcutaneous administration . when preparing the no emulsion or specific carrier solution according to the present invention , it is important that the medium is de - oxygenized before addition of no . otherwise the added no will be decomposed by oxygen . it is also necessary to use , store and administer the emulsion under exclusion of oxygen . in practice , the storage vessels , vials , bottles or bags , as well as the tubes and cannulas should be non - permeable to oxygen or at least have reduced permeability to oxygen . a skilled person can easily identify suitable packaging materials . except for this consideration , conventional apparatuses and practices for administering pharmaceuticals can be used . one important clinical advantage of the present invention is that the effects of the gaseous no , when administered to the patient in a composition according to the invention , will be most significant in hypoxic tissue . when gaseous no formulated is given as an intravenous infusion , the risk of so called proximal steal , i . e . increased blood flow in neighboring healthy vessels , is avoided . this is a common side effect of vasodilating substances , leading to lowered blood pressure and related systemic symptoms . another advantage is that the manufacture of the inventive compositions is easy and requires no harsh conditions , which may alter or damage other components optionally present in the composition . yet another advantage is that the release of no seems to be non - enzymatic , based on an experiment using a perfused lung model . a non - enzymatic release mechanism indicates that a composition according to the invention would avoid the tolerance development , associated with conventional no - donating compositions . yet another advantage , especially in comparison with administration of no in saline only , or no in carbon dioxide , is the considerably lower formation of methemoglobin . further advantages will become evident to a skilled person upon study of the description and examples . the experiments were approved by the local animal ethics committee . male white new zealand rabbits ( n = 20 , body weight 2 . 456 ± 0 . 086 kg ) were anaesthetized via an ear vein with sodium pentobarbital , 6 mg ml − 1 in normal saline , 40 - 60 mg kg - 1 . the animals were placed in supine position and tracheotomised just below the cricoid cartilage to allow mechanical ventilation using a tracheal cannula with an outer diameter of 5 mm . the animals were ventilated by a harvard apparatus rodent ventilator ( model 683 , harvard apparatus , south natick , mass ., usa ). the ventilator was supplied with no - free air using a charcoal filter ( 110 × 11 cm ). ventilation rate was 40 min − 1 at constant volume where the tidal volume was initially adjusted to keep the end - tidal co2 at 4 . 5 - 5 . 3 % as determined by a ventilatory monitor ( oscar - oxy , datex , helsinki , finland ) sampling gas ( 150 ml min − 1 , 15 - 20 % of minute ventilation ) from one of two side - arms connected to the tracheal cannula , and using a de - humidifying tube . the minute ventilation was 0 . 64 - 0 . 96 l min − 1 . to the other side arm a pressure transducer ( statham , hato rey , puerto rico ) was connected thus monitoring the insufflation pressure . the gas from the ventilator outlet was led through a switching valve to either of two beakers creating a positive end - expiratory pressure ( peep ) of 1 - 2 cmh 2 o or 4 - 5 cmhbo . during the experiment the gas flow was altered between the lower peep ( 9 min ) and the higher peep ( 1 min ) with an interval of totally 10 min . a continuous infusion containing glucose ( 24 . 3 g l − 1 ), dextran 70 ( 26 . 5 g l − 1 ), nahco 3 ( 6 . 2 g l − 1 ), sodium pentobarbital ( 4 . 1 g l − 1 ) and pancuronium bromide ( 98 mg ml − 1 ) was administrated at a rate of 5 ml kg − 1 h − 1 via the same ear vein by means of a terumo stc - 521 syringe pump ( terumo corp ., tokyo , japan ). a heparinized catheter was inserted in the left common carotid artery for blood pressure and heart rate recordings ( pressure transducer , statham , hato rey , puerto rico ), and arterial blood sampling . another catheter was inserted in the right jugular vein for drug and muscle emboli administration . body temperature was maintained at 37 - 38 . 5 ° c . by means of a heating pad connected to a thermostat . the muscles from the anterior compartment of the right lower hind limb were resected and placed in normal saline . hereafter the animals were allowed a 30 - 60 min intervention - free period to obtain stable circulatory conditions and stable concentrations of expired no . no concentration , in mixed exhaled gas , was continuously measured by means of a chemiluminescence based system ( niox , aerocrine ab , solna , sweden ) sampling at 100 ml min − 1 at the end of a mixing chamber connected to the ventilator exhaust . the full mixing of expired air thus measured on was intermittently checked by monitoring co2 concentration in the same chamber . in a few experiments , gas for no measurement was sampled from the trachea at the same point as for tidal co2 measurements , thus yielding breath by breath no concentrations . calibration was done using certified no standard gas in nitrogen ( aga specialgas , lidingδ , sweden ). the resected muscle tissue was cleared from all visible connective tissue and then homogenized and dissolved in normal saline to a concentration of 0 . 1 g muscle ml − 1 . 50 ie heparin per ml was added to the mixture . the homogenate was filtered through a filter ( 500 μm ) to prevent clotting in the three way stop - cock . the animals were divided into two groups ; 1 ) one group receiving a high dose ( 58 mg kg − 1 ) muscle homogenate and 2 ) a second group receiving the nitric oxide inhibitor l - name ( 30 mg kg − 1 ) 40 min before challenge with lower doses ( 30 to 7 . 5 mg kg − 1 ) muscle homogenate , since initial pilot experiments indicated a marked enhancement of emboli effects after l - name pretreatment . blood samples were collected and analyzed for blood gases and acid - base status ( abl 300 , radiometer a / s , copenhagen , denmark ) before l - name administration ( group 2 , time =− 40 min ) and shortly before muscle emboli challenge ( group 1 and 2 , time =− 5 min ). the muscle homogenate was infused by means of an infusion pump ( cma / 100 , microinjection pump , carnegie medicine ab , stockholm , sweden ) with a flow of 150 μl kg − 1 min − 1 via a three way stop - cock into a carrier flow ( 864 syringe pump , univentor ltd ., zejtun , malta ) of 150 μl kg − 1 min − 1 normal saline through the jugular vein catheter until full muscle emboli dose for each group was received . arterial blood samples were collected and analysed at 10 min , 20 min , 40 min and 60 min after embolization . no concentration in exhaled gas , end - tidal co 2 , heart rate , mean arterial pressure and insufflation pressure was continuously monitored on a grass polygraph ( grass instruments co , quincy , mass ., usa ) during the experiments . one rabbit pre - treated with l - name ( 30 mg kg − 1 ) received one infusion with no - gas dissolved in normal saline and one with no - gas dissolved in lipid emulsion ( intralipid ®, fresenius kabi ) through the catheter in the jugular vein without carrier flow . the infusion rate was for both liquids 0 . 5 ml kg − 1 min − 1 . there was a recovery period between the two infusions for about 200 min . the infusion liquids were created the same way . first the liquid was de - oxygenated for 20 min , in a gas - tight glass chamber with a rubber membrane with an inert gas ; in this case helium gas , but nitrogen , argon etc could also be used . after this no oxygen were allowed to enter the liquid throughout the following procedure . the liquid was then purged with pure no for a few minutes . the liquid was then collected through the rubber membrane in a gas - tight syringe with needle and from this syringe infused by means of syringe pump ( 864 syringe pump , univentor ltd ., zejtun , malta ) in the jugular vein catheter . heparin was purchased from kabi vitrum , stockholm , sweden , pancuronium bromide ( pavulon ®) was from organon , oss , holland , sodium pentobarbital was from apoteksbolaget , stockholm , sweden and dextran 70 ( macrodex ®) was from pharmalink , spanga , sweden . l - name ( n g - nitro - l - arginine methyl ester ) and routine chemicals were purchased from sigma chemical company , st louis , mo ., usa . statistical data are given as mean and standard error of the mean ( sem ). statistical significance was calculated by means of repeated measurements anova on ranks with dunnet &# 39 ; s post hoc analysis . p & lt ; 0 . 05 was assigned as significance difference . all statistical calculations were done by using a computer program ( sigmastat , jandel , san rafael , calif ., usa ). results in experiments on intravenous infusion of no dissolved in liquid medium infusion of l - name ( 30 mg kg − 1 ) throughout 10 min decreased exhaled nitric oxide ( from 19 ppb to & lt ; 1 ppb , fig1 ), increased systemic mean arterial blood pressure ( map , from 103 cmh 2 o to 128 cmhao ), and lowered heart rate ( hr , from 274 beats min − 1 to 258 beats min ′ 1 ). end - tidal co 2 and the relevant blood gas parameters were normal . rapid infusion ( 0 . 5 ml kg − 1 min − 1 during 30 min ) of no - gas dissolved in normal saline decreased map ( from 128 cmh 2 o to 75 cmh 2 o ), increased hr ( from 258 beats min ′ 1 to 295 beats mirf 1 ), and slightly increased exhaled nitric oxide ( from 0 ppb to 2 . 5 ppb , fig1 ). the methb fraction increased dramatically ( from 0 . 1 % to 20 %, fig2 ). about 200 min after the infusion , the animal had almost completely recovered , and exhaled no , map , hr and methb were 0 . 8 ppb , 123 cmh 2 o , 313 beats min − 1 and 2 . 5 % respectively . upon infusion ( 0 . 5 ml kg − 1 min − 1 during 30 min ) of no - gas dissolved in lipid emulsion exhaled no increased ( from 0 . 8 ppb to 32 . 5 ppb , fig1 ), map fell from 106 cmh 2 o to 55 cmh 2 o while hr and methb fraction ( fig2 ) were hardly affected . the results clearly show that the administration of no , via the blood circulation to the lungs , dissolved in a liquid medium , is heavily increased ( about 15 times ), monitored as exhaled no , when no is dissolved in lipid emulsion compared to normal saline . the present inventors point out a noticeable disadvantage of dissolving no in normal saline compared to lipid emulsion , in that methb is greatly increased . generation of methb may be serious if arterial oxygen saturation is reduced , for example in conditions with pulmonary hypertension like pulmonary embolism . in this experiment , the present inventors used a very high infusion rate and therefore map decreased significantly , but believe that a much slower infusion rate is sufficient to generate beneficial effects in the lung in conditions with pulmonary hypertension or thromboembolism and may achieve this without causing a major decrease in the systemic arterial blood pressure . notice that exhaled no increased to 32 . 5 ppb from & lt ; 1 ppb and that normal levels of no in mixed exhaled breath is approximately 20 ppb . further it might not be necessary to generate these levels in exhaled gas as the beneficial effects probably are on the vasculature . the magnitude of the fall in map could also partly be due to the inhibition of endogenous no generation . in another experiment , the present inventors successfully treated venous gas embolism with no dissolved in lipid emulsion , in an animal with inhibited no production , whereas it was impossible to treat the same condition with inhaled nitric oxide in the same experimental setting . the beneficial effects may be induction of vasodilation in the pulmonary vasculature , inhibition of aggregation of thrombocytes and / or minor vasodilation in the whole or parts of the systemic circulation , for example in the coronary circulation . the experiments were approved by the local animal ethics committee . male white new zealand rabbits were subjected to different doses of an intravenous infusion of no - substituted solutions at different doses . several physiological parameters were measured during the experiments , including no concentration in mixed exhaled gas ( feno ). the animals were anaesthetized via an ear vein with sodium pentobarbital , 6 mg ml − 1 in saline , 40 - 60 mg kg − 1 . the animals were placed in supine position and tracheotomised to allow mechanical ventilation , using a constant volume ventilator ( model 683 , harvard apparatus , south natick , mass ., usa ). the ventilator was supplied with no - free air using a charcoal filter ( 110 × 11 cm ). respiratory rate was 40 min − 1 , and tidal volume was initially adjusted to keep the end - tidal co 2 ( etco 2 ) at 4 . 5 - 5 . 3 % as determined by a gas analyser ( oscar - oxy , datex , helsinki , finland ), which sampled gas ( 150 ml min − 1 , 15 - 20 % of minute ventilation ) from one of two side - arms connected to the tracheal cannula , and using a naphion ® sampling catheter . to the other side - arm a pressure transducer ( statham , hato rey , puerto rico ) was connected to monitor the insufflation pressure ( ip ). the gas from the ventilator outlet was led through a switching valve to either of two beakers creating a positive end - expiratory pressure ( peep ) of 1 - 2 cmh 2 o or 4 - 5 cmhao . during the experiment the gas flow was altered between the lower peep ( 9 min ) and the higher peep ( 1 min ) with an interval of totally 10 min in order to optimise ventilation and prevent atelectasis formation . a continuous infusion containing glucose ( 24 . 3 g l − 1 ), dextran 70 ( makrodex ® 26 . 5 g l − 1 ), nahco 3 ( 6 . 2 g l − 1 ), sodium pentobarbital ( 4 . 1 g l − 1 ) and pancuronium bromide ( 98 mg ml − 1 ) was administered at a rate of 5 ml kg − 1 h − 1 via the same ear vein by means of a terumo stc - 521 syringe pump ( terumo corp ., tokyo , japan ). a heparinised catheter was inserted in the left common carotid artery for mean blood pressure ( map ) and heart rate ( hr ) recordings ( statham pressure transducer ), and arterial blood sampling . another catheter was inserted in the right jugular vein for administration of infusions . body temperature was maintained at 38 - 38 . 5 ° c . by means of a heating pad connected to a thermostat . the animals were allowed a 30 - 60 min intervention - free period to obtain stable circulatory conditions and stable feno - values . feno was continuously measured by means of a chemiluminescence - based system ( niox ®, aerocrine ab , solna , sweden ) sampling at 100 ml min − 1 at the end of a mixing chamber connected to the ventilator exhaust . the completeness of the mixing of expired air was intermittently checked by monitoring co 2 concentration in the same chamber . calibration was performed using certified no standard gas in nitrogen ( aga specialgas , lidingδ , sweden ). different carrier media solutions ( table 1 ) were dissolved and diluted with saline or water to obtain different concentration of the solutions . the solution was then placed in a gas - tight chamber and deoxygenated by means of helium bubbling for 10 min . the glass chamber was then gassed with pure nitric oxide gas for 3 - 4 min . after the stabilisation period , the animals received intravenous infusions ( cma / 100 , carnegie medicine ab , stockholm , sweden ) of the different solutions at different infusion rates into a saline carrier flow ( 864 syringe pump , univentor ltd , zejtun , malta ) of 100 μl kg − 1 min − 1 through the jugular vein catheter . blood samples were collected and analyzed for blood gases and acid - base status ( abl 300 , radiometer a / s , copenhagen , denmark ) intermittently . feno , etco 2 , hr , map and ip were continuously monitored on a grass polygraph ( grass instruments co , quincy , mass ., usa ) during the experiments . heparin ( kabi vitrum , stockholm , sweden ), pancuronium bromide ( pavulon ®, organon , oss , holland ), dextran 70 ( macrodex ®, pharmalink , spanga , sweden ) and sodium pentobarbital ( apoteksbolaget ) were purchased from apoteksbolaget , stockholm , sweden . the other chemicals were from sigma chemical co , st louis , mo ., usa . the results show that many of the tested compounds function as selective no carriers and support the generalizations presented in the claims . compared to the saline control , glucose , fructose , galactose , ribose , sorbitol , mannitol , fucose , 2 - deoxy - ribose , 1 - o - methyl - ribose , sucrose , lactobionic acid , insulin , dextran , fucoidan , 1 - propanol , 2 - propanol , 1 , 2 - propanediol , 1 , 3 - propanediol , glycerol , polyethylene glycol , n - acetyl - cysteine , and albumin exhibited a noticeable effect . when unsubstituted l - cysteine was deoxygenated and exposed to no gas , a copious precipitate , unsuitable for infusion , was formed . when short chain alcohols were tested , a marked effect was recorded for 1 - propanol and 2 - propanol . also the compounds 1 , 2 - propanediol and 1 , 3 - propanediol exhibited no delivering capacity in the experiments . although the invention has been described with regard to its preferred embodiments , which constitute the best mode presently known to the inventors , it should be understood that various changes and modifications as would be obvious to one having the ordinary skill in this art may be made without departing from the scope of the invention which is set forth in the claims appended hereto . abman s h , chatfield b a , hall s l & amp ; mcmurtry i f ( 1990 ). role of endothelium - derived relaxing factor during transition of pulmonary circulation at birth . am j . physiol . 259 : h 1921 - 7 gustafsson l e , leone a m , persson m g , wiklund n p & amp ; moncada s ( 1991 ). endogenous nitric oxide is present in the exhaled air of rabbits , guinea pigs and humans . biochem biophys res commun . 181 : 852 - 7 . heymann m a ( 1999 ). control of the pulmonary circulation in the fetus and during the transitional period to air breathing . eur j obstet gynecol reprod biol . 84 : 127 - 32 persson m g , gustafsson l e , wiklund n p , moncada s & amp ; hedqvist p ( 1990 ). endogenous nitric oxide as a probable modulator of pulmonary circulation and hypoxic presser response in vivo . acta physiol scand . 140 : 449 - 57 rimeika d et al ., am j respir crit . care med 2004 stamler j s , loh e , roddy m a , currie k e & amp ; creager m a ( 1994 ). nitric oxide regulates basal systemic and pulmonary vascular resistance in healthy humans . circulation . 89 : 2035 - 40 . tanus - santos j e & amp ; theodorakis m j ( 2002 ). is there a place for inhaled nitric oxide in the therapy of acute pulmonary embolism ?, am j respir med . 1 : 167 - 76 .

US-57333508-A

the invention relates to : a support for a cartridge provided with one or more electronically readable information carrying areas . the invention further relates to the use of a composite material for a support . the object of the present invention is to provide means , which are capable of securely transferring information with an increased density from a cartridge to an electronic circuit , and which are flexible and may be customized to a variety of physical designs . the problem is solved in that the support for the cartridge is at least partially constituted by one or more electrically connecting supports , each comprising a number of closely spaced mutually electrically insulated conductors embedded in an electrically insulating material that stretches from one of the supporting surfaces of the cartridge to a contact area for receiving and transferring the information , when said cartridge is positioned in said support . this has the advantage of providing a flexible solution , allowing a large information density on a cartridge to be safely transferred to an electronic circuit . the invention may be used e . g . in connection with replaceable medication cartridges for medication delivery devices and with other cartridges from which an item of information is to be electronically transferred .

fig1 - 3 show a cartridge containing an electrically readable information in the form of patterns of electrically conducting and electrically insulating areas and a support according to the invention comprising one or more electrically connecting supports for transferring the information to an electronic circuit . a support according to the invention has the combined function of receiving and mechanically supporting a part of the cartridge provided with information carrying areas and of transferring the information from the these information carrying areas to an electronic circuit for further processing . with reference to fig1 , 2 and 3 ( having reference numerals starting with 1 , 2 and 3 , respectively ), the cartridge 10 , 20 , 30 , respectively , is only partially shown , as indicated by the ‘ broken ’ outline in the right - hand part of the cartridge . the cartridge possesses a rotational symmetry as indicated by the arrow 11 , 21 , 31 , symbolizing the axis of symmetry . a label 12 , 22 , 32 containing information carrying areas laid out in the axial direction of the cartridge , is located on the outer surface at one axial end of the cartridge , where a lid 13 , 23 , 33 , optionally in the form of a piston when the cartridge is a replaceable medication cartridge for a medication delivery device , provides a closure of the cartridge . the label 12 , 22 , 32 comprises an electrically conducting foil 120 , 220 , 320 having information carrying areas 121 - 127 , 221 - 227 , 325 extending in the axial direction of the cartridge . in fig1 and 2 , a multitude of information carrying areas ( 121 - 127 , 221 - 227 , respectively , plus the ones situated on the hidden part of the surface ) are evenly distributed on the surface of the cartridge in a radial direction ( i . e . along the whole periphery encircling the axial direction of the cartridge ). each information carrying area , comprising patterns of electrically conducting and electrically insulating patches , thus only covers a limited radial sector of the surface . in fig3 , on the other hand , only one information carrying area 325 is indicated . this extends , however , along the whole periphery of the cartridge ( i . e . the item of information is represented by closed rings 3251 - 3260 of electrically conducting and electrically insulating areas ). each of the information carrying areas 121 - 127 , 221 - 227 , 325 contains an item of information in the form of patterns of electrically conducting and electrically insulating areas . each pattern represents an item of information in binary form . each bit of information is represented by an electrically characteristic layer in a predefined position in the information carrying area . a binary one in a specific predefined position may be represented by an electrically conducting layer covering that predefined position , and a binary zero in a specific predefined position may be represented by an electrically insulating layer covering that predefined position . alternatively , binary one may be represented by an insulating layer and binary zero by a conducting layer . because the foils 120 , 220 , 320 in fig1 - 3 containing the information carrying areas 121 - 127 , 221 - 227 , 325 are electrically conducting , it is only necessary to apply an electrically insulating layer ( e . g . a paint ) to the predefined positions representing one of the a binary states ( in this embodiment ‘ zero ’). in fig1 - 3 , the cartridge is shown in a position just above the support 15 , 25 , 35 , respectively , which , again for illustrative purposes , is shown just above a pcb with electronic components and connecting wires 16 , 26 , 36 containing pads 163 , 263 , 264 , 363 with electrical connections , symbolically indicated by an arrow 162 , 262 , 362 , to a processing unit 161 , 261 , 361 , e . g . a microprocessor . the support consists of one or more electrically connecting supports 151 , 251 , 252 , 351 embedded in an electrically insulating material 155 , 255 , 355 . the electrically connecting supports comprise alternating layers of electrically conducting 1511 , 2511 , 3511 and electrically insulating 1512 , 2512 , 3512 layers of an elastomeric material , e . g . silicone rubber with the electrically conducting layer having a concentration of carbon black sufficient for electrical conduction . each electrically conducting layer is electrically insulated from all other electrically conducting layers , so that each electrically conducting layer in effect represents an insulated conductor . by controlling the layer thicknesses , the maximum ‘ density of information ’ in the axial direction may be controlled . in the embodiments of fig1 - 3 , the supports 15 , 25 , 35 , including the electrically connecting supports 151 , 251 , 252 , 351 , are shown to be adapted to receive the curved shape of the part of the cartridge , where the information carrying areas 121 - 127 , 221 - 227 , 325 are located , by shaping them equivalently . this makes possible the use of non - elastic materials for the support , if convenient . in an operating configuration , the support is placed ( and optionally fastened ) on the pcb 160 , 260 , 360 so that electrical contact between the electrically connecting supports 151 , 251 , 252 , 351 and the pads 163 , 263 , 264 , 363 is ensured . the cartridge is positioned on the support so that electrical contact between one ( fig1 , 3 ) or two ( fig2 ) of the information carrying areas in their full axial lengths ( i . e . involving all patches of a given information carrying area representing bits of information ) and the electrically connecting supports is ensured . the geometrical dimensions of the patches , layers and pads and mutual distance between adjacent information carrying areas on the cartridge and corresponding electrically connecting supports are discussed below with reference to fig6 and 8 . by applying a specific electric potential to the electrically conducting foil 120 , 220 , 320 , this potential will be transferred from those predefined areas containing a conductive layer ( i . e . in the present embodiment those predefined areas not being covered by an insulating layer ) to the corresponding pads on the pcb . via the connecting circuitry , a direct measure of the pattern of binary states of the information carrying area connected to the pads by a given electrically connecting support is presented on the inputs of the processing unit , possibly by appropriately terminating the inputs with pull - up or pull - down circuitry depending on the potential applied to the electrically conducting foil and the definition of the binary states . a specific part of the foil may be preferably reserved to the application of the electric potential ( e . g . an area of the foil circumfering the cartridge and not occupied by information carrying areas , in fig3 e . g . the part of the foil 320 not covered by information bits in predefined positions 321 - 330 ). the support 15 , 25 , 35 is only shown as having an axial length corresponding to the axial length of the corresponding information carrying areas ( e . g . 125 in fig1 ) but it may of course extend in both axial directions if appropriate for the application in question . likewise the support is shown to cover a certain radial sector ( less than 90 degrees ), but it may of course cover any radial sector , including 360 degrees , if appropriate . in a preferred embodiment , the sector covered by the support is less than 180 degrees allowing a direct ‘ vertical ’ placement of the cartridge in the support ( in opposition to the case of a 360 degrees support , where the cartridge has to be axially inserted ). in fig1 - 3 , the label 12 , 22 , 32 containing information carrying areas 121 - 127 , 221 - 227 , 325 is placed in one axial end of the cartridge 10 , 20 , 30 covering only the space occupied by the axial extent of the lid / piston 13 , 23 , 33 to ensure that a full view of the contents of the cartridge is available for inspection . of course it might be located in any convenient position along the surface of the cartridge . similarly , in fig1 - 3 , the information carrying areas extend in the axial direction of the cartridge . they might as well extend in a radial direction ( as discussed in connection with fig4 and 5 ) or in a direction there between ( e . g . forming one or more helixes on the surface of the cartridge ), if convenient , as long as the support , including the electrically connecting support ( s ), is adapted thereto . the electrical connections , schematically indicated by an arrow 162 , 262 , 362 , connecting the pads 163 , 263 , 264 , 363 with the processing unit 161 , 261 , 361 may be a one to one parallel set of electrical connections between each pad and a corresponding input on the processor 161 , 261 , 361 , but it may also comprise a multiplexing or coding unit to reduce the number of necessary inputs to the processing unit . fig1 shows a cartridge containing an electrically readable information in the form of patterns of patches in the axial direction of the cartridge and a support according to the invention comprising one electrically connecting support for transferring the information to an electronic circuit . the binary information contained in each of the information carrying areas 121 , 122 , 123 , 124 , 125 , 126 , 127 is the same as schematically indicated in the information carrying areas 125 and 126 in that the patterns of electrically conducting patches , exemplified by 1250 , 1260 ( no filling ), and electrically insulating patches , exemplified by 1251 , 1261 ( hatched ), are identical . the embodiment in fig1 benefits from the rotational symmetry of the cartridge 10 and the label 12 with identical information carrying areas 121 - 127 equally distributed on the label along the periphery of the cartridge in that it only requires the user to position the cartridge properly in a radial direction ( possibly involving a slight rotation of the cartridge around its axis of symmetry ) to ensure that an electrical contact between one of the information carrying areas 121 - 127 and the electrically connecting support 151 is present ( since the positioning in an axial direction 11 may be mechanically ensured by receiving means for the cartridge ). the control of the cartridge being correctly positioned may be in the hands of the processing unit 161 , which , if necessary , may indicate to the user via a display ( not shown ) or a voice interface that a corrective action is required , and which may block further use of the device , if the cartridge is not correctly positioned . fig2 shows a cartridge containing an electrically readable information in the form of patterns of patches in the axial direction of the cartridge and a support according to the invention comprising two electrically connecting supports for transferring the information to an electronic circuit . in the embodiment in fig2 , the support 25 comprises two electrically connecting supports 251 , 252 for simultaneously reading two items of information from two information carrying areas ( e . g . 225 , 226 ) on the cartridge 20 . in fig2 the evenly distributed information carrying areas 221 - 227 contain an item of information in a true binary form alternating with the information in its inverted form as indicated by the schematically illustrated patterns of electrically conducting 2261 and insulating 2251 patches in information carrying areas 225 and 226 , respectively , one pattern being the inverse of the other . apart from the advantages of the rotational symmetry as described above in connection with fig1 , the embodiment of fig2 has the advantage of reading the information in a binary true and inverted form , which allows the safety in reading to be improved . instead of providing the information in its true and inverted forms , the same binary representation of the item of information may be provided in all information carrying areas ( as in fig1 ) and read twice , which also allows an improved safety in reading . in the embodiment of fig2 , the electrically conducting ‘ end ’- patches 2250 , 2260 may be used for connecting a power supply voltage . fig3 shows a cartridge containing an electrically readable information in the form of ring patterns and a support according to the invention comprising one electrically connecting support for transferring the information to an electronic circuit . in the embodiment in fig3 , the support 35 comprises only one electrically connecting support 351 for reading an item of information from an information carrying area 325 on the cartridge 30 . the information carrying area 325 extends along the whole periphery of the cartridge 30 . a binary representation of the item of information is implemented by closed rings 3251 - 3260 of electrically conducting and electrically insulating areas in predefined positions . this embodiment has the advantage of having a full rotational symmetry so that the cartridge 30 may be ( radially ) arbitrarily oriented in the support . fig4 . a - 4 . e show various ways of placing information carrying areas for holding electronically readable information on a cartridge . fig4 . a - 4 . d show a cartridge 40 with an axis of rotational symmetry 41 and information carrying areas located at one axial end of the cartridge . fig4 . a shows two information carrying areas 401 , 402 positioned side by side in a radial direction on the surface of the cartridge 40 ( i . e . along the periphery perpendicular to the axis of symmetry ). each information carrying area covers only a limited radial sector of the surface . fig4 . b shows two information carrying areas 403 , 404 positioned side by side in the axial direction 41 on the surface of the cartridge 40 ( i . e . along the periphery parallel to the axis of symmetry ). each information carrying area 403 , 404 covers only a limited radial sector of the surface . fig4 . c shows two information carrying areas 405 , 406 positioned side by side in the axial direction on the surface of the cartridge 40 ( i . e . along the periphery parallel to the axis of symmetry 41 ). each information carrying area 405 , 406 encircles the entire radial periphery of the cartridge . fig4 . d shows information carrying areas 410 , 411 , 412 , 413 , 414 positioned side by side , evenly distributed in a radial direction on the surface of the cartridge 40 ( i . e . along the periphery perpendicular to the axis of symmetry ). each information carrying area covers only a limited radial sector of the surface . information carrying areas 410 , 411 , 412 , 413 , 414 plus identical ones situated on the hidden part of the surface are evenly distributed on the surface of the cartridge in a radial direction , i . e . extending along the whole periphery encircling the axial direction of the cartridge . fig4 . e shows an information carrying area 415 extending along the major part of the axial length of the cartridge 40 . the information carrying area is located within in a surface area 420 corresponding to a radial sector 421 . in fig4 . e a single information carrying area is shown within the surface area 420 . there might as well , however , be several information carrying areas located side by side in axial ( cf . fig4 . b ) or radial ( cf . fig4 . a ) direction . fig5 . a - 5 . e show various ways of laying out the electrically conducting and electrically insulating areas in predefined positions within an information carrying area , implementing a binary representation of an item of information in its true and inverted form . in each of fig5 . a - 5 . e two information carrying areas containing an item of information in a true and inverted binary form , respectively , are schematically shown . each information carrying area has a rectangular shape defining a longitudinal direction as the direction defined by its longest side . a direction is also defined by the direction perpendicular to the face between two neighboring predefined positions each containing a specific bit of information . fig5 . a shows an embodiment with two information carrying areas 50 , 51 located side by side in a direction perpendicular to the direction 505 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 511 ( no filling ) or electrically insulating 501 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 50 , 51 may e . g . be used in fig4 . a . and 4 . d . fig5 . b shows an embodiment with two information carrying areas 52 , 53 located side by side in a direction perpendicular to the direction 525 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 531 ( no filling ) or electrically insulating 521 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches are separated by a an ‘ empty ’ space 520 , 530 of width equal to the width of each of the information carrying patches 521 , 531 . the ‘ empty ’ space may consist of an electrically conducting or insulating layer ( as long as the pads on the pcb ( cf . fig1 - 3 ) are correspondingly laid out ). the structure of information carrying areas 52 , 53 may e . g . be used in fig4 . a . and 4 . d . fig5 . c shows an embodiment with two information carrying areas 54 , 55 located side by side in a direction 545 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 551 ( no filling ) or electrically insulating 541 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 54 , 55 may e . g . be used in fig4 . a . and 4 . d . fig5 . d shows an embodiment with two information carrying areas 56 , 57 located side by side in a direction 565 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 562 , 571 ( no filling ) or electrically insulating 561 , 572 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 56 , 57 may e . g . be used in fig4 . b . and 4 . c . fig5 . e shows an embodiment with two information carrying areas 58 , 59 located side by side in a direction perpendicular to the direction 585 defined by adjacent predefined positions . each individual bit of information is implemented as a patch of electrically conducting 591 ( no filling ) or electrically insulating 581 ( hatched ) material located at a specific predefined position of the information carrying area . neighboring patches abut each other . the structure of information carrying areas 58 , 59 may e . g . be used in fig4 . b . and 4 . c . fig6 . a - 6 . c show various geometries of an electrically connecting support according to the invention . common for fig6 . a - 6 . c is that the layer thicknesses 630 , 640 of the electrically insulating and conducting layers , respectively , are exaggerated compared to the dimensions of the patches 61 on the information carrying areas and the pads 62 on the pcb . fig6 . a shows an embodiment of an electrically connecting support 60 , where the thickness t il 630 of the insulating layer 63 is larger than the thickness t cl 640 of the conducting layer 64 . the patches 61 of the information carrying area are shown to be of equal width wpda 610 and to abut each other . the pads 62 on the pcb are shown to have equal width wcp 620 and to be evenly distributed with a distance diacp 621 between each pad . fig6 . b shows an embodiment of an electrically connecting support 60 , where the thickness t il of the insulating layer 63 is smaller than the thickness t cl of the conducting layer 64 . fig6 . c shows an embodiment of an electrically connecting support 60 , where the thickness t il of the insulating layer 63 equals the thickness t cl of the conducting layer 64 . the relation diacp & gt ; 2 * t cl makes sure that the electrical states of adjacent information carrying patches on the cartridge are not transferred to the same pad in the contact area under the assumption that the border between adjacent patches is located at a position ‘ corresponding to midway between two pads ’. the fulfillment of the relation wcp & gt ; t il + t cl ensures that at least one conducting layer contacts any given pad . correspondingly , the fulfillment of the relation wpda & gt ; t il + t cl ensures that each patch has contact to at least one of the conducting layers of an electrically connecting support , when the cartridge is properly placed in the support . in fig6 . a - 6 . c , the information carrying patches on the cartridge are shown as abutted . this need not be the case . they may have any width wpda as long as the relation wpda & gt ; t il + t cl is fulfilled to ensure that at least one conducting layer contacts any given information carrying patch . the relations reflect the minimum distances of pads and patches and between pads and thus for given layer thicknesses determine the information density ( minimum width per bit ). fig7 . a - 7 . b show an example of a cartridge and a support according to the invention comprising three electrically connecting supports made of elastic materials . fig7 . a shows a cartridge 71 having an axis of rotational symmetry 72 being positioned just above a support 70 comprising three individual electrically connecting supports 701 , 702 , 703 ready for receiving the cartridge . the cartridge is provided with information carrying areas positioned on the cartridge along its radial periphery with a spacing corresponding to the geometry of the electrically connecting supports 701 , 702 , 703 . the space between the electrically connecting supports may be filled with an isolating material ( e . g . silicone rubber ), not shown . in fig7 . b the cartridge 71 is positioned in the support 70 and fixed with a slight downwards pressure indicated by the arrow 73 . the support including the electrically connecting supports 701 , 702 , 703 is made of elastic materials so that it conforms to the shape of the cartridge over the axial length of the support , when the cartridge is placed in the support . the three items of information that may be simultaneously read may be identical , in which case the redundancy may be used to improve the safety in reading ( by a simple majority test or by more advanced error correcting techniques ), or they may be different , in which case a larger amount of information may be read from the cartridge . fig8 shows geometries involved in reading an item of information provided a multitude of times along the periphery of a cartridge with a rotational symmetry by means of two electrically connecting supports . in fig8 , the electrically connecting supports 81 , 82 are shown in a position where they read information from information carrying areas 830 , 840 , respectively , and transfer the information to groups of pads 83 , 84 , respectively , on a pcb . the information carrying areas 810 , 820 , 830 , 840 , 850 , 860 on a label 80 carry an item of information alternatingly in a binary true and inverted form as indicated by the schematically shown individual patches of equal width wpda 89 . the patches are either electrically conducting 8102 ( no filling ) or electrically insulating 8101 ( hatched ). the following geometric relations between the information carrying areas positioned on a cartridge and the electrically connecting supports 81 , 82 of a support according to the invention for the cartridge : hica = height 87 of information carrying areas dica = distance 88 between information carrying areas hctm = height 85 of electrically connecting supports dctm = distance 86 between electrically connecting supports . hica & lt ; dctm ensures that the cartridge cannot be positioned in such a way that a given information carrying area has contact to two electrically connecting supports at the same time . hctm & lt ; dica ensures that the cartridge cannot be positioned in such a way that a given electrically connecting support has contact to two information carrying areas at the same time . dica & lt ; 2 * hctm + dctm ensures that the cartridge cannot be positioned in such a way that the electrically connecting supports fall entirely between two information carrying areas , in which case they would not have contact to any of the information carrying areas of the cartridge . dctm & lt ; 2 * hica + dica ensures that the cartridge cannot be positioned in such a way that two adjacent information carrying areas fall entirely between the electrically connecting supports , in which case the latter might not have contact to any of the information carrying areas of the cartridge . in a preferred embodiment , the following relation is fulfilled ( in addition to the above mentioned relations between dctm , hctm , dica , hica ), dctm + hctm = dica + hica , which ensures that the electrically connecting supports 81 , 82 will have contact to two of the information carrying areas irrespective of the radial orientation of the cartridge in the support . some preferred embodiments have been shown in the foregoing , but it should be stressed that the invention is not limited to these , but may be embodied in other ways within the subject - matter defined in the following claims . the invention may for example be applied to the electronic marking of cartridges for other purposes than medical , e . g . film cartridges , various cassettes containing media holding digital data or analog signals ( e . g . representing software , data , film or music ), etc ., that are used in an electronic ‘ environment ’ ( e . g . in a camera , computer , recorder , player , viewer , etc . ).

US-56815309-A

a litter box enclosure assembly incorporates an electric air pump located within an airtight container connected to the enclosure . the enclosure has a flap located in one wall to allow the cat to enter and exit . malodorous air is continuously removed from the litter box enclosure as it is compressed by the air pump and moved under pressure through a small diameter hose to a remote location .

this invention is best understood by reference to the drawings . referring to fig1 to 3 , the preferred embodiment of the litter box enclosure 1 is rectangular in shape and contains a top , a bottom , and four walls connecting the top and bottom . other shapes are suitable , such as square , triangular with three walls , cylindrical with a single wall , pyramidal with three walls and a top formed by the intersection of the three walls , and the like . a bottom is preferred but not required . an opening 2 of an appropriate size to allow ingress for the cat is located in one of the walls . a pivoting flap 3 is positioned within the opening and is of such a design that it can be easily pushed open from either direction and is not completely airtight . to allow entry by the human caretaker for the cat , the litter box enclosure preferably has an upper section 8 and bottom section 9 . the bottom section is secured to the upper section by clips 5 or the like to ensure a tight fit . the enclosure is preferably made of plastic although other materials can be used . a litter box containing litter ( not shown and not part of the enclosure ) is placed in the bottom section of the enclosure . an air pump 4 is attached to the top of the litter box with the air pump &# 39 ; s intake stem 10 communicating with the interior of the litter box enclosure . the air pump compresses air and moves it under pressure through a small diameter hose . the most common types of air pumps use a moving diaphragm or cylinder to compress the air . a suitable air pump is a single outlet rena model 300 aquarium air pump manufactured by rena france . this air pump employs a moving diaphragm and is able to pump up to 200 liters of air per hour at a maximum pressure of 300 mb . the choice of the air pump is dependent on the size of the enclosure . as the size of the enclosure increases , the capacity of the air pump increases correspondingly . one end of a small diameter flexible hose 6 is attached to the outlet stem 11 on the air pump . the other end of the small diameter hose is passed through an exterior wall 12 to the outdoors . the small diameter hose can alternately be passed through an exterior window . as another alternative , the outlet of the hose can be vented to an interior space , such as a garage or a crawl space , if odor in such a space is not a concern or if the air is filtered to reduce odor . the diameter of the outlet hose is generally less than one inch and is preferably less than one - half inch . when the air pump is connected to a power source via the air pump &# 39 ; s power cord 7 , the pump begins drawing malodorous air from the interior of the enclosure through the pump &# 39 ; s intake stem . the malodorous air is compressed by the pump and exits the pump under pressure through the pump &# 39 ; s outlet stem and enters the small diameter hose . the malodorous air travels through the small diameter hose to the outdoors . referring now to fig4 , this movement of air sets up an air pattern in which air from the environment ( represented by arrows 13 ) surrounding the enclosure is pulled into the enclosure through the opening covered by the flap . the air then moves through the enclosure ( represented by arrows 14 ) and into the pump where it is compressed and travels under pressure through the small diameter hose and exits to the outdoors ( represented by arrows 15 ). the use of a pump to compress the malodorous air allows a small diameter hose to be used to move the malodorous air under pressure to a remote location outdoors . this eliminates the need for the bulky large diameter duct work and accompanying modifications to exterior walls or windows that must be used with systems designed using fans as the means of ventilation . because the malodorous air is pumped under pressure , the maximum length of tubing that may be used and the number of bends allowed are also significantly greater than with the fan based systems . referring now to fig5 , a second embodiment of the litter box differs from the first embodiment in the location of the air pump . in the second embodiment , the air pump is mounted away from the enclosure and communicates with the interior of the enclosure via a large diameter hose 16 connected between fitting 18 of the enclosure and intake fitting 19 of the air pump . this embodiment reduces the noise level inside the litter box enclosure . referring now to fig6 , a third embodiment of the litter box enclosure reduces the noise level from the air pump inside the enclosure and in the environment surrounding the enclosure . this enclosure incorporates the use of a pump contained within an airtight box or other enclosure 17 connected to the litter box enclosure via a large diameter hose . one end of a large diameter hose is connected to the air intake stem 20 on the airtight box and the other end of the large diameter hose is connected to the air outlet stem on the litter box enclosure . the diameter of the hose is such that air can easily pass between the litter box enclosure and the airtight box . the diameter of the large hose is generally about one to three inches and is preferably about one and one - half to two inches . the small diameter hose 6 passes through the side of the airtight box through a hole slightly smaller than the diameter of the hose such that an airtight seal is made but the hose is not restricted to a point where air cannot flow easily under pressure . the power cord for the pump is also passed through the wall of the airtight box such that an airtight seal is made . when the air pump of the third embodiment is turned on , malodorous air is drawn from the litter box enclosure through the litter box enclosure &# 39 ; s outlet stem , through the large diameter hose , through the airtight box &# 39 ; s intake stem , through the airtight box , through the air pump &# 39 ; s intake stem , and into the pump where the malodorous air is compressed . the compressed malodorous air exits the air pump through the air pump &# 39 ; s exit stem and moves under pressure through the small diameter hose , and through an exterior wall or window to the outdoors .

US-89423607-A

a stump grinder has a grinding arm that durably mounts a rotatable grinding wheel by securing the drive shaft of a motor to the grinding wheel such that a pair of bearings within the motor support one side of the grinding wheel and by supporting the other side of the grinding wheel with a stub shaft received within a third bearing . the grinding arm is laterally offset on the frame of the stump grinder to have a swing angle that is not symmetrical relative to the width of the frame , but with the swing angle starting at one side of the frame and then traversing across substantially the entire width of the frame to improve the ability of the operator to see the grinding wheel . a single joystick is movable in orthogonal directions corresponding to desired up and down and side - to - side pivoting motions of the grinding arm . the joystick includes a depressible trigger for starting and stopping the operation of the grinding wheel .

referring first to fig1 , one embodiment of a stump grinder according to this invention is generally illustrated as 2 . stump grinder 2 comprises a traction frame 4 that carries a power source 6 , such as an internal combustion engine , that provides the power for propelling frame 4 over the ground . the propulsion means can take different forms , but in the illustrative embodiment shown in fig1 comprises a pair of elongated , ground engaging tracks 8 . a single such track 8 is located adjacent and immediately outboard of each of the opposite left and right sides of frame 4 . frame 4 has an upwardly extending portion 10 at the rear thereof behind which an operator may walk on the ground as frame 4 is propelled over the ground . the top of rear portion 10 of frame 4 carries various controls that may be comfortably gripped by the operator as the operator stands behind frame 4 . among these controls is a traction and steering control indicated generally as 12 . when power source 6 is in operation , the operator may manipulate traction and steering control 12 to cause a drive system ( not shown ) carried on frame 4 to drive ground engaging tracks 8 in forward or reverse at desired speeds with steering being accomplished through driving tracks 8 differentially at different speeds . the tracked frame 4 illustrated herein as well as the traction and steering control 12 are of the type shown in u . s . pat . nos . 6 , 460 , 640 and 6 , 709 , 223 , which are assigned to the assignee of this invention and which are hereby incorporated by reference . a grinding arm 14 is mounted on the front of frame 4 in a laterally offset position in which grinding arm 14 extends forwardly along the left side of frame 4 with grinding arm 14 overlying the left side of frame 4 . grinding arm 14 comprises two sections thereof , namely a rear section 16 and a front section 18 . rear section 16 of grinding arm 14 pivots on frame 4 about a lateral , substantially horizontal pivot axis x such that the entire grinding arm 14 , i . e . both the rear and front sections 16 and 18 thereof , can swing or pitch downwardly or upwardly towards or away from the ground as indicated by the arrows a and b in fig3 . pivot axis x is located very low on frame 4 at a distance that is only a few inches above the rotational axis of the front drive pulley or sprocket on track 8 . front section 18 of grinding arm 14 pivots relative to rear section 16 about a substantially vertical pivot axis y to swing or pivot front section 18 from side - to - side as indicated by the arrows c and d in fig2 and 3 . referring to fig3 and 4 , frame 4 includes a pair of laterally spaced , forwardly extending support walls 20 having at least lower portions thereof that extend forwardly to a front end of frame 4 . a top wall 22 joins and connects support walls 20 together over rear portions of support walls 20 . note that in fig4 the inner support wall 20 has been removed to illustrate a first hydraulic actuator 24 that is located between support walls 20 and beneath top wall 22 . the cylinder 26 of first hydraulic actuator 24 is pivotally connected to the rear of support walls 20 by a pivot pin 30 . rear section 16 of grinding arm 14 also includes a pair of side walls 32 that are joined or connected together by a top wall 34 . side walls 32 of rear section 16 have a slightly narrower spacing than the spacing of support walls 20 of frame 4 such that rear ends of side walls 32 of rear section 16 nest between support walls 20 of frame 4 . side walls 32 of rear section 16 are generally l - shaped with one leg of the l - shape extending downwardly to pivotally journal rear section 16 of grinding arm 14 , and thus the entire grinding arm 14 , on a pivot pin 36 that is carried between support walls 20 and that forms the horizontal pivot axis x for grinding arm 14 . the rod 27 of first hydraulic actuator 24 pivotally connects to the rear ends of side walls 32 of rear section 16 at a pivot pin 38 close to the juncture of the legs of the l - shape and above the pivot pin 36 forming the pivot axis x . thus , retraction of rod 27 into cylinder 26 of first hydraulic actuator 24 causes upward pivoting of grinding arm 14 in the direction of arrow b and extension of rod 27 out of cylinder 26 causes downward pivoting of grinding arm 14 in the direction of arrow a . front section 18 of grinding arm 14 is generally similar in structure to that of rear section 16 in the sense that front section 18 also comprises a pair of laterally spaced side walls 40 that are joined or connected together by a top wall 42 . side walls 40 of front section 18 are laterally spaced apart by a greater distance than side walls 32 of rear section 16 to allow the rear of front section 18 to telescopically nest over and around the front of rear section 16 . a vertical pivot structure 44 forming the vertical pivot axis y pivotally joins the front and rear sections 18 and 16 together with side walls 40 of front section 18 having u - shaped cutouts 46 to allow front section 18 to swing or pivot around the front of rear section 16 without interference between the two . as shown in fig3 , a second hydraulic actuator 48 has a cylinder 50 that is pivotally mounted by a pivot pin 52 to the exterior of one of side walls 32 of rear section 16 . rod 51 of second hydraulic actuator 48 is pivotally connected to an exterior of one of side walls 40 of front section 18 of grinding arm 14 . extension and retraction of rod 51 of second hydraulic actuator 48 causes front section 18 of grinding arm 14 to swing or pivot about the vertical pivot axis y relative to rear section 16 of grinding arm 14 . fig1 - 4 illustrate grinding arm 14 in a home position in which grinding arm 14 is substantially horizontal and with grinding arm 14 being longitudinally aligned with rear section 16 of grinding arm 14 with grinding arm 14 extending straight ahead in a longitudinal fore - and - aft direction . from this home position , grinding arm 14 can pivot or pitch downwardly in the direction of arrow a in fig3 approximately 28 ° and can pivot or pitch upwardly in the direction of arrow b in fig3 approximately 52 °, for a total of approximately 80 ° of swing about the horizontal pivot axis x . from this home position , front section 18 of grinding arm 14 can pivot to the left in the direction of arrow c in fig3 approximately 80 ° and can pivot to the right in the direction of arrow d in fig3 approximately 20 °, for a total of approximately 100 ° of swing about the vertical pivot axis y . clearly , front section 18 of grinding arm 14 has an asymmetric swing angle in which it swings approximately four times further to the right than it does to the left ( i . e . 80 ° to the right versus 20 ° to the left ). front section 18 of grinding arm 14 has a front end that houses a rotatable grinding wheel 54 . grinding wheel 54 is in the form of a substantially flat , planar disc that has a plurality of stump or wood grinding tools 56 attached to the periphery thereof at circumferentially spaced locations . the nature of the wood grinding tools 56 that are used is not important to this invention and may be of any type that is known in the stump grinder art . grinding wheel 54 is rotatably journalled on grinding arm 14 for rotation about a lateral , substantially horizontal , grinding axis x 1 . see fig3 . as shown in fig5 and 6 , grinding wheel 54 is mounted to front section 18 of grinding arm 14 and is powered by a hydraulic motor 58 in a simple and durable manner . motor 58 is bolted to an exterior of one of side walls 40 of front section 18 . motor 58 has an inner portion 60 extending through side wall 40 to be positioned relatively close to one side face of grinding wheel 54 . motor 58 has an inwardly projecting drive shaft 62 that sticks further inwardly from the inner portion of motor 58 such that drive shaft 62 extends into , but not through , a central bore 64 in grinding wheel 54 . fig6 depicts central bore 64 . motor 58 includes a pair of radial bearings ( not shown ) within the housing thereof that rotatably journal and support drive shaft 62 of motor 58 against radial loads on drive shaft 62 . motor 58 is preferably a tj series motor manufactured by the hydraulic pump / motor division of parker hannifin corporation . one face of grinding wheel 54 has a drive hub 68 bolted thereto . the interior of drive hub 68 has a keyed , splined , or tapered drive connection ( not shown ) to drive shaft 62 of motor 58 . thus , as motor 58 is rotated by hydraulic fluid flow therethrough , the rotation of drive shaft 62 will be transferred through drive hub 58 to grinding wheel 54 to rotate the same about its axis of rotation x 1 . the support of grinding wheel 54 could end there , as is conventional in the stump grinder art , with grinding wheel 54 simply being supported by motor 58 alone . however , the applicants have found that this imposes undesirably high loads on motor 58 in many stump and wood grinding operations . thus , grinding wheel 54 of this invention is further supported on the other side or face thereof as well . a support hub 70 that carries an outwardly extending stub shaft 72 is bolted to the opposite side face of grinding wheel 54 . see fig7 . a third radial bearing 74 , namely a stub shaft bearing , is then bolted to the inside of the opposite side wall 40 of front section 18 of grinding arm 14 . third bearing 74 rotatably journals and supports stub shaft 72 to support the opposite side of grinding wheel 54 . thus , going from right to left in fig5 , there are three radial bearings that carry the radial loads from grinding wheel 54 , i . e . a first drive shaft radial bearing inside motor 58 , a second drive shaft radial bearing inside motor 58 with both drive shaft bearings being on one side of grinding wheel 54 , and a third stub shaft radial bearing 74 on the opposite side of grinding wheel 54 . this allows a hydraulic motor 58 to be simply and inexpensively bolted to one side wall 40 of front section 18 of grinding arm 14 but , with the use of stub shaft bearing 74 , still provides radial bearing support on both sides of grinding wheel 54 . enough vertical slop or play is desirably provided between the bolts 76 and the holes that are used to bolt stub shaft bearing 74 in place such that the vertical position of stub shaft bearing 74 on side wall 40 can be shifted up and down as need be before stub shaft bearing 74 is firmly tightened into place to allow alignment of stub shaft 72 with drive shaft 62 . referring now to fig2 and 7 , stump grinder 2 of this invention includes a joystick 80 for simple and intuitive operation of grinding arm 14 and grinding wheel 54 . joystick 80 has a centered neutral position as is typical of joysticks , which neutral joystick position corresponds to the home position of grinding arm 14 . joystick 80 is pivotally mounted in any suitable manner in frame 4 for movement in a longitudinal fore - and - aft direction as indicated by the arrows e and f in fig2 . this longitudinal motion of joystick 80 will control first hydraulic actuator 24 to cause grinding arm 14 to pivot up in the direction of the arrow b when joystick 80 is pulled back in the direction of arrow f and to cause grinding arm 14 to pivot down in the direction of the arrow a when joystick 80 is pushed forwardly in the direction of arrow e . the pivotal mounting of joystick 80 also permits movement of joystick 80 in a lateral side - to - side direction as indicated by the arrows g and h in fig2 . this lateral motion of joystick 80 will control second hydraulic actuator 48 to cause front section 18 of grinding arm 14 to swing from side - to - side in a direction corresponding to the direction of joystick 80 , front section 18 swinging in the direction of the arrow c when joystick 80 swings in the direction of the arrow g and in the direction of the arrow d when joystick 80 swings in the direction of the arrow h . thus , the user need only operate a single control , namely joystick 80 , and need move that control only in a direction corresponding to the up and down and side - to - side pivoting that is desired for grinding arm 14 . this greatly eases the task of operating grinding arm 14 , especially for a new or relatively unskilled operator , since the operator need not grip and coordinate the operation of separate control levers . all the operator need use is the single joystick 80 . to further ease the task of operating stump grinder 2 , joystick 80 can be provided with a compressible trigger 82 on the front side thereof that controls the on - off operation of grinding wheel 54 . in order to start grinding wheel 54 , the operator need only press a button 84 on top of joystick 80 and then squeeze trigger 82 rearwardly until the top of trigger 82 abuts against joystick 80 . a switch ( not shown ) will be closed by trigger 82 and grinding wheel 54 will start rotating . once trigger 82 is closed , the operator can release button 84 on top of joystick 80 . to stop grinding wheel 54 , the operator need only release trigger 82 , which causes trigger 82 to pivot back forwardly away from joystick 80 under the bias of a spring ( not shown ), to stop the rotation of grinding wheel 54 . integrating the on - off control for grinding wheel 54 on the same joystick 80 that controls the up and down pitching of grinding arm 14 and the side - to - side traverse of grinding wheel 54 further simplifies the task of operating stump grinder 2 . the offset nature of grinding arm 14 provides better visibility to the operator during a stump grinding operation . of course , during such an operation , the operator will wear eye protection to protect his or her eyes from wood chips or other debris being generated by stump grinder 2 . but , grinding wheel 54 can now traverse or swing from the extreme left side of frame 4 in a large arc extending in front of frame 4 and across substantially the entire width of frame 4 without being obstructed by rear section 16 of grinding arm 14 , which remains in place on the left side of frame 4 out of the line of vision of the operator . this allows the operator to better see and place grinding wheel 54 at a desired location on the stump or other debris that is being ground down . various modifications of this invention will be apparent to those skilled in the art . thus , the scope of this invention is to be limited only by the appended claims .

US-201514847477-A

a towel dispenser includes a housing for receiving toweling . the housing includes a main body ; a loading door that is configured to rotate relative to the main body between a closed position and an open position ; and a guide system that includes a first roller attached to the main body and a second roller attached to the loading door . the towel dispenser may include a motor for driving dispensing of the toweling from the housing and an associated sensor . the towel dispenser can be mounted to an underside of a cabinet . in an aspect , the loading door includes a curved body and a lip that generally extends away from the curved body . a portion of the main body that extends over the lip when the loading door is in the closed position includes the motor therein .

referring to the drawings wherein identical reference numerals denote the same elements throughout the various views , fig1 shows a towel dispenser 10 according to one embodiment of the present invention . the dispenser 10 is for automatically dispensing conventional pre - perforated paper towels such that they can be separated at a perforation 16 . therefore the dispenser 10 can be mounted where consumer paper towels are typically made available such as under a household cabinet 18 and above a counter 19 as shown in fig1 . referring now to fig2 and 3 , dispenser 10 includes a housing 20 that includes a main body 22 and a loading door 24 . the main body 22 includes side walls 26 and a front wall 28 . the main body 22 defines a cavity 32 that is dimensioned to receive toweling 12 . in this regard , tabs 34 are positioned within cavity 32 on opposite sides of cavity 32 for supporting the toweling 12 . in the illustrated embodiment , the cavity 32 is dimensioned to receive the toweling 12 in the form of a roll 14 of standard consumer paper toweling but it should be appreciated that the toweling 12 could be accordion folded or the like . a perforation 16 ( as shown in fig6 ) is formed within the toweling 12 of roll 14 . the perforation 16 is dimensioned to define an edge of an individual towel and to assist separation of individual towels from the roll 14 . roll 14 will typically contain many perforations 16 . it should be appreciated that , alternatively , the toweling 12 could be accordion folded or otherwise provided . one edge of front wall 28 defines a separation device 36 for further assisting the separation of individual towels from roll 14 . as used herein , the term “ toweling ” refers to any sheet or web material that is suitable for wiping or drying . by way of example and not limitation , toweling 12 can be formed of paper , a synthetic material ( such as a polymeric film ), woven textile , or a non - woven textile material . as used herein , the term “ perforation ” refers to the point of separation between individual sheets within the toweling 12 and can be defined by a score , a opening or row of openings formed in toweling 12 such that an individual towel can be separated from the toweling 12 . the loading door 24 is pivotally attached to the main body 22 and movable between a closed first position and an open second position . when in the closed first position , the door 24 covers an opening 38 that is formed in the main body 22 . when in the open second position , the door 24 provides for access to the cavity 32 through the opening 38 . position indicating sensors ( not shown ) are provided for generating a signal indicative of the position of the door 24 . the door 24 includes a curved body 42 , a lip 44 , and two bracket walls 46 that are disposed generally perpendicularly to the lip 44 and at opposite sides thereof . as can be seen in fig1 , when the door 24 is in the closed first position , lip 44 of door 24 and the front wall 28 define a gap 45 . referring now to fig5 , a guide system 50 is positioned within the housing 20 and includes a plurality of guiding members . the guide system 50 defines a path p as shown in fig3 and 4 . the path p can contact the guide bar 53 as shown in fig3 or can bypass the guide bar 53 as shown in fig4 . the guide system 50 is configured such that when the roll 14 of toweling 12 is positioned within the cavity 32 , toweling 12 extends along path p through the gap 45 . a first set of guiding members are attached to the main body 22 and include a drive roller 52 and a guide bar 53 . the drive roller 52 extends between side walls 26 and is positioned between cavity 32 and front wall 28 . guide bar 53 also extends between side walls 26 and is positioned between the drive roller 52 and the cavity 32 . a second set of guiding members includes a rotatable sensor roller 54 and rotatable a pinch roller 58 that each extend between the two bracket walls 46 and are movable with the door 24 . continuing to refer to fig5 , the sensor roller 54 is generally cylindrical and is connectable to a motor 62 via a transmission and that includes a gear 66 that is attached to the sensor roller 54 . in the illustrated embodiment , the sensor roller 54 is configured to be driven such that it has a slower surface speed that the drive roller 52 . in this manner , tension is created in toweling 12 between the sensor roller 54 and the drive roller 52 such that the perforation 16 can be expanded . alternatively , the sensor roller 54 is not attached to the motor 62 but is configured to be rotated by contact with the toweling 12 . in the illustrated embodiment , the sensor roller 54 has a centrally formed circumferential ridge 55 disposed between two end sections 56 . the end sections 56 have a first diameter and the ridge 55 has an second diameter . the second diameter of the ridge 55 is greater than the first diameter and is for expanding the perforation 16 as it passes over the sensor roller 54 . alternatively , the sensor roller 54 could have a consistent diameter across its full length and could be straight or bowed for expansion of the perforation 16 . as can be seen in fig5 , the sensor roller 54 is positioned generally parallel to the pinch roller 58 . the pinch roller 58 is generally cylindrical and of uniform diameter and includes a plurality of sub - rollers 59 . the pinch roller 58 is also connectable to motor 62 via the transmission . referring now to fig3 and 4 , the motor 62 is mounted on one of the side walls 26 and is configured to be powered by a battery 68 . the motor 62 is mechanically connected to the drive roller 52 by the transmission . in the illustrated embodiment , the transmission includes a plurality of gears . as used herein , the term “ gears ” refers to a device having a toothed surface that is configured to interlock with another toothed surface . alternatively the transmission could include a belt and pulley , wheels , or other such power transmitting structure . referring now to fig3 , a perforation sensor 80 is included in the housing 20 and is configured to generate a signal indicative of the presence of a perforation 16 in the toweling 12 , i . e ., a perforation signal . in the illustrated embodiment , the perforation sensor 80 is a photo - electronic device and includes a light source 82 positioned on one side of path p and a photo - conductive receiver 84 positioned on an opposite side of path p and is operable to detect light from the light source 82 . the sensor 80 is configured to generate a signal when it receives light from the light source 82 . in this regard , light from the light source 82 is normally blocked by the toweling 12 between the light source 82 and the receiver 84 . however , if a perforation 16 is positioned between the light source 82 and the receiver 84 , then the light passes through the perforation 16 to the receiver 84 and the sensor 80 generates the perforation signal . in the illustrated embodiment , the light from the light source 82 is directed at a relatively small portion relative to the width of the toweling 12 . in other embodiments the light source 82 and the receiver 84 can be configured such that the light source 82 emits light that is directed to more of the toweling 12 , up to the full width of the toweling 12 . alternatively , the light source 82 and the receiver 84 could be positioned on the same side of the path p and a reflector ( not shown ) positioned on the opposite side of the path p . it should also be appreciated that the sensor 80 can be based on other known technologies such as the following : the sensor 80 can be capacitive and use a capacitive coupled sensor . the sensor 80 can be based on mechanical detection and detect a perforation 16 through movement of a micro - switch that mechanically changes states when a perforation 16 moves past the sensor 80 . the sensor 80 can be based on the hall effect and be configured to sense a marker on the toweling 12 such as a metal flag . the sensor 80 could be configured to detect a perforation 16 based on a change in radio frequency . a proximity sensor 92 is mounted on main body 22 as shown in fig2 and 3 . the proximity sensor 92 is configured to generate a signal that is indicative of the presence of a hand or other object . an alternative on switch 94 is positioned on the housing 20 and is operable to close an electrical circuit . an emergency off switch 96 is positioned on the housing 20 and is operable to close an electrical circuit . a controller 98 is mounted within the housing 20 , as shown in fig3 , and is electrically connected to the perforation sensor 80 , the motor 62 , the battery 68 , the emergency off switch 96 , the proximity sensor 92 , the position indicating sensors of the loading door 24 , and the on switch 94 . the controller 98 is configured to activate the motor 62 , based on a signal from the proximity sensor 92 or the off switch 96 and to deactivate the motor 62 after the perforation signal is generated by perforation sensor 80 . in the illustrated embodiment , the controller 98 is configured to deactivate the motor 62 a predetermined time after the perforation signal is generated such that the perforation 16 is positioned near the separation device 36 . the controller 98 is also configured to activate the motor 62 when the on switch 94 is closed and to deactivate the motor 62 when the emergency off switch 96 is closed . the present invention can be better understood with respect to the operation of the dispenser 10 as follows . prior to dispensing towels , the roll 14 is placed within the housing 20 and a length of the toweling 12 extending from roll 14 is threaded along path p so that the toweling 12 extends from roll 14 through gap 45 . dispensing of a towel is initiated by moving an object such as a person &# 39 ; s hand such that it is detected by the proximity sensor 92 . the controller 98 activates the motor 62 in response to a signal generated by the proximity sensor 92 and toweling 12 is dispensed through gap 45 . when a perforation 16 is detected by the perforation sensor 80 , it generates the perforation signal that is then received by the controller 98 . the controller 98 deactivates the motor 62 after the perforation 16 has passed through the gap 45 . in this regard , the perforation 16 is positioned outside of the housing 20 and a towel can easily be removed by tearing the toweling 12 at the perforation 16 either free from separation device 36 or by engaging separation device 36 with the toweling at the perforation 16 . referring now to the detection of perforation 16 by the perforation sensor 80 , as can be seen in fig6 , each opening of the perforation 16 has a first diameter d prior to reaching the sensor roller 54 . in the illustrated embodiment , each opening of the perforation 16 is expanded to have a second diameter d 2 between the sensor roller 54 and the drive roller 52 . each opening of the perforation 16 is further expanded to have a third diameter d 3 if the opening passes over or near ridge 55 of the sensor roller 54 . the third diameter d 3 is greater than the second diameter d 2 which is greater than the first diameter d 1 . alternatively , the sensor roller 54 and the drive roller 52 are not configured to expand the openings of the perforation 16 prior to detection of the perforation 16 by the perforation sensor 80 . in this alternative , perforation sensor 80 is configured to detect the perforation 16 when the opening 38 has the first diameter d 1 . the present invention also provides a method for loading the towel dispenser 10 . the loading door 24 is moved to its open second position such that opening 38 is accessible and the sensor roller 54 and the pinch roller 58 are moved clear of path p . the roll 14 is inserted into the housing 20 through the opening 38 and positioned on tabs 34 . a length of toweling 12 is extended from the roll 14 across the loading door 24 such that it extends over the sensor roller 54 and the pinch roller 58 . the loading door 24 is moved to the closed first position such that the sensor roller 54 and the pinch roller 58 are moved up into position to define path p . in this manner , the toweling 12 that was extended over the sensor roller 54 and the pinch roller 58 is threaded along path p . the pinch roller 58 traps the toweling 12 against the drive roller 52 . in one embodiment , upon closing of the loading door 24 , the controller 98 activates the motor 62 to dispense an individual towel as described above . in an alternative embodiment of the present invention , there is provided a user interface ( not shown ) which is configured to provide for selection of a quantity of perforations to be detected before the motor 62 is deactivated . in this manner , the user can select the number of paper towels to be dispensed during one dispensing cycle . the number selected can be displayed on display 99 as can the number of towels actually dispensed per cycle . the foregoing has described a towel dispenser 10 capable of dispensing toweling 12 until a perforation 16 within the toweling 12 is detected . while specific embodiments of the present invention have been described , it will be apparent to those skilled in the art that various modifications thereto can be made without departing from the spirit and scope of the invention . accordingly , the foregoing description of the preferred embodiment of the invention and the best mode for practicing the invention are provided for the purpose of illustration only and not for the purpose of limitation .

US-77922010-A

an ornamental device includes a two - part curvilinear member , preferably having a band affixed to either end . each band is provided with complementary fasteners to enable securing the device about a user &# 39 ; s wrist , ankle , or arm . an inner side of the member is provided with a thin , transparent cover that is flexible and resilient . when the cover is pulled from the curvilinear member , the cover forms an arcuate shape that mirrors the arcuate shape of the curvilinear member while still being attached . in this position , it enables a user to insert a paper bearing a reading between the cover and curvilinear member . forcing the cover back against the curvilinear member allows the cover to hold the paper reading in place .

the best mode for carrying out the invention is presented in terms of its preferred embodiment 10 , herein depicted within fig1 through 3 b and in terms of an alternate embodiment 50 , herein depicted in fig4 . however , the invention is not limited to the described embodiment , and a person skilled in the art will appreciate that many other embodiments of the invention are possible without deviating from the basic concept of the invention and that any such work around will also fall under scope of this invention . it is envisioned that other styles and configurations of the present invention can be easily incorporated into the teachings of the present invention , and only one particular configuration shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope . the terms “ a ” and “ an ” herein do not denote a limitation of quantity , but rather denote the presence of at least one of the referenced items . the present invention describes a bracelet with message holding means ( herein described as the “ device ”) 10 , which provides a plate 20 and a film panel 30 configured to entrap a media panel 100 envisioned to contain an inspiring message or other uplifting visual message indicia 105 in a convenient location for viewing when desired . referring now to fig1 and 2 , rear and front perspective views of the device 10 , according to the preferred embodiment of the present invention , are disclosed . the device 10 includes a curvilinear plate 20 having a connected film panel 30 , where the film panel front surface 35 is positioned forcibly against a rear surface portion 23 of the plate 20 in a parallel manner , thereby clamping the inserted the media panel 100 between . the plate 20 is envisioned to provide a curvilinear member having arcuate rear 23 surface being designed to comfortably partially wrap around a user &# 39 ; s wrist area if so utilized ( see fig4 ). the front surface 25 is preferably configured to also have an arcuate shape . the plate 20 is envisioned being made of a rigid plastic or metal material and is envisioned to include a printed , etched , or otherwise applied wrist plate indicia 24 upon a front surface portion 25 . the wrist plate indicia 24 is envisioned to provide decorative designs and patterns , as well as med - alert symbols , script or logos based upon a user &# 39 ; s preference such as , but not limited to , sports names / logos , personal names , symbols , pictures , and the like , to further customize and personalize the device 10 . the film panel 30 is envisioned to be made of flexible transparent plastic material such as extruded polycarbonate sheet or equivalent material and also includes a rear 33 and front 35 surface . the film panel 30 further includes a screen - printed or foil - stamped silver film panel border 34 intended to decoratively surround the message indicia 105 upon the media panel 100 . a particular embodiment of the device 10 is illustrated here having rectangular - shaped plate 20 and film panel 30 portions ; however , it is understood that the portions of the device 10 may be introduced having various perimeter shapes such as oval , elliptical , polygonal , and the like , without deviating from the teachings of the invention , and as such should not be interpreted as a limitation of scope . the plate 20 and the film panel 30 are to have similar perimeter shapes and are affixed to each other via a pair of metallic first rings 40 a along one ( 1 ) side edge , and a pair of metallic second rings 40 b located along an opposing side edge . the first 40 a and second 40 b rings pass jointly through respective pairs of plate apertures 22 and pairs of film panel apertures 32 to attach and position the film panel 30 in a parallel manner with regards to the plate 20 . the apertures 22 , 32 and rings 40 a , 40 b are particularly positioned so as to create a compressing and bowing - effect upon the film panel 30 , thereby holding the film panel 30 in compression against the plate 20 . referring now to fig3 a and 3 b , top views of the device 10 depicting closed and open states , according to the preferred embodiment of the present invention , are disclosed . the device 10 clamps the media panel 100 between the plate 20 and the film panel 30 and allows a user to observe a message indicia 105 printed upon the media panel 100 , when desired . the media panel 100 may be quickly replaced by manually flexing the film panel 30 away from the plate 20 to an open position as seen in fig3 b ; inserting another media panel 100 containing a different message indicia 105 ; and , returning the film panel 30 to a closed state against the plate 20 as seen in fig3 a . referring now to fig4 , an alternate bracelet embodiment 50 depicting the device 10 affixed to bracelet sections 60 a , 60 b , according to an alternate embodiment of the present invention , is disclosed . an alternate embodiment 50 of the device 10 is illustrated here having an affixed first bracelet section 60 a at one ( 1 ) end portion being mechanically affixed to the first rings 40 a , and a second bracelet section 60 b being affixed to an opposing end portion using the second ring portions 40 b . the bracelet sections 60 a , 60 b are illustrated here comprising a chain - link construction using plastic or metal link elements and being joined together by a clasp 62 or equivalent means ; however , it is understood that the alternate bracelet embodiment 50 may include various styles of bracelet sections 60 a , 60 b based upon a user &# 39 ; s preference such as beaded - type , strap - type , rigid ring - type , or others , without being interpreted a limitation of scope . it is envisioned that other styles and configurations of the present invention can be easily incorporated into the teachings of the present invention , and only one particular configuration shall be shown and described for purposes of clarity and disclosure and not by way of limitation of scope . the preferred embodiment of the present invention can be utilized by the common user in a simple and effortless manner with little or no training . after initial purchase or acquisition of the device 10 , it would be installed as indicated in fig1 through 3 b . the method of installing and utilizing the preferred embodiment of the device 10 may be achieved by performing the following steps : procuring a model of the device 10 having a desired size , wrist plate indicia 24 , and perimeter shape ; selecting and / or purchasing a media panel 100 containing an inspirational or motivational message indicia 105 ; flexing the film panel 30 outwardly away from the plate 20 using one &# 39 ; s fingers until in an open state ; positioning the media panel 100 against a rear surface 23 of the plate 20 with the message indicia 105 facing outward ; pressing inwardly upon the film panel 30 to have the film panel front surface 35 retain the media panel 100 against the plate 20 ; placing the device 10 in a readily observable location such as on a desk - top , within one &# 39 ; s purse , in one &# 39 ; s pocket , or the like ; observing the message media 105 when desired ; and , being motivated , inspired , or uplifted by the media panel 100 , afforded a user of the present invention 10 . the method of utilizing the alternative embodiment 50 of the device 10 may be achieved by performing the following steps : installing a media panel 100 within the device 10 as described above ; attaching the alternate bracelet embodiment portion 50 to one &# 39 ; s wrist by wrapping the first bracelet section 60 a and second bracelet section 60 b around a user &# 39 ; s wrist area ; joining the bracelet sections 60 a , 60 b using the clasp 62 ; tilting the plate 20 outwardly from the user &# 39 ; s wrist area to observe the message media 105 when desired to receive motivation , inspiration , or the like . the foregoing descriptions of specific embodiments have been presented for purposes of illustration and description . they are not intended to be exhaustive or to limit to the precise forms disclosed and many modifications and variations are possible in light of the above teachings . the embodiments were chosen and described in order to best explain principles and practical application to enable others skilled in the art to best utilize the various embodiments with various modifications as are suited to the particular use contemplated .

US-201414154523-A

a trough drinker is provided which is detachably secured to the exterior of the supply line separately from and operably associated with a detachable trigger drinker or nipple drinker . the trough drinker includes a vertically extending stem , an elongated housing disposed about the stem and closely separated therefrom , a trough portion extending about the circumference of the housing for retaining water , a base skirt radially extending from the lower portion of the stem , an annular flange extending from the upper portion of the housing , and a spring biasing arrangement to move the flange upward when a predetermined level of fluid is present in the trough . the trigger drinker or nipple drinker is longitudinally offset from the trough drinker along the supply line such that the upward movement of the flange causes the trigger drinker or nipple drinker to be actuated and fluid to flow into the trough over the exterior surface of the housing . the trigger drinker or nipple drinker is separately detachable from the supply line without removing the trough drinker . the trough drinker is snap - fit to the supply line such that rotation and longitudinal movement are prevented . the spring biasing force on the flange is exteriorly adjustable by a lever protrusion . the trough drinker may be readily assembled from or disassembled into its separate components to facilitate cleaning , storage and shipping .

fig1 which illustrates a preferred embodiment of the present invention , shows a watering system having a fluid supply line 10 for transporting water or medicated fluid from a conventional source ( not shown ), supporting pipe 20 , trigger drinker 30 and trough or mini drinker 40 . pipe 20 is secured to supply line 10 by conventional means , such as clamps ( not shown ), to prevent the lengths of tube which form supply line 10 from bending , buckling , or leaking at their joints . pipe 20 is , for example , rigid galvanized steel pipe and may be adjustably suspended by conventional means from the ceiling of the poultry house . by raising or lowering pipe 20 , the vertical position of supply line 10 from the floor area can thus be optimized . since pipe 20 does not transport fluid directly , the choice of materials for its construction can be made to maximize strength and rigidity . on the other hand , supply line 10 can be constructed of more sanitary , durable , and corrosion resistant materials . trigger drinker 30 is of conventional construction and mounting into supply line 10 , as shown in u . s . pat . no . 4 , 491 , 088 . briefly , saddle 32 is ultrasonically welded to supply line 10 and forms a fluid conduit to the interior of the supply line . valve housing 34 is detachably snap - fit into sealing engagement with saddle 32 by a mating hook arrangement . a ball / pin valve assembly , preferably with multi - seat sealing , is provided within housing 34 to control fluid flow from supply line 10 out of the valve along trigger pin 36 . such trigger drinkers are extremely responsive to pecking actuation by poultry . even slight contact with trigger pin 36 causes the valve to permit fluid passage . thus , birds receive precisely the amount of fluid desired , according to the amount of pecking . it has been found that , given a choice between an open trough water supply and a trigger drinker , most poultry prefer to obtain fluid from the trigger drinker , even if it means crowding about that drinker in competition with other birds . however , as discussed above , there are circumstances where a trough drinker is still desirable , at least until the birds are old enough to effectively use trigger drinkers . for that purpose , among others , the present invention provides trough drinker 40 which is detachably snap - fit onto supply line 10 at a location spaced apart or offset from trigger drinker 30 along longitudinal axis 15 of supply line 10 . trough drinker 40 includes support stem 42 which extends generally vertically downward from supply line 10 . housing 44 is disposed about support stem 42 and includes shaft 46 through which stem 42 passes . trough portion 48 is formed as a lower , outward extension of housing 44 and extends circumferentially about the housing to retain fluid w therein . flange 50 is formed as upper , outward extension of housing 44 . where , in preferred embodiments , housing 44 is freely rotatable about stem 42 , flange 50 is disposed circumferentially about housing 44 . flange 50 extends outwardly along longitudinal axis 15 at least as far as trigger pin 36 . base skirt 60 is attached to stem 42 below trough portion 48 . spring device 70 , illustrated , for example , as a coil spring , is mounted about stem 42 between base skirt 60 and spring land 72 of housing 44 . for ease of manufacture , housing 44 is , for example , formed with two separable components 44a and 44b , corresponding respectively to the upper and lower portions of housing 44 . these components are slidingly friction - fit together at final assembly , but are readily disassembleable for cleaning , repair , storage , or shipping . upper component 44a includes flange 50 and shield boss 52 which extends upwardly over stem 42 from the juncture of flange 50 and the housing . flange 50 includes at least one port 54 at the base of the flange near that juncture . as shown in fig4 stem 42 has a non - circular cross - sectional configuration . shaft 46 , on the other hand , is , for example , formed with a circular cross - sectional configuration . thus , with respect to shaft 46 , stem 42 includes a plurality of grooves 56 . sliding and rotational contact between stem 42 and shaft 46 is therefore made only at a limited number of contact points 58 . in embodiments where it is especially desirable to further reduce component wear and stem / shaft contact , radial recesses 59 are formed in shaft 46 . in embodiments where it is especially desirable to further disassemble the trough drinker , base skirt 60 includes keyed slot 62 configured to receive free end 64 of stem 42 . free end 64 includes , for example , opposing projections 66 therefrom which fit through and below slot 62 to rotatably friction - lock skirt 60 to stem 42 . tensioning arrangement 74 is provided for adjustably tensioning spring 70 against spring land 72 . arrangement 74 includes base portion 76 which is , for example , integrally formed with skirt 60 about slot 62 . base portion 76 includes sequential series of stepped ratchet surfaces 78 on its upper face . cap portion 80 is rotatably mounted over the upper face of base portion 76 and includes complementary series of stepped ratchet surfaces 82 on its lower face . cap portion 80 also includes keying radial projections 84 from its outer circumference . handle 86 is provided to manipulate the tensioning arrangement . handle 86 includes ring 88 having slots 89 on its interior circumference . slots 89 correspond to and retain projections 84 . thus , as handle 86 rotates over the surface of skirt 60 ratchet surfaces 78 and 82 slidingly engage in steps such that the upper surface of cap portion 80 is progressively raised , and then dropped as highest ratchet projection is passed over . spring 70 is supported at its lower end against the upper surface of cap portion 80 . as rotation of handle 86 causes cap portion 80 to rise , tension on spring 70 is increased . alternatively to complementary stepped ratchets , arrangement 74 could include series of progressively stepped &# 34 ; v &# 34 ; surfaces , thus permitting rotation of handle 86 in either direction . stem 42 is , for example , integrally formed with a resilient snap - fit clamp 90 having a generally u - shaped cross - sectional configuration , as shown in fig5 . clamp 90 is sufficiently rigid to restrict rotational and longitudinal sliding of trough drinker 40 about supply line 10 once secured in place . for environments wherein a particularly large amount of jostling and bumping of the trough drinker by the poultry or small animals is expected , additional devices are provided to rigidly locate the trough . saddle 32 is formed with surface recess 38 . projection 92 is provided to extend from clamp 90 to complementarily engage surface recess 38 and thereby prohibit unintentional longitudinal sliding of trough drinker 40 along axis 15 . upper flared lips 94 are provided on clamp 90 to engage a lower portion of pipe 20 and thereby prohibit unintentional rotation of trough drinker 40 about supply line 10 . where clamp 90 is not centered above stem 42 and extends further to one side , as shown in fig1 it has been found to be especially advantageous to provide reinforcement to stem 42 . for example , triangular bridging strut 96 is provided between one side of stem 42 and the lower portion of clamp 90 . likewise , reinforcing boss 98 is formed at the base of the stem / clamp juncture . from the above - detailed description of the preferred embodiments , operation of the trough drinker will now be readily understood . briefly , trigger drinker 30 is attached to supply line 10 separately from trough drinker 40 and operates independently when trough drinker 40 is not present . the independent operation of trigger drinker 30 is described in detail in the disclosure of u . s . pat . no . 4 , 491 , 088 . trough drinker 40 is initially attached to supply line 10 at a position offset from trigger drinker 30 . until a predetermined level of water w is provided to trough portion 48 , spring 70 counteracts the weight of housing 44 and the water therein and forces flange 50 upward into actuating engagement with trigger pin 36 . fluid from supply line 10 is thus provided through trigger drinker 30 and along the upper surface of flange 50 into annular distribution area 100 between flange 50 and shield 52 . fluid immediately drains from distribution area 100 through ports 54 to the exterior surface of housing 44 . shield 52 prevents fluid from draining down shaft 46 or to any concealed chambers . from the exterior surface of housing 44 , fluid runs directly into trough portion 48 . when the predetermined level of fluid is obtained in trough portion 48 , the upward force of spring 70 is overcome and flange 50 moves away from trigger pin 36 , thereby shutting off the flow of fluid to the trough portion . as the poultry consumes the fluid from the trough portion , the water level decreases and spring 70 again causes flange 50 to actuate trigger drinker 30 to refill trough portion 48 . rotation of handle 86 changes the force exerted by spring 70 and thereby selectively establishes the predetermined fluid level of trigger drinker actuation . for example , with more tension on spring 70 , chicks will be able to drink from a relatively full trough . as tension on spring 70 decreases , the water level in trough portion 48 is also decreased . thus , an optimum water level can be established according to bird maturity . the present invention thus provides an efficient and sanitary means of watering even chicks that would otherwise not be strong enough to use trigger drinkers . as those chicks mature , the trough drinker can be removed and the birds will readily take fluid at the trigger drinker , especially since it is at the same watering location they are used to . clogging and bacterial contamination are avoided since the present invention does not employ an integral internal valve . the entire valve arrangement is contained within the trigger drinker . if the valve needs to be repaired or replaced , it can be detached without removing the trough drinker . to the extent that some fluid of debris does inadvertently enter shaft 46 , grooves 56 on stem 42 facilitate ready passage through the housing . since only the internal fluid sealing of trigger drinker 30 is employed , trough drinker 40 does not compound leakage concerns . this drinker is attached only to the exterior of the supply line and is positively located with respect to the trigger drinker by projection 92 . the trough drinker is also rigidly clamped against jostling which could otherwise cause spillage . to relieve stress on the trough drinker caused by the press of birds on only one side , it has been found to be particularly advantageous to form housing 44 to be freely rotatable about stem 42 with close spacing between shaft 46 and contact points 58 to prevent &# 34 ; wobble &# 34 ; which might otherwise lead to spillage . wobbling has also been found to be reduced through the use of relatively elongated housing 44 engaging stem 42 for a considerable length along shaft 46 . because of its longitudinal and radial stability , the present invention provides a further improvement over the prior art in not requiring added weights to maintain suspension stability . at the same time , raising and lowering of the overall watering system and overhead support construction is thus simplified . the present invention further simplifies attachment and detachment of watering system components ; time consuming and leakage prone threading is no longer necessary . it is now relatively simple to preassemble the entire watering system and snap on or off as many trough drinkers as may be needed . for example , in some applications not every trigger drinker need be accompanied by a trough drinker . the present invention is easy to clean . all fluid flow is on the housing exterior and , if the components are formed from non - corrosive , injection molded plastics , can be readily wiped clean . if a particular trough drinker must be removed for cleaning or repair , it is not necessary to shut off fluid flow in the entire line , the trigger drinker continues to seal against leaks . the present invention further takes advantage of the trigger drinker to minimize the exposed volume of water and preserve fluid freshness . also , by selective variations in spring tension , it is possible to alter the water level as the birds mature , rather than or in addition to raising or lowering the vertical height of the entire watering system . further , the spring tension adjustment mechanism is readily accessible and easy to operate without drinker disassembly . it is also important to note that the present invention can be utilized alternatively as a platform drinker , wherein skirt 60 rests on the poultry house floor , or as a suspension drinker vertically spaced above the floor without any adjustment . thus , where the floor is uneven or littered to various heights , a watering system employing the present invention can operate without leakage with some drinkers actually suspended while others are in contact with the floor . skirt 60 is preferably as wide as trough portion 48 and prevents housing 44 from being moved to actuate the trigger drinker by contact with the floor or litter or the birds themselves . the demand responsive trough drinker of the present invention also employs flange 50 to some extent to prevent perching on the outer lip of trough portion 48 since flange 50 overhangs substantially toward that outer lip . in general , the present invention is compatible with most preexisting trigger drinker systems and , thus , does not require a complete overhaul of the entire watering system . also , this arrangement is relatively inexpensive to manufacture and maintain . fig7 and 8 show an alternative embodiment of the present invention . many of the features shown in fig1 are also present in this alternative embodiment and are correspondingly numbered . the principle distinctions are that no adjustable tensioning arrangement is employed with spring 70 &# 39 ;, flange 50 &# 39 ; is adapted for use with nipple drinkers and a locking cap is provided with base skirt 60 &# 39 ;. specifically , spring 70 &# 39 ; extends from spring land 72 to base portion 76 &# 39 ;. unlike the corresponding element in fig1 base portion 76 &# 39 ; can be formed with a flat upper surface . appropriate spring tension is established by selection of the spring to function similarly to the embodiment of fig1 . in this simplified arrangement , spring 70 &# 39 ; counteracts the force of gravity on drinker 40 to force flange 50 &# 39 ; upward into actuating engagement with nipple drinker 30 &# 39 ; when the water supply in trough 48 falls below a predetermined level . when trough 48 is thereby refilled , spring 70 &# 39 ; is compressed and flange 50 &# 39 ; moves out of actuating engagement with nipple drinker 30 &# 39 ;. a particular advantage of the embodiment of fig7 is its adaptability for use with nipple drinkers as well as trigger drinkers . as shown , flange 50 &# 39 ; is formed with circumferential ridge 101 on its inner surface 100 &# 39 ;. ridge 101 includes flat portion 102 aligned beneath the actuating pin 104 of nipple drinker 30 &# 39 ;. thus , vertical movement of drinker 40 causes vertical movement of pin 104 . in nipple drinkers , primarily actuatable by vertical pin movement , this vertical movement of pin 104 is sufficient to cause fluid flow through the nipple drinker . the same result is provided with trigger drinkers , actuatable by vertical and / or horizontal pin movement . another feature of the embodiment of fig7 is the use of a vertical end wall 106 on flange 50 &# 39 ;. end wall 106 reduces the outward extension of flange 50 &# 39 ; while shielding the nipple or trigger drinker from inadvertent actuation . reducing the outward extension of flange 50 &# 39 ; enlarges the trough opening and increases accessibility to the water therein . finally , a locking cap 108 is provided to prevent unlocking rotation of base skirt 60 &# 39 ;. keyed opening 62 includes , for example , wing portions 110 which are otherwise exposed from below when skirt 60 is rotated into friction lock with stem 42 , as shown in fig8 . cap 108 includes cap projections 112 which are dimensioned to correspond with the openings of wing portions 110 and friction - fit therein . when cap projections 112 are inserted within wing portions 110 , base skirt 60 cannot be rotated with respect to stem 42 to an unlocking position since cap projections 112 block stem projections 66 . although the present invention has been described in detail , the same is by way of illustration and example and is not to be taken by way of limitation . the spirit and scope of the present invention are to be limited only by the terms of the appended claims .

US-8441987-A

injection devices , systems and methods are disclosed for injecting two or more medicaments to a patient at a single injection site while preferably minimizing any mixing of the medicaments prior to delivery to the patient . the invention can also be used to sequentially deliver the medicaments to the patient in a repetitive manner . for example , the injection apparatus can sequentially provide a first medicament and then a second medicament to the patient during a first injection procedure . during a second injection procedure , the injection apparatus can again sequentially provide the first medicament and the second medicament to the patient either at the injection site of the first injection procedure or at a different injection site . multi - lumen manifolds are disclosed for coupling to conventional drug ampoules , to permit the user to sequentially delivery different medicaments via a single skin penetration and to reduce losses associated with usage . systems including multiple drug reservoirs and filling adaptors are also disclosed .

for a fuller appreciation of the invention , various terms used in this specification are defined . the term “ medicament ” as used herein is intended to encompass not only prescription and over - the - counter drugs , but also various other therapeutic and cosmetic agents , including , not limited to anesthetic agents , toxins , nerve relaxing agents , vitamins , collagen and other biocompatible fillers , sunscreens , pigmentation and / or skin bleaching agents , synthetic and natural agents , including small molecules and larger molecules , such as peptides , proteins , lymphokines , growth factors , hormones , antibodies , conjugates of antibodies with other agents , and other chemical or biological molecules that can provide desired effects when injected into biological tissue . the term “ medicament ” as used herein further encompasses water , saline , and lumen - cleaning or purging solutions . fig1 illustrates an injection apparatus 10 in accordance with the present invention having a medicament delivery portion 12 and an injection manifold 14 in fluid communication with the medicament delivery portion 12 . the medicament delivery portion 12 is configured to provide independent delivery of at least two separate medicaments to a patient via the injection manifold 14 . the injection manifold 14 is configured to penetrate tissue of a patient and allow independent transmission of separate medicaments while limiting or preventing mixing of the medicaments prior to delivery to the patient . the medicament delivery portion 12 can include a number of medicament reservoirs that contain and allow delivery of separate medicaments to a patient . as illustrated in fig1 , the medicament delivery portion 12 can include a first reservoir assembly 13 having a first reservoir 16 defining a first lumen 17 and a first actuator 20 . the medicament delivery portion 12 can also include a second reservoir assembly 15 having a second reservoir 18 defining a second lumen 19 and a second actuator 22 . in one embodiment , the first reservoir assembly 13 and the second reservoir assembly 15 can be configured as syringes where the first 16 and second 18 reservoirs are formed as substantially cylindrical syringe chambers and the first 20 and second 22 actuators are formed as syringe plungers . each of the first 16 and second 18 reservoirs can be configured to contain separate medicaments for delivery to the injection manifold 14 . for example , the first reservoir 16 can be configured to contain a first medicament within the first lumen 17 , such as an agent used in cosmetic surgery ( e . g ., botox , collagen , restylane ) and a second reservoir 18 can be configured to contain a second medicament within the second lumen 19 , such as an anesthetic agent ( e . g ., novocain , lidocaine ). each of the first 20 and second 22 actuators can also be configured to provide independent delivery of the medicaments from each of the respective reservoirs 16 , 18 to the injection manifold 14 . for example , operation of the first actuator 20 ( e . g ., depression of the first syringe plunger ) can deliver a portion of the medicament contained within the first reservoir 16 to the injection manifold 14 while operation of the second actuator 22 ( e . g ., depression of the second syringe plunger ) can deliver a portion of the medicament contained in the second reservoir 18 to the injection manifold 14 . with each actuator 20 , 22 configured to operate independently from the other , the injection apparatus 10 can provide independent subcutaneous delivery of multiple medicaments to a patient during a single injection ( i . e ., at a single injection site ). the injection manifold 14 can couple to the medicament delivery portion 12 via a connector 26 . for example , the connector 26 can be a threaded connector , a luer locking element , or some other connecting element useful for providing a sealed fluidic coupling between the injection manifold 14 and the medicament delivery portion 12 . in one embodiment , the connector 26 can align the lumens 17 , 19 of the medicament reservoirs 16 , 18 with corresponding hollow needles associated with the injection manifold 14 to provide fluid communication between the medicament delivery portion 12 and the injection manifold 14 . the injection manifold 14 can include a number of hollow needles configured to transmit medicaments from the medicament delivery portion 12 to a tissue while limiting mixing of the medicaments prior to delivery to the tissue . for example , in one embodiment , the injection manifold 14 can include an inner needle 28 in fluid communication with the first reservoir 16 and an outer needle 30 that at least partially surrounds the inner needle 28 and in fluid communication with the second reservoir 18 . in another embodiment , the injection manifold 14 can include more than two needles . for example , the injection manifold 14 can include a two inner needles disposed within the outer needle 28 , each inner needle in fluid communication with a corresponding ( e . g ., separate ) reservoir assembly . in one embodiment , the outer needle 30 includes a first end 36 that can couple to the second reservoir 18 via the connector 26 , a second end 38 configured to insert within a tissue of a patient , and a lumen 40 extending between the first end 36 and the second end 38 and in fluid communication with the lumen 19 of the second reservoir 18 . in one embodiment , the outer needle 30 can be smaller than a 28 gauge needle . for example , the outer needle can be a 30 gauge needle having an outer diameter 33 of approximately 0 . 31 mm and an inner ( e . g ., lumen ) diameter 34 of approximately 0 . 19 mm . in one embodiment , the inner needle 28 includes a first end 42 that can couple to the first reservoir 16 via the connector 26 , a second end 44 configured to insert within a tissue of a patient , and a lumen 46 extending between the first end 42 and the second end 44 and in fluid communication with the lumen 17 of the first reservoir 16 . in one embodiment , the inner needle 28 can be smaller than a 30 gauge needle . for example , the inner needle 28 can be a 36 gauge needle having an outer diameter of approximately 0 . 11 mm and an inner ( e . g ., lumen ) diameter 32 of approximately 0 . 06 mm . in another example , the needle can be a 34 . 5 gauge needle having an outer diameter 31 of approximately 0 . 15 mm and an inner ( e . g ., lumen ) diameter 32 of approximately 0 . 08 mm . the relatively small sizes of the lumens 46 , 40 of the needles 28 , 30 , combined with the positioning of the needles 28 , 30 relative to each other ( e . g ., such as when the outer needle 30 surrounds a portion of the inner needle 28 ) can minimize an effect of capillary action within the lumens 46 , 40 of the needles 28 , 30 . as such , the gauge size and relative positioning of the needles 28 , 30 can minimize or prevent mixing or the exchange of medicaments between the needles 28 , 30 . for example , regarding the capillary properties of a lumen or tube , generally the narrower the tube the further a liquid can be drawn within the tube . referring to fig1 , assume a 36 gauge inner needle 28 inserts within a lumen 40 of a 30 gauge outer needle 30 . because the lumen 40 of the outer needle 30 can be relatively larger than the lumen 46 of the inner needle 28 ( i . e ., the lumen 46 of the inner needle 28 is narrower than the lumen 40 of the outer needle 30 ), the lumen 40 can draw a medicament to a lower ( i . e ., more proximal ) level 50 within the injection manifold 14 relative to a higher ( i . e ., more distal ) level 52 of the medicament drawn by the lumen 46 . such positioning of the medicaments within the lumens 46 , 40 can minimize or prevent mixing of the medicaments carried by the needles 28 , 30 . in one embodiment , one of the needles 28 , 30 of the injection manifold 14 can be configured with a cutting surface to allow the injection manifold 14 to penetrate the tissue of a patient . for example , the second end ( e . g ., distal tip ) 38 of the outer needle 30 can be configured with a beveled edge 48 that can cut into tissue and allow insertion of the outer needle 30 and the inner needle 28 into the tissue of a patient . in another embodiment , one of the needles 28 , 30 of the injection manifold 14 can be configured with a non - cutting surface . for example , the second end ( e . g ., distal tip ) 44 of the inner needle 30 can be configured as having a blunt ( e . g ., non - cutting ) surface . in one embodiment , the second end 44 of the inner needle 28 can be recessed ( e . g ., shorter ) relative to the distal tip 38 of the outer needle 30 to minimize contact between the inner needle 28 and the tissue of a patient as the outer needle 30 inserts within the tissue of the patient during an injection procedure . as such , the recess limits axial loading of the inner needle 28 by the tissue and thereby minimizes the possibility of the inner needle 28 bending or fracturing during an injection procedure . during operation , the injection apparatus 10 can deliver medicaments carried by the injection apparatus 10 to a patient . for example , the injection apparatus 10 can penetrate a skin region of a patient , such as at an injection site . in one embodiment , the distal tip 38 of the outer needle 30 can pierce the tissue of the patient at the injection site such that the distal tip 38 of the outer needle 30 and the distal tip 44 of the inner needle 28 insert within the tissue . the injection apparatus 10 can then deliver a first medicament to the patient at the injection site . for example , the second actuator 22 associated with the second reservoir 18 can be actuated to deliver a portion of the medicament contained in the second reservoir 18 , such as an anesthetic agent , through the lumen 40 of the outer needle 30 and into the tissue . following injection of the first medicament , the injection apparatus 10 can then deliver a second medicament to the injection site either at substantially the same depth as the first medicament or at a different depth than the first medicament . in one embodiment , the position of the injection apparatus can be maintained relative to the injection site , thereby maintaining the relative position of the inner needle within the tissue . in another embodiment , the injection apparatus 10 can advance into the tissue such that the inner needle 28 positions at a different depth than the outer needle 30 . the first actuator 20 associated with the first reservoir 16 can then be actuated , independently from the second actuator 22 , to deliver a portion of the medicament contained in the first reservoir 16 , such as a cosmetic agent , through the lumen 46 of the inner needle 28 and into the tissue . also during operation , the medicament delivery process described above can be repeated to deliver additional doses of the medicaments to the patient . in one embodiment , each medicament from the first 16 and second 18 reservoirs can be repeatedly delivered to the patient at the same injection site . for example , after the apparatus 10 has delivered doses of the first and second medicaments to the tissue , the apparatus 10 can deliver a second dose of the first and second medicaments to the tissue . in another embodiment , after delivery of the first and second medicaments to the patient at a first injection site , the injection manifold 14 can be removed from the first injection site and inserted within a second ( e . g ., different ) injection site of the patient . alternating delivery of the first and second medicaments from the first 16 and second 18 reservoirs can then be repeated for the second , and subsequent , injection sites of the patient . as indicated above , the injection apparatus 10 can allow independent subcutaneous delivery of multiple medicaments to a patient during a single injection while limiting mixing of the medicaments prior to delivery to a patient . the injection apparatus 10 can be configured in a variety of ways to allow such medicament delivery to the patient . in one example , the reservoir assemblies 13 , 15 can be positioned relative to each other in various configurations . in one embodiment as illustrated in fig1 , the first reservoir assembly 13 is disposed within the second reservoir assembly 15 . for example , the first reservoir assembly 13 can be positioned concentrically relative to the second reservoir assembly 15 such that the first actuator 20 and the second actuator 22 align along a common longitudinal axis 25 , as also illustrated in fig2 . with such a configuration , the second actuator 22 can define an opening 23 through which the second first actuator 20 can extend , thereby allowing independent actuation of the first 20 and second 22 actuators . returning to fig1 , with the first reservoir assembly 13 is disposed within the second reservoir assembly 15 , the medicament delivery portion 12 can include structures that couple the fluid reservoirs 16 , 18 to each other . for example , the medicament delivery portion 12 can include an end cap 24 , such as disposed at a first or proximal end 25 of the medicament delivery portion 12 and one or more struts 33 , such as disposed at a second or distal end 27 of the medicament delivery portion 12 . the end cap 24 can couple the first reservoir 16 and the second reservoir 18 to provide a degree of rigidity or stability to the apparatus 10 . the end cap 24 can also maintain a spaced - apart relationship between the first reservoir 16 and the second reservoir 18 at the proximal end 25 of the medicament delivery portion 12 . for example , the end cap 24 orients the first reservoir 16 relative to the second reservoir 18 to define a toroid - shaped lumen 19 between the walls of the reservoirs 16 , 18 for containment of a medicament within the second reservoir 18 . as shown in fig1 and 3 , the struts 36 are disposed between the first reservoir 16 and the second reservoir 18 and can couple the first reservoir 16 and the second reservoir 18 to provide a degree of rigidity or stability to the apparatus 10 . the struts 36 can also maintain a spaced - apart relationship between the first reservoir 16 and the second reservoir 18 at the distal end 25 of the medicament delivery portion 12 . for example , the struts 36 can divide the lumen 19 formed between the walls of first reservoir 16 and the second reservoir 18 into subsections , such as a first lumen 19 - 1 , a second lumen 19 - 2 , a third lumen 19 - 3 , and a fourth lumen 19 - 4 to maintain a fluid pathway between the second reservoir 18 and the injection manifold 14 . while the reservoir assemblies 13 , 15 can be positioned within one another , as described above , the reservoir assemblies 13 , 15 can also be positioned in a side - by - side or adjacent relationship . for example , fig4 and 5 illustrate an embodiment of the injection apparatus 10 ′ configured with a first reservoir assembly 13 ′, having a first reservoir 16 ′ and a first actuator 20 ′, positioned adjacent to a second reservoir assembly 15 ′ having a second reservoir 18 ′ and a second actuator 22 ′. as shown in fig4 , the actuators 20 ′, 22 ′ can be configured as independently actuatable in a “ split plunger ” arrangement to allow independent delivery of medicaments to an injection site . with the reservoir assemblies 13 ′, 15 ′ positioned in a side - by - side or adjacent relationship , the injection manifold can be configured to attach to the adjacent reservoir assemblies 13 ′, 15 ′ to provide fluid communication between the associated reservoirs 16 ′, 18 ′ and the needles of the injection manifold . for example , the injection apparatus 10 ′, as shown in fig5 , can include an injection manifold 14 ′ coupled to the first 16 ′ and second 18 ′ reservoirs and having an inner needle 28 ′ and an outer needle 30 ′. while the needles 28 ′, 30 ′ are illustrated as being substantially aligned ( e . g ., aligned along a longitudinal axis ) with the first reservoir 16 ′, the needles 28 ′, 30 ′ can be offset relative to the second reservoir 18 ′ ( e . g ., offset relative to a longitudinal axis of the second reservoir 18 ′). such an offset provides fluid communication between the adjacently positioned reservoirs 16 ′, 18 ′ and the respective needles 28 ′, 30 ′. the actuators 20 , 22 of the injection assembly 10 can be manually operated to deliver medicaments from the reservoirs 16 , 18 to the injection manifold 14 . however in one embodiment , operation of the actuators can be automated . fig6 illustrates an embodiment of a medicament delivery portion 12 ′ of an injection assembly 10 having automated actuators . the medicament delivery portion 12 ′ can include a controller 80 in electrical communication with actuators 90 , 92 and electrically couples to a power supply 86 , such as either an internal power supply ( e . g ., a battery ) or an external power supply . the first actuator 90 , such as a valve , can position in fluid communication with the first reservoir 16 and with the inner needle 28 . the second actuator 92 , such as a valve , can position in fluid communication with the second reservoir 18 and the outer needle 30 . the controller 80 can include a memory 82 and a processor 84 . the memory 82 can be any type of computer readable medium such as electronic semiconductor memory ( e . g ., random access memory or read only memory ), programmable memory ( e . g ., eeprom ), or another storage or enclosable medium such magnetic or optical disk storage . the processor 84 can be any type of central processing unit , microprocessor , programmable gate array ( pga ) or other circuitry that are capable of executing , interpreting , operating , being configured with , or otherwise performing sets of logic instructions such as computer program code . a data bus 83 or other circuitry can interconnect the memory 82 and the processor 84 . the controller 80 , in one embodiment , is configured to control delivery of a proscribed dosage ( e . g ., volume ) of the medicaments contained within the reservoirs 16 , 18 to an injection site . for example , based upon instructions stored in the memory 82 and executed by the processor 84 , at a first time , the controller 80 can send a first signal to the first actuator 90 and to the second actuator 92 . the first signal can cause the first actuator 90 to prevent the flow of medicament from the first reservoir 16 to the inner needle 28 and can cause the second actuator 92 to allow a flow of medicament from the second reservoir 18 to the outer needle 30 . after delivery of a proscribed dosage of the medicament from the first reservoir 16 , the controller 50 can then send a second signal to the first 90 and second 92 actuators that can cause the first actuator 90 to allow a flow of medicament from the first reservoir 16 to the inner needle 28 and can cause the second actuator 92 to prevent a flow of medicament from the second reservoir 18 to the outer needle 30 . such automated delivery can provide sequential delivery of medicaments to a single injection site and can allow delivery of substantially precise dosages of the medicaments to the site . as indicated above , the injection manifold 14 can deliver multiple medicaments to a patient during a single injection while limiting or preventing mixing of the medicaments prior to delivery to the patient . the injection manifold 14 can be configured in a variety of ways to allow such medicament delivery to the patient . in one embodiment , the needles 28 , 30 are oriented substantially coaxially relative to each other . for example , fig7 illustrates an embodiment of a 30 gauge inner needle 28 coaxially disposed within a 36 gauge outer needle 30 . the 30 gauge inner needle 28 defines a lumen 46 having cross - sectional area of approximately 2800μm 2 . the annular cross - sectional area of a lumen 40 formed between an outer wall 52 of the inner needle 28 and an inner wall 54 of the outer needle 30 is approximately 18 , 800μm 2 . the relatively large lumen 40 formed between the outer needle 28 and the inner needle 28 reduces the capillary properties of the lumen 40 and minimizes mixing of the medicaments carried by the needles 28 , 30 . in another embodiment , the needles 28 , 30 are oriented in a substantially eccentric manner relative to each other . fig8 illustrates an embodiment of a 34 . 5 gauge inner needle 28 ′ eccentrically disposed within the 36 gauge outer needle 30 ( e . g ., a longitudinal axis of the inner needle 28 ′ is offset from a longitudinal axis of the outer needle 30 ). the 30 gauge inner needle 28 ′ has a lumen 50 ′ having a cross - sectional area of approximately 5000μm 2 . the annular cross - sectional area of a lumen 58 ′ formed between an outer wall 52 ′ of the inner needle 28 ′ and an inner wall 54 ′ of the outer needle 30 ′ is approximately 10 , 700μm 2 . the relatively large lumen 58 ′ formed between the outer needle 28 ′ and the inner needle 28 ′ reduces the capillary properties of the lumen 58 ′, compared to the relatively small lumen 50 ′ of the inner needle 28 ′, and minimizes mixing of the medicaments carried by the needles 28 ′, 30 ′. in one embodiment , the injection manifold 14 can include connection elements that allow one or more reservoir assemblies to attach to the injection manifold 14 . for example , fig9 illustrates an embodiment of the injection manifold 14 ″ having hubs 140 configured to allow attachment of medicament reservoirs to the injection manifold 14 ″. in one embodiment , the injection manifold 14 ″ includes a first hub 140 - 1 and a second hub 140 - 2 for attachment of a first medicament reservoir 16 and a second medicament reservoir 18 , respectfully . the injection manifold 14 ″ can include fluid pathways formed between the hubs 40 and corresponding needles . in one embodiment , the injection manifold 14 ″ can include a first fluid pathway 142 between the first hub 140 - 1 and the inner needle 28 for transmission of a first medicament from the first reservoir 16 to the inner needle 28 and can also include a second fluid pathway 144 between the second hub 140 - 2 and the outer needle 30 for transmission of a second medicament from the second reservoir 18 to the outer needle 30 . in one embodiment , the injection manifold 14 ″ can include a distributor 147 positioned between the second fluid pathway 144 and the outer needle 30 . the distributor 147 can be configured to provide a substantially uniform distribution of the second medicament from the second fluid pathway 144 to the outer needle 30 . the injection apparatus 10 can be provided prior to use ( e . g ., such as by a manufacturer ) with each of the medicament reservoirs filled with a separate ( e . g ., distinct ) medicament . however , in certain cases , the injection apparatus 10 can be provided with substantially empty medicament reservoirs that require filling prior to use of the injection apparatus 10 . as indicated above , however , the injection assembly 10 can include two or more needles , each in fluid communication with a medicament reservoir . in one embodiment , a filling adaptor can be provided to allow the medicament reservoirs of the injection apparatus 10 to be selectively filled prior to use using the needles of the apparatus 10 . fig1 illustrates a filling adaptor 70 that can provide the medicament reservoirs ( e . g ., lumens 17 , 19 of the reservoirs 16 , 18 ) with access to a medicament , such as contained within a container 72 . in one embodiment , the adaptor 70 can include a fitting portion 74 and a body portion 76 . the fitting portion 74 can be configured to couple the adaptor 70 to the container 72 and the body portion 76 can be configured to provide selective access to the medicament within the container . as will be described with respect to fig1 and 12 , the body portion 76 can define a fluid passageway that provides a first lumen of the injection assembly 10 access to the medicament and can also include a lumen engagement portion , such as formed as an elastomeric pad , that can block a second lumen of the injection assembly 10 access to the medicament . fig1 illustrates an embodiment of the adaptor 70 configured to provide medicament access to an inner needle 28 , and an associated reservoir 16 of the injection assembly 10 . the body portion 76 can define an opening 79 oriented substantially at a central location of the adaptor 70 and configured to align with the lumen 46 of the inner needle 28 . the body portion 76 can also include an engagement portion 78 oriented substantially about a circumference of the adaptor 70 and configured to align with or engage the lumen 40 between the inner needle 28 and the outer needle 30 . during operation , as the injection manifold 14 inserts within the adaptor , the inner needle 28 can insert within the opening 79 and the outer needle 30 can engage the engagement portion 78 . as a result , the lumen 46 of the inner needle 28 can access the medicament contained in the container 72 , thereby allowing the associated medicament reservoir 16 to be filled with the medicament . additionally , the material forming the engagement portion 78 can fill or substantially encompass a cross - sectional area of the lumen 40 between the inner needle 28 and the outer needle 30 thereby limiting or preventing the lumen &# 39 ; s 40 access to the medicament contained in the container 72 and preventing the associated medicament reservoir 18 from being filled with the medicament . fig1 illustrates an embodiment of the adaptor 70 configured to provide medicament access to an outer needle 30 , and an associated reservoir 18 of the injection assembly 10 . the body portion 76 can define one or more openings 79 ′ positioned substantially about a circumference of the adaptor 70 and configured to align with the lumen 40 between the inner needle 28 and the outer needle 30 . the body portion 76 can also include an engagement portion 78 ′ oriented substantially at a central location of the adaptor 70 and configured to align with the lumen 46 of the inner needle 28 . during operation , as the injection manifold 14 inserts within the adaptor , the outer needle 30 can insert within the opening 79 ′ and the inner needle 28 can engage the engagement portion 78 ′. as a result , the lumen 40 between the inner needle 28 and the outer needle 30 can access the medicament contained in the container 72 , thereby allowing the associated medicament reservoir 18 to be filled with the medicament . additionally , the material forming the engagement portion 78 ′ can fill or substantially encompass a cross - sectional area the lumen 46 of the inner needle 28 thereby limiting or preventing the lumen &# 39 ; s 46 access to the medicament contained in the container 72 and preventing the associated medicament reservoir 16 from being filled with the medicament . as indicated above , the injection manifold 14 is configured to penetrate tissue of a patient and allow independent transmission of separate medicaments while limiting or preventing mixing of the medicaments prior to delivery to the patient . as described in fig7 - 9 , the injection manifold can include a number of concentric or otherwise nested needles configured to transmit medicaments from the medicament delivery portion 12 to the patient . however , in other embodiments , the injection manifold 14 includes a single needle that allows independent transmission of separate medicaments while limiting or preventing mixing of the medicaments prior to delivery to the patient . fig1 illustrates an embodiment of an injection manifold 100 having ports 102 , a needle 104 , and fluid pathways 106 disposed between the needle 104 and the ports 102 . the injection manifold 100 can include a first port 102 - 1 and a second port 102 - 2 that can be configured to couple to drug sources , e . g . drug - loaded syringes , containing distinct medicaments . the fluid pathways can include a first pathway 106 - 1 and a second fluid pathway 106 - 2 in fluid communication with the first port 102 - 1 and the second port 102 - 2 and in fluid communication with a lumen 108 defined by the needle 104 . the needle lumen 108 can have a diameter that minimizes or prevents the medicaments sequentially delivered from the first port 102 - 1 and the second port 102 - 2 from mixing within the needle 104 . for example , in one embodiment the needle 104 can be configured as a 30 gauge needle ( e . g ., having a diameter of approximately 0 . 19 mm ). while the embodiment of the injection manifold 100 illustrated in fig1 is shown as having two ports 102 and two fluid pathways 106 , the injection manifold 100 can have more than two ports 102 and two fluid pathways 106 . for example , fig1 illustrates another embodiment of an injection manifold 100 having a first port 102 - 1 , a second port 102 - 2 , and a third port 102 - 3 configured to couple to a third reservoir . the injection manifold 100 can also have a third fluid pathway 106 - 3 disposed between the third port 106 - 3 and the lumen 108 of the needle 104 . in one embodiment , the third port 102 - 3 can couple to a reservoir containing a saline solution . in such an embodiment , the third fluid pathway 106 - 3 is configured to direct saline from the reservoir and through the lumen 104 of the needle 108 prior to delivery of a first medicament from the first port 102 - 1 to the needle 104 and prior to delivery of a second medicament from the second port 102 - 2 to the needle 104 . the saline can flush the lumen 108 of the needle prior to delivery of the medicament from either port 102 - 1 , 102 - 2 , thereby minimizing mixing of medicaments within the needle 104 . fig1 , 15a and 15 b illustrate yet another embodiment of the invention in which a low - loss injection manifold 150 is shown having manifold body 152 defining two medicament reservoirs 116 and 118 , a distal injector 114 and two plunger - type actuators 120 and 122 for manual dispensing of medicaments . as shown in more detail in the cross - sectional views of fig1 a and 15b , reservoir 116 includes an inner lumen 130 , through which the distal end 134 of plunger 120 passes to dispense medicament from reservoir 116 via needle 124 . the distal wall 136 of the lumen 130 is configured to receive the distal end 134 of plunger 120 in a mating relationship ( e . g ., matching frusco - conical shapes ) such that there is substantially no residual volume or waste of medicament ( e . g ., less than 10 microliters , preferably less than 5 microliters , more preferably less than 1 microliter in certain applications ). essentially , the only residual medicament ( following full depression of plunger 120 ) will be in antechamber 144 and the needle itself . lumen 132 , which permits delivery of a second separate medicament , can also be designed for substantially no residual medicament by appropriate sizing of passageway 142 . optionally , the injection manifold can further include an access port 146 for purging passageway 142 , antechamber 144 and needle 124 . although the device of fig1 , 15a and 15 b is shown with two lumens , it should be clear three or more reservoirs can likewise be constructed for delivery of multiple medicaments . one skilled in the art will appreciate further features and advantages of the invention based on the above - described embodiments . accordingly , the invention is not to be limited by what has been particularly shown and described , except as indicated by the appended claims . all publications and references cited herein are expressly incorporated by reference in their entirety .

US-33778806-A

the disclosure relates to an apparatus which is applicable such as , for example , an automatic golf ball dispenser , and comprises a ball magazine floor which consists of a number of tracks for golf balls so that these are arranged in rows after one another , the ends of the tracks being combined to form a pivotal cradle whose depth corresponds to one golf ball , whereby each pivoting of the cradle entails emptying of only that number of golf balls which is present in the cradle .

the present invention will now be described in conjunction with its application in an automatic golf ball dispenser whose basic construction is illustrated in fig1 - 3 . in fig1 there is only shown an upper portion of a box - shaped automatic golf ball dispenser and in fig1 only the upper portion of walls 1 , 2 and 3 are shown , as well as a removable lid or top 4 . the walls 1 , 2 and 3 may , if desired , extend down to a substrate and , in cases when the walls 1 , 2 and 3 consists of sheet metal , these are anchored on a framework with legs which carry the entire dispenser . the lid or top portion 4 may , furthermore , be pivotal so that it may be opened for replenishing the automatic dispenser with balls 5 . the balls 5 rest on a floor 6 in a ball magazine . in order that loading on the floor 6 be not too great , the magazine is provided with a relief floor 7 which is located most proximal the floor 6 and is fixedly retained in the wall 1 and the wall 3 and the opposing wall 8 to the wall 3 , as illustrated in fig2 . a further relief floor 9 is fixedly retained in the wall 2 and the walls 3 and 8 . both of the relief floors 7 and 9 , and the magazine floor 6 proper , are disposed at a certain angle of inclination . for example , at least the magazine floor 6 may be inclined at an angle of 10 degrees . the magazine floor 6 consists of a number of spaced - apart parallel rods or tubes 10 , as is more clearly illustrated in fig3 . the tubes 10 form tracks for the balls 5 , and the balls 5 will roll along the tubes 10 down to a ball cradle at that end of the magazine floor 6 located most proximal the wall 1 . the floor in the cradle may be considered as a continuation of the floor 6 . the floor in the cradle thus consists of a number of parts of similar tubes 10 as the floor 6 and the tubular parts are , at one end , fixedly retained to one shank of an l - shaped bar 11 whose other shank forms a roof in the cradle . above the roof shank of the l - shaped bar 11 , there is disposed an arched surface 12 which extends along the entire cradle . the cradle is pivotally disposed about a shaft 13 which is pivotally journalled in bearings 14 and 15 on the side walls 3 and 8 . the pivot shaft 13 extends into the connection between the shanks of the l - shaped bar 11 . the arched surface 12 is , as has been mentioned above , fixedly retained to the top shank and to the edge facing away from the magazine , by means of support members 16 . pivoting of the cradle is realised by means of an arm 17 whose one end is journalled at 18 in the cradle and whose other end is journalled on an excentric disk 19 . beneath the cradle , there is disposed a ball track 20 which is retained to the wall 1 with a slope from the wall 8 towards the wall 3 and which may extend beyond the wall 3 and discharge above , for example , a ball bucket . when the cradle is pivoted by means of the arm or rod 17 , the row of balls located in the cradle will be emptied into the track 20 and thereafter roll out into the bucket or container at its end . the arched surface 12 will retain the remaining balls on the magazine floor 6 . a flat bar 21 is disposed above the balls located most proximal the cradle and prevents the balls from climbing on one another if they are forced back by the arched surface 12 up along the magazine floor 6 . in the magazine floor 6 , in a direction ahead of the cradle , there is disposed , slightly above the magazine floor 6 , a roller 22 which is journalled in bearings 23 and 24 on the walls 3 and 8 . the distance between the circumferential surface 25 of the roller and the magazine floor 6 is adapted such that the balls 5 are allowed passage , as illustrated in fig1 . on its circumferential surface , the roller 22 is provided with ridges 26 which are of such elevation that , when they are located in register with the floor 6 , they prevent the passage of golf balls 5 . when the roller 22 rotates , the ridges 26 thereon will , thus , each time they pass a position in register with the floor 6 , force the golf balls in a rearward direction , whereby the golf balls will , on the one hand , be arranged in a suitable manner between the rods 10 , and , on the other hand , be subjected to a certain cleansing action . the roller 22 is positively coupled , by the intermediary of a belt or chain 27 , to the same shaft as the excentric disk , this shaft being driven by an electric motor 28 via a worm gear . if the distance between the relief floor 7 and the roller 22 is so great that the balls 5 may pass between them , there may be disposed on the underface of the relief floor 7 , a wall portion which extends towards the roller 22 so that the balls 5 may not jump over the roller . suitably , the electric motor 28 is driven via an electronic circuit which , in its turn , is regulated by means of a coin - operator , or a special automatic acceptance device for counters , the electronic circuit being arranged such that insertion of a counter causes the wheel 19 to rotate one revolution and thereby pivot the cradle and empty 25 golf balls 5 into the track 20 . in the present case , the apparatus is , thus , operative to discharge 25 balls 5 for each single revolution of the wheel 19 . when the wheel 19 rotates , the roller 22 will also rotate and arrange the balls 5 before these have reached the cradle . while fig3 illustrates a number of 25 balls for each pivoting of the cradle , there is , naturally , nothing to prevent certain parts of the cradle and the magazine floor 6 from being shut off , so that only 10 or 15 balls are allowed passage into the cradle . for attaining an improved cleansing effect , it is , naturally not inconceivable that the ridges 26 be provided with brushes or be replaced by brushes . thanks to the space between the rods or tubes 10 , all dirt will fall down beneath the floor 6 and , in many cases , it is fully conceivable to allow the apparatus to stand free on a substrate so that it is a matter of no inconvenience to remove the dirt which passes the floor rods 10 . there may very well be provided a sheet metal tray , between the wall 3 and the most proximal tube 10 in the floor 6 , the tray preventing balls 5 from falling down between the wall 3 and the adjacent tube 10 . the same may also apply to the opposing wall 8 . such walls are intimated in fig3 and the height thereof , as well as their possible sloping out towards the walls 3 and 8 , are adapted to suit each individual case . it should , here , be further observed that the ridges 26 on the roller circumferential surface 25 may be more or less than three , as illustrated in fig1 but the distance between two ridges may , naturally , not be so small that the ball 5 is not free on any given occasion .

US-51857383-A

a device removing the stem and blossom portions of fruit utilizing a support for the fruit which is capable of orienting the stem or the blossom portion of the fruit in an upright position . the support permits access to either the stem or blossom portion of the fruit and is spanned by a pair of fruit reamers . each fruit reamer is capable of completely dressing out the stem and blossom portions of the fruit when the first and second reamers are brought toward one another .

various aspects of the present invention will evolve from the following detailed description of the preferred embodiments thereof which should be taken in conjunction with the prior described drawings . the invention as a whole is shown in the drawings by reference character 10 . the fruit indent removing device 10 includes as one of its elements a support 12 for the fruit 14 , which is depicted as an apple . apple 14 possesses a stem 16 and the remnant of a full blossom 18 , known as the cylex . in the fruit processing field the indent 20 adjacent the stem 16 is known as the stem indent and the depression surrounding the cylex 18 is known as the blossom indent 22 . apple 14 is depicted in fig1 as being oriented with the stem indent 20 up and the blossom indent 22 down . support 12 is in the form of a cup having wall portions 24 and bottom portion 26 with a central opening 28 . thus , support 12 permits access to the blossom indent 22 as well as the stem indent 20 . it should also be noted , that apple 14 may be oppositely oriented such that the blossom indent 22 is up and the stem indent is down , for the purpose of processing afforded by the device 10 of the present invention . structural member 30 is used to move support 12 according to directional arrow 32 , it being understood that a support identical to support 12 is also connected to structural member 30 to present additional apples in the position of apple 14 depicted in fig1 . reamers 32 and 34 are also illustrated in fig1 as being above and below apple 14 , respectively . with reference to reamer 32 , it should be understood that reamer 34 possesses a similar mechanism for turning and raising the same relative to apple 14 . reamer 32 includes a bit 36 which is connected to a collet shaft 38 . collet shaft 38 rotates and is capable of moving longitudinally within bearing 40 along axis 41 , fig7 . the outer race of bearing 40 is connected to fixed structural member 42 which gives support to collet shaft 38 . collet shaft 38 includes a step - down shaft 44 which creates a pair of shoulders 46 and 48 serving as cam surfaces for cam follower arm 50 which takes the form of a yoke bracketing shaft 44 . rotatable member 52 rides on shoulders 46 and 48 and is capable of moving collet shaft 38 , and another not shown , according to directional arrow 54 . cam follower arm 50 pivots at pivot point 56 and includes a cam follower 58 which travels within track 60 of cam 62 . cam 62 rotates about shaft 64 according to directional arrows 66 . as previously stated , a similar arrangement would move reamer 34 upwardly into blossom indent 22 . collet shaft 38 terminates in a spline surface 68 which mates with the inner spline surface 70 of driving member 72 . motor 74 imparts rotational motion to motor shaft 76 which is linked to driving member 72 . again , a motor , such as motor 74 , would also rotate reamer 34 below support 12 . turning now to fig5 and 6 , another embodiment 10a of the device of the present invention is depicted . device 10a includes a first reamer 80 and a second reamer 82 . apple 14 is depicted schematically in fig5 and 6 but is oriented in the same way as in fig1 - 4 , i . e . stem 16 up and blossom 18 end down . support 84 includes an annular member 86 capped by a funnel member 88 having a central opening 90 formed by plurality of fingers 91 , fig1 . it should be realized , that support 84 may take various forms each having an opening therethrough for access by lower reamer 82 . in the mass processing aspect of device 10 , support 84 is moved according to directional arrow 92 such that similar supports having other apples will subsequently be positioned between first and second reamers such as reamers 80 and 82 as shown in fig5 and 6 . in addition , reamers 80 and 82 include support plates 92 and 94 which may extend perpendicularly to the fig5 and 6 illustrations and to support similar pairs of reamers . thus , device 10 is susceptible to parallel lines of processing such that plates 92 and 94 will move downwardly and upwardly relative to apple 14 , respectively and remove the indents from apple 14 and apples intersected by a plane containing axis 96 and lying perpendicular to the sheet containing fig5 and 6 . as is apparent in fig1 , plate 86 includes supports 95 and 97 similarly constructed to support 84 , in this regard . moreover , stabilizer 101 is also depicted in fig5 and 6 for maintaining the upright orientation of apple 14 . stabilizer 101 includes a pressing member 103 possessing central opening 105 . pressing member 103 connects to bushing 107 , which moves along spring loaded shaft 109 , fastened to support plate 92 . of course parallel apples found in supports 95 and 97 will also include stabilizers similar to stabilizer 101 . turning now to fig7 reamer 80 is shown in further detail . pulley 98 connects to hollow rotating shaft 100 by the use of clamp 102 . hollow rotating shaft 100 extends into and is fixed to a bushing 104 which includes a slot 106 . although bushing 104 is depicted as being a separate component from hollow rotating shaft 100 , they may be formed as a unitary element . inner shaft 108 lies within hollow rotating shaft 100 and bushing 104 . pin or protuberance 110 causes inner shaft 108 to turn or spin with hollow rotating shaft 100 and bushing 104 . however , inner shaft 108 is free to move longitudinally along axis 152 relative to the encompassing elements , according to directional arrow 112 . stop means 114 is also illustrated in fig7 for the relative movement of inner shaft 108 relative to busing 104 . a flange 116 is fixed to inner race 118 of bearing 120 . bushing 104 and connected inner shaft 100 move together as a unit . slot 106 and pin 110 define the relative longitudinal movement limits of inner shaft 108 relative to bushing 104 . it should also be noted that pin 110 motivates inner shaft 108 relative to bushing 104 in a rotational direction according to directional arrow 122 . with reference to fig8 and 9 , it may be observed that reamer 80 includes an auger 124 having a bit end 126 and a base portion 128 . it may be apparent that reamer 82 also includes an auger 130 of similar construction . auger 124 is provided with a plate 132 which threadingly engages the threaded outer surface 134 of base portion 128 of auger 124 . a set screw 136 fixes plate 132 along outer surface 134 to set the penetration depth of bit 126 of auger 124 into apple 14 . in addition , inner shaft 108 includes a threaded inner portion 138 which adjusts the distance that base portion 128 extends within the cavity 140 surrounded by threaded inner portion 138 of inner shaft 108 . nut 142 holds auger 124 in place relative to inner shaft 108 . moreover , means 144 is shown in fig7 for accommodating the reaming of fruits such as apples of different height and diameter . namely , a flange 146 cuttingly engages a threaded outer portion 148 of inner shaft 108 . a coil spring 150 engages flange 116 and flange 146 to urge inner shaft 108 and auger 124 downwardly . spring 150 would permit auger 124 to remain in a longitudinal position along axis 152 with the downward movement of bushing 104 , which will be explained hereinafter . the position of flange 146 determines the tension on spring 150 which in turn determines the force of penetration of auger 124 . this adjustment depends on the hardness or softness of the flesh of the apple 14 being reamed . it is believed that the shape of bit 126 is suitable for reaming apples , however other shapes may suffice in this regard . in addition , the removal of indents 20 and 22 from apple 14 may be achieved by mechanisms other than rotating augers depicted in the embodiments shown herein . returning to fig7 it may be observed that support plate 92 connected to removable keyed portions 152 and 154 which are linked to a cam arm 156 which operates similarly to the cam depicted in fig1 . consequently plate 92 moves upwardly and downwardly according to directional arrow 158 . it may also be observed that plate 92 is fixed to outer race 160 of bearing 120 . turning now to fig1 - 15 , an auger 176 is depicted in substitution for auger 124 of fig8 . auger 176 includes a shaft 178 terminating a cutting bit portion 180 . cutting bit portion 180 of auger 176 includes a relatively wide upper portion 182 which converges to a relatively narrow bottom portion 184 , terminating in tip 186 . auger 176 includes relieved areas 188 and 190 , fig1 , having ramped surfaces 192 and 194 , respectively . ramped surfaces 192 and 194 extend outwardly from base 178 to cutting edges 196 and 198 . relieved portions 188 and 190 provide space for the cut or waste matter deriving from the flesh of the fruit 14 being reamed by device 10 . such cut matter is usually in the form of a curlicue . ramped surfaces 192 and 194 direct such waste matter 200 , fig1 upwardly and outwardly from auger 176 , directional arrow 202 , fig1 . flanges 204 and 206 extend outwardly from top portion 182 . edges 208 and 210 , fig1 , are capable of further cutting , the top portion of apple 14 to ensure complete removable of the fly legs . in operation , with respect to the embodiments shown in fig1 - 4 , the user advances an apple 14 within support 12 to the position shown in fig1 by manual or automated means known in the prior art , directional arrow 160 . cam 62 is timed to turn via shaft 64 such that cam follower arm 50 lowers collet shaft 38 and bit 36 downwardly into stem indent 20 . motor 74 , through driving member 72 and collet shaft spline surface 68 , turns bit 36 . a similar mechanism is utilized to raise and turn reamer 34 below apple 14 into blossom indent 18 . as previously discussed , apple 14 may be turned upside down relative to its depiction in fig1 - 6 such that the stem 16 is facing downwardly . turning to fig3 it may be observed that reamers 32 and 34 dress out stem and blossom indents 20 and 22 , leaving the seed cell 162 relatively intact . it should be noted that the seeds 164 and seed cell 162 may be easily removed from apple 14 at a later stage by filtering . turning now to fig4 it should be observed that cam 62 and another similar cam ( not shown ) are then timed to retract reamers 32 and 34 from apple 14 . it should be noted that cavities 166 and 168 , with stem and cylex removed , respectively , have been formed in apple 14 by the reaming process heretofore described . with respect to the embodiments shown in fig5 - 10 , a similar indent reaming device is depicted where augers 124 and 130 are moved toward one another according to directional arrows 172 and 174 . the movement of support plates 92 and 94 , and thus , augers 124 and 130 , are accomplished by a cam mechanism similar to that shown in fig1 or by conventional means . also augers 124 and 130 may be turned by motor means and linkages such as those depicted in fig1 relative to reamer auger 32 . auger 176 may be substituted for either auger 124 or 130 in the reaming process herein before described . after reaming by either the disclosed devices 10 or 10a , exemplar apple 14 is then moved by support 12 according to directional arrow 170 for further processing which may include peeling , crushing , grating , and the like in the production of applesauce . while in the foregoing embodiments of the invention have been set forth in considerable detail for the purpose of making a complete disclosure of the invention it may be apparent to those of skill in the art that numerous changes may be made in such details without departing from the spirit and principles of the invention .

US-72962291-A

a medical device mounting system is disclosed for connecting a medical device suite to ceiling support structure . the system includes a plurality of portions connected to form a box beam structure that has high strength and high rigidity to withstand substantial bending loads associated with heavy medical device suites . the system includes a structure connection portion for engaging ceiling structure , a central mounting panel portion , and a base plate portion for engaging the medical device suite at or above the ceiling panel level . the mounting panel portion includes multiple mounting panels formed into a box beam shape . the base plate portion forms an egg - crate structure . the structure connection portion includes a plurality of tubular members that connect to longitudinal members of the mounting panel portion , and a plurality of plate portions that facilitate fixation of the assembly to ceiling structure . other embodiments are disclosed and claimed .

referring to fig1 - 3 , a medical device mounting system 1 is illustrated in a position engaged with exemplary ceiling support structure “ css ”. the medical device mounting system 1 generally includes a mounting panel portion 2 , a base plate portion 4 , and a structure connection portion 6 . the structure connection portion 6 is configured to attach to ceiling structure located above the ceiling plane “ cp .” the base plate portion 4 is configured to attach to one or more medical device suspension devices , such as suspension arms and the like . in use , the medical device mounting system will be disposed above the ceiling such that only the attached medical device system ( s ) will protrude below the ceiling itself . the mounting panel portion 2 of the system 1 includes a plurality of longitudinal structural members configured into a box - like arrangement , which provides the mounting system 1 its substantial stiffness . this box - beam arrangement is formed from first and second pairs of mounting panels 8 , 10 . a face of one of the first mounting panels 8 is shown in fig1 , while a face of one of the second mounting panels 10 is shown in fig2 . fig4 a - 4e illustrate features of the first mounting panel 8 , which includes a pair of spaced - apart longitudinal structural members 8 a , a pair of spaced - apart horizontal structural members 8 b , and a pair of diagonal structural members 8 c . as shown , the longitudinal structural members 8 a have first and second ends 8 a 1 , 8 a 2 . the horizontal structural members 8 b also have first and second ends 8 b 1 , 8 b 2 . the horizontal structural members are spaced apart by a distance “ hd ,” and are connected to the longitudinal structural members 8 a such that their first ends 8 b 1 are connected to a first one of the longitudinal members and their second ends 8 b 2 are connected to a second one of the longitudinal members . each of the diagonal structural members 8 c has first and second ends 8 c 1 , 8 c 2 , which are positioned to engage the horizontal and longitudinal structural members 8 a , 8 b to form an “ x ” arrangement between the pair of horizontal structural members 8 b . the first end 8 c 1 of each diagonal member connects to a first end 8 b 1 of one of the pair of horizontal structural members 8 b , while the second end 8 c 2 of each diagonal member connects to a second end 8 b 2 of the other of the pair of horizontal structural members . in some embodiments , this “ x ” arrangement ( or “ racking arrangement ”) may be placed closer to the top end of the structure than the bottom end . for shorter mounting systems , the racking arrangement may be optional . for longer mounting systems , the racking arrangement may be duplicated one or more times along the length of the mounting system ( see , e . g ., fig1 a , 11 b ). the resulting “ racking ” arrangement of horizontal and diagonal structural members is shown in fig4 c . this configuration provides enhanced racking strength to the first mounting panel 8 . the longitudinal and horizontal structural members 8 a , 8 b are sized to provide the first mounting panel 8 with a desired length “ pl 1 ,” and a desired width “ pw 1 .” the length “ pl 1 ” and width “ pw 1 ” may be adjusted depending upon the requirements ( e . g ., load , stiffness ) of a particular medical device being supported , and / or by the physical limitations of the area above the ceiling . referring now to fig5 a - 5e features of the second mounting panel 10 will be described . as can be seen , the second mounting panel 10 is generally configured in the same manner as the first mounting panel 8 . thus , the second mounting panel 10 includes a pair of spaced - apart longitudinal structural members 10 a , a pair of spaced - apart horizontal structural members 10 b , and a pair of diagonal structural members 10 c . the longitudinal structural members 10 a have first and second ends 10 a 1 , 10 a 2 , the horizontal structural members 10 b have first and second ends 10 b 1 , 10 b 2 , and the diagonal structural members 10 c have first and second ends 10 c 1 , 10 c 2 . the horizontal structural members are spaced apart by a distance “ hd ,” and are connected to the longitudinal structural members 10 a such that their first ends 10 b 1 are connected to a first one of the longitudinal members 10 a and their second ends 10 b 2 are connected to a second one of the longitudinal members 10 a . the diagonal structural members 10 c are positioned to engage the horizontal and longitudinal structural members 10 a , 10 b to form an “ x ” arrangement . thus , the first end 10 c 1 of each diagonal member connects to a first end 10 b 1 of one of the pair of horizontal structural members 10 b and the second end 10 c 2 of each diagonal member connects to a second end 10 b 2 of the other of the pair of horizontal structural members . the resulting “ racking ” arrangement of horizontal and diagonal structural members 10 b , 10 c is shown in fig5 c . as with the first panel , the illustrated configuration provides enhanced racking strength to the second mounting panel 10 . the longitudinal and horizontal structural members 10 a , 10 b are sized to provide the second mounting panel 10 with a desired length “ pl 2 ,” and a desired width “ pw 2 .” as can be seen , “ pl 2 ” is substantially the same as “ pl 1 ,” while “ pw 2 ” is slightly larger than “ pw 1 .” referring back to fig3 , it can be seen that the first mounting panels 8 are connected to the second mounting panels such that the resulting square box beam formed by the pairs of panels 8 , 10 has a box width “ bw ” that is equal to the width of the second panel “ pw 2 ”. in the illustrated embodiment , the longitudinal and horizontal structural members 8 a , 8 b ; 10 a , 10 b are 2 - inch × 2 - inch square steel tubular members , while the diagonal structural members 8 c , 10 c are ½ inch flat steel members . the longitudinal structural members 8 a , 10 a may be made from at least 13 gauge material , while the horizontal and diagonal structural members 8 b , 10 b , 8 c , 10 c may be made from at least 14 gauge material . the structural members may be welded together at the previously described connection points . alternatively , some of the structural members may be connected together using appropriately sized fasteners , such as rivets and / or nut / bolt combinations . to provide additional stiffness to the individual longitudinal members 8 a , 10 a at desired locations , additional angle members may be welded or fastened to exterior portions of the longitudinal members . referring now to fig6 a and 6b , the base plate portion 4 of the system 1 will be described . as previously noted , the base plate portion 4 provides the interface connection between the disclosed system 1 and a medical device system , such as a suspension arm . in the illustrated embodiment , the base plate portion 4 comprises a plurality of longitudinal members oriented to form a substantially square box structure that is engageable with the longitudinal structural members 8 a , 10 a of the first and second mounting panels 8 , 10 . the base plate portion 4 generally includes a structural portion 4 a and a medical device engagement portion 4 b . the structural portion 4 a includes first and second sets of longitudinal members 4 a 1 , 4 a 2 . in the illustrated embodiment , the first set of longitudinal members 4 a 1 comprise first and second members positioned parallel with each other and spaced apart by a distance “ bw .” distance “ bw ” may be substantially the same as the distance “ pw 2 ” ( fig5 a ) to allow the structural portion 4 a to engage the longitudinal members 8 a , 10 a of the first and second mounting panels 8 , 10 . the second set of longitudinal members 4 a 2 comprise first , second , third and fourth members positioned parallel to each other , and perpendicular to the first set of longitudinal members 4 a 1 . thus , first ends 4 a 21 of the second set of longitudinal members 4 a 2 are connected to one member of the first set 4 a 1 , while second ends 4 a 22 of the second set 4 a 2 are connected to the other member of the first set 4 a 1 . as can be seen , the individual longitudinal members each have a height “ lmh ” that is substantially greater than their thickness “ lmt .” the resulting arrangement approximates an egg - crate structure having substantial stiffness in all three planes . the medical device engagement portion 4 b includes individual plates 4 b 1 - 4 b 4 connected between adjacent ones of the second set of longitudinal members 4 a 2 . each of the individual plates 4 b 1 - 4 b 4 includes a hole 5 configured to receive fasteners for attaching the base plate portion 4 to a medical device system . it will be appreciated that the size , arrangement , number of individual plates , and number of fastener holes may be varied depending upon the particular application . the base plate portion 4 engages the mounting panel portion 2 near the first ends 8 a 1 , 10 a 1 of the longitudinal structural members 8 a , 10 a of the first and second mounting panels 8 , 10 . in the illustrated embodiment , the longitudinal structural members 8 a , 10 a engage the first and second sets of longitudinal members 4 a 1 , 4 a 2 where the outside sets of members 4 a 1 , 4 a 2 intersect . the base plate portion 4 may be connected to the mounting panel portion 2 at these points via welding , or through the use of appropriately sized fasteners . in the illustrated embodiment , the long longitudinal members 4 a 1 , 4 a 2 are ½ - inch thick steel plate members ( i . e ., “ lmt ” is about ½ - inch ), having a height “ lmh ” of about 5 - inches . the plates 4 b 1 - 4 b 4 are 1 - inch thick steel plate members . these members may be welded together at the previously described connection points . alternatively , one or more of these members may be connected together using appropriately sized fasteners . referring now to fig7 a - 7d , a first embodiment of the structure connection portion 6 will be described in greater detail . the structure connection portion 6 , as previously noted , is configured to connect the mounting panel portion 2 to ceiling structure ( css ) located above the ceiling plane “ cp ” ( see fig1 ). as such , the structure connection portion 6 comprises a plurality of connection sub - sections 6 a , each configured to engage one of the four corners of the mounting panel portion 2 . the connection sub - sections 6 a are also each configured to engage the ceiling support structure (“ css ”) ( see also fig1 ). fig7 a shows a plan view of a first embodiment of the structure connection portion 6 , taken from above the ceiling support structure ( css ), showing the structure connection portion connected to the css . fig7 b is a cross - section view of a single connection sub - section 6 a taken along line 7 b - 7 b of fig7 a . fig7 c is a side view of the connection sub - section 6 a of fig7 b , while fig7 d is a top plan view of the same connection sub - section 6 a . as can be seen , the connection sub - sections 6 a include first and second pairs of opposing structural angle clips 6 a 1 , 6 a 2 . the first angle clips 6 a 1 are positioned with respect to each other so that their vertical legs 6 a 11 are parallel to each other , and their horizontal legs 6 a 12 point away from each other . the second angle clips 6 a 2 are similarly positioned with respect to each other so that their vertical legs 6 a 21 are parallel to each other , and their horizontal legs 6 a 22 diverge from each other . the second pairs of angle clips 6 a 2 are sandwiched between the first pairs of angle clips 6 a 1 so that a vertically - oriented enclosure 7 is formed by the respective vertical legs 6 a 11 , 6 a 21 of the clips . this vertically - oriented enclosure 7 is sized to receive respective pairs of longitudinal structural members 8 a , 10 a , of the mounting panel portion 2 . thus arranged , each of the connection sub - sections 6 a is configured to engage one of the four corners of the mounting panel portion 2 . each of the angle clips 6 a 1 , 6 a 2 may have one or more holes disposed in the horizontal and / or vertical legs 6 a 11 , 6 a 12 , 6 a 21 , 6 a 22 to receive suitably - sized fasteners for connecting the structure connection portion 6 to the ceiling support structure ( css ) and / or the mounting panel portion 2 . alternatively , or in addition , portions of the angle clips may be welded to the css and / or the mounting panel portion 2 . in one embodiment , the angle clips are made from ¼ - inch thick steel , and the individual pairs of clips 6 a 1 , 6 a 2 are welded together to form the individual connection sub - sections 6 a . it will be appreciated that other sizes , material types , and connection types can also be used as desired . referring now to fig8 a - 8d , a second embodiment of the structure connection portion will be described in greater detail . the structure connection portion 60 of fig8 a - 8d may function similarly to the structure connection portion 6 of fig7 a - 7d . thus , the structure connection portion 60 is configured to connect the mounting panel portion 2 to ceiling structure ( css ) located above the ceiling plane “ cp ” in the manner shown in fig1 . as can be seen , the structure connection portion 60 provides a simplified arrangement as compared to the multiple angle - clip arrangement of structure connection portion 6 . thus , the structure connection portion 60 comprises a plate portion 62 and first and second tubular members 64 a , 64 b oriented substantially perpendicular to an upper surface 66 of the plate portion . the first and second tubular members 64 a , 64 b may have a connection portion length “ cpl ” to provide a desired length of engagement between the structure connection portion and the mounting panel portion 2 . in one embodiment , the connection portion length “ cpl ” is about 7 - inches . the first and second tubular members 64 a , 64 b may be square steel tubular members . in one embodiment , the first and second tubular members 64 a , 64 b are 1¾ - inch square tubular members made from steel of at least 12 gauge . it will be appreciated that other tubular shapes ( circular , triangular ), gauges , and materials can also be used provided the resulting structure connection portion 60 provides a desired strength and stiffness . in one embodiment , the first and second tubular members 64 a , 64 b may be welded to the plate portion 62 . the plate portion 62 may include a plurality of holes 68 for receiving fasteners to enable the structure connection portion 60 to be connected to the ceiling support structure “ css .” in the illustrated embodiment the holes 68 as elongated so they can receive fasteners in any of a variety of positions along the hole , thus providing a degree of flexibility in engaging the structure connection portion 60 to the ceiling support structure css . it will be appreciated , however , that the holes could be circular , and also that greater numbers of holes 68 could be used . in one exemplary embodiment , the plate portion 62 is a steel plate having a plate thickness “ pt ” of about ½ - inch . in use , the first and second tubular members 64 a , 64 b can engage one of the four corners of the mounting panel portion 2 , while the plate portion 62 can engage the ceiling support structure ( css ) to thereby connect the mounting panel portion 2 to the ceiling in a manner similar to that shown in fig1 . fig9 a and 9b show the structure connection portion 62 engaged with four corners of the mounting panel portion 2 . namely , the first and second tubular members 64 a , 64 b engage the second ends 8 a 2 , 10 a 2 of longitudinal structural members 8 , 10 of the mounting panel portion 2 . in one embodiment , the first and second tubular members 64 a , 64 b are sized and configured to be received within the second ends 8 a 2 , 10 a 2 of longitudinal structural members 8 , 10 . it will be appreciated , however , that this could be reversed such that the first and second tubular members 64 a , 64 b can be sized and configured to be received within the second ends 8 a 2 , 10 a 2 of longitudinal structural members 8 , 10 . the first and second tubular members 64 a , 64 b may have one or more holes disposed along the length thereof to receive suitably - sized fasteners for connecting the structure connection portion 60 to the second ends 8 a 2 , 10 a 2 of longitudinal structural members 8 , 10 . alternatively , or in addition , portions of the first and second tubular members 64 a , 64 b may be welded to the second ends 8 a 2 , 10 a 2 of longitudinal structural members 8 , 10 . fig1 a and 10b show an alternative base plate portion 104 , which may be used for mounting two or more medical device systems . the base plate portion 104 is similar to the base plate portion 4 described in relation to fig6 a and 6b . thus , the base plate portion 104 comprises a plurality of longitudinal members oriented to form a substantially square box structure that is engageable at its inside corners with the longitudinal structural members 8 a , 10 a of the first and second mounting panels 8 , 10 . the base plate portion 104 generally includes a structural portion 104 a and a medical device engagement portion 104 b . the structural portion 104 a includes first and second sets of longitudinal members 104 a 1 , 104 a 2 . in the illustrated embodiment , the first set of longitudinal members 104 a 1 comprise first , second , third and fourth members positioned parallel with each other . the second set of longitudinal members 104 a 2 comprise first and second members spaced apart by a distance “ bw ” that is substantially the same as the distance “ pw 2 ” ( fig5 a ). the first and second sets of longitudinal members 104 a 2 , 104 a 2 are connected to form an egg - crate arrangement as previously described . as with the previous embodiment , the individual longitudinal members each have a height “ lmh ” that is substantially greater than their thickness “ lmt .” the resulting egg - crate arrangement provides the structure with substantial stiffness in all three planes . the medical device engagement portion 104 b includes individual plates 104 b 1 - 104 b 4 connected between adjacent ones of the second set of longitudinal members 104 a 1 . each of the individual plates 104 b 1 - 104 b 4 includes one or more holes 105 configured to receive fasteners for attaching the base plate portion 104 to a medical device system . it will be appreciated that the size , arrangement , and number of individual plates may be varied depending upon the particular application . the base plate portion 104 engages the mounting panel portion 2 near the first ends 8 a 1 , 10 a 1 of the longitudinal structural members 8 a , 10 a of the first and second mounting panels 8 , 10 . in the illustrated embodiment , the longitudinal structural members 8 a , 10 a engage the first and second sets of longitudinal members 104 a 1 , 104 a 2 where the outside sets of members 104 a 1 , 104 a 2 intersect . the base plate portion 104 may be connected to the mounting panel portion 2 at these points via welding , or through the use of appropriately sized fasteners . in the illustrated embodiment , the long longitudinal members 104 a 1 , 104 a 2 are ½ - inch thick steel plate members ( i . e ., “ lmt ” is about ½ - inch ), having a height “ lmh ” of about 5 - inches . the plates 104 b 1 - 104 b 4 are 1 - inch thick steel plate members . these members may be welded together at the previously described connection points . alternatively , one or more of these members may be connected together using appropriately sized fasteners . although the disclosed system has been described in relation to particular material types , sizes and connection methods , it will be appreciated that these materials , sizes , materials and connection methods are only examples , and are not intended to limit the scope of the disclosed structure . it is contemplated that other sizes , shapes , gauges and materials can be used to form the structural members , depending upon the specific final operating conditions of the medical device mounting system . for example , in one alternative embodiment , the disclosed system may include a single post / tube on each corner of the mount as compared to the double - post / tube configuration shown in the figures . such an arrangement can be modified by size or thickness to support required loads . in addition , individual dimensions of the resulting structure , as well as size and dimensions of the individual structural elements , may be based on individual configuration of the ceiling structure to which the system will be mounted . for example , fig1 a and 11b show an embodiment of the disclosed mounting system 100 in which multiple “ x ” arrangements ( i . e ., racking arrangements ) 102 are disposed adjacent to each other along the length of the system . as with the embodiment described in relation to fig1 and 2 , the “ x ” arrangements 102 consist of diagonal structural members 108 c having first and second ends 108 c 1 , 108 c 2 , which are positioned to engage adjacent longitudinal and horizontal structural members 108 a , 108 b to form “ x ” arrangements between the members 108 a , 108 b . as can be seen , one end of each diagonal member connects to an end of one pair of horizontal structural members 108 b , while another end of each diagonal member 108 c connects to another end of the other of the pair of horizontal structural members 108 b . the resulting multiple “ racking ” arrangements shown in fig1 a , 11 b provides enhanced racking strength to the mounting structure 100 as compared to systems that include only a single racking arrangement , or no racking arrangement at all . thus , the individual components of the disclosed device may be constructed of any of a variety of materials appropriate for the intended application , taking into consideration the strength and rigidity requirements of the application , and the forces applied to the frame system . steel is one such example of an appropriate material . while the present invention has been disclosed with reference to certain embodiments , numerous modifications , alterations and changes to the described embodiments are possible without departing from the spirit and scope of the invention , as defined in the appended claims . accordingly , it is intended that the present invention not be limited to the described embodiments , but that it has the full scope defined by the language of the following claims , and equivalents thereof .

US-201213352563-A

we disclose a method for operating an online computer database system that enables users to pay make bet offers and respond to bet offers in a variety of ways . the method , implemented via the computer system , displays these bet offers , bet challenges , and the responses to those offers and challenges , thus providing new ways to force people to explicitly or implicitly express their opinions .

module 1 describes methods for enabling a user to enter an offer targeted to a specific person or persons or org or orgs . several different offers are described . module 2 describes methods for registering responses from targets of offers . module 6 describes methods for targeting more than one person with an offer , and ordering the targets according to priority of getting paid . module 7 describes methods for enabling more than one user to contribute to an offer to pay for a bet - response . module 8 describes methods for enabling people to post rates for making and / or reacting to bet offers on particular subjects . a problem of public speech is how to elicit an honest opinion on a subject from politicians and business decision makers who may be hurt by being honest . these challenges force a person ( an individual or an organization ) to : ( a ) make a bet offer — a specific expression of uncertainty — about a subject , or ( b ) admit to ignorance about the subject , or ( c ) show that she is hiding something . we name these challenges after galileo galilei , who stood for honest , expression that acknowledges uncertainty . as tools for forcing honest expression , galileo challenges can be important for public and political speech . for instance , the create - a - bet challenge is well suited to asking a person to convert a public statement he has previously made into a bet . imagine that a senator says , “ i think decriminalizing drugs would be a national disaster .” you could then ask him to specify what he means through a bet . in a bet he must give specific answers the following questions : what does “ decriminalizing drugs ” mean ? what does “ national disaster ” mean ? what are the odds that this “ national disaster ” will occur ? as in this hypothetical example , one often says : “ i think so and so will happen .” but , a person does not just “ think ” that some event will happen , she thinks there is some probability it will happen . a person may not provide a numerical probability estimate , such as “ i think there is a 30 % chance . . . ” but a feeling of probability is part of any guess . indeed , we do not usually think in numerical probabilities and we do not usually state probabilities in numbers . yet , being specific about predictions and expressing our uncertainty with numerical probability estimates is usually the more informative , scientific approach . it is also the proper economic approach because a proper estimate of the cost of an investment should take into account the best estimate of the probability that the investment will succeed . this estimate dramatically affects the projected cost of success . for example , if one thinks that a program , say , the missile defense system , has a 50 % chance of succeeding . then , by simple logic , one also thinks that the cost of success is , on average , twice the budgeted cost . that &# 39 ; s because over a series of programs that have a 50 % chance of success , half will fail . the costs of the failures need to be added to the costs of the successes to yield an average cost . so , lawmakers should , where feasible , state in specific terms the effect of passing a proposed law or program and state the chances that the effect will occur if the law or program passes . further , they should state the effect of defeating a proposed law or program , and state the chances that the effect will occur if the law or program is defeated . of course , at present , lawmakers rarely even state numerical probability estimates that a law or program will succeed in achieving specific objectives . only if we force lawmakers to reveal their uncertainty , as in a galileo challenge , will they do so . politics offers another good example . we all know that they don &# 39 ; t know what they &# 39 ; re doing in washington . it &# 39 ; s not that they &# 39 ; re fools ; it &# 39 ; s just that nobody knows how to handle many of the problems . a lot of experts have studied these subjects . but they know much less than they will admit . if somebody ran for office saying that they didn &# 39 ; t have answers , nobody would pay attention to him . everybody wants an answer . but someday , maybe , everybody will slowly come around to the realization that the experts don &# 39 ; t know almost everything . the great obstacle to discovering the shape of the earth , the continents , and the ocean was not ignorance , but the illusion of knowledge . in a create - a - bet - offer challenge , you state the subject you want a person to bet on , and then you offer that person an amount of money to create a bet offer about the subject . your challenge and the target person &# 39 ; s response are displayed publicly . a person creating a bet offer cannot hide by using vague language ; he must use highly specific speech that is precise enough to test for truth , so that the bet can be settled . the foundation of honest speech is specificity , as galileo pointed out in an essay defending of the scientific method . there is no doubt whatever that by introducing irregular lines one may save not only the appearance in question but any other . yet i warn sarsi that far from being of any assistance to his teacher &# 39 ; s case , this would only prejudice it more seriously . . . lines are called regular when , having fixed and definite description , they are susceptible of definition and of having their properties demonstrated . irregular lines are those which have no determinacy whatever , but are indefinite and casual and hence undefinable ; no property of such lines can be demonstrated , and in a word nothing can be known about them . hence , to say , “ such events take place thanks to an irregular path ” is the same as to say , “ i do not know why they occur .” the introduction of such lines is in no way superior to the “ sympathy ,” “ antipathy ,” “ occult properties ,” “ influences ,” and other terms employed by some philosophers as a cloak for the correct reply , which would be : “ i do not know .” that reply is as much more tolerable than the others as candid honesty is more beautiful than deceitful duplicity . in creating a bet , a bettor must also must give the odds , a probability estimate that is a specific , explicit statement of uncertainty . now the next subject , and the last main subject that i want to talk about , is the one i really consider the most important and the most serious . and that has to do with the question of uncertainty and doubt . a scientist is never certain . we all know that . we know that all our statements are approximate statements with different degrees of certainty ; that when a statement is made the question is not whether it is true or false but rather how likely it is to be true or false . richard feynman , address at conference celebrating 400th anniversary of galileo &# 39 ; s birth , 1964 in creating a bet offer , a bettor also states how much money he is willing to risk , which is usually a powerful indicator of his confidence in the opinion stated in his bet offer . now , let us see how a create - a - bet - offer challenge can force a person to stake out a specific position and acknowledge uncertainty , or admit she is hiding something . in creating a bet offer , a person can set the odds so that she thinks she is getting a good deal . therefore , she cannot logically say she is refusing to create a bet offer because it is a bad financial deal . she cannot hide behind the “ i don &# 39 ; t bet ” excuse . but a person can say that she is not going to waste her valuable time in creating offers . it follows , then , that a person who is offered a sum of money to create a bet offer has six basic responses : 1 . accept and give a bet opinion on a subject . 2 . decline and say , “ you are not paying me enough to create the bet offer .” 3 . decline and say , “ i do not know enough to bet .” 4 . decline and say , “ no comment ,” thereby demonstrating that she is not willing to be specific or acknowledge her uncertainty about the subject . 5 . decline and say , “ giving a bet opinion ( being honest ) would cost me more outside the bet than the expected profit from the bet .” 6 . decline and say , “ i &# 39 ; m tapped out . i don &# 39 ; t have any funds available to bet .” if the target of a galileo challenge says that she is not being paid enough to create a bet , then forcing her response becomes a matter of finding her labor rate . what is a reasonable sum of money to offer someone to create a bet offer ? that depends on the person . a create - a - bet - offer challenge leaves a target person with wiggle room to create a bet that avoids the subject that the challenger wants exposed . the react - to - a - bet - offer challenge is better suited to pinning a person down on a narrow question . in the react to a bet challenge , you make a bet offer and then pay a person to review the offer and decide to accept or decline it . by stating an opinion through a bet , you are stating it precisely and forcing your target to acknowledge his opinion and uncertainty about the very specific topic of your bet . a person who is offered a reasonable sum of money to review a bet offer can then : 1 . accept and thereby state his bet opinion . 2 . reply with a new offer ( he may , for example , change the odds of your offer ) and thereby state his bet opinion . 3 . decline and say , “ you are not paying me enough to review your bet offer .” 4 . decline and say , “ your bet statement is biased , so i do not want to comment on it .” 5 . decline and say , “ i do not know enough to bet .” 6 . decline and say , “ no comment ,” thereby demonstrating that she is not willing to be specific or acknowledge her uncertainty about the subject of your bet offer . 7 . decline and say , “ accepting the bet would cost me more outside the bet than the expected profit from the bet .” 8 . decline and say , “ i &# 39 ; m tapped out . i don &# 39 ; t have any funds available to bet .” what is a reasonable sum of money to offer someone to review a bet offer ? that depends on the person . the problem with a react - to - a - bet - offer challenge is that the challenger may pose a bet statement that is biased . thus , we introduce the challenge below , which prevents the challenger or the target from creating a biased bet statement that can nullify the significance of the bet offer . the idea of a betting on a neutral party statement is similar to the idea of a debate in which a neutral moderator chooses the question and the debaters react to that question . in a bet - on - a - neutral - party - statement challenge you pay bet press to find a neutral party to create a bet statement about a particular subject . ( a bet statement is a statement that can found true or false for a reasonable amount of money and in a reasonable amount of time .) you offer to pay a target without seeing the bet statement . ( a ) the subject of the bet ( b ) how much you will pay the target ( c ) the minimum amount of money that the target must risk in a bet offer . after the neutral party creates the statement , and if the target of your challenge agrees to get paid , then she has to : ( a ) review the statement , ( b ) state the odds that it is true , ( c ) pick a side true or false and ( d ) put an amount of money at risk in a bet offer . the neutral party &# 39 ; s bet statement and the target &# 39 ; s response are displayed publicly . by allowing a neutral party to create the bet statement you are showing that you are not trying to trap the target with a biased bet statement . likewise , the target cannot make a biased bet statement . the idea is to let a neutral person encapsulate an issue / subject in a bet statement and then get an honest expression of probability about that statement from the target . a person who is offered a reasonable sum of money to review a the bet statement and make a bet offer about it can then : 1 . accept and thereby state his bet opinion . 2 . decline and say , “ you are not paying me enough to review the bet statement .” 3 . decline and say , “ i do not know enough to bet .” 4 . decline and say , “ no comment ,” thereby demonstrating that she is not willing to be specific or acknowledge her uncertainty about the subject of your bet offer . 5 . decline and say , “ giving a bet opinion ( being honest ) about the neutral party statement would cost me more outside the bet than the expected profit from the bet .” 6 . decline and say , “ i &# 39 ; m tapped out . i don &# 39 ; t have any funds available to bet .” what is a reasonable sum of money to offer someone to review a neutral bet statement and make a bet offer on it ? that depends on the person . bet - response means a bet offer or a stated ( public ) refusal to make a bet offer about a specified subject or a specified bettable statement . many distinct types of bet - response are possible , so the term bet - response is somewhat broad and imprecise . an offer to pay for a bet - response ( pfbr ) or a pay for a bet - response offer ( pfbro ) means an offer in which a user offers to pay a person or persons or organization to provide a bet opinion of some sort . sender means a user who creates a pfbr offer and directs (“ sends ”) it to a target , which may be a person , or class of persons , or an organization . target means a person , class of persons , or an organization to which a pfbr offer has been directed (“ sent ”). escrow agent means a system - authorized user who has the ability to approve the transfer of a payment to an intended user , usually a target , from an escrow account that corresponds to a particular pfbr offer . neutral , statement creator means a system - authorized user who creates bettable statements based upon non - bettable descriptions of a subject , provided by a sender . this kind of user is called neutral because she has no allegiance to either a sender or target . module 1 : steps for entering an offer to pay for a bet - response the invention provides a method of ( or system for ) enabling a sender to enter one or more different kinds of pay - for - a - bet and / or react - to - a - bet offer , also called pfbr offers . the target &# 39 ; s name / identity will be inherently part of such an offer . a sender will be identified by the system , but the sender &# 39 ; s identity can optionally be part of — displayed with — a pfbr offer . thus , offers can be found ( searched for ) in the system under the target &# 39 ; s name and , possibly , the sender &# 39 ; s name . further , the target &# 39 ; s response or lack of response ( see module 2 below ) will be stored and displayed along with the pfbr . in describing the offers , we will repeat disclosures originally made in chapters 18 and 19 of u . s . pat . no . 6 , 443 , 841 ( and in the preface above ). we do so for the sake of a fuller explanation of the options that the invention can enable . certain offers described below require that a target make a bet offer in order to be paid . in these offers , a sender can specify ( and the inventive method and system can enable the sender to specify ): the amount the sender requires that the target risk in the bet offer , whether the target must make a lock - in commitment , the duration of the offer . illustrative scenario : trying to get a bet - response from a chief financial officer for illustration &# 39 ; s sake , let us imagine one scenario in which the offers described below can be used . we will imagine that a sender wants to elicit a bet - response ( an “ honest ” opinion ) from the chief financial officer ( cfo ) of a company whose stock has dropped . the sender is an investor who would like to know if the company is a good investment , in particular , whether the company is in danger of defaulting on any of its loans . so , we imagine that the sender uses the invention to makes the pfbr offers described below . ( in practice , a sender probably would not make all of these offers at once .) for simplicity , we &# 39 ; ll assume all offers are for $ 1 , 000 . 1 . sender offers to pay a target to make a bet offer on a specified subject . a sender can ask a target to bet on a specified subject , by which we mean a topic that is described in a somewhat vague statement that is not precise enough to be bet upon directly . for example , the sender can offer to pay the cfo $ 1 , 000 to make a bet offer on the subject of : is your company in danger of going under ? the cfo , in this example case , would have to then convert the vague statement , is your company in danger of going under ?, into a bettable statement of his choice , and further , specify the odds ( or other payoff rules ) and stakes , and the rest of the information required for a bet offer . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : the subject that the target is to create a bet offer about . 2 . sender offers to pay a target to make a bet offer about a statement in the past that the target has made . a sender can cite a statement that a target has made in the past and ask that the target convert that statement into a bet offer . for example , assume a cfo says in an investment conference , “ we are confident that our current business will comfortably support existing debt levels .” the sender could then offer to pay the cfo to convert this statement into a bet offer . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : a statement that the target made in the past , which the sender will pay the target to convert into a bet offer . 3 . sender offers to pay a target to make a bet offer about a statement in the past that someone else , or an org , has made , other than the sender or the target . almost the same as above , a sender can ask that the target convert a specified statement made by someone else or by some org into a bet offer . for example , imagine that the president of a company makes a statement such as , “ we are confident that our current business will comfortably support existing debt levels .” the sender could ask that the cfo convert this statement into a bet offer . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : a specified statement ( or citation data identifying a specified statement ) that the some specified person or org has made in the past , which the sender will pay the target to convert into a bet offer . 4 . sender offers to pay a target to make a bet offer about a specified bettable statement . a sender can offer to pay a target to make a bet offer about a bettable statement that the sender specifies . for example , a sender who is interested in what a cfo really thinks about the financial condition of the cfo &# 39 ; s company could offer to pay the cfo $ 1 , 000 to make a bet offer about the following bettable statement : by jan . 1 , 2004 , pinnacle holdings will default on at least one of its loans or will renegotiate with at least one lender , resulting in a dilution of the ownership of current stockholders of at least 10 %. accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : the bettable statement that the target is to create a bet offer about . 5 . sender offers to pay a target to read a specified bet offer made . a sender can offer to pay a target to read a bet offer , which may or may not be made by the sender . for simplicity , we will assume that the sender makes the bet offer . by being paid , the target must admit that he has reviewed the bet offer . the target &# 39 ; s willingness to then accept or refuse the offer can have significance . for example , a sender might present the following bet offer : bettable statement : by jan . 1 , 2004 , pinnacle holdings will default on at least one of its loans or will renegotiate with at least one lender , resulting in a dilution of the ownership of current stockholders of at least 10 %. odds : 1 - 1 side i choose : true stake i risk : $ 50 , 000 now , if the cfo refuses to accept this bet , then one might infer that the cfo believes the odds are indeed close to , greater than 50 % that the company will default on a loan or dilute shareholders . conversely , if the cfo accepts the offer , then one might infer that the cfo believes that the odds are less than 50 % that the company will default or dilute . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies a bet offer made by the sender and / or other bettor ( s ). 6 . sender offers to pay a target to both read a specified bet offer and accept the offer . a sender can offer to pay a target to both read a bet offer by the sender or another bettor and accept the offer . if the target does not accept the offer then the payment is void . for example , taking the illustration just above , a sender can require that the cfo target not only read the bet offer , but also accept it , in order to get paid . this type of offer can be more useful that simply paying a target to read a bet offer . the offer does not leave the sender vulnerable to having a target just take the pfbr money with a “ no comment ,” response . note , too , that the sender can specify that the target must put up a certain amount of money at stake , an amount that could be greater than , equal to , or less than the amount needed to cover the sender &# 39 ; s stake . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : a bet offer made by the sender a requirement that the target accept the bet offer a requirement that the target put up a certain amount of money at stake . 7 . sender offers to pay a target to make a bet offer about a bettable statement created by a neutral third part where the subject of the statement is specified by the sender . a problem with the pfbr offers above is that the target can create a bet that does not really provide an honest opinion , but that evades the issue that the sender wants the target to provide a bet opinion about . alternatively , a sender can pay a target to respond to the sender &# 39 ; s bet offer . but , in this case , the target may complain that the bet offer is an unfair characterization of an issue . a solution to these two problems is to have the sender specify a general topic / subject and then specify that neutral third party — a neutral , statement creator — who will create the bettable statement that the target can make a bet about . for example , the sender might specify the following subject : the financial condition of pinnacle holdings . a neutral , statement creator can then create a bettable statement on this topic . a variety of methods are possible for choosing a neutral statement creator . the inventive method and system can include a system - authorized class of statement creators who are neutral and can be categorized according to their expertise . further , the invention can include steps for enabling a sender to request that such a user create a bettable statement based upon a subject that the sender specifies . the inventive method and system can also enable neutral , statement creator to communicate with a sender to get a better idea of the subject that the sender has in mind . accordingly , the invention can provide a method of ( or system for ) enabling a sender to choose to enter a pfbro in which the sender specifies : a statement creator to enter a bettable statement about the subject to be displayed along with the pfbro . as noted above , and in patent u . s . pat . no . 6 , 443 , 841 , the invention includes steps for enabling a target to respond to a pfbro . further , the response , or lack of response , is displayed along with the offer . the invention can also enable a target to enter a text comment and / or select from a set of standard responses , including the responses described in the preface above . the invention will enable anyone to look up her own name and find pfbro &# 39 ; s directed to her . similarly , the invention can enable a user to specify an email “ address for service ” where senders can send pfbro &# 39 ; s . yet , in some cases , these two channels to a target may not suffice ; a target may not specify an address , and may not use the system to find offers . thus , the invention can include steps for enabling a sender to specify that a pfbro is to be delivered by a physical delivery service of some sort , such as federal express or the post office . other well - known “ proof - of - service ” methods can be used as well . accordingly , the invention can provide steps for enabling a sender to specify a mode of delivery for a pfbro , and further , the enter evidence that the pfbro was delivered to its intended target . yet what if a target is a class of persons , such as all the employees of a given company ? most commonly , a target that is a group will be a group that is associated with an organization . thus , to accommodate the case of a class of persons , who belong to an organization , the invention can provide a method of ( or system for ) enabling a sender to direct a pfbro to a named group of people , or to people that belong to a named org . that is , the sender can specify the group or org . other users can then find pfbro &# 39 ; s under the name of orgs , just as users can find offers under the names of individuals . while this method does not guarantee delivery to all the people that belong to a named group or org , it does make delivery of a pfbro to its target group more likely . the invention will include authentication processes for ensuring that a user who responds to a pfbro is the genuine target of that offer . the invention will include methods for transferring funds from a sender to a target . these methods can include an escrow account into which a sender &# 39 ; s funds are kept until the target has fulfilled the obligations of the pfbro . the escrow account can include third - party oversight by a human escrow agent who can determine whether the conditions have been met . upon approval of the escrow agent , entered into the system , the payment offered in a pfbro can be transferred to the target ( via any known method , such as , to a target &# 39 ; s internal or external bank account ). the invention will include processes for enabling a sender to direct the same offer to more than one target . in making a pfbro , the sender will commit a certain amount of money , which we will call the sender &# 39 ; s budget . given that a sender &# 39 ; s budget is often limited , it useful to enable a sender to prioritize targets according to which targets will be paid if there are not enough funds available to pay them all . for example , assume that sue makes offers to pay $ 5 , 000 to a company &# 39 ; s president and its cfo and any other employee in the company to make a bet about whether the company will default on a loan within 3 years . and , assume that sue only has $ 10 , 000 to pay targets to make bet - responses . and assume she prefers to elicit a bet - response from the company president . then , she can list the targets and prioritize them so that if her pfbro is accepted by more than one target , the offer is struck with her preferred targets , in order of priority , until her budget ($ 10 , 000 in this case ) is exhausted . thus , invention will provide a method of ( or a system for ): enabling a user to enter a list of targets and to prioritize those targets according to the order in which target &# 39 ; s bet - response will be accepted by the sender over the others in the list . if more than one target can accept a pfbro , then using a deadline is a useful method for deciding when to determine which targets can strike an agreement with the sender to get paid for a bet - response . by deadline method we mean that the sender sets a deadline . before that deadline , any number of eligible targets can agree to accept the offer . when the deadline expires , the offers are then struck according to the target &# 39 ; s priority and according to the sender &# 39 ; s budget . it is also possible to divide the budget . this method is particularly appropriate where a target is a group of people , such as the employees of a company , and where the sender has not specified a priority order within that group . in this case it is reasonable to divide the budget or assign it randomly to anyone in the target group . accordingly , the invention will provide a method of ( or system for ) enabling more than one user to accept a pfbro and , further , for striking offers between a sender and multiple targets who have accepted the offer , according to the priority of those targets , as specified by the sender and within the limits of the budget that the sender has committed to the pfbro . the striking process can be automated within the system . the striking process can also be aided by a system administrator who can be paid for his efforts . the method of prioritizing pfbro &# 39 ; s can also apply analogously to prioritizing the acceptance of bet offers . this kind of process was disclosed in u . s . pat . no . 6 , 443 , 841 . the disclosure of this specification adds some processes regarding pfbro &# 39 ; s . where the processes disclosed here are novel , and where they can be applied to the targeting — restricting the acceptance , that is — of bet offers , we assert that these processes can be incorporated into the invention of u . s . pat . no . 6 , 443 , 841 . moreover , these processes may be split off into their own distinct inventive set of processes for targeting bet offers and pfbro &# 39 ; s , especially given the reality of limited budget for paying for bet - responses and limited funds for making bet offers . a future utility application may elaborate on the applications of the methods disclosed here where bet offers are concerned . 7 . module for enabling more than one sender to contribute to a pfbro the invention can also include processes for enabling more than one sender to contribute to a pfbro . this capability can be especially important where a wealthy target is concerned who requires a large amount of money in order to make a bet - response . to achieve this object , the inventive method and system can enable an initial sender to post a pfbro and further enable the sender to , along with the offer , request that other users contribute money to the offer and become partner senders . the inventive method and system can further provide a process for enabling a user who finds such an offer to commit to contributing to the offer . the amount that any such user commits to paying can be added to the total amount pledged , and put in a common escrow account . the inventive system can also display that more than one sender has contributed to the offer and can display the identities of the all the senders . 8 . module for posting rates charged by users for responding to an offer if a system exists for paying people to make and / or respond to bet offers , then it is also useful to enable users to post the rates they charge for responding to such offers . thus , the invention can provide a method of ( or system for ) enabling a user to post the amount of money that the user requires to be compensated for making a bet - response . the invention can enable a user to set a rate for each different kind of pfbro the system enables ( see the description of module 1 above ). for example , a user can set a rate of $ 500 for making a bet offer on a sender specified subject . accordingly , the invention can enable a user to view a list of types of pfbro &# 39 ; s , and to specify a compensation rate for each kind . the resulting rate sheet can then include the user &# 39 ; s name and can be displayed to senders and other users of the inventive system . in addition to a rate for making and / or responding to a bet offer , a user can specify the minimum amount he will risk if he responds with a bet offer . this commitment can show the user &# 39 ; s general willingness to make a meaningful bet offer about a given topic or statement specified by any sender . in addition to posting a minimum amount he will put at stake , a user can also post the profit margin he will build into any bet offer he makes ( see u . s . pat . no . 6 , 443 , 841 on the usefulness of posting a desired profit margin ).

US-1746404-A

a customization system for an article of footwear is disclosed . the customization system comprises an insert system . the insert system includes an insert and a heel member . both the insert and the heel member may be interchangeable , allowing the user to modify the article of footwear to provide a customized fit or performance optimization .

an insert for customizing an article of footwear is provided to customize fit or performance of the article of footwear . in some cases , a customizable insert for the insole and a heel member are used . the insert and heel member may also add additional support or cushioning for the foot while inside an article of footwear , so that these performance characteristics of the article of footwear are optimized for high - performance use of the article of footwear . for example , an insert may provide some extra cushioning between the foot and a full - length composite plate to reduce stresses to the foot . in addition , by inserting a heel member with the insole , extra support is provided to the heel to prevent slipping within the article of footwear . fig1 is an exploded isometric view of a preferred embodiment of insert 1702 and heel member 1704 as viewed from below . insert 1702 is preferably made of some material that provides cushioning for the foot , reducing stresses that may be applied to the foot during motion . insert 1702 is preferably made of a lightweight and flexible material that can cover , substantially cover , or replace an insole of an article of footwear . heel member 1704 is shaped to fit around the heel . heel member 1704 is also preferably made of a lightweight and flexible material . insert 1702 and heel member 1704 need not be composed of the same material . heel member 1704 includes rear extension 1708 and lateral extension 1710 . it also includes a medial extension , not shown in fig1 . additionally , heel member 1704 includes heel member base 1712 , in which hole 1714 is disposed . lateral extension 1710 , rear extension 1708 and the medial extension are all disposed at an angle to heel member base 1712 . rear extension 1708 is disposed between , and at an angle to , lateral extension 1710 and the medial extension . heel member base 1712 includes first base surface 1740 and a second base surface ( not shown .) in a preferred embodiment , heel member 1704 can also include an inner wrap , not shown here , which provides extra cushioning for the heel . in some embodiments , a means of fastening heel member 1704 to the inside of an article of footwear is provided . in a preferred embodiment , heel member 1704 includes first recessed portion 1732 , disposed on lateral extension 1710 . heel member 1704 also includes second recessed portion 1734 , disposed along rear extension 1708 . heel member 1704 also includes a third recessed region , disposed along the medial extension , not shown here . as seen in fig1 , insert 1702 includes recessed portion 1720 at the rear of insert 1702 . insert 1702 also includes central protruding region 1722 at the rear of insert 1702 . central protruding region 1722 is disposed with respect to first insert surface 1730 of insert 1702 in a way that allows for central protruding region 1722 to be flush with first insert surface 1730 . in a preferred embodiment , central protruding region 1722 is simply a region of first insert surface 1730 that has not been removed in the creation of recessed portion 1720 . fig2 is a plan view of a preferred embodiment of heel member 1704 . first recessed region 1732 , second recessed region 1734 , and third recessed region 1802 are disposed along lateral extension 1710 , rear extension 1708 , and medial extension 1804 , respectively . in some embodiments , a first releasable fastener 1820 may be inserted into first recessed region 1732 . likewise , a second releasable fastener 1822 may be inserted into second recessed region 1734 . likewise , a third releasable fastener 1824 may be inserted into third recessed region 1802 . in some embodiments , first releasable fastener 1820 , second releasable fastener 1822 , and third releasable fastener 1824 may be a low - profile hook or loop portion of a hook - and - loop releasable fastener . in a preferred embodiment , a low - profile velcro ® strip may be used as a releasable fastener , either hook or loop . heel member 1704 further includes second base surface 1806 of heel base 1712 . fig3 is an isometric view of a preferred embodiment of insert 1702 and heel member 1704 joined together as viewed from below . when joined together , heel member 1704 and insert 1702 may be referred to collectively as insert system 1903 . the recessed portion ( not shown in fig3 ) of insert 1702 contacts the second base surface of heel member base 1712 . central protruding region 1722 fits inside hole 1714 of heel member 1704 . this allows insert 1702 and heel member 1704 to be joined . preferably , the recessed portion of insert 1702 and heel member base 1712 comprise the same thickness , so that first base surface 1740 is disposed flush with first insert surface 1730 of insert 1702 . in other words , outer surface 1905 , comprised of first insert surface 1730 and first base surface 1740 is smooth . in some embodiments , first rim 1206 of protruding region 1722 is made slightly larger than second rim 1208 of heel member hole 1714 . this allows for an interference fit between central protruding region 1122 and heel member 1704 . in some embodiments , there may be more than one central protruding region included in insert 1702 , and more than one hole included in heel member 1704 . multiple protruding regions and cutouts may be used in a fashion similar to central protruding region 1722 and hole 1714 to give multiple interference fits that allow heel member 1704 to be joined with insert 1702 . fig4 is a plan view of a preferred embodiment of an article of footwear 2000 . article of footwear 2000 includes opening 2002 . opening 2002 is configured to receive the foot of a wearer . article of footwear 2000 includes collar 2030 . opening 2002 is also where an insert and a heel member may be inserted into article of footwear 2000 . in some embodiments , article of footwear 2000 includes a releasable fastener attached to inside surface 2040 of collar 2030 . in a preferred embodiment , article of footwear 2000 includes several attachment regions , each with a separate releasable fastener . in the embodiment shown here , article of footwear 2000 includes first attachment region 2004 , disposed just inside opening 2002 , along medial side 2010 of article of footwear 2000 . article of footwear 2000 also includes second attachment region 2006 , disposed just inside opening 2002 , along the rear side 2012 of article of footwear 2000 , and article of footwear 2000 also includes third attachment region 2008 , disposed just inside opening 2002 , along lateral side 2014 of article of footwear 2000 . first attachment region 2004 preferably includes a low - profile hook or loop releasable fastener . similarly , second attachment region 2006 preferably includes a low - profile hook or loop releasable fastener . similarly , third attachment region 2008 preferably includes a low - profile hook or loop releasable fastener . if a low - profile hook releasable fastener is used with the heel member , a low - profile loop releasable fastener is also preferably used in all three attachment regions of article of footwear 2000 . if a low - profile loop releasable fastener is used with the heel member , a low - profile hook releasable fastener is preferably used in all three attachment regions of article of footwear 2000 . in a preferred embodiment , the releasable fastener system is velcro ®. fig5 is an isometric view of a preferred embodiment of footwear system 2100 with heel member 1704 , insert 1702 , and article of footwear 2000 . heel member 1704 and insert 1702 are preferably joined prior to insertion in article of footwear 2000 . insert 1702 with joined heel member 1704 are preferably inserted into article of footwear 2000 using footwear opening 2002 . in a preferred embodiment , insert 1702 is shaped like the last of the article of footwear so that insert 1702 extends into article of footwear 2000 and preferably lies substantially flush with the sole . fig6 is a plan view of a preferred embodiment of article of footwear 2000 , after heel member 1704 and insert 1702 have been inserted through opening 2002 . first releasable fastener 1820 of heel member 1704 is attached to third attachment region 2008 of article of footwear 2000 . second releasable fastener 1822 of heel member 1704 is attached to second attachment region 2006 of article of footwear 2000 . third releasable fastener 1824 of heel member 1704 is attached to first attachment region 2004 of article of footwear 2000 . shown schematically in fig6 as protruding slightly from article of footwear 2000 for clarity , the outer surfaces of first attachment region 2004 , second attachment region 2006 , and third attachment region 2008 are preferably flush with the outer surface of article of footwear 2000 on an inside portion of collar 2030 . similarly , the outer surfaces of the corresponding fasteners on heel member 1702 , fasteners 1820 , 1822 , and 1824 , are also substantially flush with an outer surface of heel member 1702 . using this arrangement of releasable fasteners , heel member 1704 is attached to article of footwear 2000 . because insert 1702 is preferably attached to heel member 1704 , the releasable fasteners also help to secure insert 1702 to article of footwear 2000 . insert 1702 and heel member 1704 can be interchanged to suit the user &# 39 ; s needs . heel member 1704 may come in a variety of different shapes and sizes , and be interchanged to accommodate different heel sizes or provide different kinds of support or impact resistance . similarly , insert 1702 may also come in a variety of different shapes and sizes , and also may be interchanged in order to allow the user to change the thickness of the insert or type of material . using this interchangeable system , users can select an appropriate insert 1702 and an appropriate heel member 1704 , assemble the two , and install the system into article of footwear 2000 to achieve a customized fit . it is preferable that a second insert and heel member are made in mirror image of insert 1702 and heel member 1704 to be inserted into an article of footwear made in the mirror image of article of footwear 2000 to form a pair . in another embodiment , the second insert and / or heel member may be of different sizes than insert 1702 and heel member 1704 , such as to compensate for a wearer &# 39 ; s differently - sized feet . in a preferred embodiment , insert 1702 and / or heel member 1704 may be used to customize the fit or performance characteristics of an article of footwear including a full - length composite plate . in an exemplary embodiment , insert 1702 and / or heel member 1704 may be used in combination the article of footwear including a full - length composite plate described in u . s . pat . no . ______ , now u . s . patent application ser . no . ______ ( attorney docket no . 51 - 1029 ), the entirety of which is incorporated herein by reference thereto . while various embodiments of the invention have been described , the description is intended to be exemplary , rather than limiting and it will be apparent to those of ordinary skill in the art that many more embodiments and implementations are possible that are within the scope of the invention . accordingly , the invention is not to be restricted except in light of the attached claims and their equivalents . also , various modifications and changes may be made within the scope of the attached claims .

US-45617406-A

a multi - source computed tomography system has a first x - ray source and a second x - ray source that are respectively optimized for different imaging procedures and can be used simultaneously in the multi - source ct system . the first x - ray source can be optimized for higher power short - term operation and the second x - ray source can be optimized for lower power , longer term operation .

one example of a dual - source ct system 1 according to the invention is shown in fig1 . this ct system 1 has a gantry housing 6 , in which are two x - ray tubes 2 and 4 arranged offset at an angle , with oppositely located detector systems 3 and 5 , which rotate about a system axis 9 for the scanning of the patient 7 , while the patient 7 is conveyed by means of the controllable patient couch along the system axis 9 through the measuring area of the ct system . a control and arithmetic unit 10 which contains computer programs prg 1 - prg n in its memory that perform the control and reconstruction during operation serves to handle control , reconstruction and execution of the inventive method . dual - energy operation is possible in the case of the ct system 1 for better differentiation of various tissue types in the area of examination of the patient 7 . to this end , the x - ray absorption must be measured at least in relation to two different energy spectra . this takes place with the aid of the dual - energy ct scanner 1 , which permits the reconstruction of two independent images for at least one axial section through the patient 7 , which were generated with different effective x - ray spectra . a simultaneous scan with two different tube voltages preferably takes place . it is important for image generation to determine the different absorption effect on the two different x - ray radiation powers . in the example shown here the two x - ray tubes 2 and 4 are operated with different acceleration voltages , so that the two x - ray spectra used differ greatly and also deliver different absorption values in the assigned detectors upon irradiation of the patient 7 . according to the invention the two x - ray tubes 2 and 4 differ in their technical aspects . the x - ray tube 2 is capable of emitting a considerably higher x - ray radiation power for a short recording time in the range up to 5 s than the x - ray tube 4 . in dual - energy operation , the x - ray tube 2 is thus operated with the higher acceleration voltage . in contrast to this the x - ray tube 4 is designed for a recording time of 40 s and more . however x - ray radiation power as high as with x - ray tube 2 cannot be achieved in this case , even for a short period . for dual - energy scans the x - ray tube 4 is thus operated with the lower acceleration voltage compared with x - ray tube 2 . it is further used — preferably with the x - ray tube 2 switched off — for whole - body scans and perfusion measurements which require recording times of 10 s or more . the x - ray tube 2 takes the form of a technically complex x - ray tube , in which the anode plate is mounted by a magnetic bearing and which is also actuated via a magnetic field . for heat dissipation purposes the anode plate is thermally coupled to a radiation surface . the rotational frequency of the anode plate can further amount to 1000 hz . by means of this construction of the x - ray tube 2 , an extremely high x - ray radiation power can be achieved for a short time , such as a radiation power of at least 100 kw for a duration of at least 2 seconds . by contrast to this , the x - ray tube 4 takes the form of a simply constructed rotary piston tube . although in this case the maximum achievable x - ray radiation power is significantly lower than with the x - ray tube 2 ( for example only 50 % compared with the x - ray tube 2 , such as a radiation power of at least 60 kw for a duration of at least 30 seconds ), a relatively high x - ray radiation power can still be achieved for recording times of 1 min and more . the diagram according to fig2 illustrates the relationship between the maximum x - ray radiation power p depending on the recording time s . the critical load curve a of the x - ray tube 2 shows a markedly higher x - ray radiation power in the short - term range of up to one second . by contrast , the x - ray tube 4 — illustrated by the critical load curve b — enables a long permanent output of up to 40 s , which lies significantly above the permanent output of x - ray tube 2 . through the use of two technically different x - ray tubes 2 and 4 the inventive dual - source ct system is optimized both for short - and long - term recordings . dual - energy operation is additionally also possible . as compared with conventional ct systems , the two x - ray tubes 2 and 4 need not be operated at the respective limit for the different types of recording which are thereby possible , the useful life of the x - ray tubes 2 and 4 is significantly increased , and the failure rate reduced . in a particular embodiment the “ dual energy ” principle can be attained in such a way that the x - ray tube 2 is operated at a high tube voltage , as less tube current is here required for the same photon flux . the x - ray tube 4 on the other hand is operated with a lower tube voltage and higher current . although modifications and changes may be suggested by those skilled in the art , it is the intention of the inventors to embody within the patent warranted heron all changes and modifications as reasonably and properly come within the scope of their contribution to the art .

US-201013499419-A

a coating and devices using the coating are provided . the coating is applied in liquid form and dried or otherwise cured to form a durable adherent coating resistant to high temperatures and having optional hydrophobic properties . the coating formulation contains an aqueous formulation of silica , one or more fillers , and sufficient base , , to have a ph exceeding about 10 . 5 during at least part of the formulation process . the formulation may contain a compound that affects surface free energy , energy to make the cured coating hydrophobic . such compounds include silanes containing halogens and in particular silanes containing one or more hydrolyzable groups attached to at least one silicon atom and a group containing one or more halogens . a medical instrument may be at least partially covered by a coating using the formulation .

the present invention is for coating formulations capable of withstanding high temperatures and adherent to metal surfaces and that may be formulated to have a surface free energy that makes the surface substantially non - stick , meaning that the surface is substantially hydrophobic or oleophobic , or both . such coating formulations have applicability when used to form a surface coat on surgical instruments receiving electrosurgical energy and contacting tissue to achieve a predetermined surgical effect . the present invention further includes applying the subject coating formulations and optionally enhancing the coating &# 39 ; s properties by applying energy , such as thermal energy . the coating formulation comprises a silicate solution , such as a colloidal silicate solution , one or more fillers , and a strong base and optionally includes one or more materials that reduce the surface free energy to enhance the non - stick properties of the surface . in one approach , a colloidal silicate solution may contain at least 10 weight percent silica . in another embodiment the colloidal silicate solution may contain about 50 weight percent silica . representative examples of colloidal silicate solutions are alkali metal silicates , including those of lithium polysilicate , sodium silicate , and potassium silicate , and colloidal silica . the colloidal silicate solution may be colloidal silica with about 50 weight percent silica . the colloidal silica average particle size may be between about 5 nm and 100 nm and it may be between about 30 and 80 nm and it may be between about 40 and 80 nm . example colloidal silica products are megasol s50 ( wesbond corporation ) and levasil ® 50 / 50 % ( h . c . starck gmbh ). the coating formulation includes a strong base in a concentration that causes the ph of the formulation to exceed 10 . 5 at least at some point during the formulation process . the strong base functions to at least partially dissolve the silica . for example , the strong base may be added in sufficient amount to cause at least the initial ph to exceed 12 and the strong base may be added to exceed 12 . 5 . the strong base used may be potassium hydroxide ( koh ). the koh may be added as a koh solution consisting of koh and water and the concentration of the solution may be approximately 50 weight percent koh , or between approximately 20 percent and 80 percent . the filler material may comprise various metal / non - metal combinations , including , for example , compositions that comprise the following : aluminum oxides ( e . g ., alumina and al 2 o 3 ), zirconium oxides ( e . g ., zr 2 o 3 ), zirconium nitrides ( e . g ., zrn ), zirconium carbides ( e . g ., zrc ), boron carbides ( e . g ., b 4 c ), silicon oxides ( e . g ., sio 2 ), mica , magnesium - zirconium oxides ( e . g ., ( mg — zr ) o 3 ), zirconium - silicon oxides ( e . g ., ( zr — si ) o 2 ), titanium oxides ( e . g ., tio 2 ) tantalum oxides ( e . g ., ta 2 o 5 ), tantalum nitrides ( e . g ., tan ), tantalum carbides ( e . g ., tac ), silicon nitrides ( e . g ., si 3 n 4 ), silicon carbides ( e . g ., sic ), tungsten carbides ( e . g ., wc ) titanium nitrides ( e . g ., tin ), titanium carbides ( e . g ., tic ), nibobium nitrides ( e . g ., nbn ), niobium carbides ( e . g ., nbc ), vanadium nitrides ( e . g ., vn ), vanadium carbides ( e . g ., vc ), and hydroxyapatite ( e . g ., substances containing compounds such as 3ca 3 ( po 4 ) 2 ca ( oh ) 2 ca10 ( po 4 ) 6 ( oh ) 2 ca5 ( oh )( po 4 ) 3 , and ca 10 h 2 o 2 6 p 6 ). filler materials may be of any shape including , for example , shapes that approximate in whole or in part or are substantially fibers , plates , spheres , rods , coils , or polyhedrons such as cubes or other shapes that may be approximated by a collection of polygons . combinations of filler materials having more than one shape may be used . for example , fillers comprising one or more materials having fiber shapes and plate - like shapes may be used . the filler may have one or more constituents comprising at least in part one or more inorganic fibers or inorganic powders such as those derived from clays with such fillers including those that contain silicon oxide , aluminum oxides , magnesium oxides , titanium oxides , chrome oxides , calcium oxides , or zirconium oxides . the filler materials may contain one or more materials that have at least 30 percent by weight al 2 o 3 or sio 2 either alone or combined with other elements , such as occurs in kaolin , talc , or montmorillonite . clays used may include substances that are members of the smectite group of phyllosilicate minerals . representative examples of clay minerals include bentonite , talc , kaolin ( kaolinite ), mica , clay , sericite , hectorite , montmorillonite and smectite . in the present invention , at least one of kaolin , talc , and montmorillonite may be used . these clay minerals can be used singly or in combination . the filler may have one or more constituents that are at least in part fibers that contain in part or wholly alumina or silica or calcium silicate , such as wollastonite , alumina fiber , silica fiber or fibers containing a combination of alumina and silica . at least one dimension , such as diameter , length , width , or particle size , of at least one of the filler materials may have a mean value of less than about 200 micrometers . the materials may have one or more material with one or more dimensions with a mean value of less than about 50 micrometers . the materials may have one or more dimensions with one or more mean values less than about 10 microns . the materials may have one or more dimensions with one or more mean values less than about 5 microns , such as both the diameter and thickness being less than about 5 microns . when montmorillonite is used as a filler it may be a form that is untreated or it may be a form that has been treated with a surface modifying process , such as a treatment to enhance its dispersion . when used , montmorillonite may be a form that has been onium ion treated . an example onium ion treated montmorillonite is nanomer ® i . 44p ( nanocor , inc .). the filler may include at least in part one or more fibers with mean diameters of between about 1 and 50 μm and it may at least in part include one or more fibers with mean diameters of between about 1 and 20 μm . example fibers include rf 50 / 99 and rf 20 / 99 ( saint - gobain ™ k . k ) and nyglos 2 and nyglos 4w ( nyco minerals , inc .). the filler may include at least in part a fiber containing al 2 o 3 and sio 2 in about equal weight percentage amounts . substances may be added to promote adhesion or production of a sealed or hydrophobic surface , including substances that increase the ph of the mixture as noted above , including sodium hydroxide or potassium hydroxide , and hydrolyzable silanes that condense to form one or more cross - linked silicone - oxygen - silicon structures ( siloxane bonds ). example materials are those that use one or more of the aforementioned colloidal silicates and clays , potassium hydroxide , and also use one or more substances that reduce the surface free energy of the surface . such substances that reduce the surface free energy include halogenated compounds and fluoropolymer compounds , such as ptfe and pfa , including aqueous dispersions of such compounds , organofunctional hydrolyzable silanes , including those containing one or more fluorine atoms on one or more pendant carbon chains . among the substances that may be included in the coating material as one or more hydrolyzable silanes are components having the general formula r m six n where r is alkyl chain and x is hydrolyzable , such a alkoxy group with m and n both integers and m + n = 4 . the hydrolyzable silane r may contain one or more halogen atoms . the hydrolyzable silane r may have a general formula of cf 3 ( cf 2 ) p ( ch 2 ) n si ( och 2 ch 3 ) 3 where p is less than about 20 and may about 8 or less and where q is about 2 . other groups besides ( och 2 ch 3 ) 3 , such as those based on methyl , propyl , or butyl groups , may be substituted and fall within the new art of this patent when they also are hydrolyzable . other halogens , such as chlorine , may be substituted for the fluorine . an example fluoroalkylalkoxysilane is tridecafluor - 1 , 1 , 2 , 2 ,- tetrahydrooctyltriethoxysilane . an example of such a silane is dynasylan f8261 ( degussa corp .). the final coating produced may have a surface free energy ( also referred to as the surface tension ) of the coating is less than about 32 millinewtons / meter and may have a surface free energy less than about 25 millinewtons / meter and may have a surface free energy less than about 15 millinewtons / meter and may be less than about 10 millinewtons / meter . the coating formulation may have materials added to modify its viscosity or surface tension . examples of such materials are amorphous silica , such as in powder form . an example amorphous silica is fumed silica and precipitated silica . an example amorphous silica is cab - o - sil ® hs - 5 ( cabot corporation ). surfactants may also be added to modify the viscosity or surface tension of the formulation . the coating formulation may include amorphous silica mixed with a strong base . the amorphous silica - strong base mixture may be used to augment or replace some or all of a colloidal silicate material and be mixed with fillers or other materials such as hydrolyzable silanes . fig1 illustrates one embodiment of a method for preparing coating formulations in accordance with the present invention . as illustrated , the method of preparation may include the step of combining a combination of silica , an inorganic filler and a base in an amount sufficient to cause the combination to have a ph of at least 10 . 5 at some point during the preparation process , step 102 . by way of example , the combining step 102 may comprise combining the constituents in varying orders and may include mixing , agitating and / or shaking the combination one or multiple times . in one approach , colloidal silica , at least one inorganic filler and potassium hydroxide may be combined . in another approach , an amorphous silica such as fumed silica , and potassium hydroxide may be initially combined , then colloidal silica and an inorganic filler may be added thereto . in yet another approach , the base may even be added later in the process ( e . g ., at step 106 or step 108 , or between steps 106 and 108 noted below ). in each approach , the base ( e . g ., potassium hydroxide ) functions to effectively dissolve at least a portion of the silica . as further illustrated in fig1 , the method may optionally include the step of combining an alkoxy silane into the combination , step 106 . as noted above , the additional of an alkoxy silane serves to enhance the non - stick properties of the coating formulation . as illustrated in fig1 , the preparation method may further include the optional step of combining at least one of water , a surfactant and a solid into the combination , step 108 . as previously noted , such constituents may be added to enhance the ability of the formulation to flow or otherwise cover surfaces to which the formulation may be applied . in relation to the optional steps , 106 and 108 , the illustrated embodiment may also include the further step of waiting a predetermined time period after such step ( s ), step 110 , so as to reduce the viscosity of the combination . in this regard , a waiting period after step 106 may serve to successively flocculate and peptize the silica . in relation to step 108 , the waiting period may serve to allow for the hydrolization of silane alkoxy groups ( e . g ., when water is combined in step 108 ). as noted in fig1 , after step 102 and optional steps 106 - 110 have been completed , the prepared formulation may be utilized to coat an apparatus component such as a metal surface ( e . g ., an electrosurgical blade ). in this regard , reference will now be made to fig2 which illustrates an exemplary embodiment of a method of coating a surface of at least one apparatus component with the inventive formulations ( e . g ., a metal surface such as an electrosurgical blade ). as shown , the method may include the steps of applying the coating formulation to the apparatus component surface , step 202 , and drying the applied coating formulation on the apparatus component surface , step 204 . the applying step 202 may be completed utilizing any of a variety of techniques , including for example , dipping , spraying , brushing , rolling , printing , etc . similarly the drying step 204 may be completed in any manner that may function to remove liquid from the coating formulation so as to yield a dry coated apparatus component surface . by way of example , such drying step may include the sub - step of exposing the coated apparatus component to a predetermined temperature range sufficient to vaporize or otherwise remove liquid present in the formulation , and including an elevated ambient temperature for a predetermined time period . as noted , the coating step 202 and drying step 204 may be optionally repeated a number of times to desirably build - up the coating layer in increments and thereby enhance coverage and overall performance . following the drying step 204 , the method may further include the step of curing the applied coating formulation on the apparatus component surface so as to yield a durable , high temperature surface coating , step 206 . further , depending upon the constituents used in the formulation , non - stick and other properties may be realized as otherwise described hereinabove . of note , while separate drying and curing steps are shown in fig2 , it should be realized that an extended drying time period will also serve to cure the inventive formulations . as such , overlap may occur between the drying and curing stages of the process . silica ( from colloidal silica ) 20 - 30 filler 15 - 30 koh 8 . 5 - 10 water ( from colloidal silica and koh solution ) 35 - 50 fluorinated silane 0 . 25 - 5 for example , the colloidal silica , filler , and koh solution are combined and mixed by shaking for one minute . the fluorinated silane is then added and the mixture shaken 15 minutes . after shaking , wait 12 hours . during this period the mixture will become less viscous as the flocculated silica peptizes and the silane alkoxy groups hydrolyze . add the fumed silica and shake five minutes . wait one hour . the mixture may then be applied by dipping , spraying brushing , printing , or other means . the coating may be applied using any means that conveys a liquid to the object to which the coating is to be applied . such methods include spraying , dipping , brushing , rolling , pad printing and printing . more than one coat may be applied , such as within 5 seconds and 4 hours of when previous coats were applied or within 5 seconds and 10 minutes of when previous coats were applied . the coated article may be allowed to air dry at between about 60 and 200 degrees fahrenheit for between about 1 and 8 hours and then cured at between about 350 and 500 degrees fahrenheit for between about 15 minutes and one hour . the final cure temperature may be between about 400 to 475 degrees fahrenheit . to reduce bubble formation during curing the temperature may be ramped between an air dry temperature and the final cure temperature such as , for example , over an interval of between about one and eight hours or over about three to six hours . the final cure may be immediately after air drying or it may be delayed . a coated article may be a substantially organic surface such as cloth or wood to which the coating is applied and allowed to dry . for materials that cannot withstand high temperatures a cure temperature less than the temperature that damages the material may be used , such as 350 degrees , although longer cure times will be required than when higher temperatures are used . a coated article may be a metal part , such as a component of an exhaust system , that needs to withstand temperatures exceeding , for example , 450 degrees fahrenheit . the coated article may be a metal surface that benefits from having non - stick or reduced - stick properties , such as cookware or oven coatings . such surfaces can be made from , for example , metal or glass . the coating may be applied to a glass surface to improve its non - stick properties . articles may be coated to provide improved properties during elevated temperature service including temperatures over 450 degrees fahrenheit . the coating may be applied articles expected to experience temperatures exceeding 600 degrees fahrenheit , such as the surfaces near the edges of electrosurgical instruments where temperatures are believed to exceed 600 degrees fahrenheit and may exceed 1 , 000 degrees fahrenheit . fig3 illustrates the cross section of an electrosurgical instrument , in this case an electrosurgical blade , that has been at least partially coated . the preferred thickness of the coating using the formulation of the present invention is between about 0 . 001 and 0 . 1 inches and more preferably between about 0 . 002 and 0 . 010 inches . preferably , at least part of the blade is left uncoated or with a coating that leads to an impedance less than about 5 , 000 ohms so that transfer of electrical energy is facilitated between the electrosurgical instrument and the tissue , such as when a very thin edge is exposed through the insulation . the blade body 1 is surrounded by insulation 2 , defined by the inventive coating except for at least a portion of the peripheral edge . the length of the body extends into the page in this figure . various additional embodiments and modifications may be apparent to those skilled in the art and are within the scope of the present invention as defined by the claims which follow .

US-201414516782-A

disclosed is a modular system for providing electrical stimulation , in which a first modular electrode section has a contoured back end configured to engage a contoured front end of another electrode section or a tool that may be used to place the first modular electrode section in the patient &# 39 ; s body . the contours of the modular electrode section allow the two components to engage with one another so as to prevent their separation in the horizontal plane , and a lead extending from the first modular electrode is configured to engage keels on the top surface of the second electrode portion or tool , with such keels providing a snap - type attachment between the lead and the second electrode portion or tool , such that the two components may be joined together but easily separated from one another through the intentional separation of the lead from the keels on the second electrode portion or tool .

the following description is of a particular embodiment of the invention , set out to enable one to practice an implementation of the invention , and is not intended to limit the preferred embodiment , but to serve as a particular example thereof . those skilled in the art should appreciate that they may readily use the conception and specific embodiments disclosed as a basis for modifying or designing other methods and systems for carrying out the same purposes of the present invention . those skilled in the art should also realize that such equivalent assemblies do not depart from the spirit and scope of the invention in its broadest form . with regard to a first aspect of a particularly preferred embodiment of the invention , a modular implantable electrode is provided , such as a scs paddle electrode , capable of being surgically implanted inside of a patient so as to transfer an electrical signal from a power source to targeted tissue in the patient . the paddle electrode is particularly configured so as to allow multiple paddle electrode sections to be longitudinally joined together in order to allow the size of an electrical contact array to be particularly configured for a specific application or patient condition . likewise , with regard to another aspect of a particularly preferred embodiment , an insertion tool is provided for engaging such modular paddle electrode sections to positively engage a portion of at least one of those modular sections and facilitate its handling by the surgeon . with reference to fig1 , a first modular paddle electrode section 100 is shown having a top surface 102 , a front end 104 , and a back end 106 . front end 104 is shaped with concavities and convexities that may aid in the insertion of first modular paddle electrode section 100 into the designated area within a patient . for instance , copending and co - owned u . s . patent application ser . no . 12 / 804 , 117 , filed on jul . 14 , 2010 by the inventor herein describes a shaped electrode and dissecting tool having a contoured front end configured to aid in the insertion of such electrode into a patient . the specification of patent application ser . no . 12 / 804 , 117 is incorporated herein by reference in its entirety . similarly , back end 106 of modular paddle electrode section 100 is shaped with complementary concavities and convexities . an electrode engaging member 200 , which may comprise a second modular paddle electrode section or alternatively an insertion tool , is likewise provided , having a top surface 202 , a front end 204 , and a back end ( not shown ). front end 204 has a contour comprised of concavities and convexities similar to the contour of front end 104 of modular paddle electrode section 100 , and is configured to mate with and closely engage back end 106 of first modular paddle electrode section 100 which is itself provided with a complementary contour to the concavities and convexities of front end 204 of electrode engaging member 200 . the complementary contours of back end 106 of first modular paddle electrode 100 and the front end 204 of electrode engaging member 200 allow close engagement of the two components so as to facilitate the controlled movement of first modular paddle electrode section 100 into position within the patient . as shown in fig2 , a complementary mating configuration may also be provided in the vertical planes of back end 106 of first modular paddle electrode section 100 and front end 204 of electrode engaging member 200 . more particularly , those ends may be curved so as to closely engage one another so as to resist separation in the vertical direction ( as viewed in fig2 ). while fig2 particularly shows curved faces on back end 106 of first modular paddle electrode section 100 and on front end 204 of electrode engaging member 200 , those of ordinary skill in the art will recognize that other mating contours , such as angled faces and edges and the like , may likewise be used to allow the two modular sections 100 and 200 to fit closely with one another , without departing from the spirit and scope of the invention . as shown in fig2 , first modular paddle electrode section 100 may have a lead 110 attached thereto which is configured to transfer an electrical signal from an implanted pulse generator to electrical contacts on first modular paddle electrode section 100 . as is described in co - pending and co - owned u . s . application ser . no . 12 / 804 , 560 filed by the inventor herein on jul . 23 , 2010 , titled “ electrode having erectable lead ,” the specification of which is incorporated herein by reference in its entirety , lead 110 may emerge from the top surface 102 of modular paddle electrode section 100 so as to not interfere with the mating of back end 106 of first modular paddle electrode section 100 with front end 204 of electrode engaging member 200 . optionally , one or more sutures 300 may be used to suture emerging lead 110 to electrode engaging member 200 after its front end 204 has been mated with the back end 106 of first modular paddle electrode 100 . alternatively , and as shown in fig3 and 4 , first modular paddle electrode section 100 may be provided keels 120 on its top surface 102 . keels 120 are formed so as to provide a channel which closely receives lead 110 , such that after lead 110 is snapped into place , keels 120 hold lead 110 in place absent the application of a significant force to withdraw it from the keels . for instance , keels 120 may have concave surfaces on their interiors which closely follow the outer dimension of lead 110 . a slit 122 is provided between keels 120 through which lead 110 may be inserted . keels 220 on electrode engaging member 200 are similarly configured , again having a slit through which lead 110 may be inserted , thus helping to hold electrode engaging member 200 to first modular paddle electrode section 100 after their respective front end 204 and back end 106 are mated with one another . with regard to another aspect of the invention , and as shown in fig5 and 6 , a strain relief 130 is provided around lead 110 , which strain relief 130 extends outward beyond back end 106 of first modular paddle electrode section 100 . electrode engaging member 200 is again provided keels 220 , again having a slit at the top surface between the two keels 220 capable of receiving lead 110 . the front most portions of keels 220 are of similar configuration to keels 120 on first modular paddle electrode section 100 , comprising two thin walls 222 configured to receive and hold strain relief 130 when the two modular paddle electrode sections 100 and 200 are mated with one another . as best seen in fig5 , walls 222 at their back ends open into a wider portion of keels 220 , with keels 220 having such wider thickness throughout the rest of their length along the top surface 202 of electrode engaging member 200 , with a slit ( as mentioned above ) configured to receive and hold lead 110 . as keels 220 are thus configured to receive both lead 110 and the back - most portion of strain relief 130 , once the first modular paddle electrode 100 is mated with electrode engaging member 200 , and strain relief 130 and lead 110 are snapped between the appropriate sections of keels 220 , the two sections 100 and 200 will likewise be held to one another by such connection . as shown in the cross - sectional view of fig7 ( showing first modular paddle electrode section 100 without strain relief 130 installed ), keels 120 extend upward from top surface 102 and at an angle less than ninety degrees to top surface 120 , thus leaning toward one another to form a trapezoidal opening between them . strain relief 130 is preferably provided a complementary trapezoidal external configuration , such that strain relief 130 may be snapped into the opening formed between keels 120 . those of ordinary skill in the art will appreciate that shapes other than a trapezoidal configuration , such as curved or angled cross - sections that are configured to removably hold strain relief 130 to first modular paddle electrode 100 , may likewise be implemented without departing from the spirit and scope of the invention . as shown in the cross - sectional view of fig8 taken along section line a - a of fig5 , strain relief 130 is shown positioned between keels 120 , with lead 110 extending outward from strain relief 130 . likewise , as shown in the cross - sectional view of fig9 taken along section line b - b of fig5 , lead 110 is shown positioned within the opening between keels 220 , with a narrow slit 230 positioned at the top between the top portions of keels 220 , through which lead 110 may be inserted . in the case where electrode engaging member 200 is configured as a second electrode section that is to be mated with first modular paddle electrode section 100 , electrode engaging member 200 may be formed from a soft silicone elastomer material , in which case slit 230 may be very narrow . in the event that electrode engaging member 200 is configured as an insertion tool that is to be mated with first modular paddle electrode section 100 , a hard plastic would likely comprise such insertion tool , in which case a wider slit 230 would be desirable . lead 110 typically comprises a plurality of wires encased within a plastic sheath which is somewhat compressible , such that it may snap into a slot in either of the foregoing configurations . still further , as shown in the side view of fig1 , and with regard to another aspect of the invention , strain relief 130 and lead 110 may be pulled up and out of first modular paddle electrode section 100 over a portion of its length in order to facilitate assembly with electrode engaging member 200 . those of ordinary skill in the art will recognize that by providing electrode engaging member 200 with a front end 204 configured to mate with the back end 106 of first modular paddle electrode section 100 , and by providing such components with mating keels and slots as described above to engage one another , the combined features of the contoured ends of each component , the strain relief 130 and lead 110 and keels 120 and 220 will offer a much better grip to hold the two components together than has been previously achieved . it should be understood that various other characteristics of the novel modular electrode of the current invention may be changed without departing from the spirit and scope of the present invention . for instance , additional features may be provided to further supplement the connection between the two components , such as a sleeve around the joint ( which sleeve could be removable during or after insertion ), or additional tabs , stiffening wires , or the like with corresponding receptacles in first modular paddle electrode section 100 . likewise , additional connections may be provided between first modular paddle electrode section 100 and electrode engaging member 200 to further supplement their connection . still further , the foregoing configurations could likewise be used to join electrodes not only end to end , as described herein , but likewise side by side , or otherwise as may be apparent to those of ordinary skill in the art . it is believed that the present invention and many of its attendant advantages will be understood by the forgoing description . it is also believed that it will be apparent that various changes may be made in the form , construction and arrangement of the components thereof without departing from the spirit and scope of the invention or without sacrificing all of its material advantages . the form herein before described is merely an explanatory embodiment thereof .

US-80481610-A

a humidifier and humidity sensor is disclosed for use with a breathing assistance apparatus . the humidity sensor preferably includes means to sense absolute humidity , relative humidity and / or temperature at both the patient end and humidifier end . the humidifier may also include provision to both control independently the humidity and temperature of the gases . further , a chamber manifold is disclosed to facilitate easy connection of the humidifier to various outlets , inlets and sensors . a heated conduit is described which provides a more effective temperature profile along its length .

fig1 illustrates a typical respiratory humidification system , comprised of three parts : 1 ) a humidification chamber located at a distance from the patient , which heats and substantially saturates gases flowing through it ; 2 ) a delivery system consisting of a flexible tube which carries humidified gases from the humidification chamber 1 to the gas outlet 5 ; and 3 ) a heater base which heats the humidification chamber 1 and provides measurement and control functions . the gas to be humidified flows into the chamber 1 from port 4 and leaves the delivery system 2 at gas exit port 5 . gas from exit port 5 flows to a patient via a face mask or similar ( not shown ). the system is controlled using sensors located at positions 7 and 8 — typically temperature probes . dry gases at the gas input 4 are heated and humidified by passing over the surface of hot water 6 in the chamber 1 so that they are substantially saturated with water vapour when they leave chamber 1 at exit port 10 . hot water 6 is heated by heater plate 9 and the amount of heating is controlled so that the gas reaches a predetermined temperature at exit port 10 . this temperature is measured by sensor 7 . therefore the humidification chamber 1 acts to heat and humidify the medical gases so that they are substantially saturated at the output of chamber 1 , and are at a predetermined temperature . the gas delivery system 2 ( also known as a delivery tube or breathing circuit ) consists of a flexible tube 11 containing a heater 12 , which may consist of a heated resistance wire . the gas from the humidification chamber 1 passes through the tube 11 and is heated by heater 12 to offset heat losses through the walls of tube 11 . the amount of heating applied to heater 12 is regulated so that the gas reaches a predetermined temperature at gas outlet 5 , as measured by sensor 8 . the control temperature at sensor 8 is usually higher than the control temperature at sensor 7 , so that the gas is heated along tube 11 to ensure that condensation doesn &# 39 ; t occur in the tube . the system as described has gas entering gas inlet 4 from a continuous flow gas source ( not shown ) and exiting the system through gas outlet 5 . however the system is equally applicable where the gas source is a ventilator , which creates intermittent flow patterns to provide breaths to a patient . in this case gas outlet port 5 is connected directly to gas inlet port 16 . the patient is connected to port 17 via an endotracheal tube or similar ( not shown ). during patient inspiration dry gases from the ventilator enter the system at inlet port 4 , pass through chamber 1 , delivery system 2 , pass through wye - piece 13 and reach the patient through port 17 . during patient exhalation gases pass back through port 17 , through wye - piece 13 , tube 14 and leave through gas outlet port 18 . tube 14 may also be heated by heater 15 to prevent condensation . humidifiers incorporating humidity sensors for display or control have been described in the prior art , however all used humidity sensors which were positioned at the patient airway . the current work describes novel humidifier configurations incorporating a humidity generating chamber located at a position which is remote from the patient , a heated breathing circuit to transfer humidity to the patient , and humidity sensors to control the level of absolute or relative humidity supplied to the patient . these humidity sensors are to be located either : one aspect of the present invention would be to use a humidity sensor as sensor 7 . the purpose of humidity sensor 7 is to determine the absolute amount of humidity which is being generated by chamber 1 . accordingly an absolute humidity sensor would be ideal for use as sensor 7 , although the use of a relative humidity sensor with associated temperature sensor could equally be used . this system has the advantage of creating a controlled level of absolute humidity at chamber outlet 10 , however this level of absolute humidity may not reach the patient if condensation is allowed to occur in tube 11 . an alternative system which would overcome this disadvantage is to use a second absolute humidity sensor at point 8 instead of a temperature sensor . the difference in absolute humidity between sensors 7 and 8 allows the humidifier to determine whether condensation is occurring between the two points . if the two absolute humidity sensors 7 and 8 read the same level of absolute humidity then no condensation is occurring in the tube . if the absolute humidity at sensor 7 is greater than at sensor 8 , then the difference shows the rate of condensation that is occurring . one control strategy would be to control the amount of heating provided to heater 12 so that the absolute humidity difference is reduced to zero . however the tube may still contain mobile condensate because the humidity difference only describes the rate of condensation , not the absolute amount of condensate in the tube . another control strategy is to remove this condensate and hence create a dry tube by heating heater 12 so that the rate of measured condensation is negative ( i . e . condensation is being evaporated in tube 11 ) until the measured condensation rate reaches zero , indicating that all of the condensate has been removed . the amount of heating can then be reduced until the sensors show that condensation has just started to occur , then the heating can be increased slightly to the optimum level . drying out of the tube may be a continuous process , or may be initiated at regular time intervals . another variation of the system shown in fig1 would be to use a temperature sensor for sensor 7 and an absolute humidity sensor at point 8 . this system is simpler than having an absolute humidity at both points 7 and 8 . in operation the controller would have to adjust the amount of heating at heater 12 and heater plate 9 so that the correct level of absolute humidity was reached without condensate in delivery tube 12 . in practice two separate control algorithms would be required , one to control the amount of heating occurring in tube 11 so that no condensation occurred , and another to control heater plate 9 so that the desired level of absolute humidity was generated in chamber 1 . the two algorithms could work concurrently because the heater plate 9 will respond slower than heater 12 , so quick changes in absolute humidity would indicate the action of heater 12 . sensor 7 provides a control point for heater plate 9 , but may not be needed . all systems described so far have used a chamber 1 which attempts to humidify the gas leaving gas outlet 10 to a high level of relative humidity . while this condition isn &# 39 ; t essential for the correct operation of the new humidification configurations just described because they use humidity control , it was essential for the prior art humidifier where control is purely based on temperature . however there are some advantages to be gained from using a chamber which heats gases to the correct absolute humidity , but at a low relative humidity ( i . e . the temperature of the gas is higher than the dewpoint of the gas , therefore the gas is not saturated ). the first advantage is that it is easier to design a heated delivery system to transport such a gas without condensation , since the gas doesn &# 39 ; t need to be heated immediately after it enters the delivery tube to prevent condensation . secondly , the use of low relative humidity gases leaving the chamber means that the heater element 12 can be rated at a lower power than would otherwise be the case , as the gas already has a higher energy content and can tolerate a greater loss of energy before the gas condenses in the tube 12 . it may even be possible to use an unheated , well insulated breathing circuit instead of a heated breathing circuit if the chamber provides gas with enough energy . note that low relative humidity chambers can only be used if the heating to the chamber is controlled using an absolute humidity sensor , not a temperature sensor , since otherwise the absolute humidity output would be too low . to this end , some humidification chamber configurations which provide a high temperature , low relative humidity gas output are shown in fig2 - 8 . fig2 shows a chamber which incorporates a metal element 20 ( e . g . a spiral scroll shape ), but without wicking paper attached . this provides both dry heating ( via the metal element ) and heated humidification from the heated water 21 . with this configuration the chamber 19 provides gas which is not saturated because some of the heating provided to the gas is dry heating via the metal scroll . the relative humidity generated by the chamber is affected by the gas flow path , scroll shape , dimensions , and the water level , and so is not readily adjustable in use . however chamber 19 does give the condensate reducing advantages provided by a low relative humidity , controlled absolute humidity output . fig3 and 4 are alternative humidification chambers which provide low relative humidity , high temperature gases at their output . fig3 shows a chamber using a porous material 22 ( such as a porous ceramic ) containing water 23 to provide a heating and humidifying function , while fig4 shows a chamber using a semipermeable membrane 24 to provide a barrier to the water 25 in the chamber . in both cases these chambers provide dry heating via the porous or semipermeable material , as well as heated humidification from the water . in both cases the ratio of heating to humidifying is fixed and cannot be easily adjusted except by limiting the water supply . fig5 to 8 show chambers that can supply gases at varying levels of relative humidity and temperature . in fig5 a variable valve 26 allows us to adjust the ratio of gas which passes through the dry bypass tube 27 to that which flows across the surface of the water 28 . the bypass tube passes under the water to heat the gas . the two gas streams merge at the output 29 . this is an example of a “ parallel ” system where the gas splits and takes two different paths to provide heating and humidification . in fig6 the gas is again split into two gas paths using an adjustable valve 30 . one part of the gas gets humidified by passing across the water 31 in chamber 32 , while the other is heated by heater 58 , which surrounds tube 33 . the gas paths merge at junction 34 . the angle of variable valves 26 and 30 in fig5 and 6 , may be permanently set , may be manually adjustable 1300 , or may be automatically adjustable for example by electromechanical actuation 1400 . one advantage of an automatically adjustable valve would be to provide a constant level of humidity out of the chamber when used with intermittent flow rates , for example when used with a ventilator . these flow patterns can be a problem because parts of the breath cycle contain less humidity than other parts , due to the chamber providing less humidity at higher flow rates . one way to overcome this problem is to measure the instantaneous flow rate using a fast response flow sensor , and then rapidly adjusting the angle of the variable valve . a more practical method of achieving this effect would be to spring - load valves 26 and 30 using springs 70 and 71 or use an elastic valve member to form the variable valve . this would mean that low flow rates would mostly pass through the bypass tubes , while high flow rates would operate the spring - loaded valve and allow more gas to pass across the water in the humidification chamber . the angle of the spring - loaded variable valve could also be used by the humidifier to measure the gas flow rate . fig7 and 8 show alternative series configurations for low relative humidity chambers , where the dry gas entering chamber 35 containing heated water 36 is either pre - heated via heater 37 in fig7 , or heated via heater 38 in fig8 after leaving the chamber . in both cases the heater provides dry heating to the gas and results in a low relative humidity , high temperature gas leaving outlet 39 . any of the low relative humidity , high temperature chambers shown in fig2 to 8 can be used in conjunction with the humidity control schemes described previously in this patent , but not successfully with the prior art humidifier due to it being temperature controlled , not humidity controlled . another facet of the invention is shown in fig9 . here the low relative humidity , high temperature humidification system from fig8 has been combined with an unheated , well insulated delivery tube . the incoming gas enters at port 35 into the standard humidification chamber 35 containing water 36 which is heated by heater plate 38 . the gas is substantially saturated in the chamber then leaves the chamber through gas outlet 39 and enters heated tube section 40 which heats the humid gas to a higher temperature , so that it has a low relative humidity . the gas then passes through tube 41 which has an insulating layer 42 around it . preferably the insulating layer is a thin jacket of stagnant air which reduces heat loss . as the high temperature gas , low relative humidity gas passes through the insulating tube , a small amount of heat is lost through the tube walls , and therefore the gas cools . however the amount of heating applied to heater 40 is controlled , so that the gas is never allowed to cool below its dewpoint , which would result in condensation within tube 41 . several different sensor configurations are proposed . firstly , sensor 43 could be an absolute humidity sensor which controls heater plate 38 so that chamber 36 produces the desired level of humidity . in one embodiment sensor 45 is a temperature sensor , which controls heater 40 so that the gas passing sensor 45 remains at a certain desired temperature . if this temperature is greater than the dewpoint of the gas at sensor 43 , then condensation should not occur in tube 41 . however there may already be condensate in tube 41 when the humidifier is turned on . if a humidity sensor is used for sensor 45 instead of a temperature sensor , then the level of condensate occurring in the tube 41 can be controlled . the algorithms described earlier in this patent for dual - humidity sensor control can be used with this system . an alternative location for the absolute humidity sensor is at position 44 instead of 43 . the absolute humidity here should be the same as at 43 because the gas has been heated and so hasn &# 39 ; t lost any moisture . however there may be advantages to placing the absolute humidity sensor at 44 , for instance due to better sensor operation in a low relative humidity environment . this location for the absolute humidity sensor can be used with either a temperature or absolute humidity sensor at location 45 . yet another aspect of this patent relates to removing the need for a sensor at the patient airway . to remove this sensor safely , we must be certain that the gas entering the delivery tube has a safe level of temperature and absolute humidity , and that the surfaces inside the delivery tube do not exceed safe temperature levels . this implies a delivery tube that has a constant internal wall temperature . it would be desirable , therefore , to have a heated delivery tube which self - regulates its temperature at a desired level . the heater could either be embedded in the wall of the delivery tube itself , or it could lie inside the lumen of the delivery tube , or it could be wrapped around the outside of the delivery tube . such a heater could be made from positive temperature coefficient ( ptc ) material ( such as “ winterguard ” from raychem corp ., menlo park , calif . usa ), so that the resistance of the heater increases if the heater is hot , resulting in reduced power . however the delivery tube may pass through more than one environment , or may have localised drafts present on certain parts of the tube . if the ptc elements are arranged in parallel , then the full benefit of the ptc heater can be envisaged . if the ptc elements are arranged in parallel , then the cold portions of the tube will have a lower resistance , which will result in more heat being dissipated . thus the tube will tend to regulate its own temperature . fig1 shows construction of a tube incorporating flexible ptc elements in a parallel wire configuration . the tube 48 is made of a flexible ptc material , which has two low resistive strip connections , 46 and 47 , on either side of it . this allows each portion of the tube to consist of short conducting segments of tube connected in parallel between conductors 46 and 47 . these segments are represented by dotted lines encircling the tube in fig1 . the conductors 46 and 47 are connected to adjustable voltage source 49 , which may be ac or dc . the tube would have an outer layer ( not shown ) which provides electrical insulation and thermal insulation to the tube . each longitudinal segment of the tube will be able to regulate its own temperature independently of the rest of the tube . to enhance this operation , it may be necessary to provide parallel slots 50 running perpendicular to the axis of the tube , to eliminate electrical cross - connection between the different ptc segments . although one specific ptc heated tube design has been envisaged and described , other ptc tube designs could be used . it may also be of advantage to create a ptc tube that has a differing temperature profile along its length rather than a constant temperature profile . the ptc design could also be extended to incorporate ptc heaters in other parts of the patient breathing circuit , such as the flexible extension tube which is usually connected between the y - piece ( port 17 of fig1 ) and the patient &# 39 ; s endotracheal tube . a further extension of the ptc tube concept would be into a self - heated and temperature controlled endotracheal tube . the ptc tube described in fig1 allows us to create a humidifier which doesn &# 39 ; t use any sensor at the patient airway . fig1 shows a humidifier configuration using this tube . gas enters humidification chamber 52 via inlet port 51 and is humidified by water 53 , heated by heater plate 54 . absolute humidity sensor 55 controls the heater plate so that the gas passing sensor 55 is at a desired level of absolute humidity . ptc tube 56 is heated by an external voltage ( not shown ) so that the internal surface temperature is at a constant desired temperature , which is selected to be above the dewpoint of the gas . the gas which leaves tube 56 at outlet 57 will therefore be near the temperature of the tube , and containing the desired level of absolute humidity which was controlled by absolute humidity sensor 55 . a variation of the system shown in fig1 would be to use a temperature sensor at position 55 . another variation of a tube with a constant internal wall temperature would a delivery tube with heated water or other fluid pumped through smaller conduits in the wall of the delivery tube . since the heated fluid has a high specific heat relative to air , the temperature of the fluid remains fairly constant during passage through the delivery wall conduits . traditional humidifiers have tended to use sensors that are probe shaped , so that they can be inserted through specifically designed holes in the side of the breathing circuit to measure temperature . however the humidifier configurations that have been described in this patent incorporate many sensors around the chamber , so the use of a manifold 59 as shown in fig1 may be useful . the humidification chamber 60 is a removable item which can be slid onto the humidifier base 61 as shown in fig1 . as the chamber 60 is slid onto the humidifier base 61 , its base makes contact with heater plate 62 and its inlet and outlet ports 63 and 64 make contact with holes 67 and 68 inside the manifold 59 . dry air to be humidified enters the manifold at port 65 , passes out of the manifold through port 67 , and flows through port 63 into the chamber 60 , where it is humidified . after leaving chamber 60 the humid gas passes through chamber port 64 into manifold port 68 . finally the humid gas leaves manifold 59 through port 66 and passes to the breathing circuit . the manifold may be a separate , removable assembly , or it may be an integral part of the humidifier base . it may contain temperature sensors , humidity sensors , flow sensors , or a heater element . these would be located inside the manifold 59 at positions 72 and 73 . the manifold 59 may be heated to prevent condensation of humid gas . it could connect to both chamber ports 63 and 64 as described , or it may only connect to the outlet port 64 . one advantage of using a manifold is that many sensors or heaters can be combined in a single , cleanable assembly , rather than requiring separate probes which need to be plugged into the breathing circuit . this simplifies connection and setup for the user . another advantage of a manifold is that the incoming dry gas temperature and flow rate can easily be measured without additional probes and connections . although absolute humidity sensors have been described with all of the different humidification schemes described in this patent , relative humidity sensors could also be used . this may involve slightly different control algorithms to the ones described in this patent . alternatively , a relative humidity sensor could be combined with a temperature sensor . this allows the absolute humidity to be calculated from relative humidity and temperature , rather than being measured directly . all of the novel humidification schemes that have been described in this patent could be used with additional temperature sensors . these may provide additional benefits such as providing a safety backup in the event of a failed humidity sensor . another benefit would be maintaining the temperature being delivered to the patient within certain limits so that the relative humidity is not too low , even though the absolute humidity was acceptable . similarly it may be useful to measure the air flowrate through the humidifier , as this is an important parameter which affects humidifier control . therefore flow sensors could be incorporated within any of the previously described systems . one useful prior art flow sensor construction would be to use a sensor based on heat loss from a hot element in the airstream . if a heated humidity sensor is used , the amount of heating that is required for the sensor to achieve temperature can be used to determine the gas flow rate . infection control is a prime consideration when designing medical components . to prevent bacterial colonisation of the components in the humidification system , any parts which come in contact with the gas stream could be made out of antibacterial plastic . to prevent contamination of sensor probes , the probe ports could incorporate a disposable sheath which protects the probe from pathogens in the breathing circuit . this would be particularly applicable to temperature probes . in general humidity probes need to have contact with the gas stream so a disposable sheath would be inapplicable to humidity sensors , unless they worked on optical principles , or unless the sheath was made of water vapour permeable material , which did not allow the passage of pathogens . the protective sheath could be an integral part of a disposable breathing circuit .

US-55479206-A

a liquid composition applied transdermally for relief of pain comprises alcohol in an amount by weight of about 60 to about 93 percent ; glycerine in an amount by weight of about 2 to about 14 percent ; and an analgesic agent in an amount by weight of about 2 to about 28 percent . the use of aloe vera is an additional optional feature . the composition features transdermal pain relief such that a patient can apply an analgesic agent directly to an area of pain without the side effects such as stomach irritation which is normally associated with aspirin , for example . the composition may be sprayed or rolled directly onto the painful area . because of the unique formula , the composition is safe to vital internal organs , requires no mixing before use , and is shelf stable for marketing purposes .

the invention comprises a liquid composition applied transdermally for relief of pain and includes alcohol in an amount by weight of about 60 % to about 93 %, glycerin in an amount by weight of about 2 % to about 14 % and an analgesic in an amount by weight of about 2 % to about 28 %. optionally , aloe vera may be added in an amount by weight of about 0 . 3 % to about 4 %. the mixing instructions for the formula are relatively simple . in one embodiment , in the percentages described below in formulas 1 through 8 , alcohol , glycerin , an analgesic agent , and optionally , aloe vera are mixed together until dissolved . the mixing in each embodiment is preferably carried out at a high speed in a stainless steel container . in another embodiment , in the percentages described below in fig1 through 8 , alcohol is first mixed with the analgesic agent , such as aspirin , for about 20 minutes , after which glycerin is added and mixed for about 10 minutes , after which aloe vera is added , if desired , and mixed for about 30 minutes . in another embodiment , in the percentages described below in fig1 through 8 , alcohol is mixed with glycerin for approximately 10 minutes , after which the analgesic agent is added and mixed for approximately 30 minutes , after which aloe vera , if employed is added and mixed for about five to about fifteen minutes . alcohol is contained within the mixture because it readily dissolves the analgesic agent and assists in allowing the analgesic agent to permeate the skin . alcohol acts a good solvent for aspirin and other analgesics . applicant &# 39 ; s formula has proven to permeate at least seven layers of skin . while isopropyl and ethyl alcohol are preferred , any alcohol having similar permeability and dissolution qualities may be employed in applicant &# 39 ; s formula . grade usp anhydrous alcohol is preferred . in the most preferred embodiment , a free , prescription grade of isopropyl alcohol is employed , which is approximately 99 . 8 percent pure . glycerin acts as a stabilizer , preventing the alcohol from deactivating the analgesic effect of the analgesic agent and allowing the analgesic to remain in solution such that the composition does not need to be shaken before use , even after months on the shelf . acetylsalicylic acid and triethanolamine salicylate are the preferred analgesics . these analgesic agents are powerful , proven pain killers and act as anti - inflammatories as well . however , it is possible that the analgesic agents would include , for example , acetylsalicylic acid , triethanolamine salicylate , ibuprofen , naprosyn , acetaminophen , and any other salicylates , such as methyl salicylate . when triethanolamine salicylate is employed , it is often added in higher quantities because of its weaker strength than aspirin . usp grades of acetylsalicylic acid , triethanolamine salicylate , and glycerine are preferred . aloe vera , another proven pain reliever , may be employed on an optional basis to increase the pain relieving qualities of the composition . if employed , it is preferably present in a pure gel state , although a tolerance to about 98 % to about 100 % purity is allowable . a preferred method of use is to direct a spray of approximately 0 . 337 ml approximately one inch away from the skin at the location where pain is indicating , then spray three times liberally on the skin and massage in until dry . after sixty seconds , the process may be repeated , followed by another application sixty seconds later if necessary . these delayed reapplications are recommended in light of the fact that if one sprays all at once , the composition may not have sufficient time to permeate the skin and may run off . it is recommended that contact with mucous membranes is avoided . the foregoing description , and the methods of use and manufacture illustrated above relate to each of the following formulas for the invention . ______________________________________ingredient percent by weight______________________________________formula 1alcohol about 60 % to about 93 % glycerin about 2 % to about 14 % analgesic agent about 2 % to about 28 % aloe vera ( optional ) about 0 . 3 % to about 4 % formula 2alcohol about 70 % to about 93 % glycerin about 2 % to about 12 % acetylsalicylic acid about 2 % to about 18 % formula 3isopropyl alcohol about 70 % to about 93 % glycerin about 2 % to about 8 % acetylsalicylic acid about 3 . 5 % to about 19 % aloe vera about 0 . 5 % to about 3 % formula 4isopropyl alcohol about 87 . 99 % glycerin about 4 . 81 % acetylsalicylic acid about 6 . 1 % aloe vera about 1 . 1 % formula 5isopropyl alcohol about 88 . 38 % glycerin about 4 . 81 % acetylsalicylic acid about 5 . 71 % aloe vera about 1 . 1 % formula 6alcohol about 60 % to about 90 % glycerin about 2 % to about 14 % triethanolamine salicylate about 8 % to about 28 % formula 7isopropyl alcohol about 62 % to about 90 % glycerin about 2 % to about 12 % triethanolamine salicylate about 7 % to about 27 % aloe vera about 0 . 3 % to about 4 % formula 8isopropyl alcohol about 81 % glycerin about 3 % triethanolamine salicylate about 15 % aloe vera about 1 % ______________________________________ formulas 1 though 8 each provide a composition which provides pain relief , yet avoids the gastric irritation associated with orally ingested aspirin . the formulas are capable of being applied topically and have at least a comparable pain relieving effect as orally ingested aspirin , yet avoid the gastric side effects associated with orally ingested aspirin . the formulas containing acetylsalicylic acid thus provide salicylic acid in the blood stream which is negligible compared to the amount of salicylic acid provided into the blood stream by orally ingested aspirin . each formula disclosed herein is a composition which provides transdermal pain relief without a digestive side effect and without being shaken or stirred before use . each formula also provides a composition which may be applied directly to the skin surrounding a specific painful location in the body to relieve the pain . in addition , each of the formulas disclosed herein provide a composition which has an effective shelf life of at least eighteen months . furthermore , the formulas will permeate at least seven layers of skin to relieve pain without a digestive side effect . when employing the formulas disclosed herein , the pain relief begins within about one to two minutes . the following examples 1 through 8 demonstrate the results of experiments employing a test solution comprising : isopropyl alcohol in an amount of about 88 . 38 % by weight , glycerin in amount of about 4 . 81 % by weight , acetylsalicylic acid in an amount of about 5 . 71 % by weight and aloe vera in an amount of about 1 . 1 % by weight (&# 34 ; test solution &# 34 ;), a representative sample of formulas 1 through 8 . these examples demonstrate the safety and usefulness of each of the formulas described herein . the objective of the test was to determine whether topical application of the test solution is followed by a rise of venous blood salicylic acid in two healthy human subjects . two male subjects , one non - smoker and one smoker , aged 26 and 29 years , and weighing 67 kg and 74 kg , respectively were studied as described below . after insertion of an intravenous cannula ( venflon 21 gauge ) into an antecubital arm vein , a 20 ml blood sample was withdrawn . the cannula was kept patent with heparinized saline . at time zero six metered sprays of the test solution were applied to a 20 cm diameter area of the skin on the lower back . the sprays were separated by only three minutes . further blood samples were taken at 1 , 2 , 3 , 4 , 5 , 6 , 8 , and 10 hours after the topical application . the subjects were kept in a designated room in the drug control centre and were allowed to eat and drink ( no alcohol ) adlibitum . blood samples were analyzed for salicylic acid . blood samples were placed in a heparinized tubes and centrifuged to provide plasma samples . aliquots were frozen at - 70 ° c . for future analysis and one set was used for immediate analysis . the plasma samples were analyzed by sim gc - ms using developments of a gc method used by rance et at , pharm pharmacol . 1975 ; 27 : 425 - 429 , which is incorporated herein in its entirety by reference . the method was found to be sensitive with a detection limit of 10 micrograms / l ( 10 ng / ml ). both subjects were found to have salicylic acid present in the plasma at time zero ( 10 ng / ml subject a , and 30 ng / ml subject b ). neither subject had any history or other evidence which would suggest liver disease . after application of the spray plasma levels rose in both subjects and in both cases the 10 hours values were higher than the 8 hour values . ______________________________________time : 0 10 h______________________________________subject a : 10 ng / ml 40 ng / mlsubject b : 30 ng / ml 300 ng / ml______________________________________ the highest blood level seen in the study of the test solution was 300 ng / ml 10 hours after topical administration of 210 mg of the test solution . the method used was so sensitive that baseline levels of salicylic acid were detected above zero . it is possible that this salicylic acid was derived from naturally occurring salicylates in fruits and vegetables . acetylsalicylic acid is rapidly hydrolyzed after absorption . the rising levels of salicylate in both subjects suggest that some of the acetylsalicylic acid applied topically was absorbed through the skin , and was hydrolyzed . the differences between the two subjects may have been due to a number of variables : skin permeability , skin blood flow , skin temperature , capacity for hydrolysis , rate of hepatic degradation of acetylsalicylic acid and renal clearance . the absolute plasma levels were an order of magnitude lower than would have been expected after an oral dose . in this study 210 mg was applied topically . by comparison , however , when 300 mg of aspirin was taken orally by 10 subjects , the average plasma levels of salicylic acid were estimated to be 22 , 26 , 21 , and 12 mg / ml at 1 , 2 , 4 , and 7 hours respectively . rance , et al , supra . a comparison of these values shows that the levels seen after topical administration of the test solution were negligible compared to those seen after oral administration of aspirin . the dose used orally was 1 . 43 times higher than the dose used topically ( six sprays ) in the pilot study . however , the blood levels were 40 , 000 to 87 , 000 times higher after the oral dose than the dose used topically in the pilot study . the blood levels after the topical administration are therefore minuscule by comparison with blood levels after oral dosage ( about 1 / 30 , 000 ). it follows that the drag levels in organs distant from the skin would also be minuscule , and it is most improbable that there would be any digestive side effect which could be attributed to salicylic acid as a consequence of the topical administration of the test solution at the dosage and in the manner described . the objective of the test was to determine whether topical application of the test solution has an appreciable change in stability . the test solution was placed in a plastic spray bottle at room temperature for six months . after six months , the data was indicative of that expected for a stabilized compound . there was no appreciable change or degradation during the six month period of any of the ingredients , and acetylsalicylic acid was found in the amount of approximately 5 . 71 % after the six month period . the objective of the test was to determine whether topical application of the test solution has an appreciable change in stability and effectiveness . after storage of over six months in a plastic spray bottle at room temperature , the test solution was applied to the headache in the neck region of a 30 year old female . the test solution was found effective in dispelling the headache . no instability or lack of effectiveness was indicated . in other tests by the inventors , a composition of the test solution prepared eighteen months previously by the inventors was proven to be stable and effective in relieving pain on human subjects . in light of the foregoing tests , it is likely that the solution is shelf stable for more than 2 years . a woman diagnosed with rheumatoid arthritis who suffered from progressive joint dysfunction employed the test solution for one month in addition to an intake of nsaid , which she had taken for years on a daily basis . the result was that after employing the test solution her joints became less swollen , and she experienced significantly more hand mobility , wrist mobility and knee motion . she was able to maintain her daily routine in more comfort and sleep pain - free . a woman suffered with bursitis in her right hip for 16 years . she received frequent cortisone injections with no relief . in 1993 , she underwent surgery to remove the bursa , following which the pain returned . the pain was so severe she could not even put a sheet over her hip at night . after a subsequent surgery in 1994 , the pain returned again . no pain relievers worked for her . after testing the test solution , continual improvement in pain relief was noticed . she can now sleep on her hip and walk long distances . the test solution was employed by a physician to treat numerous painful conditions ranging from disc degeneration to muscular strains . the results were most impressive . patients responded to the tests and received pain relief in a very satisfactory manner . a male who had been in a serious automobile accident and had undergone several back surgeries and was nevertheless in serious pain tested the test solution and found that he was able to decrease a daily dose of morphine necessary for pain relief by one half when he employed the composition . the secondary benefit was that his stomach was given substantial relief and his specialist agreed that a surgery would not be required to rectify severe stomach ulcers caused by the previous medication . all internal bleeding has stopped and he is almost completely free from stomach pain . after bruising her toe , which immediately became swollen and painful , a woman confirmed that the toe was broken . after applying the test solution and gently massaging it into the toe , the swelling became tolerable and she was able to wear a high - heeled shoe without any further discomfort . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrated and not restrictive . the scope of the invention is , therefore , indicated by the appended claims rather than by the foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .

US-61693196-A

an ambulatory repeater for use in automated patient care is presented . a local memory store includes a cryptographic key , sensitive information , and physiological measures . the cryptographic key is uniquely assigned to the implantable medical device prior to implant of the implantable medical device into a patient . the sensitive information is preencrypted under the cryptographic key and physiological measures are measured by the implantable medical device . an authentication module is in receipt of the cryptographic key . a permissions module confirms authorization of an external data processing device against the cryptographic key . a decryption module decrypts the sensitive information with the cryptographic key into decrypted information . a processor is operatively coupled to the local memory store . a communications module exchanges the decrypted information and the physiological measures with the external data processing device over a wireless interface contingent upon the authorization confirmation . an internal power supply supplies power to the foregoing components .

fig1 is a block diagram showing , by way of example , an implantable medical device ( imd ) 103 . the imd 103 , such as a pacemaker , implantable cardiac defibrillator ( icd ) or similar device , is surgically implanted in the chest or abdomen of a patient to provide in situ therapy , such as pacing , cardiac resynchronization , defibrillation , neural stimulation and drug delivery , and physiological data monitoring . examples of cardiac pacemakers suitable for use in the described embodiment include the pulsar max ii , discovery , and discovery ii pacing systems and the contak renewal cardiac resynchronization therapy defibrillator , sold by guidant corporation , st . paul , minn . the imd 103 includes a case 104 and terminal block 105 coupled to a set of leads 106 a - b . the leads 106 a - b are implanted transvenously for endocardial placement . the imd 103 is in direct electrical communication with the heart 102 through electrodes 111 a - b positioned on the distal tips of each lead 106 a - b . by way of example , the set of leads 106 a - b can include a right ventricular electrode 111 a , preferably placed in the right ventricular apex 112 of the heart 102 , and a right atrial electrode 111 b , preferably placed in the right atrial chamber 113 of the heart 102 . the set of leads 106 a - b can also include a right ventricular electrode 114 a and a right atrial electrode 114 b to enable the imd 103 to directly collect physiological measures , preferably through millivolt measurements . the imd 103 includes a case 104 and terminal block 105 coupled to a set of leads 106 a - b . the imd case 104 houses hermitically - sealed components , including a battery 107 , control circuitry 108 , memory 109 , and telemetry circuitry 110 . the battery 107 provides a finite , power source . the control circuitry 108 controls therapy delivery and monitoring , including the delivery of electrical impulses to the heart 102 and sensing of spontaneous electrical activity . the memory 109 includes a memory store in which the physiological signals sensed by the control circuitry 108 can be temporarily stored , pending telemetered data download . the telemetry circuitry 110 provides an interface between the imd 103 and an external device , such as a programmer conventional or ambulatory repeater , or similar device . for near field data exchange , the imd 103 communicates with a programmer or conventional or ambulatory repeater ( not shown ) through inductive telemetry signals exchanged through a wand placed over the location of the imd 103 . programming or interrogating instructions are sent to the imd 103 and the stored physiological signals are downloaded into the programmer or repeater . for far field data exchange , the imd 103 communicates with an external device capable of far field telemetry , such as a radio frequency ( rf ) programmer , conventional or ambulatory repeater , or other wireless computing device , as further described below with reference to fig2 . other types of data interfaces are possible , as would be appreciated by one skilled in the art . other configurations and arrangements of leads and electrodes can also be used . furthermore , although described with reference to imds for providing cardiac monitoring and therapy delivery , suitable imds also include other types of implantable therapeutic and monitoring devices in addition to or in lieu of cardiac monitoring and therapy delivery imds , including imds for providing neural stimulation , drug delivery , and physiological monitoring and collection . fig2 is a process flow diagram 120 showing interfacing with the imd 103 of fig2 using an ambulatory repeater 123 . the ambulatory repeater 123 provides a portable means for securely transacting a data exchange session with the imd 103 and , in turn , at least one of a conventional or “ base ” repeater 124 , server 125 , or programmer 126 , as further described below with reference to fig5 . unlike a base repeater 124 , the ambulatory repeater 123 can collect patient health information as frequently or infrequently as needed and , due to being immediately proximate to the patient , can measure the activity level of the patient during normal everyday activities , rather than only at home or in a clinical setting . interfacing 120 with the imd 103 includes key generation 121 , authentication 129 , activation 130 , protected data storage and retrieval 131 , unprotected data storage and retrieval 136 , and optional data exchanges 132 , 133 , 134 with the base repeater 124 , server 125 , and programmer 126 . key generation 121 creates a cryptographic key 122 , which is used to encrypt and decrypt any sensitive information exchanged with the imd 103 , such as during protected data storage and retrieval 131 using long range telemetry or over any other unsecured interface . the cryptographic key 122 can be statically generated and persistently stored , dynamically generated and persistently stored , dynamically generated and non - persistently stored as a session cryptographic key 122 , or a combination of the foregoing . persistently - stored cryptographic keys 122 are maintained in a fixed secure key repository , such as a programmer , patient designator , secure database , token , base repeater 124 , ambulatory repeater 123 , and on the imd 103 itself . statically generated and persistently - stored cryptographic keys are stored in the imd 103 prior to implantation , such as during the manufacturing process . dynamically generated and persistently - stored cryptographic keys are generated dynamically , such as by the ambulatory repeater 123 for subsequent download to the imd 103 using short range telemetry following implantation . dynamically generated and non - persistently - stored session cryptographic keys are also generated dynamically and shared with the imd 103 , but are not persistently stored and are used for a single patient data exchange . each cryptographic key 122 is uniquely assigned to the imd 103 . in one embodiment , the cryptographic key 103 has a length of 128 bits , is symmetric or is both 128 - bits long and symmetric . other cryptographic key lengths and symmetries are possible . authentication 129 provides an opportunity to securely obtain the cryptographic key 122 uniquely assigned to the imd 103 . in one embodiment , the imd 103 interfaces with an external source , such as the ambulatory repeater 123 or other wireless computing device , to either receive or share the cryptographic key 122 assigned to the imd 103 , such as described in commonly - assigned u . s . pat . no . 7 , 838 , 828 , issued nov . 9 , 2010 , the disclosure of which is incorporated by reference . in a further embodiment , the ambulatory repeater 123 retrieves the cryptographic key 122 from the imd 103 using secure , short range telemetry , such as inductive telemetry , as further described below with reference to fig5 . in a further embodiment , the cryptographic key 122 is entrusted to a third party , such as hospital or emergency services , as a form of key escrow . under normal circumstances , the cryptographic key 122 will not be released unless the requester performs proper authentication 129 . however , the cryptographic key 122 could be released under specifically - defined circumstances , such as a bona fide medical emergency , to a third party to facilitate access to patient health information in the imd 103 , ambulatory repeater 123 , base repeater 124 , server 125 , programmer 126 , or other such authenticated device . following authentication 126 , the ambulatory repeater 123 can be used to securely transact data exchange sessions with the imd 103 . each data exchange session is secure in that the patient health information being exchanged is safely protected from compromise and interception by encryption prior to being transmitted . thus , the communication channel can be unsecured , as the data itself remains protected . as the ambulatory repeater 123 remains physically proximal to the patient , secure data exchange sessions are performed either as on demand or per a schedule , as further described below with reference to fig6 and 9 . briefly , activation 130 can occur due to a patient - initiated interrogation , on demand or at scheduled times . a patient - initiated interrogation is triggered by a manual override of the ambulatory repeater 123 by the patient when the patient , for instance , feels ill , or otherwise inclined to take a reading of data values . on demand interrogation occurs due to a remote or local event , such as remote activation request from the server 125 . scheduled interrogation is specified by a healthcare provider and remains in effect until a new schedule is downloaded . upon activation 130 , protected data storage and retrieval 131 and unprotected data storage and retrieval 136 are performed . during protected data storage and retrieval 131 , sensitive information 127 ( si ), particularly phi , is provided to and retrieved from the imd 103 , as further described below . during unprotected data storage and retrieval 136 , non - sensitive information ( non - si ) 135 is retrieved from and sent to the imd 103 directly via the ambulatory repeater 123 . protected data storage and retrieval 131 and unprotected data storage and retrieval 136 can occur simultaneously during the same data exchange session . in a further embodiment , the si 127 provided to the imd 103 can include programming instructions for the imd 103 . in one embodiment , the bulk of the patient health information retrieved from the imd 103 is non - si 135 . si 127 is generally limited to only patient - identifiable health information , which typically does not change on a regular basis . the non - si 135 loosely falls into two categories of data . first , physiological data relates directly to the biological and biochemical processes of the body , such as salinity , pulse , blood pressure , glucose level , sweat , and so forth . second , behavioral data relates to physical activities performed by the patient either during the course of a normal day or in response to a specific request or exercise regimen , such as sitting , standing , lying supine , and so forth . other types of patient health measures are possible . during protected data storage and retrieval 131 , si 127 , particularly phi , can be received into the ambulatory repeater 123 from one or more sensors 128 and from a patient or clinician , respectively via the base repeater 124 and server 125 or programmer 126 . part or all of the sensitive information 127 is preferably preencrypted using the cryptographic key 122 , including any phi , which can be stored on the imd 103 as static data for retrieval by health care providers and for use by the imd 103 , such as described in commonly - assigned u . s . pat . no . 7 , 475 , 245 , issued jan . 6 , 2009 , the disclosure of which is incorporated by reference . if the sensitive information needs to be retrieved , the ambulatory repeater 123 obtains the cryptographic key 122 , if necessary , through authentication 126 and retrieves the encrypted information 128 from the imd 103 for subsequent decryption using the cryptographic key 122 . in one embodiment , the sensitive information 127 , including any phi , is encrypted using a standard encryption protocol , such as the advanced encryption standard protocol ( aes ). other authentication and encryption techniques and protocols , as well as other functions relating to the use of the cryptographic key 122 are possible , including the authentication and encryption techniques and protocols described in commonly - assigned u . s . pat . no . 7 , 155 , 290 , issued dec . 26 , 2006 , the disclosure of which is incorporated by reference . ambulatory repeater - to - sensor data exchanges 139 enable the ambulatory repeater 123 to receive patient health information from the sensors 138 , including external sensors , such as a weight scale , blood pressure monitor , electrocardiograph , holter monitor , or similar device . in a further embodiment , one or more of the sensors 138 can be integrated directly into the ambulatory repeater 123 , as further described below with reference to fig6 . the non - si 135 and si 127 is exchanged with at least one of three external data processing devices , which include the base repeater 124 , server 125 , and programmer 126 . in addition , the ambulatory repeater 123 is communicatively interfaced to at least one external sensor to directly measure patient health information , as further described below beginning with reference to fig5 . ambulatory repeater - to - base repeater data exchanges 132 enable the ambulatory repeater 123 to function as a highly portable extension of the base repeater 124 . unlike the base repeater 124 , the ambulatory repeater 123 includes a power supply that enables secure interfacing with the imd 103 while the patient is mobile and away from the base repeater 124 and can interrogate the imd 103 at any time regardless of the patient &# 39 ; s activity level . ambulatory repeater - to - server data exchanges 133 enable the server 125 to directly access the imd 103 via the ambulatory repeater 123 through remote activation , such as in emergency and non - emergency situations and in those situation , in which the base repeater 125 is otherwise unavailable . ambulatory repeater - to - programmer data exchanges 134 supplement the information ordinarily obtained during a clinical follow - up session using the programmer 126 . the ambulatory repeater 123 interfaces to and supplements the retrieved telemetered data with stored data values that were obtained by the ambulatory repeater 123 on a substantially continuous basis . in addition , patient health information can be shared directly 137 between the base repeater 124 , server 125 , and programmer 126 . other types of external data processing devices are possible , including personal computers and other ambulatory repeaters . fig3 is a functional block diagram 150 showing , by way of example , an ambulatory repeater 123 in handheld form factor 151 , in accordance with one embodiment . the handheld form factor 151 enables the ambulatory repeater 123 to be carried by the patient and can be implemented as either a stand - alone device or integrated into a microprocessor - equipped device , such as a personal data assistant , cellular telephone or pager . other types of handheld form factors are possible . the handheld form factor 151 includes a display 152 for graphically displaying indications and information 157 , a plurality of patient - operable controls 153 , a speaker 154 , and a microphone 155 for providing an interactive user interface . the handheld form factor 151 is preferably interfaced to the imd 103 through rf telemetry and to the base repeater 124 , server 125 , and programmer 126 through either rf telemetry , cellular telephone connectivity or other forms of wireless communications , as facilitated by antenna 156 . the display 152 and speaker 154 provide visual and audio indicators while the controls 153 and microphone 155 enable patient feedback . in addition , one or more external sensors ( not shown ) are interfaced or , in a further embodiment , intergraded into the handheld form factor 151 for directly monitoring patient health information whenever required . the types of indications and information 157 that can be provided to the patient non - exclusively include : in addition to securely exchanging data with the imd 103 , the ambulatory repeater 123 can perform a level of analysis of the downloaded telemetered data and , in a further embodiment , provide a further visual indication 158 to the patient for informational purposes . the handheld form factor 151 can also include a physical interface 159 that allows the device to be physically connected or “ docked ” to an external data processing device , such as the base repeater 124 , for high speed non - wireless data exchange and to recharge the power supply integral to the handheld form factor 151 . the ambulatory repeater 123 can continue to securely communicate with the imd 103 , even when “ docked ”, to continue remote communication and collection of telemetered data . fig4 is a functional block diagram 170 showing , by way of example , an ambulatory repeater 123 in wearable form factor 171 , in accordance with a further embodiment . the wearable form factor 171 enables the ambulatory repeater 123 to be worn by the patient and can be implemented as either a stand - alone device or integrated into a microprocessor - equipped device , such as a watch or belt . other types of wearable form factors are possible . similar to the handheld form factor 151 , the wearable form factor 171 includes a display 172 for graphically displaying indications and information 177 , a plurality of patient - operable controls 173 , a speaker 174 , and a microphone 175 for providing an interactive user interface . the wearable form factor 171 is preferably interfaced to the imd 103 through rf telemetry and to the base repeater 124 , server 125 , and programmer 126 through either rf telemetry , cellular telephone connectivity or other forms of wireless communications , as facilitated by antenna 176 . the display 172 and speaker 174 provide visual and audio indicators while the controls 173 and microphone 175 enable patient feedback . in addition , one or more external sensors ( not shown ) are interfaced or , in a further embodiment , intergraded into the wearable form factor 171 for directly monitoring patient health information whenever required . the wearable form factor 171 also includes a physical interface 179 that allows the device to be physically connected or “ docked ” to an external data processing device . fig5 is a functional block diagram 190 showing , by way of example , systems for securely communicating using an ambulatory repeater 123 , in accordance with one embodiment . by way of example , an ambulatory repeater 123 in a wearable form factor 171 is shown , although the ambulatory repeater 123 could also be provided in the handheld form factor 151 . the ambulatory repeater 123 securely interfaces to the imd 103 over a secure data communication interface 191 , such as described above with reference to fig2 . the ambulatory repeater interrogates the imd 103 due to a patient - initiated interrogation , on demand , or at scheduled times . patient - initiated interrogations are triggered by the patient through a manual override of the ambulatory repeater 123 . in one embodiment , the patient is limited in the number of times that a patient - initiated interrogation can be performed during a given time period . however , in a further embodiment , a healthcare provider can override the limit on patient - initiated interrogations as required . on demand interrogations occur in response to a remote or local event , such as a health - based event sensed by the ambulatory repeater 123 . scheduled interrogations occur on a substantially regular basis , such as hourly or at any other healthcare provider - defined interval . the schedule is uploaded to the ambulatory repeater 123 and remains in effect until specifically replaced by a new schedule . the ambulatory repeater 123 can also be activated by indirect patient action , such as removing the device from a “ docking ” station . once activated , parametric and behavioral data collected and recorded by the imd 103 from the external sensors are monitored by the ambulatory repeater 123 in a fashion similar to the base repeater 124 . however , the power supply enables the ambulatory repeater 123 to operate separately and independently from external power sources , thereby allowing the patient to remain mobile . the ambulatory repeater 123 also provides the collateral benefits of functioning as an automatic data back - up repository for the base repeater 124 and alleviates patient fears of a lack of monitoring when away from the base repeater 124 . in a further embodiment , the parametric and behavioral data is gathered and analyzed by either the ambulatory repeater 123 or an external data processing device , such as repeater 124 , server 125 or programmer 126 , and provided for review by a healthcare provider . alternatively , the analysis can be performed through automated means . a set of new imd parameters can be generated and provided to the ambulatory repeater 123 for subsequent reprogramming of the imd 103 . periodically or as required , the ambulatory repeater 123 interfaces to one or more of the base repeater 124 , server 125 , and programmer 126 to exchange data retrieved from the imd 103 . in one embodiment , the ambulatory repeater 123 interfaces via a cellular network 191 or other form of wireless communications . the base repeater 124 is a dedicated monitoring device specifically matched to the imd 103 . the base repeater 124 relies on external power source and can interface to the imd 103 either through inductive or rf telemetry . the base repeater 124 further interfaces to the ambulatory repeater 123 either through a physical or wireless connection , as further described above . the server 125 maintains a database 192 for storing patient records . the patient records can include physiological quantitative and quality of life qualitative measures for an individual patient collected and processed in conjunction with , by way of example , an implantable medical device , such a pacemaker , implantable cardiac defibrillator ( icd ) or similar device ; a sensor 138 , such as a weight scale , blood pressure monitor , electrocardiograph , holter monitor or similar device ; or through conventional medical testing and evaluation . in addition , the stored physiological and quality of life measures can be evaluated and matched by the server 123 against one or more medical conditions , such as described in related , commonly - owned u . s . pat . no . 6 , 336 , 903 , to bardy , issued jan . 8 , 2002 ; u . s . pat . no . 6 , 368 , 284 , to bardy , issued apr . 9 , 2002 ; u . s . pat . no . 6 , 398 , 728 , to bardy , issued jun . 2 , 2002 ; u . s . pat . no . 6 , 411 , 840 , to bardy , issued jun . 25 , 2002 ; and u . s . pat . no . 6 , 440 , 066 , to bardy , issued aug . 27 , 2002 , the disclosures of which are incorporated by reference . the programmer 126 provides conventional clinical follow - up of the imd 103 under the direction of trained healthcare professionals . in one embodiment , the ambulatory repeater 123 interfaces via a cellular network 191 or other form of wireless communications . other types of external data processing devices and interfacing means are possible . in a further embodiment , the ambulatory repeater 123 interfaces to emergency services 193 , which posses a copy of the cryptographic key 122 ( shown in fig2 ) held in a key escrow . under ordinary circumstances , patient health information is exchanged exclusively between the ambulatory repeater 123 and authenticated external data processing devices , such as the base repeater 124 , server 125 , and programmer 126 . however , in a bona fide emergency situation , the emergency services 193 can use the cryptographic key 122 to access the patient health information in the ambulatory repeater 123 and imd 103 , as well as the repeater 124 , server 125 , and programmer 126 . other forms of key escrow are possible . fig6 is a functional block diagram 190 showing , by way of example , the internal components of the ambulatory repeater 123 in the wearable form factor 171 of fig4 . by way of example , the ambulatory repeater 123 includes a processor 202 , memory 203 , authentication module 212 , communications module 205 , physical interface 213 , optional integrated sensor 214 , and alarm 215 . each of the components is powered by a power supply 204 , such as a rechargeable or replaceable battery . the internal components are provided in a housing 201 with provision for the antenna 176 and physical interface 179 . the processor 202 enables the ambulatory repeater 123 to control the authentication and secure transfer of both non - sensitive and sensitive information between the imd 103 , one or more external sensors ( not shown ), and one or more of the base repeater 124 , server 125 , and programmer 126 . the processor 202 also operates the ambulatory repeater 123 based on functionality embodied in an analysis module 207 , schedule module 208 and override module 209 . the analysis module 207 controls the translation , interpretation and display of patient health information . the schedule module 208 controls the periodic interfacing of the ambulatory repeater 123 to the imd 103 and external data processing device . the override module 209 controls the patient - initiated interrogation . other control modules are possible . the communications module 205 includes an imd telemetry module 210 and external data processing device ( edpd ) telemetry module 211 for respectively interfacing to the imd 103 and external data processing device , such as the base repeater 124 , server 125 , and programmer 126 . preferably , the ambulatory repeater 123 interfaces to the imd 103 and external sensors through inductive rf telemetry , bluetooth , or other form of secure wireless interface , while the ambulatory repeater 123 interfaces to external data processing device preferably through rf telemetry or via cellular network or other form of wireless interface . the authentication module 206 is used to securely authenticate and encrypt and decrypt sensitive information using a retrieved cryptographic key 212 . the memory 203 includes a memory store , in which the physiological and parametric data retrieved from the imd 103 are transiently stored pending for transfer to the external data processing device and , in a further embodiment , download to the imd 103 . the physical interface 213 controls the direct physical connecting of the ambulatory repeater 123 to an external data processing device or supplemental accessory , such as a recharging “ dock ” or other similar device . the optional integrated sensor 214 directly monitors patient health information , such as patient activity level . lastly , the alarm 215 provides a physical feedback alert to the patient , such as through a visual , tactual or audible warning , for example , flashing light , vibration , or alarm tone , respectively . other internal components are possible , including a physical non - wireless interface and removable memory components . fig7 is a flow diagram showing a method 220 for providing automated patient care using an ambulatory repeater 123 , in accordance with one embodiment . the purpose of this method is to periodically activate and securely exchange information with the imd 103 , one or more sensors 138 , and an external data processing device that includes one or more of a base repeater 124 , server 125 , and programmer 126 . the method 220 is described as a sequence of process operations or steps , which can be executed , for instance , by an ambulatory repeater 123 . the method begins by obtaining the cryptographic key 122 ( block 221 ), as further described below with reference to fig8 . the method then iteratively processes data exchange sessions ( blocks 222 - 226 ) as follows . first , the ambulatory repeater 123 is activated ( block 223 ), which includes securely interrogating the imd 103 , as further described below with reference to fig9 . next , the ambulatory repeater 123 performs a data exchange session with one or more of the external data processing devices , including the base repeater 124 , server 125 , and programmer 126 , as further described below with reference to fig1 . following completion of the data exchange session , the ambulatory repeater 123 returns to a stand - by mode ( block 225 ). processing continues ( block 226 ) while the ambulatory repeater 123 remains in a powered - on state . fig8 is a flow diagram showing a routine 240 for obtaining a cryptographic key 122 for use in the method 220 of fig7 . the purpose of this routine is to securely receive the cryptographic key uniquely assigned to the imd 103 into the ambulatory repeater 123 . initially , the cryptographic key 122 is optionally generated ( block 241 ). depending upon the system , the cryptographic key 122 could be generated dynamically by the base repeater 124 or programmer 126 for subsequent download to the imd 103 using short range telemetry following implantation . similarly , the cryptographic key 122 could be generated during the manufacturing process and persistently stored in the imd 103 prior to implantation . alternatively , the cryptographic key 122 could be dynamically generated by the imd 103 . next , a secure connection is established with the source of the cryptographic key 122 ( block 242 ). the form of the secure connection is dependent upon the type of key source . for instance , if the key source is the imd 103 , the secure connection could be established through inductive or secure rf telemetric link via the base repeater 124 or programmer 126 . if the key source is the base repeater 124 , a secure connection could be established through the dedicated hardwired connection . finally , the cryptographic key 122 is authenticated and obtained ( block 243 ) by storing the cryptographic key 122 into the authentication module 206 . fig9 is a flow diagram showing a routine 260 for activating an ambulatory repeater 123 for use in the method 220 of fig7 . the purpose of the routine is to activate the ambulatory repeater 123 prior to interrogating the sensors 138 and imd 103 . the ambulatory repeater 123 can be activated as scheduled ( block 261 ) or through manual action directly or indirectly by the patient ( block 262 ) or remotely , such as by the server 125 ( block 265 ). manual activation typically involves either a direct patient - initiated interrogation ( block 263 ), such as operating a manual override control , or indirect action , such as removing the ambulatory repeater 123 from a “ docking ” cradle ( block 264 ). similarly , remote activation involves either health - based data transfer triggers ( block 266 ) or system - based data transfer triggers ( block 267 ). a health - based data transfer is triggered when a prescribed or defined health status or alert condition is detected . a system - based data transfer trigger occurs typically due to a device - specific circumstance , such as data storage nearing maximum capacity . other forms of manual and remote ambulatory repeater activations are possible . upon activation , the sensors 138 and imd 103 are interrogated ( blocks 268 and 269 ), as further described below with reference to fig1 . fig1 is a flow diagram showing a routine 280 for performing a secure data exchange for use in the method 220 of fig7 . the purpose of this routine is to exchange data between the ambulatory repeater 123 and one or more external data processing device , such as the base repeater 124 , server 125 , and programmer 126 . initially , any sensitive information 127 is encrypted ( block 281 ) using , for instance , the cryptographic key 122 that is uniquely assigned to the imd 103 , or other cryptographic key ( not shown ) upon which the ambulatory repeater 123 and external data processing device have previously agreed . a secure connection is opened with the external data processing device ( block 282 ) and the sensitive information is exchanged ( block 283 ). the connection is “ secure ” in that the sensitive information is only exchanged in an encrypted or similar form protecting the sensitive information from compromise and interception by unauthorized parties . in the described embodiment , the secure connection is served through a web - based data communications infrastructure , such as web - sphere software , licensed by ibm corporation , armonk , n . y . other types of data communications infrastructures can be used . upon the competition of the exchange of sensitive information , the secure connection with external data processing device is closed ( block 284 ) and a non - secure connection is open ( block 285 ). similarly , non - sensitive information is exchanged ( block 286 ) and the non - secure connection is closed ( block 287 ). the non - sensitive information can be sent in parallel to the sensitive information and can also be sent over the secure connection . however , the sensitive information cannot be sent over the non - secure connection . fig1 is a flow diagram showing a routine 300 for interrogating an imd 103 for use in the method 220 of fig7 . the purpose of this routine is to retrieve encrypted sensitive information 128 , including any phi , from the imd 103 and to decrypt the encrypted sensitive information 128 using the cryptographic key 122 uniquely assigned to the imd 103 . initially , the ambulatory repeater 123 authenticates with the imd 103 ( block 301 ). a connection is established between the imd 103 and the ambulatory repeater 123 ( block 302 ) via an rf connection . encrypted sensitive information 127 , including any phi , is retrieved from the imd 103 ( block 303 ) and the connection between the imd 103 and the ambulatory repeater 123 is closed ( block 304 ). the encrypted sensitive information 128 is then decrypted using the cryptographic key 122 ( block 305 ). while the invention has been particularly shown and described as referenced to the embodiments thereof , those skilled in the art will understand that the foregoing and other changes in form and detail may be made therein without departing from the spirit and scope of the invention .

US-89370407-A

a balloon catheter includes a first outer tubular member , a second inner tubular member , an inflatable balloon , and a drug coating applied to at least a portion of the inflatable balloon . the inflatable balloon has opposing distal and proximal end portions . the inflatable balloon resides on the first and second tubular members in a twisted turn orientation of a pre - determined angle relative to the proximal end portion of the inflatable balloon attached to the first outer tubular member , such that the second inner tubular member achieves a constant torque of the balloon to twist and fold itself when retracted back into a portion of the first outer tubular member . folds caused by the twisted turn orientation are configured and adapted to protect the drug coating while the inflatable balloon is deflated , thereby reducing premature drug elution and increasing the reliability and consistency of drug delivery .

the present invention is now described more fully with reference to the accompanying drawings , in which an illustrated embodiment of the present invention is shown . the present invention is not limited in any way to the illustrated embodiment as the illustrated embodiment described below is merely exemplary of the invention , which can be embodied in various forms , as appreciated by one skilled in the art . therefore , it is to be understood that any structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a basis for the claims and as a representative for teaching one skilled in the art to variously employ the present invention . furthermore , the terms and phrases used herein are not intended to be limiting but rather to provide an understandable description of the invention . it is to be appreciated and understood that the present invention , in accordance with the illustrated embodiments , is directed to a system and method for protecting a drug and delivering a drug to a surgical site using foldable balloon catheters , wherein the balloon is folded onto itself tightly around the catheter in a twisted ( overlapping ) matter each time the balloon is caused to be deflated . the folds of the balloon protect the drug during insertion and positioning , therein reducing premature drug elution and providing reliable and consistent delivery of the drug to the surgical site . as will be apparent from the below description in accordance with the illustrated embodiments of fig1 to 17 , the balloon catheter 10 in accordance with the illustrated embodiments of the invention includes an outer shaft tubing 12 and a distal inner shaft tubing 14 ( e . g ., a guidewire lumen — as the inner shaft lumen is often used as a guidewire lumen , whereby the balloon catheter is introduced over a guidewire into the vessel to the desired location ) and a balloon 20 affixed thereto as described below . it is to be appreciated the inner shaft tubing 14 resides the length of the catheter 10 and is slideably received within the outer tubing 12 having a distal end portion 16 extending distally from a distal end portion 18 of the outer tubing 12 . a proximal section 22 of a balloon 20 is mounted onto the outer tubing 12 by known adhesive means ( e . g ., heat , glue , and the like ) with a distal section 24 of the balloon 20 being mounted onto the inner tubing 14 also by known adhesive means ( e . g ., heat , glue , and the like ) such that the balloon 20 is sealed between both the inner 14 and outer tubing 12 members in an manner suitable for inflation . further , a self twisting and self wrapping of the balloon 20 during inflation and deflation is achieved whereby the distal end 24 of the balloon 20 is prescribed with an at least forty - five degree twisted turn orientation relative to the proximal section 22 of the balloon 20 which is then attached to the distal inner tubing 14 in a twisted condition such that the inner tubing 14 achieves a constant torque of the balloon 20 to twist and fold itself . depending on the shape and size of the balloon , several twists exceeding 360 ° may be provided . a drug coating 26 is applied to at least a portion of balloon 20 , wherein folds 28 caused by the twisted turn orientation are configured and adapted to protect drug coating 26 while balloon 20 is deflated , thereby reducing premature drug elution during insertion and delivery of balloon 20 to the surgical site . turning now descriptively to the drawings , in which similar reference characters denote similar elements throughout the several views , fig1 depicts a balloon 20 for use with a catheter device 10 . preferably medical grade material is used to fabricate balloon 20 which material is typically very thin but rather rigid plastic , so that the inflated diameter is predictable and doesn &# 39 ; t vary greatly as a function of inflation pressure . because of this , catheter balloons do not stretch like a rubber balloon when inflated , but rather they unfold . fig2 depicts an outer shaft tubing member 12 ( having a inner shaft tubing member 14 slideably received therewithin ) received through the interior portion of the balloon 20 so as to extend from the proximal section 22 of balloon 20 to distal end section 24 . fig3 depicts the folding of balloon 20 about outer shaft tubing 12 . it is to be appreciated that folding is the process of wrapping the wing portions of balloon 20 spirally around the outer shaft tubing 12 . folding may be done by either hand or machine . when performed by hand as shown in fig3 , it is accomplished by holding the shaft 12 in one hand while gripping and turning the adjacent part of the balloon 20 around the catheter axis with the other hand . the balloon 20 is preferably folded incrementally , moving both the folding and grasping hands incrementally in steps from the distal 24 to the proximal 22 end of the balloon 20 . following the folding , the balloon 20 is preferably placed in an introducer sheath to hold it in the folded position and guide it to a desired surgical location . fig4 depicts the balloon 20 in a folded position on outer shaft tubing 12 ready for insertion into the lumen 102 , shown in fig7 , of an introducer 100 while fig5 depicts the balloon 20 in at least a partially inflated position . reference is now made to fig6 to 13 illustrating the self - twisting balloon features of the present invention . with reference to fig6 , illustrated is a balloon 20 of balloon catheter 10 in a fully wrapped position , preferably in preparation for insertion into the lumen 102 , shown in fig7 , of an introducer sheath 100 . fig7 illustrates the balloon catheter 10 ( in which the balloon 20 is tightly wrapped around the outer shaft tubing 12 of catheter 10 ) being introduced into the lumen 102 of introducer sheath 100 . fig8 a to 8c illustrate the sequential steps of the balloon catheter 10 ( of fig6 ) being slideably received within the lumen 102 of introducer sheath 100 such that it extends distally from the distal end 104 of the lumen 102 ( which is to be understood to be inserted in a vessel ) of introducer 100 so as to be exposed to a vessel ( fig8 c ). fig9 a to 9c illustrate the sequential steps of balloon 20 being inflated ( via preferably an inflation fluid , such as saline solution or a contrast medium ) such that the portion of the balloon 20 extending from the distal end 104 of the lumen sheath 102 , unwraps ( e . g ., unfolds ) from the outer shaft tubing 12 of catheter 10 . fig1 depicts the balloon 20 in a fully inflated position while fig1 depicts the balloon 20 being deflated , preferably via the use of a pulling vacuum provided on an inflation syringe wherein it is to be appreciated and understood , in accordance with the present invention , the balloon wraps ( folds ) itself into the wrapped position shown in fig3 a to 3c . with reference to fig1 , the balloon 20 is illustrated in a fully deflated and tightly wrapped position about the outer shaft tubing 12 of catheter 10 . as illustrated in fig1 , this enables the balloon catheter 12 to be retracted back into the lumen 102 of introducer 100 such that the balloon catheter 10 may be transported to another surgical location or removed from the patient &# 39 ; s body via introducer 100 . turning now to fig1 - 17 , illustrated is a drug eluting foldable balloon catheter in accordance with the present invention , and a method of using the drug eluting foldable balloon catheter . with reference to fig1 , balloon 20 for use with catheter device 10 , as described above with reference to fig1 , is shown . drug coating 26 , is applied to balloon 20 . those skilled in the art will readily appreciate that drug coating 26 can be applied by means of a polymer or the like . those skilled in the art will also readily appreciate that a variety of drug types can be used for drug coating 26 , such as for example , steroids , anti - clotting , anti - thrombolytic , anti - inflammatory , paclitaxel and everolimus or the like . fig1 depicts the folding of balloon 20 , as previously described above with reference to fig3 . fig1 depicts balloon 20 folding about outer shaft tubing 12 . it is to be appreciated folding is the process of wrapping the wing portions of balloon 20 spirally around the outer shaft tubing 12 . folding may be done by either hand or machine , as described above . when deflated , folds 28 are created by folding or wrapping the wing portions of balloon 20 . folds 28 are configured and adapted to protect at least a portion of the previously applied drug coating 26 from prematurely eluting from balloon 20 , which can cause dilution , premature absorption , or the like . in addition , by reducing premature elution , the drug can be delivered to the desired surgical site in a more reliable and predictable manner . now with reference to fig1 , after the folding of balloon 20 and insertion of catheter 10 into lumen 102 of introducer sheath 100 , catheter 10 is delivered to the surgical site , in this case a vessel , with drug coating 26 at least partially intact . lumen 102 and introducer sheath 100 are not shown in fig1 , but described above with reference to fig6 - 8c . fig1 shows balloon 20 inflated as described above with reference to fig9 a - 9c , such that the portion of balloon 20 extending from distal end 104 of lumen sheath 102 , has unwrapped ( e . g ., unfolded ) from the outer shaft tubing 12 of catheter 10 . when balloon 20 is fully inflated , folds 28 are no longer present to protect drug coating 26 , therefore drug coating 26 is permitted to be eluted from balloon 20 . optional embodiments of the present invention may also be said to broadly consist in the parts , elements and features referred to or indicated herein , individually or collectively , in any or all combinations of two or more of the parts , elements or features , and wherein specific integers are mentioned herein which have known equivalents in the art to which the invention relates , such known equivalents are deemed to be incorporated herein as if individually set forth . the above presents a description of a best mode contemplated for carrying out the present balloon folding and wrapping devices and methods , and of the manner and process of making and using them , in such full , clear , concise , and exact terms as to enable any person skilled in the art to which it pertains to make and use these devices and methods . these balloon folding and wrapping devices and methods are , however , susceptible to modifications and alternative method steps from those discussed above that are fully equivalent . consequently , these balloon folding and wrapping devices and methods are not limited to the particular embodiments disclosed . on the contrary , these balloon folding and wrapping devices and methods cover all modifications and alternative constructions and methods coming within the spirit and scope of the present invention . for instance , a device using a single outer tubing and employing two discrete lumens may also be used in addition to what is illustrated . the descriptions above and the accompanying drawings should be interpreted in the illustrative and not the , limited sense . while the invention has been disclosed in connection with the preferred embodiment or embodiments thereof , it should be understood that there may be other embodiments which fall within the scope of the invention as defined by the following claims . where a claim , if any , is expressed as a means or step for performing a specified function , it is intended that such claim be construed to cover the corresponding structure , material , or acts described in the specification and equivalents thereof , including both structural equivalents and equivalent structures , material - based equivalents and equivalent materials , and act - based equivalents and equivalent acts .

US-201313905608-A

pharmaceutical presentations of phenoxathiin - based mao - a inhibitors are disclosed whereby the mao receptors are protected from binding to active ingredient in the stomach . particular phenoxathiin - based mao - a inhibitors include those of the following formula : wherein n is 0 , 1 or 2 ; r1 is a branched or straight chain c1 - 5 alkyl or c3 - 6 cycloalkyl optionally substituted with hydroxyl , or one or more halogens ; and x 1 , x 2 , x 3 , x 4 , and x 5 are either all hydrogens or one or two of x 1 , x 2 , x 3 , x 4 , and x 5 are halogen and the remainder are hydrogens , with the proviso that when n is 0 or 1 and each x is hydrogen , r 1 is not methyl . a wide variety of enteric mechanisms may be utilized so as to provide release of the active ingredient essentially out of the environment of the stomach after ingestion as a pharmaceutical presentation , such as a tablet or capsule . presentations include enteric coated tablets , enteric coated capsules , capsules containing enteric coated beads .

monoamine oxidase inhibitor ( maoi ) agents can cause dangerous food reactions following the consumption of tyramine - rich dietary foods and beverages . this dangerous side - effect has minimized the use of maois even though they are highly effective in the treatment of major depressive disorder , social phobia and panic attack . reversible inhibitors of monoamine oxidase type - a ( rimas ) are a family of psychiatric drugs and natural compounds that inhibit monoamine oxidase temporarily and reversibly . the pharmacological properties of the rimas permit oral administration in antidepressant doses of these agents while lessening the risk of the cheese reaction . however , therapeutic doses of some rimas can still potentiate the tyramine pressor effect as much as 40 - to 50 - fold . as a result , rimas also are seldom used therapeutically . as provided herein , greater safety factors for a particular class of rimas , termed phenoxathiin - based mao - a inhibitors ( also referred to herein as “ active ” or “ active ingredient ”), as defined above in the summary , can be achieved through an enteric formulation that release in the intestine so as to avoid competing with dietary tyramine for mao - a in the gastrointestinal and hepatic tissues . such a formulation is particularly effective with cx157 since this rima is devoid of inhibitory actions on mao - b , thus allowing tyramine inactivation through the mao - b pathway . thus the specific and reversible properties of cx157 as a mao - a inhibitor provide a favorable profile for a weak potentiating effect on the oral tyramine pressor effect . provided herein are formulations engineered to initiate drug release in the middle to lower portions of the small intestine , with a delayed release time of greater than , for example , approximately 1 hour , 1 . 25 hours , 1 . 5 hours , 1 . 75 hours or 2 hours after dosing . such pharmaceutical formulations are manufactured in such a way that the product passes unchanged through the stomach of the patient , and dissolves and releases the active ingredient when it leaves the stomach and enters the middle and lower portions of the small intestine . such formulations can be in tablet or pellet form , where the active ingredient is in the inner part of the tablet or pellet and is enclosed in a film or envelope , the “ enteric coating ,” which is insoluble in acid environments , such as the stomach , but is soluble in near - neutral environments such as the small intestine . the instant enteric coating - containing formulations avoid much of the drug competition with dietary tyramine for mao - a since dietary tyramine is rapidly absorbed and metabolized in the stomach and upper portion of the small intestine and the liver with an average tmax of 1 . 25 hours . in this regard , human plasma pharmacokinetic data of tyramine , administered with food in a capsule , in an oral dose of 200 mg demonstrated a rapid absorption of tyramine with a tmax achieved within 1 . 25 hours and non - detectable levels observed 3 - 4 hrs after dosing . in accordance with the above , various formulations and presentations of phenoxathiin - based mao - a inhibitors , and particularly , of cx157 are provided herein . for example , clinical trial and commercial tablets of a phenoxathiin - based mao - a inhibitor such as cx157 can be coated , encapsulated or otherwise treated so as to render the tablet enteric . as used herein , all expressions of percentage , ratio , proportion and the like , will be in weight units unless otherwise stated . expressions of proportions of the enteric product will refer to the product in dried form , after the removal of the water in which many of the ingredients are dissolved or dispersed . the term “ sugar ” refers to a sugar other than a reducing sugar . a reducing sugar is a carbohydrate that reduces fehling &# 39 ; s ( or benedict &# 39 ; s ) or tollens &# 39 ; reagent . all monosaccharides are reducing sugars as are most disaccharides with the exception of sucrose . one common binding or filling agent is lactose . this excipient is particularly useful for tablets since it compresses well , is both a diluent and binder , and is cheap . however , it is a reducing sugar and it may be that the active ingredient interacts with lactose both at room temperature and under accelerated stability conditions ( heat ). therefore , avoidance of lactose and other reducing sugars from formulations comprising the active ingredient may be important . as discussed below , sucrose is a particular sugar . in a particular enteric product , a core of active is surrounded by an enteric coat and formed into a pellet . the pellets can then be loaded into gelatin capsules . the various components and layers of the pellet will be individually discussed as follows , together with the methods of adding the different ingredients to build up the pellet . a particular core for the pellet is typically prepared by applying an active ingredient - containing layer to an inert core . such inert cores are conventionally used in pharmaceutical science , and are readily available . a particular core is one prepared from starch and sucrose , for use in confectionery as well as in pharmaceutical manufacturing . however , cores of any pharmaceutically acceptable excipient can be used , including , for example , microcrystalline cellulose , vegetable gums , waxes , and the like . the primary characteristic of the inert core is to be inert , with regard both to the active ingredient and the other excipients in the pellet and with regard to the subject who will ultimately ingest the pellet . the size of the cores depends on the desired size of the pellet to be manufactured . in general , pellets can be as small as 0 . 1 mm , or as large as 2 mm . particular cores are from about 0 . 3 to about 0 . 8 mm , in order to provide finished pellets in the size range of from about 0 . 5 to about 1 . 5 mm in diameter . for instance , the cores can be of a reasonably narrow particle size distribution , in order to improve the uniformity of the various coatings to be added and the homogeneity of the final product . for example , the cores can be specified as being of particle size ranges such as from 18 to 20 u . s . mesh , from 20 to 25 u . s . mesh , from 25 to 30 u . s . mesh , or from 30 to 35 u . s . mesh to obtain acceptable size distributions of various absolute sizes . the amount of cores to be used can vary according to the weights and thicknesses of the added layers . in general , the cores comprise from about 10 to about 70 percent of the product . more particularly , the charge of cores represents from about 15 to about 45 percent of the product . when manufacture of the pellet begins with inert cores , the active ingredient can be coated on the cores to yield a final drug concentration of about 10 to about 25 percent of the product , in general . the amount of active ingredient depends on the desired dose of the drug and the quantity of pellets to be administered . the dose of active ingredient is in the range of about 50 - 500 mg , more particularly about 60 - 200 mg , and the usual amount of pellets is that amount which is conveniently held in gelatin capsules . the volume of gelatin capsules can range of from about 15 % to about 25 % of active in the present product . a convenient manner of coating the cores with active ingredient is the “ powder coating ” process where the cores are moistened with a sticky liquid or binder , active ingredient is added as a powder , and the mixture is dried . such a process is regularly carried out in the practice of industrial pharmacy , and suitable equipment is known in the art . such equipment can be used in several steps of the present process . this process can be conducted in conventional coating pans similar to those employed in sugar coating processes . this process can be used to prepare pellets . alternately , the present product can be made in fluidized bed equipment ( using a rotary processor ), or in rotating plate equipment such as the freund cf - granulator ( vector corporation , marion , iowa ). the rotating plate equipment typically consists of a cylinder , the bottom of which is a rotatable plate . motion of the mass of particles to be coated is provided by friction of the mass between the stationary wall of the cylinder and the rotating bottom . warm air can be applied to dry the mass , and liquids can be sprayed on the mass and balanced against the drying rate as in the fluidized bed case . in some embodiments , a powder coating is applied . in such embodiments , the mass of pellets can be maintained in a sticky state , and the powder to be adhered to them , active ingredient in this case , can be added continuously or periodically and adhered to the sticky pellets . when all of such active has been applied , the spray can be stopped and the mass allowed to dry in the air stream . it can be appropriate or convenient to add some inert powders to the active ingredient . additional solids can be added to the layer with active ingredient . these solids can be added to facilitate the coating process as needed to aid flow , reduce static charge , aid bulk buildup and form a smooth surface . inert substances such as talc , kaolin , and titanium dioxide , lubricants such as magnesium stearate , finely divided silicon dioxide , crospovidone , and non - reducing sugars , e . g ., sucrose , can be used . the amounts of such substances are in the range from about a few tenths of 1 % of the product up to about 20 % of the product . such solids are typically of fine particle size , e . g ., less than 50 micrometers , to produce a smooth surface . the active ingredient can be made to adhere to the cores by spraying a pharmaceutical excipient which is sticky and adherent when it is wet , and dries to a strong , coherent film . those skilled in the art are aware of and conventionally use many such substances , most of them polymers . particular such polymers include hydroxypropylmethylcellulose , hydroxypropylcellulose and polyvinylpyrrolidone . additional such substances include methylcellulose , carboxymethylcellulose , acacia and gelatin , for example . the amount of the adhering excipient can be in the range from about 4 % to about 12 % of the product , and depends in large part on the amount of active to be adhered to the core . the active ingredient can also be built up on the cores by spraying a slurry comprising active suspended in a solution of the excipients of the active layer , dissolved or suspended in sufficient water to make the slurry sprayable . such a slurry can be milled through a machine adapted for grinding suspension in order to reduce the particle size of active . grinding in suspension form can be desirable because it avoids dust generation and containment problems which arise in grinding dry powder drugs . a particular method for applying this suspension is the pharmaceutical fluidized bed coating device , such as the wurster column , which consists of a vertical cylinder with an air - permeable bottom and an upward spraying nozzle close above the bottom , or a downward - spraying nozzle mounted above the product mass . the cylinder is charged with particles to be coated , a sufficient volume of air is drawn through the bottom of the cylinder to suspend the mass of particles , and the liquid to be applied is sprayed onto the mass . the temperature of the fluidizing air is balanced against the spray rate to maintain the mass of pellets or tablets at the desired level of moisture and stickiness while the coating is built up . on the other hand , the core can comprise a monolithic particle in which the active ingredient is incorporated . such cores can be prepared by the granulation techniques which are wide spread in pharmaceutical science , particularly in the preparation of granular material for compressed tablets . the cores can be prepared by mixing the active into a mass of pharmaceutical excipients , moistening the mass with water or a solvent , drying , and breaking the mass into sized particles in the same size range as described above for the inert cores . this can be accomplished via the process of extrusion and marumerization . the core for the pellet can also be prepared by mixing active with conventional pharmaceutical ingredients to obtain the desired concentration and forming the mixture into cores of the desired size by conventional procedures , including but not limited to the process of r . e . sparks et al ., u . s . pat . nos . 5 , 019 , 302 and 5 , 100 , 592 , incorporated by reference herein . a particular protected core of the enteric pharmaceutical product comprises 3 - fluoro - 7 -( 2 , 2 , 2 - trifluoroethoxy ) phenoxathiin 10 , 10 - dioxide ( also referred to herein as cx157 ) of the following formula : as an active ingredient . another particular protected core of the enteric pharmaceutical product comprises 3 -( 2 , 2 , 2 - trifluoroethoxy ) phenoxathiin 10 , 10 - dioxide ( also referred to herein as cx009 ) of the following formula : as an active ingredient . another particular protected core of the enteric pharmaceutical product comprises 3 -( 2 , 2 , 2 - trifluoro - 1 - methylethoxy ) phenoxathiin 10 , 10 - dioxide ( hereinafter “ cx2614 ”) of the following formula : as an active ingredient . methods for preparation of the above phenoxathiin - based mao - a inhibitors and other phenoxathiin - based mao - a inhibitors are known in the art , as exemplified in u . s . pat . no . 6 , 110 , 961 , which is incorporated by reference herein in its entirety . also provided herein are oral compositions such as tablets or capsules containing said active ingredient which have a low excipient load such that once or twice a day dosing is possible , preferably with one or two such compositions being administered at each dosing . the enteric product provided herein can utilize any physical form of the active ingredient . when the active pharmaceutical ingredient is cx157 , the active ingredient can be in the “ high melt ” crystalline form . the “ high melt ” crystalline form for cx157 is taught in u . s . application ser . no . 11 / 773 , 892 , which is incorporated by reference herein in its entirety , where “ form a ” of the aforementioned application is the form referred to herein as “ high melt .” briefly , the high melt form can be characterized as having a melting point at about 169 - 176 ° c . ; about 170 - 174 ° c ., about 171 - 173 ° c ., about 171 - 172 ° c ., or about 171 ° c . the high melt form is distinguishable from at least one other form of 3 - fluoro - 7 -( 2 , 2 , 2 - trifluoroethoxy ) phenoxathiin - 10 , 10 - dioxide , which melts at about 158 - 163 ° c ., typically about 160 - 162 ° c . the high melt form also can be characterized as containing less than about 1 % h 2 o , about 1 %- 0 . 001 % h 2 o , about 0 . 5 %- 0 . 01 % h 2 o , about 0 . 05 %- 0 . 01 % h 2 o , or about 0 . 02 % h 2 o , as determined by the karl fischer method . in addition , the high melt form can be characterized as having an attenuated total reflectance fourier transform infrared spectrum at 1480 - 1440 cm − 1 substantially identical to fig2 ( a ) of the aforementioned application , having an attenuated total reflectance fourier transform infrared spectrum at 970 - 800 cm − 1 substantially identical to fig2 ( a ) of the aforementioned application , or having an attenuated total reflectance fourier transform infrared spectrum substantially identical to fig2 ( a ) of the aforementioned application . the attenuated total reflectance fourier transform infrared spectrum of the high melt form is distinguishable from the attenuated total reflectance fourier transform infrared spectrum at 970 - 800 cm − 1 and 1480 - 1440 cm − 1 of another form of cx157 , which is substantially identical to fig2 ( b ) of the aforementioned application . the high melt form can further be characterized as dissolving at about 75 - 85 ° c ., about 75 - 80 ° c ., about 75 - 78 ° c ., or about 75 - 77 ° c . in a solvent that is 10 % ( v / v ) water in acetic acid when the ratio ( w / v ) of compound to solvent is about 1 . 6 g : 10 ml . the high melt form can be characterized as having a major x - ray powder diffraction peak at about d spacings 4 . 0 , 4 . 4 and / or 8 . 0 . the high melt form can be characterized as substantially lacking an x - ray powder diffraction peak at about d spacings 10 . 3 , 7 . 3 , and / or 3 . 65 . the high melt form can be characterized as having a major x - ray powder diffraction peak at about 2θ = 11 . 0 °, 20 . 1 °, and / or 22 . 2 °, using cuk α radiation . the high melt form also can be characterized as substantially lacking an x - ray powder diffraction peak at 2θ = 8 . 5 °, 12 . 0 °, and / or 24 . 6 °, using cuk α radiation . the high melt form also can be characterized as having an x - ray powder diffraction pattern substantially identical to fig1 ( a ) of the aforementioned application . the x - ray powder diffraction pattern of the high melt form is distinguishable from the x - ray powder diffraction properties of another form of cx157 , which has major peaks at about d spacings 10 . 3 , 7 . 3 , and / or 3 . 65 , and about 2θ = 11 . 0 °, 20 . 1 °, and / or 22 . 2 °, using cuk α radiation , and has an x - ray powder diffraction pattern substantially identical to fig1 ( b ) of the aforementioned application . the separating layer between the active - containing core and the enteric layer is not required , but is a particular feature of the formulation . the functions of the separating layer , if desired , are to provide a smooth base for the application of the enteric layer , to prolong the resistance of the pellet to acid conditions , and / or to improve stability by inhibiting any interaction between the drug and the enteric polymer in the enteric layer . the smoothing function of the separating layer is purely mechanical , the objective of which is to improve the coverage of the enteric layer and to avoid thin spots in it , caused by bumps and irregularities on the core . accordingly , the more smooth and free of irregularities the core can be made , the less material is needed in the separating layer , and the need for the smoothing characteristic of the separating layer can be avoided entirely when the active is of extremely fine particle size and the core is made as close as possible to truly spherical . when a pharmaceutically acceptable non - reducing sugar is added to the separating layer , the pellet &# 39 ; s resistance to acid conditions can be markedly increased . accordingly , such a sugar can be included in the separating layer applied to the cores , either as a powdered mixture , or dissolved as part of the sprayed - on liquid . a sugar - containing separating layer can reduce the quantity of enteric polymer required to obtain a given level of acid resistance . use of less enteric polymer can reduce both the materials cost and processing time , and also can reduce the amount of polymer available to react with active . the inhibition of any core / enteric layer interaction is mechanical . the separating layer physically keeps the components in the core and enteric layers from coming into direct contact with each other . in some cases , the separating layer can also act as a diffusional barrier to migrating core or enteric layer components dissolved in product moisture . the separating layer can also be used as a light barrier by opacifying it with agents such as titanium dioxide , iron oxides and the like . in general , the separating layer can include coherent or polymeric materials , and finely powdered solid excipients which constitute fillers . when a sugar is used in the separating layer , it is applied in the form of an aqueous solution and constitutes part of or the whole of the coherent material which sticks the separating layer together . in addition to or instead of the sugar , a polymeric material can also be used in the separating layer . for example , substances such as hydroxypropylmethylcellulose , polyvinylpyrrolidone , hydroxypropylcellulose and the like can be used in small amounts to increase the adherence and coherence of the separating layer . a filler excipient also can be used in the separating layer to increase the smoothness and solidity of the layer . substances such as finely powered talc , silicon dioxide and the like are universally accepted as pharmaceutical excipients and can be added as is convenient in the circumstances to fill and smooth the separating layer . in general , the amount of sugar in the separating layer can be in the range of from about 2 % to about 10 % of the product , when a sugar is used at all , and the amount of polymeric or other sticky material can be in the range of from about 0 . 1 to about 5 %. the amount of filler , such as talc , can be in the range of from about 5 to about 15 %, based on final product weight . the separating layer can be applied by spraying aqueous solutions of the sugar or polymeric material , and dusting in the filler as has been described in the preparation of an active layer . the smoothness and homogeneity of the separating layer can be improved , however , if the filler is thoroughly dispersed as a suspension in the solution of sugar and or polymeric material , and the suspension is sprayed on the core and dried , using equipment as described above in the preparation of cores with active layers . the enteric layer is comprised of an enteric polymer , which can be chosen for compatibility with the active ingredient . the polymer can be one having only a small number of carboxylic acid groups per unit weight or repeating unit of the polymer . a particular enteric polymer is hydroxypropylmethylcellulose acetate succinate ( hpmcas ), which product is defined as containing not less than 4 % and not more than 28 % of succinoyl groups , which are the only free carboxylic groups in the compound . see japanese standards of pharmaceutical ingredients 1991 , page 1216 - 21 , standard no . 19026 . hpmcas is available from shin - etsu chemical co ., ltd ., tokyo , japan , under the trademark aqoat . it is available in two particle size grades and three molecular weight ranges . for example , the l grade , having number average molecular weight of 93 , 000 can be used . enteric polymers can be applied as coatings from aqueous suspensions , from solutions in aqueous or organic solvents , or as a powder . one skilled in the art will be able to select from known solvents and / or methods as desired . the enteric polymer can also be applied according to a method described by shin - etsu chemical co . ltd . ( obara , et al ., poster pt6115 , aaps annual meeting , seattle , wash ., oct . 27 - 31 , 1996 ). in this method , when the enteric polymer is applied as a powder the enteric polymer is added directly in the solid state to the tablets or pellets while plasticizer is sprayed onto the tablets or pellets simultaneously . the deposit of solid enteric particles is then turned into a film by curing . the curing is done by spraying the coated tablets or pellets with a small amount of water and then heating the tablets or pellets for a short time . this method of enteric coating application can be performed employing the same type of equipment as described above in the preparation of cores with active ingredient layers . when the enteric polymer is applied as an aqueous suspension , a problem in obtaining a uniform , coherent film often results . in instances in which this problem may arise , a fine particle grade can be used or the particles of polymer can be ground to an extremely small size before application . it is possible either to grind the dry polymer , as in an air - impaction mill or to prepare the suspension and grind the polymer in slurry form . slurry grinding is generally preferable , particularly since it can be used also to grind the filler portion of the enteric layer in the same step . in some embodiments , it is advisable to reduce the average particle size of the enteric polymer to the range from about 1 micrometer to about 5 micrometers , particularly no larger than 3 micrometers . when the enteric polymer is applied in the form of a suspension , the suspension is typically maintained homogeneous . such precautions include maintaining the suspension in a gently stirred condition , but not stirring so vigorously as to create foam , and assuring that the suspension does not stand still in eddies in nozzle bodies , for example , or in over - large delivery tubing . frequently , polymers in suspension form will agglomerate if the suspension becomes too warm , and the critical temperature can be as low as 30 ° c . in individual cases . since spray nozzles and tubing are exposed to hot air in the usual fluid bed type equipment , care must be taken to assure that the suspension is kept moving briskly through the equipment to cool the tubing and nozzle . when hpmcas is used , in particular , it is advisable to cool the suspension below 20 ° c . before application , to cool the tubing and nozzle by pumping a little cold water through them before beginning to pump the suspension , and to use supply tubing with as small a diameter as the spray rate will allow so that the suspension can be kept moving rapidly in the tubing . in one embodiment , one can apply the enteric polymer as an aqueous solution whenever it is possible to do so . in the case of hpmcas , dissolution of the polymer can be obtained by neutralizing the polymer , particularly with ammonia . neutralization of the polymer can be obtained merely by adding ammonia , preferably in the form of aqueous ammonium hydroxide to a suspension of the polymer in water ; complete neutralization results in complete dissolution of the polymer at about ph 5 . 7 - 5 . 9 . good results are also obtained when the polymer is partially neutralized by adding less than the equivalent amount of ammonia . in such case , the polymer which has not been neutralized remains in suspended form , suspended in a solution of neutralized polymer . the particle size of the polymer can be controlled when such a process is to be used . use of neutralized polymer more readily provides a smooth , coherent enteric layer than when a suspended polymer is used , and use of partially neutralized polymer provides intermediate degrees of smoothness and coherency . particularly when the enteric layer is applied over a very smooth separating layer , excellent results can be obtained from partially neutralized enteric polymer . the extent of neutralization can be varied over a range without adversely affecting results or ease of operation . for example , the extent of neutralization can range from about 25 % to about 100 % neutralization . another particular condition is from about 45 % to about 100 % neutralization , and another condition is from about 65 % to about 100 %. still another particular manner of neutralization is from about 25 % to about 65 % neutralized . it may be found , however , that the enteric polymer in the resulting product , after drying , is neutralized to a lesser extent than when applied . when neutralized or partially neutralized hpmcas is applied , the hpmcas in the final product can be from about 0 % to about 25 % neutralized , more particularly from about 0 % to about 15 % neutralized . a plasticizer can be used with enteric polymers for improved results . in the case of hpmcas , a particular plasticizer can be triethyl citrate , used in an amount up to about 15 %- 30 % of the amount of enteric polymer in aqueous suspension application . when a neutralized hpmcas is employed , either lower levels or no plasticizer can be required . minor ingredients , such as antifoam , suspending agents when the polymer is in suspended form , and surfactants to assist in smoothing the film , are also commonly used . for example , silicone anti - foams , surfactants such as polysorbate 80 , sodium lauryl sulfate and the like and suspending agents such as carboxymethylcellulose , vegetable gums and the like , can commonly be used at amounts in the general range up to 1 % of the product . usually , an enteric layer is filled with a powdered excipient such as talc , glyceryl monostearate or hydrated silicon dioxide to build up the thickness of the layer , to strengthen it , to reduce static charge , and to reduce particle cohesion . amounts of such solids in the range of from about 1 % to about 10 % of the final product can be added to the enteric polymer mixture , while the amount of enteric polymer itself can be in the range from about 5 % to about 25 %, more particularly , from about 10 % to about 20 %. application of the enteric layer to the pellets follows the same general procedure previously discussed , using fluid bed type equipment with simultaneous spraying of enteric polymer solution or suspension and warm air drying . temperature of the drying air and the temperature of the circulating mass of pellets are typically kept in the ranges advised by the manufacturer of the enteric polymer . a finishing layer over the enteric layer is not necessary in every case , but can improve the elegance of the product and its handling , storage and machinability and can provide further benefits as well . the simplest finishing layer is simply a small amount , about less than 1 % of an anti - static ingredient such as talc or silicon dioxide , simply dusted on the surface of the pellets . another simple finishing layer is a small amount , about 1 %, of a wax such as beeswax melted onto the circulating mass of pellets to further smooth the pellets , reduce static charge , prevent any tendency for pellets to stick together , and increase the hydrophobicity of the surface . more complex finishing layers can constitute a final sprayed - on layer of ingredients . for example , a thin layer of polymeric material such as hydroxypropylmethylcellulose , polyvinylpyrrolidone and the like , in an amount such as from about 2 % up to about 10 %, can be applied . the polymeric material can also carry a suspension of an opacifier , a bulking agent such as talc , or a coloring material , particularly an opaque finely divided color agent such as red or yellow iron oxide . such a layer quickly dissolves away in the stomach , leaving the enteric layer to protect the active ingredient , but provides an added measure of pharmaceutical elegance and protection from mechanical damage to the product . finishing layers to be applied to the present product are of essentially the same types commonly used in pharmaceutical science to smooth , seal and color enteric products , and can be formulated and applied in the usual manners . the following examples set out the preparation of a number of different enteric granules consistent with , and that exemplifies the teachings provided herein . the examples are intended further to enlighten the reader about the present enteric presentations and their methods of manufacture ; additional variations within the concept of the invention will be clear to one skilled in the art and their preparation will be within the scientist &# 39 ; s competence . the active layer is built up by suspending 3 - fluoro - 7 -( 2 , 2 , 2 - trifluoroethoxy ) phenoxathiin 10 , 10 - dioxide 25 % w / w in a binder solution consisting of 6 . 4 % w / w sucrose and 3 . 2 % w / w hydroxypropylmethylcellulose ( hpmc ). the resulting suspension is then passed through a coball mill ( fryma mashinen ag , rheinfelden , switzerland ) model ms - 12 to reduce the particle size of the bulk drug . the milled suspension is applied to 1 . 5 kg of sucrose starch non - pareils in a fluid bed dryer fitted with a wurster column . upon completing the application of the desired quantity of active ingredient suspension , the core pellets are completely dried in the fluid bed dryer . the separating layer which contains talc 12 % w / w , sucrose 6 . 75 % w / w and hydroxypropylmethylcellulose 2 . 25 % w / w is then applied as an aqueous suspension to the active core pellets . upon completing the application of the desired quantity of suspension , the pellets are completely dried in the fluid bed dryer . the enteric coating aqueous suspension contains hydroxypropylmethylcellulose acetate succinate type lf 6 % w / w , talc 1 . 8 % w / w , triethyl citrate 1 . 2 % w / w which is fully neutralized by the addition of 0 . 47 % w / w ammonium hydroxide . this enteric coating suspension is applied to the separation layer coated pellets . upon completing the application of the desired quantity of enteric coating suspension , the pellets are completely dried in the fluid bed dryer and a small quantity of talc is added to reduce static charge . a finishing layer is then applied which contains color mixture white ( comprised of titanium dioxide and hydroxypropylmethylcellulose ) 8 % w / w and hydroxypropylmethylcellulose 2 % w / w . upon completing the application of the desired quantity of color coating suspension , the pellets are completely dried in the fluid bed dryer and a small quantity of talc is added to reduce static charge . the resulting pellets are assayed for active content and filled into capsules to provide 60 mg of 3 - fluoro - 7 -( 2 , 2 , 2 - trifluoroethoxy ) phenoxathiin 10 , 10 - dioxide . the cx157 layer is added in a cf granulator , at a batch size of 5 . 5 kg . all of the ingredients of the cx157 layer except the cx157 , the lactose and the talc are dissolved or suspended in water , and the liquid is slowly sprayed onto the circulating beads and used to adhere the cx157 , lactose and talc in building up the cx157 layer . similarly , the separating layer is built up in the cf granulator by dissolving the hydroxypropylcellulose in water , and using the solution to adhere the talc on top of the cx157 layer . the enteric layer is built up in a fluidized bed granulator provided with a top - spray system at a batch size of 1 . 3 kg . the sesquioleate is dissolved along with the triethyl citrate in water , and the micronized hpmcas - lf is carefully dispersed and suspended in the cooled solution for spraying into the fluidized bed , maintaining the temperature of the liquid below 15 ° c . the temperature of the fluidizing air is 70 °- 80 ° c . when the hpmcas - lf suspension and the talc had been completely added , the batch is dried , and the finishing layer is added in the fluidized bed granulator as well . all of the ingredients of the finishing layer are dissolved or suspended in water , and the suspension is sprayed into the batch , maintaining the fluidized air at 70 °- 80 ° c . the product is made in a cf granulator . the powder layer is applied after the product is dried , in a simple rotating pan without air flow . each dose of completed granules is filled in # 3 gelatin capsules . the product is made in substantially the same manner as example 3 above . the product is made in a cf granulator at a batch size of 1 . 0 kg . the cx157 layer is built up by spraying into the granulator with inlet air temperature of 80 ° c . a suspension of the cx157 in a 120 mg / gm aqueous solution of hydroxypropyl - methylcellulose . the suspension is applied to the slowly , keeping the inlet temperature of the fluidizing air at about 80 ° c . when the cx157 suspension addition is complete , the granules are allowed to air dry . then the separating layer is built up by spraying into the granulator an aqueous solution of the hydroxypropylmethylcellulose . the enteric polymer is neutralized with ammonium hydroxide to dissolve it in water . a sufficient amount of water is used to prepare a 5 % w / w solution , and sufficient ammonium hydroxide ( 28 % ammonia solution ) is added to achieve a ph of about 6 . 9 . after the polymer had been neutralized , the triethyl citrate and talc are added to the solution , and gently stirred to suspend the talc . then the suspension is applied to the subcoated granules in the granulator , using an inlet air temperature of about 70 ° c . after completing the enteric coating application , the pellets are placed onto a paper - lined tray and dried in the dry house at 110 ° f . for 3 hours . the pellets are then filled into size # 3 gelatin capsules . the product is made in the same manner used in example 5 , except that the cx157 suspension is passed through a tri - homo disperser — homogenizer ( tri - homo corporation , salem , mass ., u . s . a .) mill . in order to alleviate static charge and to improve flow , a small amount of talc is added to the pellets prior to capsule filling . the cx157 layer is built up by suspending cx157 in a 4 % w / w solution of the hydroxypropylmethylcellulose in water , and milling the suspension with a coball mill ( fryma mashinen ag , rheinfelden , switzerland ) model ms - 12 . a fluid bed dryer with a wurster column is used to make this product at a batch size of 1 . 0 kg . the separating layer is added from a 4 % w / w solution of the hydroxypropylmethylcellulose in water . in order to prepare the enteric coating suspension , purified water is cooled to 10 ° c . and the polysorbate , triethyl citrate and silicone emulsion are added and dispersed or dissolved . then the hpmcas and talc are added and agitated until homogeneity is obtained . to this suspension , a carboxymethylcellulose aqueous solution , 0 . 5 % w / w , is added and blended thoroughly . the enteric suspension is maintained at 20 ° c . during the coating process . the enteric suspension is then added to the partially completed pellets in the wurster column at a spray rate of about 15 ml / min , holding the temperature of the inlet air at about 50 ° c . the product is dried in the wurster at 50 ° c . when the enteric suspension had been fully added , and then dried on trays for 3 hours in a dry house at 60 ° c . a finishing layer is then applied which consisted of a 4 . 5 % w / w / hydroxypropylmethylcellulose solution containing titanium dioxide and propylene glycol as plasticizer . the pellets are completely dried in the fluid bed dryer and then are then filled in size 3 gelatin capsules . the product is made in essentially the same manner as that of example 7 above , with the exception that approximately 25 % of the enteric polymer had been neutralized with ammonium hydroxide prior to addition to the remaining components of the enteric coating suspension . the product is made essentially as is the product of example 7 except that in this instance the hpmcas - lf is fully neutralized to a ph of 5 . 7 and complete solubility in water . the product is made substantially according to the process used in example 7 . in this instance , the sucrose is dissolved in the water used to form the separating layer , and the hpmcas - lf is fully neutralized . the product is made substantially according to the process used in example 10 . pellets made according to the above examples , and gelatin capsules filled with various batches of such pellets , are thoroughly tested in the manners usual in pharmaceutical science . results of stability tests show that the pellets and capsules have sufficient storage stability to be distributed , marketed and used in the conventional pharmaceutical manner . testing further shows that the pellets and capsules pass the conventional tests for enteric protection under conditions prevailing in the stomach . it has also been shown that the pellets release their load of cx157 acceptably quickly when exposed to conditions prevailing in the small intestine . accordingly , the present invention is demonstrated to solve the problems which previously are encountered in the formulation of other cx157 pellets . all excipients except for eudragit l - 30 d - 55 ( methacrylic acid - ethyl acrylate copolymer ( 1 : 1 ) dispersion 30 percent ) and triethyl citrate are mixed and granulated with water and compressed into tablets . triethyl citrate and water are homogenized , and eudragit is added to the homogenized mix to obtain a dispersion that contains about 54 % water . the tablets are sprayed with the dispersion in a glatt coater ( glatt muschinen & amp ; apparatebau ag , pratteln switzerland ) coating pan . the inlet air temperature is 55 ° c ., the outlet air temperature is between 40 - 44 ° c ., and the spraying rate is 20 rpm . the pan speed is set to 5 rpm . the tablet dissolution profile is analyzed using united states pharmacopeia method & lt ; 724 & gt ; for coated tablets . after 120 minutes in 0 . 1n hcl , the tablets are transferred to phosphate buffer solution . particles ( sugar spheres ) for capsule filling are made using the ingredients listed in the following table : peg 6000 is mixed with water to form a solution . cx - 157 is then added and the solution is mixed . hydroxypropylmethylcellulose is added to water , and the two solutions are combined and mixed . suglets are placed in a wurster fluid bed drier and the combined solution is sprayed on to the suglets . the inlet temperature is 55 ° c ., and the outlet temperature is between 29 ° c . and 47 ° c . the spray rate is between 8 and 16 gram / min . the airflow rate is between 50 - 120 m 3 / hour . the particles ( sugar spheres ) are then coated with an enteric coating , as described below : the percentage of coating is calculated as eudragit weight / cx - 157 coated particle weight . triethyl citrate and water are homogenized , and eudragit is added to attain a dispersion which contains 45 . 4 % water . the drug coated pellets are placed in the wurster fluid bed drier a second time . the dispersion is sprayed at a rate of between 8 and 16g / min . the inlet temperature is between 33 ° c . and 48 ° c ., and the outlet temperature is between 25 ° c . and 45 ° c . the airflow rate is between 40 and 120 m 3 / hour . after coating , the enteric coated pellets are dried for 90 minutes . six batches of enteric coated pellets are formed with different amounts of coating in each batch . the enteric coated particles are then filled into hdp # 1 capsules . the dissolution profile of the capsules batches in hcl 0 . 1 n , based on usp procedures , is taken . the dissolution profile of the capsules in phosphate buffer is measured . the dissolution profile would show that the enteric coating is effective in protecting the spheres from being dissolved in the stomach , thereby eliminating cheese effect in subjects who are treated with the capsules . capsules comprising spheres as in such capsules would be effective in treating depression because the spheres maintain integrity in stomach - like conditions , and are easily soluble in intestine - like conditions . the above examples also can be used to formulate tables and capsules in quantities of active ingredient ranging from , for example , 50 - 500 mg , including 100 - 200 mg . since modifications will be apparent to those of skill in this art , it is intended that this invention be limited only by the scope of the appended claims .

US-201013143408-A

a tray for quick and easy installation on an infant seat comprising a tray having an opening therein forming a substantially u - shaped back bar that seats under stop means on the back support of the infant seat , the tray including an upwardly extending enclosure along the forward end and sides .

referring to the drawings , one popular form of infant seat is shown at 10 . it includes a back support 12 and side portions 16 and 18 which help contain the child in the seat and generally function as arm rests . the infant seat is shaped to provide a pleasing appearance and includes a platform 15 adapted to be positioned on an automotive vehicle seat . straps are provided with this type of infant seat for holding it on the vehicle seat and for holding the infant in the infant seat . these straps are not pertinent to the present invention and are not shown in the drawings for the sake of simplicity . the tray device of the present invention is shown at 19 and includes a tray 20 which is formed of a substantial material such as wood for example . an opening 22 is formed in the tray 20 which results in a substantially u - shaped back rod 24 that conforms to the configuration of the seat 10 . the opening 22 extends forward into the tray 20 to provide room for the infant and is shaped to provide maximum tray surface in front and along the side of the infant . the opening is curved to avoid sharp edges . an edge enclosure 26 extends around the front and sides of the tray and is attached to the tray so that toys and objects can be placed on the tray without falling off . a stop means in the form of a block 28 is affixed to the back support 12 of the infant seat 10 by any suitable means such as an adhesive . the tray member 19 is positioned on the infant seat 10 as shown in broken lines in fig3 of the drawings . the opening 22 is placed over the back support 12 of the infant seat and is tilted backward so that the back bar 24 will pass below the stop block 28 . the forward end of the tray is then tipped down so that the tray engages the side portions 16 and 18 of the infant seat and the back bar 24 moves up to engage the bottom side of the stop block 28 for providing cantilevered support of said tray . the stop block 28 is located so that the tray will be in a substantially level position when it is attached . the tray member 19 is quickly and easily removed by reversing the procedure . no fasteners or pivot construction are required . a restraining strap 29 ( fig3 ) can be used to secure the forward portion of the tray to the seat and fix it in position . the strap 29 is secured to the platform 15 by any suitable means such as bolt 30 , and includes fastening means such as the snap fastener 32 and hook 34 for connecting the strap 29 to the tray member 19 . the tray fits comfortably close around the child and provides substantial space for holding toys or other objects for the child to play with . the edge enclosure keeps such objects from falling off the tray . the tray is substantially flat and has no heavy frame members or the like , making it easy to transport and store . another embodiment of the tray member is shown in fig6 of the drawing wherein the tray is formed of a one piece plastic construction . the configuration of the tray lends itself to plastic molding processes for rapid and relatively inexpensive production . the tray member of the present invention can be formed to fit different types of infant seat configurations available on the market by changing the shape of the opening .

US-28594381-A

a method of embryo transfer that improves fertility rates by eliminating transferred air during the procedure is provided . also provided is a method for hormonally enhancing the uterine wall of a patient either prior to or during the time of et . quantitative administration of transfer solutions is accomplished with a modified apparatus that provides for implantation of an embryo into the uterus of a patient . the apparatus comprises an outer sheath and an inner lumen arranged to be slidably disposed within the outer sheath . the inner lumen includes at least one visual marker situated on the exterior surface adjacent its distal end thereof .

the problems associated with large quantities of transferred air during et procedures are solved and a technical advance is achieved in an improved delivery catheter for use in an et procedure and method for loading the delivery catheter that involves replacing the air bubble with a liquid medium , e . g ., a separation oil , at the start of the procedure , to improve the rate of fertility . referring now in detail to the various figures of the drawings wherein like reference characters refer to like parts , there is shown at 6 in fig1 through 6 , an embodiment of the delivery catheter is illustrated as including an outer sheath 10 being in the form of a hollow tube and provided towards its proximal end with a hub 20 provided with a series of axially extending fins 24 to assist in manipulation . as best shown in fig5 , the distal end of the outer sheath 10 is provided at intervals of a predetermined distance , e . g ., one centimeter , with gradations 28 of any suitable measure , e . g ., microliters . the gradations are marked as a plurality of rings about the distal end , and which may be slightly indented into the outer surface thereof . alternatively , the gradations 28 may be of a distinctive color . as best seen in fig5 and 6 , the remote distal tip 32 of the outer sheath 10 is chamfered for minimal trauma . the outer sheath 10 is formed of any suitable material , and preferably a generally rigid plastic material such as teflon ®. the outer sheath 10 is adapted to accommodate therewithin an inner lumen 36 having an external diameter such as to be an easy sliding fit within the outer sheath 10 and an internal passageway 34 having a diameter of a size to readily accommodate an embryo . as best shown in fig1 and 5 , the inner lumen 36 is provided at its proximal end with a hub 40 , the hub 40 being provided about its external surface with a plurality of axially extending fins 44 to assist manipulation . the inner lumen 36 is provided with an inner bore 42 ( fig2 ) that is in open communication with the internal passageway 34 . the hubs 20 and 40 are adapted such that they interlock in their closed position as shown in fig1 and 5 . the hubs 20 and 40 are provided to enable a physician and / or an embryologist to hold the outer sheath 10 with one hand while using the other hand to slide the inner lumen 36 through the outer sheath 10 during an embryo transfer procedure . referring now to fig1 and 5 , the distal end of the inner lumen 36 is provided at intervals of a predetermined distance , e . g ., one centimeter , with gradations 38 of any suitable measure , e . g ., microliters . the gradations 38 are marked as a plurality of rings about the distal end , and may be slightly indented into the outer surface thereof . alternatively , the gradations 38 may be of a distinctive color to allow the operator to precisely aspirate an exact quantity of a fluid medium to achieve a consistent protocol . as best shown in fig2 - 5 , the remote distal tip 46 of the inner lumen 36 is provided with a smoothly radiused chamfer for minimal trauma to the uterine tissues . the inner lumen 36 in accordance with this embodiment of the invention is preferably soft and flexible and formed of a biologically acceptable synthetic polymer . referring now to fig1 - 4 , there is shown a standard syringe 52 having a barrel 56 and a plunger 60 disposed therein . referring now to fig1 , the syringe 52 is shown with the plunger 60 disposed fully within the length of the barrel 56 . the syringe 52 includes a distal end 61 which is sized to snugly fit within the inner bore 42 of the inner lumen 36 . referring now to fig2 - 4 , to load the inner lumen 36 for the embryo transfer procedure , the distal end 61 of the syringe 52 is inserted into the inner bore 42 of the inner lumen 36 with the plunger 60 disposed fully within the length of the barrel 56 of the syringe 52 . a predetermined amount of a first fluid medium , e . g ., from 6 to 9 microliters of a wash fluid 64 , is drawn into the internal passageway 34 of the inner lumen 36 and into the barrel 56 of the syringe 52 by withdrawing the plunger 60 along a portion of the length of the barrel 56 . next , an excess amount of the wash fluid 64 is ejected from the syringe 52 and internal passageway 34 by depressing the plunger 60 . by utilizing the gradations 38 marked on the distal end of the inner lumen 36 , an accurate volume of wash fluid 64 can be obtained within the internal passageway 34 . the et delivery catheter 6 is then held vertically to enable air to escape out the remote distal tip 46 of the inner lumen 36 . often , the sides of the et delivery catheter 6 are tapped by the forefingers to loosen any air bubbles from the internal sides of the barrel 56 . referring now to fig3 , a predetermined amount of a second fluid medium , e . g ., approximately 3 microliters of a separation oil 68 , may be drawn into the internal passageway 34 of the inner lumen 36 adjacent the first fluid medium , by slowly withdrawing the plunger 60 from the barrel 56 of the syringe 52 , as indicated by the arrow in fig3 . any suitable separation oil 68 may be utilized for the purpose of separating the wash fluid 64 from the culture medium containing one or more embryos 72 . one particular product which could be utilized as a separation oil in accordance with the present invention is an enhanced oil for tissue culture manufactured by conception technologies of san diego , calif . under catalog numbers otc - 100 ( 100 ml ) and otc - 500 ( 500 ml ). by utilizing the gradations 38 marked on the distal end of the inner lumen 36 , an accurate volume of the separation oil 68 within the internal passageway 34 can be achieved . likewise , unwanted air and any unneeded volume of separation oil 68 can be expelled through the remote distal tip 46 by depressing the plunger 60 of the syringe 52 and / or tapping with forefingers to loosen air bubbles . lastly , as best shown in fig4 , the gradations 38 located at the distal end of the inner lumen 36 enable an operator to draw a predetermined amount of a third fluid medium , e . g ., approximately 3 - 6 microliters of a fluid culture medium containing one or more embryos 72 , into the internal passageway 34 of the inner lumen 36 . as shown in fig4 , the third fluid medium in which the embryos 72 are located is shown as being situated adjacent the separation oil 68 . the fluid culture medium in which the embryos 72 are located includes a water - based portion and sometimes , an oil - based portion . when an oil - based portion is used , it is done so to prevent evaporation of the water - based portion and prevent dehydration of the embryos 72 . one product which is suitable for utilizing as the oil - based portion of the fluid culture medium is the enhanced oil for tissue culture manufactured by conception technologies of san diego , calif . under catalog numbers otc - 100 ( 100 ml ) and otc - 500 ( 500 ml ), as mentioned in connection with the separation oil described above . as best shown in fig4 , the three fluid media , e . g ., the wash fluid 64 , the separation oil 68 , and the plurality of embryos 72 disposed within a fluid culture medium are shown disposed within the internal passageway 34 of the inner lumen 36 . the separation oil 68 is utilized as a replacement to the volume of air which under existing techniques is utilized to separate the wash fluid 64 from the embryos 72 . by replacing the volume of air with the separation oil 68 , the drawbacks associated with the use of air in embryo transfer procedures is eliminated . for example , the use of a separation oil 68 will facilitate movement of the embryos 72 from the site of ejection to the optimal location for implantation within the uterus and will facilitate interaction between the embryo 72 and the receptive surface of the uterus . embryos 72 will flow more readily within a liquid environment than a gaseous ( air ) environment . in accordance with the present invention , ingredients may be added to the separation oil 68 and / or wash fluid 64 , including progesterone and / or estrogen to stimulate the luteal phase which determines the time of ovulation within the menstrual cycle and establishes the peak moment of receptivity within the uterus . by including such hormones within the separation oil 68 and wash fluid 64 for administration into the uterus , the concentrations of such hormones needed for luteal stimulation and support is substantially less than required when such hormones are administered by vaginal suppository , intramuscular or other systemic means . it should be understood that the hormones needed for stimulation of the luteal phase may be added to the separation oil 68 and / or the wash fluid 64 and delivered directly into the uterus during an et procedure utilizing the delivery catheter 6 described herein . alternatively , the hormones may be introduced directly into the uterus utilizing any other suitable delivery device and may be delivered into the uterus at any point in time , either prior to or during the et procedure . one embodiment of the present invention is a method to hormonally prepare the uterus prior to the introduction of a fertilized egg during embryonic implantation . embryonic implantation in humans is a complex process , part of which requires hormonal preparation of the uterus prior to the involvement of a fertilized egg . this preparation has been described in general terms as “ the window of implantation ” of the ovulation cycle whereby progesterone is secreted by the corpus luteum , situated on the developing ovary , and travels down the fallopian tube into the uterus in a slow but timely manner each month of a woman &# 39 ; s hormonal cycle . consequently , embryonic implantation is a synchronized process between hormonal preparation and implantation of a fertilized egg . generally about 15 % of the population experience difficulty in achieving pregnancy by the natural process involving hormonal preparation and implantation so many revert to an assisted or artificial means of achieving pregnancy such as in vitro fertilization . for in vitro fertilization to occur , the same uterine hormonal preparation during the window of implantation , as in a natural pregnancy , must be achieved in order for successful implantation of a deposited embryo and ultimate pregnancy . current approaches to methods involving uterine preparation include intramuscular injection ( im ) of micronized progesterone in oil and peri - vaginal delivery ( pv ) of an assortment of products that contain micronized progesterone such as : gels , effervescent tablets , creams , suppositories , etc . these forms of hormonal delivery enter the bloodstream and the progesterone molecules eventually reach the outside of the uterus ( myometrium ) and propagate toward the endometrial innermost layer of the uterus , where implantation occurs . unfortunately , these conventional “ extra - uterine ” systemic administrations of progesterone result in inconsistent bioavailability , especially with respect to timing and the window of implantation which affects proper and consistent embryonic implantation . evidence supported by endometrial biopsies demonstrate periods of time when progesterone concentrations are far below the levels known to facilitate implantation . conversely , some endometrial biopsies show excessively high progesterone concentration levels , far outside the norm , which act as a deterrent to implantation , much like an intrauterine device ( iud ) that emits daily high doses of progesterone to prohibit implantation and pregnancy . one embodiment of the present invention provides a means to control the bioavailability of progesterone within an acceptable concentration and time range in order to establish a progesterone dominant uterus ( over antagonist - estrogen ) and achieve implantation ( and ultimately pregnancy ) more often than the 27 % fertility plateau that is witnessed in ivf when one single embryo is transferred to the uterus , another embodiment of the invention provides a method of targeted intrauterine administration to precisely establish a progesterone dominant uterus within the window of implantation , resulting in a uterus primed and ready to receive a developing blastocyst for implantation . this targeted approach mitigates the anatomical and physiological aspects found in prior methods that restrict progesterone reaching the endometrium , while eliminating the excessive buildup that occurs which hinders implantation via conventional methods . accordingly , a hormonal preparation containing a formulation with at least one implantation promoter such as progesterone , estrogen or combinations thereof is delivered to the target site . the hormonal preparation is administered in the proper proportions and with the proper timing to optimize and ensure the probability of a successful pregnancy . the time period for administration of a hormonal preparation prior to depositing the embryo varies from the same day to 270 days post administration . the concentration range of the implantation promoter is between approximately 0 . 001 micrograms to 1000 milligrams . hormonal preparations may be in a nanoformulation and incorporate a micronized particle mix using micronization methods known in the art such as wet - milling of particles . excipients can be used which are known to alter the pharmacokinetics and dynamics of hormonal bioavailability . the optimum specific time period and hormone concentration range can be determined through routine experimentation wherein the most desirable bioavailability range for promoting the maximum effect of uterine factors necessary for implantation is determined . because of the direct delivery to the endometrial surface at precisely the right time , timing and concentration can be easily modified for optimum activity of the uterine factors . these factors include ; aquaporins ( aqps ), epithelial sodium channels ( enacs ), prostaglandins , activation of the sodium pump and hne - 1 protein for embryonic transport and immobilization , and other genomic factors on the uterine and blastocyst surfaces that require precise hormonal exposure to assure needed dialog between the uterus and blastocyst ( termed : maternal dialog ), for the continued decidualization process of implantation to occur . a still further embodiment of the present invention is where the administration of an implantation promoter to the uterine target site occurs simultaneously with the deposition of the embryo . administration and deposition occur simultaneously through the same delivery device . depositing the fertilized embryo at the implantation site can occur through any delivery means know in the art . these may include an embryo transfer catheter , syringe , or other ejection device . the fertilized embryo can also be deposited directly by manually placement of the embryo . however another embodiment of the present invention incorporates the use of a delivery means having a catheter with an outer sheath and an inner lumen slidably disposed within the outer sheath , as described elsewhere herein , the internal lumen has an internal passageway configured to hold an embryo and having a means for quantitative administration of a fluid medium . accordingly both the embryo and hormonal preparation can be delivered through the same device with the quantitative administration of a fluid medium containing a hormonal preparation having a formulation with at least one implantation promoter . this delivery means is ideally suited for the simultaneous delivery of a hormone preparation and the deposition of the fertilized embryo . also because of the quantitative delivery of the device , deposition of the fertilized embryo can occur with the precisely - timed delivery of a prior amount of implantation promoter to have the uterus hormonally prepared for implantation . referring now to fig5 and 7 , once the predetermined volumes of fluid media have been accurately drawn within the internal passageway 34 of the inner lumen 36 , delivery of the embryos 72 to the uterus 76 is possible . the distal ends of the outer sheath 10 and inner lumen 36 are brought together . the physician and / or embryologist directs the end of the et delivery catheter 6 transvaginally to the desired location within the uterus , either by conventional means or by improved ultrasound guided techniques . the gradations 28 provided at the distal end of the outer sheath 10 enable the physician and / or the embryologist to determine the distance the catheter 6 has been inserted into the uterus . the et delivery catheter 6 must be gently advanced through the cervical canal to overcome obstruction or tortuous route so that the delivery catheter 6 can pass into the uterus . the physician and / or embryologist then ejects the embryos 72 through the distal end of the inner lumen 36 by depressing the plunger 60 of the syringe 52 . in this manner , the entire contents are expelled out of the internal passageway 34 . in this manner , the wash fluid 64 washes the wall of the internal passageway 34 and carries out any adherent embryos 72 that may have attached themselves to the wall of the internal passageway 34 by way of surface tension . once the embryo transfer is completed , the physician extracts the distal tip of the et delivery catheter from the cervix . this method of et is superior to other methods because the delivered embryos are much more likely to flow within a liquid environment than a gaseous ( air ) environment . the details of the construction or composition of the various elements of the et delivery catheter 6 of the present invention not otherwise disclosed are not believed to be critical to the achievement of the advantages of the present invention , so long as the elements possess the strength or flexibility or softness needed for them to perform as disclosed . the details of such construction is believed to be well within the ability of one of ordinary skill in this area , in view of the present disclosure , and are within the spirit of the invention and the scope of the claims .

US-201514797411-A

a portable , towable livestock sprayer establishes a portal through which livestock move . a rigid , frame includes a removable tongue for connection to the draft vehicle . a pivoted , wheeled subframe hinged to the frame is switched between deployed or retracted orientations . the tongue fits to the subframe and functions as a leverage tool . with the sprayer properly positioned adjacent a livestock gate , a shroud assembly is deployed . photo - eyes determine the presence and direction of travel of animals being sprayed . a pump system controls solution . the shroud transforms between a stable , compact transportation orientation , and a deployed orientation conformed to the required dimensions . separate , extensible shroud wings are folded together during transportation , or separately deployed on opposite sides of the sprayer to block escape routes . each wing comprises an inner section adapted to be removably coupled to the frame , and an outer section slidably telescoped to the inner section enabling width adjustments .

turning now to the drawings , my new portable sprayer has been generally designated by the reference numeral 20 . it is adapted for automatic use with a variety of livestock , including horses , cattle , sheep and the like . sprayer 20 comprises a rigid frame 22 ( fig2 ) that is adapted to be disposed upon the ground 24 or other relatively flat supporting surface . rigid , upright portal 26 that is vertically supported upon frame 22 defines a passageway 27 through which livestock moves to be sprayed . the sprayer is towed by attachment to a removable tongue 29 normally projecting from the front of the frame 22 . the frame forms a towable carriage with subframe 32 that is pivotally coupled to the frame at the rear of the sprayer 20 . to tow the sprayer 20 , the pivotal subframe 32 at the rear of the sprayer 20 is deployed as seen in fig1 , with wheels 33 ( fig2 ) fully contacting and rolling upon ground 24 . when a desired spray location is reached , the subframe 32 is uncoupled and it pivots to the “ out of the way ,” retracted position seen in fig8 and 9 . when the sprayer 20 is properly positioned adjacent a livestock gate for spraying moving livestock , the shroud assembly 34 is unpacked and extended from the sides of the sprayer to block any escape pathways , insuring that the animals are all treated . however , the shroud assembly 34 is temporarily stored within the passageway area 27 and secured relative to the frame during transportation of the sprayer 20 between locations . when the sprayer reaches the desired operational destination , the shroud assembly 34 is then unconnected and deployed , as will hereinafter be described in detail . the battery - powered control circuitry to be described hereinafter is located within housing 36 atop portal 26 for activating the sprayer 20 . photo eyes 40 detect the presence of cattle or livestock . each photo eye unit contains a pair of photocell units aimed at a mirror on the opposite side of the portal . when an animal breaks the light return path , the presence of an animal is detected . however , as there are pair of units , the direction of animal travel is determined as well . the treatment solution to be sprayed ( i . e ., insecticide , pesticide or the like ) is stored within tank 38 over portal 26 . upon appropriate detection , solution is vigorously sprayed upon cattle traversing the passageway 27 , through nozzles 42 , as explained in detail hereinafter . solar collector panel 41 recharges the batteries ( not seen ) within housing 36 . with primary reference directed to fig1 – 2 , 4 and 8 – 10 , the welded , tube steel frame 22 ( fig2 , 9 ) is generally rectangular , comprising a front span 44 , a rear span 45 ( fig1 , 9 ), and a pair of spaced apart and parallel sides 47 extending between front and rear spans 44 , 45 . the smaller , steel subframe 32 is also rectangular . the subframe legs 49 extending from opposite sides of subframe end 52 are pivotally coupled to frame sides 47 via hinges 51 . when the subframe 32 is deployed for sprayer transportation and movement as in fig2 , it is parallel with the main frame 22 . to this effect there is a middle subframe leg 53 disposed between the outermost subframe legs 49 . legs 49 and 53 are parallel . the rear span 45 of the main frame 22 has a short stub 54 projecting from it . when the subframe 32 is oriented parallel with the frame 22 during sprayer movements ( i . e ., as in fig1 – 3 ), the middle subframe leg 53 assumes a position parallel to and adjacent with stub 54 , and is held by fasteners 56 ( i . e ., fig2 , 4 ) are inserted between and through the aligned stub 54 and subframe middle leg 53 to pin and thus lock the subframe 32 relative to the frame 22 . the towing tongue 29 is removable from the sprayer , and it has multiple functions . the conventional trailer socket 58 is secured on a conventional neck 59 ( fig2 ) that is connected to tongue shaft 60 ( fig2 , 8 ). a lower , angled terminal portion of the shaft 60 is slidably and releasably captivated within the angled anchor sleeve 62 ( i . e ., fig1 – 3 , 8 ) welded to front frame span 44 . when tongue 29 is coupled to sleeve 62 in this fashion and then pinned ( and the subframe 32 is similarly secured within frame 22 as aforesaid ), the entire sprayer may be conveniently towed about by a suitable tractor or “ all terrain vehicle ” ( i . e ., an “ atv ”) which is coupled to the tongue in the usual manner . given the weight and construction of the sprayer 20 as discussed , an atv like a honda model 400 four wheel drive unit is more than adequate . however , the tongue 29 has an important alternative function . after the sprayer 20 is towed to a suitable location , the tongue 29 can be removed from sleeve 62 ( i . e ., fig1 , 3 ) for use as a lever to manipulate the subframe , as seen in fig1 . it will be noted that the subframe 32 supports an alternative square socket 64 ( i . e ., fig1 ). when the tongue 29 is inverted and then inserted into subframe socket 64 , the subframe can be manipulated to deflect and align the previously described subframe leg 53 and stub 54 . this enables the fasteners 56 to be inserted or withdrawn . when the sprayer is transformed into the operational position of fig8 , 9 , the subframe 32 pivots upwardly about hinges 51 when the fasteners 56 are removed , and subframe is forced by gravity away from its former parallel orientation with respect to the flat and stationary frame 22 . when the subframe is to be moved back into the transportation position ( i . e ., from the position of fig8 to that of fig2 ), tongue 29 is positioned as in fig1 . the tongue engages socket 64 ( fig2 , 4 ) and shaft portion 60 functions as a lever for manually manipulating and facing the subframe 32 back into position with wheels 33 contacting the ground and elevating the sprayer . hand manipulation occurs just prior to reinstalling the wing - nut fasteners 56 to pin the subframe into the transportation position . the upright portal 26 surrounds the passageway 27 through which livestock to be treated pass . two parallel , vertically upright stanchions , 68 , 69 , respectively , are welded to frame spans 45 and 44 . a rigid upper strut 70 ( fig1 ) transversely extends between stanchions 68 and 69 , forming the top of portal 26 . strut 70 supports tank 38 , control housing 36 , and the solar collector panel 41 on its top , as well as the spray nozzle 42 which is mounted on its underside facing downwardly towards passageway 27 . other spray nozzles 42 are also secured to stanchions 68 and 69 , and they face inwardly towards the passageway 27 . livestock 67 ( fig1 ) detected within the passageway are treated with vigorous spray patterns 61 ( fig1 ) established by the cooperating nozzles 42 . to prevent dripping , leakage , or siphoning through the nozzles when the sprayer ( i . e ., the pump ) is turned “ off ”, each spray nozzle 42 includes an internal check valve nominally rated at twenty pounds . fluid can only be sprayed through the nozzles 42 in response to predetermined line pressure . a pair of spaced - apart photo eyes 40 is mounted within housing 39 on stanchion 68 ( fig1 , 14 ). the photo eyes 40 direct a beam of light across the portal and passageway 27 towards a companion pair of reflectors 43 ( fig2 , 15 ) mounted in a similar housing 39 b ( fig1 ) on stanchion 69 . preferably three - inch diameter , center - mounted allen bradley model 92 - 39 reflectors are used . by using a pair of photo eyes and a pair of companion reflectors , the direction of travel , rather than the mere presence of an animal , is ascertained . each allen bradley brand photo eye 40 comprises a light emitter and a companion sensor . light directed across the portal towards the reflectors 43 is normally reflected back and sensed , in the absence on an animal , whose presence breaks the return path of reflected light . depending upon which of the two sensors first detects “ breaking ” of the normal beam pattern , not only the presence of an animal is detected , but the direction of animal travel is determined as well . as explained hereinafter , the control system will not initiate a spray sequence unless the direction of travel is correct . the shroud assembly 34 comprises a pair of separate , extensible wings 72 ( i . e ., fig8 ). with primary reference directed now to fig7 – 9 and 11 , each wing 72 is identical . the purpose of the wings 72 is to shroud that portion of an animal path that is between the sprayer 20 and adjacent structure , such as posts 74 ( fig1 ). each wing 72 comprises an inner section 76 adapted to be coupled to one of the vertical stanchions 68 or 69 , and an outer , extensible section 77 that is slidably telescoped to section 76 . preferably , each inner wing section 76 comprises three spaced - apart and parallel rails 78 , 79 , 80 extending horizontally between vertical ends 81 , 82 ( i . e ., fig7 ). rails 78 and 80 terminate inwardly in l - hooks 84 , 85 respectively ( fig7 ) that project downwardly towards sleeves 88 , 89 . pairs of sleeves 88 , 89 are welded in spaced relation upon both stanchions 69 and 68 . outer wing sections 77 preferably comprise three spaced apart and parallel horizontal rails 83 welded to an end piece 87 . rails 83 are slidably , coaxially telescoped to rails 78 , 79 , 80 of the inner wing sections 76 . when inner and outer wing sections are telescoped together for transportation ( i . e ., as in fig1 ), abutting wings are held folded together in flat , abutting relation place by projecting clasps 90 ( i . e ., fig8 , 9 ). in the transportation mode of fig1 and 7 , the twin wings 72 are folded adjacent one another and positioned substantially as in fig7 , such that the hooks 84 , 85 mate within and are captivated by the sleeves 88 , 89 . when deployed outwardly for spraying operations , the wings 72 are oriented and manipulated as illustrated in fig8 , 9 , such that they project laterally away from the stanchions 68 , 68 , with l - hooks 84 , 85 appropriately aligned with and mated to sleeves 88 , 89 , and with the formerly telescoped sections pulled apart to shroud the areas adjacent the sprayer . the fluid control and flow circuit has been generally designated by the reference numeral 100 ( fig1 ). where practicable , reference numerals used previously to indicate hardware items are used again to designate the same parts in schematic form . reservoir tank 38 stores a volume of insecticide to be applied as aforesaid . to load tank 38 , solution may be suctioned from a user - supplied , external container 102 via a line 103 through manually operated first control valve means comprising valves 104 and 109 . valve 104 connects to the twelve - volt d . c . pump 105 via a conventional t - connection . electric pump 105 fills tank 38 through manual valve 106 that outputs via lines 108 , 110 into tank inlet 112 . at this time manual valves 109 and 111 remain closed . after filling tank 38 , manual valves 104 and 106 are closed , and the second control valve means ( i . e ., comprising valves 109 and 111 is opened . with valves 109 and 111 open , solution may be sprayed . fluid is drawn from tank 38 via strainer / check - valve 101 through line 107 and valve 109 into pump 105 , which outputs through opened valve 111 and lines 113 , 114 , 115 , 116 and 118 to spray nozzles 42 . a return bleed - off line 121 communicates with check - valve equipped . tank nozzle 123 to vent overpressure , recycling fluid to tank 38 . spraying occurs when the pump 105 is actuated by the controller to be described hereinafter , after tank 38 is filled , and valves 109 and 111 are opened . the controller circuitry implements the logic of fig1 through a programmable allen bradley model 1760 - l - 12dwd controller disposed within housing 36 . the software control program has been generally designated by the reference numeral 120 ( fig1 ). program initiation is manually switched “ on ” as indicated by step 122 , thereby energizing node 123 . a “ test mode ” switch is turned on in step 124 to bypass the sensing circuitry ; this is done when filling the tank 38 or testing it . if the test mode switch 124 is “ on ,” the pump 105 ( i . e . fig1 ) is energized per step 125 . in step 126 a first , conventional level - measuring float within solution tank 38 ( i . e ., fig1 ) is queried ; if the tank is empty , a warning light is flashed in step 128 , warning of an empty tank . if the tank is empty , the controller does not actuate the pump . a separate float within the tank can sense a “ low tank ” condition in step 129 , it is indicated by warning lights flashed in step 130 . when solution is “ low ,” the tank 38 should be filled as discussed above . step 122 also initiates an animal counting function if the test mode switch in step 124 is “ off .” photo eyes 40 are queried in step 134 to determine animal presence , and the right direction of travel . of the two sensor paths in the assemblies , the first signal must be derived from the appropriate sensor to determine if the travel direction is right . if the travel direction is right , the count is made in step 135 . the operator must input a manual decision by activating a “ count only ” switch in step 137 ; if “ true ” ( i . e ., animals are counted but not sprayed ), a return occurs on line 138 . if “ false ” ( i . e ., spraying should commence ), then step 139 implements a delay timer so that spray does not get in the face of the animals . delay completion is sensed at 140 ; if an appropriate selected time interval has elapsed , step 142 turns on the sprayer and starts a spray counter . step 142 thus energizes pump 105 after valves 109 , 111 ( fig1 ) are first manually opened . step 144 monitors the photo eye assemblies 40 to make sure an animal is still present ( i . e ., that the optical path across the portal is still blocked .) timing step 146 monitors the length of time that spray is applied . if the sprayer is on too long ( i . e ., pump 105 is running ) or if the animal being sprayed exits the portal , then a turn - off step 148 occurs . this causes a timer reset in step 150 , returned on line 151 , and the circuit 120 looks for a new animal , whereupon the process is repeated . from the foregoing , it will be seen that this invention is one well adapted to obtain all the ends and objects herein set forth , together with other advantages which are inherent to the structure . it will be understood that certain features and sub - combinations are of utility and may be employed without reference to other features and subcombinations . this is contemplated by and is within the scope of the claims . as many possible embodiments may be made of the invention without departing from the scope thereof , it is to be understood that all matter herein set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense .

US-70371803-A

embodiments described herein relate to a connecting member for maintaining the spacing between at least two anchor members screwed into vertebrae and methods for stabilizing the spine using a connecting member . one embodiment of a connecting member can include a first rigid portion formed of a first material , a second rigid portion formed of the first material and a connecting body comprising a second material that is more elastically deformable than the first material .

the various portions of a connecting member are described initially with reference to fig1 . the connecting member 10 has two cylindrical rigid parts 12 and 14 . each rigid part 12 , 14 has a fixing , first portion 16 , 18 and a fastening , second portion 20 , 22 forming an enlargement . the facing fastening portions 20 and 22 are connected together by a connecting body 24 so that the rigid parts 12 and 14 are in axial alignment . the connecting member 10 is therefore circularly symmetrical about the axis a . how the two rigid parts 12 and 14 are fastened together is described below with reference to fig2 . the connecting body 24 is a plastics material body obtained by polymerization . the material of the body is chosen from materials which are more elastically deformable than the material of said rigid parts 12 , 14 and , most importantly , whose elastic properties are of the same order of magnitude as those of the posterior ligaments that hold the spine together . organic silicon compounds constitute polymers whose mechanical properties can be determined by the choice of their basic components , in particular by their degree of substitution , the nature of the substituents , and their molecular weight , and whose elastic behavior predominates over its plastic behavior . they therefore constitute a family of materials suitable for interconnecting the two rigid parts 12 and 14 . also , these polymers can adhere strongly to materials of inorganic composition . thus the connecting body 24 provides good means for fastening together the rigid parts 12 , 14 , which are generally made of titanium alloy . nevertheless , the polymer materials that can be used are not limited to organic silicon compounds , and any other material having comparable properties could be suitable . the material of the connecting body 24 is adapted to adhere to the fastening walls 20 ′ and 22 ′ of said fastening second portions 20 , 22 . however , to increase the adhesion , openings 30 , 32 are formed in the fastening walls 20 , 22 of the fastening , second portions and are adapted to cooperate with asperities 26 , 28 on the connecting body 24 which are inserted into the openings 30 , 32 . this feature increases the contact area between the two materials and thereby increases the connecting force between them in a direction normal to said surface of contact and creates static friction forces which are additional to the adhesion force . a connection of the above kind is obtained either by injecting the polymer while hot between the two rigid parts 12 and 14 held facing each other in a mold , or by cold molding the mixture of monomers between the two rigid parts 12 and 14 , if the speed of the reaction is sufficiently low . the asperities 26 , 28 are therefore formed in situ , when the polymer liquid or paste inserted into the openings 26 , 28 solidifies after cooling or after a chemical reaction . obviously , the connecting body 24 consists of the polymer disposed between the rigid parts 12 and 14 , more specifically between the fastening walls 20 ′ and 22 ′, and , in order to retain the polymer between the facing portions while it is in the liquid state , the walls of the mold must necessarily surround the space between and in line with the two rigid parts 12 , 14 . in a particular embodiment ( not shown ) the openings 30 , 32 formed in the fastening walls 20 ′ and 22 ′ open onto the outside wall of the rigid parts 12 and 14 so that the liquid polymer penetrates entirely into the openings 30 , 32 without it being possible for air to be trapped therein . this reinforces the fastening of the connecting body 24 to the rigid parts 12 , 14 . also , the openings 30 , 32 , which are shown as parallel to the longitudinal axis of the connecting member in fig2 , can be oblique to that longitudinal axis and / or not rectilinear . these configurations increase the static friction forces of the polymer on the rigid parts , which fastens them together more strongly . now that the manner in which the two rigid parts are fastened together has been described , movement of the rigid parts relative to each other is described with reference to fig1 . given the circular symmetry of the rigid parts 12 and 14 and the connecting body 24 , and the nature of the material of the connecting body 24 , the connecting member 10 is able to bend in all directions in a plane pp perpendicular to the axis a of the connecting member when the two first portions are immobilized . bending of the connecting member 10 compresses one edge of the connecting body 24 and stretches the diametrally opposite edge , whereas the rigid parts 12 and 14 retain their shape . because the material of the connecting body 24 is elastically deformable , when the stresses causing the bending are removed , the connecting member 10 returns to its original state in which the rigid parts 12 and 14 are in axial alignment . also , the rigid parts 12 and 14 can move relative to each other in opposite directions along the longitudinal axis a to compress or stretch the connecting body 24 . the relative movement of the two rigid parts 12 and 14 can occur in directions other than the directions described above , but the connecting member is principally loaded in bending , tension and compression , as described in more detail below . deformation of the connecting member connected with relative movement of the anchor members 42 and 44 is described next with reference to fig3 . fig3 shows the connecting member 10 whose two rigid parts 12 and 14 interconnect the two anchor members 42 and 44 . the two anchor members 42 and 44 are parallel to each other in a common axial plane pa . each anchor member 42 , 44 has a threaded shank 46 with a u - shaped head 48 at the top whose inside wall is threaded so that a screw - forming member 50 can be screwed into it . thus the first portions 16 and 18 of the rigid parts 12 and 14 are accommodated in the heads 48 of the respective anchor members 42 and 44 and are locked to them by tightening the screw - forming members 50 . as a result , when the threaded shanks 46 of the anchor members move towards each other due to the effect of opposite forces t and − t in the plane pa and substantially parallel to the axis a the anchor members 42 and 44 deform the connecting member , which bends . the bending of the connecting member 10 compresses the lower edge 52 of the connecting body 24 and stretches the diametrally opposite upper edge 54 , while the rigid parts 12 and 14 retain their shape . because the material of the connecting body 24 is elastically deformable , when the stress is removed the connecting member reverts to its original rectilinear shape and the threaded shanks of the anchor members 46 return to their former relative position . the mechanism of elastic bending of the connecting member 10 and the anchor members 42 , 44 described above is the same if the threaded shanks 46 of the anchor members 42 and 44 move away from each other , the connecting member bending with the opposite curvature . also , the anchor members 42 and 44 are movable in translation relative to each other along the axis a , their relative movement stretching or compressing the connecting body 24 . the use of the connecting member 10 in a vertebral stabilization system for fastening together at least two vertebrae v 1 and v 2 is described below with reference to fig4 . the vertebrae v 1 , v 2 each have respective median planes pv 1 , pv 2 substantially perpendicular to the axis ar of the spine of which they form part , and respective posterior walls ppv 1 , ppv 2 defining a posterior median plane ppr of said spine . the stabilizing system includes at least two anchor members 42 and 44 respectively screwed into the posterior walls ppv 1 , ppv 2 of the vertebrae v 1 , v 2 , so that a line l that intersects the two anchor members 42 and 44 is substantially parallel to said axis ar of the spine . the two first portions 16 and 18 of the connecting member 10 interconnect the two anchor members 42 and 44 . as a result , the vertebrae v 1 and v 2 , which are interconnected in their posterior portions , possess relative mobility along the axis ar of the spine . thus when the spine is stretched , the vertebrae v 1 and v 2 move away from each other in opposite directions e and − e , which causes the threaded shanks 46 to move away from each other , deforming the connecting member 10 , and in particular its connecting body 24 . this is because the connecting body is compressed both longitudinally and at the upper edge 54 . the deformed connecting member has it concave side facing away from the spine . when the spine is bent , the inverse effect occurs and the vertebrae v 1 and v 2 move towards each other , which induces deformation of the connecting member with its concave side facing toward the spine . the connecting body is then subjected to longitudinal extension of its upper edge 54 and possibly to compression of its lower edge 52 . it will be understood that the connecting member 10 achieves greater relative mobility of the vertebrae compared to the prior art connecting rods , which cannot be compressed longitudinally . in a particular embodiment as shown in fig5 , the connecting member has three rigid rod - forming parts 12 , 14 , 15 and two connecting bodies 24 1 , 24 2 interconnecting the three rigid parts 12 , 14 , 15 . to this end , the central rigid part 15 includes a fixing , first portion and two fastening , second portions , with one fastening , second portion on each side of said fixing , first portion . the fastening , second portions are connected to the two connecting bodies 24 1 , 24 2 . the other two rigid parts 12 , 14 , situated at the two ends of the connecting member , have a single fastening , second portion connected to the connecting bodies . the connecting member therefore maintains the spacing between three anchor members that it interconnects , which are fixed to three substantially equidistant vertebrae , to align them . each rigid part of the connecting member is fixed to an anchor member so that there are respective elastically deformable connecting bodies between the pairs of vertebrae . in this way , a single connecting member stabilizes three vertebrae , which reduces the time needed to assemble the stabilizing system as a whole and consequently the operating time . also , because the three vertebrae are interconnected by a single connecting member , their mobility relative to each other is better controlled . it goes without saying that providing connecting members having more than three rigid parts connected together by elastically deformable connecting bodies would not depart from the scope of the invention .

US-60690109-A

the present invention relates to a hair iron having a buffer member , particularly to a hair iron having a buffer member , which is located in between two opposing heating plates to help hair passing through the heating plates to be straightened smoothly and prevent thermal deformation of hair . the invention is characterized by a hair iron comprising a first pressing member 10 and a second pressing member 20 to which heating plates 12 and 22 having built - in thermal wire heaters 13 and 23 are attached , respectively . a buffer member 40 is attached to the heating plate 22 which is attached to the second pressing member 20 .

hereunder the invention is described in more detail , referring to the attached drawings . referring to fig3 a and 3b , a hair iron according to the present invention includes a first pressing member 10 and a second pressing member 20 . referring to fig4 and 5 , the first and second pressing members 10 and 20 have heating plates 12 and 22 , to which heaters 13 and 23 are attached , respectively , and buffer members 40 and 40 ′ are attached to both sides of the heating plate 22 which is attached to the second pressing member 20 . in this invention , each of the heating plates 12 and 22 means a single member to transfer heating temperature from a heater to hair . the heater 23 and heating plate 22 can be assembled in a body or implemented by separate elements with a high heat conductance . furthermore , since the buffer members 40 and 40 ′ are disposed on the heating plate 22 , the only one temperature zone is created in between the first and second pressing members 10 and 20 . it should be noted that the buffer members 40 and 40 ′ are formed on the heating plate 22 so that they and hair to be thermal - treated are positioned at the same temperature zone . the buffer members 40 and 40 ′ are made of heat - resistant silicone . once the buffer members 40 and 40 ′ and the heating plates 12 and 22 are heated at the same temperature zone , hair is straightened by the hair iron at the same condition so that the hair straightening is smoother . the buffer members 40 and 40 ′ may be either attached on the surface of the heating plate 22 or inserted in a groove 22 a formed on the surface of the heating plate 22 . referring to fig4 , the buffer members 40 and 40 ′ may be attached on the surface of the heating plate 22 of the second pressing member 20 . in addition to heat - resistant silicone , the buffer members 40 and 40 ′ may be made of any other materials that are elastic and heat resistant . in case that the buffer members 40 and 40 ′ are the above - mentioned thermal expansion substance , the structure of them may be different from those of the heat resistance , which will be described below in detail . external cases 11 and 21 of semicircle housings cover the whole structure of the heating plates 12 and 22 , the heaters 13 and 23 , and supporting housings 11 ′ and 21 ′, respectively . since the first and second pressing members 10 and 20 are symmetrical in shape , the second pressing member 20 having the buffer members 40 and 40 ′ will be described in detail . in the case of the second pressing member 20 , the external case 21 is mechanically joined to the outside of the heating plate 22 . the supporting housing 21 ′ of a semicircle housing has protrusion parts 21 ″ at both ends thereof , grooves are formed at both ends of the second heating plate 22 . in more detail , expended parts 20 ′, which are vertically and downwardly expended from outside of the second heating plate 22 , are formed and the grooves are formed in parallel between the both ends of the heating plate 22 and the expended parts 20 ′. the protrusion parts 21 ″, which are expended from both ends of the supporting housing 21 ′, are then inserted into the grooves , being engaged with the expended parts 20 ′. in the present invention , it should be noted that there is a space between the heating plate 22 and the supporting housing 21 ′ to reduce the total weight of the hair iron . preferably , the supporting housing 21 ′ is mad of a heat - resistant material and a reflecting film can be coated on the supporting housing 21 ′. referring again to fig3 , the first and second pressing members 10 and 20 may open and shut by a hinge 5 . a spacing stick 60 is fixed to the first or second pressing member 10 or 20 . the spacing stick 60 has a horizontally expanded part 61 at the end to avoid breakaway from the second pressing member 20 . the second pressing member 20 has a spacing member 62 , which allows the spacing stick 60 to move up and down . the spacing between the first pressing member 10 and the second pressing member 20 can be adjusted by a pressure of the first and second pressing members 10 and 20 with fingers . at the bottom of the spacing member 62 is mounted a spring 63 . although the buffer members 40 and 40 ′ are attached on the heating plate 22 ( fig4 ), they are disposed in grooves ( fig5 ) of the heating plate 22 . heat - resistant silicone is inserted into the grooves as the buffer members 40 and 40 ′. particularly , referring fig5 , the members 40 and 40 ′ have horizontally expanded parts 40 a and 40 a ′ in order to prevent the members 40 and 40 ′ from breakaway from the grooves of the heating plate 22 . that is , the horizontally expanded parts 40 a and 40 a ′ are inserted into the grooves , and thus the buffer members 40 and 40 ′ are not separated from the heating plate 22 . like other conventional hair irons , the hair iron of the present invention has a temperature controller 70 , power supply wires , etc . as a means of controlling temperature . detailed description thereabout is omitted , because it is well known in the related art . on the surface of the heating plates 12 and 22 is formed a ceramic coating , teflon coating or anodizing coating . the heat - resistant silicone used in the invention can endure up to 100 - 230 ° c . hereunder is given a description of how to straighten or roll hair using the hair iron of the present invention . first , plug in the power supply to heat the heating plates 12 and 22 . while the heating plates 12 and 22 are heated , the temperature controller 70 maintains the temperature adequately . then , hair that is located in between the opposing first and second pressing members 10 and 20 is smoothly pulled by the hair iron while pressing the outside of the first and second pressing members with hand . at this point , hair is pressed in between the heating plate 12 and the buffer members 40 and 40 ′ and heat is transferred to the hair . because the buffer members 40 and 40 ′ are made of heat - resistant silicone which is elastic , the hair can be effectively pressed . consequently , hair can be straightened . hair located between the buffer members 40 and 40 ′, which are attached on or inserted into the heating plate 22 of the second pressing member 20 , and the heating plate 12 is pressed well and glides smoothly , because the heat - resistant silicone is soft and the whole hair within the hair iron is disposed at the same temperature . also , because the heat - resistant silicone is located between the metallic heating plates 12 and 22 , damage done to hair by heat can be reduced . the buffer member 40 may be replaced with a new one after prolonged use . the hair iron of the present invention has the buffer members 40 and 40 ′ which prevent hair from being directly pressed by the heating plates 12 and 22 . the buffer members 40 and 40 ′ also hold hair smoothly and hair damage can be prevented . referring to fig6 , a substance having an expansion coefficient can be used for the buffer members 40 and 40 ′. in this embodiment , the buffer members 40 and 40 ′ are also disposed within the grooves of the heating plate 22 ; however , it is not necessary to protrude prominently from the surface of the heating plate 22 at the normal state where electric power is not applied to the hair iron . once power is applied to the hair iron and the heating plates 12 and 22 are increased up to a predetermined temperature , the buffer members 40 and 40 ′ are expanded and then the top portions of the expanded buffer members 40 and 40 ′ are thermally protruded from the surface of the heating plate 22 . referring to fig7 , the buffer members 40 and 40 ′ in the heating plate 22 of fig6 have a reversed v - or u - shape approximately and a plurality of supporting bars 501 which are provided to maintain the reversed v - or u - shape . the members 40 and 40 ′ may be thermally protruded upward in a range of 0 . 1 to 1 . 5 mm . typically , the members 40 and 40 ′ may be protruded at a temperature of 180 to 230 ° c . the buffer members of the present invention prevent hair from being pulled off and makes hair straightening or rolling more pleasant when using a hair iron . while the present invention has been described in detail with reference to the preferred embodiments , those skilled in the art will appreciate that various modifications and substitutions can be made thereto without departing from the spirit and scope of the present invention as set forth in the appended claims .

US-64867709-A

we disclose haptotactic peptides having sequences homologous to specific portions of the carboxy terminal sequence of fibrinogen chains . the peptides derived from fibrinogen pre - cγ chain possess activities of cell attraction or cell attachment to a surface to which the peptide is covalently bound .

the present invention relates to novel peptides , which are homologous to haptotactic epitopes of fibrinogen , as well as to uses for these sequences in vivo as well as in vitro . for example , these peptide sequences have potential medical uses , including but not limited to therapeutic and diagnostic uses . the synthetic peptide sequences are homologous to regions of the fibrin ( ogen ) molecule , yet retain certain desired properties of the entire molecule , such as cell adhesive effects . in particular , these cell attachment peptides comprise novel sequences homologous to 19 – 21 amino acids sequence of the carboxy termini of the β chain and αe chains of fibrinogen , which are now disclosed in other regions of fibrinogen as well as in other proteins . the term “ fibrin ( ogen )” is known in the art and denotes either fibrinogen or fibrin or a mixture of fibrin and fibrinogen , and is referred to herein according to this definition . hereinafter , the term “ biologically active ” refers to molecules , or complexes thereof , which are capable of eliciting an effect in a biological system . hereinafter , the term “ fragment ” refers to a portion of a molecule or a complex thereof , in which the portion includes substantially less than the entirety of the molecule or the complex thereof . the term “ amino acid ” refers to compounds which have an amino terminus and carboxy terminus , preferably in a 1 , 2 - 1 , 3 -, or 1 , 4 - substitution pattern on a carbon backbone . α - amino acids are most preferred , and include the 20 natural amino acids ( which are l - amino acids except for glycine ), which are found in proteins , the corresponding d - amino acids , the biosynthetically available amino acids which are not found in proteins ( e . g ., 4 - hydroxy - proline , 5 - hydroxy - lysine , citrulline , ornithine , canavanine , djenkolic acid , β - cyanolanine ), and synthetically derived α - amino acids , such as amino - isobutyric acid , norleucine , norvaline , homocysteine and homoserine . β - alanine and γ - amino butyric acid are examples of 1 , 3 and 1 , 4 - amino acids , and many others are well known to the art . statine - like isosteres ( a dipeptide comprising two amino acids wherein the conh linkage is replaced by a choh ), hydroxyethylene isosteres ( a dipeptide comprising two amino acids wherein the conh linkage is replaced by a chohch 2 ), reduced amide isosteres ( a dipeptide comprising two amino acids wherein the conh linkage is replaced by a ch 2 nh linkage ) and thioamide isosteres ( a dipeptide comprising two amino acids wherein the conh linkage is replaced by a csnh linkage ) are also useful residues for this invention . as used herein “ peptide ” indicates a sequence of amino acids linked by peptide bonds . the peptide analogs of this invention comprise a sequence of amino acids of 7 to 24 amino acid residues , preferably 8 to 21 residues , each residue being characterized by having an amino and a carboxy terminus . hereinafter , the term “ peptide ” refers a sequence of amino acids , while the term “ peptidomimetic ” refers to analogues and mimetics having substantially similar or identical functionality to that of the haptotactic peptide which it is intended to mimic , including analogues having synthetic and natural sequences . hereinafter , the term “ haptotactic peptide ” refers to amino - acid sequences or analogues or derivatives or peptido - mimetics thereof , which are capable of eliciting attachment responses from cells , whereby the attachment of the cells in the presence of the haptotactic molecule is at least 50 % greater than that in the absence thereof . hereinafter the term “ epitope ” refers to the active site on a complex molecule , which can react with antibodies or cell receptors . the term “ epitope ” is used herein , but is not limited to describing relatively short linear peptidic sequences on polypeptides or proteins ( such as 8 – 10 amino acids in length ) which can induce cell haptotaxis by interacting with cell attachment sites . epitopes may also be formed by amino acid residues at sites which are not contiguous in the primary sequence of the polypeptide . hereinafter , the term “ wound - healing cells ” refers to those cells , which promote healing of a wound , including , but not limited to , fibroblasts , smooth muscle endothelial cells , osteoblasts and chondrocytes . based on the known ( wo99 / 61041 ) activity of the cαe and its sequence homology to cβ , it is now disclosed that we have identified and characterized novel haptotactic peptides . one novel haptotactic peptide , which is homologous to the cβ 20 - mer sequence , comprises the fragment adjacent to , i . e . just preceding , the c - terminal of the γ chain , termed herein precγ ( γ 366 - 386 ). we have further identified other proteins that contain regions with significant homology to cβ . table 1 summarizes these proteins in sub - sets based on their biological function ( table 1 ; 1st column ) including hemostasis ( fibrinogen ), modulators of angiogenesis ( angiopoietins ) ( 24 – 30 ), microfibril associated glyco - protein of the vasculature ( microfibril associated protein 4 ) ( 31 – 34 ) and extracellular proteins of the tenascin family ( 35 – 37 ). for example , angiopoietin 1 ( ang1 ) and angiopoietin 2 ( ang2 ) ( mw ˜ 130 kda ) ( 25 – 28 ) contain the haptotactic motif shared by fibrinogen cβ and precγ ( the degree of homology having a statistical significance of p & lt ; 0 . 001 ). these factors are secreted by cells to modulate vasculature formation in normal and cancer tissue . while ang1 serves as a stimulator of capillary development , ang2 is an inhibitor thereof . the receptors for these angiopoietins have been identified as the tyrosine kinase receptors tie 1 - and tie - 2 ( 26 – 30 ). the family of tenascins , which contains a fibrinogen - like domain ( 34 – 37 ) also contain a sequence homologous to cβ . tenascins have been associated with the growth of neurons , but are ubiquitous and may serve other developmental functions , including binding to and modulating membrane sodium channels . cell receptors identified to date for tenascins include integrins α 8 β 1 and α 9 β 1 . some tenascins are organized as hexamers . smith - magenis syndrome ( sms ) is a clinically recognizable multiple congenital anomaly / mental retardation syndrome associated with deletion of chromosome 17p11 . 2 . the gene encoding a human microfibril - associated glycoprotein - 4 ( mfap4 ) has been mapped to the sms region that has a fibrinogen - like domain . a full - length cdna corresponding to the mfap4 gene contains a coding region of 255 amino acids . deletion of the mfap4 gene locus in sms patients has been considered in the pathogenesis of this genetic disorder ( 34 – 37 ). homology is defined as meaning positional identity relative to the sequence of interest , as employed by the gene - bank data bases . partial sequence identity ( termed “ positive homology ”) also adds to the score by defining certain amino acids as equivalent to one another ( i . e . positive homology groupings are : s = t = n ; r = k = q ; f = y ; v = m = l = i ). the novel haptotactic peptides ( comprising homologous sequence variants of known haptotactic peptides ) were synthesized as individual peptides , namely : fibrinogen γ chain peptide , designated herein as precγ , ( seq id no : 1 ); angiopoietin 1 peptide , designated herein as c - ang1 , ( seq id no : 2 ); angiopoietin 2 peptide , designated herein as c - ang2 ( seq id no : 3 ); tenascin x peptide designated herein as c - tenx ( seq id no : 4 ), and microfibril associated glycoprotein 4 peptide designated herein cmfap ( seq id no : 5 ). active fragments of these cell attachment peptides are also now disclosed comprising 8 – 10 amino - acid long peptides ( 8 – 10 mers ) of the above described haptotactic peptides such as : the sequences of these peptides are given in tables 2 and 3 below . hereinafter , the term “ haptotactic peptide ” refers to peptides shown in tables 1 , 2 and 3 , as well as to analogues , derivatives , or peptido - mimetics thereof , which are capable of eliciting attachment responses from cells . based on the high attachment activity of the synthetic 19 – 21 mer peptides homologous to sequences in fibrinogen cβ and precγ chains as well as the other proteins with homologous sequences , a haptotactic consensus sequence called hapt 15 ( seq id no : 11 ) has been constructed comprising the amino acids : wherein x denotes an amino acid , or may be absent thereby forming a direct bond . extensions at the n or c termini of this sequence are explicitly encompassed within the scope of the present invention . it should be noted that conservative replacements of the amino acid residues of this consensus sequence are also encompassed within the scope of the present invention , as is well known in the art . based on the activity of the synthetic 8 – 10 mer sequences a shorter haptotactic consensus sequence hapt 9 epitope ( seq id no : 12 ) was constructed : wherein x denotes an amino acid or may be absent thereby forming a direct bond . the haptotactic peptides of the present invention are contemplated for many different uses , including but not limited to the treatment of a wound bed . additional uses of the haptotactic peptides of the present invention include , but are not limited to , the separation of different types of cells from mixed cell cultures , the implantation of peptide - coated prosthetic devices , the identification and analysis of cell receptor mechanisms , the design of peptide - derivatized drugs to augment drug delivery and for diagnostic purposes . furthermore , as explained in greater detail below , the haptotactic peptides of the present invention or their dna or rna sequences can also be used as tools for biological analysis and for further research and development . these contemplated compositions , composites and uses of the haptotactic peptides of the present invention are outlined in the examples below and are intended as illustrations only and are not meant to be limiting in any way . the present invention is drawn towards novel cell attachment epitopes and in particular to novel peptides which are homologous to regions of the carboxy termini of fibrinogen chains . methods of using these peptidic sequences are also contemplated , including methods for the promotion of wound healing , for use as pharmaceutical compositions either per se or in conjunction with a medical device or implant , for the separation of cells from mixed populations , for the identification and analysis of cell receptor mechanisms , for use in augmenting drug delivery , prevention of restenosis and for diagnostic purposes . the principles and operation of the invention , using peptidic amino acid sequences of fibrin and homologous sequences according to the present invention may be better understood with reference to the following non - limiting illustrative examples . the peptides of the present invention were synthesized and tested in cell culture systems as described below in the section entitled “ experimental procedure ”. the results are given in the section entitled “ results ”. essentially , specific peptides in tables 2 and 3 were synthesized and covalently attached to sepharose beads , to form sb - peptide ( e . g ., sb - precγ , sb - c - ang1 , or sb c - tenx ). fibrinogen was similarly covalently attached to sepharose beads , to form sb - fib . the sb - ligand combination was then incubated with cultured cells . the data as shown in the “ results ” section , indicated that a family of peptides homologous to the fibrinogen β - chain carboxy termini appeared to be potent for cell binding , showing potency equivalent to that of the parent fibrinogen molecule . the binding experiments with fitc - tagged peptides also indicated that the haptotactic peptides could self aggregate as well as bind to fibrinogen , fibrin and liposomes . from a biophysical perspective , these results strongly suggest that the hydrophobic c - termini of the β - chain and analogues found in the αe chain and the internal γ - chain , probably play a role in fibrin self - assembly during the various polymerization interactions it undergoes following thrombin activation . the peptides of the above invention are significantly homologous to one another . from the perspective of fibrinogen biology , these sequences are highly conserved . based on the lack of immunogenicity of fibrinogen itself , these haptotactic fibrino - peptides are probably non - immunogenic , and advantageously are therefore not expected to elicit immune responses . structure / function studies were performed to identify smaller active regions of the haptotactic peptides homologues to the fibrinogen cβ . selected modifications of the 19 – 21 mer peptides covalently bound to sepharose beads were carried out and their haptotactic activity evaluated . the tools and techniques arising from these haptotactic peptides will find application in diverse fields associated with cell manipulation , wound healing , targeted drug delivery and tissue engineering . synthesis of custom made c - terminal peptides : the peptides sequences presented in tables 2 and 3 were synthesized using standard procedures , by commercial laboratories ( novatide ltd ., haifa , israel ; synpep labs , california , us ; new york blood center microchemistry lab , new york , us ). the experiments employed peptides that were & gt ; 85 – 95 % pure as determined by hplc / mass - spectrometry . covalent coupling of peptides or proteins to sepharose beads : peptides , fibrinogen and other proteins were covalently bound to cnbr - activated sepharose 4b beads ( pharmacia , piscataway , n . j .) in a procedure previously used to bind fibrinogen , thrombin and bsa ( 15 , 16 ). concentrations of peptides bound to sb in different preparations were in the range of 2 – 7 μm . sb coated with either bsa , fibrinogen , fibronectin or thrombin were similarly prepared . the coated sb were stored in saline at 4 ° c . with 0 . 1 % azide . before testing with cell cultures , the beads were washed 3 – 5 times in sterile saline to remove all traces of azide . sb haptotaxis assay : the attachment of sb - ligand to cells in nearly confluent cultures was measured as previously described ( 15 , 16 ). essentially , about 20 – 150 μl of suspended ( 50 % v / v ) sb - peptide or sb - protein were added to 6 – 24 well plates with near confluent cell cultures and dispersed by gentle shaking for 1 min . the plates were then incubated for up to 4 days . at different time points , the number of sb tethered to cells was counted with an inverted phase microscope . typically , approximately 300 sb ( but not less then 200 ) were counted in each well , and the ratio of the number of sb attached to the cells in each well , was calculated relative to the total number of sb . only sb coated with haptotactic materials became attached to the cell layer , ultimately to be engulfed by cells and tethered to the plate . without a ligand or coated with a neutral molecule such as bsa ( control ), none of the sb became attached to cells on the plate . percent sb attached to the cell surface at different time intervals provided a quantitative assay of the degree and the kinetics of the haptotactic response . at least 3 wells were measured for each variant and each experiment was repeated at least 3 times . monitoring cell number with the mts assay : the mts calorimetric assay ( celltitre 96 aqueous assay by promega ) was used to assay cell proliferation with peptide levels ranging up to 100 μg / ml and to evaluate the number of viable cells obtained in the adhesion assays . the mts assay is based on dehydrogenate conversion of mts by viable cells to colored tetrazolium salt and performed in 96 well plates , as previously described ( 15 , 16 ). the optical density ( od ) of the dye was measured at 492 nm by a computerized microplate reader ( anthos ht - ii , salzburg ). the od of the dye was calibrated to correlate linearly with the cell number . the plating density and incubation conditions were optimized for each cell type . fluorescence microscopy and confocal laser fluorescence microscopy : light and fluorescent microscopy were carried out using an olympus system . confocal laser microscopy was done with a computerized zeiss confocal axiomate microscope ( lsm410 ) with multiple excitation wavelengths . for examination of cell interaction with fitc - peptides , the cells were grown on glass coverslips to near confluence , then incubated with 10 μg / ml fitc - tagged peptides at room temperature . at different time points , the cells were washed and fixed in 0 . 5 % buffered glutaraldehyde . coverslips with the cells were placed on a microscope slide with pbs - glycerol 80 % with 2 % dabco and examined . the representative fields of cells were visualized by phase contrast numarski optics . fluorescence intensity at the fitc wavelength ( excitation 488 nm , emission 515 nm ) and scans were stored in the computer for further image reconstruction fitc - tagged peptides ( 10 μg / ml ) were mixed with either sb - fib , sb - peptide incubated for 1 hour at ambient temperature , and visualized by confocal fluorescent microscopy . alternately , 100 μl of fibrin clot ( 2 . 4 mg / ml ) was formed from fibrinogen and thrombin . after clot formation , 100 μl fitc - tagged peptides ( 10 μg / ml ) were layered onto the clot , incubated for 1 hour at ambient temperature . the clot was washed with tris buffer and visualized by confocal fluorescent microscopy . some structure function tests were carried out by measuring the haptotactic response of a given cell to sb - peptide before and after treating the sb - ligand with either trypsin , or oxidation conditions or after undergoing acetylating reaction to acetylate free amines . based on the results with such treatments with 19 – 21 mer peptides , smaller 8 – 10 mer peptides were synthesized , coupled to sb and tested for haptotactic activity , according to the methods described above . the cells examined were grown in 6 - well plates on cover slips to reach near confluence . at the time of examination , the cover slips were inverted and put on a microscope slide supported by 2 thin spacers so that a thin gap (˜ 2 mm ) was left between the cells on the coverslip and the slide . this was filled with culture medium . to follow the uptake , 10 μg / ml fitc - labeled peptide was added into the culture medium in the gap . at different time points , medium was replaced with fresh medium and the fluorescence was viewed and photographed , using an olympus fluorescent microscope system . dissolve peptide in minimum dimethyl sulfoxide dmso , make & lt ; 0 . 1 mm in phosphate buffer . mix 1 ml of dss ( disuccinimidyl subarate ) in dmso ( 2 . 5 mm ) in phosphate buffer and incubate with sponge for 30 min . at room temperature . stop reaction by adding 1 ml tris - saline buffer . pieces of peptide - coated sponge or untreated control were mixed with trypsinized fibroblasts ( hf ) or other cell types in cell culture medium and incubated . after 3 – 21 days incubation , sponge samples were removed , fixed with 95 % alcohol and 0 . 1 mm propidium iodide ( pi ) was added to stain the cell nuclei . the sample was rinsed and examined by confocal fluorescent microscopy . summary of haptotactic effect of 19 – 21 mer peptides with fibroblasts ( hf ), endothelial cells ( baec ) and smooth muscle cells ( smc ). the % haptotaxis was obtained by monitoring the attachment of 19 – 21 mer peptide - coated sepharose beads ( sb - peptide ) onto a near confluent cell layer . periodically ( i . e . 24 hr ), the fraction of sb - peptide bound to the cell layer was counted out of a field of 200 or 300 sb total . the results demonstrate that the peptides seq id 1 – 5 are haptotactic as they can render an otherwise neutral sb attractive to cells at levels equivalent to fibrinogen . in order to identify smaller active regions of the haptotactic peptides homologues to the fibrinogen cβ , selected modifications of the 19 – 21 mer peptides covalently bound to sepharose beads were carried out and their residual haptotactic activity evaluated . thus , it was noted that trypsin significantly reduced haptotactic activity of the cβ but not the c - ang1 . acetylation of k and r moieties in cβ reduced % haptotactic response of smc and hf , but did not affect the responsiveness of ec . oxidation of the m group particularly reduced the attractiveness of the peptides for hf . as only cβ has an internal lysine ( k ) site capable of being digested by trypsin , and considering the lack of activity of the shorter cβ12 – 21 ( not shown here ), this indicates that the first 8 – 10 amino acids might be adequate for a minimal haptotactic epitope . these data suggested that the lysine ( k ) at position 9 was important for the haptotactic activity of cβ , and further suggested that the sequences 1 – 10 might be critical to the haptotactic activity of the peptides . based on these results ( summarized in table 6 , a number of 10 - mer peptides were synthesized and tested for haptotactic activity ( see table 7 ). summary of haptotactic effects of 8 – 10 - mer peptides with fibroblasts ( hf ), endothelial cells ( baec ) and smooth muscle cells ( smc ). % haptotaxis was monitored by following up the attachment of 10 - mer peptide - coated sepharose beads ( sb - peptide ) onto a near confluent cell layer ( fig1 and 2 ). periodically , the fraction of sb - peptide bound to the cell layer was counted out of a field of 200 or 300 sb total . the results demonstrate that the 8 – 10 mer peptides of seq id 6 – 10 are indeed haptotactic as they can render an otherwise neutral sb attractive to cells . to test whether the haptotactic peptides modulate cell proliferation , cells were incubated with a range of 1 – 50 um concentrations of the peptides of interest for 3 – 4 days then the number of viable cells was determined with the mts colorimetric assay . none of the peptides of seq id nos . : 1 – 10 affected the rate of proliferation of hf , baec or smc relative to untreated controls . exposure of cultured human fibroblast cells to a solution of 10 μm fitc peptide fitc - cβ or precγ ( sequence id # 1 ) resulted in uptake into the cell cytoplasm , as shown by fluorescence microscopy ( fig3 ). after a longer exposure of more than 1 hour or with fixed cells , accumulation of the fitc - peptide in the cytoplasm and around the nucleus was clearly observed ( data not shown ). in most cases , the fluorescence became concentrated in discrete cytoplasmic vesicles . these haptotactic peptides could be used to increase the cellularization of implants or to induce a better cellular contact with the implant . for example a peptide coated sponge implanted into bone tissue could induce osteogenic cells to migrate into and attach to the sponge and create improved new bone matrix at the site of the implant . in another use , an electronic signaling or monitoring device coated with haptotactic peptides would exhibit improved binding to the cells within the implant area and be better incorporated into the tissue , thereby allowing its electronic functionality to be more efficient . polynucleotide sequences that encode for the amino acid sequences of the haptotactic peptides can be used to generate the peptides in genetically modified cells as is well known in the art . the dna and rna sequences can also be used for medical or diagnostic purposes . for example , one could monitor the mrna sequences which encode for the haptotactic peptides to determine if those sequences are being biosynthesized by the cells or tissue being examined or if their synthesis is increased or decreased as a result of a therapeutic treatment or drug dosage . fitc - tagged peptides ( 10 μg / ml ) were mixed with either sb - fib , sb - cb , incubated for 1 hour at ambient temperature , and visualized by confocal fluorescent microscopy . similarly , 100 ul fibrin clot ( 2 . 4 mg / ml ) was formed from fibrinogen and thrombin . after clot formation , 100 ul fitc - tagged peptides ( 10 μg / ml ) were layered onto the clot , incubated for 1 hour at ambient temperature . the clot was washed with tris buffer and visualized by confocal fluorescent microscopy . fluorecsent micrographs reveal that the haptotactic fibrino - peptides bind to fibrinogen and to itself ( i . e . sb - peptide ). the interactions of haptotactic peptides with liposomes indicate that these peptides can bind to hydrophobic cell membranes and possibly to hydrophobic regions of large molecules . without wishing to be limited by a single mechanism , functional cell attachment features of fibrinogen chains and homologues of fibrinogen chain , as in tables 2 and 3 are critical to the normal development and wound healing of all species . peptide analogues of those in tables 2 and 3 could be synthesized with non - natural synthetic amino acids or with d - amino acids , which would also provide a means of modulating the rate of peptide degradation within the cell and thereby prolong their biological lifetime , or create more selectivity to different cell types . coating of matrices with haptotactic peptides increases cell attachment in - vivo as well as in - vitro 1 . cell culture model : a polymeric sponge containing free carboxy groups was covalently coated with haptotactic peptide according to known methods ( 38 ) as follows : cβ peptide was coupled to the matrix by employing a water soluble carbodiimide reagent 1 - ethyl - 3 ( 3 - dimethylaminopropyl ) carbodiimide hydrochloride ( edc ) ( mw 191 . 7 , pierce co ) as follows : matrix ( 100 mg ) suspended in 2 ml conjugation buffer ( 0 . 1 m mes ( 2 -[ n - morpholinoethane sulfonic acid ), ph 4 . 5 – 5 ). fitc - cβ peptide ( 100 μl , 2 mg / ml ) was added and the mixture stirred on an orbital shaker . edc ( 2 mg ) was added and the entire mixture was shaken at ambient temperature for 2 hours the reaction was stopped by adding 100 μl tris / saline buffer and the matrix isolated . on the basis of the residual od 280 of the supernatant , more than 70 % of the fitc - peptide became coupled to the matrix to form peptide - matrix sponge . a control polymeric sponge and cβ - matrix sponge was incubated with trypsinized fibroblasts for over 10 days . samples of sponge were removed at specified intervals ( days 3 and 21 ), and were fixed and stained with propidium iodide to visualize cell nuclei . confocal fluorescence micrographs show that relative to the untreated control sponge , the cβ - treated sponge showed higher cellularization , namely an increase of cell content by more than 50 % within 3 days , and the difference increased over a 21 day incubation period , where more than doubling of the the cell number was recorded . similar results were obtained with other haptotactic peptides relative to untreated controls . 2 . animal model : implant control sponge or cβ - coated sponge under the skin of the back of rats and close the wounds . after 4 . 5 and 8 weeks , the animals were sacrificed and the implant areas examined histologically . in sets of control sponges , one could observe cells accumulating on the edges of the sponge and penetrating into the sponge inter - fibrous spaces . the cells form extracellular matrix with collagen deposition and granulation tissue , including the presence of giant cells and granulocytes and some inflammatory driven leukocytes . after 4 . 5 weeks , the sponges coated with cβ peptide showed significantly - increased cellularity consisting of both fibroblasts and leukocytes and formation of more granulation tissue , relative to the control . polynucleotide sequences that encode for the amino acid sequences of the haptotactic peptides can be used to generate the peptides in genetically modified cells as is well known in the art . the dna and rna sequences can also be used for medical or diagnostic purposes . without wishing to be limited , two examples of dna sequences that encode for the amino acid sequences of the haptotactic peptides are as follows : k g s w y s m r k m s m k i r p f f p q q ( seq id no : 14 ) k t r w y s m k k t t m k i i p f n r l t ( seq id no : 1 ) the amino acids of the haptotactic peptides can be encoded by other variant dna sequences . the dna and rna sequences that code for the amino acids of the haptotactic peptides can be used for medical as well as diagnostic purposes . while the invention has been described with respect to a limited number of embodiments , it will be appreciated that many variations , modifications and other applications of the invention may be made . the scope of the invention is not intended to be defined by the particular exemplifications used for illustrative purposes herein , but rather by the claims which follow . 1 . mosesson m . and doolittle r . ( eds ). the molecular biology of fibrinogen and fibrin . ann . n . y . acad . sci . volume 408 : ( 1983 ). 2 . henschen a ., lottspeich f ., kehl m ., southan c . covalent structure of fibrinogen . ann . n . y . acad . sci . 408 : 28 – 43 ( 1983 ). 3 . spraggon g ., everse s . j ., doolittle r . f . crystal structure of fragment d from human fibrinogen and its crosslinked counterpart from fibrin . nature 389 : 455 – 462 ( 1997 ). 4 . murakawa , m ., okamura , t ., kamura , t ., shibuya , t ., harada , m ., niho , y . diversity of primary structures of the carboxy - terminal regions of mammalian fibrinogen aa - chains . thrombosis & amp ; haemostasis , 69 : 351 – 360 , ( 1993 ). 5 . mosesson . m . fibrinogen heterogeneity . ann . n . y . acad . sci . 408 : 28 – 43 ( 1983 ). 6 . veklich y i , gorkun o v , medved l v , niewenjuizen w and weisel j w . carboxyl - terminal portions of the α chains of fibrinogen and fibrin . j . biol . chem . 268 : 13577 – 13585 ( 1993 ). 7 . fu , y . and grieninger , g . fib420 : a normal human variant of fibrinogen with two extended α chains . proc . natl . acad . sci . usa , 91 : 2625 – 2628 , ( 1994 ). 8 . fu , y , weissbach , l ., plant , p . w ., oddoux , c ., cao , y ., liang , t . j ., roy , s . n ., redman , c . m . and grieninger , g . carboxy - terminal - extended variant of the human fibrinogen α subunit : a novel exon containing marked homology to β and γ subunits . biochem ., 31 : 11968 – 11972 ( 1992 ). 9 . grieninger g ., lu x ., cao y ., fu y ., kudryk b . j ., galanakis d . k ., hertzberg k . m . fib 420 , a novel fibrinogen subclass : newborn levels are higher than adult . blood 90 : 2609 – 2614 ( 1997 ). 19 . spraggon g , applegate d , everse s j , zhang j z , veerapandian l , redman c , doolittle r f , grieninger g . crystal structure of a recombinant αe c domain from human fibrinogen 420 . proc . natl . acad . sci usa 95 : 9099 – 9104 ( 1998 ). 11 . gorodetsky , r ., vexler a ., shamir m ., an j ., levdansky l ., and marx g . ( 1999 ). fibrin microbeads ( fmb ) as biodegradable carriers for culturing cells and for accelerating wound healing . j . invest . dermatol . 112 , 866 – 872 ( 1999 ). 12 . gorodetsky r ., vexler a ., an j ., mou x , marx g . haptotactic and growth stimulatory effects of fibrin ( ogen ) and thrombin on cultured fibroblasts . j . lab . clin . med . 131 : 269 – 280 ( 1998 ). 13 . farrell d h & amp ; thiagarajan p . binding of recombinant fibrinogen mutants to platelets . j . biol . chem . 269 : 226 – 231 ( 1994 ). 14 . thiagarajan p ., rippon a . j ., farrell d . h . alternative adhesion sites in human fibrinogen for vascuilar endothelial cells . biochemistry 35 : 4169 – 4175 ( 1996 ). 15 . hantgan r r , endenburg s , cavero i , marguerie g , uzan a , sixma j j and de groot p g . inhibition of platelet adhesion to fibrin ( ogen ) in flowing whole blood by rgd and fibrinogen γ chain carboxy terminal peptides . thrombos . haemostas . 68 : 694 – 700 ( 1992 ). 16 . bednar b , cunningham m e , mcqueney p a , egbertson m s , askew b c , bednar r a , hartman g d , gould r j . flow cytometric measurement of kinetic and equilibrium binding parameters of arginine - glycine - aspartic acid ligands in binding to glycoprotein iib / iiia on platelets . cytometry 28 : 1 58 – 65 ( 1997 ) 17 . varadi a . and scheraga h . localization of segments essential for polymerization and for calcium binding in the γ - chain 357 – 411 of human fibrinogen . biochem . 25 : 519 – 528 ( 1986 ). 18 . suehiro k ; mizuguchi j ; nishiyama k ; iwanaga s farrell d h ; ohtaki s j fibrinogen binds to integrin alpha ( 5 ) beta ( 1 ) via the carboxyl - terminal rgd site of the alpha - chain biochem ( tokyo ) 128 ( 4 ): 705 – 10 ( 2000 ) 19 . savage b ., bottini e . & amp ; ruggeri z m ., interaction of integrin alpha iib beta with multiple fibrinogen domains during platelet adhesion , j . biol . chem . 270 : 28812 – 7 ( 1995 ). 20 . thompson , w . d ., smith , e . b ., stirk , c . m ., marshall , f . i ., stout , a . j . and kocchar , a ., angiogenic activity of fibrin degradation products is located in fibrin fragment e , j . pathol ., 168 : 47 – 53 ( 1992 ). 21 . savage b ., bottini e . & amp ; ruggeri z m ., interaction of integrin alpha iib beta iiia with multiple fibrinogen domains during platelet adhesion . j . biol . chem . 270 : 28812 – 7 ( 1995 ). 22 . gray , a . j ., bishop , j . e ., reeves , j . t . and laurent , g . j . ; aα and bβ chains of fibrinogen stimulate proliferation of human fibroblasts . j . cell sci ., 104 : 409 – 413 , ( 1993 )). 23 . saldeen t : vasoactive peptides derived from degradation of fibrinogen and fibrin . proc . ny acad sci usa , 408 : 424 – 431 ( 1983 )). 24 . suri c ., jones p . f ., patan s ., bartunkova s ., maisonpierre p . c ., daavais s ., sato t . n ., yancopulos g . d . requisite role of angiopoietin 1 , a ligand for the tie2 receptor during embryonic angiogenisis . cell 87 : 1171 – 80 ( 1996 ). 25 . maisonpierre p . c . et al . angiopoietin - 2 , a natural antagonist for tie2 that disrupts in vivo angiogenisis . science 277 : 55 – 60 ( 1996 ). 26 . partanen j ., armstrong e ., makela t ., korhonen j ., sandberg m ., renkonen r ., knuutila s ., huebner k ., alitalo k . a novel endothelial cell surface receptor tyrosine kinase with extracellular epidermal growth factor homology domains . molec . cell . biol . 12 1698 – 1707 ( 1992 ). 27 . sato t . qin y ., kozak c . a ., audus k . l . tie - 1 and tie - 2 define another class of putative receptor tyrosine kinase genes expressed in early embryonic vascular system . proc . natl . acad . sci . usa 90 : 9355 – 58 ( 1993 ). 31 . sato t . n ., tozawa y . deutsch u ., wolburg - buchholz k ., fujiwara y ., gendron - maguire m ., gridley t ., wolburg h ., risau w ., qin y . distinct roles of the receptor tyrosine kinases tie - 1 and tie - 2 in blood vessel formation . nature 376 : 70 – 74 ( 1995 ). 28 . mustonen t ., alitalo k . endothelial receptor tyrosine kinases involved in angiogenisis . j . cell biol . 129 : 895 – 898 ( 1995 ). 29 . hashiyama m ., iwama a ., oshira k ., kurozumi k ., yasunaga k ., shimizu y ., masuho y ., matsuda i ., yamaguchi n ., suda t . predominant expression of receptor tyrosine kinase , tie , in hematopoietic stem cells and b cells . blood 87 : 93 – 101 ( 1996 ). 30 . zhao z , lee c , jiralerspong s , juyal r c , lu f , baldini a , greenberg f , caskey c t , patel p i . the gene for a human microfibril - associated glycoprotein is commonly deleted in smith - magenis syndrome patients . hum mol genet apr 4 : 4 589 – 97 ( 1995 ). 31 . xia s ., ozsvath k ., hirose h ., tilson m . d . partial amino acid sequence of a novel 40 kda human aortic protein , with vitronectin - like fibrinogen - like and calcium binding domains : aortic aneurysm - associated protein - 40 ( aaap40 ) [ human magp - 3 , proposed ]. biochem . biophys . res . comm . 219 : 36 – 39 ( 1996 ). 32 . kobayashi r ., mizutani a ., hikada h . isolation and characterization of a 36 - kda microfibril - associated glycoprotein by the newly synthesized isoquinoline sulfonamide affinity chromatography . biochem . biophys . res . comm . 198 : 1262 – 1266 ( 1994 ). 33 . zhao z , lee c , jiralerspong s , juyal r c , lu f , baldini a , greenberg f , caskey c t , patel p i . the gene for a human microfibril - associated glycoprotein is commonly deleted in smith - magenis syndrome patients . hum mol genet 4 589 – 97 ( 1995 ) 34 . brown - augsburger p , broekelmann t , rosenbloom j , mecham r p . functional domains on elastin and microfibril - associated glycoprotein involved in elastic fibre assembly [ published erratum appears in biochem j 1997 , 863 : biochem j aug 15 318 ( pt 1 ): 149 – 55 . ( 1996 ) ( check ref ): 35 . erickson h . p . tenascin - c , tenascin - r and tenascin - x : a family of talented proteins in search of functions . curr . op . cell biol . 5 : 869 – 76 ( 1993 ). 36 . zhi - cheng xiao , david s . ragsdale , jyoti dhar malhotra , laura n . mattei , peter e . braun , melitta schachner , and lori l . isom tenascin - r is a functional modulator of sodium channel subunits . j biol chem , 274 : 26511 – 26517 , 1999 . 37 . jayashree srinivasan , melitta schachner , and william a . catterall interaction of voltage - gated sodium channels with the extracellular matrix molecules tenascin - c and tenascin - r . pnas . 95 : 15753 – 15757 , 1998 . 38 . timkovich , r . ( 1977 ). detection of the stable addition of carbodiimide to proteins . anal . biochem . 79 , 135 – 143 .

US-18118702-A

a multi - purpose light is disclosed . the multi - purpose light includes a housing , an illumination mechanism provided in the housing for illuminating the mailbox interior and a switch provided on the housing for reversibly activating the illumination mechanism . aa pivot contact having a generally cylindrical pivot portion is rotatably mounted in the housing and engaged by the switch . a contact extension extends from the pivot portion . the switch is moveable between a first position wherein the contact extension disengages the illumination mechanism and the illumination mechanism is extinguished , and a second position wherein the pivot contact rotates in the housing and the contact extension engages the illumination mechanism to activate the illumination mechanism . an activation clip embodiment of the multi - purpose light is also disclosed .

referring initially to fig1 – 6 and 12 of the drawings , a switch - operated embodiment of the multi - purpose light of the present invention is generally illustrated by reference numeral 1 . the multi - purpose light 1 includes an elongated , generally rectangular , typically plastic housing 2 , having a front end 2 a and a rear end 2 b and constructed of a front housing panel 3 which engages a complementary rear housing panel 4 typically in a snap - fit . as illustrated in fig1 , the interior of the rear housing panel 4 has a rectangular battery compartment 4 a for containing a battery assembly 19 , as will be hereinafter described . a neck seat 4 b communicates with the battery compartment 4 a in the right housing panel 4 , and a generally beveled , concave or dish - shaped reflection surface 10 is shaped in the rear housing panel 4 at the front end 2 a of the housing 2 , the purpose of which neck seat 4 b and reflection surface 10 will be hereinafter described . the front housing panel 3 , similar in shape to the rear housing panel 4 and having an interior battery compartment ( not illustrated ) complementary in size and shape to the battery compartment 4 a of the rear housing panel 4 , is characterized by a panel bevel 3 a and a pair of spaced - apart , tapered panel extensions 3 b that contribute to the concavity of the reflection surface 10 of the rear housing panel 4 when the front housing panel 3 is attached to the rear housing panel 4 , as illustrated in fig1 . in a preferred embodiment , the reflective surface 10 of the rear housing panel 4 and the panel bevel 3 a and panel extensions 3 b of the front housing panel 3 are coated with a white or silver reflective paint or other light - reflective medium , according to the knowledge of those skilled in the art . a neck notch ( not shown ) is shaped in the front housing panel 3 , between the panel extensions 3 b for purposes which will be hereinafter described . as illustrated in fig2 , a flexible attachment clip 5 is typically provided on the outside surface of the rear housing panel 4 for removably attaching the housing 2 to the right side wall 25 of the mailbox 22 in an illustrative application of the multi - purpose light 1 , as illustrated in fig1 and hereinafter described . the attachment clip 5 is typically generally flush with the flat rear end 2 b of the housing 2 , and is disposed on the housing 2 opposite the reflection surface 10 , as illustrated in fig1 . as illustrated in fig1 , a pivot pin 45 extends from the rear housing panel 4 , into the battery compartment 4 a and inserts in a pivot pin receptacle ( not illustrated ), provided in the front housing panel 3 , for purposes hereinafter described . as illustrated in fig3 and 4 , the battery assembly 19 is contained in the assembled housing 2 as hereinafter further described , and includes a first battery 8 , having a negative terminal 8 a and a positive terminal 8 b ; and a second battery 18 , having a negative terminal 18 a and a positive terminal 18 b . a typically plastic bulb harness 21 of the battery assembly 19 includes an elongated , flat harness base 21 a and a perpendicularly - extending harness neck 21 b , which harness base 21 a is fitted on the bottom end thereof with a metal negative contact 26 that engages the negative terminal 8 a of the first battery 8 . the harness base 21 a is further provided with a metal positive contact 27 which engages the positive terminal 18 b of the second battery 18 . the threaded bulb base 20 a of a light bulb 20 is threaded into the harness neck 21 b of the bulb harness 21 . the negative contact 26 and positive contact 27 each extends from the bottom surface of the harness base 21 a and terminates inside the harness neck 21 b of the bulb harness 21 , where the negative contact 26 establishes electrical contact between the negative terminal 8 a of the first battery 8 and the bulb base 20 a of the light bulb 20 , and the positive contact 27 establishes electrical contact between the positive terminal 18 b of the second battery 18 and the bulb base 20 a of the light bulb 20 . as further illustrated in fig3 and 4 , an elongated , plastic spring mount plate 15 of the battery assembly 19 is fitted with a metal contact spring 9 which extends through a spring opening ( not illustrated ) provided in the spring mount plate 15 and is disposed in electrical contact with the positive terminal 8 b of the first battery 8 . the cylindrical contact base 16 a of a metal clip contact 16 extends through an opening ( not illustrated ) provided in the spring mount plate 15 and is disposed in electrical contact with the negative terminal 18 a of the second battery 18 . the battery assembly 19 is seated in the battery compartment 4 a ( fig1 ) of the rear housing panel 4 and in the complementary battery compartment ( not illustrated ), provided in the front housing panel 3 , with the harness neck 21 b of the bulb harness 21 extending through the neck seat 4 b of the rear housing panel 4 and the complementary neck notch ( not illustrated ) of the front housing panel 3 . accordingly , as illustrated in fig1 , the light bulb 20 is disposed adjacent to the reflection surface 10 of the rear housing panel 4 and the panel bevel 3 a and panel extensions 3 b of the front housing panel 3 . as illustrated in fig2 – 4 , a switch slot 76 is provided in the rear end 2 b of the housing 2 of the multi - purpose light 1 , and a switch 75 is slidably mounted in the switch slot 76 . a switch connector 77 , which is preferably a flexible rubber or plastic material , is attached to the switch 75 and extends through a connector opening 78 provided in the rear end 2 b of the housing 2 , as illustrated in fig3 and 4 . the extending end of the switch connector 77 is attached to a pivot contact 36 which is pivotally mounted in the housing 2 as hereinafter further described . as illustrated in fig5 and 6 , the pivot contact 36 includes a pivot contact body 37 which is typically plastic . the pivot contact body 37 includes a generally cylindrical pivot portion 38 and an elongated contact extension 41 which extends from the pivot portion 38 . a pivot pin opening 39 extends through the pivot portion 38 , and a spring attachment tab 44 typically extends from the contact extension 41 . an electrically - conductive coating 40 , which may be copper or aluminum , for example , is provided on the pivot portion 38 , the contact extension 41 and the spring attachment tab 44 of the pivot contact body 37 . an elongated attachment slot 42 , the purpose of which will be hereinafter described , is provided in the pivot portion 38 of the pivot contact body 37 . as illustrated in fig3 and 4 , when the front housing panel 3 is mounted to the rear housing panel 4 , the pivot contact 36 is pivotally mounted on the pivot pin 45 , which extends from the rear housing panel 4 ( fig1 ) and through the pivot pin opening 39 ( fig5 ) of the pivot portion 38 . the contact spring 9 is attached to the spring attachment tab 44 of the pivot contact 36 , and the switch connector 77 of the switch 75 is inserted in the attachment slot 42 and secured therein using techniques known to those skilled in the art . as shown in fig3 , the switch 75 is normally positioned in the switch slot 76 to orient the pivot contact 36 in such a position that the contact extension 41 does not contact the clip contact 16 . upon sliding of the switch 75 in the direction indicated by the arrow if fig3 , by actuation of the switch connector 77 , the contact portion 38 pivots in the clockwise direction on the pivot pin 45 such that the contact extension 41 contacts the clip contact 16 , thus establishing electrical communication between the first battery 8 and second battery 18 through the contact spring 9 and clip contact 16 , thereby illuminating the light bulb 20 of the multi - purpose light 1 , as illustrated in fig4 . upon sliding of the switch 75 in the opposite direction , by actuation of the switch connector 77 the contact portion 38 pivots in the counterclockwise direction on the pivot pin 45 such that the contact extension 41 is moved out of contact with the clip contact 16 , thereby extinguishing the light bulb 20 , as illustrated in fig3 . referring next to fig3 , 4 and 11 of the drawings , in one possible application the multi - purpose light 1 is attached to the right side wall 25 of a post - type mailbox 22 with the housing 2 extending into the mailbox interior 24 , by inserting the right side wall 25 of the mailbox 22 between the attachment clip 5 and the outside surface of the right side panel 4 . accordingly , the reflection surface 10 faces the mailbox interior 24 . after opening the mailbox door 23 , a user ( not shown ) slides the switch 75 in the switch slot 76 , causing contact of the contact extension 41 of the pivot contact 36 with the clip contact 16 and illuminating the light bulb 20 , as heretofore described with respect to fig4 . the mailbox interior 24 is therefore sufficiently illuminated to enable the user to view the contents of the mailbox interior 24 . it will be appreciated from a consideration of fig4 that the beveled or concave reflection surface 10 , in combination with the panel bevel 3 a and panel extensions 3 b , reflects or scatters the light from the light bulb 20 to illuminate substantially the entire mailbox interior 24 . after removing the mailbox contents from the mailbox interior 24 , the user then slides the switch 75 in the opposite direction in the switch slot 76 , causing the contact extension 41 of the pivot contact 36 out of contact with the clip contact 16 and extinguishing the light bulb 20 , as heretofore described with respect to fig3 . it will be appreciated by those skilled in the art that the multi - purpose light 1 can be attached to the interior of a variety of enclosures including a purse ( not illustrated ), for example , for selective illumination of the interior of the enclosure by manipulation of the switch 75 , depending on the desires of the user . referring next to fig7 – 10 of the drawings , an alternative embodiment of the multi - purpose light of the present invention is generally indicated by reference numeral 1 a . the multi - purpose light 1 a includes an activation clip 11 which is attached to the pivot portion 38 of the pivot contact 36 , as illustrated in fig9 and 10 . the activation clip 11 , which is constructed of an electrically - conductive metal , includes a long segment 12 , the extending end of which typically terminates in a loop 12 a . an angled short segment 13 extends from the other end of the long segment 12 . the extending end of the short segment 13 is inserted in the attachment slot 42 ( fig5 ) of the pivot contact 36 and secured therein according to the knowledge of those skilled in the art . an l - shaped , typically plastic sheath 14 is bonded or otherwise attached to the outside surfaces of the long segment 12 and short segment 13 , respectively , of the activation clip 11 . the short segment 13 of the activation clip 11 extends through a left panel clip notch ( not illustrated ) and an aligned right panel clip notch 7 , provided in the front housing panel 3 and attached rear housing panel 4 , respectively , of the housing 2 at the rear end 2 b thereof . the contact spring 9 is attached to the spring attachment tab 44 of the pivot contact 36 . accordingly , as illustrated in fig9 , the activation clip 11 can be pressed against the housing 2 with the long segment 12 thereof seated in a clip depression 11 a ( fig8 ) provided in the front end 2 a of the housing 2 , wherein the pivot contact 36 is disposed in such a position that the contact extension 41 disengages the clip contact 16 , thereby breaking electrical contact between the positive terminal 8 b of the first battery 8 and the negative terminal 18 a of the second battery 18 and extinguishing the light bulb 20 . as illustrated in fig1 , upon release , the pivot portion 38 of the pivot contact 36 rotates in the clockwise direction on the pivot pin 45 and the activation clip 11 extends from the clip depression 11 a by operation of the contact spring 9 . the contact extension 41 of the pivot contact 36 contacts the clip contact 16 , thereby establishing electrical contact between the positive terminal 8 b of the first battery 8 and the negative terminal 18 a of the second battery 18 and energizing the light bulb 20 . referring next to fig9 , 10 and 13 of the drawings , in one possible application the multi - purpose light 1 a is attached to the right side wall 25 of a post - type mailbox 22 with the housing 2 extending into the mailbox interior 24 , by inserting the right side wall 25 of the mailbox 22 between the attachment clip 5 and the outside surface of the right side panel 4 , as illustrated in fig4 . accordingly , the reflection surface 10 faces the mailbox interior 24 . when the mailbox door 23 of the mailbox 22 is in the closed position , the mailbox door 23 presses the activation clip 11 against the rear end 2 b of the housing 2 , with the long segment 12 of the activation clip 11 seated in the clip depression 11 a ( fig8 ) of the housing 2 . the contact extension 41 of the pivot contact 36 is spaced from the clip contact 16 , breaking electrical contact between the first battery 8 and second battery 18 . upon opening of the mailbox door 23 as illustrated in fig1 , the spring - biased activation clip 11 is released , whereupon the activation clip 11 pivots outwardly from the clip depression 11 a of the housing 2 as the contact spring 9 rotates the pivot portion 38 of the pivot contact 36 in the clockwise direction on the pivot pin 45 and the contact extension 41 of the pivot contact 36 contacts the clip contact 16 . the pivot contact 36 therefore establishes electrical contact between the positive terminal 8 b of the first battery 8 and the negative terminal 18 a of the second battery 18 to energize the light bulb 20 . upon closing of the mailbox door 23 , the mailbox door 23 pushes against the activation clip 11 at the loop 12 a of the long segment 12 thereof to seat the long segment 12 in the clip depression 11 a of the housing 2 . accordingly , as heretofore described with respect to fig9 , the pivot portion 38 of the pivot contact 36 rotates in the counterclockwise direction on the pivot pin 45 such that the contact extension 41 disengages the clip contact 16 , against the bias of the contact spring 9 exerted against the contact extension 41 , to break electrical contact between the first battery 8 and the second battery 18 and extinguish the light bulb 20 . it will be appreciated that the loop 12 a end of the long segment 12 of the activation clip 11 can be bended beyond the plastic sheath 14 to enhance the contact capability of the activation clip 11 with the mailbox door 23 , as needed in the event that the activation clip 11 partially loses its shape after repeated use . it will be further appreciated by those skilled in the art that the multi - purpose light 1 a can be attached to the interior of a variety of enclosures including a purse ( not illustrated ), for example , for automatic illumination of the interior of the enclosure by release of the activation clip 11 . referring again to fig3 , 4 , 9 and 10 of the drawings , it is understood that the multi - purpose light 1 and 1 a of the present invention can be constructed using light bulbs 20 of any suitable type , including those capable of being energized using one battery . in that case , the first battery 8 is provided in electrical contact with the light bulb 20 through the negative contact 26 ( fig9 ) of the bulb harness 21 , and in electrical contact with the pivot contact 36 through the contact spring 9 , as heretofore described , except the second battery 18 is omitted from the battery assembly 19 and the clip contact 16 is provided in direct electrical contact with the light bulb 20 , through the positive contact 27 ( fig9 ) of the bulb harness 21 . while the preferred embodiments of the invention have been described above , it will be recognized and understood that various modifications can be made in the invention and the appended claims are intended to cover all such modifications which may fall within the spirit and scope of the invention .

US-87463804-A

this invention provides a method of treating lung cancer including administering a therapeutically effective amount of a compound of 0089 - 0022 formula i to a subject in need thereof . the compound activates pyruvate kinase m2 isoform to treat the lung cancer . in one example , the lung cancer is non - small cell lung cancer .

as used herein and in the claims , “ comprising ” means including the following elements but not excluding others . pyruvate kinase m2 isoform ( pkm2 ), a key mediator of glycolysis , is a rate limiting enzyme , which catalyzes the final step in glycolysis , transfers the phosphate from phosphoenolpyruvate ( pep ) to adenosine diphosphate ( adp ). in mammals , there are totally four isoforms of pyruvate kinase , pkl , pkr , pkm1 and pkm2 , encoded by two genes , pkrl and pkm . pkl is mainly expressed in liver meantime ; pkr is in red blood cells ; both of which are encoded by pkrl . pkm1 is found in many normal tissues , but pkm2 is expressed in highly proliferating cells ; both of which are encoded by pkm . pkm2 has a special characteristic that it can alter into two function forms : the active tetrameric form and the inactive dimeric form . the tetrameric pkm2 has a high affinity for pep and leads glycolysis by the pyruvate oxidation in mitochondria . dimeric pkm2 has a low affinity for pep and leads glycolysis by lactic acid fermentation in the cytosol . cancer cells prefer the dimeric pkm2 to increase the glucose uptake , and this action facilitates accumulation of the glycolytic intermediates for the anabolic processes , like the syntheses of nucleic acid , amino acid and lipid . if using rna interference to knock down pkm2 , cancer cells &# 39 ; growth was significantly inhibited . further , if pkm2 were switched to the pyruvate kinase m1 isoform , the tumor formation and growth were slowed down in vivo . thus , the metabolic differences provide a potential for a treatment of cancers . pkm2 activators aim to induce tetramerization of pkm2 . the first small molecules to activate pkm2 was reported by the nih chemical genomics center . after that , more activators have been reported , but only a few were tested in vitro and in vivo . in an example embodiment in accordance with the invention , a new pkm2 activators was screened out using molecular docking screening technique . kinase - based and cell - based assays were utilized to detect the pkm2 activation of several compounds on two nsclc cell lines ( a549 and h1975 , which are egfr wild type and egfr double mutant ( t790m / l858r ) respectively ). the result showed that formula i was a potent pkm2 activator . it can directly activate pkm2 activity through phosphorylation of pkm2 , further induce apoptosis in a549 and h1975 cell lines via regulation of glycolysis . this compound can be developed as a new anti - cancer drug for lung cancer . seven lung cancer cell lines ( a549 , h1975 , hcc827 , h820 , h1650 , h358 and h460 ) and two normal cell lines ( ccd19 - lu and beas2b ) were purchased from atcc ( american type culture collection ). the lung cancer cell lines were cultivated with rpmi 1640 medium . ccd19 - lu were cultivated with mem medium supplement with 10 % fetal bovine serum . both 1640 medium and mem medium were supplemented with 10 % fetal bovine serum ( fbs ) and 100 u / ml penicillin and 100 μg / ml streptomycin ( gibco , big cabin , okla ., me , usa ) ( gibco , big cabin , okla ., me , usa ), 100 u / ml , penicillin and 100 μg / ml and streptomycin ( gibco , big cabin , okla ., me , usa ). beas2b were cultivated in culture flasks pre - coated with a mixture of 0 . 01 mg / ml fibronectin , 0 . 03 mg / ml bovine collagen type i and 0 . 01 mg / ml bovine serum albumin dissolved in bebm medium ( lonza , allendale , n . j ., us ). the cells were cultured in incubator with 5 % co2 at 37 ° c . formula i was purchased from top science co . ltd ( shanghai , china ). primary anti - bodies of β - actin , total / phosphor - pkm2 ( t -/ p - pkm2 ), total / phosphor - akt ( t - ip - akt ), bcl - 2 were purchased from cell signaling technology ( danvers mass ., usa ). fluorescein - conjugated anti - rabbit as secondary anti - body was purchased from odyssey ( belfast , me ., usa ). cells were seeded in a 96 - well microplate with 3000 - 5000 cells / well confluence , and put into an incubator overnight for cells adhesion . different concentrations of formula i were added with dmso as vehicle control . the microplates were incubated for another 48 hours and 72 hours separately . each dosage was repeated in triplicate . 10 μl of mtt ( 5 mg / ml ) solution was added to each well . the plate was then placed back into the incubator for 4 hours . after that , 100 μl of resolved solution ( 10 % sds and 0 . 1 mm hcl ) was added to each well . before dissolving the formazan crystals , the microplate was put back into the incubator for another 4 hours . the absorbance of the plate was measured at 570 nm with reference 650 nm by a microplate reader ( tecan , morrisville , n . c ., usa ). cell viability was calculated by percentages of the absorbance of the treatment group divided by the absorbance of untreated group . at least three independent experiments were performed for data analysis and presentation . a549 and h1975 cells ( 1 × 10 5 cells / well ) were seeded in a well plate with 6 wells for 24 hours , and treated with the indicated concentrations of formula i for an additional 24 hours , 48 hours and 72 hours at 37 ° c . after indicated hours , the cells were washed by ice - cold 1 × pbs once and harvested by trypsination . then cells were centrifuged , collected , and resuspended in ice - cold 1 × pbs . after removing the supernatants , cell pellets were re - suspended in 100 μl 1 × annexin - binding buffer . the cells were then double - stained with annexin - v fitc and pi ( 100 μg / ml ) of 2 μl respectively for 15 min at room temperature in dark . after that , 300 μl 1 × annexin - binding buffer was added . apoptotic cells were quantitatively counted by a bd aria iii flow cytometer ( bd biosciences , san jose , calif ., usa ) after incubation a549 and h1975 cells with formula i for 24 hours and 72 hours , a549 and h1975 cells were harvested and washed with cold 1 × pbs . then , cells were lysed with ice - cold ripa lysis buffer with protease , and phosphatase inhibitors were added to extract the cell protein extraction . the supernatants were collected by centrifugation at 12 , 000 g , for 5 minutes . the quantitation of total protein extraction was measured by bio - rad dctm protein assay kit ( bio - rad , philadelphia , pa ., usa ). then 30 μg of protein were loaded and electrophoretically separated on 8 % sds - page gel and then transferred to nitrocellulose ( nc ) membrane . membranes were blocked with 5 % non - fat milk and pbs containing 0 . 1 % tween - 20 ( tbst ) for 1 hour at room temperature . after 1 hour , membranes were incubated with primary anti - bodies ( 1 : 1000 dilution ) against β - actin , total / phosphor - pkm2 , total / phosphor - akt , and bcl - 2 at 4 ° c . with gently shaking overnight . membranes were washed with tbst for 3 times ( 5 minutes / time ), and incubated with secondary fluorescent antibody ( 1 : 10000 dilutions ) for 1 hour at room temperature . rewashing with tbst for 3 times ( 15 minutes / time ), the stripes were visualized by li - cor odessy scanner ( belfast , me ., usa ). pkm2 biochemical assay compounds were pre - incubated with 2 nmol / l pkm2 enzyme in reaction buffer ( 50 mmol / l tris - hcl , ph 8 . 0 , 200 mmol / l kcl , 30 mmol / l mgcl2 , 2 mmol / l dithiothreitol ( dtt ), 5 % dmso ) for 30 minutes at room temperature . adp and pep were then added to final concentrations of 75 mmol / l and 15 mmol / l , respectively . after 30 minutes , atp formation was measured by kinase glo ® plus from promega , and concentration at half - maximal activation ( ac50 ) values were determined using prism graphpad software . 6 . molecular docking study on the interaction between formula i and pkm2 . molecular docking calculation is performed to study the interaction between formula i and the homodimer interface of pkm2 by induced fit docking module in schrodinger software ( schrodinger , inc ., new york , n . y ., 2009 ). the studied compound is prepared and optimized in the ligprep module . the 3d structure of pkm2 is derived from the pdb database ( pdb id : 3me3 ) and prepared using the protein preparation wizard . during the induced fit docking , centroid of the co - crystalized ligand is defined as the active site and the pose of ligand is valued with xp docking score . the pose with the highest score is selected for further analysis . all the data were presented as mean ± sd of 3 individual experiments . differences were analyzed by one - way anova using graph prism 5 . 1 . molecular docking showed that formula i is a direct pkm2 activator by binding to the kinase pocket . the binding affinity of formula i was evaluated by the xp docking score . the best pose with a docking score of − 12 . 038 kcal / mol was selected to represent the acceptor - ligand binding modes . as shown in fig1 a and fig1 b , the interaction between formula i and the homodimer of pkm2 occurred symmetrically . according to fig1 a , the oxygen atom and nitrogen atom in each sulfonyl group of formula i formed hydrogen bonding interactions to the corresponding backbone atoms of leu353 and tyr390 in both chains . the biphenyl group of formula i was settled in the middle of two phe26 and formed a close π - π stacking interaction with both phe26 in the dimer . the residues around the binding site shown in fig1 b was colored according to their hydrophobicity . it was observed that the binding site was mainly constituted by a series of hydrophobic and aromatic residues ( colored in green ). so the hydrophobic interaction between the acceptor and ligand seemed to be the vital factor for ligand affinity . 2 . enzyme activity assay showed that formula i had the pkm2 activating ability . pkm2 enzyme activity assay over the concentration of formula i was performed in kinase glo ® plus assay . the controls were conducted in the presence of 5 % dimethyl sulfoxide ( dmso ) and normalized to 100 %± sd . fig2 shows a graph 200 with a x - axis showing concentration and a y - axis showing pkm2 enzyme activity . the results in the graph suggest that pkm2 activator formula i could enhance in a dose - dependent manner . ( n = 3 , ** p & lt ; 0 . 005 , *** p & lt ; 0 . 001 ). the enzyme activity showed the ac50 value of formula i was 5 . 5 ± 1 . 0 μm . the maximum pkm2 enzyme activity was more than 200 % compared to that in controls . fig2 . shows pkm2 enzyme activity of formula i . the maximal pkm2 activity thereof was more than 200 % relative to activity in controls conducted in the presence of 5 % dmso ( normalized to 100 %± sd ) seven lung cancer cell lines ( a549 , h1975 , hcc827 , h820 , h1650 , h358 and h460 ) and two normal cell lines ( ccd19 - lu and beas2b ) were selected to do the cytotoxic test . different cells were seeded at 3000 - 5000 cells per well in 96 - well plates in 1640 media , and formula i and dmso ( 0 . 1 % final concentration ) were added 24 hours later . the viability effect thereof was determined by mtt assay after 48 hours and 72 hours respectively . mtt assay showed the inhibition activity of formula i on cell proliferation on different nsclc cells and normal cells at two time points , 48 hours and 72 hours . as shown in fig3 a - fig3 i and fig6 . fig3 a - fig3 i shows viability effect induced by pkm2 activator formula i in different lung cancer ( a549 , h1975 , hcc827 , h820 , h1650 , h358 , h1460 ) and normal cell ( ccd19 - lu , beas2b ) cell lines at two time points . different cells were seeded at 3000 - 5000 cells per well in 96 - well plates in 1640 media , and formula i and dmso ( 0 . 1 % final concentration ) were added 24 hours later . viability was determined by mtt assay after 48 hours and 72 hours respectively . 4 . formula i significantly induced apoptosis in a549 and h1975 cells as examined by quantitative annexinv / pi flow cytometry analysis . using quantitative apoptosis measurement method , flow cytometry analysis showed that formula i induced significant level of apoptosis in a concentration - dependent manner in both a549 and h1975 cell lines . compared with the control group , formula i showed significant higher level of apoptosis and the apoptosis level increased in time dependent manner . ( n = 3 , ** p & lt ; 0 . 005 , *** p & lt ; 0 . 001 ) as shown in fig4 a , fig4 b , fig4 c , fig4 d , fig4 e and fig4 f . 5 . formula i led to a dose - dependent increase in pkm2 phosphorylation . western blot analysis showed that formula i activated phosphorylation of both pkm2 in a dose - dependent manner in both a549 and h1975 cell lines , indicating the anti - cancer efficacy is mediated by suppression of akt pathway . and β - actin is used as a loading control and normalization . as shown in fig5 a and 5 b . a new pkm2 activator formula i was tested , which targets the last step of glycolysis — pkm2 . results showed its potent anti - cancer activity in nsclc cells . formula i exhibited direct pkm2 kinase activation activity , inhibited phosphorylation of akt and induced apoptosis . as such this formula i can be developed as new anti - cancer drug nsclc patients by targeting pkm2 . although the description referred to particular example embodiments , it will be clear to one of ordinary skill in the art that example embodiments in accordance with the invention may be practiced with variation of these specific details . hence these example embodiments should not be construed as limited to the embodiments set forth herein .

US-201715406798-A

an apparatus for disinfecting an enclosed space for the preservation and sterilization of harvested foods , and for reducing toxic gas levels associated with confining animals in an enclosed space using ozone and an ozone distribution device .

with reference to the drawings , fig1 - 6 depict an apparatus for injecting and controlling the ambient gas in an enclosed space , generally indicated by the reference numeral 10 . the system employs the use of the enclosed space ( 52a - 52b ; 62a - 62b ), a source of pure dry oxygen 40 , an ozone generator 18 , and a fluid transport communication system for transferring the ozone so generated into the desired enclosed space at desired levels for maintaining the ambient atmosphere in the enclosed space with desired levels of ozone and oxygen , depending on the ultimate purpose of the enclosed space . referring to fig1 - 6 , oxygen source 40 may be an oxygen concentrator that has a fixed position relative to one or more rooms ( 52a - 52b ; 62a - 62b ), which are the enclosed spaces . as seen in fig4 fluid control line 42 is disseminated from oxygen source 40 to a plurality of apparatuses 10 which are mounted on the back wall of enclosed spaces 52a - 52b . apparatuses 10 may also be mounted on any of the walls of the enclosed spaces , or on the ceiling . referring back to fig1 - 6 , the ozone generator 18 has a distribution device attached to its output , such as a system of fan assemblies 24 , or a regulated pressure nozzle 20 , or both , that allows for a predetermined amount of ozone to be distributed into each enclosed space as a function of time . as seen in fig1 and 2 , the unit 10 comprises an upper compartment 12 and a lower compartment 14 , wherein led power light 13 is electrically connected to lower compartment 14 . referring to fig2 ozone generator 18 and transformer 16 are electrically connected , and are disposed within lower compartment 14 . ozone generator 18 is connected to at least one fan assembly 24 via conduit 22 . as seen in fig1 and 2 , fan assemblies 24 are mounted in upper compartment 12 . the fan assemblies 24 are mounted on mounting ports , wherein alternate mounting ports 25 are also located in the upper compartment 12 so that the fan assemblies 24 can be relocated to any other mounting port in the upper compartment 12 , so that ozone can be directed in whatever direction provides the optimum pattern of dispersal for the particular enclosed space . referring now to fig3 a fan assembly is shown , comprising fan blades 26 , fan housing 28 , and threaded aperture 30 disposed in the top surface of fan housing 28 . aperture 30 is disposed in the top surface of fan housing 28 , such that aperture 30 is centered in the swept area . fitting 32 , in the form of an elbow and nozzle , is screwed into threaded aperture 30 at the upper periphery of the fan housing , and in such close proximity ( e . g . 0 . 002 &# 34 ; to 0 . 010 &# 34 ;) to the outer tip of the fan blades 26 , such that crystalline products of oxidation which constantly accumulate at the point where the highest concentration of oxidizer meets the room air are removed by the suction and pulsating action of the passing fan blades 26 . in a typical installation , fan assembly 24 has five blades and operates at from 2 , 900 - 3 , 200 revolutions per minute . this results in 14 , 500 - 16 , 000 pulsations per minute , which keeps the injector orifice clear of debris and keeps the injection point clear of solidified products of oxidation that might otherwise block the injector tube . furthermore , in an animal confinement environment , dust from animal feed and dry feces , and animal hair , which accumulate on and around the fan , do not dislodge and fall into the small injection orifice because it is at the top of the fan . this action keeps the injection point clear of debris that might otherwise block the injection tube . referring now to fig5 an alternate embodiment of the instant invention is shown , wherein vegetables are stored for months at a time without ever opening the enclosure . in this embodiment , the enclosure itself is sealed completely . the enclosure ( 62a , 62b ) may contain its own fans 64 for movement of the ambient gases contained therein over these long periods of time . with such fans already in place , the present invention can be used with o 3 injectors 20 that are in fluid communication with the interior of the enclosed space ( 62a , 62b ) to provide a controlled , timed amount of ozone and oxygen into the volume as a function of the empirical calculations to maintain a particular level of o 3 . in this embodiment , the unit 10 is mounted outside the storage room or enclosed area 62a , 62b , and the unit 10 only has the lower compartment 14 containing the ozone generator and transformer . the fans are eliminated from the upper compartment 12 , and the ozone is piped directly into the storage room 62a , 62b via a small diameter tube 22 , passing through the insulated wall of the storage room or enclosed area . the ozone is then dispersed by fans 64 contained within the storage room . as described above , the ozone generator modules 18 are supplied with 85 %- 92 % purity oxygen from a centrally located oxygen source 40 . referring now to fig6 another alternate embodiment of the instant invention is shown for use in a transport container . the unit used in a transport container is essentially the same as the modular system described above , except that all the components , including the oxygen source 40 , are packaged in one very compact device , which is generally small enough and light enough to be contained in the refrigeration compartment itself . the system and method described herein provides a means of introducing and widely dispersing a high purity ozone mixed with a high purity oxygen within an enclosed area . each unit has a sealed compartment 14 containing the electronics where the ozone is generated . in the preferred embodiment , the unit has a sealed compartment containing the electronics where the ozone is generated and an upper , open compartment containing a plurality of dispersion fans . the dispersion fans can be relocated to any of six other mounting ports in the upper compartment so that ozone can be directed in whatever direction provides the optimum pattern of dispersion . the instant invention has been shown and described herein in what is considered to be the most practical and preferred embodiment . it is recognized , however , that departures may be made therefrom within the scope of the invention and that obvious modifications will occur to a person skilled in the art .

US-20964294-A

a vertical bar is placed over an incision and is spaced from the incision by upper and lower spider legs that have feet resting on the patient &# 39 ; s body . the upper spider feet are held to the body by a neck strap and the lower feet by a waist strap . the bar is formed of telescoping sections to accommodate body movements and to adjust to patients of different size . the upper spider legs are v - shaped in elevation to permit the user to wear an open - neck shirt without the protector being visible .

various objects , advantages , and features of the invention will be apparent in the following description and claims considered together with the drawings forming an integral part of this application and in which : fig1 is an elevation view of a person having a presently preferred embodiment of my protector attached to the person by a neck strap and a waistband . fig2 is a side view of the person and the protector of fig1 . fig3 is a sectional view on an enlarged scale along the line iii -- iii of fig1 showing the telescoping construction of the protector bar . fig4 is an end view on an enlarged scale of the upper pair of spider legs of the protector of fig1 . fig5 is a bottom end view of the protector of fig1 on an enlarged scale . referring to fig1 and 2 , a patient 9 has a neck 10 and a body 11 having a waist 12 . disposed about the neck 10 is a neck strap 13 supporting a pair of spider legs 14 connected to a vertical bar having an inner telescoping portion 16 and a lower telescoping portion 17 . the bottom of the lower bar section 17 is supported by a pair of spider legs 18 to which is secured a waist strap 19 . the details of construction of the protector are shown in fig3 , and 5 , and in fig3 it will be noted that the lower bar member 17 is hollow and telescopes over the exterior of the upper bar member 16 , which is also hollow . this telescoping action allows not only for adjustment to fit the particular patient 9 , but also permits the patient to bend over , and this shorter distance of the body from the upper chest to the waist is accommodated by the upper bar member 16 telescoping within the lower bar member 17 . referring to fig4 it will be noted that the spider legs 14 are connected to the upper bar member 16 at an angle 21 , which causes the bar 16 to be spaced from the chest of the patient 9 . the outer ends of the spider legs 14 terminate in flattened feet 22 to match the contour of the patient &# 39 ; s chest . projecting from the outer side of each of the feet 22 is a strap loop 23 , which is the means of attachment of the neck strap 13 to the spider legs 14 . referring to fig5 it will be noted that the lower spider legs 18 are connected at a much larger angle 26 to the lower bar member 17 and thus space the bar 17 at a lesser distance from the body of the user . this difference in spacing is necessitated by the curvature of the upper chest and the upper spider legs 14 and must accommodate this curvature and lift the bar 16 a greater distance away from the body to achieve the same parallelism to the user &# 39 ; s chest . this is best illustrated in fig2 . the lower spider legs 18 terminate in feet 27 , which have loops 28 formed on the outer surface thereof . one end of the waist strap 19 may be fastened to one such loop 28 . a hook may be inserted into the other loop 28 , and the outer end of the hook 29 may be connected to the belt strap 19 . the belt strap may have an adjustment buckle 20 as shown in fig2 . it will be noted particularly with reference to fig1 that in the elevation view there illustrated the spider legs 14 are formed at an angle 31 with respect to each other to create a v - shape . the spider legs 14 thus have a double angle , one illustrated in fig1 and the other illustrated in fig4 . this v - shaped angle 31 permits the patient 9 to wear an opened - neck shirt and still not have the protector show . the incision for open - heart surgery is normally vertical and normally toward the center of the chest ; hence , it would usually be disposed approximately under the bar 16 - 17 . this bar , accordingly , keeps clothing and any other objects from touching or rubbing against the incision and thus prevents itching and irritation . the use of the waist strap 19 holds the lower end of the bar 16 - 17 against the body , thereby preventing any pendulum effect of the bar . the protector is useful also for vertical incisions on the back of the chest . the straps are removable for washing . the absence of adhesives in the use of this protector ensures maximum skin comfort for the patient and avoids the unpleasantness of stripping away strongly adhesive materials from the skin . this is particularly important after surgery wherein the chest is usually closely shaves ; after a few days the sprouting hairs on a man &# 39 ; s chest become extremely irritated by adhesives . in actual use the protector has proven to be very comfortable . this is particularly true of heart patients , who are required to engage in regular walking exercise , thereby exposing the wound to rubbing of clothing unless it is protected . the protector accommodates the circulation of air to assist in the healing of the incision . the neck strap 13 , as well as the waist strap 19 , is preferably adjustable . the entire protector may be quickly installed by slipping the neck strap 13 over the head and wrapping the waistband 19 around the waist , hooking it by the hook 29 shown in fig5 . the telescoping construction of the bar 16 - 17 permits the use of the same protector on adults and on children . the spacing of the upper spider legs 14 is such that the protector may be readily used by women , the protector not touching the breast areas of the chest . the protector may be worn in bed , thereby preventing rubbing of bedding on the incision , and is strong enough to resist breakage if the sleeper should accidentally roll over on the protector . if seepage occurs from the incision , a necessary bandage may be applied to the incision and the protector may be disposed over the bandage . i prefer to make the protector of lightweight materials . while lightweight metals could be used , i prefer at present to make it out of strong plastic with thin sections to thereby achieve minimum weight . the invention has been described with reference to a presently preferred embodiment thereof as required by the statutes . it will be obvious to those skilled in the art that various modifications , variations , and improvements may be made in the device , and all such that fall within the true spirit and scope of the invention are included within the language of the following claims .

US-85093277-A

a method for destroying harmful cells is provided , applicable in treating proliferative diseases . the cells are destroyed by a combined treatment with a chemiluminescent agent and with a ligand - photosensitizer conjugate . the chemiluminescent agent emits light on reacting with oxygen species present in situ , the conjugate binds to the cell through its ligand and is activated by the emitted light , thereby destroying the cell . the method is demonstrated on a conjugate of transferrin - hematoporphyrin , which destroys cancerous cells in the presence of luminol .

it has now been found that bioconjugates comprising hematoporphyrin ( hp ) and carrier protein transferrin ( tf ) significantly improve the specificity and efficiency of pdt for erythroleukemic cells , when applied with luminol . the observed synergistic toxic effect does not depend on the order in which the cells are contacted with a chemiluminescent agent and with a ligand - photosensitizer conjugate . it is known that chemiluminescent agents ( cl ), such as luminol or iso - luminol or lucigenin , emit light when being oxidized . without wishing to be bound by theory , luminol appears , in a method according to the invention , to be induced to emit light after activation by in situ existing oxidizing factors which include molecular oxygen , or chemical groups and molecules capable of providing oxygen atoms or peroxides or other reactive oxygen species ( ros ). said oxidizing factors , such as oxygen or ros , will induce the light emission , setting in motion a cascade of events including the formation of further ros , activating the ps component of the ligand - toxin conjugate , and ending with the cell destruction . this ros and oxygen source , whether metabolically produced or provided by outside oxygen supply , prolongs the pdt cycle . a surprisingly low concentration of cl agent , not expected to be toxic by itself , is sufficient to kill the target cells . furthermore , since the pdt components of the invention need not be present simultaneously , another problem of the prior art pdt is obviated , i . e ., the requirement of the coordinated presence of several factors in the cell . the preferred conjugate of the invention , tf - hp conjugate , was separated from tf and hp by hplc and characterized by uv - vis spectrophotometry ( fig1 ). the tf spectrum reveals a typical maximum at λ = 280 nm , whereas hp absorption maximum is at λ = 375 nm . the hp - tf conjugate has two absorption peaks at λ = 280 nm and 412 nm and the spectrum is characterized by a red shift of the maximum and is not a simple superposition of the spectra of its components . fig2 depicts the dose - response effect of hp or tf - hp ltc treatment on the viability of fl , k562 and u - 76 cells . incubating the cells with various concentrations of hp or tf - hp in the dark followed by overnight exposure to ambient fluorescent light showed that for all cell types , tf - hp was much more cytotoxic than hp alone . fig3 ( table 1 ) shows that the concentration of tf - hp required to achieve ld 50 was more than 6 - fold lower than for hp . furthermore ld 100 values were only obtained with the tf - hp . u - 76 hybridoma cells were relatively insensitive to pdt . the concentration of tf - hp required to reach ld 90 in these cells was & gt ; 19 . 4 fold higher than for fl cells and & gt ; 3 . 5 fold higher than for k - 562 cells . this order of sensitivity was retained at the concentrations required for ld max ( 3 . 37 for fl and 0 . 8 for k562 ). furthermore , 100 % cytotoxicity was only obtained when the conjugate was used against the erythroleukemic cell lines . a similar pattern of sensitivity was also seen with free hp treatment . while a similar ( 90 %) ld max was reached for both erythroleukemic lines , fl cells were 16 . 6 more sensitive than k - 562 . further evidence for the increased cytotoxicity of tf - hp over free hp was obtained from fluorescence microscopy , which illustrated the presence and location of the ps in fl cells after 45 and 60 minutes incubation with either hp or tf - hp . at both time points , relatively faint ( as no anti bleaching solution was used ) hp fluorescence was observed mainly constrained to the plasma membrane region . significantly greater fluorescence was apparent in cells treated with tf - hp . after 45 minutes the conjugate localized in membrane patches ( possibly demarcating endolysosomal compartments ) and had infiltrated much of the cytoplasm by 60 minutes further , the ability of an intracellular chemiluminescent light signal to induce pdt was tested . fig4 illustrates the cytotoxicity induced in fl cells cultured in the dark with hp or tf - hp either alone or together with 10 μm luminol . the cells were not exposed to ambient fluorescent light at any stage of the procedure . it was found that i ) luminol alone induced about 15 % cytotoxicity , ( ii ) hp alone had little effect on cell viability , ( iii ) cytotoxicity reached a maximum of 30 % in the presence of hp and luminol and iv ) luminol induced a significant ( 95 %) pdt effect upon addition of tf - hp . fig5 further demonstrates that the cytotoxic luminol - induced pdt effect is dependent on the concentration of both tf - hp and luminol with a combination of 10 μm luminol and 3 μm of conjugate producing maximum cytotoxicity . a reduction in tf - hp concentration had less effect on cytotoxicity than did lowering the level of luminol . it was checked whether the synchrony in exposure to luminol and tf - hp is a requirement for this cytotoxicity by incubating cells first with tf - hp , washing and then exposing them to luminol following various delay times . the time taken to wash the cells and return them to culture was approximately 15 minutes . while delaying the exposure to luminol by 30 minutes had no effect on the cytotoxicity ( fig6 a ), after 60 minutes of delay , the pdt effect was reduced by 50 %. however by reversing the protocol , ( fig6 b ) it was found that pre - incubation with luminol for 24 hrs sensitized the cells to the delayed exposure to tf - hp and the pdt effect was dose dependent . this invention addresses two problems of pdt technology . the first problem concerns the development of pdt systems to enhance the efficiency of ps delivery to target cells . most targeted pdt studies have used monoclonal antibodies as the address moiety . as the use of antibodies poses several practical limitations , an alternate approach may target a tf - ps conjugate to tf receptors . the therapeutic potential of tf - protein [ weaver m . et al . : j neurooncol . 65 ( 2003 ) 3 - 13 ], and tf - chemical [ singh m . et al . : anticancer res . 18 ( 1998 ) 1423 - 7 ] toxin conjugates have already been examined , but less is known about tf - ps conjugates particularly with regard to hp which , although having been used successfully in free form in the clinic for over a decade [ dolmans d . e . et al . : nature reviews cancer 3 ( 2003 ) 380 - 7 ], it has been little tested in targeted pdt [ hamblin m . r . et al . : j . photochem . photobiol . 26 ( 1994 ) 45 - 56 ]. the instant invention provides tf - hp conjugates that are at least 6 - fold more effective in inducing cell death even at the ld 50 level ( fig2 and table 1 ). aside from increasing target specificity and efficiency , pdt induced cell death is faster when tf - hp is used . for example during optimization of the ltc cytotoxicity assay , it was found by us that while almost 100 % cytotoxicity was achieved after only 30 minutes exposure to tf - hp , about 2 hr were required for maximum activity ( 24 %) of free hp . moreover , fluorescence microscopy of hp and tf - hp - treated fl cells demonstrated that tf - hp is taken up more rapidly and that it reaches intracellular organelles , and this would provide for more effective disruption of intracellular membranes . the second problem of pdt technology is addressed by the invention , concerning the source of the luminescent activating signal delivered to the ps . an external radiation provides homogeneous excitation of ps in the tissue culture or during subcutaneous injection , however the penetration of visible light into internal tissue is limited to a few millimeters , precluding the use of pdt for deeper tissue targets . efforts to overcome this limitation have concentrated on new external light devices or improved catheters . the aim of the invention was to provide a molecular light - emitting mechanism within the ps - loaded target cell . this strategy is non - invasive , does not expose normal tissue to irradiation and a molecular illuminator can be transported to target cells in vivo . we use the term intracellular activation of pdt ( iap ) to describe such molecular systems . luminol is a chemiluminescent activator that undergoes a light emitting process catalyzed by metal ions and hydrogen peroxide . this process is employed in chemiluminescent detection techniques and in cell physiology studies , but the invention takes advantage of luminol as an energy source in the field of pdt of cancer cells . the emission spectrum of luminol comprises two major peaks , at 424 and 485 nm . it was observed by us that the first peak corresponded to a crest in the absorption spectrum of tf - hp ( 412 nm , fig1 ), suggesting , together with the enhanced intracellular uptake of the tf - hp relative to hp , that an iap involving luminol is effective . initially hp or tf - hp was mixed with luminol and added to fl cell culture in the dark ( fig4 ). high concentrations of tf - hp alone induced low - level cytotoxicity in accordance with previous reports [ supino r . et al . : chem . biol . interact . 57 ( 1986 ) 258 - 94 ; luksiene z . et al . : medicina 39 ( 2003 ) 677 - 82 ], an effect that may be related to the ability of hp to inhibit the activity of protein kinase c . not only was there a significant pdt effect when both tf - hp and luminol were added to the cells , but the cytotoxic efficiency of tf - hp over hp was even more enhanced than that seen with the external light source ( fig2 ). however the concentration of tf - hp required to reach ld max in the iap system was 6 . 7 times higher than with external radiation ( fig4 and table 1 ). in a previous study , carpenter [ carpenter s . et al . : proc . natl . acad . sci . usa 91 ( 1994 ) 12273 - 7 ] described a bioluminescent iap system for pdt that induced killing of virus - infected cells , involving the activation of hypericin following oxidation of luciferin by luciferase . additional experiments assessed whether or not the ps and iap systems need to be applied simultaneously in order to produce an effective pdt response ( fig6 ). delaying addition of luminol to tf - hp - loaded cells by 45 minutes did not reduce cytotoxicity and as the cells were thoroughly washed before exposure to luminol these results reflect activation of intracellular tf - hp rather than material loosely bound to the membrane . delaying exposure to luminol by a further 30 minutes decreased the pdt effect by half suggesting that the tf - hp residence time is a limiting factor in this system . when the components were added in the reverse order luminol - loaded cells remained very sensitive to pdt even when addition of tf - hp was delayed for 24 hrs . as mentioned , photodynamic therapy ( pdt ) involves a two - stage process . in the first step , a light - absorbing photosensitizer ( ps ) ( for instance hematoporphyrin , hp ), is endocytosed . in the second step , the ps is activated by light , transferring energy to a cytoplasmic acceptor molecule that activates molecular oxygen , yielding reactive oxygen species ( ros ) that damage the cellular components , particularly membrane phospholipids . the outcome of this process leads to cytolysis . efforts to expand the use of pdt in the clinic have been hindered by the lack of ps target cell specificity and lack of tissue penetration of external light radiation . the invention provides bioconjugates comprising the carrier protein transferrin and hp ( tf - hp ) that significantly improve the specificity and efficiency of pdt for erythroleukemic cells by a factor of almost 20 - fold at the ld 50 level . fluorescence microscopy showed that the conjugates are endocytosed and accumulate in intracellular vesicles whereas free hp was mostly membrane bound . in addition , it was shown by the inventors that the use of external radiation for ps activation can be bypassed by incubating the cells with luminol either prior to or together with tf - hp . luminol is activated intracellularly to yield chemiluminescent radiation that stimulated pdt - induced cytotoxicity in 95 % of cells . these strategies provide safer and more effective applications of pdt . the present invention provides a new approach to overcome the limitations of pdt applications . the efficacy of the targeted ltc strategy using the tf - hp system is first established , and then in vitro applicability of luminol is demonstrated , wherein luminol can be used as a powerful molecular inducer of intracellular cl for the destruction of leukemic cells , obviating the use of external light sources in pdt . in conclusion , the invention provides tf - hp conjugates as a viable vehicle for pdt induced cytotoxicity . enhanced targeting of the ps with carrier proteins that are efficiently endocytosed increase therapeutic efficacy of pdt by reducing dosage and overcoming toxicity to normal tissue inevitably produced with free ps . the invention thus provides means for destroying cells associated with proliferative diseases , for example cancer . the invention will be further described and illustrated in the following examples . hp , rabbit anti - human transferrin , goat anti - bovine serum albumin , transferrin , n - hydroxysuccinimide ( nhs ) and luminol were purchased from sigma - aldrich chemical co . n , n - dicyclohexyl carbodiimide ( dcc ) and tetrahydrofuran ( thf ) were from carlo erba . horse serum ( hs ), fetal calf serum ( fcs ), l - glutamine and combined antibiotics were purchased from biological industries ltd . ( bet haemek , israel ). hplc solvents were from merck . u - 76 is a murine hybridoma that secretes igg1 antibody against dinitrophenol ( dnp ) and was a kind gift of prof . eshhar ( weizmann institute of science , rehovot , israel ). these cells as well as friend &# 39 ; s leukemia ( fl ) cells were grown in dmem containing 15 % hs , 2 mm l - glutamine and combined antibiotics . human k - 562 cells were grown in rpmi / 15 % hs / glutamine / antibiotics . all cells were maintained at 37 ° c . in a humidified incubator containing 6 % co 2 . 0 . 11 mmole hematoporphyrin hydrochloride was dissolved in 10 ml chloroform and activated by addition of 0 . 173 mmole of nhs and 0 . 11 mmole dcc . the mixture was stirred at room temperature for 2 . 5 hrs . following evaporation with a stream of air , the residue was dissolved in 2 ml of thf and the activated hp was slowly added to a solution of 15 mg transferrin dissolved in 10 ml of 0 . 1m nahco 3 cooled on ice . the solution was allowed to warm to room temperature , adjusted to ph 7 . 5 and stirred vigorously overnight . tubes containing hp were protected from light exposure . the conjugate solution was centrifuged ( 7200 × g , 30 mins , 4 ° c .) and the supernatant was analyzed spectroscopically for the content of protein ( λ = 280 nm ) and hp ( λ = 400 nm ). after dialysis , a small portion of the crude reaction product was chromatographed over sephadex g - 50 equilibrated with 5 mm nahco 3 ( ph 8 . 0 ) or 10 mm pbs ( ph 7 . 2 ). fractions containing materials with absorption peaks at 280 and 400 nm were collected and stored at 4 ° c . hplc : tf , hp and tf - hp were chromatographed over a c - 18 column ( 3 . 9 mm × 300 mm bondclone , particle diameter 10 μm , phenomenex ) using a hplc jasco - 1580 with a jasco 1575 uv / vis detector . the solvent system was composed of acetonitrile - water with 1 % trifluoroacetic acid and compounds were eluted with a linear gradient ( 20 - 100 % acetonitrile ). absorbance spectrum : the absorbance spectra of pbs solutions of hp ( 0 . 02 mg / ml ), tf ( 1 . 4 mg / ml ) and hp - tf ( 1 . 4 mg / ml ) were recorded with a chemusb2 - uv - vis spectrophotometer having optical resolution of 1 nm , grating of 600 lines per mm equipped with ccd array detector . the samples were scanned in the absorbance region of 250 - 500 nm . biological activity : this was assessed by the ability of anti - transferrin or anti - bsa antibodies to inhibit pdt - induced cytotoxicity and was tested using fl cells exposed to tf - hp either alone or together with varying concentrations of each antibody . late log - phase cells were washed with dmem pre - warmed to 37 ° c . and cultured at 0 . 5 - 1 × 10 5 cells / ml either alone or with increasing concentrations of tf - hp ltc for 2 hrs at 37 ° c . in 6 % co 2 . cells were then washed with dmem , exposed to ambient fluorescent light ( fluence rate = 0 . 5 mw / cm 2 ) for 12 - 16 hours and then re - cultured in full medium for 24 hrs . cell viability was determined by trypan blue exclusion . experiments were repeated at least three times . the optimal exposure times of cells to the ps and fluorescent radiation were determined in preliminary time - course experiments . fl cells were grown on glass slides in tissue culture dishes together with hp or tf - hp and the incorporated fluorescence was followed at various time intervals with an ax70 olympus microscope equipped with a high - pressure mercury lamp for excitation and a set of filters for blue violet excitation ( band path 420 - 480 nm ), dichroic mirror ( 455 nm ) and a cut - on red emission barrier filter ( 580 nm ). fluorescence was analyzed with an x60 objective , without addition of any anti bleaching solution , and recorded by a ccd camera . fl cells were washed and cultured for 20 hrs with different concentrations of hp or tf - hp ( 0 . 07 , 0 . 15 or 0 . 3 μm ) together with luminol ( 0 - 10 μm ). manipulations of cells and components were performed with the room lights switched off . culture plates were wrapped in aluminum foil during the culture period . subsequently , experiments aimed to test whether a pdt effect could be obtained by staggering the exposure of the cells to either luminol or tf - hp conjugate . fl cells were cultured for 2 hrs in the dark at 37 ° c . with tf - hp ( 3 μm ), washed and re - suspended in medium at the standard culture concentration . this procedure took approximately 15 minutes . then , the cells were kept at 37 ° c . for an additional 0 , 30 , 60 or 90 minutes , luminol ( 10 μm ) was added and the cultures incubated in the dark for a further 16 hrs . alternatively , cells were first cultured for 24 hrs in the dark in the presence of 10 μm luminol , washed or not - washed and then cultured further for 24 hrs in the presence of tf - hp ( 0 - 3 μm ) at 37 ° c . during washing procedures and cell handling , special care was taken to maintain the cells in a dark environment . while this invention has been described in terms of some specific examples , many modifications and variations are possible . it is therefore understood that within the scope of the appended claims , the invention may be realized otherwise than as specifically described .

US-85068110-A

the present invention provides an operator - controllable system that allows the operator to make initial field operation settings for the towed working tool quickly and easily when hitching the working tool to the towing vehicle , e . g ., tractor . once an initial setup is completed , in operation , the invention , which in one form is a leveling arrangement for the working tool , automatically maintains the optimal operation settings throughout the vertical operational range of the working tool . for example , if the optimal operation settings is a level implement throughout its operating range , the leveling arrangement will maintain the implement level as the implement is raised and lowered .

turning now to the figures , a farming system 10 is generally comprised of a farm implement 12 that is hitched to a towing vehicle 14 , such as a tractor . in the illustrated embodiment , the farm implement 12 is a tillage machine but the invention is not so limited . the farm implement 12 is generally comprised of a hitch frame 16 and a main frame 18 to which a plurality of ground engaging tools 20 are conventionally attached . the ground engaging tools 20 in the illustrated embodiment include a combination of shanks 22 and coulters 24 but it is understood that other types or other combinations of tools could be used . the hitch frame 16 couples the main frame 18 to the hitch 26 of the towing vehicle 14 in a conventional manner . fig2 provides a simplified isometric view of the farm implement 12 . in the view of fig2 , for purposes of simplification , the ground engaging tools 20 have been removed . from fig2 it will be appreciated that the main frame 18 consists a pair of outer rails 28 extending parallel to one another in a longitudinal direction between a header bar 30 and a footer bar 32 . to provide additional stability , the main frame 18 includes an intermediate crossbar 34 . in addition to outer rails 28 , the main frame 18 also has a pair of inner rails 36 that extend parallel to one another in a longitudinal direction between the header bar 30 and a trailing bar 38 that is spaced rearward ( in the fore - aft direction ) of the footer bar 32 . working tools , such as harrows ( as shown in fig1 ), may be mounted to the trailing bar 38 . the inner rails 36 are positioned inboard of the outer rails 28 . the rails and bars are interconnected in a known manner using brackets , weldments , and the like . it will also be appreciated that wing frame sections ( not shown ) may be mounted to the main frame 18 to provide additional width or coverage of the implement . preferably , such wing sections are pivotally mounted or otherwise associated with the main frame 18 to allow the implement to fold for transport and storage . viewing from the towing vehicle 14 rearward , there is extending transverse to the rails and slightly forward of the footer bar 32 a rod 40 having a first end ( not numbered ) connected to a first ( right ) wheel assembly 42 and a second end ( not numbered ) connected to a second ( left ) wheel assembly 44 . wheel assembly 42 includes inboard and outboard tires 46 , 48 , respectively , mounted in a conventional manner to inboard and outboard axles 50 , 52 , respectively . the axles 50 , 52 are both connected to a tire mount 54 that is pivotally connected to a mounting bracket 56 that is connected to the footer bar 32 . the tire mount 54 is caused to pivot relative to the mounting bracket 56 by an actuator 58 , which in a preferred embodiment , is a hydraulic actuator having barrel 60 connected to the footer bar 32 by flange 62 and an extendible rod 64 connected to the tire mount 54 in a conventional manner . when the rod 64 is extended , the wheel assembly 42 is rotated underneath the main frame 18 to raise the main frame 18 . conversely , when the rod is retracted , the wheel assembly is pivoted away from the footer bar which causes the frame to be lowered . wheel assembly 44 also includes inboard and outboard tires 66 , 68 , respectively , mounted in a conventional manner to inboard and outboard axles 70 , 72 , respectively . the axles 70 , 72 are both connected to tire mount 74 that is pivotally connected to a mounting bracket 76 that is in turn connected to the footer bar 32 . the tire mount 74 is caused to pivot relative to the mounting bracket 76 by an actuator 78 , which in a preferred embodiment , is a hydraulic actuator having a barrel 80 connected to the footer bar 32 by a flange 82 and an extendible rod 84 connected to the tire mount 74 in a conventional manner . when the rod 84 is extended , the wheel assembly 44 is rotated underneath the main frame 18 to raise the main frame 18 . conversely , when the rod is retracted , the wheel assembly is pivoted away from the footer bar which causes the frame to be lowered . with additional reference to fig3 , 4 a , and 4 b , the hitch frame 16 consists of an a - frame 86 with a coupler 88 at the point - end of the a - frame 86 for attaching to the hitch 26 ( or tow bar ) of the towing vehicle 14 . the legs 86 a , 86 b of the a - frame 86 are connected to a shortened cross member 90 that is pivotably connected to the header bar 30 by a pair of pivots 92 , 94 . a cylinder mount 96 is mounted to the legs 86 a , 86 b generally above the transverse leg 98 of the a - frame 86 . interconnected between the cylinder mount 96 and the coupler 88 is a turnbuckle 100 . a pair of hydraulic cylinders 102 , 104 is interconnected between the cylinder mount 96 and an inverted v - frame 106 . the legs 106 a , v - frame 106 b of the v - frame 106 are attached to the inner rails 36 by brackets 108 , 110 , respectively . the hydraulic cylinders 102 , 104 are pivotally coupled to a bracket 112 , which extends from the forward end of the v - frame 106 . this pivoting connection allows the cylinders 102 , 104 to rotate relative to the v - frame 106 , which , as will be described more fully below , allows the outer rails 28 and the inner rails 36 to be kept relatively level as the vertical position of the tractor hitch 26 changes . the turnbuckle 100 is used for setting the height of the coupler 88 to match the height of the hitch 26 for the towing vehicle 14 pulling the farm implement 12 . that is , the towing vehicle 14 and the farm implement 12 are placed in a fore - aft arrangement and on substantially level ground . the turnbuckle 100 is tuned so that the a - frame 86 is pivoted either upward or downward to match the position of the tractor hitch 26 . it is contemplated that the turnbuckle 100 may include markings or other indicators to guide an operator in setting the tension in the turnbuckle 100 , and thus pivoting the a - frame 86 , based on an expected range of tractor hitch positions , e . g ., a height range of 15 - 22 ″. once this adjustment has been made for the specific tractor , the turnbuckle 100 does not need to be reset . and , as will be described more fully below , the actuators 58 , 78 and hydraulic cylinders 102 , 104 will cooperate to maintain the main frame 18 level through a normal operating range . it is contemplated that tuning devices other than the aforedescribed turnbuckle could be used to adjust the height of the coupler 88 . turning now to fig5 , the present invention provides a hydraulic system 114 for use with farm implement 12 or other similar type of farming implement . farm implement 12 has been described as having a main frame 18 supported by a pair of wheel assemblies 42 , 44 . as noted above however , it is contemplated that the farm implement 12 may be equipped with left and right wing sections ( not shown ) that are each supported by one or more wheel assemblies ( not shown ). the hydraulic system 114 will be described with respect to a farm implement having a main frame and a pair of wing sections , and more particularly , a farm implement having hydraulic cylinders 58 , 78 for raising and lowering the main frame 18 and hydraulic cylinders 116 , 118 for raising and lowering left and right wing sections , respectively . the hydraulic system 114 further includes hydraulic cylinders 102 , 104 which are used to pivot the hitch frame 16 against the tractor hitch 26 to keep the main frame 18 level as the main frame 18 is raised and lowered . the hydraulic system 114 has a supply line 120 that couples in a conventional manner to the supply port 122 of the towing vehicle 14 and a return line 124 that couples in a conventional manner to the return port 126 of the towing vehicle 14 . the supply line 120 supplies hydraulic fluid to cylinders 58 , 78 through a diverter 128 . cylinders 58 and 116 are connected in series such that hydraulic fluid flows from the supply line 120 first through cylinder 58 and then to cylinder 116 through connecting line 130 . in a similar manner , cylinders 78 and 118 are connected in series such that hydraulic fluid from the supply line 120 first through cylinder 78 and then to cylinder 118 through connecting line 132 . in the illustrated embodiment , the hydraulic fluid from cylinder 116 dumps directly into the return line 124 whereas hydraulic fluid from cylinder 118 flows through a diverter 134 to supply hydraulic fluid to cylinders 102 and 104 . hydraulic fluid from both cylinders 102 , 104 dumps into the return line 124 . it will thus be appreciated that cylinders 58 , 78 , 102 , 104 , 116 , and 118 are plumbed together . the volumes of the cylinders are specifically coordinated such that the extension rates of the cylinder rods will cause the implement frame ( main frame and wing sections ) to raise ( or lower ) equally thereby keeping the frames level as they are raised ( or lowered ). the hydraulic system 114 further has a depth control limit switch 136 plumbed between the supply line 120 and wheel assemblies &# 39 ; cylinders , e . g ., cylinders 58 and 78 . the depth control limit switch 136 is utilized to top frame movement at any point in the operational range , thereby allowing an operator to set the depth of tillage . that is , the depth control limit switch 136 stops movement of the frames in the downward direction such that the maximum implement depth desired may be set prior to tillage with the implement fully adjustable above this depth . turning now to fig6 , a hydraulic system 138 according to another embodiment of the invention is shown . in this embodiment , a flow divider 140 is used to provide the correct ratio of hydraulic flow to the cylinders . also , in this embodiment , cylinder 118 dumps into the return line 124 rather than cylinders 102 , 104 . it will further be seen that in this embodiment , a single , rather than two , hydraulic cylinders are used to pivot the hitch frame 16 relative to the tractor hitch 26 . the invention is not so limited however . from fig6 , it will be appreciated the hydraulic fluid flows to both “ sets ” of cylinders , e . g ., lift cylinders 58 , 78 , 116 , 118 and hitch frame cylinder 102 , through the flow divider 140 rather than between the sets of cylinders . from the foregoing , it will be appreciated that the crop residue and soil - conditioning machine of the present invention simplifies initial machine field operation settings . first , the mechanical turnbuckle provides quick and easy adjustment with an indicator showing the positions for draw bar heights from 15 - 22 ″. once this adjustment has been made for the specific tractor used for towing , the turnbuckle need never be changed and the combination of the transport design and hydraulic circuit self levels the implement . to set the main depth of the implement , there is a single point depth control ( not shown ) located conveniently on the leveling frame for easy operator access , e . g ., connected to v - frame 106 and rod 40 with a crank handle ( not shown ) mounted adjacent bracket 112 , on the same side of the tractor as the cab door to minimize distance . by setting this prior to heading to the field , the operator can choose to focus on other operational concerns , while being able to hydraulically raise the machine from the cab . as any of these hydraulic adjustments are made , the self - leveling hydraulic circuit compensates to maintain levelness . the hydraulic self - leveling system enables the operator to make “ on the go ” fine tuning adjustment to the depth of each component on the machine . in an alternate embodiment of the invention , two hydraulic switches — one at the front of the machine attached to the self - leveling component and the other controlling hydraulic fluid flow to the lift cylinders — could be used rather than a flow divider . while the invention has been described in terms of various specific embodiments , those skilled in the art will recognize that the invention can be practiced with modification within the spirit and scope of the claims .

US-201113237208-A

a headgear for securing and positioning a mask suitable for the treatment of sleep disordered breathing is constructed from a composite including polyurethane foam . it includes a back portion with upper and lower straps connected to the back portion . the straps have relatively narrow strap ends the lower straps are displaced downward with respect to the back portion . a quick release mechanism near the front of the face attaches the headgear to the mask . additional components can be attached to the straps to alter their elasticity and stiffness .

the invention provides headgear ( 10 ) for securing and positioning a mask suitable for the treatment of sleep disordered breathing . the headgear is constructed from a composite of polyurethane foam , loop material and hook material whose shape includes a pair of upper straps ( 20 ) and lower straps ( 30 ) and a generally triangular back portion ( 40 ). a piece of hook material ( 22 ) is attached to the end of each of the four straps so that the straps may be secured to the attachment points on the mask . the end includes a main body ( 23 ) and a tapered free end portion ( 25 ). the composite has three layers . the first layer , which in use is positioned against the head of the patient , is constructed from polyester or nylon fabric . the second , middle layer is constructed from an hypoallergenic breathable polyurethane foam . the third layer is constructed from loop material . a suitable material for constructing the composite is breath - o - prene ® manufactured by accumed , new york , united states of america . the total thickness of the composite is approximately 2 mm . the upper and lower pairs of straps are approximately 150 mm apart when laid flat . the upper and lower straps have an approximate total length ( from the left side to the right side ) of 610 mm . the generally triangular back portion ( 40 ) of the headgear ( 10 ) is constructed and arranged to engage generally with the occiput of the patient &# 39 ; s head in use . in use , the base of the triangle is positioned at the crown of the head , while the apex of the triangle lies generally just above the point of contact between the skull and the muscles of the neck . the headgear of the present invention is configured to minimize the discomfort associated with the use of hook material . in prior art headgear , that discomfort can arise where the hook material may be in contact with the patient &# 39 ; s skin , say the cheek or neck regions , for extended periods of time . that undesirable contact will occur where the hook material , to some extent is not entirely located on the receiving loop material , but lies tangential to the loop material , and to some extent extends beyond the loop material and comes in contact with the patient &# 39 ; s skin , either continuously while the headgear is in use or when it is compressed against the skin , as can occur when the patient head changes position during the sleep period . as shown in fig4 , the width of each lower strap is constant for approximately half their length , forming a relatively wide portion ( 24 ), and then over a relatively short distance , changes to a narrower width for the remaining half of their length , forming a relatively narrow portion ( 26 ), terminating at the point where the hook material ( 22 ) is joined to the composite material . a characteristic of this configuration is that the point of contact where the hook material detachably binds with the strap loop material is positioned on the wide portion ( 24 ) and is wider by approximately 1 cm than the width of the engaging hook material . by adopting this configuration , the target region for binding is relatively greater in area than is the case with prior art . prior art headgear includes a tapered end hook section that is of narrower width than that of the intended contact loop section of the strap . however , the prior art hook section tapered end is less than one half the length of the hook section , that is , it does not represent the majority of the length of the hook section nor does its length represent the majority of the length of the intended corresponding contact loop section ( i . e ., the maximum extent of the loop section covered by the hook section ). in contrast to the prior art , with the present invention the attachment of the hook material is facilitated , as relatively less precision is required in the placement of the hook section to achieve binding . this reduced dependence on precision is of advantage to all persons using the headgear and is of particular benefit to the user that may be trying to fit the headgear in a home environment and where it is not possible to directly sight the headgear components they are manipulating . furthermore , compared to the prior art ( where the hook material and the target region are of substantially the same width ), this configuration reduces the chance of exposing some of the hook material to interfere with the wearer , causing discomfort and possibly skin irritation or abrasion . a length of each of the left and right lower straps is displaced vertically lower by approximately 1 cm ( 28 ). by adopting this configuration , it is possible to optimize the design of the base of the back portion so as to achieve the desired security of attachment but avoid compromising comfort in a situation where the lowest point of the headgear in the occiput region is extended to a position that is lower than is otherwise required in order to achieve a sufficiently lowest strap point . this approach avoids the prior art problem of having the headgear rear portion extending beyond what would otherwise be required and thereby engaging the sensitive area below the occipital lobe . preferably the headgear of the present invention includes a quick release mechanism ( 50 ) ( see fig5 ), and this is especially so when the headgear is intended to be used with a mask that covers the patient &# 39 ; s nose and mouth . the quick - release mechanism ( 50 ) suitable for incorporation into the preferred embodiment is constructed from a sub - assembly of three components : ( i ) a release loop of a cord material ( 52 ), ( ii ) a generally rectangular length of hook material ( 54 ), and ( iii ) a generally rectangular length of a composite fabric ( 56 ) which can bind to the hook material , as discussed above . the sub - assembly is generally rectangular in shape and in use forms an extension of one of the lower straps . preferably the loop cord is constructed from braided cord about 17 cm long . the cord loop ( 52 ) is sewn to one end of the length of hook material ( 54 ). the hook material ( 54 ) and composite fabric ( 56 ) are joined at the other end of the hook material ( 54 ), preferably via a weld joint . in use , the end of the hook material ( 54 ), to which is connected the loop cord ( 52 ), is secured , using the hook and loop mechanism , to the end of a modified lower strap which , in contrast to the lower straps ( 30 ) shown in fig4 , does not contain hook material . the other end ( 56 ) of the quick release mechanism ( 50 ) is free to be connected to a headgear attachment point on the mask shell and releasably attached to an exposed portion of the hook material ( 54 ). if it is desired to use the quick - release mechanism ( 50 ), it is convenient for the patient to pull down on the loop of braided cord ( 52 ), thereby disengaging the lower strap from the mask shell and allowing the mask to then be readily removed from the patient &# 39 ; s face . a quick - release mechanism of this configuration may be used on headgear that is fabricated of materials and in configurations that are different to those of the type described above and as such is an invention in its own right . in one form of the invention , the extensibility of the straps can be altered by attaching lengths of generally inextensible material ( 62 ) such as cotton or silk to the straps , as shown in fig6 b . the effect of this arrangement is to make the headgear less extensible along the length of the straps than in a vertical direction . in a preferred embodiment , lengths of cotton are sewn to the straps . in another form of the invention , the stiffness of the straps can be altered by attaching stiffening material ( 64 ) to the top and bottom edge of the straps , as shown in fig6 a . alternatively , or in addition , the strap may be stiffened by any other suitable means including by adding stitching as lines , in a crisscross pattern , or both . this makes the headgear less “ floppy ” and more convenient to put on the head of a wearer . in another form of the invention , the headgear is constructed from an anisotropic material that is more extensible in a first direction than in a direction at an angle of 90 degrees to the first direction . this enables the headgear to be cut from a single piece of composite material and yet have different extensibilities in different directions . preferably , the headgear will be more extensible in a vertical direction than in a horizontal direction . hence the upper and lower straps will be less extensible in a direction along their length than in a direction along their width . this means that the back portion of the headgear can be more extensible in a direction from the base of the skull to the crown , than in a direction at right angles to that direction .

US-80578710-A

an extraction device for extracting some or all of a tooth from a patient , such as the root of the tooth . one embodiment of the device includes an extraction bit having helical windings without a linear core portion separate from the windings , and in that manner is distinguishable from a common screw . the extraction bit may include a partial - spiral flute or groove formed in a tip thereof . a lockable and releaseable hand piece for attaching to the extraction bit provides leverage to the user for dislodging the tooth root , and is reversible in its attachment position to the extraction bit .

for the purposes of promoting an understanding of the principles in accordance with the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended . any alterations and further modifications of the inventive features illustrated herein , and any additional applications of the principles of the invention as illustrated herein , which would normally occur to one skilled in the relevant art and having possession of this disclosure , are to be considered within the scope of the invention claimed . applicant has discovered that the process of extracting a severed tooth root from the mouth of a patient is enhanced significantly by using a special helical extraction bit with a fluted tip . the special extraction bit is applied to the severed tooth root with a conventional dental drill . as the bit penetrates the tooth root , it burrows into the root and its special design causes it to dislodge and displace tooth root particulates from the root as it burrows , thereby reducing and even eliminating splitting action within the tooth root , and without removing any part of the jaw bone . the disadvantages described above in conjunction with the prior art tooth root extraction devices are overcome by the invention shown in fig4 - 11 . before discussing the operation and further advantages of the invention , it is thought proper to explain the structural aspects of the invention , as illustrated in the accompanying drawings , in detail . referring to fig5 an extraction bit 30 is inserted into a conventional dental drill 32 . the bit 30 terminates in a distal body 34 comprising a plurality of substantially helical windings 36 extending in a generally proximal - to - distal direction helical winding . at least a majority length of the distal body 34 is characterized by an absence of an elongate linear core portion such as a solid or hollow cylindrical core , for example separate from the helical windings 36 . although the distal body 34 does not actually have a hollow core portion , the helical windings 36 characterize the entire distal body 34 , as opposed to a conventional wood screw 38 as shown in fig4 which has a linear core portion 40 separate from and in addition to its conventional threads 42 . although the windings 36 are presently preferred , the principles of the present invention also include the alternative windings shown in fig8 . more specifically , fig8 shows an extraction bit 80 having a distal body 82 comprised of helical windings 84 that surround a central core space 86 , as opposed to the windings 36 of fig5 which do not define a central core space . of course , neither the distal body 34 of fig5 nor the distal body 82 of fig8 include an elongate linear core portion separate from the helical windings 36 ( fig5 ) or 84 ( fig8 ), respectively . this structural aspect of having helical windings without having a separate elongate linear core portion distinguishes the embodiments of fig5 and 8 from common screw 38 shown in fig4 said screw 38 having the separate linear core portion 40 in addition to windings or threads 42 that are formed upon the core portion 40 . the windings 36 of fig5 are not formed upon a core portion since there is no separate core portion , even though the windings 36 may not define a hollow core space like the core space 86 defined by the windings 84 in fig8 . stated another way , the helical windings 36 of fig5 define a substantially helical axis ( shown most clearly as item 54 in fig6 ) without the windings 36 surrounding a central core space , as opposed to the windings 84 of fig8 which do indeed surround the central core space 86 . the helical windings 36 of fig5 and the helical windings 84 of fig8 preferably comprise less than five windings . it is further preferable that the windings 36 and 84 define a linear length , such as indicated by brackets 34 and 82 , respectively , that is greater than one - tenth and less than one - half of a length of the extraction bits 30 and 80 , respectively . referring now to fig9 it is further shown that the principles of the present invention also include an extraction bit 90 having a distal body 92 which includes helical windings 94 formed upon and surrounding a separate linear core portion 96 , as opposed to the windings 36 and 84 of fig5 and 8 , respectively , which do not have any such linear core portion . the helical windings 94 preferably terminate in a tip portion 98 which has an open recess 100 formed therein . the open recess 100 is preferably a partial - spiral groove . the recess 100 is formed in the sides of the windings 94 and in a distal half of the distal body 92 . the recess 100 is preferably in a section of winding that comprises less than one - half of one winding , preferably less than one - third of one winding , more preferably less than one - fourth of one winding , and most preferably less than one - fifth of one winding . the recess 100 comprises an elongate shape that extends in a generally nonparallel direction with respect to a helical axis of the windings 94 . the conventional dental drill 32 of fig5 is operable to rotate the bit 30 as known to those of ordinary skill in the field of dentistry . the drill 32 may therefore be described as a rotating means for rotating the bit 30 to thereby embed at least a portion of the distal body 34 into the root 12 ( fig1 - 2 ) of a tooth . the dental drill 32 is also described as a motorized boring instrument . referring now more particularly to fig5 and 6 , the helical windings 36 preferably terminate in a tip portion 46 which has an open recess 48 formed therein . the open recess 48 is preferably a partial - spiral groove . the helical windings 36 comprise a proximal half 50 and a distal half 52 , and the recess 48 is formed in the sides of the windings 36 and in the distal half 52 of said distal body 34 . the recess 48 is preferably formed in a distal - most portion of the windings 36 , in a section of winding that comprises less than one - half of one winding , preferably less than one - third of one winding , more preferably less than one - fourth of one winding , and most preferably less than one - fifth of one winding . the helical windings 36 define a substantially helical axis 54 . the recess 48 comprises an elongate shape that extends in a generally nonparallel direction with respect to the helical axis 54 , as shown in fig6 . referring now to fig5 - 7 , a cross - section of the helical windings 36 taken orthogonal to the helical axis 54 comprises a teardrop shape 56 as shown in fig7 . the teardrop shape 56 has a single point 58 at one end thereof . preferably , an exterior perimeter 60 of the cross - sectional teardrop shape 56 includes two opposing concave sections 62 that are adjoined to form the single point 58 . the teardrop shape 56 is preferably substantially symmetrical . the single point 58 of the cross - sectional teardrop shape 56 indicates a helical exterior edge 64 that is formed on the distal body 34 . the helical edge 64 is preferably sharpened to accomplish a cutting action therewith when the distal body 34 is rotatably embedded into the tooth root 12 . the bit 30 further includes a proximal portion 66 having an at least partially annular recess 68 formed therein , and a central portion 70 interconnecting the proximal portion 66 and the distal body 34 . the central portion 70 and proximal portion 66 are preferably characterized by an absence of threads formed thereon . as shown most clearly in fig5 the helical windings 36 define a surrounding outer boundary , represented schematically by dashed lines 74 , that tapers radially inwardly in a proximal - to - distal direction . the windings 36 may alternatively define a surrounding outer boundary having a substantially constant radius along a majority length of said windings . referring now to fig1 - 12 , the invention further includes a hand piece 110 , which operates as an extraction means for extracting the extraction bit 30 of fig5 and the tooth root 12 of fig2 from a mouth of a patient . the hand piece 110 includes a head 112 , which operates as a gripping means for gripping the extraction bit 30 when said bit 30 is embedded in the tooth root 12 , such that a proximal portion 114 of said gripping means ( head 112 ) extends laterally outward from the bit 30 ( shown in phantom line in fig1 ). the hand piece 110 further includes a handle means 120 defining a central axis 122 at a distal end 124 thereof for receiving the proximal portion 114 of the head 112 on said distal end 124 . a locking means 126 , preferably disposed on the distal end 124 of the handle means 120 , is provided for locking said proximal portion 114 of the head 112 to said handle means 120 at any of a plurality of selectable positions of said proximal portion 114 about the central axis 122 of the handle means 120 . accordingly , the handle means 120 and the head 112 are releasably attached to one another , preferably by the locking means 126 . the handle means 120 preferably comprises an elongate , reversible handle member defining an arch , as shown most clearly in fig1 . the locking means 126 preferably comprises a spring - loaded pin member disposed in the distal end 124 of the handle means 120 . the proximal portion 114 of the head 112 includes one or more apertures 128 formed therein , configured and positioned to be aligned with the spring - loaded pin 126 . accordingly , the user may adjust the position of the head 112 about the axis 122 of the handle means 120 by simply depressing the spring - loaded pin 126 and rotating the head 112 relative to the distal end 124 of the handle means 120 about the axis 112 , until the spring - loaded pin 126 is aligned with a desired aperture 128 at which time the pin 126 is ejected through said aperture 128 by the spring portion 130 to thereby releasably secure the head 112 in position relative to the handle means 120 . the proximal end 114 of the head 112 includes a receiving chamber formed therein , said receiving chamber being configured and adapted to receive the distal end 124 of the handle means 120 . the apertures 128 are formed in sidewalls of the proximal end 114 for receiving the pin member 126 therethrough when aligned with said pin member 126 . the invention may be designed to have two apertures 128 positioned opposite one another on opposing sides of the proximal end 114 , to thereby permit 180 - degree reversibility of the head 112 relative to the handle means 120 . alternatively , there may be several apertures 128 formed in the proximal end 114 of the head 112 . the head 112 preferably includes a plurality of sliding members 132 and a means for ( i ) sliding said sliding members 132 radially inwardly into a locking position about the bit 130 and ( ii ) sliding said sliding members 132 radially outwardly into a releasing position . the operative features of the head 112 are shown more clearly in fig1 . the sliding members 132 each include a beveled contacting face 134 which engages a corresponding beveled contacting face 136 of a button 138 . as shown in fig1 , there are preferably four separate sliding members 132 slidably disposed in the casing 133 of the head 112 , each sliding member being biased by a lateral spring member 140 shown in fig1 . the button 138 thus rests upon the beveled contacting faces 134 of the sliding members 132 , and also upon axial spring members 142 . the axial spring members 142 are disposed between the button 138 and a stopping plate 144 , said stopping plate 144 in turn resting in slidable engagement upon ribs 146 of the sliding members 132 . as such , when the extraction bit 30 is inserted into the head 112 , it abuts the stopping plate 144 which holds the bit 30 into a position with the annular recess 68 being in alignment with lateral contacting faces 148 of the sliding members 132 . the button 138 must be pressed downwardly ( in the direction indicated by arrow 150 ) to force the sliding members radially outwardly by engagement along the beveled contacting planes between surfaces 134 and 136 , to thereby remove the lateral contacting faces 148 sufficiently to permit insertion of the bit 30 into the head 112 and against the stopping plate 144 . once the bit 30 resides against the plate 144 with the annular recess 68 in alignment with the lateral contacting faces 148 of the sliding members 132 , and button 138 is released by the user to permit the lateral contacting faces 148 of the sliding members 132 to slide into position within the annular recess 68 of the bit 30 , thereby releasably locking the bit 30 within the head 112 . in operation , the bit 30 is inserted within the dental drill 32 , which the operator actuates to induce either a low - speed or high - speed rotational movement to the bit 30 about its elongate axis . the operator , typically a dentist , then applies the rotating bit 30 to the severed root 12 shown in fig2 . once a sufficient portion of the windings 36 of the bit 30 has been properly embedded into the tooth root 12 with the drill 32 , the drill 32 is removed . the bit 30 may be further turned by hand , or with the aid of a manually operable gripping tool 72 which might illustratively comprise a wrench , in order to refine the position of the bit 30 within the tooth root 12 . the gripping tool 72 is thus configured and adapted for gripping the bit 30 when the bit 30 is at least partially embedded within a portion of the tooth of a patient , such as the root 12 . when the bit 30 is properly lodged within the severed root 12 to the operator &# 39 ; s satisfaction , the hand piece 110 is locked in place to the proximal end 66 of the bit 30 . at this point the handle means 120 is extending laterally outwardly from the bit 30 . the operator simply grasps the handle means 120 to lift and elevate the tooth root 12 from the mouth of the patient . the head 112 of the hand piece 110 and its internal working structure as explained above collectively provide the advantages of a quick engagement and release of the head 112 to the bit 30 . the operator simply presses the button 130 to slide the sliding members 132 radially outwardly enough to permit entry of the proximal end 66 of the bit 30 into the head and into position against the stopping plate 144 as shown in fig1 . the arch of the handle means 120 aids the operator in providing an optimal lifting force to the tooth root 12 , in that the operator may choose whichever point along the arched portion is optimal according to experience to grip and lift as may best suit the particular position of the root 12 and the configuration of the patient &# 39 ; s mouth ( not shown ). the operator will likely prefer to position the arch of the handle means 120 to extend upwardly from the patient &# 39 ; s mouth when extracting a root from the upper teeth of the patient . the handle means 120 is conversely positioned downwardly from the patient &# 39 ; s mouth when extracting a root from the lower teeth . the versatility of applicant &# 39 ; s invention permits the operator to use the single hand piece 110 regardless of whether the severed root to be extracted resides among the upper or lower teeth . the handle means 120 may also be re - positioned with respect to the head 112 , by utilizing the locking means 126 as explained above . accordingly , the extraction bit 30 may be described as an embedding means for becoming at least partially embedded within a portion of the tooth root 12 of a patient , said embedding means terminating in a distal body 34 comprising a plurality of substantially helical windings 36 extending in a generally proximal - to - distal direction , wherein at least a majority length of said distal body 34 is characterized by an absence of an elongate linear core portion separate from said helical windings 36 . it will be appreciated that the structure and apparatus disclosed herein in the form of the bits 30 , 80 and 90 are merely examples of embedding means within the principles of the present invention , and it should be appreciated that any structure , apparatus or system for embedding which operates the same as , or equivalent to , those disclosed herein are intended to fall within the scope of an embedding means as applied to tooth extraction , including those structures , apparatus or systems for embedding which are presently known , or which may become available in the future . anything which functions the same as , or equivalently to , an embedding means as described herein falls within the scope of this element . in accordance with the features and combinations described above , a preferred method of extracting at least a portion of a tooth from a mouth of a patient comprises the steps of : ( a ) boring a hole into the portion of the tooth with a boring instrument and displacing tooth particulates with said boring instrument , as said hole is being bored , without splitting said portion of the tooth , and lodging the boring instrument into a position of stability in the portion of the tooth ; and ( b ) extracting the portion of the tooth by retracting the boring instrument from the mouth of the patient . another method of extracting at least a portion of a tooth from a mouth of a patient comprises the steps of : ( a ) boring a hole into the portion of the tooth with a motorized boring instrument having a partial - spiral flute formed in a tip section thereof without removing any portion of a jaw bone of the patient , and lodging at least a portion of the boring instrument into a position of stability in the portion of the tooth ; and ( b ) extracting the portion of the tooth by retracting the boring instrument from the mouth of the patient . a still further method of extracting at least a portion of a tooth from a mouth of a patient comprises the steps of : ( b ) activating the motorized boring instrument and boring the bit into the portion of the tooth and lodging at least a portion of the bit into a position of stability in the portion of the tooth ; ( d ) extracting the portion of the tooth by elevating the arched handle without maintaining any force - distributing member in a static position against any teeth of the patient . it is to be understood that the above - described arrangements are only illustrative of the application of the principles of the present invention . numerous modifications and alternative arrangements may be devised by those skilled in the art without departing from the spirit and scope of the present invention and the appended claims are intended to cover such modifications and arrangements . thus , while the present invention has been shown in the drawings and fully described above with particularity and detail in connection with what is presently deemed to be the most practical and preferred embodiment ( s ) of the invention , it will be apparent to those of ordinary skill in the art that numerous modifications , including , but not limited to , variations in size , materials , shape , form , function and manner of operation , assembly and use may be made without departing from the principles and concepts set forth herein .

US-16709698-A

the present invention relates to a composition for the enzymatic hydrolysis of lactose containing two lactase enzymes having distinct ph optima . the composition is suitable for treating or controlling the symptoms of lactose intolerance in humans .

the present invention is characterized by the use of first and second , active lactases , having different optimum ph ranges , for the enzymatic hydrolysis of lactose . this composition may be used to treat or control the symptoms of lactose intolerance in animals , particularly mammals such as humans . as used in the present invention , “ optimum ph range ” means the ph over which the hydrolytic activity of the lactase is within about 10 to 100 percent of its maximum , and “ optimum ph value ” means the ph at which the lactase exhibits maximum hydrolytic activity . fig1 and 2 show the optimum ph ranges and values for lactase derived from a . oryzae and k . lactis , respectively . the reaction conditions for fig1 were 2 . 0 μg / ml ( micrograms / milliliter ) a . oryzae lactase , 4 . 7 % lactose , 30 ° c . and 10 min . reaction . the reaction conditions for fig2 were 200 μg / ml k . lactis lactase , 0 . 25 % o - nitrophenyl - β - d - galactoside ( substrate ), phosphate buffer , 0 . 1 mm mg ++, 37 ° c . and 15 min . reaction . the first , active lactase is preferably an enzyme that is capable of catalyzing the hydrolysis of lactose in the stomach . lactases derived from fungi are generally known to have optimum ph values which fall within the acid range . gekas , et al ., supra , p . 3 . the first , active lactase preferably has an optimum ph range that is within the range of about ph 3 . 0 to about ph 6 . 0 . the first , active lactase can be derived from the following genera of fungi : aspergillus ; mucor ; fusarium ; scopuloriopsis ; alternaria ; and curvularia and the bacterium thermus aquaticus . the lactases , having the optimum ph value shown in the parentheses , are preferably derived from the following fungi : aspergillus oryzae ; ( 4 . 5 - 5 . 0 ) aspergillus niger ( 3 . 0 - 4 . 0 ); fusarium moniliforme ( 3 . 8 - 5 . 0 ); scopulariopsis ( 3 . 6 - 5 . 0 ); mucor pucillus ( 4 . 5 - 6 ), alternaria alternara ( 4 . 5 - 5 . 5 ); and curvularia inaegualis ( 3 . 4 - 4 . 3 ) and the bacterium thermus aquaticus ( 4 . 5 - 5 . 5 ). the second , active lactase has an optimum ph value which falls within the more neutral region . this lactase is capable of catalyzing lactose hydrolysis in the neutral environments of the intestines and the stomachs of the elderly , suffering from achlorhydria , and users of h 2 blockers . the optimum ph range for these enzymes is preferably , within the range of about ph 6 . 0 to about ph 8 . 0 . because of this activity in the neutral region , the second , active lactase is capable of hydrolyzing any undigested lactose which may be passed to the intestines , as well as any lactose in the stomach of a user having a more neutral stomach ph . lactases derived from yeast and bacteria are generally known to have optimum ph values in the more neutral region ( 6 - 7 and 6 . 5 - 7 . 5 , respectively ). gekas , et al ., supra , p . 2 . the second , active lactase can be derived from organisms within the genera of kluyveromyces ( saccharomyces ), lactobacillus , bacillus , streptococcus , and escherichia . lactase derived from the following organisms , having the optimum ph value shown in the parentheses , are preferred : kluyveromyces lactis ( 6 . 5 ), kluyveromyces fragilis ( 6 . 6 ), lactobacillus thermophilus ( 6 . 2 - 7 . 1 ), bacillus circulans ( 6 . 0 ), lactobacillus bulgaricus ( 7 . 0 ), leuconostoc citrovorum ( 6 . 5 ), bacillus stearothermophilus ( 6 . 0 - 6 . 4 ), streptococcus thermophilus ( 6 . 5 - 7 . 5 ), and bacillus sp . ( 6 . 8 ). in view of the above - noted article by genkas , et al ., which is hereby incorporated by reference , it will be appreciated that the lactases used in the present invention can be produced by a variety of well known techniques . many of these lactases are produced by commercial processes which cultivate the bacterium , yeast or fungus , and then isolate the lactase from the culture or culture broth of the microorganism . further techniques for preparing such lactases may be found in u . s . pat . no . 3 , 629 , 073 , issued dec . 21 , 1971 ; u . s . pat . no . 3 , 718 , 739 , issued feb . 27 , 1973 ; and u . s . pat . no . 3 , 919 , 049 , issued nov . 11 , 1975 , all of which are hereby incorporated by reference . in accordance with another embodiment of the present invention , the second lactase having an optimum ph range encompassing the neutral region may contain an enteric coating . this coating remains intact in the stomach , but will dissolve and release the second active lactase once it reaches the more neutral environment of the small intestine . the enteric coating protects against irreversal deactivation of the lactase in the stomach , thus making the enzyme available for hydrolysis of lactose in the intestines . however , if the patient suffers from achlorhydria , the second active lactase is generally not enterically coated . suitable enteric coatings for the second active lactase include amylose acetate phthalates , styrene - maleic acid copolymer , cellulose acetate succinate , cellulose acetate phthalate , polyvinyl acetate phthalate , hydroxy - propylmethylcellulose phthalate , fatty acids , fatty acid esters , glycerol esters , polyglycerol esters , paraffin waxes , carnauba wax , formalized gelatin , shellac and hydrogenated vegetable waxes , such as hydrogenated castor oil and cottonseed oil . other suitable enteric coatings are disclosed in lieberman , h . a . et al ., pharmaceutical dosage forms : tablets , vol . 3 , pp . 114 - 116 ( 1990 ), which is hereby incorporated by reference . the enteric coating is applied to the second lactase using conventional particle coating techniques . if the second lactase is granulated with other excipients , the resulting granule may also be coated with the enteric material . the enterically coated second lactase will generally contain from about 2 to about 15 weight percent of the enteric coating . if the composition is intended for use in patients having a more neutral stomach ph , a portion or all of the second lactase particles may be free of the enteric coating . if only a portion of this enzyme in the composition is enterically coated , the uncoated enzyme is , upon ingestion , immediately available for hydrolysis of lactose in the stomach , while the enterically coated enzyme is available for lactose hydrolysis in the intestines . the lactase compositions of the present invention can be combined with a pharmaceutically acceptable carrier and administered orally . the unit dosages of these compositions may be in the form of solid preparations , such as tablets , pills , capsules , caplets , powders , granules and wafers , or liquid preparations , such as suspensions or dispersions in aqueous or non - aqueous vehicles , such as syrups and elixirs . in preparing solid unit dosage forms , the first and second lactases are mixed with conventional solid fillers or carriers , such as starch , talc , calcium phosphate , calcium sulfate , calcium stearate , magnesium stearate , stearic acid , sorbitol , mannitol , gelatin , natural or synthetic gums , such as carboxymethylcellulose , methylcellulose , alginates , dextrans , acacia gum , karaya gum , locust bean gum , tragacanth and other conventional carriers . additionally , other excipients such as diluents , binders , lubricants , disintegrants , colors and flavoring agents may be employed . suitable liquid forms of the present invention can be prepared by incorporating the lactase in aqueous or non - aqueous dispersions , suspensions , or solutions . conventional liquid carriers such as glycerol , and edible glycols , edible oils , such as cottonseed oil , soybean oil , corn oil , peanut oil , safflower oil , and other triglyceride oils , and dispersing or suspending agents , such as the aforementioned natural and synthetic gums . conventional methods are employed for preparing the solid and liquid forms of the present invention . suitable techniques are described in remington &# 39 ; s pharmaceutical sciences , 18th ed ., chapters 83 and 89 ( 1990 ), which is hereby incorporated by reference . the lactase compositions of the present invention can also be produced in powdered or granular form for direct admixture with food products consumed by subjects suffering from lactose intolerance . for instance , in the case of a lactose intolerant infant , a suitable amount of the lactase composition of the present invention , in a powdered or granular form , can be added directly to the milk or other food consumed by the infant . in the case of an animal , such as a mammal , that normally requires a dietary regime of whey , the lactase composition of the present invention may be added directly to the whey . the lactases employed in the compositions are present in therapeutically effective amounts to hydrolyze the lactose normally present in the food products consumed by the subject . this amount , of course , will vary within wide limits , depending in part upon the lactase activity of the particular enzyme , the magnitude of the lactose intolerance in the particular subject and the dietary characteristics of the subject . in general , on an oral unit dosage basis for humans , the composition contains the first lactase in an amount equivalent to about 3000 to about 6000 fcc lac u and the second lactase in an amount equivalent to about 7000 to about 35 , 000 neutral lactase units . a fcc lactase unit ( fcc lac u ) and a neutral lactase unit are defined as that quantity of enzyme that will liberate 1 μmol of o - nitrophenol from o - nitrophenyl - β - d - galactoside per minute under the conditions , of the assay described in food chemicals codex , national academy press , wash ., d . c ., pp . 491 - 2 ( 1981 ), which is hereby incorporated by reference , at ph 4 . 5 and 6 . 5 , respectively . when the composition is in the form of a tablet or other solid form , a unit dosage will generally contain from about 1 to about 15 weight percent of the first lactase , from about 8 to about 80 weight percent of the second lactase and from about 20 to about 80 weight percent of a pharmaceutically acceptable carrier . the lactase composition is administered to the subject prior to or concurrently with the consumption of lactose - containing food products . the following example illustrates a specific embodiment of the present invention . this invention , however , is not confined to the specific limitations set forth in this example but rather to the scope of the appended claims . unless otherwise stated , the percentages and ratios given below are by weight . this example provides a formulation for preparing a caplet form of the present invention containing an enzyme derived from aspergillus oryzae as the first lactase enzyme having activity in the acid region and an enzyme derived from kluyveromyces lactis as the second lactase having activity in the neutral region . each caplet has a total weight of 770 mg and an adult human would generally consume two or more caplets per dose . the lactase powder derived from k . lactis is coated with the following enteric suspension : the enzyme powder is charged into a wurster fluidized bed coating apparatus and fluidized by a flow of warm air . the enzyme powder attains a product temperature of 28 - 37 ° c . the enteric suspension is then sprayed onto the fluidized enzyme particles at a rate of 9 ml / min . until the coated enzyme particles contain approximately 13 % by weight of the enteric coating . the enterically coated enzyme particles are combined with the following ingredients to produce the caplet : the enterically coated lactase ( k . lactis ), lactase derived from a . oryzae and microcrystalline cellulose are dry blended in a twin shell blender for 20 min . the magnesium stearate is added to the mixture and blended for an additional 5 min . the mixture is then compressed into a caplet on a rotary tablet press . various modifications can be made from the above - described embodiments without departing from the spirit and scope of the present invention .

US-54397595-A

a medical unit including a unit main body having an upper face and a circuit therein . the unit main body further including an input means arranged on the upper face and connected to the circuit , and a connected section arranged on the upper face to which the connector section of an external device is connected . preferably , the medical unit includes : an ultrasonic probe having a probe element at its distal end and an electrical connection section at its proximal end ; and an ultrasonic diagnostic unit main body having an upper face and a circuit therein for processing ultrasonic signals transmitted from said ultrasonic probe element , said ultrasonic unit main body further including an input means arranged on said upper face and connected to said circuit , and a connected section arranged on said upper face to which said electrical connection section is connected .

although this invention is applicable to numerous and various types of medical units , it has been found particularly useful in the environment of ultrasonic diagnostic units . therefore , without limiting the applicability of the invention to ultrasonic diagnostic units , the invention will be described in such environment . referring now to fig1 - 3 , a first embodiment of the medical unit according to the present invention will be described . as shown in fig1 , the ultrasonic diagnostic unit 1 according to the present embodiment comprises an ultrasonic probe 2 , an ultrasonic diagnostic unit main body 3 ( hereinafter referred to as “ diagnostic unit main body ”) to which the ultrasonic probe 2 is connected , and a display device 4 that can display ultrasonic diagnostic images . although in the present embodiment , the display device is designed to be separated from the ultrasonic diagnostic unit main body , the display device may be integrated into the ultrasonic diagnostic unit main body . the ultrasonic probe 2 has an insertion section 21 that is inserted into a body cavity , a probe element ( not shown ) embedded in the distal section of the insertion section , and a probe connector section 22 disposed on the proximal section of the insertion section 21 as an electric connection section . an electric contact point ( not shown ) is arranged on the probe connector section 22 . the diagnostic unit main body 3 includes a unit main body connector section 31 , to which the probe connector section 22 is removably connected , and an ultrasonic transmit - receive circuit to produce ultrasonic driving signals and process ultrasonic signals . the display device is connected to the diagnostic unit main body 3 via an image cable 41 . a control panel 32 is arranged on the upper face of the diagnostic unit main body 3 . the control panel 32 allows a user to control and direct external devices including the unit main body connector section 31 , ultrasonic probe 2 , and display device 4 . the control panel 32 is preferably comprised of waterproof or water - resistant members including a waterproof sheet - like switch . the control panel 32 is , for example , comprised of a power switch 34 , various switches including a gain switch 35 a for adjusting the amplification degree of ultrasonic echo , and a freeze switch 35 b for stopping ultrasonic image updating , a keyboard switch 36 for alphanumeric character , katakana , hiragana , etc . the unit main body connector section 31 and control panel 32 are arranged side by side . the unit main body connector 31 has a concave shape substantially corresponding to that of the probe connector section 22 of the ultrasonic probe 2 . the unit main body connector 31 further has plural electric contact points 33 electrically conducting to corresponding electric contact points of the probe connector section 22 arranged on the bottom face 31 a of the concave section of the probe connector section 22 . thus , as shown in fig3 , the probe connector section 22 is designed to be attached to or removed from the unit main body connector section 31 in a direction substantially vertical to the upper face of the diagnostic unit main body 3 . in the present embodiment , since the control panel 32 is situated in the upper part of the ultrasonic diagnostic unit 1 , the unit main body connector section 31 is also arranged in the upper part of the ultrasonic diagnostic unit 1 . as shown in fig4 and 5 , a cover 42 is arranged over the unit main body connector section 31 to cover it , and can be opened and closed with respect to axis 43 . at least a portion of the cover 42 is formed out of transparent material . the cover 42 is designed to be shut while the probe connector 22 is connected to the unit main body connector section 31 . with the cover 42 closed , dust or water cannot easily infiltrate into the unit main body connector section 31 . moreover , a control section ( not shown ) is embedded in the ultrasonic diagnostic unit to terminate the passage of electric current to the unit main body connector section 31 . the control section has a detection means ( not shown ) to detect the cover 42 opening or closing . the detection means may be a well - known optical sensor or contact sensor , which allows terminating the passage of electric current to the unit main body connector section 31 when the cover 42 is closed . therefore , electric contact points on the unit main body connector section 31 are protected from shorts . referring back to fig3 , a knob section 23 is preferably arranged on the probe connector section 22 . the knob section 23 allows the probe connector section 22 to be attached to and removed from the unit main body connector section 31 . by appropriately operating the knob section 23 , the probe connector section 22 can either be fixedly retained to or removed from the unit main body connector section 31 . in addition , an information display section 24 is arranged on the probe connector section 22 . the information display section 24 is an identifying means for identifying the kind of the ultrasonic probe 2 , and in the present embodiment , probe information including frequency is specified . the information display section is situated near the control panel 32 when the probe connector 22 is connected to the unit main body connector section 31 . since the cover 42 is transparent , the information display section 24 can be viewed from the outside even when the cover 42 is in a closed position . although in the present embodiment , the cover is preferably transparent as a whole , only a portion corresponding to the information display section may be formed out of transparent material . as shown in fig2 , the size of the diagnostic unit main body 3 can be miniaturized using high - density mounting technology such as ic technology . in the diagnostic unit main body 3 , are arranged an ultrasonic transmit - receive circuit 37 for transmitting and receiving ultrasonic signals , and forming beams , via the probe connector section 22 connected to the unit main body connector section 31 , a control panel controlling circuit 38 connected to various switches 34 , 35 a , 35 b , etc . on the control panel 32 , and a video signal producing circuit 39 for producing video signals ( image signals ) from electric signals transmitted from the ultrasonic transmit - receive circuit 37 and outputting them . the operation of the ultrasonic diagnostic unit 1 of the present invention will now be described with reference to fig1 - 3 . at first , the surgeon selects an ultrasonic probe 2 , and the probe connector section 22 of the ultrasonic probe 2 is fit in the unit main body connector section 31 . and , by operating the knob section 23 , the probe connector section 22 is fixedly retained to the unit main body connector section 31 . next , the power switch 34 arranged on the diagnostic unit main body 3 is turned on , and switches 34 , 35 a , 35 b , etc . on the control panel 32 are appropriately operated . this allows control signals to be transmitted from the control panel controlling circuit 38 to the ultrasonic transmit - receive circuit 37 . thus , it is possible to control the ultrasonic functions to adjust the amplification degree of echo signals , or to stop transmitting and receiving ultrasonic waves , for example . next , ultrasonic diagnosis starts . ultrasonic signals are transmitted from the ultrasonic probe element ( not shown ), while reflected echo signals are received by the ultrasonic probe element . after being amplified , the received echo signals are converted into digital signals thorough an a / d converter ( not shown ), and formed into beams through a digital delay circuit ( not shown ). those signals formed into beams are processed through a digital filter ( not shown ), and through the video signal producing circuit 39 , converted into video signals which are output to the display device 4 or a printer ( not shown ). when the ultrasonic probe 2 is replaced with another type probe ( not shown ) as necessary , the knob section 23 of the probe connector section 22 fixedly retained on the diagnostic unit main body 3 is operated to remove the ultrasonic probe 2 . the probe connector section 22 can then be removed from the diagnostic unit main body 23 . and , the replacement process is finished by arranging and fixedly retaining the probe connector section of another type ultrasonic probe on the unit main body connector section 31 . during examination , the surgeon can confirm the kind of ultrasonic probe by viewing the information display section 24 or display device 4 near the control panel 32 . although in the present embodiment , a single unit main body connector section 31 is arranged on the diagnostic unit main body 3 , plural main body connector sections 31 may be so arranged . since in this way , the unit main body connector section to which the probe connector section of the ultrasonic probe is connected is arranged near the control panel of the ultrasonic diagnostic unit main body in a plane of the same direction as the control panel , it is easy to replace the ultrasonic probe with another . in addition , even when the ultrasonic diagnostic unit main body has only one unit main body connector section , it is easy to replace the ultrasonic probe with another . furthermore , by viewing the information display section arranged on the probe connector section of the ultrasonic probe , the user can easily identify the kind of the ultrasonic probe connected to the ultrasonic diagnostic unit main body . while there has been shown and described what is considered to be preferred embodiments of the invention , it will , of course , be understood that various modifications and changes in form or detail could readily be made without departing from the spirit of the invention . it is therefore intended that the invention be not limited to the exact forms described and illustrated , but should be constructed to cover all modifications that may fall within the scope of the appended claims .

US-80968101-A

a scale controller system and method of using the system is disclosed . the scale controller is adapted for use with a grain cart or similar implement that includes a discharge opening and conveyor . the system includes a scale and a plurality of sensors that work together to automate numerous functions that are typically performed manually . for example , the present invention discloses a system that automatically records the amount of material loaded or unloaded by continuously monitoring the load on a scale and the rpms of a power take - off shaft that drives a conveyor .

the present invention may be susceptible to embodiments in different forms . for example , a storage carrier for storing bulk material may be included in a variety of implements , including those that may be mobile or stationary . such implements include but are not limited to grain carts , feed mixers , manure spreaders , grain bins , and seed tenders . referring now to fig1 , one embodiment of the automatic start / stop control in accordance with the invention is shown . a grain cart 100 comprises a storage carrier 105 that is configured to store material in a hopper 110 and discharge the material through an opening 120 at the base of the hopper 110 . the storage carrier 105 includes a loadcell 130 that continuously monitors the weight of material present in the storage carrier 110 . the loadcell 130 may be located in a number of locations , including but not limited to a hitch 132 or wheel axle 134 . the opening 120 at the base of the carrier 110 is separated from a conveyor 140 by a hopper door 150 . the hopper door 150 may be mechanically , hydraulically , or electrically actuated . the conveyor 140 is typically either an auger or belt conveyor . the conveyor 140 is driven by a pto shaft 210 which is in turn driven by the engine or other power source of a tractor 200 . there is a sensor 160 on the grain cart 100 that monitors the rpms of the pto shaft 210 . the entire system is controlled by an operator 220 who sits in the cab 230 of the tractor 200 . inside the cab 230 is a scale control panel 300 that includes a plurality of buttons and a display . turning now to fig2 , a view of the scale control panel 300 is shown in accordance with the present invention . the scale control panel 300 includes a display 310 , on which various information is displayed . the scale control panel 300 also includes a plurality of buttons 320 on its face that control various functions of the automatic start / stop system . fig3 is a flow chart 400 that illustrates a typical unloading sequence performed in accordance with the present invention . first , at step 410 , the control panel 300 is turned on when the operator 220 starts the tractor 200 . next , at step 415 the operator 220 starts the pto shaft 210 . at decision gate 420 , the sensor 160 that monitors the rpm &# 39 ; s of the pto shaft 210 is configured such that when the rpm &# 39 ; s of the pto shaft 210 reach a pre - determined speed at which the conveyor 140 may be safely loaded with material , the scale control system , at step 430 , enters a “ start ” sequence . next , at step 440 , upon entering the “ start ” sequence , the operator 220 opens hopper door 150 to load the conveyor 140 with material . during the unloading sequence , at decision gate 445 , the loadcell 130 continuously monitors the weight present in the hopper 110 . additionally , the sensor 160 on the pto shaft 210 continuously monitors the rpm &# 39 ; s of the pto shaft 210 . the system may notify the operator 220 if the rpm &# 39 ; s of the pto shaft 210 drop below a pre - determined value , prompting the operator 220 to manually adjust the opening of the hopper door 150 to decrease the flow rate of material onto the conveyor 140 to prevent a stall . at step 450 , when a pre - determined amount of material is unloaded from the hopper 110 , the hopper door 150 may be closed , at which time any remaining material on the conveyor 140 is unloaded . next , at step 460 , the operator 220 disengages the pto shaft 210 . at step 470 , when the conveyor 140 is completely unloaded , the system enters a “ stop ” sequence , thus completing the unloading sequence . finally , at step 480 , the amount of weight unloaded is recorded onto storage media . the automatic start / stop control can be used to automatically start , stop and record unloading material , such as grains , from a grain cart into a truck . the following is an example to demonstrate how the control would be used in this process . the scale would have already been turned on and zero / balanced prior to obtaining the load from the combine . once that load is obtained , and the operator of the grain cart decides to unload , the operator cart would pull alongside a truck and extend the grain cart auger over the truck hopper . the scale keeps a record of the gross weight and continuously monitors the load for weight changes . once the conveyor is positioned properly , the operator begins the unloading process by engaging the pto , thus starting the conveyor . when the system senses that the pto is turning at or above a pre - designated rpm , and the operator confirms that the cart is properly positioned for unloading the grain from the cart , and opens the hopper door to allow grain to flow onto the conveyor . thus the “ start ” process is automatically begun by the scale . the operator continues to unload the amount desired and the scale continues to monitor the weight of the grain cart . once the desired amount has been unloaded , the operator will stop unloading by closing the hopper door . the scale will sense that the weight stops changing and the scale will perform various checks to verify that the operator has finished unloading grain from the cart and automatically activate the “ stop ” process for the scale . the data associated with this process , such as total weight unloaded , date , time , location , etc ., is recorded at this time and the scale returns to weighing . this example is similar to example # 1 , but is used to unload manure . the scale would have already been turned on and zero / balanced prior to being loaded with manure . to unload , the operator of a manure spreader would enter the field and activate the pto and hydraulics . up to this point , the scale has been keeping a record of the gross weight loaded and continuously monitors the load for weight changes and changes in pto rpm and hydraulic pressure . when the operator starts the manure spreading process , the sensors change states , which indicates that the operator has started unloading manure . the scale senses the activated sensors , does various checks to confirm that the operator is actually unloading the manure from the spreader and automatically begins the “ start ” process . the operator continues to unload the amount of manure desired and the scale continues to monitor the sensors and the weight of the manure . once the sensor is de - activated or the desired amount of manure has been unloaded , the scale will perform various checks to verify that the operator has finished unloading manure from the spreader and automatically activate the “ stop ” process for the scale . the data associated with this process , such as total weight unloaded , date , time , location , etc ., is recorded at this time and the scale returns to weighing . this example is similar to example # 1 , but is used to unload feed for livestock . the automatic start / stop control can be used to automatically start , stop and record unloading material , such as feed from a feed mixer into a feed bunk in a pen . the following is an example to demonstrate how the control would be used in this process . the scale would have already been turned on and zero / balanced prior to the feed mixer being loaded with the various components of the rations to be mixed , and the mixer will have already mixed the components to arrive at the mixed ration . to unload , the operator of the feed mixer would pull alongside the feed bunk for the pen and start the feed mixer . the scale maintains a record of the gross weight when loaded and continuously monitors the mixer for weight changes . when the operator starts unloading feed to the feed bunk , the scale senses the weight changing and does various checks to verify that the operator is actually unloading feed from the mixer . when the scale senses a change in weight , it automatically begins recording , thus automatically beginning the “ start ” process . the operator continues to unload the amount desired and the scale continues to monitor the weight of the feed mixer . once the desired amount has been unloaded to that feed bunk , the system will automatically stop the unload process . when the weight stops changing , the scale will perform various checks to verify that the unloading process is complete and automatically activate the “ stop ” process for the scale . the data associated with this process , such as total weight unloaded , date , time , location , etc ., is recorded at this time and the scale returns to weighing . this example is similar to example # 3 , but includes a pto sensor attached to the machine that helps identify when the operator is able to start and stop unloading by monitoring the speed at which the pto shaft is spinning at any given time . the scale would have already been turned on and zero / balanced prior to the feed mixer being loaded with the rations to be mixed , and the mixer will have mixed the components . to unload , the operator of the feed mixer would pull alongside the feed bunk for the pen and start the feed mixer . the scale maintains a record of the gross weight when the feed mixer is loaded and continuously monitors the weight and sensor for changes that indicate that the operator has activated the feed mixer for unloading . when the scale senses the sensor activate , it does various checks to verify that the operator is actually unloading the feed from the mixer . thus the scale automatically begins the “ start ” process . the operator continues to unload the amount desired and the scale continues to monitor the weight of the feed mixer and the sensor . once the sensor is de - activated or the desired amount has been unloaded , the scale will perform various checks to verify that the operator has finished unloading feed from the feed mixer and automatically activate the “ stop ” process for the scale . the data associated with this process , such as total weight unloaded , date , time , location , etc ., is recorded at this time and the scale returns to weighing . although the invention has been herein described in what is presently perceived to be the most practical and preferred embodiments , it is to be understood that the invention is not intended to be limited to the specific embodiments set forth above . rather , it is recognized that modifications may be made by one of skill in the art of the invention without departing from the spirit or intent of the invention and , therefore , the invention is to be taken as including all reasonable equivalents to the subject matter of the appended claims and the description of the invention herein .

US-201113272378-A

spectacles for use in an eye monitoring system include a pair of ocular frames and a sensor unit adapted to be positioned adjacent an eye of the wearer . a nose bridge connects the ocular frames and incorporates an adjustment mechanism for adjusting the vertical position of the sensor unit relative to the eye . a frame arm extends from the outer edge of each ocular frame and is adapted to fit over the ear of a wearer . the sensor unit incorporates two infra red emitters at different angles and an infra red detector recessed into the surface of the unit to reduce the proportion of signal received by said detector which is not from the signal emitter reflected by the eye or eyelids .

a preferred embodiment of the invention will now be described with reference to the drawings in which : fig1 is a rear view of the spectacles according to a first embodiment of the invention ; fig2 is a schematic view of the connection between the ocular frame and the frame arm ; fig3 illustrates the relationship between the position of sensor unit and the eye ; fig4 illustrates one embodiment of the nose bridge of this invention ; fig5 shows the nose bridge relative to the ocular frames ; fig7 is an exploded view of the frame of this invention in a second embodiment ; fig1 illustrates the pivoting of the ocular lenses in the embodiment shown in fig7 ; fig1 is a rear view of the frame of fig7 illustrating the attachment of the sensor arm ; fig1 is a detail illustrating the sensor arm adjustment mechanism ; fig1 illustrates the sensor pad unit with cable used in the embodiment of fig7 ; fig1 is a detailed view of the sensor pad ; fig1 is a view of the sensor pod incorporating the sensor pad of fig1 ; fig1 illustrates location of the embodiment of fig7 relative to the nose and eyes of a wearer ; fig1 a b and c illustrate 3 views of the frame of this invention incorporating a nose adjustment piece ; fig1 a and b illustrates 2 views of the frame of this invention with a second nose adjustment piece ; fig1 a and b illustrates 2 views of the frame of this invention with a third nose adjustment piece . the spectacles are part of a system of the type disclosed in patent specification wo 03 / 039358 the contents of which are incorporated herein by reference . in fig1 the sensor assembly a is located on the lower portion of one ocular frame member . the nose piece b connects the two ocular frame members and by way of the adjustable nose piece arm c allows the vertical location of the ocular frames . the adjustable frame arm hinge d allows movement of the ocular frames relative to the frame arm . fig2 is a side view of frame arm showing hinge point a where arms can be bent and at b where frame arm can be bent up or down if required this invention is based on research which shows that the key metrics vital for good quality of signal ( qos ) from the largest portion of the population depends on the sensor angle relative to user &# 39 ; s eye ( left ) sensor position relative to frame ( right ) as shown in fig3 in which : a — angle at which sensor assembly points at eye relative to bottom of the frame b — angle at which the sensor assembly is adjusted for each user through changing the tilt on the frame c — x distance between centre of pupil and sensor assembly d — eye e — sensor unit f — distance from centre of frame to centre of sensor unit g — degree of wrap on frame to provide optimal vision for the user h — toe in of sensor unit to counteract the wrap on the frame the above metrics ( see fig3 ) are adjusted to a fixed secure position with the key adjustment metrics : adjust tilt of arm by bending at hinge point ( see fig1 , d ) a . adjustment of arms to provide stable latching mechanism to the users head and comfort ( as per standard optometrist fitting procedures ) a . adjustment of sensor assembly relative to eye up / down to obtain the correct angle at the eye ( see fig3 , a ) b . adjustment of sensor assembly relative to eye towards and away ( see fig2 , b ) a . 2 different angles are used to obtain the greatest coverage across the population . ( see fig3 , a ) the frame provides a stable platform for maintaining a fixed static position for the sensor assembly in the correct location relative to the eye ( see fig1 ). the frame carries the following key features for good qos from the largest portion of the population : 1 . tilt of frame ( see fig2 and 3 , b ) 2 . intraocular spacing of sensor assembly ( see fig3 , f ) 3 . frame wrap ( see fig3 , g ) 4 . adjustable nose piece with fixed locators ( see fig2 , a ) the nose piece sits in the centre of the frame ( see fig5 a ) and provides one of the key fitment metrics . this is achieved through a fixed adjustable range provided by a series of holes on the adjustment plate with screws holding nose piece securely in position ( see fig1 , b ). as shown in fig4 the holes a allow adjustable , fixed positions for the adjustable metal nose pad arms b nose bridge location on frame is shown in fig4 in which a is a slot for nose piece to provide adjustment in the y axis . the nose bridge provides key fitment metrics to obtain good qos from a user : 1 . adjustment of sensor assembly relative to eye up / down by sliding the plate up and down ( see fig5 , a ) 2 . adjustment of sensor assembly relative to eye towards and away by bending nose pad arms ( see fig4 , b ). alternative systems for adjusting the nose piece are also within the scope of this invention . the sensor assembly is a plastic assembly which encapsulates the sensor s and emitters e in cavities within the frame with the following key features : 1 . creates an aperture for the sensor element s to collect targeted information from the correct region for good qos 2 . the emitters are arranged at 2 angles to cover largest portion of population 3 . 3 % carbon filled abs plastic is used to absorb ir light and prevent leakage of ir light from the emitter cavities to sensor cavities . the emitters provide pulses of invisible ir light ( wavelength 940 nm ) from an led positioned about 13 +/− 3 mm below and 12 +/− 3 mm in front of the eye , housed in a frame that could also hold prescription lenses or sunglasses , if needed ( fig1 ). the ir pulses are brief (& lt ; 100 microsec ) and repeated at a frequency of 500 hz . they are directed up in a 30 degree beam centered on the lower edge of the upper eyelid . the total ir light reflected back from the eye and eyelids is detected by the matched phototransistor beside the led . in the embodiment of the invention illustrated in fig7 to 16 the frame consists of ear stems 11 and 12 . these may be of the wrap around type to maintain a stable position on the wearers head . an elastic strap may also be used to secure the frame to the head . the ear stem 12 incorporates an electronics module 13 which includes a microprocessor connected by a cable 29 to the sensor pad 26 shown in detail in fig1 . the ocular frame 14 incorporates a central nose bridge 15 . the lenses are secured to lens attachment unit 16 . the lenses may be of any type including prescribed lenses or sun protection lenses and may be clear or tinted as shown in fig9 a and b . the unit 16 incorporates pivot pins 17 cooperating with pin recesses 17 a that enable the lenses to be flipped up as shown in fig1 . the pins are shaped to provide two stable positions namely parallel to the face and at right angles to the face when flipped up . a nose adjustment piece 30 is attached to the unit 16 . the attachment piece 30 comes in a range of incrementally changing sizes to suit a range of facial and nose types . the sensor arm 20 has attachment portion 22 at one end which is secured to the unit 16 by screw 19 and the sensor pod 24 at its other end . the slot 18 in unit 16 provides a number of vertical positions for the sensor arm attachment so that the position of the sensor pod 24 can be adjusted relative to the eye . the sensor pad 26 is fitted to the pod 24 so that the sensors are resiliently mounted in the pod . the sensor pad consists of the emitters 27 and the receiver / detector 28 . each emitter 27 and detector 28 is individually mounted on a resilient finger . the sensor pod 24 may be rotated through 10 ° of arc to further adjust the sensors relative to the eye . the sensor pod 24 or sensor arm 20 may be of variable length to suit a range of eye widths . the position of the frame relative to the face is adjusted by selecting a nose piece 30 from a range of nose pieces . in fig1 - 19 three nose pieces 30 are shown which explain the incremental adjustments which can be made . fig1 illustrates a base nose support 30 while fig1 illustrates a nose support with an incremental vertical adjustment 31 . fig1 illustrates the nose piece with an incremental horizontal adjustment 32 to place the frame further away from the face . by using combinations of one or more of the incremental vertical and horizontal adjustments a wide range of facial types can be accommodated . in the embodiment shown in fig7 to 16 a microprocessor 13 housed in the arm 12 of the glasses controls the timing , duration and intensity of ir pulses , and digitizes the analogue output from the sensor ( 0 to 3 . 3 volts ). the digital output from the glasses is sent via a light cable either to a bench - top processing unit for laboratory experiments , or to a unit installed in a vehicle for use while driving . the digitized output from the phototransistor represents the amount of ir light reflected back from the eye and eyelids . this is influenced by several factors , such as the shape and reflectance of the reflecting surface ( highly pigmented skin reflects less than white skin ). the surface of the cornea is approximately spherical and about 10 mm in diameter . as it rotates with eye movements , the angle of the reflecting surface of the eye changes in relation to the sensor . however , the major factor affecting the amount of reflected light that is measured is the distance between the reflecting surface and the sensor . this changes with corneal movement in any direction , and also with eyelid closure . it is this changing proximity of the reflecting surface in relation to the sensor that forms the basis of the system as described in wo 03 / 039358 for monitoring eye and eyelid movements . differences in the reflectance of the cornea , iris , scleral conjunctiva , and the skin of the eyelids are also involved but they are probably less important than previously assumed . software developed specifically for the system as described in wo 03 / 039358 uses period - amplitude analysis of both the position and velocity signals to derive a wide range of variables characterizing eye and eyelid movements . in fitting the frames to each user a technician needs to be guided by the quality of the signal received from the detector to ensure that the fitting will ensure that analyzable signals are being received . the technician selects an appropriate nose piece 30 and the adjusts the sensor arm 20 until an optimum signal is received . those skilled in the art will realize that this invention provides a practical and convenient spectacle frame for collecting eye movement data . those skilled in the art will also realize that the spectacle frames may be arranged in other embodiments apart from those described without departing from the core teachings of this invention .

US-6313006-A

an infusion catheter for delivering drugs or other agents to selected sites in an organism , such as a human . in an alternate embodiment , a catheter system is disclosed having an infusion catheter and a pump that may be implanted or disposed outside the organism . in either embodiment , the free end of the catheter bears a rounded tip that has at least one elution hole for discharging an agent or drug to a selected site . the catheter has a tubular inner liner that is integral with the tip . the inner liner and tip are formed from a drug compatible polymeric material that is relatively nonporous and unreactive with the agent to be infused . a biocompatible flexible elastomeric tubular jacket surrounds the inner liner and a portion of the tip excluding that portion containing the elution hole or holes . since the agent flowing in the catheter is isolated from the jacket while flowing through the catheter , and since the inner liner is relatively nonporous and unreactive with the agent to be used , the agent is prevented from diffusing out of the catheter , adsorbing to the surface of the biocompatible jacket , reacting adversely with the jacket material or becoming exposed to substances diffusing through the jacket .

a catheter system 22 is disclosed that may be understood by reference to the figures , particularly fig2 . catheter system 22 includes a catheter 27 and an implantable infusion pump ( iip ) 29 . catheter 27 has a proximal end 28 and a distal end 30 . fig2 depicts a preferred embodiment of catheter system 22 where catheter 27 and distal end 30 are shown in an enlarged sectional view and with iip 29 shown in a partial cut - away view . the size of catheter 27 and distal end 30 are highly exaggerated for ease of illustration of the structure thereof and the full length of catheter 27 is not shown for simplicity of illustration . proximal end 28 of catheter 27 is coupled to a pump connector 40 that is in fluid communication with iip 29 . the connection between catheter 27 and pump connector 40 is shown schematically in fig2 . it should be understood that the actual type of connection between pump connector 40 and catheter 27 will vary depending upon the particular type of iip utilized . catheter 27 includes an elongated inner liner 41 that extends from pump coupling 40 and terminates at distal end 30 in a tip 31 . liner 41 forms a lumen 42 through which the selected agent , drug or other fluid is delivered to the patient at tip 31 . liner 41 and tip 31 are preferably integrally molded , though , as discussed below , they may be fabricated as separate units and later coupled . tip 31 has a generally rounded end 44 to minimize tissue disruption during insertion . at least one elution hole 46 is formed through tip 31 . in the preferred embodiment , one to several elution holes 46 a - i extend from lumen 42 of catheter 27 through the walls of tip 31 to enable fluid to flow from lumen 42 through elution holes 46 a - i and into the particular site within the body . there are three elution holes that are collinear with holes 46 g - i that are not shown because distal end 30 is shown in half section . elution holes 46 a - i are depicted as being disposed approximately normal to the longitudinal axis 50 of catheter 27 . however , it should be understood that elution holes 46 a - i may be disposed at other angular geometries as well . it should be further understood that , while tip 31 must have at least one elution hole to deliver an agent to the body , the actual number of holes will depend upon the agent , drug or fluid to be delivered , and the particular delivery site within the body . in a preferred embodiment , elution holes 46 a - i are cylindrical and have a diameter of approximately 0 . 016 ″. because it is possible to have a difference in external diameters of tip 31 and inner liner 41 , there may be a peripheral shoulder 52 formed at the junction between inner liner 41 and tip 31 . it is desirable that inner liner 41 be relatively flexible , compatible , and generally non - reactive with the particular agent , drug or fluid to be infused . catheter 27 may not be manufactured solely of this lining material because the material may often be too rigid to make a usable catheter for actual use . rigidity problems that may be inherent in the material of inner liner 41 are not an issue to the overall stiffness of catheter 27 if only tip 31 and the relatively thin inner liner 41 are made from the rigid material . while the particular material for inner liner 41 used will depend on the agent , drug or other fluid infused , some possible materials are nonporous polyethylene , polytetraflouroethylene ( ptfe ) or teflon ® as it is commonly known in the trade , and polyurethane . it is important that the material used to form inner liner 41 be relatively nonporous to avoid the potential of contaminants , such as co 2 , diffusing from the organism into lumen 42 . an elongated jacket or jacket 54 surrounds inner liner 41 . jacket 54 extends from coupling 40 to shoulder 52 on tip 31 . there is preferably a relatively tight tolerance between the external diameter of inner liner 41 and the internal diameter of jacket 54 . in a preferred embodiment , the tolerance is approximately 0 . 005 ″. jacket 54 is preferably formed of a flexible biocompatible substance that is relatively non - porous . the biocompatible substance utilized for making up jacket 54 may include silicone , barium loaded silicone , polyurethane , polyether urethane , polyether urethane urea , styrene butadiene rubber and other related flexible biocompatible polymers . presently , silicone is the preferred material for jacket 54 . jacket 54 is secured to inner liner 41 by a suitable adhesive applied to the interface 56 between the outer surface of inner liner 41 and the inner surface of jacket 54 . the adhesive is applied along the entire length of interface 56 as well as shoulder 52 and the portion of jacket 54 abutting shoulder 52 . the adhesive is preferably a biocompatible medical silicone adhesive suitable to bond the silicone elastomer to the inner liner . other types of adhesives are suitable as well such as , for example , medical grade urethane . ultimately , the particular type of adhesive used will depend upon the materials used to form jacket 54 and inner liner 41 . in the embodiment of the invention shown in fig2 the drug delivered through catheter 27 never contacts the adhesive that binds liner 41 to jacket 54 since the adhesive is “ sealed ” between inner liner 41 and jacket 54 . further , in this embodiment , a continuous surface is provided along the entire length of inner lumen 42 of catheter 27 . as a result , there are no crevices , cracks , breaks or discontinuities along inner lumen 42 for the agent , drug or fluid being delivered to invade . if the agent , drug or fluid were to invade a crack or similar break in inner liner 41 , the agent , drug or fluid could be contaminated by either the adhesive that binds inner liner 41 to jacket 54 or by gases or other materials that might diffuse through jacket 54 from outside jacket 54 . the contaminated agent , drug or other fluid would then contaminate the remaining agent , drug or fluid in lumen 42 . the actual thickness of the walls of inner liner 41 and jacket 54 will depend upon the particular environment where the catheter will be used . ordinarily , the wall thickness of inner liner 41 will be relatively less than the wall thickness of jacket 54 . however , if inner liner 41 is composed of a sufficiently flexible material , it may have a wall thickness relatively larger than the wall thickness of jacket 54 . fig3 depicts an alternate preferred embodiment of distal end 30 . in this embodiment , tip 31 is not molded integrally with inner liner 41 , but rather is formed as a separate piece that is fixed to inner liner 41 and jacket 54 by a suitable biocompatible adhesive . the agent , drug or other fluid still exits tip 31 through orifices 46 located near the distal end 30 of tip 31 . tip 31 has a cylindrical nipple portion 58 that has an outer peripheral surface 60 with approximately the same external diameter as the external diameter of inner liner 41 . nipple portion 58 also has a peripheral shoulder 62 with an external diameter greater than the external diameter of outer peripheral surface 60 and a front peripheral surface 64 that extends at a right angle to outer peripheral surface 60 . a tip lumen 76 extends from front peripheral portion 64 through nipple portion 58 to orifices 46 . tip lumen 76 has an inner diameter equal to the inner diameter of inner liner 41 . when tip 31 is mated with inner liner 41 and jacket 54 , front peripheral surface 64 abuts peripheral surface 66 on inner liner 41 and peripheral shoulder 62 abuts peripheral surface 68 on jacket 54 . a continuous lumen is formed from the proximal end of inner liner 41 to orifices 46 . because orifices 46 pass through the material of tip 31 that is the same material as inner liner 41 and because this material is non - reactive to the - agent , drug or fluid passing through catheter 27 , the agent , drug or other fluid contacts only the non - reactive material lining of catheter 27 . to secure tip 31 to the rest of catheter 27 , a suitable biocompatible adhesive , such as the type disclosed above , is applied to front peripheral surface 64 , outer surface 60 , and peripheral shoulder 62 before the parts are joined . because jacket 54 is physically isolated from lumen 42 of catheter 27 by integrally formed or coupled inner liner 41 and tip 31 , agents , drugs or other fluids passing through lumen 42 that may be sensitive to the material of jacket 54 are not exposed to jacket 54 while flowing through lumen 42 and ultimately discharging out of elution holes 46 a - i . as a result , the infused agent , drug or other fluid is exposed only to the agent , drug or other fluid non - reactive material of inner liner 41 and tip 31 . furthermore , there is no joint or seal point between inner liner 41 and jacket 54 that is exposed to the agent , drug or fluid flowing through catheter 27 that might lead to undesirable seepage through jacket 54 . catheter 27 is ordinarily fabricated in the following two fashions depending on whether tip 31 is integrally molded with inner liner 41 or not . if tip 31 is integrally molded with inner liner 41 , inner liner 41 is extruded with an integral tip 31 . next , jacket 54 is extruded . tip 31 may then be molded or otherwise manipulated to the desired configuration . a suitable biocompatible adhesive is applied to the outer surface of inner liner 41 and jacket 54 is slid over inner liner 41 . if tip 31 is not to be integrally molded with inner liner 41 , inner liner 41 is extruded without an integral tip 31 . tip 31 is then separately extruded , molded or otherwise formed . if tip 31 is extruded , tip 31 may then be molded to the desired configuration . next , jacket 54 is extruded . a suitable biocompatible adhesive is applied to the outer surface of inner liner 41 and jacket 54 is slid over inner liner 41 . the final step entails coupling tip 31 to inner liner 41 and jacket 54 using a suitable biocompatible adhesive . the suitable biocompatible adhesive is applied to front peripheral surface 64 , outer surface 60 , and peripheral shoulder 62 before these parts are joined with jacket 54 and inner liner 41 . fig4 depicts an alternate preferred embodiment of distal end 30 of catheter 27 where a radiographic marker 70 is coupled to tip 31 . radiographic marker 70 renders at least a portion of tip 31 opaque to x - rays , enabling tip 31 to be observed during fluoroscopy or via x - ray to facilitate placement of distal end 30 and tip 31 . in a preferred embodiment , radiographic marker 70 comprises a semispherical portion 72 that has a cylindrical nipple 74 emanating away therefrom . semispherical portion 72 provides a rounded profile for minimizing tissue disruption during insertion . cylindrical nipple 74 is sized to fit snugly within lumen 42 and be held in place via a suitable biocompatible adhesive , such as those discussed above . in a preferred embodiment , radiographic marker 70 comprises tantalum powder dispersed in a matrix composed of a biocompatible adhesive , such as the ones discussed above . the preferred ratio of tantalum to adhesive is 3 to 1 . ordinarily , radiographic marker 70 will be premolded prior to insertion into lumen 42 . after radiographic marker 70 has been inserted into lumen 42 , a thin coating of the same biocompatible adhesive is preferably applied to the exterior of semispherical portion 72 . other materials may also be suitable for the radiographic marker 70 , such as barium or similar materials . alternatively , radiographic marker 70 may be composed of a material that is sensitive to nuclear magnetic resonance imaging ( mri ) to enable tip 31 to be detected during an mri scan . a preferred material for radiographic marker 70 in this embodiment is platinum , although tantalum , cobalt , and similar materials are also suitable . regardless of whether radiography or mri is being utilized , the goal of providing a radiographic marker 70 is to enable the operator to accurately detect the precise location of tip 31 to facilitate placement and later verification of the integrity and position of catheter 27 . fig5 and 6 depict an application of catheter system 22 for infusing neurological or analgesic agents , drugs or other fluids directly into the spinal column of the body 26 . fig5 shows the general placement of catheter system 22 in relation to the body 26 . fig6 is a cross - sectional view of the spinal column 34 of the body 26 that shows some potential infusion sites . in fig5 and 6 , distal end 30 and tip 31 are obscured by vertebrae 36 . an implantable infusion pump ( iip ) 29 is surgically implanted subcutaneously in the abdominal region of the body 26 . catheter 27 is tunnelled subcutaneously and the distal end 30 and tip 31 are positioned between vertebrae 36 to infuse the agent , drug or other fluid into either the epidural space 37 or the intrathecal space 38 , depending on whether distal end 30 and tip 31 are passed through the arachnoid membrane 39 . it should be understood that the particular placement of distal end 30 and tip 31 along the spinal column will depend on where specifically the agents , drugs or other fluids are desired to be delivered . fig7 depicts a preferred embodiment of the catheter system 22 in another possible medical application , an intracerebroventricular placement , wherein catheter system 22 provides infusion of neurological agents or drugs directly into the brain 24 in a human body 26 . catheter system 22 comprises a catheter 27 which has a proximal end 28 coupled to an iip 29 and a free distal end 30 for insertion into an organism , in this case , a human body 26 . it should be understood that catheter system 22 could be also be used on non - human animals . a catheter tip 31 is disposed at the extreme end of distal end 30 . tip 31 has a rounded leading exterior surface to minimize disruption during insertion . in the medical application portrayed in fig7 distal end 30 is intracerebrally disposed so that tip 31 projects into the cerebral ventricle 32 of the brain 24 . distal end 30 is surgically implanted in the brain 24 and catheter 27 is subsequently tunnelled subcutaneously through the body 26 to the location in the body 26 where the iip 29 will be implanted . iip 29 is ordinarily surgically implanted subcutaneously in the abdominal region of the body 26 . iip 29 may be any of a number of commercially available implantable infusion pumps such as , for example , the synchromed pump , model 8615 , manufactured by medtronic , inc ., minneapolis , minn . while an implantable iip 29 is depicted , it should be understood to those skilled in the art that the device used to deliver agent to catheter 27 may be either implanted or extracorporeal . many modifications and variations may be made in the techniques and structures described and illustrated herein without departing from the spirit and scope of the present invention . accordingly , the techniques and structures described and illustrated herein should be understood to be illustrative only and not limiting upon the scope of the present invention .

US-51752500-A

the present invention relates to a standup exercise apparatus that simulates walking and jogging with arm exercise . more particularly , the present invention relates to an exercise machine having separately supported pedals for the feet and arm exercise coordinated with the motion of the feet where the pedal stride length is determined by the movements of an operator . crank arms are positioned on the framework forward the operator at a height comparable to the pedals . easy starting occurs in the default mode .

referring to the drawings in detail , pedals 46 and 48 are shown in fig1 and 2 in forward and rearward positions of the preferred embodiment . crank arms 4 , 6 rotate about pivot axis 7 on framework 70 . foot support members 14 , 16 have pedals 46 , 48 attached . support links 8 , 10 are connected intermediate the ends to crank arms 4 , 6 at pivots 9 , 11 and to foot support members 14 , 16 at pivots 13 , 15 . tracks 90 , 94 are attached to frame members 74 at pivot 93 and to track actuator 96 which is also attached to framework 74 . rollers 40 , 44 are connected to foot support members 14 , 16 at pivots 41 , 43 and are in rollable contact with tracks 90 , 94 . handles 36 , 38 are attached to handle supports 80 , 84 which are connected to framework 70 at pivot 39 . connector links 30 , 34 are connected to handle supports 80 , 84 at pivots 35 , 37 and to one end of support links 8 , 10 at pivots 31 , 33 . crossover member 56 is connected to framework 70 at pivot 55 . crossing links 50 , 54 are connected to crossover member 56 at pivots 53 , 59 and to handle supports 80 , 84 at pivots 51 , 57 . crossover member 56 and crossing links 50 , 54 form a crossover assembly as shown in fig1 and 2 that cause handle 36 to move forward when handle 38 moves rearward . load resistance is imposed upon cranks 4 , 6 by pulley 49 which drives flywheel 63 by belt 69 coupled to pulley 71 which is supported by the framework 70 at shaft 61 . tension belt 64 encompasses flywheel 63 with load actuator 66 connected for adjustment to vary the intensity of exercise on the exercise apparatus . control system 68 is connected to load actuator 66 and track actuator 96 with wires 67 , 65 , 95 using conventional means not shown . control system 68 can be programmed to adjust tension belt 64 using load actuator 66 or to change the incline of tracks 90 , 94 using track actuator 96 to vary the intensity of exercise during operation . framework 70 is attached to longitudinal frame members 74 which are attached to cross members 73 , 75 that are supported by a generally horizontal surface . operation begins when an operator places the feet upon the pedals 46 , 48 in the default side by side position of pedals 46 , 48 . moving the handles 36 , 38 and applying body weight to pedals 46 , 48 starts the crank arms 4 , 6 moving with ease . holding handles 36 , 38 generally still as denoted by handle position 1 ′, pedals 46 , 48 move through a relatively short pedal curve 1 shown in fig1 . allowing the handles 36 , 38 to move through handle range 3 ′ causes pedals 46 , 48 to move along pedal curve 3 . allowing handles 36 , 38 to move through handle range 5 ′ results in pedal curve 5 . even shorter pedal curves are possible when the user is not grasping the handles whereby only the feet of the user define the motion . in the preferred embodiment , pedals 46 and 48 are shown in fig3 and 4 in forward and rearward positions . crank arms 4 , 6 rotate about pivot axis 7 positioned forward of an operator at generally pedal height on framework 70 . foot support members 14 , 16 have pedals 46 , 48 attached at the ends . drive links 20 , 22 are connected to crank arms 4 , 6 at pivots 9 , 11 . drive link supports 86 , 88 are connected to drive links 20 , 22 at pivots 77 , 79 and to framework 70 at pivot 87 . support links 8 , 10 are connected to drive links 20 , 22 at pivots 21 , 23 and to foot support members 14 , 16 at pivots 13 , 15 . guides 26 , 28 are connected to framework 70 at pivot 17 and to foot support members 14 , 16 at pivots 25 , 27 . for this embodiment , guides 26 , 28 are further described as rocker links 26 , 28 . handles 36 , 38 are attached to control links 80 , 84 which are connected to framework 70 at pivot 39 . connector links 30 , 34 are connected to control links 80 , 84 at pivots 35 , 37 and to support links 8 , 10 at pivots 31 , 33 . crossover member 56 is connected to framework 70 at pivot 55 . crossing links 50 , 54 are connected to crossover member 56 at pivots 53 , 59 and to control links 80 , 84 at pivots 51 , 57 . crossover member 56 and crossing links 50 , 54 form a crossover assembly as shown in fig3 and 4 that cause control link 80 to move forward when control link 84 moves rearward . energy storage devices 60 , 62 are shown in fig3 and 4 as springs 60 , 62 connected to control links 80 , 84 at pivots 83 , 85 and to framework 70 at pivot 47 . springs 60 , 62 are intended to cause control links 80 , 84 to have a bias towards the default vertical position where the shortest stride occurs at elongate curve 1 . load resistance is imposed upon cranks 4 , 6 by pulley 49 which drives flywheel 63 by belt 69 and pulley 71 . flywheel 63 is supported by framework 70 at pivot 61 . tension belt 64 encompasses flywheel 63 for adjustable load resistance using adjustment knob 91 to vary the intensity of exercise on the exercise apparatus . framework 70 is attached to longitudinal frame members 74 and to cross members 73 , 75 that are supported by a generally horizontal surface . operation begins when an operator places the feet upon the pedals 46 , 48 in the default side by side position of pedals 46 , 48 . in the default mode , control links 80 , 84 are caused to be generally vertical in a side by side position by springs 60 , 62 . other forms of energy storage devices 60 , 62 may also be used . in the default mode , pedals 46 , 48 will follow the shortest stride length along default elongate curve 1 . startup is easy along the default elongate curve 1 . handles 36 , 38 remain generally stationary at position 1 ′ while pedals 46 , 48 follow elongate curve 1 . when handles 36 , 38 move through handle range 3 ′, pedals 46 , 48 move along pedal curve 3 . when handles 36 , 38 move through an even greater handle range 5 ′, pedals 46 , 48 follow pedal curve 5 . the maximum stride occurs when pedals 46 , 48 follow pedal curve 2 while handles 36 , 38 have the handle range 2 ′. an alternate embodiment is shown in fig5 which is essentially the same as the alternate embodiment shown in fig3 and 4 except that guides 26 , 28 have been replaced with rollers 40 , 44 and tracks 90 serving as guides . tracks 90 are attached to framework 70 and 74 at a predetermined angle . however , as shown in fig1 and 2 tracks 90 can be configured to have adjustable angles . rollers 40 , 44 are connected to the foot support members 14 , 16 at pivots 41 , 43 . the remainder of this alternate embodiment is essentially the same as the preferred embodiment of fig3 and 4 . operation is the same as the preferred embodiment where only pedal curves 2 and 5 are being shown in fig5 . in summary , the present invention has distinct advantages over prior art because the elliptical stride movement of the pedals 46 , 48 change with the range of movement 1 ′, 3 ′, 5 ′, 2 ′ of the handles 36 , 38 while maintaining a generally elliptical pedal curves 1 , 3 , 5 , 2 even for the longest pedal stride . easy starting occurs in the default mode . the present invention may be embodied in other specific forms without departing from its spirit or essential characteristics . the described embodiments are to be considered in all respects only as illustrative , and not restrictive . the scope of the invention is , therefore , indicated by the claims , rather than by foregoing description . all changes which come within the meaning and range of equivalency of the claims are to be embraced within their scope .

US-201213385425-A

this invention relates to a method of inhibiting tnfα or il - 1β expression with an extract of andrographis paniculata . the extract contains andrographolide , 14 - deoxy - andrographolide , 14 - deoxy - 11 , 12 - dehydrogen - andrographolide , and neoandrographolide .

this invention includes methods of inhibiting expression of tnfα or il - 1β , treating a tnfα related - disorder , and treating an il - 1β - realted disorder by administering to a subject in need thereof an effective amount of the above - described extract . the term “ an effective amount ” refers to the amount of the extract which is required to confer one of the above - described effects in the subject . effective amounts may vary , as recognized by those skilled in the art , depending on route of administration , excipient usage , and the possibility of co - usage with other agents . the term “ treating ” refers to administering the extract to a subject that has a tnfα related disorder or an il - 1β related disorder , or has a symptom of the disorder , or has a predisposition toward the disorder , with the purpose to cure , heal , alleviate , relieve , alter , remedy , ameliorate , improve , or affect the disorder , the symptoms of the disorder , or the predisposition toward the disorder . to prepare an extract for use in this invention , one can immerse the aerial part of andrographis paniculata in one or more suitable solvents , e . g ., ethanol , methanol , and acetone ; separate the liquid from the solid residue ; and concentrate the liquid . the extract thus obtained may be further processed . for example , one can remove impurities or modify the ratio of the components by chromatography . to practice one of the above - described methods , one administers to a subject in need thereof orally , rectally , parenterally , by inhalation spray , or via an implanted reservoir a composition that is either the above - mentioned extract alone or a mixture of the extract and a pharmaceutically acceptable carrier . the term “ parenteral ” as used herein includes subcutaneous , intracutaneous , intravenous , intramuscular , intraarticular , intraarterial , intrasynovial , intrasternal , intrathecal , intralesional and intracranial injection or infusion techniques . an oral composition can be any orally acceptable dosage form including , but not limited to , tablets , capsules , emulsions and aqueous suspensions , dispersions and solutions . commonly used carriers for tablets include lactose and corn starch . lubricating agents , such as magnesium stearate , are also typically added to tablets . for oral administration in a capsule form , useful diluents include lactose and dried corn starch . when aqueous suspensions or emulsions are administered orally , the active ingredient can be suspended or dissolved in an oily phase combined with emulsifying or suspending agents . if desired , certain sweetening , flavoring , or coloring agents can be added . a sterile injectable composition ( e . g ., aqueous or oleaginous suspension ) can be formulated according to techniques known in the art using suitable dispersing or wetting agents ( such as , for example , tween 80 ) and suspending agents . the sterile injectable preparation can also be a sterile injectable solution or suspension in a non - toxic parenterally acceptable diluent or solvent , for example , as a solution in 1 , 3 - butanediol . among the acceptable vehicles and solvents that can be employed are mannitol , water , ringer &# 39 ; s solution and isotonic sodium chloride solution . in addition , sterile , fixed oils are conventionally employed as a solvent or suspending medium ( e . g ., synthetic mono - or di - glycerides ). fatty acids , such as oleic acid and its glyceride derivatives are useful in the preparation of injectables , as are natural pharmaceutically - acceptable oils , such as olive oil or castor oil , especially in their polyoxyethylated versions . these oil solutions or suspensions can also contain a long - chain alcohol diluent or dispersant , or carboxymethyl cellulose or similar dispersing agents . an inhalation composition can be prepared according to techniques well known in the art of pharmaceutical formulation and can be prepared as solutions in saline , employing benzyl alcohol or other suitable preservatives , absorption promoters to enhance bioavailability , fluorocarbons , and / or other solubilizing or dispersing agents known in the art . a topical composition can be formulated in form of oil , cream , lotion , ointment and the like . suitable carriers for the composition include vegetable or mineral oils , white petrolatum ( white soft paraffin ), branched chain fats or oils , animal fats and high molecular weight alcohols ( greater than c12 ). the preferred carriers are those in which the active ingredient is soluble . emulsifiers , stabilizers , humectants and antioxidants may also be included as well as agents imparting color or fragrance , if desired . additionally , transdermal penetration enhancers may be employed in these topical formulations . examples of such enhancers can be found in u . s . pat . nos . 3 , 989 , 816 and 4 , 444 , 762 . creams are preferably formulated from a mixture of mineral oil , self - emulsifying beeswax and water in which mixture the active ingredient , dissolved in a small amount of an oil , such as almond oil , is admixed . an example of such a cream is one which includes about 40 parts water , about 20 parts beeswax , about 40 parts mineral oil and about 1 part almond oil . ointments may be formulated by mixing a solution of the active ingredient in a vegetable oil , such as almond oil , with warm soft paraffin and allowing the mixture to cool . an example of such an ointment is one which includes about 30 % almond and about 70 % white soft paraffin by weight . a carrier in a pharmaceutical composition must be “ acceptable ” in the sense of being compatible with the active ingredient of the formulation ( and preferably , capable of stabilizing it ) and not deleterious to the subject to be treated . for example , solubilizing agents , such as cyclodextrins ( which form specific , more soluble complexes with one or more of active compounds of the extract ), can be utilized as pharmaceutical excipients for delivery of the active compounds . examples of other carriers include colloidal silicon dioxide , magnesium stearate , cellulose , sodium lauryl sulfate , and d & amp ; c yellow # 10 . a suitable in vitro assay can be used to preliminarily evaluate the efficacy of the above - described extract in inhibiting expression of tnfα or il - 10 expression . the extract can further be examined for its efficacy in treating a tnfα related disorder or an il - 1β related disorder by in vivo assays . for example , the extract can be administered to an animal ( e . g ., a mouse model ) having a tnfα or il - 1β related disorder and its therapeutic effects are then accessed . based on the results , an appropriate dosage range and administration route can also be determined . without further elaboration , it is believed that the above description has adequately enabled the present invention . the following specific examples are , therefore , to be construed as merely illustrative , and not limitative of the remainder of the disclosure in any way whatsoever . all of the publications , including patents , cited herein are hereby incorporated by reference in their entirety . dried powder of the aerial part of andrographis paniculata ( 1 kg ) was suspended in 85 % ethanol . the suspension was refluxed for two hours and filtered . the residue was extracted with 85 % ethanol again . the combined ethanol solutions were cooled and concentrated to afford 105 g of the desired extract . hplc analysis shows that the extract contained 4 . 0 % andrographolide . an in vitro assay was conducted to evaluate the efficacy of the andrographis paniculata extract in inhibiting expression of tnfα and il - 1β expression . peripheral blood monocytes ( pbmc ) cells were isolated from fresh blood using the ficoll - paque plus ( amersham bioscience ) according to the protocol recommended by the manufacturer . the cells were suspended in rpmi 1640 media containing 10 % fbs at a concentration of 1 × 10 5 cells / ml and seeded in a 96 - well plate ( 1 × 10 4 cells total in each well ). each reaction was carried out in three wells . 10 μl of the andrographis paniculata extract in dmso was added into each well ( final concentrations : 0 . 1 , 0 . 3 , 1 , 3 , 10 , and 30 μg / ml ). wells containing dexamethason ( calbiochem .) at the final concentration of 10 μm were used as positive control . wells containing 10 μl of the media were used as negative control . the plate was incubated at 37 ° c . under 5 % co 2 for 15 minutes . after 10 μl aliquots of 100 μg / ml lipopolysaccharide were added to all wells except for the negative control , the plate was incubated at 37 ° c . under 5 % co 2 overnight . the plate was spun at 1000 rpm for 15 minutes and the supernatants were collected . concentrations of tnfα and il - 1β were measured using the tnfα elisa ( enzyme linked immunosorbent assay ) kit and il1 - β elisa kit ( jingmei bioengineer technology ). inhibition ⁢ ⁢ ratio ⁢ ⁢ ( % ) = ( 1 - c extract - c control c lps - c control ) × 100 where c extract is the concentration of tnfα or il - 1β in pbmc cells treated with the extract and lps , c lps is the concentration of tnfα or il - 1β in pbmc cells treated with lps and dexamethason , and c control is the concentration of tnfα or il - 1β in pbmc cells without being treated with lps or the extract . the results show that the extract significantly inhibited expression of both tnfα and il - 1β . in vivo assays were conducted to evaluate the efficacy of the andrographis paniculata extract in treating inflammatory bowel disease ( ibd ). balb / c male mice ( 18 - 24 g ) were anaesthetized with 1 % pentobarbital sodium at 0 . 05 mg / 10 g . to induce ibd , 1 . 5 mg of 2 , 4 , 6 - trinitrobenzenesulfonic acid ( tnbs ; sigma ) in 50 % ethanol was administered slowly to each mouse ( except blank control mice ) via a catheter . blank control mice only received 0 . 1 ml of 50 % ethanol . the mice were treated with the extract of andrographis paniculata 24 hours and 2 hours prior to the tnbs administration and daily for 5 days after the administration . the body weight of each mouse was monitored every day before and after the tnbs administration . the mice were sacrificed 24 hours after the last administration of the extract . colons were removed and weighed . furthermore , the colon weight to body weight ratio was calculated and adhesion between colon and other organs was also monitored . samples of colon tissues located precisely 2 cm above the anal canal were obtained , fixed in 10 % buffered phosphate , embedded in paraffin , sectioned , and stained with hematoxylin / eosin . the degree of inflammation on microscopic cross sections was graded from 0 to 4 ( 0 : no signs of inflammation ; 1 : a very low level of inflammation ; 2 : a low level of leukocyte infiltration ; 3 : a high level of leukocyte infiltration , a high vascular density , and a thickened colon wall ; and 4 : transmural infiltrations , loss of goblet cells , a high vascular density , and a thickened colon wall ). the results show that when mice were treated with 150 mg / kg tnbs alone , they had severe illness characterized by diarrhea , profound and sustained weight losses , a significant increase of the colon weight to body weight ratio , and a mortality rate of 50 %. macroscopic examination indicates that the colon of each of mice had transmural inflammation in all layers of the bowel wall . in contrast , when mice were treated with the extract of andrographis paniculata ( 500 mg / kg / day ) prior to the induction of ibd , they had a reduced overall mortality rate , less severe wasting syndrome , a lower colon weight to body weight ratio , and a lower ibd score . the bowel wall was sleek and was not adhesive with surrounding tissues . in a separate assay , male wistar rats were used to evaluate the efficacy of the andrographis paniculata extract in treating ibd following a procedure similar to that described above . to induce ibd , the rats were administered with 2 , 4 - dinitrobenzenesulfonic acid , instead of tnbs . similar results were obtained . specifically , rats treated with the andrographis paniculata extract had a reduced overall mortality rate , less severe wasting syndrome , a lower colon weight to body weight ratio , and a lower ibd score , compared with those not treated with the extract . a number of embodiments of the invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are also within the scope of the following claims .

US-71726010-A

an improved pultrusion process for preparing composite materials having about 10 percent to about 45 percent by volume of reinforcing fibers so as to produce a composite material having enhanced flexibility as compared with composite materials having a higher percent of reinforcing fibers by volume . articles of manufacture made from composite material produced by the improved pultrusion process , specifically spinal implants , are also provided .

the present disclosure provides a pultrusion process for producing fiber - reinforced thermoplastic or thermoset composite material having about 10 % to about 45 % by volume of reinforced fibers that has increased flexibility over composite material made according to existing standard pultrusion methods having much higher percentage by volume of reinforcing fibers . the present invention may be understood more readily by reference to the following detailed description of the invention taken in connection with the accompanying drawing figures , which form a part of this disclosure . it is to be understood that this invention is not limited to the specific devices , methods , conditions or parameters described and / or shown herein , and that the terminology used herein is for the purpose of describing particular embodiments by way of example only and is not intended to be limiting of the claimed invention . also , as used in the specification and including the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include the plural , and reference to a particular numerical value includes at least that particular value , unless the context clearly dictates otherwise . ranges may be expressed herein as from “ about ” or “ approximately ” one particular value and / or to “ about ” or “ approximately ” another particular value . when such a range is expressed , another embodiment includes from the one particular value and / or to the other particular value . similarly , when values are expressed as approximations , by use of the antecedent “ about ,” it will be understood that the particular value forms another embodiment . the composite material of the present disclosure is prepared using a pultrusion method discussed herein that generally wraps and / or braids individual reinforcing fibers , for example such as glass or wire fibers , with fibrous material having a lower melting point than the melting point of the reinforcing fibers . in one embodiment of the present disclosure , individual reinforcing fibers or bundles of reinforcing fibers are first impregnated with a resin , for example a polymeric material such as polyester . the impregnated reinforcing fibers are then wrapped or braided with fibrous material having a lower melting point than the melting point of the reinforcing fibers , so as to provide additional bulk and strength to the reinforcing fibers . the additional bulk and strength of the wrapped and / or braided reinforcing fibers allows a reduced amount of reinforcing fibers to be used in the pultrusion process in order to pull the material through the heated die . that is , since the reinforcing fibers are wrapped and / or braided with fibrous material going into the heated die they have additional strength and therefore less of the continuous fibers are required to pull the pultrusion material through the heated die as it is being cured . it is envisioned that the pultrusion process of the present disclosure may be used to manufacture implants , for example plates , rods or vertebral implants that can be employed to treat spinal disorders such as , for example , degenerative disc disease , disc herniation , osteoporosis , spondylolisthesis , stenosis , scoliosis and other curvature abnormalities , kyphosis , tumor and fractures . it is further envisioned that the implants manufactured using the pultrusion technique described in the present disclosure may be employed with surgical treatments including open surgery and minimally invasive procedures , of such disorders , such as , for example , discectomy , laminectomy , fusion , bone graft , implantable prosthetics and / or dynamic stabilization applications . it is further contemplated that the disclosed pultrusion process can be used to make a solid composite pultrusion materials having predetermined properties , for example , strength and flexibility , that can be used to manufacture bone fasteners , rods , plates and other implants that may be employed in a surgical treatment with a patient in a prone or supine position , employing a posterior , lateral or anterior approach . the implants made from the composite material produced according to the disclosed pultrusion process may be employed with procedures for treating the lumbar , cervical , thoracic and pelvic regions of a spinal column . implants prepared from materials produced according to the pultrusion process described herein generally have fewer reinforcing fibers , for example between about 10 % to about 45 % by volume , than implants prepared from other pultrusion techniques . the following discussion includes a description of a pultrusion process , resulting composite material , and implants made from the composite materials , such as rods , plates and bone fasteners related components and exemplary methods of employing the implants in accordance with the principles of the present disclosure . alternate embodiments are also disclosed . reference will now be made in detail to the exemplary embodiments of the present disclosure , which are illustrated in the accompanying figures . turning now to fig1 - 3 , there is illustrated components used in the pultrusion process , composite material configurations , and implants in accordance with the principles of the present disclosure . in one embodiment , in accordance with the principles of the present disclosure , the pultrusion method provides individual reinforcing fibers or bundles of reinforcing fibers impregnated with a resin , for example a polymeric material such as polyester . as shown in fig1 - 3 , impregnated or non - impregnated reinforcing fibers 30 are wrapped and / or braided with fibers 20 produced from thermoset or thermoplastic materials having a lower melting point that the continuous reinforcing fiber 30 so as to provide a wrapped and / or braided continuous fiber 10 having additional bulk and strength . the additional bulk and strength of the wrapped and / or braided reinforcing fibers 10 allows for a reduced number or volume of reinforcing fibers to be used in the pultrusion composition but , yet still provides the required strength to pull the pultrusion material through the heated die in order to produce a cured composite material . the resulting cured material has between about 10 % to about 45 % reinforcing fibers by volume . in another embodiment of the present disclosure , the resulting cured material has between about 15 % to about 40 % by volume . in yet another embodiment of the present disclosure , the resulting cured material has between about 25 % to about 35 % by volume . the degree of flexibility of the resulting composite material is inversely proportional to the amount of continuous reinforcing fibers in the resulting composite . that is , the more reinforcing fibers in the final composite , the less flexibility the resulting composite material and the implants made from the material will have . the flexibility of the resulting composite material can also be controlled by the placement or positioning of the reinforced fibers in the composite material . since the resulting composite material has a lower percentage of reinforced fibers , these fibers can be arranged in such a way as to produce a predetermined desired flexibility . that is , as shown in fig2 and 3 , the reinforcing fibers can be placed around the periphery of the resulting composite material to provide a structure having a less flexible outer surface than inner core . alternatively , the reinforcing fibers can be arranged in the center of the composite material so as to make the resulting composite material more flexible around the edges than in the center . still further , the composite material can also have the reinforcing fibers evenly dispersed throughout the resulting composite so as to provide a composite having uniformed flexibility and strength . it is envisioned that various other arrangements can be used so as to produce composite materials having different desired flexibility and strength . a particular composite material can be produced or selected to make an implants having a desired flexibility profile . the resulting implant produced from the selected composite material can be further machined to provide the final configuration of the implant . for example , once a rough implant is machined from the composite material produced according to the disclosed disclosure , textured surfaces , chamfer surfaces , cavities and openings can be machined into the implant in order to produce the final product . the amount of flexibility of a particular implant can be controlled by the number of reinforcing fibers , the amount of braiding , as well as , the type of thermoplastic or thermoset used in the pultrusion process . as stated above , implants prepared from composite material produced according to the pultrusion method disclosed herein generally have fewer reinforcing fibers , for example between about 10 % to about 45 % by volume . these fibers can be orientated in the same direction , at an angle or in a predetermined orientation in order to produce a composite having the desired properties . that is , the reinforcing fibers can be arranged in a direction and / or orientated so that they are substantially parallel to the longitudinal axis , substantially perpendicular to the longitudinal axis , oblique to the longitudinal axis or some combination thereof . each orientation provides different degrees of flexibility . for example , as stated above , an implant made form composite material where all of the reinforced fibers are positioned around the perimeter of the solid composite has a more flexible inner portion than outer portion . in yet another embodiment of the pultrusion process in accordance with the present disclosure is prepared using chopped reinforced fibers , fragmented reinforced plates , or particulates of the reinforced elements in addition to the continuous reinforcing fibers discussed above . these fragments can be coated on the material used to braid the reinforcing fibers so as to provide continuous fibers and short fragments and / or plates within the resulting composite material . this adds additional strength to the resulting composite material without significantly changing flexibility of the resulting composite material . since the fragments of the reinforced fibers are not continuous , they move autonomously to one another and therefore do not significantly change the flexibility of the resulting composite material . the reinforced material these fragments / plates can be cured in accordance with the process of the present disclosure as discussed above . the reinforcing fibers of the present disclosure can be made form one or more of the following materials suitable for medical applications , including metal wires , polymers , ceramics , biocompatible materials and / or their composites , depending on the particular application and / or preference of a medical practitioner . for example , reinforcing fibers can be fabricated from materials such as commercially pure titanium , titanium alloys , grade 5 titanium , cobalt - chrome alloys , stainless steel alloys , metallic alloys , glass , carbon fibers , as well as man - made products that have a higher melting point than the matrix in which they wrapped / braided with according to the principle of the disclosed pultrusion process . materials used to wrap or braid the reinforcing fibers include but are not limited to thermoplastics such as polyaryletherketone ( paek ) including polyetheretherketone ( peek ), polyetherketoneketone ( pekk ) and polyetherketone ( pek ), carbon fiber reinforced peek composites , peek - baso 4 composites , ceramics and composites thereof such as calcium phosphate ( e . g . skelite ™ manufactured by biologix inc . ), rigid polymers including polyphenylene , polyamide , polyimide , polyetherimide , polyethylene , polyurethanes of any durometer , epoxy and silicone . different material composites can be used in order to achieve various desired characteristics such as strength , rigidity , elasticity , compliance , biomechanical performance , durability and radiolucency or imaging preference . the matrix used to wrap the reinforcing components of the disclosed pultrusion process may also be fabricated from a heterogeneous material such as a combination of two or more of the above - described materials as long as the resulting material has a melting point that is lower than the melting point of the material used to make the reinforcing fibers . in assembly , operation and use , implants made from materials produced according to the pultrusion process of the present disclosure may be employed with a surgical procedure for treatment of a spinal disorder affecting a section of a spine of a patient , as discussed herein , for example the implant can be used in areas where increased flexibility is necessary for normal function . that is , in joints , flexion points , intervertebral discs , or used in connection with a surgical procedure to correct spinal fractures , disorders or injury . it is contemplated that implants produced from the disclosed pultrusion process can be used in conjunction with vertebral fusion and / or dynamic stabilization applications of the affected section of the spine so as to facilitate healing and therapeutic treatment , while providing flexion , extension and / or torsion capability . implants can be coated with osteogenic , or therapeutic materials once produced . in use , to treat the affected section of the spine , a medical practitioner may obtain access to a surgical site in any appropriate manner , such as through incision and retraction of tissues . it is envisioned that the implant produced in accordance with the pultrusion process of the present disclosure , may be used in any existing surgical method or technique including open surgery , mini - open surgery , minimally invasive surgery and percutaneous surgical implantation , whereby vertebrae v is accessed through a micro - incision , or sleeve that provides a protected passageway to the area . once access to the surgical site is obtained , the particular surgical procedure is performed for treating the spinal disorder . the implant having increased flexibility can be in the form of a vertebral rod system , plate , bone fastener , or in any other useful structure is then employed to augment the surgical treatment . it will be understood that various modifications may be made to the embodiments disclosed herein . therefore , the above description should not be construed as limiting , but merely as exemplification of the various embodiments . those skilled in the art will envision other modifications within the scope and spirit of the claims appended hereto .

US-201213366980-A

a system and method for delivery of cardioplegic solution to the heart of a patient incorporates novel venturi flow cells individually adapted for insertion in the blood and crystalloid solution lines together with transducers for measuring a pressure drop across each venturi flow cell and transmitting it to a microprocessor to calculate flow rate for display on a monitor . the novel self - venting and self - priming transducers and venturi flow cells are incorporated in a disposable cassette . the transducers in the disposable cassette are removably snap connected to a hand set or plug housing which communicates with the computer or microprocessor and monitor . a novel variable ratio valve permits infinitely variable ratios of blood and crystalloid solution .

referring now to fig1 and 1a there can be seen an overall schematic showing of the cardioplegia system of the invention . as shown a source of blood 20 communicates with a venturi flow cell and transducer assembly or cassette 22 by means of a line or tubing 24 which passes through a one way check valve 26 . the check valve 26 communicates with a line or tubing 28 which is connected to a venturi flow cell 30 for blood . the check valve 26 permits flow in one direction only and prevents oscillatory flow . the venturi flow cell 30 which carries blood communicates with a transducer 38 and a transducer 40 by means of tubing or lines 42 and 44 respectively . two sources of crystalloid solution 31 and 32 selectively communicate with venturi flow cell and transducer assembly or cassette 22 by means of tubing or line 34 attached to a venturi flow cell 36 . the venturi flow cell 36 for crystalloid solution communicates with a transducer 46 and a transducer 48 by means of tubing or lines 50 and 52 respectively . the transducers 38 and 40 detect pressure changes within venturi flow cell 30 and transducers 46 and 48 detect pressure changes within venturi flow cell 36 . the venturi flow cell 30 for blood communicates with variable ratio valve 58 by means of line or tubing 56 . similarly , venturi flow cell 36 for crystalloid solution communicates with variable ratio valve 58 by means of line or tubing 54 . the blood and / or crystalloid solution are combined within variable valve 58 and then exit the valve 58 by means of line or tubing 60 . line or tubing 60 passes through peristaltic pump 62 and heat exchanger 64 . tubing or line 66 exits heat exchanger 64 for delivery to a patient by means of tubing or line 66 . a transducer housing connector or hand set 68 contains quick connectors 70 , 72 , 74 , and 76 which connect to transducers 46 , 38 , 48 and 40 respectively . the connectors 70 , 72 , 74 , and 76 transmit signals from the transducers 46 , 38 , 48 and 40 respectively by means of line 78 to a microprocessor within monitor 80 held by support arm and holder 81 . the microprocessor converts the signals received from the transducers 46 , 38 , 48 , and 40 into analogous electronic signals . then , the microprocessor uses the electronic signals to calculate the flow rate through the venturi cells 30 and 36 . the flow rate is then displayed on the monitor 80 . the method of the invention for delivery of cardioplegia includes the steps of providing at least one source of blood and providing at least one source of crystalloid solution . the blood is flowed from at least one source of blood through a first passage having a convergent portion and a divergent portion separated by a constriction . the pressure within the convergent portion and within the constriction is then measured . the difference in measured pressure is calculated and then used to calculate the flow rate of the blood . similarly , the crystalloid solution is flowed from at least one source of crystalloid solution through a second passage having a convergent portion and a divergent portion separated by a constriction . the pressure within the convergent portion and within the constriction is then measured . the difference in measured pressure is calculated and then used to calculate the flow rate of the crystalloid solution . the blood and crystalloid solution from the first and second passages are flowed into a chamber having means therein for selectively blocking all or a part of the flow from the first and second passages into the chamber . next the blood and / or the crystalloid solution is flowed from the chamber into a heat exchanger for temperature control of the blood and / or the crystalloid solution . finally , the blood and / or crystalloid solution is delivered to a patient . preferably , the pressure difference is measured by passing the blood and the crystalloid solution into contact with one side of a diaphragm exposed to ambient pressure . the opposite side of the diaphragm is exposed to a conduit which is connected to an electronic device having means responsive to pressure to cause an electronic signal to be formed which is analogous to the pressure difference . the electric signal is then sent to a microprocessor for calculating the pressure difference and flow rate of the blood and crystalloid solution . the calculated flow rates of the blood and crystalloid solution are displayed on a display monitor . looking more particularly at fig6 - 15a there can be seen the transducer and venturi flow cell assembly or cassette 22 in greater detail . as shown , the cassette 22 includes a top wall mounting plate or lid member 82 which is united along its peripheral edge to a bottom shallow box member 84 . the top wall or lid member 82 is provided with openings 85 , 86 , 87 , 88 for holding the transducers 46 , 38 , 48 , and 40 respectively . similarly , the bottom or box member 84 is provided with openings 89 , 90 , 91 , and 92 to hold the transducers 46 , 38 , 48 , and 40 respectively . two additional pairs of slots or openings 93 , 94 and 95 , 96 in the top wall mounting plate or lid member 82 which are aligned with openings 93a , 94a and 95a , 96a in bottom or box member 84 to hold venturi flow cells 30 and 36 . an enlarged showing of the transducer 46 can be seen in fig1 . as shown , the transducer 46 includes a chamber or isolator 97 having a membrane or diaphragm 98 extending across the chamber 97 . the membrane or diaphragm 98 divides or isolates the chamber 97 into an upper or first compartment 100 and a lower or second compartment 102 . the membrane should be formed of a liquid impermeable material to prevent liquid from entering the lower compartment 102 . the lower compartment 102 includes a tubular projection 104 having an o - ring 106 . the tubular projection 104 is adapted for snap connection to a connector 70 on transducer housing connector or hand set 68 . the upper compartment 100 has an opening or port 108 which communicates with a self - vent or autovent housing 110 through a passage or conduit 112 which contains a one way valve in the form of a duck bill valve 114 . as seen more particularly in fig1 , 11 and 12 , the autovent housing or chamber 110 includes a generally concave base member 116 and a generally convex top member 118 . the base member 116 has a central raised cap 120 having side walls 122 with openings 124 therein which communicate with passage or conduit 112 of upper compartment 100 of chamber 97 . the raised cap 120 extends into the autovent housing or chamber 110 . a series of arc shaped curved ribs or ridges 126 on the interior surface of base member 116 form tiers surrounding the raised cap 120 . the arc shaped ribs 126 are formed in increasing lengths as they are located distant from the raised cap 120 . between the tiers of curved ribs or ridges 126 are areas free of ribs or ridges 126 adapted to form ramps or passages 128 between the tiers of ridges 126 . in a similar fashion as seen particularly in fig1 , the top member 118 includes a depressed cup member or covering 130 having side walls 132 with openings 134 therein . the cup member 130 extends into the autovent or self - vent housing 110 . a series of arc shaped curved ribs or ridges 136 on the interior surface of top member 118 form tiers surrounding the cup member 130 . the arc shaped ribs 136 are formed in increasing lengths as they are located distant from the cup member 130 . between the tiers of curved ribs or ridges 136 are areas free of ribs or ridges 136 adapted to form channels or passages 138 between the tiers of ridges 136 . as shown in fig1 , between the base member 116 and the top member 118 is disposed a membrane 140 . the membrane 140 divides the autovent housing 110 into an upper chamber or cavity 142 and a lower chamber or cavity 144 . the membrane 140 is of the type which will permit the passage of air or other gas but not liquid . a preferred membrane is a 0 . 45 micron filter membrane formed of polytetrafluoroethylene ( ptfe ). other membrane materials can be used as long as the membrane will pass air or other gas but not liquids . the presence of the ribs 126 and 136 prevents the possibility of the membrane 140 from sealing to the top member 118 or the base or lower member 116 . the cup shaped member 130 protects the membrane from accidental damage . the dome shape of the top member 118 together with the channels or passages 138 aid the exit of air or other gas from the autovent housing 110 . the upper compartment 100 of the chamber or isolator 97 has a port 146 which extends upwardly into a raised tubular member 148 having an extension 150 for receipt of a small diameter tube 50 . the tube 50 is connected to venturi flow cell 36 for crystalloid solution . preferably , the transducers 38 , 40 , 46 , and 48 are made of a clear plastic material such as polycarbonate or polyvinyl chloride . use of a clear plastic material permits the visual inspection of the transducers to determine if the blood or crystalloid solution is flowing properly . a detailed view of the venturi flow cell 30 which carries blood can be seen in fig1 , 14 , and 14a . the venturi flow cell 36 which carries crystalloid solution has different dimensions from venturi flow cell 30 as hereinafter described . however , the venturi flow cell 36 operates in the same manner as venturi flow cell 30 . the differences in dimensions are related to the different fluids of crystalloid solution and blood . these dimensions compensate for the differences in viscosity over a range of flow rates and over a range of temperatures . as shown , venturi flow cell 30 for blood is formed of a relatively short tube 154 having a constricted , narrowed portion or throat 156 . the upstream inlet side or converging portion 158 of the constriction or throat 156 is formed into a barbed end 160 for connection to tube 28 . a relatively narrow diameter pressure port or tap 162 in the upstream inlet or converging side or portion 158 of venturi flow cell 30 opens into a relatively large diameter tubular extension or conduit 164 for connection to conduit or tube 42 to transducer 38 . directly above the constricted portion or throat 156 is a small diameter pressure port or tap 166 which opens into a relatively large diameter tubular extension or conduit 168 for connection to conduit or tube 44 to transducer 40 . the downstream outlet or diverging side 170 of venturi flow cell 30 for blood is also formed into a barbed end 172 for slip fit connection to tube or conduit 56 . the upstream inlet or converging side 158 of the venturi flow cell 30 for blood decreases in diameter from pressure port or tap 162 to the constriction or throat 156 . on the downstream outlet or diverging side 170 of the throat 156 , the venturi flow cell 30 increases in diameter . the upstream inlet or converging side 158 and the downstream outlet or diverging side 170 of the venturi flow cell 30 are not symmetrical . a detailed view of the venturi flow cell 36 which carries crystalloid solution can be seen in fig1 and 15a . as shown , venturi flow cell 36 for crystalloid solution is formed of a relatively short tube 189 having a constricted , narrowed portion or throat 190 . the upstream inlet or converging side or portion 191 of the constricted portion or throat 190 is formed into a barbed end 192 for connection to tube 34 . a relatively narrow diameter pressure port or tap 193 in the upstream inlet or converging side or portion 191 of venturi flow cell 36 opens into a relatively large diameter tubular extension or conduit 194 for connection to conduit or tube 50 to transducer 46 . directly above the constricted portion or throat 190 is a small diameter pressure port or tap 195 which opens into a relatively large diameter tubular extension or conduit 196 for connection to conduit or tube 52 to transducer 48 . the downstream outlet or diverging side 197 of venturi flow cell 36 for crystalloid is also formed into a barbed end 198 for slip fit connection to tube or conduit 54 . the upstream inlet or converging side 191 of the venturi flow cell 36 for crystalloid decreases in diameter from pressure port 193 to the throat 190 . on the downstream outlet or diverging side 197 of the throat 190 , the venturi flow cell 36 increases in diameter . the upstream inlet or converging side 191 and the downstream outlet or diverging side 197 of the venturi flow cell 36 are not symmetrical . it is important to note that the venturi flow cell 30 for blood and the venturi flow cell 36 for crystalloid have different dimensions . in particular , as seen in fig1 , 14 , 14a , 15 , and 15a , the diameter of the throat or constricted portion 156 of venturi flow cell 30 for blood is larger and longer in length than the throat or constricted portion 190 of venturi flow cell 36 for crystalloid solution . for example , the venturi flow cell 30 for blood preferably has an upstream inlet or convergent portion interior diameter , d1 , in the range of 6 . 0 - 7 . 0 mm , and most preferably in the range of about 6 . 5 mm ± 0 . 05 mm . the cross sectional area , a1 , of the upstream inlet or convergent portion is preferably in the range of 25 mm 2 to 34 mm 2 , and most preferably is about 29 mm 2 . the diameter , d2 , of the constriction or throat 156 is preferably in the range of 1 . 6 - 2 . 0 mm , and most preferably has a diameter of about 1 . 8 ± 0 . 05 mm . the cross sectional area , a2 , of the constriction or throat 156 is at least 2 mm 2 . preferably , the cross sectional area , a2 is in the range of 2 mm 2 to 3 mm 2 , and most preferably is about 2 . 5 mm 2 . the ratio of the cross sectional area , a1 of the convergent portion and the cross sectional area , a2 , of the constriction or throat is preferably in the range of about 8 . 33 to 1 to about 17 to 1 . most preferably the ratio is 11 . 6 to 1 . the length , l , of the constriction or throat 156 is preferably in the range of 8 . 0 - 9 . 0 mm , and most preferably in the range of 8 . 5 mm ± 0 . 05 mm . the pressure ports or taps 162 and 166 have axial centers , b1 and b2 , which are preferably in the range of 10 . 0 - 20 . 0 mm apart and most preferably are 15 mm ± 0 . 3 mm apart . for best results , the convergent cone angle , c , of the venturi flow cell 30 for blood is in the range of 20 °- 30 ° and most preferably is 26 °± 1 °. the divergent cone angle , e , of the venturi flow cell 30 for blood is preferably in the range of 10 °- 20 °, and most preferably is in the range of 15 °± 1 °. for the venturi flow cell 36 for crystalloid solution , the upstream or inlet interior diameter , d1 , is preferably in the range of 5 . 6 - 6 . 6 mm , and most preferably 6 . 1 mm ± 0 . 05 mm . the cross sectional area , a1 , of the upstream inlet or convergent portion is preferably in the range of 25 mm 2 to 34 mm 2 , and most preferably is about 29 mm 2 . the diameter , d2 , for the constriction or throat 190 is preferably in the range of 0 . 8 - 1 . 2 mm and most preferably is in the range of 1 mm ± 0 . 05 mm . the cross sectional area , a2 , of the constriction or throat 156 is at least 0 . 5 mm 2 . preferably , the cross sectional area , a2 is in the range of about 0 . 5 mm 2 to about 1 . 13 mm 2 , and most preferably is about 0 . 78 mm 2 . the length , l , of the constriction or throat 190 is preferably in the range of 3 . 5 - 4 . 5 mm , and most preferably is in the range of 4 mm ± 0 . 13 mm . the ratio of the cross sectional area , a1 , of the upstream inlet or convergent portion to the cross sectional area , a2 , of the constriction preferably is in the range of about 22 to 1 to about 68 to 1 . most preferably , the ratio is 37 . 1 to 1 . the pressure ports or taps 193 and 195 have axial centers , b1 and b2 , which are preferably in the range of 10 . 0 - 20 . 0 mm apart , and most preferably are in the range of 15 mm ± 0 . 3 mm apart . for best results , the convergent cone angle , c , of the venturi flow cell 36 for crystalloid solution is preferably in the range of 20 °- 30 °, and most preferably in the range of 26 °± 1 °. the divergent cone angle , e , of the venturi flow cell 36 for crystalloid solution is preferably 10 °- 20 °, and most preferably is in the range of 15 °± 1 °. it is important that the location and distance between the pressure port or tap 162 and pressure port or tap 166 , and the location and distance between the pressure port or tap 193 and the pressure port or tap 195 , and the volume be fixed and known in order to be able to calculate the flow rate through each venturi cell 30 and 36 by means of the pressure drop between pressure ports . with the flow rate known , the quantity of fluid flowing can be calculated . the venturi principle equation to be used to calculate the quantity of fluid flowing through the venturi flow cells 30 and 36 is given below : ## equ1 ## wherein : a1 = d1 2 π / 4 a1 is the cross sectional area at the pressure port or tap opening into the upstream or convergent side of the venturi cell . a2 is the cross sectional area at the pressure port or tap opening into the throat or constricted portion . d1 is the upstream or inlet interior diameter of the venturi flow cell . c v is the velocity coefficient which is determined by the identity of the fluid and the reynolds number and is unique to the geometry of the venturi flow cell . p1 is the pressure at the pressure port or tap opening into the upstream or convergent side of the venturi cell . p2 is the pressure at the pressure port or tap opening into the throat or constricted portion . in order to calculate the c v , empirical tests are conducted using for example , blood flow within the venturi flow cell for blood within a wide range of known flow rates . then , the results obtained using the venturi cells are compared with the known flow rates . the differences between the two values constitute the c v . the different c v values are then plotted so that the appropriate correction for each flow rate can be used to provide an accurate result . thus , a correction factor is determined for each flow rate for a given fluid through a specific venturi flow cell . the correction factor together with the venturi equation is incorporated into the software used in the microprocessor within the monitor 80 so that a corrected value is displayed on the monitor . an example of a graph of blood flow over a wide range of known flow rates for a given venturi flow cell for blood is shown in fig2 . the specific dimensions of the venturi flow cells have been found to avoid turbulence which could give a false pressure reading . the venturi flow cells 30 and 36 are supported by a pair of side brackets or struts 174 and 176 which surround the upstream inlet end 158 and the downstream outlet end 170 respectively . between the brackets or struts 174 and 176 are a pair of reinforcing ribs or fins 178 and 180 . as shown particularly in fig1 , the bracket 174 has an extension 182 which terminates in a detent or catch 184 . the other bracket 176 also extends away from the cell 30 to form a right angle extension 186 which has a flange or lip 188 at the end . the flange or lip 188 is retained by the detent or catch 184 on the bracket 174 . the mounting plate or top member 82 of the cassette 22 contains two pairs of slots or openings 93 , 94 and 95 , 96 which receive the brackets 174 and 176 of the venturi flow cells 30 and 36 . the brackets 174 and 176 of the venturi flow cells 30 and 36 are secured under the mounting plate or top member 82 by means of the flange or lip 188 on extension 186 engaging the detent or catch 184 on the bracket 174 . the microprocessor based vcr monitor 80 receives data in the form of process signals to derive blood and crystalline flow and volume , and to measure antegrade and retrograde pressure and solution temperature . as shown in fig2 - 5 , the monitor 80 receives data from the cassette 22 through the line 78 . other connectors for receipt of data can be found at the rear of the monitor 80 as shown in fig2 . the antegrade infusion pressure data or information is received through port or connector 199 . the retrograde infusion pressure data is received through port or connector 200 . downloading of data to a computer or to a printer can be done through connector 201 . the data from a temperature probe is received through connector 202 . fig3 shows a side mounted power switch 203 , a charging indicator 204 , and a port 205 for an a / c adaptor . the port 205 connects to a 12 volt , nickel - metal hydride rechargeable battery pack within the monitor 80 . fig4 and 5 show two different screen displays for display of information received through the ports 199 , 200 , 201 , 202 , and through line 78 from cassette 22 . entering information and switching between functional screens of the monitor 80 is made through menu switches 206 and up / down rocker switches 207 . while the flow rate is displayed on the monitor 80 , the relative ratio of blood and crystalloid solution is determined by the operation of a variable ratio valve 58 . the variable ratio valve 58 is unique in that it can be manually operated to provide all crystalloid solution , all blood , or any ratio of crystalloid solution and blood . as an alternative to manual operation , as indicated in fig1 a , the valve 58 can be operated by a servo 208 which responds to electrical impulses from a driver 209 which receives commands from the microprocessor within the microprocessor based vcr monitor 80 . with respect to the manual operation , as shown particularly in fig1 - 21 , the variable ratio valve 58 includes a valve housing 211 . the valve housing 211 includes a cylindrical chamber 212 having an opening 214 in the base of the chamber 212 . the top of the chamber 212 is open and is surrounded by an outer circular flange 216 . the flange 216 has two detents or raised stops 218 and 220 shown in outline in fig2 on its top surface . as shown in fig1 , a pair of inlet ports 222 and 224 communicate with two parallel tubular projections 226 and 227 respectively . the tubular projections 226 and 227 extend from the valve housing 211 . each tubular projection 226 and 227 has an inner chamber 228 and 229 having a one way check valve disposed therein in the form of a duck bill valve 230 and 232 respectively . in order to facilitate connection with tubing 54 and 56 from the venturi flow cells 36 and 30 , the tubular projections 226 and 227 are provided with barbed tapered ends 234 and 236 respectively . in this manner , crystalloid solution from venturi flow cell 36 flows through tubing 54 to barbed end 234 into tubular projection 226 through duck bill valve 230 in chamber 228 to enter chamber 212 of variable ratio valve 58 . similarly , blood from venturi flow cell 30 flows through tubing 56 to barbed end 236 into tubular projection 227 through duck bill valve 232 in chamber 229 to enter inlet port 224 of chamber 212 in variable ratio valve 58 . opposite the inlet ports 222 and 224 is an outlet port 238 having a tubular projection 240 extending therefrom . the tubular projection 240 extends from the valve housing 211 and has a barbed tapered end 242 to facilitate connection to tubing 60 . the axial centers of inlet ports 222 and 224 and the outlet port 238 lie in a plane which bisects the axial center 244 of chamber 212 . tubular projections 226 and 227 are supported by a bracket or strut 244 . similarly , a bracket or strut 246 supports tubular projection 240 . another pair of brackets or struts 247 and 248 are disposed on opposite sides of the valve housing 211 to serve as a means for securing the variable ratio valve 58 to a holder 250 . a substantially cylindrical cup shaped valve core member 252 is mounted for rotation within the chamber 212 . the valve core member 252 has a bottom tubular projection 254 which is sized to fit into opening 214 in the bottom of chamber 212 . the tubular projection 254 can be secured within opening 214 by means of a c - clip 256 . surrounding the exterior of the cylindrical valve core member 252 are two spaced apart substantially parallel raised rings , bands or cams 258 and 260 . within chamber 212 , band or cam 258 overlies inlet port 222 for crystalloid solution and band or cam 260 overlies inlet port 224 for blood . the width of band or cam 258 and band or cam 260 is great enough to cover inlet ports 222 and 224 respectively . this can be seen in fig1 and 20 . the circular space between each band , ring , or cam 258 and 260 forms a channel or passage 262 . channel or passage 262 is in fluid communication with outlet port 238 . each band 258 and 260 is eccentric . thus , as valve core 252 is rotated over a prescribed arc of travel within valve housing 211 , the gap or space overlying channel 222 increases while the gap or space overlying channel 224 decreases or vise versa , depending of the direction of rotation . the bands 258 and 260 are arranged so that the deepest or thickest point of band 258 is adjacent to the thinnest point of band 260 . in this manner , as shown in fig1 , 18 and 19 , when band 258 has its thinnest portion overlying inlet port 222 there is a space 264 between the band 258 and the inlet port 222 . as shown in fig1 , this permits crystalloid solution to enter port 222 as indicated by the arrows . from inlet port 222 , the crystalloid solution enters channel 262 where it enters outlet port 238 . at the same time , as seen in fig1 , band 260 has its thickest portion overlying inlet port 224 so that entry of blood is effectively blocked . the above condition is effected when the inner valve core member 252 is rotated counterclockwise until it is stopped by detent 218 . rotation of the inner cup shaped valve core member 252 clockwise until it is stopped by detent 220 brings about the opposite effect . that is , band 258 has its thickest portion overlying inlet port 222 blocking entry of crystalloid solution . concurrently , band 260 has its thinnest portion overlying inlet port 224 so that blood can enter into chamber 212 , through channel 262 to outlet port 238 . the increasing and decreasing thickness of bands or cams 258 and 260 provides a gradually increasing and decreasing ramp function along the path of rotation . the bands do not have to be mirror images of each other . thus , the increasing and decreasing ramp function does not have to be even but can be adjusted specifically for the density of the fluid , i . e . blood , or crystalloid solution . in this manner , rotation of the valve core member 252 over a prescribed arc of travel permits the ratio of crystalloid to blood to be infinitely varied from all crystalloid , mixtures of blood and crystalloid in all proportions , to all blood depending on the degree of rotation . channel 262 is always open to outlet port 238 regardless of the position of bands 258 and 260 . surrounding the cup shaped valve core member 252 is a rotatable collar 270 which is disposed between the valve housing 211 and an upper flange 272 surrounding the top of valve core member 252 . with the bottom 254 of core member 252 secured within opening 214 in chamber 212 , the collar 270 is held in place . an o - ring 274 surrounds and seals the bottom tubular projection 254 within opening 214 of chamber 212 . another o - ring 276 seals the upper portion of core member 252 within chamber 212 . this can be seen in fig1 and 20 . a graphical scale 278 showing rotation position over a prescribed arc of travel is disposed about the circumference of the outer flange 216 of chamber 212 . this scale 278 can be substituted with any equivalent scale or divisions to indicate the relative proportions of blood and crystalloid solution admitted to channel 262 in chamber 212 . the collar 270 includes an opening or window 280 which reveals the scale 278 . a pointer or arrow 282 marks the divisions on the scale 278 . sidewall 284 of the window 280 is stopped by detent 218 when the collar 270 and valve core member 252 are rotated clockwise . sidewall 286 of the window 280 is stopped by detent 218 when the collar 270 and core member 252 are rotated counterclockwise . as shown in fig2 , three spaced apart side ribs or flanges 288 , 290 , and 292 on the exterior wall of valve core member 252 are received in three slots or notches 294 , 296 , and 298 around the central opening 300 of collar 270 . the ribs or flanges 288 , 290 , and 292 when seated within the slots 294 , 296 , and 298 cause the core member 252 to rotate with the collar 270 . around the periphery of the collar 270 are a plurality of knobs or rounded ribs 302 . the knobs or rounded ribs 302 provide ease in grasping the collar 270 for rotating the collar 270 and the core member 252 to give the desired ratio of blood to crystalloid solution . the actual ratio is displayed on the monitor 80 as determined by flow through the venturi flow cells 30 and 36 and corresponding to the signals sent from the transducers 38 , 40 , 46 and 48 to the monitor 80 . the design of the variable ratio valve 58 ensures that each side of the valve will shut off to allow no flow as well as to provide adequate resolution during use so that the blood to crystalloid ratio can be adjusted at various flow rates . another embodiment of the variable ratio valve 58 is shown in fig2 , 23 , 24 and 25 . as shown , the valve 400 has a similar construction to valve 58 and like parts are labeled the same . the main difference is in the configuration of the core 402 and the valve body 404 . as can be seen in fig2 , the valve core 402 has a cam or band surface 405 with a depression or recess 406 therein . within the recess or depression 406 is disposed a plug 408 made of a material which is softer than the material of the core 402 or the cam 405 . also , the cam or band 405 has an offset or shoulder 410 formed within the surface of the cam or band 405 . the inlet port 412 for crystalline solution is detailed in fig2 . here it can be seen that the valve body 405 in the region of the inlet port has a slightly projecting flattened curve area 414 and 416 on either side of the inlet port 412 . the curve area 414 and 416 is adapted to receive the plug 408 when the cam or band 405 is rotated to bring the plug 408 opposite the inlet port 412 . similarly , as can be seen in fig2 , the valve core 402 has a cam or band surface 418 with a depression or recess 420 therein . within the recess or depression 420 is disposed a plug 422 made of a material which is softer than the material of the core 402 or the cam 418 . also , the cam or band 418 has an offset or shoulder 424 formed within the surface of the cam or band 418 . the inlet port 426 for is blood shown in fig2 . here it can be seen that the valve body 405 in the region of the inlet port 426 also has a slightly projecting flattened curve area 414 and 416 on either side of the inlet port 426 as shown in fig2 . the curve area 414 and 416 is adapted to receive the plug 422 when the valve core 402 is rotated to bring the cam or band 418 with the plug 422 opposite the inlet port 426 for blood . another feature of the variable ratio valve 400 is that the cam or band surfaces 405 and 418 have a different lobe shape as they function over a sweep of 288 degrees instead of 180 degrees . also , rotation of the valve core 402 is stopped by a single detent 428 which lies in a plane bisecting inlet ports 412 and 426 . the shoulder or offset areas 410 and 424 allow for a slightly increased gap between the valve core 402 and the valve body 405 which allows for easier priming . while the variable ratio valves 58 and 400 are shown with two inlets , more inlets can be incorporated to provide more than two different fluids . similarly , additional cam or band surfaces can be incorporated into the valve core member 252 or 402 to admit variable amounts of additional fluids . preferably , the venturi flow cells 30 and 36 , the transducers 38 , 40 , 46 , and 48 , and the variable ratio valve 58 are made of a clear plastic such as polyvinylchloride or polycarbonate . other plastics can be used which are approved for medical use . clear plastic is preferred for convenience in observing the flow of blood or crystalloid solution through the cells 30 and 36 . the variable ratio valve 400 preferably is made of a clear , polycarbonate or other hard , rigid material with the plugs 408 and 422 preferably being made of a softer plastic such as polyethylene to ensure a good seal . for the same reasons , clear plastic tubing is preferred to permit observation of liquid flow through the tubing . the system as described can be used to provide a range of flow of from 0 ml to 250 ml per minute for the crystalloid solution and a range of flow of from 0 ml to 500 ml per minute for the blood . best results are obtained with the pump 62 being operated at no more than 70 revolutions per minute . the blood parameters can be controlled within a wide range . preferably , the hematocrit is kept in the range of from 15 % to 35 % by volume and the temperature is kept in the range of 18 ° c . to 42 ° c . the crystalloid solution parameters can be controlled within a wide range . preferably , the dynamic viscosity is kept in the range of from 19 to 26 centipoises ( salt water ± 15 %) and the temperature is kept in the range of 0 ° c . to 42 ° c . for clinical use , the flow rate measurement is accurate to ± 5 % ( full scale output ) for blood or crystalloid . the dimensions and designs of the individualized venturi flow cells , transducers , autovents , tubing , and variable ratio valve optimize the flow characteristics of the two fluids , blood and crystalloid solution while ensuring sufficient pressure drop across the venturi flow cells 30 and 36 to permit detection with standard high definition pressure monitoring equipment . at the same time , the designs and dimensions avoid creating shear forces which would cause destruction of red blood cells ( hemolysis ). various modifications of the invention are contemplated which will be obvious to those skilled in the art and can be resorted to without departing from the spirit and scope of the invention as defined in the following claims .

US-69025996-A

this invention relates to novel forms of clarified hydrocolloids including gels , films , foams , capsules and sponges . the invention also pertains to novel processes for producing the various physical forms of the clarified hydrocolloids . the invention also includes clarified hydrocolloid composites ; borated cis 1 , 2 - diol containing hydrocolloids ; and clarified hydrocolloids of low viscosity .

although there are a number of published procedures in the patent and journal literature for clarifying hydrocolloids , such as glucomannans , galactomannans , and fermentation polysaccharides , particularly for structure determination and derivatization , no clarified products having significant sales seem to be available commercially . this fact tends to demonstrate that none of these methods are cost - effective or , in some cases , capable of scale - up , or in other cases , the clarified hydrocolloids suffer a loss in properties , when compared to the unclarified hydrocolloids . in the case of locust bean gum and konjac , clarified products are manufactured by , for example , fmc corporation to be sold as blends . significant viscosity reduction is evident with their commercial products . we have developed a simple but non - obvious process that results in dry hydrocolloid products that , when reconstituted , form clear viscous sols , free from essentially all particulates and retain desirable physical properties , unlike commercially available products . while we do not wish to be adversely bound by any theories , we offer the explanation that the unique method according to the invention appears to surmount the difficulties inherent with prior processes by minimizing heating and high - shear stirring in the dissolution step . this keeps the impurities in as large a particulate state as possible . the process follows with centrifuging to remove the filter - blinding materials , filtering the mixture at a temperature less than about 45 ° c ., except when the polysaccharides are insoluble at this temperature , using an appropriate filter aid , recycling the filtrate until it is crystal clear , recovering the clarified hydrocolloid through isopropyl alcohol coagulation , and maintaining ready re - solubility in the clarified products with a final wash of high - titer alcohol . this procedure can be used to clarify virtually all hydrocolloids , including konjac , guar gum , locust bean gum , aloe acemannan , and xanthan gum , to name a few . the clarified hydrocolloids obtained by the method according to the invention can be recovered directly , such as by coagulation in isopropyl alcohol , or can be combined with one or more other hydrocolloid sols and then recovered . the process of the invention can impart unique properties to the composite clarified hydrocolloids that are different from the individual clarified hydrocolloids . such properties cannot be achieved by direct blends of the solid materials . in one embodiment of the invention , a simple yet unique way for preparing low - viscosity , clarified depolymerized konjac has also been discovered and developed . the products and process of the invention differ from the prior art in a number of respects . there are in existence a number of patents and publications that disclose procedures for “ clarifying ” konjac and other hydrocolloids . the products derived from most of these procedures are either unsatisfactory or the method is laborious and not cost - effective . using the method according to the invention for clarifying polysaccharides , it is likely that cost - effective products can be obtained . these clarified polysaccharides can either be blended with other ingredients , co - precipitated with other hydrocolloids , or co - dried with other materials , leading to a number of interesting and useful , commercially feasible , clarified polysaccharide - based products . the key inventive and successful factors with this process , and what makes it unique and different from existing konjac clarification processes , and other hydrocolloid clarification procedures , is a combination of the way the crude hydrocolloids are reconstituted to minimize the possibility for degradation or conversion to insoluble entities , maintaining the impurities in as large a particle size as possible , the centrifugation method used to remove the filter - blinding solids , the filtration , and the polysaccharide recovery . all these steps lead to retention or enhancement of viscosity and other desirable properties . the use of hydrogen peroxide in a heterogeneous reaction , i . e ., imbibing the peroxide into the dry konjac powder and allowing the reaction to take place until the mixture becomes fluid , also is unique . in addition to the polysaccharides mentioned in this discussion , there is no reason to believe that the following natural polysaccharides cannot be clarified using appropriate temperature and time modifications of the basic method . a non - limiting list follows . agar , agarose , algins , β -, κ -, ι - carrageenans , chitosan , collagen , curdlan and other β - 1 , 3 - glucans , fig seed gum ( galacturonan ), gellan , hyaluronic acid , pectins , rhizobium gum and porphyridium cruentum polysaccharide . acacia gum , gum arabic , λ - carrageenan , chondroitin sulfates , dextrans , flaxseed gum , gum ghatti , inulin ( fructan ), karaya gum , larch arabinogalactan , levan ( fructosan ), cassia , tara , fenugreek and other galactomannans , oat glucans , okra mucilage , psyllium seed gum , pullulan , quince seed gum , rhamsan , scleroglucan , starches ( amylose , amylopectin ), succinoglucan , tamarind gum , gum tragacanth , wellan , and xanthan gum . clarified hydrocolloids , prepared according to the invention , can be used individually or with one or more other hydrocolloids and / or other ingredients as thickeners or viscosifiers , gelling agents , film - formers , coatings , foams , sponges or capsules . potential applications for these include the following : ingredients in foods , beverages , nutraceuticals , pharmaceuticals , tabletting aids , tablet coatings , encapsulating material , drug delivery substrates , diagnostics , cosmetics , personal care products , wound and burn care products , aqueous fluids absorbent , cell growth matrices , tissue engineering substrates , plant propagation supports , prosthetics , contact lenses , life sciences research , photographic film , and the like . fig1 to 6 illustrate schematic flowsheets of various procedures that can be used to convert clarified hydrocolloids such as konjac , aloe mannan , guar gum and locust bean gum into films , foams , sponges and capsules . fig1 illustrates a schematic flow sheet of various types of films that can be prepared from clarified konjac sol according to the invention . fig2 illustrates a schematic flow sheet of various types of films that can be prepared from clarified guar , locust bean gum or other galactomannan sol according to the invention . fig3 illustrates a schematic flowsheet of various types of foams that can be made from clarified konjac sol according to the invention . fig4 illustrates a schematic flowsheet of various types of foams that can be made from clarified guar or locust bean gum sol according to the invention . fig5 illustrates a schematic flowsheet of various types of sponges that can be made from clarified konjac sol according to the invention . fig6 illustrates a schematic flowsheet of various types of capsules that can be made from clarified hydrocolloid sols according to the invention . although isopropyl alcohol ( 2 - propanol ) coagulation has been used as the recovery method in many of the examples given , it is conceivable that other methods , such as spray drying , freeze drying , etc ., can be used as well , to recover the clarified polysaccharides and composites . using a 2 - liter pyrex measuring bowl , 10 grams of amophol lg konjac powder ( shimizu chemical corp ., lot lhb27 ) was dispersed in 1 liter of deionized water ( tap water may be satisfactory ) containing 25 grams of dissolved nacl using a hand - held braun blender / homogenizer to assure complete dispersion and minimize clumping . the container was covered with plastic film and the contents heated to boiling in a microwave oven . occasional hand - stirring with a spatula was needed initially to keep the swelling particles from settling . the hot mixture , containing both dissolved konjac and swollen particles as well as particulate impurities , was allowed to cool to near room temperature . a brief high shear blending with the braun blender was used to assist in the dissolution of the swollen particles . fifty grams of dicalite speedplus filter aid was added , along with 500 ml of de - ionized water . the mixture was blended briefly ( braun blender ), then filtered through a cloth pad in a 2 - liter pressure filtration device , recycling until crystal clear . the clear filtrate was collected ( ˜ 1400 ml ) and then coagulated in 3 liters of 85 % isopropyl alcohol ( ipa )( aq .). after { fraction ( 1 / 2 )} hour , the white , voluminous fibrous coag was collected on fine - mesh nitex cloth , squeezed , pulled apart , washed in 500 ml 60 % ipa for { fraction ( 1 / 2 )} hour using magnetic stirring , again collected on nitex , squeezed , pulled apart , and washed , with magnetic stirring in 500 ml of 99 % ipa . the washed , clarified konjac fibers were again collected on nitex cloth , squeezed , then pulled apart and dried in a forced air oven at about 40 ° c . the dried , fluffy white product , 7 . 4 g or 74 % yield , without moisture correction , was ground to - 20 mesh . a clear 0 . 5 % sol was formed when this material was dissolved in 0 . 5 % nacl ( aq .) a 1 % sol in de - ionized water exhibited a viscosity of 10 , 870 mpas at 25 ° c ., using the # 2 spindle and 0 . 3 rpm settings on the brookfield dv - ii + viscometer . an equivalent concentration of the starting material ( 1 . 35 % based on 74 % yield ) had a viscosity of 5 , 250 mpas at 22 ° c ., # 2 spindle , 0 . 3 rpm . in a similar manner other konjac flour - based products from shimizu chemical industries , amophol ts , propol rs , and propol rx - h were clarified . yields obtained were 72 . 0 %, 65 . 5 %, and 58 . 2 % respectively . five grams of amophol ts ( lot tgj22 , shimizu chemical corporation ) was dispersed in 0 . 5 liters of de - ionized water using a spatula . the mixture was heated to boiling in a microwave oven . an additional 250 ml of de - ionized water was added and stirred in using an arrow overhead stirrer . to this was added 25 grams of dicalite speed plus filter aid and stirred until homogeneous . this was filtered at room temperature through a thick cloth pad in a 2 - liter pressure filtration apparatus ( pfa ). only 200 ml of clear filtrate was collected before a tough film blinded the filter . the filtrate was coagulated in 400 ml of 85 % ipa , stirring with a spatula while pouring . after one - half hour , the coag was collected on nitex cloth , squeezed , and washed by stirring with 200 ml of 60 % ipa for 20 minutes , again collecting on nitex cloth and squeezing . 200 ml of 99 % ipa was used for the final wash after collecting and squeezing , the coag was dried at about 38 ° c . in a one - pass hot air oven . after grinding to − 20 mesh , 0 . 4 g ( about 60 % yield ) of white powder was obtained . in a like manner , 10 g of konjac flour m ( shimizu chemical corporation , lot 981027 ) was clarified with 6 . 37 g ( 63 . 7 % yield ) being obtained . the viscosity of a 1 % sol of the clarified material was 1 , 156 mpas compared with a 1 % viscosity of 656 mpas for the konjac flour . filtration difficulties were encountered with direct filtration of the konjac sol because of the formation of a waxy flexible film on the surface of the filter aid . the procedure was modified to include a centrifugation step before filtration . filtration of the combined centrifugates was rapid and able to be done at low pressure input . to 1 liter of de - ionized water was added 6 . 7 g of konjac flour ap ( shimizu chemical corporation , lot 990820 ) and dispersed using a wire whisk attachment on a braun hand - held blender . after standing at room temperature for about one hour to hydrate , the high - shear blade attachment to the braun blender was used to prepare a smooth sol . this sol was distributed into 4 screw - cap polypropylene centrifuge bottles and centrifuged at 11 , 000 rpm for 40 minutes , using a sorvall rc2 - b centrifuge . after the supernatants were removed by decantation and combined , 50 g of dicalite speed plus filter aid was added and mixed in thoroughly . this was filtered through a felt pad in a 2 - liter pressure filtration device . filtration was rapid and accomplished at & lt ; 20 psi . the filtrate ( 800 ml ) was sparkling clear . to this was added 500 ml of 99 % ipa and the stirred with a spatula to mix thoroughly . a mucoid coag formed which on standing became firm enough to handle . this was collected on nitex cloth , squeezed , pulled apart and washed in 300 ml of 99 % ipa and again collected on nitex cloth , squeezed and dried at about 38 ° c . in a one - pass hot air oven . after grinding to − 20 mesh , 2 . 38 g ( about 35 . 5 % yield ) of white powder was obtained . a 1 % sol in de - ionized water was clear and exhibited a viscosity of 8 , 125 mpas at 21 . 3 ° c ., using the # 2 spindle and 0 . 3 rpm settings on the brookfield dv - ii + viscometer . conductivity was 20 μs at 21 . 5 ° c . using an oakton tdstestr ™ conductivity meter . two pilot plant scale - ups of this procedure yielded white powders having viscosities of 25 , 250 and 29 , 030 mpas respectively for 1 % sols compared with 32 , 500 for a 1 . 35 % sol of the konjac flour ap . to 350 g of amophol ts ( shimizu chemical corporation , lot thf 19 ) in a stainless steel 5 - quart kitchen aid mixing bowl was added 1400 ml of 10 % hydrogen peroxide and the mixture blended until it became a stiff homogeneous paste . the bowl was covered with saran wrap and placed in a 65 ° c . water bath for 5 hours , occasionally mixing with a spatula . during this time a nearly clear , slightly yellow , low - viscosity fluid was obtained . after allowing the reaction product to cool to room temperature , 25 g of dicalite speed plus filter aid was added and mixed in with a broad spatula . this mixture was filtered through a 30 g pre - coat of the filter aid on a felt pad in a 2 - liter pressure filtration device . the clear filtrate ( ca . 1500 ml ) was coagulated in 4 . 5 liters of rapidly stirring 99 % ipa . the fine precipitate was collected on nitex cloth , squeezed , washed for 20 minutes in 4 liters of stirred 99 % ipa , collected on nitex cloth , squeezed , and dried at about 38 ° c . in a one - pass hot air oven . 299 . 5 g ( 86 . 5 %) of fine white granular powder was obtained . a clear 10 % solution ( w / w ) of this material in de - ionized water was easily prepared . properties of this 10 % solution were as follows : viscosity = 1 . 4 mpas , ph = 2 . 98 , turbidity = 16 . 4 n . t . u . commercial grade guar gum , procol f ( lot : a7265b ), was obtained from polypro international , minneapolis , minn . to 10 g was added 30 ml of 99 % ipa and the mixture stirred with a spatula until homogeneous . while agitating with the wire whisk attachment to a braun hand - held blender , one liter of de - ionized water was added rapidly and stirred until nearly homogeneous . after standing at room temperature for one hour to complete hydration , the mixture was heated to boiling using a microwave oven then homogenized using the blender attachment . the mixture was reheated to boiling and transferred to 2 - 250 ml polypropylene screw - cap centrifuge bottles and centrifuged for 30 minutes at 11 , 000 rpm , using a sorvall rc2 - b centrifuge . after the supernatants were removed by decantation and combined , 25 g of dicalite speed plus filter aid was added and mixed in thoroughly . this was filtered through a 30 gram pre - coat of the speed plus on a felt pad in a 2 - liter pressure filtration device . the filtrate ( ca . 800 ml ) was sparkling clear . this was coagulated in 800 ml of rapidly stirring 99 % ipa . the coag was collected on nitex cloth , squeezed , pulled apart and washed in 250 ml of 99 % ipa and again collected on nitex cloth , squeezed and dried at about 38 ° c . in a one - pass hot air oven . after grinding to − 20 mesh , 4 . 65 g ( 46 . 5 % yield ) of white powder was obtained . the 1 % sol viscosity of clarified guar was & gt ; 2 , 000 mpas compared with 2 , 575 mpas for a 1 % sol of the procol f . using a braun hand - held mixer , 2 g of commercial locust bean gum ( t . i . c . gums , por / a , fcc powder , lot : p00124 ) was suspended in 300 ml of de - ionized water containing 2 g of nacl . this was covered with saran wrap and heated to boiling in a microwave oven . the mixture was re - blended , 10 g of dicalite speedplus filter aid was added and mixed in thoroughly . this was then filtered through a 10 g pre - coat of the filter aid on a felt pad in a 500 ml pressure filtration vessel , recycling until sparkling clear . the clarified locust bean gum was recovered by coagulating the filtrate ( ca . 250 ml ) in 500 ml of 85 % ipa . the coag was collected on nitex cloth , squeezed , and washed successively with 200 ml 60 % ipa , and 200 ml of 99 % ipa , each time stirring for { fraction ( 1 / 2 )} hour , then collecting the coag on nitex cloth and squeezing . drying was effected at about 38 ° c . in a one - pass hot air oven . after grinding to − 20 mesh , 1 . 28 g ( 64 % yield ) of white powder was obtained . a 1 % sol of the clarified locust bean gum was clear and colorless and exhibited a viscosity of 438 mpas compared with a 1 % sol viscosity of 212 mpas for the starting material . to 5 g of aloe glucomannan ( carrington laboratories &# 39 ; acemannan 95008 , lot : 10608 ) was added sufficient 99 % ipa to just wet the powder evenly when stirred with a spatula . using the wire whisk attachment to the braun hand - held mixer , 750 ml of de - ionized water was added . the dispersed suspension was allowed to stand until fully hydrated . the mixture was brought to a boil in a microwave oven and blended using the blender attachment to the braun . this sol was distributed into 3 - 250 ml screw - cap polypropylene centrifuge bottles and centrifuged at 10 , 000 rpm for 30 minutes , using a sorvall rc2 - b centrifuge . after the supernatants were removed by decantation and combined , 25 g of dicalite speed plus filter aid was added and mixed in thoroughly . this was filtered through a 30 g pre coat of the filter aid on a felt pad in a 2 - liter pressure filtration device . the filtrate ( 650 ml ) was clear but not sparkling . the clarified aloe glucomannan was recovered by adding 650 ml of 99 % ipa and mixing thoroughly . after standing at room temperature for an hour to harden , the coag was collected on nitex cloth , squeezed , and washed using 300 ml 99 % ipa stirring for { fraction ( 1 / 2 )} hour , then collecting the coag on nitex cloth and squeezing . drying was effected at about 38 ° c . in a one - pass hot air oven . after grinding to − 20 mesh , 2 . 0 g ( 40 % yield ) of white powder was obtained . a 1 % sol of the clarified aloe glucomannan was clear and very viscous . ten grams of keltrol t ( monsanto , lot 8k0725k ) was dispersed in one liter of deionized water using a braun hand - held blender . dissolution was completed by heating to boiling in a microwave oven . twenty grams of celite ( 3 micron ) was added and dispersed uniformly . the mixture was brought to boiling and filtered through a 30 gram pre - coat in a pressure filtration device . about 920 ml of filtrate was collected . this was coagulated in 2 liters of 99 % ipa after mixing in 20 ml of 10 % nacl . the coagulum was collected on nitex cloth , squeezed , and placed in 500 ml of 85 % ipa overnight . the coag was collected and dried at about 38 ° c . in a single - pass , forced air oven . the white product was ground to − 20 mesh yielding 6 . 8 g ( 68 %) of powder . the viscosity of a 1 % sol was 3 , 000 mpas compared with a viscosity of 3 , 562 mpas for a 1 % sol of the starting material . the following examples are only a small part of the infinite number of combinations possible . concentrations can be altered as can the materials for co - processing . additionally , other soluble and / or insoluble materials can be included . one liter of 1 % clarified konjac ( marine bioproducts , lot 268 ) sol , 335 ml of 1 % cmc ( hercules , cellulose gum type 7mf ph , lot 66989 ) sol , and 14 ml of 10 % nacl ( aq .) solution were combined , mixed thoroughly with a braun hand - held blender , then coagulated in 2 . 5 liters of rapidly stirred 99 % ipa . the white stringy coag was collected on a fine sieve , squeezed to remove fluid , pulled apart , then washed by stirring with one liter of 99 % ipa for 15 minutes . the washed coag was collected on nitex cloth , squeezed , then dried in a forced - air oven at about 38 ° c . after grinding to − 20 mesh , 10 . 7 g ( 80 . 1 % yield ) of white product was obtained . this was more readily soluble in water than was the clarified konjac control and rapidly formed a clear sol , almost spontaneously . one percent sols of clarified konjac ( marine bioproducts , lot 257 ) and hec ( hercules , natrosol 250l nf , fp10 , lot 13879 ) were prepared . to 400 ml of the konjac sol was added 100 ml of the hec sol , the two mixed together thoroughly using a braun hand - held blender , heated to boiling , then coagulated in 1 liter of 85 % ipa while stirring with a spatula . the coag was collected on a nitex cloth , squeezed , then washed successively with 500 ml of 85 % ipa for 20 minutes and 250 ml of 99 % ipa for 10 minutes , each time stirring , then collecting on nitex and squeezing to remove as much fluid as possible . drying was done in a forced - air oven at about 38 ° c . after grinding to − 20 mesh , 3 . 2 g ( 64 % yield ) of white product was obtained . this was more readily soluble in water than was the clarified konjac control and rapidly formed a clear sol . one percent sols of clarified konjac ( marine bioproducts , lot 257 ) and hpmc ( hercules , benecel mp - 824 , fp10 , lot 13510 ) were prepared . to 240 ml of the konjac sol was added 60 ml of the hpmc sol , the two mixed together thoroughly using a braun hand - held blender , heated to boiling , then coagulated in 500 ml of 85 % ipa while stirring with a spatula . the coag was collected on a nitex cloth , squeezed , then washed successively with 300 ml of 85 % ipa for 20 minutes and 300 ml of 99 % ipa for 10 minutes , each time stirring , then collecting on nitex and squeezing to remove as much fluid as possible . drying was done in a forced - air oven at about 38 ° c . after grinding to − 20 mesh , 1 . 3 g ( 43 . 3 % yield ) of white product was obtained . ( the low yield is due to the fact that hpmc is some - what soluble in the alcohol concentrations used .) the konjac / hpmc composite was more readily soluble in water than was the clarified konjac control and rapidly formed a clear sol . twenty milliliters each of 1 % clarified konjac sol ( marine bioproducts , lot 268 ) and 1 % clarified locust bean gum ( marine bioproducts , dwr343b ) were prepared using de - ionized water . these were combined , mixed thoroughly , heated to boiling in a microwave oven , and coagulated in 100 ml of 85 % ipa . the coag was collected on nitex cloth , squeezed , pulled apart , and washed by stirring for ten minutes with 100 ml of 85 % ipa . after collecting on nitex cloth , squeezing , and pulling apart , the washed coag was dried in a one - pass hot air oven at about 38 ° c ., then ground to − 20 mesh ( 0 . 31 g , 77 % yield ). to 100 ml of clarified guar ( marine bioproducts , dwr2 - 21 - 1 ) sol was added 300 ml of a 1 % aqueous sol of clarified konjac ts ( marine bioproducts , lot 268 ), the sols mixed well with a spatula and then coagulated in 800 ml of 99 % ipa while stirring with a spatula . the fibrous white coag was collected on nitex cloth and squeezed to remove adhering fluid . after washing in 500 ml of 99 % ipa for 0 . 5 hours , the coag was collected , squeezed , then dried in a one - pass hot air oven at about 38 ° c . the coag was ground to − 20 mesh , giving 3 . 55 g ( 88 . 8 % yield ) of white powder . when placed in water it hydrated rapidly and dissolved . one liter aqueous sols each of clarified konjac ( marine bioproducts , lot 268 ) and agar ( marine bioproducts , lot 276 ) were prepared . both were heated to near boiling using a microwave oven , mixed thoroughly along with 30 ml of 10 % nacl ( aq .). the composite was recovered by pouring into 5 liters of rapidly stirring 85 % ipa . the white , fibrous coag was shredded using a braun hand - held blender , then collected on nitex cloth and squeezed to remove the adhering fluid . the coag was washed successively using 2 liters of 85 % ipa then 1 . 5 liters of 99 % ipa , each time stirring 20 minutes , collecting on nitex and squeezing . drying was done at about 38 ° c . in a one - pass forced air oven . after grinding to − 20 mesh , 30 . 0 g ( 75 % recovery ) of white powder was obtained . a 1 % gel prepared from this powder was elastic , nearly clear and colorless . one and a half liters each of 1 % aqueous sols of clarified konjac ( marine bioproducts , lot 268 ) and xanthan ( monsanto , keltrol t , lot 8k0725k ) were prepared and heated to boiling . these sols were combined , along with 30 ml of 10 % nacl , mixed thoroughly while hot using a braun hand - held blender , then coagulated by pouring into 6 liters of rapidly stirring 85 % ipa . the fibrous white coag was collected on a fine sieve , squeezed , and pulled apart . after washing by stirring for 20 minutes in 1 liter 85 % ipa , the coag was again collected , squeezed to remove the adhering alcohol , pulled apart and dried on nitex cloth in a one - pass 38 ° c . forced air oven . after grinding to − 20 mesh , 28 . 3 g ( 94 % yield ) of off - white powder was obtained . this powder rapidly absorbed about 200 × its weight of de - ionized water or about 50 × its weight of 1 % nacl to form a particulate gel . when heated and cooled , a clear elastic gel was formed . aqueous gels of 0 . 06 % were prepared that had a jello ®- like consistency . to a dry mixture of 2 . 5 g of clarified guar ( mbi lot dwr344 - 1 ) and 2 . 5 g of keltrol t xanthan ( monsanto lot 8k0725k ) was added about 10 ml of 99 % isopropyl alcohol and the mixture was stirred to ensure complete wetting . while being stirred with an overhead stirrer , 500 ml of deionized water was added . after dispersion was complete , the mixture was heated to boiling in a microwave oven and 400 ml was coagulated in 1 liters of 99 % ipa using a spatula to agitate the mixture . after standing for one hour at ambient temperature to harden the precipitate , the product was collected using a plastic sieve . after squeezing , the precipitate was transferred to 300 ml of 99 % ipa and stirred for about 20 minutes . the precipitate was collected on a nitex cloth , squeezed , and dried in a 38 ° c . single - pass , forced - air oven . after grinding to − 20 mesh , 3 . 16 g of powder was obtained . when 50 ml of water was added to 250 mg of this sample , the water was rapidly absorbed to form a relatively clear , semi - coherent gel . when this was brought to boiling in a microwave oven , it dissolved rapidly to form a clear , viscous solution , which when cooled , formed a clear , elastic gel . deacetylated konjac gels , films , foams , sponges , beads , and other forms can be prepared when konjac glucomannan is heated with alkali , about ph = 7 . 5 - 11 . deacetylation occurs and the resulting gel product is water insoluble and thermostable . if the gel formed by deacetylation is frozen and thawed , a tough , coherent spongeous mass is formed . porosity of the sponges depends on the rate of freezing of the sols . other hydrocolloids and soluble and / or insoluble materials can be included . the deacetylated konjac films are boiling water insoluble and are formed from a clarified konjac sol by adding alkali before casting the film , then heating to ensure that deacetylation occurs . films can be prepared from a clarified konjac / xanthan sol that are clear and hot water (& gt ; 85 ° c .) soluble . if films are prepared from a clarified konjac sol without heating , they are cold water soluble . to 250 ml of a 1 % clarified konjac sol ( mbi lot 268 ) was added 2 . 5 ml of 1m naoh . this was blended quickly , yet thoroughly , using the wire whisk attachment of the braun hand - held blender . this mixture was rapidly poured equally into three 100 ml beakers . these were covered with plastic wrap and placed in a 99 ° c . oven to deacetylate and form a gel . this gel was not completely clear like the starting konjac sol , but slightly hazy . gels containing 0 . 5 % and 0 . 25 % clarified konjac were also prepared in this manner . to 300 ml of a 1 % clarified konjac sol ( mbi lot 268 ) in deionized water was added 1 . 5 g of glycerol . after mixing well , the sol was brought to boiling in a microwave oven , let stand in a 99 ° c . oven for 15 minutes to deaerate and poured into three oblong plastic dishes ( 11 cm × 18 . 5 cm ). the sols were dried to films at about 38 ° c . in a one - pass forced air oven . these films were tough , flexible , and fully transparent . when wet with water , the film rapidly absorbed water and disintegrated , then gradually dissolved . to 300 ml of a hot (& lt ; 80 ° c .) aqueous 0 . 5 % sol of 1 : 1 clarified konjac / xanthan ( see example 16 ) was added 1 . 5 g of glycerol and the mixture stirred thoroughly . after reheating to boiling , the sol was placed in a 99 ° c . oven for 15 minutes to deaerate , then poured into three oblong plastic dishes ( 11 cm × 18 . 5 cm ). the sols were dried to films at about 38 ° c . in a one - pass forced air oven . these films were tough , flexible , and fully transparent . when wet with water , the film rapidly absorbed water and became quite tough and elastic , while remaining transparent . to 100 ml of a 1 % clarified konjac sol ( mbi lot 268 ) in deionized water was added 0 . 5 g of glycerol , and 1 . 0 ml of 1m naoh . after mixing thoroughly with the wire whisk attachment of the braun hand - held mixer , the mix was poured into an oblong plastic dish ( 11 cm × 18 . 5 cm ). the dish was covered and placed in a 99 ° c . oven to set . the cover was removed and the dish placed in a 38 ° c ., one - pass , forced air oven to dry . the resulting film was not completely transparent , but slightly hazy . it was tough and flexible and rapidly imbibed water , maintaining its toughness and flexibility . in the stainless steel bowl of a kitchen aid mixer was placed 300 g of 1 % clarified ts konjac ( mbi , lot 268 ), 40 g of a 3 % aqueous sol of hydroxyethyl cellulose ( hercules , natrosol 250 m pharm , lot fp 10 13809 ) as a foaming agent , and 4 g of glycerol as a plasticizer . this was mixed using the standard paddle attachment . there was insufficient hec to induce foaming so about 5 ml of a solution of hand - soap ( unknown origin ) shavings was added and after beating for about 10 minutes on high speed , a thick white foam resulted . three ml of 1m naoh was added and rapidly beat into the foam . the foam was portioned into a variety of plastic dishes , covered and placed into a 99 ° c . oven for about one hour to deacetylate the konjac and form a thermo - irreversible gel matrix . the syneresate was removed by decantation and three of the foams dried in a 38 ° c . one - pass forced - air oven . when a sample of the white foam was placed in deionized water , it hydrated rapidly . the remaining three foams from example 22 were placed , covered tightly , in a − 18 ° c . freezer overnight . the frozen foams were thawed in hot running water and the water expressed from the jelly fish - like , tough foamy masses using a thumb and forefinger . the resulting partially de - watered foams were covered with 99 % ipa and let stand for about 1 hour . the fluid was expressed by squeezing and the procedure repeated . these were then blotted between paper towels and dried on a rack in the hood . the resulting white parchment - like sheets rapidly hydrated to form tough jelly fish - like masses . three hundred milliliters of a hot sol containing 3 . 0 g of 1 : 1 clarified konjac / xanthan and 1 g of glycerol was prepared in a 2 - liter measuring bowl . this was placed in a boiling water bath and 2 ml of a solution of hand - soap shavings in deionized water was added . the mixture was then foamed using the wire whisk attachment on a braun hand - held mixer . the foam was distributed into plastic dishes at room temperature . setting was rapid . the foams were removed from the dishes and placed on a rack in a 38 ° c . one - pass forced air oven to dry . rehydration in water was rapid and a voluminous , low strength , clearish foamy mass resulted . in 1 % nacl , rehydration was slower and resulted in a significantly lower volume , stronger , elastic hydrated foam . the gels from example 18 were placed in a − 18 ° c . freezer overnight to freeze . they were then thawed using warm running tap water . the 1 % gel / sponge had very small pores and was too firm to squeeze to fully convert to a sponge . the lower percentage gels , when frozen and thawed , gave jellyfish - like sponges . when soaked in 99 % ipa , squeezed and dried , parchment like disks were obtained that imbibed water , but more slowly and to a lesser extent than the frozen , thawed , and dried foams . preparation of these amorphous solids consists of forming a sol of the cis 1 , 2 - diol , and thermostable additives , if any , by dispersing the components in cool water , heating the mixture to boiling , adding hot aqueous sodium tetraborate , and allowing to cool . other components can be added at suitable temperatures . if film preparation is desired , the hot sol can be distributed on a surface to form a film and the film used as is or dried for powders or granules , the solid diol can be triturated with a concentrated solution of sodium tetraborate with or without glycerol . for in situ - formed coatings , the sponge , cloth , gauze , or other material to be coated can either be dipped into the hot mix , removed and drained , and optionally dried . alternatively , the coatings can be applied by successively dipping the material to be coated into the borate solution , draining , blotting , blowing , or squeezing to remove the excess , if desired ; dipping next into a cis - 1 , 2 - diol polymer solution , with or without additives ; and finally again into the borate solution . if desired , this series can be repeated . possible additives to the polymeric cis - 1 , 2 - diol reaction mixture used for any of the products are : other borate - reactive and / or non - reactive hydrocolloids ; reactive or non - reactive low molecular weight substances ; insoluble particulates , both swellable and non - swellable , including charcoal and encapsulated chemical and / or biological reagents , ion - exchange resins , etc . ; therapeutics ; enzymes ; antibodies ; antimicrobials ; etc . gelling hydrocolloids , such as agar , gellan , carrageenan , and curdlan can be added to the clarified konjac , guar , locust bean gum , or aloe mannan sols before cross - linking with borate . at concentrations where the hydrocolloid would have formed a firm gel alone , combinations can yield products with unique properties . the following two examples are not meant to be limiting , since many different combinations of cis - 1 , 2 - diol containing molecules will cross - link using borates and can be combined with each other and / or non - reactive molecules to give unique properties . in addition , glycerol and / or other compatible plasticizers can be added and clear , hydratable films prepared . to three 50 - ml samples of 1 % clarified konjac ( mbi , lot 268 ) in deionized water was added selected amounts of a 3 . 79 % borax solution (= 2 . 0 % nab 4 o 7 ). after mixing thoroughly with a spatula , they were covered with plastic wrap and heated to boiling in a microwave oven , stirred again , and allowed to cool to room temperature . the following observations were made : ml borax observations ( all clear and colorless ) 1 mucoid consistency and slimy feel ( free konjac ) 5 flexible and slightly moist 15 firmer and slightly fragile films were prepared from the gels in example 26 by adding a small amount of glycerol , heating to boiling in a microwave oven , mixing thoroughly and pouring into 11 cm × 18 . 5 cm rubbermaid ™ plastic dishes . the gels were dried to films using a 38 ° c . one - pass , forced - air oven . clear flexible films resulted that rapidly hydrated in deionized water . to 50 ml of the 1 % clarified konjac sol ( see example 26 ) was added 1 ml of a hand - soap shavings sol and the mixture whipped to a stiff foam using the wire whisk attachment of the braun hand - held blender . two milliliters of the 3 . 79 % borax solution was added and whipped in . a very elastic foam resulted . this was placed on inverted plastic dishes and dried using a 38 ° c . one - pass , forced - air oven . a thin whitish dried foam resulted that hydrated rapidly in deionized water to a tough , elastic thin foam . to three 50 - ml samples of 1 % clarified guar ( mbi , lot dwr3 - 33 - 1 ) in deionized water was added selected amounts of a 3 . 79 % borax solution (= 2 . 0 % nab 4 o 7 ). after mixing thoroughly with a spatula , they were covered with plastic wrap and heated to boiling in a microwave oven , stirred again , and allowed to cool to room temperature . the following observations were made : ml borax observations ( all clear and colorless ) 1 flexible and slightly fragile 5 flexible and fragile 15 firmer and fragile films were prepared from the gels in example 29 by adding a small amount of glycerol , heating to boiling in a microwave oven , mixing thoroughly and pouring into 11 cm × 18 . 5 cm rubbermaid ™ plastic dishes . the gels were dried to films using a 38 ° c . one - pass , forced - air oven . a clear flexible film resulted from the first gel that was lowest in borate . the other two formed more brittle films . all hydrated rapidly in deionized water , became putty - like , and gradually dissolved when excess water was present . to 50 ml of the 1 % clarified guar sol ( see example 29 ) was added 1 ml of a hand - soap shavings sol and the mixture whipped to a stiff foam using the wire whisk attachment of the braun hand - held blender . one milliliter of the 3 . 79 % borax solution was added and whipped in . a very elastic foam resulted . this was placed on inverted plastic dishes and dried using a 38 ° c . one - pass , forced - air oven . thin , whitish dried foams resulted that hydrated rapidly in deionized water to a tough , elastic thin foam that , over a period of time , continued swelling . in a manner analogous to example 19 , 1 . 35 g of glycerol was added to 300 ml of a 1 % clarified guar sol prepared in deionized water . after mixing well , the sol was brought to boiling in a microwave oven , let stand in a 99 ° c . oven for 15 minutes to deaerate and poured into three oblong plastic dishes ( 11 cm × 18 . 5 cm ). the sols were dried to films at about 38 ° c . in a one - pass forced air oven . these films were tough , flexible , and fully transparent . when wet with water , the film rapidly absorbed water and disintegrated , then gradually dissolved . if clarified locust bean gum is substituted for guar , similar films result . a clear , hot water soluble film was prepared using the 1 : 1 guar / xanthan composite sol described in example 17 . after adding 0 . 5 g of glycerin and 100 ml of deionized water , the remaining sol ( 100 ml ) was heated to boiling in a microwave oven and distributed equally into each of two oblong rubbermaid ™ plastic storage dishes and dried in a single pass , forced - air oven . the clear , flexible films rapidly absorbed ambient temperature water and became weak and swollen . in hot water , they dissolved . if clarified locust bean gum is substituted for the guar , similar films result . in a manner analogous to example 24 , three hundred milliliters of a hot sol containing 3 . 0 g of 1 : 1 clarified guar / xanthan and 1 g of glycerol is prepared in a 2 - liter measuring bowl . this is placed in a boiling water bath and 2 ml of a solution of hand - soap shavings in deionized water is added . the mixture is then foamed using the wire whisk attachment on a braun hand - held mixer . the foam is distributed into plastic dishes at room temperature . setting is rapid . the foams are removed from the dishes and placed on a rack in a 38 ° c . one - pass forced air oven to dry . if clarified locust bean gum is substituted for the guar , similar foams result . application of the clarified hydrocolloids to capsule formation and encapsulation techniques clarified hydrocolloids afford new opportunities in the fields of capsule formation , encapsulation , and particle coating , including controlled release . capsules made from natural , plant - origin , clarified polysaccharides offer a viable alternative to the animal - origin gelatin - based capsules . the spontaneous cross - linking that occurs with gelatin is not an inherent property with most polysaccharide systems and should result in retention of the desirable characteristics . many commercially available polysaccharides , because of the particulate materials they contain , cannot be used for capsule applications , particularly if clear capsules are essential . however , mixtures containing hydrocolloids that form clear sols ( natural , semi - synthetic , and / or synthetic ), such as disclosed herein , can be used . the particular clarified hydrocolloid or hydrocolloid system that is chosen will depend on the properties desired for the finished capsule ( s ). properties such as permeability , solubility , drug release , and disintegration time , to name a few , can be varied by using appropriate hydrocolloids and other components . because the viscosity of the hydrocolloid sols limit the concentrations that can be used , fillers can be added to increase the total solids concentration . these fillers can be the lower molecular weight fragments of the same hydrocolloid , or other low molecular weight hydrocolloids , or a combination . plasticizers can be added to impart flexibility to the capsules . these plasticizers can be glycerin , propylene glycol , polyethylene glycols , polypropylene glycols , or sorbitol , to name a few , or combinations thereof . other soluble and / or insoluble materials can be added to impart specific functionality to the capsules . these can act as gates to let in body fluids to release the capsule contents in a controlled manner . formation of the capsules from gelling formulations can be made using a self - gelling composition , sequential dipping in a sol of one hydrocolloid and then another synergistic one or another gelling agent . fixatives , such as formaldehyde , glyoxal , and / or other suitable cross - linking agents can be used to impart water insolubility to the capsules . encapsulation involves film formation around a desired substance . a wide variety of clarified hydrocolloids and mixtures containing clarified hydrocolloids can be used . various formulations for film formation have been demonstrated in examples 19 - 21 , 27 , 30 , 32 and 33 herein . these are but a few of the formulations that can be used for encapsulation and are not meant to be limiting in any way . depending on the properties desired for the dry capsule , there are many combinations of different hydrocolloids , different types of the same hydrocolloid , concentrations and relative concentrations of hydrocolloids , plasticizers , fillers , disintegrating agents , insoluble particulates , etc ., that can be used in the formulations . the following examples of capsule formation are presented for illustration purposes with the understanding that they are non - limiting . to a dry mixture of 0 . 40 g of clarified guar ( mbi dwr - 36 - 1 ) and 0 . 40 g of agar ( mbi na # 4c ) was added about 3 ml of 99 % isopropyl alcohol and the mixture stirred thoroughly with a spatula to ensure that each particle was wetted with the alcohol . forty milliliters of deionized water was added , while stirring vigorously with a magnetic stirrer , and stirring continued until the guar was uniformly hydrated . the mixture was covered with plastic wrap , heated to boiling in a microwave oven , and placed in a boiling water bath . approximately 4 - inch lengths of { fraction ( 3 / 16 )}″ and { fraction ( 1 / 4 )}″ diameter acetron ® plastic rods ground to rounded ends were used for capsule formation . for each capsule , a rod was dipped in the hot sol to a depth of approximately { fraction ( 1 / 2 )}″, then withdrawn and rotated in the air to obtain near - uniformity while the sol gelled . occasionally , more of the hot sol was added to the rod , using a spatula , and slow twirling upside - down was continued until the gel set . the unused end of the rod was placed in a small beaker and then the gel was dried in a one - pass forced air oven at about 40 ° c . when dry , a cut was made through the dried capsule around the rod with a sharp knife at about { fraction ( 1 / 4 )}″ from the end . using a firm rotary motion of the rod and holding the capsule between the thumb and index finger , it was slipped off the rod . the capsules were firm and clear . in a like manner , clear capsules composed of clarified guar / xanthan , agar / clarified konjac , clarified konjac / xanthan , and clarified low viscosity konjac / xanthan , according to the invention , were prepared . many other formulations are possible . to 1 g of a 1 : 1 clarified guar / xanthan composite ( mbi dwr4 - 7 - 1 ) was added about 5 ml of 99 % isopropyl alcohol to wet the material . with rapid magnetic stirring , 45 ml of deionized water containing 0 . 5 g glycerin was added . stirring was continued until the mixture was evenly hydrated . the beaker was covered with plastic wrap and the contents heated to boiling in a microwave oven during which time the mixture became a clear sol . this was placed in a boiling water bath to maintain the fluid state . capsule formation was the same as described in example 35 , except that the dried capsule was strongly adhered to the rod . instead of cutting { fraction ( 1 / 4 )}″ from the end , { fraction ( 1 / 8 )}″ cuts were made and the capsules were peeled from the template rods . the capsules were clear and flexible . as will be apparent to those skilled in the art in the light of the foregoing disclosure , many alterations and modifications are possible in the practice of this invention without departing from the spirit or scope thereof . accordingly , the scope of the invention is to be construed in accordance with the substance defined by the following claims .

US-80440201-A

this invention relates to compounds of formula , in which r denotes a hydrogen atom or a methoxy radical . the invention also concerns the salts of said compounds , their racemic forms , their enantiomers , the preparation of said derivatives and drugs containing same .

in patent applications wo 91 / 12264 and wo 91 / 13907 , ureidoacetamide derivatives are described which are useful as cholecystokinin ( cck ) and gastrin antagonists . it has now been found that the compounds of formula : ## str1 ## in which r represents a hydrogen atom or a methoxy radical , their salts , their racemates and their enantiomers unexpectedly have cck antagonist properties which are much better than those of the ureidoacetamides of patent applications wo 91 / 12264 and wo 91 / 13907 . the subject of the present invention is thus the compounds of formula ( i ), their salts , their enantiomers , their preparation and the medicaments containing them . the compounds of formula ( i ) can be prepared by reacting a derivative of formula : ## str2 ## in which r represents a hydrogen atom or a methoxy radical , with an amine of formula : ## str3 ## in the form of a salt . this reaction is generally carried out in an inert solvent , such as benzene or toluene , at the boiling temperature of the reaction mixture . tetraalkylammonium or trialkylphenylammonium salts , and preferably tetra - n - butylammonium salts , can be used as salts . the derivatives of formula ( ii ) can be obtained by application or adaptation of the methods described in the patent applications wo 91 / 12264 and wo 91 / 13907 . the enantiomers can be prepared from the chiral precursors of the compound of formula ( iii ). preferably , the enantiomers are prepared from a tetraalkylammonium salt ( form b ) of the amine of formula ( iii ) or from the hydroquinine salt ( form a ) of the amine of formula ( iii ). the compounds of formula ( i ) can be purified by the usual known methods , for example by crystallization , precipitation , chromatography or extraction . the compounds of formula ( i ) and their enantiomers can be converted to metal salts or to addition salts with nitrogenous bases according to methods known per se . these salts can be obtained by reacting a metal base ( alkali metal or alkaline - earth metal , for example ), ammonia , an amine or a salt of an organic acid with a compound of formula ( i ) or its enantiomers , in a solvent . as examples of pharmaceutically acceptable salts , there can be mentioned the salts with alkali metals ( sodium , potassium , lithium ) or with alkaline - earth metals ( calcium , magnesium ), the ammonium salt , or the salts of nitrogenous bases ( ethanolamine , trimethylamine , methylamine , benzylamine , n - benzyl - β - phenethylamine , choline , arginine , leucine , lysine , n - methylglucamine ). the compounds of formula ( i ) and their enantiomers have advantageous pharmacological properties . these compounds have a strong affinity for cholecystokinin ( cck ) and gastrin receptors and are thus useful in the treatment and prevention of disorders linked to cck and to gastrin in the nervous system and the gastrointestinal system . in this way , these compounds can be used for the treatment of the prevention of psychoses , of anxious disorders , of panic attacks , of parkinson &# 39 ; s disease , of tardive dyskinesia , of irritable bowel syndrome , of acute pancreatitis , of ulcers , of disorders of intestinal motility , of certain tumours sensitive to cck , as an appetite regulator , in weaning from chronic treatments and alcohol or medicinal abuse , and as a pupil constrictor . these compounds also have a potentiating effect on the analgesic activity of narcotic and non - narcotic medicaments . additionally , they can have their own analgesic effect . moreover , the compounds having a high affinity for cck receptors modify memorising abilities . consequently , these compounds can be effective in memory disorders . affinity of the compounds of formula ( i ) for cck receptors was determined according to a technique inspired by that of a . saito et al . ( j . neuro . chem ., 37 , 483 - 490 ( 1981 ) in the cerebral cortex . in this test , the ic 50 of the compounds of formula ( i ) is less than 2 nm . moreover , it is known that the products which recognize the central receptors of cck have a similar specificity for the receptors of gastrin in the gastrointestinal tract ( bock et al ., j . med . chem ., 32 , 16 - 23 ( 1989 ); reyfeld et al ., am . j . physiol ., 240 , g 255 - 266 ( 1981 ); beinfeld et al ., neuropeptides , 3 , 411 - 427 ( 1983 )). the compounds of formula ( i ) have a low toxicity . their subcutaneous ld 50 in mice is greater than 40 mg / kg . 6 . 7 g of tetra - n - butylammonium ( rs )- 1 -( 3 - aminophenyl ) ethanesulphonate are added to a solution of 5 . 5 g of 2 -{ 2 -[( 1 - imidazolyl ) carboxamido ]- n -( 3 - methoxyphenyl ) acetamido }- n - methyl - n - phenylacetamide in 120 cm 3 of toluene . the reaction mixture is stirred at reflux for 5 hours and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 45 ° c . the residue is dissolved in 200 cm 3 of methylene chloride and the solution obtained is washed with 200 cm 3 of a 2n aqueous hydrochloric acid solution and then with 2 times 200 cm 3 of water . the organic phase is dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the crude product obtained is stirred for 30 minutes in 100 cm 3 of diisopropyl ether . the insoluble product is separated by filtration and then dissolved in 20 cm 3 of acetone . 3 . 0 g of potassium nonafluorobutanesulphonate in solution in 10 cm 3 of acetone are added and then 25 cm 3 of diisopropyl ether are added . the insoluble product is separated by filtration , washed with 2 times 5 cm 3 of acetone and then 4 times 15 cm 3 of diisopropyl ether and air - dried . there are thus obtained 5 . 5 g of potassium ( rs )- 1 -{ 3 -{ 3 -[ n -( 3 - methoxyphenyl )- n -( n - methyl - n - phenylcarbamoylmethyl ) carbamoylmethyl ]- ureido } phenyl } ethanesulphonate melting at approximately 180 ° c . ______________________________________1 . 43 [ d , j = 7 hz , 3h , -- ch ( ch . sub . 3 )--] 3 . 18 [ broad s , 3h , -- n ( ch . sub . 3 )--] 3 . 60 [ mt , 1h , -- ch ( ch . sub . 3 )--] 3 . 65 [ broad d , j = 5 hz , 2h , -- co ( ch . sub . 2 ) nh --] 3 . 79 [ s , 3h , -- och . sub . 3 ] 4 . 09 [ large , 2h , -- co ( ch . sub . 2 ) n & lt ;] 6 . 28 [ broad t , j = 5 hz , 1h , -- nh --] 6 . 86 [ d , j = 7 . 5 hz , 1h , -- c . sub . 6 h . sub . 4 (-- h4 ) of the n -( 3 - methoxyphenyl )] from 6 . 95 to 7 . 15 [ mt , 4h , aromatic protons ] 7 . 17 [ broad s , 1h , -- c . sub . 6 h . sub . 4 (-- h2 ) of the n -( 3 - methoxyphenyl )] from 7 . 30 to 7 . 50 [ mt , 11h , aromatic protons ] 8 . 80 [ broad s , 1h , -- co -- nh -- ar ]. ______________________________________ tetra - n - butylammonium ( rs )- 1 -( 3 - aminophenyl )- ethanesulphonate can be prepared in the following way : 0 . 8 g of 5 % palladium charcoal is added to a solution of 17 . 8 g of tetra - n - butylammonium ( rs )- 1 -( 3 - nitrophenyl ) ethanesulphonate in 200 cm 3 of ethanol . the suspension is stirred for 3 hours at a temperature in the region of 25 ° c . under a hydrogen atmosphere ( 100 kpa ). the catalyst is separated by filtration and the filtrate is concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 16 . 7 g of tetra - n - butylammonium ( rs )- 1 -( 3 - amino - phenyl ) ethanesulphonate in the form of an oil used as is in subsequent syntheses . tetra - n - butylammonium ( rs )- 1 -( 3 - nitrophenyl )- ethanesulphonate can be prepared in the following way : 25 . 3 g of ( rs )- 1 -( 1 - bromoethyl )- 3 - nitrobenzene are added to a solution of 20 . 8 g of sodium sulphite in 260 cm 3 of water . the reaction mixture is stirred at 80 ° c . for 5 hours , cooled to approximately 25 ° c . and run into 2 . 5 liters of a 0 . 5m aqueous potassium dihydrogenphosphate solution . 40 g of tetra - n - butylammonium hydrogensulphate are added . the mixture is extracted with 3 times 500 cm 3 of methylene chloride . the combined organic phases are washed with 2 times 500 cm 3 of water , dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 51 . 4 g of tetra - n - butylammonium ( rs )- 1 -( 3 - nitrophenyl ) ethanesulphonate in the form of an oil used as is in subsequent syntheses . ( rs )- 1 -( 1 - bromoethyl )- 3 - nitrobenzene can be prepared according to the method described by e . felder et al ., j . med . chem ., 13 , 559 ( 1970 ). 2 -{ 2 -[( 1 - imidazolyl ) carboxamido ]- n -( 3 - methoxphenyl ) acetamido }- n - methyl - n - phenylacetamide can be prepared in the following way : a solution of 3 . 1 g of 2 -[ 2 - amino - n -( 3 - methoxyphenyl ) acetamido ]- n - methyl - n - phenylacetamide in 30 cm 3 of anhydrous tetrahydrofuran is added to a solution of 3 . 0 g of n , n &# 39 ;- carbonyldiimidazole in 30 cm 3 of anhydrous tetrahydrofuran . the solution is stirred for 16 hours at a temperature in the region of 25 ° c . and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the residue is dissolved in 50 cm 3 of ethyl acetate and the solution obtained is washed with 4 times 30 cm 3 of water . the organic phase is dried over magnesium sulphate and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 4 ° c . there are obtained , after recrystallisation from ethyl acetate , 3 . 5 g of 2 -{ 2 -[( 1 - imidazolyl ) carboxamido ]- n -( 3 - methoxyphenyl ) acetamido }- n - methyl - n - phenylacetamide melting at 146 ° c . 2 -[ 2 - amino - n -( 3 - methoxyphenyl ) acetamido ]- n - methyl - n - phenylacetamide can be prepared in the following way : 1 . 3 g of hydrazine hydrate are added to a solution of 3 . 5 g of 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ]- n - methyl - n - phenylacetamide in 60 cm 3 of methanol . the reaction mixture is stirred at reflux for 30 minutes and then , after cooling , 100 cm 3 of water are added . the mixture is concentrated to approximately 100 cm 3 , then brought to a ph of 9 with a 2n aqueous sodium hydroxide solution and extracted with 2 times 50 cm 3 of ethyl acetate . the combined organic phases are washed with 2 times 50 cm 3 of water , dried over magnesium sulphate and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 3 . 0 g of 2 -[ 2 - amino - n -( 3 - methoxyphenyl ) - acetamido ]- n - methyl - n - phenylacetamide in the form of an oil used as is in subsequent syntheses . 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ]- n - methyl - n - phenylacetamide can be prepared in the following way : 10 cm 3 of dimethylformamide and then , over 1 hour , 30 . 2 g of oxalyl dichloride are added to a suspension of 80 . 6 g of 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetic acid in 900 cm 3 of 1 , 2 - dichloroethane . the mixture is stirred for 2 hours at a temperature in the region of 25 ° c . and then 58 . 6 g of n - methylaniline are added over 45 minutes . the reaction mixture is stirred for 2 hours at a temperature in the region of 25 ° c ., washed with 2 times 500 cm 3 of water and then 300 cm 3 of a saturated aqueous sodium hydrogencarbonate solution , dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the residue is stirred for 1 hour in 300 cm 3 of diisopropyl ether , the insoluble product is separated by filtration , washed with 3 times 60 cm 3 of diisopropyl ether and air - dried . there are thus obtained 84 g of 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ]- n - methyl - n - phenylacetamide melting at 137 ° c . 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetic acid can be prepared in the following way : 74 . 0 g of trifluoroacetic acid are added to a solution of 42 . 0 g of tert - butyl 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetate in 500 cm 3 of methylene chloride . the solution obtained is stirred at reflux for 5 hours and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the residue is stirred for 1 hour in 100 cm 3 of diisopropyl ether , the insoluble product is separated by filtration , washed with 3 times 40 cm 3 of diisopropyl ether and air - dried . there are thus obtained 36 g of 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetic acid melting at 203 ° c . tert - butyl 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetate can be prepared in the following way : 14 . 9 g of an oily suspension ( 60 % by weight ) of sodium hydride are added over 30 minutes to a solution of 96 g of n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamide in 1000 cm 3 of anhydrous tetrahydrofuran . the suspension is stirred for 4 hours at a temperature in the region of 20 ° c . and then 72 . 7 g of tert - butyl bromoacetate are added over 15 minutes . the reaction mixture is stirred for 16 hours at a temperature in the region of 25 ° c ., slowly hydrolyzed with 50 cm 3 of water and then concentrated to dryness under reduced pressure . the residue obtained is stirred for 1 hour in 400 cm 3 of water , the insoluble product is separated by filtration , washed with 3 times 100 cm 3 of water , 2 times 100 cm 3 of diisopropyl ether and air - dried . there are thus obtained 82 . 0 g of tert - butyl 2 -[ n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamido ] acetate melting at 148 ° c . n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamide can be prepared in the following way : 22 . 0 g of triethylamine and then 48 . 0 g of 2 - phthalimidoacetyl chloride in solution in 300 cm 3 of methylene chloride are added to a solution of 26 . 0 g of 3 - methoxyaniline in 200 cm 3 of methylene chloride while maintaining the temperature at approximately 20 ° c . the reaction mixture is stirred for 4 hours at this temperature and then 800 cm 3 of water are added . the insoluble product is separated by filtration , washed with 3 times 100 cm 3 of water and air - dried . there are thus obtained 65 . 0 g of n -( 3 - methoxyphenyl )- 2 - phthalimidoacetamide melting at 171 ° c . 2 - phthalimidoacetyl chloride can be prepared according to the method described by w . grassmann and e . schulte - uebbing , chem . bet ., 83 , 244 - 247 , ( 1950 ). 2 . 7 g of tetra - n - butylammonium 1 -( 3 - aminophenyl ) ethanesulphonate , form b , are added to a solution of 2 . 1 g of 2 -{ 2 -[( 1 - imidazolyl ) carboxamido ]- n -( 3 - methoxyphenyl ) acetamido }- n - methyl - n - phenylacetamide in 130 cm 3 of toluene . the reaction mixture is stirred at reflux for 5 hours and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 45 ° c . the residue is dissolved in 100 cm 3 of methylene chloride and the solution obtained is washed with 50 cm 3 of a 2n aqueous hydrochloric acid solution and then with 2 times 50 cm 3 of water . the organic phase is dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the crude product obtained is stirred for 30 minutes in 50 cm 3 of diisopropyl ether . the insoluble product is separated by filtration and then dissolved in 6 cm 3 of acetone . 1 . 2 g of potassium nonafluorobutanesulphonate in solution in 3 cm 3 of acetone are added and then 5 cm 3 of diisopropyl ether are added . the insoluble gum is separated and then stirred for 1 hour in 12 cm 3 of an acetone and diisopropyl ether mixture ( 50 / 50 by volume ). the insoluble product is separated by filtration , washed with 2 times 5 cm 3 of an acetone and diisopropyl ether mixture ( 50 / 50 by volume ) and then with 4 times 5 cm 3 of diisopropyl ether , and air - dried . there are thus obtained 1 . 55 g of potassium (-)- 1 -{ 3 -{ 3 -[ n -( 3 - methoxyphenyl )- n -( n - methyl - n - phenylcarbamoylmethyl ) carbamoylmethyl ] ureido } phenyl } ethanesulphonate melting at approximately 180 ° c . ______________________________________1 . 43 [ d , j = 7 hz , 3h , -- ch ( ch . sub . 3 )--] 3 . 18 [ broad s , 3h , -- n ( ch . sub . 3 )--] 3 . 60 [ mt , 1h , -- ch ( ch . sub . 3 )--] 3 . 65 [ broad d , j = 5 hz , 2h , -- co ( ch . sub . 2 ) nh --] 3 . 79 [ s , 3h , -- och . sub . 3 ] 4 . 09 [ large , 2h , -- co ( ch . sub . 2 ) n & lt ;] 6 . 28 [ broad t , j = 5 hz , 1h , -- nh --] 6 . 86 [ d , j = 7 . 5 hz , 1h , -- c . sub . 6 h . sub . 4 (-- h4 ) of the n -( 3 - methoxyphenyl )] from 6 . 95 to 7 . 15 [ mt , 4h , aromatic protons ] 7 . 17 [ broad s , 1h , -- c . sub . 6 h . sub . 4 (-- h2 ) of the n -( 3 - methoxyphenyl )] from 7 . 30 to 7 . 50 [ mt , 11h , aromatic protons ] 8 . 80 [ broad s , 1h , -- co -- nh -- ar ]. ______________________________________ tetra - n - butylammonium 1 -( 3 - aminophenyl )- ethanesulphonate , form b , can be prepared in the following way : 0 . 2 g of 5 % palladium charcoal is added to a solution of 2 . 8 g of tetra - n - butylammonium 1 -( 3 - nitrophenyl ) ethanesulphonate , form b , in 50 cm 3 of ethanol . the suspension is stirred for 2 hours at a temperature in the region of 25 ° c . under a hydrogen atmosphere ( 100 kpa ). the catalyst is separated by filtration and the filtrate is concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 2 . 8 g of tetra - n - butylammonium 1 -( 3 - aminophenyl ) ethanesulphonate , form b , in the form of an oil used as is in subsequent syntheses . tetra - n - butylammonium 1 -( 3 - nitrophenyl )- ethanesulphonate , form b , can be prepared in the following way : 5 . 2 g of potassium nonafluorobutanesulphonate in solution in 12 cm 3 of acetone are added to a solution of 10 . 5 g of n - benzylquininium 1 -( 3 - nitrophenyl ) ethanesulphonate , a mixture of forms a and b ( approximately 15 / 85 in moles ), in 16 cm 3 of acetone . the insoluble product is separated by filtration and then dissolved in 9 cm 3 of water . 8 . 4 cm 3 of a 1n aqueous hydrochloric acid solution and 1 . 15 g of r -(-)- phenylglycinol are added . the solution obtained is concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 50 ° c . the residue obtained is extracted with 3 times 15 cm 3 of acetonitrile at reflux . the organic phases are combined and concentrated to approximately 7 cm 3 ; after cooling , the crystals are separated by filtration and dissolved in 7 . 5 cm 3 of a 1n aqueous sodium hydroxide solution . the solution obtained is washed with 8 times 25 cm 3 of diethyl ether and then 60 cm 3 of a 0 . 5m aqueous potassium dihydrogenphosphate solution and 2 . 3 g of tetra - n - butylammonium hydrogensulphate are added . the mixture is extracted with 3 times 30 cm 3 of methylene chloride . the combined organic phases are dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 2 . 8 g of tetra - n - butylammonium 1 -( 3 - nitrophenyl ) ethanesulphonate , form b , in the form of an oil used as is in subsequent syntheses . n - benzylquininium 1 -( 3 - nitrophenyl ) ethanesulphonate , a mixture of forms a and b , can be prepared in the following way : 87 g of potassium dihydrogenphosphate and 32 . 4 g of n - benzylquininium chloride are added to a solution of 17 . 2 g of potassium ( rs )- 1 -( 3 - nitrophenyl ) ethanesulphonate in 400 cm 3 of water . the mixture is extracted with 2 times 300 cm 3 of methylene chloride . the combined organic phases are washed with 2 times 200 cm 3 of water , dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the foam obtained is dissolved in 120 cm 3 of 2 - propanol at reflux . after cooling , the crystals are separated by filtration and washed with 2 times 15 cm 3 of 2 - propanol . there are obtained , after 2 recrystallizations from 350 and 500 cm 3 of 2 - propanol , 15 . 6 g of n - benzylquininium 1 -( 3 - nitrophenyl ) ethanesulphonate , form a , melting at approximately 110 ° c . [ α ] d 20 =- 151 . 3 °± 1 . 5 ( c = 1 . 009 %; methanol ). the propanol solutions are combined and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 45 ° c . there are thus obtained 25 . 0 g of n - benzylquininium 1 -( 3 - nitrophenyl )- ethanesulphonate , a mixture of forms a and b ( approximately 15 / 85 in moles ). potassium ( rs )- 1 -( 3 - nitrophenyl ) ethanesulphonate can be prepared in the following way : 25 . 3 g of ( rs )- 1 -( 1 - bromoethyl )- 3 - nitrobenzene are added to a solution of 20 . 8 g of sodium sulphite in 260 cm 3 of water . the reaction mixture is stirred at 80 ° c . for 5 hours , cooled to approximately 25 ° c . and run into 2 . 5 liters of a 0 . 5m aqueous potassium dihydrogenphosphate solution . 40 g of tetra - n - butylammonium hydrogensulphate are added . the mixture is extracted with 3 times 500 cm 3 of methylene chloride . the organic phases are washed with 2 times 500 cm 3 of water , dried over magnesium sulphate , and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the oil obtained is dissolved in 65 cm 3 of acetone and 34 g of potassium nonafluorobutanesulphonate in solution in 75 cm 3 of acetone are added . the insoluble product is separated by filtration , washed with 3 times 50 cm 3 of diisopropyl ether and air - dried . there are thus obtained 22 . 4 g of potassium ( rs )- 1 -( 3 - nitrophenyl ) ethanesulphonate , melting at a temperature greater than 260 ° c . and used as is in subsequent syntheses . ( rs )- 1 -( 1 - bromoethyl )- 3 - nitrobenzene can be prepared according to the method described by e . felder et al ., j . med . chem ., 13 , 559 ( 1970 ). 6 . 7 g of tetra - n - butylammonium ( rs )- 1 -( 3 - aminophenyl ) ethanesulphonate are added to a solution of 2 . 8 g of 2 -{ 2 -( 1 - imidazolyl ) carboxamido ]- n - phenyl - acetamido ]- n - methyl - n - phenylacetamide in 70 cm 3 of toluene . the reaction mixture is stirred at reflux for 5 hours and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 45 ° c . the residue is dissolved in 100 cm 3 of methylene chloride and the solution obtained is washed with 100 cm 3 of a 2n aqueous hydrochloric acid solution and then with 2 times 100 cm 3 of water . the organic phase is dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the crude product obtained is stirred for 30 minutes in 60 cm 3 of diisopropyl ether . the insoluble product is separated by filtration and then dissolved in 20 cm 3 of acetone . 1 . 9 g of potassium nonafluorobutanesulphonate in solution in 10 cm 3 of acetone are added . the insoluble product is separated by filtration , washed with 4 times 5 cm 3 of acetone and then 4 times 8 cm 3 of diisopropyl ether and air - dried . there are thus obtained 5 . 5 g of potassium ( rs )- 1 -{ 3 -[ 3 -( n -( n - methyl - n - phenylcarbamoylmethyl )- n - phenyl - carbamoylmethyl ] ureido } phenyl ) ethanesulphonate melting at approximately 210 ° c . 2 -{ 2 -[( 1 - imidazolyl ) carboxamido }- n - phenylacetamido }- n - methyl - n - phenylacetamide can be prepared in the following way : a solution of 37 g of 2 -( 2 - amino - n - phenylacetamido )- n - methylacetamide in 150 cm 3 of anhydrous tetrahydrofuran is added to a solution of 31 g of n , n &# 39 ;- carbonyldiimidazole in 300 cm 3 of anhydrous tetrahydrofuran . the solution is stirred for 3 hours at a temperature in the region of 25 ° c . and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . the residue is dissolved in 500 cm 3 of ethyl acetate and the solution obtained is washed successively with 4 times 300 cm 3 of distilled water and with 300 cm 3 of a saturated aqueous sodium chloride solution . the organic phase is dried over magnesium sulphate and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are obtained , after recrystallization from ethyl acetate , 33 . 3 g of 2 -{ 2 -[( 1 - imidazolyl ) carboxamido }- n - phenylacetamido }- n - methyl - n - phenylacetamide melting at 120 ° c . 2 -( 2 - amino - n - phenylacetamido )- n - methyl - n - phenylacetamide can be prepared in the following way : 0 . 25 g of hydrazine hydrate is added to a solution of 1 . 4 g of n - methyl - n - phenyl - 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetamide in 15 cm 3 of methanol . the reaction mixture is stirred at reflux for 2 hours . after cooling and addition of 5 cm 3 of a 4n aqueous hydrochloric acid solution , the insoluble product is separated by filtration . the filtrate is concentrated to dryness under reduced pressure ( 2 . 7 kpa )) 30 ° c . the residue obtained is dissolved in 10 cm 3 of distilled water and then the solution obtained is washed with 10 cm 3 of diethyl ether , basified with 0 . 5 g of sodium hydroxide pellets and extracted with 2 times 20 cm 3 of ethyl acetate . the combined organic phases are dried over magnesium sulphate and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 30 ° c . there is thus obtained 0 . 9 g of 2 -( 2 - amino - n - phenylacetamido )- n - methyl - n - phenylacetamide in the form of an oil used as is in subsequent syntheses . n - methyl - n - phenyl - 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetamide can be prepared in the following way : 3 . 9 g of oxalyl dichloride and then one drop of dimethylformamide are added to a suspension of 10 . 1 g of 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetic acid in 125 cm 3 of 1 , 2 - dichloroethane . the mixture is stirred for 2 hours at a temperature in the region of 25 ° c . and then 7 . 7 g of n - methylaniline in solution in 30 cm 3 of 1 , 2 - dichloroethane are added . the solution obtained is stirred for 2 hours at a temperature in the region of 25 ° c . and then washed with 2 times 80 cm 3 of distilled water , dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are obtained , after recrystallization from diisopropyl ether , 9 . 6 g of n - methyl - n - phenyl - 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetamide melting at 216 ° c . 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetic acid can be prepared in the following way : 17 . 9 g of trifluoroacetic acid are added to a solution of 8 g of tert - butyl 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetate in 30 cm 3 of dichloromethane . the solution obtained is stirred at reflux for 1 hour and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are obtained , after recrystallization from diisopropyl ether , 5 . 9 g of 2 -( n - phenyl - 2 - phthalimidoacetamido )- acetic acid melting at 224 ° c . tert - butyl 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetate can be prepared in the following way : 92 . 4 g of sodium hydrogen carbonate are added to a solution of 207 g of tert - butyl n - phenylglycinate in 500 cm 3 of 1 , 2 - dichloroethane . the suspension is stirred at a temperature in the region of 5 ° c . and a solution of 223 g of 2 - phthalimidoacetyl chloride in 1100 cm 3 of 1 , 2 - dichloroethane is added . the reaction mixture is stirred at reflux for 4 hours . after separation of the insoluble product by filtration , the filtrate is washed with 300 cm 3 of distilled water , dried over magnesium sulphate and concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are obtained , after recrystallization from acetonitrile , 236 g of tert - butyl 2 -( n - phenyl - 2 - phthalimidoacetamido ) acetate melting at 128 ° c . tert - butyl n - phenylglycinate can be prepared in the following way : 58 g of tert - butyl bromoacetate are added to a solution of 56 g of aniline in 600 cm 3 of 1 , 2 - dichloroethane and the solution obtained is stirred at reflux for 48 hours . after cooling , the insoluble product is separated by filtration and the filtrate is washed with 200 cm 3 of a 0 . 1n aqueous hydrochloric acid solution and with 3 times 200 cm 3 of distilled water . the organic phase is dried over magnesium sulphate and then concentrated to dryness under reduced pressure ( 2 . 7 kpa ) at 40 ° c . there are thus obtained 54 g of tert - butyl n - phenylglycinate in the form of an oil used as is in subsequent syntheses . 2 - phthalimidoacetyl chloride can be prepared according to the method described by w . grassman and e . schulte - uebling , chem . ber ., 83 , 244 ( 1950 ). the medicaments according to the invention consist of a compound of formula ( i ) in the free form or in the form of an addition salt with a pharmaceutically acceptable acid , in the pure state or in the form of a composition in which it is combined with any other pharmaceutically compatible product , which can be inert or physiologically active . the medicaments according to the invention can be used orally , parenterally , rectally or topically . tablets , pills , powders ( gelatin capsules or cachets ), or granules can be used as solid compositions for oral administration . in these compositions , the active principle according to the invention is mixed with one or a number of inert diluents , such as starch , cellulose , sucrose , lactose or silica , under an argon stream . these compositions can also comprise substances other than the diluents , for example one or a number of lubricating agents such as magnesium stearate or talc , a colouring agent , a coating agent ( dragees ) or a varnish . pharmaceutically acceptable solutions , suspensions , emulsions , syrups and elixirs containing inert diluents such as water , ethanol , glycerol , vegetable oils or paraffin oil can be used as liquid compositions for oral administration . these compositions can comprise substances other than the diluents , for example wetting , sweetening , thickening , flavouring or stabilizing substances . the sterile compositions for parenteral administration can preferably be aqueous solutions or non - aqueous solutions , suspensions or emulsions . water , propylene glycol , a polyethylene glycol , vegetable oils , in particular olive oil , injectable organic esters , for example ethyl oleate , or other suitable organic solvents can be used as solvent or vehicle . these compositions can also contain adjuvants , in particular wetting , isotonizing , emulsifying , dispersing and stabilizing agents . sterilization can be carried out in several ways , for example by aseptic filtration , by incorporating sterilizing agents in the composition , by irradiation or by heating . they can also be prepared in the form of sterile solid compositions which can be dissolved at the time of use in sterile water or any other injectable sterile medium . the compositions for rectal administration are suppositories or rectal capsules which contain , besides the active product , excipients such as cocoa butter , semi - synthetic glycerides or poly ( ethylene glycol ) s . the compositions for topical administration can be , for example , creams , lotions , eye drops , mouthwashes , nose drops or aerosols . in human therapeutics , the compounds according to the invention are particularly useful in the treatment and prevention of disorders linked to cck and to gastrin in the nervous system and the gastrointestinal system . these compounds can thus be used in the treatment and prevention of psychoses , anxious disorders , of panic attacks , of parkinson &# 39 ; s disease , of tardive dyskinesia , of irritable bowel syndrome , of acute pancreatitis , of ulcers , of disorders of intestinal motility , of certain tumours sensitive to cck , of memory disorders , as analgesics , as potentiation agents of the analgesic activity of narcotic and non - narcotic analgesic medicaments and as an appetite regulator , in weaning from chronic treatments and alcohol or medicinal abuse and as a constrictor of the pupil of the iris of the eye . the doses depend on the desired effect , on the duration of treatment and on the administration route used ; they are generally between 0 . 05 g and 1 g per day orally for an adult with unit doses ranging from 10 mg to 500 mg of active substance . generally , the doctor will determine the appropriate dosage depending on the age , weight and all the other factors specific to the subject to be treated . gelatin capsules containing 50 mg of active product are prepared , according to the usual technique , which have the following composition : ______________________________________potassium ( rs )- 1 -{ 3 -{ 3 -[ n -( 3 - methoxyphenyl )- 50 mgn -( n - methyl - n - phenylcarbamoyl - methyl ) carbamoylmethyl ] ureido } phenyl }- ethanesulphonatecellulose 18 mglactose 55 mgcolloidal silica 1 mgsodium carboxymethylstarch 10 mgtalc 10 mgmagnesium stearate 1 mg______________________________________ tablets containing 50 mg of active product are prepared , according to the usual technique , which have the following composition : ______________________________________potassium (-)- 1 -{ 3 -{ 3 -[( n -( 3 - methoxyphenyl )- 50 mgn -( n - methyl - n - phenylcarbamoyl - methyl ) carbamoylmethyl ] ureido } phenyl }- ethanesulphonatelactose 104 mgcellulose 40 mgpolyvidone 10 mgsodium carboxymethylstarch 22 mgtalc 10 mgmagnesium stearate 2 mgcolloidal silica 2 mgmixture of hydroxymethylcellulose , glyceroland titanium oxide ( 72 / 3 . 5 / 24 . 5 ) q . s . for onecoated tablet completed to 245 mg______________________________________ an injectable solution containing 10 mg of active product is prepared which has the following composition : ______________________________________potassium ( rs )- 1 -{ 3 -{ 3 -[ n -( n - methyl - n - 10 mgphenylcarbamoylmethyl )- n - phenylcarbamoyl - methyl ] ureido } phenyl } ethanesulphonatebenzoic acid 80 mgbenzyl alcohol 0 . 06 cm . sup . 3sodium benzoate 80 mg95 % ethanol 0 . 4 cm . sup . 3sodium hydroxide 24 mgpropylene glycol 1 . 6 cm . sup . 3water q . s . for 4 cm . sup . 3______________________________________ although the invention has been described in conjunction with specific embodiments , it is evident that many alternatives and variations will be apparent to those skilled in the art in light of the foregoing description . accordingly , the invention is intended to embrace all of the alternatives and variations that fall within the spirit and scope of the appended claims . the above references are hereby incorporated by reference .

US-39704495-A

the present invention relates to an access assembly to provide access to the interior of a vessel and comprising : a base to extend through a sidewall of the vessel and having a tubular sealing portion providing a passageway axially extending therethrough , a pierceable sealing member arranged across the sealing portion to obstruct the passageway , at least one closure member axially displaceable relative to the base between a sealing position , in which the closure member completely obstructs and seals the passageway , and a leakage position , in which the closure member leakily obstructs the passageway .

the access assembly 10 as illustrated in fig1 - 5 is intended to be attached to a sidewall 14 of a vessel 12 . as shown in fig1 - 5 , the access assembly 10 comprises a tubular - shaped base 20 , which extends outwardly from the sidewall 14 of the vessel 12 . the access assembly 10 and / or its base 20 serves as a discharge nozzle or spout , especially for extracting small sized samples from the liquid medium contained therein and confined by the vessel 12 . as further indicated in fig1 , a distal direction 1 points to the interior of the vessel 12 while an opposite proximal direction 2 points away from the outside of the vessel &# 39 ; s 12 sidewall 14 . axial displacement of various components or parts of the access assembly 10 typically occurs either in distal - direction 1 or in proximal - direction 2 . as shown in fig8 a , the base 20 comprises a tubular - shaped sealing portion 28 , which in sealing position as shown in fig1 engages with an annular sealing ring 74 of a distal closure member 70 . adjacent to the tubular sealing portion 28 and in proximal - direction 2 there is provided a radially widening frusto - conical or tapered sidewall portion 26 extended into a receiving portion 24 , which is also of tubular shape . as illustrated in fig8 a , the inner and free diameter of the receiving portion 24 is larger than the diameter of the sealing portion 28 . the base 20 is adapted to sealingly engage with the distal closure member 70 , which comprises an annular groove 73 to receive a correspondingly - shaped sealing ring 74 , typically in form of an o - ring of elastomeric material . as for instance illustrated in fig6 a and 6 b , the distal closure member 70 comprises a sleeve - like geometry and features a proximally extending receptacle 71 to receive a pierceable sealing member 60 extending all over the inner diameter of the distal closure member 70 . by means of the pierceable sealing member 60 , the passageway 25 through the distal closure member 70 can be substantially obstructed . at its proximal end , the distal closure member 70 comprises an inner thread 72 by way of which the distal closure member 70 can be releasably engaged with a distal end portion of an insert 30 as illustrated in fig1 . hence , the inner thread 72 of the distal closure member 70 may threadedly engage with an outer thread 31 of the insert 30 . additionally , the distal closure member 70 comprises a stepped down portion or a ledge 79 that serves as a distal abutment for the pierceable sealing member 60 . when screwing the distal closure member 70 onto the distal end of the insert 30 , the sealing member 60 or septum can be clamped or constrained between said ledge 79 and a distal end face 32 of the insert 30 . in the sealing position as illustrated in fig1 , the sealing ring 74 radially abuts with the tubular sealing portion 28 of the base 20 . since the interior or the through opening formed by the distal closure member 70 is obstructed by the pierceable sealing member , the entire passageway 25 extending through the base 20 is obstructed in a sealed and liquid tight way . the insert 30 comprises a radially outwardly extending flange 37 , which engages with a radially inwardly extending flange 86 of a fastening ring 80 , which is separately illustrated in fig1 . the fastening ring 80 comprises a sidewall 88 provided with an inner thread 82 which is adapted to threadedly engage with a proximally located outer thread 22 of the base 20 . in the sealing position as shown in fig1 , the fastening ring 86 receives the insert 30 in its through opening 84 and is further threadedly engaged with the base 20 . by means of the mutually engaging flange portions 86 and 37 , the insert 30 is axially constrained and axially fixed to the base 20 . in this configuration , the sealing ring 74 is sealingly engaged with the tubular sealing portion 28 of the base 20 . by at least partially unscrewing the fastening ring 80 as indicated in fig2 , the insert can be displaced in proximal direction 2 so that the sealing ring 74 of the distal closure member 70 slides along the frusto - conical sidewall portion 26 to reach the receiving portion 24 . in this configuration , the seal is no longer active and a forced leakage may evolve in form of a streamlet 100 extending through the interface of base 20 and distal closure member 70 . however , in the leakage position as indicated in fig2 , the insert 30 is still fixed to the base 20 since the mutually engaging threads 82 and 22 of fastening ring 80 and base 20 are still in mutual engagement . in this configuration , the distal closure member 70 and the sealing member 60 still obstruct a major portion of the diameter of the passageway 25 of the base 20 . hence , in the leakage position only a fairly small streamlet 100 may evolve and escape from the access assembly 10 in a rather controlled way . in addition and as illustrated in fig1 there may be also provided a slide ring 81 at a proximal end of the fastening ring 80 . the slide ring 81 may be further engaged with a locking ring 83 which is adapted to radially engage with an annular groove 38 on the outer circumference of the insert 30 , as illustrated in fig1 . the slide ring 81 and / or the locking ring 83 may be designed as an integral component or portion of the fastening ring 80 . slide ring 81 and / or fastening ring 83 may be also provided as a separate part to be assembled with the fastening ring 80 . removal of the insert 30 from the base 20 is particularly necessary to replace a pierceable sealing member 60 , e . g . a septum . in the event that the vessel 12 is still filled with a liquid substance , an operator will immediately observe the draining streamlet 100 and may return the insert 30 and the fastening ring 80 into the sealing position as indicated in fig1 . it is only when no streamlet 100 evolves in the leakage position that it is recommendable to completely unscrew the fastening ring 80 from the base 20 in order to slidingly displace the insert 30 into a release position as indicated in fig3 . in this configuration , the entire insert 30 with the distal closure member 70 assembled thereon can be removed from the base 20 for replacing the pierceable sealing member 60 . for this purpose , the distal closure member 70 comprises radially outwardly extending and diametrically oppositely located recesses 76 at an inside wall 78 of a distal rim 75 at its distal end face 77 . as indicated in fig7 a and 7 b , a tool 90 comprising a correspondingly - shaped projection 92 with lateral and oppositely located rounded end sections 94 can be inserted into the oppositely located recesses 76 in order to transfer an angular momentum to the distal closure member 70 for the purpose of unscrewing the same from the distal end of the insert 30 . the radially outwardly extending recesses 76 are of particular benefit especially for cleaning of the access assembly 10 and / or of the vessel 12 receiving the same . in preferred embodiments , the distal end face 77 of the distal closure member 70 is flush with the inside wall of the vessel 12 . since the outer circumference of the rim 75 is of annular and recess - free shape , no grooves or recesses will be formed in the interface between the rim 75 and the surrounding sidewall 14 of the vessel 12 . this way , the interface between distal closure member 70 and sidewall 14 of the vessel 12 can be easily cleaned . for extracting of a sample from the interior of the vessel 12 by making use of the pierceable sealing member 60 , the proximal closure member 50 substantially obstructing the passageway 25 through the insert 30 has to be removed . also here , a forced leakage mechanism is implemented in a similar way as already described with respect to the distal closure member 70 and the base 20 . the insert 30 is also of tubular shape and comprises a tubular - shaped sealing portion 35 , which engages with an annular sealing ring 56 located in an annular groove 55 of the proximal closure member 50 . moreover , the passageway 25 also extends through the insert 30 . the proximal closure member 50 comprises a stepped down shaft 54 at its distal end in which the annular groove 55 is located . adjacent to the shaft 54 , there is provided a radially widened flange or disc portion 57 featuring an outer thread 58 to engage with an inner thread 36 located at a proximal end of the insert 30 . the proximal closure member 50 further comprises a handle portion or a radially widened grip section 52 at its proximal end allowing to induce a torque for screwing or unscrewing the proximal closure member 52 to and from the insert 30 . between the proximally located inner thread 36 and the sealing portion 35 , the insert 30 comprises a frusto - conical or tapered sidewall portion 34 which serves as a radially widening portion into which the sealing ring 56 is axially shifted when the proximal closure member 50 is axially displaced in proximal direction 2 to reach a leakage position as it is indicated in fig4 . there , the sealing engagement between the sealing ring 56 and the sealing sidewall portion 35 is no longer maintained . in the event that the disc - shaped sealing member 60 is subject to malfunction , a streamlet 102 evolves by way of which a limited amount of the liquid medium may discharge through the non - sealing threaded interconnection of proximal closure member 50 and insert 30 . the mutually corresponding threads 58 , 36 are of non - sealing type so that the proximal closure member 50 can be kept securely fastened to the insert 30 while the streamlet 102 escapes through the threaded interconnection . even in case that the septum or sealing member 60 is completely broken , the proximal closure member 50 may withstand a respective fluid pressure which may build up in the interior of the access assembly 20 , hence , in its passageway 25 . the geometric shape and dimensions of the distal closure member 50 and the insert 30 are designed such , that a non - sealing but leaking configuration can be attained in which the proximal closure member 50 is still securely fastened to the insert 30 . in the event that a streamlet 102 does not evolve when displacing the proximal closure member 50 into the leakage position as illustrated in fig4 , the closure member 50 may be unscrewed further to reach a release position as indicated in fig5 . in this configuration , the proximal closure member 50 may be taken out of the insert 30 for providing free access to the pierceable sealing member 60 located at the distal end of the insert 30 . then , an operator may enter the insert 30 with a tipped piercing element , such like a cannula to penetrate or to puncture the pierceable sealing member 60 and to withdraw a sample from the liquid medium contained in the vessel 12 . here , the distally and radially inwardly tapered sidewall portions 34 , 33 of the insert 30 also serve as a deflecting portion to guide the tipped piercing element and to prevent blunting thereof . since the exact radial location of the pierceable sealing member 60 may be difficult to determine , it may happen , that the tipped and free end of the piercing member may hit a sidewall portion of the insert 30 when manually inserted into the insert 30 . by providing the sidewall portions 33 , 34 with a radially inwardly tapered shape , the tipped piercing element may be guided and deflected in order to hit the radially centrally located pierceable sealing member 60 provided at the distal end face 32 of the insert 30 . furthermore and as indicated in fig1 and 8 b , the insert 30 is rotatably locked to the base 20 by means of three radially outwardly extending projections 41 that engage with correspondingly - shaped and axially extending grooves 21 provided at the inside sidewall 23 of the proximal end of the base 20 . said grooves 21 extend radially outwardly from the inside sidewall 23 of the base 20 . by means of mutually engaging or mutually mating projections 41 and grooves 21 , the insert 30 is exclusively slidingly displaceable relative to the base 20 in distal and proximal direction 1 , 2 . by inhibiting a rotation of the insert 30 relative to the base 20 , unintentional unscrewing of the distal closure member 70 from the distal end of the insert 30 while the distal closure member 70 is still constrained in the tubular sealing portion 28 of the base 20 can be effectively prevented .

US-201414761806-A

methods and compositions for reducing fibrosis and cirrhosis are provided in which an effective dose of an admixture of a polysaccharide compound and , for example , a compound selected from the group consisting of antibodies specific to intracellular or cell - surface : beta - pdgf receptors ; synaptophysin ; zvegf3 ; ccr1 receptors ; connective tissue growth factor ; alpha 1 - smooth muscle actin ; matrix metalloproteinases mmp 2 and mmp9 ; matrix metalloproteinase inhibitors timp1 and tmp2 ; integrins ; tfg - β1 ; endothelin receptor antagonists ; and collagen synthesis and degradation modulating compounds ; actin synthesis and degradation modulating compounds ; and tyrosine kinases is administered to an animal in order to treat fibrosis .

detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely illustrative of the invention that may be embodied in various forms . in addition , each of the examples given in connection with the various embodiments of the invention are intended to be illustrative , and are not restrictive . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . the following terms shall have the meanings indicated herein and in the claims , unless required otherwise by the context . “ cmf - pbs ” shall mean ca 2 + - and mg 2 + - free phosphate - buffered saline , ph 7 . 2 . “ administration ” refers to oral , or parentereal including intravenous , subcutaneous , topical , transdermal , intradermal , transmucosal , intraperitoneal , intramuscular , intracapsular , intraorbital , intracardiac , transtracheal , subcutaneous , subcuticular , intraarticular , subcapsular , subarachnoid , intraspinal , epidural and intrasternal injection and infusion . “ subject ” is defined here and in the claims as a mammal including a human in need of therapy for , or susceptible to , a condition or its sequelae . the subject may include dogs , cats , pigs , cows , sheep , goats , horses , rats , and mice and humans . the term “ subject ” does not exclude an individual that is normal in all respects . “ patient ” shall mean a human subject who has presented at a clinical setting with a particular symptom or symptoms suggesting the need for treatment . “ treatment of fibrosis ” refers to prognostic treatment of subjects at high risk of developing a fibrotic or cirrhotic condition as well as subjects who have already developed a fibrotic or cirrhotic condition , regardless of location or type of tissue in which the fibrotic or cirrhotic condition arises . “ treatment ” may also be applied to the reduction or prevention of abnormal cell proliferation , cell aggregation and cell dispersal ( metastasis ). “ cirrhosis ” refers to any tissue disorder , including such cellular disorders including , but not limited to , renal cirrhosis , liver cirrhosis , ovarian cirrhosis , lung cirrhosis , gastrointestinal or stomach cirrhosis . the term “ cirrhosis ” refers to an advanced stage of fibrosis , defined by the presence of encapsulated nodules , and eventually cancer . for purposes of this specification and claims , “ cirrhosis ” is considered to be a type of fibrosis , and is included within the meaning of the term “ fibrosis ” used herein . “ fibrosis ” refers to any tissue disorder , including , but not limited to , such cellular disorders as , for example , cirrhosis , kidney fibrosis , liver fibrosis , ovarian fibrosis , lung fibrosis , gastrointestinal or stomach fibrosis , fibroids . the term “ fibrosis ” refers to both the pathological process leading from tissue injury through its encapsulation by extracellular matrix , and the result of the process , which is a pathological formation of scar tissue . fibrosis is a systemic response to chronic injury , developing through a series of highly coordinated molecular events , collectively called fibrogenesis . the steps immediately following chronic liver injury represent a process called “ initiation ”, which in turns are early events of “ activation ” of hepatic stellate cells . the next step of stellate cells activation is “ perpetuation ”, and this leads to proliferation , fibrogenesis and matrix degradation . “ molecular markers ”, or “ biochemical markers ”, or “ biomarkers ”, or “ markers ” refers to individual molecules of biological origin , which can be monitored as a “ readout ” of specific metabolic events . these events are accompanied by formation of the “ markers ”, the quantitative level of which can often be used as an indication to advancement of the event . examples of such markers in fibrosis are collagen i ( a marker on fibrosis ), alpha 1 - smooth muscle actin ( a marker on activation of stellate cells ), beta pdgf - receptor ( a marker on proliferation ), matrix metalloproteinases and their inhibitors mmp2 , mmp9 , timp1 and tmp2 ( markers on matrix degradation ), cytokine tfg - β1 ( a marker on fibrogenesis ). “ admixture ” means more than one component mixed together to form a combination . for purposes of the present invention , “ admixture ” means the mixture of two or more compounds at any time prior or subsequent to , or concomitant with , administration . “ depolymerization ” refers to partial or complete hydrolysis of the polysaccharide backbone occurring for example when the polysaccharide is treated chemically resulting in fragments of reduced size when compared with the original polysaccharide . “ effective dose ” refers to a dose of a compound and / or admixture that improves the symptoms of the subject or the longevity of the subject suffering from or at high risk of suffering from cirrhosis . the effective dose in embodiments of this invention can be quantitatively defined as an amount of a polysaccharide compound administered alone or in a mixture with a dose of a antifibrotic compound administered in a subject for treating fibrosis that decreases a level of a chosen molecular marker by at least about 5 percent . “ saccharide ” refers to any simple carbohydrate including monosaccharides , monosaccharide derivatives , monosaccharide analogs , sugars , including those , which form the individual units in an oligosaccharide or a polysaccharide . “ monosaccharide ” refers to polyhydroxyaldehyde ( aldose ) or polyhdroxyketone ( ketose ) and derivatives and analogs thereof . “ oligosaccharide ” refers to a linear or branched chain of monosaccharides that includes up to about 10 saccharides units linked via glycosidic bonds . “ polysaccharide ” refers to polymers formed from about 10 to over 100 , 000 saccharide units linked to each other by hemiacetal or glycosidic bonds . the polysaccharide may be either a straight chain , singly branched , or multiply branched wherein each branch may have additional secondary branches , and the monosaccharides may be standard d - or l - cyclic sugars in the pyranose ( 6 - membered ring ) or furanose ( 5 - membered ring ) forms such as d - fructose and d - galactose , respectively , or they may be cyclic sugar derivatives , for example amino sugars such as d - glucosamine , deoxy sugars such as d - fucose or l - rhamnose , sugar phosphates such as d - ribose - 5 - phosphate , sugar acids such as d - galacturonic acid , or multi - derivatized sugars such as n - acetyl - d - glucosamine , n - acetylneuraminic acid ( sialic acid ), or n - sulfato - d - glucosamine . when isolated from nature , polysaccharide preparations comprise molecules that are heterogeneous in molecular weight . polysaccharides include , among other compounds , galactomanans and galactomannan derivatives ; galacto - rhamnogalacturons and galacto - rhamnogalacturon derivatives , and galacto - arabinogalacturon and galacto - arabinogalacturon derivatives . “ backbone ” means the major chain of a polysaccharide , or the chain originating from the major chain of a starting polysaccharide , having saccharide moieties sequentially linked by either α or β glycosidic bonds . a backbone may comprise additional monosaccharide moieties connected thereto at various positions along the sequential chain . “ esterification ” refers to the presence of methylesters or other ester groups at the carboxylic acid position of the uronic acid moieties of a saccharide . “ monosaccharides and their derivatives ” refers to , within the context of this invention , any of the standard and possible derivatives of monosaccharides ( sugars ), including but not limited to deoxymonosaccharides , dideoxymonosaccharides , sugar alcohols , sugar acids , sugar esters , sugar ethers , sugar halides , amino sugars , sugar phosphates , pyranose and furanose cyclic forms , open ring forms , sulfonic esters of sugars , glycosidic derivatives , glycols , glycolenes , keto sugars , diketo sugars , protected sugars , acetals such as benzilidenes and ketals such as isopropylidenes , nitro sugars , n - acetyl sugars , n - acetylmuramic acid , and antibiotic sugars such as nojirimycin and dihydronojirimycin . “ efficacy ” of a antifibrotic compound refers to the relationship between a minimum effective dose and an extent of toxic side effects . efficacy of an compound is increased if a antifibrotic end point can be achieved by administration of a lower dose or a shorter dosage regimen . if toxicity can be decreased , a antifibrotic compound can be administered on a longer dosage regimen or even chronically with greater patient compliance and improved quality of life . further , decreased toxicity of an compound enables the practitioner to increase the dosage to achieve the antifibrotic endpoint sooner , or to achieve a higher antifibrotic endpoint . “ pharmaceutically acceptable carrier ” refers to any and all solvents , dispersion media , e . g ., human albumin or cross - linked gelatin polypeptides , coatings , antibacterial and antifungal compounds , isotonic , e . g ., sodium chloride or sodium glutamate , and absorption delaying compounds , and the like that are physiologically compatible . the use of such media and compounds for pharmaceutically active substances is well known in the art . preferably , the carrier is suitable for oral , intravenous , intramuscular , subcutaneous , parenteral , spinal or epidural administration ( e . g ., by injection or infusion ). depending on the route of administration , the active compound can be coated in a material to protect the compound from the action of acids and other natural conditions in one embodiment , the collagen marker is measured and quantitated by morphometry , using four picrosirius red stained slides per animal . nine pictures are taken randomly per slide , for a total 36 pictures per animal , which are then evaluated using the bioquant ™ image analysis program . in another embodiment the following markers — alpha 1 - smooth muscle actin , beta pdgf - receptor , tgf - beta receptor , mmp1 , mmp2 , mmp13 , timp1 , tmp2 and collagen i — are assessed using cdna obtained by reverse transcription from mrna , extracted from liver tissue . in one embodiment an effective amount of a polysaccharide compound administered alone or in a mixture with a dose of a therapeutic agent administered in a subject for treating fibrosis is defined as one decreasing a level of a chosen molecular marker by 20 percent . in another embodiment the effective amount of an administered polysaccharide compound is defined as decreasing a chosen molecular marker between 5 and 50 percent and higher , depending on an advancement of the disease . in one embodiment , an effective amount of a polysaccharide compound administered alone or in a mixture with a dose of a antifibrotic compound administered in a subject for treating fibrosis is defined as one decreasing a level of a chosen molecular marker by 20 percent . in yet another embodiment an effective amount of an administered polysaccharide compound is defined as decreasing a chosen molecular marker between 5 and 50 percent and higher , depending on an advancement of the disease . in another embodiment , if an inducer of fibrosis , such as carbon tetrachloride ( subcutaneously ) or thioacetamide ( intra - peritoneally ) administered alone , causes formation of the biochemical markers , but a concurrent administration of the inducer and a suitable polysaccharide including but not limited to galactomannan , rhamnogalacturonan , or arabinogalactan , does not lead to formation of the same marker , or leads to formation of the same marker but in a reduced amount , it can be suggested that said polysaccharide prevents or slows down fibrosis . in yet another embodiment , if said polysaccharide is administered at later stages of development of fibrosis , and the administration causes reduction of the level of the biochemical markers compared to that in control or to that in the same experimental animal , it can be suggested that the polysaccharide is able to reverse or slow down fibrosis . in yet another embodiment , if said polysaccharide is administered at later stages of development of fibrosis , and the administration causes reducing of the level of the biochemical markers compared to that in control or to that in the same experimental animal , and then subsequent disappearance of the markers coincides with the return to health of a subject with respect to this particular pathology , it can be suggested that the polysaccharide is able to reverse fibrosis . in yet another embodiment , if said polysaccharide is administered at the late stages of fibrosis , which can be determined as cirrhosis , and the administration causes a reduction of the level of the biochemical markers compared to that in control or to that in the same experimental animal , it can be suggested that the polysaccharide is able to slow down or reverse cirrhosis . in yet another embodiment , if said polysaccharide is administered at later stages of development of fibrosis , and the administration causes reduction of the level of the biochemical markers compared to that in control or to that in the same experimental animal by at least approximately 5 %, it can be suggested that the polysaccharide is able to reverse or slow down fibrosis . in one embodiment of the patent a method for treating a fibrosis in a subject is disclosed , comprising administering parenterally an effective dose of a neutral or a cationic polysaccharide compound in an admixture with a dose of a compound to said subject in need thereof in order to treat fibrosis . in another embodiment the above method is disclosed , wherein the fibrosis is of the liver . in yet another embodiment the method is disclosed , wherein the fibrosis is of the lung . in another embodiment the fibrosis is of the kidneys . in another embodiment the polysaccharide compound is a rhamnogalacturonan . in another embodiment the polysaccharide compound is an arabinogalactan . in another embodiment the galactomannan has a molecular weight between 20 , 000 and 400 , 000 d . in another embodiment the ratio of mannose to galactose in a galactomannan is 1 . 7 : 1 . in another embodiment the ratio of mannose to galactose in a galactomannan is 2 . 2 : 1 . in another embodiment a molecular weight of the rhamnogalacturonan is between 20 , 000 and 400 , 000 d . in another embodiment the ratio of galactose to rhamnose in the rhamnogalactan is 3 . 7 : 1 . in another embodiment the ratio of galactose to rhamnose in the rhamnogalactan is between 0 . 4 and 6 . 7 to 1 . in another embodiment the arabinogalactan has a molecular weight between 20 , 000 and 200 , 000 d . in another embodiment the ratio of galactose to arabinose in the arabinogalactane is between 1 . 2 and 9 . 0 to 1 . in a further embodiment of the invention , galacto - rhamnogalacturonate ( gr ) is a branched heteropolymer of alternating 1 , 2 - linked rhamnose and 1 , 4 - linked gala residues that carries neutral side - chains of predominantly 1 , 4 - b - d - galactose and / or 1 , 5 - a - l - arabinose residues attached to the rhamnose residues of the rgi backbone . gr side - chains may be decorated with arabinosyl residues ( arabinogalactan i ) or other sugars , including fucose , xylose , and mannose . these are also referred to in commercial use as pectic material . in one embodiment , preparation involved modifying naturally occurring polymers to reduce the molecular weight for the desired range , adjusting the alkylated groups ( demethoxylation or deacetylation ), and adjusting side chain oligosaccharides for optimum efficacy . for example , natural polysaccharides may have a molecular weight range of between about 40 , 000 - 1 , 000 , 000 with multiple branches of saccharides , for example , branches comprised of 1 to 20 monosaccharides of glucose , arabinose , galactose etc , and these branches may be connected to the backbone via neutral monosaccharides such as rhamnose . these molecules may further include a single or chain of uronic acid saccharide backbone that may be esterified from as little as about 2 % to as much as about 30 %. the multiple branches themselves may have multiple branches of saccharides , the multiple branches optionally including neutral saccharides and neutral saccharide derivatives creating mainly hydrophobic entities . an example of a galactomannan is a polysaccharide prepared from guar gum and having a size is in the range of 2000 - 600 , 000 d or in the range of 90 , 000 to 415 , 000 d or in the range of 20 , 000 - 200 , 000 d . in specific examples , the galactomannan may have an average size molecular weight of 50 , 000 d or 215 , 000 d . in a further embodiment of the invention , the galactomannan is isolated from powder obtained from the seed of the plant cyamopsis tetragonoloba . in a further embodiment , a rhamnogalacturonate has a molecular weight range of 2 , 000 to 200 , 000 d . in specific examples , the rhamnogalacturonanate may have an average size molecular weight of 34 , 000 d or 135 , 000 d and is obtained through chemical , enzymatic , physical treatments and purification from pectic substance of citrus peels and apple pomace or soybean hull or alternatively processed from sugar beet pectin . in further embodiments of the invention , a galactomannan is used to reduce fibrosis under a antifibrotic action of an antifibrotic compound when it is mixed with the compound prior to administration . the galactomannan may be a β - 1 , 4 d - galactomannan . moreover , the galactomannan may include a ratio of 2 . 0 - 3 . 0 mannose to 0 . 5 - 1 . 5 galactose . the ratio of mannose to galactose may be 2 . 6 mannose to 1 . 5 galactose or 2 . 2 mannose to 0 . 9 galactose or 1 . 13 mannose to 1 galactose or 2 . 2 mannose to 1 galactose . in a further embodiment , the ratio of galacto - polysaccharide to an antifibrotic compound in the mixture may be in the range of 0 . 1 : 1 w / w to 10 : 1 w / w . in an embodiment of the invention , administration of the mixture results in a reduced fibrosys ( as determined by a reduced level of the specific markers ) of greater than 20 % compared to best standard of therapy . in another embodiment , the galacto - polysaccharide in combination with anti - fibrotic drugs reduced fibrosis by greater than 50 % compared with standard care . a further embodiment of the invention provides a method for use in treating a fibrosis including but not limited to , of the liver , the lungs , the kidneys , the eye , the skin . in an embodiment of the invention , galacto - rhamnogalacturonates ( gr ) is a branched heteropolymer of alternating a - 1 , 2 - linked rhamnose and a - 1 , 4 - linked gala residues that carries neutral side - chains of predominantly 1 , 4 - b - d - galactose and / or 1 , 5 - a - l - arabinose residues attached to the rhamnose residues of the rgi backbone . gr side - chains may be decorated with arabinosyl residues ( arabinogalactan i ) or other sugars , including fucose , xylose , and mannose . these are also referred to in commercial use as pectic material . in one embodiment , soluble chemically altered galacto - rhamnogalacturonates are prepared by modifying naturally occurring polymers to reduce the molecular weight for the desired range , reducing the alkylated group ( de - methoxylation or de acetylation ) prior to chemical modification , the natural polysaccharides may have a molecular weight range of between about 40 , 000 - 1 , 000 , 000 with multiple branches of saccharides , for example , branches comprised of 1 to 20 monosaccharides of glucose , arabinose , galactose etc , and these branches may be connected to the backbone via neutral monosaccharides such as rhamnose . these molecules may further include a single or chain of uronic acid saccharide backbone that may be esterified from as little as about 2 % to as much as about 30 %. the multiple branches themselves may have multiple branches of saccharides , the multiple branches optionally including neutral saccharides and neutral saccharide derivatives creating mainly hydrophobic entities . we describe chemical modification procedures that involves a enzymatic , peroxide and transition metals or peroxide / ascorbate session of the glycosidic bond in the polymer backbone or alkaline reductive depolymerization or controlled into smaller , branched polysaccharide molecules , using controlled conditions of time , temperature and buffer . treatments ( see example 1 , 2 , 3 ). the first purification procedure is extraction of the polysaccharide with alkaline and / or chelation solution to remove proteins , pigments and other impurities . the following are merely illustrative examples of the production of polysaccharides that are not meant to limit the invention . a starting polysaccharide is treated with u . v . radiation or suspended in 70 % alcohol treatment for about 48 hours to reduce microbial contamination . all further steps are conducted under semi - sterile conditions . after irradiation the polysaccharide is slowly dissolved in distilled water and the amount of total carbohydrate is determined by the phenol sulfuric acid method ( fidler et al ., cirrhosis res ., ( 1973 ), vol . 41 , pp . 3642 - 3956 .) a solution in distilled water is prepared at 20 g / l of polysaccharide , starting for example with usp pectin ( pelco ) is made and ph is adjusted to ph 5 . 5 with 1 m sodium succinate , the polysaccharide solutions is then incubated at fix temperature , for example ; 20 ° c . and peroxide and / or ascorbate are added together as in example ( fig1 ) or sequentially . h 2 o 2 caused a slow scission of usp pectin at ph 5 . 5 , at 10 mm ( fig1 ). the half time required to double the specific fuidity was 15 ± 72 h ( fig1 ). l - ascorbate at same condition and concentration induced faster scission . by far the most dramatic effect , however , was produced by combination of 5 mm ascorbate and 5 mm h2o2 which caused faster scission . sequential addition of ascorbate to polysaccharide solution already containing even 1 mm h 2 o 2 caused further stimulation of scission . the rate and extent of scission was determined by the dose of ascorbate added , time of addition post h 2 o 2 addition , ph and temperature . these indicate that an initial reaction preceded the scission process . a ph of 4 . 5 , gave the shortest delay and the greatest rate of scission . thus the enhanced effect of ascorbate depended on h 2 o 2 or dehydroascorbate produced by the reactions ( below ). for example digestion of 20 g / l of usp pectin with 10 mm h2o2 or 10 mm ascorbate or the combination of both at 5 mm each indicate a linear relation between digestion time and the viscometer measurements as below . ( fig1 ). the kinetics were also well correlated with incubation temperature . this method can be further enhanced in presence of metals like ca ++ , cu ++ or fe ++ . the most likely source of cleavage is fenton reaction ( halliwell , b . and gutteridge , j . m . c . ( 1990 ) methods enzymol . 186 , 1 - 85 ) which generates ionized oh , requires h2o2 and the reduced form of a transition metal ion , cu + reported being 60 times more effective than fe2 + all the polysaccharide samples usually contained measurable traces of fe , cu and zn in ppm level . the cu and fe content was similar in several commercial polysaccharides ( as reported in their c of a ) and similarly analytical grade ascorbic acid contained low ppm traces of cu and fe . therefore , when no transition metal are deliberately added , the fenton reactions would be feasible . cu + + h 2 o 2 → + oh + oh − + cu 2 + ( 3 ) the ph of the polysaccharide solution is increased to ph 10 with , for example , 3 n naoh . after short incubation at 5 to 50 ° c . for 30 to 60 minutes , 10 to 20 % ethanol is added and the purified polysaccharide is precipitated . this removed proteins and pigments associated with commercially available polysaccharides . the polysaccharide is then dissolved to a 20 g / l and then an acid is added , for example trifluoroacetic acid at final concentration of 0 . 01 to 1 . 0 m has been demonstrated to give a controlled de - polymerization . other acids or combination of them like sulfuric , hcl , acetate , propionic acid , or methansulfonic acid can be used to shorten the hydrolysis time and improve the yield of a desired structure of branched polysaccharide without oxidation . after appropriate time intervals , for example a time course from 10 minutes to 48 hours , at temperature of 15 to 121 ° c ., the solution is neutralized to ph 3 to 5 , cooled to 4 ° c . and centrifuged to remove any insoluble matter . then the supernatant is neutralized to a final ph of about 6 . 0 to 8 . 0 with 1 n naoh for example , 20 % ethanol is added to recover the soluble polysaccharide . ratio of polysaccharide to acid , type of acid , concentration , ph temperature and time interval are selected so to generate a soluble branched polysaccharide that has a molecular weight of 50 kd , 60 kd , 75 kd , 90 kd , 105 kd , 125 kd , 150 kd , 175 kd , and up to 200kd . the resulting soluble branched polysaccharide product can further washed with 70 % ethanol or with 100 % acetone to provide a final dry powder . thereupon the soluble branched polysaccharide is resolubilized in water to a final concentration of about 5 - 15 % by weight for analytical identification , efficacy or toxicological studies . the soluble branched polysaccharide may be further diluted for use according to embodiments of the invention in which concentrations of 0 . 01 - 10 % may be provided to cells . depending on the desired soluble branched polysaccharide composition and molecular weight . the ph of the polysaccharide solution is increased to ph 9 with , for example , 3 n naoh . after short incubation at 5 to 50c for 30 to 60 minutes , 10 % ethanol is added and the purified polysaccharide is precipitated . this removed proteins and pigments associated with commercially available polysaccharides . then reducing compound such as a sodium borohydride , lithium borohydrate , sodium cyanoborohydride , sodium triacetoxyborohydride or other borohydrate salts to create a session by alkaline reductive mechanism of the glycosidic bonds . this form fragments of a size corresponding to a repeating subunit . ( u . s . pat . no . 5 , 554 , 386 ). again temperature and time can be used to shorten the hydrolysis time and improve the yield of polysaccharide . after appropriate time intervals , for example a time course from 30 minutes to 24 hours , at temperature of 25 to 75 ° c ., the solution is cooled to 4 ° c . and centrifuge to remove any insoluble matter . then the supernatant is neutralized to a final ph of about 6 . 0 with 1 n hcl for example , 20 % ethanol is added to recover the soluble polysaccharide . ratio of polysaccharide to reductive compound , type of compound , concentration , ph , temperature and time interval are selected so to generate a soluble branched polysaccharide that has a molecular weight of 50 kd , 60 kd , 75 kd , 90 kd , 105 kd , 125 kd , 150 kd , 175 kd , and up to 200 kd . the resulting soluble branched polysaccharide product can further fractionate with 20 to 70 % ethanol and finally with 100 % acetone to provide a final dry powder . thereupon the soluble branched polysaccharide is resolubilized in water to a final concentration of about 5 - 15 % by weight for analytical identification , efficacy or toxicological studies . the soluble branched polysaccharide may be further diluted for use according to embodiments of the invention in which concentrations of 0 . 01 - 10 % may be provided to cells . depending on the desired soluble branched polysaccharide composition and molecular weight . the target molecular weight range for the chemically soluble branched polysaccharides is in the range of 50 to 200 kd . as the temperature ( or ph ) increases , a so - called β - elimination starts . the β - elimination in present of alkaline borohydrates results in controlled process of chain cleavage accommodated with loss of viscosity and gelling properties , which are used to monitor the reaction for example polysaccharide produced from guar gum a powder from seeds of cyamopsis tetragonoloba we provide a method of treating a subject with a antifibrotic compound that increases the efficacy of the antifibrotic compound . the method requires the co - administration of the compound with a polysaccharide . in addition to increasing efficacy , the co - administration of a polysaccharide with a antifibrotic compound may reduce the toxicity of the compound . in embodiments of the invention , the polysaccharide , galactomannan , has been shown to be effective in increasing the efficacy of antifibrotic compounds when coadministered with the compounds . although the examples provided herein describe the beneficial effects of galactomannans , we do not exclude the possibility that other polysaccharides may have a similar effect . the increase in efficacy may arise from a synergistic effect between the galactomannan and the antifibrotic compound mixture . both the polysaccharide and the antifibrotic compound may separately be formulated , in a dry form for example as a powder , or in a liquid form . in a preferred embodiment , the polysaccharide and antifibrotic compound are mixed prior to administration . the mixture may be in the form of a liquid , a powder or an aerosol . one of ordinary skill in the art can determine and prescribe the effective amount of the antifibrotic composition required based on clinical protocols . in general , a suitable daily dose of a composition of the invention will be that amount of the composition , which is the lowest dose effective to produce a antifibrotic effect . galactomannan is a polymer that may occur in a variety of size ranges . moreover , the galactomannan may be derivatized or hydrolyzed to result in fragments of the native molecule or may be reacted to provide chemically modified forms of the native molecule . embodiments of the invention provide a galactomannan having a molecular weight in the range of 20 , 000 - 600 , 000 d . the galactomannan may further have a size in the range of 90 - 415 , 000 d or . 40 , 000 - 200 , 000 d , or 50 , 000 - 80 , 000 d . example 1 utilizes a galactomannan with an average molecular weight of 65 , 000 d while example 2 utilizes a galactomannan with an average molecular weight of 83 , 000 d . the ratio of mannose to galactose may vary according to the source of the galactomannan and the isolation procedure . in embodiments of the invention , the galactomannan may have a mannose to galactose ratio of 2 . 0 - 3 . 0 , mannose : 0 . 5 - 1 . 5 galactose . the ratio of mannose to galactose maybe 2 . 6 : 1 . 5 or 2 . 2 : 0 . 9 or 1 . 13 : 1 or 2 . 2 : 1 . in example 1 , the ratio of mannose to galactose is 1 . 7 : 1 and in example 2 , the selected ratio of mannose to galactose in the galactomannan is 2 . 2 : 1 . in one preferred embodiment , the structure of galactomannans is a poly - β - 1 , 4 - mannan backbone , with the side substituents bound via α - 1 , 6 - glycoside linkages . the active galacto - polysaccharide is produced from powder readily available from the wood of the larch tree primarily larix occidentalis ( western larch ). the process in general follow the preparation listed above for rhamnogalacturonate and galactomannan . the target molecular weight is 20 , 000 to 70 , 000 d with at least 5 % terminal galactose side chain . the following discussions and examples of assays utilized to demonstrate efficacy and effective dose are to be used as illustrative examples and are not meant to limit the present invention to the examples illustrated . example 1 . liver , lung , kidney and plasma distribution of radiolabeled ( tritiated ) galactomannan in healthy male athymic ncr - nu mice . twelve male ncr - nu athymic nude mice ( charles rivers laboratories , raleigh , n . c .) were acclimated in the laboratory one week prior to experimentation . the animals were housed in microisolator cages , four per cage , and using a 12 - hour light / dark cycle . all animals received sterilized tap water and sterile rodent food ad libitum . the animals were observed daily and clinical signs were noted . the mice were healthy and had not been previously used in other experimental procedures . the mice were randomized and were comparable at the initiation of treatment . tritiation of the galactomannan was performed as follows . 12 . 8 mg of the galactomannan was dissolved in 2 . 0 ml of water and exposed to 25 curies of tritium gas in the presence of pd / baso 4 catalyst ( 120 mg , totally insoluble in water ). after one hour the gas supply was removed , the catalyst was filtered away , and the aqueous solution of the galactomannan was evaporated to dryness repeatedly ( four - fold , adding water ), until no labile tritium was found . total yield of the labeled galactomannan was 3 . 8 mc i , specific radioactivity was 300 μc i / mg . all twelve mice were given a single intravenous injection of cold or tritiated galactomannan ( either 6 or 60 mg / kg ) on the same day . non - labeled galactomannan was formulated in saline , and tritiated galactomannan was added to the solution so that each animal received 10 μc i of radioactivity . all dosing solutions ( 100 μl each ) were counted in duplicate . six mice were injected with 6 mg / kg solution , and six mice with 60 mg / kg solution . two mice from each group were bled at 1 , 6 , and 24 hrs after injection , and plasma was prepared . animals were then sacrificed ; livers , kidneys and lungs were collected , weighed and flash - frozen for further analysis . after weighing , livers were dissolved in 10 ml of soluene 350 and incubated first for 4 hrs at 50 ° c ., and at room temperature , until tissues were solubilized . one ml of the resulting solution was counted in a scintillation counter as a single sample . based on tissue weight and the sample volume , the number of μc i of tritiated galactomannan per gram of tissue was calculated . kidneys were treated in the same manner , but dissolved in two ml of soluene . after the tissue was solubilized at room temperature , 15 ml of safety solve scintillation fluid was added and samples were incubated overnight . five ml of the resulting solution were diluted in 15 ml of safety solve and counted in a scintillation counter as a single sample . lungs were treated in the same manner but dissolved in one ml of soluene . plasma samples ( 50 μl each ) were placed direct into safety solve and counted as a single sample . the statistical evaluation was based on experiments to trace and quantify the labeled galactomannan in organs / tissues ( liver , kidneys , lung , and plasma ). six mice were treated with galactomannan at 60 mg / kg with each of 2 mice sacrificed at 1 , 6 , and 24 hours ; six mice were treated with galactomannan at 6 mg / kg with each of 2 mice sacrificed at 1 , 6 , and 24 hours , as described above . the percentages of 3 h - galactomannan recovered per organ ( μc i / gram ) was used for analyses ; plasma outcome ( μc i / ml ) was counted from the entire sample . the assessment of radiolabel uptake was challenging with only two mice per treatment - sacrifice time combination and occasional outliers . to address the number of mice per group , pooling tests were performed for the two galactomannan treatment groups ; this would potentially increase sample size per group to four , to address possible outliers , all outcomes for each individual mouse was visually compared to the other mice in the series - treatment - time combination ; the four possible mice outcomes were considered in this evaluation since any sigma - based rule would have excluded none or both observations if applied separately to the two different series . sas ( version 6 . 12 , cary , n . c .) was used for all analyses . proc anova was used for pooling tests , while proc freq was used to estimate means and standard deviations . it was observed that galactomannan freely binds to liver , kidney , lung , and plasma , and did not reach limits of the binding , e . g . did not reach saturation of the binding between the 6 mg / kg and 60 mg / kg doses . when 6 mg / kg ( with a relative radioactivity of 1 . 0 ) and 60 mg / kg ( with a relative radioactivity of 0 . 1 ) doses of galactomannan were administered , the amount of bound radioactive galactomannan was the same ; that is , the amount of bound galactomannan increased 10 - fold for the 10 - times higher dose . the distribution of radioactivity in whole tissues as well as per weight or volume ( in plasma ) was practically identical for 6 and 60 mg / kg of galactomannan , hence , the respective data were pooled for table 1 . overall , the data in table 1 are average for four animals . 3 h - galactomannan elimination from plasma , kidneys , and lungs in the various groups was relatively slow . an average of approximately 50 % of the one - hour radioactivity was detected at 6 hours . elimination of 3 h - galactomannan from the liver was more gradual than in other tissues , and on average , more than 50 % of the radioactivity detected at one hour after injection was still present at 24 hours . this can be compared , for example , with clearance of 5 - fluorouracil from the liver , which was eliminated to 1 . 6 % after 24 hrs , and from the lungs and the kidneys , which was eliminated to 3 . 6 % and 3 . 8 %, respectively , for the same period . example 2 . assessing the antifibrotic efficacy of a modified galacto - rhamnogalacturonate compounds in lx2 , an immortalized human hepatic stellate cell line the antifibrotic activity of a galacto - polysaccharides was determined in triplicate , at five concentrations and three time points ( 4 , 12 and 24 hrs ) on hepatic stellate cell ( hsc ) proliferation , employing the method of 3h - thymidine incorporation , as well as regarding the galacto - polysaccharide effect on the following markers of fibrogenesis : collagen i ( a marker on fibrosis ) alpha 1 - smooth muscle actin ( a marker on activation of stellate cells ) beta pdgf - receptor ( a marker on proliferation ) mmp2 , mmp9 , timp1 and timp2 ( markers on matrix degradation ) tfg - β1 ( a marker on fibrogenesis ). two more polysaccharides served as reference compounds . they were a galacto - rhamnogalacturonate from citrus , and a galactomannan from guar gum . lx2 cells , an immortalized human hepatic stellate cell line , were incubated at 370c in an atmosphere of 5 % co2 in dulbecco &# 39 ; s modified minimal essential medium ( gibco brl life technologies , rockville , md .) containing 1 % fetal calf serum ( fcs ), 2 mmol / l of l - glutamine and 5000 iu / ml of penicillin / 5000 g / ml streptomycin for 1 to 2 days before starting experiments . they were then serum starved with 0 . 1 % bsa ( 0 . 2 % fcs ) for 24 hours , and treated with each of the three polysaccharides in the following concentrations : galactomannan 0 . 5 - 1 mg / ml , citrus galacto - rhamnogalacturonate 0 . 1 - 0 . 5 mg / ml or apple galacto - rhamnogalacturonate 0 . 1 - 0 . 5 mg / ml for 12 , 24 , 48 and 72 hours . the exact concentrations of each modified polysaccharide was adjusted according to ongoing data during the experiment . to confirm that the hypothesized reductions in fibrogenic markers were not accounted for by decreasing cell viability , an mtt viability assay was performed . 200 μl of the mtt solution ( 2 mg of mtt in 1 ml of dmem ) were added to each well of 24 - well plate and incubated at 37 ° c . for 1 hr . after the incubation , the media was discarded and 100 μl of n - propanol added to each well . after 5 - 10 minutes of reaction , 50 μl of the solution was taken from each well and transferred into 96 - well plate and the o . d . was read with elisa reader at 570 nm . to indicate that the effects of the polysaccharides were specific for fibrogenic gene expression , cell proliferation was assessed in the presence of the polysaccharides . assessment of proliferation is a valuable indicator of stellate cell activation , and thus compounds that reduce proliferation are expected to reduce the overall number of fibrogenic cells during liver injury , which might be erroneously taken as a specific marker - reducing effect . cells were serum starved , then incubated in medium containing 3 h thymidine as previously described ( 22 ). after washing the cells with cold pbs 3 times , 500 μl of 0 . 25 n naoh / 0 . 25 % sds is added to each well of 24 - well plate and transferred to scintillation vials containing 100 μl of 1 n hcl . then 5 ml of scintillation solution is then added to the vial and vortexed . cpm is read in scintillation counter ( ls3801 liquid scintillation system , beckman ). the antifibrogenic activity of the polysaccharides was measured by their effect on expression of established fibrotic markers by quantitative real time rt - pcr of fibrotic marker mrnas . rna from lx2 cells was extracted and purified using the qiagen rnaeasy mini - kit . concentrations was then measured in life science uv / vis spectrophotometer du 530 bekman . total rna was reverse transcribed to complementary dna ( cdna ) using the reverse transcription system by promega ( madison , wis .) ( sprint ™ powerscript ™ double preprimed single shots , clontech , usa ). one microgram of rna in 7 . 7 μl of nuclease - free water was added to 2 . 5 μl of 10x reverse transcriptase buffer , 10 μl of 25 mm mgcl2 , 2 . 5 μl of 10 mm dntp , 1 μl of random primer , 0 . 5 μl of rnase inhibitor and 0 . 8 μl of amv reverse transcriptase ( one microgram of rna was added into a tube containing reaction mixture which contains 0 . 5 μg of powerscript reverse transcriptase , 20 μm random hexamer primers , 20 μm oligo ( dt ) 18 primers , 10 mg / ml bsa , 1 m dtt , 10 mm dntp mix , 10x reaction buffer , cryoprotectant and stabilizers ). the reaction was performed for 10 min at 25 ° c . ( annealing ), 60 min at 42 ° c . ( cdna - synthesis ), and 5 min at 95 ° c . ( enzyme denaturation ), 80 min at 42 ° c ., 10 min at 70 ° c . by ptc - 200 , peltier thermal cycler . real - time quantitative pcr was analyzed in triplicate and performed with abi prism 7900ht sequence detection system ( applied biosystems , foster city , calif .) lightcyclerr480 , roche , usa . one microliter of cdna was used in each pcr reaction , platinum taq dna polymerase , syber green , 100 mm dntp ( invitrogen corp , carlsbad , calif .) taq polymerase , dntp , dmso , 25 nm mgcl2 , 10x taq buffer , nf h2o , zybo green , and the fluorescence signals was captured during each of the 40 ( 45 ) cycles , in proportion to the quantities of double - stranded dna ( denaturation 15 s at 95 ° c ., annealing 15 s at 56 ° c . and extension 40 s at 72 ° c .) ( 1 cycle for denaturation 5 min at 950c ), 45 cycles for amplification ( 10 sec at 95 ° c ., 10 sec at 55 ° c ., 12 sec at 72 ° c . ), 12 sec at 65 ° c . for melting curve , and 10 sec at 40 ° c . for cooling ). detection of the pcr products by agarose gel electrophoresis was used to confirm the homogeneity of the dna products . gapdh was used as a reference gene for normalization , and water was be used as negative control . relative quantitation was calculated using the comparative threshold cycle ( ct ) method as described in the user bulletin , abi prism 7900ht sequence detection system ( relative quantification analyses was done using the lightcycler 480 relative quantification software supplied by the company ). ct indicates the fractional cycle number at which the amount of amplified target genes reaches a fixed threshold within the linear phase of gene amplification , and is inversely related to the abundance of mrna transcripts in the initial sample . mean ct of duplicate ( triplicate ) measurements were used to calculate δct as the difference in ct for target and reference ( gapdh ) genes . δct for each sample was compared to the corresponding ct of the control experiment and expressed as δδact . relative quantization was expressed as fold - induction or repression of the gene of interest compared to the control condition according to the formula 2 - δδct . a figure below ( fig . # 2 - effect of galacto - polysaccharides &# 39 ; derivatives on molecular markers of fibrogenesis ) shows that the galacto - rhamnogalacturonate ( gr - 300 ) suppresses the fibrosis markers &# 39 ; expression between 50 % and 80 % while the galactomannan ( davanat ) and the galacto - rhamnogalacturonate ( gr - 200 ) decrease fibrosis markers &# 39 ; expression from 0 to 40 %. these results indicate a significant antifibrotic effect of the polysaccharides , particularly that of apple origin , on human hepatic stellate cells , and suggest that the polysaccharides can protect from and even reverse the progression of liver fibrosis . the results ( fig . # 1 ) of qrt - pcr tests for fibrosis markers collagen i ( coll 1 ), alpha - 1 smooth muscle actin ( asma ), platelet derived growth factor receptor - beta ( pdgfbr ), transforming growth factor receptor beta - 1 ( tgfbr1 ), matrix metalloproteinase 2 ( mmp2 ), tissue inhibitor of metalloproteinase 1 ( timp i ) and tissue inhibitor of metalloproteinase 2 ( timp ii ) after 48 hrs as control , and in the presence of 1 mg / ml davanat , 0 . 1 mg / ml gr - 200 or 0 . 1 mg / ml gr - 300 . the results are shown after normalization to gapdh expression levels as a house keeping gene . in order to confirm that the observed reductions in fibrogenic markers are not accounted for by decreasing cell viability , an initial mtt cell viability assay was performed on the lx2 cell line assayed in the above figure . the rationale behind assessing viability is to demonstrate that the compounds are not simply toxic in a non - specific manner , but rather that they exerted quantitative , measurable effects on the biology of hepatic stellate cells through specific molecular interactions . obtained results ( fig3 - cell viability , treatments vs . control untreated ) showed that the significantly decreased expression of fibrosis markers was not due to decreased cell viability ( fig . # 2 ) but rather due to an actual effect on mrna expression . this figure shows results of the mtt viability test for human hepatic stellate cell ( hsc ) line lx2 in the absence of polysaccharides as control and in the presence of davanat ( 1 mg / ml ), gr - 200 and gr - 300 ( 0 . 1 mg / ml ) ( bar on the right ). the data show that none of the three polysaccharides significantly effects the cell viability within error margin ( typically 2 % to 10 % in these experiments ). similarly , there was no significant effect of any of the three polysaccharides on cell lx2 proliferation , measured using 3 h - thymidine incorporation assay ( fig4 below - proliferation results of 3 galacto - polysaccharides on hepatic stellate cell ( lx2 cell line ) using 3 h - thymidine incorporation assay ). the results ( fig . # 4 ) shows human hepatic stellate cell ( hsc ) line lx2 proliferation test using 3h - thymidine incorporation assay in the absence of polysaccharides as control , and in the presence of 1 mg / ml davanat , gr - 200 or gr - 300 . the data show that none of the three polysaccharides significantly effects the cell proliferation within error margin ( typically 10 % to 30 % in these experiments ) one can see that the galacto - rhamnogalacturonate from apple showed downregulation of a full panel of activation - related mrnas , indicating a global effect on slowing down stellate cell specific activation . this is a manifestation of fibrotic process slowing down or even reversing . pathogen - free male wistar rats were housed at a constant temperature and supplied with laboratory chow and water ad libitum . thioacetamide ( taa , from wako pure chemical co ., osaka , japan ) was used to induce liver fibrosis model . the induction regimen and dosage was 50 mg / body , intraperitoneally administrated twice a week into rats ( n = 8 - 15 ) for up to 8 weeks . the admixture was administered either intraperitoneally or orally every day for 6 weeks . for testing reversibility of disease the admixture was administered either intraperitoneally or orally during the last 3 - 4 weeks of the induction period . 24 - 48 after the final treatment , the animals were anesthetized , and the peritoneal cavity was opened . the liver was perfused with phosphate - buffered saline via the portal to remove all blood from the whole liver lobules . subsequently , part of the liver was treated with 10 % formaldehyde and used for histologic examination . the remaining part was frozen in liquid nitrogen and stored at 80 ° c . for fibrosis markers analysis . in other animal model fibrosis and cirrhosis were induced by bile duct ligation . rats were laparotomized and the common bile ducts were ligated at two different sites . the rats were administered with the admixture — in this example including corticosteroid ( 10 mg / body )— intraperitoneally every day for 2 weeks . the results were that treatment with the admixture either intraperitoneally or orally suppressed fibrosis of the liver by at least 50 % versus control untreated animals .

US-74972807-A

brim templates , covers and methods of modifying and changing brims on caps and visors . novel digitally printed on indicia designs , words and / or colors can be placed on fabric brim covers . the brim covers can have an upper cover with overhanging edges that wrap about perimeter edges of existing hat brim , and a lower cover for covering a lower surface of the existing hat brim . the covers can be attached with by peeling off backing layers that reveal sticky surfaces that allow the covers to be easily attached to existing brims and easily removable from the existing brims without damaging the brims .

before explaining the disclosed embodiments of the present invention in detail it is to be understood that the invention is not limited in its applications to the details of the particular arrangements shown since the invention is capable of other embodiments . also , the terminology used herein is for the purpose of description and not of limitation . a list of components from the figures will now be described . 1 . prior art baseball cap 2 . existing visor on baseball cap 4 . head cover portion of baseball cap 10 . top brim replacement template cover 12 . upper cover for brim 13 . inner concave curved edge 14 . tab edges 14 x . right end tab 14 y . left end tab 15 . outer convex curved edge 16 . lower peel and stick layer 17 . rear end of upper cover 18 . front end of upper cover 18 a . right side of upper cover 18 b . left side of upper cover 19 . cut 20 . bottom brim template cover 21 . front end of bottom cover 21 a . right side of bottom cover 21 b . left side of bottom cover 22 . bottom exposed cover 23 . inner concave curved edge 24 . rear end of bottom cover 25 . outer convex curved edge 26 . removable peel and stick layer the novel invention uses both a top brim template 10 and a bottom brim template 20 . the novel replacement brim template covers 10 and 20 can have selected indicia placed thereon such as but not limited to digital or other printing on a fabric , plastic , or any other layer material . the novel brims can be customized with different indicia , such as but not limited to different designs , sports teams , sports memorabilia , animal prints , different colors , combinations , thereof , and the like . fig2 a shows the top cover 12 of the novel replacement top brim template cover 10 with the outer lip tab edges 14 . fig2 b shows the bottom peel and stick layer 16 the top brim template 10 of fig2 a . referring to fig2 a - 2b , the top brim template cover 10 can be formed from a fabric or nylon or cotton , and the like material , and can optionally have a waterproof coating . the exposed visible surface of the top cover 12 of the top brim template 10 , can have a customized indicia thereon , such as but not limited to different designs , sports teams , sports memorabilia , animal prints , and the like . the top brim template cover 10 can have a generally arc shape to conform to the brims on existing baseball and golf type hats , with an inner concave edge 13 and an outer convex edge 15 . the top brim template cover 10 can consist of a single material layer and a plurality of side by side tabs 14 , the template 10 having an arc curved shape on a front end 18 , a left side 18 b , a right side 18 a and a rear end 17 . the tab edges 14 can be formed by cutting small triangular cuts approximately 1 inch in from the outer edge 15 . the front end of the top brim template cover 10 having a convex curved outer perimeter portion with the plurality of side by side tabs 14 substantially adjacent to one another , and the plurality of side by side tabs 14 continuously extending from the left side 18 b of the template around the front end 18 to the right side 18 a of the template . each of the side by side tabs 14 can be separated by one another by a cut 19 that consists of two straight lines that are each joined together at one end . the plurality of side by side tabs 14 include a right end tab 14 x and a left end tab 14 y that are substantially different in shape and size from all other ones of the plurality of side by side tabs 14 . the rear end 17 of the top brim cover template 10 can consist of a single , continuous smooth arcuate surface between the right end tab 14 x and the left end tab 14 y . the single , continuous smooth arcuate surface of the rear end 17 of the top brim cover template 10 can be positioned against a surface where the existing brim meets a crown portion of the headwear . the template can be approximately 5 and ¼ inches on the sides approximately 2 inches from center and be approximately 7 inches across the template cover 12 from the left side to the right side . there is an extra ½ ″ around the entire design to wrap around to the bottom of the brim . underneath the top cover 10 can be a removable peel and stick paper type layer 16 , which reveals a sticky adhesive layer under the top cover 12 . the removable paper type layer 16 can be sized to substantially cover the undersurface of the top cover 12 . a double sided adhesive tape with paper layers can be used that works with fabric materials , where the adhesive is pressure and / or heat activated . such adhesive tape can include but is not limited to those described in u . s . pat . no . 4 , 884 , 973 to konishi et al . ; and u . s . patent application publications : 2007 / 0084559 to graziano ; and 2008 / 0214079 to harai et al ., which are each incorporated by reference in their entirety . fig3 a shows the bottom cover 22 of the novel replacement bottom brim template cover 20 . fig3 b shows the peel and stick layer 26 for the bottom brim template cover 20 . referring to fig3 a - 3b , the bottom brim template cover 20 can also be formed from a fabric or nylon or cotton , and the like material , and can optionally have a waterproof coating . the exposed visible surface of the bottom cover 22 of the bottom brim template cover 20 , can have a customized indicia thereon , such as but not limited to different designs , sports teams , sports memorabilia , animal prints , and the like . the bottom brim template cover 20 can have a generally arc shape to conform to the brims on existing baseball and golf type hats , with an inner concave edge 23 designating a rear end 24 and an outer convex edge 25 designating a front end . the outer convex edge 25 further includes a left side 21 b and a right side 21 a . the front end 21 having a smooth surface along an outer perimeter of the arc shape and the rear end 24 having a smooth arcuate surface . the template cover 20 can be sized smaller than the top template cover 10 without the extra dimensions for the tab edges 14 , since there are no tab edges on the bottom template cover 20 . on the other side of the bottom template cover 20 can be a removable peel and stick paper type layer 26 , which reveals a sticky adhesive layer under the bottom cover 22 the removable paper type layer 26 can be sized to substantially cover the undersurface of the bottom cover 22 . fig4 a is a front view of a cap 1 having the top template cover 10 starting to be applied to the visor 2 on the hat 10 . fig4 b is a bottom view of the tab edges 14 being bent around the perimeter of the visor 2 on the hat 1 . referring to fig2 a , 2 b , 4 a and 4 b , a user can remove the paper type layer 16 revealing a sticky ( adhesive ) surface of the top cover 12 of the top brim template cover 10 . with the visor / brim 2 positioned on a flat surface , the user can position the top cover 12 over the existing visor / brim 2 on the hat 1 , so that the tab edges 14 extend over the perimeter edges of the visor / brim 2 . next , the user can press down making sure the top cover 12 covers all of the existing upper surface of the visor / brim 2 on the hat by carefully pressing down . if necessary , the user can trim the edges of the top brim cover 12 so that the top brim cover substantially fits on , conforms to , and covers all of the existing upper surface of the brim / visor 2 on the hat 1 . next , the user can bend the tab edges 14 underneath the visor / brim 2 so that their sticky undersurface adheres to the undersurface of the visor / brim 2 . fig5 a is a front view of the cap 1 with the top brim template 10 fully installed . fig5 b is a bottom view of the hat 1 with the bottom template cover 20 installed . referring to fig3 a , 3 b , 5 a and 5 b , after the top template cover 10 is installed , the user positions the hat 1 upside down so that the visor / brim 2 with installed top template cover 10 is against a flat surface . next , the user removes the peel and stick paper layer 26 from the bottom template cover 20 revealing a sticky ( adhesive ) surface on one side of the bottom cover 22 . the user then positions the bottom cover 12 so that the sticky surface is pressed against the bottom of the visor / brim 2 , effectively covering the bent tab edges 14 . if necessary , the user can trim the edges of the bottom brim cover 22 so that the bottom brim cover substantially fits on , conforms to and covers all of the existing bottom surface of the brim / visor 2 on the hat 1 . when finished the visor / brim 2 of the hat 1 has a completely new exposed indicia surface that has been customized by the user . the indicia can include any type of text , image , artwork , combinations thereof , and the like . the novel replacement brim template covers 10 , 20 can be marketed in a kit . a kit can include a two piece set having an upper template cover 10 with overhanging edges 14 and a lower template cover 20 . both the upper cover and the lower cover can have a removable backing layer that can each be peeled off to reveal a sticky ( reusable adhesive ) layer surface . the sticky layer surface of the upper cover can be fit over the top of the existing hat brim so that the perimeter edges can overhang about the perimeter edges of the existing hat brim and folded back . next the sticky surface of the lower cover can be fit over the bottom surface of the existing hat brim so that it covers the folded back portions of the top cover . the peel and stick backings also allow for the brim covers to be easily peeled off of the existing brims and changed out with different replacement brim covers without causing damage to the underlying existing brims . other types of fasteners can also be used to attach the replacement brim covers to existing brims , can include such as but not limited to hook and loop fasteners ( such as velcro ®) or snap fasteners , and the like . the adhesive layer and / or the other types of fasteners , allow for the template covers to be removable from the existing brims without destroying the existing brims . although the embodiment shows a hat portion with the visor / brim , the invention can be used just with visors / brims that have straps that attach about one &# 39 ; s head without a head type covering portion . while the invention has been described , disclosed , illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice , the scope of the invention is not intended to be , nor should it be deemed to be , limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended .

US-201313934990-A

a snuff holding and dispensing apparatus including a body member having a hollow interior divided into a holding area for holding a quantity of snuff and a dispensing area for receiving a plug of snuff from the quantity of snuff in the holding area , and a plunger movable between a load position for allowing the plug of snuff to pass from the holding area to the dispensing area and a discharge position for dispensing the plug of snuff through a discharge opening in the body member . the plunger coacts with passage structure between the holding and dispensing areas of the interior of the body member to form a sharp slicing mechanism to slice the plug of snuff from the quantity of snuff as the plunger moves from the load position to the discharge position .

the holder 11 of the present invention is for holding and dispensing snuff . looking , in general , at fig1 thru 4 , the holder 11 includes a body member 13 having an access opening 15 for access into a hollow interior 17 for allowing snuff to be placed within the hollow interior 17 and having an outlet opening 19 which provides a passage for removing the snuff from the hollow interior 17 thereof . the body member 13 is defined by a box - like container including a front wall member 21 in which access opening 15 is provided , a back wall member 23 , a first side wall member 25 , a second side wall member 27 , a top member 29 and a bottom member 31 with the edges of the various members joined together to form a rigid unit . the specific construction of the body member 13 may vary as will be apparent to those skilled in the art . for example , the body member 13 may be molded out of an acrylic plastic or the like . more specifically , the front wall member 21 , back wall member 23 , first side wall member 25 , second side wall member 27 , top member 29 and bottom member 31 may be injection molded as a one - piece integral unit out of acrylic plastic or the like . the holder 11 includes a door means 33 slidably mounted in the front wall member 21 of the body member 13 for movement between a closed position 35 ( see fig1 ) in which the access opening 15 is obstructed and an open position 37 in which the access opening 15 is open ( see fig3 ). the door means 33 may consist of simply a flat plate - like member having a raised portion 33 &# 39 ; at one end for a thumb hold to move the door means 33 from a closed position 35 to an open position 37 . guide means 38 are preferably provided in the front wall member 21 of the body member 13 for guiding the door means 33 between a closed position 35 ( shown in fig1 ) and an open position 37 ( shown in fig3 ). the guide means 38 may simply consist of a channel member 39 cut into the front wall member 21 and running around the periphery of the access opening 15 of the body member 13 . the channel member 39 is constructed in a manner well known to those skilled in the art so as to guidingly constrain the door means 33 when forceably moved between a closed position 35 and an open position 37 . the holder 11 includes a closure member 41 pivotally attached by a pivoting member 42 extending through and into the upper portion of the first side member 25 of the body member 13 ( see fig5 ). the closure member 41 is constructed simply of a small sheet of acrylic plastic which has a pivoting member 42 which may simply consist substantially of a typical screw or the like of well - known construction . the closure member 41 is preferably attached to the upper portion of the first side wall member 25 by pivoting member 42 for movement between an open position 43 in which the outlet opening 19 is opened ( see fig4 ) and a closed position 45 in which the outlet opening 19 is obstructed ( see fig1 ). the closure member 41 is also used as a backing means whose use will hereinafter become apparent . the holder 11 includes a plunger means 47 movably mounted between a retracted position 49 ( see fig1 and 5 ) and an extended position 51 ( see fig3 and 11 ). plunger means 47 includes an elongated flat head 53 horizontally positioned above the top member 29 of the body member 13 , a cylindrical plug 55 horizontally positioned in spaced relationship below the top member 29 thereof and parallel with the head 53 , and an upwardly extending leg 57 rigidly connecting the head 53 and plug 55 together ( see fig6 thru 8 ). the plunger means 47 may be injection molded as a one - piece unit out of acrylic plastic or the like . the top member 29 has an elongated slot 59 cut vertically through the end of top member 29 adjacent the second side wall member 27 and from where slot 59 extends substantially halfway across top member 29 toward the first side wall member 25 . the use of the slot 59 will hereinafter become apparent ( see fig9 ). the body member 13 includes a cylindrical bore 61 extending from the outlet opening 19 in the first side wall member 25 thereof and extending longitudinally through the opposite second side wall member 27 ( see fig5 and 11 ). the cylindrical bore 61 extends parallel at a spaced distance below the top member 29 and receives the plug 55 of the plunger means 47 . plug 55 is arranged in bore 61 so that the leg 57 is positioned next to the second side wall member 27 and extends upwardly through the slot 59 in the top member 29 with the head 53 extending horizontally above the top member 29 ( as shown in fig5 ). the slot 59 allows the plunger means 47 to slidably move longitudinally between a retracted position 49 in which the plunger means 47 is positioned next to the second side wall member 27 ( see fig5 ) and an extended position 51 in which the plunger means 47 is positioned next to the first side wall member 25 with the plug 55 substantially touching the closure member 41 ( see fig3 and 11 ). the opening 63 opposite the outlet opening 19 , which is the other end of the cylindrical bore 61 , is sealed off by a small sheet 65 of acrylic plastic adhered to the second side wall member 27 by an adhesive ( not shown ) of the type well known to those skilled in the art . the sheet 65 keeps the plunger means 47 from being removed from the cylindrical bore 61 . the holder 11 preferably includes a bias means 67 for regulating the amount of snuff falling into the bore 61 . the bias means 67 is defined by an inclined flat surface 69 which extends inwardly and upwardly from the inner upper portion of first side wall member 25 at an angle relative thereto , interrupting or cutting away a portion of the cylindrical bore 61 and extending to a place adjacent top member 29 ( see , in general , fig5 and 11 ). inclined surface 69 is disposed at a 30 ° angle relative to top member 29 and cylindrical bore 61 . a vertical surface 71 depends from the upper end of inclined surface 69 and cuts downwardly across cylindrical bore 61 to establish with inclined surface 69 a notch - like opening or passage 73 from interior 17 into cylindrical bore 61 when plunger means 47 is in the retracted position 49 . the end 55 &# 39 ; of plug 55 is preferably flush with surface 71 when the plunger means 47 is in the retracted position . the intersection of inclined surface 69 with cylindrical bore 61 establishes a generally elliptical edge 75 ( see fig1 ) which is preferably sharp for a purpose to be hereinafter described . the inclined surface 69 regulates the amount of snuff that falls into the cylindrical bore 61 . more specifically , when the holder 11 is used the holder 11 is turned upside down as shown substantially in fig1 allowing the snuff &# 34 ; s &# 34 ; that is enclosed within the interior 17 of the body member 13 to fall downwardly through passage 73 filling up the exposed cylindrical bore 61 to the left of the plug 55 , as viewed in fig5 ( i . e ., the space between the plug 55 and closure member 41 ). then as the plunger means 47 is longitudinally moved from the retracted position 49 into the extended position 51 , the plug 55 travels within the bore 61 causing a portion of snuff &# 34 ; s &# 34 ; to be substantially sliced by the plug 55 forcing snuff &# 34 ; s &# 34 ; past the sharp edge 75 of the bias means 67 . the snuff &# 34 ; s &# 34 ; in front of the plug 55 is formed and compressed against the back of closure member 41 into a substantially cylindrical plug of snuff s &# 39 ;. when the desired amount of snuff &# 34 ; s &# 34 ; is compressed within the bore 61 , the closure member 41 is pivoted from the normally closed position 45 to the open position 43 and the plug of snuff s &# 39 ; is pushed from the bore 61 into the mouth of the user by slidably moving the plunger means 47 to the full extended position 51 . when the plug of snuff s &# 39 ; is compressed , the body member 13 may be inverted allowing easier access to the user &# 39 ; s mouth ( being placed substantially as shown in fig4 ). if a bigger plug of snuff s &# 39 ; is desired , the filling process is simply repeated until the desired size of plug s &# 39 ; is obtained . in other words , in the filling operation above described , a plug of snuff s &# 39 ; may be formed in cylindrical bore 61 against the inside of closure member 41 . then while the closure member 41 remains closed and with the plug of snuff s &# 39 ; in cylindrical bore 61 , the plunger means 47 is moved to the retracted position 49 . then , with the holder 11 turned upside down , more snuff &# 34 ; s &# 34 ; is shaken down through passage 73 in behind the first plug of snuff , which is then compressed against the first plug and so on until the desired size of snuff plug s &# 39 ; is formed . as thus constructed and used , the holder 11 provides a means to sanitarily carry and dip snuff without the waste and spillage that normally occurs when dipping snuff . also , the holder 11 allows the user to dip snuff while operating a motorized vehicle or the like . although the present invention has been described and illustrated with respect to a preferred embodiment and a preferred use thereof , it is not to be so limited since changes and modifications can be made therein which are within the full intended scope of the invention .

US-78174085-A

a modular article of furniture capable of assuming a variety of shapes and configurations and having at least one body support structure having at least one seatrest unit and at least one releasably associated upper body support . the seatrest unit is formed in the geometric shape of either a square , triangle or rhombus , the sides of each individual unit being equal to one another and also equal to the sides of each other individual unit . the seatrest units may be combined and associated with each other and / or with one or more upper body supports to provide variable furniture configurations . the resulting modular article of furniture offers a variable and interchangeable body support structure having a floating appearance and wherein the seat support may comprise a soft - sided cushion arrangement .

with reference now to the drawings , and more particularly to fig1 , 7 and 8 , there is shown a base 2 which may be either square , triangular or rhombus in shape having sides all of equal length . base 2 is typically formed from wood or other suitable material and rests flush on the floor to provide a stable support for the completed modular article on furniture . upper body support guide 10 is disposed on the top of base 2 and permanently affixed thereto . guide 10 is comprised of guide members 12 radially extending outward towards the corners of the base 2 . guide members 12 form a plurality of v - shaped guides each facing respectively the outer edges of the base . on each base , whether square , triangular or rhombus in shape , the v - shaped guides are disposed a predetermined distance from each edge of each base , such distance being substantially equal to the height of triangular support member 40 , and the angle formed by the intersection of the guide members of each v - shaped guide is substantially equal to the angle formed by the sides 54 and 56 of triangular support member 40 . the v - shaped guides perform a two - fold function . first , the guides direct the triangular support member 40 of upper body support 44 ( shown in detail in fig2 ) into releasably secured engagement and secondly , the guides provide a means for retaining seat support 21 at a predetermined distance above the base . seat support 21 comprises a cushion support 33 and a bottom plate 22 , the bottom plate typically formed from wood or other suitable material in the same geometric shape as base 2 and disposed on the top of and in confronting spaced relationship to base 2 to define predetermined gap 46 . bottom plate 22 is permanently affixed and secured to guide 10 by screws 30 or other suitable means . predetermined gap 46 , between base 2 and bottom plate 22 , allows upper body support 44 , more particularly shown in fig2 to slidably move within gap 46 for releasable engagement with base 2 providing a stable upper body support that is not affixed to or in releasable contact engagement with cushion support 33 . this feature allows cushion support 33 to be constructed either of a soft - sided or hard material . in fig2 cushion 48 is disposed on top of cushion support 33 and formed in the same geometric configuration to provide a seat support . also shown in fig2 is upper body support 44 comprising rectangular upper body support frame 50 and triangular support member 40 associated therewith and in perpendicular relationship thereto . upper body support 44 is of a width equal to the side of base 2 . triangular support member 40 comprises sides 54 and 56 and base 58 , the angle formed between sides 54 and 56 being substantially equal to the angle formed by the intersection of guide members 12 . triangular support member 40 is so designed to easily move within the predetermined gap 46 and is guided therein by guide members 12 . this feature allows the upper body support to be easily positioned within predetermined gap 46 for releasably secured engagement with base 2 . it should be noted that the upper body support is adapted to be releasably secured to any side of base 2 . further , a number of upper body supports may be simultaneously releasably secured to base 2 to form a desired modular furniture configuration . associated with triangular support member 40 is releasably securing mechanism 60 that releasably secures triangular support member 40 to base 2 . fig2 generally shows rectangular upper body support frame 50 and triangular support member 40 as tubular in structure and substantially acting as a frame upon which fabric 70 may be upholstered thereto . however , rectangular upper body support frame 50 and triangular support member 40 may also be formed from a substantially solid unitary structure . in fig3 there is shown an embodiment for releasably securing triangular support member 40 within predetermined gap 46 to base 2 . support rod 120 , having end portions 122 and 124 , is rotatably disposed between base 58 and the intersection of sides 54 and 56 of triangular support member 40 . cams 126 and 128 are disposed along rod 120 and spaced intermediate base 58 and the intersection of sides 54 and 56 . rod 120 is supported at end portion 122 by transverse bore 126 through triangular support member 40 and further supported at end portion 124 by transverse bore 128 through base 58 . rod 120 is restrained from transverse movement by washer 130 disposed about rod 120 between restraining extensions 132 and the inside surface of sides 54 and 56 . rod 120 is further restrained from transverse movement by biased spring member 134 disposed about rod 120 and intermediate cam 128 and base 58 . cams 126 and 128 are identical in structure each having a generally rectangular planar first portion 136 disposed about rod 120 and affixed thereto in perpendicular relation , and further having a gripping end portion 138 for providing releasable contact engagement with retaining plate 141 . as evident from fig3 and 4 , contact surface 137 of gripping end portion 138 engage receiving slots 139 when rotated through an angle of 90 ° and are restrained from further rotational movement once engaged . end portion 124 is disposed flush with the outer surface of base 58 and having recess 43 adapted to receive wrench 91 for turning rod 120 . once triangular support member 40 is inserted within predetermined gap 46 , positioning upper body support frame 50 in substantially perpendicular confronting relationship with seat support 21 , wrench 91 is inserted into recess 43 and turned clockwise to rotate cams 126 and 128 into contact engagement with retaining plate 141 , more specifically shown in fig4 . in fig5 there is shown an alternative retaining means having retaining bracket 20 affixed to base 2 by screw 74 or similar fastening means , bracket 20 having slotted key opening 76 adapted to receive latch extensions 78 of securing member 80 . securing member 80 is integrally and rotatably associated with triangular support member 40 to provide releasably secured engagement with securing bracket 20 . securing member 80 comprises cylindrical rod 82 having end portions being retained and supported by triangular support member 40 . latch extensions 78 are disposed on end portion 88 of rod 82 and extending in outward perpendicular relationship thereto for insertion into slotted key opening 76 to provide releasably secured engagement of triangular support member 40 . affixed to end portion 90 is actuating turning lever 94 . turning lever 94 is affixed to rod 82 , such that the rotation of turning lever 94 through an angle of 90 ° also causes latch extension to rotate through a similar angle . latch extensions 78 are retained at a predetermined distance from triangular support member 40 , such distance being slightly greater than the depth of slotted key opening 76 . latch extension is retained at said predetermined spaced relation from triangular support member 40 by retaining apparatus 100 . retaining apparatus 100 comprises washer 102 disposed about rod 82 and in contact relation with sides 54 and 56 of triangular support member 40 and spring retainer 108 . retaining spring 104 is disposed about rod 82 intermediate spring retainer 108 and sleeve 106 . sleeve 106 is disposed along rod 82 and in confronting relationship with spring retainer 108 at one end and triangular support member 40 at the other . upper body support 44 may be releasably secured within the predetermined gap to any of the sides of base 2 . typically , triangular support member 40 is inserted into predetermined gap 46 along any side of base 2 and guided into secured engagement with securing bracket 20 by guide members 12 . once positioned in confronting relationship with securing bracket 20 , latch extensions 78 are inserted into slotted key opening 76 . lever 94 is then turned through an angle of 90 ° to rotate latch extensions 78 through a similar angle and thus provide releasably secured engagement of triangular support member 40 to retaining bracket 20 . to detach upper body support 44 , lever 94 is turned through 90 ° which in turn positions latch extensions 78 to be withdrawn from slotted key opening 76 . in fig9 - 13 , there are shown various combinations of the seatrest units and upper body supports . specifically , in fig9 rhombus seatrest unit 300 is abutted on one side by square seatrest unit 302 and on another side by rhombus seatrest unit 304 . triangular seatrest unit 306 is abutted to rhombus seatrest unit 304 . the geometric seatrest units combined as shown in fig9 provide a contiguous and easily changeable seating arrangement that may rest flush against a wall surface forming an obtuse angle . also shown are upper body supports 44 associated with the sides of the geometric - shaped units to form a contiguous , upper body support held in releasably secured engagement to base 2 and in confronting unsecured relation to cushion support 33 of the completed modular article of furniture . disposed on the completed modular article of furniture shown in fig9 are upper body support pillows 200 having substantially curved and tapered support surface 202 and substantially planar back surface 204 , the length of the planar back surface being substantially equal to the width of the upper body support 44 . the substantially curved and tapered support surface and the planar back surface allow the pillows to remain in stable contact relationship with one or more upper body supports , and further , be associated with one another to provide a contiguous back and side cushion support irrespective of any configuration and arrangement of the seatrest units . in fig1 is shown a square seatrest unit having three upper body supports associated on three sides of the square seatrest unit to form a chair structure . fig1 and 12 again show the geometric seatrest units alone or in combination with one another and also with one or more upper body supports 40 to provide yet another versatile modular seating arrangement . particularly in fig1 , rhombus seatrest unit 300 is combined with upper body support 40 to provide an alternative seat support unit that may rest flush against a wall surface forming an obtuse angle or acute angle . this modular article of furniture thus provides one geometric unit or article of furniture in which a user may rearrange the upper body supports to accommodate both an obtuse and acute wall configuration . the reverse curve arrangement in fig1 comprises two square seatrest units 302 and two traingular seatrest units 306 combined with one another and with a plurality of upper body supports as shown to provide a modular article of furniture having two continuous seatrest units each facing in the opposite direction and having a contiguous backrest . this modular article of furniture thus provides with a minimum number of geometrically - shaped units a modular article of furniture that may be employed as a room divider . as is apparent from fig9 - 12 , and more specifically fig1 where is shown a variety of possible modular configurations , the square , triangular and rhombus seatrest units allow a modular article of furniture to be constructed and rearranged to adapt to numerous spatial requirements and at the same time provide a contiguous seat and upper body structure with a minimum number of different geometrically - shaped units irrespective of the desired configuration . while a specific embodiment has been shown and described , it should be understood that many modifications may be made therein . accordingly , the appended claims should be construed to cover all equivalents falling within the true scope of the invention .

US-67896176-A

the headache mitigating apparatus includes at least a transverse strap configured to wrap around a user &# 39 ; s head in the manner of a hat band and at least one strap configured to extend under the user &# 39 ; s occipital bone and rest along the user &# 39 ; s upper neck as well as extending over the head strap at a forward end thereof . the apparatus can include bladders in the transverse and occipital straps , respectively . the bladders can be filled simultaneously or separately with a pneumatic hand pump such as those found on sphygmomanometers or may include an inflation apparatus which is operable via a push button , in a manner similar to that in which self - inflating items inflate . at least one strap may also accommodate a gel pack for heating or cooling . one or both straps may include buckles or hook and loop closures configured to be adjusted to secure the apparatus to the user &# 39 ; s head .

the following detailed description is merely exemplary in nature and is not intended to limit the described embodiments or the application and uses of the described embodiments . as used herein , the word “ exemplary ” or “ illustrative ” means “ serving as an example , instance , or illustration .” any implementation described herein as “ exemplary ” or “ illustrative ” is not necessarily to be construed as preferred or advantageous over other implementations . all of the implementations described below are exemplary implementations provided to enable persons skilled in the art to make or use the embodiments of the disclosure and are not intended to limit the scope of the disclosure , which is defined by the claims . for purposes of description herein , the terms “ upper ”, “ lower ”, “ left ”, “ rear ”, “ right ”, “ front ”, “ vertical ”, “ horizontal ”, and derivatives thereof shall relate to the invention as oriented in fig1 . furthermore , there is no intention to be bound by any expressed or implied theory presented in the preceding technical field , background , brief summary or the following detailed description . it is also to be understood that the specific devices and processes illustrated in the attached drawings , and described in the following specification , are simply exemplary embodiments of the inventive concepts defined in the appended claims . hence , specific dimensions and other physical characteristics relating to the embodiments disclosed herein are not to be considered as limiting , unless the claims expressly state otherwise . a first embodiment of the present invention will be described next with reference to fig1 of the drawings . this embodiment comprises a headache mitigating apparatus ( 10 ) consisting of a head strap ( 12 ) that completely circles the circumferences of the user head ( 36 ). a suboccipital strap ( 14 ) is used in connection with the head strap ( 12 ), not limited to , but in union with the suboccipital middle connector member ( 48 ). the suboccipital middle connector member ( 48 ) helps provide stability of the device by connecting itself to the head strap ( 12 ). its purpose is not limited to but includes supporting the head mitigating apparatus ( 10 ) to the head ( 36 of fig3 ). gaps ( 56 ) are located just below the front upper strap ( 16 ) and on opposite sides of the suboccipital middle connector member ( 48 ). its purpose is to lighten the headache mitigating apparatus and to provide air circulation to certain areas of the head ( 36 ). in addition , a front head strap bladder ( 38 ) is used to apply pressure to the back side of the head alleviating certain types of headaches suboccipital bladder ( 42 ) is used to apply pressure to the suboccipital muscles which are the main cause of many headaches . another bladder ( 40 ) shown in fig3 is used to provide pressure to the forehead . an inflation bulb ( 24 ) generates air pressure to the bladders by a squeezing action that introduces air through a tube ( 28 ) directed to the individual bladders simultaneously and uniformly in nature . bladders ( 38 , 40 , 42 ) are all connected through internal tubing ( not shown ) that may take different passages inside the head mitigating apparatus ( 10 ). strap buckles ( 20 ) are located uniformly to the sides of the suboccipital strap ( 14 ) and are used to adjust the head mitigating apparatus ( 10 ) to the individual user &# 39 ; s head ( 36 of fig3 ). in fig2 , a front perspective view of the apparatus of fig1 is illustrated . this embodiment comprises a headache mitigating apparatus ( 10 ). consisting of a head strap ( 12 ) that completely circles the circumference of the user head ( 36 ). a suboccipital strap ( 14 ) is used in connection with the head strap ( 12 ), not limited to , but in union with the suboccipital middle connector member ( 48 ). in this view , bladders ( 38 , 40 , 42 ) are not depicted to better demonstrate the suboccipital pocket ( 50 ) which may be used to insert a cooling gel pad or warming pad ( not shown ). the cooling / warming pad may be inserted through slit ( 54 ) or an suboccipital insertion / removal bladder may be used . in alternative embodiments , the pocket ( 50 ) may also house different types of inserts including but not limited to protrusions , aroma therapy inserts and magnets . in other alternative embodiments , there may be one or more slits placed in various positions on the headband such as but not limited to anywhere on the suboccipital strap ( 14 ) or head strap ( 12 ). with respect to fig3 , a side perspective view of the preferred embodiment is illustrated showing the head strap ( 12 ) securely attached around the circumference of the head ( 36 ). the headache mitigating apparatus ( 10 ) snuggly fits around the front forehead ( 18 ) and suboccipital ( 14 ) strap by means of strap buckles ( 20 ) adjustment of the straps ( 12 , 14 , 16 ) are used to comfortably secure the head mitigating apparatus ( 10 ) to different head ( 36 ) sizes . bladders ( 38 , 40 , 42 ) are all inter connected with tubing ( not shown ) that permits even air pressure throughout . inflation bulb ( 24 ) provides a means of manually applying air pressure through tube ( 28 ) to the suboccipital bladder ( 42 ), head rear bladder ( 38 ), and forehead head strap bladder ( 40 ). gap areas ( 56 ) permit air circulation to those parts of the head and make the head mitigating apparatus light . the suboccipital middle connector member ( 48 ) helps provide stability of the device by connecting the suboccipital strap ( 14 ) to the head strap ( 12 ). pressure is applied to the forehead area ( 18 ) by forehead bladder ( 40 ). the suboccipital strap ( 14 ) is typically positioned just above the upper neck area ( 22 ), below the suboccipital bone ( not shown ). its main purpose it to provide pressure to the suboccipital muscles . when the user wishes to reduce pressure from the bladders ( 38 , 40 , 42 ) the pressure release valve ( 26 ) is used . it should be noted that the invention is not limited to but may use a bladder type cuff device for pressurizing the bladders ( 38 , 40 , 42 ). a lower occipital strap end ( 30 ) is used to pull the suboccipital strap ( 14 ) comfortably to the upper neck area ( 22 ). an upper head strap end ( 32 ) is used to fasten the head strap ( 12 ) comfortably around the user , and also used to loosen the head mitigating apparatus . with respect to fig4 , a back - head perspective view of the preferred embodiment is illustrated clearly showing how the head strap bladder ( 38 ) and suboccipital bladder ( 42 ) apply pressure to the back side of the head . suboccipital middle connector member ( 48 ), clearly connects the head strap ( 12 ) section to the suboccipital strap ( 14 ). gaps ( 56 ) are clearly shown providing ventilation to the rest of the head ( 36 ). straps ( 20 ) can be easily adjusted by the user for each side . the upper neck area is located just below the suboccipital strap ( 14 ) where the sub occipital muscles are located . the inflation bulb ( 24 ), pressure release valve ( 26 ) and tube ( 28 ) can be moved to the side after use freeing up the user to move around . in some embodiments , the inflation bulb ( 24 ) may be detached from headache mitigating apparatus ( 10 ). with respect to fig5 , a slightly different embodiment is used whereby the suboccipital middle connector member ( 48 ) is not incorporated , and an integral hand pump ( 34 ) is used at the front upper strap ( 16 ). when hand pump ( 34 ) is actuated , air is pushed through tube ( 28 ) to the internal bladders ( not shown ) of the headache mitigating apparatus ( 10 ). straps ( 20 ) are used to adjust the suboccipital strap ( 14 ) to a comfortable fit for the user . upper head strap ends ( 32 ) are used to fasten and adjust the head strap ( 12 ). since no suboccipital middle connector member ( 48 ) is used a wider gap area ( 56 ) is created . this helps provide more ventilation and cooling for the user . this type of design helps provide a slightly different pressure to the suboccipital muscles . when it is desired to unpressurize the hidden bladders ( not shown ), air release button ( 46 ) is held so air may be released . in addition , in this alternative embodiment a suboccipital pocket ( 50 ) may be used to insert a cooling gel pad or warming pad ( not shown ). the cooling / warming pad may be inserted through slit ( 54 ) or an suboccipital insertion / removal bladder may be used . with respect to fig6 a side perspective view of the alternative head mitigating apparatus ( 10 ) is illustrated clearly showing how the upper head strap end ( 32 ) is used to fasten and adjust head strap ( 12 ). air pressure can be inserted into the bladders by hand pump ( 34 ) connected to a tube ( 28 ) going to different bladders ( not shown ). lower suboccipital strap end ( 30 ) is also used to adjust the fit of the occipital strap to the back - neck area . suboccipital pocket ( 50 ) can hold a heating / cooling gel to stimulate the occipital muscles when pressure is applied to the bladders ( not shown ). the gel is inserted through the suboccipital slit ( 54 ). this design does not use a ( suboccipital middle connector member ( 48 ). with respect to fig7 , a rear perspective view of the alternative head mitigating apparatus ( 10 ) is illustrated incorporating all the same features as that of fig6 . with respect to fig8 , a front perspective view of an alternative embodiment of the head mitigating apparatus ( 10 ) incorporating the suboccipital middle connector member ( 48 ) and using a hand pump ( 34 ) for inflation is illustrated . gaps ( 56 ) are used to provide air circulation to the user . suboccipital middle connector member ( 48 ) is used to provide a path to the head strap ( 12 ), strap buckles ( 20 ) are used to securely fasten the suboccipital strap ( 14 ) to the upper neck area ( 22 ). two upper head strap ends ( 32 ) are used to pull , fasten and adjust head strap ( 12 ) to the user . fig5 , 7 are similar in nature to fig8 , 10 with the exception of the suboccipital middle connector member . with respect to fig1 a front view of an alternative embodiment of the head mitigating apparatus with an inflatable air valve ( 44 ) is illustrated . in this embodiment , the user can inflate the internal bladders ( not shown ) by inserting an air pin into air valve ( 44 ). the same air valve ( 44 ) is used to deflate pressure to the internal bladders . again , in this embodiment the forehead bladder ( 40 ), head strap bladder ( 38 ) and suboccipital bladder ( 42 ) are not shown but are all connected internally by a tube ( 28 ) configuration applying equal pressure throughout . with respect to fig1 a side perspective view of an alternative embodiment of the head mitigating apparatus ( 10 ) with an inflatable air valve is depicted . inflatable air valve ( 44 ) is located at the forehead area ( 18 ) of the user . head strap area ( 12 ) has internal bladders located in the front and rear used to apply pressure to the head and to the sub occipital bladder ( 42 ) not shown in this illustration . the suboccipital strap ( 14 ) and head strap ( 12 ) use strap buckles ( 20 ) for making adjustments to the head and neck area . a suboccipital pocket ( 50 ) is also used whereby a cooling gel or heating pad can be inserted through the suboccipital slit ( 54 ) and rest in pocket ( 50 ). it should be noted that the headache mitigating apparatus may be configured but not limited to industry standard materials often used for head use . the bladders may be filled in synchronicity or independently from each other with air for pressurization , which may be either identical or different , in the manner in which a blood pressure cuff is inflated . each user can distribute pressure discriminatingly to determine what works best for their particular type of headache . also , the strap that wraps around the upper neck region 15 may hold accessory insertable / removable bladder ( s ) ( 52 ) of material such as gel that can be heated or cooled which is inserted into a central area of the occipital strap ( 14 ) via a slit ( 54 ) leading into a small pocket ( 50 ) provided therein , which are only described here once , for brevity it should be noted that the invention is not limited strap buckles ( 20 ) such as those illustrated , but may use other suitable connectors , not limited to but including hook and loop structures , ratcheting mechanisms , etc . loosening contraction of the muscles in the upper neck area ( 22 ) ultimately decreases tension on structures attached thereto , as known in the art , which causes headache pain . it should be noted that the pump device ( 34 ) is similar in nature as other industry standard devices that allow air to be drawn and or released when the bladders are inflated , the pump may apply a constant or pulsed pressure to help loosen tightly contracted muscles in the upper neck area ( 22 ). loosening contraction of the muscles in the upper neck area ( 22 ) ultimately decreases tension on structures attached thereto , as known in the art , which cause the headache pain . it should be noted that the pump device is similar in nature as other industry standard devices that allow air to be drawn and or released . the interior bladders ( 18 , 38 , 42 ) may be , but is not limited to , being filled simultaneously or separately , to apply specific pressure to a desired area . the bladders are expanded manually or mechanically by means of a pump . the headache mitigating apparatus ( 10 ) according to the present disclosure alleviates numerous types of headaches using inflatable bladders to relieve upper neck area ( known as suboccipital ) muscle tension . the apparatus ( 10 ) in its various embodiments comprises a head strap ( 12 ) that wraps around the head in the manner of a hatband and at least one other strap , a suboccipital strap ( 14 ) that passes under the occipital bone ( not shown ) resting along the upper neck area ( 22 ) as well as extending over and above a forward area ( 18 ) of the head strap ( 12 ), creating a narrow x shape to the headache mitigating apparatus ( 10 ) when viewed from the side . both straps ( 12 , 16 ) are primarily configured with bladders ( 38 , 40 , 42 ). both straps 12 , 14 are adjustable to fit the user &# 39 ; s head and may be attached and held in position by suitable buckles 22 such as those illustrated , or with other suitable connectors , not limited to but including hook and loop structures , ratcheting mechanisms , etc . a headache mitigating apparatus comprising at least a first adjustable strap which snugly engages about the head of a wearer about a front to back circumference of the head and at least a second adjustable strap extending downwardly and rearwardly from opposite positions along the first adjustable strap into a position where it abuts an area at the juncture of the head and an area the neck known as the suboccipital area , with at least the second adjustable strap being releasably inflatable to apply pressure against the suboccipital area . a headache mitigating apparatus of claim 1 wherein the first adjustable strap is also releasably inflatable . the headache mitigating apparatus of claim 1 wherein the second adjustable strap further incorporates a forwardly and upwardly adjustable extension which extends across a forehead portion of the head of the wearer . the headache mitigating apparatus of claim 3 wherein the forwardly and upwardly adjustable extension which extends across a forehead portion of the head of the wearer is also releasably inflatable . a headache mitigating apparatus wherein the accessory further wide adjustable strap positioned across a crown of the head of the wearer is also releasably inflatable . a headache mitigating apparatus wherein the straps include bladders therein which may be inflated or deflated via use of a hand pump . a headache mitigating apparatus wherein the straps include bladders therein which may be inflated or deflated via use of a mechanical pump carried by the apparatus . a headache mitigating apparatus wherein the straps further include cavities therein into which replaceable hot or cold inserts may be inserted to apply heat or cold as desired . a headache mitigating apparatus wherein the straps further include hot or cold inserts which are permanently affixed to the straps . a headache mitigating apparatus further including a pressure control valve to limit inflation of the bladders . a head mitigating apparatus wherein the area of each bladder ( s ) and the force of air delivered by the pump into said bladder ( s ) may create a p h of at least 0 . 01 lb f / in 2 in each bladder whereas p h = f a / a b . a head mitigating apparatus , wherein the summative p h from the bladder ( s ) creates a f h greater than 0 . 1 kg · m / s 2 to the user &# 39 ; s head / neck whereas p h = pressure in bladders , f h = force applied to the head , f a = force applied by pump to an individual bladder , a b = the area of an individual bladder and p h = f a / a b . the headache mitigating apparatus of claim 9 wherein the cavities may alternatively house protrusion inserts that apply localized pressure . the headache mitigating apparatus of claim 9 wherein the cavities may alternatively house magnets . the headache mitigating apparatus of claim 9 wherein the cavities may alternatively house aromatherapy inserts . at least a first adjustable strap which snugly engages about the head of a wearer about a front to back circumference of the head and at least a second adjustable strap extending downwardly and rearwardly from opposite positions along the first adjustable strap into a position where it abuts an area at the juncture of the head and an area the neck known as the suboccipital area , with at least the second adjustable strap being releasably inflatable to apply pressure against the suboccipital area , wherein the first adjustable strap is also releasably inflatable . a headache mitigating apparatus comprising : at least a first adjustable strap which snugly engages about the head of a wearer about a front to back circumference of the head and at least a second adjustable strap extending downwardly and rearwardly from opposite positions along the first adjustable strap into a position where it abuts an area at the juncture of the head and an area the neck known as the suboccipital area , with at least the second adjustable strap being releasably inflatable to apply pressure against the suboccipital area . wherein the first adjustable strap is also releasably inflatable , wherein the straps further include cavities therein into which replaceable hot or cold inserts may be inserted to apply heat or cold as desired . it should be noted that various modifications to the implementations described in this disclosure may be readily apparent to those skilled in the art , and the generic principles defined herein may be applied to other implementations without departing from the spirit or scope of this disclosure . thus , the disclosure is not intended to be limited to the implementations shown herein , but is to be accorded the widest scope consistent with the principles and features disclosed herein .

US-201715411815-A

a stabilizing roller for a line trimmer device that includes a housing with a cylindrical bore for receiving and mating with a ball roller . the lower end of the housing is open to allow the ball to contact the ground while in operation . the ball is maintained in the housing on the lower end using either an integral lip or a removable retaining plate . the upper end of the housing is closed with a cap designed to mate with the ball during operation . thus , the ball is free to roll . the housing is connected to a line trimmer device by either a bolt attached to the head of the line trimmer device or a frame and attachment means connected to the extension arm of the line trimmer device .

fig1 illustrates a conventional line trimmer 34 . a cutting head 50 is connected upon a distal end of a handle shaft 30 . handle grips 70 employed by a user to operate and control the trimmer 34 are positioned along the length of the shaft 30 . at an upper end of the shaft 30 opposite the cutting head 50 , a rotating motor 75 provides the rotation for the cutting head 50 . alternate embodiments of this invention are shown in fig2 and 4 . in fig1 a stabilizer assembly 10 is shown attached to a stabilized line trimmer 34 by mounting arm 26 . the stabilizer assembly 10 comprises a ball housing 11 that serves as a partial enclosure of a rotatable ball 19 . in the preferred embodiment , the housing 11 includes a cylindrical bore 12 . it should be understood , however , that the bore 12 may have any cross - sectional shape without departing from the scope of this invention . at a top end 13 of the housing 11 is a top housing cover 16 . the top housing cover may be either permanently attached , as in fig2 or removably attached , as in fig3 . at a bottom end 14 of the housing 11 is a retaining means in the form of a retaining plate 33 , as shown in fig2 . a round ball retaining orifice is located substantially at a center of the retaining plate 33 giving the plate 33 a ring shape . an interior edge of the orifice creates a retaining seat 31 upon which the ball 19 rests in the relaxed condition of fig2 . it is contemplated that the retaining plate 33 may be connected to the bore 12 in a variety of ways or may be constructed integrally therewith . three connections are illustrated in the drawings . in fig2 a circular receiving groove 32 is recessed into an interior surface 15 of the bore 12 . the retaining plate 33 is installed into the groove 32 and retained therein . in fig3 the plate 33 is bolted to a bottom edge of the housing 11 with small bolts 35 . finally , in fig4 and 5 , the retaining plate 33 is integrally connected to the housing 11 . fig4 illustrates one possible alternative housing 11 design in which the housing 11 is made up of an upper housing 38 and a lower housing 39 . the lower housing 39 has an inner diameter slightly greater than the upper housing 38 outer diameter so that the upper housing 38 can be removably disposed in the lower housing 39 . the upper housing 38 contains coaxial , radial pin receiving holes 42 positioned substantially near the bottom of the upper housing 38 . the lower housing 39 contains receiving slots 44 positioned and designed to receive and mate with pins 40 securably maintained in the upper housing pin receiving holes 42 . however , the pins 40 may also be integral with the housing 11 . the receiving slots 44 and pins 42 are designed to hold the upper housing 38 and lower housing 39 together during operation of the stabilizer 10 . during operation of the stabilized trimmer 34 , the bore 12 is substantially vertically oriented , with a longitudinal centerline of the bore 12 providing a vertical axis for the housing 11 . the interior surface 15 of the bore 12 and the lower surface 18 of the cover 16 define an axial cavity within which the substantially spherical ball 19 is retained . the axial cavity is preferably constructed to conform to the shape of the ball 19 when installed therein and accommodate free rotation of the ball 19 within the housing 11 . to that end , in the preferred embodiment , the lower surface 18 of the top housing cover 16 has a substantially concave spherical design with a radius similar to , but slightly greater than a radius of the ball 19 . in a like manner , a minimum interior diameter of the bore 12 is just greater than the diameter of the ball 19 . this configuration provides a clearance between the ball 19 and the interior 15 when said ball 19 is in the relaxed position and resting upon the retaining seat 31 as shown in fig2 . as shown therein , said retaining seat 31 has an interior diameter less than the diameter of the ball 19 . by this configuration , the stabilizer assembly 10 provides for free rotation of the ball 19 , even when said ball 19 is in contact with the interior surface of the housing 11 . in order for the stabilizer assembly 10 to operate properly , the ball 19 must stay in contact with the surface of the ground . therefore , the ball 19 may not recede completely into the axial cavity . to the contrary , the ball 19 must protrude below the retaining plate 33 . this is assured by selecting a ball 19 having a size in which the diameter of the ball 19 is greater than the length or depth of the axial cavity measured along the vertical axis of the housing 11 . for the stabilizer assembly 10 to function as intended , said stabilizer 10 must be properly positioned and oriented relative to the cutting head 50 of the trimmer 34 . in an operative configuration , proper orientation requires that the stabilizer assembly 10 be substantially vertical so that the ball 19 rests upon the ground &# 39 ; s surface when the cutting head 50 is at an appropriate cutting height . three securing means for achieving the operational configuration are illustrated . fig3 and 4 show the stabilizer assembly 10 attached directly to the cutting head 50 using a cooperating cam means . in fig3 attachment is accomplished by bolting the stabilizer assembly 10 to a bottom cap 25 of the cutting head 50 . above the cap 25 is a monofilament compartment 55 in which a supply of monofilament line 52 is contained for radial deployment during rotatable operation of the head 50 . an interior of the line compartment 55 contains a monofilament spool upon which monofilament line is wound . extending from the compartment 55 is cutting line 60 which provides the desired cutting and removal of vegetation and debris . the compartment 55 is conventionally rotated by a rotating means taking the form of either an electric or gasoline motor 75 . a flying debris shield 67 will typically be provided to protect the user during operation . in the embodiments shown in fig3 and 4 , the top housing cover 16 has a bore 20 therethrough with an enlarged recess 36 at a lower end of said bore 20 . the recess 36 may have any cross - sectional shape including circular , elliptical , and rectangular , among others . a noncircular recess 36 has an advantage if the attachment means is designed to mate with the recess in order to prevent relative rotation of the attachment means and the stabilizer assembly 10 . reducing the relative rotation of the parts , reduces the part wear . the attachment means of fig3 is a threaded male connector , or bolt 21 , designed to mate with a threaded bore 24 in the bottom cap 25 of the line trimmer head 50 . threaded bore 24 extends into the center of the spool of the compartment 55 through the bottom cap 25 . to accomplish attachment of the stabilizer assembly 10 to the cutting head 50 , an upper surface 17 of the housing cover 16 is placed adjacent to a lower surface of the bottom cap 25 of the line compartment 55 . each of the adjacent surfaces are constructed for face - to - face abutment . when properly positioned , the bore 20 through the top housing cover 16 of the stabilizer 10 is co - axially aligned with the threaded bore 24 of the line compartment 55 . connection is established by inserting a threaded bolt 21 up through the bore 20 and threadably securing a threaded bolt body 23 of the bolt 21 in the threaded bore 24 . in fig3 a head 22 of the bolt 21 , or threaded male connector , is contained within the recess 36 and mates with a land surface 37 such that it is completely retained out of the interior cavity of the stabilizer assembly 10 . with the bolted connection tightened , the stabilizer assembly 10 rotates together with the line compartment 55 during operation . as a result of the constant rotation of the stabilizer assembly 10 during use in this configuration , a floating action of the ball 19 within the housing 11 is assisted . the attachment means of fig4 is a threaded female connector 45 designed to mate with a line trimmer cutting head bolt 48 . a cutting head bolt 48 extends from the center of the bottom cap 25 . to attach the stabilizer assembly 10 to the cutting head 50 , the upper surface 17 of the housing cover 16 is pressed against the bottom cap 25 of the line compartment 55 . with the stabilizer assembly 10 in the proper position , the cutting head bolt 48 passes through and is substantially coaxial with the top housing cover bore 20 . the threaded female connector 45 having a threaded bore 46 threadably engages the cutting head bolt 48 and secures the stabilizer assembly 10 to the cutting head 50 . a connector head 47 of the female connector 45 is completely contained within the recess 36 and mates with the land surface 37 . in an alternative embodiment shown in fig1 and 2 , the stabilizer assembly 10 is attached to the line trimmer 34 using a mounting arm 26 . the stabilizer assembly 10 is connected to the arm 26 at a stabilizer end 27 . the arm 26 is connected to the handle shaft 30 at a shaft end 28 which is distally located to the stabilizer end 27 . the connections at both ends 27 and 28 of the arm 26 may be accomplished by any suitable connecting means . it is specifically contemplated that such connecting means may include , inter alia , clamps , brackets , screws , bolts , welds , adhesives , and integral construction . proper orientation of the stabilizer assembly in this configuration depends upon the shape and length of both the shaft 30 and arm 26 , the connection points of the cutting head 50 and the arm 26 to the shaft 30 , and the desired cutting height . proper orientation is easily achieved through design in which these variables are considered . it will become obvious to one of ordinary skill in the art to substitute other materials and parts for those disclosed herein . thus , various modifications are possible without departing from the scope of the invention . for example , features of one embodiment may be employed in other embodiments of the invention

US-9753793-A

in a method of strengthening pathological muscles , the patient is subjected to a therapeutic strengthening exercise for strengthening a target muscle . the method begins at the start of the strengthening exercise in response to exacerbation of symptoms exhibited by patient . the symptoms exhibited by the patient during the strengthening exercise are minimized by a series of steps including adjusting an intensity of the strengthening exercise , limiting a range of motion of the strengthening exercise , dividing evenly a prescribed number of sets and repetitions corresponding to the strengthening exercise , dividing unevenly the prescribed number of sets and repetitions corresponding to the strengthening exercise , varying a speed at which the patient is subjected to the strengthening exercise , modifying a position of the patient for the strengthening exercise , matching a mode of the strengthening exercise to the modified patient &# 39 ; s position , and switching between primary , secondary and tertiary actions of the patient &# 39 ; s target muscle .

embodiments of the bam method of the invention are described below with reference to fig1 - 4 . procedure method — begins at the start of the strengthening exercise in response to an exacerbation of signs and symptoms ( fig1 ). 1 . adjust the intensity or weight so the first set is at 60 %- 70 % of a perceived rating of exertion ( pre ) without any symptoms exacerbating ( step 1 ). complete exercise ( go to fig4 and continue ) or , if symptoms do not resolve , continue to next step . 2 . limit the range of motion of the exercise to the symptom free range of motion ( step 2 ). the symptom free range of motion must be 60 %- 70 % of the exercise &# 39 ; s full range . complete exercise ( go to fig4 and continue ) or , if symptoms do not resolve , continue to next step . sometimes the painful range of motion is in the middle of the entire range of motion . in this situation , use the range of motion before and after the arc of the painful range of motion . 3 . divide the sets and repetitions evenly ( i . e . 6 × 5 , 2 × 15 ) ( step 3 ) ( fig2 ). complete exercise ( go to fig4 and continue ) or , if symptoms do not resolve , continue to next step . 4 . divide the prescribed number of sets and repetitions unevenly ( step 4 ). any combination . ( i . e . [ 1 × 10 ]+[ 2 × 5 ]+[ 1 × 4 ]+[ 1 × 2 ]+[ 2 × 1 ]). complete exercise ( go to fig4 and continue ) or , if symptoms do not resolve , continue to next step . 5 . vary the speed at which the prescribed therapeutic exercise is performed either decrease or increased ( step 5 ). complete exercise ( go to fig4 and continue ) or if symptoms do not resolve continue to next step . 6 . modify position for exercise to be performed ( step 6 ) ( fig3 ). supported vs unsupported . gravity eliminated vs gravity assist . complete exercise ( go to fig4 and continue ) or , if symptoms do not resolve , continue to next step . 7 . change the exercise mode to compliment position ( step 7 ). complete exercise ( go to fig4 and continue ) or if symptoms do not resolve continue to next step . 8 . switch to the target muscle &# 39 ; s secondary or tertiary action or the target action &# 39 ; s secondary or tertiary movers ( step 8 ). if symptomatic , return to step 1 , otherwise continue to next step ( go to fig4 and continue ). referring to fig4 , upon successful completion of any step , go to stage i and continue with exercise until completion at stage ii . however , if symptoms arise after the successful modification during the exercise , go to stage iii , increase rest periods and or decrease speed at which the exercise is performed . continue until the exercise is completed at stage ii or stop exercise as not to overwork the bam muscle ( stage iiia ). if symptoms do not resolve exercise prescription is complete for session . any further exercise will be intolerable for patient . record successful sets and repetitions ( stage iiib ). stages i , ii , iii , iiia and iiib shown in fig4 are further described below : stage i : symptoms after successful completion . upon successful completion of any step , stage iii : however , if symptoms arise during the exercise increase rest periods and or decrease speed at which the exercise is performed . stage iiia : stop exercise as not to overwork the bam muscle . if symptoms do not resolve exercise prescription is complete for session . any further exercise will be intolerable for patient . examples of the bam method are presented below using patient a and patient b . in the examples , patient a will achieve success at step 4 while patient b will achieve success at step 7 . in addition , patient b will be given an alternate scenario in which step 7 is unsuccessful . patient b will then proceed to step 8 . in the following procedural example , patient a is receiving a prescription of therapeutic exercise from a physical therapist for his shoulder . the prescribed exercise is standing shoulder flexion with a dumbbell 0 - 90 degrees range of motion . in this example patient a will move through steps 1 - 4 , where patient a will achieve success at step 4 . 1 . in step 1 , the therapist adjusts the prescription by increasing or decreasing the intensity or weight using a perceived rating of exertion scale where 100 % is maximum effort and 0 % is no effort at rest . the target progressive resistive exercise without exacerbation of signs or symptoms should be 60 %- 70 % perceived rating of exertion . patient a is using a 1 pound dumbbell at a 60 %- 70 % perceived rating of exertion , however , the exercise is painful in the upper half of the range of motion . 2 . for step 2 , patient a achieves symptom free shoulder flexion in a fraction of the 0 - 90 degree range of motion . the exercised range of motion is equal to 54 degrees ( 60 %- 70 % of the exercises full range ), which is rounded to 55 degrees . patient a proceeds to next step . 3 . in step 3 , patient a performs shoulder flexion without symptoms , yet the symptoms exacerbate after 5 repetitions . the prescribed number of sets and repetitions ( 6 × 5 ), which can be performed without the exacerbation of any symptoms . however , patient a can only complete 4 sets of 5 repetitions without pain . patient a proceeds to next step . 4 . in step 4 , patient a is prescribed 4 sets of 5 repetitions , 2 sets of 3 repetitions and 2 sets of 2 repetitions ( any multiples to reach the target work volume of 30 repetitions ). during the unevenly distributed sets and repetitions , patient a requires increased rest periods to complete the exercise without exacerbation of symptoms . patient a is successful . upon successful completion of any step , go to stage i and continue with exercise until completion at stage ii . however , if symptoms arise after the successful modification during the exercise , go to stage iii , increase rest periods and or decrease speed at which the exercise is performed . continue until the exercise is completed at stage ii or stop exercise as not to overwork the bam muscle ( stage iiia ). if symptoms do not resolve exercise prescription is complete for session . any further exercise will be intolerable for patient . record successful sets and repetitions ( stage iiib ). in the next procedural example , patient b is receiving a prescription of therapeutic exercise from a physical therapist for her hip . the target progressive resistive exercise without exacerbation of signs or symptoms should be 60 %- 70 % perceived rating of exertion . patient b , is using a plate loaded isokinetic pulley machine set to 20 pounds to perform standing hip extension at 0 - 15 degrees range of motion at a 60 %- 70 % perceived rating of exertion . the exercise is painful throughout the whole range of motion . in the example , patient b will proceed through steps 1 - 7 . patient b will achieve success by step 7 . in addition , an alternate scenario at step 7 will be given where patient b must proceed to step 8 to achieve success . 1 . in step 1 , adjust by increasing or decreasing the intensity or weight using a perceived rating of exertion scale where 100 % is maximum effort and 0 % is no effort at rest . the target progressive resistive exercise without exacerbation of signs or symptoms should be 60 %- 70 %. patient b , is using 20 pounds at 60 %- 70 % perceived rating of exertion , but the exercise is painful in the whole range of motion of 0 - 15 . the physical therapist adjusts the exercise prescription by decreasing the weight to 10 pounds , without success . patient b proceeds to next step . 2 . for step 2 , patient b is unable to achieve symptom free resistive hip extension despite any modifications of range of motion . patient b proceeds to next step . 3 . for step 3 , patient b is unable to achieve symptom free resistive hip extension despite any modifications of dividing the prescribed number of sets and repetitions evenly . symptoms are still present . patient b proceeds to next step . 4 . for step 4 , patient b is unable to achieve symptom free resistive hip extension despite any modifications of dividing the prescribed number of sets and repetitions unevenly . step 4 is not successful . symptoms are still present . patient b proceeds to next step . 5 . for step 5 , patient b is unable to achieve symptom free resistive hip extension despite any modifications of changing the speed from 90 degrees per second to 60 degrees per second . other multiple variations of speed are also unsuccessful . symptoms are still present . patient b proceeds to next step . 6 . in step 6 , the physical therapist adjusts the exercise prescription to perform the exercise supine . 7 . in step 7 , the physical therapist then matches the appropriate exercise mode for the position adjustment . exercise tubing is attached to the patient &# 39 ; s ankle . the patient performs hip extension by pulling on the band with his leg starting at 50 degrees of flexion range of motion to 0 degrees range of motion ( neutral ). the patient is successful . in an alternate scenario , patient b is unsuccessful at step 7 . patient b proceeds to step 8 . 8 . in step 8 , if hip extension elicits pain from the primary action of the gluteus maximus , then switch to external rotation the secondary action of the gluteus maximus . patient b proceeds back to step 1 . upon successful completion of any step , go to stage i and continue with exercise until completion at stage ii . however , if symptoms arise after the successful modification during the exercise , go to stage iii , increase rest periods and or decrease speed at which the exercise is performed . continue until the exercise is completed at stage ii or stop exercise as not to overwork the bam muscle ( stage iiia ). if symptoms do not resolve exercise prescription is complete for session . any further exercise will be intolerable for patient . record successful sets and repetitions ( stage iiib ). maximizes strengthening benefits : the bam method maximizes strengthening benefits by allowing an increased tolerance for therapeutic exercise . improves patient compliance : a treatment &# 39 ; s effectiveness is directly related to tolerance and compliance of the treatment . by minimizing the symptoms , especially pain , it attenuates the inhibitory effects of pain . improves rates of success : if a patient is able to tolerate and is compliant with the treatment , the treatment &# 39 ; s rate of success will increase .

US-201514726486-A

a product for therapeutic , non - slip animal boots . the product includes boots of various materials molded into grids and shaped to cover an animal &# 39 ; s paws , and a means of securing the boots to the animal &# 39 ; s paws .

the present invention , which is described more fully hereinafter , provides a therapeutic pet boot for therapeutically increasing traction , providing shock absorption , increasing sensitivity , increasing breathability , increasing ability to visually inspect the animal &# 39 ; s foot while the boot is on , and improving ease of placing the boot on the animal . this invention may be embodied in many different forms and should not be construed as limited to the specific embodiments described herein . referring to fig1 , 2 , 3 , and 4 , the preferred embodiment of the boot has a top section and a bottom section attached to each other on three sides at the edge of the top and bottom sections . each section is made of lsr strands approximately ⅛ inch in diameter . the sections are manufactured via injection molding thereby creating all the two portions and strap simultaneously and without seams . the top and bottom sections of the boot are fused at the semi - circular end of the sections , and on the sides . the semi - circular end is the toe end of the boot . in the preferred embodiment the top section of the boot is approximately one inch longer at the rear end than the bottom section . the top and bottom sections of the boot are not attached to each other at the rear end of the boot , thereby creating an opening for the animal &# 39 ; s paw . the toes of the animal are slipped into this opening and the boot is slid up the animal &# 39 ; s foot until the animal &# 39 ; s toes reach the toe - end of the boot . in the preferred embodiment the lsr strands are laid out in a grid , thereby creating cells between the lsr strands . each cell is approximately ⅝ inches square for the extra large size boot . the cells are open to allow air flow through the lsr strands . in the preferred embodiment the bottom section of the boot is approximately one inch shorter than the top section of the boot , at the rear end of the boot . a strap is attached to the bottom section of the boot extending approximately ten inches at a right angle from one side of the boot at the rear of the boot . the strap is attached along the length of the rear end of the bottom section of the boot and extends outward perpendicularly , giving an overall strap length of about ten inches . the strap includes a section of hook and loop fastener attached along the length of the loose end of the strap . another section of hook and loop fastener is attached to the top rear of the top section of the boot . another section of hook and loop fastener is attached to the bottom of the boot at the rear of the bottom section of the boot . after the boot has been placed on the animal &# 39 ; s foot the strap is wrapped around the top of the animal &# 39 ; s ankle , over the rear portion of the top of the boot , and under the rear of the boot , allowing all of the sections of hook and loop fasteners to secure the boot on the animal &# 39 ; s foot . in alternate embodiments any known adjustable fasteners for straps are used . referring to fig1 , which is a top view of the inventive boot , the top portion of the boot [ 101 ] comprises a grid of flexible lsr strands made up of a first set of lsr strands [ 102 ] set in parallel to each other approximately ⅝ inches apart , and a second set of lsr strands [ 103 ] also in parallel to each other , but set at right angles to the first set of lsr strands . this arrangement leaves multiple square cells [ 104 ] of empty space between the lsr strands . the cells [ 104 ] allow for relatively free air flow between the animal &# 39 ; s paw and the outside of the boot . the cells [ 104 ] also allow for visual inspection of the animal &# 39 ; s paw without removing the boot . the cells [ 104 ] also allow foreign objects , such as dirt or small rocks , to exit the boot through normal movement of the animal , without removing the boot . a bottom portion of the boot , made of similarly arranged lsr grid , is attached to the top portion along the edge of both the top and bottom portions of the boot at the parallel sides [ 105 ] and at the curved front of the boot [ 106 ]. in the preferred embodiment the lsr making up this outer edge [ 105 ] and [ 106 ] is thicker than the lsr making up the remainder of the top and bottom portions of the boot . the top portion of the boot [ 101 ] is not attached to the bottom portion at the rear [ 107 ] of the boot , thereby leaving an opening [ 108 ] between the two portions for the animal &# 39 ; s paw to be placed inside the boot . at the rear of the boot [ 107 ] a strap [ 109 ] is attached along the entire length of the rear [ 107 ] of the bottom section of the boot , and extends perpendicular to one side [ 105 ] of the boot at the edge of the boot . the hook portion [ 110 ] of a hook and loop fastener is attached to the strap [ 109 ] in an orientation leaving the hook portion [ 110 ] of the fastener exposed on the surface of the strap [ 109 ]. after the animal &# 39 ; s paw is inserted into the opening [ 108 ] at the rear [ 107 ] of the boot , the strap is wrapped over the rear [ 107 ] edge of the top portion of the boot [ 101 ] and attaches to the loop portion of the fastener on the top rear portion of the top of the boot and around the bottom portion of the boot to attach to the loop portion of the hook and loop fastener , which is attached to the bottom portion of the boot . referring to fig2 , which is a bottom view of the inventive boot , the bottom portion of the boot [ 201 ] comprises a grid of flexible lsr strands made up of a first set of lsr strands [ 202 ] set in parallel to each other approximately ⅝ inches apart , and a second set of lsr strands [ 203 ] also in parallel to each other , but set at right angles to the first set of lsr strands . as with the top portion of the boot [ 101 ] this arrangement leaves multiple square cells of empty space between the lsr strands [ 204 ]. a cross section of the lsr strands [ 202 ] and [ 203 ] reveals that they are approximately ⅛ inches in diameter and that the cross section is slightly oval shaped with the flatter portions of the lsr arranged to contact the animal &# 39 ; s paw and the ground , in order to provide increased comfort under the animal &# 39 ; s paw . the top portion of the boot [ 101 ] is attached to the bottom portion [ 201 ] along the edge of both the top and bottom portions of the boot at the parallel sides [ 205 ] and at the curved front of the boot [ 206 ]. the parallel sides [ 205 ] and curved front [ 206 ] of fig2 correspond to the curved front of the boot [ 106 ] and the parallel sides [ 105 ] of fig1 . in the preferred embodiment the lsr making up this outer edge [ 205 ] and [ 206 ] is thicker than the lsr making up the remainder of the top and bottom portions of the boot . this outer edge [ 205 ] and [ 206 ] of fig2 also corresponds to the outer edge [ 105 ] and [ 106 ] of fig1 . the top portion of the boot [ 201 ] is not attached to the bottom portion [ 101 ] at the rear [ 207 ] of the boot , thereby leaving an opening [ 208 ] between the two portions for the animal &# 39 ; s paw to be placed inside the boot . the opening [ 208 ] between the two portions of fig2 corresponds to the opening [ 108 ] of fig1 . at the rear of the boot [ 207 ] a strap [ 209 ] is attached along the entire length of the rear [ 207 ] of the bottom section of the boot [ 201 ], and extends perpendicular to one side [ 205 ] of the boot . the strap [ 209 ] corresponds to the strap [ 109 ] of fig1 . the hook portion [ 110 ] of a hook and loop fastener is attached to the strap [ 109 / 209 ] in an orientation leaving the hook portion [ 110 ] of the fastener exposed on the surface of the strap [ 109 / 209 ]. the loop portions [ 210 ] of the hook and loop fastener are attached to the top portion of the boot at the rear of the boot and are attached to the bottom portion [ 201 ] of the boot at the rear [ 207 ] of the boot in an orientation to allow it to contact the hook portion [ 211 ] of the fastener , which is attached to the strap [ 109 / 209 ]. the hook portion of the fastener in fig2 corresponds to the hook portion of the fastener [ 110 ] in fig1 . after the animal &# 39 ; s paw is inserted into the opening [ 108 / 208 ] at the rear [ 107 / 207 ] of the boot , the strap is wrapped over the rear [ 107 ] edge of the top portion of the boot [ 101 ] and around the rear [ 207 ] edge of the bottom portion [ 201 ] of the boot to attach to the hook [ 110 / 211 ] and loop [ 210 ] portions of the hook and loop fastener . referring to fig3 , which is a side view of the inventive boot , the top portion of the boot [ 301 ] and the bottom portion of the boot [ 302 ] comprise a grid of flexible lsr strands [ 303 ] and multiple square cells [ 304 ], as previously described . the top portion [ 301 ] corresponds to the top portion [ 201 ] from fig2 . the bottom portion [ 302 ] corresponds to the bottom portion [ 101 ] from fig1 . the top portion [ 301 ] and bottom portion [ 302 ] are attached at the edge of both the top and bottom portions of the boot at the parallel sides [ 305 ] and at the curved front of the boot [ 306 ]. the parallel sides [ 305 ] and curved front [ 306 ] of fig3 correspond to the curved front of the boot [ 106 ] and the parallel sides [ 105 ] of fig1 , and to the curved front of the boot [ 206 ] and the parallel sides [ 205 ] of fig2 . in the preferred embodiment the lsr making up this outer edge [ 305 ] and [ 306 ] is thicker than the lsr making up the remainder of the top and bottom portions of the boot . the top portion of the boot [ 301 ] is not attached to the bottom portion [ 302 ] at the rear [ 307 ] of the boot , thereby leaving an opening [ 308 ] between the two portions for the animal &# 39 ; s paw to be placed inside the boot . the opening [ 308 ] between the two portions of fig3 corresponds to the opening [ 108 ] of fig1 and the opening [ 208 ] of fig2 . at the rear of the boot [ 307 ] a strap [ 309 ] is attached along the entire length of the rear [ 307 ] of the bottom section of the boot [ 302 ], and extends perpendicular to one side of the boot . the strap [ 309 ] corresponds to the strap [ 109 ] of fig1 and to the strap [ 209 ] of fig2 . referring to fig4 , which is a toe view of the inventive boot , the top portion of the boot [ 401 ] and the bottom portion of the boot [ 402 ] comprise a grid of flexible lsr strands [ 403 ] and multiple square cells [ 404 ], as previously described . the top portion [ 401 ] corresponds to the top portion [ 201 ] from fig2 , and to the top portion [ 301 ] from fig3 . the bottom portion [ 402 ] corresponds to the bottom portion [ 101 ] from fig1 and to the bottom portion [ 302 ] from fig3 . the top portion [ 401 ] and bottom portion [ 402 ] are attached at the edge of both the top and bottom portions of the boot at the parallel sides [ 405 ] and at the curved front of the boot [ 406 ]. a strap [ 407 ] is attached is attached along the entire length of the rear of the bottom section of the boot , and extends perpendicular to one side [ 405 ] of the boot . the strap [ 407 ] corresponds to the strap [ 109 ] of fig1 and to the strap [ 209 ] of fig2 and to the strap [ 309 ] of fig3 . referring next to fig5 , 6 , 7 , and 8 the preferred embodiment of the overboot consists of a light - weight nylon upper bonded to a silicone rubber sole . the sole covers the bottom half of the overboot from the toe - end of the overboot , ending half way between the toe end and the rear of the overboot . the overboot is large enough to easily slip over the animal &# 39 ; s paw as well as over the therapeutic boot disclosed above , and to cover several inches of the animal &# 39 ; s leg above the ankle . the overboot includes excess material on the top portion of the overboot . the excess material folds across the top of the animal &# 39 ; s paw , ankle , and lower leg . folding the excess material creates an exterior shape of the overboot that conforms to the shape of the animal &# 39 ; s paw , ankle , and lower leg . the overboot also includes two straps , the first strap located at the rear of the overboot and the second strap located proximal to the animal &# 39 ; s ankle . the straps wrap around the exterior of the overboot and are secured with hook and loop fasteners . referring to fig5 , which is a side view of the inventive overboot , shown with the hook and loop fasteners [ 501 ] in the closed position ( fastened ) as would be found when the overboot has been placed upon the animal , the overboot includes a light - weight nylon upper [ 502 ] bonded to a silicone rubber sole [ 503 ]. the sole [ 503 ] covers the bottom half of the overboot from the toe - end [ 504 ] of the overboot , ending between the toe end [ 505 ] and the rear of the overboot . the overboot is large enough for the rear portion [ 505 ] of the nylon upper [ 502 ] to cover several inches of the animal &# 39 ; s leg above the ankle . the overboot includes excess material on the top portion of the overboot [ 506 ], which folds across the top of the animal &# 39 ; s paw , ankle , and lower leg . the overboot includes an opening [ 507 ] for the animal &# 39 ; s paw to be inserted . the hook and loop fasteners [ 501 ] include an upper strap [ 508 ] located at the upper rear of the overboot , and a lower strap [ 509 ] located proximal to the animal &# 39 ; s ankle . after the animal &# 39 ; s paw is inserted into the opening [ 507 ] of the overboot , the upper strap [ 508 ] wraps around the animal &# 39 ; s leg at the outer circumference of the opening [ 507 ]. the lower strap [ 509 ] wraps around the exterior of the overboot at the animal &# 39 ; s ankle joint . the upper strap [ 508 ] and lower strap [ 509 ] include the hook portion of hook and loop fasteners bonded to the straps . the straps wrap around the exterior of the overboot and are secured with loop fasteners which are bonded to the exterior of the overboot . referring to fig6 , which is a toe view , the inventive overboot includes a solid silicone sole [ 601 ] bonded to the light weight nylon upper [ 602 ], and an opening [ 603 ] for insertion of the animal &# 39 ; s paw . the sole [ 601 ], nylon upper [ 602 ], and opening [ 603 ] of fig6 correspond to the sole [ 503 ], nylon upper [ 502 ], and opening [ 507 ] of fig5 . the nylon upper [ 602 ] includes an upper fold [ 604 ] and a lower fold [ 605 ]. the lower fold [ 605 ] allows the nylon upper [ 602 ] to be tightened around the animal &# 39 ; s paw at the toe [ 606 ]. the upper fold [ 604 ] allows the nylon upper [ 602 ] to be tightened around the animal &# 39 ; s leg at the opening [ 603 ]. the overboot also includes an upper strap [ 607 ] and a lower strap [ 608 ]. the upper strap [ 607 ] and a lower strap [ 608 ] of fig6 correspond to the upper strap [ 508 ] and a lower strap [ 509 ] of fig5 . one end of the upper strap [ 607 - a ] is attached at the front of the upper portion of the nylon upper [ 602 ] parallel to the opening [ 603 ] and the other end [ 607 - b ] extends unattached away from the overboot . after the animal &# 39 ; s paw has been inserted the unattached end of the upper strap [ 607 - b ] is wrapped around the perimeter of the opening [ 603 ], enclosing the animal &# 39 ; s paw within the nylon upper [ 602 ] and fastened to the attached end of the upper strap [ 607 - a ] via hook and loop fasteners bonded to the upper strap [ 607 ]. one end of the lower strap [ 608 - a ] is attached at approximately the center of the nylon upper [ 602 ] approximately where the animal &# 39 ; s ankle joint is located , and the other end [ 608 - b ] extends unattached away from the overboot . after the animal &# 39 ; s paw has been inserted the unattached end [ 608 - b ] of the lower strap [ 608 ] is wrapped around the outside of the nylon upper [ 602 ] at the animal &# 39 ; s ankle joint and fastened to the attached end [ 608 - a ] of the lower strap [ 608 ] via hook and loop fasteners bonded to the lower strap [ 608 ]. referring to fig7 , which is a bottom view , the overboot includes a silicone sole [ 701 ], a nylon upper [ 702 ], a lower strap [ 703 ], an upper strap [ 704 ], and an opening [ 705 ] for the animal &# 39 ; s paw . the sole [ 701 ], nylon upper [ 702 ], lower strap [ 703 ], upper strap [ 704 ], and opening [ 705 ] for the animal &# 39 ; s paw of fig7 correspond to the sole [ 601 ], nylon upper [ 602 ], lower strap [ 608 ], upper strap [ 607 ], and opening [ 603 ] for the animal &# 39 ; s paw of fig6 , and the sole [ 503 ], nylon upper [ 502 ], lower strap [ 509 ], upper strap [ 508 ], and opening [ 507 ] for the animal &# 39 ; s paw of fig5 . the silicone sole [ 701 ] is bonded to the bottom portion of the nylon upper [ 702 ] from the toe [ 706 ] to the lower strap [ 703 ], located at approximately the location of the animal &# 39 ; s ankle . referring to fig8 , which is a top view , the overboot includes a nylon upper [ 801 ], a lower strap [ 802 ], an upper strap [ 803 ], an opening [ 804 ] for the animal &# 39 ; s paw , and a toe [ 805 ]. the nylon upper [ 801 ], lower strap [ 802 ], upper strap [ 803 ], opening [ 804 ], and toe [ 805 ] of fig8 correspond to the nylon upper [ 702 ], lower strap [ 703 ], upper strap [ 704 ], opening [ 705 ], and toe [ 706 ] of fig7 ; to the nylon upper [ 602 ], lower strap [ 608 ], upper strap [ 607 ], opening [ 603 ], and toe [ 606 ] of fig6 ; and the nylon upper [ 502 ], lower strap [ 509 ], upper strap [ 508 ], opening [ 507 ], and toe [ 504 ] of fig5 . the overboot also includes excess material [ 806 ] in the nylon upper [ 801 ] to allow for folding the nylon upper [ 801 ] to tighten the overboot around the animal &# 39 ; s leg . the excess material [ 806 ] of fig8 corresponds to the excess material [ 506 ] of fig5 . the excess material [ 806 ] is divided into an interior section [ 806 - a ] and an exterior section [ 806 - b ]. the interior section [ 806 - a ] is triangular with one side beginning from the toe [ 805 ] to one side [ 806 - c ] of the opening [ 804 ], a second side extending from the side [ 806 - c ] to a point [ 806 - d ] located approximately halfway between the side [ 806 - c ] and a second side [ 806 - e ] of the opening [ 804 ], and a third side extending from the point [ 806 - d ] to the toe [ 805 ]. the exterior section [ 806 - b ] is also triangular with one side beginning from the toe [ 805 ] to the second side [ 806 - e ] of the opening [ 804 ], a second side extending from the side [ 806 - e ] to the point [ 806 - d ], and a third side extending from the point [ 806 - d ] to the toe [ 805 ]. after the animal &# 39 ; s leg is inserted into the overboot the exterior section [ 805 b ] of the excess material [ 805 ] is folded over the interior section [ 805 - a ] of the excess material . the upper strap [ 803 ] and lower strap [ 802 ] are then wrapped around the exterior of the nylon upper [ 801 ] and fastened via hook and loop fasteners that are bonded to the upper strap [ 803 ] and lower strap [ 802 ], thereby securing the animal &# 39 ; s paw within the overboot . although the present invention has been described with reference to preferred embodiments , numerous modifications and variations can be made and still the result will come within the scope of the invention . no limitation with respect to the specific embodiments disclosed herein is intended or should be inferred .

US-201414120609-A

an eye shade is presented including a first side connected to an intermediate layer . a second side is connected to the intermediate layer . a first outer eye portion and a second outer eye portion are formed from the first side , the intermediate layer and the second side . the first and second outer eye portions extend outward . the first outer eye portion and the second outer eye portion are convex shaped .

the invention generally relates to an eye shade . referring to the figures , exemplary embodiments of the invention will now be described . the exemplary embodiments are provided to illustrate the invention and should not be construed as limiting the scope of the invention . fig1 illustrates a front view of an embodiment of the invention . in this embodiment of the invention , eye shade 100 comprises left outer eye portion 110 , right outer eye portion 120 , outer nose portion 130 and front portion 140 . left outer eye portion 110 , and right outer eye portion 120 are convex in shape extending away from front portion 140 . outer nose portion 130 is convex in shape extending away from front portion 140 . fig2 illustrates the rear view of eye shade 100 . left inner eye portion 210 is the inner compliment to left outer eye portion 110 . right inner eye portion 220 is the compliment to right outer portion 120 . left inner eye portion 210 and right inner eye portion 220 are both concave shaped . rear portion 240 is the compliment to front portion 140 . inner nose portion 230 is the compliment to outer nose portion 130 . inner nose portion 230 is concave in shape . left inner eye portion 210 and right inner eye portion 220 can vary in length , width and depth dimensions to prevent various sized eyelashes and eye portions of users from coming into contact with the surface of either left inner eye portion 210 or right inner eye portion 220 . fig1 b illustrates a side view of an eye portion of the embodiment illustrated in fig1 . only one eye portion is illustrated as the left and right eye portions are symmetrical the depth h ( illustrated in fig1 b ) of either left inner eye portion 210 or right inner eye portion 220 can be a depth in the range of three - fourths ( ¾ ) of an inch to three and a half ( 3½ ) inches at the center of either inner left eye portion 210 or inner right eye portion 220 . that is , different embodiments can have different depth h to accommodate various length eye lashes or enhanced eyelashes ( such as false or fake eyelashes ). eye shade 100 can vary in dimension so as to accommodate various facial shapes and sizes . eye shade 100 can have both front portion 140 and rear portion 240 comprised of suitable man - made material that can be formed over an inner portion lying between front portion 140 and rear portion 240 that is comprised of suitable compressible material , such as a foam rubber type material . the composition of front portion 140 , rear portion 240 and inner portion 190 ( illustrated in fig1 a ) lying between front portion 140 and rear portion 240 are such that eye shade 100 can be formed by a heat source in a press which molds the composite materials . since eye shade 100 is comprised of molded material , eye shade 100 has “ memory .” therefore , eye shade 100 can be folded , twisted , washed , etc ., and will retain its formed shape . eye shade 100 can have varying means for positioning on or attaching to a face . such means include a single strap , a plurality of coupled straps , etc . these positioning / attaching means can be made of a single elastic piece attached to right end side 160 and left end side 150 , or separate pieces wherein complimentary pieces are each coupled to right end 160 and left end 150 . for embodiments of eye shade 100 having a plurality of positioning / attaching pieces , various means can be used for fastening each of the plurality of pieces together . these means include , velcro ® hook and loop fasteners , metal connectors , plastic connectors , buckles , snaps , etc . the positioning pieces can be adjustable and also vary in length and width , to accommodate various sized users . in this embodiment the nose portion , comprising outer nose portion 130 and inner nose portion 230 , can be varied in size to accommodate various sized noses . in another embodiment of the invention , the nose portion can be partially or entirely removed . fig3 illustrates a front view of another embodiment of the invention . eye shade 300 is comprised of left outer eye portion 330 , right outer eye portion 320 , front portion 310 , left end 350 , right end 340 , outer nose portion 380 and bridging portion 360 . left outer eye portion 330 and right eye outer eye portion 320 are can be flat or slightly convex in shape extending outward slightly from bridging portion 360 . left outer eye portion 330 and right outer eye portion 320 comprise most of eye shade 300 with the exception of outer nose portion 380 and bridging portion 360 . in another embodiment of the invention , left outer eye portion 330 and right outer eye portion 320 are combined to form a single outer portion ( not shown ). in this embodiment of the invention , eye shade 300 does not have left and right outer eye portions that are separately distinguishable . fig4 illustrates a rear view of eye shade 300 , left inner eye portion 420 surrounds left inner eye cavity portion 440 . right inner eye portion 410 surrounds right eye cavity 450 . left inner eye cavity 440 and right inner eye cavity 450 are concave in shape . inner nose portion 430 is concave in shape . when eye shade 300 is placed over a user &# 39 ; s eyes , left inner eye cavity 440 and right inner eye cavity 450 are not brought into contact with a user &# 39 ; s eyelashes or eye portions . left inner eye cavity 440 and right inner eye cavity 450 can be formed with varying dimensions to allow a person with long eyelashes or enhanced eyelashes ( i . e ., false or fake eyelashes , from coming into contact with the surface of eye shade 300 . fig3 b illustrates a side view of an eye portion of the embodiment illustrated in fig3 . only one eye portion is illustrated as the left and right eye portions are symmetrical . the depth h ( illustrated in fig3 b ) of either left inner eye cavity 440 or right inner eye cavity 450 can be a depth in the range of three - fourths ( ¾ ) of an inch to three and a half ( 3½ ) inches at the center of either inner left eye cavity 440 or inner right eye cavity 450 . that is , different embodiments can have different depth h to accommodate various length eye lashes or enhanced eyelashes ( such as false or fake eyelashes ). eye shade 300 can vary in dimension so as to accommodate various facial shapes and sizes . eye shade 300 can have varying means for positioning on or attaching to a face . such means include a single strap , a plurality of coupled straps , etc . these positioning / attaching means can be made of a single elastic piece attached to right end side 340 and left end side 350 , or separate pieces wherein complimentary pieces are each coupled to right end side 340 and left end side 350 . for embodiments having a plurality of positioning / attaching pieces , various means can be used for fastening each of the plurality of pieces together . these means include , velcro ® hook and loop fasteners , metal connectors , plastic connectors , buckles , snaps , etc . the positioning pieces can be adjustable and also vary in length and width , to accommodate various sized users . in this embodiment the nose portion , comprising outer nose portion 330 and inner nose portion 430 , can be varied in size to accommodate various sized noses . also , the nose portion can be partially or entirely removed without affecting the scope of this embodiment . fig5 illustrates a front view of still another embodiment of the invention . eye shade 500 is comprised of front portion 510 , left outer eye portion 520 , right outer eye portion 530 , outer nose portion 540 , left side portion 550 , and right side portion 560 . left outer eye portion 520 and right outer eye portion 530 are convex in shape extending away from front portion 510 . outer nose portion 540 is triangular shaped and polygonal in dimension . outer nose portion 540 , however , is not necessarily restricted to such a shape , and for example , may be circular , elliptical , oval , triangular with rounded angles , trapezoidal , diamond shaped , heart - shaped , etc . eye shade 500 has a linear upper circumferential portion . fig6 illustrates a rear view of eye shade 500 . left inner eye portion 620 and right inner eye portion 630 are concave in shape . left inner eye portion 620 and right inner eye portion 630 can have variable dimensions to allow for varying lengths of eye portions ( i . e ., eyeball , upper and lower eyelids , eyebrow ), eyelashes and additional eyelash enhancements ( i . e ., false or fake eyelashes ) that can be added to a person &# 39 ; s upper or lower eye lids , without such lashes or enhancements coming into contact with the inner surface of either left inner eye portion 620 or right inner eye portion 630 . fig5 b illustrates a side view of an eye portion of the embodiment illustrated in fig5 . only one eye portion is illustrated as the left and right eye portions are symmetrical the depth h ( illustrated in fig5 b ) of either left inner eye portion 620 or right inner eye portion 630 can be a depth in the range of three - fourths ( ¾ ) of an inch to three and a half ( 3½ ) inches at the center of either inner left eye portion 620 or inner right eye portion 630 . that is , different embodiments can have different depth h to accommodate various length eye lashes or enhanced eyelashes ( such as false or fake eyelashes ). eye shade 500 can have both front portion 510 and rear portion 610 comprised of suitable man - made material that can be formed over inner portion 590 ( illustrated in fig5 a ) lying between front portion 510 and rear portion 610 that is comprised of suitable compressible material , such as a foam rubber type material . the composition of front portion 510 , rear portion 610 and inner portion 590 lying between front portion 510 and rear portion 610 is such that eye shade 500 can be formed by a heat source in a press which molds the composite materials . since eye shade 500 is comprised of molded material , eye shade 500 has “ memory .” therefore , eye shade 500 can be folded , twisted , washed , etc ., and will retain its formed shape . eye shade 500 can have varying means for positioning on or attaching to a face . such means include a single strap , a plurality of coupled straps , etc . these positioning / attaching means can be made of a single elastic piece attached to right side portion 560 and left side portion 550 , or separate pieces wherein complimentary pieces are each coupled to right side portion 560 and left side portion 550 . for embodiments having a plurality of positioning / attaching pieces , various means can be used for fastening each of the plurality of pieces together . these means include , velcro , metal connectors , plastic connectors , buckles , snaps , etc . the positioning pieces can be adjustable and also vary in length and width , to accommodate various sized users . in this embodiment of the invention , the nose portion , comprising outer nose portion 540 and inner nose portion 640 , can be varied in size to accommodate various sized noses . also , the nose portion can be partially or entirely removed . the forming of eye cavities having suitable dimensions and shapes allow the inventive eye shades to be worn by users without having a user &# 39 ; s eye portions ( i . e ., eyeball , upper and lower eyelids , eyebrow ), eye lashes , or eye lash enhancements ( i . e ., false or fake eyelashes ) coming into contact with inner eye portions of the eye shades during use . also , a user &# 39 ; s eye makeup will not be compromised by wearing the various embodiments of the invention as the eye portions of the eye shade embodiments extend beyond the general orbital area ( e . g ., eye liner extending beyond the orbital extremity area opposite of the nasal area , eye shadow , eyebrow liner ). therefore , a user can open , close , or blink their eyes without coming into contact with an inner eye portion of embodiments of the invention . moreover , a user wearing enhanced eye lashes , such as very long novelty eye lashes , can use the above mentioned embodiments of the invention without the enhanced eye lashes coming into contact with inner portions . while certain exemplary embodiments have been described and shown in the accompanying drawings , it is to be understood that such embodiments are merely illustrative of and not restrictive on the broad invention , and that this invention not be limited to the specific constructions and arrangements shown and described , since various other modifications may occur to those ordinarily skilled in the art .

US-169801-A

the present invention is an improved food storage container . the container can be a re - sealable flexible bag or a semi - rigid container , either of which is coupled to an absorbent pad . the absorbent pad absorbs excess liquid eluted from the food stored within or formed by condensation during refrigeration . as a result , the liquid is transported away from the food located in the container via capillary action , reducing rotting , reducing the formation of bacteria without the use of potentially harmful chemicals , preservatives , or other additives , which prolongs the storage life , quality , and nutritional value of foods products kept within the container .

a detailed illustrative embodiment of the present invention is disclosed herein . however , techniques , systems and operating structures in accordance with the present invention may be embodied in a wide variety of forms and modes , some of which may be quite different from those in the disclosed embodiment . consequently , the specific structural and functional details disclosed herein are merely representative , yet in that regard , they are deemed to afford the best embodiment for purposes of disclosure and to provide a basis for the claims herein that define the scope of the present invention . initially , the use of the terms “ container ,” “ device ,” “ food storage device ,” food storage container ,” “ insert ” and the like are not meant to limit the scope of the present invention . rather , the terms are used interchangeably and are meant to be merely illustrative in nature of certain aspects of the present invention . further , the use of the term “ bacteria ” is not intended to limit the scope of the present invention to a particular microorganism . rather , the use of the term “ bacteria ” is merely illustrative of any type of microorganism that can impact the quality , shelf life , or nutritional value of food , including but not limited to viruses , fungi , protozoa , and helminths . in addition , the preferred embodiment of the present invention describes the absorbent material as a rectangular pad , however , it is not meant to limit the scope of the present invention . the term is meant to be merely illustrative in nature of certain aspects of the present invention , as various shapes and configurations of the material can be utilized in accordance with the present invention . in addition , the preferred embodiment of the present invention depicts the absorbent material as occupying the entire surface area of a food storage device . however , it is contemplated that less absorbent material can be used ( i . e ., an amount that covers only a portion of the interior surface area of a food storage container ) in accordance with the present invention . moreover , well known methods , procedures , and substances for both carrying out the objectives of the present invention and illustrating the preferred embodiment are incorporated herein but have not been described in detail as not to unnecessarily obscure aspects of the present invention . the following presents a detailed description of a preferred embodiment of the present invention . referring now to fig1 - 2 , shown is a food storage container in accordance with the preferred embodiment . in this example , food storage container 100 is flexible plastic bag 150 . the bag comprises top 107 , opposing sides 103 and 105 which form opposing lateral edges 111 and 113 , and bottom 109 . food storage container 100 also comprises re - sealable mechanism 115 , described in greater detail below . absorbent material 101 is attached at one or more of points 201 , 203 , or 205 to flexible bag 150 as discussed in greater detail below . flexible bag 150 may be comprised of any one of a variety of structures , such as a standard freezer bag or any known ziploc ® brand plastic bag sold by s . c . johnson home storage , inc . of racine , wis . a standard quart or gallon bag is preferred as flexible bag 150 , but other bag sizes may be used in accordance with the present invention . as shown in fig1 - 2 , flexible bag 150 is formed from a single sheet of material that is folded to form opposing sides 103 and 105 and bottom 109 . opposing sides 103 and 105 are attached to each other at lateral edge 111 , lateral edge 113 and bottom 109 by utilizing the known process of heat sealing . of course , any other known method of attaching opposing sides can be utilized in accordance with the present invention . as a result of this process , flexible bag 150 forms a hollow recess suitable for storing food . although flexible bag 150 is preferably formed from a single sheet folded at bottom 109 , flexible bag 150 does not need to be formed from a single sheet . for example , flexible bag 150 can be formed from separate sheets are attached at lateral edges 111 , 113 and at bottom 109 of flexible bag 150 . flexible bag 150 is preferably comprised of a thermoplastic material or a blend of thermoplastic materials . of course , flexible bag 150 can be comprised of other materials in accordance with the present invention . for example , flexible bag 150 can also be made from a plurality of layers of co - extruded films . this technique is disclosed in u . s . pat . no . 5 , 292 , 392 to miller , et al ., herein incorporated by reference . flexible bag 150 is preferably comprised of a material that is at least partially impermeable to air and water . suitable thermoplastics include , for example , polyolefins such as high density polyethylene ( hdpe ), low density polyethylene ( ldpe ), linear low density polyethylene ( lldpe ), and polypropylene ( pp ); thermoplastic elastomers such as styrenic block copolymers , polyolefin blends , elastomeric alloys , thermoplastic polyurethanes , thermoplastic copolyesters , and thermoplastic polyamides ; polymers and copolymers of polyvinyl chloride ( pvc ), polyvinylidene chloride ( pvdc ), s . c . johnson & amp ; son , inc .&# 39 ; s saran polymers ( racine , wis . ), ethylene / vinyl acetate copolymers , cellulose acetates , polystyrene , thermoplastic polyvinyl alcohols ; single site catalyst resins ; and nylons such as non - crystalline nylons and amorphous nylons . preferably , flexible bag 150 is comprised of polyethylene and more preferably from a blend of low density polyethylene ( ldpe ) and linear low density polyethylene ( lldpe ), which is preferred for its greater tear strength . the thickness and strength of the material used for flexible bag 150 may vary widely . however , the material should be thick enough and strong enough to resist punctures . thus , the thickness of the material can be anywhere from 1 to 4 millimeters and preferably has an elastic modulus below 50 , 000 pounds per square inch . alternatively , thicker components may be used if extra puncture resistance is desired for certain applications . in an alternative embodiment , flexible bag 150 is comprised of paper or lined paper . for example , traditional wax paper bags , which are commonly utilized for storing cereals , grains , and other dry food products , are particularly suited for use in accordance with the present invention . a wax paper bag coupled to the absorbent material of the present invention allows a user to keep grains , and the like from becoming saturated with moisture , which prevents the food product from becoming moldy . of course , it is contemplated that other materials can be utilized in accordance with the present invention . re - sealable mechanism 115 comprises two mating elements which , when closed , prevent the passage of fluid . any closure may be used to close flexible bag 150 , including , as non - limiting examples , a zipper , a zipper with a sliding closing mechanism , an adhesive strip , a hook - and - loop fastener , snaps and buttons , and a tying mechanism such as string or a thin metal wire . the process of adding a closing mechanism is well known , and is taught , for example , in u . s . pat . no . 5 , 012 , 561 , to porchia , et al . and u . s . pat . no . 5 , 070 , 584 to dais , et al ., each of which is incorporated herein by reference . many variations of flexible bag 150 are possible . for example , flexible bag 150 can be a variety of different colors . flexible bag 150 may have curled in or curled out edges at top 107 . alternatively , flexible bag 150 can have a print strip ( not shown ) which allows a user to label the contents of the container . absorbent material 101 preferably comprises a pad of liquid absorbent material , the thickness of which may be varied to control the absorbency thereof . typically , the thickness is between about 1 / 32 to ⅛ inches so as to permit absorption and retention of a substantial quantity of liquid . a number of different materials may be used , such as stacked layers of tissue - like wadding , a mat of conventional defiberized wood pulp ( known in the art as wood fluff ), a mat of synthetic pulp such as rayon , a mat of cotton , a mat of absorbent paper , fenestrated cloth , a fenestrated compressed sponge , composite materials , or combinations of the above , either with or without fenestrations . in one embodiment of the present invention , absorbent material 101 is comprised of hydrophilic cellulose base fibers . other preferred materials include a layer of wood fluff in conjunction with a thin layer of tissue - like paper wadding . wood fluff is well known in the art and consists of defiberized cellulose fibers which have been formed into a compressed batt in the manner of a non - woven fabric . the fluff layer has little or no consistency or integrity , and it is thus difficult to maintain in web form during manufacturing operations . the paper wadding , which is also known in the art , is produced on a paper making machine , and may , if desired , be creped for added body . the wadding typically has a texture similar to household facial tissue , and has substantially more integrity than does the wood fluff . the layers of wadding and wood fluff are superposed and mechanically interconnected by diamond - shaped embossing and / or fenestrations illustrated by parallel lines on absorbent material 101 in the accompanying fig1 - 8 . advantageously , theses features maintain the relative positioning of the layers and the integrity of the wood fluff . in addition , the fenestrations facilitate adhering absorbent material 101 to flexible bag 150 . the embossing comprises myriad distinct indentations along the lines of the diamond - shaped pattern and which serve to compact and thereby interconnect the superposed layers along those lines . absorbent material 101 is attached to flexible bag 150 at one or more locations . preferably , absorbent material 101 is attached to flexible bag 150 by one or more heat sealing lines 201 , 203 , and 205 . in the preferred embodiment , absorbent material 101 is heat sealed through the fenestrations and / or diamond shaped embossing in such a manner as to reduce any potential negative effect on the volume of flexible bag 150 . advantageously , this process does not utilize any adhesive , glue , or other potentially harmful chemical . of course , any other means for attaching absorbent material 101 to flexible bag 150 can be utilized in accordance with the present invention as long as it does not use harmful chemicals . as depicted in fig3 , an optional semi - permeable sheet 301 can be utilized in accordance with the present invention . semi - permeable sheet 301 is comprised of a material which is non - reactive to food products . for example , semi - permeable sheet 301 may comprise a flexible thermoplastic film , such as polyethylene having a thickness between about 0 . 00035 to 0 . 005 inches . the peripheral edges of semi - permeable sheet 310 is preferably sealably secured together by any suitable means , such as a hot melt adhesive seal or by heat sealing to thereby sealably enclose the mat of absorbent material 101 between semi - permeable sheet 301 and flexible bag 150 . in addition , the semi - permeable sheet 301 comprised a plurality of minute pores which permit liquid to pass from the exposed surface of semi - permeable sheet 301 to absorbent material 101 . preferably , the pores are uniformly distributed over the surface area of semi - permeable sheet 301 . also , semi - permeable sheet 301 is preferably oriented so that the peripheral portions extend toward absorbent material 101 , which acts to retard the diffusion of liquid outwardly from absorbent material 101 . in use , juices exuded from the food product stored in food container 100 or condensation formed during refrigeration flows through semi - permeable sheet 301 ( if present ) into absorbent material 101 . the capillary action of absorbent material 101 draws the liquids into the pad where they are prevented from resaturating the food product . optional semi - permeable sheet 301 helps to prevent the absorbed liquids from directly contacting the food product , and the capillary action of absorbent material 101 ( and the small size of the pores of semi - permeable sheet 301 if utilized ) acts to retard the reverse flow of the liquids through the openings . as a result , the exuded liquids do not come into contact with the food product stored in food container 100 , reducing rotting , reducing the appearance of food breakdown and the formation of bacteria . referring next to fig4 , disclosed is another example of a food storage container in accordance with the present invention . as shown , food storage container 400 comprises rigid storage container 450 , which comprises sidewall 405 and bottom 407 , absorbent material 101 , and lid 403 . rigid storage container 450 comprises bottom 407 and sidewall 405 . preferably , sidewall 405 extends upward from bottom 407 and is attached to form a perimeter . as shown , sidewall 405 is square shaped , however , other shapes , such as ovular and circular , can be utilized in accordance with the present invention . rigid storage container 450 also comprises lid 403 , which is adapted to snugly fit over the perimeter formed by sidewall 405 . in the preferred embodiment , rigid storage container 450 and lid 403 are comprised of a thermoplastic material or a blend of thermoplastic materials . of course , rigid storage container 450 can be comprised of other materials in accordance with the present invention . suitable thermoplastics include , for example , polyolefins such as high density polyethylene ( hdpe ), low density polyethylene ( ldpe ), linear low density polyethylene ( lldpe ), and polypropylene ( pp ); thermoplastic elastomers such as styrenic block copolymers , polyolefin blends , elastomeric alloys , thermoplastic polyurethanes , thermoplastic copolyesters , and thermoplastic polyamides ; polymers and copolymers of polyvinyl chloride ( pvc ), polyvinylidene chloride ( pvdc ), s . c . johnson & amp ; son , inc .&# 39 ; s saran polymers ( racine , wis . ), ethylene / vinyl acetate copolymers , cellulose acetates , polystyrene , thermoplastic polyvinyl alcohols ; single site catalyst resins ; and nylons such as non - crystalline nylons and amorphous nylons . absorbent material 101 is constructed in a manner as previously described . referring next to fig5 & amp ; 7 , shown are cross - sectional views of the attachment of absorbent material 101 to rigid container 450 . fig5 depicts absorbent material 101 attached to bottom 407 of rigid container 450 by heat sealing . alternatively , as shown in fig7 , absorbent material can be attached to bottom 407 via one or more plastic rivets 701 . in addition , absorbent material 101 can be attached to lid 403 of rigid container 450 . these well known rivets 701 are attached to bottom 407 through the pores of absorbent material 101 and heated from the underside of bottom 407 which effectively “ melts ” the bottom of rivet 701 . in the alternative examples of fig6 & amp ; 8 , food storage container 400 further comprises option semi - permeable sheet 301 , constructed in a manner as previously described . as in other embodiments , fig6 & amp ; 8 show the interaction of attachment between bottom 407 , absorbent material 101 , and semi - permeable sheet 301 to create food container 400 . in fig6 , the constituent parts are attached via heat sealing in a manner as previously described . fig8 show the utilization of one or more plastic rivets 701 , which are attached in a manner as previously described . in use , food is placed into food storage rigid container 450 and the lid is snugly fitted onto sidewall 405 . juices exuded from the food product stored in food container 400 or condensation formed during refrigeration flows through semi - permeable sheet 301 ( if present ) into absorbent material 101 . the capillary action of absorbent material 101 draws the liquids into the pad where they are prevented from resaturating the food product . optional semi - permeable sheet 301 helps to prevent the absorbed liquids from directly contacting the food product , and the capillary action of absorbent material 101 ( and the small size of the pores of semi - permeable sheet 301 if utilized ) acts to retard the reverse flow of the liquids through the openings . as a result , the exuded liquids do not come into contact with the food product stored in food container 400 , reducing rotting and reducing the appearance of food breakdown and the formation of bacteria .

US-36415506-A

the invention provides compounds represented by the formula i , each of which compounds may have sphingosine - 1 - phosphate receptor agonist and or antagonist biological activity : and wherein the variables y , r 4 , n , a , x , z , r 1 , o , r 3 , r 2 and p are as defined in the specification . these compounds are useful for treating a disease or condition selected from the group consisting of glaucoma , dry eye , angiogenesis , cardiovascular conditions and diseases , and wound healing .

unless otherwise indicated , the following terms as used throughout this specification have the following meanings : “ pharmaceutically acceptable salt ” refers to those salts which retain the biological effectiveness and properties of the free bases and which are obtained by reaction with inorganic acids such as hydrochloric acid , hydrobromic acid , sulfuric acid , nitric acid , phosphoric acid , methanesulfonic acid , ethanesulfonic acid , p - toluenesulfonic acid , salicylic acid and the like . “ alkyl ” refers to a straight - chain , branched or cyclic saturated aliphatic hydrocarbon . preferably , the alkyl group has 1 to 12 carbons . more preferably , it is a lower alkyl of from 1 to 7 carbons , most preferably 1 to 4 carbons . typical alkyl groups include methyl , ethyl , propyl , isopropyl , butyl , isobutyl , tertiary butyl , pentyl , hexyl and the like . the alkyl group may be optionally substituted with one or more substituents are selected from the group consisting of hydroxyl , cyano , alkoxy , ═ o , ═ s , no 2 , halogen , dimethyl amino and sh . “ alkenyl ” refers to a straight - chain , branched or cyclic unsaturated hydrocarbon group containing at least one carbon — carbon double bond . preferably , the alkenyl group has 2 to 12 carbons . more preferably it is a lower alkenyl of from 2 to 7 carbons , most preferably 2 to 4 carbons . the alkenyl group may be optionally substituted with one or more substituents selected from the group consisting of hydroxyl , cyano , alkoxy , o , s , no 2 , halogen , dimethyl amino and sh . “ alkynyl ” refers to a straight - chain , branched or cyclic unsaturated hydrocarbon containing at least one carbon — carbon triple bond . preferably , the alkynyl group has 2 to 12 carbons . more preferably it is a lower alkynyl of from 2 to 7 carbons , most preferably 2 to 4 carbons . the alkynyl group may be optionally substituted with one or more substituents selected from the group consisting of hydroxyl , cyano , alkoxy , o , s , no 2 , halogen , dimethyl amino and sh . “ aryl ” refers to an aromatic group which has at least one ring having a conjugated pi electron system and includes carbocyclic aryl , heterocyclic aryl and biaryl groups . the aryl group may be optionally substituted with one or more substituents selected from the group consisting of halogen , trihalomethyl , hydroxyl , sh , oh , no 2 , amine , thioether , cyano , alkoxy , alkyl , and amino . “ alkaryl ” refers to an alkyl that is covalently joined to an aryl group . preferably , the alkyl is a lower alkyl . “ carbocyclic aryl ” refers to an aryl group wherein the ring atoms are carbon . “ heterocyclic aryl ” refers to an aryl group having from 1 to 3 heteroatoms as ring atoms , the remainder of the ring atoms being carbon . heteroatoms include oxygen , sulfur , and nitrogen . “ hydrocarbyl ” refers to a hydrocarbon radical having only carbon and hydrogen atoms . preferably , the hydrocarbyl radical has from 1 to 20 carbon atoms , more preferably from 1 to 12 carbon atoms and most preferably from 1 to 7 carbon atoms . “ substituted hydrocarbyl ” refers to a hydrocarbyl radical wherein one or more , but not all , of the hydrogen and / or the carbon atoms are replaced by a halogen , nitrogen , oxygen , sulfur or phosphorus atom or a radical including a halogen , nitrogen , oxygen , sulfur or phosphorus atom , e . g . fluoro , chloro , cyano , nitro , hydroxyl , phosphate , thiol , etc . “ amide ” refers to — c ( o )— nh — r ′, wherein r ′ is alkyl , aryl , alkylaryl or hydrogen . “ ester ” refers to — c ( o )— o — r ′, wherein r ′ is alkyl , aryl or alkylaryl . “ thioamide ” refers to — c ( s )— nh — r ′, wherein r ′ is alkyl , aryl , alkylaryl or hydrogen . “ thiol ester ” refers to — c ( o )— s — r ′, wherein r ′ is alkyl , aryl , alkylaryl or hydrogen . “ amine ” refers to a — n ( r ″) r ′″ group , wherein r ″ and r ′″ are independently selected from the group consisting of alkyl , aryl , and alkylaryl . “ thioether ” refers to — s — r ″, wherein r ″ is alkyl , aryl , or alkylaryl . “ sulfonyl ” refers to — s ( o ) 2 — r ″″, where r ″″ is aryl , c ( cn )═ c - aryl , ch 2 cn , alkyaryl , sulfonamide , nh - alkyl , nh - alkylaryl , or nh - aryl . also , alternatively the substituent on the phenyl moiety , as shown below , is referred to as an o , m or p substituent or a 2 , 3 or 4 substituent , respectively . ( obviously , the 5 substituent is also a m substituent and the 6 substituent is an o substituent .) specific compounds of the invention and their selectivity are at the sphingosine - 1 - phosphate receptors reported in table i , below . compounds were assessed for their ability to activate or block activation of the human s1p3 receptor in t24 cells stably expressing the human s1p3 receptor . ten thousand cells / well were plated into 384 - well poly - d - lysine coated plates one day prior to use . the growth media for the s1p3 receptor expressing cell line was mccoy &# 39 ; s 5a medium supplemented with 10 % charcoal - treated fetal bovine serum ( fbs ), 1 % antibiotic - antimycotic and 400 μg / ml geneticin . on the day of the experiment , the cells were washed twice with hank &# 39 ; s balanced salt solution supplemented with 20 mm hepes ( hbss / hepes buffer ). the cells were then dye loaded with 2 um fluo - 4 diluted in the hbss / hepes buffer with 1 . 25 mm probenecid and incubated at 37 ° c . for 40 minutes . extracellular dye was removed by washing the cell plates four times prior to placing the plates in the flipr ( fluorometric imaging plate reader , molecular devices ). ligands were diluted in hbss / hepes buffer and prepared in 384 - well microplates . the positive control , sphingosine - 1 - phosphate ( sip ), was diluted in hbss / hepes buffer with 4 mg / ml fatty acid free bovine serum albumin . the flipr transferred 12 . 5 μl from the ligand microplate to the cell plate and took fluorescent measurements for 75 seconds , taking readings every second , and then for 2 . 5 minutes , taking readings every 10 seconds . drugs were tested over the concentration range of 0 . 61 nm to 10 , 000 nm . data for ca + 2 responses were obtained in arbitrary fluorescence units and not translated into ca + 2 concentrations . ic 50 values were determined through a linear regression analysis using the levenburg marquardt algorithm . as a result of the above activity of the compounds utilized in the method of the present invention , it is clear that such compounds may be used in treating the following diseases and conditions for the following reasons . s1p3 subtypes are expressed in primary human trabecular meshwork cells and s1p decreases outflow facility & gt ; 30 % in perfused porcine eyes ( see iovs 45 , 2263 ; 2004 ) by altering paracellular permeability . s1p3 receptor subtype is expressed in vascular endothelial cells and sirna knockdown of s1p1 and s1p3 inhibits angiogenesis . s1p also promotes vascular endothelial cell migration and promotes barrier assembly and integrity . the invention is further illustrated by the following examples which are illustrative of a specific mode of practicing the invention and are not intended as limiting the scope of the claims . unless otherwise indicated , the following chemical abbreviations are used in the examples : benzylamine , benzyl bromide , n - butylamine , 3 - chlorobenzylamine , 4 - chlorobenzylamine , furfuryl amine , 2 , 5 - difluorobenzylamine , 3 , 4 - difluorobenzylamine , 3 , 5 - difluorobenzylamine , iodobenzene , 2 - iodopyridine , 2 - iodothiophene , ethyl acetoacetate , ethyl benzoylacetate , ethyl5 - hydroxy - 2 - methylindole - 3 - carboxylate , ethyl isobutyrylacetate , ethyl3 - oxovelarate , 2 - fluorobenzylamine , 3 - fluorobenzylamine , 4 - fluorobenzylamine , 2 - methoxybenzylamine , 3 - methoxybenzylamine , 4 - methylbenzylamine , 2 - thiophenemethylamine and3 -( trifluoromethyl ) benzylamine were purchased from aldrich chemical company . general procedure 1 . to a solution of ethyl acetoacetate ( 1 . 3 ml , 10 mmol ) and benzylamine ( 1 . 2 ml , 10 . 5 mmol ) in toluene ( 10 ml ) was added p - toluenesulfonic acid monohydrate ( 95 mg , 0 . 5 mmol ). the mixture was heated at 140 ° c . to reflux for 4 h , cooled to 0 ° c . and filtered . the filtrate was concentrated under reduced pressure to give a yellow oil ( 2 . 6 g ). to a solution of 1 , 4 - benzoquinone ( 1 . 49 g , 13 . 8 mmol ) in nitromethane ( 5 ml ) was added a solution of the above yellow oil in nitromethane ( 3 . 5 ml ) slowly . the resulting mixture was stirred at room temperature for 18 h and was cooled to 0 ° c . and filtered . the solid was washed with cold nitromethane to yield ethyl 1 - benzyl - 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylate ( compound 1 ) as a beige solid . 1 h - nmr ( chloroform - d ) δ 1 . 45 ( t , j = 7 . 0 hz , 3 h ), 2 . 70 ( s , 3 h ), 4 . 40 ( q , j = 7 . 2 hz , 2 h ), 5 . 09 ( s , 1 h ), 5 . 31 ( s , 2 h ), 6 . 75 ( dd , j = 8 . 6 , 2 . 5 hz , 1 h ), 6 . 92 - 7 . 01 ( m , 2 h ), 7 . 08 ( d , j = 8 . 8 hz , 1 h ), 7 . 23 - 7 . 32 ( m , 3 h ), 7 . 65 ( d , j = 2 . 6 hz , 1 h ). general procedure 2 a solution of ethyl 1 - benzyl - 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylate ( compound 1 , 873 mg , 2 . 83 mmol ) and naoh ( 2 . 2 g , 56 mmol ) in etoh ( 10 ml ) and h 2 o ( 10 ml ) was heated to 90 ° c . for 16 h . the reaction was quenched with 6m hcl ( 10 ml ), extracted with etoac , washed with brine , dried over na 2 so 4 , and concentrated under reduced pressure . the residue was purified by flash column chromatography on silica gel ( 30 % etoac - hexanes to 20 % meoh - etoac ) to yield 1 - benzyl - 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylic acid ( compound 2 ) as a reddish brown solid . 1 h - nmr ( methanol - d 4 ) δ 2 . 67 ( s , 3 h ), 5 . 41 ( s , 2 h ), 6 . 68 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 6 . 96 - 7 . 03 ( m , 2 h ), 7 . 15 ( d , j = 8 . 8 hz , 1 h ), 7 . 20 - 7 . 32 ( m , 3 h ), 7 . 55 ( d , j = 2 . 1 hz 1 h ). general procedure 3 . to a solution of 1 - benzyl - 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylic acid ( compound 2 , 205 mg , 0 . 73 mmol ) in ch 2 cl 2 ( 5 ml ) and dmf ( 3 ml ) was added edc ( 211 mg , 1 . 1 mmol ), hobt ( 149 mg , 1 . 1 mmol ) and 3 , 5 - difluorobenzylamine ( 260 μl , 2 . 2 mmol ). the mixture was stirred at room temperature for 16 h , diluted with etoac , and washed with 1m hcl , and brine , and dried over na 2 so 4 , and concentrated under reduced pressure . the residue was purified by flash column chromatography on silica gel ( 30 % to 50 % etoac - hexanes ) to yield 1 - benzyl - 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylic acid , 3 , 5 - difluorobenzylamide ( compound 3 ) as a beige solid . 1 h - nmr ( methanol - d 4 ) δ 2 . 57 ( s , 3 h ), 4 . 61 ( s , 2 h ), 5 . 40 ( s , 2 h ), 6 . 70 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 6 . 77 - 6 . 88 ( m , 1 h ), 6 . 97 - 7 . 07 ( m , 4 h ), 7 . 14 - 7 . 19 ( m , 1 h ), 7 . 20 - 7 . 32 ( m , 4 h ). the following compounds were prepared using general procedures 1 , 2 and 3 and the appropriate amines and beta - ketoester starting materials , which are available from aldrich chemical company or prepared as described below : 1 h - nmr ( acetone - d 6 ) δ 2 . 73 ( s , 3 h ), 4 . 64 ( d , j = 6 . 1 hz , 2 h ), 5 . 59 ( s , 2 h ), 6 . 77 ( dd , j = 8 . 5 , 2 . 0 hz , 1 h ), 6 . 93 - 7 . 01 ( m , 2 h ), 7 . 25 - 7 . 40 ( m , 6 h ), 7 . 88 ( br s , 1 h ). 1 h - nmr ( acetone - d 6 ) δ 2 . 74 ( s , 3 h ), 4 . 68 ( d , j = 5 . 9 hz , 2 h ), 5 . 59 ( s , 2 h ), 6 . 77 ( dd , j = 8 . 8 , 2 . 4 hz , 1 h ), 6 . 93 - 7 . 33 ( m , 6 h ), 7 . 38 ( d , j = 15 . 6 hz , 2 h ), 7 . 9 ( br s , 1 h ). 1 h - nmr ( chloroform - d ) δ 0 . 95 ( t , j = 7 . 5 hz , 3 h ), 1 . 38 ( m , 2 h ), 1 . 70 ( m , 2 h ), 2 . 69 ( s , 3 h ), 4 . 03 ( t , j = 7 . 5 hz , 2 h ), 4 . 59 ( d , j = 6 . 1 hz , 2 h ), 5 . 81 ( s , 1 h ), 6 . 23 ( br t , 1 h ), 6 . 66 ( m , 1 h ), 6 . 80 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 86 ( br d , 2 h ), 7 . 15 ( br d , 2 h ). 1 h - nmr ( chloroform - d ) δ 0 . 95 ( t , j = 7 . 5 hz , 3 h ), 1 . 36 ( m , 2 h ), 1 . 70 ( m , 2 h ), 2 . 69 ( s , 3 h ), 4 . 03 ( t , j = 7 . 5 hz , 2 h ), 4 . 58 ( d , j = 6 . 1 hz , 2 h ), 5 . 75 ( s , 1 h ), 6 . 20 ( br t , 1 h ), 6 . 76 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 7 . 05 - 7 . 16 ( m , 5 h ). 1 h - nmr ( chloroform - d ) δ 2 . 67 ( s , 3 h ), 3 . 81 ( s , 3 h ), 4 . 67 ( d , j = 5 . 6 hz , 2 h ), 5 . 30 ( s , 2 h ), 6 . 17 ( t , j = 5 . 6 hz , 1 h ), 6 . 73 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 6 . 83 ( dd , j = 7 . 8 , 2 . 2 hz , 1 h ), 6 . 94 - 7 . 02 ( m , 4 h ), 7 . 09 ( d , j = 9 . 1 hz , 1 h ), 7 . 22 ( d , j = 2 . 3 hz , 1 h ), 7 . 23 - 7 . 33 ( m , 4 h ). 1 h - nmr ( acetone - d 6 ) δ 2 . 78 ( s , 3 h ), 4 . 64 ( d , j = 6 . 1 hz , 2 h ), 5 . 38 ( s , 2 h ), 6 . 34 - 6 . 37 ( m , 2 h ), 6 . 74 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 7 . 23 - 7 . 45 ( m , 6 h ), 7 . 81 ( s , 1 h ). 1 h - nmr ( acetone - d 6 ) δ 2 . 77 ( s , 3 h ), 4 . 68 ( d , j = 6 . 1 hz , 2 h ), 5 . 38 ( s , 2 h ), 6 . 34 - 6 . 39 ( m , 2 h ), 6 . 77 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 7 . 04 - 7 . 33 ( m , 3 h ), 7 . 39 ( d , j = 16 . 1 hz , 2 h ), 7 . 45 ( d , j = 2 . 6 hz , 1 h ), 7 . 88 ( b s , 1 h ). 1 h - nmr ( acetone - d 6 ) δ 2 . 78 ( s , 3 h ), 4 . 66 ( d , j = 6 . 2 hz , 2 h ), 5 . 59 ( s , 2 h ), 6 . 74 ( dd , j = 8 . 8 , 2 . 4 hz , 1 h ), 6 . 80 - 7 . 02 ( m , 3 h ), 7 . 08 ( d , j = 8 . 8hz , 1 h ), 7 . 28 ( d , j = 2 . 4 hz , 1 h ), 7 . 32 ( d , j = 5 . 0 hz , 1 h ), 7 . 38 ( d , j = 16 hz , 2 h ), 7 . 42 ( b s , 1 h ). 1 h - nmr ( acetone - d 6 ) δ 2 . 78 ( s , 3 h ), 4 . 66 ( d , j = 6 . 2 hz , 2 h ), 5 . 38 ( s , 2 h ), 6 . 34 - 6 . 39 ( m , 2 h ), 6 . 74 ( dd , j = 8 . 8 , 2 . 4 hz , 1 h ), 6 . 80 - 6 . 90 ( m , 1 h ), 7 . 08 ( dd , j = 8 . 8 , 2 . 4 hz , 1 h ), 7 . 23 - 7 . 32 ( m , 3 h ), 7 . 27 ( d , j = 2 . 4 hz , 1 h ) 7 . 42 ( d , j = 15 . 9 hz , 2 h ), 7 . 45 ( d , j = 2 . 1 hz , 1 h ), 7 . 84 ( s , 1 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 55 ( s , 3 h ), 4 . 57 ( s , 2 h ), 5 . 38 ( s , 2 h ), 6 . 69 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 99 ( 2 br d , 2 h ), 7 . 16 ( d , j = 8 . 8 hz , 1 h ), 7 . 17 - 7 . 30 ( m , 7 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 65 ( s , 3 h ), 4 . 60 ( s , 2 h ), 5 . 52 ( s , 2 h ), 6 . 73 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 90 - 7 . 00 ( m , 3 h ), 7 . 10 - 7 . 39 ( m , 6 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 64 ( s , 3 h ), 4 . 60 ( s , 2 h ), 5 . 52 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 91 ( 2 br d , 2 h ), 7 . 16 ( d , j = 2 . 2 hz , 1 h ), 7 . 24 - 7 . 27 ( m , 2 h ), 7 . 31 ( d , j = 4 . 0 hz , 1 h ), 7 . 35 ( d , j = 7 . 0 hz , 2 h ), 7 . 42 ( d , j = 7 . 5 hz , 2 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 67 ( s , 3 h ), 4 . 69 ( s , 2 h ), 5 . 55 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 94 ( m , 2 h ), 7 . 40 ( m , 1 h ), 7 . 20 ( m , 2 h ), 7 . 28 ( m , 1 h ), 7 . 32 ( overlap m , 1 h ), 7 . 32 ( d , j = 8 . 8 hz , 1 h ), 7 . 50 ( t , j = 7 . 5 hz , 1 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 68 ( s , 3 h ), 3 . 81 ( s , 3 h ), 4 . 61 ( s , 2 h ), 5 . 55 ( s , 2 h ), 6 . 75 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 85 ( dd , j = 2 . 5 , 8 . 4 hz , 1 h ), 6 . 94 ( m , 2 h ), 7 . 02 ( 2 br d , 2 h ), 7 . 19 ( d , j = 2 . 5 hz , 1 h ), 7 . 28 ( m , 2 h ), 7 . 32 ( d , j = 8 . 7 hz , 1 h ). 1 h - nmr ( methanol - d 4 ) δ 0 . 95 ( t , j = 7 . 5 hz , 3 h ), 1 . 39 ( m , 2 h ), 1 . 71 ( m , 2 h ), 2 . 60 ( s , 3 h ), 3 . 78 ( s , 3 h ), 4 . 11 ( t , j = 7 . 5 hz , 2 h ), 4 . 58 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 7 . 03 ( dd , j = 2 . 2 , 8 . 4 hz , 1 h ), 6 . 90 ( 2 br d , 2 h ), 7 . 15 ( d , j = 2 . 2 hz , 1 h ), 7 . 21 ( d , j = 8 . 8 hz , 1 h ), 7 . 26 ( d , j = 8 . 4 hz , 1 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 63 ( s , 3 h ), 4 . 58 ( s , 2 h ), 5 . 53 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( 2 br d , 2 h ), 7 . 06 ( t , j = 8 . 8 hz , 2 h ), 7 . 15 ( d , j = 2 . 2 hz , 1 h ), 7 . 25 ( dd , j = 4 . 0 , 6 . 6 hz , 1 h ), 7 . 29 ( d , a j = 8 . 8 hz , 1 h ), 7 . 35 ( dd , j = 13 . 6 , 8 . 4 hz , 2 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 32 ( s , 3 h ), 2 . 64 ( s , 3 h ), 4 . 55 ( s , 2 h ), 5 . 52 ( s , 2 h ), 6 . 73 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( m , 2 h ), 7 . 14 ( d , j = 2 . 2 hz , 1 h ), 7 . 15 ( d , j = 9 hz , 2 h ), 7 . 24 - 7 . 30 ( m , 4 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 65 ( s , 3 h ), 4 . 58 ( s , 2 h ), 5 . 53 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( 2 br d , 2 h ), 7 . 16 ( d , j = 2 . 2 hz , 1 h ), 7 . 24 - 7 . 34 ( m , 5 h ), 7 . 42 ( s , 1 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 64 ( s , 3 h ), 4 . 57 ( s , 2 h ), 5 . 52 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( 2 br dd , 2 h ), 7 . 15 ( d , j = 2 . 2 hz , 1 h ), 7 . 25 ( dd , j = 2 . 2 , 4 . 0 hz , 1 h ), 7 . 29 ( d , j = 9 hz , 1 h ), 7 . 35 ( d , j = 8 . 4 hz , 2 h ), 7 . 40 ( d , j = 8 . 4 hz , 2 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 64 ( s , 3 h ), 3 . 91 ( s , 3 h ), 4 . 60 ( s , 2 h ), 5 . 52 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 88 - 6 . 95 ( m , 3 h ), 7 . 00 ( d , j = 8 . 0 hz , 1 h ), 7 . 14 ( d , j = 2 . 2 hz , 1 h ), 7 . 24 - 7 . 35 ( m , 4 h ). 1 h - nmr ( methanol - d 4 ) δ 2 . 64 ( s , 3 h ), 4 . 67 ( s , 2 h ), 5 . 53 ( s , 2 h ), 6 . 73 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( m , 2 h ), 7 . 17 ( d , j = 2 . 2 hz , 1 h ), 7 . 25 ( dd , j = 2 . 2 , 4 . 0 hz , 1 h ), 7 . 30 ( d , j = 9 . 0 hz , 1 h ), 7 . 53 ( m , 2 h ), 7 . 70 ( m , 2 h ). 1 h - nmr ( methanol - d 4 ) δ 1 . 13 ( t , j = 7 . 5 hz , 3 h ), 3 . 04 ( q , j = 7 . 5 hz , 2 h ), 4 . 58 ( s , 2 h ), 5 . 41 ( s , 2 h ), 6 . 64 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 98 ( 2 br d , 2 h ) 7 . 10 ( d , j = 8 . 8 hz , 1 h ), 7 . 17 ( d , j = 2 . 2 hz , 1 h ), 7 . 20 - 7 . 35 ( m , 6 h ). 1 h - nmr ( methanol - d 4 ) δ 1 . 13 ( t , j = 7 . 5 hz , 3 h ), 3 . 04 ( q , j = 7 . 5 hz , 2 h ), 3 . 78 ( s , 3 h ), 4 . 60 ( d , j = 6 . 2 hz , 2 h ), 5 . 39 ( s , 2 h ), 6 . 64 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 80 ( br d , 1 h ), 6 . 98 ( 2br d , 4 h ), 7 . 08 ( d , j = 8 . 8 hz , 1 h ), 7 . 17 ( d , j = 2 . 2 hz , 1 h ), 7 . 22 - 7 . 25 ( m , 4 h ). 1 h - nmr ( chloroform - d ) δ 1 . 34 ( d , j = 7 . 0 hz , 6 h ), 3 . 57 - 3 . 74 ( m , 1 h ), 4 . 51 ( d , j = 5 . 9 hz , 2 h ), 5 . 36 ( s , 2 h ), 6 . 38 ( t , j = 6 . 0 hz , 1 h ), 6 . 68 ( dd , j = 8 . 8 , 2 . 3 hz , 1 h ), 6 . 87 - 6 . 95 ( m , 3 h ), 6 . 97 - 7 . 05 ( m , 2 h ), 7 . 05 - 7 . 16 ( m , 2 h ), 7 . 17 - 7 . 28 ( m , 3 h ). 1 h - nmr ( methanol - d 4 ) δ 1 . 13 ( t , j = 7 . 5 hz , 3 h ), 3 . 05 ( q , j = 7 . 5 hz , 2 h ), 4 . 61 ( s , 2 h ), 5 . 41 ( s , 2 h ), 6 . 68 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 82 ( m , 1 h ), 7 . 00 ( m , 4 h ), 7 . 11 ( d , j = 8 . 8 hz , 1 h ), 7 . 18 - 7 . 30 ( m , 4 h ). 1 h - nmr ( chloroform - d ) δ 1 . 39 ( d , j = 7 . 3 hz , 6 h ), 3 . 65 - 3 . 79 ( m , 1 h ), 4 . 68 ( d , j = 6 . 2 hz , 2 h ), 5 . 42 ( s , 2 h ), 6 . 32 ( t , j = 6 . 0 hz , 1 h ), 6 . 66 - 6 . 77 ( m , 2 h ), 6 . 89 - 6 . 98 ( m , 4 h ), 7 . 01 ( d , j = 8 . 8 hz , 1 h ), 7 . 13 ( d , j = 2 . 1 hz , 1 h ), 7 . 21 - 7 . 34 ( m , 3 h ). 1 h - nmr ( chloroform - d ) δ 1 . 38 ( d , j = 7 . 0 hz , 6 h ), 3 . 80 ( s , 3 h ), 4 . 67 ( d , j = 5 . 9 hz , 2 h ), 5 . 39 ( s , 2 h ), 6 . 22 ( t , j = 5 . 6 hz , 1 h ), 6 . 67 ( dd , j = 8 . 6 , 2 . 5 hz , 1 h ), 6 . 79 - 6 . 85 ( m , 1 h ), 6 . 89 - 7 . 02 ( m , 5 h ), 7 . 11 ( d , j = 2 . 3 hz , 1 h ), 7 . 20 - 7 . 32 ( m , 4 h ). 1h nmr ( methanol - d ) δ 4 . 39 ( s , 2 h ), 5 . 23 ( s , 2 h ), 6 . 67 ( 2d , j = 8 . 4 hz , 2 h ), 6 . 79 ( m , 2 h ), 6 . 90 ( 2 d , 8 . 4 hz , 2 h ), 7 . 17 ( d , j = 8 . 4 hz , 1 h ), 7 . 22 ( m , 3 h ), 7 . 39 - 7 . 47 ( m , 6 h ). the following compounds were prepared , by the general procedures illustrated in schemes 2 and 3 , below , from ethyl 1 - benzyl - 2 - methyl - 1h - indole - 3 - carboxylate ( compound 57 ), which was synthesized as described in general procedure 11 : 1 h - nmr ( chloroform - d ) δ 2 . 72 ( s , 3 h ), 4 . 71 ( d , j = 3 . 9 hz , 2 h ), 5 . 37 ( s , 2 h ), 6 . 72 ( dt , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 97 ( br dd , 3 h ), 7 . 19 - 7 . 30 ( m , 6 h ), 7 . 72 ( d , j = 7 . 0 hz , 1 h ). 1 h - nmr ( chloroform - d ) δ 2 . 72 ( s , 3 h ), 4 . 68 ( d , j = 6 . 1 hz , 2 h ), 5 . 37 ( s , 2 h ), 6 . 33 ( br s , 1 h ), 6 . 99 ( br d , 2 h ), 7 . 14 - 7 . 30 ( m , 9 h ), 7 . 70 ( d , j = 6 . 6 hz , 1 h ). 1 h - nmr ( chloroform - d ) δ 2 . 73 ( s , 3 h ), 4 . 73 ( d , j = 5 . 7 hz , 2 h ), 5 . 37 ( s , 2 h ), 6 . 32 ( br s , 1 h ), 6 . 99 ( br d , 3 h ), 7 . 12 - 7 . 36 ( m , 9 h ), 7 . 72 ( d , j = 6 . 6 hz , 1 h ). 1 h - nmr ( chloroform - d ) δ 2 . 72 ( s , 3 h ), 3 . 82 ( s , 3 h ), 4 . 71 ( d , j = 5 . 8 hz , 2 h ), 5 . 36 ( s , 2 h ), 6 . 27 ( br s , 1 h ), 6 . 85 ( dd , j = 2 . 4 . 8 . 8 hz , 1 h ), 7 . 00 ( br d , 3 h ), 7 . 17 ( m , 2 h ), 7 . 26 - 7 . 32 ( m , 6 h ), 7 . 72 ( m , 1 h ). general procedure 4 . to a solution of 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxaldehyde ( 500 mg , 2 . 45 mmol ) in dmf ( 5 ml ) was added potassium carbonate ( 1 . 0 g , 7 . 35 mmol ) and benzyl bromide ( 0 . 44 ml , 3 . 68 mmol ). the mixture was stirred at room temperature for 4 h , diluted with etoac , washed with h 2 o , brine , dried over na 2 so 4 , and concentrated under reduced pressure . the residue was triturated with et 2 o - hexane to yield 1 - benzyl - 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxaldehyde ( compound 50 ) as a yellow solid ( 600 mg , 83 %). 1 h - nmr ( methanol - d 4 ) δ 2 . 76 ( s , 3 h ), 5 . 60 ( s , 2 h ), 7 . 04 - 7 . 11 ( m , 2 h ), 7 . 26 - 7 . 37 ( m , 3 h ), 7 . 60 ( d , j = 9 . 1 hz , 1 h ), 8 . 15 ( dd , j = 8 . 9 , 2 . 2 hz , 1 h ), 9 . 11 ( d , j = 2 . 3 hz , 1 h ), 10 . 20 ( s , 1 h ). general procedure 5 . to a suspension of 1 - benzyl - 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxaldehyde ( compound 50 , 150 mg , 0 . 51 mmol ) in acetonitrile ( 6 ml ), tert - butanol ( 6 ml ) and h 2 o ( 6 ml ) was added 2 - methyl - 2 - butene ( 4 ml ), potassium phosphate monobasic ( 1 . 4 g , 10 . 2 mmol ), sodium chlorite ( 80 %, 1 . 15 g , 10 . 2 mmol ). the mixture was stirred at room temperature for 20 h , more potassium phosphate monobasic ( 0 . 35 g , 2 . 6 mmol ) and sodium chlorite ( 80 %, 0 . 29 g , 2 . 6 mmol ) were added and stirred at room temperature for 24 h . the solvent was removed under reduced pressure . the residue solid was washed with h 2 o (× 3 ) and filtered , dissolved in acetone and filtered to yield 1 - benzyl - 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxylic acid ( compound 51 ) as a yellow powder ( 160 mg , 100 %). 1 h - nmr ( acetone - d 6 ) δ 2 . 83 ( s , 3 h ), 5 . 68 ( s , 2 h ), 7 . 06 - 7 . 15 ( m , 2 h ), 7 . 25 - 7 . 41 ( m , 3 h ), 7 . 68 ( d , j = 9 . 1 hz , 1 h ), 8 . 10 ( dd , j = 9 . 1 , 2 . 3 hz , 1 h ), 9 . 11 ( d , j = 2 . 3 hz , 1 h ). the title compound was prepared from 1 - benzyl - 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxylic acid ( compound 51 ) by general procedure 3 . 1 h - nmr ( dmso - d 6 ) δ 2 . 60 ( s , 3 h ), 4 . 51 ( d , j = 6 . 2 hz , 2 h ), 5 . 60 ( s , 2 h ), 7 . 01 - 7 . 08 ( m , 2 h ), 7 . 20 - 7 . 49 ( m , 6 h ), 7 . 74 ( d , j = 8 . 8 hz , 1 h ), 8 . 05 ( dd , j = 9 . 1 , 2 . 3 hz , 1 h ), 8 . 57 ( t , j = 5 . 7 hz , 1 h ), 8 . 71 ( d , j = 2 . 1 hz , 1 h ). the title compound was prepared from 5 -( benzyloxy )- 1h - indole - 3 - carboxaldehyde by , in order , general procedures 4 , 5 , and 3 . 1 h - nmr ( methanol - d 4 ) δ 4 . 53 ( s , 2 h ), 5 . 11 ( s , 2 h ), 5 . 39 ( s , 2 h ), 6 . 92 ( dd , j = 9 . 1 , 2 . 3 hz , 1 h ), 7 . 14 - 7 . 39 ( m , 12 h ), 7 . 43 - 7 . 49 ( m , 2 h ), 7 . 79 ( d , j = 2 . 3 hz , 1 h ), 7 . 91 ( s , 1 h ). general procedure 6 . to a solution of 1 - benzyl - 2 - methyl - 5 - nitro - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 45 , 97 mg , 0 . 22 mmol ) in meoh ( 20 ml ) and etoac ( 20 ml ) was added pd — c ( 10 %, 47 mg , 0 . 045 mmol ). the reaction was stirred under hydrogen for 24 h , filtered through celite , washed with meoh - etoac ( 1 : 1 ) to yield 5 - amino - 1 - benzyl - 2 - methyl - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 46 ) as a white solid ( 93 mg , 100 %). 1 h - nmr ( methanol - d 4 ) δ 2 . 54 ( s , 3 h ), 4 . 58 ( s , 2 h ), 5 . 35 ( s , 2 h ), 6 . 69 ( dd , j = 8 . 5 , 2 . 1 hz , 1 h ), 6 . 95 - 7 . 01 ( m , 2 h ), 7 . 12 ( d , j = 8 . 5 hz , 1 h ), 7 . 16 - 7 . 36 ( m , 6 h ). the title compound was prepared from 1 - benzyl - 5 -( benzyloxy )- 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 52 ) by general procedure 6 . 1 h - nmr ( methanol - d 4 ) δ 4 . 52 ( s , 2 h ), 5 . 36 ( s , 2 h ), 6 . 74 ( dd , j = 8 . 8 , 2 . 6 hz , 1 h ), 7 . 12 - 7 . 36 ( m , 9 h ), 7 . 54 ( d , j = 2 . 1 hz , 1 h ), 7 . 86 ( s , 1 h ). general procedure 7 . to a solution of 5 - amino - 1 - benzyl - 2 - methyl - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 46 , 50 mg , 0 . 12 mmol ) in pyridine ( 3 ml ) was added acetic anhydride ( 120 μl , 1 . 23 mmol ). the reaction was stirred at room temperature for 72 h , diluted with etoac , washed successively with 1m hcl , h 2 o , brine , dried over na 2 so 4 , and concentrated under reduced pressure . the residue was crystallized from ch 2 cl 2 - et 2 o to yield 5 - acetamido - 1 - benzyl - 2 - methyl - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 47 ) as a white solid ( 37 mg , 68 %). 1 h - nmr ( methanol - d 4 ) δ 2 . 13 ( s , 3 h ), 2 . 58 ( s , 3 h ), 4 . 59 ( s , 2 h ), 5 . 44 ( s , 2 h ), 6 . 96 - 7 . 04 ( m , 2 h ), 7 . 14 - 7 . 37 ( m , 9 h ), 7 . 99 ( d , j = 2 . 1 hz , 1 h ). general procedure 8 . to a mixture of 5 - hydroxy - 2 - methyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( 0 . 76 g , 3 . 47 mmol ) and potassium carbonate ( 0 . 92 g , 6 . 67 mmol ) in acetonitrile ( 10 ml ) was added benzyl bromide ( 1 . 0 ml , 1 . 4 g , 8 . 4 mmol ). the mixture was heated at 75 - 80 ° c . for 18 h . the reaction was cooled to room temperature , quenched with water , extracted with etoac , washed with brine , dried over na 2 so 4 , and concentrated under reduced pressure . the residue was purified by flash column chromatography on silica gel ( 30 % etoac - hexanes ) to yield 5 - benzyloxy - 2 - methyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( compound 53 ) as a yellow solid ( 0 . 56 g , 52 %). 1 h - nmr ( methanol - d 4 ) δ 1 . 39 ( t , j = 7 . 0 hz , 3 h ), 2 . 64 ( s , 3 h ), 4 . 32 ( q , j = 7 . 0 hz , 2 h ), 5 . 10 ( s , 2 h ), 6 . 84 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 7 . 20 ( d , j = 8 . 8 hz , 1 h ), 7 . 23 - 7 . 40 ( m , 5 h ), 7 . 45 ( 2 br d , 2 h ), 7 . 58 ( d , 2 . 2 hz , 1 h ). general procedure 9 . to a mixture of 5 - benzyloxy - 2 - methyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( compound 53 , 0 . 14 g , 0 . 45 mmol ) in toluene ( 6 ml ) having been degassed under argon for 15 min . was added 2 - iodo - benzene ( 0 . 10 ml , 0 . 48 g , 0 . 88 mmol ), potassium phosphate ( 0 . 20 g , 0 . 94 mmol ), copper ( i ) iodide ( 24 mg , 0 . 13 mmol ), and then n , n ′- dimethylethylenediamine ( 12 mg , 0 . 14 mmol ) with continued degassing . the tube was then sealed and mixture was heated at 140 ° c . for 24 h . the reaction was then cooled and filtered . the filtrate was concentrated under reduced pressure and the crude product residue was purified by flash column chromatography on silica gel ( 30 % etoac - hexanes ) to yield 5 - benzyloxy - 2 - methyl - 1 - phenyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( compound 54 ) as an orange oil ( 0 . 13 g , 76 %). 1 h - nmr ( chloroform - d ) δ 1 . 44 ( t , j = 7 . 0 hz , 3 h ), 2 . 57 ( s , 3 h ), 4 . 42 ( q , j = 7 . 0 hz , 2 h ), 5 . 16 ( s , 2 h ), 6 . 86 ( dd , j = 2 . 7 , 8 . 8 hz , 1 h ), 6 . 92 ( d , j = 8 . 8 hz , 1 h ), 7 . 25 - 7 . 41 ( m , 5 h ), 7 . 48 - 7 . 60 ( m , 5 h ), 7 . 78 ( d , j = 2 . 7 hz , 1 h ). the title compound was prepared from 5 - benzyloxy - 2 - methyl - 1 - phenyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( compound 54 ) by general procedure 2 . 1 h - nmr ( methanol - d 4 ) δ 2 . 60 ( s , 3 h ), 5 . 12 ( s , 2 h ), 6 . 84 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 90 ( d , j = 8 . 8 hz , 1 h ), 7 . 26 - 7 . 63 ( m , 10 h ), 7 . 77 ( d , j = 2 . 6 hz , 1 h ). the title compound was prepared from 5 - benzyloxy - 2 - methyl - 1 - phenyl - 1h - indole - 3 - carboxylic acid ( compound 55 ) by general procedure 3 . 1 h - nmr ( methanol - d 4 ) δ 2 . 44 ( s , 3 h ), 4 . 60 ( s , 2 h ), 5 . 10 ( s , 2 h ), 6 . 85 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 90 ( d , j = 8 . 8 hz , 1 h ), 7 . 21 - 7 . 45 ( m , 8 h ), 7 . 54 - 7 . 66 ( m , 3 h ). general procedure 10 . to a mixture of 5 - benzyloxy - 2 - methyl - 1 - phenyl - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluoro - benzylamide ( compound 56 , 0 . 15 g , 0 . 31 mmol ) in methanol ( 15 ml ), which was degassed with argon for 10 min , was added 10 % palladium on carbon ( 0 . 17 g ), with continued degassing . the reaction was placed in par tube on hydrogenator and hydrogenated at 45 psi for 18 h . the reaction was then filtered , concentrated under reduced pressure and the crude product residue was purified by flash column chromatography on silica gel ( 30 % etoac - hexanes ) to yield 5 - hydroxy - 2 - methyl - 1 - phenyl - 1h - indole - 3 - carboxylic acid , 3 , 4 - difluorobenzylamide ( compound 29 ) as a solid ( 0 . 11 g , 92 %). 1 h - nmr ( methanol - d 4 ) δ 2 . 42 ( s , 3 h ), 4 . 59 ( s , 2 h ), 6 . 66 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 82 ( d , j = 8 . 8 hz , 1 h ), 7 . 21 - 7 . 26 ( m , 3 h ), 7 . 30 - 7 . 40 ( m , 3 h ), 7 . 53 - 7 . 65 ( m , 3 h ). the title compound was prepared from 2 - iodo - pyridine by following , in order , general procedures 8 , 9 , 2 , 3 and 10 . 1 h - nmr ( methanol - d 4 ) δ 2 . 51 ( s , 3 h ), 4 . 59 ( s , 2 h ), 6 . 70 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 7 . 03 ( d , j = 8 . 8 hz , 1 h ), 7 . 20 - 7 . 26 ( m , 3 h ), 7 . 33 ( m , 1 h ), 7 . 55 ( m , 2 h ), 8 . 10 ( dt , j = 2 . 2 , 8 . 8 hz , 1 h ), 8 . 65 ( dd , j = 2 . 2 , 5 . 7 hz , 1 h ). the title compound was prepared from 2 - iodothiophene by following , in order , general procedures 8 , 9 , 2 , 3 and 10 . 1 h - nmr ( methanol - d 4 ) δ 2 . 45 ( s , 3 h ), 4 . 58 ( s , 2 h ), 6 . 70 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 94 ( d , j = 8 . 8 hz , 1 h ), 7 . 12 ( dd , j = 1 . 3 , 3 . 5 hz , 1 h ), 7 . 16 - 7 . 46 ( m , 5 h ), 7 . 55 ( dd , j = 1 . 4 , 5 . 7 hz , 1 h ). the title compound was prepared from methyl iodide by following , in order , general procedures 8 , 9 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 2 . 55 ( s , 3 h ), 3 . 85 ( s , 3 h ), 4 . 72 ( d , j = 6 . 1 hz , 2 h ), 6 . 25 ( br s , 1 h ), 6 . 73 ( m , 1 h ), 6 . 80 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 97 ( 2d , j = 8 . 8 hz , 3 h ), 7 . 26 - 7 . 33 ( m , 3 h ), 7 . 51 - 7 . 60 ( m , 3 h ). the title compound was prepared from methyl iodide by following , in order , general procedures 8 , 9 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 2 . 73 ( s , 3 h ), 3 . 69 ( s , 3 h ), 3 . 84 ( s , 3 h ), 4 . 69 ( d , j = 6 . 1 hz , 2 h ), 6 . 19 ( br s , 1 h ), 6 . 71 ( dt , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 91 ( dd , j = 2 . 2 8 . 8 hz , 1 h ), 6 . 95 ( br d , 2 h ), 7 . 19 ( d , j = 2 . 2 hz , 1 h ), 7 . 21 - 7 . 26 ( m , 1 h ). the title compound was prepared from methyl iodide by following , in order , general procedures 8 , 9 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 2 . 73 ( s , 3 h ), 3 . 68 ( s , 3 h ), 3 . 81 ( s , 3 h ), 4 . 71 ( d , j = 6 . 1 hz , 2 h ), 6 . 15 ( br s , 1 h ), 6 . 87 ( dd , j = 2 . 2 , 8 . 8 hz , 1 h ), 6 . 97 ( m , 2 h ), 7 . 13 ( 2 br d , 1 h ), 7 . 18 ( d , j = 2 . 6 hz , 1 h ), 7 . 22 ( d , j = 8 . 4 hz , 2 h ). the title compound was prepared from 2 - iodopyridine by following , in order , general procedures 8 , 9 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 2 . 52 ( s , 3 h ), 4 . 60 ( s , 2 h ), 5 . 10 ( s , 2 h ), 6 . 89 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 7 . 10 ( d , j = 8 . 8 hz , 1 h ), 7 . 21 - 7 . 45 ( m , 6 h ), 7 . 55 ( 2 br , d , 2 h ), 8 . 10 ( dt , j = 2 . 2 , 7 . 9 hz , 1 h ), 8 . 65 ( m , 1 h ). general procedure 11 .- to a mixture of sodium hydride ( 0 . 28 g , 60 % in mineral oil , 0 . 17g , 7 . 0 mmol ) in 10 ml of tetrahydrofuran stirring at 0 ° c . under argon , was added 2 - methyl - 1h - indole - 3 - carboxylic acid ethyl ester ( 1 . 17 g , 5 . 8 mmol ) and the solution was stirred at 0 ° c . for 15 min . benzyl bromide ( 0 . 80 ml , 1 . 15 g , 6 . 7 mmol ) was then added and the reaction allowed to warm to room temperature and stirred for 24 h . the reaction was cooled to 0 ° c ., quenched with water , extracted with etoac , washed with brine , dried over na 2 so 4 , and concentrated under reduced pressure . the residue was purified by flash column chromatography on silica gel ( 40 % etoac - hexanes ) to yield 1 - benzyl - 2 - methyl - 1h - indole - 3 - carboxylic acid , ethyl ester ( compound 57 ) as a tan solid ( 1 . 13 g , 67 %). 1 h - nmr ( chloroform - d ) δ 1 . 46 ( t , j = 7 . 0 hz , 3 h ), 2 . 73 ( s , 3 h ), 4 . 42 ( q , j = 7 . 0 hz , 2 h ), 5 . 36 ( s , 2 h ), 6 . 97 ( dd , j = 2 . 1 , 8 . 8 hz , 2 h ), 7 . 15 - 7 . 30 ( m , 6 h ), 8 . 17 ( d , j = 8 . 5 hz , 1 h ). the title compound was prepared from 2 - bromomethylthiophene by following , in order , general procedures 11 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 2 . 81 ( s , 3 h ), 4 . 66 ( s , 2 h ), 5 . 49 ( s , 2 h ), 6 . 29 ( br s , 1 h ), 6 . 83 ( br d , 1 h ), 6 . 91 ( m , 1 h ), 7 . 12 - 7 . 26 ( m , 4 h ), 7 . 42 ( m , 2 h ), 7 . 68 ( m , 2 h ). the title compound was prepared from 2 - bromomethylthiophene by following , in order , general procedures 11 , 2 and 3 . 1 h - nmr ( chloroform - d ) δ 1 . 56 ( s , 3 h ), 2 . 81 ( s , 2 h ), 3 . 81 ( s , 3 h ), 4 . 69 ( d , j = 5 . 7 hz , 1 h ), 5 . 48 ( s , 2 h ), 6 . 25 ( br t , 1h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 88 - 6 . 95 ( m , 3 h ), 7 . 00 ( d , j = 8 . 0 hz , 1 h ), 7 . 14 ( d , j = 2 . 2 hz , 1 h ), 6 . 84 ( br d , 2 h ), 6 . 91 ( m , 1 h ), 6 . 99 ( m , 2 h ), 7 . 17 - 7 . 22 ( m , 3 h ), 7 . 30 ( d , j = 8 . 0 hz , 1 h ), 7 . 39 ( d , j = 7 . 0 hz , 1 h ), 7 . 68 ( d , j = 2 . 2 hz , 1 h ). the title compound was prepared from 2 - bromomethylthiophene by following , in order , general procedures 11 , 2 and 3 . 1 h - nmr ( methanol - d 4 ) δ 2 . 63 ( s , 3 h ), 4 . 58 ( s , 2 h ), 5 . 53 ( s , 2 h ), 6 . 72 ( dd , j = 2 . 6 , 8 . 8 hz , 1 h ), 6 . 91 ( 2 br d , 2 h ), 7 . 06 ( t , j = 8 . 8 hz , 2 h ), 7 . 15 ( d , j = 2 . 2 hz , 1 h ), 7 . 25 ( dd , j = 4 . 0 , 6 . 6 hz , 1 h ), 7 . 29 ( d , j = 8 . 8 hz , 1 h ), 7 . 35 ( dd , j = 13 . 6 , 8 . 4 hz , 2 h ). the foregoing description details specific methods and compositions that can be employed to practice the present invention , and represents the best mode contemplated . thus , however detailed the foregoing may appear in text , it should not be construed as limiting the overall scope hereof , rather , the ambit of the present invention was to be governed only by the lawful construction of the appended claims .

US-67516807-A

a medical dressing for treating open chest injuries , or other injuries that compromise or could possibly compromise the pleural space of the chest cavity . specifically , a medical dressing used by first responders to treat an open pneumothorax , treat and / or prevent a tension pneumothorax from developing , remove the accumulated blood of a hemothorax or re - inflating a collapsed lung without invasive procedures and in some instances act as a conduit for treating a tension pneumothorax or a collapsed lung with invasive procedures .

referring to fig1 and 3 , medical dressing ( 10 ) is comprised of one - way valve ( 20 ) and body attaching means ( 12 ) whose center translates into duct segment ( 16 ). body attaching means ( 12 ) has a top side ( 17 ) and an underside ( 19 ) ( see fig5 ). referring to fig5 underside ( 19 ) of body attaching means ( 12 ) includes non - adhesive underside section ( 30 ) and adhesive underside section ( 14 ). referring again to fig1 and 2 , tear - away backing ( 13 ) covers underside ( 19 ) and is attached to adhesive underside section ( 14 ). one - way valve ( 20 ) has sides ( 28a - b ), lower end ( 24 ), and air exit end ( 26 ). body attaching means ( 12 ) has non - adhesive finger hold ( 11 ) positioned proximate to non - adhesive finger hold ( 15 ) of tear - away backing ( 13 ), such that the care provider may pull non - adhesive finger hold ( 15 ) away from non - adhesive finger hold ( 11 ) to remove tear - away backing ( 13 ) from adhesive underside section ( 14 ). referring to fig1 the center of body attaching means ( 12 ) translates into duct segment ( 16 ). duct segment ( 16 ) allows exhaled air from the wound to pass through body attaching means ( 12 ), into one - way valve ( 20 ) and through air exit end ( 26 ) of one - way valve ( 20 ). referring to fig8 duct segment ( 16 ) is comprised of first conical section ( 40 ), cylindrical section ( 42 ) and second conical section ( 44 ). the interior of lower end ( 24 ) of one - way valve ( 20 ) is attached to the exterior of cylindrical section ( 42 ) of duct segment ( 16 ) by an adhesive material that is capable of being sterilized . one - way valve ( 20 ) is made of natural rubber , vinyl or other materials which will allow sides ( 28a - b ) of one - way valve ( 20 ) to separate when air is expelled from the wound hole through the interior of one - way valve ( 20 ), yet allows sides ( 28a - b ) to collapse against each other after the air has been expelled . the preferred material being natural rubber . body attaching means ( 12 ) is made of a flexible polymeric material capable of being sterilized and yet sufficiently rigid such that the sides of duct segment ( 16 ) do not collapse against each other during normal operation . the preferred being a styrene block copolymer that is impermeable to both air and fluid such as kraton 62700 series styrene block copolymers product nos . 2705 , 2706 and 2712 by shell oil company . adhesive underside segment ( 14 ) is created by applying most non - air permeable hypo - allergenic adhesives to underside ( 19 ) of body attaching means ( 12 ), the preferred being a doubled - sided , pressure sensitive adhesive product no . 1524 by 3m . one - way valve ( 20 ) and body attaching means ( 12 ) may also be made of clear materials that will enable the care provider to view the wound even after medical dressing ( 10 ) is applied . body attaching means ( 12 ) and one - way valve ( 20 ) are constructed of pliable , flexible materials so that medical dressing ( 10 ) will adhere to any contour of the human body , including the female breast or a well developed male chest . this is an important feature as current day medical dressings are not normally capable of conforming to these areas . the flexibility of one - way valve ( 20 ) also allows medical dressing ( 10 ) to be attached to the downside of the patient . although one - way valve ( 20 ) may not open to allow air to be expelled because the patient is lying on the valve , the flexibility of body attaching means ( 12 ) and one - way valve ( 20 ) of medical dressing ( 10 ) assures that the tissue surrounding the wound will not be further traumatized due to hard or unbendable materials putting pressure on the patient &# 39 ; s traumatized skin , and applicant &# 39 ; s device will be operable when ( 1 ) the patient is not lying on it . the flexibility of one - way valve ( 20 ) and the manner in which duct segment ( 16 ) of body attaching means ( 12 ) is attached to one - way valve ( 20 ) assures medical dressing ( 10 ) can be packaged in a generally flat , envelope manner . in this manner , medical dressing ( 10 ) is either as small as , or possibly smaller , than current day aluminum / gauze dressing . consequently , in medical situations where supply space is in short demand , at least the same number of medical dressings ( 10 ) may be packed as prior art gauze / aluminum dressings . this is specially important in medic packs utilized in war zones or on battle fields . medical dressing ( 10 ) may also be constructed such that one - way valve ( 20 ) and body attaching means ( 12 ) are one sheet of pliable plastic and / or other material that is non - permeable yet capable of being sterilized . to use medical dressing ( 10 ) in a non - invasive procedure , the patient &# 39 ; s skin around the wound hole is wiped clear of blood and sweat to enhance the adhesive effect of adhesive underside section ( 14 ) of underside ( 19 ) of body attaching means ( 12 ). tear - away backing ( 13 ) is removed from adhesive underside segment ( 14 ) of underside ( 19 ) of body attaching means ( 12 ) by pulling finger hold ( 11 ) of body attaching means ( 12 ) in an opposite direction from finger hold ( 15 ) of tear - away backing ( 13 ). duct segment ( 16 ) of body attaching means ( 12 ) and one - way valve ( 20 ) are positioned over the wound hole ( see fig7 ). this placement assures duct segment ( 16 ), one - way valve ( 20 ), and air exit end ( 26 ) of one - way valve ( 20 ) are appropriately positioned over the wound hole . adhesive segment ( 14 ) of underside ( 19 ) of body attaching means ( 12 ) is then pressed against the skin to assure medical dressing ( 10 ) attaches securely to the skin of the patient . as the patient exhales , air is released through duct segment ( 16 ) via body attaching means ( 12 ) into one - way valve ( 20 ) and out through air exit end ( 26 ) of one - way valve ( 20 ) by the separation of sides ( 28a - b ) of one - way valve ( 20 ). after the exhaled air exits through air exit end ( 26 ) of one - way valve ( 20 ), sides ( 28a - b ) of one - way valve ( 20 ) collapse back against each other , thus preventing air from returning through one - way valve ( 20 ) when the patient inhales . additionally , as the patient inhales , sides ( 28a - b ) of one - way valve ( 20 ) are sucked against each other , further preventing air from entering the wound through one - way valve ( 20 ). if the patient has a multitude of chest wounds , including wounds on the downside , medical dressing ( 10 ) is applied to each wound . when the patient exhales , and one - way valve ( 20 ) is operable , sides ( 28a - b ) of one - way valve ( 20 ) make an audible flutter . if body attaching means ( 12 ) and one - way valve ( 20 ) are made of a clear material , the care provider may also visually determine if the one - way valve is clogged . because of the accessibility of one - way valve ( 20 ), if one - way valve ( 20 ) becomes inoperable due to clogging with blood or other fluids , a suction device can be inserted into one - way valve ( 20 ) to immediately remove any material that may be causing one - way valve ( 20 ) to be inoperable without breaking the seal created between the wound and one - way valve ( 20 ) or requiring replacement of medical dressing ( 10 ). referring to fig9 if a hemothorax or a collapsed lung is to be treated without invasive procedures , suction device ( s ) is inserted into one - way valve ( 20 ) and duct segment ( 16 ) by forcing sides ( 28a - b ) of one - way valve ( 20 ) apart and inserting suction device ( s ) into one - way valve ( 20 ). tip ( t ) of suction device ( s ) is positioned directly above the wound hole . in this manner , suction device ( s ) removes fluids , air and blood clots which may be on the surface of or being expelled out of the wound hole . if a hemothorax is being treated , the patient may also be turned on the side which has the wound . in this position , blood may drain from the pleural space through the wound hole which suction device ( s ) may collect . fig1 illustrates medical dressing ( 10 ) being used as a conduit for a catheter ( c ). if a severe tension pneumothorax or a collapsed lung is to be treated with invasive procedure , the catheter ( c ) is inserted into the patient &# 39 ; s chest near the second intercostal space ( between the second and third rib ) in the mid - clavicular line ( an imaginary line going straight down from the center of the clavicle ) of the patient &# 39 ; s chest on the side of the tension pneumothorax or collapsed lung until trapped air begins to escape from the pleural space . catheter ( c ) remains in the chest until all pressure is relieved . medical dressing ( 10 ) is positioned such that one - way valve ( 20 ) and duct segment ( 16 ) encircle catheter ( c ). to use , sides ( 28a ) and ( 28b ) of one - way valve ( 20 ) are forced apart and catheter ( c ) is inserted into one - way valve ( 20 ). adhesive underside segment ( 14 ) of underside ( 19 ) of body attaching means ( 12 ) is then applied to the skin securing medical dressing ( 10 ) such that one - way valve ( 20 ) of medical dressing ( 10 ) supports catheter ( c ). catheter ( c ) can remain in the patient &# 39 ; s chest for an unlimited amount of time . leaving catheter ( c ) in the lung assures that a crisis situation will not arise again . by using medical device ( 10 ), catheter ( c ) is sufficiently protected and supported such that catheter ( c ) will not be moved into a position that could be detrimental to the patient . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the appended claims will cover such modifications that fall within the scope of the invention .

US-20701794-A

in an automated methodology for in vivo image - guided cell patch clamping , a cell patch clamping device is moved into position and targeted to a specific cell using automated image - guided techniques . cell contact is determined by analyzing the temporal series of measured resistance levels at the clamping device as it is moved . the difference between successive resistance levels is compared to a threshold , which must be exceeded before cell contact is assumed . pneumatic control methods are used to achieve gigaseal formation and cell break - in , leading to whole - cell patch clamp formation . an automated robotic system capable of performing this methodology automatically performs patch clamping in vivo , automatically locating cells through image guidance and by analyzing the temporal sequence of electrode impedance changes . by continuously monitoring the patching process and rapidly executing actions triggered by specific measurements , the robot can rapidly find target cells in vivo and establish patch - clamp recordings .

in one aspect , the present invention is an apparatus and a methology that enable automated image - guided whole - cell patch clamp recordings in vivo . the invention is related to and builds on the inventions disclosed in u . s . pat . no . 9 , 668 , 804 , issued jun . 6 , 2017 , which claims the benefit of u . s . provisional application ser . no . 61 / 558 , 841 , filed nov . 11 , 2011 , and u . s . pat . no . 9 , 498 , 293 , issued nov . 22 , 2016 , which claims the benefit of u . s . provisional application ser . no . 61 / 726 , 008 , filed nov . 13 , 2012 , the entire disclosures of which are herein incorporated by reference . a robotic system according to the invention automatically completes the tasks involved in two - photon image - guided patch clamp recordings . specifically , a robot according to the invention fully automates movement of a patch pipette onto the targeted cell , formation of a gigaohm seal , and break - in for the whole - cell configuration , all of which are critical for successful patch - clamp recordings . with appropriate fluorescence labeling techniques , the current invention can target a specific cell type to record from , making it possible to perform experiments that are not feasible with the previous blind autopatcher . for example , systematic and specific examination of specific target genetically modified cells or sparse cell types can be easily and automatically performed with the current invention , whereas these types of studies are impractical with the blind autopatcher , which is unbiased and tends to capture abundant cell types . in contrast to the image - guided automatic pipette positioning system of long et al ., the current invention automates the critical procedures for patch - clamp recordings , including moving the pipette further to make its tip touch the target cell , forming a tight gigaohm seal by adjusting pressure applied to the pipette , and establishing the whole - cell configuration by applying a strong pulse of suction at the pipette tip , making it a fully automated system for two - photon image - guided patch clamp recordings . in one aspect of the invention , closed - loop image - guided pipette positioning inside the brain is a unique feature that allows the system to fully automate patch - clamp recordings . this closed - loop closely mimics the manual approach that an expert experimenter would use to bring a patch pipette onto the target cell membrane , and it can be broken down to three main stages : ( i ) a target cell image is acquired and its center location is automatically detected to determine if it has moved from its original position due to the movement of the pipette inside the brain ; ( ii ) the x - and y - offsets between the pipette tip and the target cell center are determined based on the pipette location , which is calculated using its initial position and movement , and the pipette is moved to compensate for these offsets ; and ( iii ) the pipette takes a μm - sized step towards the target cell in the z - direction , and the loop returns to the first stage . with this loop , it can be ensured that every target cell movement is accounted for and the pipette tip makes contact with the specific target cell membrane . fig1 depicts an example embodiment of an automated two - photon image - guided patch clamp methodology for use in an automated two - photon image - guided autopatcher , which is a fully automated system for targeted whole - cell recordings in vivo . in the embodiment of fig1 , target cell imaging and detection step 110 employs microscope objective 112 to locate target cell 114 in brain 116 . this is followed by open - loop pipette positioning step 120 , which positions and prepares pipette 122 for closed - loop image - guided pipette positioning step 130 , which comprises the steps of iteratively detecting position offsets 132 , moving pipette 122 to target cell 114 center 134 , and moving pipette 122 down 136 to contact target cell 114 . once target cell contact is achieved , the steps of gigaseal formation 160 , using light suction , and break - in 170 , using strong suction , achieve the whole - cell patch clamp . in a particular aspect , the invention includes a method for automatically detecting the location of the pipette tip from a stack of two - photon images taken around the pipette of interest . the method is developed based on the finding that , for pipettes at a steep angle ( for example , from 30 degrees to 60 degrees ), the image near or right at the focal plane of the pipette tip has its brightest pixels ( i . e . pixels with highest intensity values ) further away from the edge of the image compared to the images that are more off - focus . the method applies identical filtering and thresholding operations on all of the images in order to find the brightest pixels and their locations in each image . the image with its brightest locations most distant from the edge of the image is considered at the focal plane of the pipette tip ( i . e . the z - location of the image is considered equal to the z - location of the pipette tip ). fig2 a - c is an overall flowchart of the methodology employed in a preferred embodiment of an automated two - photon image - guided autopatcher , according to the present invention . in fig2 a - c , r 0 is pipette resistance inside artificial cerebrospinal fluid ( acsf ), above the brain surface ; r b1 is pipette resistance inside the brain , 40 μm above the target cell ; r b2 is pipette resistance inside the brain , 20 μm above the target cell ; r ( t ) is the first of three consecutive pipette resistance values measured while stepping towards the target cell ; r ( t + 1 ) is the second of three consecutive pipette resistance values measured while stepping towards the target cell ; r ( t + 2 ) is the third of three consecutive pipette resistance values measured while stepping towards the target cell ; r ( t + 3 ) is the first of two consecutive pipette resistance values used to determine if the contact between the pipette and the cell membrane is tight ; r ( t + 4 ) is the second of two consecutive pipette resistance values used to determine if the contact between the pipette and the cell membrane is tight ; r ( before suction ) is the pipette resistance measured right before suction for sealing is applied ; r suction is the pipette resistance measured every 1 second after applying suction during gigaseal formation ; r hyper is the pipette resistance measured every 1 second after applying hyperpolarizing voltage during gigaseal formation ; r sealing is the pipette resistance measured every 1 second after releasing suction during gigaseal formation ; and r break is the pipette resistance measured every 1 second during break - in . as shown in fig2 a , during target cell imaging stage 210 , the system performs automated imaging and identification of fluorescently - labeled cells inside the brain , after which a target cell to patch is selected ( fig3 ). this is followed by pipette imaging stage 220 , during which a pipette is installed , initial pipette images are acquired , and the initial location of the pipette tip is identified . the patch clamp process is initiated by open - loop pipette positioning stage 230 , during which the pipette is prepared for clamping and moved into an initial location above the target cell . as shown in fig2 b , during closed - loop image - guided pipette positioning stage 240 , the robot performs image - guided lowering of the pipette to the appropriate depth for the step of target cell contact acquisition 250 . during target cell contact acquisition stage 250 , the robot iteratively moves the pipette and measures the resistance in order to determine whether or not the target cell has been contacted . if , as determined by the resistance measurements , the target cell has not been successfully contacted after the pipette distance has been repeatedly adjusted and the maximum probe depth has been reached , the pipette is retracted back to the surface for possible installation of a new pipette . if , as determined by the resistance measurements , the target cell has successfully been contacted , gigaseal formation stage 260 begins ( fig2 c ). as shown in fig2 c , during gigaseal formation stage 260 , the robot applies suction pulse and hyperpolarizing voltage to achieve a gigaseal . once gigaseal formation 260 is achieved and verified , break - in stage 270 begins . during break - in stage 270 , break - in is initiated by application of a suction pulse , leading hopefully to a successful whole cell patch clamp . alternatively , or in addition , a gigaseal cell - attached patch may be achieved . once a successful whole - cell patch clamp is achieved , whole - cell recording 290 may begin . an aspect of the autopatcher automated methodology is that the robot analyzes the temporal series of the measured pipette resistances in order to determine whether a cell has been located or not . in the preferred embodiment , the robot computes the difference between successive pipette resistances and compares it to a constant threshold . this can be expressed as : for a series of multiple consecutive pipette positions ( equal or unequal in spacing ), 1 to n , with r ( n ) being the measurement of the resistance at position n and n is greater than or equal to 2 , a neuron that is suitable for patching has been encountered if : for example , a neuron suitable for patching has been encountered at position 3 , if r 3 − r 1 & gt ; threshold and r 3 & gt ; r 2 & gt ; r 1 . it will be clear to one of skill in the art that the execution of this algorithm would be extremely difficult , if not impossible , for humans to perform manually in a rapid , systematic way . the systematic execution of such a series of steps in time ( i . e ., monitoring resistance , determining position , voltage , and pressure ) has therefore not before been possible . automated in vivo cell patching according to the invention works because the algorithm employed overcomes this problem and also mitigates the challenges of the noisy environment , such as heart beat , breathing , and non - neuronal cells . a preferred embodiment of the method starts with automated imaging and identification of fluorescently - labeled cells inside the brain , after which the user can select a target cell to patch . fig3 depicts a preferred embodiment of a cell detection and selection method , according to one aspect of the present invention . in fig3 , raw image 310 of fluorescently labeled cells 315 is filtered and thresholded 320 to isolate 330 the cells 315 from the background 335 . the contour 337 of each cell 315 is then traced and overlaid 340 on the original raw image to produce contour image 350 . finally , a cell is selected 360 to patch , the boundary of which 365 is shown highlighted 370 . the microscope objective is then moved away from the brain , providing enough space for the user to install a fluorescent dye - filled patch pipette into the pipette holder and to bring it into the field - of - view inside the artificial cerebrospinal fluid ( acsf ) above the brain . following this open - loop pipette positioning , the pipette tip is automatically detected ( fig4 ), and its location is used to calculate the optimal trajectory to the target cell . before moving along this trajectory , high positive pressure ( for example , but not restricted to , 150 - 200 mbar ) is applied to the pipette , and the pipette resistance inside the acsf is recorded . fig4 is a schematic representation of pipette tip detection . in fig4 image slices , represented by the three example slices 410 , 415 , 420 shown , each separated by a 2 μm step , are acquired around fluorescent dye - filled pipette 430 . each slice captures shapes and characteristics that are unique to the specific z - location from which the image is acquired . for the three example slices : slice 410 , image 440 acquired 20 μm above pipette tip 430 ; slice 415 , image 445 acquired at pipette tip 430 ; slice 420 , image 450 acquired 20 μm below pipette tip 430 . from these slices , the closest slice to the pipette tip is determined in order to calculate the z - location of the tip , and the pipette boundary within this image is traced 460 to detect 470 the x - y location of the tip 480 once the pipette is positioned in the upper cortical layers , its resistance is measured again to check if any significant increase ( for example , but not limited to , by 15 %) has occurred while penetrating the brain surface , using this change as an indication of pipette contamination or blockage . another indication of pipette blockage is the presence of fluorescent dye around the pipette tip ( fig5 a - b ), which the method checks for in a preferred embodiment . in case of a significant resistance increase , or little to no dye flowing out of the pipette tip , this embodiment of the method attempts clearing the pipette tip by applying a brief pulse of high positive pressure . however , if the original resistance cannot be recovered or dye cannot be ejected from the pipette tip even after several pulses , the contaminated pipette is retracted automatically to be replaced with a new pipette . fig5 a and 5b are example images of a pipette after penetrating through the upper cortical layers of the brain . shown in fig5 a is clean pipette 510 ejecting fluorescent dye 520 around its tip 530 . shown in fig5 b is a contaminated pipette 540 with no dye being ejected from the tip 550 even with high positive pressure . in one embodiment , if the pipette tip is clean , it is initially moved to the position 50 μm above the original center position of the target cell , and a new image stack is acquired around the target cell to detect any movement of the target cell due to the insertion of the pipette into the brain . with the updated target cell position , the pipette is then moved to the position 25 μm above the target cell center , and the method enters the closed - loop pipette positioning stage . the closed - loop starts by re - capturing an image of the target cell and detecting its movement . next , the pipette moves in the x - and y - directions to compensate for the offset between the pipette tip and the target cell center . this pipette position adjustment in the x - y plane is followed by a 3 μm step towards the cell in the z - direction , and the method returns to the start of the loop , where another image is acquired to determine the new offset . the method remains in this loop until the pipette tip makes contact with the target cell membrane , which is indicated by both visual ( pipette tip within the boundary of the target cell soma ; fig6 a - c ) and electrical ( pipette resistance increase that exceeds a certain threshold ; fig7 a - c ) signals . fig6 a - e and fig7 a - e depict example two - photon microscope images and raw current traces , respectively , each image and trace corresponding to the closed - loop image - guided pipette positioning stage , the gigaseal formation stage , or the break - in stage . in fig6 a - e , a series of two - photon microscope images show the automated movement of the pipette to the target cell center ( fig6 a - c ), to form a gigaseal ( fig6 d ), and to break in ( fig6 e ). the circle 610 marks the pipette tip location , the cross 620 marks the target cell center , and ( x , y , z ) 630 , 640 , 650 are the offset from the pipette tip to the target cell center in cartesian coordinates , moving to ( 0 , 0 , 0 ) by fig6 c . in fig7 a - e , example raw current traces of the pipette in response to 50 hz , 10 mv square voltage pulses are depicted , with each trace in fig7 a - e corresponding to the associated image in fig6 a - e . as shown in previous studies describing the manual two - photon image - guided patch clamp process [ margrie , t . w . et al .,“ targeted whole - cell recordings in the mammalian brain in vivo ”, neuron 39 , 911 - 918 ( 2003 ); komai , s ., denk , w ., osten , p ., brecht , m . & amp ; margrie , t . w , “ two - photon targeted patching ( tptp ) in vivo ”, nat . protoc . 1 , 647 - 652 ( 2006 ); musser , m . & amp ; margrie , t . w ., “ two - photon targeted patching and electroporation in vivo ”, cold spring harb . protoc . 2014 , 78 - 85 ( 2014 )], a clear heartbeat modulation of the pipette current was observed when the cell membrane was hit by the pipette tip ( fig7 c ). in some embodiments , this observation may be used in the method to complement or replace the resistance change as the signal for pipette - cell membrane contact . the next stage , gigaseal formation , is implemented by dynamically applying light suction and hyperpolarization voltage . when a stable gigaohm seal is established , the method moves to the break - in stage , in which a ramp of strong suction is applied to rupture the patch of membrane and achieve the whole - cell configuration . a robotic system capable of executing this method integrates the previously developed autopatcher control box [ kodandaramaiah , s . b ., franzesi , g . t ., chow , b . y ., boyden , e . s . & amp ; forest , c . r ., “ automated whole - cell patch - clamp electrophysiology of neurons in vivo ”, nature methods 9 , 585 - 587 ( 2012 ); kodandaramaiah , s . b . et al ., “ assembly and operation of the autopatcher for automated intracellular neural recording in vivo ”, nat . protoc . 11 , 634 - 654 ( 2016 )] with automated control of a two - photon image - guided patch - clamp rig . the autopatcher system is described in detail in u . s . patent application ser . no . 13 / 676 , 082 , filed nov . 13 , 2012 , now u . s . pat . no . 9 , 668 , 804 ( 2017 ), and u . s . patent application ser . no . 14 / 079 , 630 , filed nov . 13 , 2013 , now u . s . pat . no . 9 , 498 , 293 ( 2016 ), which are herein incorporated by reference in their entireties . fig8 is a schematic representation of a two - photon image - guided autopatcher , which integrates the previously developed “ blind ” autopatcher with a two - photon laser scanning microscope . shown in fig8 are control computer 805 , which controls laser 810 that produces light 812 for two - photon microscope 815 . two - photon microscope 815 comprises dichroics 820 , 822 , pmt 1 825 , and pmt 2 830 . computer 805 also controls x - y stage and z - focus motors 835 . objective 838 is shown above test subject 840 , which is held in place by fixation plate 842 . pipette 845 is held and positioned by 4 - axis manipulator 848 and headstage 850 . amplifier 855 communicates with digitizer 860 and autopatcher control box 865 , which comprises switch 868 , autopatcher digital board 870 - and valves 875 . valves 875 provide pressure to pipette 845 via tubing 878 , with possible values of high positive pressure 880 , low positive pressure 882 , atmospheric pressure 884 , and suction pressure 886 . in order to implement the invention , it was necessary to develop both a means for automated control of the image acquisition system and a means for analyzing and utilizing the data acquired from the image acquisition system to control the “ blind ” autopatcher . for automated image acquisition and analysis , in a prototype embodiment , the two - photon microscope and stage motors are controlled by a matlab - based module that runs in parallel with scanlmage [ pologruto , t . a ., sabatini , b . l . & amp ; svoboda , k .,“ scanlmage : flexible software for operating laser scanning microscopes ”, biomed . eng . online 2 , 13 ( 2003 )], an open - source software package commonly used for in vivo image - guided patch - clamp recordings . the module also communicates with a micromanipulator and the autopatcher control box to automate pipette movement onto the target cell , gigaseal formation , and break - in . when tested on tdtomato - labeled parvalbumin ( pv )- positive interneurons in the mouse cortex , the system could achieve the whole - cell configuration in 9 ± 4 minutes from the time a patch pipette is placed inside the acsf above the surface of the brain . fig9 a - c through fig1 depict example characteristics and recording quality of autopatched cells achieved using the prototype embodiment . a maximum intensity projection ( mip ) of a two - photon image stack acquired around an autopatched cell and its voltage traces under current clamp are shown in fig9 a - c and fig1 , respectively . shown in fig9 a - b are the separate image channels , with fig9 c depicting the merged image . shown in fig1 are voltage recordings from an autopatched neuron under current - clamp , with 0 . 75 - second long current injections (− 70 , 0 , and 350 pa ; top ) and at rest ( bottom ). metrics of recording quality of pv - positive interneurons patched by the system ( n = 10 ), such as access resistance , resting potential , and holding current ( fig1 - 13 ), were not significantly different when compared to those of the same cells patched fully manually in acute brain slices or in vivo ( n = 5 ; student &# 39 ; s t - test with 95 % confidence level ; p = 0 . 1024 for access resistance ; p = 0 . 9755 for resting potential ; p = 0 . 4960 for holding current ). fig1 is a scatter plot of access resistance of autopatched neurons as a function of their depth inside the brain ; fig1 is a scatter plot of resting potential of autopatched neurons as a function of their depth inside the brain ; and fig1 is a scatter plot of holding current of autopatched neurons as a function of their depth inside the brain . in fig1 - 13 , the solid line is the mean , and the dashed lines are mean ± standard deviation . it was found that 20 . 8 % of pipette penetrations ( 10 out of 48 ) ended in a successful whole - cell state , defined as that with less than 200 pa of leakage current when held at − 65 mv in voltage - clamp mode , which is comparable to the rate reported in literature for fully manual two - photon image - guided patch clamp recordings in vivo [ margrie , t . w . et al . targeted whole - cell recordings in the mammalian brain in vivo . neuron 39 , 911 - 918 ( 2003 )]. even with complete removal of the dura vfrom mouse preparations , some of the pipettes became occluded while moving through the upper cortical layers ( fig5 b ), accounting for several unsuccessful penetrations ( n = 11 out of 48 ). if these contaminated pipettes that were automatically retracted by the system before entering the closed - loop pipette positioning stage are not considered , the system has the success rate of 27 . 0 % ( 10 out of 37 ). in an example implementation of the invention , control instructions for the image acquisition and analysis process were implemented using matlab . table 1 contains a list and description of the major control code listings that accompany this disclosure as a computer program listing appendix , which has been incorporated by reference herein . a requirement for implementation of the invention was the development of a methodology and apparatus for analyzing the two - photon images acquired using the two - photon laser scanning microscope for detection of the boundaries and centroids of target cells in order to assist in selecting a target cell and acquiring information for automatically guiding the pipette tip to the center of it . the module called find_center_and_circle_soma_cell_radius_range . m was created to analyze a raw two - photon image to detect boundaries and centroids of cells in the image . this module employs a modified version of a previously - reported image analysis technique developed for fluorescent cell detection , but uses user - defined detection criterion , such as cell body radii and cell body brightness , to detect cells in the image that meet the criterion . another requirement for implementation of the invention was the development of a methodology and apparatus for using the two - photon images in detection of the location of the pipette tip in order to assist in automatically guiding the tip to the target cell and identifying when contact has been made . the find_one_pipette_hjs . m module uses a newly developed strategy for tip detection and was created to analyze a z - stack of two - photon images in order to identify the image in the stack that corresponds to the z - coordinate of the pipette tip and then call a function for identifying x - and y - coordinates of the pipette tip from the image . a second module , called pipette_tip_detection_hjs . m , also uses the newly developed strategy for tip detection and was created to analyze a two - photon image corresponding to the z - coordinate of the pipette tip to determine the x - and y - coordinates of the pipette tip . additionally , new control instructions were developed to improve control of the autopatcher gigaseal formation and break - in processes . the module called pressure_control_hjs . m sends commands to the autopatcher control box to apply a single desired pressure to the pipette . pressure calibration values determined using the pressure_control_hjs_calibration . m function are used to find the correct command ( such as voltage ) to apply to the valves in the autopatcher control box in order to produce the desired pressure . the module called ramp_pressure_control_hjs . m sends commands to the autopatcher control box to apply pressure in a ramp of desired slope to the pipette . the module called ramp_pressure_control_res_meas_hjs . m sends commands to the autopatcher control box to apply pressure in a ramp of desired slope to the pipette while measuring pipette resistance . these modules both employ pressure calibration values determined using the pressure_control_hjs_calibration . m function in order to find the correct command to apply to the valves in the autopatcher control box in order to produce the desired ramp of pressure . while example implementations of control instructions are presented herein , it will be clear to one of skill in the art that other software platforms , languages , control parameters , and control instructions would also be suitable for use in the control apparatus of the invention and so should be considered to be within the scope of the invention . experiments demonstrate that a robotic system according to the invention provides similar recording quality and success rate as fully manual whole - cell recordings in vivo . since the robot reduces the need for manual manipulation and labor , the system will not only lower the barrier for those new to patch clamp recordings , but also will become a useful tool for expert electrophysiologists . in addition , the modular nature of the methodology will help make the system capable of automated multi - cell patch - clamp recordings , ultimately enabling studies of neuronal networks in the intact brain . while a preferred embodiment is disclosed , many other implementations will occur to one of ordinary skill in the art and are all within the scope of the invention . each of the various embodiments described above may be combined with other described embodiments in order to provide multiple features . furthermore , while the foregoing describes a number of separate embodiments of the apparatus and method of the present invention , what has been described herein is merely illustrative of the application of the principles of the present invention . other arrangements , methods , modifications , and substitutions by one of ordinary skill in the art are therefore also considered to be within the scope of the present invention , which is not to be limited except by the claims that follow .

US-201715643462-A

otitis externa is a condition of the outer ear canal in mammalian animals , especially dogs and cats , marked by inflammation and infection of tissue , buildup of ear wax , and draining of ear exudate . symptoms of infection are , among others , excessive cerumen , alopecia in the ear flap , crusts , and ear pruritis . typical causes of otitis externa are fungi , bacteria , and mites . a medicating mixture in accordance with the invention , comprising cold - pressed citrus oil , deionized water , and , optionally , hydrolysates of milk proteins , when applied topically to an infected ear canal can produce significant reduction in symptoms . in a clinical study , 95 % of an infected population of dogs were normalized without other or further treatment .

it has been found that cold - pressed citrus oil , derived by pressing without heat in known fashion from the rind of any of various citrus fruits , is highly effective in alleviating and normalizing the symptoms of otitis externa . in a first embodiment of a normalizing ear cleaner composition in accordance with the invention , the citrus oil is diluted with deionized water to a level of about 65 %- 85 % citrus oil and about 15 %- 35 % deionized water ; and preferably to a level of about 78 % citrus oil and 22 % deionized water , as described in more detail below . preferably , the citrus oil of the invention is an orange oil derived from citrus aurantium and / or citrus reticulata by cold pressing , although citrus oils derived from other citrus fruits are also contemplated within the scope of the invention . this process is an important aspect of providing citrus oils that can perform the intended functions of the present invention . by preventing the accumulation of d &# 39 ; limonene , as is known to be found in citrus - based oils produced by processes such as distillation or solvent extraction , the cold - press process used to obtain the citrus oil used in the present normalizing ear cleaner composition does not contain an aggressive orange distillate that is known to cause tissue irritation . in the present cold - press process , the citrus oils are concentrated to a point just short of gellation . the residual moisture level of the oils allows them to be flowable under most conditions commonly found in homes , on store shelves , in veterinary clinics , and during transportation . typically , the range in water content of the component referred to in the formulation as “ cold - pressed citrus oil ” in accordance with the invention is between about 68 % and about 76 %. this component preferably also contains surfactants , stabilizers , preservatives , a bactericide , colorants , a ph adjuster , an inorganic base , and sodium tetraborohydrate decahydrate . surfactants form preferably about 21 % of this component prior to the addition of deionized water . the preferred formulation of the first embodiment composition is 77 . 42 % “ cold - pressed citrus oil ” as defined above and 22 . 58 % deionized water . in a second embodiment of a normalizing ear cleaner composition in accordance with the invention , citrus oil is diluted with deionized water to a level of about 78 % citrus oil and the mixture is fortified with colostrum - derived proteins to a level of about 3 . 2 %. the preferred formulation of the second embodiment therefore is 77 . 42 % “ cold - pressed citrus oil ”, 19 . 35 % deionized water , and 3 . 23 % colostrum - derived proteins including cytokines . the colostrum - derived proteins include a variety of hormones , enzymes , and cytokines that are highly useful in normalizing inflammation and infection in the ear canal . as with any surface integrity challenge , the surface lining ( epithelial tissue ) of the ear canal can be compromised in numerous ways resulting in inflammation . typically , inflammation is the response to the presence of microorganisms or to injury . inflammation is a vital protective mechanism since it is the means by which phagocytic cells and defensive molecules such as antibodies gain access to sites of microbial invasion or tissue damage . the cytokine blend that is supplied in the ear cleaner , derived preferably from bovine colostrum , is included to help the body &# 39 ; s innate immunity and to promote tissue healing by reducing damage and enhancing the repair of damaged tissue . the cytokines in the ear cleaner composition are very versatile and flexible in their activity at the surface area in the ear canal . cytokines are low molecular weight regulatory proteins secreted from white blood cells ( lymphocytes ) as well as a variety of other cells in response to inducing stimuli . cytokines typically are recovered from colostrum , for example , bovine colostrum . some cytokines have singular roles while other have multiple activities . cytokines include interferon ( named for its interference with viral replication ), migration inhibition factor ( mif ), lymphotoxin ( lt ), tumor necrosis factor ( tnf ), interleukins , chemokines , several growth factors , and lymphokines . cytokines share many properties with hormones and growth factors and the distinction in the art between these three classes of mediators is becoming very blurry . in the present invention , cytokines regulate the intensity and duration of the immune response by stimulating or inhibiting the activation , proliferation , and / or differentiation of various cells , and by regulating the secretions of antibodies or other cytokines . with many ear problems related to allergic reactions , cytokine support is an essential element in modulating the negative results of such a situation in the ear canal . many organisms are associated with an animal &# 39 ; s body surface , and thus any compromise in the integrity of the epithial lining of the ear canal can present an opportunity for the tissues to be invaded and damaged . these invasions can result in allergic reactions due to the body &# 39 ; s acquired immune system &# 39 ; s ability to defend itself against invading microorganisms or those substances that are recognized as exogenous antigens . in a third embodiment of an ear cleaner composition in accordance with the invention , cold - pressed citrus oils are partially replaced by a class of compounds referred to herein as “ active oils ”. examples of such active oils are buriti oil , andiroba , babacu , castanha do brasil , passiflora edulis seed oil , passiflora incarnata seed oil , pequi oil , acai oil , annato oil , brazil nut oil , and copaiba oil . such oils have various specific normalizing properties that can be of great advantage in some cases of otitis externa . in a method for use of a normalizing ear cleaner in accordance with the invention , the composition can be applied directly via dropper or indirectly via a soft gauze or cotton pad . it is important to allow the cleaner to migrate into the ear canal so as to get next to the tympanic membrane . it is also vitally important to be certain that there is a tympanic membrane before introducing the medication into an ear . after a proper application of the composition , the ear “ wax ” and accompanying unwanted materials will flake up and will be easily groomed away by the animal &# 39 ; s natural grooming process , or alternatively the flakes can be wiped out of the ear with a soft cotton or gauze pad . in most cases of otitis externa , moistening of the ear canal for cats requires ½ cc - 1 cc and dogs 1 - 5 cc of the composition applied to all areas of the ear and ear canal , followed by a gentle cleaning with soft cotton or gauze pads , to enable the deep cleaning action of the ear cleaner composition to remove the unwanted materials from deep within the canal . after the first cleaning and the flaking of the foreign matter , application of the composition is repeated preferably only once per week until the ear becomes normal . treatment should be repeated weekly until desired results are accomplished . yeast infections may require a cleaning every three days until the infection is gone or totally under control . usually large ears will require 1 cc of composition in cats and 5 cc in dogs . if the hair surrounding the external ear canal is soiled with exudates , it is advisable to shave the hair if possible . if shaving is impractical , then saturating the soiled hair with the normalizing ear cleaner is advisable so as to allow the cleaner an opportunity to suppress bacteria and yeast growth . in cases of otitis externa wherein infection and inflammation are minimal and the principal symptom is excess cerumen and dirt , the first embodiment of an ear cleaner composition described above may be all that is required for loosening and flushing of matter to achieve ear normalization . for more serious cases involving extensive infection , rupture of the skin , and inflammation , the second or third embodiments described above are preferred treatments . from the foregoing description , it will be apparent that there has been provided an improved normalizing ear cleaner for alleviating otitis externa in animals , and especially in cats and dogs . variations and modifications of the herein described normalizing ear cleaner , in accordance with the invention , will undoubtedly suggest themselves to those skilled in this art . accordingly , the foregoing description should be taken as illustrative and not in a limiting sense .

US-65174507-A

the invention provides water continuous or bicontinuous fat emulsions , comprising fat , protein , humectants and relatively low amounts of water and which emulsions display an water activity of 0 . 6 to 0 . 8 and have a shelf life at ambient temperature of more than 6 months . a method of preparing the emissions is also provided .

it is essential that the emulsions of the invention are water continuous or bicontinuous or otherwise they are not easily dispersible in cold water . by the term “ cold water ” as used herein is meant water that is not heated , that is , water of about ambient temperature . the storage properties of the emulsions also strongly depend on the water activity thereof . this water activity ( aw ) is defined as the ratio of the water pressure of the ( food ) substrate to the water pressure of pure water at the same temperature . aw is measured by “ hygroskop bt - rs1 ” meter available from retronic a . g ., switzerland or by an “ aw box ” available from novasina , switzerland . the emulsions have a water activity ( aw ) in the range of from 0 . 6 to 0 . 8 . preferably , the water activity is in the range of from 0 . 6 to 0 . 7 . the water activity is obtained , generally , by evaporating ( or otherwise removing water from the emulsion until the required water activity is achieved . the claimed water activity of the emulsions is obtained , generally , by evaporating ( or otherwise removing ) water until the desired water activity is achieved . within the water activity of 0 . 6 - 0 . 8 , the amounts of humectant and water can be balanced to produce the desired water activity within this range whilst maintaining the water continuous or bi - continuous properties of the emulsion . this is influenced also by the amount of water in the emulsion . it is preferred that the emulsions comprise water and one ore more humectants in a weight ratio of from 3 to 1 : 1 to 3 , more preferably 2 . 5 to 1 : 1 to 2 . 5 , most preferably 2 to 1 : 1 to 2 , such as 1 . 5 to 1 : 1 to 1 . 5 . the type of emulsion can be determined by measuring the electrical conductivity of the emulsion ; conductivities of less than 1 micro siemens / cm are considered as representative for emulsions that are fat continuous emulsions , whilst conductivities of more than 1000 micro siemens / cm are considered as typical for water continuous emulsions . the emulsion has the consistency of a paste and therefore displays a viscosity in the range of from 50 - 400 pa . s , preferably between 100 - 200 pa . s , at shear rate 1 / s as measured by carrimed rheometer csl 100 . the emulsions may also preferably have a stevens hardness in the range of from 25 - 200 or 400 g , preferably 40 - 125 gram as measured by stevens lfra texture analyzer at 22 ° c . with probe diameter 12 . 7 mm ( 0 . 5 inch ), speed 2 mm / s , and penetration depth 25 mm . the fat component of the emulsions is a vegetable fat or animal fat and can be selected from a broad range of fats from which the most suitable fats are fats selected from at least one of the group consisting of : palm oil and hardened palm oil or factions thereof ; soy bean oil and hardened soy bean oil or fractions thereof ; sunflower oil and hardened sunflower oil or fractions thereof ; rape seed oil and hardened rape seed oil or fractions thereof ; cotton seed oil and hardened cotton seed oil or fractions thereof , arachidic oils and hardened arachidic oil or fractions thereof . it is preferred that the fat component is selected from palm kernel oil and hardened palm kernel oil or fractions thereof ; coconut oil and hardened coconut oil or fractions thereof . mixtures of one or more of these fats may also be used . the most preferred fats are the fats based on palm kernel or coconut , as these fats are required for the preparation of a coconut cream . the emulsion comprise an amount of from 40 to 85 wt % of the vegetable or animal fat , based on the weight of the emulsion . preferably the emulsions comprise an amount 52 to 67 wt % of a vegetable or animal fat . in order to stabilise the emulsion it can comprise an amount of protein , in particular , proteins derived from dairy products such as milk or whey protein . proteins from vegetable sources or from animal sources such as chicken may also be applied . however the use of caseinate is preferred . these proteins also have emulsifier properties and therefore can stabilise the emulsions . the emulsions comprise an amount of from 1 to 10 wt % of protein , preferably 5 to 8 wt %. the emulsions also contain at least one humectant . the humectant plays a role both in the control of the water activity of the emulsion and in determining its consistency . the humectant may be selected from carbohydrates , polyalcohols and edible inorganic salts . the carbohydrates suitably are selected from the group consisting of mono , di and polysaccharides , hydrolysed polysaccharides , chemically or enzymatically modified polysaccharides . in combination with , or independently , a polyalcohol can be present as humectant . the most preferred polyalcohol is glycerol . the edible inorganic salts can also be used to control the water activity of the emulsion . it is especially preferred that the salt is derived from an alkali or alkaline earth metal salt , especially of a halogenide . accordingly , sodium or potassium halogenides are preferred . the emulsions comprise an amount of from 1 to 30 or 35 wt % of the humectant , preferably 5 to 20 wt %. for some systems amounts of 20 to 30 wt % may be used . a mixture of one or more types of the above humectants may be used . the emulsions also comprise 5 to 15 wt %, preferably 11 to 15 wt % of water . for some emulsions , amounts of up to 25 wt % of water may be used . in addition to the above components , the emulsion can also comprise a preservative . these can be selected from well known food grade preservatives including potassium sorbate ; sulphur dioxide , hydroxybenzoic acid or its lower alkyl esters ( i . e . derived from alcohols with 1 to 4 c - atoms ), sodium hydrogensulphite or potassium hydrogensulphite or meta sulphites from alkali metals . the emulsions of the invention have the additional advantage that because of their low water activity it is not necessary to add edible acids in order to prevent microbiological spoilage . not adding edible acids can also have taste advantages for some emulsions e . g . those based on coconut may suffer undesirable taste changes if significant levels of acid are added . accordingly , the emulsions preferably comprise less than 5 % by weight , more preferably less than 1 % by weight of edible acids . it is especially preferred that the emulsions are substantially free of added edible acid . the emulsions of the invention typically are pastes and preferably have a non - transparent white colour . they are intended for use either as a food product per se , or more preferably in the preparation of food products . the emulsions may be diluted with water before use , or , they may be used in their undiluted state . in either case the emulsions may be used in the preparation of food products such as stews , curries , meat based and vegetable based meals and sauces . the shelf life of the emulsion is more than 6 months at 20 to 35 ° c ., which makes for excellent commercial use . the emulsions can be prepared by any suitable method . preferably , they are prepared by a method which ensures that the flavour components of the fat component , e . g . coconut , remain in the emulsion . the most preferred process for producing a coconut fat based product forms the second aspect of the invention . typical conditions that are applied in step ( i ) of the method of the invention are overpressures of from 5 to 350 kg / cm2 , whereas the evaporation in step ( v ) is preferably performed at a pressure of from 10 to 50 mm hg and at a temperature of from 40 to 70 ° c . the emulsions may be subjected to a heat treatment step if desired . preferably the emulsions are subjected to a mild heat treatment step as a harsher step , such as ultra high temperature treatment , may result in discolouration or undesirable flavour changes of the emulsion . when used , this heat treatment step is undertaken to inhibit microbiological growth . suitable conditions for the mild heat treatment are heating the emulsion at elevated temperatures for up to about 10 minutes . for example , heating at 65 - 75 ° c . for up to 5 minutes . heating conditions of 70 ° c . for 5 minutes or 75 ° c . for 1 minute are suitable examples . split stream processing , however , is also possible . herein the water and the fat phases are separated and thereafter the other ingredients ( including humectants ) are added to the water phase or to part of the water phase , which is then totally or partially recombined with the fat phase . many variations however are possible here , in particular with respect to limitation of the amount of partial product that will be subjected to pasteurisation conditions . the invention will be further explained by reference to the following examples . further examples within the scope of the invention will be apparent to the person skilled in the art . 1 . a fresh coconut milk product was produced from grated mature coconut meat , free from brown testa , with a hydraulic press without added water at a temperature of 25 - 30 ° c . large solids and possible impurities were removed by a vibratory sieve of 150 microns . yield of the fresh product was around 70 %. the fresh product was after pressing immediately heated for 1 min at 75 ° c . to avoid discoloration and / or other microbiological deterioration processes . the product contained 56 wt % water , 34 wt % oil , 3 . 5 wt % protein and 6 . 5 wt % carbohydrates . 2 . to the fresh product the following ingredients were added ( basis of 100 parts product ): the product and ingredients were mixed in a mixing vessel , equipped with a silverson high - speed stirrer and stirred for circa 2 minutes and again heated for 1 minute at 75 ° c . 3 . subsequently , the water level of the mixture was reduced in a roto - visco vacuum evaporator set at a reduced pressure of − 50 /− 60 cm hg and a temperature of 55 ° c . the water evaporation converted the oil - in - water emulsion into a thick paste , the final water level was 12 . 5 wt %. the water activity of the product was 0 . 65 . 4 . the product was removed from the roto - visco equipment and stored in a suitable closed container . using the ingredients and process mentioned a safe ( microbiologically ) product was obtained with a storage stability of at least 9 months at 20 - 30 ° c . 5 . to reconstitute the coconut milk the concentrated product was mixed with water of 30 ° c . by simple stirring for circa 2 minutes . a typical ratio of 1 part paste to 3 parts of water was used . 2 . the fresh product was fed into a continuous centrifuge in which oil phase and water phase were separated . 3 . to ⅕ parts of the water phase the following ingredients were added ( basis of 100 parts end product ): the water phase and ingredients were mixed in a mixing vessel , equipped with a ultra turrax stirrer , and stirred for circa 5 minutes and again heated for 1 minute at 75 ° c . 4 . subsequently the oil phase was mixed into the water phase and homogenised with a colloid mill . the homogenisation converted the oil - in - water emulsion into a thick paste , the final water level was 13 . 5 %. the water activity of the product was 0 . 63 . 5 . the product was packed in a suitable closed container . using the ingredients and process herein a safe ( microbiologically ) product was obtained with a storage stability of at least 9 months at 20 - 30 ° c . 6 . to reconstitute the coconut milk the concentrated product was mixed with water of 30 ° c . by simple stirring for circa 2 minutes . a typical ratio of 1 part paste to 3 parts of water was used . 2 . the fresh product was fed into a continuous centrifuge in which oil phase and water phase were separated . the water phase was taken for the concentration step and the water level reduced . 3 . to the water phase the following ingredients were added ( basis of 100 parts product ): so 2 ( as na 2 s 2 o 5 or nahso 3 ) the water phase and ingredients were mixed in a mixing vessel , equipped with a silverson colloid mill for circa 2 min and again heated for 1 minute at 75 ° c . 4 . subsequently , the water level of the mixture was reduced in a roto - visco vacuum evaporator set at a reduced pressure of − 50 /− 60 cm hg and 55 ° c . to obtain a final water level of 13 wt % in the concentrated paste . the water activity of the water phase was 0 . 65 . 5 . the concentrated water phase was removed from the roto - visco equipment . 6 . subsequently the oil phase was mixed into the water phase and homogenised with a colloid mill . the homogenisation converted the oil - in - water emulsion into a thick paste , the final water level was 13 . 5 %. the water activity of the product was 0 . 65 . 7 . the product was packed in a suitable closed container . using the ingredients and process mentioned a safe ( microbiologically ) product was obtained with a storage stability of at least 9 months at 20 - 30 ° c . 8 . to reconstitute the coconut milk the concentrated product was mixed with water of 30 ° c . by simple stirring for circa 2 minutes . a typical ratio of 1 part paste to 3 parts of water was used .

US-48468604-A

the main goals of the invention are to develop the long - term release of granisetron injection implant composition with biodegradable polymer and to develop relative processing . granisetron is mixed with different biodegradable polymers , and then hot melt extrusion technique with different diameter , temperature , rate of extrusion and holding time is applied to make implant . in vitro dissolution of the granisetron injection implant composition shows the component continued release of the drug for over 7 days .

cancer patient treated with traditional chemotherapy often has symptoms of nausea , vomiting , limb neurological paralysis , oral mucositis , and suppression of bone marrow blood forming mechanism . the most notorious side effect of all is nausea and vomiting . about 80 % to 90 % cancer patients suffer serious nausea and vomiting within 24 hours after chemotherapy . the vomiting caused by chemotherapy includes acute vomiting ( within 24 hours after chemotherapy ), delayed vomiting ( after 24 hours of chemotherapy , may last 3 to 5 days ), and expected vomiting ( 24 hours before next chemotherapy ). once developed nausea and vomiting , patients can &# 39 ; t eat , and it further affects patient &# 39 ; s nutrition status causing malnutrition , reducing immunity , and lowering patient &# 39 ; s willingness to chemotherapy . therefore , nausea and vomiting not only affect patient &# 39 ; s life quality seriously , but also reduce patients &# 39 ; obedience or cause their inability to finish chemotherapy with appropriate dosage more importantly . it further leads to the increase of death rate , shortening living time , and seriously affecting treatment results of patients . therefore , anti - vomiting agent is absolutely necessary for application when patients receive chemotherapy . most current anti - vomiting agents on the market can relieve acute vomiting caused by chemotherapy , but are not effective to relieve delayed vomiting except palonosetron ( aloxi ®). aloxi ® can only work for medium level of delayed vomiting along with side effect of headache . the present invention provides a pharmaceutical composition of controlled release ganisetron implant , comprising 0 . 5 to 50 parts of poly ( lactic - co - glycolic acid ) ( plga ) and poly ( lactic - co - glycolic acid )- polyethylene glycol ( plga - peg ) mixture , based on 1 part of granisetron . preferred controlled release granisetron implant pharmaceutical composition in the present invention comprises 1 to 10 parts of plga and plga - peg mixture , based on 1 part of granisetron . the implant formulation is a sustained release type . current medicine using biodegradable polymer as pharmaceutical carrier on the market , such as eligard ®, zoladex ®, trelstar ®, and so on , provides drug release for more than a month . as for 3 to 5 days of delayed vomiting for chemotherapy patients , this invention provides drug release lasting for 7 days . it can continuously release drug without affecting next chemotherapy . the chemical of granisetron is endo - n -( 9 - methyl - 9 - azabicyclo [ 3 . 3 . 1 ] non - 3 - yl )- 1 - methyl - 1h - indazole - 3 - carboxamide with molecular weight of 312 . 4 . known synthesis technique of granisetron is listed in u . s . pat . no . 4 , 884 , 808 in prior art as a reference of the present invention . granisetron is therapeutically active in the free base form , as well as in pharmaceutically acceptable acid addition salts thereof . granisetron hydrochloride , for example , is a white to off - white solid , having a molecular weight of 348 . 9 , a reported melting point in the range of about 290 to about 292 ° c ., and is soluble in water and normal saline at 20 ° c . furthermore , the present invention extends to any pharmacological active ingredient , especially the pharmaceutical compounds with similar chemical characteristics of granisetron . the term “ granisetron ,” as used herein , includes the free base form of this compound , as well as pharmaceutically acceptable acid addition salts thereof . granisetron hydrochloride is particularly preferred for the embodiments of the present invention . biodegradable polymer of the present invention indicates that lots of monomers polymerize to form material with huge molecular weight . the polymer is biocompatible , but hardly soluble or insoluble in water . it can be degraded by human body voluntarily , go through inner metabolism , and degraded molecules can be released to the outside . the carrier in the present invention for controlled drug release comprises but not limited to plga and plga - peg . ratio of lactic acid and glycolic acid of polymer is related to desired sustained release time . selection range is from 100 / 0 to 40 / 60 , and preferred range is from 100 / 0 to 50 / 50 . for example , preparation of sustained release implant lasting more than 7 days comprises a ratio of lactic acid and glycolic acid of polymer as 50 / 50 , wherein molecular weight of plga polymer mn ( number average molecular weight ) ranges from 1900 to 17000 mw ( weight average molecular weight ) ranges from 3500 to 32000 and that of plga - peg polymer mn ranges from 50000 to 70000 mw ranges from 70000 to 120000 . the ratio of peg in plga - peg is 5 to 20 %, and preferred ratio is 5 to 15 %. the present invention further provides a preparation method of granisetron sustained implant , comprising following steps : in order to evenly distribute drug substance granisetron in polymer evenly , a table - top crusher is used to crush polymer and granisetron drug substance with medium speed , and sieve the powder through a mesh . mix quantified amount of crushed polymer and granisetron drug substance in vortex mixer for even distribution . the ratio of granisetron and polymer is 1 : 1 to 2 : 5 , and preferred ratio is 1 : 1 to 2 : 3 . preparation of various polymer mixture can be performed with table - top crusher with medium speed and sieve it through a mesh . put quantified amount of polymer powder into vortex mixer to mix polymers and gain evenly distribute polymer mixture , or dissolve two polymer mixtures in dichloromethane and retain solid material after solvent evaporation . dry solid material under vacuum condition , crush and sieve it to obtain well mixed micronized polymer . injectable implant formulation is obtained by hot - melting extrusion process , including filling mixed granisetron / polymer powder from step 1 into a hot mold of a hot - melt extruder and heating it at appropriate temperature . the temperature range is 50 to 110 ° c . ( preferred temperature is 60 to 100 ° c . ), heating time is 5 to 10 minutes ( preferred time is 6 to 8 minutes ), appropriate diameter of implant is 1 . 0 to 1 . 5 mm ( preferred diameter is 1 . 0 to 1 . 35 mm ) to obtain injectable implant formulation . extrude the injectable implant by the hot melt extruder . the examples below are non - limiting and are merely representative of various aspects and features of the present invention . preparation of granisetron hcl and plga in a ratio of 2 : 3 for controlled release injectable implant crushed plga polymer and granisetron hcl active pharmaceutical ingredient with a crusher separately and passed it through no . 140 mesh ( 106 μm ). 400 mg fine powder of granisetron and 600 mg fine powder of plga polymer ( weight average molecular weight of 12000 ) were mixed in vortex mixer for 2 minutes , and filled 1 g of plga polymer and granisetron hcl mixture into a hot mold of a hot - melt extruder . the mixture material was heated in a mold chamber at 70 ° c . for 7 minutes to melt before extrusion . it generated injectable implant with diameter of 1 . 1 mm , and the injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 by mixing granisetron hcl and plga in a ratio of 2 : 3 . while filling plga polymer and granisetron hcl powder into the hot mold of the hot - melt extruder , heated it at 80 ° c . for 7 minutes to melt the mixture before extrusion . it generated injectable implant with diameter of 1 . 1 mm , and the injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 . two polymers , plga ( weight average molecular weight of 12000 ) and plga - peg ( weight average molecular weight of 80000 ), were mixed in a ratio of 5 : 1 . granisetron hcl and polymer mixture were mixed in a ratio of 2 : 3 and filled into the hot mold of the hot - melt extruder heated at 80 ° c . it generated injectable implant with diameter of 1 . 30 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 . two polymers , plga ( weight average molecular weight of 12000 ) and plga - peg ( weight average molecular weight of 80000 ), were mixed in the ration of 5 : 2 . granisetron hcl and polymer mixture were mixed in a ratio of 2 : 3 and filled into hot mold of hot - melt extruder heated at 80 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 . granisetron hcl and polymer plga ( weight average molecular weight of 6000 ) were mixed in a ratio of 2 : 3 and filled into the hot mold of the hot - melt extruder heated at 61 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 . mixed one part of low molecular weight polymer plga ( weight average molecular weight of 6000 ) and one part of high molecular weight polymer plga ( weight average molecular weight of 12000 ) and dissolved them in dichloromethane . solid substance after solvent evaporation and drying in vacuum was ground , and sieved to obtain homogeneous mixture of polymer microparticle . granisetron and polymer mixture were mixed in a ratio of 2 : 3 and filled into the hot mold of the hot - melt extruder heated at 72 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was formed as shown in example 6 . five parts of low molecular weight polymer plga ( weight average molecular weight of 6000 ) and one part of high molecular weight polymer plga - peg ( weight average molecular weight of 80000 ) were mixed and dissolved them in dichloromethane . solid substance after solvent evaporation and drying in vacuum was ground , and sieved to obtain homogeneous mixture of polymer microparticle . granisetron and polymer mixture were mixed in a ratio of 1 : 1 and filled into the hot mold of the hot - melt extruder heated at 70 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed with same plga polymer mixture composition as shown in example 7 . granisetron hcl and plga polymer mixture were mixed in a ratio of 40 : 60 and filled into the hot mold of the hot - melt extruder heated at 66 ° c . it generated injectable implant with diameter of 1 . 30 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure with the same plga polymer mixture composition was performed as shown in example 7 . granisetron hcl and plga polymer mixture were mixed in a ratio of 36 : 64 and filled into the hot mold of the hot - melt extruder heated at 74 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure with the same plga polymer composition mixture was performed as shown in example 7 . granisetron hcl and plga polymer mixture were mixed in a ratio of 38 : 62 and filled into the hot mold of the hot - melt extruder heated at 71 ° c . it generated injectable implant with diameter of 1 . 35 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . the same experimental procedure was performed as shown in example 1 . granisetron hcl and low molecular weight pla ( weight average molecular weight of 3500 ) were mixed in a ratio of 2 : 3 and filled into the hot mold of the hot - melt extruder heated at 100 ° c . it generated injectable implant with diameter of 1 . 3 mm , and the dry injectable implant was stored in an air tight nitrogen - flushed container . dissolution test with granisetron hcl implant obtained from examples 1 to 11 was performed . procedure was listed as follows : determined the weight of implant , put it into a screwed cap vial , and added 5 ml of ph7 . 4 isotonic pbs , and kept it in 37 ° c . water bath shaking at 50 rpm . removed 1 ml solution after appropriate time , and used hplc to analyze granisetron hcl content . removed residual solution from vials , added another flesh 5 ml of ph7 . 4 isotonic pbs , and continued the dissolution test . medical dissolution profiles were shown in fig1 to fig8 . dissolution profile of fig7 clearly showed that the sustained implant from the present invention can release granisetron hcl for more than 7 days . according to the result of present invention , one shot of granisetron sustained implant was enough for one - week dosage for anti - nausea . in vivo animal test with granisetron implant obtained from example 10 was performed . procedure was listed as follows . male new zealand white rabbit was used as test animal with weight range of 3 . 0 to 3 . 5 kg in triplicate . granisetron hcl implant obtained from example 10 in a dose of 10 mg / dose was injected to rabbits by subcutaneous route . 2 ml of blood from marginal ear vein after 2 , 4 , 6 , 8 , 10 , 24 , 30 , 48 , 72 , 96 , 120 , 168 , 216 hours of injection was taken . supernatant was removed after centrifugation , and samples was extracted with toluene , and analyzed by hplc . the blood concentration was calculated by winnonlin ( scientific consulting , inc .) for plasma concentration - time area under curve ( auc ) and absorption rate . medicine concentration profile was shown in fig9 . absorption rate was shown in fig1 . from results of fig9 and 10 , it showed that sustained implant of present invention can last for more than 7 days of granisetron hcl concentration in plasma . examples provided above are non - exclusive . present invention and other variable points are obvious to people skilled in this art and are expected to be included in the scope of claim . the scope of current invention is based on claims , not limited in the examples above .

US-42672109-A

a method and device for measuring blood flow in the bone after a fracture , wherein a hole is drilled into the bone . the method includes the steps of inserting the metal sleeve of an osteoscope into the hole ; inserting the optics of an osteoscope into the metal sleeve and focused on the cavity created by the drill ; filling the device and the cavity with a physiological solution such that the pressure of the solution is above the systolic blood pressure ; decreasing the pressure of the solution while observing the cavity through the osteoscope , and recording the pressure in the system at the commencement of bleeding .

as disclosed herein , the invention relates to a device and method for the measurement of blood flow in the bone . all references cited herein are incorporated by reference in their entirety as though fully set forth . unless defined otherwise , technical and scientific terms is used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs . one skilled in the art will recognize many methods and materials similar or equivalent to those described herein , which could be used in the practice of the present invention . indeed , the present invention is in no way limited to the methods and materials described . as depicted in fig5 ( a ), the first step of the method according to the invention is to repose the fracture . in step ( b ), a kirschner wire is inserted into the femoral head , and in ( c ) a second kirschner wire is inserted into the femoral head . the insertion of the kirschner wires fix the femoral head . in step ( d ), a hole is drilled into the femoral head . the kirschner - wire is used as a guide for drilling . then , a thread is cut into the hole that has been created ( e ), and a screw is driven into the hole for the fixation of the fracture ( f ). after the fracture is fixed by one screw , a second hole is drilled through the neck of the femur into the head , parallel with the neck axis , in the former place of the kirschner wire that has been removed ( g ). a “ thicker ” drill bit , that is used for that , has an external diameter d 1 approximately of the same size as the external diameter of the sleeve of the osteoscope , and the end of the drill is of a thinner diameter d 2 . the metal sleeve of the osteoscope is then inserted into the hole ( h ). a “ thinner ” drill is applied through the tube of the sleeve ( i ). the diameter d 3 of the drill is approximately the same as the internal diameter of the sleeve of the osteoscope , and the end of the drill is of a thinner diameter d 2 . this “ thinner ” drill is 1 . 5 mm longer than the sleeve of the osteoscope . the use of the “ thinner ” drill allows the removal of the small bone fragments from the sheath . the end of the drill excavates a small cavity into the bone . the shape and measurements at the end of the drills are the same for both the thicker and thinner drills . the optics of the osteoscope is inserted into the sleeve , as depicted in fig5 ( j and k ). the small hole is in the focus of the optics . the surface of the small part of the cavity is at least 30 mm 2 preferably at least 35 mm 2 , most preferably at least 40 mm 2 . the system is filled up with physiological solution and the blood is rinsed out of the visual scope . the pressure of the physiological solution is increased above the systolic blood pressure . while the small hole is being observed through the osteoscope , the pressure is being decreased continuously , and at the commencement of bleeding , the pressure in the system is measured . if the circulation is acceptable , the difference between the systolic pressure and the pressure in the head is less than 60 hg mm , and the surgical intervention is osteosynthesis ( ie the femoral head preservation ). in this instance , the second screw is inserted to fix the fracture ( l and m ). the final result in this scenario is the fracture fixed with screws . the method includes the use of two drills . the external diameter of one drill is approximately the same size as the external diameter of the metal sleeve ; the external diameter of the second drill is approximately the same size as the inner diameter of the metal sleeve . the end sections of the drills are thinner , enabling them to create a small cavity in the bone , as shown in fig5 j and k . the length of the end sections is preferably at least 1 mm . a commercially available endoscope with 0 ° optics can be used for purposes described herein . the optics of the osteoscope should be at least 400 mm long , preferably 450 mm long and most preferably 500 mm long . the metal sleeve has two connections and a reservoir with physiological solution . the pressure of the solution is controlled by a manometer . returning to fig5 ( k ), one can see , that the device includes an osteoscope , the optics 1 of which is inserted into a metal sleeve 2 well known in the art . the metal sleeve 2 has two connections : flow in connection 3 and flow out connection 4 . through these connections the device is connected to reservoir 5 with physiological solution . the device is provided with means for producing and a manometer for measuring pressure in the system . it should preferably contain a flushing fluid pump and a flushing fluid collection container as well . the optics 1 is inserted into the sleeve 2 to be about 2 mm shorter , than the sleeve , as shown in fig5 ( k ). at the other end , the optics is connected to a display 6 showing the inside of the small cavity in the bone . the display unit also contains screen 7 for the manometer showing the pressure of the physiological solution . the device is further provided with a cuff 8 for monitoring the blood pressure of the patient . screen 9 in the display unit shows the value of the blood pressure . it is advantageous if the device contains a computer unit for controlling the system and for recording the results . acceptable circulation is when the difference between the systolic pressure and the measured pressure is less than 60 mm hg . if the difference in the pressure is more than 60 mm hg , the surgical intervention may be the implantation of a prosthesis . if this is not the case , the surgical intervention may be femoral head preservation . according to the present invention , the method of treatment of bone fractures , preferably femoral neck fracture is measuring circulation of blood in the femoral head and thereafter surgically performing either femoral head preservation ( if there is adequate circulation ) or implantation of a prosthesis ( if there is inadequate circulation ). it will be readily apparent to those of skilled in the art that the inventive devices and methods can be used to measure blood pressure in any number of bones . the invention is by no means limited to the measurement of blood flow in the femur . one skilled in the art will recognize many methods and materials similar or equivalent to those described herein , which could be used in the practice of the present invention . indeed , the present invention is in no way limited to the methods and materials described . for purposes of the present invention , the following terms are defined below . the following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention . to the extent that specific materials are mentioned , it is merely for purposes of illustration and is not intended to limit the invention . one skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention . ( 1 ) repose the fracture . ( 2 ) insert a kirschner wire into the femoral head . ( 3 ) insert a second kirschner wire into the femoral head . the insertion of the kirschner wires fix the femoral head . ( 4 ) drill a hole into the femoral head . the kirschner - wire is used as a guide for the drilling . ( 5 ) cut a thread into the hole that has been created . ( 6 ) drive a screw into the hole for the fixation of the fracture . ( 7 ) after the fracture is fixed by one screw , drill a second hole through the neck of the femur into the head , parallel with the neck axis , in the former place of the kirschner wire that has been removed . here a “ thicker ” drill is used , where the external diameter of the bit is of the same size as the external diameter of the sleeve of the osteoscope , and the end of the drill is a thinner diameter . ( 8 ) insert a metal sleeve of a osteoscope into the hole . the “ thinner ” drill is applied through the tube of the sleeve so that in this way , bone fragments are removed . here a “ thinner ” drill is used , which is 1 . 5 mm longer than the sleeve . the end of the drill excavates a small cavity into the bone . ( 9 ) insert the optics of anosteoscope into the sleeve , so that the small cavity previously created is in the focus of the osteoscope . ( 10 ) fill up the system with physiological solution and rinse blood out of the visual scope . ( 11 ) increase the pressure of the physiological solution so that it is above the systolic blood pressure . while the small hole is being observed through the osteoscope , the pressure is being decreased continuously , and at the commencement of bleeding , the pressure in the system is measured . the inventors determine excellent circulation of a femoral head if the difference between systolic pressure and the pressure in the head is lower than 30 hg mm . average circulation of a femoral head is determined if the difference between the systolic pressure and the pressure in the head is lower than 60 hg mm but 30 hg mm or higher , minimal circulation of a femoral head is determined if the difference between systolic pressure and the pressure in the head is 60 hg mm or higher . if the circulation is acceptable , the surgical intervention is osteosynthesis ( ie the femoral head preservation ). in this instance , a second screw is inserted to fix the fracture . if there is no circulation or the circulation is minimal , the screw and the femoral head are removed and prosthesis is implanted . while the description above refers to particular embodiments of the present invention , it should be readily apparent to people of ordinary skill in the art that a number of modifications may be made without departing from the spirit thereof . preferably , the device is provided with means ( e . g . computer unit ) for controlling and monitoring the method , as well as for storing and processing the data obtained during the use of the device . the presently disclosed embodiments are , therefore , to be considered in all respects as illustrative and not restrictive .

US-11485908-A

in a method for deaerating a liquid the liquid is pressurized to a pressure above atmospheric , after which it is guided to an upstream end of a nucleation valve . a low pressure resides on the downstream end of the nucleation valve and as the liquid passes the valve , bubble nucleation is initiated , forming the first step in a deaeration process . according to the method the temperature and pressure on the downstream side of the valve is controlled such that the static pressure is above the saturation pressure , while the lowest pressure as the liquid passes the valve is below or equal to the saturation pressure .

some portions of a system for processing a liquid will be described referring to fig1 . the present invention may form part of such a system , though individual components may be replaced without departing from the scope of the invention as defined by the claims . starting at an upstream position , the system comprises a tank 2 or other system for holding or delivering the liquid to be processed . the system also comprises a pump 4 for increasing the pressure in the liquid , subjecting it to an elevated static pressure p upstream such that it is forced downstream . the pump 4 may in one or more embodiments be a centrifugal pump , yet other alternatives may be feasible . piping 6 guides the liquid to the first processing step , namely to the nucleation valve 8 . before describing details of the valve , some words about the arrangement downstream the valve should be mentioned . the piping 10 guiding the liquid following the nucleation valve 8 debouches in a separation vessel 12 . in the present embodiment the separation vessel 12 comprises an expansion vessel , connected to a vacuum pump 14 in an upper end , and connected to an evacuation system 16 for liquid in a lower end . air and other gases resulting from the deaeration will be evacuated via the upper end , while deaerated liquid will be pumped out via the lower end of the vessel . to avoid evacuation of vaporized liquid the upper end of the vessel may comprise a condenser , condensing the vaporized liquid such that it may leave via the lower end instead . the vacuum pump 14 generates a lowered static pressure pressure p downstream propagating to the downstream end of the nucleation valve 8 . returning to the nucleation valve 8 , the increased static pressure upstream the valve will push the liquid towards the nucleation valve 8 and the lowered static pressure downstream the valve will pull the liquid , the relevant term to consider being the pressure drop over the valve 8 , which may be defined as δp = p upstream − p downstream . in the present embodiment p downstream preferably corresponds to a pressure above the vapor pressure at the residing temperature and for the fluid being processed , such to avoid flashing , partly since the generation of flash is energy consuming . to this end it should be mentioned that as the liquid passes the constriction of the valve it will accelerate to a significant velocity , which may cause the dynamic pressure to momentarily drop below the vapor pressure . the rapid pressure drop “ shocks ” the liquid such that a homogenous nucleation occurs , which is beneficial for deaeration . it has been confirmed in experiments that the momentary flash or cavitation in the valve 8 is beneficial from a deaeration perspective . immediately after being homogenously nucleated the liquid enters the low pressure region downstream the valve in the form of a jet 18 , which rapidly breaks up such that the liquid exposes a large surface area forming the interface between gas and liquid . conditions beneficial for deaeration thus prevail downstream the valve . this is schematically illustrated in fig2 the valve layout , e . g . in terms of exact shape of its nozzle orifice ( s ) is not crucial , yet some parameters seem to be important , and two are worth mentioning in particular : 1 ) the pressure drop should occur rapidly , basically instantly as the liquid passes the valve 8 . this indicates that the valve construction should be non - complex , without any intricate tubing following or preceding the nozzle orifice . 2 ) after the pressure drop the resulting jet should be non - constraint , i . e . a free jet should be allowed to form and break up . this also indicates that a non - complex valve construction without intricate tubing following the orifice is advantageous . in one embodiment the valve may be of a type having a conical regulating plug with a lip seal . this is a standard type of valve and examples include the spc - 2 valve ( alfa laval ), which is a sanitary electro - pneumatic regulating valve for use in stainless steel pipe systems . a simple hour - glass shaped restriction will also due , at least during constant operating conditions , yet a controllable valve is preferred . for the above reasons , a diffusion reactor 20 is arranged downstream the valve 8 , as part of the piping 10 . the diffusion reactor 20 will enable turbulent diffusion of the dissolved gas in the liquid phase to the now existing and growing nuclei / gas bubbles , and it should have a construction not entailing a large pressure drop . in the embodiment of fig2 the diffusion reactor 20 comprises a rectilinear pipe , having a diameter such that it does not interact with the formation of the previously mentioned jet 18 . sooner or later as the jet 18 breaks up the flow will diverge and interact with the walls of the diffusion reactor , and even a non - breaking jet would sooner or later impact on the lower wall due to gravity . the flow will continue towards the separation vessel , pulled by the vacuum , where it will be separated into a liquid flow and a gas flow . at some point the jet will fill the whole diameter of the diffusion reactor 20 , the exact location depending on pressure , temperature , flow velocity , etc . in the present embodiment the diffusion reactor 20 is arranged in a horizontal direction . in a second embodiment the diffusion reactor may be arranged in a vertical direction , with the jet coming from above . with this arrangement the pressure loss generated by the diffusion reactor will be compensated by the effect of gravity , reducing the losses in the system . the diffusion reactor may be mounted in any inclination between vertical and horizontal without departing from the scope of the present invention , as defined by the claims . in the text below some operating parameters for embodiments of the present invention are listed , which may facilitate enablement for a skilled person . the amount ( or rate ) of liquid being processed may be in the order of up to about 100 , 000 i / h , though smaller flows are possible , and in experiments conducted flows in the order of 6 , 000 i / h have been used . these rates are common within the field of the invention , and details in regard of pumps and such on the downstream side of the valve 8 will not be discussed in detail . the pressure drop over the valve δp preferably exceeds 2 bar , and it is even more preferred that it exceeds 3 bar , and it may be as high as 4 bar or 5 bar . there is no technical problem in increasing δp even further yet the pump used to elevate the pressure will be increasingly expensive . the temperature downstream the valve should preferably be lower than the flash temperature ( the boiling point at the prevailing pressure p downstream ), such as − 10 ° c . below flash or − 5 ° c . or between those temperatures and the flash temperature . temperatures closer to flash have been found to increase the deaeration efficiency . flash boiling will still have a beneficial impact on the deaeration , yet experiments verify that it is not as dramatic as for prior art systems . the length of the diffusion reactor may be about 100 - 200 cm , yet it may be even longer . a longer diffusion reactor will improve the deaeration efficiency , yet it may also increase pump losses , which is an unwanted feature . the diameter of the diffusion reactor may be about 5 cm ( 2 ″ pipe ) and it may be manufactured from stainless steel . in theory the diameter of the diffusion reactor would benefit from being larger , since it would result in lower pressure loss , yet due to parameters related to working at pressures close to vacuum may result in a tradeoff where the suggested diameter is beneficial . smaller diameters may result in reduced deaeration efficiency , supposedly due to a shorter hold up time and an increased interaction between the jet ( or spray ) and the walls of the diffusion reactor , and due to increased pressure losses , e . g . making the pressure drop less abrupt . there is no abrupt pressure drop as the liquid passes from the diffusion reactor 20 into the separation vessel 12 , in which the separation process initiated in the nucleation valve 8 is finalized . the separation vessel 12 may therefore be of quite rudimentary design as compared to prior art systems where flashing takes place in the expansion vessel . further , since flash boiling is avoided to a large extent , the amount of vapor is reduced , resulting in that less energy has to be spent on condensing the vapor . all components of the system being in contact with the product should be made from food grade material or approved for use when processing foodstuff . the pressure in the liquid upstream the nucleation valve , as well as the flow through the nucleation valve may be controlled by the nucleation valve 8 and the pump 4 , i . e . a frequency regulated pump , and for these purposes the pump 4 may also comprise a control valve ( not shown ). if the temperature of the liquid upstream the nucleation valve 8 is controlled , this may be effected by means of a heat exchanger . the pressure downstream the nucleation valve 8 is controlled by pressure regulation of the separation vessel 12 . the temperature of the liquid downstream the nucleation valve 8 is normally not controlled in situations where no flash boiling occurs . the pressure in the separation vessel 12 may be used to control the temperature , if so desired . in order to substantiate and validate the present invention according to several embodiments thereof extensive experimental studies were conducted . in those experiments the flow of the liquid ranged from 3 , 000 to 9 , 000 i / h , the relative flash temperature from − 35 to + 1 ° c . ( negative indicating a temperature below flash boiling ), and ranged between 1 and 5 bar . for each of the numerous measurement points several aspects , such as oxygen concentration as a function of the position after the nucleation valve , the void fraction as a function of the position after the nucleation valve , pressure as a function of the position after the nucleation valve , the overall deaeration efficiency , the cavitation index , etc was measured , estimated or calculated . fig3 is a graph showing the oxygen removal efficiency as a function of δp for some different temperatures ( again the temperatures are given relative to the flash temperature ). the graph indicates that for a system according to at least one embodiment of the present invention the oxygen removal efficiency does not vary significantly between a temperature slightly below the flash boiling temperature and a temperature slightly above the same .

US-201615059531-A

cigar cutters having sliding blades are disclosed . the cutters are relatively flat and are designed to fit in a pocket . the inner ends of the blades have arcuate cutting edges to aid in cutting . the outer ends of the blades have handles with apertures .

fig1 shows a perspective view of a cigar cutter 10 according to the present invention as it appears ready to receive and cut the ends of a cigar . cigar cutter 10 includes two generally flat reciprocating members 15 and 20 which , in a preferred embodiment are identical in form with one another . reciprocating members 15 and 20 comprise blade carrying portions 24 and 22 and blade portions 33 and 35 . reciprocating members 15 and 20 are arranged within casing 40 for opposing and cooperating movement relative to each other . reciprocating members 15 and 20 may further comprise handle portions 16 and 17 having apertures 5 and 7 for inserting a thumb or a finger therethrough . opposing and cooperating blade portions 33 and 35 , and blade carrying portions 22 and 24 move past one another as the cutter is operated . the preferred embodiment shown in the drawing figures comprises two blade members 33 and 35 . however , other possible configurations and arrangements , including an arrangement whereby reciprocating members 15 and 20 each carry dual blade members , may be utilized while remaining within the scope of the present invention . reciprocating members 15 and 20 are preferably formed from sheet metal , but may be formed of any suitable material and superposed one upon the other and secured together within casing 40 . reciprocating members 15 and 20 are slidably disposed within a casing 40 such that each reciprocating member is capable of motion in an outwardly direction . an outwardly direction is understood herein to be in the direction which tends to move blade portions 33 and 35 away from and out of casing 40 , i . e ., in the direction of arrow 27 for reciprocating member 20 and in the direction of arrow 28 for reciprocating member 15 . casing 40 is adapted to include a generally circular opening 25 for passing the end of a cigar therethrough . in order to limit the outward movement of the reciprocating members of the cutters and to prevent disengagement of the reciprocating members from casing 40 , reciprocating members 15 and 20 , and casing 40 may be provided with mechanical means for limiting motion in the outwardly direction of reciprocating members 15 and 20 and for guiding them in their travel . such limiting means may include projecting lugs ( not shown ) which overlie the side edges of reciprocating members 15 and 20 such that lugs engage each other when reciprocating members 15 and 20 are fully outwardly extended . another means for limiting the outward motion of reciprocating members 15 and 20 is illustrated in fig6 and 8 . other mechanical means of limiting the outward motion of reciprocating members 15 and 20 , and for securing reciprocating members in a closed position within casing 40 are known in the art and need not be elaborated upon herein . fig2 is a top plan view of reciprocating member 15 . as previously stated , reciprocating members 15 and 20 are preferably substantially identical to one another and placed back to back within casing 40 . that is , end 49 of blade portion 33 is placed adjacent to the corresponding end of blade portion 35 as shown in fig4 . a significant feature of the present invention is the design of blade portions 33 and 35 of reciprocating members 15 and 20 . as opposed to being semicircular in shape blade portions 33 and 35 have a generally sickle shape . that is , they are characterized by a non - constant radius of curvature , as best illustrated in fig2 . if an imaginary pivot point such as 45 is selected to lie along the central longitudinal axis 44 of reciprocating member 15 , and radial elements such as 46 , 47 and 51 are extended from pivot point 45 to blade portion 33 , it will be seen that the radial elements 46 , 47 and 51 have gradually diminishing lengths as they are positioned over the length of blade portion 33 in a clockwise direction . in other words , their lengths are non - constant over the length of blade portion 33 . furthermore , the change in the lengths of the radial elements define a curvature for blade portion 33 which has a generally sickle shape . blade portions 33 and 35 are preferably , but need not be , characterized by a gradually increasing blade pitch , or steepness over the length of blade portion 33 , as illustrated in fig2 . the pitch of blade portion 33 is shallower at end 48 as can be seen from the relatively greater width of blade portion 33 at end 48 compared to the width at end 49 . the pitch of blade portion 33 gradually grows steeper toward end 49 , where the pitch is greatest . the term pitch is used to refer to the steepness of the cutting edge , and is effected by varying the angle at which the edge is ground during manufacture . accordingly , the term pitch is used synonymously herein with the term grind angle . various manufacturing techniques for accomplishing a gradually increasing or diminishing pitch , or steepness , are known in the art and may be applied to produce blade portions 33 and 35 of the present invention . the sickle shape of blade portions 33 and 35 produces an advantageous slicing motion when blade portions 33 and 35 are brought into contact with the side of cigar 50 . as illustrated in fig4 both blade portions 33 and 35 simultaneously contact the same side of cigar 50 ( generally at points 63 and 64 ) as reciprocating members 15 and 20 operate to cut the tip of cigar 50 . in the view shown in fig4 the left side of cigar 50 is contacted by both blade portions 33 and 35 as they begin to cut cigar 50 . the forces imparted by blade portions 33 and 35 to cigar 50 as the tip is cut , tend to move cigar 50 to the right , i . e ., in the direction of arrow 60 . this motion is directed against and opposed by , casing 40 as cigar 50 is moved within opening 25 in the direction of arrow 60 against casing 40 . therefore the cutting forces of blade portions 33 and 35 upon cigar 50 will be exerted in the direction shown by arrows 61 and 62 . due to the sickle shape of blade portions 33 and 35 , forces 61 and 62 tend to act at generally right angles to each other and tend to produce motion of cigar 50 in the general direction shown by arrow 60 . the motion of cigar 50 in the direction of arrow 60 is opposed and limited by casing 40 . in this manner casing 40 , rather than an opposing blade , absorbs a portion of the initial cutting forces . as blade portions 33 and 35 are advanced toward each other a transverse ( in the direction of lines 61 and 62 ) slicing effect of blade portions 33 and 35 upon cigar 50 is produced . in use , the operation of cigar cutter 10 is as follows . when it is desired to carry the cigar cutter in the pocket or purse , the fingers or thumb of an operator are inserted around or through apertures 5 and 7 of handle means 16 and 17 . reciprocating members 15 and 20 are then pushed toward one another causing blade portion 33 to slide over blade portion 35 , while blade portion 35 slides beneath blade portion 33 , until handle means 16 and 17 are brought into contact with casing 40 . in this position blade portions 33 and 35 lie completely within casing 40 . mechanical engaging means of a type well known in the art may be used to hold reciprocating members 15 and 20 securely in position within casing 40 while cutter 10 is carried in a pocket or purse . when it is desired to cut the end of a cigar , the operator moves reciprocating members 15 and 20 into the relative position indicated in fig1 and 4 , that is extended outwardly from casing 40 . mechanical means as are well known in the art may be used to limit the outward motion of reciprocating members 15 and 20 so that blade portions 33 and 35 are prevented from escaping from casing 40 . as best illustrated in fig4 the end of a cigar 50 is then inserted through opening 25 of casing 40 and between blade portions 33 and 35 . the operator may then insert his thumb and one finger through apertures 5 and 7 and proceed to squeeze blade portions 33 and 35 toward one another thus clipping the end of cigar 50 . fig5 illustrates the relative position of reciprocating members 15 and 20 and blade portions 33 and 35 as they are brought into closer contact with cigar 50 . as can be appreciated from the drawing , the sickle shape of blade portions 33 and 35 continues to produce a transverse slicing motion as opposed to a blunt crushing motion upon cigar 50 . fig6 shows an alternative embodiment 200 of a cigar cutter according to the present invention . cigar cutter 200 is constructed such that reciprocating members 220 and 215 are limited in their travel in the outward direction , that is in the direction shown by arrows 285 and 286 in fig7 by retaining means 270 . retaining means 270 is preferably a small screw which is insertable through case 240 through a small threaded opening in case 240 . the placement of retaining means 270 is preferably along center line 291 , and to one side of opening 225 . to accommodate retaining means 270 , reciprocating members 220 and 215 are adapted to include a recessed portion defining an elongated notch or slot such as that shown at 280 in fig8 . elongated notch 280 is provided along one side of reciprocating member 220 . preferably , elongated notch 280 is located along the longest side , side a , of reciprocating member 220 as shown in fig8 . likewise , reciprocating member 215 is adapted to include a corresponding elongated notch ( not shown ). like elongated notch 280 , the notch of reciprocating member 215 is preferably located along the longest side of reciprocating member 215 . the elongated notches of each reciprocating member are arranged to overlap each other when reciprocating members 220 and 215 are operably disposed within case 240 . retaining means 270 , in this case a small screw , is insertable through case 240 and through the slots of each reciprocating member 215 and 220 such that stopping edge 299 , and the corresponding stopping edge of reciprocating member 215 are engaged by the retaining means when reciprocating members 215 and 220 are extended fully outwardly from case 240 . in that manner reciprocating members 215 and 220 are limited in their outward travel and prevented from escaping case 240 during operation of cigar cutter 200 . when it is desired to replace reciprocating members 215 and 220 , retaining means 270 can be removed and reciprocating members 215 and 220 slidably separated from case 240 . replacement members for reciprocating members 215 and 220 can then be slidably inserted and retaining means 270 reinserted . it is intended that the above description of preferred embodiments of the structure of the present invention and the description of its operation are but one or two enabling best mode embodiments for implementing the invention . other modifications and variations are likely to be conceived of by those skilled in the art upon a reading of the preferred embodiments and a consideration of the appended claims and drawings . these modifications and variations still fall within the breadth and scope of the disclosure of the present invention .

US-92112197-A

an investigative x - ray apparatus comprises a source of x - rays emitting a cone beam centred on a beam axis , a collimator to limit the extent of the beam , and a two - dimensional detector , the apparatus being mounted on a support which is rotatable about a rotation axis , the collimator having a first state in which the collimated beam is directed towards the rotation axis and the second state in which the collimated beam is offset from the rotation axis , the two - dimensional detector being movable accordingly , the beam axis being offset from the rotation axis by a lesser amount than the collimated beam in the second state . the x - ray source is no longer directed towards the isocentre as would normally be the case ; the x - ray source is not orthogonal to the collimators . this is advantageous in that the entire field of the x - ray tube can be utilised . as a result , a lesser field is required of the x - ray tube and the choice of tube designs and capacities can be widened so as to optimise the performance of the x - ray tube in other aspects .

fig1 shows a typical radiotherapy machine . this has a rotatable support 10 on which is mounted a therapeutic x - ray source 12 which is able to produce a collimated beam of high energy x - rays 14 centred on a therapeutic beam axis 16 . also mounted on the rotatable support 10 is an investigative x - ray source 18 , which produces a beam of low - energy x - rays 20 along an investigative beam axis 22 . on the opposite side of the support 10 , a flat panel detector 24 is positioned so as to intersect with the investigative beam axis 22 . the rotatable support 10 is arranged to rotate about an axis which passes through the coincidence of the therapeutic beam axis 16 and the investigative beam axis 22 , and which is orthogonal to both axes . in this case , the therapeutic beam axis and the investigative beam axis are orthogonal to each other , but this is not essential and other designs are possible . the point of coincidence of the two beam axis 16 , 22 and the rotation axis of the support 10 is referred to as the “ isocentre ”. a patient table 26 is located slightly below the isocentre , and a patient 28 resting on the patient table will therefore just lie at the isocentre of the apparatus . in practice , the patient table 26 is made so as to be moveable , to allow the patient to be positioned relative to the isocentre , and permit the treatment of tumours at a variety of bodily locations . during treatment , the therapeutic x - ray source 12 is activated and the beam 14 is collimated so as to match the shape of the tumour . the rotatable support 10 can be used to rotate the therapeutic x - ray source 12 around the patient so as to direct the beam 14 towards the patient from a variety of directions . provided that the tumour is at or near the isocentre , it will always be irradiated . however , the use of a variety of irradiation directions is one factor in reducing the dosage given to healthy tissue whilst maximising the dosage given to the tumour . it is of course essential to ensure that the patient is correctly positioned prior to treatment . to do so , the investigative x - ray source 18 is activated and the low energy beam 20 is passed through the patient and , after attenuation by the patient , is detected by the flat panel detector 24 . this produces a two - dimensional projection image of the patient . the rotatable support 10 is then used to rotate the investigative x - ray source 18 and the flat panel detector 24 around the patient thereby producing a collection of projected images showing the patient from every variety of directions . these can be reconstructed using known algorithms to produce a three - dimensional image of the patients adhering structure , the process known as computed tomography or ct scanning . this internal image of the patient can be used as a final check that the patient is in the correct position , and potentially , as a source of feedback to allow fine adjustment of the position of the patient table 26 . in fig1 , the investigative beam 20 is shown collimated so that the image it projects covers the entire working surface of the flat panel detector 24 . as a result , the width of the beam 20 at the patient 28 is large enough to ensure that the whole of the patient 28 is included in the image obtained by the flat panel detector 24 . problems can arise in the case of very large patients , part of whom will lie outside the beam 20 . in general , it is not possible simply to select a larger flat panel detector 24 and allow a wider beam , since the flat panel detector 24 is a high value item and larger examples cannot be procured at economic cost . accordingly , larger patients are dealt with as shown in fig2 . the same flat panel detector 24 is moved on its support to an offset position , as shown . whilst the flat panel detector 24 still coincides with the investigative beam axis 22 , that axis 22 now crosses the flat panel detector 24 near one edge of the detector 24 . the investigative beam 20 is now collimated slightly differently so that it is no longer centred on the investigative axis 22 but extends from that axis 22 and to one side . as a result , the beam 20 produces an image of approximately one half of the patient 28 , in this case the half lying above the isocentre . however , as the apparatus is rotated around the patient 28 , after a total rotation of 180 ° the image will show the area of the patient below the isocentre . fig3 and 4 illustrate the point schematically . in fig3 , the solid vertical line 30 shows the section of the patient which is being viewed at the start of the rotation process . this is represented as a line , whereas the images are of course projected images rather than a section , but fig3 illustrates the principle only . as the apparatus rotates , the effective image moves through an angle to the dotted line 32 , and as rotation continues further the images moves to the dotted line 34 . thus , as rotation continues , the image taken of the patient maps out a cylindrical volume centred on the axis of rotation . fig4 illustrates the offset method . a solid line 36 of identical length to the solid line 30 is again rotated , but this time the axis of rotation is at one end of the solid line 36 . thus , as the image rotates through 38 and 40 etc ., a larger cylinder is mapped out . this caters for the larger patient . however , it can be seen that twice as many lines are required to map out the same cylindrical volume . thus , the offset rotation arrangement must either spend twice as long gathering images in order to produce the same quality ct reconstruction , or must accept a lower quality ct reconstruction deriving from fewer images . this choice is however clinically useful . fig5 shows an improved apparatus for use in this type of diagnosis . this comprises , in general , an x - ray generating source 50 and a collimator set 52 . the investigative beam axis 22 is shown , together with the isocentre 54 and the flat panel detector 24 . the x - ray source 50 , which we will described in more detail later , produces a beam 56 which is then collimated in the collimator 52 . in this design of collimator set 52 , a number of slots 58 , 60 are provided to receive collimators and filters as required . the first slot 58 contains a beam collimator 62 to produce the investigative beam 20 from the output beam 56 of the source 50 , so that the beam 20 just covers the flat panel detector 24 . in this case , as shown , the beam collimator 62 collimates the beam 56 evenly , by reducing its width equally on both sides . as shown in fig5 , the collimator 52 is aligned with the beam axis 22 and the isocentre 54 . however , the x - ray source 50 is offset by an angle 66 from being perfectly orthogonal to the investigative beam axis 220 . as a result , the x - ray source 50 and the collimator 52 are not in alignment , and the approximate centre 68 of the beam does not coincide with the isocentre 54 . however , the beam does extend across the beam axis 22 and the isocentre 58 is included within the extent of the beam 20 . fig6 shows the same apparatus in which an alternative beam collimator 62 ′ has been fitted , together with an alternative filter 64 ′. the second filter 64 ′ differs only in that its centre is suitably offset . the alternative beam collimator 62 ′ differs in that it collimates the beam asymmetrically with respect to the beam 56 emanating from the x - ray source 50 , but nevertheless symmetrically about the beam axis 22 and the isocentre 54 . in this way , the apparatus can be used as described with respect to fig1 . fig7 shows the same apparatus with a still further alternative collimator 62 ″ and filter 64 ″. in this case , the collimator 62 ″ collimates the beam 56 asymmetrically , but this time in the opposite sense to that of fig6 . instead of returning the beam towards the isocentre 54 , the beam is offset still further from the isocentre 54 such that the beam 20 only just overlaps with the isocentre 54 . this produces an offset beam for use in the manner as described with respect to fig2 above . it will be appreciated that the two extremities of collimation that are required in clinical practice , as shown in fig6 and fig7 respectively , now occupy the extremities of the usable area of the beam . the fullest available extent 56 of the beam is therefore used , by virtue of the angle 66 between the x - ray source 50 and the collimator set 52 . this relieves the designer of the need to select an x - ray tube on the basis of its wide available field , and allows the optimisation of the x - ray tube based on other requirements of the device . fig8 shows , for information , a typical target 70 for use in an x - ray source 50 . fig9 shows the apparatus , schematically , including the target 70 . a high voltage source 72 , typically providing 150 kv is arranged to produce a potential between a hot filament 74 and the anode 70 . the anode 70 is itself mounted on a spindle 76 which is rotatable by a motor 78 . thus , a beam of electrons 80 travels from the filament 74 towards the anode 70 . the anode 70 has a molybdenum core 82 with a generally circular face on which is mounted an annular ring 84 of tungsten / rhenium target material . the apparatus is disposed such that the electron beam 80 lands on the anode at the target material 84 . the surface is slightly bevelled so that , in respect of the surface , the electron beam 80 arrives at an angle and , as a result , an emitted beam of x - rays 86 departs the anode 70 in a direction which is roughly perpendicular to the incoming electron beam 80 . this beam 86 is then collimated by suitable beam stops 88 to produce the output beam 56 of the x - ray source . the motor 78 drives the anode 70 via the spindle 76 so that the annular target 84 is constantly rotating . as a result , the point of contact of the incoming electron beam 80 is constantly moving across the anode although the rotationally symmetric design of the anode 70 means that this does not affect the output beam 56 . as a result , the anode 70 is better able to cool notwithstanding the energy absorbed from the electron beam 80 . the entire apparatus of fig9 is typically enclosed within a suitable vacuum flask , which is itself suspended in a bath of flowing oil so as to assist in heat removal . it will be appreciate from fig8 and 9 that it is only possible to widen the output beam 56 within limits . the width of the output beam 56 will in practice be limited by the size of the rotating anode 70 and by the geometry of the apparatus , for example of the direction of the electron beam 80 , the degree to which the target surface 84 is bevelled , and the dimensions of the target surface 84 . limitations such as the need to rotate the anode 70 and the requirement that the anode be adequately cooled mean that there are limits to the available width of the beam 56 . beyond those available limits , the x - ray intensity becomes less uniform as it eventually fades away to nothing , a phenomenon known as “ tube heel ”. accordingly , the invention as described with respect to fig5 , 6 and 7 allows the available extent of the x - ray beam to be used more efficiently , thereby relaxing the design requirements placed on this aspect of the x - ray tube and allowing it to be optimised in other respects . it will of course be understood that many variations may be made to the above - described embodiment without departing from the scope of the present invention .

US-65924305-A

the invention is an improved form of a rheologically modified fluid which is capable of suspending various particulates including polysaccharides , hydrocolloids , and other food approved items , in a pumpable oil - based carrier fluid . the modified fluid can be thickened such that it can be used as a lubricant or a food item . the modified fluid preferably contains food approved ingredients . a representative system comprises a carrier fluid , a thickening or gelling hydrocolloid , and an oil - thickening compound . a preferred carrier fluid is vegetable oil , a preferred hydrocolloid is xanthan gum , and a preferred oil thickening compound is fumed silica .

a rheologically modified edible oil was developed . cab - o - sil ® m - 5 fumed silica from cabot corporation was used to thicken vegetable oil . the greatest thickening efficiency with the fumed silica is realized when — oh groups on the silica surface can bond to each other to form network structure . the thickening of the oil more importantly depends on the silica concentration , the amount of water and the amount of surfactant present in the system . the silica concentrations used for thickening the oil are in the range of about 1 % to about 5 %. the amount of surfactants ( mixtures of span 80 and tween 80 ) added to thicken the oil are in the range of about 0 . 0 % to about 1 %. the amount of water added is about 0 % to about 1 %. the impact of the addition of fumed silica , fumed silica + water , and fumed silica + surfactant on the behavior of vegetable oil is shown in table 1 . all values presented herein are on a weight basis unless otherwise noted . the percentage of fumed silica , water and surfactant are on the basis of total solution weight ( fumed silica , fumed silica + water , fumed silica + surfactant ). all data presented here are at ambient temperature unless otherwise noted . one approach to produce a liquid delivery system for xanthan gum is to activate the fumed silica with the appropriate amount of water to form hydrogen bonds among themselves in vegetable oil at lower loading . such examples are shown in table 1 . as the silica is activated , the silica particles can come together and form a rigid network . oil is trapped in the silica network , resulting in increased viscosity of the system . with higher concentrations of silica , there is an increase in the viscosity of the system , whereas with higher amounts of water , the system is destabilized . limiting the water concentration minimizes the solution viscosity . a second approach for producing a liquid delivery system for xanthan gum is to add a mixture of surface active agents ( surfactants ) capable of interacting with the silica particles in vegetable oil . as the hydrophilic surfactant head groups interact with the silica particles , the hydrophobic tails will interact among themselves . this interaction forms a network that traps the oil and results in increased viscosity of the system . such examples are shown in table 1 . with higher concentrations of silica and surfactants , there is an increase in the viscosity of the system . limiting the surfactant concentration minimizes the solution viscosity . a third approach for producing a liquid delivery system for xanthan gum is to add a higher amount of fumed silica to the vegetable oil . at higher levels of silica , the silica particles can effectively form a silica network in the system . such examples are shown in table 1 . with higher concentrations of silica , there is an increase in the viscosity of the system . limiting the silica concentration minimizes the solution viscosity . the present invention is directed to compositions of matter where edible oils are viscosified by blending with fumed silica and water ( about 0 . 2 % basis total volume .). depending on the application , water may or may not be required but is tolerated in the fluid . the physical properties of this rheologically modified oil are related to the fumed silica concentration . when the fumed silica is about 1 to about 5 % basis total weight , the edible oil rheology is sufficient to suspend particulates such as xanthan gum . however , this suspension readily flows making it easy to mix , pump , and convey . at higher silica loading , the edible oil becomes very thick and could provide value as a machine lubricant in food applications . the thicker edible oil can also be used for making coatings that could be brushed onto a grill or other cooking surface . healthy spreads can also be developed using this technology . for example , an olive oil can be viscosified and used as a spread or a component in other foods and this component may contain flavorings . it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present invention . all parts , percentages and ratios used herein are expressed by weight unless otherwise specified . all documents cited herein are incorporated by reference . to 489 g of vegetable oil , 10 g of cab - o - sil ® m - 5 fumed silica is added and dispersed throughout the oil with mixing . 1 g of water is then added . the vegetable oil , fumed silica , and water are then mixed for 5 minutes on a silverson mixer at 6 , 000 rpm to thicken the oil . the fumed silica - thickened vegetable oil has sufficient rheology to suspend xanthan gum particles . this suspension readily flows and is easy to mix , pump , and convey . methods used to measure mixing , pumping , and conveyance of materials are well known to those skilled in the art . the shear viscosity at high shear rates (≧ 20 sec − 1 ) typically predicts the flow characteristics of the fluid during pumping or mixing . see table 1 . the xanthan slurry is prepared using the above mentioned thickened vegetable oils . the desired amount of the xanthan gum is added to the modified oils to prepare the slurry . the concentration of the gum here is 40 %. after the addition of the gum , the slurries are stirred for 20 minutes using a bench top mixer . the nature of the slurry ( free flowing or thick paste ) depends on the amount of fumed silica or fumed silica + water or fumed silica + surfactant present in the system . the stability of the slurries at ambient temperature is tested by monitoring them at different intervals of time . fig1 shows the slurry just after mixing . from this figure , it can be seen that all the slurries are stable . after 24 hours of storage at ambient temperature , there is top layer separation of the oil in the system containing fumed silica + water and fumed silica + surfactant , which can be seen in fig2 . the system containing fumed silica without water and surfactant is quite stable and there is no separation at all . fig3 shows the stability of the above systems after a week of preparation . this figure clearly shows that the slurries prepared with the system containing only fumed silica and vegetable oil are quite stable after a week of storage at ambient temperature . clear separation of the oil layer at the top can be observed for the systems containing fumed silica + water and fumed silica + surfactant . this is because water and surfactant help fumed silica particles to form aggregates . so at lower concentrations of silica , water or surfactant can bring the silica particles together to form aggregates . the formation of these networks helps to trap the oil , hence modifying the viscosity of the oil system . but the addition of xanthan gum to the system disturbs the network by either interacting or taking away the water or surfactant from the silica , hence breaking the network . with the breaking of these networks , more and more oil trapped in the network comes out at the top of the slurry . whereas , in the case of silica only , the network among the silica particles is much stronger than the network formed with the help of water and surfactant . so the addition of xanthan gum has little effect on the system containing fumed silica and vegetable oil . a creamy , smooth textured italian dressing was prepared with a xanthan gum slurry . the dressing was easily pourable and eye appealing . the dressing had excellent emulsion stability , flavor release , and mouth feel . the slurry was hydrated with available water under vigorous agitation conditions for 15 minutes . a dry blend of the remaining ingredients was added to the slurry . egg yolks were then introduced into the slurry , followed by vegetable oil , vinegar , and lemon juice . the mixture was homogenized using a colloid mill , with a mill setting of 0 . 25 mm ( 00 . 1 in .). the ingredient formulation is presented in table 2 .

US-38297906-A

the invention relates to a pharmaceutical composition and a method for treating drug addicts &# 39 ; withdrawal syndrome and detoxifying addicts . the pharmaceutical composition comprises aconitane derivative of formulas i , ii , their inorganic acid salts or mixtures thereof , and tetrahydroprotoberberine derivatives of formula ii . the method of treatment comprises administering the pharmaceutical composition to drug addicts . the pharmaceutical composition of the present invention produces no drug dependence , excellent effects , fast action and low side - effects .

according to this invention , the inventive pharmaceutical composition may contain or may not contain anticholinergic agents , such as , scopolamine hydrobromide , anisodamine hydrobromide , and the like , as well as pharmaceutically acceptable excipients . preferred aconitane derivatives include lappaconitine hydrobromide , lappaconine hydrobromide , n - deacetyl - lappaconitine hydrobromide , the total alkaloids of aconitum sinomontanum nakai . preferred tetrahydroprotoberberine derivatives having the structure of formula iii or their inorganic acid salts are the 1 - tetrahydropalmatine , dl - tetrahydropalmatine sulfate , and stepholidine hydrobromide . the preferred anticholinergic agents are scopolamine hydrobromide and anisodamine hydrobromide . particularly good effects are achieved when the pharmaceutical composition contains anticholinergic agents . 1 . the formulation including lappaconitine hydrobromide and 1 - tetrahydropalmatine or dl - tetrahydropalmatine sulfate or stepholidine hydrobromide , scopolamine hydrobromide and / or anisodamine hydrobromide as well as a conventional pharmaceutical excipient . 2 . the formulation containing lappaconine and 1 - tetrahydropalmatine or dl - tetrahydropalmatine sulfate or stepholidine hydrobromide , scopolamine hydrobromide and / or anisodamine hydrobromide as well as a conventional pharmaceutical excipient . 3 . the formulation including n - deacetyllappaconitine hydrobromide and 1 - tetrahydropalmatine or dl - tetrahydropalmatine sulfate or stepholidine hydrobromide , scopolamine hydrobromide and / or anisodamine hydrobromide as well as a conventional pharmaceutical excipient . 4 . the formulation including the total alkaloid hydrobromides of aconitum sinomontanum and 1 - tetrahydropalmatine or dl - tetrahydropalmatine sulfate or stepholidine hydrobromide , scopolamine hydrobromide and / or anisodamine hydrobromide as well as a conventional pharmaceutical excipient . according to this invention , the pharmaceutical composition of this invention can be used in the form of a tablet , powder , capsule or administered by injection . the form of tablet or capsule is preferred . this invention also provides a method for the treatment of drug - addicts &# 39 ; withdrawal syndrome and detoxification of drug addicts , which comprises administering an anti - withdrawal syndrome or detoxification effective amount of the pharmaceutical composition of this invention to the drug addicts . the administration route of the inventive composition can be oral , subcutaneous injection , intramuscular injection , intravenous instillation , and the like . oral administration is preferred . in the treatment by oral administration route , the dosage is generally 0 . 05 ˜ 0 . 25 mg / kg / per time of aconitane derivatives of formula i or ii or their inorganic acid salts , 1 - 2 . 5 mg / kg / per time of tetrahydroprotoberberine or its inorganic acid salt , 0 . 00033 ˜ 0 . 005 mg / kg / per time of scopolamine hydrobromide , and / or 0 . 066 ˜ 0 . 16 mg / kg / per time of anisodamine hydrobromide . generally , oral administration is given during the first four days , the inventive composition is given every 6 hours , 4 times a day , 2 tablets or 2 pills per time ; during the following three days , the composition is given every 8 hours , 3 times a day , 2 tablets or pills per time . male mice weighing 18 ˜ 22 g were used for the test and divided into 3 groups ( 10 for every group ). the first group of mice was given a subcutaneous injection in a dose of 80 mg / kg morphine hydrochloride every day for 20 days . the second group of mice was given a subcutaneous injection of lappaconitine hydrobromide ( 8 mg / kg ) for 20 days . the third group was a control group and was given physiological saline . 6 hours after being given the last dose , all the mice were given an intraperitoneal injection of 10 mg / kg allyl dromaran , and then were placed in a cone cylinder cage ( diameter = 30 cm , height = 35 cm ). the number of jumps for each mouse in 60 minutes was recorded . the mice of the first group after administrating morphine looked excited , frequently ran around and showed obvious pilo - erection reaction . the mice of the group also showed an obvious jumping reaction after injection of allyl dromaran . the mice of the second group after administrating lappaconitine hydrobromide looked quiet and immobile and showed no pilo - erection reaction . after the injection of allyl dromaran they showed no jumping reaction . in another case , male mice weighing 18 - 22 g were divided into four groups ( 10 for every group ). two groups of mice were injected subcutaneously with lappaconitine hydrobromide 7 times within 2 days . the initial dosage was 3 . 5 mg / kg . then , additional doses of 0 . 5 mg / kg and 1 . 0 mg / kg were given for every injection in each group , respectively . the third group of mice was injected subcutaneously with morphine hydrochloride 7 times within 2 days . the initial dosage was 2 . 5 mg / kg and an escalating dose schedule of 5 , 10 , 20 , 30 , 40 , 50 mg / kg was applied . the fourth group of mice was used as control group and was given physiological saline . two hours after the last injection , all the mice of the above four groups were injected with 50 mg / kg nalorphine through the intraperitoneal cavity . the number of jumps within 10 minutes in each group of mice were recorded . the data obtained is summarized in table 4 . the test result in table 4 shows that lappaconitine hydrobromide obviously differs from morphine hydrochloride , and the former does not cause drug dependence . wister male rats weighing 200 - 250 g were divided into 3 groups ( 10 for each group ). all three groups were given subcutaneous injections of 25 mg / kg morphine hydrochloride twice a day . the injections lasted for 12 weeks to cause the rats to become dependent upon morphine . after discontinuing the injections of morphine , the rats were suppressive and immobile , refusing food and losing weight ( after 24 hours , the average weight loss per rat was 25 g ). then , the three groups of rats were injected with morphine , lappaconitine , and physiological saline , respectively . the weight changes of the rats were observed and recorded in fig1 . abscissa - time ( hr ): 24 hours after stopping the injection of morphine for three groups of rats , and injecting them subcutaneously with morphine , lappaconitine and physiological saline , respectively , the average weight change of the rats within 8 hours in each group were recorded . the 24th hour after stopping of the injection of the morphine is assumed to be zero . ordinate - weight of rats : the average weight lost of the three groups of rats at the 24th hour after stopping the injection of morphine , and the average weight change in 8 hours in each group after 24 hours of injection with morphine , after the rats were given injections of morphine , physiological saline and lappaconitine , respectively . in the test , the average weight before stopping injection of morphine is assumed to be zero . fig1 shows that the group of rats which were injected with morphine turned to being excited from being suppressive , moved increasingly , frequently took food and water , and the weight increased to the level shown very quickly before stopping injection of morphine . fig1 also shows that the group of rats which were injected with lappaconitine still looked suppressive and no weight increase was observed . the test results indicated that lappaconitine did not act as a substitution for morphine . three of 6 macaca mulatta weighing 2 . 75 ˜ 4 . 75 kg were subcutaneously injected with lappaconitine twice a day . the initial dosage is 0 . 1 mg / kg , and the dose was successively escalated to the maximum tolerance dosage , 2 mg / kg within 50 days . then , the tolerance dosage was maintained to the 53rd day , 67th day and 92nd day , respectively . the total injection dosages for the three monkeys were 196 , 400 and 635 mg , respectively . on day 63 and day 92 , the injections of lappaconitine to the monkeys was stopped . during the following 24 hours , the monkeys had no different behavior and appetite from that before stopping injection . on day 29 , 53 , 59 , 67 and 90 , injections to the monkeys were discontinued and after 18 hours , subcutaneous injection of nalorphine ( 4 or 8 mg / kg ) were given . no withdrawal symptoms were observed . another three monkeys were given subcutaneous injection of morphine twice a day . the initial dosage was 2 . 5 mg / kg , and the dosage was successively increased to 25 mg / kg on day 21 . then , this dosage was maintained until the 30th day , and the monkeys showed dependence on morphine . 18 hours after stopping the injection of morphine , the monkeys showed obvious withdrawal syndrome , such as , agitation and restlessness , turning , sometimes lying on the side or on the bottom of the cage , scratching , chain biting , crying , vomiting , shivering , paroxysmal tremor , and the like . at that time , if a subcutaneous injection of nalorphine was given to the monkeys , the above symptoms would be more obvious . after subcutaneous injection of morphine to the monkeys , the above withdrawal symptoms were obviously reduced or disappeared in 3 ˜ 5 minutes . a subcutaneous injection of 2 mg / kg lappaconitine could not relieve or weaken the above withdrawal symptoms . this indicates that lappaconitine does not act as a substitute for morphine . the above test results are shown in table 5 . the above test results also indicate that lappaconitine , unlike morphine , does not cause dependence after long term use . healthy mice weighing 18 - 22 g were given toxicity dosages of lappaconitine through intra gasteria , subcutaneous injection and intravenous injection , and then showed toxicity reactions , such as , paroxysmal restlessness , and foreleg tic . when given a lethal dosage , the mice showed paroxysmal convulsion , respiration suppression until suffocation , and death . the ld50 values ( 95 % confidence limit ) for , intra gasteria , subcutaneous injection and intravenous injection were 32 . 4 ( 25 . 9 - 40 . 5 ), 11 . 7 ( 9 . 2 - 14 . 9 ) and 8 . 4 ( 7 . 2 - 9 . 7 ) mg / kg , respectively . after being given intraperitoneal injection of toxicity dosage of lappaconitine , rats looked suppressive and immobile lying on stomach in cage , obvious suppression of respiration and showed convulsions before death . the ld50 for lappaconitine was 16 . 5 ( 15 . 0 - 18 . 1 ) mg / kg . two macca mulatta were given subcutaneous injections of 2 mg / kg lappaconitine . no toxic reaction and no effect on electrocardiography were observed . 30 minutes after being given subcutaneous injection of 3 mg / kg lappaconitine , the monkeys showed restlessness , slobbering , increased swallowing , drooping eyelids , and rigidity of leg muscles . after 45 minutes , one monkey increased restlessness , and further developed convulsion . during convulsion its respiration stopped , and was recovered with artificial respiration . the convulsion still continued until death after 1 hr . another monkey did not give signs of convulsion , and the above toxic reaction lasted for 2 hours and then disappeared . electrocardiography examination indicated that t wave had elevation , t wave and p wave fused , and r wave became smaller and notching . next day , the electrocardiography examination indicated that the monkey was normal . ten wister rats weighing 200 ˜ 250 g were divided into 2 groups ( 5 for each group ). each group was given intraperitoneal injection of 5 mg / kg or 10 mg / kg of lappaconitine a day , respectively . the injection was continued for 30 days . 5 wister rats of a control group were given subcutaneous injections of saline ( 2 ml / kg ). compared to the control group , the medicated groups of rats showed inhibited weight increase at different levels . no obvious change was observed in electrocardiography examination . no change was observed during tests of the hepatic and renal function ( gpt , zinc sulfate turbidity test , urea nitrogen , creatinine ) and histological and pathological examination of different viscera . another ten wister rats were medicated with successively escalated doses , in other words , the rats were first injected with lappaconitine ( 8 mg / kg ) intraperitoneally . after one week with 10 mg / kg ; after 2 weeks with 12 mg / kg ; after 16 days with 14 mg / kg ; and the last dose was maintained until day 28 . the test results indicated that the weight increase of the medicated group of rats was a little suppressed , compared to the control group . the histological and pathological examination of all viscera indicated similar results to the control group , except a little myocardial edema and hydropic degeneration . three macca mulatta weighing 2 . 75 ˜ 4 . 75 kg were injected with lappaconitine subcutaneously twice a day . initiated with 0 . 1 mg / kg , the dosage was increased successively to the highest tolerated dosage , 2 mg / kg within 50 days , and the last dosage was maintained to day 53 , day 67 and day 92 , respectively . the accumulated injective dosage was 196 , 400 and 635 mg , respectively . no toxic reaction for the monkeys was observed during the administration process . no obvious change appeared during the continuous electrocardiographic examination . histological and pathological examinations mainly indicated stimulating reaction , except a little edema and hydrodenaturation in the liver and increasing cerebral colloid cells . iii . a treatment test for mice dependent on morphine or cocaine male mice weighing 18 - 22 g were injected subcutaneously with morphine ( 100 mg / kg ) twice a day , and the injection was continued for 8 days . 6 hours after the last dose , the mice were injected with nalorphine ( 50 mg / kg ). the mice showed frequent movement , attacking reactions and jumping reactions . the jumping reaction was most vigorous within the first 30 minutes . based on the jumping reactions of the mice , those morphine - dependent mice whose jumping number within 30 minutes was more than 60 % of the average jumping number , were selected and divided at random into 8 groups of 10 mice each . a seven - day treatment to relieve morphine - dependence was conducted based on the medications , the dose and administration route listed in table 6 for each group of mice which were morphine - dependent . in the first 4 days , administration was given once per 6 hours , four times a day . from day 5 through day 7 , administration was given once every 8 hours , three times a day . on day 5 and day 8 of treatment , respectively , subcutaneous injections of nalorphine ( 50 mg / kg ) were made to induce addiction . the test results indicated that each group of mice gave a negative reaction against nalorphine except the control group of morphine dependent mice , most of which died during seven days of subcutaneous injection of saline . during the 3 - day observation following after stopping the treatments , the mice treated did not show withdrawal symptoms . even when nalorphine ( 50 mg / kg ) was injected subcutaneously , the mice did not exhibit withdrawal symptoms either . the results are listed in table 6 . in the same way as described above , subcutaneous injection of cocaine ( 10 mg / kg ) were given to the mice twice a day , and the injection was continued for 7 days . during this period of injection of cocaine , the mice gave abnormal signs such as anorexia , pilo - erection , and frequent walking with holding tail , and the like . after treatment with lappaconitine , the mice recovered to normal . a 29 year old male addict had taken heroine for about 4 years . the pharmaceutical composition of medications of this invention were administered to him before he showed withdrawal symptoms . in the first day after administration , the addict did not show withdrawal symptoms , except for intermittent perspiration . in the second day of treatment , the addict showed withdrawal symptoms , such as , light perspiration , yawing , lacrimation , mydriasis , and the like , as well as vomiturition once , diarrhoea once , light * elbow ache lasting intermittently about 16 hours and somewhat serious ** palpitations lasting intermittently about 4 hours . however , the addict had normal sleep and diet . the above withdrawal symptoms disappeared in the evening of the second day and did not reappear . he is cured . a 27 year old male addict had taken heroine for about 6 years . the pharmaceutical composition of this invention was administered to him before he showed withdrawal symptoms . in the first day after administration , the withdrawal symptoms did not appear until 10 hours after administration of the composition of the day . after 10 hours , the addict was observed to show withdrawal symptoms , such as , light yawing , raving in sleep , mydriasis and the like , as well as vomiturition once , abdominal pains twice and diarrhoeas . the withdrawal symptoms lasted 38 hours and included mainly intermittent light * palpitation , ache of shanks and arms , as well as somewhat serious ** palpitation which lasted intermittently for 5 hours . the addict had normal sleep and diet . the above withdrawal symptoms disappeared at the 60th hour after administration and did not reappear . he was cured . a 29 year old male addict had taken heroine for about 5 years . the pharmaceutical composition of this invention was given to him before he was observed to show withdrawal symptoms . he was not observed to show the symptoms within 12 hours after administration . after 12 hours , the addict showed symptoms , such as , light palpitation , perspiration , mydriasis and the like , as well as vomiturition three times and diarrhoea twice , and light * or somewhat serious ** aches of shanks and waist . the addict had normal sleep and diet . the above withdrawal symptoms disappeared totally and did not reappear at the 65th hours after administration . he was cured . the above clinical test results demonstrated that the pharmaceutical composition of this invention to treat drug addiction does not cause drug dependence . it is effective to relieve drug dependence , to cure withdrawal symptoms and acts rapidly without side effects . light * is marked as +, the manifestations demonstrated palpitation , aches of waist and legs told by addicts ; lying and sitting ; sometimes tossing and tumbling on bed ; no pain in addicts face ; sometimes having hours of sleep . somewhat serious ** is marked as ++, the manifestations demonstrated nervous walking back and forth in the room ; or having aches of waist and legs , requirement for extending arms and legs , having pain on addicts face . serious *** is be marked as +++, the manifestations demonstrated wild behavior ; producing bloody behavior , such as bumping with head , persecution , etc . in the cases of treatment , a few addicts said that they felt unwell as if an insect was crawling within their arms and legs . table 1______________________________________the composition of formula i______________________________________no . aconitane derivatives formula mw mp (° c . ) ______________________________________1 lappaconitine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 8 584 224 - 2252 lappaconine c . sub . 23 h . sub . 37 no . sub . 6 423 78 - 803 n - deacetyllappaconitine c . sub . 30 h . sub . 42 n . sub . 2 o . sub . 7 542 117 - 1194 isolappaconitine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 8 584 198 - 2005 deoxylappaconitine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 7 568 212 - 214neofinaconitrine c . sub . 30 h . sub . 42 n . sub . 2 o . sub . 6 5267 ranaconitine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 9 600 130 - 1318 ranaconine c . sub . 23 h . sub . 37 no . sub . 7 439 105 - 1079 n - deacetylranaconitine c . sub . 30 h . sub . 42 n . sub . 2 o . sub . 8 558 125 - 12710 finaconitine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 10 616 220 - 22111 n - deacetylfinaconitine c . sub . 30 h . sub . 42 n . sub . 2 o . sub . 9 574 121 - 12312 puberanine c . sub . 32 h . sub . 44 n . sub . 2 o . sub . 9 60013 episcopalisine c . sub . 29 h . sub . 39 no . sub . 6 49714 episcopalisinine c . sub . 22 h . sub . 35 no . sub . 5 393 152 - 15415 episcopalitine c . sub . 24 h . sub . 37 no . sub . 5 41916 delavaconitine c . sub . 29 h . sub . 39 no . sub . 6 49717 delavaconine c . sub . 22 h . sub . 35 no . sub . 5 393 15218 aconosine c . sub . 22 h . sub . 35 no . sub . 4 377 142 - 14319 scopaline c . sub . 2l h . sub . 33 no . sub . 4 363 167 - 169______________________________________aconitaneno . derivatives specific rotation r . sub . 1 r . sub . 2______________________________________ 1 lappaconitine [ α ]. sub . d . sup . 25 27 . 0 °( c0 . 22 , chcl . sub . 3 ) oacabz h 2 lappaconine oh h 3 n - deacetyl - [ α ]. sub . d . sup . 33 39 . 9 °( c1 . 5 , chcl . sub . 3 ) oabz hlappaconitine 4 isolappaconi - oacabz ohtine 5 deoxyl - oacabz happaconitine 6 neofinaconi - oabz htine 7 ranaconitine [ α ]. sub . d . sup . 22 40 . 2 °( c0 . 19 , meoh ) oacabz oh 8 ranaconine oh oh 9 n - deacetyl - [ α ]. sub . d . sup . 26 43 . 7 °( c2 . 0 , chcl . sub . 3 ) oabz ohranaconitine10 finaconitine [ α ]. sub . d . sup . 22 44 . 7 °( c0 . 1 , me oacabz oh11 n - deacetyl - [ α ]. sub . d . sup . 10 34 . 9 °( c0 . 46 , chcl . sub . 3 ) oabz ohfinaconitine12 puberanine [ α ]. sub . d . sup . 20 16 . 6 °( c0 . 6 , chcl . sub . 3 ) oacabz oh13 episcopali - [ α ]. sub . d . sup . 21 - 11 . 7 °( c3 . 2 , etoh ) h hsine14 episcopalis - [ α ]. sub . d . sup . 26 - 8 . 7 °( c6 . 8 , etoh ) h hinine15 episcopalitine [ α ]. sub . d . sup . 22 - 0 . 90 °( c14 . 0 , etoh ) h h16 delavaconi - [ α ]. sub . d . sup . 17 - 9 . 56 °( c7 . 0 , etoh ) h htine17 delavaconine [ α ]. sub . d . sup . 15 - 6 . 4 °( c1 . 23 , chcl . sub . 3 ) h h18 aconosine [ α ]. sub . d . sup . 22 - 25 . 4 °( c4 , me hh ) h19 scopaline h h______________________________________no . r . sub . 3 r . sub . 4 r . sub . 5 r . sub . 6 r original plant______________________________________ 1 oh h h och . sub . 3 αoch . sub . 3 aconitum sino - montanum nakai ; a . finetianum hand - mazz 2 oh h h och . sub . 3 αoch . sub . 3 3 oh h h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz 4 h h h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz 5 h h h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz 6 h h h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz 7 oh h h och . sub . 3 αoch . sub . 3 aconitum sino - montanum nakai ; a . finetianum hand - mazz 8 oh h h och . sub . 3 αoch . sub . 3 9 oh h h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz10 oh oh h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz11 oh oh h och . sub . 3 αoch . sub . 3 a . finetianum hand - mazz12 oh h h och . sub . 3 βoch . sub . 3 a . barbatum var . puberulum13 oh h h ob . sub . z αoch . sub . 3 a . episcopale le &# 39 ; vl14 oh h h oh αoch . sub . 3 a . episcopale le &# 39 ; vl15 h h h oac αoch . sub . 3 a . episcopate le &# 39 ; vl16 h h oh ob . sub . z αoch . sub . 3 a . delavayi franch17 h h oh oh αoch . sub . 318 h h h oh αoch . sub . 3 a . forestii diels19 h h h oh αoh a . episcopale le &# 39 ; vl______________________________________ table 2__________________________________________________________________________the composition of formula iiname formula mw mp (° c .) specific rotation r . sub . 1 r . sub . 2 r . sub . 3 original plant__________________________________________________________________________aconinec . sub . 25 h . sub . 41 no . sub . 9 499 132 [ a ]. sub . d + 23 ° oh oh oh__________________________________________________________________________ table 3__________________________________________________________________________the compound of formula iii tetrahydro protoberberineno . derivatives formula mw mp (° c .) specific rotation r . sub . 1__________________________________________________________________________1 1 - tetrahydropal c . sub . 22 h . sub . 25 no . sub . 4 355 144 [ α ]. sub . d . sup . 26 - 295 °( c = 0 . 8 , etoh ) och . sub . 3matine2 dl - tetrahtdropal c . sub . 22 h . sub . 25 no . sub . 4 355 148 - 149 [ α ]. sub . d 0 ° och . sub . 3matine3 stephoridine c . sub . 19 h . sub . 27 no . sub . 4 327 129 - 133 [ α ]. sub . d . sup . 21 - 263 °( c = 0 . 337 , meoh ) oh4 corydaline c . sub . 22 h . sub . 27 no . sub . 4 369 135 [ α ]. sub . d . sup . 20 + 311 °( c = 0 . 8 , etoh ) och . sub . 35 xylopinine c . sub . 23 h . sub . 25 no . sub . 4 355 181 - 182 [ α ]. sub . d . sup . 15 - 177 . 2 °( c = 4 . 07 , chcl . sub . 3 ) och . sub . 3__________________________________________________________________________ table 4______________________________________observation of jumping reaction for mice after subcutaneousinjections of lappaconitine or morphine______________________________________ accumu - number admini - lated of micegiven stration total given numberpharma - dosage * dosage pharma - of miceceuticals ( mg / kg ) / day ( mg / kg ) ceuticals tested______________________________________physiologi - -- 2 10 10cal 2 20 10 10salinemorphine 2 . 5 2 157 . 5 10 10 80 20 1600 10 10lappaconi - 3 . 5 2 35 10 10tine 3 . 5 2 45 . 5 10 5 ** 8 . 0 20 160 18 18______________________________________ ip number of jumpinggiven mg / kg allyl - jumping times ofpharmaceuticals nalorphine dromaran mice each mouse______________________________________physiological 50 0 0saline 10 0 0morphine 50 7 9 10 9 34lappaconitine 50 0 0 50 0 0 10 1 0 . 2______________________________________ * once a day for 20 days group ; five injections on first day and twice on the second day for the 2 day group . ** during the administration of the pharmaceuticals , five mice died of accumulated toxicity . table 5______________________________________observation of the substitution role of lappaconitine in thewithdrawal syndrome of morphine -- dependent monkeys withdrawal syndrome injection of accumulated 18 hr after nalorphineno . of morphine total dosage stopping 0 . 5 mg / kgmonkeys ( day ) ( g ) morphine sc______________________________________6 42 4 . 66 + 7 40 3 . 56 + 62 6 . 59 + 69 7 . 56 + 91 10 . 97 + 8 33 3 . 61 + 49 6 . 06 + ______________________________________ notes : + means symptoms present . - means no symptoms . table 6__________________________________________________________________________observation of treatment for morphine -- dependent mice__________________________________________________________________________ days of number of dosage administration accumulated mice number of mg / g ( time / hour ) total dosage morphine - micemedication ( administration route ) day day ( mg / kg ) dependent treatment__________________________________________________________________________saline 10 ml / kg 1 / 6 1 / 8 250 ml 10 08 ( sc ) lappaconitine 0 . 45 1 / 6 1 / 8 11 . 25 10 10hydrobromide ( sc ) lappaconitine 0 . 225 1 / 6 1 / 8 5 . 63 10 10hydrobromide * ( sc ) scopolamine 0 . 05hydrobromide ( sc ) lappaconitine 0 . 45 1 / 6 1 / 8 11 . 2 10 10hydrobromidescopolamine 0 . 1 2 . 5hydrobromide ( sc ) lappaconitin 0 . 9 1 / 6 1 / 8 22 . 5 10 10hydrobromidescopolamine 0 . 2 5 . 0hydrobromide ( ig ) lappaconitine 0 . 45 1 / 6 1 / 8 11 . 25hydrobromide 0 . 1 2 . 5 10 10scopolamine ( ig ) hydrobromiden - deacetyllapp - 5 1 / 6 1 / 8 125 10 10aconitine ( sc ) hydrobromidelappaconine 5 1 / 6 1 / 8 125 10 10hydrobromide ( sc ) ( s ) __________________________________________________________________________ number of jumping mice ( nos . of jumping mice / nos . of survived mice ) day 1 day 4 nalorphine day 5 after stopping after stoppingmedication mg / kg of treatment drug administration__________________________________________________________________________saline 50 4 / 6 ** 3 / 3 ** 1 / 2 ** lappaconitine 50 1 / 10 * 0 / 10 0 / 10hydrobromidelappaconitine 50 1 / 10 *. sup . 4 1 / 10 * 1 / 10hydrobromide , scopolaminehydrobromidelappaconitine 50 0 / 10 0 / 9 0 / 9hydrobromide , scopolaminehydrobromidelappaconitine 50 0 / 10 0 / 8hydrobromide , scopolaminehydrobromidelappaconitine 50 1 / 10 *. sup . 5 0 / 9 0 / 9hydrobromide , scopolaminehydrobromiden - deacetyllapp - 50 0 / 10 0 / 10 0 / 10aconitinehydrobromidelappaconine 50 0 / 10 0 / 10 0 / 10hydrobromide__________________________________________________________________________ note * denotes a clinical prescription , but the scp is larger than clinic prescription . ** 4 / 6 denotes six mice survived , of which four were jumping and the numbe of jumps of the four is 17 , 14 , 8 and 16 . respectively ; 3 / 3 means three mice survived , and the number of jumps of the three are 12 , 10 and 9 , respectively ; 1 / 2 denotes that two mice being survived , and one jumped 7 times . *. sup . 3 denotes that ten mice survived during the test , but only one jumped five times . *. sup . 4 denotes that ten mice survived during test , and only one jumped 10 , 6 and 1 times , on the fifth day of treatment , the eighth day of treatment and the fourth day , respectively , of stopping administration . *. sup . 5 denotes that ten mice survived during the test , only one jumped 1 times .

US-12536393-A

ultrasonic imaging method and apparatus capable of displaying on a screen not only the shapes of internal organs but also the differences in properties thereof . the ultrasonic imaging method includes the steps of obtaining plural kinds of image data by transmitting plural kinds of ultrasonic waves at different transmission power and receiving the plural kinds of ultrasonic waves reflected from an object to be inspected ; and performing arithmetic by using the plural kinds of image data obtained at step to thereby figure out new image data .

preferred embodiments of the present invention will now be described with reference to the drawings . the same components are designated by the same reference numeral and an explanation thereof will be omitted . fig1 is a block diagram showing an ultrasonic imaging apparatus according to an embodiment of the present invention . referring to fig1 a system control unit 1 controls the entire system to acquire combined images by arithmetically processing plural kinds of frame data which are obtained based on signals acquired by transmitting plural kinds of ultrasonic waves at different transmission power and receiving the ultrasonic waves reflected from a reflector . the reason will be explained why the ultrasonic imaging apparatus makes use of the plural kinds of ultrasonic waves transmitted at different transmission power . fig2 shows echo intensity vs . transmission power as to reflectors a and b which exist within the interior of a living body as an object to be inspected . as can be seen in fig2 such acoustic characteristics can vary diversely depending on the reflectors such as internal organs , e . g ., including ones like reflector a having an acoustic characteristic indicative of a response in the form of an exponential function and ones like reflector b indicating a linear response to transmission power within a specified range but showing no change out of the specified . thus , it is possible to extract an image of a specific internal organ , etc . by multiplying by appropriate coefficients a plurality of ultrasonic images , which are obtained by transmitting and receiving ultrasonic waves at at least two different kinds of transmission power , and finding the difference therebetween , thereby canceling the background indicative of linear acoustic characteristics with respect to the ultrasonic transmission power . a probe 2 includes an ultrasonic transducer array having a plurality of ultrasonic transducers which are arranged one - dimensionally or two - dimensionally . as the ultrasonic transducers , vibrators can be used which are made of piezoelectric ceramics represented by pzt ( pb ( lead ) zirconate titanate ) or polymer piezoelectric elements such as pvdf ( polyvinyl difluoride ). the vibrators have electrodes attached thereto and are connected via lead wires to an electronic circuit included in a main body of the ultrasonic imaging apparatus . the probe 2 may include a backing material for supporting the vibrators and providing acoustic attenuation to the vibrators , an acoustic matching layer ensuring effective transmission of ultrasonic waves , and an acoustic lens for gathering the ultrasonic waves . the ultrasonic imaging apparatus further includes a transmission delay control circuit 11 for controlling ultrasonic wave transmitting / receiving conditions under the control of the system control unit 1 , a transmission power control circuit 12 , a transmission frequency control circuit 13 , a reception sensitivity control circuit 21 and a reception delay control circuit 22 . in conformity with the control of the system control unit 1 , the transmission frequency control circuit 13 controls a signal generator 14 in order to transmit ultrasonic waves having a predetermined frequency . the signal generator 14 generates signals in accordance with the control of the transmission frequency control circuit 13 . a plurality of transmission drive circuits 15 amplify and delay the signals generated by the signal generator 14 , to thereby output drive signals . on the basis of the drive signals , the probe 2 transmits ultrasonic waves to an object to be inspected and receives the ultrasonic waves reflected from the object to output detection signals . the detection signals are amplified by a plurality of amplifiers 23 . the transmission power control circuit 12 controls the amplitude of the drive signals output from the plurality of transmission drive circuits 15 so that the ultrasonic wave transmission power is controlled . the transmission delay control circuit 11 controls the delay time of the drive signals output from the plurality of transmission drive circuits 15 . this allows each of the plurality of ultrasonic transducers included in the probe 2 to transmit ultrasonic waves having a phase difference corresponding to the time difference of the drive signals , at predetermined transmission power , toward the object to be inspected . ultrasonic beams are thus formed by wavefront combining of such plurality of ultrasonic waves . the reception sensitivity control circuit 21 controls gains of the plurality of amplifiers 23 to thereby control the reception sensitivity . the reception delay control circuit 22 controls the delay time of the detection signals in the reception delay circuit 24 . a signal processing unit 31 subjects output signals of the reception delay circuit 24 to log compression , detection , analog - to - digital conversion and other processing , to create image data for output . under the control of the system control unit 1 , an address control unit 33 provides as its output an address for controlling the storage region for the output image data . in accordance with the address , a primary storage unit 32 sequentially stores the image data output from the signal processing unit 31 . those image data are stored in separate regions corresponding to ultrasonic wave transmission power to constitute frame data for each transmission power . in this manner , the primary storage unit 32 stores frame data obtained as a result of transmission / reception of ultrasonic waves in accordance with different transmission power . a table 35 stores coefficients for use in combining a plurality of frame data stored in the primary storage unit 32 . referring to the table 35 , an arithmetic unit 34 executes arithmetic processing on the frame data stored in the primary storage unit 32 to create combined image data . the created combined image data are stored in a secondary storage unit 36 and displayed on a screen of a display unit 38 such as a crt . an image processing unit 37 subjects the combined image data to interpolation , response modulation processing , gradation processing or other processing . a recording unit 39 records the combined image data on a recording medium such as a hard disk or a magneto optical disk ( mo ). the ultrasonic imaging apparatus according to this embodiment may be of an independent type which incorporates the secondary storage unit 36 , the display unit 38 and the recording unit 39 into the main body , or may be of a network connection type which is connected via a network to the secondary storage unit 36 , the display unit 38 , the recording unit 39 and so on . operations of the ultrasonic imaging apparatus according to this embodiment will then be described with reference to fig1 - 3 . fig3 is a flowchart showing the operations of the ultrasonic imaging apparatus according to this embodiment . initialization is first performed at step s 1 . more specifically , ultrasonic wave transmission power e 1 and ultrasonic wave transmission power e 2 are set in order to transmit plural kinds of ultrasonic waves at different transmission power . herein , a frequency of the ultrasonic waves to be transmitted may be set . after the initialization , the system control unit 1 first sends control signals to the transmission power control unit 12 and the transmission frequency control unit 13 in order to transmit ultrasonic waves at the transmission power e 1 , and sends address control signals to the address control unit 33 in order to control the image data storage region . then at step s 2 , ultrasonic waves at the transmission power e 1 are transmitted from the probe 2 toward the object to be inspected . that is , under the control of the transmission frequency control circuit 13 , the signal generator 14 generates signals having a predetermined frequency and supplies the signals to the transmission drive circuits 15 . the transmission drive circuits 15 impart a given delay to the signals under the control of the transmission delay control circuit 11 , and send drive signals to the probe 2 at the transmission power e 1 controlled by the transmission power control circuit 12 . this allows the ultrasonic transducers included in the probe 2 to vibrate and transmit ultrasonic waves to the object . the transmitted ultrasonic waves are reflected from the reflector existing in the interior of the object , and at step s 3 the reflected waves are received and converted into electric signals by the ultrasonic transducers , which electric signals are output as detection signals . the detection signals are subjected to various signal processing . more specifically , the detection signals are amplified by the amplifiers 23 and entered into the reception delay circuit 24 to have a given delay under the control of the reception delay control circuit 22 . the output signals from the reception delay circuit 24 are subjected in the signal processing unit 31 to log compression , detection , analog - to - digital conversion and other processing , and then output as image data . the output image data are stored in the primary storage unit 32 at step s 5 . such transmission / reception of the ultrasonic waves at steps s 2 to s 5 is iterated a plurality of times to effect the ultrasonic beam scanning ( step s 6 ), whereby image data are stored in the primary storage unit 32 so that frame data reflecting the acoustic characteristics as to the transmission power e 1 are obtained . it is to be understood that the ultrasonic wave transmission timing at step s 2 may be set such that the next ultrasonic wave is transmitted without waiting for the completion of the signal processing and the completion of image data storage at step s 4 and s 5 , as long as it can be separated from the precedingly transmitted ultrasonic wave . it is then judged at step s 7 whether or not the measurement is to be continued by changing the ultrasonic wave transmission power . if affirmative , then the procedure goes to step s 8 in which the system control circuit 1 changes and issues various control signals in order to transmit ultrasonic waves at the transmission power e 2 . in response to this , the transmission power control circuit 12 and the transmission frequency control circuit 13 control the transmission drive circuits 15 and the signal generator 14 respectively for the purpose of transmitting ultrasonic waves at the transmission power e 2 set at step s 1 . the address control unit 33 enters into the primary storage unit 32 an address for designating a storage region which stores image data obtained by transmitting and receiving the ultrasonic waves at the transmission power e 2 . furthermore , steps s 2 to s 6 are iterated so that the image data obtained by transmitting and receiving the ultrasonic waves at the transmission power e 2 are accumulated in the primary storage unit 32 to constitute frame data . then , the system control unit 1 changes and issues various control signals in order to again transmitting ultrasonic waves at the transmission power e 1 . thus , by alternately iterating the transmission of the ultrasonic waves at the transmission power e 1 and the transmission of the ultrasonic waves at the transmission power e 2 , the frame data obtained by transmitting and receiving the ultrasonic waves at the transmission power e 1 and the frame data obtained by transmitting and receiving the ultrasonic waves at the transmission power e 2 are alternately stored in the primary storage unit 32 . then , at step 9 , the arithmetic unit 34 performs arithmetic processing for the frame data stored in the primary storage unit 32 , while referring to the table 35 . description will be made herein of the arithmetic processing in case of transmitting and receiving two different ultrasonic waves at different transmission power . in this case , a reflector a in fig2 is a contrast medium a flowing in a blood vessel , while a reflector b is an internal organ b . fig4 a illustrates an image made up on the basis of frame data d ( e 1 ) acquired by transmission / reception of ultrasonic waves at the transmission power e 1 , whilst fig4 b illustrates an image made up on the basis of frame data d ( e 2 ) acquired by transmission / reception of ultrasonic waves at the transmission power e 2 . in fig4 a and 4 b , broken lines denote a boundary between an image of the contrast medium a and an image of the internal organ b , and also denote a boundary between the internal organ b and the background . as seen in fig4 a and 4 b , when the transmission power rises from e 1 to e 2 , the brightness of the entire screen including the background increases accordingly . however , in case of the reflectors having nonlinear acoustic characteristics with respect to the ultrasonic wave transmission power , like the contrast medium a and the internal organ b , an increase of the transmission power will not uniformly result in an increase of the echo intensity . for example , the increased transmission power leads to a sharply increased echo intensity as in the contrast medium a , but to insignificant change as in the internal organ b . it is therefore possible to extract image data of the contrast medium a and of the internal organ b by multiplying the frame data d ( e 1 ) and d ( e 1 ) by appropriate coefficients so as to cancel the background and finding the difference therebetween . let g ( e 1 , e 2 ) be combined image data which have been arithmetically processed , and k 1 and k 2 be positive coefficients stored in the table 35 , then the combined image data can be figured out from g ( e 1 , e 2 )= k 2 × d ( e 2 )− k 1 × d ( e 1 ) the frame data d ( e 1 ) and d ( e 2 ) used herein are preferably shortest interframe data . as a result of such arithmetic processing , as is clear from reference to fig2 the data on the contrast medium a are positive values and data on the internal organ b are negative values . in order to use these data for image display , a certain value may be added to the combined image data . more specifically , let c be a constant , then the combined image data g ′( e 1 , e 2 ) for display can be given as g ′ ( e 1 , e 2 )= g ( e 1 , e 2 )+ c fig5 shows an image defined by the thus obtained combined image data g ′( e 1 , e 2 ). the arithmetically processed combined image data are stored in the secondary storage unit 36 at step s 10 . the combined image data may be subjected to image processing such as interpolation , response modulation processing and gradation processing by the image processing unit 37 . furthermore , on the basis of such combined image data , combined images may be displayed on the screen of the display unit 38 such as a crt ( step s 11 ) or saved on various record media in the recording unit 39 ( step s 12 ). when displaying a combined image , display of only the tissue extracted may possibly make the whole image unclear . in such an event , additional processing such as coloring on each extracted tissue may be effected for display . for example , as seen in fig6 portions indicated by positive value data contained in the combined image data g ( e 1 , e 2 ), i . e ., data on the contrast medium a may be displayed in red , and portions indicated by negative value data on the internal organ b may be displayed in green , further they may be superimposed on an image of the original image data d ( e 1 ) or d ( e 2 ). effecting such processing would make the position of the internal organ , etc . apparent in a visual field and enable a pathologically changed tissue within the internal organ to be seen distinctly . as set forth hereinabove , according to the present invention , there can be obtained image data containing the difference in the acoustic characteristics depending on the properties of each tissue , which could not be obtained by only the transmission / reception of ultrasonic waves at a single kind of transmission power . this enables tissues of internal organs , etc . different in not merely the shape but also in properties to be extracted for display on the screen . consequently , in the ultrasonic diagnosis , the status of pathologically changed tissues can be diagnosed in addition to the finding of the pathologically changed tissues . while illustrative and presently preferred embodiments of the present invention have been described in detail herein , it is to be understood that the inventive concepts may be otherwise variously embodied and employed and that the appended claims are intended to be construed to include such variations except insofar as limited by the prior art .

US-11411802-A

a transobturator technique was developed for treating male urinary incontinence . this approach helped to design specific instruments to pass around the ischio - pubic branches of the male pelvis from inside to outside . the inside - out transobturator sling technique uses specific instruments and a polypropylene mesh with two arms that are passed inside to outside through the obturator foramens , pulled for compressing the bulbar urethra upward , and tied to each other across the midline . the mesh passes around the ischio - pubic branch before being tied under the bulbar urethra where it brings tension and support .

in describing a preferred embodiment of the invention illustrated in the drawings , specific terminology will be resorted to for the sake of clarity . however , the invention is not intended to be limited to the specific terms so selected , and it is to be understood that each specific term includes all technical equivalents which operate in a similar manner to accomplish a similar purpose . as shown in fig1 a , 1 b and 1 c , each helical passer is made of three parts : a handle 22 , a vertical segment 24 and a horizontal segment 26 formed in a spiral . the handle 22 has a height of 8 to 15 cm . it can be either made of stainless steel or any other material such as plastic . the vertical segment 24 measures from 2 to 6 cm ; preferably 4 cm , with a diameter of 2 . 5 to 4 . 5 mm in section . it can also be made of stainless steel . it can either be connected to the handle unless it is formed integrally as one piece . the segment 26 is spirally shaped in a horizontal plane , perpendicular to the vertical segment 24 . segment 26 measures 6 to 10 cm — preferably 8 . 5 , with a diameter of 2 . 5 to 4 . 5 mm in section . it is also made of stainless steel . the spiral is divided into four parts as shown in fig1 c . the first part 28 is a 2 - cm long linear segment which makes a 10 ° angle with the sagittal plane of the vertical segment 26 . the second part 30 is a 4 - cm long , circular segment of a circle of 3 - cm of radius . the third part 32 is a 2 . 5 - cm long , circular segment of a circle of 1 . 6 - cm of radius . the fourth part 34 is the tip that can have three different shapes . segment 34 a is a ½ cm conic segment formed by three curled segments enabling the attachment of a tube (‘ tube - passing ’ needle ) ( fig1 ci ). segment 34 b is an eyelet of 0 . 5 to 1 . 5 mm through which a string is passed (‘ stringpassing ’ needle ) ( fig1 cii ). in segment 34 c , the very end of the tip is flat and is 5 - mm shorter . this spiral of 1 . 5 to 3 . 5 mm of diameter can receive a hollow tube whose distal end is sharply pointed and measures 5 mm (‘ tube - supporting ’ needle ) ( fig1 ciii ). the “ introducer ” or “ guide ” as shown in fig2 a , 2 b and 2 c is an 8 to 12 - cm long instrument with a semi - cylindrical hollow gutter of a 3 to 5 - mm diameter . it is made of stainless steel , and has a blunt atraumatic tip 36 . the body 38 of the introducer is not straight right but wiggles on its center creating a distance one centimeter between the proximal and the distal ends . this particular shape is intended to prevent any important compression of the bulbar urethra during the procedure . in addition the proximal extremity 40 of the guide is winged 42 , 44 to serve as the handle . the accurate guide or introducer acts as a shoehorn to avoid any intrusion into the pelvis during the procedure . the mesh shown in fig2 d is made of synthetic material preferably low density polypropylene . it can be either cut or shaped in the operating room from a proper metallic frame or be included in a ready to use set . the prosthesis comprises a central part 46 of 5 to 10 - cm long and 2 to 5 - cm in width . its anterior end 48 is linear but the posterior extremity 50 is rounded . the mesh is laterally prolonged by two lateral arms 52 , 54 of 10 to 15 cm in length . the width of the lateral arm progressively decreases at 56 in a distance of 2 to 4 cm , from 4 cm to 2 cm . thus the latter segment measures from 8 to 13 cm . the arms 52 , 54 of the mesh do not arise from the middle of the prosthesis but are more posterior . additional materials to those aforementioned include two polyethylene hollow tubes . these tubes have from 25 to 40 cm of length with an outer diameter of 3 . 8 to 4 . 6 mm . the inner diameter measures from 2 . 8 to 3 . 8 mm . two nylon guide wires are used of 60 to 100 cm long , and 0 . 5 to 1 . 3 mm in section . the surgical procedure can be carried out under general or spinal anaesthesia . and antibioprophylaxis is achieved by per - operative intravenous administration of 2g of a third generation cephalosporin . the patient is installed in gynecologic position ; thighs are put in hyper flexion up to 110 ° with an additional slight abduction as shown in fig3 through 14 . sterile draping of the operative field is achieved after proper cleansing of the perineum up to the hypogastric region with a standard antiseptic solution . care is taken to maintain an easy access to the penis and the perineum all along when surgery proceeds . a 16 - french foley catheter is inserted first . afterwards the scrotum is temporarily suspended by stitches on both inner thighs to improve the access of the perineum . then a 6 - cm long median incision is performed from behind the scrotum as it stops 2 - cm away from the anal margin . and dissection of subcutaneous fatty tissue reveals colle &# 39 ; s fascia ( fig3 ). transaction of colle &# 39 ; s fascia reveals the bulbo spongious muscle . thereafter the bulbo spongious muscle is dissected upwards to the pubic symphysis and downwards to the central body of the perineum . dissection is then conducted laterally to the ischio cavernous muscles . these muscles - ischio cavernous and bulbo cavernous - limit a triangular space which dissection gives access to the median perineal aponeurosis . at that stage , it is reminded that the important blood vessels and nerves run along the inner aspect of ischio cavernous muscles . cautious hemostasis of small perforating vessels is realized by the electrocautery . the specifically designed helical passers shown in fig1 a through 1c are then used to turn around ischio pubic branches from inside to outside . the passers allow the introduction of the hollow plastic tubes from outside to inside . finally the arms the mesh can traverse the obturator foramens guided through the hollow tubes . the right side is started first . the bulbar urethra is reclined on the left side using a faraboeuf retractor ; thus giving sight to the median perineal plane ( fig4 ). then metzebaum scissors are used to open up the median perineal aponeurosis . the incision goes from the upper part of the triangular space to the lateral edge of the bulb . scissors transect the muscular plane before perforating the upper aspect of the median perineal aponeurosis ( fig5 ). then the guide is inserted through that plane with a 45 ° angle to come in contact with the upper aspect of the ischio pubic branch . the blunt tip of the guide is then used to pass through both the internal obturator muscle and the obturator membrane ( fig6 ). afterwards the helical passer is slid into the gutter of the guide to perforate the obturator membrane ( fig7 - 8 ). at that time the guide is removed and a rotation movement going forwards is applied to the passer as its distal end 34 appears at the junction between the ischio pubic branch and the pubic bone ( fig8 ). the 30 - cm long hollow plastic tube 58 is then clipped on the extremity of the passer and the device is rotated backwards . at that time the tube bridges the median perineal incision and the upper aspect the ischio pubic branch ( fig9 ). thereafter the same procedure is also conducted on the opposite side . the proximal extremity of the mesh ( m ) is brought in contact with the bulb ( fig1 a ). then this rounded extremity of the mesh fixed with a 2 / 0 non - absorbable sutures ( mersuture ©) to the central body of the perineum ( fig1 b ). the nylon guide wires 60 are then attached to the arm of the mesh and altogether passed throughout the tube until it reaches the larger part ( the 2 to 4 - cm long proximal part )( fig1 a , 11 b , 11 c ). a christophe grip is used to temporarily fasten the plastic tube and the mesh together . the same procedure is then conducted on the opposite side ( fig1 - 12 ). afterwards the anterior part of the mesh is fixed with two stitches of 2 / 0 non - absorbable suture to the aponeurosis of ischio cavernous muscles ( fig1 ). a slight tension on the guide wire unfolds the mesh . to perform a multi channel urodynamic study , the bladder is filled with 300 ml of saline . the urodynamic urethral catheter assesses an initial abdominal leak point pressure ( alpp ) and a maximal closure pressure ( pcm ). by pulling on both arms 52 , 54 of the mesh the bulbar urethra is compressed upwards ( fig1 , 13 a , 13 b ). the plastic tubes and the nylon guides are then removed and the arms of the mesh are temporarily crossed under the bulb ( fig1 ) until the leak pressure is heightened to 60 or 120 cm of water . finally the arms of the mesh are definitely knitted ( fig1 a ). the 16 - french foley catheter is inserted back , ideally without any resistance . closure of the tissues is realized step by step . the foregoing description should be considered as illustrative only of the principles of the invention . since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and , accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .

US-97680107-A

technical problem : to provide a composition for aerosol having an excellent pests control effect . solution to problem : a composition for pest control aerosol comprising ; a compound of formula wherein r a represents a hydrogen atom or a methyl group , r b represents a methyl group or a methoxymethyl group , an organic solvent having a boiling point of 220 ° c . or higher and a propellant , and the content of the organic solvent being 10 to 30 wt % of the total amount of the composition .

the present compounds include [ 2 , 3 , 5 , 6 - tetrafluoro - 4 -( methoxymethyl ) phenyl ] methyl = 2 , 2 - dimethyl - 3 -( 1 - propenyl ) cyclopropanecarboxylate ( hereinafter referred to as “ compound a ”), [ 2 , 3 , 5 , 6 - tetrafluoro - 4 - methylphenyl ] methyl = 2 , 2 - dimethyl - 3 -( 1 - propenyl ) cyclopropanecarboxylate ( hereinafter referred to as “ compound b ”), and [ 2 , 3 , 5 , 6 - tetrafluoro - 4 -( methoxymethyl ) phenyl ] methyl = 2 , 2 - dimethyl - 3 -( 2 - methyl - 1 - propenyl ) cyclopropanecarboxylate ( hereinafter referred to as “ compound c ”). the present compounds are the compounds disclosed in jp - a - 11 - 222463 , jp - a - 2000 - 63329 , and jp - a - 2001 - 11022 , and can be prepared by the processes disclosed in the publications . the present compounds may be present as isomers due to two asymmetric carbon atoms on the cyclopropane ring and the double bond . any mixture containing active isomers at any ratio may be used for the present invention . the content of the present compound contained in the composition of the invention is generally 0 . 1 to 10 wt % of the total amount of the composition . the composition of the invention contains an organic solvent having a boiling point of 220 ° c . or higher . in view of persistence after the application , the organic solvent may be for example an ester solvent having a boiling point of 220 ° c . or higher , preferably from 220 to 500 ° c . herein the boiling point is shown as a value measured at atmospheric pressure . the ester solvent is preferably an ester of 12 to 30 carbon atoms , and examples thereof include alkyl carboxylates of 12 to 30 carbon atoms , for example , alkyl alkylcarboxylates of 12 to 30 carbon atoms such as isopropyl myristate , hexyl laurate , and isopropyl palmitate ; dialkyl dicarboxylates of 12 to 30 carbon atoms such as diisopropyl adipate , dioctyl adipate , isononyl adipate , and diisodecyl adipate ; trialkyl acetylcitrates of 12 to 30 carbon atoms such as triethyl acetylcitrate and tributyl acetylcitrate ; trialkyl citrates of 12 to 30 carbon atoms such as triethyl citrate ; and dialkyl phthalates of 12 to 30 carbon atoms such as dibutyl phthalate and diisononyl phthalate . more preferred examples of the ester solvent include alkyl alkylcarboxylates of 12 to 30 carbon atoms , dialkyl dicarboxylates of 12 to 30 carbon atoms , trialkyl acetylcitrates of 12 to 30 carbon atoms , trialkyl citrates of 12 to 30 carbon atoms , and dialkyl phthalates of 12 to carbon atoms . alkyl alkylcarboxylates of 12 to 30 carbon atoms , dialkyl dicarboxylates of 12 to 30 carbon atoms , and trialkyl acetylcitrates of 12 to 30 carbon atoms are especially preferred . specific examples of the ester solvent include preferably dibutyl phthalate , isopropyl myristate , diisopropyl adipate , dioctyl adipate , isononyl adipate , diisodecyl adipate , triethyl acetylcitrate , tributyl acetylcitrate , and triethyl citrate , more preferably isopropyl myristate , diisopropyl adipate , dioctyl adipate , isononyl adipate , diisodecyl adipate , triethyl acetylcitrate , and tributyl acetylcitrate . other examples of the organic solvent having a boiling point of 220 ° c . or higher include saturated hydrocarbons such as straight - chain saturated hydrocarbons , branched saturated hydrocarbons , and alicyclic saturated hydrocarbons , and aromatic hydrocarbons , particularly isopar m ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 223 to 254 ° c . ), isopar v ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 273 to 310 ° c . ), ip solvent 2835 ( a saturated hydrocarbon from idemitsu kosan co ., ltd ., the boiling point : 277 to 353 ° c . ), norpar 13 ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 222 to 242 ° c . ), norpar 15 ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 249 to 274 ° c . ), neothiozol ( a saturated hydrocarbon from chuo kasei co ., ltd , the boiling point : 225 to 247 ° c . ), exxsol d110 ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 249 to 267 ° c . ), exxsol d130 ( a saturated hydrocarbon from exxonmobil yugen kaisha , the boiling point : 279 to 313 ° c . ), alkene l ( an aromatic hydrocarbon from nippon oil corporation , the boiling point : 285 to 309 ° c . ), alkene 200p ( an aromatic hydrocarbon from nippon oil corporation , the boiling point : 321 to 390 ° c . ), alkylidene carbonates such as ethylene carbonate and propylene carbonate , and glycol ethers such as diethylene glycol monobutyl ether and triethylene glycol monomethyl ether . the content of the organic solvent having a boiling point of 220 ° c . or higher is 10 to 30 wt %. the organic solvent may be used alone or in combination of two or more . the propellants contained in the composition of the invention include , for example , a nitrogen gas , a compressed air , a carbon dioxide gas , a liquefied petroleum gas ( lpg ), and dimethyl ether . the propellant contained in the composition of the invention may be used alone or in combination of two or more . if necessary , one or more of other pest control agents , repellents , synergists , stabilizers and flavors may be conveniently contained in the composition of the invention . the other pest control agents include , for example , organic phosphorus compounds such as dichlorvos , fenitrothion , tetrachlorvinphos , fenthion , chlorpyrifos , and diazinon ; carbamate compounds such as propoxur , carbaryl , metoxadiazone , and fenobucarb ; inhibitors of chitin formation such as lufenuron , chlorfluazuron , hexaflumuron , diflubenzuron , cyromazine , and 1 -( 2 , 6 - difluorobenzoyl )- 3 -[ 2 - fluoro - 4 -( 1 , 1 , 2 , 3 , 3 , 3 - hexafluoropropoxy ) phenyl ] urea ; juvenile hormone - like agents such as pyriproxyfen , methoprene , hydroprene , and fenoxycarb ; neonicotinoid compounds ; and n - phenylpyrazole compounds . the repellents include , for example , n , n - diethyl - m - toluamide , limonene , linalool , citronellal , menthol , menthone , hinokitiol , geraniol , eucalyptol , indoxacarb , carane - 3 , 4 - diol , mgk - r - 326 , mgk - r - 874 , and bay - kbr - 3023 . the synergists include , for example , 5 -[ 2 -( 2 - butoxyethoxy ) ethoxymethyl ]- 6 - propyl - 1 , 3 - benzodioxole , n -( 2 - ethylhexyl ) bicyclo [ 2 . 2 . 1 ] hept - 5 - ene - 2 , 3 - dicarboxyimide , octachlorodipropyl ether , isobornyl thiocyanoacetate , and n -( 2 - ethylhexyl )- 1 - isopropyl - 4 - methylbicyclo [ 2 . 2 . 2 ] oct - 5 - ene - 2 , 3 - dicarboxyimide . the composition of the invention can be prepared for example by mixing the present compound , the organic solvent , and the propellant , and , if necessary the other pest control agent , a repellent , a synergist , a stabilizer , a flavor , or the like . the pest control aerosol of the invention contains the composition of the invention . in such pest control aerosol , the composition of the invention is usually contained in an aerosol device . the aerosol devices are generally equipped with a pressure vessel containing the composition and the like to be sprayed in the form of a mist with the aid of pressure of a propellant . the pest control aerosol can be prepared for example by charging an aerosol vessel with the present compound and the organic solvent , and , if necessary , the other pest control agent , a repellent , a synergist , a stabilizer , a flavor , or the like ; attaching an aerosol valve to the vessel ; filling the vessel with the propellant via a stem ; shaking the vessel ; and attaching an actuator to the vessel . the aerozol valves include , but are not limited to , push down - type valves . the actuators include , for example , button - type or trigger - type actuators . the pest control method of the invention is carried out by spraying an effective amount of the composition of the invention to a pest , a path of the pest and / or a habitat of the pest . in particular , it is carried out by spraying the composition of the invention to the pest , a path of the pest and / or a habitat of the pest through the use of the pest control aerosol containing the composition of the invention . for practical purposes , it is advantageous to spray the composition of the invention to a space to be pest - controlled . in such a case , the amount of the present compound to be sprayed is usually 0 . 001 to 1000 mg / m 3 , preferably 0 . 001 to 100 mg / m 3 , more preferably 0 . 01 to 10 mg / m 3 in terms of the total amount of the present compound . when applied to a plane , the amount is 0 . 0001 to 1000 mg / m 2 in terms of the total amount of the present compound . examples of the space where the composition of the invention is sprayed include room interiors , living rooms , dining rooms , wardrobes , closets , chests such as japanese chest , cupboards , toilets , bathrooms , storerooms , warehouses , and car interiors . furthermore , the composition can also be sprayed to outside open space . examples of the pests which can be controlled by the composition of the invention include arthropods such as insects and acarian , particularly the following pests may be mentioned . pyralidae such as chilo suppressalis , cnaphalocrocis medinalis , and plodia interpunctella ; hadeninae such as spodoptera litura , mythimna separate , and mamestra brassicae ; pieridae such as pieris rapae ; tortricidae such as adoxophyes spp . ; carposinidae ; lyonetiidae ; lymantriidae ; plusinae ; agrotis spp . such as agrotis segetum and agrotis ipsilon ; and helicoverpa spp ., heliothis spp ., plutella xylostella , parnara guttata , tinea translucens , and tineola bisselliella , etc . culex spp . such as culex pipiens pallens , culex tritaeniorhynchus , and culex pipiens quinquefasciatus ; aedes spp . such as aedes aegypti and aedes albopictus ; anophelinae such as anopheles sinensis and anopheles gambiae ; chironomidae ; muscidae such as musca domestica , muscina stabulans , and fannia canicularis ; calliphoridae ; sarcophagidae ; anthomyiidae such as delia platura and delia antique ; tephritidae ; drosophilidae ; psychodidae ; phoridae ; tabanidae ; simuliidae ; stomoxyini ; and ceratopogonidae , etc . blattella germanica , periplaneta fuliginosa , periplaneta americana , periplaneta australasiae , periplaneta brunnea burmeister , and blatta orientalis , etc . formicidae ; polistinae such as polistes chinensis , polistes riparius , polistes jadwigae , polistes rothneyi , polistes mandarinus , polistes snelleni , and polistes japonicus ; vespinae such as vespa mandarinia , vespa simillima xanthoptera , vespa analis , vespa crabro , vespa ducalis , vespula flaviceps , vespula shidai , and dolichovespula media ; bethylidae ; xylocopa ; pompilidae ; sphecidae ; and eumenidae , etc . delphacidae such as laodelphax striatellus , nilaparvata lugens , and sogatella furcifera ; deltocephalidae such as nephotettix cincticeps and nephotettix virescens ; aphidoidea ; pentatomidae ; aleyrodidae ; coccoidea ; tingidae ; psyllidae ; and cimicidae , etc . attagenus japonicus , anthrenus verbasci ; diabrotica spp . such as diabrotica virgifera virgifera and diabrotica undecimpunctata howardi ; scarabaeidae such as anomala cuprea and anomala rufocuprea ; curculionoidea such as sitophilus zeamais , lissorhoptrus oryzophilus , anthonomus grandis , and callosobruchus chinensis ; tenebrionidae such as tenebrio molitor and tribolium castaneum ; chrysomelidae such as oulema oryzae , phyllotreta striolata , and aulacophora femoralis ; anobiidae ; epilachna spp . such as epilachna vigintioctopunctata ; lyctinae ; bostrychidae ; cerambycidae ; paederus fuscipes , etc . pyroglyphidae such as dermatophagoides farinae and dermatophagoides pteronyssinus ; acaridae such as tyrophagus putrescentidae and aleuroglyphus ovatus ; glycyphagidae such as glycyphagus privates , glycyphagus domesticus , and glycyphagus destructor ; cheyletidae such as cheyletus malaccensis and cheyletus fortis ; tarsonemidae ; chortoglyphidae ; haplochthoniidae ; tetranychidae such as tetranychus urticae , tetranychus kanzawai , panonychus citri , and panonychus ulmi ; ixodidae such as haemaphysalis longicornis , etc . the compositions of the invention are especially effective to control so - called flying pests , for example mosquitoes and flies classified as diptera and bees classified as hymenoptera . hereinafter , the present invention is described specifically by way of formulation examples and test examples to which the present invention is not limited . first , some formulation examples of the aerosol containing the composition of the invention are described . the term “ part ( s )” means part ( s ) by weight . into an aerosol can 4 . 3 parts of compound a and 10 . 0 parts of dibutyl phthalate are charged , a valve part is attached to the can , and the can is filled with 85 . 7 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 1 containing 100 parts of the composition of the invention . into an aerosol can 4 . 3 parts of compound a and 30 . 0 parts of dibutyl phthalate are charged , a valve part is attached to the can , and the can is filled with 65 . 7 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 2 containing 100 parts of the composition of the invention . aerosols 3 and 4 are prepared analogously to the process described under preparation examples 1 and 2 , except that isopropyl myristate is employed in place of dibutyl phthalate . aerosols 5 and 6 are prepared analogously to the processes described under preparation examples 1 and 2 , except that diisopropyl adipate is employed in place of dibutyl phthalate . aerosols 7 and 8 are prepared analogously to the processes described under preparation examples 1 and 2 , except that dioctyl adipate is employed in place of dibutyl phthalate . aerosols 9 and 10 are prepared analogously to the processes described under preparation examples 1 and 2 , except that diisononyl adipate is employed in place of dibutyl phthalate . aerosols 11 and 12 are prepared analogously to the processes described under preparation examples 1 and 2 , except that diisodecyl adipate is employed in place of dibutyl phthalate . aerosols 13 and 14 are prepared analogously to the processes described under preparation examples 1 and 2 , except that triethyl acetylcitrate is employed in place of dibutyl phthalate . aerosols 15 and 16 are prepared analogously to the processes described under preparation examples 1 and 2 , except that tributyl acetylcitrate is employed in place of dibutyl phthalate . aerosols 17 and 18 are prepared analogously to the processes described under preparation examples 1 and 2 , except that triethyl citrate is employed in place of dibutyl phthalate . aerosols 19 and 20 are prepared analogously to the processes described under preparation examples 1 and 2 , except that isopar m ( from exxonmobil yugen kaisha ) is employed in place of dibutyl phthalate . aerosols 21 and 22 are prepared analogously to the processes described under preparation examples 1 and 2 , except that norpar 13 ( from exxonmobil yugen kaisha ) is employed in place of dibutyl phthalate . aerosols 23 and 24 are prepared analogously to the processes described under preparation examples 1 and 2 , except that exxsol d110 ( from exxonmobil yugen kaisha ) is employed in place of dibutyl phthalate . aerosols 25 and 26 are prepared analogously to the processes described under preparation examples 1 and 2 , except that alkene l ( from nippon oil corporation ) is employed in place of dibutyl phthalate . aerosols 27 and 28 are prepared analogously to the processes described under preparation examples 1 and 2 , except that propylene carbonate is employed in place of dibutyl phthalate . aerosols 29 and 30 are prepared analogously to the processes described under preparation examples 1 and 2 , except that diethylene glycol monobutyl ether is employed in place of dibutyl phthalate . into an aerosol can ( product name : ae180won , from toyo seikan kaisha , ltd ) 4 . 3 parts of compound a and 13 . 6 parts of isopropyl myristate were charged , a push down - type valve with a stem having a pore size of 0 . 33 mm was attached to the can , and the can was filled with 82 . 1 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 31 containing 100 parts of the composition of the invention . aerosol 32 was prepared analogously to the process described under preparation example 31 , except that propylene carbonate was employed in place of isopropyl myristate . into an aerosol can 1 . 2 parts of compound a and 30 . 0 parts of dibutyl phthalate were charged , a valve part was attached to the can , and the can was filled with 68 . 8 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 33 containing 100 parts of the composition of the invention . aerosol 34 was prepared analogously to the process described under preparation example 33 , except that isopropyl myristate was employed in place of dibutyl phthalate . into an aerosol can 1 . 2 parts of compound a and 10 . 0 parts of isopropyl myristate were charged , a valve part was attached to the can , and the can was filled with 88 . 8 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 35 containing 100 parts the composition of the invention . aerosols 36 to 70 are prepared analogously to the processes described under preparation examples 1 to 35 , except that compound b is employed in place of compound a . aerosols 71 to 105 are prepared analogously to the processes described under preparation examples 1 to 35 , except that compound c is employed in place of compound a . into an aerosol can ( product name : ae180won , from toy ° seikan kaisha , ltd ) 4 . 3 parts of compound a and 27 . 2 parts of isopropyl myristate were charged , a push down - type valve with a stem having a pore size of 0 . 33 mm was attached to the can , the can was filled with 68 . 5 parts of a propellant ( liquefied petroleum gas ) via the valve part to give aerosol 106 containing 100 parts of the composition of the invention . into an aerosol can ( product name : ae180won , from toyo seikan kaisha , ltd ) 4 . 3 parts of compound a and 17 . 4 parts of ethanol were charged , a push down - type valve with a stem having a pore size of 0 . 33 mm was attached to the can , the can was filled with 77 . 8 parts of a propellant ( liquefied petroleum gas ) via the valve part to give comparison aerosol 1 . into an aerosol can ( product name : ae180won , from toyo seikan kaisha , ltd ) 4 . 3 parts of compound a and 6 . 8 parts of isopropyl myristate were charged , a push down - type valve with a stem having a pore size of 0 . 33 mm was attached to the can , the can was filled with 88 . 9 parts of a propellant ( liquefied petroleum gas ) via the valve part to give comparison aerosol 2 . into an aerosol can ( product name : ae180won , from toyo seikan kaisha , ltd ) 4 . 3 parts of compound a and 54 . 4 parts of isopropyl myristate were charged , a push down - type valve with a stem having a pore size of 0 . 33 mm was attached to the can , the can was filled with 41 . 3 parts of a propellant ( liquefied petroleum gas ) via the valve part to give comparison aerosol 3 . the following test examples show that the compositions of the invention and the aerosols containing the composition of the invention have an excellent pest control effect . in the following test examples , [ 2 , 3 , 5 , 6 - tetrafluoro - 4 -( methoxymethyl ) phenyl ] methyl =( 1r )- trans - 2 , 2 - dimethyl - 3 -( 1 - propenyl ( e / z = 1 / 8 )) cyclopropanecarboxylate was employed as compound a . in addition , in the following test examples , all aerosols were equipped with a button - type actuator having a nozzle size of 0 . 41 mm . about 0 . 11 g of the composition of the invention was sprayed to a cuboid test chamber ( 28 m 3 ) having dimensions of 3 . 0 m × 4 . 0 m × 2 . 3 m through the use of aerosol 31 . the composition was sprayed once from the entrance of the chamber toward the center , and then the chamber was closed . after 8 hours from the spraying , 100 adults of female culex pipiens pallens were put into the chamber . after 2 , 3 , 5 , 7 , 10 and 15 minutes , the number of knock - down culex pipiens pallens was counted , and kt50 ( the time necessary to knock down 50 % of the tested mosquitoes ) was determined from the obtained data . the tests were carried out in the same manner as above for aerosol 106 and comparison aerosols 1 , 2 and 3 . aerosols 5 , 9 , 15 and 17 were prepared according to the processes described under preparation examples 5 , 9 , 15 and 17 . the aerosol can and valve used in preparation example 31 were employed for these aerosols , and a button - type actuator having a nozzle size of 0 . 41 mm was attached thereto . about 20 mg of the composition of the invention was sprayed to a cubic chamber having each edge length of 70 cm through the use of aerosol 5 . the composition was sprayed once from the window at the center of the near side of the chamber toward the center of the chamber , and then the chamber was closed . after 14 hours from the spraying , 20 adults of female culex pipiens pallens were put into the chamber . after 2 , 3 , 5 , 7 , 10 and 15 minutes , the number of knock - down culex pipiens pallens was counted , and kt50 ( the time necessary to knock down 50 % of the tested mosquitoes ) was determined from the obtained data . the tests were carried out in the same manner as above for aerosols 9 , 15 and 17 .

US-201113820801-A

the present invention relates to a process which allows for the preparation of tea products comprising tea juice which are suitable for diluting to prepare beverages . the present inventors have identified that generation of carbon dioxide during the storage of tea juice in containers can cause problems . it is an object of the present invention to provide a packaged tea juice in a stable form . the present inventors have now surprisingly found that treating tea juice using a specific time - temperature regime leads to a reduction in co 2 generation during storage .

step ( a ) of the process of the invention comprises expressing juice from fresh tea leaves thereby to produce leaf residue and tea juice . it is particularly preferred that the fresh tea leaves comprise material from var . assamica as this variety naturally has a high level of tea actives and so leads to a high level of actives in the leaf residue even after removal of the juice . most preferably the fresh leaves are fresh leaves from var . assamica . the amount of expressed juice is preferably at least 50 ml per kg of the fresh tea leaves . it is preferred that the amount of juice expressed in step ( a ) is less than 800 ml per kg of tea leaves , more preferably less than 700 ml and most preferably less than 600 ml . it is also preferred , however that the amount of expressed juice is at least 75 ml per kg of the fresh tea leaves , more preferably at least 100 ml and most preferably at least 150 ml . when referring to the volume of juice expressed per unit mass of tea leaves it should be noted that the mass of the tea leaves is expressed on an “ as is ” basis and not a dry weight basis . thus the mass includes any moisture in the leaves . the juice comprises preferably at least 4 % by weight tea solids , more preferably at least 4 . 5 % by weight tea solids and most preferably at least 5 % by weight tea solids . there is no particular upper limit for the amount of tea solids in the tea juice and the tea juice may preferably comprise up to 30 % by weight tea solids . water soluble tea solids preferably constitute 70 - 100 % by weight of the tea solids , more preferably 80 - 100 % by weight of the tea solids and most preferably 90 - 100 % by weight of the tea solids . the expression step may be achieved in any convenient way so long as it allows for separation of the tea juice from the leaf residue and results in the required quantity of juice . the machinery used to express the juice may , for example , include a hydraulic press , a pneumatic press , a screw press , a belt press , an extruder or a combination thereof . the juice and the leaf residue may be preferably separated by filtration or centrifugal separation . the juice may be obtained from the fresh leaves in a single pressing or in multiple pressings of the fresh leaves . preferably the juice is obtained from a single pressing as this allows for a simple and rapid process . in order to minimise generation of off - flavours in the leaf tea and / or juice , it is preferred that the expression step is performed at ambient temperature . for example , the leaf temperature may be from 5 - 40 ° c ., more preferably 10 - 30 ° c . the time and pressure used in the expression step can be varied to yield the specified amount of juice . typically , however , the pressures applied to express the juice will range from 0 . 5 mpa ( 73 psi ) to 10 mpa ( 1450 psi ). the time over which the pressure is applied will typically range from 1 s to 1 hour , more preferably from 10 s to 20 minutes and most preferably from 30 s to 5 minutes . prior to expression , the fresh tea leaves may undergo a pre - treatment including , for example , a unit process selected from maceration , withering , fermentation or a combination thereof . it is preferred that the fresh leaves are not heat treated to deactivate fermentation enzymes prior to the step of expressing the juice . it is particularly preferred that the fresh tea leaves are not subjected to a step of steaming or pan firing prior to the step of expressing the juice . it is preferred that the tea leaves have enzyme activity of ppo ( polyphenol oxidase ) of at least 8000 units per gram of the tea leaves prior to the step of expressing the juice . the enzyme activity of ppo is preferably greater than 10000 units per gram of the fresh tea leaves , more preferably greater than 20000 units per gram of the fresh tea leaves . the enzyme activity is preferably up to 100000 units per gram of the fresh tea leaves . ppo activity is determined according to the procedure given by moore and flurkey ( moore , b . m ., flurkey , w . h . sodium sulphate activation of a plant polyphenol oxidase . j . biol . chem . 1990 , 265 , 4982 - 4988 ). ppo activity is determined by monitoring the o - quinone formation at 400 nm using (+)- catechin as the substrate with a spectrophotometer ( perkin - elmer ). the assay is preferably carried out over a period of time in a reaction volume of 3 ml using 0 . 1 m sodium phosphate - citrate ( ph 5 . 5 ) as the buffer and (+)- catechin ( 3 mm ) at 40 ° c . the reactions are preferably arrested by addition of 0 . 2 ml of stop mix solution consisting of acetonitrile , acetic acid and water ( 60 : 10 : 30 , v / v / v ). one unit of enzyme activity is defined as change in 0 . 001 absorbance unit at 400 nm per minute in an aliquot of the enzyme used . the fresh leaves may or may not be fermented prior to expression . if the leaves are fermented prior to expression then it is particularly preferred that they are macerated prior to fermentation . whether or not the fresh leaves are fermented , maceration prior to expression may help in decreasing the time and / or pressure required to express the specified quantity of juice . tea juice separated from the leaf residue typically has a high content of water - soluble tea solids and is a valuable raw material for producing tea products . step ( b ) comprises heating the tea juice to 60 - 150 ° c . for a duration of 0 . 5 seconds to 20 minutes . when the juice is heated to a temperature in the range 60 - 99 ° c ., the duration is preferably 30 seconds to 20 minutes , more preferably 1 - 15 minutes and most preferably 2 - 10 minutes . when the juice is heated to a temperature in the range 100 - 150 ° c ., the duration is preferably 1 - 45 seconds , more preferably 2 - 30 seconds and most preferably 4 - 15 seconds . the step of heating is preferably carried out in a heat exchanger . a double pipe heat exchanger , shell and tube heat exchanger or plate heat exchanger is preferably used for the heating step . the juice is packaged , by which is meant that the juice is contained within a sealed container . in particular the package is sealed to ensure that the chamber is impermeable to microbiological contaminants by which is meant that the packaged composition can be stored for at least 6 months at a temperature of 20 ° c . without the amount of spore - forming bacteria ( bacillus and clostridia spp ) in the liquid composition increasing above 100 cfu / ml . suitable packages include sachets , pouches , capsules , cartons or bottles . preferably the juice is filled into the packaging , then the package is sealed . from the point of view of cost and convenience of storage and / or packaging , it is preferred that the package is a flexible sachet or pouch . the problem of co 2 generation is particularly apparent for such packaging . sachets and pouches are typically formed from flexible packaging material . the most preferred packaging material is a plastic - foil laminate material , especially material comprising a metal ( such as aluminium ) foil layer sandwiched between two or more plastic ( such as polyethylene terephthalate , polyethylene , polypropylene or combinations thereof ) layers . it is preferred that a gas other than oxygen , preferably nitrogen is purged through the juice prior to the step of packaging the liquid tea product in a sealed container . it is further preferred that the container is sealed immediately after the step of purging . the process of the present invention results in juice which generates less co 2 on storage . it is preferred that the package comprises a headspace and the packaged product can be stored at a temperature of 20 ° c . for 1 month without the content of co 2 in the headspace increasing above 25 % by volume of the headspace . more preferably the amount of co 2 in the headspace after 1 month is less than 20 % by volume , more preferably still less than 15 % by volume and most preferably from 0 . 001 to 10 % by volume . preferably the process comprises a further step of processing the leaf residue to produce leaf tea and / or tea extract . the leaf tea and / or extract is of a quality comparable to that of conventional leaf teas or extracts even though it has been produced from leaf residue which has had the juice removed therefrom . thus the leaf residue is processed separately from the tea juice . in particular the expressed tea juice is not contacted with the leaf residue during manufacture of the leaf tea and / or tea extract . the leaf residue may be processed to produce green leaf tea , black leaf tea or oolong leaf tea . in the case of oolong leaf tea and black leaf tea the process comprises fermenting the leaf residue . the manufacturing processes of green leaf tea , black leaf tea and oolong leaf tea are well known and suitable processes are described , for example , in “ tea : cultivation to consumption ”, k . c . willson and m . n . clifford ( eds ), 1 st edn , 1992 , chapman & amp ; hall ( london ), chapters 13 and 14 . a step common to manufacture of all leaf teas is a drying step . in the case of oolong and black leaf tea , the drying step usually also serves to deactivate the fermentation enzymes . efficient drying requires high temperatures and so it is preferred that the process comprises drying the leaf residue at a temperature of at least 75 ° c ., more preferably at least 90 ° c . although the leaf residue may be extracted with a solvent prior to drying of the leaf residue , in an especially preferred embodiment the extract is produced from made tea . thus it is preferred that process comprises a step of processing the leaf residue to produce leaf tea and then extracting the leaf tea with a solvent to produce a tea extract . the most preferred solvent is an aqueous solvent . preferably the aqueous solvent comprises at least 50 % water by weight of the solvent , more preferably at least 90 % and most preferably from 99 to 100 %. the solvent may be cold and have a temperature , for example , in the range of from 1 to 50 ° c . it is most preferred , however , that the solvent is hot as hot solvents tend to be more efficient at extracting tea solids . thus it is preferred that the solvent temperature is greater than 50 ° c ., more preferably at least 70 ° c . and most preferably from 80 to 100 ° c . preferably the solvent is contacted with the leaf residue for a time of at least 1 minute . however , because the leaf residue has a good rate of infusion , it is preferred that the solvent is contacted with the leaf residue in step ( b ) for a time of less than 1 hour , more preferably less than 30 minutes and most preferably less than 15 minutes . the leaf residue and solvent are preferably contacted in a weight ratio in the range of 1 : 1 to 1 : 1000 , more preferably from 1 : 4 to 1 : 100 and most preferably from 1 : 6 to 1 : 20 . following contact of leaf residue with solvent , the leaf residue is usually separated from the liquid extract . thus in a preferred embodiment , the process comprises a step of de - leafing the extract . this de - leafing step can readily be achieved , for example , by filtering and / or centrifuging the extract . the invention will now be demonstrated with help of following non - limiting examples . the effect of heat treatment of the tea juice on co 2 production fresh tea leaves from a south indian garden were taken and were withered for 18 hours to bring the moisture of the leaves to 75 - 80 %. the tea leaves were subjected to ctc ( cut tear curl ) for 4 times to obtain macerated dhool . the dhool was fermented for 1 hour and then juice was squeezed out from the fermented dhool by a pneumatic press operating at a pressure of 6 kg / cm 2 . about 1000 g of fresh dhool resulted into 280 ml of tea juice . the ppo activity of the fermented dhool was found to be 13118 units / g of the fresh tea leaves . insolubles from the tea juice were removed by centrifugation of the extracts at 8000 rpm for about 20 min ( using a beckman centrifuge ) and the decanted juice was collected . heat treatment was carried out on the decanted juice the decanted juice was taken in a vial ( 5 ml juice in a 22 ml vial ). the vial was sealed and placed in a hot water bath . the vial contents were heated to a specific temperature ( 65 ° c ., 75 ° c . or 85 ° c .) and the temperature maintained for a specific time period . the sealed vials were stored at temperature of 20 ° c . vials were taken out after specific durations of storage and analyzed for carbon dioxide . in another experiment , the treatment of the decanted tea juice was carried out in ft74 uht / htst processing system ( armfield , uk ) where the juice was heated to 136 ° c . and held for 30 seconds and filled into 330 ml cans . during the filling operation , the temperature of the juice was 88 ° c . and it took about 1 minute to fill the can . the can was then sealed and cooled to 25 ° c . by immersing in a cold water bath for 15 minutes . protein precipitation in tea juice was done with chilled acetone . chilled acetone was added to the tea juice on ice in the ratio of 1 : 1 gradually and slowly . this mixture was stirred on ice for 2 hours . tea juice with acetone was then centrifuged at 10 , 000 rpm for 10 min to pellet out the proteins . the supernatant was discarded and the pellet was dissolved in a minimal amount of buffer . ( wessel , d ., flugge , u . i . anal . biochem . 1984 , 138 , 141 - 143 ). this pellet was used as the source of enzyme for the assay for ppo activity . the ppo activity was determined according to method of moore and flurkey , 1990 ( moore , b . m ., flurkey , w . h . sodium sulphate activation of a plant polyphenol oxidase . j . biol . chem . 1990 , 265 , 4982 - 4988 ) by monitoring the o - quinone formation at 400 nm using (+)- catechin as the substrate with a spectrophotometer ( perkin - elmer ). the assay was carried out over a period of 20 minutes in a reaction volume of 3 ml using 0 . 1 m sodium phosphate - citrate ( ph 5 . 5 ) as the buffer and (+)- catechin ( 3 mm ) at 40 ° c . with appropriate enzyme and substrates blanks . the reactions were arrested by addition of 0 . 2 ml of stop mix solution consisting of acetonitrile , acetic acid and water ( 60 : 10 : 30 , v / v / v ). one unit of enzyme activity is defined as a change of 0 . 001 absorbance unit at 400 nm per minute in an aliquot of the enzyme used . the headspace gas was analyzed by pbi dansensor , a headspace gas analyzer . in this instrument carbon dioxide is analyzed by a non dispersive ir sensor . the cap of the sealed vial / can containing tea juice was pierced with the needle which is the inlet for the analyzer . after the analysis , results were expressed in terms of volume percentage . the experiments were carried out at various time - temperature regimes as tabulated below along with the resulting co 2 generation after storage time ranging from 0 - 38 days . from the above data , it can be seen that subjecting the tea juice to heat treatment ( temperature greater than 60 ° c .) leads to a significant reduction in the formation of carbon dioxide during storage as compared to the tea juice that is not subjected to heat treatment ( i . e . the control ) from the data in table 2 , it is clear that the treatment at the higher temperature ( greater than 100 ° c .) results in a significant decrease in the amount of carbon dioxide even after 8 months of storage . tea juice was prepared using the process described above ( 65 - 85 ° c .) in all respects except that the fresh tea leaves were steamed , i . e . exposed to steam ( steam temperature 85 ° c .) after the step of withering and before the step of ctc . the ppo activity of the steamed tea leaf was found to be zero . the effect in terms of co 2 formation , and aroma are given below . it can be seen that the step of steaming reduces the problem of co 2 production on one hand but on the other hand introduces a strong cooked note in the juice that is not preferable . decanted juice was prepared using the process described above . however , the decanted juice was diluted by adding water to vary the tea solids in the juice before subjecting the juice to heat treatment at 75 ° c . for 2 minutes . the results are tabulated below : it can be seen that in dilute juices , the problem related to carbon dioxide is relatively less severe even when there is no heat treatment . the effect of purging nitrogen on carbon dioxide production during storage the following experiments were carried out using a different batch of set of fresh tea leaves ( south indian gardens ). one experiment was carried out in the same manner as that reported in table 1 ( 75 ° c ., 2 minutes ). the other experiment was carried out in a the same manner as this experiment in all respects except that nitrogen gas was purged through the vial containing the juice for 3 minutes using a compressed nitrogen gas cylinder , before capping the vial . the sealed vials were then subjected to heat treatment ( 75 ° c ., 2 minutes ) in the manner of the experiments in table 1 . the results of the carbon dioxide in the headspace as a function of storage duration are tabulated below for both these experiments . from the results it is clear that a process involving a step of purging of gaseous nitrogen through the juice results in a further reduction in formation of carbon dioxide during storage .

US-201113885733-A

apparatus for adjusting the longitudinal and angular position of a work surface support leg is disclosed . the leg passes through a channel in a cap held via a spring and pin to a base . the leg &# 39 ; s angular position is adjusted by rotating the cap , moving a tooth through a series of mating depressions , while the longitudinal position is adjusted by moving the leg with a series of notches that mate with a locking tooth in the cap . a knob interfaces with the cap via a rotary cam having high and low steps and a matching cam rider . the low step allows separation between the cap and base and the high step locks the cap to the base , thereby locking in the adjustment setting for the leg . the invention affords superior convenience when making angular and longitudinal leg adjustments , especially for people with physical handicaps .

fig1 shows an overall perspective view of an inventive work support 100 illustrating several inventive forms of adjustable legs 104 , not all of which would be used combined as shown . the work support 100 includes a platform 102 with leg adjusters 120 , typically four as illustrated by the embodiment of fig1 . each leg adjuster 120 comprises a base 125 that is molded as part of , or attached through some other means to , the side of the platform 102 , a rotating cap 106 , a manual locking knob 134 ( preferably wing shaped ), and an adjustable leg 104 . each leg 104 comprises a series of longitudinally spaced notches 110 ( e . g ., a circumferential groove on a cylindrical leg post ), a protrusion 114 ( e . g ., o - ring ) at each leg end 109 , and a leg shank 108 of length l 1 onto which a leg extension 112 may be attached to increase the effective length of the leg 104 . fig2 shows a side view of the work support 100 with the platform 102 , leg adjuster 120 , and an adjuster base 125 onto which the cap 106 can be movably attached . the base 125 has at least one , and preferably an arcuate series of , teeth 126 ( e . g ., radial ridges ) spaced around an arc having a radius of curvature , and a central hole 128 at the axis of the radius of curvature . the purposes of the teeth 126 and the hole 128 will be elucidated later in this description . fig3 shows further detail of the leg extension 112 . a short cavity 113 is dimensioned to accept the leg shank 108 such that friction from the o - ring 114 holds the leg extension 112 in place . the leg extension 112 thus allows customizability in the length of the leg 104 and is optionally covered at least at the bottom end with a cushioning and / or non - slip material 146 ( e . g ., resilient foam ). fig4 and 5 show detailed perspective views of the cap 106 . the cap 106 is arranged around a rotational axis defined by an axle pin 130 passing through a center hole 128 , and has a planar first axial side 144 , the plane being normal to the axle pin 130 . a channel 123 crosses the cap 106 parallel to the first axial side 144 of the cap 106 , is open on the first axial side 144 , and is dimensioned to hold the leg 104 between the channel 123 and the plane defined by the first axial side 144 . protruding into the channel 123 is a locking tooth 122 ( e . g ., a ridge ) that is dimensioned to mate with the notches 110 in the leg 104 when it is in the channel 123 . a bottom view of the cap 106 with a mated leg 104 ( a portion thereof being shown in ghosted outline ) is illustrated in fig5 . thus , a leg 104 properly placed in the channel 123 is held against longitudinal leg movement by the locking tooth 122 , especially when the leg 104 is pressured along a side of it opposite the locking tooth 122 . the illustrated embodiment of the cap 106 is made of molded plastic , so it is hollow to minimize plastic use . therefore the channel 123 is implemented as a series of four plastic ridges , each one of which forms a short portion of the channel 123 across its width , as shown . likewise , the tooth 122 is another ridge with a top edge that protrudes into the path of the channel 123 . the cap 106 has an arcuate series of spaced - apart depressions 124 which are dimensioned to mate with the one or more teeth 126 of the base 125 . the teeth 126 are also shaped such that when the teeth 126 are mated with the depressions 124 , the cap 106 can be rotated about the base hole 128 such that the teeth 126 move out of the depressions 124 to which they are mated and into adjacent depressions 124 . thus the cap 106 , when rotated , will change the angular position of the leg 104 when it is in the channel 123 . although the drawings discussed herein show depressions 124 on the cap 106 and the teeth 126 on the base 125 , the depressions 124 and the tooth / teeth can of course be on either the cap 106 or the base 125 . fig6 shows a top view of the cap with a mated leg 104 . an axle pin 130 passes through a spring 132 , preferably a compression spring , and a central cap hole 129 , which is rimmed by a rotary cam 138 comprising at least one , but preferably four , two - step 137 cam sets . although the embodiment disclosed herein shows a coiled spring 132 , the invention can accommodate other types of springs 132 ( e . g . a beveled spring washer ). the spring 132 biases the cap 106 against the leg 104 . at each end of the leg 104 the o - ring 114 is stretch - fitted into an end groove 116 . in addition to providing friction to hold the leg extension 112 , the o - ring 114 also serves as a laterally protruding end stop to prevent the leg 104 from slipping through and out of the channel 123 . the leg 104 also has an overall leg length l 2 that can be varied by providing different lengths l 1 for the shank 108 . two shank lengths l 1 are shown ( compare fig1 and 6 ), though an array of lengths can be accommodated , e . g ., 6 ″, 9 ″, 12 ″. for example , the leg 104 in fig6 is 6 ″ ( six inches ) long ( l 2 ), comprising a shank length l 1 of 1 . 5 ″, a 3 ″ notched portion divided into 1 ″ increments by the notches 110 , and a top end 109 also being 1 . 5 inches long . for a 9 ″ version , the length l 1 of the shank 108 is increased to 4 . 5 ″ and everything else stays the same . fig8 shows a side view , while fig9 shows the same view in cross - section , of the knob 134 , the cap 106 , and the base 125 , through all of which passes the axle pin 130 . a head or clip ring 142 in a groove on one end of the axle pin 130 and a clip ring 142 in a groove on the other end hold everything together with pressure from the spring 132 biasing the cap 106 against the base 125 . the knob shank 140 is hollow to contain the pin 130 while a number of cam riders 136 equal to the number of cam sets in the rotary cam 138 rim one end of the knob shank 140 . this is shown in further detail in fig7 . although only one cam set 138 and one cam rider 136 are needed , four are shown as preferred in order to prevent wobbling of the knob 134 . thus , the cam rider ( s ) 136 of the knob 134 can be mated with the cam ( sets ) 138 of the cap 106 , as shown in the close - up view of fig8 a . for a given cam set 138 , when the knob 134 is in the “ lock ” position , the cam rider 136 rests on a middle step 137 b of the cam 138 . a top step 137 c is a stop that prevents any further rotation of the knob 134 in the “ lock ” direction , providing a discrete stopping point for the cam rider 136 . when the knob 134 is turned in the “ unlock ” direction , the cam rider 136 moves to the bottom step 137 a , while another top step 137 c once again stops any further rotation . the extra space afforded by the bottom step 137 c allows the cap 106 to be moved out against the spring bias such that the teeth 126 are no longer mated with the depressions 124 . this allows the angular position of an object placed in the channel 123 ( e . g . a leg ) to be adjusted by applying torque to the cap 106 . the unique locking and unlocking ability afforded by the knob 134 and cam 138 , combined with a click - stop system , allows simultaneous , one - handed adjustment of the angular and longitudinal position of the leg 104 . when one wants to make leg 104 adjustments , one merely needs to turn the knob 134 in a discrete turn to the “ unlock ” position , which enables adjustment of the leg 104 in discrete units of adjustment . moreover , even while unlocked , the adjuster 120 will hold any given leg 104 position setting by spring bias 132 until light force is exerted to either turn the cap 106 or longitudinally push / pull the leg 104 from one “ click - stop ” setting to the next , either angularly or longitudinally , individually or simultaneously . the spring 132 causes the movements to “ click ” and stop when the leg 104 or cap 106 moves to a new mating engagement of tooth / depression ( 122 / 110 or 126 / 124 , respectively ). because the click stop positions are spaced apart in relatively large increments ( e . g ., one inch spacing between leg grooves 110 , e . g ., fifteen degree angular increments between cap / base depressions 124 ) a leg position setting made and locked in on a first leg 104 is easily recognized for duplicating on a second leg 104 of the work support 100 . again one - handed adjustment is enabled since a plurality of legs 104 can be adjusted one at a time . thus , longitudinal and angular adjustment of the leg 104 is controlled by a single knob 134 , allowing simple and quick click - stop style adjustment . this is especially important for people with physical handicaps including , for example , limited arm / hand dexterity , strength , and / or mobility , for whom extra convenience can mean the difference between the ability and inability to adjust a work support by themselves . this also allows the inventive work support 100 to be used in a variety of situations and for a variety of purposes ( e . g . in bed for reading a book , in a chair or wheelchair for holding a laptop or keyboard , etc .). thus , the easily adjustable inventive work support 100 offers superior convenience for both handicapped and able - bodied people . although the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character — it being understood that only preferred embodiments have been shown and described , and that all changes and modifications that come within the spirit of the invention are desired to be protected . undoubtedly , many other “ variations ” on the “ themes ” set forth hereinabove will occur to one having ordinary skill in the art to which the present invention most nearly pertains , and such variations are intended to be within the scope of the invention , as disclosed herein .

US-16868208-A

an electrical conductor assembly utilized , for example , in a defibrillator patch lead to interconnect a pulse generator and monitoring unit , and a wire mesh electrode pad . the electrical conductor includes a teflon insulated drawn brazed stranded wire cable which is wrapped in a drawn filled tube wire multifilar coil encased in a biocompatible insulative tubing .

fig1 illustrates a defibrillator patch lead 20 including an elongated lead body 22 extending from a proximal end 24 to a distal end 26 according to the present invention . the proximal end 24 includes a connector assembly 28 which includes a biocompatible insulative material formed to provide sealing rings 30 , and to leave exposed an electrically conductive connector pin 32 . the connector assembly 28 is configured for insertion into a receiving element of a signal processing and pulse generating device ( not shown ). while the electrode assembly is herein depicted as a defibrillator patch electrode , it should be appreciated that the conductor configuration of the present invention is also applicable to other types of leads and to other devices , such as implantable cardioverter defibrillator accessories including lead adapters or lead extenders . at the distal end 26 of the lead 20 is located an electrode assembly 40 . the electrode assembly 40 includes a wire mesh element 42 which is secured in an area 27 via a conductive connector element 44 ( fig6 ), to the electrical conductors within the elongated lead body 22 . the connector element 44 as well as the peripheral edge of the wire mesh element 42 are encased in a molded element 46 , which is a biocompatible inert insulation material . the wire mesh element 42 may simply be a round , oval - shaped , or other suitably curved - shape wire mesh preferably formed from 17 to 19 gage ( 0 . 003 inch / 0 . 005 inch diameter ) titanium or platinum wire . fig2 is an enlarged axial cross - sectional view of a portion of the lead body 22 . starting at the right side of fig2 the elongated lead body 22 is depicted as including a drawn filled tube ( dft ) conductor coil 50 which is wrapped about an insulator 54 which encases a drawn brazed stranded ( dbs ) conductor cable 52 . preferably , these components are inserted into a biocompatible insulative tubing element 56 , such as the insulation material sold under the name extra tear resistant ( etr ) silicone elastomer tubing , manufactured by dow corning , having a wall thickness of approximately 0 . 6 mm . in this embodiment , the conductor coil 50 includes five helically wound dft wires 60 , described in greater detail below . fig3 is an enlarged cross - sectional view of the dbs conductor cable 52 taken along cross - sectional line 3 -- 3 of fig2 . fig3 illustrates the plurality of individual drawn brazed stranded ( dbs ) wires 62 which make up the dbs cable 52 . the plurality of individual dbs wires 62 are braided together to form the dbs cable 52 . in addition , the dbs cable 52 is encased in the insulating material 54 , such as the insulation material sold under the name teflon tape wrap , manufactured by dupont . fig4 depicts in greater detail a cross - sectional view of one of the dbs wires 62 taken from the dbs cable 52 . as depicted in the enlarged view of fig4 the central portion 64 of the dbs wire 62 has a core portion 66 with a plurality of radially extending ridges 68 , which combine to form an essentially star - shaped cross - sectional profile . this central portion 64 is preferably a silver matrix conductor . the central portion 64 is encased in an alloy material 70 to form a round wire . the alloy material 70 is preferably a nickel alloy such as mp35n , or may be of a suitable stainless steel or other suitable material . the advantage of the inclusion of material in the star - shaped cross - section for the central portion 64 is exhibited in the form of lower resistance per unit of length . fig5 depicts an enlarged cross - sectional view of one of the drawn filled tube ( dft ) wires 60 which comprise the dft conductor coil 50 . as depicted in fig5 the core of the dft wire 60 is a solid cylindrical element 72 which is encased in a suitable conductive material 74 , such as mp35n . the core of the dft wire 60 is preferably a silver or copper composition , or some other suitable low resistance material . returning to fig2 the dbs cable 52 extends essentially axially within the lead body 22 . the individual dbs wires 62 which comprise the dbs cable 52 are braided together in order to provide both strength and flexibility . the dft conductor coil 50 is wrapped about the dbs cable 52 in an essentially helical manner , providing both structural support and flexibility . the final step in constructing the lead body 22 is installing the dft conductor coil 50 wrapped dbs cable 52 within the biocompatible insulative tubing material 56 , to form the lead body 22 which is lightweight , durable and electrically redundant . the area 27 shown in fig1 including the assembled connector element 44 and portions of the elongated lead body 22 and wire mesh element 42 , are illustrated in the enlarged cross - sectional view of fig6 . for a more complete description of one apparatus and method for providing the interconnection between electrical conductors and the electrode mesh , see assignee &# 39 ; s copending u . s . pat . application no . 07 / 926 , 076 , filed aug . 5 , 1992 , entitled &# 34 ; implantable defibrillator patch lead ,&# 34 ; which is incorporated herein by reference . briefly , the dbs cable 52 is inserted into a core sleeve 78 and crimped thereto . the core sleeve 78 is configured to be inserted into a hollow cylindrical area 80 defined by a cylindrical element 82 projecting from the connector element 44 . upon insertion of the core sleeve 78 , and a portion of the lead body 22 , into the cylindrical element 82 , the core sleeve 78 is secured within the cylindrical element 82 by crimping or by laser welding . the connector element 44 also includes a body portion 90 which is preferably formed from titanium or platinum depending on the material for the wire mesh . in fig6 the body portion 90 of connector element 44 includes a retaining flap 96 which defines a slot opening 98 against the body 90 . the wire mesh element 42 is inserted into the slot opening 98 and secured via welding to the connector element 44 . preferably , the width of the slot is closely matched to the thickness of the wire mesh element 42 . thus , the thickness of the slot opening 98 is preferably in the range of about 0 . 25 mm to 0 . 30 mm . the connector element 44 is fabricated from titanium or platinum to provide high corrosion resistance and durability . in addition , the wire mesh element 42 is preferably fabricated from titanium , which may have a titanium nitride surface coating , or of platinum or some other suitable material to improve electrical characteristics . as illustrated , the laser weld locations 100 melt the material of the retaining flap 96 , securing it to the wire mesh element 42 which is inserted into the slot opening 98 . in addition , the material of the wire mesh element 42 , as well as the material of the body portion 90 of the connector element 44 , have been melted such that the metal of the body 90 is secured to the wire mesh element 42 . by this configuration , the interconnection strength between the connecting element 44 and the wire mesh element 42 is significantly enhanced and will survive the repeated flexure accompanying its intended location on the exterior surface of the heart . it should also be noted that with respect to fig6 substantially all of the connector element 44 and portions of the wire mesh element 42 as well as portions of the elongated lead body 22 will be encased in the biocompatible insulative material of the molded element 46 , to provide insulation and to minimize the foreign body reaction to the patch lead 20 . the biocompatible coating of the molded element 46 is shown by the dashed lines in fig6 . as an example of the reduction in the tip - to - tip resistance arising from the lead body 22 according to the present invention , the resistance for various cable configurations per unit of length was determined . using a length of 60 cm as the standard , a dbs cable of a conventional configuration has a resistance of 0 . 78 ω , and a dft coil can have even higher resistance . by comparison , a dbs cable wrapped in a dft conductor coil according to the present invention has a resistance of 0 . 56 ω for the same 60 cm length . thus , the lead body 22 of the present invention exhibits a 30 % reduction in the tip - to - tip electrical resistance . although dft conductors have much higher corrosion resistance than dbs , the dft coil has relatively high electrical resistance to maintain high fatigue life . in this design , a dft coil design of very high fatigue life with relatively high electrical resistance is used together with dbs . so the overall design has very low electrical resistance , high fatigue life , and high corrosion resistance . it should be evident from the foregoing description that the present invention provides many advantages over defibrillator patch leads of the prior art . although preferred embodiments are specifically illustrated and described herein , it will be appreciated that many modifications and variations of the present invention are possible in light of the above teaching to those skilled in the art . it is preferred , therefore , that the present invention be limited not by the specific disclosure herein , but only by the appended claims .

US-92607592-A

a one step hair color and relaxer system comprising : an alkalizing agent in the range between about 0 . 1 % to about 8 %, based upon the total concentration of the hair color and relaxer system ; a hair dye ; and an oxidizing agent in the range between about 0 . 1 % to about 6 %, based upon the total concentration of the hair color and relaxer system ; wherein the ph of the hair color and relaxer system is in the range between about 9 to about 14 .

the present inventors have unexpectedly discovered that a one step process which simultaneously and permanently de - frizz hair , relax curls and deposit permanent hair color is , in fact , possible . it was discovered that by mixing , for example , lioh and h 2 o 2 in a specific concentration and ph ranges , a unique oxidative hair coloring , smoothing , de - frizzing and curl relaxing product can be formed . key components of this hair color and relaxer system , include , but are not limited to : alkalizing agent ( e . g ., lithium hydroxide , ammonium hydroxide , monoethanolamine , aminomethyl propanol , sodium hydroxide , potassium hydroxide , metal hydroxide blends , and other strong alkali ) around in a concentration range between about 0 . 1 % to about 8 %, by weight , of the hair color and relaxer system , more preferably between about 1 % to about 5 %, most preferably about 3 % to about 5 %, an oxidizer agent , e . g ., hydrogen peroxide , having a concentration range between about 0 . 1 % to about 6 %, by weight , of the hair color and relaxer system , more preferably between about 0 . 1 % to about 3 %, most preferably about 1 % to about 2 %; and an oxidative dye or combinations of oxidative and direct dyes having a concentration range between about 0 . 5 to about 20 %, by weight , of the hair color and relaxer system , more preferably between about 1 % to about 15 %, most preferably about 1 . 5 % to about 10 %. it is preferred that the hair color and relaxer system have a ph range between about 9 to about 14 , more preferably between about 10 . 0 to about 13 , most preferably about 10 . 5 to about 12 . with the preferred concentration range of the alkalizing agent , we are able to soften the cysteine and form cysteic acid via a hydrogen peroxide oxidation pathway . this is also a preferred pathway for elimination of lanthionine formation as lanthionine formation is usually associated with significant hair damage . in this process , hair keratin gets softened by lioh forming cysteic acid while making the hair very receptive to dye deposition . when applied to hair , lioh reacts with di - sulfide bond in cystine to form small amounts of sulfenic acid which is easily oxidized by peroxide to form cysteic acid as shown below : this reaction was confirmed by the measured increase of cysteic acid in test hair swatches as will be shown below . various reducing agents were evaluated to determine optimum curl relaxation from the hair color and relaxer system of the present disclosure . the color results produced by products made with various reducing materials were evaluated on hair swatches by an expert panel . the positive control in this case was the traditional hair color . the negative control was a traditional relaxer that did not deposit the color at all , but removed the existing color , making hair appear lighter , which is an undesirable effect . most reducing agents were inferior to traditional demi color in their color deposition . thus , this type of a system needs to have different color pallet to provide the desirable hair color deposit . curl relaxation is the second key benefit of the hair color and relaxer system of the present disclosure . it was one object of the present disclosure to also identify the most suitable reducing agent to be used in the hair color and relaxer system to achieve the most curl relaxation . the relaxation was evaluated by the expert panel on the scale of 1 to 5 . traditional hair color was used as a negative control and designated as ‘ 1 ’, while traditional relaxer was presented as a positive control and was designated as ‘ 5 ’. lithium hydroxide and ammonium thioglycolate gave notable improvement over traditional hair color and were rated above ‘ 1 ’. lithium hydroxide was more available to complete a higher degree of curl relaxation . ammonium thioglycolate consumed the hydrogen peroxide yielding the same curl relaxation but with very poor color formation and deposit . ammonium thioglycolate also gave a significant temperature rise . many agents used for hair relaxing without hydrogen peroxide , can produce heat when reacting with hydrogen peroxide . the heat is undesirable as it may irritate the scalp and sometimes even dangerous as the clients can get burned with the product mixture . table 1 shows that ammonium sulfite and ammonium thioglycolate can experience 5 to 7 degree temperature rises as compared to the traditional hair color . lithium hydroxide did not result in any significant temperature rise . overall , lioh was the preferred embodiment to relax / defrizz hair under oxidative ( e . g ., hydrogen peroxide ) environment with relaxing and frizz reductions effects . the relaxing of fiber indicates that cysteine was reduced , thereby allowing for the relaxing / defrizzing of the fiber . once lithium hydroxide was identified as the leading candidate for the hair color and relaxer system based on the experiments above , the concentrations needed to be optimized to balance performance as a relaxing agent while minimizing the impact on the color uptake and hair damage . the relaxation effect showed to be directly proportional to the concentration of lioh in the mixture . lithium hydroxide purchased for this experiment was used in a mono - hydrate formula ( lioh * h 2 o ). the concentration based on the raw material specification is lioh * h20 — minimum 56 . 5 % active . we have explored and tested multiple concentrations , e . g ., 7 % lioh mono - hydrate , is approximately 4 % active in - base , and when mixed 1 : 1 = 2 % on head and 4 % lioh mono - hydrate equates to 2 . 3 % in base , when mixed 1 : 1 = 1 . 1 % on head , both work well . going below 4 %, proved to be of little value @ 1 . 1 % on head below traditional mild relaxers ( tbc ) to produce visible result . the concentration of 4 % of lioh * h 2 o in the formula provides minimal decrease in color uptake . table 2 supports conditions for max color deposition and maximum relaxation of curly hair . we believe that excess lioh is neutralized by hydrogen peroxide reducing color uptake but provides maximum curl deformation . at 4 % ( i . e . 1 . 1 % lioh on head )— max color with moderate curl deformation is achieved . the working mixture ph range of between about 10 . 5 to about 12 is critical to have this reaction mechanism . the maximum increase in swatch length , most relaxation , was achieved at 4 volume ( i . e . 1 . 2 % peroxide ). although higher volume developer provided more color deposit and would be better for coloring of hair , the 4 vol developer provided maximum hair relaxation without significant decrease in the color uptake . once the formula and developer were optimized , the optimal combination was applied to hair to evaluate potential damage to the critical amino acids . traditional hair color formula and hair relaxers were used as positive and negative controls . untreated hair was analyzed as a baseline . when hair is treated with a chemical relaxer , hair cystine is cleaved , and a new crosslink , the lanthionine , is subsequently formed to help stabilize the hair in the straight configuration . lanthionine is a major reaction product between metal alkali and cysteine . however , as shown above , we have observed that permanent hair straightening is possible without lanthionine formation . the narrow range of lioh allowed us to achieve the straightening and smoothing without forming lanthionine . the analysis of amino acid content below show that the hair color and relaxer system of the present disclosure with lioh and low volume developer can produce curl relaxation without lanthionine formation . the above study showed that the ph of the hair color and relaxer system of the present disclosure is critical and can increase cysteic acid and prevent the lanthionine formation associated with amino acid damage to hair . the target hair color and relaxer system formulation provides hair damage similar to that of traditional hair color technology and can operate in ph range of between about 10 . 5 to about 12 . listed below are examples of hair color and relaxer system formulations according to the present disclosure : hcrs hair color and relaxer system “ light brown ” with 4 % lioh hcrs hair color and relaxer system “ light brown ” with 4 % lioh the hair color and relaxer system of the present disclosure was analyzed first in the research and development laboratory using untreated curly and wavy hair . the performance of this system was tested against an existing hair color formula . control ( just curly / wavy hair ), single shampoo , 6 , 12 , 18 , and 24 shampoos the swatches were then ( all ) dyed - out for 30 minutes , rinsed , blow dried , and flat ironed using a flat iron . the swatches were then left for 24 hours for the process to settle . the swatches were then washed to the designated amount of shampoos on the label of each swatch and just blow dried . the side - by - side study showed that 2 - in - 1 color and smooth did relax curl / wavy , smooth frizzy , and calm unruly hair after between 1 and 18 shampoos . swatches that were dyed out using ordinary hair color did not relax curly / wavy , smooth frizzy , or calm unruly hair , as shown on the left - control of fig1 - 6 . the hair color and relaxer system treatment gives long lasting color and relaxing of curl . it was also found very beneficial to use heat styling tools to further straighten and relax curls . it is known that heat improves reformation of hydrogen bond and in conjunction with the hair color and relaxer system enhances cysteine reduction / oxidation reaction , which results in smoother hair . based on the laboratory evaluation it is obvious that while results may vary based on the concentration of active ingredients , the changes made to hair using hair color and relaxer system of the present disclosure are permanent . salon evaluations of the hair color and relaxer system , in test salon fig6 - 8 show the beneficial effects that the hair color and relaxer system of the present disclosure have when applied to the respective hair of models a , b and c . while we have shown and described several embodiments in accordance with our disclosure , it is to be clearly understood that the same may be susceptible to numerous changes apparent to one skilled in the art . therefore , we do not wish to be limited to the details shown and described but intend to show all changes and modifications that come within the scope of the appended claims .

US-201615183210-A

the present invention relates to the cryopreservation and preparation of warmed oocytes for fertilization . cryopreservation of oocytes using vitrification methods is disclosed . exemplary techniques include making a vent in the zona pellucida surrounding the oocyte ; contacting the oocyte with a vitrification solution comprising at least one cryoprotectant ; and vitrifying the oocyte . further methods of warming the vitrified oocyte , in preparation for intracellular sperm injection are disclosed , allowing for the assessment of successful fertilization .

it is an object of the invention to provide methods of vitrification of oocytes . additionally , the invention allows for assessment of oocyte viability at least two hours after warming , and allows for assessment of successful fertilization of warmed oocytes within at least eighteen hours of intracellular sperm injection ( icsi ). prior to describing the invention in more detail , the following definitions are intended for the terms used herein : the term “ vitrification ” as used herein refers to the solidification of a biological sample at low temperature , not by ice crystallization but by extreme elevation in viscosity during cooling . preferably , an oocyte is suspended at about 0 ° c . or above , in a highly concentrated solution of permeating cryoprotectant , which largely displaces water in the oocyte . the oocyte may then be loaded onto a cryoloop before plunging it directly into liquid nitrogen and achieving a cooling of between 15 , 000 to 30 , 000 ° c ./ min . water is transformed directly from the liquid phase to a glassy , vitrified state . with this method fewer damaging ice crystal form than in conventional freezing . although the terms “ freezing ” and “ thawing ” are commonly used for conventional cryopreservation , the terms “ cooling ” and “ warming ” are used herein for vitrification procedures . vitrification protocols are constantly being improved and are simple , fast , and inexpensive . the term “ vitrification solution ” as used herein shall mean any aqueous mixture containing at least one permeating cryoprotectant . the oocyte is preferably contacted with a series of vitrification solutions with cryoprotectants of increasing concentrations prior to vitrification . preferably , permeating cryoprotectants are added to an initial vitrification solution comprising g - mop , ( hepes buffered amino acid produced by in vitro life ). enhanced media and 5 mg human serum albumin ( hsa )/ ml . preferably , permeating cryoprotectant concentrations in vitrification solution range from about 0 % to less than or equal to about 20 %. most preferably , the combined cryoprotectant concentration in each solution of a series of vitrification solutions is about 0 . 625 %, about 1 . 25 %, about 2 . 5 %, about 5 %, about 10 %, and about 20 %. there exist special carrier systems for vitrification solutions ( e . g ., the open pulled straws medical technology ( mtg ), vertriebs - gmbh , germany , the flexipet - denuding pipette fdp cook ivf , spencer , ind ., the cryoloop hampton research , laguna niguel , calif . ), or the cryostraw for the hemistraw system ivm , l &# 39 ; aigle , france ), all of which minimize the volume of the vitrification solution to keep the cooling rate as high as possible . in one embodiment of the claimed method , all steps other than vitrification are carried out at about 36 ° c . to about 38 ° c . in the preferred embodiment , all steps other than vitrification are carried out at about 37 ° c . the term “ cryoprotectant ” as used herein refers to a substance that is used to protect a cellular sample from damage due to ice crystallization . the term “ permeating cryoprotectant ” as used herein shall mean a cryoprotectant useful in the present invention capable of penetrating the cellular plasma membrane . permeating cryoprotectants include but are not limited to dimethylsulphoxide ( dmso ), acetamide , and 1 , 2 propanediol , for example . additional permeating cryoprotectants include but are not limited to glycerol and glycols such as ethylene glycol ( eg ) and propylene glycol . prefereably , osmotic pressures inside and outside the cell increase equally with the concentration of permeating cryoprotectants . most prefereably , a permeating cryoprotectant can serve as both a solvent and a solute in a vitrification solution . the term “ non - permeating cryoprotectant ” shall mean a cryoprotectant which does not penetrate cellular plasma membranes . non - permeating agents facilitate the speed at which vitrification occurs and also mitigate cellular damage . prefereably , high concentrations of non - permeating cryoprotectants in vitrification solutions draw water out of the oocyte by osmosis . a decreased volume of water in the oocyte reduces the volume of permeating cryoprotectants required to completely displace water from the oocyte , and shortens the time required for the displacement to be completed . additionally , non - permeating cryoprotectants are included in warming solutions to decrease swelling of the oocyte as permeating cryoprotectants are removed from the cell . non - permeating cryoprotectants include but are not limited to macromolecules and sugars . prefereably , non - permeating cryoprotectants include sucrose , fructose , glactose , lactose , mannose , raffinose and trehalose ; proteins found in milk and egg yolk , such as albumin ; amides ; synthetic polymers such as ficoll , polyethylene glycol , polyvinylpyrrolidone or methyl cellulose ; and algae - derived polysaccharides such as agarose and alginate . non - permeating cryoprotectants typically do not serve as solvents . the term “ warming solution ” as used herein shall mean any aqueous mixture applied to the oocyte after vitrification . the oocyte is preferably contacted with a series of warming solutions after vitrification of sequentially decreasing concentrations of non - permeating cryoprotectant . in one embodiment , the non - permeating cryoprotectant is added to an initial warming solution comprising g - mop and 5 mg human serum albumin ( hsa )/ ml . preferably , concentrations of the non - permeating cryoprotectant in the series ranges from about 0 m to about 1 . 5 m . most preferably , the non - permeating cryoprotectants are sucrose and ficoll . preferably , the sucrose concentration in each warming solution of the series is about 1 . 5 m , about 0 . 75 m , about 0 . 5 m , about 0 . 25 m , about 0 . 125 m , and about 0 m . the term “ oocyte ” as used herein refers to an female gamete . the oocyte is a large and essentially stationary cell which undergoes meioses when fertilized by a sperm , the male gametocyte . oocytes are classified as primary or secondary oocytes , depending on whether they have undergone zero or one meiotic divisions . two primary oocytes are created when an oognium divides by mitosis . each primary oocyte then divides in meiosis i into a haploid secondary oocyte , and typically a first polar body with less cytoplam than the secondary oocyte , which soon disintegrates . however , cytoplamic distribution can be equal and result in two secondary oocytes . a second meiosis then occurs . the oocytes described herein are prefereably in the metaphase stage of this second meiotic division . preferably , a sample oocyte is obtained a prepared for cryopreservation through methods well - known in the art . the term “ zona pellucida ” as used herein refers to the glycoprotein membrane surrounding the plasma membrane of an oocyte or blastocysts . surrounding and penetrating the zona pellucida is the corona radiata , a single layer of columnar granulose cells that assist in both providing nutrients to the oocyte and in regulating the maturation of the oocyte . several more layers of granulose cells may surround the corona radiata . the term “ vent ” as used herein shall mean an opening in the zona pellucida surrounding an oocyte or blastula . preferably a vent shall mean a slit opening of about 5 μm to about 25 μm in length , more preferably between about 10 μm to about 20 μm , and about 10 μm to about 15 μm and most preferably between about 12 μm to 15 μm in length . the vent shall preferably penetrate all layers of the zona pellucida , but not the oocyte &# 39 ; s plasma membrane . preferably a vent is made by laser incision , using for example , a 1 . 48 micron infrared diode laser . a vent may also be made by piercing the zona pellucida with a sharp pipette or microneedle . alternatively , a vent may be made by microscopically applying acidified media , such as tyrode solution , to the zona pellucida to induce local thinning . preferably , at least one vent is made in the zona pellucida . most preferably , one vent is made in the zona pellucida . following creation of a vent in the zona pellucida surrounding the oocyte , the oocyte is preferably contacted with a vitrification solution and promptly vitrified . following vitrification , the oocyte may be treated with a series of warming solutions containing non - permeating cryoprotectants of sequentially decreasing concentrations . the oocytes may then be washed and cultured before fertilization by intracytoplasmic sperm injection ( icsi ), for example . the term “ cryosurvival rate ” refers to the number of oocytes that are morphologically intact post - thawing / warming , as a percentage of the total number cryopreserved . the terms “ a ” or “ the ” shall refer to either the plural or the singular form of the referenced noun . vitrification protocols presented herein will be applicable to egg banking . egg banking can be used for the purpose of fertility preservation ( fp ) to allow for family planning , oocyte donation , or to preserve fertility prior to ovarian failure . egg banking may also be a desirable option for women of reproductive age with malignant diseases , the treatment of which involves surgery , radiation , or chemotherapy , which would lead to oocyte destruction . egg banking may also be used by persons with moral or religious objections to embryo but not oocyte cryopreservation . in one preferable embodiment , non - permeating cryoprotectants are present in the vitrification solution . non - permeating cryoprotectants promote the rate of vitrification and decrease the risk of cellular damage . non - permeating cryoprotectants include , for example , macromolecules and sacharides . specific non - permeating agents include sucrose , fructose , galactose , lactose , mannose , raffinose and trehalose ; proteins , such as those found egg yolk or milk , including for example albumin or bovine serum ; synthetic polymers such as polyethylene glycol , polyvinylpyrrolidone , methyl cellulose or amides . algae - derived polysaccharides such as agarose and alginate are useful as non - permeating cryoprotectants . most preferably , sucrose is used . inclusion of a non - permeating cryoprotectant preferably also helps prevent over - swelling of the cell during the warming process when permeated cryoprotectant is removed . in the following example , all steps other than vitrification were carried out at 37 ° c . first , cumulus cells were removed from a sample cumulus - oocyte complex by gentle pipetting . the oocyte was then transferred into human tubal fluid ( htf ) supplemented with 10 % synthetic serum for two hours . after incubation for 2 hours , a 10 μm to 15 μm vent was made in the zona pellucida using a becton dickinson laser . five minutes after the vent was created , the oocyte was treated with vitrification solutions , in sequentially increasing concentrations of permeating cryoprotectants . the initial vitrification solution was prepared by combining g - mop with 5 mg hsa / ml . then , 8 parts of the initial vitrification solution were combined with 1 part ethylene glycol ( eg ) and 1 part dimethylsulphoxide ( dmso ). these concentrations such that the eg and dmso comprised 0 . 625 % of the solution . the oocyte was then submersed in the vitrification solution comprised of 0 . 625 % dimethylsulphoxide ( dmso ) and ethylene glycol ( eg ). after that , the oocyte was moved into a solution comprised of 1 . 25 % dmso and eg for 1 minute . next , the oocyte was moved into a solution comprising 10 % dmso and eg for 1 minute . finally , the oocyte was moved into a solution comprising 20 % dmso and eg , and held there for only 20 seconds . while in the 20 % dmso and eg solution , the oocyte was loaded onto a cryoloop and directly plunged into liquid nitrogen . after the vitrification in liquid nitrogen , the oocyte was stored at about − 190 ° c . for 1 - 3 months . the first step in removing the oocyte from cryopreservation was to warm the oocyte directly plunging the cryoloop into a series of warming solutions held at about 37 ° c . with sequentially decreasing concentrations of sucrose . first the oocyte was plunged into a warming solution with 1 . 5 m sucrose for 50 seconds . after that , the oocyte was moved into a 0 . 75 m sucrose solution for 15 seconds . next , the oocyte was held in 0 . 5 m sucrose solution for one minute . then the oocyte was submersed in 0 . 25 m sucrose for one minute . after that , the oocyte was moved into a 0 . 125 m sucrose for one minute . the warmed oocyte was then washed three times with global one media after the last warming solution . the oocyte was then cultured in global one media for about 2 hours before icsi . an alternative approach to the oocyte vitrification process utilized the same methods as disclosed in example 1 , except for those steps described differently below . the initial vitrification solution was prepared by combining g - mop with 5 mg hsa / ml . next , the oocyte was submersed in the vitrification solution of 1 . 25 % ethylene glycol ( eg ) for 1 minute and then moved into a solution of 2 . 5 % eg for 1 minute . following that , the oocyte was transferred into a solution of 5 % dmso and eg for 1 minute and thereupon is moved into a solution of 20 % eg for 1 min . finally , the oocyte was transferred into a solution of 40 % eg , and held there for only 20 seconds . while in the 40 % eg solution , the oocyte was loaded onto a cryoloop , directly plunged into liquid nitrogen and then cryo - stored at about − 190 ° c . while different embodiments of the invention have been described in detail herein , it will be appreciated by those skilled in the art that various modifications and alternatives to the embodiments could be developed in light of the overall teachings of the disclosure . accordingly , the particular methods and arrangements are illustrative only and are not limiting as to the scope of the invention that is to be given the full breadth of any an all equivalents thereof . results achieved using the methods of the present invention were compared with the results compared with conventional methods . results using conventional methods were obtained from barritt et al ., donor oocyte cryopreservation resulting in high pregnancy and implantation rates . fertility and sterility 86 ( suppl 2 ) p - 473 , s311 . as shown in table i , 16 female patients out of 20 were selected for this study using the methods of the present invention . out of these 16 patients , 12 showed pregnancies based on bhgc levels , and 9 patients were still pregnant after 6 - 7 weeks , based on ultrasound testing . based on these results , only 1 . 6 embryos were transferred per patient . in contrast , the conventional method selected 5 . 75 embryos per patient . as such , on a patient per patient comparison , the results obtained using the instant methods are more successful than those obtained using conventional methods . eggs were frozen according to the methods herein , the eggs were then selected for thawing following polar body biopsy with comparative genomic hybridization . furthermore , table i , shows the number of oocytes using the methods of the present invention and the number of oocytes using conventional methods . the number of oocytes that were thawed using the present methods , was 48 , 46 or 96 % of which survived vitrification . of these 46 oocytes , 44 were successfully fertilized , ultimately resulting in 11 pregnancies , or 44 % as indicated by fetal heart beat . in contrast , results using conventional methods show that of 79 thawed oocytes , 68 , or 86 % survived and 61 were fertilized , ultimately resulting in only 6 or 26 % pregnancies . a comparison of these results shows that the methods of oocyte vitrification of the present invention allow a greater rate of births based on a few number of embryos transferred per patient .

US-82699807-A

an external minisplint device comprises an elongated body supporting at least one pair of clamps each of which is capable of securing at least one pair of transverse bone bolts . a longitudinal guide associated with the elongated body guides the longitudinal translational movement of at least one of the clamps . the minisplint device further comprises at least one longitudinal adjustment screw which can rotate within the elongated body and which engages a corresponding threaded hole formed in the clamp capable of translational motion for selectively positioning it along the longitudinal guide . the screw has a head which partly projects from the end of the elongated body . the adjustment screw is axially imobilized when it is rotated . the axial immobilizer comprises at least one smooth key , and preferably a pair of smooth gauged keys insert in the elongated body in tangential contact with the base of a circular groove formed in the head of the adjustment screw .

with reference to fig1 and 2 , an external minisplint device according to the invention , indicated as a whole by reference number 1 , is illustrated , and essentially comprises an elongated body 2 which supports a pair of clamps 3 , 4 for bone bolts f . elongated body 2 preferably comprises a parallelepiped - bar of approximately rectangular cross - sectional shape having a longitudinal axis l . body 2 has a longitudinal groove 5 which extends over a good or substantial part of its length and defines a longitudinal guide means for at least one of the clamps , such as clamp 3 . clamp 3 can be moved along groove 5 by means of an adjusting or adjustment screw 6 which is rotatably supported in two end holes in body 2 in line with longitudinal axis l . adjustment screw 6 has a recessed hexagonal head 7 for an allen key which projects from the end of body 2 . the end hole opposite head 7 of screw 6 is closed off by means of a plug 8 of elastomer material to avoid the build - up of impurities and the risk of infections . fixed clamp 4 comprises a base 9 which is integral with body 2 and a cover 10 which is connected to base 9 by means of a locking screw 11 which also has a recessed hexagonal head . movable clamp 3 also has a base 12 with a depending slide - flange , lower appendage or key 13 of a width slightly less than that of groove 5 so that it can slide freely along it . in lower appendage or key 13 there is a threaded hole which is engaged by adjustment screw 6 . the longitudinal ends of key 13 have rounded ends so that they can be inserted into the ends of complementary shape in groove 5 so as to increase the useful travel of movable clamp 3 as illustrated in fig2 a . covers 10 , 14 respectively are anchored on bases 9 , 12 of clamps 4 , 3 by means of corresponding locking screws 11 , 15 which have recessed hexagonal heads . in accordance with the invention , adjustment screw 6 is immobilized axially with respect to elongated body 2 by an axial immobilizing means comprising at least one smooth gauged pin , e . g ., 16 , which is inserted in a transverse hole in the body 2 and is designed to engage tangentially with a circumferential or circular recess or groove 17 having a semi - circular cross - section formed in the head of adjustment screw 6 allowing it to rotate about its longitudinal axis l . preferably two pins 16 , 16 . 1 are provided on opposite sides of head 7 of adjustment screw 6 in a substantially symmetrical arrangement relative to axis l . as a result of the substantial force exerted by pins 16 , 16 . 1 , screw 6 is axially immobilized in an extremely secure and reliable way and without any risk of breakage even when very high stresses are applied . that is , pins 16 , 16 . 1 are able to resist substantial forces tending to cause displacement of screw 6 relative to body 2 in a direction parallel to axis l . furthermore , given the fact that the key 13 and pins 16 , 16 . 1 are made to dimensions with extremely small tolerances , the play in the rotatable coupling is reduced to a minimum , thus allowing micrometer adjustment of the movement of the clamp 3 . in order to increase the flexibility with which the clamps 3 , 4 can be used , three transverse seats ( e . g ., 18 , 19 , 20 ) for the same number of bone bolts are provided on each of these instead of the two normally present in clamps used for grasping bone bolts . for simplicity only the seats in clamp 3 will be described below , it being understood that the seats in clamp 4 are identical . three transverse grooves which are parallel to each other , indicated respectively by 18 , 19 , 20 , are provided on the upper face of base 12 of clamp 3 , while a similar number of grooves 21 , 22 , 23 are provided in cover 14 in corresponding positions . when the two sets of grooves 18 , 19 , 20 , 21 , 22 , 23 are coupled together , the transverse cross - section resulting from the seats for the bolts is approximately elliptical and not circular , in order to provide secure immobilization of bone bolts of different diameters of , for example , 2 millimeters ( mm ) and 5 mm . additionally , the spacing a between grooves 18 and 19 , or between grooves 21 and 22 , on the same side of locking screw 15 , is equal to approximately half the distance b between grooves 19 and 20 , or between grooves 22 and 23 , on the opposite side with respect to screw 15 , so that three different spacings are possible . for example , if distance a is 4 mm and distance b is 8 mm , two bone bolts can be fitted with spacings of 4 mm , 8 mm or 12 mm . it is desirable that a cylindrical insert 24 of elastomer material for example teflon ®, having a central hole for adjustment screw 6 and having an internal diameter which is slightly less than the external diameter of screw 6 is provided in the lower part of key 13 of movable clamp 3 to exert an anti - loosening braking effect on the latter . insert 24 is coaxially lodged in an annular groove formed on the inner surface of the threaded hole in key 13 inwardly of the ends of the hole . the central hole of insert 24 may have the same diameter as the threaded hole in key 13 . a further clamp for transverse bone bolts anchored to body 2 at the end adjacent to fixed clamp 4 may also be provided , as indicated in general by reference number 25 . in particular , clamp 25 may comprise a forked stirrup 26 with an approximately u - shaped transverse cross - section with three pairs of opposing grooves provided on the inner faces of the stirrup to hold the bone bolts . the stirrup 26 may be anchored to the end face of base 9 of body 2 by means of a screw 27 which is also used to tighten the opposing faces of the stirrup against the bone bolts . fig3 and 4 illustrate an articulated minisplint indicated generally by 1 &# 39 ;. parts in fig3 and 4 designated by reference numerals having a prime (&# 39 ;) correspond to parts in fig1 and 2 having the same reference numerals but without the prime (&# 39 ;). minisplint 1 &# 39 ; comprises an elongated body 2 &# 39 ; in the shape of a parallelepiped - bar having a rectangular cross - section , connected to an arm 28 by means of an axial joint which is indicated generally by reference number 29 . elongated body 2 &# 39 ; has a longitudinal groove 5 &# 39 ; and an adjustment screw 6 &# 39 ; which is axially immobilized by means of a pair of keys 16 &# 39 ;, 16 . 1 &# 39 ;. arm 28 has an integral extension 9 &# 39 ; which forms the base of clamp 4 &# 39 ;. in particular , axial joint 29 is formed of a pair of eyes 30 between which the end of arm 28 is inserted . the two parts , arm 28 and body 2 &# 39 ;, are hinged together by means of a pin 31 whose axis h is substantially parallel to the seats 9 &# 39 ;, 12 &# 39 ; of the clamps 4 &# 39 ;, 3 &# 39 ; of the bone bolts . desirably , pin 31 has a head 32 with a hexagonal recess , a smooth central portion 33 and a threaded end 34 onto which is screwed a lock nut 35 . thus , the pin 31 can be unscrewed and its position reversed to reduce the size of the joint 29 on the side adjacent to the bone , thus making the fixation right - handed or left - handed according to requirements . articulated minisplint or fixator 1 &# 34 ; shown in fig5 and 6 differs from that in fig3 and 4 essentially in the fact that the axis v of axial joint 36 between elongated body 2 &# 34 ; and arm 37 is substantially perpendicular to the seats of the clamps 3 &# 34 ;, 4 &# 34 ; for the bone bolts . parts in fig5 and 6 designated by reference numerals having a double - prime (&# 34 ;) correspond to parts in fig3 and 4 having the same reference numerals but with a single - prime (&# 39 ;). body 2 &# 34 ; slidably supports clamp 3 &# 34 ; which can move via an adjustment screw 6 &# 34 ; which is axially immobilized by means of a pair of gauged pins 16 &# 34 ;, 16 . 1 &# 34 ;. articulated minisplint 1 &# 39 ;&# 34 ; illustrated in fig7 and 8 differs from those in fig3 to 6 in that connecting joint 38 comprises a pair of jaws 39 , 42 with a hemispherical cavity for a ball 40 formed on arm 43 connected to base 9 &# 39 ;&# 34 ; of clamp 4 &# 39 ;&# 34 ;. parts in fig7 and 8 designated by reference numerals having three primes (&# 39 ;&# 34 ;) correspond to parts in fig3 and 4 , and fig5 and 6 having the same reference numerals but with a single - prime (&# 39 ;) and double - prime (&# 34 ;), respectively . the opening defined by jaws 39 , 42 through which the portion of ball 40 contiguous with arm 43 extends is generally circular to allow pivoting of arm 43 about axis x ( i . e . in the horizontal plane in fig7 ), about axis y ( i . e ., in the vertical plane in fig7 ) or in planes therebetween . lodging of ball 40 in the hemispherical cavity between jaws 39 , 42 also allows pivoting or twisting of arm 43 about axis z in fig7 . jaws 39 , 42 can be tightened against ball 40 by means of a locking screw 41 so as to lock the orientation of clamp 4 &# 39 ;&# 34 ;. the clamp 4 &# 39 ;&# 34 ; is shaped in such a way ( i . e ., by arm 43 being integral with an end edge of base 9 &# 39 ;&# 34 ;) that the seats of clamp 4 &# 39 ;&# 34 ; for the bone bolts f &# 39 ;&# 34 ; are located in a plane which is substantially parallel to the plane containing the seats of clamp 3 &# 39 ;&# 34 ; when clamp 4 &# 39 ;&# 34 ; is located in its outermost position relative to clamp 3 &# 39 ;&# 34 ;, i . e ., when minisplint 1 &# 34 ; is in a substantially straight condition as shown in fig7 . the portions of the interior surfaces of bases 9 &# 39 ;&# 34 ;, 12 &# 39 ;&# 34 ; on which bone bolts f &# 39 ;&# 34 ; are seated are substantially flat , and the interior surfaces each have an integral boss through which locking screws 11 &# 39 ;&# 34 ;, 15 &# 39 ;&# 34 ; extend . spherical joint minisplint device 1 iv illustrated in fig9 and 10 differs from that in fig7 and 8 essentially in the fact that the seats of clamp 4 iv for the bone bolts f iv are located in a plane which is substantially perpendicular to the plane containing the seats of clamp 3 iv when clamp 4 iv is located in its outermost position relative to clamp 3 iv , i . e ., when minisplint 1 iv is in substantially straight condition as shown in fig9 . this results from arm 43 a being integral with the surface of base 9 iv opposite the surface on which bone bolts f iv are seated which gives clamp 4 iv a &# 34 ; t &# 34 ;- configuration . parts in fig9 and 10 designated by reference numerals having the superscript ( iv ) correspond to parts in fig7 and 8 having the same reference numerals but with triple - primes (&# 39 ;&# 34 ;). parts in fig9 and 10 designated by reference numerals having a superscript ( a ) correspond to parts in fig7 and 8 having the same reference numerals but without any superscript . the portions of the interior surfaces of bases 9 iv , 12 iv on which bone bolts f iv are seated are substantially flat , and the interior surfaces each have an integral boss through which locking screws 11 iv , 15 iv extend . fig1 and 12 illustrate an articulated minisplint device indicated generally by reference number 100 which comprises two elongated bodies 101 , 102 defined by parallelepiped - bars of slightly different lengths which slidably support clamps 103 , 104 which can be moved along longitudinal grooves 105 , 106 by means of corresponding adjusting screws 107 , 108 . adjustment screws 107 , 108 are also axially immobilized against the corresponding bars 101 , 102 by means of smooth gauged pins 109 , 109 . 1 , 110 , 110 . 1 which act together with circumferential grooves made in heads 111 , 112 of the screws 107 , 108 . the portions of the interior surfaces of bases 126 , 127 on which bone bolts f1 are seated are substantially flat , and the interior surfaces each have an integral boss through which locking screws 130 , 131 extend . the two elongated bodies 101 , 102 are joined together by means of a joint 113 whose axis k is substantially parallel to the seats of the clamps 103 , 104 for the bone bolts f1 . for accurate and micrometer adjustment of the angle β formed between the two bodies 101 , 102 there is provided an actuator 114 having screws 120 , 121 with opposing threads acting on the ends of the bars 101 , 102 adjacent to joint 113 . in particular , the actuator 114 essentially provides two elongate housings comprising stirrups or forks 115 , 116 formed towards the adjacent ends of bodies 101 , 102 which are capable of housing corresponding cylindrical blocks 117 , 118 for rotation about respective central axes of the bodies 101 , 102 which are transverse to the longitudinal central axes of the corresponding cylindrical blocks . cylindrical blocks 117 , 118 are rotatably fixed relative to the corresponding forks 115 , 116 about the longitudinal central axes of the cylindrical blocks . screw 119 is defined by a cylindrical bar having ends 120 , 121 which are externally threaded in opposite directions ( i . e ., right - and left - handed ) and which engage corresponding holes with opposing threads in cylindrical blocks 117 , 118 . for example , screw 119 also has a central cylindrical expansion 122 with transverse holes 123 for the introduction of an adjustment key . by rotating oppositely threaded bars 120 , 121 of screw 119 of actuator 114 , pairs of stirrups 115 , 116 are caused to move together or move apart in a direction parallel to the longitudinal axis of the threaded bars 120 , 121 with a consequent micrometric change in the angle β formed between the two elongated bodies 101 , 102 . such relative movement of stirrups 112 , 113 , and concomitant pivoting of about axis k , alters the angle between the stirrups and screw 119 which is permitted by the allowed rotation of cylindrical blocks 117 , 118 about their respective transverse central axes . in use , all that is necessary is to insert the bone bolts f , f &# 39 ;, f &# 34 ;, f &# 39 ;&# 34 ;, f iv , f1 , or kirschner wires into the bone stumps at suitable distances corresponding to the spacings between the clamps 3 , 4 ; 3 &# 39 ;, 4 &# 39 ;; 3 &# 34 ;, 4 &# 34 ;; 3 &# 39 ;&# 34 ;, 4 &# 39 ;&# 34 ;; 3 iv , 4 iv , and then immobilize the clamps on the free ends of the bone bolts and finally bring about longitudinal movement of the clamps , via longitudinal guide means 5 , 5 &# 39 ;, 5 &# 34 ;, 5 &# 39 ;&# 34 ;, 5 iv , 105 , 106 , and positioning of the elongated bodies and arms supporting the clamps , via axial joints 29 , 36 , connecting joints 38 , 38 a , and joint 113 , so as to set the fracture or correct deformation . while the invention has been described by reference to certain preferred embodiments , it should be understood that numerous changes could be made within the spirit and scope of the inventive concept described . accordingly , it is intended that the invention not be limited to the disclosed embodiments , but that it have the full scope permitted by the language of the following claims .

US-8222598-A

a dilatation balloon catheter capable of creating perfusion passages during balloon inflation is formed by a plurality of cooperating expandable members disposed at a distal end of a catheter shaft , thereby forming a composite balloon . the expandable members are generally side - by - side , and are supported at the distal end of the shaft by at least one support member , which is connected between a distal end of the composite balloon and the catheter shaft . distal ends of the expandable members are sealed and united within a tubular connector ; proximal ends of the expandable members are bonded within and communicate with an inflation lumen at the distal end of the shaft . the outer surfaces of the inflatable members cooperate to dilate the wall of an artery . the outer surfaces of the inflatable members further define two sinuses adjacent to the juxtaposed outer surfaces of the inflatable members , which permit passive perfusion of blood through the composite balloon during a dilatation procedure .

fig1 shows a side view of perfusion balloon dilatation catheter 10 for performing dilatation of an artery . catheter 10 generally includes manifold 12 , elongated tubular shaft 14 , composite balloon 16 and guide wire support tube 18 . manifold 12 is located at the proximal end of catheter 10 and includes inflation port 20 , through which inflation fluid is provided to and withdrawn from composite balloon 16 . elongated tubular shaft 14 is a single lumen tube having its proximal end 22 connected to manifold 12 and its distal end 24 connected to composite balloon 16 . shaft 14 includes lumen 26 ( shown in fig2 - 3 ) which extends from proximal end 22 to distal end 24 . lumen 26 of shaft 14 is in fluid communication with inflation port 20 of manifold 12 , and also with composite balloon 16 . shaft 14 is comprised of proximal section 28 , which is a stainless steel hypotube , and distal section 30 , which is made of any one of a number different shaft materials specifically used for angioplasty catheters , such as polyethylene or polyimide . distal section 30 is connected to proximal section 28 at junction 32 . shaft 14 may also be a single material or multiple materials . in some embodiments , distal section 30 has greater flexibility than proximal section 28 . distal end 24 is flared slightly to accept composite balloon 16 . composite balloon 16 includes first expandable member 34a and second expandable member 34b . first and second expandable members 34a , 34b are made of tubes of a flexible , inflatable polyolefin copolymer material , such as surlyn 8527 from dupont . first and second expandable members 34a , 34b include proximal sections 38a , 38b , intermediate expandable bodies 40a , 40b , and distal sections 42a , 42b , respectively . each proximal section 38a , 38b has relatively small inner and outer diameters which permits side - by - side insertion of proximal sections 38a , 38b within distal end 24 of shaft 14 . intermediate expandable bodies 40a , 40b are integral with proximal sections 38a , 38b , respectively . expandable bodies 40a , 40b are generally parallel , with outer surfaces 44a , 44b of expandable bodies 40a , 40b , respectively , becoming generally contiguous along contact surface 46 when expandable bodies 40a , 40b are inflated . in an inflated state , expandable bodies 40a , 40b each have an expanded inner and outer diameter which is larger than the relatively small inner and outer diameters of proximal sections 38a , 38b . distal sections 42a , 42b are integral with expandable bodies 40a , 40b , respectively , with each distal section 42a , 42b having inner and outer diameters which are smaller than the inner and outer diameters of expandable bodies 40a , 40b . distal sections 42a , 42b converge , and are joined and sealed together by adhering tube 50 over distal sections 42a , 42b at distal end 48 . tube 50 is a relatively short tubular section of an elastic polymer , such as polyurethane , which has an unexpanded inner diameter that is smaller than the combined outer diameter of distal sections 42a , 42b . tube 50 is stretched so as to increase its inner diameter , thereby permitting insertion of a flexible adhesive , such as urethane 3507 from h . b . fuller and distal sections 42a , 42b , within tube 50 . tube 50 is then permitted to constrict around distal sections 42a , 42b , which seals and secures together distal sections 42a , 42b . positioned over tube 50 at distal end 48 of composite balloon 16 is guide wire support 18 . guide wire support 18 is a relatively short tubular section of a polymer , such as polyethylene , which provides opening 52 ( shown in fig2 ) and permits insertion and free longitudinal movement of a guide wire external to catheter 10 . fig2 is an enlarged perspective view of the distal end of catheter 10 . as shown in fig2 composite balloon 16 is supported at distal end 24 of shaft 14 by support members 54a and 54b , which extend from shaft 14 into first and second expandable members 34a , 34b , respectively ( shown in fig3 ). support members 54a , 54b are made of stainless steel , and provide sufficient rigidity to composite balloon 16 to permit its advancement when catheter 10 is advanced within an artery . in one embodiment , guide wire support 18 is secured to tube 50 by bond 56 ( shown in fig5 ) such that opening 52 is generally aligned with contact surface 46 . guide wire support 18 has an inner diameter which is larger than an outer diameter of distal end 48 . this allows catheter 10 to be advanced over guide wire 58 , with guide wire 58 generally positioned between first expandable member 34a and second expandable member 34b adjacent contact surface 46 . in an alternative embodiment shown in fig5 a , rib 19 bifurcates guide wire support 18 to form openings 53a and 53b . opening 53b is bonded over tube 50 to secure guide wire support 18 to distal end 48 ; opening 53a provides a guide wire passage for insertion and free longitudinal movement of a guide wire external to catheter 10 . in another alternative embodiment shown in fig5 b , guide wire support 18 includes support tube 55 , which is bonded within opening 52 by adhesive 57 . support tube 55 provides structural stability to the connection of guide wire support 18 while also providing a passageway for a guide wire . guide wire 58 is longer than catheter 10 and generally extends from distal end 48 of composite balloon 16 , external to composite balloon 16 and catheter shaft 14 , to a point proximal of manifold 12 . guide wire 58 includes distal spring tip 58a , which has sufficient flexibility to facilitate advancement of guide wire 58 through the tortuous curves of an artery , to and across a stenosis of the artery . with guide wire 58 in place within an artery , catheter 10 can be easily advanced over the guide wire 58 to the stenosis . in addition , the location of guide wire 58 external to catheter 10 permits rapid exchange of composite balloon 16 with guide wire 58 remaining in place within the artery across the stenosis . fig3 is a longitudinal sectional view of composite balloon 16 which best shows its bilateral symmetry . first expandable member 34a and second expandable member 34b have generally identical , mirror image contours along the length of composite balloon 16 . proximal ends 60a , 60b of proximal sections 38a , 38b are generally aligned and include openings 62a , 62b , respectively . as shown in fig3 and 4 , proximal ends 60a , 60b of proximal sections 38a , 38b are inserted side - by - side into flared distal end 24 of distal shaft section 30 and sealed therein by bond 64 . with distal ends 60a , 60b secured within flared distal end 24 , openings 62a , 62b communicate with shaft lumen 26 . openings 62a , 62b further communicate with interiors 66a , 66b of first and second expandable members 34a , 34b . included within interiors 66a , 66b of first and second expandable members 34a , 34b are support members 54a , 54b . as shown in fig3 and 5 - 5b , the distal - most end of support members 54a , 54b are positioned within distal ends 70a , 70b of distal sections 42a , 42b and secured therein by any suitable adhesive material . distal ends 70a , 70b , which have a combined outer diameter larger than the unexpanded inner diameter of tube 50 , are generally aligned , and are joined and sealed together by coating distal ends 70a , 70b with an adhesive material and inserting them within tube 50 while it is expanded . tube 50 is allowed to constrict around distal ends 70a , 70b to provide a fluid tight seal at distal end 48 of composite balloon 16 , thereby permitting expansion of first and second expandable members 34a , 34b when fluid pressure is provided through lumen 26 of shaft 14 . constriction of tube 50 around distal ends 70a , 70b also aids in retaining the distal - most end of support members 54a , 54b within distal ends 70a , 70b at distal end 48 of composite balloon 16 . positioned within first expandable member 34a on support member 68a is marker band 76 . marker band 76 is made of radiopaque material , as is well known in the art , which permits a physician to monitor the advancement and positioning of composite balloon 16 . as shown in fig3 and 3a , support members 54a , 54b extend proximally through interior 66a , 66b of first and second expandable members 34a , 34b , out openings 62a , 62b and within lumen 26 to junction 32 . the proximal - most ends of support members 54a , 54b are then secured by either bonding or brazing to proximal end 74 of proximal shaft section 28 . as further shown in fig3 a , distal shaft section 30 is positioned over distal end 74 of proximal shaft section 28 at junction 32 and secured by bond 75 to effect a fluid - tight connection between proximal shaft section 28 and distal shaft section 30 . fig6 is a cross - sectional view of the composite balloon of fig2 taken along lines 6 -- 6 and shown inflated and positioned within artery 80 . under fluid pressure , expandable members 34a , 34b inflate causing outer surfaces 44a , 44b to make contact at contact surface 46 . expansion of interiors 66a , 66b under fluid pressure cause outer surfaces 44a , 44b to contact and expand artery wall 82 and press lesion 84 into artery wall 82 . the interaction of outer surfaces 44a , 44b adjacent to contact surface 46 also forms sinus 86 and sinus 88 , which allow passive perfusion of blood through artery 80 during prolonged inflation of composite balloon 16 . in addition to permitting passive perfusion of blood , sinus 86 also accommodates guide wire 58 . guide wire 58 is capable of moving freely through sinus 86 without completely obstructing the passive flow of blood through sinus 86 . fig6 a shows composite balloon 16 of fig6 with sheath 90 surrounding outer surfaces 44a , 44b . sheath 90 is made of a flexible material which conforms to the general shape of composite balloon 16 when first and second inflatable members 34a , 34b are inflated . sheath 90 has an outer surface 92 which contacts artery wall 82 of artery 80 , and presses lesion 84 into artery wall 82 when composite balloon 16 is inflated . when sheath 90 is used over composite balloon 16 , sinus 86 is formed by the interaction of outer surfaces 44a , 44b , contact surface 46 and inner surface 94 of sheath 90 . in those embodiments in which it is used , sheath 90 is preferably bonded to exterior surfaces 44a , 44b of composite balloon 16 . fig7 shows an enlarged prospective view of a second embodiment of composite balloon 16 of the present invention . this second embodiment is similar to the embodiment shown in fig1 - 6a with one exception : secondary guide wire support 100 is secured over shaft 14 near flared distal end 24 . secondary guide wire support 100 , which is configured similar to guide wire support 18 , has an inner diameter which is larger than an outer diameter of distal shaft section 30 , thereby creating secondary guide wire passage 102 . secondary guide wire support 100 can also be configured similar to the alternative embodiments shown in fig5 a and 5b . secondary guide wire support 100 is bonded to distal shaft section 30 and oriented such that secondary guide wire passage 102 is generally aligned with opening 52 of guide wire support 18 . the inner diameter of secondary guide wire support 100 is also slightly larger than an outer diameter of flared distal end 24 so as to permit composite balloon 16 to move freely over guide wire 58 when guide wire 58 is inserted through secondary guide wire passage 102 and opening 52 . with guide wire 58 inserted in this manner , advancement of composite balloon 16 over guide wire 58 is facilitated by having two spaced apart points of support . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize that changes may be made in form and detail without departing from the spirit and scope of the invention .

US-44208195-A