Datasets:

tharindu

/

patents

like 0

a method and a device for effecting the cordless retraction of the gingival sulcus tissue prior to the taking of an impression of a tooth for making a crown or bridge which is attained by controlling any bleeding in the gingival sulcus area , and utilizing a dental dam preferably formed of a sponge or foam like material to contain an astringent fortified silicone impression material embedded about the prepared tooth , and using the patient &# 39 ; s biting force to apply the necessary pressure onto the dam until the silicone impression material sets and adheres to the dam to enhance easy removal of the set impression material from the tooth . the dam is formed to accommodate either the posterior teeth or the anterior teeth .

referring to the drawings , there is shown a tooth 20 which has been prepared for receiving a crown or bridge . however , before the impression can be taken for preparing the crown or bridge , it is imperative that the gingival sulcus tissue 21 be retracted in order for the dentist to make an accurate impression of the prepared tooth 20 . in accordance with this invention and to control any excessive gingival bleeding , an application of a liquid hemostatic agent 22 , e . g . aluminum chloride , ferric sulfate or other suitable astringent is applied to the cut tissue in the area of the gingival sulcus . the astringent can be applied with centrix &# 39 ; s benda micro applicator 23 as seen in fig1 , or by any other suitable applicator , e . g . centrix , inc .&# 39 ; s benda ® brush , softstix ™ disposable applicator , or syringe , and the like . the astringent 22 is applied with moderate pressure and by rubbing the astringent solution against the cut tissue to infuse the astringent solution into the cut capillaries . after the bleeding is under control , a dam 24 is adjusted and fitted to the prepared tooth 20 and to at least one tooth mescal and distal beyond the prepared tooth or teeth 20 . in accordance with this invention , the dam 24 is formed of a porous foam or sponge type material which may be either natural or synthetic . the dam 24 , as shown in fig4 , is formed for use on posterior teeth . as shown , the dam 24 may be formed as an elongated block of a sponge , foam , or other type of porous material . it will be understood that the block of foam or sponge may be of any desired length from which the dentist may sever therefrom the desired length necessary to dam one or more teeth being worked upon . conversely , the dam 24 may be pre - cut to size , depending upon the number of teeth that may require gum retraction and to which the finished crown or bridge is to be applied . as seen in fig4 , the foam or sponge dam 24 is provided with a longitudinally u - shaped groove or trough 24 a extending along the length thereof . the respective opposed side walls 24 b and 24 c and interconnected web or bottom 24 d , as shown in fig4 , are sufficiently thick to contain and exert the necessary pressure to effect the gum tissue retraction as will be herein described . fig7 illustrates a modified block of sponge or foam material from which a modified dam construction for use with anterior teeth is formed , as will be hereinafter described . after the bleeding of the gum tissue to be retracted is controlled , the groove 24 a of an appropriate size dam 24 is filled with a hereinbefore described fortified silicone type impression material 26 , as shown in fig2 . the silicone material 26 may comprise a two - part composition which includes a base portion and a catalyst portion which , when mixed , will quickly set and become solid . the time of setting can be varied within a predetermined time range by controlling the ratio of catalyst to base . such silicones are available from various manufacturers , e . g . conquest by pentron , exaflex by g . c ., extrude by kerr corporation or impress and express by 3m corporation . while the silicone materials are preferred , other materials such as polyethers , polysulfides and any other dental moldable materials may be used . the condensation silicone materials are preferred . the silicone material 26 is further fortified with between five percent ( 5 %) to twenty percent ( 20 %) by weight of a suitable astringent to aid in the gum tissue retraction and hemostasis . any of the known astringents may be used which are rendered compatible with the silicone . some of the known astringents or hemostasis agents are aluminum potassium sulfate , aluminum sulfate , or alum , ferric sulfate , aluminum ammonionium sulfate , ferric chloride , aluminum chloride , sodium chloride , zinc chloride and others . the same silicone material is also applied about the gingival sulcus area as shown in fig3 , preferably by syringing . the entire prepared tooth 20 is then covered with the same silicone material as shown in fig4 . it will be understood that the step of applying the silicone material to the dam 24 or about the tooth as shown in fig3 and 4 can be reversed . with the tooth covered with the silicone material 26 , and with the groove 24 a of the dam 24 filled with the same silicone material , the silicone - filled dam 24 is placed onto the silicone covered tooth , as best seen in fig5 . with the filled dam 24 disposed over the silicone covered tooth or teeth , the patient is instructed to apply a biting force or pressure onto the dam 22 as shown in fig5 , and to maintain the biting pressure on the dam 24 until such time that the silicone material sets , approximately 5 to 7 minutes . upon setting of the silicone material , the dam 24 and the set moldable material is removed to expose the prepared tooth as shown in fig6 . as the dam 24 is formed of a porous or foam sponge - like material , the silicone material , upon setting , will penetrate the pores of the foam material , causing the set silicone material to mechanically adhere to the dam 24 whereby the set silicone material can be removed in unison upon the removal of the dam 24 . the tooth may then be lightly washed , dried and examined to determine if the gum tissue has been sufficiently retracted so as to enable an accurate impression to be made . the bite pressure imparted by the patient onto the dam 24 as seen in fig5 , causes the silicone impression material to be forced into the gingival sulcus space , which together with the interaction of the astringent material causes the gum tissue in the gingival sulcus area to retract to enlarge the space 27 between the tooth and surrounding gum tissue as noted in fig6 . in the event additional retraction of the gum tissue is required , the procedure hereinabove described may be repeated . while the sponge or foam dams 24 , as described herein , are preferred , it will be understood that other means may be used in lieu of the foam or sponge dams , e . g . a cotton roll or hollowed cotton gauze or pad , or other suitable material capable of containing the silicone , astringent based , material when the biting pressure is applied and maintained . the use of the biting pressure on the dam 24 causes the silicone material containing the astringent material to be forced onto the gingival sulcus space , causing the gum tissue to be retracted an amount sufficient to permit an accurate tooth impression to be made for making a crown or bridge . while the method described is in reference to retracting the gum tissue of a posterior tooth , the same method is applicable for retracting the gum tissue of an anterior tooth . however , for an anterior gum retraction , the dam is preferably constructed with a v - shaped groove , as in fig7 . referring to fig7 , an anterior dam 28 may be severed from an elongated block 29 of foam or sponge like material similar to that hereinbefore described , except the groove 30 is generally v - shaped as shown in fig7 . the opposed sides of the v - shaped groove 30 converge inwardly of the foam or sponge block . in all other respects , the construction of dam 28 and the use thereof is similar to that described with respect to the construction and use of dam 24 . it will be understood that the foam material , from which the described dams are made , may be formed of open or closed cells , natural or synthetic foam or sponge . the method described and the dam for effecting the same is relatively simple , expedient and results in a positive retraction of the gum tissue so as to ensure that all margins can be captured in a subsequent impression procedure . the described invention further reduces the trauma and discomfort often encountered by the patient in a gum retraction procedure . also , the present invention provides enhanced results with much greater ease on the part of the dentist . the procedure is rendered so simple that it can be delegated to a dental assistant . while the preferred embodiments of the present invention have been illustrated and described , it will be obvious to those skilled in the art that various modifications may be made without departing from the spirit and scope of this invention .

US-30769502-A

a method of obtaining beneficial biological results associated with caloric restriction may be gained by administration of a composition containing at least one active agent which blocks metabolism of glucose as a source of energy in cells in glucose metabolism blocking effective amounts to an animal in need thereof .

it is the purpose of this invention to provide benefits associated with caloric restriction by controlled administration of antimetabolites of glucose . judicious use of compounds that block the normal metabolism of cellular glucose can result in changes in physiological function that are similar to those arising from caloric restriction . the compounds and compositions used in accord with the teachings herein often lower body temperature . such lowering of body temperature and slowing of the rate of metabolism in the tissues often is beneficial in treatment of trauma and in other treatment modalities where decrease in metabolic rate is desirable . two related aspects must be addressed . glucose is used by cells both as an energy source ( catabolic mode ) and for incorporation into other compounds ( anabolic mode ). inhibition or interference with anabolic uses of glucose should be avoided , since this may lead to production of anomalous glycoproteins and glycolipids and eventually to undesired side effects . it should be noted that various non - nutritious sweet compounds ( some of them carbohydrates ) have been suggested as agents to reduce obesity based on the theory that , if these compounds can not be a source of energy , caloric intake may be reduced . the instant invention does not relate simply to agents that lack nutritional value . these prior art agents that have been used simply to avoid / treat obesity perform a different function and do not provide the benefits sought in the practice of the instant invention . to fully mimic the beneficial effects of caloric restriction , it is necessary that glucose anti - metabolites be given over an extended time period . previous studies clearly show that it is not possible to administer compounds such as 2 - deoxy - d - glucose in high doses , since significant untoward side effects and toxicity have often been observed . however , studies in rodents ( lane et al ., j . anti - aging med . 1 ( 4 ): 327 - 337 , 1998 ) have shown that long - term disruption of glucose metabolism using a lower dose of 2 deoxy - d - glucose can mimic some of the major metabolic hallmarks of caloric restriction , including reduced body temperature , weight loss , and lower fasting insulin levels . in light of the above potential physiologic benefits of caloric restriction weighed against the negative aspects of metabolic inhibition by 2 - deoxy - d - glucose , alternatives which act as antimetabolites of glucose without the potentially harmful side effects are preferred for purposes of practicing the invention . 5 - thioglucose , an analog of glucose , has ( in vivo ) more pronounced effects than 2 - deoxy - d - glucose . the compound is believed to act mainly by inhibiting glucose uptake by cells . the majority of 5 - thioglucose ( 97 %) injected into a rat has been found excreted unchanged in urine ( hoffman et al ., biochemistry 7 , pp 4479 - 4483 ( 1968 )). 5 - thioglucose is remarkably non - toxic ; ld 50 was measured to be 14 g / kg , by injection , in rats ( chen et al ., arch . biochem . biophys ., 169 , pp 392 - 396 ( 1975 )). since 5 - thioglucose seems to be excreted unchanged in urine , this compound presents certain advantages for chronic administration over 2 - deoxy - d - glucose . nevertheless , since 5 - thioglucose inhibits glucose uptake , appropriate dosing can result in benefits associated with caloric restriction . this analog of glucose , in contrast with 2 - deoxy - d - glucose , is not metabolized ( jay et al ., j . neurochem . 55 , pp . 989 - 1000 ( 1990 )) and , thus may provide certain advantages for use in chronic administration . in the context of this invention , 3 - o - methylglucose can prevent utilization of glucose as an energy source as demonstrated by response to its administration in rats . the responses were about seven times weaker than those to 2 - deoxyglucose . this compound is a non - reducing analog of glucose and is enzymatically converted to 1 , 5 - anhydroglucitol - 6 - phosphate , albeit the conversion is less efficient than that of 2 - deoxyglucose ( sols et al ., j . biol . chem ., 210 , pp 581 - 595 ( 1954 )). 1 , 5 - anhydroglucitol - 6 - phosphate is an allosteric ( non - competitive ) inhibitor of hexokinase , which catalyzes the first and the regulatory step of the entire glycolysis ( crane et al ., j . biol . chem ., 210 , pp . 597 - 696 ( 1954 )). furthermore 1 , 5 anhydroglucitol - 6 - phosphate is a non - reducing analog and cannot be a substrate for the next step of glycolysis catalyzed by glucose 6 - phosphate isomerase . consequently , this analog could accumulate in cells and act as a very effective metabolic block to glucose utilization . another advantage relating to its non - reducing character is that this compound cannot be incorporated into glycolipids , glycoproteins and glycogen . thus , its effects are specific to glycolysis and would not be expected to affect other metabolic processes or exert toxicity of some glucose anti - metabolites previously discussed . interestingly , this compound ( or its phosphate ) has been found in the human body . it would found to be present in cerebrospinal fluid of patients who had occasional high blood glucose ( from diabetes and diseases of kidney ) in large enough concentrations to be detected in tests performed in normal clinical settings . these compounds are non - reducing analogs of fructose . fructose is an important component of food and fructose phosphates and diphosphate are intermediate products of glycolysis . nevertheless , inhibition of metabolic events involving fructose and its phosphates by anhydrosugar analogs is difficult . alpha and beta anomers of fructose , which spontaneously inter - convert , correspond to different anhydrosugars , to 2 , 5 - anhydroglucitol and 2 , 5 - anhydromannitol , respectively . thus , only a few of the enzymatic conversions can be inhibited by a single compound . the 2 , 5 - anhydromannitol has been investigated in some detail . that compound is taken up by cells and converted into 2 , 5 - anhydromannitol - 1 - phosphate . that phosphate is an analog of fructose - 1 - phosphate , but can not be cleaved by the aldolase and , therefore , the utilization of both glucose and fructose by cells is blocked . the 2 , 5 ,- anhydromannitol had been found to interfere in glucose formation and utilization in isolated rat hepatocytes ( riquelme et al ., proc . natl . acad . sci . usa , 80 , pp 431 - 435 ( 1983 )). mannoheptulose is present in reasonable amounts in some foods ( e . g . some avocados contain up to 5 % of the wet weight ) and can be classified as a “ generally recognized as safe ” substance for the human consumption . in studies of metabolism , 10 grams of mannoheptulose have been safely administered to humans orally . about 5 % of the mannoheptulose ingested was reported to appear in urine after oral dosing . the fate of injected mannoheptulose has previously been investigated in rats : 66 % was excreted unchanged , 29 % was metabolized , and , a day after the injection , 5 % remained in the body ( simon et al ., arch . biochem . biophys ., 69 , pp . 592 - 601 ( 1957 )). fresh avocadoes ( lula variety ) were obtained from fresh king incorporated ( homestead , fla .). the avocados were manually split open and the pits were removed and discarded . the remaining skin and pulp were ground through a hobart commercial food preparation machine ( serial # 11 - 10410235 ) using a 12¼ sieve . the ground avocado was then transferred to an edwards freeze drier ( super modulyo model , crawely , sussex , england ). the freeze drier was set at − 20 ° c . for the first 24 hours , − 5 ° c . for the following 24 hours and 5 ° c . for the final 72 hours . upon removal from the freeze drier , the meal was ground to a powder using a straub grinding mill ( model 4e , philadelphia , pa .). the avocado meal was analyzed and found to contain 10 . 35 % mannoheptulose . ( it should be noted that the amount of mannoheptulose found in avocados various with the particular strain , some avocados having little or no mannoheptulose .) the use of mannoheptulose for purposes of obtaining benefits associated with inhibiting metabolism of glucose was tested in beagle dogs . a total of 12 beagles were utilized for the study and were fed a standard commercial diet throughout the study period . fasting blood samples were drawn 7 , 6 , 4 , and 2 days prior to administration of mannoheptulose . the mannoheptulose was delivered to the dogs in the form of a freeze - dried avocado meal containing 10 to 12 % mannoheptulose . this preparation was adjusted to provide mannoheptulose doses of 2 , 20 and 200 mg / kg body weight ( mh - 2 , mh - 20 , mh - 200 , respectively ). fasting blood samples were collected 1 , 3 , 5 and 7 days after initiation of the administration of mannoheptulose . insulin levels were lowered by up to 35 % in dogs who had received the avocado meal when compared to those dogs on similar diets who had not received meal with their diets . those changes were similar to the decreases found in mammals on caloric restricted diets . in contrast , plasma glucose concentrations of dogs fed the same standard diet which did not contain the avocado meal did not show such effects . the mechanism by which insulin is reduced relates to the fact that glucose must be metabolized by the pancreas to stimulate insulin secretion ( german et al ., proc . nat . acad . sci . 90 : 1781 - 1785 . 1993 ). mannoheptulose is thought to inhibit glucokinase , the initial enzyme involved in glucose metabolism in pancreas and liver . therefore , reduced insulin levels indicate that mannoheptulose has indeed inhibited glucose metabolism . this effect on glucokinase by mannoheptulose would indicate use of mannoheptulose directed at inhibition of tumor growth as an alternative to administration of 2 - deoxy - d - glucose . ( see board , m ., et al ., cancer res . 55 ( 15 ): 3278 - 3285 . 1995 .) mannoheptulose would present a safe alternative to 2 - deoxy - d - glucose , since it would avoid some untoward effects seen when 2 - deoxy - d - glucose is administered on a long - term basis . the availability of glucose to cells can also be decreased using other dietary supplements than those specifically identified herein which have similar effect on metabolism of glucose that can result in an inhibition of glucose processing . the methods of the invention may be practiced by administering the active agents orally or parenterally , though oral administration would be the norm . when lowering of tissue metabolism is desired , as an adjunct to treatment of trauma , the active agents may be administered intravenously . dosage will depend on the agent used and will vary depending on the extent of lowering of tissue metabolism that is desired and the size and condition of the animal to which the agent is to be administered . dosage in the range of 0 . 001 g / kg to about 1 g / kg would be suggested . dosage at the lower range would be appropriate when using 2 - deoxy - d - glucose in large mammals . higher dosage , particularly of compounds such as 5 - thio - d - glucose or mannitol should be readily tolerated . the dimensions and values disclosed herein are not to be understood as being strictly limited to the exact numerical values recited . instead , unless otherwise specified , each such dimension is intended to mean both the recited value and a functionally equivalent range surrounding that value . for example , a dimension disclosed as “ 40 mm ” is intended to mean “ about 40 mm .” all documents cited in the detailed description of the invention are , in relevant part , incorporated herein by reference ; the citation of any document is not to be construed as an admission that it is prior art with respect to the present invention . to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference , the meaning or definition assigned to the term in this document shall govern . while particular embodiments of the present invention have been illustrated and described , it would be obvious to those skilled in the art that various other changes and modifications can be made without departing from the spirit and scope of the invention . it is therefore intended to cover in the appended claims all such changes and modifications that are within the scope of this invention .

US-8271008-A

a mallet style golf club with a novel head design consists of solid materials laminated or inlaid horizontally to yield a single surface alignment aid on the surface that strikes the golf ball . optional alignment markings on the top surface of the club , centered over the point on the face where there is minimal torque when the head strikes the golf ball , combine with the single surface alignment aid on the face to form a single surface two - dimensional alignment system . an inlaid or laminated line on the circumference of the mallet joins the inlaid or laminated horizontal line on the front face to form a visually perceived 360 degree , three dimensional alignment aid . the resilient nature of the solid materials used for the preferred embodiment imparts a softer “ feel ” to the golfer , reduces skid of the ball after the ball is struck , and produces a light - weight club , allowing the golfer to use a fuller complete stroke for each putt , thereby improving precision and accuracy from putt to putt . the sole of the club head is curved upward from the center of the head toward the heel and toe to decrease friction and resistance from contact with the grass or ground as the putter head swings away from and through the ball during the putting stroke . lead or alloy weights may be added through a cavity to optimize the weight and balance . milling the face improves the contact point between the face and the golf ball .

fig1 illustrates a mallet style golf club having a shaft 10 with a gripping portion 12 attached to one end of the shaft using adhesive or other means known to those skilled in the art and are as such considered to be within the purview of the present invention . at the other end of the shaft is the mallet style golf head 2 through 6 which is attached using adhesive or other means known to those skilled in the art and are as such also considered to be within the purview of the present invention . in the preferred embodiment ( putter ), a cavity is drilled / carved into the top of the putter head , near the face , between the sweet spot and the heel of the putter head to accommodate the external diameter of a shaft . the cavity in the preferred embodiment ( putter ) is drilled / carved from the top into the middle of the putter head to create an angle of lie for the shaft that measures 68 ° to 76 ° from the heel - toe horizontal plane that is tangential to the top of the putter head . fig2 through fig6 illustrate a preferred embodiment of a mallet style golf head ( putter ) 2 though 6 of the present invention which has an object , among others , the design of a 360 degree , three - dimensional single surface alignment system for putting . prior art contains markings on top of club heads which enable the golfer to align the hand position and club face position using parallax . other prior art is available with grooves , engraving , and / or applied markings on the face of the putter head which allow the golfer to “ line - up ” a putt . in these inventions , the integrity of the putter face is in some way violated , which can affect the true point of contact between the ball and the club face . such violations in integrity can produce laterally deflected rebounding forces causing the ball to deflect off the true line of the putt , thereby negating any benefit of an alignment system on the face of the putter head . the single surface one , two or three dimensional alignment system of the present invention maximizes the potential for proper alignment of the shot yet minimizes the chances for the shot to be deflected because of any irregularities on the face of the putter head . fig2 shows a preferred embodiment of the formation of the single surface three - dimensional alignment system 2 , 4 , 6 , 8 . while not illustrated , any means of assembly of contrasting colored pieces 2 , 4 , 6 of the same material to create a horizontal line on the face of the putter may be employed within the spirit of the present invention . in the preferred embodiment , the putter head may be manufactured by joining two or more pieces of the same material using epoxy or any bonding material that is compatible with the material used for the putter head . optional placement of an alignment line 8 on the top of the putter head , over the “ sweet spot ” by any known means may be considered within the scope of the present invention . in the preferred embodiment , lines and holes are drilled / carved on top of the putter head over the “ sweet spot .” the cavities are filled with a material that is compatible with the material in the putter head , can be inlaid into the cavities in the putter head , creates a contrasting color with the top of the putter head , and does not distort the overall shape of the putter head . fig2 also shows a preferred embodiment of the putter head with an arcuate curvature of the sole . this arcuate shape allows the golfer to adjust the hand position at address to the ball to a flatter or more upright position without increasing the area of contact between the sole of the putter head and the putting surface . minimizing this contact area reduces the amount of drag or resistance if the golfer hits a “ fat shot ” ( a fat shot is when the club hits or brushes the ground behind the ball before impact ). also , the arcuate shape provides similar benefits to the golfer when the ball may be putted but lies in taller grass surrounding the green ( the “ fringe ”). in the preferred embodiment , the arcuate shape is formed through cutting , milling , sanding or molding the bottom component of the putter head to the specified number of degrees measured from the bottom center to the heel and to the toe of the putter head . fig3 demonstrates the principle of the 360 degree , three - dimensional alignment system in the preferred embodiment whereby the top alignment line 8 forms a visually perceived 90 ° angle with the thin visible horizontal contrasting line 4 on the face when the putter head is positioned correctly at the address of the golf ball . in addition , the thin visible line 4 is visually perceived around the circumference of the putter head when the eyes are positioned correctly at the address of the golf ball . the correct positioning of the putter head is thus provided on three planes : ( 1 ) top alignment line 8 perceived at a 90 ° angle to ( 2 ) contrasting line 4 on the face and ( 3 ) the perception of a thin contrasting line 4 continuing around the circumference of the putter head , intersecting with thin line 4 on the face forming the 360 degree component of the alignment system . the visibility of the thin horizontal line 4 on the face is due to the loft of the club face . the visibility of the continuation of the thin line 4 around the remainder of the putter head is due to an angle cut around the top circumference of the club . the perceived intersection of the face and circumference thin line 4 gives the 360 degree component of the alignment system . these two concepts illustrating the angles to form line 4 are shown for the preferred embodiment in fig6 . fig4 and 5 show the design , placement , and outward appearance of the cavity for weight insertion for the preferred embodiment . although not illustrated , a cavity for weight insertion , created using any means , is considered within the scope of the present invention . in the preferred embodiment , the cavity is created on the bottom of the putter head by drilling / carving an inner core for insertion of a molten liquid alloy ( of greater density than the material used for the putter head ) used to add additional mass to the putter head . proximal to the surface of the bottom of the putter head , a larger diameter / width cavity with a depth that is sufficient to accommodate a cover and seal for the weight cavity is drilled / carved in a position to the original cavity that creates concentricity . small capillary type cavities are drilled / carved in a radial direction to the original cavity to allow a molten liquid alloy to form an anchor within the subject cavity upon solidification . the purpose of optimizing weight is to keep the putter head at a mass that imparts a good roll to the ball yet is not so heavy as to make the golfer execute too short a back swing or grip the club too tightly . either or both actions result in incomplete strokes or putts that are too forceful . although not illustrated , the preferred embodiment ( putter ) of the club head is made with a methyl methacrylate monomer and aluminum trihydrate by dupont corian ®. this material imparts a “ softer feel ” than metal but has sufficient hardness to create a roll to the ball that has minimal skidding at impact . reducing skid allows the ball to better roll on line toward the target . prior art includes nonmetal materials , such as graphite , ceramics , and corian ; however , these materials have not been manufactured into a design that provides a single surface facial alignment system or a 360 degree , three dimensional alignment system . the preferred embodiment ( putter ) of the present invention combines a single material 360 degree , three dimensional alignment system , weight optimization , reduced putter head putting surface contact ( reduced potential for drag ), and a nonmetal material in the putter head . these attributes produce a putter head and putter that offer the golfer the optimal conditions to aim , align , and execute an on line shot . these attributes also enable the golfer to utilize a longer back stroke on both long and short ( less than three feet ) putts , which allows for a pendulum - like stroke , enhances putting accuracy , and results in fewer putting strokes per round of golf . for other mallet style clubs , the present invention describes a combining of similar composition materials ( e . g . metal , wood , composites ) to form a 360 degree , three dimensional alignment system . this alignment attribute enables the golfer to position hands and eyes ( which impact head and body position ) over the ball and receive immediate feedback if either is not properly positioned . this present invention , therefore , relates to a mallet golf head comprising a club - head body having a front face ; a top ; a bottom or sole ; a heel ; a toe ; and a rear wherein the front face has a ball striking surface with at least one visible horizontal element aligned in the center of the front face to form a single surface alignment aid and wherein the top has a shaft - receiver cavity between the sweet spot and the heel . the invention further relates to a mallet style golf head wherein the club - head body comprises a metallic or nonmetallic material . the present invention further comprises a putter head wherein the club - head body consists essentially of a synthetic polymeric material selected from corian ® ( methyl mathacrylate monomer and aluminum trihydrate ) from dupont , or a similar synthetic solid acrylic polymer materials such as those available from formica , nevamar , or wilsonart . the invention further relates to a mallet style golf head wherein at least two pieces of a nonmetallic solid material wherein said pieces form a visible horizontal line element in the center of the front face to form the single - surface alignment aid . the invention further comprises a mallet style golf head wherein the club - head body comprises three joined layers of a nonmetallic solid material , wherein the center layer of the three joined layers is the visible horizontal element aligned in the center of the front face to form the single - surface alignment aid . the invention further relates to a mallet style club head wherein the club - head body comprises three joined layers of a nonmetallic solid material , wherein the nonmetallic material is selected from corian ® and further wherein said center layer is the visible horizontal element aligned in the center of the front face and said layer is a different color than the first or third layer to form the single - surface alignment aid . the invention further relates to a mallet style golf head wherein the top of the club head body contains an optional inlaid line at a 90 ° angle to the single surface alignment aid on the front face , and in combination with said single surface alignment aid , forms a two dimensional alignment system . the invention further relates to a mallet golf style golf head wherein there is an inlaid or laminated line joining the laminated or inlaid horizontal line on the front face and continuing around the circumference of the club forming a visually perceived 360 degree , three dimensional alignment aid . the invention further relates to a mallet style golf head comprising a cavity on a nonstriking surface of the putter head wherein said cavity permits addition of a weight which adds additional mass to the club head . the present invention , therefore , relates to a mallet style golf club comprising a club shaft selected from stainless steel , graphite , aluminum , wood , or titanium and gripping portion selected from leather , cork , rubber , or usga conforming grip material at one end of said shaft ; a mallet head attached to the other end of said shaft via a shaft receiver cavity on the head wherein the head comprises a club - head body having a front - face ball striking surface , a top ; a sole ; a heel ; a toe ; and a rear , wherein the front face has at least one visible horizontal element aligned in the center of the front face to form a single surface alignment aid and further wherein the top may optionally contain an inlaid line formed at a 90 ° angle to the horizontal alignment aid to form , in combination with said horizontal alignment aid , a two dimensional alignment system , and wherein the circumference of the mallet has an inlaid or laminated line that connects with the visible inlaid or laminated horizontal line on the front face thereby creating a visually perceived 360 degree , three dimensional alignment aid . the invention further relates to a mallet style golf club wherein the head comprises a metallic or nonmetallic solid material . the invention further comprises a mallet style golf club wherein the nonmetallic material is selected from corian ® ( methyl methacrylate monomer and aluminum trihydrate ) from dupont or similar synthetic solid polymer materials from formica , nevamar , or wilsonart . the invention further relates to a mallet style golf club wherein the club - head body comprises at least two attached pieces of a nonmetallic solid material wherein , for the two pieces , the horizontal line formed between the two attached pieces forms the visible horizontal element aligned in the center of the front face to form the single surface alignment aid , and the inlaid or laminated line on the circumference of the mallet joins the inlaid or laminated horizontal line on the front face to form the visually perceived 360 degree , three dimensional alignment aid . the invention further relates to a mallet style golf club wherein the putter head may optionally contain a cavity on a nonstriking surface wherein said cavity permits addition of a weight which adds additional mass to the club head . the invention further relates to a mallet style golf club wherein the club - head sole may be curved to form an arcuate shape from the bottom center of the head to the bottom of the toe and to the bottom of the heel of the putter head and the arcuate shape is less that or equal to 15 ° from the horizontal plane tangential to the bottom center the head to the bottom of the heel and toe but is greater than zero degrees . the invention further relates to a mallet style golf club wherein the angle of the front - face striking surface of the club - head from the sole to the top of the head ( loft ) is greater than or equal to two degrees and less than or equal to 65 degrees . the invention further relates to a mallet style golf head wherein the front - face striking surface of the club - head is milled . the present invention , therefore , relates to a method of silk touch ™ alignment whereas the method comprises utilizing a mallet golf club comprised of a club shaft selected from stainless steel , graphite , aluminum , wood , or titanium and gripping portion selected from leather , cork , rubber , or usga conforming grip material at one end of said shaft ; a mallet style club head attached to the other end of said shaft via a shaft receiver cavity on the club head wherein the putter head comprises a club - head body having a front - face ball striking surface , a top ; a sole ; a heel ; a toe ; and a rear , wherein the front face has at least one visible horizontal element aligned in the center of the front face to form a single surface alignment aid and further wherein the top may optionally contain an inlaid line formed at a 90 ° angle to the horizontal alignment aid to form , in combination with said horizontal alignment aid , a two dimensional alignment system to increase alignment precision and accuracy , and the inlaid or laminated line on the circumference of the mallet joins the inlaid or laminated horizontal line on the front face to form a visually perceived 360 degree three dimensional alignment aid . the present invention further relates to a method of silk touch ™ alignment , wherein the mallet style club head comprises a nonmetallic solid material . the present invention further relates to a method of silk touch ™ alignment , wherein said non - metallic material is selected from corian ®. this invention has been described in detail and refers to a preferred embodiment ( putter ), but it will be understood that various other modifications may be effected by the spirit and scope of this invention ,

US-23669999-A

a method and apparatus for selectively flexibly retaining a plurality of distinct containers for transport , the containers being of an non - predetermined size and shape , the method and apparatus allowing containers to be added or removed at the discretion of the user , and the containers being retained by engagement with and deformation of the carrier .

the present invention , shown in various figures , is a carrier 110 for transporting a plurality of containers 122 , 124 by placing the containers 122 , 124 on the base 116 and extending the handles 118 , 120 upwardly to deformably engage the periphery of the containers 122 , 124 and form a unitary handle for ease of transport . the present invention restricts the movement of the containers 122 , 124 with respect to each other and with respect to the carrier 110 . fig1 shows a preferred embodiment of the carrier 110 . the carrier 110 consists of a first and second annular rings 112 , 114 having a joined together part or base 116 and a separated part of the first and second annular rings 112 , 114 forming first and second handles 118 , 120 . the stretched diameter of the openings in annular rings 112 , 114 is between a quarter of the diameter of the goods to be carried and eight times the diameter of the goods to be carried and preferably is between half the diameter of the goods to be carried and between three times the diameter of the goods to be carried with a most preferred length of twenty - seven inches . the width of handles 118 , 120 when laid flat ( not in z - fold ) is between 3 / 8 inch and thirty inches and preferably is between one inch and between twenty - four inches with a most preferred width of six inches . fig2 shows the carrier 110 loaded with two containers 122 , 124 and prepared for use . the first container 122 has been placed on the base 116 supporting the first container 122 which in turn , supports the second container 124 . the carrier 110 annular rings 112 , 114 have been extended upwardly to frictionally engage the first container 122 and the second container 124 retaining the containers 122 , 124 in a relatively fixed position with respect to the base 116 . the carrier 110 is constructed from a thin flexible material , such as plastic or any other suitable material . while the carrier 110 could be constructed of paper , or other non - elastic material , it is , however , preferred that the construction material have some elasticity so that the carrier 110 will deform to better cradle the containers 122 , 124 and return to its previous size and shape . the elasticity of the carrier 110 further provides for a more conforming engagement between the carrier 110 and the containers 122 , 124 being carried . the plastic for construction of the carrier 110 is selected based on the cost and physical properties of the plastic , for example , flexibility , modulus of stretching , tear strength , etc . cosmetic properties of the carrier 110 plastic may include color and texture . it is preferred that the plastic selected for the carrier 110 is recyclable such as a group 4 ldpe type plastic . the carrier 110 can be constructed from sections sliced from a tube , slicing partially through to bifurcate the tube and form the handles 118 , 120 of the carrier 110 . with this construction , however , each annular ring 112 , 114 is then a single thickness or material which when of the proper strength and elasticity will form a carrier 110 , but , the single thickness of material through the handles 118 , 120 have been found to be less comfortable for the user . preferably , the carrier 110 is constructed from two panels 130 , of the type shown in fig4 . each of the panels 130 can then be formed from a continuous sheet of plastic , or other suitable substance and each panel 130 partially slit to form the two half handles 132 , 134 . two of the panels 130 can then be joined together at their respective base ends 144 and half handle ends 140 , 142 to form a completed carrier . the panels 130 may be joined together by any suitable means that preferably forms a continuous seam , such as , heat sealing , adhesives , sewing , or less desirably metallic fasteners . when the panels 130 are constructed from a preferred plastic film , the plastic can be selected to be readily heat sealable to provide for convenient and rapid construction . when constructed of a thin plastic , the carrier 110 would require inconveniently wide handles 118 , 120 , to provide sufficient strength to carry an average load of containers 122 , 124 . however , to overcome this limitation of materials , the half handles 132 , 134 are each preferably folded into a &# 34 ; z &# 34 ; fold to increase the strength while not increasing the actual width of the half handle 132 , 134 . by varying the width of the &# 34 ; z &# 34 ; fold 138 , the strength and deformability of the handle 118 , 120 can be varied to suit the needs of the particular usage . the &# 34 ; z &# 34 ; fold 138 in the half handles 132 , 134 in addition to increasing the strength provides for a thicker more comfortable handle for the user . the &# 34 ; z &# 34 ; folds 138 when engaging the sides of the containers 122 , 124 can stretch and deform to more closely approximate the size and shape of the containers 122 , 124 . while the width of the &# 34 ; z &# 34 ; fold 138 can vary within a wide range , it has been found that the preferred size of the &# 34 ; z &# 34 ; fold 138 is to reduce the width of the of the half handle 132 , 134 to slightly more than one half of its unfolded width . this provides the maximum increase in strength while also providing six layers in the handle area to increase the comfort to the user and minimizing tearing of the handle 118 , 120 when used . when the preferred carrier 110 is constructed from panels 130 , the pair of previously &# 34 ; z &# 34 ; folded panels 130 are joined at their respective base ends 144 by overlapping the base ends 144 of a first panel 130 and a second panel 130 and heat sealed across the width of the base ends 144 to form the base 116 . similarly , the half handle ends 140 , 142 of the first panel 130 are overlapped on the half handle ends 140 , 142 of a second panel 130 and heat sealed across the respective widths of the half handle ends 140 , 142 to form the handles 118 , 120 . when constructed in this manner , the &# 34 ; z &# 34 ; fold of the panels 130 is also heat sealed in place . heat sealing is well known in the art of plastic fabrication and is commonly performed by passing the layers of plastic film to be sealed between rollers heated to a suitable temperature . the heated rollers partially melt the plastic film and fuse the multiple layers into one piece . the rollers may be plain or corrugate to emboss a pattern upon the sealed area . in its use , after a consumer has selected and paid for his selections and the selections placed in containers 122 , 124 of conventional design , a carrier 110 is taken from storage and placed on a convenient surface . the first container 122 is thence placed overlying the base 116 of the carrier 110 , a second container 124 may then be placed atop the first container 122 , additional containers 122 may also be added to the stack of containers . the handles 118 , 120 are then lifted to engage the periphery of the containers 122 , 124 and brought together forming a singular handle which may be grasped by the consumer to carry the carrier 110 and its contents . when needed , the containers 122 , 124 may be shifted or rotated so that they are more convenient to carry in the carrier 110 . should the consumer purchase additional goods , additional containers 124 may be added to the carrier 110 without disturbing its functionality . should the consumer have an oddly shaped container or have difficulty carrying the carrier 110 , the containers 122 , 124 can be rearranged so that a plurality of vertices of the containers 122 , 124 are engaged by the handles 118 , 120 of the carrier 110 . when so engaged , the &# 34 ; z &# 34 ; fold 138 of the respective handles 118 , 120 deforms to retain the vertex of the container 122 so that the container 122 does not shift and can be easily transported to another location . after the consumer has transported the containers 122 , 124 to the desired location , the containers 122 , 124 can be removed from the carrier 110 and used or stored . the carrier 110 having served its purpose may now be disposed of , but , it is preferred that the carrier 110 is retained for reuse or recycling . although the present invention has been described with reference to preferred embodiments , workers skilled in the art will recognize changes may be made in form and detail without departing from the spirit and scope of the invention .

US-6173898-A

an introducer sheath has multiple distal slots allowing for translation of a catheter within a cardiac cavity . a pair of longitudinal slots are provided on opposite sides of the sheath near the distal end . a portion of the catheter may deploy from one of the slots while the ablation tip deploys from the opposing slot . the sheath design provides greater maneuverability for the catheter in a direction orthogonal to the tissue to be ablated , while restricting lateral movement of the catheter . the longitudinal direction of the slots further aids in the formation of linear lesions using the catheter .

several embodiments of an endocardial ablation system 2 , including an ablation catheter 4 with an armature - type suspension system , an introducer sheath 6 , and an ablation electrode 8 , according to the present invention is depicted in the figures . as described further below , the endocardial ablation system 2 of the present invention provides a number of advantages , including , for example , mitigating electrode - tissue contact problems . the suspension system of the ablation catheter 4 facilitates enhanced tissue contact in difficult environments ( e . g ., during ablation of a contoured or trabecular surface on a beating heart ), whether creating a spot lesion or a continuous linear lesion , by facilitating contact of the ablation electrode 8 with surface contours of endocardial tissue . this is particularly useful for treatment of atrial flutter where it is desirable to create a linear lesion along the trabecular slope of the isthmus between the ostium of the inferior vena cava and the tricuspid valve in the right atrium . fig1 is an isometric view of one embodiment of a catheter 4 , emerging from a sheath 6 that has been cut away , with an ablation electrode 8 attached to the distal end of the catheter 4 . ( as used herein , “ proximal ” refers to a direction away from the body of a patient and toward the clinician . in contrast , “ distal ” as used herein refers to a direction toward the body of a patient and away from the clinician .) the catheter 4 , sheath 6 , and ablation electrode 8 together form the endocardial ablation system 2 depicted in detail fig5 - 9 . the catheter 4 is designed for insertion within a main lumen 10 of the sheath 6 ( see fig3 ). axiomatically , the diameter of the main lumen 10 is sized to accommodate the outer diameter of the catheter 4 . as shown in fig2 , the catheter 4 is a component - built catheter , in this embodiment divided into three sections , a proximal section 14 , a suspension section 16 , and a distal section 18 . the suspension section 16 is located between the proximal section 14 and the distal section 18 . in this embodiment , both the proximal section 14 and the distal section 18 are of a more rigid construction than the suspension section 16 , which is comparatively pliant . while more rigid than the suspension section 16 , the proximal section 14 and the distal section 18 may each have different levels of stiffness or rigidity . in other embodiments it may be desirable to include additional component sections of varying degrees of rigidity depending upon the need of the procedure to be performed . for example , a distal tip of the distal section 18 might be formed of a soft or pliable material to minimize abrasion of the endocardial tissue . if desirable , certain of the component sections may be formed with curved shapes to assist the placement of the catheter 4 based upon the anatomy of the heart . for example , as shown in fig2 , the distal section 18 has a slight curve at its proximal end . the suspension section 16 may also have a curve to initiate the orientation of the distal section 18 of the catheter 4 out of the lower port 28 . the arc or radius of curvature of a particular section may be selected to allow the catheter 4 to appropriately “ fit ” in various sizes of heart cavities , to position the catheter 4 with respect to a particular tissue location for ablation application , or to orient the attached ablation electrode 8 at a particular angle or direction . however , each of the sections of the catheter 4 is pliant compared to the sheath 6 and , when introduced into the sheath 6 , each of the sections of the catheter 4 is constrained by the sheath 6 and conforms to the orientation of the sheath 6 . as shown in fig2 , the catheter 4 may be formed from sections of different materials . fig1 and 12 depict one exemplary embodiment for forming such a component catheter . the catheter wall 44 may be formed of several layers of materials to ultimately create a composite structure . in the embodiment of fig1 and 12 the catheter wall is composed of an inner tube 70 of plastic , which is initially surrounded by a cylindrical braid 72 of metal fibers , for example , stainless steel fibers . the metallic braid 72 is included in the catheter wall 44 to add stability to the catheter 4 and also to resist radial forces that might crush the catheter 4 . the metallic braid 72 also provides a framework to translate torsional forces imparted by the clinician on the proximal section 14 to the distal end to rotate the catheter 4 for appropriate orientation of the ablation electrode 8 . the choice of a flat , angled braid pattern for the metallic braid 72 as depicted adds hoop strength to the catheter 4 without impacting the flexibility of the catheter 4 . based upon the exemplary configuration of fig2 , three collinear sections of equal diameter plastic tubing abutted together surround the metallic braid 72 . a first tube 74 is composed of a first plastic material , a second tube 76 is composed of a second plastic material , and a third tube 78 is composed of a third plastic material . the component plastic sections of the catheter wall 44 may be composed , for example , of pebax ® resins ( autofina chemicals , inc ., philadelphia , pa . ), or other polyether - block co - polyamide polymers , wherein different formulas are used to create the desired material stiffness within each section of the catheter 44 . these sections of different material enable the catheter 16 to have , for example , different mechanical properties ( e . g ., flexibility ) at different locations along the catheter shaft . for example , the proximal section 14 of the catheter wall 44 may be formed by the first tube 74 having a relatively stiffer material formulation than the suspension section 16 , allowing for greater transfer of control exerted at the proximal end of the catheter 4 to the distal end . the suspension section 16 may be formed by the second tube 76 having a relatively more pliant material formulation than the first tube 74 of the proximal section 14 to provide a level of suspension to the distal tip 18 as further described below . the distal section 18 may be formed by the third tube 78 having a relatively more rigid material formulation to create greater stiffness than the suspension section 16 as well to provide appropriate support to the ablation electrode 8 . the inner tube 70 is generally chosen to have a relatively pliant material formulation . in an exemplary embodiment , the first tube 74 may have a hardness of 72 shore a , the second tube may have a hardness of 55 shore a , the third tube may have a hardness of 65 shore a , and the inner tube may have a hardness of 40 shore a . the distal section 18 may further be composed of a radiopaque marker to allow a clinician to visualize the position of the tip of the catheter 4 in the heart . once the appropriate material qualities of the plastic for each of the inner , first , second , and third tubes 70 , 74 , 46 , 48 are chosen , the catheter wall 44 can be fabricated . as previously described , the inner tube 70 is first surrounded by the metallic braid 72 . the first , second , and third tubes 74 , 76 , 78 are then placed around the metallic braid 72 and are abutted together , end - to - end . the first , second , and third tubes 74 , 76 , 78 may then be covered by a shrink wrap tube ( not shown ), if desired , to maintain the close abutment between the adjacent ends of the first , second , and third tubes 74 , 76 , 78 . the layered structure of the inner tube 70 , the metallic braid 72 , the first , second , and third tubes 74 , 76 , 78 , and the shrink wrap is then heated to a temperature at which the plastic materials composing each of the inner , first , second , and third tubes 70 , 74 , 76 , 78 begins to melt . the plastic of the inner tube 70 flows through the interstices of the metallic braid 72 from the inside . similarly , the plastic of the first , second , and third tubes 74 , 76 , 78 flows through the interstices of the metallic braid 72 from the outside . in this manner , the inner tube 70 is welded to the first , second , and third tubes 74 , 76 , 78 and the metallic braid 72 is encapsulated between them to form the catheter wall 44 as shown in fig1 . similarly , the adjacent ends of the first tube 74 and second tube 76 are welded together and the adjacent ends of the second tube 76 and the third tube 78 are welded together . if the shrink wrap tube is used , it encapsulates the entire catheter wall 44 of the component catheter 4 . as indicated above , the various sections of the catheter 4 may be provided with preset curves . such curvature can be imparted to the catheter 4 , for example , by placing a mandrel of a desired form in the catheter 4 and thermally setting the desired curvature to the catheter wall 44 . although the catheter wall 44 depicted in the figures ( and as shown in cross - section in fig1 ) has a circular cross section , the cross - section of the catheter wall 44 may be other than circular . the introducer sheath 6 may similarly be composed of several component sections of different materials as indicated in fig3 and 4 . a proximal portion 20 of the sheath 6 is connected with a spanning member 22 , which is in turn connected with an anchor member 24 , which forms the distal end of the sheath 6 . similar to the catheter 4 , the proximal portion 20 and the anchor member 24 may be composed , for example , of pebax ® resins . in this application , the hardness of the plastic formulations may be greater than that of the catheter 4 in order to guide the catheter 4 within the main lumen 10 and anchor lumen 12 of the sheath 6 . the proximal portion 20 and the anchor member 24 may be of the same or different material formulations with similar or different hardness measurements depending upon the needs of the particular procedure to be performed . the spanning member 22 may be composed of a stiffer material than both the proximal portion 20 and the anchor member 24 of the sheath 6 in order to maintain the integrity of the sheath 6 . two opposing linear slots are formed in the wall of the spanning section 22 of the sheath 6 to create the upper port 26 and the lower port 28 . the linear slots may be between 2 and 4 cm in length . in one exemplary embodiment , these linear slots may each be about 3 cm in length . the formation of such linear slots in the sheath 6 weakens the wall of the sheath 6 because of the significant amount of material removed from the spanning member 22 . in order to provide adequate strength , the spanning member 22 may be composed , for example , of a stainless steel tube covered with an aseptic plastic , with an arc - shaped length of material removed on opposite sides of the tube . these arc shaped lengths form the upper port 26 and the lower port 28 , respectively , which are defined along the length by thin rectangular walls of remaining material . in alternate embodiments , the upper port 26 may be longer that the lower port 28 or vice versa . the proximal and distal ends of these rectangular walls are integral with tubular caps , which are attached to the proximal portion 20 of the sheath 6 on the proximal end and the anchor member 24 on the distal end . the increased structural rigidity of the spanning member 22 facilitates the stability of the sheath 6 to act as a platform for deployment of the catheter 4 from the upper port 26 and lower port 28 . in an alternate embodiment , the spanning member 22 may be formed of a shape - memory metal in order to provide sufficient tensile strength and alternately flexibility to negotiate the vasculature to reach the heart and enter an atrial chamber . for example , nitinol , a nickel - titanium ( niti ) alloy with shape - memory properties may be used for the spanning member 22 . shape - memory metals , such as nitinol are materials that have been plastically deformed to a desired shape before use . then upon heat application , either from the body as the catheter is inserted into the vasculature or from external sources , the fixation element is caused to assume its original shape before being plastically deformed . nitinol and other shape - memory alloys are able to undergo a “ martensitic ” phase transformation that enables them to switch from a “ temporary ” shape to a “ parent ” shape at temperatures above a transition temperature . below that temperature , the alloy can be bent into various shapes . holding a sample in position in a particular parent shape while heating it to a high temperature programs the alloy to remember the parent shape . upon cooling , the alloy adopts its temporary shape , but when heated again above the transition temperature the alloy automatically reverts to its parent shape . alternately , or in addition , shape - memory materials may also be super elastic — able to sustain a large deformation at a constant temperature — and when the deforming force is released they return to their original undeformed shape . common formulas of nitinol have transformation temperatures ranging between − 100 and + 110 ° c ., have great shape - memory strain , are thermally stable , and have excellent corrosion resistance , which make nitinol exemplary for use in medical devices for insertion into a patient . for example , the spanning section 22 may be designed using nitinol with a transition temperature around or below room temperature . before use the sheath 6 is stored in a low - temperature state . by flushing the sheath 6 with chilled saline solution , the nitinol spanning section 22 can be kept in its deformed state while positioning the sheath 6 at the desire site . when appropriately positioned , the flow of chilled saline solution can be stopped and the sheath 6 warmed by body heat , or warm saline can be substituted to allow the nitinol to recover its “ preprogrammed ” shape . the anchor member 24 extends distally beyond the spanning member 22 . increased stiffness of the anchor member 24 also helps provide increased structural integrity of the sheath 6 . the anchor member 24 may be pressed or anchored against tissue in a cavity of the heart , for example , an atrium wall 56 as shown in fig1 - 15 , to help stabilize the endocardial ablation system 2 while the heart is beating . the anchor member 24 may be composed of a polymer of greater hardness and / or stiffness than the proximal portion 20 of the sheath 6 or it may even be composed of stainless steel or another suitable material to provide the desired rigidity and structural integrity . the anchor member 24 may terminate with an atraumatic distal tip 58 of a softer material to mitigate possible damage to the atrial wall 56 . the distal tip 58 of the anchor member may further have a radiopaque marker to help in identifying the location of the distal end of the sheath 6 during a procedure . in the particular embodiment of fig1 , and 6 - 10 , a brush electrode 8 is depicted as the ablation electrode 8 . a continuous linear lesion 54 ( as shown in fig1 - 14 ) is able to be formed because of the superior ability of the filaments 40 of the brush electrode 8 to maintain contact with the tissue 52 and to transfer ablative energy to the tissue 52 . in an alternative embodiment , for example , as shown in fig1 , the catheter 4 may incorporate a ball electrode 8 ′ as the ablation electrode . although not as capable of conforming to trabecular surfaces as the brush electrode 8 , the ball electrode 8 ′ may be desired for use in certain circumstances for creating spot ablations . other electrode tips known in the industry may alternately be used if so desired . the novel brush electrode 8 of the type depicted in fig1 and 6 - 10 was originally disclosed in u . s . patent application ser . no . 10 / 808 , 919 filed 24 mar . 2004 , entitled brush electrode and method for ablation , which is hereby incorporated by reference in its entirety as though fully set forth herein . as shown in greater detail in fig7 - 10 , the brush electrode 8 may be composed of a plurality of filaments 40 , either conductive or nonconductive , arranged in a bundle and protruding from the distal section 18 of the catheter 4 . such a flexible brush electrode 8 provides enhanced tissue contact , particularly for use on contoured or trabecular surfaces . the filaments 40 may be constructed from a variety of different materials , including nonconductive materials , semi - conductive materials , and conductive materials . for example , the filaments 40 may be formed from metal fibers , metal plated fibers , carbon compound fibers , and other materials . very thin , carbon fibers may be used . relatively thicker but less conductive thunderon ® acrylic fibers ( nihon sanmo dyeing company ltd ., kyoto , japan ) may also be used for the brush electrode filaments 40 . nylon fibers coated with conductive material may also be used . filaments 40 constructed from metal plated fibers , like coated nylon fibers , may comprise flattened areas around their outer surfaces , resulting in the filaments 40 having noncircular cross - sectional shapes . the brush filaments 40 may be insulated from each other , or they may be in electrical contact with each other . conductive or nonconductive fluids may flow interstitially between and among the filaments 40 themselves or along the outer surface of the filaments 40 . an embedded portion 48 of the filaments 40 forming the brush electrode 8 may be contained within the catheter lumen 30 at the distal tip 18 of the catheter 4 while an exposed portion 46 may extend distally from the distal tip 18 . the exposed portion 46 of the brush electrode 8 may project a few millimeters from the distal tip 18 of the catheter 4 . the distance that the exposed portion 46 of the brush electrode 8 extends from the distal tip 18 of the catheter 18 varies depending upon a number of factors including the composition of the filaments 40 comprising the brush electrode 8 and the particular area to be treated with the brush electrode 8 . the distal tip 18 of the catheter 4 may itself be conductive or nonconductive . fig7 is a cross - section view of the ablation system 2 as shown in fig5 with the catheter 4 and the brush electrode 8 contained within the main lumen 10 and anchor lumen 12 of the sheath 6 . fig9 is similarly a cross - section view of the ablation system 2 as shown in fig6 , in this instance with the catheter 4 and the brush electrode 8 unfurling from the lower port 28 and upper port 26 of the sheath 6 . as depicted in fig7 and 9 , the catheter houses a conductor 32 having an insulated portion 34 and an uninsulated portion 36 that carries ablative energy ( e . g ., radio frequency current ) from an energy source in a controller ( not shown ) to the brush electrode 8 . the conductor 32 extends within the catheter lumen 30 along a longitudinal axis of the catheter 4 . the conductor 32 may comprise , for example , insulated copper wire with an uninsulated portion 36 in electrical contact with the brush electrode 8 . in this embodiment , the uninsulated portion 36 of the conductor 32 is formed or tied in a loop or noose 38 around the embedded portion 48 of the filaments 40 of the brush electrode 8 , as shown to better advantage in fig8 and 10 . at the loop or noose 38 , ablative energy is transferred from the conductor 32 to the conductive filaments 40 of the brush electrode 8 . in this embodiment , the uninsulated portion 36 of the primary conductor 32 is connected to the embedded portion 48 of the brush electrode 8 so that the connection between the conductor 32 and the brush electrode 8 is protected within the catheter wall 44 . a lead 42 may extend substantially parallel to the conductor 32 . a distal end of the lead 42 is embedded with the filaments 40 comprising the brush electrode 8 , as shown in fig8 and 10 . the lead 60 , when present , may be operatively connected to a sensor embedded in the brush electrode 8 ( e . g ., a thermal sensor , an ultrasound sensor , or a pressure sensor ). fig1 is an enlarged view of the circled region of fig9 . as shown in fig1 , the brush electrode 8 may have a relatively flat working surface 50 at the distal end 32 of the brush electrode 8 . in other words , in this depicted embodiment , all of the filaments 40 comprising the brush electrode 8 extend approximately the same distance from the distal section 18 of the catheter 4 . thus , the brush tip provides a relatively flat working surface 50 comprising the longitudinal ends of the filaments 40 . the catheter wall 44 of the distal section 18 of the catheter 4 provides mechanical support for the filaments 40 and may also provide electrical shielding . the filaments 40 may alternatively be trimmed to provide a variety of configurations and shapes for the working surface 30 of the brush electrode 8 , which may provide advantages for special applications of the brush electrode 8 . for example , a blade - shape may be formed by creating an edge of longer filaments of the brush electrode 8 resulting in a line of contact with the tissue . alternatively , the brush electrode 8 may have a wedge - shaped working surface 50 to facilitate angular placement and increase the area of the working surface 50 . this configuration may be advantageous for point applications of ablative energy . as another example , the working surface 50 of the brush electrode 8 may have a concave portion or channel , which may be beneficial for wrap - around applications and provide advantages when ablating curved surfaces like the outer surface of a blood vessel . alternatively , the working surface 50 of the brush electrode 8 may have a convex , trough - shaped tip , which may be beneficial , for example , when reaching into troughs or depressions on a contoured surface . the working surface 50 of the brush electrode 8 may also be domed , hemispherical , a frustum , or conical , coming nearly to a point at the most distal end of the brush electrode 8 , with its longest filaments 40 proximal to the longitudinal axis of the catheter 4 . the brush electrode 8 is depicted in many of the drawings with a circular cross section , but it may have different cross - sectional configurations . in one embodiment , conductive or nonconductive fluid may flow through the catheter lumen 30 from a fluid source ( e . g ., a pump and reservoir in a controller ) to the brush electrode 8 . when the fluid flows through the brush electrode 8 , it creates a wet - brush electrode in which impinging jets of fluid traveling interstitially impact the tissue 52 at an interface between the tissue 52 and the brush electrode 8 to help control temperature changes at the interface . when using conductive fluid and either conductive or nonconductive filaments 40 , the brush electrode 8 may act as a virtual electrode . if there is no direct contact between conductive filaments and the tissue 52 , or the filaments 40 are entirely nonconductive , the conductive fluid flowing through the catheter lumen 30 makes the electrical contact at the interface between the brush electrode 8 and the tissue 52 . the brush electrode 8 according to the present invention delivers ablative energy to the tissue via the conductive filaments 40 alone , via the conductive fluid alone , or via both the conductive filaments 40 and the conductive fluid . in the latter two configurations , the brush electrode 8 is referred to as a wet - brush electrode . since it is possible for the conductive fluid to escape from the exposed portion of the wet - brush electrode before reaching the working surface 50 at the distal tip of the wet - brush electrode , there is some ablative energy leakage to the surrounding blood . the leakage of ablative energy to the surrounding blood is in part due to direct contact between the blood and the conductive filaments and in part due to the conductive fluid escaping between the filaments 40 to the surrounding blood , particularly when substantial splaying of the filaments 40 occurs . as the catheter 4 is further deployed from the sheath 6 , the curved section 16 continues to furl and also translates linearly in the direction of the anchor member 58 as indicated by comparison of the positions of the catheter 4 in each of fig9 - 11 . the deployment of the catheter 4 maintains the distal tip 18 and the attached ablation electrode 8 in contact with the trabecular slope 26 of the isthmus 24 . the creation of a linear lesion 54 in the tissue 52 of the isthmus 64 of the right atrium 60 is depicted schematically in fig1 and 14 . in this procedure , a linear series of ablation lesions is created from the annulus of the tricuspid valve 28 to the inferior vena cava 22 in the isthmus 24 of the right atrial tissue 52 bordering the eustachian ridge . this isthmus 24 of tissue is critical to the large right atrial reentrant circuit responsible for atrial flutter . the ablation lesions 54 damage atrial tissue 52 preventing the conduction of electrical impulses through the critical isthmus 24 . when the line of conduction block is complete , the atrial flutter circuit is shorted and the arrhythmia is cured . as shown in fig1 , the sheath 6 is positioned as desired in the heart , for example , in the right atrium 60 with the distal tip 58 of the anchor member 24 set securely against the atrial wall 56 . this placement of the sheath 6 fixes the position of the ablation system 2 and minimizes movement of the ablation system 2 with respect to the heart when the heart beats . a linear lesion 54 is initiated by the deployment of the catheter 4 from the lower port 62 of the sheath 6 . when moved proximally out of the anchor lumen 12 such that the ablation electrode 8 is between the spanning members 22 , the distal section 18 of the catheter 4 drops from the lower port 38 as the suspension section 16 is not rigid enough to support the distal section 18 . in addition , as described above , the suspension section 16 may also be formed with a preset curvature that directs the distal section out of the sheath 6 through the lower port 28 . the suspension section 14 bends to create a curved or angled relationship between the proximal section 14 and the distal section 18 . as the distal section 18 drops out of the lower port 28 of the sheath 6 , the ablation electrode 8 is oriented toward the sloped isthmus 24 and is placed in contact with the tissue 52 , initially on the isthmus 64 adjacent the tricuspid valve 68 . once the ablation electrode contacts the tissue 52 , the catheter 4 may further be pushed distally to orient the distal section 18 generally orthogonally to the tissue 52 . in order to achieve this orthogonal orientation , the suspension section 16 and the proximal end of the distal section 18 may push through the upper port 26 in the sheath 6 . because the suspension section 16 is of a relatively pliable construction , the suspension section 16 is able to bend easily to allow the distal section 18 to orient appropriately . by creating an orthogonal orientation , a greater surface area of the working surface 50 of the ablation electrode 8 is placed in contact with the tissue 52 . upon activation of a source of ablative energy connected with the ablation electrode 8 , the tissue 52 is necrotized and a lesion 54 is formed . as the catheter 4 is further manipulated . to create a linear lesion along the isthmus 64 of the right atrium 60 , the catheter 4 is further manipulated in a similar manner to both relocate the ablation electrode 8 along trabecular surface 36 of the isthmus 2 and maintain the orientation of the distal section 18 generally orthogonal to the tissue 52 . from the initial position the catheter 4 may be pulled proximally through the main lumen 10 . this movement relaxes the distal section 18 from the orthogonal position and increases the angle formed by the suspension section 16 between the proximal section 14 and the distal section 18 to generally “ flatten ” the catheter 4 . in this manner , the distal section 18 , and consequently the ablation electrode 8 , is pulled along the isthmus 64 . once moved proximally a small amount to reposition the ablation electrode 8 , the catheter 4 may then be moved distally within the main lumen 10 . the ablation electrode 8 interfaces with the tissue 52 to maintain its new position , thereby forcing the distal section 18 to again be pushed into a position generally orthogonal to the tissue 52 . the distal section 18 is able to return to an orthogonal position because of the flexibility of the suspension section 16 , which again forms a smaller angle between the proximal section 14 and the distal section 18 of the catheter 4 . this orthogonal orientation again increases the surface area contact of the working surface 50 of the ablation electrode 8 with respect to the tissue 52 . as the ablation electrode is moved along the trabecular slope 66 of the isthmus 64 , the distance between the sheath 6 and the tissue 52 decreases . however , the sheath 6 does not interfere with the placement of the ablation electrode 8 because the upper port 26 allows the suspension section 16 and the distal section 18 to extend above the sheath 6 as indicated in fig1 . the spanning members 22 further aid the positioning of the ablation electrode 8 by restricting lateral movement of the catheter 4 with respect to the sheath 6 . the pliability of the suspension section 16 acts as an armature - type suspension , allowing the ablation electrode 8 to easily follow the undulations of a trabecular surface . by maintaining a close interface between the ablation electrode 8 and the endocardial tissue 52 on the isthmus 64 along a linear path as shown in fig1 and 14 , a continuous linear lesion 54 may be created . in this manner , the endocardial ablation system 2 of the present invention provides a simple mechanism to direct an ablation electrode to treat a sloped trabecular surface 26 along the isthmus 24 between the inferior vena cava 62 and the tricuspid valve 68 in the right atrium 60 . the preset curves of the suspension section 16 and the distal section 18 maintain the orientation of the ablation electrode 8 toward the trabecular slope 66 . further , because of the pliability of the suspension section 16 , the distal section 18 may be oriented orthogonally to the isthmus 64 at any point along the trabecular slop 66 , regardless of the distance between the sheath 6 and the tissue 52 of the isthmus at a particular point . this allows the ablation catheter 8 to contact any portion of the trabecular slope 66 desired . this is achievable by merely introducing the catheter 4 into the right atrium 60 through the sheath 6 and manipulating the catheter 4 proximally and distally . thus , the endocardial ablation system 2 of the present invention is relatively easy for a clinician to use compared to the extensive training required to manipulate a steerable catheter or other similar device . alternatively , the ablation electrode may embody other electrode forms to achieve particular desired results . for example , fig1 depicts an embodiment of the present invention in which a ball electrode 8 ′ is integrated with the distal section 18 of the catheter 4 . a catheter 4 according to the present invention incorporating a ball electrode 8 ′ can similarly be manipulated in conjunction with the sheath 6 of the present invention to ablate tissue 52 and create a lesion 54 . different ablation electrodes in addition to the brush electrode 8 and ball electrode 8 ′ including , for example , virtual electrodes , may also be used depending upon the application or ablation effect desired . however , the advantages of the armature - type suspension system of the endocardial ablation system 2 of the present invention for maintaining tissue contact are applicable regardless of the electrode chosen for use . although various embodiments of this invention have been described above with a certain degree of particularity , or with reference to one or more individual embodiments , those skilled in the art could make numerous alterations to the disclosed embodiments without departing from the spirit or scope of this invention . it is intended that all matter contained in the above description and shown in the accompanying drawings shall be interpreted as illustrative only of particular embodiments and not limiting . all directional references ( e . g ., proximal , distal , upper , lower , upward , downward , left , right , lateral , front , back , top , bottom , above , below , vertical , horizontal , clockwise , and counterclockwise ) are only used for identification purposes to aid the reader &# 39 ; s understanding of the present invention , and do not create limitations , particularly as to the position , orientation , or use of the invention . connection references ( e . g ., attached , coupled , connected , and joined ) are to be construed broadly and may include intermediate members between a collection of elements and relative movement between elements unless otherwise indicated . as such , connection references do not necessarily infer that two elements are directly connected and in fixed relation to each other . it is intended that all matter contained in the above description or shown in the accompanying drawings shall be interpreted as illustrative only and not limiting . changes in detail or structure may be made without departing from the basic elements of the invention as defined in the following claims .

US-19055905-A

a suture display rack and procedure kit is provided which , upon folding , presents a plurality of stacked suture packages for seriatim review . the suture display rack is a substantially u - shaped structure with a floor portion and two opposing sidewall portions . a longitudinal fold line is provided in the floor portion parallel to the planes formed by the side walls such that , upon folding , the side wall portions may be brought into the same horizontal plane to form the base for the suture display rack . the suture packages may be loosely held in the rack or alternatively hinged to a side wall or contained in sheaths for ease of review and removal . the suture display rack may be securely adhered to a desired surface or may be set up in a portable manner .

referring now to the figures and , in particular to fig1 there is shown a suture display rack 20 in accordance with a preferred embodiment of the present invention . the suture display rack 20 contains a plurality of suture packages 22 serially stacked for easy access and review . in the embodiment of fig1 suture packages 22 are arranged in sheets 24 of four suture packages in side by side configuration . other arrangements are contemplated depending upon the surgical procedure , the packaging size , etc . the sheets 24 are presented to the user in angular form for ease of review of the individual suture packages . in the unfolded configuration , best seen in fig2 - 2a , the suture display rack comprises a substantially u - shaped container 26 having a horizontal floor portion 28 and two outwardly diverging side wall portions 30 . in a preferred embodiment shown in fig1 wherein suture packages are loosely stacked within the suture display rack , an inwardly converging flange portion 32 is formed at an end of the side wall portion 30 in order to prevent the stacked suture packages from sliding out and to maintain them in alignment when the suture display rack is set up . alternatively , the suture packages my be removably hinged to one of the diverging side wall potions as shown in fig2 - 5 . sheaths 36 ( fig6 ) also may b rotatably fixed to one of the diverging side walls to hold individual suture packages . these sheaths may be formed of a transparent or translucent plastic or paper material and may be color coded as desired . where either of these to alternate embodiments are used , the flange portion 32 may e eliminated . a fold line 34 is formed longitudinally along the floor portion 28 parallel to the planes formed by side wall portions 30 to facilitate bending of the suture display rack 20 . the storage rack is preferably formed from a moldable plastic material such as , for example , polyethylene terephthalate ( petg ), eastman kodak 6763 or other suitable material . during set up , the rack 20 is folded until the outwardly diverging side wall portions 30 are in substantially the same horizontal plane thus forming the floor portion 28 into a substantially triangular shape as shown in fig1 and 4 - 6 . in this folded configuration , side wall portions 30 form a stable base for the suture display rack 20 and the folded floor portion serves to support and present the suture packages in an organized and easily reviewable angled format . it - s readily apparent that the angled presentation of the suture packages is easily varied by increasing or decreasing the total angle of divergence 8 of side wall portions 30 within the range of 0 ° and 180 °, with 0 ° representing parallel sidewalls and 180 ° representing sidewalls in the same horizontal plane ( fig2 a ). the total angle of divergence 8 represents the sum of the radial angles of divergence α and β of side walls 30 from a plane perpendicular to floor portion 28 . referring to fig2 - 5 , there is shown a sequential storage and set up of a suture display rack in accordance with another preferred embodiment of the present invention . the unfolded suture display rack 20 , having a plurality of suture packages 22 removably hinged to side wall portion 30 , is stored within a procedure tray 38 . for convenience and ease of sterilization the loaded suture display rack is sealed within the procedure tray 38 by a cover sheet 40 constructed of a material which is pervious to ethylene oxide sterilizing gas . the preferred material is a spun bonded polyolefin , such as tyvek 1073b available from e . i . dupont de nemours & amp ; co . once the cover sheet 40 is peeled back , ( fig3 ) the suture display rack 20 is lifted ut and moved to a preferably sterile field at a desired location in the operating room . the suture display rack is folded downwardly along fold line 34 ( fig4 until side walls 30 are in substantially the same horizontal plane . adhering means , in this case two - way tape 42 , s positioned on the outer side of side walls 30 . when the desired location is selected , the backing of the tape 42 is removed and the suture display rack is firmly adhere ( fig5 ). alternatively , where a movable suture display rack is desired , locking means in the for of flap 44 ( fig6 ) is provided to interconnect and lock the opposing sides of the folded floor position 28 to hold the suture display rack in fixed orientation without the need for adhering means to fix the side walls 30 to a mounting location . in this embodiment the folded suture display rack may be moved from one location to another . referring to fig7 - 9 , another preferred embodiment of the suture display rack 46 is shown having an expanded capacity for storing and dislaying suture packages 47 in two suture containment levels . in the unfolded configuration , best seen in fig8 the suture display rack 46 comprises a container 48 having an upper containment level 50 and a lower containment level 52 formed therein . lower containment level 52 is at least partially defined by sidewall 54 , floor portion 56 and alignment walls 58 and 60 . upper containment level 5 is disposed above lower containment level 52 and is at least partially defined by sidewall 62 , support projection 64 and alignment walls 66 and 68 . as in previous embodiments , a fold line 70 is provided in floor portion 56 allowing sidewalls 54 and 62 to pivot . sidewalls 54 and 62 are preferably formed in a diverging configuration and , together act as a base for the display rack 46 in its folded position . see fig7 and 9 . a plurality of sheaths 72 are flexibly mounted in both upper and lower containment levels 50 and 52 in a substantially stacked horizontal configuration to facilitate efficient storage . referring to fig 10 - 11 , there is shown a preferred embodiment of the sheath 72 in accordance with the present invention . the sheath 72 comprises an elongated sheet of retaining material 74 , such s for example , paper , plastic , especially heat sealable plastic , etc ., which is folded in half around shaft 76 and bonded to form pockets 78 therein . in the embodiment shown in fig1 - 11 , the retaining material 74 is a heat sealable plastic and pockets 78 are formed by hear sealing opposing faces of the retaining material 74 along lines 80 substantially perpendicular to shaft 76 . using this fabrication method , sheaths 72 can be efficiently and ecomically produced . sheaths 72 may be mounted within upper and / or lower containment levels 50 and 52 using a variety of methods . as shown in fig1 , 13 and 14 , shafts 76 of sheaths 72 are inserted into bores 82 formed in alignment walls 58 , 60 , 66 and 68 respectively . alternatively , snap fit clips 84 may be formed in either he sidewalls 54 and 62 or alignment walls 58 , 60 , 66 and 68 to receive and retain shafts 76 of sheaths 72 . these clips 84 may be disposed on separate shelf structure 86 within the upper and lower containment levels 50 and 52 where desired . magnet bars 88 may be included as part of suture display rack 46 and are adapted to hod metallic elements such as , for example , used needles , clips , staples , etc . to facilitate accounting for such elements after surgery is completed . in the embodiment shown in fig7 - 9 , a magnet bar 88 is mounted on folding support structure 90 attached to sidewalls 54 and 62 . in the unfolded position ( fig8 ) support structure 90 is disposed over adjacent containment levels 50 and 52 and is substantially parallel to suture packages 47 in sheaths 72 for efficient storage . upon folding ( fig7 and 9 ) the support structure 90 pivots respectively about sidewalls 54 and 62 and lays flat on the supporting surface in the same horizontal plane as sidewalls 54 and 62 . in this position magnet bars 88 are presented for receiving and retaining metallic elements . in order to deploy this embodiment of the suture display rack into the folded position ( fig7 ), both sidewalls 54 and 62 are grasped and pivoted downward about fold line 70 . when both sidewalls 54 and 62 are in substantially the same horizontal plane , locking means are employed to maintain the rack in the folded position . in the embodiment shown in fig7 - 9 , a overcenter hinge 92 is provided adjacent to and transverse of fold line 70 . this hinge 92 is flexibly attached to alignment walls 58 and 66 and is adapted to flex to allow folding of sidewalls 54 and 62 and the thereafter maintain sufficient tension on alignment walls 58 and 66 to maintain the rack 46 in the folded position . referring now to fig1 - 14 , there is presented another preferred embodiment of the present invention . the embodiment of fig1 - 14 is substantially the same as that shown and described above with respect to fig7 - 9 with the exception that the suture packages 47 disposed in lower containment level 52 are adapted to b displayed in a plane substantially parallel to the display plane of the suture packages in upper containment level 50 and only a single magnet bar is used . this display orientation is accomplished in the present embodiment by lengthening sidewall 94 and providing enlarged alignment walls 96 and 98 adjacent sidewall 94 . support structure 100 is added to support the suture packages when the rack 102 is folded . sheaths 72 are positioned n bores 82 formed in alignment walls 96 , 98 , 66 and 68 respectively to receive shafts 76 therein . upon deployment from the folded position ( fig1 ) the suture packages 47 in lower containment level 52 are simply pivoted back about shafts 76 against support structure 100 to orient those packages in a plane substantially parallel to the display plane of the packages in the upper containment level . as in previously described embodiments , an overcenter hinge 92 is used as the lacking means to maintain sidewalls 94 and 62 in the desired base portion . alternatively , other locking or adhering means may be employed to maintain the display rack in the folded position including , but not limited to , two - way tape , locking tabs , etc . to the extent not already indicated , it also will be understood by those of ordinary sill in the art that any one of the various specific embodiments herein described and illustrated may be further modified t incorporate features shown in other of the specific embodiments . the invention in it broader aspects therefore is not limited to the specific embodiments herein shown and described but departures may be made therefrom within the scope of the accompanying claims without departing from the principles of the invention and without sacrificing its chief advantages .

US-62856790-A

an intraoperative tissue oximetry device includes a tissue marker that includes one or more pens or one or more similar ink sources , such that the tissue marker can mark tissue according to oxygen saturation measurements made by the tissue oximetry device , thereby visually delineating regions of potentially viable tissue from regions of potentially nonviable tissue .

the present invention relates generally to a tissue oximetry device for measuring oxygen saturation in a local tissue volume . more specifically , the present invention relates to a wireless , handheld , tissue oximetry device that has self - contained optics ( lights sources and detectors ), computer processing , a display , a power - supply , and a tissue marker for marking tissue as the tissue is probed by the self - contained optics . fig1 a and 1b are a simplified perspective view and a top view , respectively , of a tissue oximetry device 100 according to one embodiment . the figures show an enclosure or housing of an oximeter probe device . tissue oximetry device 100 is configured to make tissue oximetry measurements , such as intraoperatively and postoperatively . in an implementation , the tissue oximetry device is handheld device and can make tissue oximetry measurements and display these measurements , without needing to connect to another external component either via a cable or wirelessly . the electronics to make measurements and calculations is contained entirely within the housing of the tissue oximetry device . the device may be a standalone handheld tissue oximetry device , without a cable or wireless connection . tissue oximetry device 100 may be a handheld device that includes a tissue oximetry probe 115 ( also referred to as a sensor head ), which may be positioned at an end of a sensing arm 114 . tissue oximetry device 100 is configured to measure the oxygen saturation of tissue by emitting light , such as red and near - infrared light , from tissue oximetry probe 115 into tissue , and collecting light reflected from the tissue at the tissue oximetry probe . tissue oximetry device 100 may include a display 112 or other notification device ( e . g ., a speaker for audible notification ) that notifies a user of oxygen saturation values measured by the tissue oximetry device . while tissue oximetry probe 115 is described as being configured for use with tissue oximetry device 100 , which is a handheld device , tissue oximetry probe 115 may be used with other tissue oximetry devices , such as a modular tissue oximetry device where the tissue oximetry probe is at the end of a cable device that couples to a base unit . the cable device might be a disposable device that is configured for use with a single patient and the base unit might be a device that is configured for repeated use . such modular tissue oximetry devices are well understood by those of skill in the art and are not described further . tissue oximetry device 100 does not require a pulsing blood flow to make an oxygen saturation measurement as compared with pulse oximeters that require a pulsing blood flow to make such measurements . while the description of the example embodiments is directed toward tissue oximetry probes that do not require a pulsing blood flow for oxygen saturation measurements , embodiments of the present invention are not so limited and may be utilized with pulse oximeters . fig1 c is a block diagram that shows tissue oximetry device 100 in further detail according to one embodiment . the components of device 100 are contained in a single enclosure or housing . tissue oximetry device 100 may include display 112 , a processor 116 , a memory 117 , a speaker 118 ( described briefly above ), one or more input devices 119 ( e . g ., one or more switches , input buttons , keypad , display 112 , if for example , the display is a touch screen , or the like ), a set of light sources 120 , a set of detectors 125 , a power source 127 , and a tissue marker 130 . processor 116 may be a microcontroller , a microprocessor , control logic , a multicore processor , or the like , and may control the operation of light sources 120 and detectors 125 . processor 116 may also control the operation of tissue marker 130 . memory 117 may include a variety of memories , such as a volatile memory 117 a ( e . g ., a ram ), a nonvolatile memory 117 ( e . g ., a disk , flash , prom , or others ), or both . user input may be by way of the input devices 119 ( e . g ., switches , touchpad , or the like ). power source 127 can be a battery , such as a disposable battery . disposable batteries are discarded after their stored charge is expended . some disposable battery chemistry technologies include alkaline , zinc carbon , or silver oxide . the battery has sufficient stored charged to allow use of the tissue oximetry device for several hours . after use , the tissue oximetry device is discarded . in other implementations , the battery can also be rechargeable where the battery can be recharged multiple times after the stored charge is expended . some rechargeable battery chemistry technologies include nickel cadmium ( nicd ), nickel metal hydride ( nimh ), lithium ion ( li - ion ), and zinc air . the battery can be recharged , for example , via an ac adapter with cord that connects to the handheld unit . the circuitry in the tissue oximetry device can include a recharger circuit ( not shown ). batteries with rechargeable battery chemistry may be sometimes used as disposable batteries , where the batteries are not recharged but disposed of after use . aspects of the invention may include software executable code or firmware ( e . g ., code stored in a read only memory or rom chip ). the software executable code or firmware may embody algorithms used in making oxygen saturation measurements of the tissue . the software executable code or firmware may include code to implement a user interface by which a user uses the system , displays results on the display , and selects or specifies parameters that affect the operation of the system . the components may be linked together via a bus 128 , which may be the system bus architecture of tissue oximetry device 100 . although this figure shows one bus that connects to each component , the busing is illustrative of any interconnection scheme serving to link these components or other components included in tissue oximetry device 100 . for example , speaker 118 , according to one specific implementation , could be connected to a subsystem through a port or have an internal direct connection to processor 116 . the foregoing listed components may be housed in a mobile housing ( see fig1 a ) of tissue oximetry device 100 . however , different implementations of tissue oximetry device 100 may include alternative housing ( such as the cables and the base units of modular oximeters described briefly above ) and may include any number of the listed components , in any combination or configuration , and may also include other components not shown . fig2 a is a simplified end view of tissue oximetry probe 115 according to one embodiment . tissue oximetry probe 115 is configured to contact tissue ( e . g ., a patient &# 39 ; s skin ) for which a tissue oximetry measurement is to be made . tissue oximetry probe 115 includes the set of light sources 120 and the set of detectors 125 . the set of light sources 120 may include two or more light sources , such as light sources 120 a and 120 b . light sources 120 may be linearly positioned across tissue oximetry probe 115 and detectors 125 may be arranged in an arc or a circle ( i . e ., circular arrangement ) on the tissue oximetry probe . more specifically , light sources 120 may be arranged linearly , such as on a line ( e . g ., a diameter ) that bisects a circle on which detectors 125 may be arranged . the light sources 120 a and 120 b are spaced a distance d 1 apart where d 1 may range from about 3 millimeters to about 10 millimeters . that is , the circle on which detectors 125 are arranged may have a diameter of about 3 millimeters to about 10 millimeters ( e . g ., 4 millimeters according to one specific embodiment ). while detectors 125 are described as being arranged in an arc or circle , tissue oximetry device 100 may have other configurations of detectors , such as linear , square , rectangular , ovoid , pseudo - random , or others . propagation depth increases with increasing source - to - detector distance , with 4 - 5 millimeters generally being a sufficient upper limit between light sources 120 a and detectors 125 to ensure few detected photons propagated in lower tissue layers . for example , these distances between light sources 120 and detectors 125 limits reflectance data to light that propagated within the top layer of tissue where little or no underlying subcutaneous fat or muscular layers contributes to the reflectance data . the set of detectors 125 may include four or more detectors . according to a specific embodiment , the set of detectors 125 includes eight detectors 125 a , 125 b , 125 c , 125 d , 125 e , 125 f , 125 g , and 125 h as shown . detectors 125 are solid - state detectors and may be mounted to a pcb ( not shown ). further , detectors 125 may be combined devices or discrete devices . in a specific implementation , detectors 125 are positioned with respect to outer light sources 120 a and 120 c such that four or more ( e . g ., fourteen ) unique source - to - detector distances are created . with greater numbers of source - to - detector distances , this can be used to obtain greater accuracy , faster calibration , and redundancy ( when duplicate source - to - detector distances are provided ). at least two source - to - detectors distances are 1 . 5 millimeters or closer , and at least two more two source - to - detectors distances are 2 . 5 millimeters or farther . in other words , a first source - to - detector distance is about 1 . 5 millimeters or less . a second source - to - detector distance is about 1 . 5 millimeters or less . a third source - to - detector distance is about 2 . 5 millimeters or greater . a fourth source - to - detector distance is about 2 . 5 millimeters or greater . there can be various numbers of sources and detector arrangements to obtain these four source - to - detector distances , such as one source and four detectors , two sources and two detectors , one detector and four sources , or other arrangements and combinations . for example , an implementation includes at least two sources and at least two detectors , where a maximum distance between a source and a detector is about 4 millimeters ( or about 5 millimeters ). at least two source - to - detector are about 2 . 5 millimeters or greater . at least two source - to - detector distances are about 1 . 5 millimeters or less . when a greater number of sources and detectors are used , greater numbers of source - to - detector distances are available . as discussed , these can be used to provide greater accuracy , faster calibration , or redundancy , or a combination . the arrangement of the sources and detectors can be in circular pattern , such as at points along the arc of a circle with radius ( e . g ., 4 millimeters , or 5 millimeters ). in an implementation , a tolerance of the detector or source positions on the arc is within 10 microns of the arc curve . in other implementations , the tolerance is within about 0 . 25 millimeters . turning now to tissue marker 130 , tissue oximetry probe 115 includes at least a dispenser portion of tissue marker 130 . fig2 shows an end view of the dispenser that can dispense a marking material on a local tissue region ( e . g ., of an extended portion of tissue ) that has been probed by tissue oximetry device 100 . the location of the marking material on tissue allows a user to subsequently identify the particular , local tissue region that has been probed . the dispenser may be located at a variety positions on the face of tissue oximetry probe 115 . according to one specific embodiment , the dispenser is located between light sources 120 a and 120 b , and may be located at the approximate center of the circular arrangement of detectors 125 . with the dispenser at the approximate center of light sources 120 and detectors 125 , a mark made by the dispenser will be substantially at a center of the local tissue region that has been probed by tissue oximetry device 100 . with the mark at the center of the probed tissue region , the mark is not displaced from the location on the local tissue region probed . according to one implementation , tissue marker 130 includes one or more dispensers that may be located at different positions on the head of tissue oximetry probe 115 . fig2 b shows an embodiment where two dispensers are located “ outside ” of light sources 120 and detectors 125 . that is , the dispensers are located at the ends of radii that are longer than the radii of light sources 120 and detectors 125 . further , the dispensers may lie on a line that passes through the center of the circle of the circular arrangement of dispensers 125 . with the dispensers located along such a line , marks made by these dispensers allow a user to readily identify the region between the marks as the local tissue region that has been probed by tissue oximetry device 100 . while the dispensers shown in fig2 a and 2b are shown as relatively localized devices ( e . g ., pen , pens , inker , inkers , and the like ) that may be configured to mark tissue with relatively small marks ( e . g ., dots ), a dispenser may be an extended device configured to make an extended mark , such as a line . for example , a dispenser may be an extended device configured to mark tissue with a circle or other closed shape , or may mark tissue with an open shape , such as a u - shape , a v - shape , or others . the dispenser may be fixed within tissue oximetry probe 115 or may be configured to be lowered when tissue is marked . various mechanical or electromechanical devices may be utilized by tissue oximetry probe 115 for lowering the dispenser . such mechanical and electro - mechanical devices are well understood by those of skill in the art and are not described in detail herein . tissue marker 130 may mark tissue with a variety inks having a variety of colors , such as gentian violet , which is the tissue marking ink approved by the fda . variations in the gentian violet chemistry constituents can give different characteristics to the ink and cause changes in color or shade . any of these colors or shades of gentian violet may be utilized by tissue marker 130 . one or more of the ink colors utilized by tissue oximetry device 100 may indicate one or more oxygen saturation ranges . for example , tissue marker 130 might be configured to : ( i ) mark tissue with a first color of ink if the tissue &# 39 ; s oxygen saturation is at or below a first threshold , ( ii ) mark the tissue with a second color of ink if the tissue &# 39 ; s oxygen saturation is above the first threshold and at or below a second threshold , and ( iii ) mark the tissue with a third color of ink if the tissue &# 39 ; s oxygen saturation is above the second threshold . the foregoing example describes the use of three colors of ink for marking tissue for visually identifying three ranges of oxygen saturation , however more or fewer colors may be utilized by tissue marker 130 for identifying more or fewer oxygen saturation ranges . processor 116 may determine the oxygen saturation of a local tissue region based on an analysis of the reflection data that has been generated by detectors 125 , and may control tissue marker 130 to mark the local tissue region with a select color of ink that identifies the range that the oxygen saturation is within . tissue marker 130 may include a variety of devices that provide marking material having one or more colors , such as ink reservoirs , pens , or the like . u . s . patent application ser . no . 12 / 178 , 359 , filed jul . 23 , 2008 , of heaton , titled “ oximeter with marking feature ”, which is incorporated by reference in its entirety , describes a variety of devices that are configured for marking tissue with one or more colors of marking material . a reservoir of the marking device can be connected to the dispenser , such as through tubing or channels , and is contains ink or other fluid ( e . g ., ink ) dispensed through the dispenser . ink can be urged from the reservoir to and through the dispenser and deposited on skin through pressure or low - frequency sound ( such using a piezoelectric transducer ). the reservoir is contained within the same housing as the processor , battery , sources , detectors , and other components of the oximeter probe . for the disposable probe , the reservoir is not refillable . according to one alternative , tissue marker 130 , under control of processor 116 , marks tissue for one or more oxygen saturation ranges , but does not mark the tissue for one or more other oxygen saturation regions . for example , tissue marker 130 might mark a local tissue region if the oxygen saturation of the local tissue region is at or below a threshold level , or alternatively might not mark the local tissue region if the oxygen saturation level is above the threshold level . markings that are made on tissue according to the above method allow a user to relatively quickly identify tissue that might have a low chance of viability if the threshold level is relatively low . alternatively , tissue marker 130 might mark a local tissue region if the oxygen saturation of the local tissue region is at or above a threshold level , and might not mark the local tissue region if the oxygen saturation level is below the threshold level . marks made from this method allow a user to relatively quickly identify tissue that might have a relatively high chance of viability if the threshold level is relatively high . information for the foregoing described threshold levels ( i . e ., ranges ) may be stored in memory 117 and accessed by processor 116 for use . the threshold levels may be stored in memory 117 during manufacture of tissue oximetry device 100 , or may be stored in the memory thereafter . for example , tissue oximetry device 100 may be configured to receive a user input for one or more user defined threshold levels and store information for these threshold levels in memory 117 . one or more input devices 119 ( or the like ) may be configured to receive a user input for a user defined threshold level and for storing the user defined threshold level in memory 117 . fig2 c shows an implementation of the geometry of a tissue oximetry probe 115 b for robust calibration and self - correction . the s 2 - detector ( second source to detector ) distances are all equal for tissue oximetry probe geometry 115 b . there are 14 unique distances between s 1 - detectors ( first source to detectors ) and s 3 - detectors ( third source to detectors ) combined for tissue oximetry probe geometry 115 b . further , the distance between the first source and first detector is equal to the distance between the third source and the fifth detector ( s 1 d 1 = s 3 d 5 ), and the distance between the first source and fifth detector is equal to the distance between the third source and the first detector ( s 1 d 5 = s 3 d 1 ). fig3 is a high - level flow diagram of a method for marking tissue to indicate ranges of oxygen saturation of the tissue . the high - level flow diagram represents one example embodiment . steps may be added to , removed from , or combined in the high - level flow diagram without deviating from the scope of the embodiment . at 300 , tissue oximetry probe 115 contacts the tissue . light ( e . g ., near - infrared light ) is emitted from one or more of the light sources 120 , step 305 , into the tissue and at least some of the light is reflected back by the tissue . each detector 125 receives a portion of the light reflected from the tissue , step 310 , and each detector generates reflectance data ( i . e ., a response ) for the portion of reflected light received , step 315 . at 320 , processor 305 determines an oxygen saturation value for the tissue based on the reflectance data . at 325 , processor 116 determines a range of oxygen saturation from a plurality of ranges of oxygen saturation in which the oxygen saturation lies . at 330 , processor 116 controls tissue marker 130 to mark the tissue with ink based on a range in which the oxygen saturation is in . for example , the processor may be configured to control the dispenser to mark the tissue with ink if the oxygen saturation is in a first range of oxygen saturation , but not mark the tissue if the oxygen saturation in a second range of oxygen saturation where the first range and second range are different , such as not overlapping ranges . while the foregoing example embodiment , discusses the utilization of two ranges of oxygen saturation by the tissue oximetry device , the tissue oximetry device may utilize more than two ranges of oxygen saturation for determining whether to mark the tissue with ink . according to one embodiment , the processor may control the dispenser to mark the tissue with a specific color of ink based on the range of oxygen saturation that the oxygen saturation is in . the particular color of ink allows a user to relatively quickly determine the ranges of oxygen saturation for the tissue without the need for re - probing the tissue or looking at a chart of the tissue that includes oxygen saturation values and matching the chart to the tissue . fig4 shows a cross - sectional view of a probe sensor assembly 115 of the tissue oximetry device in one implementation . the probe sensor assembly includes a printed circuit board ( pcb ) 400 with an aperture 410 . there are optic fibers having fiber cores 415 where each fiber core is positioned within a jacket . the optical fibers run through the pcb . fig5 - 6 show views of an led board and a detector board of the probe sensor assembly 115 . there are optical fiber connections between the led and detector boards , which connect to the sensor openings . fig7 - 12 show the fiber optic connections of the probe sensor assembly 115 in an implementation . fig8 shows the interface block of the led pcb . fig9 shows the window location in the detector pcb for the sources s 1 , s 2 , and s 3 , as viewed from the component side of the detector pcb . fig1 shows the cross - sectional view c - c of fig7 where the optical fibers enter the detector pcb and the tips of the optical fibers are flush with the surface of the aperture plate . fig1 shows the cross - sectional view d - d of fig7 . fig1 shows the cross - sectional view e - e of fig7 where the optical fibers connect to the led pcb of the probe sensor assembly . tissue oximetry device 100 may be configured to allow a user to manually control the tissue oximetry device to mark tissue , allow processor 116 to control marking the tissue , or both . for example , one of input devices 119 may be configured to control tissue marker 130 to mark a local tissue region if a user activates the input device . the input device may be conveniently located for a user to operate tissue oximetry device 100 to make an oxygen saturation measurement , and operate the input device without moving tissue oximetry probe 115 from the local tissue region that was probed . tissue oximetry device 100 may be switched between the processor controlled method of marking tissue and the manually controlled method ( e . g ., activating one of the switches ) of marking tissue . one or more other of input devices 119 may be configured for switching tissue oximetry device 100 between these two methods of marking tissue . this description of the invention has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form described , and many modifications and variations are possible in light of the teaching above . the embodiments were chosen and described in order to best explain the principles of the invention and its practical applications . this description will enable others skilled in the art to best utilize and practice the invention in various embodiments and with various modifications as are suited to a particular use . the scope of the invention is defined by the following claims .

US-201615214355-A

an electric beverage maker includes a lower , water boiling vessel , a funnel extending into the lower vessel and having an upper compartment for receiving a beverage , and an upper vessel mounted over the funnel to receive water which has passed up the funnel through the compartment , and from which the beverage is dispensed . the lower vessel is formed with an opening in its lower region , which is closed by a thick film electric heater . the heater is controlled by a control which operates to disable the heater until such time as the control is reset manually by a user .

with reference to fig1 to 3 , a coffee making appliance 2 in accordance with the invention comprises three main components : a lower , water boiling , vessel 4 , an upper beverage receiving vessel 6 and an intermediate funnel 8 . the upper and lower vessels 6 , 4 are of a molded plastics construction , while the funnel is metallic . the upper vessel 6 is provided with a skirt 10 provided with an inwardly facing screw thread 12 which engages with a complementary screw thread 14 provided on the upper neck 16 of the lower vessel 4 . the upper vessel 6 is also provided with an upwardly extending spout 18 with apertures 20 at its upper and through which boiled water enters the upper vessel 6 , as will be discussed further below . the upper vessel 4 is also provided with an inwardly facing flange 22 for receiving a seal 24 . as can be seen from fig1 , when assembled , the seal 24 is trapped between the flange 24 on the upper vessel 6 and the upper end 26 of the lower vessel 4 . the funnel 8 is provided with a peripheral flange 28 , which rests upon the upper edge 26 of the lower vessel 4 . a strainer 30 is provided integrally in the funnel 8 for retaining a charge of coffee 32 and a removable filter plate 33 arranged on the top of the charge 32 to prevent grounds being carried into the upper vessel 6 . the lower vessel 4 is provided with an inwardly extending flange 34 towards it lower end , the flange defining a opening 36 in the lower part of the vessel 4 . the wall of the lower vessel 4 extends downwardly below the flange 34 to form a skirt 38 . a heater 40 is mounted to close the opening 36 . a safety pressure valve ( not shown ) is provided in the wall of the lower vessel 4 . the heater 40 is a thick film printed element , and is shown in greater detail in fig1 . as is known in the art , the heater 40 comprises a thick film resistive heating track 150 , laid on an insulating substrate 152 which is provided on a 0 . 8 mm thick stainless steel plate . the heating track 150 is terminated by a pair of low resistance contact portions 156 . it will also be noted , however , that the resistive track 150 is provided generally only around the periphery of the heating plate . this leaves an unheated area 158 in the center of the heater which is beneath the funnel 8 . the heater 40 is associated with a control unit 42 . the control unit 42 is an adaptation of the applicant &# 39 ; s commercially available u36 control which is a thermally - sensitive overheat protection control normally used in kettles and which incorporates a 360 ° cordless connector 44 for engagement with a corresponding connector on a power base ( not shown ). the principles of operation of such a control are described in pct international publication wo 99 / 48331 . as can be seen from fig1 , the central , planar , part of the heater 40 is arranged to slope in one direction , in fact at about 3 ° to the horizontal . as shown schematically in fig4 , the control 42 includes a molded control body 42 , which receives the heater 40 , clips ( not shown ) being provided around the inner periphery of the control molding 44 to hold the heater 40 in place on the control unit prior to its assembly into the appliance . the flange 34 of the vessel body 4 is provided with a number of bosses 46 which extend into bores 48 provided in the molding 44 , the peripheral flange 50 of the heater being scalloped in the region of these bores in order to allow for the passage of respective fixing screws 52 . a seal 54 is provided around the flange 50 of the heater , and when the control 42 and heater 40 are mounted to the vessel body 4 as a subassembly , the seal 54 is compressed against the flange 34 to make a water - tight seal around the heater 40 to prevent water entering the control 42 . as shown schematically in fig4 and 5 , the control comprises a thermally sensitive bimetallic actuator 60 mounted on one arm 62 of a generally u - shaped leaf spring member 64 . the other arm 66 of the member is provided at its free end with a contact 68 which makes electrical connection with a contact 72 provided on the heater 40 . the cross limb 74 of the member 64 is connected to one side of the electrical supply to the control , e . g . being connected to the line or neutral terminal of the connector 44 . a tongue 76 is upstanding from the arm 66 so as to underlie a peripheral region 78 of the actuator 60 whereby when the actuator operates it will push down the arm 66 and thereby open the set of contacts 70 , 72 . in a conventional kettle , the actuator 60 will detect overheating of the kettle , for example when it boils dry or it is turned on without any water in it . in the context of the present invention , however , boiling dry of the lower vessel 4 will indicate that all , or a substantial part of , the water has been evaporated from the lower vessel 4 and that the heater 40 can then be turned off . in fact , the actuator 60 is arranged under an upper part of the sloping heater 40 such that that part of the heater 40 becomes exposed before all the liquid has evaporated away . this is advantageous in helping ensure that the periphery of the heater 40 and the surrounding vessel body does not overheat . the conventional u36 control is configured such that it will cycle , i . e . it will allow the contacts 70 , 72 to reclose after the heater 40 has cooled . however , this is not desirable in the case of the present invention . accordingly , a mechanism is provided whereby once the actuator 60 operates to open the contact 70 , 72 the contacts will be held open . a number of different mechanisms to achieve this are disclosed herein . in a first arrangement , shown in fig6 , the bimetallic actuator 60 is chosen such that it is a non - self resetting actuator , i . e . the actuator 60 will only revert to its original position ( and thus allow re - energization of the appliance heater ) after operation either when the temperature falls significantly below ambient temperature or when it is physically reset by a user . a reset mechanism suitable for this purpose is shown in fig6 . in this embodiment , a reset plunger 80 is mounted in a bore 82 in the control molding 44 . the lower end 84 of the plunger 60 is angled and rests upon a spring loaded button 86 which extends through an aperture 88 in the side wall of the molding 44 and also through an aperture 90 in the skirt 38 of the lower vessel 4 . when it is desired to reset the control after it has operated ( in which situation the components will assume the positions shown in phantom in fig6 ), the button 86 is pressed inwardly , causing the plunger 80 to move upwardly under a camming action so as to contact the periphery of the actuator 60 and so force it to return to its original configuration , thereby allowing the contacts 70 , 72 to reclose . when the button 86 is released , it returns to its original position under the action of the spring 90 and the plunger 80 will return to its original position under its own weight . an alternative mechanism is shown in fig7 . in this embodiment , the reset button 92 acts on a lever arm 94 which is pivotally mounted to the molding 44 . a spring 96 is arranged on a spigot 98 provided on the lever 94 to provide a return force on the button 92 . when the button 92 is pressed , the lever 94 will rotate anti - clockwise such that its free end 100 will engage the periphery of the actuator 60 in order to force it back towards its original position . in a yet further embodiment , shown in fig8 , a spring loaded button 102 is provided with a cam surface 104 at its free end such that when the button 102 is pressed the upper most part of the cam surface 104 moves into contact with the periphery of the actuator 60 in order to reset it . other reset mechanisms are also envisaged . a further embodiment is shown schematically in fig9 . in this embodiment , the actuator 60 is , instead , a conventional auto - resetting actuator which will return to its original configuration after cooling to a temperature around or above ambient . in this arrangement , however , the end of the contact carrying arm 66 is provided with a latch 110 which , when the contacts 70 , 72 are opened under the action of the actuator 60 , engages behind a catch 112 provided on the control molding 44 to retain the contacts 70 , 72 open even after the actuator 60 has returned to its original configuration . when the spring loaded reset button 114 is pressed , the latch 110 is disengaged by the free end 116 of the button 114 bending the resilient arm 66 back to disengage the latch 110 from under the catch surface 102 , thereby allowing the contacts to return to their closed position . in a further , similar , arrangement shown in fig1 , the end 120 of the contact carrying arm 122 is provided with a depending catch 124 . the lower edge 126 of the catch 124 is sloped , as shown . a wire spring 128 which is fixed in the control housing 130 at one end 132 extends across the control housing 130 below the sloped edge 126 of the catch 124 . the other end 134 of the spring 128 is free to deflect . a button 140 extends through the wall 142 of the control housing 130 and has a free end 144 which in its rest position is abutted by the spring 128 . when the bimetallic actuator 146 operates it will move contact arm 122 downwardly causing the sloping edge 126 of the catch 124 to engage the spring 128 and push it to one side until the contact arm 122 has fully deflected , whereupon the spring 128 will move back under its own resilience to engage the catch 124 thereby preventing the contact arm 122 returning to its rest position even after the bimetallic actuator 146 has reset . to reset the contact arm 122 , the button 140 must be pressed in to deflect the spring 128 out of the catch 124 . after it has disengaged , the spring 128 will act to return the button to its rest position . operation of an appliance in accordance with the invention will now briefly be described . firstly , a desired volume of water is placed in the lower vessel 4 . this volume can be pre - measured or gauged from volumetric marks ( not shown ) provided on the inside of the vessel wall . the funnel 8 is then filled with coffee grounds 32 ( or other foodstuffs ) until it is level with the rim and the strainer filter plate 34 used to tamp down the coffee . it is then rested on the top of the grounds 32 . if desired , a false floor can be placed in the funnel 8 before filling to take up some of the volume , whereby the amount of coffee or other foodstuff can be varied in order to vary the strength or the volume of the beverage produced . the funnel 8 is then placed in position on the lower vessel 4 and the upper vessel 6 , which carries the seal 22 , then screwed onto the upper end 16 of the lower vessel 4 so as to seal the lower vessel 4 . the whole appliance is then placed on its power base ( not shown ) and the reset button 86 etc pressed to supply power to the heater 40 . the water in the lower vessel 4 is then heated to a point where steam vapor is generated which creates a pressure in the lower vessel 4 . this forces the water from the lower vessel 4 up through the funnel 8 , through the coffee grounds 32 , where it infuses with the coffee , up the spout 18 and out of the apertures 20 formed in the spout 18 of the upper vessel 6 . by virtue of the unheated area 158 beneath the funnel 8 , water directly below the funnel 8 does not boil during the bulk water heat - up phase . this prevents the coffee grounds 32 being scalded by steam until properly wet . this improves the flavor of the brewed coffee . once the majority of the water has been pushed out of the lower vessel 4 through the funnel 8 , the temperature of the heater 40 will begin to rise , and this rise will be detected by the actuator 60 of the control 42 . in particular , the actuator 60 of the control will operate to open the contact 70 , 72 thereby disconnecting the power supply to the heater 40 when the area of the heater 40 under which it is arranged boils dry . the contact 70 , 72 are then maintained open by one of the various mechanisms described in fig6 to 10 in order to stop the heater 40 re - energizing . the appliance can then be lifted and the beverage dispensed from the upper vessel 6 , whereafter the upper vessel 6 may be unscrewed from the lower vessel 4 , the funnel 8 removed and the appliance cleaned . the process will then be repeated to prepare a new beverage , the act of pressing the reset button 86 allowing the contacts 70 , 72 to reclose in order to supply power once more to the heater 36 . it will be appreciated that various modifications can be made to the preferred embodiments of the invention described above without departing from the scope of the invention . for example , controls other than those specifically described may be used , so long as they detect overheating of the heated base vessel . furthermore , other latching mechanisms may be envisaged for holding open the contacts of a control upon operation . furthermore , the invention is not limited to the use of thick film printed elements , but can be used with electric heating elements suitably mounted under the base of the vessel . also , the appliance need not be cordless , as shown and the appliance may be adapted to make other beverages such as soup . although this invention has been shown and described with respect to the detailed embodiments thereof , it will be understood by those skilled in the art that various changes in form and detail thereof may be made without departing from the spirit and scope of the invention .

US-7499002-A

quick or instantaneous stopping of rapidly rotating members places severe stress loads on components . these loads are substantially reduced by providing a quick - stopping apparatus including a damped member having an attached element which is movable into engagement with a rotating member . in response to such engagement , the energy of the rotating member is rapidly decelerated through the damped member thus reducing peak stress loads associated with almost instantaneous deceleration .

in fig1 an exemplary harvesting machine 10 includes an attachment 12 for gathering crop material and feeding the material sequentially to an auger 14 , then between a first pair of feed rolls 16 , 18 , a second pair of feed rools 20 , 22 and then to a crop chopping or cutting device 24 . thereafter , the chopped crop material is delivered via a conveyor 26 to be expelled from a spout 28 . it is well known that many of these general features of a crop harvesting machine are common to both pull - type and self - propelled units . lower feed roll 18 has been found to be an advantageous location for a known metal detector unit 30 . metal detected in the vicinity of the feed rolls causes a signal to be sent to a stop device which stops the feed rolls in a fraction of a second thus avoiding further passage of the detected metal . an advantageous quick - stop apparatus generally designated 32 , is operably connected to feed roll 18 . an appropriate , well known linkage and drive system 34 ultimately connects the rotating feed roll 18 to an associated rotating member such as a ratchet wheel 36 formed of a suitable metal and having a plurality of concave notches 38 formed about the wheel circumference . wheel 36 is mounted for rotation about an axis a in a direction indicated by an arrow designated r . a shock absorber type reaction member , fig1 and 2 , is generally designated 40 and is mounted adjacent wheel 36 . member 40 includes a slide 42 having a stop 70 and a stop mount 64 . slide 42 is supported by support sleeves 44 , 46 . slide 42 , stop 70 and stop mount 64 are movable relative to support sleeves 44 , 46 and relative to ratchet wheel 36 . this is accomplished by slidably mounting the steel slide portion 42 in at least one but preferably the two fixed tubular steel supports 44 , 46 mounted on harvester 10 . slide 42 includes a cylindrical portion 48 and a reduced diameter extension 50 . cylindrical portion 48 is slidably mounted in suports 44 , 46 . a suitable steel plate 52 is preferably welded to an end 54 of portion 48 and an aperture 56 is formed in plate 52 . a plurality of steel plates 58 are carried by extension 50 between support 44 and a threaded end of extension 50 . means , such as a pair of elastomeric members 62 are carried by extension 50 in a manner separating plates 58 , for damping movement of slide 42 . this is accomplished by movement of slide 42 in supports 44 , 46 in the direction indicated by an arrow designated c 1 , for compressing members 62 between plates 58 in a position designated p c ( fig2 ), thus absorbing energy imposed on slide 42 . obviously , energy thus absorbed by members 62 will move slide 42 in the direction of an arrow designated c 2 returning members 62 in a relaxed position designated p r , see fig1 . elastomeric members 62 are commercially available and are preferably formed of neoprene . the tubular stop mount 64 is preferably a steel casting having a bore 66 formed therethrough . mount 64 is removably attached to slide portion 42 via a pin 68 . in this manner , mount 64 reciprocates with slide portion 42 and is limited from rotation by pin 68 . the stop 70 includes a dog - leg shaped steel flat pivotally attached to mount 64 at pin 72 having a pawl 74 fixedly attached thereto such as by welding or the like . a rounded or convex end 76 of pawl 74 is formed for mating engagement with concave notches 38 . in this manner stop 70 is movable with reaction member 40 and is also movable relative to reaction member 40 . such relative movement is accomplished by stop 70 being pivoted about pin 72 between a first position , free of engagement with ratchet wheel 36 , see fig1 and a second position in engagement with wheel 36 , see fig2 . a steel flat forms an extension 78 fixedly attached to stop 70 such as by welding or the like . means , such as a solenoid 80 and a tension spring 82 , are connected for moving stop 70 between the first and second positions . in the preferred embodiment , see fig1 and 2 , solenoid 80 is connected to extension 78 at pin 84 by a suitable flexible steel cable 86 for pivoting stop 70 about pin 72 . a suitable brace 88 retains solenoid 80 in a fixed position relative to reaction member 40 . brace 88 is secured to machine 10 by welding or the like . thus , solenoid 80 is in a fixed position relative to the movable reaction member 40 . resilient steel tension spring 82 interconnects stop 70 and plate 52 of slide 42 . one end of spring 82 is secured through aperture 56 of plate 52 and another end of spring 82 is secured through an aperture 90 formed in stop 70 . solenoid 80 is preferably a commercially available series 1500 sold under the tradename synchro - start . in fig1 solenoid 80 is illustrated in an energized mode wherein stop 70 is pivoted by cable 86 to the first position as previously described . in fig2 solenoid 80 is illustrated in a deenergized mode wherein stop 70 is pivoted by spring 82 to the second position as previously described . fig3 and 4 illustrate an alternative embodiment which is basically the same as the embodiment of fig1 and 2 . one difference is that plate 52a of slide 42a also functions as a brace for supporting solenoid 80a . thus , solenoid 80a moves with slide 42a but has a greater exposure to shock loads and vibration . also , in the alternative embodiments of fig3 and 4 , since solenoid 80a moves with slide 42a rather than relative to it , a rigid rod 90 , rather than a cable 86 ( fig1 and 2 ), can be pivotally linked to a rigid arm 92 which is pivotally linked to extension 78a for interconnecting solenoid 80a and stop 70a . the alternative embodiment of fig5 includes a reaction member 40b adjacent ratchet wheel 36b . member 40b includes a slide 42b having a stop 70b . slide 42b is supported by a stationary support rod 90 secured by bolts 96 in support flanges 92 , 94 . flanges 92 , 94 are affixed to machine 10 . stop 70b is pivotally carried on slide 42b for movement between the first and second positions as previously discussed . rod 90 includes a first diameter portion 96 separated from a reduced diameter portion 98 by a shoulder 100 and an abutting washer 101 . slide 42b is urged into engagement with washer 101 by a pair of concentric steel compression springs 102 , 104 . upon engagement of stop 70b with ratchet wheel 36b , slide 42b moves relative to support rod 90 and flanges 92 , 94 for compressing springs 102 , 104 thus damping movement of slide 42b . solenoid 80b is secured on machine 10 and a flexible cable 86b connects to move stop 70b to the first position when solenoid 80b is energized . a spring 82b moves stop 70b to the second position when solenoid 80b is deenergized . the significant difference here is that slide 42b slides on a stationary rod 90 and concentric springs 102 , 104 are used rather than elastomeric members 62 . with the parts assembled as set forth above , it can be seen that when stop 70 is in the first position as illustrated in fig1 and 2 , ratchet wheel 36 can freely rotate in direction r . upon deenergization of solenoid 80 , spring 82 pivots stop 70 about pin 72 urging pawl 74 into one of the notches 38 . forces acting on stop 70 are transmitted to slide 42 of reaction member 40 thus moving slide 42 in direction c 1 relative to solenoid 80 , which compresses elastic elements 62 into position p c between plates 58 . after the forces are dissipated , elements 62 relax to position p r and slide 42 moves in direction c 2 . in the alternative embodiment illustrated in fig3 and 4 , solenoid 80a is fixedly attached to slide 42a and thus moves with slide 42a rather than remaining stationary . in the alternative embodiment illustrated in fig5 compression springs 102 , 104 are used to damp movement of slide 42b mounted on stationary rod 90 . the foregoing has described a damped apparatus for quick - stopping rotating members wherein the energy of the rotating member is rapidly decelerated through a damped member thus reducing peak stress loads associated with almost instantaneous deceleration . it is anticipated that aspects of the present invention , other than those specifically defined in the appended claims , can be obtained from the foregoing description and the drawings .

US-43216482-A

a dilation tower providing a darkened space for performing a dilated fundus examination in bright environments is provided . in order to reach more patients in need of dfes , the dilation tower provided may be configured to be mobile . a method of administering a dfe on a patient comprising the steps of positioning said patient in a patient area of a dilation tower , enclosing said patient and said patient area with a patient area cloak , and performing said dfe on said patient is also provided .

the following detailed description is presented to enable any person skilled in the art to make and use the invention . for purposes of explanation , specific details are set forth to provide a thorough understanding of the present invention . however , it will be apparent to one skilled in the art that these specific details are not required to practice the invention . descriptions of specific applications are provided only as representative examples . various modifications to the preferred embodiments will be readily apparent to one skilled in the art , and the general principles defined herein may be applied to other embodiments and applications without departing from the scope of the invention . the present invention is not intended to be limited to the embodiments shown , but is to be accorded the widest possible scope consistent with the principles and features disclosed herein . referring to the drawings , fig1 illustrates an exemplary embodiment of the disclosed invention . the dilation tower 1 depicted in fig1 has a patient side 2 and a medical professional side 3 . the patient side 2 is provided with a patient area cloak 4 over and defining a patient area 5 that includes a place for a patient to sit ( e . g ., patient seat 6 ) during the examination . although an unattached chair 6 is shown in fig1 as the place for a patient to sit , it is contemplated that a dilation tower 1 of the present invention could be equipped with a patient seat 6 that is physically attached to or made part of the tower table base unit 7 . in some embodiments , the patient area cloak 4 is disposed on a right and a left patient area cloak arm 8 , 9 . preferably , the right and left patient area cloak arms 8 , 9 are extendable in the direction of the patient side 2 to a desired length in order to completely cover the occupied patient area . therefore , the right and left patient area cloak arms 8 , 9 are preferably retractable in the direction of the medical professional side 3 . the retraction / extension of the right and left patient area cloak arms 8 , 9 can be accomplished by any known means , for example telescoping arms , sliding arms , and tension arms . more preferably , right and left patient area cloak arms 8 , 9 are independently extendable / retractable with right and left arm extension members 8 a and 9 a ( see fig7 ). as shown in fig1 , right and left patient area cloak arms 8 , 9 also preferably include set screws 8 b , 9 b to maintain the desired length . the dilation tower 1 of the present invention is designed to be mobile and for placement in high traffic areas , such as shopping malls , stores , etc ., where patients can be solicited to undertake a dfe . while such high traffic areas provide access to target patients who need or may need a dfe , these environments present too much light for a dfe to be performed properly . the patient area cloak 4 functions to create a dark environment for the patient and the patient area 5 of the dfe equipment 14 . as shown in fig5 , dfe equipment 14 will normally be positioned to span patient side 2 and medical professional side 3 . the patient area cloak 4 can be made from any suitable material ( or fabric ) to block ambient light from the surrounding environment . preferably , the material of patient area cloak 4 will be opaque or substantially opaque . the patient area cloak 4 can be constructed to comprise more than one layer of material or fabric in order to be opaque or substantially opaque . the patient area cloak 4 is designed to have a first side 4 a , which extends between a right and a left tower 10 , 11 and down from the tower bridge 12 to a tower table equipment surface 13 in order to the to create a light barrier or “ wall ” between the patient area 5 and the medical professional side 3 . the first side 4 a should provide sufficient material to encounter dfe equipment 14 and still reach the tower table equipment surface 13 . in some embodiments , first side 4 a may extend down beyond the tower table equipment surface 13 to further block light . in some such embodiments , first side 4 a may extend down to the floor or substantially to the floor . first side 4 a may be affixed to the right and the left tower 10 , 11 , the tower bridge 12 , and the tower table equipment surface 13 by any suitable fastener , such as hook and loop fasteners , magnets , or an adhesive . in preferred embodiments , the first side 4 a is kept taught or relatively taught to the dfe equipment 14 by means of elastic , cinch or drawstring , hook and loop fasteners , adhesive , or other suitable means . such may be accomplished by including an opening ( s ) or hole ( s ) in the first side 4 a for positioning part of the dfe equipment 14 through . preferably , first side 4 a may be temporarily affixed to the dilation tower 1 to permit removal for maintenance , cleaning , etc . of first side 4 a . the patient area cloak 4 is designed to have a second ( right ) side 4 b , which extends down from the right patient area cloak arm 8 . the second ( right ) side 4 b should extend down sufficiently to provide a dark environment for the patient and the dfe equipment 14 . in some embodiments , second ( right ) side 4 b will extend at least to the tower table equipment surface 13 . in other embodiments , second ( right ) side 4 b may extend down beyond the tower table equipment surface 13 to further block light . in some such embodiments , second ( right ) side 4 b may extend down to the floor or substantially to the floor . second ( right ) side 4 b may be affixed to the right tower 10 by any suitable fastener , such as hook and loop fasteners , magnets , or an adhesive . preferably , second ( right ) side 4 b may be temporarily affixed to the dilation tower 1 to permit removal for maintenance , cleaning , etc . of second ( right ) side 4 b . in preferred embodiments where the right patient area cloak arm 8 is extendable / retractable , second ( right ) side 4 b is designed to accommodate the full extension / retraction thereof . second ( right ) side 4 b may be affixed to right patient area cloak arm 8 by any convenient means to accomplish the goals of blocking light and , where applicable , extension / retraction of the material . for example , the second ( right ) side 4 b may be affixed by hook and loop fastener , adhesive , curtain rings / hooks or similar device , by inserting right patient area cloak arm 8 through second ( right ) side 4 b , etc . second ( right ) side 4 b may be designed to be stationary ( i . e ., only extendable / retractable when right patient area cloak arm 8 is extended / retracted ) or independently extendable / retractable along right patient area cloak arm 8 . the patient area cloak 4 is designed to have a third ( left ) side 4 c , which extends down from the left patient area cloak arm 9 . the third ( left ) side 4 c should extend down sufficiently to provide a dark environment for the patient and the dfe equipment 14 . in some embodiments , third ( left ) side 4 c will extend at least to the tower table equipment surface 13 . in other embodiments , third ( left ) side 4 c may extend down beyond the tower table equipment surface 13 to further block light . in some such embodiments , third ( left ) side 4 c may extend down to the floor or substantially to the floor . third ( left ) side 4 c may be affixed to the left tower 11 by any suitable fastener , such as hook and loop fasteners , magnets , or an adhesive . preferably , second ( right ) side 4 b may be temporarily affixed to the dilation tower 1 to permit removal for maintenance , cleaning , etc . of third ( left ) side 4 c . in preferred embodiments where the left patient area cloak arm 9 is extendable / retractable , third ( left ) side 4 c is designed to accommodate the full extension / retraction thereof . third ( left ) side 4 c may be affixed to left patient area cloak arm 9 by any convenient means to accomplish the goals of blocking light and , where applicable , extension / retraction of the material . for example , the third ( left ) side 4 c may be affixed by hook and loop fastener , adhesive , curtain rings / hooks or similar device , by inserting left patient area cloak arm 9 through third ( left ) side 4 c , etc . third ( left ) side 4 c may be designed to be stationary ( i e , only extendable / retractable when left patient area cloak arm 9 is extended / retracted ) or independently extendable / retractable along left patient area cloak arm 9 . the patient area cloak 4 is designed to have a fourth side 4 d , which extends down from between the right and the left patient area cloak arms 8 , 9 . the fourth side 4 d should extend down sufficiently to provide a dark environment for the patient and the dfe equipment 14 . in some embodiments , fourth side 4 d will extend at least to the level of the tower table equipment surface 13 . in other embodiments , fourth side 4 d may extend down beyond the level of the tower table equipment surface 13 to further block light . in some such embodiments , fourth side 4 d may extend down to the floor or substantially to the floor . in some embodiments , fourth side 4 d may be an extension of either second ( right ) side 4 b or third ( left ) side 4 c . in these embodiments , fourth side 4 d is capable of attaching to the opposite side ( 4 b or 4 c ) and / or arm ( 8 or 9 ), and , preferably , the free edge of fourth side 4 d may also be capable of being temporarily affixed the opposite side ( 4 b or 4 c ) by any suitable fastener , such as hook and loop , magnets , etc . where fourth side 4 d is not an extension of either second ( right ) side 4 b or third ( left ) side 4 c , it is designed to be temporarily attached to either one or both of sides 4 b and 4 c and arms 8 and 9 . in embodiments where the right and the left patient area cloak arms 8 , 9 are mounted on arm swivel members ( such as shown in fig6 - 9 and 11 - 13 ) and embodiments where the right and the left patient area cloak arms 8 , 9 can be positioned in narrow / wide configurations ( such as shown in fig5 , and 12 ), fourth side 4 d is designed to accommodate a wide variety of widths . preferably , fourth side 4 d may be temporarily affixed to the dilation tower 1 to permit removal for maintenance , cleaning , etc of fourth side 4 d . the patient area cloak 4 is designed to have a fifth ( top ) side 4 e , which extends across the top between the right and the left patient area cloak arms 8 , 9 and from the tower bridge 12 to the ends of the right and the left patient area cloak arms 8 , 9 . in some embodiments , fifth ( top ) side 4 e may be an extension of the first side 4 a , the second ( right ) side 4 b , the third ( left ) side 4 c , the fourth side 4 d , or any combination of these . fifth ( top ) side 4 e may be affixed to the right and the left patient area cloak arms 8 , 9 and / or the tower bridge 12 . preferably , fifth ( top ) side 4 e may be temporarily affixed to the dilation tower 1 to permit removal for maintenance , cleaning , etc . to better prevent light from entering patient area 5 during an examination , the patient area cloak 4 may optionally include flaps or extensions that extend over or across a joint created by a patient area cloak side piece ( 4 a - 4 e ) and / or a physical structure of the dilation tower 1 ( e . g ., tower bridge 12 ; right and left tower 10 , 11 ; or right and left patient area cloak arms 8 , 9 ). in other words , the flap or extension is intended to cover any gaps at an edge of the patient area cloak 4 . the flaps can be made from the same material as the patient area cloak side pieces ( 4 a - 4 e ) or from another material entirely . alternatively , they can be an extension from one or more of these . the flaps can be affixed to the patient area cloak 4 by any suitable means , including sewing , hook and loop , magnets , buttons , zippers , pins , snaps , clasps , hooks , etc . also , where necessary , a user can position at least the patient side 2 of the dilation tower 1 over a dark , low gloss flooring cover ( e . g ., a mat ) to minimize light reflected from the floor under the patient area cloak 4 . as can be appreciated from fig1 - 13 , the patient area cloak 4 may comprise more than one panel , which advantageously allows for limiting light from the medical professional side 3 entering the patient side 2 during an examination . as shown in fig1 , cloak first side / panel 4 a is configured to have a portal or opening through which the dfe equipment 14 can extend through on the dilation table 1 from the medical professional side 3 to the patient side 2 . preferably the portal or opening is configured to be held tight against the dfe equipment 14 for limiting light from the medical professional side 3 entering the patient side 2 during an examination , such as lining the portal with an elastic band 33 . finally , patient area cloak 4 is designed to have at least one opening or entry 15 through which a patient can enter patient area 5 . patient area entry 15 may be positioned anywhere on patient area cloak 4 that is suitable for patient entry into patient area 5 . by way of example only , patient area cloak 4 may be configured to have a patient area entry 15 at the meeting of third ( left ) side 4 c and fourth side 4 d . such a configuration could be accomplished by making third ( left ) side 4 c slidable on left patient area cloak arm 9 , again by way of example only . allowing for the patient area entry 15 to be expandable is preferred to better accommodate patients of various sizes without the patient having to come in contact with the patient area cloak all while maintaining a compact footprint of dilation tower 1 . alternatively , patient area cloak 4 may be configured to lift over the right and left patient area cloak arms 8 , 9 to create the entry 15 for the patient . some embodiments of dilation tower 1 may further comfortably accommodate patients of various sizes by employing a pivot mechanism 16 attached to the tower bridge 12 , as shown in fig5 , that allows for expansion of the patient area 5 by pivoting either right or left patient area cloak arms 8 , 9 or both . similarly , as shown in fig6 - 8 and 11 - 13 , a swivel mechanism 17 located on right and left towers can be used to accomplish the same expansion of the patient area 5 while maintaining a compact footprint of dilation tower 1 . patient area cloak 4 in such embodiments must be designed to accommodate such expansion by containing sufficient material to expand and / or pivot / swivel . preferably , right or left patient area cloak arms 8 , 9 that incorporate a pivot 16 or swivel mechanism 17 include a means to maintain a desired pivot / swivel , such as a set screw 8 b / 9 b , spring , tension rod , and / or other known means . for example , fig1 - 13 shows right or left patient area cloak arms 8 , 9 that incorporate a swivel mechanism 17 . in fig1 , the right and left patient area cloak arms 8 , 9 are swiveled to a narrow position ( relative to a “ normal ” position , see fig1 ). both extendable arms 8 a , 9 a are held in a non - extended position by set screws 8 b , 9 b by applying pressure to extendable arms 8 a , 9 a . similarly , the narrow swiveled position is held in place by set screw 31 b placed in a cross bar 31 and applying pressure to extendable cross bar 31 a . cross bar 31 and extendable cross bar 31 a are affixed to right and left patient area cloak arms 8 , 9 by fasteners 32 . in fig1 , the right and left patient area cloak arms 8 , 9 are swiveled to a wide position ( relative to a “ normal ” position , see fig1 ). extendable arm 8 a is held in an extended position by set screw 8 b , and extendable arm 9 a is held in a non - extended position by set screw 9 b . the wide swiveled position is held in place by set screw 31 b placed in a cross bar 31 and applying pressure to extendable cross bar 31 a . dilation tower 1 is configured to comprise a tower table 18 with equipment surface 13 for holding dfe equipment 14 spanning between patient side 2 and medical professional side 3 . tower table 18 is attached to a tower table base unit 7 . preferably , tower table 18 is height adjustable , as shown in fig2 and 8 , by raising / lowering tower table base unit extension arm 7 a . tower table base unit extension arm 7 a may be raised and lowered manually . in some embodiments , tower table base unit extension arm 7 a may be raised and lowered pneumatically . in yet other embodiments , tower table base unit extension arm 7 a may be raised and lowered mechanically . tower table 18 also serves to receive right and left towers 10 , 11 by attachment via tower base plates 19 . tower base plates 19 can be configured to be permanently attached to a tower 10 , 11 , as shown in fig4 and 6 , for example by welding . alternatively , tower base plates 19 can be configured to receive tower structural members 10 a , 11 a , as shown in fig5 . in both configurations , towers 10 , 11 are affixed to tower table by tower base plate fasteners 29 , as shown in fig4 - 5 . tower base plate fasteners 29 can be any suitable fastener , for example bolt and nut . tower table base unit 7 is optionally equipped with electrical power , as shown in fig1 and 2 . a power cable 20 is supplied for tower table base unit 7 to receive electricity . one or more power outlets 21 are provided in electrically equipped tower table base units 7 for supplying power to the dfe equipment 14 , optional multimedia players 24 ( discussed below ), and / or other equipment . the electrical supply can be centrally controlled by power switch 22 . the power switch 22 is preferably located on the medical professional side 3 of dilation tower 1 . in preferred embodiments , tower table base unit 7 contains wheels 23 or other suitable means for mobility . wheels 23 optionally may contain wheel locks to secure the location of dilation tower 1 when occasionally bumped or otherwise comes into contact with a person ( e . g ., patient and / or medical professional ) or other object . as previously mentioned , one object of the present invention is to reach more patients . the dilation tower 1 of the present invention is designed to accomplish this goal without formal appointments or the intimidation of a formal setting ( i . e ., doctor &# 39 ; s office ). we believe the best opportunity to reach out to more patients , especially underserved populations , is to provide a compact , mobile dilation tower of the present invention in high traffic pedestrian environments , such as malls , large stores , and / or shopping centers . use of wheels 23 or mobility means allows better access and mobility to and within such target environments . now referring to fig3 , the tower bridge 12 is preferably configured to contain a platform 28 for attaching multimedia players 24 . multimedia players 24 may be provided for in situ audio - visual marketing of the dilation tower 1 and services associated with it . multimedia players 24 could also be used for marketing other services and locations of the medical professional user of the dilation tower 1 . alternatively , multimedia players 24 can be used to market products and / or services unrelated to the medical professional user or the dilation tower 1 . multimedia players 24 are held fast to dilation tower 1 by multimedia holders 25 . holders 25 are preferably configured to securely receive multimedia players 24 , while also allowing multimedia players 24 to be removed by authorized personnel ( e . g ., by key or electrical security means ). as a primary marketing tool , multimedia holders 25 are preferably mounted onto bridge platform 28 by a multimedia base 26 . multimedia base 26 may contain a swivel to allow multimedia players 24 to be rotated around the axis of the swivel base 26 to be positioned in an optimal direction to attract potential patients around the dilation tower 1 . multimedia player electrical wires 27 may be necessary for some models to provide continuous electrical power to multimedia players 24 . so that the wires 27 do not simply hang down and possibly interfere with the examination , tower bridge 12 and right and left towers 10 , 11 are preferably configured to be hollow and act as a conduit for wires 27 from multimedia players to power outlets 21 on tower table base unit 7 or other sources of electricity . one or more access holes 30 for the tower bridge 12 electrical conduit is / are provided on bridge platform 28 . in embodiments comprised of right and left tower structural members 10 a , 11 a , right and left tower covers 10 b , 11 b provide concealment of the wires 27 as a conduit . referring to fig4 , tower table 18 is designed to provide an equipment surface 13 with sufficient dimensions for dfe equipment ( not shown ) to span across patient side 2 and medical professional side 3 , while also providing attachment and support for right and left towers 10 , 11 via tower base plates 19 and fasteners 29 . preferably , base plates 19 and fasteners 29 take up little , if any , of tower table equipment surface 13 . referring now to fig5 , dfe equipment 14 is shown placed on dilation tower 1 spanning across patient side 2 and medical professional side 3 . the medical professional may adjust the right and left patient area cloak arms 8 , 9 according to the needs of the patient . as shown in fig5 , the right and left patient area cloak arms 8 , 9 can be adjusted laterally toward / away from the right and left towers 10 , 11 , by extension of right and left patient area cloak arms 8 , 9 , and / or axially about pivot 16 for larger patient area 5 needs . for embodiments having right and left patient area cloak arms 8 , 9 sitting on swivel members 17 , such as in fig6 and 7 , the medical professional may adjust the arm extensions 8 a , 9 a ( fig7 ) or the arms 8 , 9 about the swivel members 17 ( fig8 ), as necessary ( fig9 ). as shown in fig8 , right and left patient area cloak arms 8 , 9 may expand to 180 degrees or more ( relative to one another and the towers ); however , this position is not practical with patient area cloak 4 attached to define the patient area 5 . another object of the present invention is to provide a method for administering a dfe to a patient in a bright environment utilizing a dilation tower 1 as described above . the medical professional will position the patient in the patient area 5 . to wit , the patient may enter patient area 5 by an entry in patient area cloak 4 and be seated in patient seat 6 . once the patient has been seated , the medical professional will then enclose ( i . e ., secure ) the patient area cloak 4 to provide a dark environment for the dfe . this step may optionally include ensuring that all seams are closed by overlapping the cloak 4 or by securing any optional flaps . by securing patient area cloak 4 , the medical professional can perform the dfe without the need of mydriatic agents ( e . g ., tropicamide ) even in otherwise bright environments . non - mydriatic examinations are preferred for the present invention because the patient will not suffer from dilated pupils and light sensitivity following the examination . as necessary , the height of tower table 18 may be adjusted up or down . the medical professional can sit or stand at or near the medical professional side to conduct the examination ( administer the dfe to the patient ). in preferred embodiments , dfe equipment 14 is utilized that allows automatic and rapid dfes for one or both eyes of the patient . after exiting the patient area 5 , patient and medical professional may review the results of the examination at the medical professional side 3 of dfe equipment 14 , on a computer device ( computer , laptop , tablet , smart phone , etc . ), and / or the results can sent electronically ( e . g ., email ) directly to the patient or the patient &# 39 ; s primary care physician for records and / or follow - up . the terms “ comprising ,” “ including ,” and “ having ,” as used in the claims and specification herein , shall be considered as indicating an open group that may include other elements not specified . the terms “ a ,” “ an ,” and the singular forms of words shall be taken to include the plural form of the same words , such that the terms mean that one or more of something is provided . the term “ one ” or “ single ” may be used to indicate that one and only one of something is intended . similarly , other specific integer values , such as “ two ,” may be used when a specific number of things is intended . the terms “ preferably ,” “ preferred ,” “ prefer ,” “ optionally ,” “ may ,” and similar terms are used to indicate that an item , condition or step being referred to is an optional ( not required ) feature of the invention . the invention has been described with reference to various specific and preferred embodiments and techniques . however , it should be understood that many variations and modifications may be made while remaining within the spirit and scope of the invention . it will be apparent to one of ordinary skill in the art that methods , devices , device elements , materials , procedures and techniques other than those specifically described herein can be applied to the practice of the invention as broadly disclosed herein without resort to undue experimentation . all art - known functional equivalents of methods , devices , device elements , materials , procedures and techniques described herein are intended to be encompassed by this invention . whenever a range is disclosed , all subranges and individual values are intended to be encompassed . this invention is not to be limited by the embodiments disclosed , including any shown in the drawings or exemplified in the specification , which are given by way of example and not of limitation . while the invention has been described with respect to a limited number of embodiments , those skilled in the art , having benefit of this disclosure , will appreciate that other embodiments can be devised which do not depart from the scope of the invention as disclosed herein . for example , the dilation tower of the present invention could be configured to have an enclosed , but expandable cell defining the patient area . accordingly , the scope of the invention should be limited only by the attached claims . all references throughout this application , for example patent documents including issued or granted patents or equivalents , patent application publications , and non - patent literature documents or other source material , are hereby incorporated by reference herein in their entireties , as though individually incorporated by reference , to the extent each reference is at least partially not inconsistent with the disclosure in the present application ( for example , a reference that is partially inconsistent is incorporated by reference except for the partially inconsistent portion of the reference ).

US-201514631291-A

the invention relates to a method for minimizing mean blood glucose levels in an insulin dependent patient by administering insulin to the patient in a sufficiently fast manner to provide a difference of 50 % or less between high and low blood glucose levels . advantageously , the insulin is administered to the patient by jet injection and the high and low blood glucose levels differ by an amount that is less than that which would be obtained after injection of insulin by a conventional needle syringe . the invention also relates to a method for reducing mean blood glucose levels in an insulin dependent patient that is receiving insulin through a conventional syringe and needle arrangement . this method provides for administration of the insulin to the patient by jet injection rather than by the syringe by substituting a jet injector for the syringe .

as used herein , “ insulin - dependent ” means that the patient is receiving treatment for elevated blood glucose by oral or intramuscular administration of insulin or other hypoglycemic agents . “ well - managed patients ” are those who faithfully follow instructions from their doctors and pharmacists for the daily administration of insulin or other hypoglycemic agents . such patients typically have hba1c values of 7 or less . needle - free injection devices generally contemplated for use with the present invention ( known in the art as “ jet injectors ”) are disclosed , for example , in u . s . pat . no . 5 , 599 , 302 , the content of which is expressly incorporated herein by reference thereto . one exemplary device for use with the present invention is the antares pharma vision needle - free insulin injection system , manufactured by antares pharma of minneapolis , minn . this precision , needle - free drug delivery system uses pressure to create a micro - thin stream of insulin that penetrates the skin and is deposited into the subcutaneous ( fatty ) tissue in a fraction of a second . the device permits dialing of dosages , and easy injection without the use of a needle . as insulin is often injected by a patient him or herself , the preferred method employs an injector that facilitates the proper insulin administration by the patient without the experience that a health provider would normally have . although the patient is the typical user envisioned , other users are envisioned as well . the preferred injector for administering the insulin has a jet nozzle configured for firing the insulin in a fluid jet in a configuration and with sufficient velocity to penetrate tissue of the patient to an injection site . a chamber is associated with the nozzle for containing the insulin and feeding the insulin to the nozzle for injection . this chamber is referred to herein as an insulin chamber as in the preferred method insulin is contained . a firing mechanism comprising an energy source is associated with the insulin chamber for forcing the insulin through the nozzle at said velocity . although the energy source of the preferred embodiment is a coil spring , other suitable energy sources including other springs can be used . a trigger of the injector is movable by the patient and associated with the firing mechanism for activating the energy source for the forcing of the insulin through the nozzle upon movement of the trigger by the patient to a firing position . the injector also has a safety mechanism with a blocking member that has a blocking position in which the blocking member prevents movement of the trigger to the firing position . a user - manipulable member of the safety mechanism is movable by the user from a safety position , allowing the blocking member to be positioned in the safety position , to a release position . in the release position , the manipulable portion is associated with the blocking member to move the blocking member to enable movement of the trigger to the firing position . the movement of the trigger with respect to the firing position preferably moves the manipulable member to the safety position , and preferably the movement of the trigger to the firing position moves the manipulable member to the safety position . the manipulable portion is moved in a first direction from the release position to the safety position , and the trigger is preferably moved in substantially the first direction towards the firing position to activate the energy source . the manipulable member is preferably moved to cause resilient movement of the blocking member from the blocking position . the blocking member itself is naturally resiliently spring - biased toward the blocking position . a latch member is preferably interposed with the firing mechanism for preventing the activation of the energy source , and the trigger is moved to the firing position to release the latch member from the firing mechanism to enable the activation of the energy source . the preferred location of the safety member and the trigger is near an axial end of the injector opposite from the nozzle , with the safety member and trigger mounted on a portion of the injector that is rotatable with respect to the nozzle to load the insulin into the chamber . a housing of the injector used in the preferred method is associated with the trigger and has an axial cross - section that is generally triangular to facilitate the patient &# 39 ; s grip during operation of the injector . the axial cross - section of this embodiment has rounded sides for comfortably holding in the patient &# 39 ; s or other user &# 39 ; s hand . this axial cross - section also comprises a lobe protruding at each apex of the cross - section configured and dimensioned for fitting adjacent the inside of the patient &# 39 ; s knuckles during the injection . a preferred housing associated with the trigger has an elastomeric surface disposed and configured for facilitating the users &# 39 ; grip and control of the injector during the injection . to facilitate the loading of the insulin into the injector , the complexity of motions is minimized to connect an adapter to the injector to load the insulin . in a preferred method , the adapter is attached to the needless injector to place an insulin passage of the adapter in fluid communication with the jet nozzle . the attaching preferably includes pushing the adapter against the nozzle without substantial relative rotation therebetween to engage the adapter and nozzle with respect to each other to keep the insulin passage in fluid association with the nozzle . the insulin chamber of the injector is then filled through the adapter and nozzle . the preferred adapter used has a first engagement portion , and the injector has a second engagement portion . one of the engagement portions is resiliently displaced by the other engagement member when the adapter is moved against the nozzle . this causes the one engagement member to move to an engagement position in which the first and second engagement members are engaged with each other to keep the insulin passage in fluid communication with the nozzle . preferably , the nozzle has an axis and attaching the adapter involves pushing the adapter against the nozzle so any relative rotation therebetween is at an angle of at most about 15 ° tangential to the axis . to achieve this , the at least one of the injector and adapter can have a slot , with the other having a protrusion that is received in the slot during the attachment . the slot is preferably substantially straight and configured for guiding and retaining the protrusion when the adapter is attached with the nozzle . in a preferred embodiment , the nozzle is attachable to a power pack portion of the injector by relative rotation therebetween as noted above , the most preferred jet injector for the invention is the antares pharma vision needle free injection device although other jet injectors with similar features can be used if desired . referring to fig1 , a preferred embodiment of an inventive needleless jet injector has an actuating mechanism 30 , preferably at a proximal side of the injector . this jet injector is the antares pharma vision device . the actuating mechanism 30 preferably includes a proximal injector housing 1 attached to a sleeve 23 , which can by rotated relative to distal injector housing 9 . the actuating mechanism 30 has a prefiring condition , which is shown in fig1 . in this position , a trigger wall 20 of trigger button 10 retains a latch member , such as balls 8 , interposed between a housing latch 15 , which is preferably fixed with respect to the sleeve 23 , and firing ram 7 . in the prefiring condition , ram 7 retains firing spring 6 in compression . at the forward , distal end of the injector is a nozzle assembly 50 that includes an insulin chamber 52 , configured for containing insulin to be injected . a plunger 45 , including seal 46 that seals against the wall of the insulin chamber 52 , is received in the chamber 52 and is shown in a preloading position . the nozzle assembly 50 includes a jet nozzle orifice 54 configured for firing the insulin from the chamber 52 in a fluid jet sufficient to penetrate tissue of the patient to an injection site . preferably , a skin contacting protrusion , such as ring 55 , extends around the orifice 54 to apply pressure on a predetermined area around the skin to improve insulin delivery to the injection site . to fill the injector , an adapter 70 is attached to the distal end of the injector , preferably to nozzle 50 , as shown in fig2 . referring to fig2 - 4 , the adapter 70 has a nozzle attachment sleeve 72 that is configured to receive nozzle 50 and to form a seal therewith . the attachment sleeve 72 and the nozzle 50 have engagement members , which preferably include a post 74 or other protrusion , preferably extending from the nozzle 50 , and a resiliently biased catch 76 . the catch 76 is disposed adjacent to and facing slot 78 formed in the sleeve 72 . the slot has a width preferably corresponding to the tangential width of the post 74 to guide the post 74 as it is inserted into the slot 78 and to hold the post 74 in engagement against the catch 76 . the catch 76 has front and rear ramps to enable the post 74 to be pushed in or out of engagement therewith , and extends from a resilient portion 82 of unitary construction with the sleeve 72 , opposite an opening 80 to provide resilience and spring characteristics to the resilient portion 82 . the resilient portion is preferably attached to the remainder of the sleeve 72 at two axial ends on opposite sides of the catch 76 . to attach the adapter 70 to the nozzle 50 , the patient or other user pushes the adapter 70 against the nozzle , preferably without substantial relative rotation therebetween . this facilitates the engagement of the adapter 70 and nozzle 50 by the patient , preferably without requiring complex motions in various directions or substantial twisting motions . thus , the slot 78 is preferably substantially straight , and any relative rotation between the nozzle 50 and adapter 70 is preferably at a pitch angle of at most about 15 ° tangential to the axis and more preferably at most about 10 °. in addition , the snap fit of the engagement portions provides the patient or user with an indication that the adapter is properly attached to load insulin into the insulin chamber 52 . preferably , the nozzle 50 is attached by a bayonet fitting to the power pack 51 of the injector , which includes the housings 1 , 9 , the energy source , and the actuating mechanism 30 . the bayonet fitting includes lugs 53 on the nozzle 50 and walls 57 within the distal housing 9 . to attach the bayonet fitting , the nozzle 50 is pushed into the distal housing 9 , and then rotated to engage the lugs 53 behind a wall 57 of the power pack 51 . preferably , the motion of the adapter 70 relative to the nozzle 50 to attach the adapter 70 is in a different direction than the motion to attach the nozzle 50 to the power pack 51 , and preferably only one of these attachment motions requires any substantial twisting . this reduces potential confusion of the user about whether the adapter 70 and the nozzle 50 are attached properly . when the adapter 70 is attached to the injector , an insulin passage 84 of the adapter 70 is in fluid communication with the jet nozzle orifice 54 . the insulin passage includes a needle bore of needle 86 , which extends into an ampule attachment portion 88 of the adapter 70 . the ampule attachment portion 86 is configured for association with an ampule 90 to extract the contents of the ampule 90 , which is preferably insulin , for delivery to the chamber 52 . tabs 92 of the - ampule attachment portion 90 extend inwardly from an outer support 94 of the ampule attachment portion 86 and are resilient to engage en enlarged end of the ampule 90 . when the ampule 90 is attached , the needle 86 pierces an end of the ampule 90 , such as a rubber seal 96 , and allows the transfer of the contents of the ampule 90 to the injector . with the adapter 70 attached , the sleeve portion 23 is rotated with respect to the distal housing 9 about threads 24 to draw the plunger 45 distally with respect to the nozzle orifice 54 , drawing medication into the ampule chamber 50 . to purge any air that may be trapped in the chamber 52 , the injector is held upright with the nozzle 50 facing up , and the sleeve 23 is turned slightly in the opposite direction . during filling , the desired dosage of the medication is withdrawn into the chamber 52 can be measured by reading a number printed on the sleeve 23 through a window 26 . referring to fig5 , once the insulin is loaded into the chamber 52 , a safety mechanism 98 keeps the injector from firing unintentionally . the safety mechanism 98 of the preferred embodiment includes a slider 100 that is manipulable by user . the slider 100 is disposed in the proximal portion of the injector and mounted to the proximal housing 1 at a distance from the portion of the trigger button 10 that is pushed to fire the injector selected , so that the slider 100 and the trigger button 10 can be operated by the same hand or finger , preferably while the injector is grasped by the patient in a manner that will enable positioning and firing of the injector into the injection site . a blocking member 102 is shown disposed in a blocking position in which it prevents movement of a portion of the trigger , such as the trigger button 10 , from moving to a firing position to fire the injector . the preferred blocking member 102 comprises a resilient plate that is biased inwardly behind a portion of the sleeve 100 and which is mounted to proximal housing 1 . a blocking portion 104 of the blocking member 102 preferably abuts and is biased against the trigger button 10 , and is stably receivable within recess 106 of the trigger button 10 . when the slider i 00 is slid rearwardly with respect to the proximal housing 1 , one or more sloped portions 108 on the slider 100 and / or blocking member 102 cause the slider 100 to move the blocking member 102 radially outwardly , radially past the adjacent portion of the trigger button 10 , preferably by camming , to allow the trigger button 10 to be moved forward to the firing position . the slider preferably includes a bump 110 extending radially outwardly which interacts with an inwardly extending foot 112 of the blocking member 102 to retain the slider 100 and the blocking member 102 in the respective positions to enable firing of the injector when the foot 112 is positioned forward of the bump 110 resting against the outside of the slider 100 . the trigger button 10 can now be depressed in a forward direction past the blocking member 102 , compressing the trigger spring 11 . in the prefiring position , the trigger button 10 retains balls 8 received in locking recess 114 of ram extension 35 , interposed with housing latch 15 to prevent firing motion of the ram 7 . when the trigger button 10 is moved forward , the balls 8 are pushed out from the locking recess 114 into trigger recess 116 , which is preferably a circumferential groove , releasing the ram extension 35 and ram 7 , which are driven forward by the compressed spring 6 , causing the plunger 45 to eject the insulin from the chamber 50 . in moving of the trigger button 10 to the firing position , a forward - facing portion of the trigger button 10 preferably contacts and moves the slider 100 forward from the release position to the safety position . when the trigger button is released by the user , spring 11 biases and moves the trigger button 10 back to the prefiring position , and the blocking member 102 is allowed to resiliently returned to the blocking position , and the safety mechanism is thus automatically reactivated . in the preferred embodiment , the slider 100 is moved in a first direction , such as distally , from the release position to the safety position , and the trigger button 10 is moved substantially in the first direction towards the firing position to activate the energy source . referring to fig6 - 8 the rear housing 1 preferably has an axial cross - section that is generally triangular for facilitating the patients grip during operation of the injector . the cross - section is preferably rounded , with convex sides 116 , to comfortably hold in the patient &# 39 ; s hand . a lobe 118 protrudes at each apex of the triangular cross - section . the lobes are also preferably rounded and dimensioned for fitting adjacent the inside of the patient &# 39 ; s knuckles during the injection and operation of the injector . preferably , an elastomer or member surface is disposed at the lobes 118 to improve the user &# 39 ; s grip . in other embodiments , the elastomeric surface can be disposed over substantially all of the surface that is locate to come into contact with the user &# 39 ; s hand during the injection or over substantially the entire rear housing 1 . the height 120 of the cross - section from a lobe 118 to an opposite side 116 is preferably about between 0 . 75 in . and 1 . 5 in ., and more preferably around 1 in . the axial length of the injector is preferably about between 5 in . and 10 in . in general , the preferred injectors , including the antares pharma vision and similar injectors , administer medication as a fine , high velocity jet delivered under sufficient pressure to enable the jet to pass through the skin . because the skin is a tissue composed of several layers and the injector is applied to the external surface of the outermost layer , the delivery pressure must be high enough to penetrate all layers of the skin . the layers of skin include the epidermis , the outermost layer of skin , the dermis , and the subcutaneous region . the required delivery pressure is typically about 2500 psi to 3500 psi . preferred embodiments of the invention are now illustrated by way of the following examples . fifteen type 1 diabetic subjects were included in a study of insulin injection using a antares pharma vision jet injection device . the subjects were eight females and seven males with the following profile : mean age of 30 ± 6 years , mean diabetes duration of 10 ± 5 years , mean body mass index ( bmi ) of 24 . 3 ± 2 . 2 kg / m 2 , as well as mean blood pressure ( bp ) of 125 ± 4 mm hg systolic and 75 ± 5 mm hg diastolic . each of the individuals also had been intensively treated since diabetes diagnosis , and the subjects had a mean daily insulin dose of 33 ± 6 u . i . informed consent was obtained from each subject for continuous subcutaneous glucose monitoring using the minimed continuous glucose monitoring system ( cgms ). the duration of the study of the subjects was three days . during the first day , each subject used a novopen demi - pen device to inject regular human insulin 30 minutes before breakfast , lunch , and dinner . during the second day , each subject used the antares pharma vision jet injection device to inject regular insulin . finally , on the third day , each subject again used the pen device to inject regular insulin . during the study , the insulin / carbohydrates ratio was 1 / 15 cho , and the mean content of the diet was 430 ± 30 kcal at breakfast , 860 ± 55 kcal at lunch , and 660 ± 45 kcal at dinner , all composed of 56 % cho , 19 % proteins , 25 % fats . as shown in fig9 - 11 , the results of the study show that insulin administered by the jet injection device , in comparison to the pen device , produced a significantly lower ( p & lt ; 0 . 01 ) glucose profile from 45 to 255 minutes after breakfast - time injection , 45 to 270 minutes after lunchtime injection , and 45 to 240 minutes after dinner - time injection . the maximum blood glucose difference was at 105 minutes after breakfast and dinner , and at 150 minutes after lunch . a significant reduction ( p & lt ; 0 . 01 ) in area under the blood glucose curve can also be seen , without lesions in the injection site ( abdominal wall ) and without a loss in blood glucose control at the end of the dosing period . furthermore , a comparison of the blood glucose profile after administration of insulin with the pen device and the antares pharma vision jet injection device demonstrates that the antares pharma vision device produces quicker absorption of regular insulin compared to the absorption profile using the pen device , and concomitantly a significantly lower blood glucose profile without an increase in hypoglycemia after food ingestion . accordingly , compared to insulin administration with a needle , the vision jet injection device demonstrated that the blood glucose profile produced by jet injection of insulin was sustained for one year and that hba i c levels declined throughout the year of using jet injection . subjects with reasonable glycemic control as evidenced by hba1c (≦ 8 . 0 %) were able to achieve meaningful improvement after changing mode of insulin administration to jet injection . thus , a needle - free jet injection administration of insulin can be advantageous in reducing the risk of diabetes complications . this example was conducted to determine whether the improvement in glycemic profile observed in short - term studies of needle - free insulin administration , such as those of example 1 , could be sustained long term , resulting in improvement of hba1c levels . to document hba1c levels in subjects using the jet - injector and to measure their blood glucose profile after one year , the following materials and methods were used . five type 1 diabetic patients ( 3 females , 2 males ) had the following profile : age 34 ± 4 years , diabetes duration 9 . 5 ± 4 . 5 years , bmi 23 ± 1 . 2 kg / m2 , systolic bp 126 ± 6 and diastolic bp 76 ± 3 mmhg , daily insulin dose 36 ± 4 iu / day ( 70 % regular , 30 % nph ). all subjects consented to periodic hba1c evaluations and 72 - hours continuous subcutaneous glucose monitoring . a baseline glucose profile was obtained while subjects used the novopen demi - pen needle device . subjects were switched to a jet - injector for one year , and a blood glucose profile was then obtained at one year . the monitoring periods were performed during working days , with the consumption of a stable diet ( breakfast 430 ± 30 , lunch 860 ± 55 , dinner 660 ± 45 kcal ) with 56 % carbohydrates , 19 % proteins , 25 % fats ) and minimal physical activity . regular - insulin was injected 30 minutes before food consumption , and nph was injected at bedtime . results : hba1c levels decreased from 7 . 3 ± 0 . 4 % at baseline to 6 . 7 ± 0 . 4 % after six months and 6 . 3 ± 0 . 2 % after one year ( see fig1 ). this is a reduction of over 8 % after 6 months and about 14 % after one year . daily glucose profiles observed at the end of one year of jet - injection consistently showed lower postprandial blood glucose compared to the baseline ( see fig1 ). conclusion : subjects experienced a continuous decline in hbalc over one year of jet - injection insulin therapy . improvements in the blood glucose profile using a jet - injector could be demonstrated with continuous monitoring . the management of nocturnal nph insulin is commonly a problem for type 1 diabetic patients because of hypoglycemia risk . the use of a jet injector reduces nocturnal glucose levels and thus reduces the hypoglycemia risk . to compare nocturnal blood glucose after nph insulin administered alternatively with a pen device ( novopen demi - pen needle device ) and a needle - free jet - injector ( antares pharma vision ® injector device ), the following materials and methods were used . 15 type 1 diabetic subjects ( 7 males , 8 females ), age 31 ± 4 and diabetes duration 9 ± 4 years , bmi 23 . 5 ± 1 . 8 kg / m2 , systolic bp 130 ± 4 and diastolic bp 78 ± 4 mmhg , were intensively treated since diabetes onset ( 43 ± 5 i . u . insulin — nph typically 30 % of the total ). the mean hba1c values were 7 . 0 ± 0 . 4 %. these subjects consented to 72 - hour continuous subcutaneous glucose monitoring ( minimed ® cgms device ) and to use the pen device the first and the third night and the vision jet injector the second night of the study . all subjects received nph in the upper arm at 11 : 00 pm each night . all the patients otherwise maintained consistent activity , insulin dose and diet during the study . results : blood glucose after using the jet injector was significantly lower than that with a pen device between 12 : 45 am to 3 : 15 am and between 5 : 30 am and 8 : 30 am ( p & lt ; 0 . 01 ) ( see fig1 ). thus , blood glucose reductions were maintained for a period of about 5 to about 8 hours while the patient was sleeping and otherwise inactive . the pen device produced lower but not statistically different blood glucose levels between 4 : 00 am and 5 : 00 am . no hypoglycemic episodes were recorded during the study . conclusions : the nighttime blood glucose profile was improved using the jet - injection compared to a pen device . blood glucose control with jet injection was superior at the end of the dosing period , and the blood glucose nadir was less pronounced after jet - injection . specifically , compared to insulin administration with a needle , the antares pharma vision jet injection demonstrated lower average blood glucose level through the night and a less - pronounced blood glucose nadir in the early morning hours . thus , the use of the vision device resulted in a superior blood glucose profile compared to that obtained by using a pen needle . most notably , the risk of nighttime hypoglycemia can be reduced when using the vision device . also , needle - free administration of nph insulin was well tolerated by all subjects . while it is apparent that the illustrative embodiments of the invention herein disclosed fulfill the objectives stated above , it will be appreciated that numerous modifications and other embodiments may be devised by those skilled in the art . therefore , it will be understood that the appended claims are intended to cover all such modifications and embodiments which come within the spirit and scope of the present invention .

US-11731705-A

a toy furniture device adapted to be converted from a couch arrangement to a fold - down bed arrangement . the device includes a main frame member within which a bed member is pivotably supported , the bed member being pivotably movable between a stored position within the main frame member and a folded - down position wherein it extends substantially perpendicularly from the main frame member . a couch frame cooperates with a couch back portion defined on a bottom panel of the bed to define a couch configuration with a vertical wall therebehind when the bed member is in the stored position . in the folded - down position of the bed member , the couch frame is disposed below the bed member so as to support same and a panel of the main frame member defines a decorative vertical wall .

with reference to fig1 there is shown a toy furniture device according to a preferred embodiment of the invention . the device includes a box - shaped main frame member 1 having an upper side wall 1a , a left side wall 1b , a right side wall 1c , a lower side wall 1d and a back panel 1e which is joined to each of the side walls to define an open box configuration of main frame 1 . the walls and back panel of the main frame 1 are desirably fabricated of a lightweight but sturdy rigid wood or plastic sheet material . preferably , both the inner and outer surfaces of each of the side walls of main frame 1 have a decorative covering applied thereto , while the inner surface of back panel 1e is decorated with a wall covering material , such as wood panelling , wall paper or the like . as also shown in fig1 the toy furniture device according to the invention includes a bed member 2 which preferably has a closed - box configuration defined by a bottom foundation panel 2a , right and left side walls , a foot side wall 2b , a head side wall 2c and an upper mattress defining wall 2d . the right and left side walls of bed 2 are respectively pivotably attached at 3 to the right and left side walls of main frame 1 , adjacent the head side wall 2c of bed 2 , such that the head portion of bed 2 is disposed within main frame 1 in both the stored and the folded - down positions of bed 2 as shown in fig1 . the bed 2 is also desirably fabricated of a lightweight but sturdy wood or plastic sheet material , and preferably has a decorative covering which simulates a conventional bed linen material , such as a bedspread . extending upwardly from head side wall 2c of bed 2 is a head board portion 2e which is decoratively covered to simulate a conventional head board . as shown in fig1 when the bed 2 is folded down to define the bed configuration of the toy furniture device according to the invention , the head board 2e extends upwardly within main frame 1 , forwardly of the decorated back panel 1e which defines a decorative vertical wall surface rearwardly of bed 2 in its folded - down position . when bed 2 is pivoted upwardly to its stored position within the main frame 2 , the head boad portion 2e extends substantially adjacent and parallel to an inner surface of the lower side wall 1d of main frame 1 . in the stored position of bed 2 , i . e ., when it is pivoted upwardly so as to be disposed entirely within main frame 1 ( shown in dashed line in fig1 ), the overall configuration of main frame 1 becomes a closed - box one , with the rear or bottom side of foundation panel 2a of bed 2 defining a vertical wall surface as shown most clearly in fig3 . to this end , such bottom side of foundation panel 2a is preferably covered with a decorative wall covering material , such as panelling or wall paper , etc . to aid in pivotal movement of bed 2 between its folded down and stored positions , a knob 4 ( fig4 ) is provided on an upper surface portion of bed foundation panel 2a . a pair of latch members 5 are mounted adjacent upper respective ends of the left and right side walls 1b , 1c of main frame 1 , such latch members being pivotable to the horizontal position shown in fig4 to retain bed 2 in its stored position within main frame 1 . latch members 5 are pivoted to a vertical orientation thereof when it is desired to pivot bed 2 to its folded - down position . the toy furniture device according to the present preferred embodiment of the invention further includes a couch frame 6 having a width dimension which is slightly greater than that of bed 2 . the couch frame 6 includes a lower foundation portion 6a with right and left side arm portions 6b extending upwardly therefrom . the lower foundation portion 6a of couch frame 6 is dimensionsed to fit closely below the bottom foundation panel 2a of bed 2 so as to support bed 2 in the folded - down position thereof , as shown in fig1 . with the bed 2 thus moved to the folded - down position thereof , the side arm portions 6b are disposed adjacent the respective outside surfaces of the right and left side walls of bed 2 . a couch cushion 6c is preferably removably disposed on couch foundation portion 6a , and is removed when bed 2 is to be moved to its folded - down position so that the couch foundation portion 6a can directly support the bed 2 thereon . to complete the couch configuration according to the invention , a couch back portion 7 is integrally provided on the rear or bottom side of bottom foundation panel 2a of bed 2 , as shown in fig3 and 4 . the couch back portion 7 is formed with a fabric which matches or coordinates with that with which the couch frame 6 is covered , and may be glued or otherwise affixed to the bottom side of foundation panel 2a . the couch back 7 is dimensioned and arranged to operatively cooperate with couch frame member 6 to define an overall couch configuation when couch frame member 6 is disposed adjacent foundation panel 2a as shown in fig3 and 4 . in such couch configuration , the remainder of foundation panel 2a above couch back 7 defines a decorative vertical wall surface rearwardly of the couch . by virtue of the foregoing construction , a child may readily convert the device according to the invention from a bed configuration to a couch configuration , and vice versa , as often as is desired . when the device is in the couch configuration thereof as shown in fig3 and 4 , the child has merely to remove couch cushion 6c , move the latches 5 to the vertical positions thereof , and pull on the knob 4 to pivot the bed 2 downwardly to the folded - down position shown in fig1 and 2 , with the couch frame 6 supporting bed 2 as described above . in such bed configuration , the couch frame 6 is preferably moved somewhat away from the main frame 2 , by a distance corresponding to the height of couch back portion 7 , as shown in fig1 . to change back to the couch configuration of the invention , the child merely reverses the foregoing sequence of operations . if desired , the toy furniture device according to the invention may also be provided with an auxiliary matching chair 8 , covered with a fabric which matches or is coordinated with the fabric of the remaining components of the device . in this respect , it is desirable that the fabric employed for covering bed 2 either matches or coordinates with that employed for covering the couch frame and cushion , and further that the remaining decoratively covered portions of the device be color coordinated with such fabric to thus present an overall aesthetic appearance for the device . it will be understood from the foregoing that conversion from the couch configuration to the bed configuration of the invention can be readily accomplished by even a young child , and the novelty afforded by such operations can provide the child with many hours of playing enjoyment . further , the above - described cooperation between the main frame 1 , bed 2 and couch frame 6 provides a simplified and compact construction wherein two entirely different furniture configurations can be obtained , each of which will have a decorative vertical wall surface exposed to view . exemplary dimensions of the various components according to the foregoing preferred embodiment of the inventions are as follows . the main frame 1 may be approximately 17 inches high , 15 inches wide and 6 inches deep . the bed member 2 may be approximately 14 inches long and 143 / 4 inches wide , to thus fit closely within main frame 1 . the couch frame may be approximately 15 inches wide , and the couch back defined on bed foundation panel 2a preferably extends approximately 5 inches above the couch cushion 6c when it is disposed on frame 6 in front of panel 2a as shown in fig4 . the bed pivot point 3 ( fig1 ) is approximately 33 / 8 inches from the bottom of main frame 1 and 51 / 4 inches from the rear side thereof . it will be understood , however , that such dimensions are merely exemplary , and may be altered as desired , provided that the interaction between the various component parts as described above is retained . although there has been described what is at present considered to be the preferred embodiment of the invention , it will be understood that the present invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the present embodiments are therefore to be considered in all respects as illustrative , and not restrictive . the scope of the invention is indicated by the appended claims rather than by the foregoing description .

US-72688185-A

a make up kit comprises a base material in which colorants may be mixed to achieve desired hues that may then be applied to a person . the kit may further comprise a mixing dish in which the make up may be mixed and an instructional aide that instructs users on how to mix the make up paints and apply the paints .

the present invention comprises a make up kit , illustrated generally at 10 in fig1 . the make up kit 10 is well adapted for retail sale , and may comprise a header card or other package 12 with aperture 14 designed to hang from a conventional retail stock hook . transparent blister cover 16 may cover header card 12 and comprise pockets 18 sized and shaped so as to accommodate make up materials 20 therewithin and hold make up materials 20 against header 20 card 12 as is well understood . other types of securing means may also be used such as stretchable or elastic bands that hold make up materials 20 against header card 12 . tape or other adhesives such as rubber cement may be used as needed or desired . header card 12 may comprise printed indicia thereon ( not shown explicitly for clarity ) that may comprise a trademark or logo , instructions , colorful graphics or the like . make up materials 20 may comprise a base material 22 , colorants 24 , an applicator 26 , a mirror 28 , and the like . while nice accessories , applicator 26 and mirror 28 are optional . further , it should be appreciated that the make up kit of the present invention contain a paint brush , sponge or other type of applicators . also present , perhaps sandwiched between blister cover 16 and header card 12 is an instructional guide 30 and mixing dish 34 . instructional guide 30 may be a compact disc ( shown ) or a printed pamphlet . as would be expected , base material 22 and colorants 24 may be positioned within containers . these containers may be squeeze tubes , paint pots , or the like as needed or desired . additionally , an empty container 32 may be provided in which to mix base material 22 and a desired colorant 24 . the base material 22 may comprise a conventional cream , grease or powder of a beige or off - white tone . also contemplated are tablets or powders that may be mixed with water to form the base . colorants 24 may comprise color concentrates . these concentrates may be in drop form , paste form , gel form , powder form , liquid form or the like . when mixed with base material 22 in empty container 32 or a mixing dish 34 , a make up paint is formed which may be applied to an individual . in an exemplary embodiment , colorants for blue , red , yellow , black , white , brown , purple , and the like may be included . in addition , glitter and sparkles may be included . applicator 26 may comprise a brush , a sponge , or other type of tool appropriate for mixing and / or applying compositions . instructional guide 30 , as previously indicated may be a compact disc , a pamphlet or the like . instructional guide 30 comprises detailed step by step instructions on mixing the base material 22 with colorants 24 to achieve desired hues as well as instructions and examples of make up schemes that may be copied to achieve desired appearances . for example , one set of instructions within instructional guide 30 may comprise instructions on how to create a desirable green hue and instructions on how to create a frankenstein - like monster . other creatures , clown faces , and the like are also contemplated . in the event that instructional guide 30 is a compact disc , it may be loaded onto a computer or similar data processing device and the instructions viewed on a monitor or display as needed or desired . an exemplary flow chart of how a user may use make up application kit 10 is illustrated in fig2 . specifically , a user may purchase the make up application kit 10 from a store or the like ( block 100 ). in the event that instructional guide 30 is a compact disc , the instructional guide 30 is loaded onto a computer ( block 102 ). suitable software launches the instructional guide 30 and the user may be allowed to select from several predetermined appearances ( block 104 ). for example , a clown , a goblin , a pirate , or the like may all be listed in a menu format and the user may select one . alternatively , thumbnail sized pictures may be presented and link to the desired instructions . other software arrangements are possible . once a desired appearance is selected , the user may view the instructions on making the needed colors for the desired appearance ( block 106 ). these instructions may include ratios and volumes of base material 22 to colorants 24 as well as mixing instructions . in one embodiment , the mixing instructions may comprise a brief video clip that illustrates how the materials should be mixed . intermixed with the mixing instructions , or presented after the mixing instructions the application instructions may be provided ( block 108 ). specifically , the user may be shown how to apply the make up in a manner that is designed to increase the likelihood that a make up job looks like the intended appearance . for example , the user may be shown how to make a happy clown face and where to apply the red make up over the white make up and how to highlight cheek bones or the like . tricks on how to make realistic looking scars and the like may also be presented for more ghoulish make up jobs . again , this may be done with video clips , pictures , audio clips , and the like . when instructional guide 30 is a printed item , the same instructions may be provided , albeit in a static form . the user may turn the page as appropriate to learn the next step in the process and refer to pictures or drawings which illustrate the mixing of the make up and the application thereof to a user . [ 0020 ] fig3 illustrates an exemplary screen shot from the compact disc as a user might see it . in the screen shot , a manikin goes through various stages as the make up is applied . other arrangements are also possible and this illustration is intended to be illustrative and not limiting . the present invention may , of course , be carried out in other specific ways than those herein set forth without departing from the scope and the essential characteristics of the invention . the present embodiments are therefore to be construed in all aspects as illustrative and not restrictive and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein .

US-4786902-A

an exercise and rehabilitation apparatus is provided having resistance load units comprising a resistance drum rotabably coupled to a user crank handle mechanism , a friction strap surrounds the resistance drum wherein the level of friction resistance between the drum and the resistance load unit housing is user selectable thereby selecting the force required to rotate the user crank . once user adjusted the resistance load unit provides a constant load to the user crank . resistance load units are mounted opposingly providing a left and right hand user crank . a variety of user crank embodiments are provided for simulating the forces and motion experienced by a user in various sporting , exercising and rehabilitation user activities .

although particular embodiments of the invention have been described in detail for purposes of illustration , various modifications may be made without departing from the spirit and scope of the invention . where examples are presented to illustrate aspects of the invention , these should not be taken as limiting the invention in any respect . referring now in greater detail to the various figures of the drawings wherein like reference characters refer to like parts , there is shown in a perspective view at 30 in fig1 , a new type of exercise , fitness and rehabilitation machine . referring to fig1 , a perspective view according to the present invention , the exercise apparatus 30 comprises left and right constant load resistance units 40 and 42 each having a central shaft 44 , opposingly and symmetrically fixed at the proximate end to opposing sides of a mounting plate 46 arranged perpendicular to the central shaft 44 of the resistance units 40 and 42 , each resistance unit having a handle hub 48 , rotatably mounted at the resistance unit distal end and arranged to rotate around the central shaft , receiving a user crank 50 with a grip 52 wherein the resistance units respectively define the force required to rotate the respective handle hubs . the resistance units 40 and 42 each further provide a tensioner adjustment knob 54 facilitating a user to select the force required to rotate the handle hub 48 . mounting plate 46 is adaptable to receive a variety of optional mounting devices . referring again to fig1 wherein an embodiment of an optional vertical mounting stand 56 is illustrated . in the illustrated embodiment , the mounting plate 46 is perpendicularly fixed to a mounting bracket 64 received by the top end of the vertical member 58 of the optional vertical mounting stand 56 . the vertical member 58 is removably fixed at the bottom end to a plurality of ground support members 60 extending radially from the vertical member 58 . stabilizing plates 62 attached to the ground support members 60 extend perpendicularly from the ground support members 60 providing a platform for a user to stand upon to further stabilize the apparatus . it will be appreciated that various other means for mounting the apparatus may be utilized . details of the mounting bracket 64 are illustrated in fig2 and 3 wherein the mounting bracket 64 comprises a front plate 66 perpendicularly attached to the mounting plate 46 , a rear plate 68 rotatably disposed adjacent to the front plate 66 and being secured by mount shaft 70 disposed through central bores in the front and rear plates . as shown further in fig4 and 14 , the rotational position of the front plate 66 relative to the rear plate 68 is locked by the user utilizing mount bracket t handle bolt rotation lock 74 disposed as a set screw to bind the front and rear plates together to prevent rotation . a mounting sleeve 72 fixed to the rear plate 68 receives the top end of the vertical member 58 of the mounting stand 56 as in fig1 . a levered height lock 76 is threaded through the mounting sleeve 72 and disposed as a set screw to selectively bind the vertical member 58 within the sleeve 72 thereby securing the vertical height . a t handle safety pin 78 is arranged to penetrate the sleeve 72 and is received by bores in the vertical member 58 thereby insuring that the vertical height adjustment remains secure as in fig1 and 15 . an alternate embodiment of the optional vertical stand is illustrated in fig1 showing a wall mount stand 180 being received by the apparatus 30 of the present invention . it will be appreciated that the mounting bracket 64 is adaptable to receive a variety of optional mounting devices . again referring to fig2 showing a top plan view of the present invention , the left 40 and right 42 resistance units are comprised of the same elements and have identical assemblage . the units differ only in rotational restriction of the handle hubs 48 so as to provide complimenting left and right motion . the housings 82 of the units are mounted opposingly on the mounting plate 46 by housing fasteners 84 wherein the unit housing central shafts 44 are disposed in line with each other such that the handle hubs 48 rotate around the same axis . in fig3 , showing a right side elevation view , the handle hub 48 is fixed to the central shaft 44 by handle hub retainer fastener 86 and handle hub retainer washer 88 wherein the handle hub 48 and associated elements form the distal end of the unit 42 . the handle hub 48 receives a handle or user crank 50 and is gripped in place by the hub crank t handle bolt 90 . also visible is the hub rotation lock pin knob 92 attached to the hub rotation lock pin 94 that slides within a bore within the handle hub 48 and is selectively secured in position by the pin securing t handle bolt 96 being received by a threaded bore perpendicular to the pin bore in the handle hub 48 . a user rotates the user crank 50 around the axis of the resistance unit 42 . the resistance unit provides resistance to the rotation . as in fig5 , the amount of resistance is user selectable by rotating the tensioner knob 54 to a position corresponding to the load required . the tensioner knob 54 has load markings 102 wherein the selected indicia is rotated to the vertical position thereby setting the resistance load presented to the handle hub 48 . in fig5 , the load setting of twenty is shown selected at 104 . the essential component of the present invention is the resistance unit . a cross section of an embodiment of the resistance unit 100 is shown in fig6 , a view taken on line 6 - 6 of the left resistance unit 40 of fig2 . a resistance drum 106 having a cylindrical shape with the distal end being a plate 136 having a concentrically and longitudinally disposed cylindrical bearing housing 134 surrounding the central shaft 44 of the unit 100 . the drum 106 is free to rotate around the central shaft 44 and is secured in position at the proximate end by rear thrust washer 138 and a lock nut 140 received by threads on the central shaft 44 . a dog gear 108 is concentrically disposed and fixed on the plate 136 of the resistance drum 106 with the dog gear engagement teeth 110 arranged along the periphery and extending outwardly and perpendicularly from the resistance drum plate 136 . the dog gear 108 has a central recess forming a housing for a sprag clutch 150 centrally disposed within the housing . the sprag clutch is a typical one - way freewheel clutch with inner and outer races permitting rotation in one direction . the sprag clutch 150 is secured within the housing by a sprag clutch retainer ring 152 . a spline 154 , being secured in place by spline thrust bearing 156 , is in direct mechanical communication with the central portion of the sprag clutch 150 and engages the spline receiver 142 of the handle hub 48 wherein the sprag spline 154 is free to rotate around the central shaft 44 . as the housing of the dog gear 108 is contiguous with the resistance drum 106 , a mechanical linkage is formed from the handle hub 48 , through the spline 154 , through the sprag clutch 150 and to the resistance drum 106 . sprag clutches inherently permit rotation in one direction only therefore in one direction of rotation the handle hub 48 rotation is the same as the resistance drum 106 whilst in the opposite direction of rotation the handle hub 48 is free to rotate without engaging the resistance drum 106 . therein lies the only distinction between the left 40 and right 42 resistance units as the sprag clutch permitted rotation directions oppose each other . the user may optionally defeat the rotation of the sprag clutch 150 by engaging the rotation lock pin 94 with the dog gear teeth 110 . in the lock position , as illustrated in fig6 and 7 , the handle hub 48 and the resistance drum 106 must rotate together in both rotational directions of the handle hub 48 . in the unlocked position , as illustrated in fig8 , the rotation lock pin 94 is withdrawn into the handle hub 48 and does not engage the teeth 110 of the dog gear 108 . the sprag clutch 150 is therefore re - engaged and the rotation restriction is restored . the lock pin securing t handle bolt 96 provides the functionality of a set screw to secure pin 94 in place in the unlocked position as in fig6 and the locked position as in fig8 . the handle hub 48 being secured to the central shaft 44 by retainer fastener 86 is drawn against the hub bearing surface 144 of the resistance unit housing 82 by tightening the fastener 86 . a bearing material , being the handle hub bearing 98 , is disposed between the hub 48 and the bearing surface 144 to permit rotation of the handle hub 48 . the bearing material may be nylon or other similar materials . referring now to fig9 a cross section of the resistance unit 100 taken on line 9 - 9 of fig6 wherein the resistance generating elements are shown in greater detail . the outside circumference of the resistance drum 106 is polished to form a smooth resistance friction surface 146 . the bottom of the resistance band friction strap 132 surrounds the drum surface 146 . the strap 132 is formed from a fabric material having a friction coefficient with metal sufficiently to grasp the drum when pressure is applied to the strap whilst sufficiently low to allow the drum to rotate when no pressure is applied . the strap 132 is held in position around the circumferential surface of drum 106 by pinching and securing the material between flanges 126 of the resistance band 112 contacting the top side of the strap 132 thereby preventing the friction strap 132 from turning with the drum 106 . the resistance band 112 is constructed from flexible metal sheeting disposed around the strap 132 , resistance band shoe 124 and tensioner receiver 114 . the resistance shoe 124 is a plate having a curvature to complement the curvature of the drum 106 and is positioned against the outer surface of the friction strap 132 . the tensioner receiver 114 is a rectangular box shaped element disposed between the top of the resistance shoe 124 and the inside surface of the resistance band 112 . the tensioner knob 54 has a threaded shaft 118 inserted through the resistance unit housing 82 , through a bore in the resistance band 112 and received by a threaded bore through the tensioner receiver 114 wherein the distal end of the shaft 118 contacts the top surface of the resistance shoe 124 . turning the tensioner knob 54 threads the tensioner shaft 118 further into the tensioner receiver 114 pressing the tensioner receiver 114 against the inside surface of the resistance band 112 and also increasing the pressure of the resistance shoe 124 against the friction strap 132 . the resistance band 112 responsively tightens against the friction strap 132 around the resistance drum 106 . the combination of increased pressure on the resistance shoe 124 and the increased pressure from the resistance band 112 on the friction strap 132 increases the force required to rotate the handle hub 48 thereby accomplishing the selection of the constant load of the resistance unit 100 of the apparatus . as in fig1 , the resistance band 112 , being formed from a sheet of metal , has a flange 126 as each end . the flanges 126 are bolted together with flange fasteners 128 and flange fastener nuts 130 . the ends of friction strap 132 are disposed between the flanges 126 and secured by the fasteners . the length of the friction strap 132 is determined by the outside diameter of the resistance drum 106 wherein the friction strap 132 fits snugly against the friction surface 146 of the resistance drum 106 . an optional protective dust cover 120 around the tensioner knob threaded shaft 118 , is disposed between the housing 82 and the bottom of the tensioner knob 54 . optional shaft packing material 122 fills the voids within the dust cover 120 . returning to fig9 , the cross sectional view of the handle hub 48 depicted provides a view of the handle receiver bores 170 and 172 wherein bore 170 is intersected by crank t handle bolt 90 . various handle or user crank 50 types may be fitted to the handle hub 48 ; however , all handles types have round crank arm rods 160 and 162 that are received by bores 170 and 172 and secured in place by crank t handle bolt 90 performing the function of a set screw against the crank rod 170 as further illustrated in fig1 . the various user handle or crank embodiments interact with a user to simulate the motion and load experienced in various user sporting , exercising and rehabilitation activities . a first embodiment of the user crank 50 is illustrated in fig1 wherein the user crank arms are joined at the distal end by a user crank grip support 164 with grip 52 perpendicularly mounted on the support 164 . with the same embodiment installed on both resistance units 40 and 42 respectively , the user may optionally stand in front of the apparatus whilst rotating the cranks . an optional adjustable horizontal bench 116 as illustrated in fig1 may be utilized to facilitate interacting with the present invention from a supine , reclined or sitting user position . a second alternate embodiment 182 of the user crank is illustrated in fig1 wherein the crank comprises the requisite arm rods 188 received by a handle hub and having a leg strap 184 fixed to the distal end . the user straps their leg into the assembly thereby providing a load to the user &# 39 ; s leg as the leg rotates the handle hub . a grip handle 186 disposed between the arm rods 188 is further provided . the embodiment provides simulation of sporting activities including kicking a ball and motion for rehabilitation . a third alternate embodiment 190 of the user crank is illustrated in fig1 and is directed to rotator cuff exercising including simulation of load and motion associated with throwing and curls . an extendable rod 194 has a cylindrically shaped user grip 183 concentrically fixed to the distal end and is received by the arm 196 being fixed to the requisite crank rods 198 for attachment to the handle hub 48 . in fig2 , a fourth alternate embodiment 200 of the user crank is directed towards exercising the core muscle groups and comprises a single crank arm rod 202 mounted in the handle hub 48 through bore 170 and secured centrally along the length of the rod by crank t handle bolt 90 . the embodiment has a left grip 206 fixed to one end of the rod 202 and a removable right grip 204 at the opposing end allowing disassembly for purposes of installation in the handle hub . a fourth alternate embodiment 210 of the user crank is illustrated in fig2 directed to the simulation of load and motion as experienced whilst playing golf and batting . the embodiment comprises the requisite crank rods 212 received by a handle hub , the crank rods 212 jointed to the proximate end of a curve shaped circular extension arm 216 by swivel joint 214 , the distal end of the curved extension arm 216 further joined to the proximate end of a secondary extension arm 220 by a first flexible joint 218 , and the distal end of the secondary curved extension arm 220 further joined to the user grip 222 by a second flexible joint 208 . the various joints and swivel of the embodiment facilitate positioning of the user grip 222 to a golfing or batting position , and provide the flexibility allowing simulation of the corresponding activities . in fig2 , a fifth alternate embodiment 224 of the user crank simulates the loads and motions of a military press and comprises a left crank arm rod 228 received by the handle hub 48 of the left resistance unit 40 and a right crank arm rod 230 received by the handle hub 48 of the right resistance unit 42 . a push grip rod 226 is secured by bushings 234 in grip rod mounting plates 232 formed in the distal ends of the crank arm rods .

US-201514727841-A

a system for controlling anesthetic gases exhausting from anesthetic administering equipment is disclosed . the system is designed so as to regulate the anesthetic gases in a manner which isolates gases and prevents them from escaping into the operating room atmosphere . a manually controllable valve having a rubber diaphragm to control the flow of gases exhausted from the system is disclosed .

referring now to the drawings , fig1 shows a source of anesthetic gas 1 which is operatively connected to a face mask 3 via gas supply tube 5 . as an alternative to the face mask an endotracheal tube or other suitable device could be used . face mask 3 is connected to breathing bag 7 via a metal fitting 9 and a flexible breathing tube 11 . a manually controllable valve 13 is operatively connected to breathing bag 7 through the vent hole 8 in the bag . valve 13 is attached to an exhaust gas hose 15 which leads uninterrupted to an exit or external vent source , usually a suction system , outside the operating room . as used here , &# 34 ; outside the operating room &# 34 ; is understood to mean an actual vent which carries the gas to a location physically outside the room or to a closed reservoir or collection system located within the operating room . the important point is that with the system as disclosed the gases are isolated from escape into the operating room atmosphere under normal conditions . valve 13 is connected to breathing bag 7 through bag vent hole 8 as shown in fig2 . the valve consists of a cylindrically shaped hollow body 17 . body 17 is open at the top and defines an outwardly protruding lip 19 at its upper edge . a flexible diaphragm 21 made of a suitable elastomer and having a lip at its outer perimeter encloses the upper end of body 17 . a slideable gas inlet port 23 is mounted within valve body 17 and protrudes through hole 25 in the bottom of body 17 . inlet port 23 has an upper flange 27 and a lower flange 29 and is open throughout its entire length to provide a passageway for the flow of exhaust gases from bag 7 into the interior of body 17 . inlet port 23 is moveable along its longitudinal axis and spring - loaded within body 17 by spring 31 . this spring 31 must provide a large measure of upward bias in order to clamp and seal bag 7 as will be explained below . a gas exit port 33 consisting of a slightly tapered tubular flange is mounted on body 17 a plurality of ports 35 are cut into the side of body 17 . these ports are sealed from the inside with an elastomer flapper 37 . valve body 17 is mounted on breathing bag 7 by pressing downward on the upper end of port 23 at flange 27 and forcing flange 29 through the side vent hole 8 of bag 7 . after release of downward pressure on slideable port 23 the force of spring 31 compresses the edges of vent hole 8 of bag 7 between flange 29 and the bottom side of valve body 17 , thus effectively sealing the side hole of the bag . tube 15 is connected to exhaust port 33 of valve 13 and attached to an exterior vent which is usually a suction system ( not shown ). breathing bag 7 is connected to face mask 3 via tube 11 , fitting 9 , and to the source of gas 1 via line 5 . face mask 3 is placed upon patient &# 39 ; s face and the source of gas turned on . the system is now ready for use . as the patient breaths , exhaled anesthetic gas and vapors move from the face mask 3 down through tube 11 and into breathing bag 7 . gas flowing into bag 7 flows upward through inlet port 23 into the interior of valve body 17 and on out through exit port 33 , tube 15 , and out of the operating room or into an alternate closed collection system . now , if the physician wishes to increase the pressure and / or volume of anesthetic gases in breathing bag 7 , he merely presses a finger downward upon flexible diaphragm 21 , either partially or completely , closing off the upper end of inlet port 23 throttling the flow of exhaust gases out of the system . closing off the flow of gas from out of the system will result in an increase in volume and pressure within bag 7 . the physician may assist the patient in breathing by rhthymically squeezing the bag 7 . he may simultaneously control the volume and pressure in the bag 7 by manually pressing diaphragm 21 against all or part of the upper end of inlet port 23 . fingertip control of the flow of gases exhausted from the system is thus provided . in the event that negative pressure develops in valve body 17 , collapse of bag 7 is prevented , as the drop in pressure in the interior of valve body 17 will cause flapper 37 to move away from ports 35 and air from the operating room atmosphere will flow into valve body 17 through holes 35 . in an alternate construction without ports 35 and flapper 37 development of negative pressure in body 17 will cause diaphragm 21 to collapse against gas inlet port 23 and seal off the flow of gas . having described the preferred embodiment of my invention , it will be apparent to those skilled in the art that modifications and changes could be made in the design without departing from the spirit and scope of my invention .

US-63322575-A

a catheter having an outer profile which is formed such that a path length along an outer surface of the catheter is greater than the corresponding length of the catheter , and to a method for determining the shape of a catheter , and wherein the elasticity and / or conductivity of the tissue into which the catheter is to be introduced is taken into account in order to determine the outer profile of the catheter .

fig1 a shows a conventional catheter 1 and more particularly a dispensing portion thereof that is inserted into a body or tissue and which is provided with an opening through which an agent can be administered to the body or tissue , such as the opening 2 at the end of the catheter . the catheter is of uniform cross - section and has a center axis 3 extending parallel to the longitudinal direction of the catheter , such longitudinal ( penetration ) direction being indicated by the arrow 4 . in use , the dispensing portion of the catheter will be inserted into a body or tissue to administer a substance to a target area . the catheter opening 2 preferably is positioned relative to the target area such the substance will be delivered to the target area and the smallest amount possible to the area surrounding the target area . as above discussed , some of the substance exiting the opening will backflow along the outer surface of the catheter and away from the area to be treated . the extent of this backflow is indicated by the length l 1 which in the case of a conventional catheter will be equal the longitudinal length r 1 of a corresponding region of the catheter . fig1 b shows an exemplary catheter 5 according to the present invention and more particularly a dispensing portion thereof that is inserted into a body or tissue and which is provided with an opening through which an agent can be administered to the body or tissue , such as the opening 6 at the end of the catheter . as shown , the catheter 5 has a cross - section that is approximately constant along the length direction 7 of the catheter dispensing portion , like the prior art catheter of fig1 a . the catheter 5 , however , has an undulating shape where a central line or axis 8 of the catheter undulates along the longitudinal direction 7 up to the opening 6 at the end of the catheter . like the prior art catheter of fig1 a , the dispensing portion of the catheter 5 will be inserted into a body or tissue to administer a substance to a target area . the catheter opening 6 preferably is positioned relative to the target area such the substance will be delivered to the target area and the smallest amount possible to the area surrounding the target area . as above discussed , some of the substance exiting the opening will backflow along the outer surface of the catheter and away from the area to be treated . the extent of this backflow is again indicated by the length l 1 which length would be the same length of the backflow if the prior art catheter 1 were used given all other conditions being the same . unlike the case of a conventional catheter , the longitudinal extent r 2 of the backflow along the length direction 7 of the catheter will be less than the longitudinal extent r 1 of the backflow associated with the prior art catheter , this being the result of the undulating outer surface 5 a of the catheter . consequently , the backflow will extend from the opening 6 by an amount less than what occurs if a prior art catheter is used by the difference between r 1 and r 2 . as used herein , a longitudinal length is a length measured along the longitudinal extent of the catheter . a longitudinal surface length is a length measured along the outer surface of the catheter in the longitudinal direction . the center line or axial length is a length measured along the center axis of the catheter . accordingly , in the prior art catheter the longitudinal surface length and axial length will be equal to the longitudinal length of the catheter for a given longitudinal length of the catheter . in the catheter of fig1 b , the longitudinal surface length will be greater than the longitudinal length for a given longitudinal length of the catheter and this would also be true of the axial length of the catheter ( i . e , the length of the catheter measured along the catheter center line ) given that the catheter center line undulates like the outer surface . fig2 shows another exemplary catheter 10 that includes lateral openings 12 a , 12 b and 12 c for dispensing a substance supplied through the catheter 10 , wherein the substance exiting the openings 12 a , 12 b and 12 c only flows a distance l 2 from the respective openings . like the catheter 5 of fig1 b , the catheter 10 has an undulating shape or form that increases the length of the outer surface 10 a , such that the an end location l 2 end of the fluid flow remains closer to the respective openings 12 a , 12 b and 12 c than would be achieved using a conventional catheter . in other words , the flow length of the substance exiting each opening will be longer than the longitudinal extent of such flow . fig3 shows another exemplary catheter 20 with a distal lateral opening 22 . the catheter 20 has an undulating form or shape on a surface 20 a such as the catheters 5 and 10 of fig1 b and 2 . unlike the catheters 5 and 10 , however , the cross - section of the catheter 20 varies in the longitudinal direction 7 to form bulge and valley regions along the length of the catheter . fig4 shows a schematic diagram of a catheter 10 , for example , inserted along an injection channel or trajectory into the tissue 30 , wherein the catheter abuts the penetrated tissue 30 via its undulating outer side 10 a . openings for dispensing a substance may be located in the peaks or valleys of the catheter . a reverse flow channel r is formed between the catheter 10 and the tissue 30 , wherein the outer profile and / or the material of the catheter 10 is selected such that by taking into account the elasticity of the respective tissue 30 , the contact area between the outer surface 10 a of the catheter 10 and the tissue 30 is maximized , thereby minimizing the reverse flow channel r . further , it is advantageous to select the amplitude 32 of the undulating outer shape of the catheter 10 to be greater , the greater the elasticity of the tissue 30 ( e . g ., amplitude of the undulating shape is proportional to the elasticity of the tissue ). also , it is preferable that the undulation length or pitch ( period ) 34 of the outer surface 10 a of the catheter 10 be reduced if the elasticity of the tissue 30 is high . equation 1 illustrates an exemplary relationship between the catheter shape and elasticity of the tissue , wherein “ outer shape ” is the outer shape of the catheter , “ elasticity ” is the elasticity of the tissue , and c 1 and c 2 are constants . c 1 and c 2 can range between about 0 and 1 , preferably between 0 . 2 and 0 . 8 , and more preferably between about 0 . 4 and 0 . 6 . although the invention has been shown and described with respect to a certain preferred embodiment or embodiments , it is obvious that equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification and the annexed drawings . in particular regard to the various functions performed by the above described elements ( components , assemblies , devices , compositions , etc . ), the terms ( including a reference to a “ means ”) used to describe such elements are intended to correspond , unless otherwise indicated , to any element which performs the specified function of the described element ( i . e ., that is functionally equivalent ), even though not structurally equivalent to the disclosed structure which performs the function in the herein illustrated exemplary embodiment or embodiments of the invention . in addition , while a particular feature of the invention may have been described above with respect to only one or more of several illustrated embodiments , such feature may be combined with one or more other features of the other embodiments , as may be desired and advantageous for any given or particular application .

US-95022310-A

a measurement method of time varying events in a target body , including the steps of providing time dependent measurements signals of parameters of the time varying events in the target body , providing ecographic m - mode image data whose spatial direction is along scan - lines or along a line or curve on a 2d or 3d image of an image sequence , defining a time interval within which the measurement signal has to be displayed and / or evaluated , generating bi - dimensional graph information , generating bi - dimensional m - mode images , determining the time instant of begin of the time interval having a univoquely relation to time varying events , rescaling the time scale of each graph , and displaying the graph of the function corresponding to one or more of the time dependent measurement signal on a background .

for the purposes of promoting an understanding of the principles of the invention , reference will now be made to the embodiments illustrated in the drawings and specific language will be used to describe the same . it will nevertheless be understood that no limitation of the scope of the invention is thereby intended , such alterations and further modifications in the illustrated device , and such further applications of the principles of the invention as illustrated therein being contemplated as would normally occur to one skilled in the art to which the invention relates . the present invention is described by means of a specific application to the field of diagnostics and particularly to the field of cardiology . nevertheless this example has not to be considered as limiting the teaching of the present invention to such fields and the scope of protection to the said particular application disclosed as it is clear that the skilled person can adapt the method to different kinds of fields and / or targets without having to carry out other actions that applying the normal skills . consider that we have built one m - mode image , and that we have the data to be displayed on a xy graph by one or more functions y = f ( t ) as illustrated in fig3 and which functions refer to the time profile of quantities that correspond to the time interval of a image acquisition . as illustrated by fig1 and 2 such image can be a directly measured m - mode image , or a sequence of 2d images , or of 3d volumetric datasets . these techniques for generating m - mode images are known and disclosed for example in u . s . pat . no . 5 , 515 , 856 , issued may 14 , 1996 to olstad et al . ; u . s . pat . no . 5 , 820 , 561 , issued oct . 13 , 1998 to olstad et al . ; and u . s . pat . no . 6 , 589 , 175 , issued jul . 8 , 2003 issued to prater et al . such functions y = f ( t ) have been measured or calculated either independently from such image sequence or evaluated from the quantification of data contained in the image sequence . more particularly fig1 shows the space - time representation , or m - mode image , as recorded directly from a echocardiographic equipment . time is the horizontal axis , space is along a line in crossing the cardiac tissue . the space line position is shown on the top - right inset . timing of contraction and expansion can be read in this representation . fig2 shows the space - time representation , or m - mode image , as reconstructed from a sequence of echocardiographic images . time is the horizontal axis , space is along a curve crossing the cardiac tissue in two regions . the spatial curve position , shown on the left panel , is constructed such that the space curve crosses two left ventricular tissue elements , the annulus and the anterior mitral valve leaflet . a curve thickness of 5 points ( 2 per each side ) has been used to obtain an improved m - mode representation . as illustrated in fig2 , further to obtaining the m - mode image data from direct ultrasound signal along a scanline , or along one line or curve drawn over one or more frames of an image sequence , of 2d images or 3d datasets , as a further improvement for the quality of the m - mode image , the line or curve can have a thickness larger than that of a single pixel and the signal is built by extracting the average value across such a thickness . this technique is disclosed with greater detail in ep 03 42 5639 ( esaote spa , amid srl ) filed on sep . 30 , 2003 . once the m - mode image has been reconstructed or generated , the m - mode image is taken to be the background over which the xy graph is plotted . an example of such xy graphs of time dependent functions y = f ( t ) is illustrated in fig3 . to achieve this the horizontal , time direction , is adapted such that the size of the m - mode is the same of that of the xy graph along the same time limits . the vertical , space direction , size of the m - mode can be expanded or shrunk , or the image cropped , such that it properly fits in the size of the xy graph along the desired limits . in this way the y = f ( t ) curves , in a xy display , is plotted on a background made of the m - mode image . the functions y = f ( t ) can be obtained by direct measurements of parameters by means of probes which are sensible to such parameters or can be obtained by further elaborating one or more time dependent measurement signals in order to extract from them a part of the recorded information which is considered relevant . as this is the case for the functions representing the time dependent evolution of the left ventricular volume in fig4 and the time dependent evolution of the myocardial strain ( tissue shortening / elongation ) on two regions of the left ventricle wall , namely the intraventricular septum ( ivs , light gray ) and the lateral wall ( lw , dark gray ) in fig5 . this quantities can be obtained for example by a method disclosed in ep 1 522 875 and / or ep 1 520 517 ( esaote spa , amid srl ) by using also the data collected by means of m - mode or b - mode ultrasound imaging . for further improvement of the quality and readability of the resulting image , the colors of the m - mode image can be changed from the original ones , if any , by changing color palette or by adjustments , like contrast , brightness , gamma , equalization , or any linear or nonlinear filtering procedure . similarly , the xy curves colors can be changed from the original , if any , or modified in drawing specification . the result is a graphic xy display , on a background m - mode , two example are shown in fig4 . the example of fig4 shows how the method according to the present invention permits to evaluate quantities that could not be accessible otherwise . in this case the time delays between the electrical start of diastole , the mechanical start , and the valvular opening , that are known to be related to the physiological function of the left ventricle are evaluated . the evaluation of proper timings and the delay between contractile or relaxation events in different regions of the left ventricle is known to be of primary importance in the diagnosis of cardiac synchronicity and subsequent resynchronization therapy , like implant of pace - maker . fig4 illustrates the xy display of the evolution of the left ventricular volume , with ecg , drawn on a background of a space - time representation , or m - mode image , constructed such that the space curve crosses two left ventricular tissue elements , the annulus and the anterior mitral valve leaflet . the m - mode image is that shown in fig2 , m - mode colors are modified from those of the originals image sequence to enhance readability . the analysis of timings shows that the beginning of diastole as an electrical event and given by the t - wave of the ecg , precedes the mechanical beginning of diastole that is represented by the beginning of volume growth . moreover , the volume begins to grow a little before the mitral valve opens . this little period is that necessary for the ventricular pressure to decrease enough and allow valvular opening . the extension of this little period is known to be highly variable in pathologic conditions . this representation allows its evaluation and use in the diagnostic process . a similar argument can be employed about timings of systole . the example of fig5 shows how the presence of a background m - mode has permitted to indicate the correct region requiring therapy , a wrong evaluation of this could worsen the cardiac function after the implant of a pace - maker . fig5 shows the xy display of the evolution of the myocardial strain ( tissue shortening / elongation ) on two regions of the left ventricle wall : the intraventricular septum ( ivs , light gray ) and the lateral wall ( lw , dark gray ). the graph is drawn on a background m - mode of the annulus whose motion gives an evaluation of the global ventricular contraction . the image is extracted from a patient with suspect synchronization pathology and is employed to verify this lack of synchronization and to evaluate which wall , if any , presents an incorrect activation of contractility . contraction is normally expected to begin , for electrical activation , after the r - wave of the ecg signal . however the ecg trace could be not a proper timing indicator in patient with a pathologic electrical activity , like this could be the case . the contraction on the intraventricular septum ( ivs ) and on the lateral wall ( lw ) appear not to be in phase as they should under healthy conditions . contraction begins later on the lw than on the ivs . the former contracts after the r - wave possibly indicating that the lw is properly activated while the ivs contraction is anticipated . the background m - mode of the annulus shows , instead , that the overall , long axis , ventricular contraction is approximately in phase with the ivs , and the lw has a delayed contraction . the support of a background m - mode suggests , in this case , that the myocardial tissue of the lw is the proper region to correct in a resynchronization therapy ( pace - maker implant ). as it appears clearly from the above the innovative approach according to the present invention allows to combine the display of different quantities and the immediate comparison of their dynamics . it has a formidable impact for the improvement of revealing the exact conditions of a target body in which time varying events occur and in the case of the present non limiting example in particular field of the diagnostic in cardiology . as already cited the data for drawing the xy graph of the time dependent evolution of the ventricular volume and of the time dependent evolution of the strain of the intraventricular septum ( ivs , light gray ) and of the lateral wall ( lw , dark gray ) can be obtained by using a known method like ones based on tissue doppler echo - cardiography as disclosed in u . s . pat . no . 6 , 352 , 507 , issued mar . 5 , 2003 to torp , et al ., and / or u . s . pat . no . 6 , 537 , 221 , issued mar . 25 , 2003 to criton et al ., and / or as reported in the literature ( urheim et al . circulation 2000 , 102 : 1158 - 1164 ; d &# 39 ; hooge et al ., eur j echocardiography 2000 , 1 : 154 - 170 ), or another method based on processing of b - mode echographic imaging disclosed in ep 1 522 875 and / or ep 1 520 517 ( esaote spa , amid srl ). while the invention has been illustrated and described in detail in the drawings and foregoing description , the same is to be considered as illustrative and not restrictive in character , it being understood that only the preferred embodiment has been shown and described and that all changes and modifications that come within the spirit of the invention are desired to be protected .

US-44853206-A

transgenic animals that do not express functional sr - bi and apoe develop severe atherosclerosis , by age four weeks in transgenic mice . moreover , these animals exhibit progressive heart block by age four weeks , and die by age nine weeks . pathology shows extensive fibrosis of the heart and occlusion of coronary arteries . the occlusion appears to be due to clotting , since fat deposition is in the walls . these animals are good models for the following diseases , and for screening of drugs useful in the treatment and / or prevention of these disorders : cardiac fibrosis , myocardial infarction , defects in electrical conductance , atherosclerosis , unstable plaque , and stroke . in contrast to other known models for atherosclerosis , these animals do not have to be fed extreme diets for long periods before developing atherosclerosis . no other known model for heart attacks and stroke is known .

the role of sr - bi has now been confirmed as the principle mediator of cholesteryl ester transport from peripheral tissues to the liver and other steroidogenic tissues , including the adrenal gland , testes and ovaries . the studies described herein demonstrate that animals which are deficient in both sr - bi and apoe are not only excellent models for atheroslerosis but also myocardial infarction and stroke , since the animals develope progressive heart block and coronary artery occlusions characterized by clots resembling those in heart attack patients . these animals can be used to screen for drugs that are effective as therapeutics or diagnostics of heart disease . compounds are preferably administered in a pharmaceutically acceptable vehicle . suitable pharmaceutical vehicles are known to those skilled in the art . for parenteral administration , the compound will usually be dissolved or suspended in sterile water or saline . for enteral administration , the compound will be incorporated into an inert carrier in tablet , liquid , or capsular form . suitable carriers may be starches or sugars and include lubricants , flavorings , binders , and other materials of the same nature . the compounds can also be administered locally by topical application of a solution , cream , gel , or polymeric material ( for example , a pluronic ™, basf ). alternatively , the compound may be administered in liposomes or microspheres ( or microparticles ). methods for preparing liposomes and microspheres for administration to a patient are known to those skilled in the art . u . s . pat . no . 4 , 789 , 734 describe methods for encapsulating biological materials in liposomes . essentially , the material is dissolved in an aqueous solution , the appropriate phospholipids and lipids added , along with surfactants if required , and the material dialyzed or sonicated , as necessary . a review of known methods is by g . gregoriadis , chapter 14 . “ liposomes ”, drug carriers in biology and medicine pp . 287 - 341 ( academic press , 1979 ). microspheres formed of polymers or proteins are well known to those skilled in the art , and can be tailored for passage through the gastrointestinal tract directly into the bloodstream . alternatively , the compound can be incorporated and the microspheres , or composite of microspheres , implanted for slow release over a period of time , ranging from days to months . see , for example , u . s . pat . no . 4 , 906 , 474 , 4 , 925 , 673 , and 3 , 625 , 214 . the pharmaceutical compositions are administered in an effective amount effective to modify or treat the disorder . these are readily determined by measuring blood , urine and / or tissue samples using clinically available tests . the exact dosages can be determined based on the use of animal models which are accepted as predictive of the effects of drugs on steroid levels , for example , of contraceptives or cortisone . with the knowledge of the cdna encoding sr - bi and regulatory sequences regulating expression thereof , it is possible to generate transgenic animals , especially rodents , for testing the compounds which can alter sr - bi expression , translation or function in a desired manner . this procedure for transient overexpression in animals following infection with adenoviral vectors is described below in the examples . there are basically two types of animals which are useful : those not expressing functional sr - bi , which are useful for testing of drugs which may work better in combination with an inhibitor of sr - bi to control levels of lipid , cholesterol , lipoprotein or components thereof , and those which overexpress sr - bi , either in those tissues which already express the protein or in those tissues where only low levels are naturally expressed . the animals in the first group are preferably made using techniques that result in “ knocking out ” of the gene for sr - bi , although in the preferred case this will be incomplete , either only in certain tissues , or only to a reduced amount . these animals are preferably made using a construct that includes complementary nucleotide sequence to the sr - bi gene , but does not encode functional sr - bi , and is most preferably used with embryonic stem cells to create chimeras . animals which are heterozygous for the defective gene can also be obtained by breeding a homozygote normal with an animal which is defective in production of sr - bi . these animals can then be crossed with other transgenic or knockout animals , as described in the following examples . equivalent animals can be produced using single knockout animals with an inhibitor , for example , an inhibitor of sr - bi administered to an apoe knockout , or verse versa . the animals in the second group are preferably made using a construct that includes a tissue specific promoter , of which many are available and described in the literature , or an unregulated promoter or one which is modified to increase expression as compared with the native promoter . the regulatory sequences for the sr - bi gene can be obtained using standard techniques based on screening of an appropriate library with the cdna encoding sr - bi . these animals are most preferably made using standard microinjection techniques . these manipulations are performed by insertion of cdna or genomic dna into the embryo using microinjection or other techniques known to those skilled in the art such as electroporation , as described below . the dna is selected on the basis of the purpose for which it is intended : to inactivate the gene encoding an sr - bi or to overexpress or express in a different tissue the gene encoding sr - bi . the sr - bi encoding gene can be modified by homologous recombination with a dna for a defective sr - bi , such as one containing within the coding sequence an antibiotic marker , which can then be used for selection purposes . animals suitable for transgenic experiments can be obtained from standard commercial sources . these include animals such as mice and rats for testing of genetic manipulation procedures , as well as larger animals such as pigs , cows , sheep , goats , and other animals that have been genetically engineered using techniques known to those skilled in the art . these techniques are briefly summarized below based principally on manipulation of mice and rats . the procedures for manipulation of the embryo and for microinjection of dna are described in detail in hogan et al . manipulating the mouse embryo , cold spring harbor laboratory , cold spring harbor , n . y . ( 1986 ), the teachings of which are incorporated herein . these techniques are readily applicable to embryos of other animal species , and , although the success rate is lower , it is considered to be a routine practice to those skilled in this art . female animals are induced to superovulate using methodology adapted from the standard techniques used with mice , that is , with an injection of pregnant mare serum gonadotrophin ( pmsg ; sigma ) followed 48 hours later by an injection of human chorionic gonadotrophin ( hcg ; sigma ). females are placed with males immediately after hcg injection . approximately one day after hcg , the mated females are sacrificed and embryos are recovered from excised oviducts and placed in dulbecco &# 39 ; s phosphate buffered saline with 0 . 5 % bovine serum albumin ( bsa ; sigma ). surrounding cumulus cells are removed with hyaluronidase ( 1 mg / ml ). pronuclear embryos are then washed and placed in earle &# 39 ; s balanced salt solution containing 0 . 5 % bsa ( ebss ) in a 37 . 5 ° c . incubator with a humidified atmosphere at 5 % co 2 , 95 % air until the time of injection . randomly cycling adult females are mated with vasectomized males to induce a false pregnancy , at the same time as donor females . at the time of embryo transfer , the recipient females are anesthetized and the oviducts are exposed by an incision through the body wall directly over the oviduct . the ovarian bursa is opened and the embryos to be transferred are inserted into the infundibulum . after the transfer , the incision is closed by suturing . methods for the culturing of es cells and the subsequent production of transgenic animals , the introduction of dna into es cells by a variety of methods such as electroporation , calcium phosphate / dna precipitation , and direct injection are described in detail in teratocarcinomas and embryonic stem cells , a practical approach , ed . e . j . robertson , ( irl press 1987 ), the teachings of which are incorporated herein . selection of the desired clone of transgene - containing es cells is accomplished through one of several means . in cases involving sequence specific gene integration , a nucleic acid sequence for recombination with the sr - bi gene or sequences for controlling expression thereof is co - precipitated with a gene encoding a marker such as neomycin resistance . transfection is carried out by one of several methods described in detail in lovell - badge , in teratocarcinomas and embryonic stem cells , a practical approach , ed . e . j . robertson , ( irl press 1987 ) or in potter et al proc . natl . acad . sci . usa 81 , 7161 ( 1984 ). calcium phosphate / dna precipitation , direct injection , and electroporation are the preferred methods . in these procedures , a number of es cells , for example , 0 . 5 × 10 6 , are plated into tissue culture dishes and transfected with a mixture of the linearized nucleic acid sequence and 1 mg of psv2neo dna ( southern and berg , j mol . appl . gen . 1 : 327 - 341 ( 1982 )) precipitated in the presence of 50 mg lipofectin in a final volume of 100 μl . the cells are fed with selection medium containing 10 % fetal bovine serum in dmem supplemented with an antibiotic such as g418 ( between 200 and 500 pg / ml ). colonies of cells resistant to g418 are isolated using cloning rings and expanded . dna is extracted from drug resistant clones and southern blotting experiments using the nucleic acid sequence as a probe are used to identify those clones carrying the desired nucleic acid sequences . in some experiments , pcr methods are used to identify the clones of interest . dna molecules introduced into es cells can also be integrated into the chromosome through the process of homologous recombination , described by capecchi , ( 1989 ). direct injection results in a high efficiency of integration . desired clones are identified through pcr of dna prepared from pools of injected es cells . positive cells within the pools are identified by pcr subsequent to cell cloning ( zimmer and gruss , nature 338 , 150 - 153 ( 1989 )). dna introduction by electroporation is less efficient and requires a selection step . methods for positive selection of the recombination event ( i . e ., neo resistance ) and dual positive - negative selection ( i . e ., neo resistance and ganciclovir resistance ) and the subsequent identification of the desired clones by pcr have been described by joyner et al ., nature 338 , 153 - 156 ( 1989 ) and capecchi , ( 1989 ), the teachings of which are incorporated herein . naturally cycling or superovulated females mated with males are used to harvest embryos for the injection of es cells . embryos of the appropriate age are recovered after successful mating . embryos are flushed from the uterine horns of mated females and placed in dulbecco &# 39 ; s modified essential medium plus 10 % calf serum for injection with es cells . approximately 10 - 20 es cells are injected into blastocysts using a glass microneedle with an internal diameter of approximately 20 μm . randomly cycling adult females are paired with vasectomized males . recipient females are mated such that they will be at 2 . 5 to 3 . 5 days post - mating ( for mice , or later for larger animals ) when required for implantation with blastocysts containing es cells . at the time of embryo transfer , the recipient females are anesthetized . the ovaries are exposed by making an incision in the body wall directly over the oviduct and the ovary and uterus are externalized . a hole is made in the uterine horn with a needle through which the blastocysts are transferred . after the transfer , the ovary and uterus are pushed back into the body and the incision is closed by suturing . this procedure is repeated on the opposite side if additional transfers are to be made . samples ( 1 - 2 cm of mouse tails ) are removed from young animals . for larger animals , blood or other tissue can be used . to test for chimeras in the homologous recombination experiments , i . e ., to look for contribution of the targeted es cells to the animals , coat color has been used in mice , although blood could be examined in larger animals . dna is prepared and analyzed by both southern blot and pcr to detect transgenic founder ( f 0 ) animals and their progeny ( f 1 and f 2 ). once the transgenic animals are identified , lines are established by conventional breeding and used as the donors for tissue removal and implantation using standard techniques for implantation into humans . the present invention will be further understood by reference to the following non - limiting examples . production and characterization of transgenic animals which do not express sr - bi to determine directly if sr - bi normally plays an important role in hdl metabolism in vivo and to establish an experimental system to examine the role of sr - bi in pathologic states , mice containing a targeted null mutation in the gene encoding sr - bi were generated . sr - bi genomic dna was isolated from a mouse strain 129 dna library ( genome systems , st . louis , mo . ), and screened by pcr amplification using primer pairs corresponding to the 5 ′ and 3 ′ ends of the msr - bi cdna . from one clone a 12 kb xba i fragment containing the first coding exon was identified . a replacement - type targeting vector , containing 0 . 75 kb and 9 kb short and long homology regions and the po12sneobpa and herpes simplex virus thymidine kinase ( tk ) cassettes , was constructed using standard methods . the vector was linearized and 100 μg were transfected by electroporation ( 240 v , 500 μf ) into 112 × 10 6 murine d3 embryonic stem cells , which were then plated onto irradiated mouse embryonic fibroblast feeder layers . after g418 / gancyclovir positive / negative selection for 7 - 8 days , 492 of the 5800 surviving colonies were picked and screened by pcr analysis using primers specific for the targeted allele ( primer 1 5 ′- tgaaggtggtcttcaagagcagtcct - 3 ′ ( seq id no : 5 ); and primer 3 5 ′- gattgggaagacaatagcaggcatgc - 3 ′ ( seq id no : 6 ); all oligonucleotide primers were synthesized by research genetics ). the presence of the targeted allele ( amplification of a 1 . 4 kb band ) was confirmed by southern blot analysis of xba i digested genomic dna using probes that yielded either the predicted 12 kb fragment characteristic of the wild - type allele or the predicted 2 . 5 kb and 9 kb fragments from the targeted mutant allele . bam hi digested genomic dna was also probed with a 0 . 9 kb fragment derived by pst i digestion of the neomycin resistance gene cassette to confirm the presence of a single neo gene in the mutant cells . embryonic stem cell clones containing a disrupted sr - bi allele were injected into c57bl / 6 blastocysts , which were implanted into recipient females . the resulting chimeric mice were crossed to c57bl / 6 female mice to generate f1 wild - type ( srbi +/+ ) and heterozygous ( srbi +/ +− ) mice on an identical 129 ( agouti )/ c57bl / 6 background . fi heterozygotes were crossed to generate f2 wild - type ( srbi +/+ ), heterozygous mutant ( srbi +/− ) and homozygous mutant ( srbi +/− ) progeny . the presence of the targeted or wild - type sr - bi alleles in dna extracted from tail biopsies was detected by pcr amplification using primer 1 in combination with either primer 3 ( mutant specific ) or primer 2 ( wild - type specific ; 5 ′- tatcctcggcagacctgagtcgtgt - 3 ′ ( seq id no : 7 )). genotypes were confirmed by southern blot analysis . mice were housed in microisolator cages and were fed ad libitum a regular rodent chow diet ( prolab 3000 , pmi feeds inc ., st . louis , mo .). samples were obtained from fasted ( 4 - 8 hrs ) or non - fasted mice that were approximately 8 - 12 weeks old ( f1 generation ) or 5 - 11 weeks old ( f2 generation ). animals were sacrificed and livers and adrenal glands were removed and immediately frozen . membranes from homogenates were prepared . 50 μg of protein per specimen were analyzed by sds - polyacrylamide ( 8 %) gel electrophoresis and immunoblotting with chemiluminescence detection as previously described using rabbit antipeptide polyclonal antibodies which specifically recognize either the approximately 82 kda murine sr - bi protein ( anti - msr - bi 485 ) or the approximately 36 kda ε - cop control cytoplasmic protein ( anti - εcop ). plasma total cholesterol ( unesterified plus esterified , mg / dl ) was measured using an enzymatic kit ( sigma chemicals , st . louis , mo .). adrenal glands were homogenized as described above . protein concentrations in the homogenates were measured using the method of lowry et al .. duplicate samples of homogenates ( 30 - 70 μl each ) were extracted with 2 ml of hexane / isopropanol ( 2 : 1 ) for 1 h at room temperature , back - washed with 1 ml of water , and phases separated by centrifugation at 800 × g for 5 min . the upper organic phase was recovered and evaporated at 37 ° c . in a speedvac concentrator and cholesterol was measured in the dried pellet using an enzymatic kit ( sigma ). cholesterol values were corrected based on the recovery of a [ 3 h ] cholesteryl ester internal standard added prior to lipid extraction . total cholesterol content was expressed as μg of cholesterol / mg total protein . pooled plasma ( 150 μl total from 2 - 6 animals ) was diluted with an equal volume of elution buffer ( 154 mm nacl 1 mm edta , ph 8 ) and subjected to fplc using two superose 6 columns ( pharmacia , piscataway , n . j .) connected in series . proteins were eluted at 0 . 25 ml / min . forty seven fractions ( 0 . 5 ml ) were collected after the first 14 ml were eluted and total cholesterol in each fraction was determined as described above . immunoblotting of the fplc fractions was performed with specific anti - apoa - i , anti - apoa - ii or anti - apoe antibodies on independent samples or by sequential labeling of a single membrane to permit simultaneous visualization of all three proteins . results are expressed as the arithmetic mean ± standard deviation . the statistical significance of the differences of the mean between groups was evaluated using the student t test for unpaired comparisons . the χ 2 test was used for genotype distribution analysis . p values & lt ; 0 . 05 are considered to be statistically significant . the sr - bi gene was inactivated in embryonic stem cells by standard homologous recombination methods . the segments replaced in the recombined mutant (“ targeted allele ”) include the entire coding region of the first coding exon ( 126 bp , 42 amino acids , containing 5 ′ untranslated sequence , a short n - terminal cytoplasmic domain , and a portion of the n - terminal putative transmembrance domain that probably also functions as an uncleaved leader sequence for insertion into the er during biogenesis ) and an additional 554 bases of the adjacent downstream intron . the mutated locus is expected to encode a transcript which would not be translated or would be translated into non - functional , non - membranous , and presumably unstable , protein . the strategy for the targeted disruption of the sr - bi locus in the mouse . abbreviations : tk , herpes simplex thymidine kinase ; neo , pol2sneobpa expression cassette , x , xba i ; b , bam , hi ; s , sac i ; “ atg ”, codon for the initiator methionine . two sets of primer pairs specific for the wild - type ( primers 1 and 2 ) or targeted mutant ( primers 1 and 3 ) alleles were used to screen genomic dna by pcr as described in heterozygous and f2 homozygous mutant animals are shown . immunoblot analysis of hepatic membranes ( 50 μg protein / lane ) from unfasted wild - type ( f1 and f2 generations ), heterozygous ( f1 and f2 generations ) and homozygous mutant ( f2 generation ) male mice were performed using polyclonal antipeptide antibodies to sr - bi ( approximately 82 kda , top ) or the internal control ε - cop ( approximately 36 kda ). essentially identical results were obtained using specimens from female mice ) confirmation of the expected null mutation by pcr . three independently derived embryonic stem cell clones containing the targeted allele were injected into c57bl / 6 blastocysts and two produced 24 male chimeras , of which 11 gave germ line transmission of the targeted sr - bi allele when crossed to c57bl / 6 females . f1 offspring were either homozygous (+/+) for the wild type allele or heterozygous (+/−) with both mutant and wild - type pcr products . f1 heterozygotes should be isogenic with the f1 wild - type controls except at the sr - bi locus . wild - type , heterozygous and homozygous mutant f2 generation offspring , whose phenotypes are subject to genetic background variability , were generated from f1 intercrosses . in the f2 progeny analyzed to date ( n = 317 ), the observed ratios of wild - type heterozygous mutant homozygous mutant offspring were 1 . 0 : 1 . 7 : 0 . 5 , values significantly different from the expected mendelian ratio of 1 : 2 : 1 ( p = 0 . 003 ). thus , there may be partially penetrant effects of the mutation either on neonatal survival or on embryonic development , which would be consistent with the distribution of sr - bi on the maternal surfaces of cells in the placenta and yolk sac during embryonic development . all of the mutants looked normal ( weight , general appearance and behavior ) and the males were fertile . no offspring from female homozygous mutants have been obtained following multiple attempts to do so , indicating a substantial , and possibly complete , decrease in fertility in these females . immunoblot analysis of liver membranes from f1 (+/+,+/−) and f2 (+/+,+/−,−/−) mice using anti - peptide antibodies which recognize the c - terminus of the sr - bi protein ( anti - msr - bi 495 ), or a segment of the putative extracellular loop ( anti - msr - bi 230 ), revealed that there was about half as much msr - bi protein in the heterozygous mutants as in the wild - type controls and no detectable sr - bi in the homozygous mutants . no fragment or other variants of the full - length protein were detected in any of the samples . in contrast , no significant differences were observed in the levels of the control protein , ε - cop . similar results were observed using adrenal tissue . thus , the mutated sr - bi gene is a functionally null allele . to determine how decreased sr - bi protein expression influenced lipoprotein metabolism , the plasma cholesterol levels in male and female wild - type and mutant mice were compared . because there were no statistically significant differences between the data from animals derived from the two independent embryonic stem cell clones , data from these two independent sets of animals were pooled . relative to wild - type controls there were statistically significant increases in the plasma total cholesterol concentrations of approximately 30 - 40 % in f1 and f2 heterozygotes and 2 . 2 - fold in f2 homozygous mutants . in contrast to the increased plasma cholesterol in the mutants , there was no statistically significant change in the levels of plasma apoa - i . these findings are consistent with the suggestion that hepatic sr - bi plays a key role in selective removal of cholesterol from circulating hdl - lower levels of hepatic sr - bi were expected to increase plasma hdl cholesterol but not directly alter apoa - i levels . to determine if the elevated levels of plasma cholesterol in the mutants were due to changes in hdl , pooled plasma samples from f1 male and female and f2 male animals were subjected to fplc and the total cholesterol content as well as the relative amounts of apoa - i , apoa - ii and apoe in each fraction were measured . for wild - type mice ( srbi +/+ ) most of the cholesterol , apoa - i and apoa - ii were in the hdl fraction , with small or undetectable amounts in the vldl and idl / ldl fractions . there was an apparently low level of apoe which both co - migrated with the hdl and with a small cholesterol peak in the idl / ldl region . the cholesterol and apolipoprotein profiles of the heterozygous mutants were similar to those of the wild - type controls , except that there was an increase in the amount of cholesterol in the hdl fractions and there was a tendency of the hdl peak ( cholesterol and / or apolipoproteins ) to be broader than that of wild - type and shifted slightly to the left , which may represent large hdl particles . this suggested that there might be a difference in the average sizes of the hdl particles due to the inactivation of one of the sr - bi alleles ; however , this shift was not observed in all specimens . in the f2 homozygous mutant animals ( srbi −/− ) the cholesterol was found in a large , somewhat heterogeneous peak in the hdl range , but shifted to the left ( larger apparent size ) of the wild - type hdl peak . the amount of cholesterol in the idl / ldl fraction varied between samples . combined immunoblot analysis of fractions 23 - 28 from the chromatograms were performed with polyclonal antibodies to apoe , apoa - i and apoaii . additional analysis of these and independent chromatograms established that there were no additional peaks containing apoa - i in fractions containing larger lipoproteins ( fractions 1 - 22 ) and that the only other peak containing a small amount of apoe was in fraction 6 , which corresponds to vldl . the distributions of apoa - i and apoa - ii were similar to that of cholesterol , although , unlike the case for apoa - i there was a notable reduction in the amount of apoa - ii relative to that seen in wild type and heterozygous mutant animals . conversely , in the homozygous mutants there was a substantial increase in the amount of apoe , whose distribution profile ( larger particles , centered around fractions 26 - 28 ) differed from , but overlapped , those of apoa - i and apoa - ii . these results with the mutant animals , in which the changes in sr - bi expression are in the physiologic range , are complementary to and consistent with the observation that transient adenovirus - mediated hepatic sr - bi overexpression results in dramatically decreased levels of hdl cholesterol and increased delivery of hdl - associated lipid to hepatocytes and the bile . in rodents , most of the plasma hdl cholesterol appears to be removed by the liver via selective uptake and the liver appears to be the site of the highest total amount of sr - bi protein expression . it seems likely that buildup of large , cholesterol - enriched lipoprotein particles in the circulation of sr - bi mutants was primarily due to decreased hepatic selective hdl cholesterol uptake . thus , it appears that murine plasma hdl cholesterol levels are particularly sensitive to physiologically relevant changes in the levels of hepatic sr - bi protein expression ( e . g ., approximately 50 % reduction in heterozygotes ). the effect of the null mutation in sr - bi on total plasma cholesterol levels was quantitatively similar to that of a null mutation in the ldl receptor . for both sets of mutants , total plasma cholesterol levels were approximately 36 % above wild - type controls for heterozygotes and approximately 114 % for homozygotes . it is important to emphasize that while the magnitudes of the effects on total plasma cholesterol of these distinct mutations ( sr - bi vs . ldl receptor ) are similar , the mechanistic consequences on lipoprotein metabolism ( e . g ., effects on the various lipoproteins ) differ . in addition to playing an important role in regulating plasma hdl cholesterol , sr - bi has been implicated in the delivery of hdl cholesterol to the adrenal gland and other steroidogenic tissues , both for the accumulation of esterified cholesterol stores and for steroid hormone synthesis . to examine this , the cholesterol content of adrenal glands in mutant and wild - type mice was measured . the results are shown in table 1 . as predicted , cholesterol stores in the adrenal gland dropped substantially in the heterozygous and homozygous mutants to 58 % and 28 % of control , respectively . it was also noted that the color of intact adrenal glands from homozygous mutants was brownish - red while that of wild - type and heterozygous animals was light yellow and , in preliminary studies , a dramatic decrease in oil red o staining of the adrenal cortex was observed in the homozygous mutants relative to the wild - type mice . thus , the total cholesterol content , color and oil red o staining characteristics of the adrenal glands in sr - bi homozygous mutants resembled those in their cholesterol - depleted counterparts in other murine mutants , including null mutants in the sr - bi ligand apoa - i . this similarity with apoa - i knockouts is consistent with the possibility that the reduction in adrenal cholesterol in the sr - bi homozygotes is a direct consequence of the loss of the key receptor for selective lipid uptake . recent antibody blocking experiments have provided additional support for a major role of msr - bi in delivering hdl cholesterol to cultured adrenocortical cells for steroidogenesis . based on the tissue distribution and hormonal regulation of sr - bi protein expression and the phenotypes of apoa - i knockouts , it seems likely that there would also be reductions in cholesterol stores in other steroidogenic tissues ( e . g ., ovary , testes ) in sr - bi homozygous mutants . adrenal cholesterol deficiency in both the apoa - i and sr - bi homozygous mutants also suggests that ldl receptors in the mouse , in which there normally is little ldl in the plasma , do not normally contribute significantly to murine adrenal cholesterol accumulation . f1 generation animals were not fasted . f2 generation animals were not fasted prior to analysis of adrenal gland cholesterol levels but were fasted for 4 - 8 h prior to analysis of plasma . to study the effects of a lack of expression of the gene encoding the scavenger receptor , class b type i ( sr - bi ) on atherosclerosis , mice deficient in sr - bi ( sr - bi ko mice ) were crossed to mice deficient in apolipoprotein e ( apo e ko mice ). mice deficient in both sr - bi and apo e ( sr - bi / apo e double ko mice ) did not survive beyond 8 - 9 weeks of age . analysis of atherosclerosis in these mice revealed extensive atherosclerotic plaque in the aortic sinuses of sr - bi / apo e double ko mice at 5 - 7 weeks of age , at which time , no atherosclerotic plaque formation was detectable in mice deficient in either sr - bi or apo e alone . further analysis of sr - bi / apo e double ko mice revealed that the animals died as the result of progressive heart block ( major cardiac conduction defects ), as revealed by changes in electrocardiograms and extensive cardiac fibrosis . these were accompanied by coronary artery atherosclerosis . complete occlusion of coronary arteries with a lipid - poor material which appears to represent the formation of occlusive fibrin / platelet clots , strongly suggests that the mice die of myocardial infarctions due to atherosclerosis / thrombosis , just like humans . these animals should prove useful as a model for human coronary artery disease and myocardial infarctions , and probably stroke . this animal system should prove to be amenable to the rapid testing of potential drugs ( since the mice succumb to mi &# 39 ; s very rapidly — within weeks ). these results also suggest that under certain circumstances , manipulation of mice deficient in either sr - bi or apo e alone ( for example interventions to alter lipoprotein metabolism , altered steroidogenesis etc ) might give rise to similarly severe coronary artery disease and myocardial infarctions , giving rise to equally useful models of human coronary artery disease . the hdl receptor sr - bi mediates the selective uptake of plasma hdl cholesterol by the liver and steroidogenic tissues . as a consequence , sr - bi can influence plasma hdl cholesterol levels , hdl structure , biliary cholesterol concentrations , and the uptake , storage and utilization of cholesterol by steroid hormone producing cells . here we used homozygous null sr - bi knockout mice to show that sr - bi is required for maintaining normal biliary cholesterol levels , oocyte development and female fertility . we also used sr - bi / apoe double homozygous knockout mice to show that sr - bi can protect against early onset atherosclerosis . although the mechanisms underlying the effects of sr - bi loss on reproduction and atherosclerosis have not been established , potential causes include changes in : i ) plasma lipoprotein levels and / or structure , ii ) cholesterol flux into or out of peripheral tissues ( ovary , aortic wall ), and iii ) reverse cholesterol transport , as indicated by the significant reduction of gallbladder bile cholesterol levels in sr - bi and sr - bi / apoe double knockout mice relative to controls . if sr - bi has similar activities in humans , it may become an attractive target for therapeutic intervention in a variety of diseases . high density lipoprotein ( hdl )- cholesterol levels are inversely proportional to the risk for atherosclerosis gordon et al ., n . engl . j . med . 321 , 1311 - 1316 ( 1989 ). this may partly be due to “ reverse cholesterol transport ” ( rct ), in which hdl is proposed to remove excess cholesterol from cells , including those in the artery wall johnson , et al ., biochim . biophys . acta , 1085 , 273 - 298 ( 1991 ), tall , a . r . j . lipid res . 34 , 1255 - 1274 ( 1993 ), pieters , et al ., biochim . biophys . acta 1225 , 125 - 134 ( 1994 ), fielding , et al ., j . lipid . res . 36 , 211 - 228 ( 1995 ), oram , et al ., j . lipid res . 37 , 2473 - 2491 ( 1996 ), breslow , j . l . in the metabolic and molecular bases of inherited diseases . eds . scriver , c . r ., beaudet , a . l ., sly , w . s ., & amp ; valle , d . ( mcgraw - hill , new york ), pp . 2031 - 2052 ( 1995 ), and transport it , either indirectly or directly glass , et al ., proc . natl . acad . sci . usa 80 , 5435 - 5439 ( 1983 ) and glass , et al ., j . biol . chem . 260 , 744 - 750 ( 1985 ), to the liver for biliary secretion . hdl can also directly deliver cholesterol to steroidogenic tissues ( adrenal gland , testis , ovary ) for storage in cytoplasmic cholesteryl ester droplets and for steroid hormone synthesis , gwynne , et al ., endocr . rev . 3 , 299 - 329 ( 1982 ), kovanen , et al ., j . biol . chem . 254 , 5498 - 5505 ( 1979 ), and plump , et al ., j . clin . invest . 97 , 2660 - 2671 ( 1996 ). thus , hdl may influence a variety of endocrine functions , including reproduction . a key mechanism of receptor - mediated direct delivery of hdl cholesteryl esters to the liver and steroidogenic tissues is selective cholesterol uptake , in which only the cholesteryl esters of the hdl particles ( not the apolipoproteins ) are efficiently transferred to cells , glass , et al ., ( 1983 ), and glass , et al ., ( 1985 ). the class b type i scavenger receptor , sr - bi , is a cell surface hdl receptor which mediates selective lipid uptake , acton , et al ., science 271 , 518 - 520 ( 1996 ), babitt , et al ., j . biol . chem . 272 , 13242 - 13249 ( 1997 ), gu , et al ., j . biol . chem . 273 , 26338 - 26348 ( 1998 ), temel , r . e ., et al ., proc . natl . acad . sci . usa . 94 , 13600 - 13605 ( 1997 ), kozarsky , k . f ., et al ., nature 387 , 414 - 417 ( 1997 ), rigotti a ., et al ., proc . natl . acad . sci . usa . 94 , 12610 - 12615 ( 1997 ), varban , m . l . et al .,. proc . natl . acad . sci . usa . 95 , 4619 - 4624 ( 1998 ), wang , n ., et al ., j . biol . chem . 273 , 32920 - 32926 ( 1998 ), ueda , y ., et al ., j . biol . chem . 274 , 7165 - 7171 ( 1999 ), reviewed in rigotti , a ., et al ., curr . opin . lipidol . 8 , 181 - 188 ( 1997 ), and krieger , m ann . rev . biochem . 68 , 523 - 558 ( 1999 ). it is most highly expressed in the liver and steroidogenic tissues , in which its activity is regulated by trophic hormones , acton , ( 1996 ), rigotti , a ., et al ., j . biol . chem . 271 , 33545 - 33549 ( 1996 ), wang , n ., et al ., j . biol . chem . 271 , 21001 - 21004 ( 1996 ), landschulz , k . t ., et al ., j . clin . invest . 98 , 984 - 995 ( 1996 ), mizutani , t ., et al ., biochem . biophys . res . commun . 234 , 499 - 505 ( 1997 ), li , x ., et al ., endocrinology 139 , 3043 - 3049 ( 1998 ), reaven , e ., et al ., endocrinology 139 , 2847 - 2856 ( 1998 ), rajapaksha , w . r ., et al ., mol . cell . endocrinol . 134 , 59 - 67 ( 1997 ), and azhar , s ., et al ., j . lipid res . 39 , 1616 - 1628 ( 1998 ). as a consequence , sr - bi is a key regulator of hdl cholesterol levels , kozarsky , ( 1997 ), rigotti a ., et al ., ( 1997 ), varban , m . l . et al ., ( 1998 ), wang , n ., et al ., ( 1998 ), and ueda , y ., et al ., ( 1999 ), and adrenal cholesterol stores , rigotti a ., et al ., ( 1997 ). the finding that hepatic sr - bi overexpression leads to significant increases in biliary cholesterol content , kozarsky , k . f ., et al ., ( 1997 ), and sehayek , e ., et al ., proc . natl . acad . sci . usa . 95 , 10194 - 10199 ( 1998 ), is consistent with gene targeting studies rigotti a ., et al ., ( 1997 ), and varban , m . l . et al ., ( 1998 ), which suggest an important role for sr - bi in rct . in addition to hdl , sr - bi can bind other ligands , including lipoproteins ( ldl , modified ldl , vldl ) and apolipoproteins , acton , s . l ., et al ., j . biol . chem . 269 , 21003 - 21009 ( 1994 ), murao , k ., et al ., j . biol . chem . 272 , 17551 - 17557 ( 1997 ), calvo , d ., et al .. arterioscler . thromb . vasc . biol . 17 , 2341 - 2349 ( 1997 ), rigotti , a ., et al ., j . biol . chem . 270 , 16221 - 16224 ( 1995 ), xu , s ., et al ., j . lipid res . 38 , 1289 - 1298 ( 1997 ), and can mediate efflux of unesterified cholesterol from cells to hdl , ji , y ., et al ., j . biol . chem . 272 , 20982 - 20985 ( 1997 ), and stangl , h ., et al ., j . biol . chem . 273 , 31002 - 31008 ( 1998 ). because inactivation of sr - bi is associated with both decreased rct , rigotti a ., et al ., ( 1997 ), and varban , m . l . et al ., ( 1998 ), and increased plasma hdl cholesterol ( albeit in abnormally large particles containing apolipoproteins ai ( apoa - i ) and e ( apoe ) rigotti a ., et al ., ( 1997 ), a key question has arisen : do decreases in sr - bi expression inhibit or promote atherosclerosis ? here we addressed this question by studying crosses between apoe ko mice , which on a chow diet spontaneously develop atherosclerosis at around 3 months of age , zhang , s . h ., et al ., science 258 , 468 - 471 ( 1992 ), zhang , s . h ., et al ., j . clin . invest . 94 , 937 - 945 ( 1994 ), and plump , a . s ., et al ., cell 71 , 343 - 353 ( 1992 ), and sr - bi ko mice . the results clearly show that genetically suppressing sr - bi activity in apoe ko mice dramatically accelerates the onset of atherosclerosis . we also report that female mice deficient in sr - bi alone are infertile , apparently due in part to abnormalities in the viability and developmental potential of their oocytes . thus , genetic ablation of sr - bi has profound effects on both cardiovascular and reproductive pathophysiology in mice . mice ( mixed c57bl / 6 × 129 background ) were housed and fed a normal chow diet as described in rigotti a ., et al ., ( 1997 ). sr - bi −/− mice rigotti a ., ( 1997 ), and apoe −/− mice ( the jackson laboratory , zhang , s . h ., et al ., ( 1992 ), and zhang , s . h ., et al ., ( 1994 )), were mated and the double heterozygous offspring were intercrossed . the resulting sr - bi +/− apoe −/− offspring were mated to produce single apoe ko and double sr - bi / apoe ko animals . genotypes were determined by pcr analysis ( rigotti a ., et al ., ( 1997 ), also see the jackson laboratory web site ). estrus cycles were followed by vaginal cytology , nelson , j . f ., et al ., biol . reprod . 27 , 327 - 339 ( 1982 ), and external appearance , hogan , b ., et al ., manipulating the mouse genome ( cold spring harbor laboratory press , plainview , n . y .) second edition . p . 129 - 191 ( 1994 ). superovulation was induced by intraperitoneal injection of 5 iu each of pregnant mare &# 39 ; s serum ( calbiochem ) and human chorionic gonadotropin ( organon ) as described in hogan , b ., et al ., ( 1994 ). pseudopregnancy was induced by mating ( confirmed by detection of vaginal seminal plug ) with vasectomized males ( taconic ) hogan , b ., et al ., ( 1994 ). ovaries were harvested and prepared for sectioning as described below , and oocytes and preimplantation embryos were harvested as described hogan , b ., et al ., ( 1994 ) and cultured in ksom medium with amino acids ( specialty media ). blood was collected in a heparinized syringe by cardiac puncture from mice fasted overnight . plasma was subjected to fplc analysis , rigotti a ., et al ., ( 1997 ), either immediately after isolation or after storage at 4 ° c . total cholesterol was assayed as described in rigotti a ., et al ., ( 1997 ). cholesterol from non - apob containing lipoproteins was determined either using the ez hdl kit ( sigma , based on an antibody which blocks detection of cholesterol in non - hdl lipoproteins , and validated by us using human or mouse lipoproteins , not shown ) or after precipitation with magnesium / dextran sulfate ( sigma ; zhang , s . h ., et al ., ( 1992 ), and plump , a . s ., et al ., j . lipid res . 38 , 1033 - 1047 ( 1997 ). plasma ( 0 . 4 μl ) and fplc fractions or pools were analyzed by sds - polyacrylamide , rigotti a ., et al ., ( 1997 ), or agarose gel electrophoresis , fielding , c . j . et al ., methods enzymol . 263 , 251 - 259 ( 1996 ), and immunoblotting , towbin , h ., et al ., proc . natl . acad . sci . usa 76 , 4350 - 4354 ( 1979 ), and ishida , b . y ., et al ., j . lipid res . 31 , 227 - 236 ( 1990 ), with chemiluminescence detection as previously described rigotti a ., et al ., ( 1997 ), using primary anti - apolipoprotein antibodies ( sigma , or gifts from j . herz and h . hobbs ) and corresponding horseradish peroxidase coupled secondary antibodies ( jackson immuno research or amersham ). the attophos chemifluorescence kit ( amersham ) and an alkaline phosphatase coupled goat anti - rabbit secondary antibody ( gift from d . housman ) were used with a storm fluorimager ( molecular dynamics ) for quantitative analysis . plasma progesterone concentrations were determined by radioimmunoassay ( diagnostics products corp , los angeles , calif .). cholesterol was extracted from gallbladder bile and assayed as described in puglielli , l ., et al ., biochem . j . 317 , 681 - 687 ( 1996 ). mice anesthetized with 2 . 5 % avertin were perfused through the left ventricle with 20 ml of ice cold pbs containing 5 mm edta . hearts were collected directly , or the mice were perfused ( 5 ml ) with paraformaldehyde and the hearts collected and treated as described bourassa , p .- a . k . et al ., j . histotechnology 21 , 33 - 38 ( 1998 ). hearts and ovaries were frozen in tissue tek oct ( sakura , torrance , calif .). serial cross sections ( 10 μm thickness through aortic sinuses zhang , s . h ., et al ., ( 1994 ), paigen , b ., et al ., atherosclerosis 68 , 231 - 240 ( 1987 ), and suzuki , h . et al ., nature 386 , 292 - 296 ( 1997 ), 5 μm for ovaries , reichert - jung cryostat ) were stained with oil red o and meyer &# 39 ; s hematoxylin , r . e . coalson in staining procedures , g . clark , ed . ( williams and wilkins , baltimore ) pp 217 - 253 ( 1981 ). images were captured for morphometric analysis using a computer assisted microscopy imaging system and lesion size was quantified as the sum of the cross - sectional areas of each oil red o staining atherosclerotic plaque in a section paigen , b ., et al ., ( 1987 ), using nih image software . immunohistochemistry with a monoclonal anti - α smooth muscle actin antibody ( sigma , gift from r . hynes ) was performed as described in rigotti , a ., et al ., ( 1996 ). cumulus / oocyte complexes , isolated from the oviducts of superovulated females as described in hogan , b ., et al ., ( 1994 ), or denuded oocytes ( zona pellucida removed as in hogan , b ., et al ., ( 1994 )) were immunostained with polyclonal rabbit anti - murine sr - bi antibodies ( acton , et al ., ( 1996 ), or a gift from k . kozarsky ) and cy3 - labeled donkey anti - rabbit secondary antibodies ( gift from r . rosenberg ) as described in babitt , et al ., ( 1997 ) and hatzapoulos a . k ., et al ., j . lipid res . 39 , 495 - 508 ( 1998 ). data were analyzed using either a two - tailed , unpaired student t - test ( total or ez hdl cholesterol from plasma , bile or fplc fractions , progesterone and apoa - i levels ) or an unpaired nonparametric kruskall - wallis test ( atherosclerotic plaque lesion sizes ) ( statview and microsoft excel ). values are presented as means ± standard deviations . homozygous sr - bi knockout ( ko ) males exhibit normal fertility , rigotti a ., et al ., ( 1997 ). in contrast , homozygous ko females are infertile . in a two month pairing of either homozygous ko or heterozygous females with homozygous sr - bi ko males ( n = 8 for each ), heterozygous females produced 19 litters and 82 healthy offspring , whereas the homozygous females produced no healthy offspring . although two pups from two homozygous sr - bi ko females were born , they died soon after . there were no obvious gross morphological abnormalities in sr - bi ko ovaries . six week old female mice were superovulated and were mated to males of the other genotype ( i . e ., sr - bi +/+ females mated to sr - bi −/− males and vice versa ) to generate embryos with heterozygous mutant genotypes . ovaries and preimplantation embryos were harvested the following morning ( day 0 ). typical oil red o staining of lipids in ovaries from sr - bi +/+ or sr - bi −/− animals was performed . phase contrast microscopy of preimplantation embryos ( cultured for one day ) from sr - bi +/+ or sr - bi −/− females mated to males of the opposite genotype was also performed . similar results were observed when sr - bi −/− males were mated to sr - bi −/− females . plasma progesterone concentrations from pseudopregnant females ( 6 days postmating , age 6 - 10 weeks , weight 19 - 25 g , n = 8 .) ( p = 0 . 08 ). percent of preimplantation embryos from sr - bi +/+ or sr - bi −/− females with normal morphology during 3 days of culture were calculated . the values represent the averages from 5 animals of each genotype . total number of embryos : sr - bi +/+ , 131 ; sr - bi −/− , 167 . histochemical analysis of ovaries from superovulated females showed reduced oil red o - staining of lipids in the ovarian corpora lutea of sr - bi ko relative to those of wild - type animals . this suggests there was reduced cholesteryl ester storage , as previously observed in adrenal glands from sr - bi ko mice rigotti a ., et al ., ( 1997 ). this raised the possibility that there might have been insufficient amounts of cholesterol substrate in the corpora lutea to sustain adequate steroid hormone production for pregnancy . however , plasma progesterone levels between pseudopregnant control and ko females 6 days after mating , either without or with superovulation were not significantly different . furthermore , several other murine homozygous knockout mutants ( e . g . lcat , acat , and apoa - i ) exhibit similar lipid depletion in steroidogenic tissues plump , et al ., ( 1996 ), meiner , v . l ., et al ., proc . natl . acad . sci . usa 93 , 14041 - 14046 ( 1996 ), and ng , d . s ., et al ., j . biol . chem . 272 , 15777 - 15781 ( 1997 ), without apparent female infertility . thus , normal lipid stores are not required for synthesis of adequate amounts of steroid hormones for female fertility . although ko females were infertile , they exhibited no obvious defects in their estrus cycles or numbers of oocytes ovulated , either during normal estrus or after superovulation ( wild type ( n = 4 ), 52 ± 5 oocytes ; sr - bi ko ( n = 3 ), 41 ± 8 , p = 0 . 2 ). because the estrus cycle and ovulation depend on estrogen ( e . g ., for follicular development and induction of lh receptors ) and progesterone ( e . g ., for follicular rupture ), elvin , j . a . et al ., reviews of reproduction 3 , 183 - 195 ( 1998 ), ko females apparently synthesize adequate levels of intra - and extraovarian steroids for at least some , if not all , ovarian functions . because the extent of ovulation by the ko mice appeared normal , we compared the viability and development of heterozygous ( sr - bi +/− ) preimplantation ( 1 - cell ) embryos placed into culture the morning ( day 0 ) after mating with males . almost all embryos from wild - type females had normal morphologies and developed into morulas or blastocysts after 3 days in culture . in contrast , the majority of embryos from ko females at harvesting had an abnormal , non - refractile morphology , reminiscent of that seen in embryos mechanically damaged during pronuclear injection , hogan , b ., et al ., ( 1994 ). the abnormal ( presumably dead ) embryos did not develop further . all of the other embryos from sr - bi ko females which appeared normal on day 0 eventually adopted the abnormal morphology and arrested ( most at the 1 - or 2 - cell stages ) in culture . we also observed a similar abnormal morphology in oocytes from wild - type females that had been treated in culture with 50 μg / ml of nystatin or filipin , cholesterol binding drugs which can perturb membrane structure , bolard j . biochim . biophys . acta 864 , 257 - 304 ( 1986 ). the same abnormal morphology was seen in newly harvested unfertilized oocytes from sr - bi ko ( n = 6 ), but not wild - type ( n = 7 ), superovulated females , although at a lower frequency ( 31 ± 22 %) than in fertilized preimplantation embryos ( 69 ± 19 %, p = 0 . 02 ). therefore , some of the oocyte abnormalities apparently are fertilization and cell division independent . using immunostaining with anti - sr - bi antibodies , we did not detect a signal for sr - bi in wild - type oocytes , either denuded ( zona pellucida removed ) or in cumulus complexes , above the background seen in oocytes from ko animals , suggesting that after ovulation murine oocytes do not express high levels of sr - bi ( also see reaven , e ., et al ., ( 1998 )). in contrast , substantial expression of sr - bi was detected in the expanded cumulus cells surrounding ovulated oocytes from wild - type , but not sr - bi ko , mice . these cells are derived from follicular granulosa cells and are believed to play a key role in oocyte development , meiner , v . l ., et al ., ( 1996 ). sr - bi expression has been reported to be induced in follicular granulosa cells soon after a luteinizing pulse of human chorionic gonadotropin mizutani , t ., et al ., ( 1997 ), li , x ., et al ., ( 1998 ), reaven , e ., et al ., ( 1998 ), and rajapaksha , w . r ., et al ., ( 1997 ). infertility in sr - bi ko females may be due to inadequate delivery of hdl - cholesterol for membrane synthesis or steroidogenesis , inadequate delivery of non - steroidal hdl lipids ( e . g ., lipid soluble vitamins ), or deficiencies in sr - bi functions other than selective cholesterol uptake ( lipid efflux , binding of non - hdl ligands ). the abnormal structure of plasma hdl in the ko animals ( large , apoe - rich , rigotti a ., et al ., ( 1997 )) may also contribute to the infertility . oocyte abnormalities may arise due to the inability of cumulus cells to express sr - bi , before or after ovulation , because sr - bi may be needed by these cells to properly nourish the oocyte and / or support its development . sr - bi expression may also be needed in ovarian interstitial and thecal cells surrounding follicles landschulz , k . t ., et al ., ( 1996 ), mizutani , t ., et al ., ( 1997 ), li , x ., et al ., ( 1998 ), and reaven , e ., et al ., ( 1998 ). during oocyte maturation or in the oviduct environment ( at least up to the one - cell stage ). sr - bi might also play a role at other stages of reproduction and development . for example , the pattern of expression of sr - bi during later stages of pregnancy hatzapoulos a . k ., et al ., ( 1998 ), and wyne , k . l . et al ., j . lipid . res . 39 , 518 - 530 ( 1998 ), and the non - mendelian ( reduced ) yield of homozygous mutant offspring from heterozygous mothers , rigotti a ., et al ., ( 1997 ), suggest it participates in the normal function of the decidua , yolk sac and / or placenta for nutrient transport and steroid hormone synthesis . although additional mechanistic studies are necessary , the current data unequivocally establish that sr - bi is important for normal oocyte maturation , embryonic development and female fertility in mice . to analyze the effects of sr - bi on atherosclerosis , we crossed sr - bi ko and apoe ko ( spontaneously atherosclerotic , zhang , s . h ., et al ., ( 1992 ), zhang , s . h ., et al ., ( 1994 ), and plump , a . s ., et al ., ( 1992 )), mice and compared the lipoprotein profiles and development of atherosclerosis in the single and double homozygous ko females at 4 - 7 weeks of age . results for males were similar , except as noted . as reported in example 1 , plasma total cholesterol in the single sr - bi kos was increased relative to controls , because of an increase in large , apoe - enriched hdl particles , rigotti a ., et al ., ( 1997 ), while the even greater relative plasma cholesterol increase in the single apoe kos was a consequence of a dramatic increase in cholesterol in vldl and idl / ldl size particles . there was increased plasma cholesterol in the double kos relative to the single apoe kos , mainly in vldl size particles . this might have occurred if sr - bi , which can bind apob containing lipoproteins , acton , s . l ., et al ., ( 1994 ), murao , k ., et al ., ( 1997 ), calvo , d ., et al ., ( 1997 ), directly or indirectly contributes to the clearance of the cholesterol in vldl size particles in single apoe ko mice ( reduced clearance in its absence ), wang , n ., et al ., ( 1998 ), and ueda , y ., et al ., ( 1999 ). the normal size hdl cholesterol peak seen in the single apoe kos virtually disappeared in the double kos . however , no statistically significant differences ( p = 0 . 1 ) in plasma levels of hdl &# 39 ; s major apolipoprotein , apoa - i , were detected . based on the analysis of lipoproteins in the single sr - bi ko mice rigotti a ., et al ., ( 1997 ), abnormally large hdl - like particles were expected to appear in the double kos . indeed , the loss of normal sized hdl cholesterol and apoa - i in the double kos was accompanied by a shift of the apoa - i into the vldl and idl / ldl size fractions . furthermore , analysis of hdl - like cholesterol in the fplc fractions using the ez hdl assay provides evidence for the presence of abnormally large hdl - like particles in the double ko mice . in the single apoe ko males , most of this cholesterol was in particles with the size of normal hdl , while in their double ko counterparts almost all of this cholesterol was in abnormally large particles . in addition , there was ˜ 3 . 7 - fold more of this hdl - like cholesterol in the double ( 133 ± 24 mg / dl ) than in the single ( 36 ± 16 mg / dl , p = 0 . 005 ) ko mice . these increases in the amounts and sizes of hdl - like cholesterol by inactivation of the sr - bi gene in an apoe ko background were reminiscent of those seen in a wild - type background (˜ 2 . 2 - fold increase in cholesterol rigotti a ., et al ., ( 1997 ), although the hdl - like particles in the double ko mice were much larger and more heterogeneous than those in the sr - bi single ko mice rigotti a ., et al ., ( 1997 ). a similar trend was seen for female mice , except that there were increased levels of abnormally large hdl - like cholesterol in the single apoe ko females relative to males . preliminary cholesterol measurements using magnesium / dextran sulfate precipitation of lipoproteins ( 40 , 45 ) support the ez hdl findings of large hdl in the double ko animals . additional evidence for abnormally large hdl - like particles in the idl / ldl size range from both males and females was obtained using agarose gel electrophoresis and immunoblotting . there was a significant reduction in the amount of immunodetectable apob present in the idl / ldl - sized particles from the double kos relative to the single apoe kos , even though there was as much or more total cholesterol in these fractions in the double kos . in addition , there was significantly greater heterogeneity in the electrophoretic mobilities of apoa - i containing idl / ldl - sized particles . this was in part due to the presence of novel apoa - i containing , apob - free , hdl - like particles . in contrast , most of the apoa - i in the single apoe kos appeared to comigrate with apob . thus , it appears that normal size hdl in the single apoe ko animals was replaced by very large ( vldl / idlildl - size ) hdl - like particles in the double ko animals . it is possible that normal size hdl is converted into these large hdl - like particles in the absence of both apoe and sr - bi because of substantially reduced selective ( sr - bi mediated ) and apoe - mediated uptake or transfer of cholesterol from hdl particles . in addition to examining plasma cholesterol , we measured biliary cholesterol in the mice . cholesterol levels in gallbladder bile were significantly reduced in sr - bi single ko ( 30 %, p & lt ; 0 . 005 ) and sr - bi / apoe double ko ( 47 %, p & lt ; 0 . 0005 ) mice relative to their sr - bi +/+ controls . this is consistent with the previous finding that hepatic overexpression of sr - bi increases biliary cholesterol levels kozarsky , k . f ., et al ., ( 1997 ) and sehayek , e ., et al ., ( 1998 ), and indicates that sr - bi may normally play an important role in the last stage of reverse cholesterol transport - transfer of plasma hdl cholesterol into bile . the data also suggest that apoe expression can regulate biliary cholesterol content in a sr - bi ko , but not sr - bi +/+ , background . atherosclerosis in the animals was assessed by analyzing plaque areas in aortic sinuses and the effects of sr - bi gene disruption on plasma lipoproteins in apoe ko mice . mice were 4 - 7 weeks old . plasma apoa - i levels ( right , mean ± sd , expressed as relative units ) were determined by sds - polyacrylamide ( 15 %) gel electrophoresis followed by quantitative immunoblotting for apoe −/− ( n = 7 ) and sr - bi −/− apoe −/− females ( n = 5 ) ( p = 0 . 1 ). lipoprotein cholesterol profiles : plasma lipoproteins from individual apoe −/− or sr - bi −/− apoe −/− females were separated based on size ( superose 6 - fplc ) and total cholesterol in each fraction ( expressed as mg / dl of plasma ) was measured . pooled superose 6 - fplc fractions (˜ 21 μl per pool ) from females in an independent experiment were analyzed by sds - polyacrylamide gradient ( 3 - 15 %) gel electrophoresis and immunoblotting with an anti - apoa - i antibody , rigotti a ., et al ., ( 1997 ). each pool contained 3 fractions and lanes are labeled with the number of the middle fraction in each pool . average ez hdl cholesterol fplc profiles for apoe −/− or sr - bi −/− apoe −/− males ( n = 3 ) or females ( n = 3 ). agarose gel electrophoresis and immunoblotting : pooled fractions ( kovanen , et al ., ( 1979 ), plump , et al ., ( 1996 ), acton , et al ., ( 1996 ), babitt , et al ., ( 1997 ), gu , et al ., ( 1998 ), temel , r . e ., et al ., ( 1997 ), kozarsky , k . f ., et al ., ( 1997 ), rigotti a ., et al ., ( 1997 ), varban , m . l . et al ., ( 1998 ), wang , n ., et al ., ( 1998 ), and ueda , y ., et al ., ( 1999 ),, 3 . 5 μl ) from the idl / ldl region of the lipoprotein profile from individual apoe −/− or sr - bi −/− apoe −/− females were analyzed using either anti - apoa - i or anti - apob antibodies . migration was upward from negative to positive . gallbladder biliary cholesterol ( mean ± sd ): total gallbladder biliary cholesterol from both male and female mice of the indicated genotypes ( n = 10 or 11 per genotype ) was measured . except for the wild - type and apoe −/− values , all pairwise differences were statistically significant ( p & lt ; 0 . 025 - 0 . 0005 ). to determine the effects of sr - bi gene disruption on atherosclerosis in apoe ko mice . atherosclerosis in sr - bi −/− ( n = 8 , 4 - 6 weeks old ), apoe −/− ( n = 8 , 5 - 7 weeks old ), or sr - bi −/− apoe −/− ( n = 7 , 5 - 6 weeks old ) female mice was analyzed in cryosections of aortic sinuses stained with oil red o and meyer &# 39 ; s hematoxylin as described in methods . representative sections through the aortic root region and cross - sectional areas of oil red o stained lesions in the aortic root region , showed average lesion areas ( mm 2 ± sd ) for sr - bi −/− apoe −/− , apoe −/− or sr - bi −/− mice , respectively , were as follows 0 . 10 ± 0 . 07 , 0 . 002 ± 0 . 002 , and 0 . 001 ± 0 . 002 ( p = 0 . 0005 ). also see table ii . high magnification views of serial sections of plaque from the aortic sinus of a 7 week old sr - bi / apoe double ko male , stained either with oil red o and meyer &# 39 ; s hematoxylin or with an anti - α actin antibody which recognizes smooth muscle cells . the lumen is to the left of the plaque . the smooth muscle wall and cellular cap are indicated . ( table ii quantitative analysis of females ; qualitative analysis of a smaller sample of males gave similar results . there were virtually no detectable lesions in the single ko animals at this relatively young age ( 4 - 7 weeks , zhang , s . h ., et al ., ( 1992 ), zhang , s . h ., et al ., ( 1994 ), plump , a . s ., et al ., ( 1992 ). however , there was substantial , statistically significant , lesion development in the double kos in the aortic root region , elsewhere in the aortic sinus ( table 11 ), and in coronary arteries . the lipid - rich lesions were cellular ( hematoxylin stained nuclei were seen at high magnification ) and in some cases had a cellular cap which stained with antibodies to smooth muscle actin . thus , the atherosclerotic plaques were relatively advanced . potential causes of the dramatically accelerated atherosclerosis in the double kos include : i ) changes in relative amounts of cholesterol in proatherogenic ( e . g ., increased vldl sized or abnormally large hdl - like particles ) and antiatherogenic ( e . g ., loss of normal hdl ) lipoproteins , ii ) altered flux of cholesterol into or out of the aortic wall , perhaps directly due to sr - bi - mediated efflux , kozarsky , k . f ., et al ., ( 1997 ), ji , y ., et al ., ( 1997 ), and stangl , h ., et al ., ( 1998 ), iii ) decreases in rct , suggested by the generation of abnormally large , hdl - like particles and decreased biliary cholesterol levels due to absence of hepatic sr - bi activity , and iv ) changes in other metabolic / organ systems which might influence the cardiovascular system . for example , there was significant accumulation of oil red o staining lipids in other tissues , including the myocardium , in the double , but not single , ko animals . in addition , at 5 - 6 weeks of age when the double kos were studied , they were somewhat smaller (˜ 20 % lower weight ) than single apoe ko controls . while most did not exhibit overt signs of illness at that time , they all died suddenly around 8 - 9 weeks of age . electrocardiographic studies indicated that premature death of the double kos was due to progressive heart block ( cardiac conduction defects ) and histology revealed extensive cardiac fibrosis and narrowing or occlusion of the coronary arteries , suggesting myocardial infarction ( mi ) due to advanced atherosclerotic disease . the anti - atherosclerotic effect of sr - bi expression in apoe ko mice is consistent with the recent reports that adenovirus - or transgene - arai , t ., et al ., j . biol . chem . 274 , 2366 - 2371 ( 1999 ), mediated hepatic overexpression of sr - bi in the cholesterol and fat - fed ldlr ko mouse reduces atherosclerosis . thus , pharmacologic stimulation of endogenous sr - bi activity may be antiatherogenic , possibly because of its importance for rct . the accelerated atherogenesis and loss of normal size hdl cholesterol in the double kos resembles that reported for high - fat diet fed single apoe ko mice zhang , s . h ., et al ., ( 1994 ), and plump , a . s ., et al ., ( 1992 ); although those mice have far higher total plasma cholesterol levels ( 1800 - 4000 vs . ˜ 600 mg / dl ). perhaps the similarities arise in part because the very high levels of large lipoproteins in the fat - fed single apoe ko might block the ability of sr - bi to interact with hdl and other ligands ( functional sr - bi deficiency due to competition ), or because of dietary suppression of hepatic sr - bi expression , fluiter , k ., et al ., j . biol . chem . 273 , 8434 - 8438 ( 1998 ). taken together with earlier work krieger , m ( 1999 ), the current study provides compelling evidence for the proposal that , at least in rodents , sr - bi is an hdl receptor which mediates physiologically relevant selective cholesterol transport and plays a key role in controlling plasma lipoprotein and biliary cholesterol concentrations and rct . it also influences hdl &# 39 ; s structure , cholesterol &# 39 ; s delivery to and utilization by cells ( including those in steroidogenic tissues ), reproductive and cardiovascular physiology and possibly other aspects of lipid metabolism , hauser , h ., et al ., biochemistry 37 , 17843 - 17850 ( 1998 ). because the in vitro activity , tissue distribution and regulation of human sr - bi , murao , k ., et al ., ( 1997 ), cao , g ., et al ., j . biol . chem . 272 , 33068 - 33076 ( 1997 ), calvo , d . et al ., j . biol . chem . 268 , 18929 - 18935 ( 1993 ), and liu , j ., et al ., j . clin . endocrinol . metab . 82 , 2522 - 2527 ( 1997 ), resemble those of the mouse , sr - bi may become an attractive target for prevention of or therapeutic intervention in a variety of human diseases acton , et al ., ( 1996 ), kozarsky , k . f ., et al ., ( 1997 ), rigotti a ., et al ., ( 1997 ), rigotti , a ., et al ., ( 1997 ), and krieger , m ., ( 1999 ). average lesion sizes in the aortic sinuses of mice deficient in sr - bi , apoe , or both . * values are the means ± sd ( number of animals indicated in parentheses ). ‡ means of combined values from the regions of the aortic root partial valve cusps , valve attachment sites and proximal aorta . † lesion sizes in each region were compared using the kruskall - wallis test modifications and variations of the methods and materials described herein will be obvious to those skilled in the art and are intended to be encompassed by the following claims . the teachings of the references cited herein are specifically incorporated herein .

US-60632400-A

a method for representing position and function of the jaw and bite of an individual . information regarding at least one part of the jaw and bite of the individual is input into the memory of a computer . vertical sections derived from the input information are displayed on a display be initiating first controls of the computer . a construction representing the vertical sections is produced . a model of the construction is produced . the model is applied to an articulator , wherein the articulator exposes and simulates position and function of the jaw and bite of the individual .

in fig1 reference 1 indicates a personal computer with a computer screen 1a . the computer equipment comprises a terminal 1b , and memory elements utilized in the computer equipment are symbolized by 2 . the computer equipment is arranged to reproduce vertical sections or contours graphically on the screen , as a function of first controls 1 . a first vertical section or contour is represented by 3 , and a second vertical section is represented by a broken line 4 . in the present case , the vertical section 4 illustrates an addition and / or alteration to the vertical section 3 . the addition and / or alteration is initiated by second signals i 2 . regarding the more detailed structure and function of the computer , reference is made to the swedish patent application cited . the vertical sections or contours represent the vertical section or the contour of the respective imaged object . in accordance with fig1 a and 1b , one vertical section at a time is reproduced on the computer screen 1a . a first vertical section of an object is symbolized by 3 &# 39 ; in fig1 a . a second vertical section of the same object is indicated by 3 &# 34 ; in fig1 b . the different vertical sections are taken at different angles of rotation about the center axis 5 of the object . the computer equipment can indicate , for example , 36 different vertical sections of the same object , in which case the vertical sections are taken after every tenth degree along the rotational turn of the object . according to fig2 an object is scanned or read by means of a device 6 which can consist of a camera , laser scan , needle scan , among others . in the present case , the object can be imaged an a photograph , drawing , or the like 7 . the object is indicated by 8 in fig2 . scanning information representing the object is shown by i 3 and is transmitted on diskette , via the telephone network 9 , or another medium , to the computer equipment 1 &# 39 ;. the latter includes receiving and adapting elements 10 for receiving the information i 3 via a connection 11 . the computer equipment includes , in a known manner , a bus connection 12 . the cpu of the computer equipment is indicated by 13 , and its memory elements by 14 . the terminal unit 1b &# 39 ; is linked to the bus connection 12 in a known manner . the information i 3 representing the object 8 is thus input to the computer 1 &# 39 ;, which operates with programs by means of which the graphic reproduction , in accordance with the above , can be effected by acting on the terminal ib &# 39 ;. fig3 shows an articulator device 15 which is known , and in which a jaw position 16 , 17 , comprising an upper jaw 16 and a lower jaw 17 , is applied by means of retention elements 18 , 19 and 20 , 21 , respectively . jaw movements can be simulated by means of the articulator . the articulator comprises hinge member ( s ) 22 . hinge member ( s ) 22 can initate simulation of movements in a known manner , for example manually , electrically , pneumatically , etc . the upper and lower jaws can thus be made to execute mutually related movements for the purpose of imitating mastication movements , for example . the movements are shown by arrows 23 , 24 and 25 , 26 , respectively . in the jaw position according to fig3 constructions or construction alterations 27 , 28 have been introduced . by means of the mobility of the articulator , the respective function of the respective construction or construction alteration can be exposed and can be observed by the dental technician . by means of the articulator , the technician can picture whether the construction or the construction alteration satisfies the dental requirements . if this is not the case , the technician can take the necessary measures . the constructions will be able to function with other units , such as teeth , bridges , implants , among others , in the jaw position or the bite . in fig3 two teeth have been indicated by 29 , 30 . fig4 shows a come construction 31 which can be produced using the novel arrangement and method . the cone construction comprises a telescope construction or a loose fixture consisting of three tooth replacement parts 32 , 33 and 34 . the tooth replacement parts are built on top of caps 35 , 36 and 37 . the caps can be pressed , via inner surfaces 35a , 36a and 37a , on to implant parts 38 , 39 and 40 . the implant parts can be secured in implants 44 , 45 and 46 in the jaw bone 47 by means of screws 41 , 42 and 43 . the implants and implant parts 38 , 44 and 39 , 45 and 40 , 46 can alternatively consist of treated tooth remnants , or other support members which are known . it should be noted here that there must be great accuracy of manufacture between the outer surfaces 38a , 39a and 40a , of the parts 38 , 39 and 40 , and the inner surfaces 35a , 36a and 37a . the cone construction is held together by fractional forces between the caps 35 , 36 and 37 and the parts 38 , 39 and 40 . the junctions ( angles ) 38b , 39b and 40b must also be formed with great precision in order to give a well - functioning cone construction . in the present case , the tooth replacement parts 32 , 33 and 34 are joined together via parts 48 , 49 . as is shown in fig4 the center axes 50 , 51 and 52 , respectively , of the respective arrangement can be vertical or can be inclined in one or other direction . it is necessary , in this respect , to be able to establish great precision in the construction , so that it can be held together by means of frictional forces in all cases . thus , in accordance with the novel method , information i 3 extracted and will be received in the computer equipment 1 &# 39 ;. the dentist or the dental technician will in this way be able to simulate the different shapes of , and additions to , the construction or construction alteration . in fig1 a specific construction is symbolized by its actual vertical section 3 . the vertical section 4 is intended to show an alteration or addition which has been effected by the operator . it will be possible for output signals i 4 , which represent the new construction , or construction alteration which has been made , to be extracted from the computer equipment for the purpose of producing a model 53 according to fig 5 . the model represents a jaw position or a bite which can be represented and simulated on the computer screen 1a . the model produced is applied in the articulator according to fig3 . the model ( can also be simulated on the computer screen 1a in whole or in part . the articulator is then acted on , in accordance with the above , to simulate movements in the tooth position or the bite . in fig6 a tooth in the upper jaw has been symbolized by 54 , and a tooth in the lower jaw has been symbolized by 55 . it can be seen from the figure that the interaction between the teeth is imposing tearing - out forces f on the upper tooth , in a direction which is at right angles to the main vertical direction 56 of the teeth . this interaction is unsatisfactory and should be corrected . fig7 shows an example of how such a correction according to the invention can be carried out . the tooth 54 &# 39 ; the upper jaw bas been provided with an added part 54a , via which the tooth 54 &# 39 ; can interact with the tooth 55 &# 39 ; in the lower jaw such that the forces of interaction f &# 39 ;, f &# 34 ; in the upper and lower teeth essentially coincide with the essentially vertical common axis 56 &# 39 ;. besides the added part 54a , the lower tooth has been corrected by means of a portion 55a having been removed . the teeth according to fig6 and 7 can also be represented on the computer screen 1a . likewise , alterations to the tooth constructions can be made with great precision in the computer equipment . the constructions and construction alterations can be effected in the computer equipment by means of so - called macro models and macro instructions . the invention is not limited to the embodiment described above , but can instead be modified within the scope of the attached patent claims and the inventive concept .

US-53278995-A

a flying disc has an outer annular doughnut - shaped hollow ring surrounding a generally planar central portion . the annular ring is permanently inflated to a high pressure . the flying disc is formed of a thermoplastic plastomer or elastomer and is capable of bouncing 20 - 25 feet after landing , and rolling an additional distance if it lands on its outer edge .

as shown in the attached drawing , fig1 - 4 , the disc amusement device of the present invention comprises a flying disc 10 which , due to its method of manufacture and its physical properties , is capable , after its flight has ended , of bouncing to a substantial degree and then rolling on its edge 12 . features which contribute to the aforementioned characteristics include the thermoplastic nature of the polymer from which the walls 14 of the flying disc 10 are made , the overall shape of the device including the preferred shape of the merger 18 between the doughnut shaped ring portion 16 and the flat portion 20 , the thickness of the walls 14 , and the pressure of inflation of the doughnut - shaped ring 16 . it is also desirable that the doughnut - shaped ring 16 be somewhat flattened , i . e . that its height be less than the distance between its outer edge 12 and its merged portion 18 with the flat central portion 20 . the overall weight of flying disc 10 should not exceed approximately 200 gms . the embodiment shown in fig1 - 4 , and particularly as shown in fig3 and 4 , is symmetrical , top and bottom , but such symmetry is only preferred , but is not essential . thus , as shown in fig1 a , the central portion 20 ′ may be bowed to a slight convex configuration of as little as two degrees , making the central portion 20 ′ almost flat , or the convexity may be as great as 20 °. the slightly bowed surface of the central portion 20 ′ assists in the flight of the flying disc . however , the disadvantage is that the flying disc of fig1 a flies more poorly if thrown in an upside - down position . the central portion 20 , 20 ′ may be embossed or debossed . substantially the same effect of the bowed central portion 20 ′ is achieved in the preferred embodiment of fig1 - 4 by the transition area 18 which constitutes a curved area providing the beginning of a concave shape . the material from which the flying disc 10 is formed is important for two reasons . first , it is highly desirable to foam the flying disc 10 by injection molding , and this means that the plastic material from which it is formed should be a thermoplastic plastomer or a thermoplastic elastomer . second , because of the desired bounceability of the flying disc 10 , the material from which its walls are formed needs to be relatively soft and flexible . the preferred material is a thermoplastic elastomer , and most desirable is a thermoplastic polyurethane . other materials , although less satisfactory , can be selected from polyethylene , polypropylene , softer polyvinyl chloride ( pvc ) and polyethylene terephthalate ( pet ). the preferred thermoplastic polyurethane is formed of polyol , diphenylmethane diisocyanate and toluene diisocyanate . fig4 a shows a less preferred variation where the transition area 18 ′ is curved in only one direction . this variation is desirably coupled with the variation of fig1 a . fig4 b shows another variation wherein the flat central portion is connected to the doughnut - shaped ring without any curvature whatsoever . this variation has the disadvantage that , although it is symmetrical and flies equally regardless of its up - or - down orientation , it does not fly as well as the preferred structure of fig3 and 4 . the flying disc 10 not only flies well , but also bounces and rolls , unlike any other known flying disc . depending on the surface on which the disc lands after flight , it can bounce as much as 25 - 30 feet . if it lands on its edge , it can also roll an additional distance . the foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can , by applying current knowledge , readily modify and / or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept , and , therefore , such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments . it is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation . the means , materials , and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention . thus the expressions “ means to . . . ” and “ means for . . . ”, or any method step language , as may be found in the specification above and / or in the claims below , followed by a functional statement , are intended to define and cover whatever structural , physical , chemical or electrical element or structure , or whatever method step , which may now or in the future exist which carries out the recited function , whether or not precisely equivalent to the embodiment or embodiments disclosed in the specification above , i . e ., other means or steps for carrying out the same functions can be used ; and it is intended that such expressions be given their broadest interpretation .

US-201313762142-A

a method for treating myocardial or skeletal muscle anoxia which occurs in coronary or post - infarct disorders or during prolonged physical activity and muscle fatigue . this method comprises the administration of a combination composition comprising an alkanoyl l - carnitine selected from the group consisting of isovaleryl l - carnitine , propionyl l - carnitine or the pharmacologically acceptable salts thereof or mixtures thereof ; and ribose or a phosphate derivative thereof .

in this test the technique adopted was the one using papillary muscle of rabbit heart perfused and subjected to anoxia which , as is known , leads to an impoverishment of its atp energy reserves . with this test , the aim was to observe whether or not preventive treatment with isovaleryl l - carnitine , with propionyl l - carnitine , with a carnitine combination or with ribose , or with a combination of these was capable of protecting cardiac muscle against the loss of atp induced by anoxia . in this test , a batch of new zealand rabbits was used , subdivided into different groups which were injected intravenously every day for three consecutive days with isovaleryl l - carnitine alone ( 100 mg / kg ), propionyl l - carnitine alone ( 100 mg / kg ) or a carnitine combination consisting of propionyl l - carnitine ( 25 mg / kg ), acetyl l - carnitine ( 25 mg / kg ), l - carnitine ( 25 mg / kg ), and isovaleryl l - carnitine ( 25 mg / kg ) or with ribose alone ( 100 mg / kg ), or ribose combined with the above - mentioned “ carnitines ”. at the end of the third day of treatment , all the animals were sacrificed and their hearts excised . sections of papillary muscle measuring 1 mm in diameter and 4 - 5 mm in thickness were isolated from the excised hearts . the isolated papillary muscle was perfused in a thermostatic bath with a saturated 100 % o 2 solution . the anoxic state was obtained by introducing 100 % n 2 instead of o 2 into the bath . for the measurement of the atp concentrations in the papillary muscle the method described by strehler was adopted ( strehler b . l . methods in enzymology 111 n . y . acad . press ., 879 , 1957 ). the analysis was carried out on tissue samples maintained in conditions of perfusion with oxygen for 90 minutes and after a period of anoxia of the same duration . the results of this test , presented in table 1 , indicate that propionyl l - carnitine , isovaleryl l - carnitine , the carnitine combination and ribose are individually capable of partly protecting the atp present in papillary muscle against anoxia , but that it was only with the combination of propionyl l - carnitine or isovaleryl l - carnitine plus ribose or with the combination of the carnitine combination plus ribose that complete protection against the anoxia - induced reduction in atp could be obtained , thus demonstrating the potent synergistic effect exerted by the components of the combination . adopting the technique described by selych ( selych et al ., angiology , 11 , 398 , 1960 ) and modified by clark ( clark c ., j . pharmacol . methods , 3 , 357 , 1980 ), these tests were used to evaluate the protective activity of isovaleryl l - carnitine , propionyl l - carnitine , carnitine combination , ribose and various combinations of the same against ventricular arrhythmias induced by left coronary ligation in the rat . coronary occlusion and the resulting myocardial anoxia lead , after 5 - 8 minutes , to the onset of arrhythmias . in these tests , ventricular ectopic contractions were counted for a period of 30 minutes after ligation both in control rats and in rats that had received slow injections into the left ventricle , 15 minutes before ligation , of a solution containing isovaleryl l - carnitine alone ( 100 mg / kg ), propionyl l - carnitine alone ( 100 mg / kg ), or carnitine combination alone consisting of propionyl l - carnitine ( 25 mg / kg ), acetyl l - carnitine ( 25 mg / kg ) and isovaleryl l - carnitine ( 25 mg / kg ) or ribose alone ( 100 mg / kg ), or a combination of ribose plus isovaleryl l - carnitine or propionyl l - carnitine or a combination of ribose plus carnitine combination at the doses described above . the results of this test ( table 2 ) indicate that , whereas isovaleryl l - carnitine alone or propionyl l - carnitine alone or carnitine combination alone or ribose alone produce only slight reductions in the number of ectopic contractions compared to controls , such contractions are reduced almost to the extent of disappearing altogether when ribose is injected in combination with isovaleryl l - carnitine , or propionyl l - carnitine , or carnitine combination , thus demonstrating the potent and unexpected synergistic effect exerted by the combination according to the present invention . what is meant by a pharmacologically acceptable salt of the various carnitines mentioned in the present invention , is , in addition to the respective inner salts , any salt of these with an acid which does not give rise to unwanted toxic or side effects . these acids are well known to pharmacologists and to experts in pharmaceutical technology . non - limiting examples of such salts are the following : chloride ; bromide ; iodide ; aspartate , acid aspartate ; citrate , acid citrate ; tartrate ; phosphate , acid phosphate ; fumarate , acid fumarate ; glycerophosphate ; glucose phosphate ; lactate ; maleate , acid maleate ; mucate ; orotate ; oxalate , acid oxalate ; sulphate , acid sulphate ; trichloroacetate ; trifluoroacetate and methane sulphonate . among these salts , isovaleryl l - carnitine acid fumarate ( u . s . pat . no . 5 , 227 , 518 ) is particularly preferred . a list of fda - approved pharmacologically acceptable acids is given in int . j . pharm ., 33 , 1986 , 201 - 217 , the latter publication being incorporated in the present specification by reference . the supplement of the invention may further comprise vitamins , coenzymes , mineral substances , aminoacids and antioxidants . the supplement may be manufactured in the form of tablets , lozenges , capsules , pills , granulates , syrups , vials or drops . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalents arrangements included within the spirit and scope of the appended claims .

US-75336810-A

a laser applicator includes an optical fiber with a core surrounded by a cladding . the cladding contains openings for coupling radiative energy outward . to accomplish an even distribution of energy , the size of the opening increases from the proximal end to the distal end . the openings are combined into groups , with the number of openings within a group varying . the openings are of a uniform size so that the area of decoupling can be produced in a simple manner .

the laser applicator comprises a catheter 10 in the form of an elongate strand . the catheter has one or a plurality of lumens . it is preformed in the manner illustrated in fig1 and is composed of a proximal section 11 and a distal end section 12 . whereas the proximal section 11 extends substantially linearly , the distal end section 12 is formed into a loop shaped as a circle open at one point . the plane of the loop is transverse , in particular at a right angle , with respect to the longitudinal direction of the proximal section . it is dimensioned such that it contacts the wall of a blood vessel from inside with slight pressure . the outer diameter of the loop is about 4 - 6 mm . the position a indicates the transition from the proximal section 11 to the end section 12 . the position b indicates the distal end of the distal end section . the decoupling portion 13 , where laser energy is coupled laterally out from the catheter , extends from the position a to the position b . in the decoupling portion 13 , the laser applicator has the cross section illustrated in fig2 . it has an integral elongate catheter body 15 of generally circular cross section and provided with a generally v - shaped groove . the groove 16 has two outwardly diverging flanks covered with a reflective layer 17 . the groove 16 extends up to near the longitudinal center axis of the catheter body 15 . the catheter body 15 includes a lumen 18 for a form wire 19 , as well as two longitudinal cooling channels 20 and 21 extending along the entire length of the catheter . a light guide 25 is set into the groove 16 from outside . the same has a core 26 and a cladding 27 surrounding the core , the material of the cladding having a lower refraction index than the core . the light guide 25 is fastened in the groove 16 by means of a transparent adhesive 28 . on the outer side , the catheter is sheathed by a transparent covering hose 29 . in the decoupling portion , the cooling channels 20 , 21 are provided with outlet bores 35 , 36 that converge towards each other and eject cooling jets outward . the outlet bores extend under an acute angle with respect to each other . they make the cooling jets impinge on the target area of the heat radiation . the outlet bores have corresponding openings in the covering hose . the light guide 25 is first machined outside the catheter by making openings 40 in the form of small bores in the decoupling portion 13 . the holes are burnt thermally into the material of the cladding by means of a focused laser beam . the light guide thus prepared is set into the lateral groove 16 of the catheter body 15 and is then fixed by means of the adhesive 28 . thereafter , the covering hose 29 is applied . the openings 40 in the cladding of the light guide are directed radially outward with respect to the center axis of the catheter body 15 . the adhesive 28 includes dispersing particles . the radiation escaping from the core 26 of the light guide is scattered at the particles and is reflected by the reflective layer 17 so that the radiation is focused at the focal point 42 where it acts on the body tissue . fig3 illustrates the arrangement of the openings 40 in the longitudinal direction of the light guide 25 along the length of the decoupling portion . the position a indicates the proximal end and the position b indicates the distal end of the decoupling portion 13 . in order to achieve a distribution of the laterally escaping energy that is as uniform as possible , the decoupling cross section has to increase towards the distal end . the openings 40 in the cladding 27 of the light guide 25 are bores of a diameter of 75 μm , thermally formed by means of a corresponding laser beam . the openings 40 are uniform in size . they all have the same diameter . all openings 40 are arranged in a linear array . they are combined into groups 45 . the number of openings in a group 45 varies . it increases from the proximal end a to the distal end b . it is obvious that the first group is formed by only one opening . thereafter , the groups become ever larger , i . e . they include more openings . the openings in a group are generally equidistant . they are arranged such that they just do not blend . the groups 45 are spaced apart . here , the distance is 400 μm . thus , the distance between the groups is constant along the decoupling portion . fig4 is an enlarged illustration of a series of groups 45 a , 45 b , 45 c . here , the last openings of the group are combined into a blended hole 46 . the blended hole is formed by the overlapping of two holes , with the degree of overlap differing for the groups 45 a and 45 b . here as well , the distance between the groups is 400 μm . by blending two openings , the overall cross section of a group can be varied with a fine grading . thus , the overall cross section is increased quasi continuously from group 45 a via group 45 b to group 45 c . the blended hole 46 is situated at the distal end of a respective group . the invention allows making the openings as uniform openings , where the only varying parameter for a change in the outlet cross section is the linear position of the openings . the invention has been described with reference to the preferred embodiments . modifications and alterations may occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .

US-200913130889-A

disclosed are devices and methods for loading an intrauterine device with a thread or suture engaged therewith into an insertion device . the devices and methods are suitable for use with an automated knot typing system .

fig1 a - d illustrates a t - frame intrauterine device ( iud ), having an eyelet ( aperture ) at one end through which a flexible member , such as a thread or suture , is secured . a conventional t - shaped iud 102 , is illustrated in fig1 a . iuds typically have a length of from about 31 . 5 mm to about 32 . 5 mm and a width of from about 31 . 5 mm to about 32 . 5 mm when the iud is in the fully deployed position . as will be appreciated by those skilled in the art , the length does not include the knot or strings that may accompany the iud . the t - shaped iud comprises an elongated body 104 having a proximal end 10 and a distal end 20 . the elongated body 104 can include a time - release drug such as a hormone . in some configurations , the time - release drug can be provided as a coating or covering . the elongated body can be formed from any suitable material , including , but not limited to plastic or metal alloy . at the distal end 20 of the iud ( i . e ., the end positioned away from the physician &# 39 ; s hand ), iud arms 106 a , 106 b are attached to or integrally formed with the elongated body 104 . the iud arms 106 a , 106 b are configurable to fold upward u or downward d to minimize the iud cross - section such that the iud can fit into an insertion device sheath or tube for insertion through the cervix and into the uterus during deployment . additionally , either or both of the iud arms 106 a , 106 b are configurable to include an enlarged or bulbous tip 108 a , 108 b , which can , for example , have a curved , spherical or semi - spherical shape . the bulbous tips 108 a , 108 b of the iud arms 106 a , 106 b can be formed such that the iud arms 106 a , 106 b , when folded upward and pushed together , form a smooth and rounded distal tip . at the proximal end 10 of the iud 102 , the iud 102 can further include one or more flexible members 110 a , 110 b , such as strings , attached to the iud 102 . the flexible members 110 a , 110 b are connectable to the iud 102 at a connection point 111 which can be an aperture or eyelet in the elongated body 104 at the proximal end 10 , e . g ., tied in a knot as illustrated . for purposes of providing perspective to the various components of the loading device and the iud and iud insertion device , the relative terms of proximal and distal have been used where proximal refers to the end closest to the user and distal refers to the end further away from the user . thus it is convenient to describe the loading device in a way which references the positioning of the proximal and distal ends of the iud and the iud insertion device . these references are provided for convenience of disclosure and are not meant to be limiting . fig1 b is a cross - section of an insertion device ( such as the insertion device shown in fig1 c ). as can be seen in this illustration when the iud 102 is positioned at the distal tip or the elongated sheath 132 of the iud insertion device 100 prior to deployment , the distal 20 tip has an aperture 131 with a diameter d 1 that is smaller than the diameter d 3 of the iud 102 . the aperture of the iud insertion device 100 has a diameter d 1 that is smaller than the diameter d 2 of the sheath of the iud insertion device 100 . the iud 102 is rotatable r in - plane about longitudinal axis x , such that the iud arms 106 a , 106 b or similar features of the iud 102 will deploy in - line with respective openings of the patient &# 39 ; s fallopian tubes . an exemplar iud insertion device 100 is illustrated in fig1 c . the iud insertion device 100 is configurable to comprise a first cavity 145 a and a second cavity 145 b in the handle 135 . during step 3 of the insertion procedure , the sheath slider 142 and string control slider 146 are in the full proximal 10 position along the longitudinal axis of the elongated guide , and at least partially surrounded by the second cavity 145 b which is proximal to the first cavity 145 a . additional visual indication features 160 , 160 ′, 160 ″ are shown . visual indication features can be provided on the elongated sheath 143 , the handle 135 , or both . the numbers 1 , 2 , and 3 on the insertion device components provide a visual indication to the user the appropriate positions of the insertion device components during the multiple phases of the insertion procedure . visual indicators , such as numbers , can be applied in any suitable fashion including , but not limited to , printing , etching , molding , stamping , and the like . moreover , visual indicators can be positioned such that they are visible only during certain aspects of the procedure , and not visible during other aspects of the procedure . fig1 d illustrates an iud partially positioned within the distal end of an iud deployment device within packaging 190 . the iud arms 106 a , 106 b extend beyond the distal end of the iud deployment device 100 . fig2 a is an exploded view of an iud insertion device loader 200 . the iud insertion device loader 200 has an elongated planar base 210 which supports a linear slider 212 . a support plate 214 can also be provided which engages the linear slider 212 . an insertion device retainer 230 is provided and is configurable to engage the insertion device ( such as the iud insertion device 100 shown in fig1 c ) during the loading process . an iud retainer 220 is positioned in - line with the insertion device retainer 230 and positioned above the support plate 214 . a clamp 250 is positioned between the iud retainer 220 and the insertion device retainer 230 . pneumatic controls 270 can be provided at one end of the assembly to apply a vacuum , for example on an end of the assembly having the insertion device retainer 230 . the vacuum can be applied by any suitable vacuum applicator , such as a vacuum pump or venturi pump . the pneumatic controls can include pneumatically controlled valves that control the flow of pressurized air . suitable valves include , for example , needle valves . the support plate 214 can engage the linear slider 212 and elongated planar base 210 by any suitable mechanism including , for example , the use of screws , bolts , washers , nuts , adhesive materials , or any other suitable material or device . fig2 b is a close - up of the clamp 250 in an open configuration which , when closed , has an aperture therethrough forming a channel 252 formed in one or both the surfaces of the interior surfaces 254 , 254 ′ of the clamp 250 . in one configuration , the clamp 250 is a bivalve having two similar parts hinged together . the two parts or plates 256 , 256 ′ of the clamp 250 open and close about a hinge 258 . when the clamp 250 is closed an aperture extends linearly from a first end to a second end . the aperture has a first recess 260 on the first end , followed by a central tubular portion 260 ′ forming an interior portion of the aperture , and then a second recess 260 ″ on the second end . as illustrated the first and second recesses are shaped to define a conical aperture where the widest portion of the aperture is adjacent the exterior surface of the clamp 250 , and the narrowest portion is adjacent the central tubular portion 260 ′. as will be appreciated by those skilled in the art , other shapes could be used without departing from the scope of the disclosure . during use , the clamp 250 can be secured in a closed position using any suitable mechanism , including , but not limited to the use of magnetic material , suitable clasps or pins . fig2 c illustrates the iud insertion device loader 200 shown in fig2 a in an assembled configuration . fig3 a - g illustrate the steps of using the iud insertion device loader 200 shown in fig2 . the iud insertion device 100 is placed on the insertion device retainer 230 . a hypotube 280 of the iud insertion device loader 200 is inserted into a proximal aperture 148 of iud insertion device 100 . a suitable hypotube 280 is a small radiused tube which can , for example , be made from stainless steel . the hypotube 280 , passes through a central aperture of the iud insertion device 100 from the proximal end 10 until it exits a distal end 20 of the iud insertion device 100 . the end of the hypotube 280 extending out of the distal end of the iud insertion device 100 is placed within the central channel 260 ′ formed in the clamp 250 while the clamp 250 is in an open position ( shown in fig2 b ). the distal end 20 of the iud insertion device 100 is positioned within the first recess 260 which is a conical aperture formed at the insertion device receiving end of the clamp 250 . the positioning of the iud insertion device 100 is such that the distal end 20 of the iud insertion device 100 is not pinched by the clamp 250 when the clamp 250 is in a closed positon ( shown in fig3 f ), or otherwise engaged by the clamp 250 to cause deformation of the distal end 20 of the iud insertion device 100 . the iud 102 is placed within the iud retainer 220 so that the flexible members 110 a , 110 b , or strings , are positioned near the iud receiving conical opening 252 ″ of the clamp 250 . the end of the strings or flexible members 110 a , 110 b are positioned near enough the iud receiving conical recess 252 ″ of the clamp 250 so that when the vacuum is applied by the vacuum applicator to the hypotube passing through the iud insertion device 100 into the clamp 250 , the strings or flexible members 110 a , 110 b are placed a centimeter or two inside the inner channel 252 ′ of the clamp / hypotube and then the vacuum draws the flexible members 110 a , 110 b through the remainder of the iud insertion device . thereafter , the clamp 250 is opened , and the iud 102 is drawn into a final position within the iud insertion device 100 so that the iud 102 and iud insertion device 100 are ready to be packaged and shipped as shown in fig1 d . once the iud is positioned within the iud inserter device , the device can be packaged , sterilized and shipped . while preferred embodiments of the present invention have been shown and described herein , it will be obvious to those skilled in the art that such embodiments are provided by way of example only . numerous variations , changes , and substitutions will now occur to those skilled in the art without departing from the invention . it should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention . it is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby .

US-201615214164-A

an apparatus is adapted for insertion in a body lumen having a surgical connection . the apparatus includes a first conduit insertable in the lumen and having a distal end portion spaced distally beyond the surgical connection . the first conduit directs fluid through the lumen and isolates the fluid from the surgical connection . the apparatus also includes a second conduit insertable in the lumen . the second conduit has a distal end portion positioned adjacent the surgical connection . the second conduit is adapted to control the pressure in a space in which the surgical connection is exposed .

the present invention is related to systems , methods , and apparatus for helping to reduce leakage through sutured connections in lumens in the body and drawing the connections together to promote quick and complete healing . the invention is described herein with respect to urinary catheters to facilitate healing of a sutured connection between the urethra and the bladder following radical prostate prostatectomy surgery . it will , however be apparent to those skilled in the art that the following detailed description is similarly applicable to sutured connections of other body lumens and other types of surgery . fig4 is illustrative of a system or apparatus 50 for helping to reduce leakage through connections , such as sutured connections , in lumens in the body and drawing the connections together to facilitate and promote quick and complete healing . fig4 illustrates a body 52 in which the prostate gland ( not shown ) together with the section of the urethra that passes through the gland is removed surgically . the remaining urethra 54 is attached to the bladder 56 via a surgical , e . g ., sutured , connection 58 to provide a urine passage . the catheter 60 is inserted into the body 52 through the penis and urethra 54 , beyond the sutured connection 58 and into the bladder 56 . referring to fig5 and 6 , the catheter 60 includes an inner , first tube or tubular member 70 , a middle , second tube or tubular member 72 , and an outer , third tube or tubular member 74 . the tubes 70 , 72 , and 74 are generally elongate and flexible and are constructed of materials , such as latex or silicone rubber , that are suitable for the medical uses described herein . the tubes 70 , 72 , and 74 are arranged generally concentric with each other and extend along a longitudinal axis 100 . the first tube 70 defines a first passage or conduit 80 that , in the embodiment illustrated and described herein , serves as a urine passage , which is described in further detail below . an annular second passage or conduit 82 is defined between an outer surface of the first tube 70 and an inner surface of the second tube 72 . in the embodiment illustrated and described herein , the second conduit 82 serves as an inflation passage for inflating or filling an elastic bulb 62 , which is described in further detail below . a third passage or conduit 84 is defined between an outer surface of the second tube 72 and an inner surface of the third tube 74 . in the embodiment illustrated and described herein , the third tube 74 may include ribs 76 on its inner surface that help support and maintain the position of the third tube on the second tube 72 . the third conduit 84 thus may comprise a series of axial grooves defined by the ribs 76 and spaced about the circumference of the second tube 72 . alternatively , the third conduit 84 could have an annular configuration similar to that of the second conduit 82 . in the embodiment illustrated and described herein , the third conduit 84 serves as a vacuum passage for helping to control pressure differentials between an annular pressure p an , an abdominal pressure p ab , and atmospheric pressure p at , which is described in further detail below . when the catheter 60 is inserted as shown in fig4 and 6 , the urine conduit 80 drains urine from the bladder to an external collection bag ( not shown ). the elastic bulb 62 at the bladder or distal end 64 of the catheter 60 is inflated or filled with saline solution delivered via the second conduit 82 to anchor it in the bladder 56 . once the bulb 62 is filled , the second conduit 72 is capped off . an annular region 90 is defined between the catheter 60 and the region of the urethra 54 and bladder 56 at or adjacent the sutured connection 58 . the third tube 74 has a distal end portion 102 that terminates adjacent or just behind the elastic bulb 62 ( i . e ., before a proximal end of the bulb ) at or in the vicinity of the annular region 90 . this places the third conduit 84 in fluid communication with the annular region 90 . referring to fig4 , an outside or proximal end portion 104 of the third tube 74 is fitted with a service connection 110 that communicates with the third conduit 84 . the service connection 110 includes an annular collar 112 that encircles the first and second conduits 70 and 72 and engages the third conduit 74 to establish fluid communication with the third conduit 84 . the service connection 110 also includes a service tube or tap 114 that is connected to the collar 112 and is in fluid communication with the third conduit 84 via the collar 112 . in use , a partial vacuum is applied to the service connection 110 . any suitable vacuum source may be used , such as an elastic squeeze bulb 116 secured to the service tube 114 . this reduces the pressure p an in the annular region 90 ( see fig5 ). the vacuum is applied such that p an is lower than atmospheric pressure p at and the abdominal pressure p ab . as a result , the pressure differential across the sutured connection 58 is reversed compared to that illustrated in fig3 . this is indicated generally in fig6 by the pressure forces 122 . as shown in fig6 , the pressure forces 122 would tend to close the sutured connection 58 , which would help speed healing . this would also help reduce or eliminate the need for the application of mechanical traction forces ( indicated generally at 124 in fig4 ). also , the reversed pressure differential would allow urine seeping around the bulb 62 into the annular region 90 to be intercepted and removed via the third conduit 84 , which helps prevent the seepage from flowing through the healing sutured connection 58 and into the abdominal cavity 130 . this may help eliminate or reduce the need for jackson - pratt drains 132 for urine removal from the abdominal cavity 130 , although drains may still be needed for removal of other fluids . if a jackson - pratt drain 132 is used , the vacuum is adjusted such that p an is less than p ab . the vacuum may thus be applied to the annular region 90 throughout substantial portion of the duration of use of the system 50 . for example , the vacuum may be removed for periodic maintenance of the system 50 . in other respects , the catheter 60 of the present invention provides similar or identical functions as the foley catheters described above . the catheter 60 it is left in place during the healing process to drain urine from the bladder 56 in order to assure complete voiding and reduce pressure stress at the sutured connection 58 . the catheter 60 also maintains the bladder 56 at atmospheric pressure p at by the open urine conduit 80 . the catheter 60 also provides mechanical support to reduce shrinkage of the urine passage caused by scar tissue contraction as the sutured connection 58 heals . optionally , traction forces 124 may be applied to press the bladder 56 more tightly against the urethra 54 to supplement the pressure forces 122 . the catheter 60 may thus comprise a foley catheter and a concentric sleeve in which the foley catheter is disposed . from the above description of the invention , those skilled in the art will perceive improvements , changes and modifications . such improvements , changes and modifications within the skill of the art are intended to be covered by the appended claims .

US-29878805-A

a substrate for mushroom cultivation comprises a polyene fungicide , in particular , natamycin . mushrooms cultivated in such substrates can be harvested earlier than mushrooms cultivated in substrates which do not include polyene fungicides . alternatively , mushrooms grown in a substrate comprising a polyene fungicide achieve a greater size than mushrooms grown for the same amount of time in a substrate which does not include a polyene fungicide .

substrates and processes of the invention are applicable to the cultivation of any species of mushroom . preferred species include pleurotus ostreatus , shiitake mushrooms and agaricus bisporus and in particular varieties of the latter species , such as agaricus bitorqius . the growth substrate may be a compost , a casing or top - layer , a defined growth substrate or any other growth substrate suitable for cultivation of mushrooms . raw materials of compost include water , straw ( e . g . wheat , rye , barley , oats or rice ), manure ( usually from horse and / or poultry ), minerals such as calcium sulphate ( or other calcium containing compounds ) phosphor , magnesium , sulphur and potassium , nitrogen sources such as proteins , amino acids , ureum , nh 4 + ; vitamins such as thiamine and biotin and additional nutrient compositions such as meal , grid and flour for example soy flour , corn gluten meal , potato protein , peanut meal , linseed meal , cotton seed , meat and bone meal , beneficial for growth of the mushroom mycelium and fruiting bodies . after the fermentation process , the compost is inoculated with mushroom spawn . the spawn can be prepared by any method known in the art . usually , the spawn is prepared by inoculating the mushroom mycelium on a carrier , e . g . rye grain . the casing may contain any suitable compound . examples of raw materials of the casing are peat , clay , marl , calcium sulphate , or “ schuimaarde ”, which is prepared from waste of the sugar / sugar beet industry . the anti - fungal agent is a polyene fungicide . examples of polyene fungicides include natamycin , nystatin , lucensomycin and ampohotericin b . the preferred polyene compound is natamycin . also , combinations of polyene fungicides with each other or with other fungicides may be used . also included in this invention are derivates of polyene fungicides for example salts of polyene fungicides ( e . g . calcium - and barium salts of natamycin ), solvates of polyene fungicides ( e . g . methanol solvate of natamycin ) and crystal modifications of polyene fungicides ( e . g . as described in european patent publication no . 670676 , ( 1995 )). a substrate of the invention may comprise any combination of said growth substrates for mushrooms and said polyene fungicides or modified forms thereof . the polyene fungicide , e . g . natamycin , can be added in an effective amount to the growth medium for mushrooms as a powder , an aqueous composition ( which 30 may be a suspension ), an aqueous composition using alkaline or acidic conditions or dissolved in a suitable solvent system , such as methanol , ethanol , propanol , glycerol , glycol , methoxy ethanol or ethoxy ethanol , or glacial acetic acid . also , suitable solubilizers can be used . the polyene fungicide can also be applied on a carrier by well - known methods . furthermore , any preparation containing polyene fungicides , e . g . natamycin , can be used in this invention . examples of such polyene fungicide preparations are the commercially available powder compositions sold under the trademarks delvocid ® or natamax ®, these compositions contain about 50 % ( w / w ) natamycin . it will be appreciated that all conventional ways of adding the natamycin are included in the present invention . examples are spraying on the compost / casing , physically mixing of natamycin with the compost / casing , soaking of compost / casing with a natamycin containing liquid . the natamycine can be sprayed on the casing and / or compost . advantageously 1 - 200 mg of natamycin per m 2 is added , preferably 1 - 100 and more preferably 3 - 30 mg / m 2 of natamycin is added to the casing and / or compost . it has been found that least the top layer of the compost or casing advantageously comprises natamycin in a concentration of 0 . 05 - 50 mg / kg , preferably 0 . 2 - 40 and more preferably 0 . 3 - 30 mg of natamycin is present per kg of the top layer of the compost or casing . in general the natamycin containing layer is 1 - 10 cm , preferably 2 - 5 cm thick . the polyene fungicide can be added to the growth substrate at any appropriate time . when applied as a powder , it can be mixed through the growth substrate , e . g . the casing and / or the compost , before , during or after fermentation . the polyene fungicide may also be an ingredient of any composition added to the growth substrate , e . g . the spawn , agents to prevent microorganism , insects , memathodes , mites and unwanted fungi , or the extra nutrients ( compositions such as meal , grid and flour for example soy flour , corn gluten meal , potato protein , peanut meal , linseed meal , cotton seed , meat and bone meal ), which are often added during or after the composting process . thus , the invention also includes any supplements , e . g . spawn , anti - microbial agents or nutritional compositions ( e . g . soybean products ), containing polyene fungicides . the concentration of polyene fungicide in a supplement will typically be higher than that present in a substrate , so that when the supplement is added to the substrate the concentration of the polyene fungicide falls to an appropriate effective concentration . alternatively , the polyene fungicide can also be added to the casing , which is often used to cover the compost layer and promotes development of the fruiting bodies . when applied as an aqueous suspension or a solution in e . g . a solvent , the polyene fungicide can be applied as described above ( i . e . mixed directly into the mushroom growth medium ). however , liquid compositions can also be sprayed over the surface of the compost and / or casing at any suitable moment . examples of suitable moments are before cultivation of the mushrooms ( during / after mycelial growth in the growth substrate ) or just after harvesting , e . g . between the first and second or second and third harvest . spraying can be carried out by any method known in the art , e . g . by using a simple sprayer or spray equipment , which is used in the mushroom industry . a saturated solution of 30 ppm of natamycin in water was prepared using well known methods . compost inoculated with spawn of a . bisporus was prepared using well known methods . two boxes of approximately 50 × 50 cm were filled with the compost , which was then covered with a casing using well known methods . directly after covering with the casing ( day 1 ), one box ( no . 1 ) was sprayed with 1 liter of water , and the other box ( no . 2 ) was sprayed with 1 liter of a solution containing 30 ppm of natamycin in water . mycelial growth was then induced by incubating the boxes for 18 days under standard conditions . on day 18 box no . 1 was sprayed with 0 . 5 liter of water , while box no . 2 was sprayed with 0 . 5 liter of a solution containing 30 ppm natamycin in water . the boxes were then incubated under standard conditions to induce formation of mushrooms . after the first and second harvest 2 liters of water was sprayed on the surface of box no . 1 , while box no . 2 was treated with 2 liters of the natamycin solution . in case of the control ( box no . 1 ) mushrooms could be harvested on day 21 , day 29 and day 35 . in case of spraying with said natamycin solution ( box no . 2 ) the mushrooms did grow considerably faster and could be harvested 1 - 2 days earlier . the quality of the mushrooms was not affected in a negative way by the natamycin treatments . this example clearly demonstrates that treatment of the growth substrate with natamycin speeds up the growth of mushrooms in such a way that harvesting can occur at least 1 day earlier . alternatively the mushrooms can grow larger in the same period of time . this example describes the effect of natamycin on the yield of mushrooms . tubs having an area of 0 . 26 m 2 were filled with commercially prepared pasteurized mushroom substrate inoculated with spawn ( seed ) of the commercial button mushroom agaricus bisporus . following colonization by the mushroom fungus , the substrate was covered by a layer of peat moss , mixed with limestone ( the casing layer ) and further incubated under well known standard conditions until mycelial strands were visible on the surface . fruiting bodies were initiated by manipulating the external environment using methods well known in the industry . 9 tubs were treated five days prior to the first flush by applying an aqueous solution containing 10 ppm of natamycin , as a control 9 tubs were treated the same way however without natamycin . the aqueous solution was applied at a rate of 1 . 84 liter per square meter and the mushroom beds were allowed to continue growing . after 3 flushes , it was demonstrated that a statistically significant yield increase could be identified as compared to the untreated control . the average yield of the untreated beds was 3 . 40 pounds per square feet , while the average yield of the beds treated with natamycin was 3 . 94 pounds per square feet . the quality of all musrooms was good . this result clearly demonstrate that treatment of natamycin enhances the yield of the mushrooms considerably . this example demonstrates the effect of natamycin against four important mushroom pathogens : the moulds mycogone pernicosa , trichoderma harzianum , dactylium dendroides and verticillium fungicola . each of these organisms were field isolates . potato dextrose agar plates containing 0 , 10 and 20 ppm of natamycin and mould suspensions were prepared using well known methods . the freshly prepared suspensions were dilluted to final concentrations of 10 4 colony forming units / ml . 10 μl of each mould suspensions was inoculated in a spot on the agar plates ( in duplo ). the plates were incubated for 5 days at 25 ° c . after 5 days of incubation on the control plates containing no natamycin , clear colonies were formed . in case of plates containing 10 ppm of natamycin inoculated with verticillium fungicola only some slight growth was observed , while on the plates containing 20 ppm of natamycin no growth was observed . in case of the three other mould species no growth was observed on plates containing 10 and 20 ppm of natamycin . these results clearly demonstrate that natamycin inhibits the growth of these four relevant mushroom pathogens .

US-60818600-A

catechol derivatives which relate to the production of nerve growth factor in particular tissues of brain are disclosed . methods for the synthesis , data on the physiological activity , and data on the toxicity of these derivatives as well as examples of preparation for their administration are also disclosed . the disclosed derivatives provide preventive and remedial effect for regressive disorders in the central nervous system including senile dementia of alzheimer type .

the present invention is a preventive and remedial preparation for regressive disorders in the central nervous system which comprises as an effective ingredient a catechol derivative having the formula ( a ): ## str1 ## wherein r is two hydrogen atoms , two acyl groups , a -- co -- group , -- co . co -- group , or -- c ( ch 3 ) 2 -- group , and wherein r 1 and r 2 are each independently a hydrogen atom or lower alkyl group . among these derivatives for use in the medicinal compositions , the below described derivative is a novel compound which has not yet been known . that is , a catechol derivative having the formula ( b ): ## str2 ## wherein r 3 is two acyl groups , a -- co -- group , -- co . co -- group or -- c ( ch 3 ) 2 -- group , and r 4 is a lower alkyl group , and wherein excluding when r 3 is acetyl group and r 4 is methyl group and when r 3 is -- co . co -- group and r 4 is methyl group . ( 1 ) a catechol derivative having the formula ( c ): ## str3 ## wherein r 5 is an acyl group and r 6 is a lower alkyl group , and wherein excluding when r 5 is an acetyl group and r 6 is a methyl group , ( 2 ) a catechol derivative having the formula ( d ): ## str4 ## wherein r 7 is a lower alkyl group , ( 3 ) a catechol derivative having the formula ( e ): ## str5 ## wherein r 8 is a lower alkyl group and wherein excluding when r 8 is a methyl group , and ( 4 ) a catechol derivative having the formula ( f ): ## str6 ## wherein r 9 is a lower alkyl group . at the first step , neurotransmitters and agonists of their receptors , neuromodulators , etc . and their structurally related compounds were selected in order to search the active derivative of this invention . typical compounds were selected from those exhibiting the activity for accelerating the production and secretion of ngf in the screening system in vitro using cultured cells . in the experiments in vivo using rats , these typical compounds have induced the production and secretion of ngf in the particular regions of brain even by the peripheral administration . furhtermore , these compounds have been confirmed to remarkably improve behavioral pharmacological parameters . supposing anti - sdat activity . thus the present invention has been achieved . that is , in the peripheral nervous system , a positive correlation has been observed between ngf - gene expression in the specific tissue and norepinephrine content , e . g . level of sympathetic innervation [ d . l . shelton and l . f . reichardt , proc . natl . acad : sci usa , 81 , 7951 - 7955 ( 1984 )]. norepinephrine itself , a neurotransmitter secreted from nerve endings , was possible to be a positive effector for the ngf - gene expression , and such suggestion led to the present invention . actually furukawa et al . have reported that l - m - cells , e . g . cultured cells derived from the peripheral tissue , were accelerated the production amount of ngf by some compounds of catecholamines . the present inventors have also identified the fact by a similar experimental system . furthermore , it has been surprisingly found that the total structure of catecholamines are not needed for exerting the acceleration effect , but catechol ring ( 1 , 2 - dihydroxybenzene ) is essential . it has also been found that the alkyl substituents at 3 - and / or 4 - positions on the catechol ring determine the activity of the catechol derivative . in addition to such a relatively simple catechol derivative , its hydroxyl groups in 1 and 2 positions were chemically modified in accordance with pharmaceutical and toxicological considerations . the derivative thus obtained has also been proved to have similar activity . more surprisingly , any of such derivative has also exerted activity for promoting the production and secretion of ngf in the culture systems of astroglial cells derived from the brain . moreover the activity of such derivative has been remarkable as compared with that of catecholamines . the typical catechol derivative has further accelerated by the peripheral administration the production of ngf in the central nervous system of rats , particularly in the cerebral cortex and hippocampus . the examination on behavioral pharmacology has also revealed that the derivative has activity for recovering model animals disordered in the memory and learning functions from their damaged conditions . in the catechol derivative of this invention having the formula ( a ) to ( f ), the acyl group is acetyl group , propionyl group , butyryl group or isobutyryl group etc . and the lower alkyl group is methyl group , ethyl group , propyl group , isopropyl group , butyl group or isobutyl group etc . the catechol derivative which may be used in this invention is prepared by the below described processes . ( 1 ) a method for reacting homocatechol with a corresponding lower fatty acid or its anhydride in the presence of an acid catalyst including mineral acids such as sulfuric acid , hydrogen halide etc ., lewis acids such as anhydrous aluminium chloride , zinc chloride , iron chloride , titanium tetrachloride , tin tetrachloride boron fluoride etc ., and the like . ( 2 ) a method for reacting homocatechol with a lower fatty acid anhydride at an elevated temperature . ( 3 ) a method for reacting homocatechol with a lower fatty acid or its anhydride in the presence of a base including alkali metal hydroxides such as sodium hydroxide , potassium hydroxide etc ., alkali metal carbonates such as sodium carbonate , sodium hydrogen carbonate , potassium carbonate potassium hydrogen carbonate etc ., alkali metal salts of fatty acid such as sodium acetate etc . and organic amines such as triethylamine , pyridine etc . ( 4 ) a method for reacting homocatechol with a lower fatty acid chloride in the presence of a base illustrated in ( 3 ). ( 1 ) the compound having the below described formula ( g ) is hydrogenated in the presence of a catalyst such as pd / c etc . to give an intermediate having the formula ( h ). the methyl groups of the intermediate are removed by subjecting to a heat treatment in a solvent such as acetic acid , acetic anhydride etc . in the presence of hydrogen iodide , hydrogen bromide , hydrogen chloride etc . the resulting 4 - alkylcatechol is reacted by the various methods illustrated in ( a ) above , and the derivative of this invention having the formula ( c ) is obtained . ## str7 ## wherein r 10 is an acyl group , r 11 is a hydrogen atom or a lower alkyl group and n is an integer of 1 or 2 . ## str8 ## wherein r 10 , r 11 and n are the same as above . ( 2 ) veratrols are reacted with a fatty acid anhydride or a fatty acid halide such as fatty acid chloride etc . in the presence of a catalyst including iodine , anhydrous aluminium chloride , zinc chloride , iron chloride , titanium tetrachloride , tin tetrachloride , boron fluoride etc . the resulting 4 - acylveratroles are subjected to hydrogenation and dehydration in the presence of a metal catalyst such as lialh 4 , nabh 4 , pd / c etc ., to clemmensen reduction , or to wolff - kishner reduction , in order to obtain corresponding 4 - alkylveratroles . the methyl groups of 4 - alkylveratroles are removed by subjecting to a heat treatment in a solvent such as acetic acid , acetic anhydride etc . in the presence of hydrogen iodide , hydrogen bromide , hydrogen chloride etc . 4 - alkylcatechols thus obtained are reacted by the various methods illustrated in ( a ) above , and the derivative of this invention having the formula ( c ) is obtained . ( 3 ) catechol is reacted with a fatty acid halide such as fatty acid chloride , fatty acid bromide etc . in the presence of a lewis acids such as anhydrous aluminium chloride , zinc chloride , iron chloride , titanium tetrachloride , tin tetrachloride , boron fluoride etc . corresponding 4 - acylcatechols thus obtained is reduced by the method illustrated in ( 2 ) to give corresponding 4 - alkylcatechols . the resulting 4 - alkylcatechols are converted to the derivative of this invention having the formula ( c ) by the various methods illustrated in ( a ). by the various methods mentioned above , the catechol derivative having the formula ( c ) can be prepared . the catechol derivative having the formula ( d ) can be prepared by reacting a 4 - alkylcatechol derivative obtained by the above method i ( b ) with phosgen or diethyl carbonate in the presence of a base . the base which may be employed in this method include , for example , inorganic bases such as sodium hydroxide , potassium hydroxide etc . and organic bases such as triethylamine , pyridine etc . the reaction is carried out without solvent or in an organic solvent such as benzene , tertrahydrofuran etc . at the room temperature or under heated conditions . the catechol derivative having the formula ( e ) can be prepared by reacting a 4 - alkylcatechol derivative obtained by the above method i ( b ) with oxalyl chloride in an inert solvent in the presence or absence of a base . the examples of the solvent which may be used in this method include , aromatic solvents such as benzene , toluene , xylene , chlorobenzene , nitrobenzene etc ., ether solvents such as dioxane , tetrahydrofuran , ethyl ether etc ., and mixtures of these solvents . the examples of the base which may be used in this method are the same as used in ii . the reaction is carried out at the room temperature or under heated conditions . the catechol derivative having the formula ( f ) can be prepared by reacting a 4 - alkylcatechol derivative obtained by the above method i ( b ) with acetone without solvent or in an inert solvent in the presence of an acid catalyst under continuously removing the water generated as a by - product . examples of the solvent which may be used in this method include alicyclic solvents such as cyclopentane , cyclohexane etc . and aromatic solvents such as benzene , toluene , xylene , chlorobenzene , nitrobenzene etc . examples of the acid catalyst which may be used in this method include mineral acids such as sulfuric acid , phosphoric acid , hydrogen halide etc ., lewis acids such as anhydrous aluminium chloride , zinc chloride , iron chloride , titanium tetrachloride , tin tetrachloride , boron fluoride etc ., organic sulfonic acids such as p - toluenesulfonic acid , methanesulfonic acid , dodecylsulfonic acid etc ., organotin compounds such as dibutyltin oxide , dibutyltin dilaurate , dimethyltin dichloride etc ., metal alkoxides such as titanium isopropoxide , cation exchange resin and the like . the derivative of this invention can be prepared by various methods illustrated above . when the derivative of this invention is used as the preventive and remedial preparation for the regressive disorders in the central nervous system , particularly for sdat , dose and dosage form depend upon the properties of the derivative and symptoms of the patient . for example , esterified 4 - n - propylcatechol can be administered a dosage of 50 - 500 mg per adult per day several times with an interval of few days orally as tablets , granules , powders , suspensions etc . or non - orally as supositories , injections , isotonic solutions for infusion etc . as a general prescription in particular , 50 - 500 mg of primary medicine is dissolved in 10 ml of oil such as cotton seed oil , corn oil , peanut oil , olive oil etc . in order to prepare non - aqueous injections . this prescription may be further added with 10 ml of water in the presence of a surfactant such as hco - 60 in a final concentration of about 5 % as hco - 60 and emulsified to prepare aqueous injections . besides tablets may be prepared as follows . with 50 mg of main medicine , crystalline cellulose ( 150 , 120 mg each ) and light anhydrous silicic acid ( 3 , 30 mg each ) are mixed as adsorbent , corn starch ( 94 , 97 mg each ) is further added as a excipient , and finally magnesium stearate ( 3 mg ) is incorporated to prepare a tablet of 500 mg . biological and pharmacological actions will hereinafter be described in detail on the derivative of this invention having the formula ( a ) to ( f ). promoting action for the production and secretion of ngf on l - m cells of mouse the mouse fibroblasts cell line , e . g . l - m cells ( atcc , ccl 1 . 2 ), has been found to be capable of growing in the absence of serum , and producing and secreting ngf in the medium . catecholamines have also been found in a relatively high concentration to accelerate these functions without being mediated by adrenergic receptors [ y . furukawa et al ., j . biol . chem ., 261 , 6039 - 6047 ( 1986 )]. according to similar systems , the activity of a series of the derivative in this invention having the formula ( a ) wherein r is two hydrogen atoms has been examined on various combinations of r 1 and r 2 alkyl groups . any derivative tested has exerted activity as illustrated in table 1 . besides l - epinephrine employed as a typical compound of the catecholamines has shown an activity of 6 . 29 ± 0 . 11 at a concentration of 0 . 05 mm , and 13 . 99 ± 0 . 83 at 0 . 15 mm . as a result of these experiments , the difference in the positions of substituent r 1 and r 2 has been found indefinite . the derivative wherein r 1 or r 2 is a n - alkyl group having 2 to 5 carbon atoms , the combination of r 1 and r 2 is less bulky , and favorably r 1 or r 2 is a hydrogen atom , has been found effective . such derivative has also been found to exhibit the efficacy almost equal to or superior to that of the effective catecholamines in a lower concentration than the latter . besides the derivative having smaller substituents decreased its activity in higher concentrations whereas no tendency was found on larger substituents . the derivative which exerted a high activity was different from catecholamines and unknown on the existence of activity for the adrenergic neurotransmitters . therefore it was considered advantageous to apply the derivative of this invention to clinical uses , and the derivative was intended to undergo a search in a higher - order examination . the compound having a high activity in table 1 , that is , the catechol derivative having a n - alkyl group in the 3 or 4 position on the ring has been observed an acute cell toxicity in higher concentrations . the toxicity was considered the result of two hydroxyl groups in the catechol structure . then the hydroxyl groups were esterified or etherified and the resulting derivative was examined the effect on the activity for the production and secretion of ngf . the results obtained are illustrated in table 2 . in this experiment , the etherified derivative obtained by converting one or both hydroxyl groups to methoxy groups exhibited no activity at all . on the other hand , the esterified derivative in the second group reduced its effect by about a half in a short - term cultivation and yet the activity lowering was inhibited in higher concentrations . furthermore the activity was found to recover to almost the same level in a long - term cultivation . besides the etherified derivative ( f ) was found to partly reserve its efficacy . therefore these chemical modifications were considered as a potent countermeasure for the utmost inhibition of acute phase toxicity in the administration for living bodies . such type of esterified derivative and a part of etherified derivative were also intended to undergo a search in a higher - order examination . the experiment was performed according to the procedures of y . furukawa et al . which is described in j . bis chem ., 261 , 6039 - 6047 ( 1986 ). mouse l - m cells were precultured in medium 199 ( a product of gibco co .) supplemented with 0 . 5 % peptone , and then innoculated in a 24 - well cultivation plate having a well surface area of 2 . 1 cm 2 ( a product of falcon co .) at a cell density of about 3 × 10 4 cells / well . the medium was cultured for 3 days at a temperature of 37 ° c . after completing the confluency ( about 10 6 cells / well ), the medium was changed to medium 199 ( 0 . 5 ml / well ) containing 0 . 5 % bovine serum albumin ( fraction v , a product of armour co .). the sample of the derivative is contained in the medium at a prescribed concentration as illustrated in the tables . ngf concentration in the medium after cultivating for 24 hours was determined according to high sensitivity elisa ( s . furukawa et al ., j . neurachem ., 40 , 734 - 744 ( 1983 )]. data are expressed as fold increase in ngf content of the medium over that cultivated in the absence of the derivative to be tested . lower detection limit of elisa is 0 . 25 pg / ml and the ngf content of control medium is normally 50 - 200 pg / 0 . 5 ml / well . data was presented as means ± se of four determinations . table - 1______________________________________derivative ( a ) r = two h concentration ratio ofr . sub . 1 r . sub . 2 ( mm ) ngf increase______________________________________control 1 . 00 ± 0 . 06h h 0 . 03 1 . 03 ± 0 . 04 0 . 10 1 . 81 ± 0 . 091st groupmethyl h 0 . 03 8 . 34 ± 0 . 82 0 . 10 3 . 92 ± 1 . 23h methyl 0 . 03 8 . 91 ± 0 . 43 0 . 10 2 . 36 ± 1 . 902nd groupmethyl methyl 0 . 03 2 . 86 ± 0 . 12 0 . 10 3 . 11 ± 0 . 22ethyl h 0 . 03 9 . 76 ± 1 . 40 0 . 10 11 . 65 ± 2 . 13h ethyl 0 . 03 10 . 03 ± 0 . 97 0 . 10 12 . 13 ± 1 . 093rd groupethyl methyl 0 . 03 6 . 62 ± 0 . 29 0 . 10 2 . 98 ± 0 . 55methyl ethyl 0 . 03 6 . 31 ± 0 . 39 0 . 10 3 . 19 ± 0 . 73n - propyl h 0 . 03 9 . 81 ± 0 . 92 0 . 10 16 . 30 ± 2 . 04h n - propyl 0 . 03 10 . 14 ± 1 . 14 0 . 10 17 . 07 ± 2 . 70h isopropyl 0 . 03 6 . 17 ± 0 . 44 0 . 10 5 . 90 ± 0 . 414th groupethyl ethyl 0 . 03 3 . 01 ± 0 . 20 0 . 10 3 . 24 ± 0 . 19n - propyl methyl 0 . 03 6 . 09 ± 0 . 65 0 . 10 6 . 98 ± 0 . 51methyl n - propyl 0 . 03 6 . 34 ± 0 . 46 0 . 10 7 . 25 ± 0 . 32n - butyl h 0 . 03 8 . 33 ± 0 . 52h n - butyl 0 . 10 13 . 96 ± 1 . 33 0 . 03 8 . 21 ± 1 . 10h sec - butyl 0 . 10 14 . 65 ± 1 . 87 0 . 03 9 . 23 ± 1 . 41h tert - butyl 0 . 10 13 . 27 ± 1 . 96 0 . 03 3 . 45 ± 0 . 35 0 . 10 4 . 29 ± 0 . 335th groupethyl methyl 0 . 03 5 . 41 ± 0 . 23 0 . 10 5 . 02 ± 0 . 49methyl ethyl 0 . 03 5 . 39 ± 0 . 31 0 . 10 5 . 22 ± 0 . 27n - butyl methyl 0 . 03 6 . 33 ± 0 . 75 0 . 10 6 . 90 ± 0 . 62methyl n - butyl 0 . 03 6 . 87 ± 0 . 60 0 . 10 7 . 73 ± 0 . 53methyl sec - butyl 0 . 03 6 . 74 ± 0 . 25 0 . 10 7 . 00 ± 0 . 76methyl tert - butyl 0 . 03 2 . 82 ± 0 . 14 0 . 10 3 . 65 ± 0 . 39n - pentyl h 0 . 03 5 . 26 ± 0 . 43 0 . 10 9 . 95 ± 0 . 98h n - pentyl 0 . 03 6 . 37 ± 0 . 25 0 . 10 10 . 24 ± 0 . 71______________________________________ table - 2______________________________________ con - cen - ratio of ngf increase * tration 24 - hr 48 - hrderivative ( a ) ( mm ) culture culture______________________________________control 1 . 00 ± 0 . 07 1 . 21 ± 0 . 06catechol 0 . 03 1 . 15 ± 0 . 04 1 . 31 ± 0 . 09 0 . 15 1 . 93 ± 0 . 12 1 . 79 ± 0 . 204 - methylcatechol 0 . 03 8 . 77 ± 0 . 66 9 . 21 ± 0 . 69 0 . 15 2 . 87 ± 0 . 54 2 . 49 ± 0 . 881st group4 - methylguaiacol 0 . 03 1 . 09 ± 0 . 06 1 . 10 ± 0 . 07 0 . 15 1 . 03 ± 0 . 05 1 . 00 ± 0 . 09r = two methyl , r . sub . 1 = h , 0 . 03 1 . 04 ± 0 . 07 1 . 03 ± 0 . 07r . sub . 2 = methyl 0 . 15 0 . 98 ± 0 . 06 0 . 98 ± 0 . 02c ( ch . sub . 3 ). sub . 2 -, r . sub . 1 = h , 0 . 03 1 . 35 ± 0 . 12 4 . 33 ± 1 . 05r . sub . 2 = methyl 0 . 15 1 . 22 ± 0 . 08 3 . 86 ± 0 . 842nd groupr = two acetyl 0 . 03 4 . 92 ± 0 . 94 7 . 71 ± 0 . 86r . sub . 1 = h , r . sub . 2 = methyl 0 . 15 4 . 21 ± 0 . 40 6 . 27 ± 0 . 75co -, r . sub . 1 = h 0 . 03 4 . 39 ± 0 . 62 7 . 54 ± 0 . 72r . sub . 2 = methyl 0 . 15 4 . 82 ± 0 . 55 6 . 99 ± 0 . 52co . co -, r . sub . 1 = h 0 . 03 4 . 24 ± 0 . 58 7 . 60 ± 0 . 43r . sub . 2 = methyl 0 . 15 4 . 62 ± 0 . 61 7 . 03 ± 0 . 69______________________________________ note : * fold increase over control of 2hr culture . promoting activity for the production and secretion of ngf in brain astroglial cells of mouse the derivative which promoted the production and secretion of ngf in the mouse cell line derived from peripheral tissue was further searched its promoting activity by astroglial cells which were considered as a major source of ngf in the central nervous system . the derivative being suitable for the object of this invention wa thus selected . it has already been elucidated that astroglial cells produce and secrete ngf in a different strength of activity depending upon their growth phase . they secrete only at a very low level of a few pg , 10 6 cells / day in the quiscent stage . on the other hand , they secret at a high high level of 200 - 300 pg / 10 6 cells / day in the growing stage when induced from the quiscent stage in the presence of 10 % of fetal calf serum [ s . furukawa et al ., biochem . biophys . res . commun ., 136 , 57 - 63 ( 1986 )]. the activity of a series of the derivative in this invention having the formula ( a ) wherein r is two hydrogen atoms has been examined on various combinations of r 1 and r 2 alkyl groups . any derivative tested has exerted activity as illustrated in table 3 . besides the fetal calf serum employed as a control has shown an activity of 45 . 58 ± 5 . 52 , while l - epenephrine has shown an activity of 8 . 62 ± 1 . 21 at the concentration of 0 . 10 mm , and 14 . 55 ± 2 . 67 at 0 . 25 mm . structure activity correlations are very similar to those of l - m cells and the difference in the positions of substituent r 1 and r 2 has been found indefinite . the derivative wherein r 1 or r 2 is a n - alkyl group having 2 to 5 carbon atoms , the combination of r 1 and r 2 is less bulky , and favorably r 1 or r 2 is a hydrogen atom has been found to exert much higher activity than that of fetal calf serum . it was noteworthy that the activity of catecholamines was remarkably weaker than that of the derivative of this invention contrary to the effect on l - m cells . hydroxy - substituted derivative of catechol has been examined its function and the results are illustrated in table 4 . also in this case , the esterified derivative inhibited the activity reduction due to cell toxicity in the acute phase and has been found to exert almost same level of activity in a long - term cultivation as compared with the derivative having free hydroxyl groups . astroglial cells are considered as major cells for the production and secretion of ngf in the brain . calculating from gene - expression frequency in the total brain , astroglial cells are considered physiologically in the quiscent stage [ d . l . shelton and l . f . reichardt , proc . natl . acad . sci . usa , 83 , 2714 - 2718 ( 1986 )]. the catechol derivative having lower n - alkyl groups at the 3 and / or 4 positions has induced a remarkable activity for producing and secreting ngf to the astroglial cells in the quiescent stage . therefore the derivative including the esterified catechol derivative is expected to remarkably activate the ngf production system in the brain by administration to the living bodies . the experiment was performed by inducing the astroglial cells from mouse forebrain to culture system according to the procedures of s . furukawa et al . which is described in biochem . biophys . res . commun ., 136 , 57 - 63 ( 1986 ). that is , forebrains of 8 - day old mice were dissected out and cut into small pieces . the pieces were washed with calcium - and magnesium - free phosphate - buffered saline ( hereinafter abbreviated as pbs ), treated with 0 . 25 % trypsin containing pbs at 37 ° c . for 30 minutes and triturated with a pasteur pipet to give a suspension . cells and cell clamps were recovered by centrifugation at 200 xg for 5 minutes . they were cultured in dulbecco modified eagle &# 39 ; s medium ( a product of gibco co . hereinafter abbreviated as dmem ) containing 10 % of fetal calf serum , 50 μ units / ml of penicillin , and 50 μg / ml of streptomycin , for 10 to 14 days with medium changes every 3 days . after completing confluency , the cells were dissociated by trypsin treatment and recultured in new culture flasks . this procedure was repeated further twice and more . the culture became a uniform cell cluster . the cell cluster for use in this invention can be stained not less than 97 % in accordance with pap staining method ( peroxidase / antioxidase staining method ) using anti - human glial fibrillar acidic protein ( gfap ) rabbit antiserum . the cells will hereinafter be referred to as astroglial cells . astroglial cells were innoculated in 24 - well plates having a well surface area of 2 . 1 cm 2 ( a product of falcon co .) at a cell density of about 3 × 10 4 cells / well and cultured for 3 days in dmem . medium supplemented with 10 % of fetal calf serum . after completing confluency about 10 7 cells / well ), the medium was changed to dmem medium ( 0 . 5 ml / well ) supplemented with 0 . 5 % of bovine serum albumin (( fraction v ) and cultured for 3 days . the culture was further continued with medium changes every 3 days . after cells were practically synchronized in the quiscent stage , the medium was changed to 0 . 5 ml of the medium supplemented with 0 . 5 % of bovine serum albumin and containing a prescribed concentration of test sample as illustrated in tables . ngf in the medium after cultivating for 24 hours was determined by the elisa as mentioned above . data are expressed as fold increase in ngf content over that in the absence of the test sample . lower detection limit of the elisa is 0 . 25 pg / ml and the ngf content of control medium was normally 1 - 10 pg / 0 . 5 ml / well . data are presented as means ± se of four determinations . table - 3______________________________________ concentration ratio ofderivative ( mm ) ngf increase______________________________________r = two hr . sub . 1 r . sub . 2 0 . 10 2 . 51 ± 0 . 07controlh h 0 . 25 1 . 92 ± 0 . 091st groupmethyl h 0 . 10 76 . 27 ± 6 . 34 0 . 25 5 . 02 ± 1 . 98h methyl 0 . 10 80 . 75 ± 4 . 21 0 . 25 4 . 89 ± 1 . 372nd groupmethyl methyl 0 . 10 4 . 97 ± 1 . 07 0 . 25 8 . 30 ± 1 . 14ethyl h 0 . 10 46 . 25 ± 3 . 97 0 . 25 62 . 75 ± 4 . 42h ethyl 0 . 10 55 . 21 ± 3 . 24 0 . 25 64 . 65 ± 4 . 263rd groupmethyl ethyl 0 . 10 50 . 26 ± 6 . 27 0 . 25 26 . 24 ± 2 . 60n - propyl h 0 . 10 72 . 93 ± 7 . 09 0 . 25 97 . 02 ± 9 . 24h n - propyl 0 . 10 68 . 43 ± 3 . 24 0 . 25 100 . 19 ± 11 . 25h isopropyl 0 . 10 34 . 65 ± 1 . 62 0 . 25 42 . 88 ± 2 . 934th groupethyl ethyl 0 . 10 16 . 71 ± 1 . 84 0 . 25 23 . 65 ± 1 . 90methyl n - propyl 0 . 10 41 . 32 ± 2 . 55 0 . 25 61 . 60 ± 4 . 62n - butyl h 0 . 10 56 . 25 ± 1 . 87 0 . 25 93 . 30 ± 1 . 65h n - butyl 0 . 10 59 . 72 ± 3 . 00 0 . 25 88 . 35 ± 2 . 47h sec - butyl 0 . 10 36 . 28 ± 3 . 49 0 . 25 70 . 11 ± 5 . 75h tert - butyl 0 . 10 18 . 53 ± 1 . 50 0 . 25 18 . 77 ± 2 . 925th groupmethyl methyl 0 . 10 43 . 62 ± 2 . 23 0 . 25 60 . 44 ± 3 . 94methyl n - butyl 0 . 10 49 . 83 ± 3 . 65 0 . 25 76 . 25 ± 6 . 64methyl tert - butyl 0 . 10 9 . 65 ± 2 . 42 0 . 25 24 . 19 ± 2 . 73n - pentyl h 0 . 10 37 . 20 ± 1 . 28 0 . 25 51 . 46 ± 1 . 40h n - pentyl 0 . 10 43 . 75 ± 4 . 71 0 . 25 61 . 03 ± 5 . 82______________________________________ table 4______________________________________ concen - tration ratio of ngf increase * derivative ( mm ) 24 - hr culture 48 - hr culture______________________________________0 . 5 % bovine serum 1 . 00 ± 0 . 05 0 . 99 ± 0 . 08albumin10 % fetal calf - serum 43 . 21 ± 6 . 20 48 . 92 ± 3 . 35r = two h , 0 . 10 77 . 34 ± 9 . 21 106 . 23 ± 7 . 61r . sub . 1 = h , r . sub . 2 = methyl 0 . 25 6 . 59 ± 1 . 34 2 . 47 ± 1 . 22r = two acetyl 0 . 10 49 . 82 ± 6 . 44 77 . 35 ± 6 . 52r . sub . 1 = h , r . sub . 2 = methyl 0 . 25 41 . 25 ± 7 . 32 82 . 37 ± 7 . 24co -, r . sub . 1 = h 0 . 10 52 . 35 ± 5 . 29 73 . 37 ± 4 . 25r . sub . 2 = methyl 0 . 25 44 . 92 ± 4 . 25 78 . 32 ± 6 . 50co . co -, 0 . 10 47 . 24 ± 3 . 98 69 . 62 ± 3 . 25r . sub . 1 = hr . sub . 2 = methyl 0 . 25 50 . 62 ± 4 . 74 70 . 22 ± 5 . 37c ( ch . sub . 3 ). sub . 2 -, 0 . 10 28 . 62 ± 2 . 23 41 . 63 ± 2 . 21r . sub . 1 = h , r . sub . 2 = methyl 0 . 25 33 . 71 ± 2 . 09 55 . 25 ± 4 . 42______________________________________ note : * fold increase over reference of 24hr culture . acute toxicity test in mice was carried out as a preliminary experiment to evaluate the effect in vivo of the derivative which had exhibited activity in the experimental system in vitro . results are illustrated in table 5 . according to the results , the acute toxicity reduces with the increase in carbon numbers of alkyl groups on the catechol ring , regardless of administration method . the tendency is particularly . remarkable in intravenous administration . when intravenous or intraperitoneal injection was performed in an amount exceeding 25 % of ld 50 , the derivative having lower alkyl groups on the ring was observed to cause transient convulsion in some experimental bodies . esterified or etherified catechol derivative has been found to remarkably increase the value of ld 50 as compared with the catechol derivative having free hydroxyl groups , and also much improve the acute phase toxicity symptoms such as convulsion . therefore the derivative of this invention , for example , the derivative a ( r = two h , r 1 = h , and r 2 = n - propyl , e . g . 4 - n - propylcatechol ) is converted to an optional type of preparation by means of known preparing method . the dose for adult by injection or oral route is preferably not more than 75 mg in intravenous injection , not more than 100 mg in non - intravascular administration and not more than 750 mg in oral administration . the esterified derivative may increase the dosage and the dose is respectively not more than 125 mg , not more than 375 - 625 mg , and not more than 1250 - 1500 mg . the catechol derivative having normal type saturated lower alkyl groups on the ring was administered by intravenous injection ( i . v . ), intraperitoneal injection ( i . p .) or oral route ( p . o .) to male ddy mice of 4 - week old . the ld 50 values ( mg / kg ) were measured by an ordinary method . results are illustrated in table 5 . table 5______________________________________ ld . sub . 50 ( mg / kg ) derivative ( a ) i . v . i . p . p . o . ______________________________________r = two h , r . sub . 1 = hr . sub . 2methyl & gt ; 50 & gt ; 200 & gt ; 500ethyl & gt ; 75 & gt ; 300 & gt ; 1000n - propyl & gt ; 150 & gt ; 500 & gt ; 1500n - butyl & gt ; 150 & gt ; 500 & gt ; 1500r . sub . 2 = hr . sub . 1methyl & gt ; 50 & gt ; 200 & gt ; 500n - propyl & gt ; 150 & gt ; 500 & gt ; 1500r = two acetyl & gt ; 250 & gt ; 750 & gt ; 2500r . sub . 1 = h , r . sub . 2 = n - propylr = -- co --, r . sub . 1 = h & gt ; 250 & gt ; 1000 & gt ; 2500r . sub . 2 = n - propylr = -- co . co --, r . sub . 1 = h & gt ; 250 & gt ; 1250 & gt ; 3000r . sub . 2 = n - propylr = -- c ( ch . sub . 3 ). sub . 2 --, r . sub . 1 = h & gt ; 500 & gt ; 1500 & gt ; 3500r . sub . 2 = n - propyl______________________________________ activation effect on the ngf production in the central nervous system of normal rats by intraperitoneal injection the derivative having the activity for promoting the production and secretion in vitro of ngf was intended to prove the activity for accelerating the production and secretion in vivo in the central nervous system . the derivative ( a ), e . g . r = two h , r 1 = h and r 2 = n - propyl ( hereinafter referred to as 4 - n - propylcatechol ), was administered to normal rats by intraperitoneal injection , and the effect was examined . 4 - n - propylcatechol was administered by intraperitoneal injection 4 times every other day in a dosage of 5 mg / kg . the rats were killed two days after the final administration . the ngf content of each parts in brain was measured . the content was compared with those of control group which was administered saline alone . the results are illustrated in table 6 . a marked activation of ngf production was observed in frontal cortex , hippocampus and olfactory bulb . significant increase in ngf level was also observed in the original region of cholinergic tracts projecting into the regions mentioned above . a variety of the derivative was administered three times every other day . the content of ngf in the forebrain after 48 hours and 7 days from the final administration was measured and illustrated in table 7 . the effect of alkyl groups ( r 1 and r 2 ) on the ring was compared in a series of the derivative ( a ) having free hydroxyl groups ( r = two h ). the derivative having alkyl groups of about three carbon atoms has been found to maintain a stable level of ngf for a long period . furthermore , the derivative having esterified hydroxyl groups has also been found to exert the same level of activity as that having free hydroxyl groups . as a summary of above mentioned results , the derivative which activated the ngf production and secretion in vitro of the astroglial cells has been proved by the experiments in vivo to be capable of activating the ngf producing ability in the specific parts of central nervous system by the peripheral administration . a frequent administration in high dose , however , is required for exhibiting the efficacy to living bodies . thus in consideration of the test results on acute toxicity , the derivative having normal type lower alkyl groups of about three carbon atoms in the 3 and / or 4 positions is assumed to be preferable and the esterified catechol derivative is presumed to be more preferable . wistar male rats ( 9 - 10 - week old , 200 - 250 g of weight ) were intraperitoneally injected with the test derivative in a volume of 0 . 5 ml as a saline solution , emulsion or suspension . dose and administration times were the same as above . the rats were killed by a hard spinal blow two days after the final administration . each parts of brain were dissected and subjected to the following treatment under ice cooling . each parts of brain were weighed and homogenized for 30 strokes by a dounce type homogenizer in a homogenization buffer ( 0 . 1 m tris - hcl , containing 2 % bovine serum albumin fraction v , 2 % gelatin , 1 . 0 m nacl , 0 . 02 % nan 3 , 2 mm edta and 2 . 6 kiu / ml of aprotinin , ph 7 . 6 ) at a concentration of 10 % ( w / v ) ( only septum 5 % ( w / v )). each homogenate was centrifuged at 100 , 000 xg for 10 minutes , and 50 μl of supernatant was added with the same amount of a dilution buffer ( 0 . 1 m tris - hcl containing 2 % bovine serum albumin fraction v , 0 . 05 % nan 3 and 20 mm cacl 2 , ph 7 . 6 ). determination was conducted in accordance with a method of s . furukawa et al . by using a high sensitivity elisa system on 8 - ngf which was described in j . neurochem ., 40 , 734 - 744 ( 1983 ). lower limit of determination is 0 . 25 pg / ml . data are indicated as a mean value ± se on the ngf content of tissue ( pg / mg wet tissue ) of five rats . table 6______________________________________ ngf content ( pg / mg wet tissue ) brain tissue saline 4 - n - propylcatechol______________________________________frontal cortex 0 . 87 ± 0 . 11 2 . 14 ± 0 . 49 * hippocampus 2 . 21 ± 0 . 32 3 . 92 ± 0 . 63 * olfactory bulb 0 . 92 ± 0 . 08 1 . 70 ± 0 . 24 ** septum 0 . 74 ± 0 . 06 1 . 39 ± 0 . 14 ** striatum 0 . 22 ± 0 . 02 0 . 24 ± 0 . 04nbm *** 0 . 71 ± 0 . 08 1 . 69 ± 0 . 17 ** cerebellum 0 . 30 ± 0 . 09 0 . 33 ± 0 . 16______________________________________ note : significantly different from saline administration (* p & lt ; 0 . 05 , ** p 0 . 01 ) *** nucleus basalis magnecellularis table 7______________________________________ ngf content ( pg / mg wet tissue of frontal cortex ) derivative ( a ) after 48 hr . after 7 days______________________________________control 0 . 92 ± 0 . 12 0 . 87 ± 0 . 09r = two h , r . sub . 1 = h 2 . 26 ± 0 . 24 ** 1 . 64 ± 0 . 46r . sub . 2 = methylethyl 1 . 96 ± 0 . 42 * 1 . 73 ± 0 . 39 * n - propyl 1 . 97 ± 0 . 41 * 2 . 28 ± 0 . 29 ** n - butyl 1 . 88 ± 0 . 46 * 2 . 25 ± 0 . 33 ** r = two h , r . sub . 2 = h 2 . 03 ± 0 . 37 ** 2 . 00 ± 0 . 43 * r . sub . 1 = n - propylr = two acetyl 1 . 71 ± 0 . 28 ** 2 . 16 ± 0 . 46 * r . sub . 1 = h , r . sub . 2 = n - propylr = -- co -- 1 . 66 ± 0 . 23 ** 2 . 23 ± 0 . 39 ** r . sub . 1 = h , r . sub . 2 = n - propylr = -- co . co -- 1 . 54 ± 0 . 20 ** 2 . 02 ± 0 . 47 * r . sub . 1 = h , r . sub . 2 = n - propylr = -- c ( ch . sub . 3 ). sub . 2 -- 1 . 15 ± 0 . 18 1 . 51 ± 0 . 49r . sub . 1 = h , r . sub . 2 = n - propyl______________________________________ note : significantly different from saline administration (* p & lt ; 0 . 05 , ** p 0 . 01 ) effects of the derivative on the behavioral parameters of rats injected with kainic acid at basal forebrain were characterized with regard to both prevention against deficits in retention of passive avoidance learning and promotion of recovery from damaged state by repeated learning . table 8 illustrates the results examined on the prevention of retention disorder by 4 - n - propylcatechol and its derivative having modified hydroxyl groups . kainic acid injected rats were markedly damaged in the retention of learning and memory . on the other hand , both derivatives which had effectively activated ngf production and secretion in vitro and in vivo exerted significant preventive effect against the regression . table 9 illustrates the results examined on the effect for the promotion of recovery from the retention deficits by repeated learning . deficits in learning and memory of kainic acid injected rats could be recovered by additional and repeated acquisition trials at every retention test . both derivatives also accelerated this process significantly . male sprague - dawley rats ( 9 - 10 weeks of age , 200 - 250 g of weight ) were anesthetized with nembutal ( 50 mg / kg , i . p .) and placed in a stereotaxic apparatus . bilateral lesions of the ventral globus pallidus were made by direct stereotaxic application ( 0 . 7 mm posterior to bregma , 2 . 7 mm lateral to the midline , and 7 . 0 mm ventral to the brain surface ) of 0 . 25 μg of kainic acid in 1 μl of pbs ( ph 7 . 4 ) to prepare disordered models . controls were sham - operated rats injected with pbs in place of kainic acid solution . passive avoidance procedures were performed by using a two chambered step - through passive avoidance apparatus with a guillotine door . a 3 ma scrambled shock was delivered to the dark floor grids for 3 seconds as a punishment . habituation trial was conducted prior to the acquisition trial . each rats were placed in the illuminated chamber and the guillotine door was raised after 10 seconds . as soon as the rats entered into the dark chamber , the door was lowered . the rats were removed after 10 seconds and returned to their home cages . rats which did not enter into the dark chamber were omitted . the acquisition trial was performed similarly to the habituation trial . in the former case , a rat was placed in the illuminated room and the door was opened after 10 seconds . the door was shut immediately after the rat entered into the dark room , a scrambled foot shock was applied , and then the animal was removed . the latency to enter the dark chamber after opening the door was recorded for 300 seconds in the retention of passive avoidance . the latency exceeding 300 seconds was calculated as 300 seconds . the preventive effects on deficits in retention were estimated by using 60 rats . thirty rats were injected with kainic acid and other 30 rats were sham - operated with pbs . each groups of animals were equally divided into three groups which were received intraperitoneally 5 mg / kg of the derivative ( a ) ( r = 2h , r 1 = h , r 2 = n - propyl , that is , 4 - n - propylcatechol ), derivative a ( r =-- co --, r 1 = h , r 2 = n - propyl ) and saline respectively as a saline solution on one , four and seven days after the operation . table 8 illustrates the results obtained by conducting the acquisition trial 10 days after the operation and the retention test after 24 hours . the promoting effects on the recovery by repeated training from the damaged state of retention were acessed by using 30 rats injected with kainic acid . rats were subjected to the acquisition trial 10 days after the operation . the rats were equally divided into 3 groups after 24 hours and injected intrapenitroneally with 5 mg / kg of 4 - n - propylcatechol and the derivative ( a ) ( r =-- co --, r = h , r 2 = n - propyl ) respectively as a saline solution . the remaining 10 rats were intraperitoneally injected with saline alone . the first retention trial was carried out two days after the injection . rats which entered into the dark chamber within 30 seconds were punished by the scrambled foot shock as a training . on the next day , all animals were administered again the same amount of test derivative or saline . these animals were subjected to the second retention trial two days after the second injection . retention trials , punishments and additional administrations were repeated as mentioned above four times in all . data were compared among each retention trial and the results are illustrated in table 9 . table 8______________________________________ animals with mean more than latency 150 sec of latencyanimals ( sec ) ( in 10 animals ) ______________________________________scham - operated ratsinjected withsaline 280 ± 5 104 - n - propylcatechol 286 ± 9 10derivative ( a ) 291 ± 7 10 ( r = -- co --, r . sub . 1 = 1 , r . sub . 2 = n - propyl ) operated rats withkainic acidinjected withsaline 27 ± 11 04 - n - propylcatechol 114 ± 44 * 3derivative ( a ) 152 ± 29 * 4 ( r = -- co --, r . sub . 1 = h , r . sub . 2 = n - propyl ) ______________________________________ note : significantly different from controls in the same operation (* p & lt ; 0 . 01 ) table 9______________________________________mean latencyre - rats injected withten - derivative ( a ) deivative ( a ) tion saline ( r = 2h , r . sub . 1 = h , ( r . sub . 1 = -- co --, r . sub . 1 = h , trial ( control ) r . sub . 2 = n - propyl ) r . sub . 2 = n - propyl ) ______________________________________1st 24 ± 12 47 ± 16 46 ± 132nd 98 ± 19 147 ± 29 167 ± 31 * 3rd 149 ± 30 201 ± 23 236 ± 28 * 4th 201 ± 23 272 ± 14 ** 284 ± 15 ** ______________________________________ note : significantly different from controls in the same retention trial (* p & lt ; 0 . 05 , ** p & lt ; 0 . 01 ) the present invention will hereinafter be illustrated in detail with respect to the following examples without restricting the scope of this invention . a mixture of 1 . 0 g ( 8 mm ) of homocatechol and 2 . 8 g ( 18 mm ) of isobutyric anhydride was added with a drop of concentrated sulfuric acid at the room temperature with a slow stirring . an exothermic reaction was immediately initiated . after completing the exothermic reaction , the reaction mixture was poured into ice water . the separated oil was extracted with ether and dried with anhydrous magnesium sulfate . then the solution was filtered , concentrated and distilled under vacuum to obtain 2 . 0 g ( 7 . 6 mm ) of 3 , 4 - diisobutyryloxytoluene as a colorless transparent liquid having a boiling point of 67 °- 68 ° c ./ 4 mmhg . ir spectrum ν max neat cm - 1 : 2980 , 2940 , 2880 , 1765 , 1615 , 1600 , 1510 , 1470 , 1390 , 1350 , 1300 , 1260 , 1235 , 1205 , 1185 , 1115 , 1045 , 950 , 910 , 805 , 790 , 750 nmr spectrum ( cdcl 3 ) δ : 1 . 29 ( 12h , d ), 2 . 26 - 2 . 34 ( 3h ), 2 . 76 ( 2h , sep ), 6 . 76 - 6 . 96 ( 3h ) in an atmospheric pressure hydrogenation equipment 10 . 0 g ( 60 . 9 mm ) of 3 , 4 - dimethoxystyrene , 0 . 5 g of palladium charcoal and 200 ml of methanol were charged and introduced with hydrogen . the reaction was continued until the absorption of hydrogen was terminated . palladium charcoal was filtered off from the reaction mixture . methanol was distilled off from the filtrate . the residue was distilled under vacuum to obtain 10 . 0 g ( 60 . 2 mm ) of 4 - ethylveratrole as a colorless transparent liquid having a boiling point of 84 °- 85 ° c ./ 2 mmhg ir spectrum ν max neat cm - 1 : 2960 , 2930 , 2880 , 2840 , 1600 , 1590 , 1510 , 1460 , 1415 , 1265 , 1230 , 1155 , 1140 , 1025 , 900 , 845 , 800 , 760 nmr spectrum ( cdcl 3 ) δ : 1 . 18 ( 3h , t ), 2 . 52 ( 2h , q ), 3 . 69 - 3 . 72 ( 6h ), 6 . 65 ( 3h ) a mixture of 10 . 0 g ( 60 . 2 mm ) of 4 - ethylveratrole , 38 . 4 g ( 639 mm ) of acetic acid and 115 . 0 g ( 668 mm ) of 47 % hydrobromic acid was heated under reflux for 4 hours with stirring . after cooling to the room temperature , 100 ml of water was added and the resultant mixture was extracted three times with each 110 ml of ether . the ether extract was successively washed with 110 ml of water , 150 g of 5 % aqueous sodium thiosulfate solution and further twice with each 110 ml of water . the resulting ether solution was dried with anhydrous sodium sulfate , filtered , concentrated and distilled under vacuum to obtain 7 . 4 g ( 53 . 6 mm ) of 4 - ethylcatechol as a light yellow liquid having a boiling point of 111 °- 112 ° c ./ 4 mmhg . ir spectrum ν max neat cm - 1 : 3380 , 3040 , 2960 , 2925 , 2880 , 1605 , 1525 , 1445 , 1350 , 1280 , 1190 , 1150 , 1110 , 1060 , 980 , 920 nmr spectrum ( cdcl 3 ): δ : 1 . 04 ( 3h , t ), 2 . 36 ( 2h , q ), 6 . 00 - 7 . 25 ( 5h ) a mixture of 4 . 6 g ( 33 mm ) of 4 - ethylcatechol and 7 . 5 g ( 73 mm ) of acetic anhydride was added with a drop of concentrated sulfuric acid at the room temperature . an exothermic reaction was immediately initiated . after cooling to the room temperature , the reaction mixture was poured into ice water . the separated oil was extracted with ether . the extracted solution was dried with anhydrous sodium sulfate , filtered , concentrated and distilled under vacuum to obtain 7 . 1 g ( 32 mm ) of 4 - ethyl - 1 , 2 - diacetoxybenzene as a colorless transparent liquid having a boiling point of 116 °- 117 ° c ./ 3 mmhg . ir spectrum ν max neat cm - 1 : 2970 , 2940 , 2880 , 1770 , 1610 , 1590 , 1505 , 1425 , 1370 , 1260 , 1210 , 1180 , 1145 , 1115 , 1060 , 1045 , 1010 , 935 , 900 , 885 , 855 , 830 795 nmr spectrum ( cdcl 3 ) δ : 1 . 20 ( 3h , t ), 2 . 20 ( 6h , s ), 2 . 60 ( 2h , q ), 7 . 20 - 7 . 55 ( 3h ) an atmospheric pressure hydrogenation equipment was charged with 17 . 8 g ( 0 . 10 m ) of 1 , 2 - dimethoxy - 4 - propenylbenzene , 0 . 9 g of palladium charcoal and 350 ml of methanol and introduced with hydrogen . the reaction was continued until the absorption of hydrogen was terminated . palladium charcoal was filtered off from the reaction mixture . the filtrate was distilled off methanol and vacuum distilled to obtain 17 . 5 g ( 0 . 097 m ) of 4 - propylveratrole as colorless transparent liquid having a boiling point of 106 °- 108 ° c ./ 4 mmhg . ir spectrum ν max neat cm - 1 : 2980 , 2950 , 2930 , 2870 , 2840 , 1600 , 1585 , 1510 , 1460 , 1415 , 1375 , 1340 , 1320 , 1260 , 1230 , 1185 , 1155 , 1140 , 1080 , 1025 , 930 , 860 , 840 , 800 , 755 nmr spectrum ( cdcl 3 ) δ : 0 . 94 ( 3h , t ), 1 . 60 ( 2h , sex ), 2 . 50 ( 2h , t ), 3 . 76 - 3 . 79 ( 6h ), 6 . 62 - 6 . 64 ( 3h ) a mixture of 15 . 0 g ( 83 mm ) of 4 - propylveratrole , 53 . 0 g ( 882 mm ) of acetic acid and 159 . 4 g ( 926 mm ) of 47 % hydrobromic acid was heated under reflux for 2 hours with stirring . after cooling to the room temperature , the reaction mixture was added with 140 ml of water and extracted three times with each 150 ml of ether . the extracted ether solution was successively washed with 150 ml of water , 150 g of 5 % aqueous sodium thiosulfate solution and then twice with each 150 ml of water . the resulting solution was dried with anhydrous sodium sulfate , distilled off ether and vacuum distilled to obtain 10 . 5 g ( 69 mm ) of 4 - propylcatechol as a light yellow liquid having a boiling point of 119 ° c / 3 mmhg . ir spectrum ν max neat cm - 1 : 3450 , 3325 , 3030 , 2915 , 2850 , 1620 , 1600 , 1515 , 1460 , 1340 , 1290 , 1275 , 1255 , 1225 , 1180 , 1145 , 1115 , 955 , 860 , 810 , 790 , 740 , 720 , nmr spectrum ( cdcl 3 ) δ : 0 . 88 ( 3h , t ), 1 . 52 ( 2h , sex ), 2 . 38 ( 2h , t ), 5 . 2 - 6 . 4 ( 2h , s , broad ), 6 . 51 - 6 . 78 ( 3h ) a mixture of 2 . 7 g ( 18 mm ) of 4 - propylcatechol and 4 . 1 g ( 40 mm ) of acetic anhydride was added with a drop of concentrated sulfuric acid . an exothermic reaction was immediately initiated . after cooling to the room temperature the reaction was poured into ice water . the separated oil was extracted with ether , dried with anhydrous sodium sulfate , and distilled off ether . the residue was vacuum distilled to obtain 4 . 2 g ( 17 mm ) of 1 , 2 - diacetoxy - 4 - propylbenzene as colorless transparent liquid having a boiling point of 111 °- 119 ° c ./ 4 mmhg . ir spectrum ν max neat cm - 1 : 2960 , 2930 , 2880 , 1770 , 1610 , 1595 , 1505 , 1465 , 1425 , 1370 , 1260 , 1220 , 1205 , 1180 , 1145 , 1115 , 1040 , 1010 , 960 , 900 , 825 , 790 nmr spectrum ( cdcl 3 ) δ : 0 . 90 ( 3h , t ), 1 . 60 ( 2h , sex ), 2 . 95 ( 6h , s ), 2 . 54 ( 2h , t ), 6 . 92 - 7 . 02 ( 3h a mixture of 41 . 45 g ( 0 . 30 m ) of veratrole , 52 . 21 g ( 0 . 33 m ) of n - butyric anhydride and 1 . 52 g ( 12 mg atom ) of iodine was heated under reflux for 7 hours , with stirring . after cooling to the room temperature , the reaction mixture was poured into 150 ml of water and extracted three times with each 150 ml of ether . the extracted ether solution was successively washed with 150 g of 12 % aqueous sodium carbonate solution , 150 g of 2 % aqueous sodium hydrogen sulfite solution and then twice with each 150 ml of water . the resulting solution was dried with anhydrous sodium sulfate and distilled off ether . the residue was recrystallized from an aqueous methanol solution to obtain 52 . 59 g ( 0 . 25 m ) of 4 - n - butyrylveratrole as light yellow crystals having a melting point of 52 °- 53 ° c . ir spectrum ν max kbr cm - 1 : 3060 , 2910 , 2830 , 1650 , 1580 , 1500 , 1460 , 1445 , 1405 , 1395 , 1300 , 1250 , 1230 , 1190 , 1180 , 1140 , 1010 , 900 , 880 , 860 , 795 , 740 . nmr spectrum ( cdcl 3 ) δ : 1 . 02 ( 3h , t ), 1 . 78 ( 2h , sex ), 2 . 91 ( 2h , t ), 3 . 96 ( 6h , s ), 6 . 86 - 6 . 94 ( 1h ), 7 . 56 - 7 . 65 ( 2h ) a mixture of 68 ml of diethylene glycol and 12 g ( 0 . 18 m ) of potassium hydroxide was gradually heated to 190 ° c . with stirring while distilling off low boiling fraction . the reaction mixture was allowed to cool to 80 °- 100 ° c . after termination of the heating and added with 12 . 7 g ( 0 . 061 m ) of 4 - n - butyrylveratrole and 7 . 6 g ( 0 . 152 m ) of hydrazine hydrate . the reaction flask was fitted with a reflux condenser , gradually heated to the reflux temperature and the temperature was maintained for an hour with stirring . thereafter the reaction mixture was gradually heated to 205 °- 210 ° c . while distilling off the low boiling fraction and heating was further continued under reflux for 3 hours . the reaction mixture was gradually cooled to 100 °- 110 ° c . after termination of the heating and poured into 60 ml of water . the flask was washed with 40 ml of water and the water was added to the above water layer . the ph of the resulting mixture was reduced to 5 . 0 by using 6n hydrochloric acid . the separated oil was extracted with ether , washed with water and dried with anhydrous sodium sulfate . the solution was distilled off ether and vacuum distilled to obtain 8 . 8 g ( 0 . 046 m ) of 4 - n - butylveratrole as colorless transparent liquid having , a boiling point of 105 °- 107 ° c ./ 5 mmhg . nmr spectrum ( cdcl 3 ) δ : 0 . 92 ( 3h , t ), 1 . 10 - 1 . 76 ( 4h , m ), 2 . 52 ( 2h , t ), 3 . 82 - 3 . 84 ( 6h ), 6 . 56 - 6 . 88 ( 6h ) a mixture of 5 . 64 g ( 29 mm ) of 4 - n - butylveratrole , 18 . 54 g ( 309 mm ) of acetic acid and 55 . 62 g ( 323 mm ) of 47 % hydrobromic acid was heated under reflux for 4 hours with stirring . the reaction mixture was cooled to the room temperature and added with 50 ml of eater . the separated oil was extracted with ether . the ether solution was successively washed with 50 ml of water , 75 g of 5 % aqueous sodium thiosulfate solution , and further twice with each 50 ml of water . the resulting solution was dried with anhydrous sodium sulfate , distilled off ether , and vacuum distilled to obtain 3 . 89 g ( 23 mm ) of n - butylcatechol as light yellow liquid having a boiling point of 125 ° c ./ 3 mmhg . ir spectrum μ max neat cm - 1 : 3340 , 3020 , 2940 , 2920 , 2855 , 1600 , 1510 , 1435 , 1340 , 1280 , 1240 , 1185 , 1140 , 1105 , 945 , 850 , 800 , 775 , 740 a mixture of 2 . 0 g ( 12 mm ) of 4 - n - butylcatechol and 2 . 8 g ( 27 mm ) of acetic anhydride was added with a drop of concentrated sulfuric acid . an exothermic reaction was immediately initiated . after cooling to the room temperature , the reaction mixture was poured into ice water . the separated oil was extracted with ether and dried with anhydrous sodium sulfate . the resulting solution was distilled off ether and vacuum distilled to obtain 2 . 8 g ( 11 mm ) of 1 , 2 - diacetoxy - 4 - n - butylbenzene as colorless transparent liquid having a boiling point of 88 °- 90 ° c ./ 2 mmhg . ir spectrum ν max neat cm - 1 : 3030 , 2960 , 2935 , 2880 , 2870 , 1770 , 1615 , 1595 , 1505 , 1470 , 1425 , 1370 , 1270 , 1260 , 1210 , 1180 , 1145 , 1115 , 1040 , 1010 , 960 , 900 , 890 , 850 , 830 . nmr spectrum ( cdcl 3 ) δ : 0 . 90 ( 3h , t ), 1 . 44 ( 4h , m ), 2 . 22 ( 6h , s ), 2 . 60 ( 2h , t ), 6 . 92 - 6 . 98 ( 3h ) a mixture of 12 . 41 g ( 0 . 10 m ) of homocatechol , 20 . 24 g ( 0 . 20 m ) of triethylamine , and 225 ml of dry ethyl ether was added dropwise under stirring over an hour with a solution of 14 . 10 g ( 0 . 11 m ) of oxalyl chloride in 30 ml of dry ethyl ether . the reaction mixture was cooled in a water bath so as to maintain the reaction temperature at 27 °- 30 ° c ., and aged for 3 hours at the same temperature after completing the addition . the resulting mixture was concentrated under reduced pressure to obtain 47 . 5 g of a solid mass . the solid mass was extracted three times with each 150 ml of hot benzene under nitrogen atmosphere . the benzene extract was collected and concentrated under reduced pressure . the crude product thus obtained was purified by sublimation at a both temperature of 80 °- 120 ° c . under pressure of 2 - 4 mmhg . the crystals obtained were 16 . 25 g and recrystallized from benzene under nitrogen atmosphere to yield 14 . 11 g ( 0 . 08 m ) of 6 - methyl - 1 , 4 - benzodioxine - 2 , 3 - dione as colorless crystals having a melting point of 121 °- 123 ° c . ir spectrum ν max kbr cm - 1 : 3100 , 3075 , 2975 , 2950 , 2880 , 1815 , 1780 , 1615 , 1515 , 1465 , 1430 , 1395 , 1360 , 1330 , 1315 , 1280 , 1265 , 1220 , 1185 , 1160 , 1135 , 1120 , 1050 , 1015 , 965 , 905 , 885 , 820 , 800 , 760 , 735 , 720 . a mixture of 3 . 46 g ( 25 mm ) of 4 - ethylcatechol , 50 ml of dry ether was added dropwise with 3 . 50 g ( 28 mm ) of oxalyl chloride over 2 hours while heating under reflux . the stirring was continued until the end of gas evolution . the reaction mixture was concentrated to dryness and recrystallized from a solvent mixture of benzene and petroleum benzine to obtain 4 . 79 g ( 21 mm ) of 6 - ethyl - 1 , 4 - benzodioxine - 2 , 4 - dione dihydrate as colorless crystals having a melting point of 99 °- 104 ° c . ir spectrum ν max kbr cm - 1 : 3340 , 2965 , 2930 , 2875 , 1775 , 1740 , 1605 , 1525 , 1510 , 1435 , 1355 , 1320 , 1300 , 1280 , 1265 , 1225 , 1180 , 1110 , 1060 , 985 , 945 , 920 , 885 , 850 , 815 , 795 , 750 , 735 , 715 , 700 . nmr spectrum ( dmso - d 6 ): δ : 1 . 18 ( 3h , t ), 2 . 54 ( 2h , q ), 6 . 6 - 7 . 0 ( 3h ), 5 . 5 - 8 . 0 ( 4h , broad ) . a mixture of 3 . 81 g ( 25 mm ) of 4 - n - propylcatechol , 5 . 06 g ( 50 mm ) of triethylamine and 50 ml of dry ether was cooled in an ice water bath so as to maintain the temperature at 5 ° c . or below . the mixture was added dropwise over 1 . 5 hours under stirring with a solution of 3 . 50 g ( 28 mm ) of oxalyl chloride in 10 ml of dry ether . after completing the dropwise addition , the temperature of the reaction mixture was gradually raised to the room temperature and then aging was conducted for an hour . the resultant mixture was heated under reflux for 3 hours in order to complete the aging . the separated crystals of triethyl ammonium chloride was filtered . after thoroughly washing the crystals with ether , the ether solution was collected and dried with anhydrous sodium sulfate . after distilling off ether , the reaction product was recrystallized from a solvent mixture of carbontetrachloride and petroleum benzine to obtain 4 . 64 g ( 22 . 5 mm ) of 6 - n - propyl - 1 , 4 - benzodioxine - 2 , 3 - dione monohydrate as colorless crystals having a melting point of 99 °- 100 ° c . ir spectrum ν max kbr cm - 1 : 3330 , 3050 , 2955 , 2925 , 2825 , 1780 , 1770 , 1605 , 520 , 1465 , 1430 , 1340 , 1305 , 1280 , 1235 , 1180 , 1110 , 960 , 940 , 890 , 860 , 810 , 790 , 750 , 730 , 700 . nmr spectrum ( dmso - d 6 ) δ : 0 . 91 ( 3h , t ), 1 . 54 ( 2h , sex ), 2 . 47 ( 2h , t ), 6 . 4 - 7 . 0 ( 3h ), 8 . 4 - 9 . 8 ( 2h ) a mixture of 4 . 16 g ( 25 mm ) of 4 - n - butylcatechol , 5 . 06 g ( 50 mm ) of triethylamine and ml of dry ether was cooled in an ice water bath so as to maintain the temperature at 5 ° c . or below . the mixture was added dropwise over 2 hours under stirring with a solution of 3 . 50 g ( 28 mm ) of oxalyl chloride in 10 ml of dry ether . after completing the dropwise addition , the temperature of the reaction mixture was gradually raised to the room temperature and then aging was conducted for an hour . the resultant mixture was heated under reflux for 3 hours in order to complete the aging . the separated crystals of triethyl ammonium chloride was filtered . after thoroughly washing the crystals with ether , the ether solution was collected and dried with anhydrous sodium sulfate . after distilling off ether , the reaction product was recrystallized from a solvent mixture of carbontetrachloride and petroleum benzine to obtain 5 . 26 g ( 23 mm ) of 6 - n - butyl - 1 , 4 - benzodioxine - 2 , 3 - dione 2 / 5 hydrate as colorless crystals having a melting point of 88 °- 93 ° c . ir spectrum νmax kbr cm - 1 : 3320 , 3060 , 2960 , 2935 , 2875 , 1810 , 1785 , 1605 , 1510 , 1470 , 1460 , 1435 , 1305 , 1260 , 1220 , 1180 , 1155 , 1135 , 1120 , 1005 , 970 , 905 , 880 , 820 , 805 , 735 , 710 . nmr spectrum ( dmso - d 6 ) δ : 0 . 94 ( 3h , t , 1 . 14 - 1 . 72 ( 4h , m ), 2 . 61 ( 2h , t ), 6 . 54 - 7 . 16 ( 3h ), 6 . 2 - 7 . 2 ( 0 . 8h ) elementary analysis [ c 12 h 12 . 8 o 4 . 4 ]: a mixture of 69 . 09 g ( 500 mm ) of veratrole , 87 . 01 g ( 550 mm ) of isobutyric anhydride and 2 . 50 g ( 20 mm ) of iodine was heated with stirring under reflux for 34 hours . after cooling to the room temperature , the reaction mixture was poured into 250 ml of water and extracted three times with each 200 ml of ether . the extracted solution was successively washed with 250 g of 12 % aqueous sodium carbonate solution , 2 % aqueous sodium hydrogen sulfite solution and further twice with each 250 ml of water . the resulting solution was dried with anhydrous sodium sulfate , distilled off ether and vacuum distilled to obtain 87 . 21 g ( 419 mm ) of 4 - iso - butyrylveratrole as yellow liquid having a boiling point of 125 °- 128 ° c ./ 2 mmhg . ir spectrum ν max neat cm - 1 : 3070 , 2960 , 2930 , 2870 , 2840 , 1670 , 1590 , 1580 , 1510 , 1460 , 1415 , 1380 , 1345 , 1265 , 1260 , 1200 , 1175 , 1140 , 1100 , 1020 , 890 , 875 , 830 , 805 , 760 , 750 . nmr spectrum ( cdcl 3 ) δ : 1 . 21 ( 6h , d ), 3 . 55 ( 2h , sept ), 3 . 96 ( 6h , s ), 6 . 88 - 6 . 96 ( 1h ), 7 . 54 - 7 . 66 ( 2h ) a mixture of 400 ml of diethylene glycol and 72 . 59 g ( 1 , 100 mm ) of potassium hydroxide was gradually heated to 190 ° c . while distilling off low boiling fraction . the reaction mixture was allowed to cool to 80 °- 100 ° c . after termination of the heating and added with 70 . 75 g ( 340 mm ) of 4 - isobutyrylveratrole and 42 . 52 g ( 849 mm ) of hydrazine hydrate . the reaction flask was fitted with a reflux condenser , gradually heated to the reflux temperature and the temperature was maintained for 2 hours with stirring . thereafter the reaction mixture was gradually heated to 205 °- 210 ° c . while distilling off the low boiling fraction , and heating was further continued for 3 hours under reflux . the reaction mixture was gradually cooled to 100 °- 110 ° c . after termination of the heating and poured into 300 ml of water . the flask was washed with 200 ml of water and the water was added to the above water layer . the ph of the resultant mixture was reduced to 2 . 0 by using 6n hydrochloric acid . the separated oil was extracted with ether , washed with water and dried with anhydrous sodium sulfate . the solution was distilled off ether and vacuum distilled to obtain 55 . 50 g ( 286 mm ) of 4 - isobutylveratrole as colorless liquid having a boiling point of 115 °- 118 ° c ./ 2 mmhg . nmr spectrum ( cdcl 3 ): δ : 0 . 89 ( 6h , d ), 1 . 83 ( 1h , nona ), 2 . 39 ( 2h , d ), 3 . 76 - 3 . 78 ( 6h ), 6 . 49 - 6 . 82 ( 3h ) a mixture of 50 . 83 g ( 262 mm ) of 4 - isobutylveratrole , 167 . 82 g ( 2 . 795 mm ) of acetic acid and 502 . 18 g ( 2 . 917 mm ) of 47 % hydrobromic acid was heated under reflux for 19 hours with stirring . the reaction mixture was cooled to the room temperature and added with 400 ml of water . the separated oil was extracted with ether . the ether solution was successively washed with 400 ml of water , 660 g of aqueous sodium thiosulfate solution , and further twice with each 400 ml of water . the resulting solution was dried with anhydrous sodium sulfate , distilled off ether , and vacuum distilled to obtain 35 . 68 g ( 215 mm ) of 4 - iso - butylcatechol as yellow viscous liquid having a boiling point of 117 °- 120 ° c ./ 2 mmhg . ir spectrum ν max neat cm - : 3300 ( broad ), 3050 , 2950 , 2910 , 2870 , 1605 , 1525 , 1465 , 1440 , 1400 , 1380 , 1365 , 1350 , 1295 , 1280 , 1250 , 1205 , 1195 , 1150 , 1110 , 1085 , 970 , 940 , 920 , 875 , 865 , 825 , 800 , 785 , 750 . nmr spectrum ( cdcl 3 ) δ : 0 . 85 ( 6h , d ), 1 . 72 ( 1h , nona ), 2 . 31 ( 2h , d ), 5 . 7 - 6 . 3 ( 2h , broad ), 6 . 43 - 6 . 74 ( 3h ) the same procedures as described in example 8 were carried out by using 4 . 16 g ( 25 mm ) of 4 - isobutylcatechol , 5 . 06 g ( 50 mm ) of triethylamine and 3 . 50 g ( 28 mm ) of oxalyl chloride . 6 - iso - butyl - 1 , 4 - benzodioxine - 2 , 3 - dione 2 / 5 hydrate was obtained in the yield of 5 . 11 g ( 22 . 5 mm ) as colorless crystals having a melting point of 92 °- 97 ° c . ir spectrum ν max kbr cm - 1 : 3350 , 3040 , 2940 , 2920 , 2865 , 1805 , 1790 , 1780 , 1630 , 1510 , 1460 , 1450 , 1430 , 1380 , 1365 , 1300 , 1260 , 1250 , 1215 , 1175 , 1150 , 1130 , 1060 , 1040 , 1020 , 1005 , 970 , 935 , 900 , 885 , 820 , 790 . nmr spectrum ( dmso - d 6 ) δ : 0 . 91 ( 6h , t ), 1 . 86 ( 1h , nona ), 2 . 49 ( 2h , d ), 4 . 4 - 5 . 4 ( 0 . 8 h ), 6 . 50 - 7 . 16 ( 3h ). elementary analysis [ c 12 h 12 . 8 o 4 . 4 ]: a mixture of 6 . 21 g ( 50 mm ) of homocatechol ( commercially available special grade reagent ), 15 ml of acetone , 30 mg of p - toluenesulfonic acid monohydrate and 15 ml of benzene was heated under reflux for 48 hours with stirring . during the reaction , a three - component azeotropic mixture composed of acetone , benzene and water as a by - product was passed through a molecular sieve packed column to remove only the by - product water . acetone and benzene were returned to the reaction system . after completing the reaction , the reaction mixture was distilled in vacuum to obtain 7 . 88 g ( 48 mm ) of 5 , 2 , 2 - trimethyl - 1 , 3 - benzodioxol as light brown liquid having a boiling point of 79 °- 80 ° c ./ 9 mmhg . ir spectrum ν max neat cm - 1 : 2990 , 2920 , 2870 , 1500 , 1440 , 1380 , 1350 , 1255 , 1230 , 1155 , 1120 , 1070 , 1040 , 980 , 930 , 880 , 840 , 825 , 795 , 745 . a mixture of 6 . 91 g ( 50 mm ) of 4 - ethylcatechol , 4 . 43 g ( 105 mm ) of 90 % sodium hydroxide and 200 ml of 1 - butanol was heated to 70 ° c . with stirring and added dropwise with 6 . 55 g ( 55 mg ) of 2 , 2 - dichloropropane over 2 hours . after aging for an hour at this temperature , the reaction mixture was further heated under reflux for 3 hours with stirring . sodium chloride formed was filtered and washed . 1 - butanol was distilled off under reduced pressure . the residue was vacuum distilled to obtain 5 . 08 g ( 29 mm ) of 5 - ethyl - 2 , 2 - dimethyl - 1 , 3 - benzodioxol as light brown liquid having a boiling point of 103 °- 105 ° c ./ 12 mmhg . in addition , 4 - ethylcatechol employed as the starting material was prepared by the following process . 3 , 4 - dimethoxystyrene was hydrogenated in methanol in the presence of pd / c catalyst . the methyl groups of resulting 4 - ethylveratrole were removed by acetic acid and hydrogen bromide to obtain 4 - ethylcatechol . ir spectrum ν max neat cm - 1 : 3030 , 2985 , 2960 , 2935 , 2880 , 1500 , 1450 , 1385 , 1380 , 1365 , 1320 , 1275 , 1260 , 1230 , 1160 , 1120 , 1060 , 980 , 920 , 835 , 805 , 785 . nmr spectrum ( cdcl 3 ) δ : 1 . 20 ( 3h , t ), 1 . 69 ( 6h , s ), 2 . 58 ( 2h , q ). the same procedures as described in example 10 were carried out by using a mixture of 7 . 61 g ( 50 mm ) of 4 - n - propylcatechol , 15 ml of acetone , 30 mg of p - toluenesulfonic acid monohydrate and 15 ml of benzene . 5 - n - propyl - 2 , 2 - dimethyl - 1 , 3 - benzodioxol was obtained in the yield of 9 . 13 g ( 47 mm ) as colorless transparent liquid having a boiling point of 82 °- 87 ° c ./ 3 mmhg . in addition , 4 - n - propylcatechol employed as the startinq material was prepared by the following process . 1 , 2 - dimethoxy - 4 - n - propenylbenzene was hydrogenated in the presence of methanol and methyl groups of resulting 4 - n - propylveratrole were removed by acetic acid and hydrogen bromide to give 4 - n - propylcatechol . ir spectrum ν max neat cm - 1 : 3060 , 3015 , 2970 , 2940 , 2920 , 2860 , 1600 , 1490 , 1440 , 1370 , 1330 , 1260 , 1245 , 1220 , 1210 , 1145 , 1115 , 1070 , 975 , 925 , 860 , 825 , 795 , 780 , 755 . nmr spectrum ( cdcl 3 ) δ : 0 . 92 ( 3h , t ), 1 . 65 ( 6h , s ), 1 . 57 ( 2h , sex ), 2 . 48 ( 2h , t ), 6 . 38 - 6 . 72 ( 3h ). the same procedures as described in example were carried out by using 4 . 16 g ( 25 mm ) of . 4 - n - butylcatechol , 15 ml of acetone , 30 mg of p - toluenesulfonic acid monohydrate and 7 ml of benzene . 5 - n - butyl - 2 , 2 - dimethyl 1 , 3 benzodioxol was obtained in the yield of 4 . 74 g ( 23 mm ) as colorless transparent liquid having a boiling point of 74 °- 75 ° c ./ 1 mmhg . in addition , the raw material 4 - n - butylcatechol was prepared by the following process . veratrole was reacted with n - butyric anhydride in the presence of iodine . resulting 4 - n - butyrylveratrol was reduced with hydrazine hydrate and potassium hydroxide in diethyleneglycol . the methyl groups of 4 - n - butylveratrole thus obtained were removed by acetic acid and hydrogen bromide to obtain 4 - n - butylcatechol . ir spectrum ν max neat cm 31 1 : 3060 , 3010 , 2975 , 2940 , 2920 , 2860 , 2845 , 1600 , 1495 , 1440 , 1380 , 1370 , 1265 , 1250 , 1225 , 1210 , 1150 , 1115 , 1075 , 975 , 935 , 830 , 795 , 780 , 760 , 745 . nmr spectrum ( cdcl 3 ) δ : 0 . 92 ( 3h , t ), 1 . 08 - 1 . 80 ( 4h , m ), 1 . 64 ( 6h , s ), 2 . 50 ( 2h , t ), 6 . 4 - 6 . 68 ( 3h ) the same procedures as described in example 10 were carried out by using 4 . 16 g ( 25 mm ) of 4 - isobutylcatechol , 15 ml of acetone , 30 mg of p - toluenesulfonic acid monohydrate and 15 ml of toluene . 5 - isobutyl - 2 , 2 - dimethyl - 1 , 3 - benzodioxol was obtained in the yield of 4 . 69 g ( 23 mm ) as colorless transparent liquid having a boiling point of 79 °- 83 ° c ./ 2 mmhg . in addition , the starting material 4 - isobutylcatechol was prepared by using isobutyric anhydride in place of n - butyric anhydride in the process of preparing the starting material in example 4 . ir spectrum ν max neat cm - 1 : 3060 , 3025 , 2980 , 2950 , 2920 , 2870 , 2845 , 1605 , 1495 , 1465 , 1450 , 1440 , 1380 , 1375 , 1365 , 1330 , 1285 , 1270 , 1255 , 1235 , 1220 , 1165 , 1155 , 1120 , 1085 , 1070 , 980 , 930 , 920 , 875 , 860 , 840 , 795 , 765 . nmr spectrum ( cdcl 3 ) δ : 0 . 85 ( 6h , d ), 1 . 4 - 2 . 0 ( 1h , m ), 1 . 65 ( 6h , s ), 2 . 37 ( 2h , d ), 6 . 3 - 6 . 7 ( 3h ). under nitrogen atmosphere , 12 . 41 g of homocatechol was dropwise added with 25 ml of an aqueous solution containing 8 . 8 g of sodium hydroxide under cooling . the mixture was cooled in an ice bath , and dropwise added with 75 ml of a toluene solution containing 22 . 5 g of phosgene over an hour while maintaining the reaction temperature at 0 °- 5 ° c . after stirring at this temperature for an hour , the temperature of the reaction mixture was raised to the room temperature and excess phosgene was purged with nitrogen . the precipitated crystals were filtered off . the toluene layer was separated from the filtrate and dried . toluene was distilled off under reduced pressure . the resulting residue was vacuum distilled to obtain 11 . 38 g of desired 4 - methyl - o - phenylenecarbonate as colorless oil having a boiling point of 74 ° c ./ 3 mmhg .

US-80186691-A

methods and apparatus are provided for monitoring plasma parameters in plasma doping systems . a plasma doping system includes a plasma doping chamber , a platen located in the plasma doping chamber for supporting a workpiece , an anode spaced from the platen in the plasma doping chamber , a process gas source coupled to the plasma doping chamber , a pulse source for applying pulses between the platen and the anode , and a plasma monitor . a plasma containing ions of the process gas is produced in a plasma discharge region between the anode and the platen . the pulses accelerate ions from the plasma into the workpiece . the plasma monitor may include a sensing device which senses a spatial distribution of a plasma parameter , such as plasma density , that is indicative of dose distribution of ions implanted into the workpiece .

before beginning a detailed description of the subject invention , mention of the following is in order . when appropriate , like reference materials and characters are used to designate identical , corresponding , or similar components in differing figure drawings . the figure drawings associated with this disclosure typically are not drawn with dimensional accuracy to scale , i . e ., such drawings have been drafted with a focus on clarity of viewing and understanding rather than dimensional accuracy . in the interest of clarity , not all of the routine features of the implementations described herein are shown and described . it will , of course , be appreciated that in the development of any such actual implementation , numerous implementation - specific decisions must be made in order to achieve the developer &# 39 ; s specific goals , such as compliance with application - and business - related constraints , and that these specific goals will vary from one implementation to another and from one developer to another . moreover , it will be appreciated that such a development effort might be complex and time - consuming , but would nevertheless be a routine undertaking of engineering for those of ordinary skill in the art having the benefit of this disclosure . for ease of reference a common identification system is used herein for describing the disclosed embodiments . an exercise treadmill as used in this specification is defined to include a treadway , which the exerciser walks upon during use , a front end , which is the end the exerciser faces when walking forward , and a back end , which is open for the exerciser to enter the treadmill . a treadmill generally includes left and right support columns or a centrally mounted support column . a treadmill generally includes a base or frame which rests on the floor through leveling feet and supports the rest of the treadmill apparatus . the invention disclosed includes mirror image left - side and right - side units for an exercise treadmill . “ mirror - image ” includes where the components of the left and right - side units are actually identical and interchangeable . for clarity , in this specification , description is provided referring to a single unit , with the understanding that the opposite side - unit is the same . referring to fig1 - 6 , a first embodiment is shown . a treadmill resistance training apparatus 100 having mirror image left and right units 10 and 12 , respectively , is coupled to a treadmill t having a treadway , a forward end f , an aft end a , a frame support f coupling treadmill t to the ground , and an upper portion u providing user interface controls and railing supports . each of units 10 and 12 includes a vertical support 102 having an adjustable base connector 110 to couple vertical support 102 to treadmill frame f , a riser portion 130 coupled to and extending upward from the base connector 110 , and an adjustable upper connector 132 to couple the vertical support 102 to the treadmill upper portion u ; a rotational coupling connector 148 connecting a rotational coupling 150 to the riser portion 130 ; a rotational coupling 150 mounted to the rotational coupling connector 148 such that the rotational axis 152 of the rotational coupling 150 is approximately horizontal ; a resistance element anchor 180 coupled to the riser portion 130 ; an elongated resistance arm 154 having opposing first and second ends 156 and 158 , respectively , the resistance arm 154 coupled to the rotational coupling 150 at a fulcrum point 152 between the resistance arm first and second ends 156 , 158 ; a first resistance element connector 160 movably coupled to the resistance arm 154 between the rotational coupling 150 connection and the first end 156 of the resistance arm 154 and including a resistance element connector locking mechanism 162 to lock the first resistance element connector 160 at user selectable positions along the resistance arm 154 ; one or more resistance elements 174 , 184 and 186 , connectable between the resistance element anchor 180 and the first resistance element connector 160 ; an adjustable handle 216 ; and , an articulation joint 206 coupling the handle 216 to the resistance arm first end 156 at a plurality of user selected angles . in the embodiment , the height of the rotational coupling connector 148 along the riser portion 130 is user adjustable . rotational coupling connector 148 includes a pair of connector bolts 230 bolted into receiving holes 236 along riser portion 130 through spacers 232 , which anchor plate 238 . the height of coupling connector 148 , and therefore fulcrum point 152 , can be adjusted without affecting the installation of the unit 10 to the treadmill by simply selecting different receiving holes 236 for attachment . riser portion 130 is coupled to adjustable base connector 110 at an adjustable height . riser portion 130 fits slidably into sleeve portion 126 of adjustable base connector 110 , so a user can move it up or down and lock it in place by inserting pin 240 into index holes 128 and through a corresponding riser receiving hole 236 . in the embodiment , resistance element anchor 180 is coupled to riser portion 130 separately from rotational coupling connector 148 and so must be moved independently . in the embodiment , adjustable base connector 110 includes first and second parallel base legs 112 and 114 which straddle a part of frame f to compress the part and couple base connector 110 to frame f and to the floor . first compression member 116 passes under frame f and is adjusted within lower slot 118 ( and a corresponding slot in leg 114 , not visible ) to abut upwardly against frame f to carry at least some of the weight of treadmill t , so that base connector 110 is more firmly coupled to the ground . first compression member 116 , with second and third compression members 120 and 122 passing above frame f , firmly compress frame f between connector legs 112 and 114 , and pass through receiving holes in sleeve portion 126 , to firmly engage adjustable base connector 110 to frame f . in the embodiment , compression members 116 , 120 and 122 are threaded connectors . upper slot 124 ( and a corresponding slot in leg 114 , not visible ) provides adjustment to provide height adjustment for base connector 110 and to displace compression member 122 for greater resistance to twisting . in the embodiment , adjustable upper connector 132 includes a clamp portion 134 to clamp against a part of the treadmill upper portion u . clamp portion 134 includes first and second opposing l - shaped clamp members 136 and 138 , which are nested so that member 136 slides within member 138 when compression member 140 is tightened , and retained in alignment by threaded fastener 144 extending through a riser portion receiving hole 236 and adjustment slots 142 in first member 136 and 146 in second member 138 . fastener 144 connecting through receiving hole 236 and clamp member slots 142 and 146 allows a user to extend the length of and select the optimum for upper connector 132 to couple vertical support 110 to treadmill upper portion u . this articulation joint , allowing rotation in a selected plane , provides great flexibility to integrate a standard unit to virtually any treadmill design , including those with only a horizontal rail extending around without left and right vertical posts . in the embodiment , first resistance element connector 160 is a short sleeve fitting slidably over resistance arm 154 , with a spring loaded locking pin 162 engagable with index holes 172 along at least a portion of the length of resistance arm 154 . moving the resistance element connection point linearly along resistance arm 154 varies the resistance experienced by the user by changing the moment arm imposed by the resistance elements created by the distance between the connection point on connector 160 and fulcrum point 152 . the moment arm imposed by the user remains essentially constant if the user grips handle 216 at the same location . a second resistance element connector 202 is coupled to resistance arm 154 between rotational coupling 150 and second end 158 of the resistance arm 154 , in this case actually mounted over second end 158 , but is not movable . one or more resistance elements 174 , 184 and 186 are connectable between resistance element anchor 180 and the second resistance element connector 202 . in the embodiment , first and second resistance element connectors 160 and 202 include opposing first and second resistance element connection points 164 , 168 and 188 , 192 , respectively , disposed on left and right sides of resistance arm 154 . in the embodiment connection points 164 , 168 , 188 and 192 are projections , with finger clamps 166 , 170 , and 190 , 194 , respectively , preventing resistance elements from slipping off . providing connection points on opposing sides of arm 154 reduces twisting torque on arm 154 , handle 216 , and rotational coupling 150 . in the embodiment , resistance arm stop 196 is provided , consisting of a flexible strap coupling at a first end 198 to second resistance element connector 188 and at a second end 200 to anchor 180 on riser portion 130 , so as to prevent resistance arm 154 from rotating beyond a selected point in one direction . stop 196 may be shifted to first resistance element connector 160 to prevent resistance arm 154 from over rotating in the opposite direction . in the embodiment , resistance elements 174 , 184 and 186 are identical , so only element 174 is described in detail . resistance element 174 is symmetrical and includes a first connection end 176 and a second connection end 178 which engage either anchor 180 or a connection point such as 164 . in the embodiment , resistance elements 174 , 184 , and 186 are bands or straps of elastomeric materials , but other resistance elements could be used , such as springs , pneumatic pistons or similar mechanisms . referring again to fig1 - 6 , and especially to fig5 and 6 , an adjustable handle 216 coupled to resistance arm 154 by articulation joint 206 is shown . in the embodiment , handle 216 includes a first part 218 coupled to articulated joint 206 and a second part 220 including an offset grip portion 222 . handle second part 220 slidably and rotatably connects to handle first part 218 along an interface region 224 , the interface region being the region in which the handle parts overlap or intersect each other . handle locking mechanism 226 allows a user to selectively lock handle second portion 220 at a selected fixed or selected dynamic position relative to the handle first part 218 . in the embodiment handle locking mechanism 226 includes a spring loaded pin 228 mounted to handle first part 218 within interface region 224 ; and , an alternating pattern of close fitting apertures 242 and transverse slotted apertures 244 disposed along the length and circumference of second handle part 220 within interface region 224 to receive pin 228 . pin and apertures could be swapped between handle first and second parts as well . when pin 228 is received in a selected close fitting aperture 242 the handle first and second parts 218 and 220 are locked relative to each other , both rotationally and lengthwise , providing a “ fixed ” locking position as shown in fig5 . when pin 228 is received in a selected transverse slotted aperture 244 the handle first and second parts 218 and 220 are prevented from sliding longitudinally or lengthwise relative to each other but have limited coaxial rotational movement relative to each other , thereby providing a “ dynamic ” locked position as shown in fig6 . providing both lengthwise and rotation adjustment , combined with the offset grip portion 222 , accommodates users of any size , from skinny to wide , and allows users to isolate different muscle groups by widening or narrowing their grip . selecting a dynamic locked position provides limited rotational movement for the offset grip portion 222 to orbit around the main longitudinal axis of handle 216 , allowing freer movement of the arms to building strength in supporting muscles and tendons for a better overall workout . reference to offset grip portion 222 does not imply that this is the only area where a user can grip handle 216 . rather , a user may grip handle 216 anywhere that is convenient . in the embodiment , articulation joint 206 couples handle 216 to resistance arm 154 . articulation joint 206 includes an index plate 208 rigidly coupled to resistance arm first end 156 and having a receiving hole 246 to receive threaded compression member 214 there through and a plurality of angle indexing holes 210 distributed around receiving hole 246 at selected angular offsets . handle first part 218 includes a first end 248 with a channel 250 forming opposing side arms 252 and 254 to receive index plat 208 , with receiving holes 256 and 258 to align with receiving hole 246 and index pin receiving holes 260 , 262 to align with indexing holes 210 . handle first part 218 extends to a second end 264 which engages with handle second part 220 . threaded compression member 214 is loosened to permit rotation to a selected angle , then tightened to compress opposing side arms 252 and 254 against index plate 208 and index pin 212 inserted through index pin receiving holes 260 and 262 aligned with indexing holes 210 to lock handle 216 at the desired angle relative to resistance arm 254 . referring to fig8 - 13 , a second embodiment 1000 is shown which is similar in many ways to the first described embodiment 100 , and so described in less detail . in a second embodiment , left and right side units 1002 and 1004 , respectively , are provided which are mirror images of each other and so a single description is provided . each of units 1010 and 1012 includes a vertical support 1102 having an adjustable base connector 1110 to couple vertical support 1102 to treadmill frame f , a riser portion 1130 coupled to and extending upward from the base connector 1110 , and an adjustable upper connector 1132 to couple the vertical support 1102 to the treadmill upper portion u ; a rotational coupling connector 1148 connecting a rotational coupling 1150 to the riser portion 1130 ; a rotational coupling 1150 mounted to the rotational coupling connector 1148 such that the rotational axis 1152 of the rotational coupling 1150 is approximately horizontal ; a resistance element anchor 1180 coupled to the riser portion 1130 ; an elongated resistance arm 1154 having opposing first and second ends 1156 and 1158 , respectively , the resistance arm 1154 coupled to the rotational coupling 1150 at a fulcrum point 1152 between the resistance arm first and second ends 1156 , 1158 ; a first resistance element connector 1160 movably coupled to the resistance arm 1154 between the rotational coupling 1150 connection and the first end 1156 of the resistance arm 1154 and including a resistance element connector locking mechanism 1162 to lock the first resistance element connector 1160 at user selectable positions along the resistance arm 1154 ; one or more resistance elements 1174 , 1184 and 1186 , connectable between the resistance element anchor 1180 and the first resistance element connector 1160 ; an adjustable handle 1216 ; and , an articulation joint 1206 coupling the handle 1216 to the resistance arm first end 1156 at a plurality of user selected angles . in the embodiment , rotational coupling connector 1148 includes a hinge connector 1266 mounted to riser portion 1130 , with hinge connector 1266 selectively lockable in a deployed position , as shown in fig7 , and a stowed position , as shown in fig9 , using hinge safety pin 1268 . hinge connector 1266 includes a u - shaped mounting bracket 1270 with mounting holes 1272 to align with riser portion index holes 1236 and receive threaded compression members 1274 , to firmly couple hinge connector 1266 to riser portion 1130 at a selected height . upper and lower hinge plates 1276 and 1278 , respectively , extend from mounting bracket spine 1280 to retain hinge post 1288 between them , which receives internal hinge axle 1282 there through , with hinge axle 1282 secured at first and second ends 1284 and 1286 by the respective hinge plates , 1276 , 1278 , leaving hinge post 1288 free to rotate about hinge axle 1282 . hinge arm 1290 is rigidly coupled to and extends out from hinge channel 1288 to receive rotational coupling 1150 at its distal end 1292 . hinge post 1288 is a hollow tube with opposing first and second ends 1294 and 1296 , respectively , and a locking pin receiving hole 1298 extending transversely through at approximately its midpoint . hinge post 1288 includes a top flange 1300 rigidly connected to first end 1294 , proximal to upper hinge plate 1276 , and including hinge index holes 1302 to receive spring loaded hinge index pin 1304 there in . hinge axle 1282 is secured at its ends 1284 and 1286 to prevent rotation , and includes hinge locking pin receiving hole 1306 transversely through its midsection so that it is aligned with receiving hole 1298 when unit 1002 is fully deployed for use , as shown in fig7 , and when unit 1002 is rotated 180 degrees around hinge axle 1282 to the fully stowed position , as shown in fig9 . an operator may disengage hinge locking pin 1304 , pull up spring loaded hinge index pin 1304 to clear hinge index holes 1302 , rotate unit 1002 to a desired position , and then reengage index pin 1304 into the selected hinge index hole 1302 . in the embodiment , resistance element anchor 1180 projects from hinge post 1288 so that the height of anchor 1180 adjusts with the rotational coupling connector 1150 to remain constant , and resistance elements 1174 , 1184 and 1186 rotate with resistance arm 1154 . base connector 1110 includes opposing first and second base plates 1112 and 1114 engage a part of frame f tightening threaded compression members 1116 . base connector sleeve portion 1126 extends upward from second base plate 1114 to receive riser portion lower end 1108 . threaded compression members 1120 and 1122 insert through riser portion receiving holes 1236 within slot 1124 to permit adjustment of the height of riser portion 1130 . in the embodiment , adjustable upper connector 1132 includes a clamp portion 1134 to clamp against a part of the treadmill upper portion u . clamp portion 1134 includes first and second opposing l - shaped clamp members 1136 and 1138 , which are nested so that member 1136 slides within member 1138 when compression member 1140 is tightened , and retained in alignment by threaded fasteners 1144 extending through adjustment slot 1142 . clamp portion 1134 includes a plurality of gripping protrusions 1330 disposed on at least a portion of the contact area between the clamp 1134 and the treadmill upper portion u . in the embodiment , upper connector 1132 includes an articulation joint 1310 to accommodate a wider range of angular adjustments . articulation joint 1310 includes an index plate 1312 rigidly coupled proximal to riser upper end 1234 . index plate 1312 includes a center receiving hole 1314 to receive retaining bolt 1320 and a plurality of index holes 1316 distributed around center receiving hole 1314 at selected angular offsets . coupling member 1328 couples at a first end 1318 to index plate 1312 by retaining bolt 1320 and at a second end 1322 to clamp portion 1134 by threaded fasteners 1144 through adjustment slot 1142 , which allows extension or retraction . coupling member 1328 includes an index hole 1324 to align with index holes 1316 and receive index locking pin 1326 . in the embodiment , a second resistance element connector movably coupled to the resistance arm between the rotational coupling and the second end of the resistance arm and including a locking portion to lock the second resistance element connector at user selectable positions along the resistance arm ; and , one or more resistance elements connectable between the resistance element anchor and the second resistance element connector . in the embodiment , first resistance element connector 1160 is a short sleeve fitting slidably over resistance arm 1154 , with a threaded locking bolt 1162 engagable with index holes along at least a portion of the length of resistance arm 1154 . moving the resistance element connection point linearly along resistance arm 1154 varies the resistance experienced by the user by changing the moment arm imposed by the resistance elements created by the distance between the connection point on connector 1160 and fulcrum point 1152 . the moment arm imposed by the user remains essentially constant if the user grips handle 1216 at the same location . a second resistance element connector 1202 is coupled to resistance arm 1154 between rotational coupling 1150 and second end 1158 of the resistance arm 1154 , and essentially identical in operation to first resistance element connector 1160 , including threaded locking bolt 1204 to engage index holes along resistance arm 1154 . one or more resistance elements 1174 , 1184 and 1186 are connectable between resistance element anchor 1180 and the second resistance element connector 1202 . in the embodiment , first and second resistance element connectors 1160 and 1202 include opposing first and second resistance element connection points 1164 , 1168 and 1188 , 1192 , respectively , disposed on left and right sides of resistance arm 1154 . in the embodiment connection points 1164 , 1168 , 1188 and 1192 are projections , with finger clamps 1166 , 1170 , and 1190 , 1194 , respectively , preventing resistance elements from slipping off . providing connection points on opposing sides of arm 1154 reduces twisting torque on arm 1154 , handle 1216 , and rotational coupling 1150 . in the embodiment , adjustable handle 1216 is coupled to resistance arm 154 by articulation joint 1206 . handle 1216 includes a first part 1218 coupled to articulated joint 1206 and a second part 1220 including an offset grip portion 1222 . handle second part 1220 slidably and rotatably connects to handle first part 1218 along an interface region 1224 , the interface region being the region in which the handle parts overlap or intersect each other . handle locking mechanism 1226 allows a user to selectively lock handle second portion 1220 at a selected fixed position relative to the handle first part 1218 . in the embodiment handle locking mechanism 1226 includes an locking pin 1228 insertable through index holes 1230 in handle first part 1218 and second part 1220 within interface region 1224 . the apparatus of claim 1 , further comprising : a power actuated resistance adjustment mechanism coupled to the resistance arm and the first resistance element connector to move the first resistance element connector to user selectable positions along the resistance arm ; and , a power actuated resistance element connector locking mechanism . referring to fig1 , a third embodiment 2000 is shown having power actuated resistance adjustment mechanisms 2402 and 2404 mounted at resistance arm 2154 first and second ends 2156 and 2158 , respectively , to adjust resistance . the third embodiment is generally similar to the second embodiment , having a riser 2130 , upper connection 2132 , first and second movable resistance element connectors 2160 and 2202 on resistance arm 2154 , with resistance arm 2154 connected at a fulcrum point to hinged connector 2266 by rotational coupler 2150 . hinge connector 2266 couples to riser portion 2130 by hinge bracket 2270 , and hinge indexing pin 2304 locks hinge connector 2266 at user selected angles . resistance elements 2174 and 2186 couple between movable connectors 2160 and 2202 and resistance element anchor 2180 projecting from hinge post 2288 to rotate therewith . a handle ( not shown ) couples to resistance arm 2154 by articulated joint 2106 . power and control are provided by controller 2406 through flexible cable 2408 to air compressor 2410 . air compressor 2410 supplies pressurized air to first and second bi - directional pistons 2416 and 2422 by flexible tubing 2412 , 2414 and 2418 , 2420 , respectively . pistons 2416 and 2420 are mounted rigidly to resistance arm 2154 . first piston 2416 couples to first resistance connector 2160 by first piston rod 2424 via universal joint 2426 . second piston 2422 couples to second resistance connector 2202 by second piston rod 2428 via universal joint 2430 . air compressor 2410 includes built in solenoid valves in fluid communication with each of the opposing piston sides in first and second pistons 2416 and 2422 to provide a controlled locking mechanism . alternatively , the pistons and associated couplings could be replaced by electromagnetically actuated linear motors , or by electrically powered lead screws , either of which could provide powered adjustment capability to move resistance element connectors 2160 and 2202 along resistance arm 2154 to a user - selected resistance level . controller 2406 may be integrated into a treadmill controller , or could be installed separately onto a treadmill at a convenient location . those skilled in the art will recognize that numerous modifications and changes may be made to the preferred embodiment without departing from the scope of the claimed invention . it will , of course , be understood that modifications of the invention , in its various aspects , will be apparent to those skilled in the art , some being apparent only after study , others being matters of routine mechanical , chemical and electronic design . no single feature , function or property of the preferred embodiment is essential . other embodiments are possible , their specific designs depending upon the particular application . as such , the scope of the invention should not be limited by the particular embodiments herein described but should be defined only by the appended claims and equivalents thereof .

US-201113576035-A

this invention generally relates to rescue , firefighting , or paying devices and , more particularly , to a fire hose dispensing device and method . the present invention includes a hose box , fire hose , and a hose box release mechanism . the device and method allow firefighters to release and pay hose without leaving the passenger compartment of a fire truck .

fig1 and 2 show the preferred embodiment of the present invention . in general , the hose paying system of the present invention generally includes an ejection mount 10 and a hose box 12 releasably attached to the ejection mount 10 . a supply hose 14 may be positioned adjacent to and connectable with the hose box 12 . as shown in fig2 the ejection mount 10 preferably resembles a right triangle when viewed from the side , but the actual shape of the ejection mount 10 is irrelevant , so long as the hose box 12 can be releasably attached to the ejection mount 10 . as shown in fig1 and 2 , and with more specificity in fig3 - 5 , the ejection mount 10 has a base 16 and a first sidewall 18 positioned substantially perpendicularly adjacent to a first side 20 of the base 16 . a second sidewall 22 is positioned substantially perpendicularly adjacent to a second side 24 of the base 16 , substantially parallel to the first sidewall 18 . a back wall 26 , having a first end 28 and a second end 30 , is positioned substantially perpendicularly adjacent to the first sidewall 18 and the second sidewall 22 , with the second end 30 of the back wall 26 positioned adjacent a third side 32 of the base 16 . a plurality of box support legs 34 extend from the back wall 26 and are positioned substantially perpendicularly adjacent the back wall 26 , substantially parallel to the base 16 . a rotatable pivot wall shaft 36 is positioned adjacent to the first end 28 of the back wall 26 , between the first and second sidewalls 18 , 22 , substantially parallel to the base 16 . a pivot wall 38 is connected to the pivot wall shaft 36 , with the pivot wall 38 having a first box guide rail 40 positioned adjacent a first side 42 of the pivot wall 38 and a second box guide rail 44 positioned adjacent a second side 46 of the pivot wall 38 . the pivot wall 38 also includes box support recesses 48 corresponding to or aligned with the box support legs 34 , so that the box support legs 34 protrude through the pivot wall 38 when the pivot wall 38 is pivoted into a closed or loaded position , as shown in fig3 or are completely obscured when the pivot wall 38 is pivoted into an open or unloaded position , as shown in fig4 . the pivot wall 38 is pivoted into an open or closed position by an actuator assembly 50 connected to the rotatable pivot wall shaft 36 . fig1 and 2 show the actuator assembly 50 positioned adjacent the first sidewall 18 of the ejection mount 10 , while fig3 - 5 show the actuator assembly 50 adjacent the second sidewall 22 of the ejection mount 10 . either configuration may be used depending on the needs of the user . the actuator assembly 50 , shown in detail in fig3 - 5 , has a fluid inlet 52 that is connected to a fluid routing valve 54 . the fluid routing valve 54 has a fluid routing switch 56 that routes a fluid , such as air or hydraulic fluid , into a jack 58 and a pressure relief valve 60 . the fluid routing switch 56 may be controlled , i . e ., opened or closed , for example , by fluid , electrical signal , or any other conventional means . in firefighting applications , a conventional electrical control device having an electrical signal switch activated inside the cab of a fire truck is the preferred method . the jack 58 has a jack body 62 and jack extension 64 , with the jack extension 64 connected to one end of a lever 66 . the other end of the lever 66 is connected to one end of a chain 68 . the other end of the chain 68 is connected to a bias spring 70 connected between the chain 68 and a spring mount 72 . the chain 68 engages a rotatable sprocket 74 connected to a first end 76 of the pivot wall shaft 36 . the ejection mount 10 is preferably mounted on a vehicle , such as the rear portion of a fire truck hose bed . in one embodiment , shown in fig1 and 2 , a swing out hinge mount 78 is attached to the rear step 80 of a fire truck and the ejection mount 10 is attached to the swing out hinge mount 78 . the swing out hinge mount 78 allows firefighters to swing the ejection mount 10 out away from rear of the fire truck , e . g ., up to about 170 degrees of rotational arc , allowing access to compartments accessible only from the rear of the fire truck . to prevent the ejection mount 10 from swinging out away from the rear of the truck during transit , a slide stop 82 is provided on either the first or second sidewall 18 , 22 of the ejection mount 10 , opposite the swing out hinge mount 78 . the slide stop 82 engages a hole drilled into the rear bumper or step 80 of the fire truck . as an alternative , the back wall 26 of the ejection mount 10 may also be securely bolted directly to the fire truck , preferably adjacent a rear portion of the fire truck hose bed . as shown generally in fig1 and 2 , and explained more fully in the several successive paragraphs , the hose box 12 is releasably loaded onto the ejection mount 10 and is subsequently expelled from the ejection mount 10 onto a surface , such as the ground . as shown generally in fig1 - 9 , the hose box 12 has a first end 84 , a second end 86 positioned opposite the first end 84 , a first sidewall 88 , formed by a substantially l - shaped member 90 and an obtuse shaped member 92 positioned perpendicularly adjacent the first and second ends 84 , 86 , a second sidewall 94 formed by a second l - shaped member 90 and a second obtuse shaped member 92 and positioned opposite and parallel to the first sidewall 88 , a top portion 96 positioned perpendicularly adjacent the first end 84 , the second end 86 , the first sidewall 88 , and the second sidewall 94 , and a base plate 98 forming a bottom portion positioned parallel to the top portion 96 and connecting the first and second sidewalls 88 , 94 . the top portion 96 can be open or closed and the first end 84 , second end 86 , first sidewall 88 , and second sidewall form 94 an internal cavity 102 . although hose box 12 can assume many different geometrical shapes , sidewalls formed from substantially l - shaped and substantially obtuse shaped members 90 , 92 provide two significant advantages . first , the shape of each sidewall 88 , 94 allows pads 100 positioned on the sidewalls 88 , 94 to contact the ground or other surface and cushion the impact of the hose box 12 . second , the obtuse shaped members 92 urge the bottom portion 98 of the hose box 12 towards the ground when the hose box 12 is ejected from the ejection mount 10 , insuring that the hose box 12 will land with the top portion 96 of the hose box 12 facing away from the ground . in one embodiment of the hose box 12 , shown in fig1 and 6 - 8 , joining members 103 connect the first and second sidewalls 88 , 94 or the first and second ends 84 , 86 adjacent the top portion 96 of the hose box 12 . the first end 84 , second end 86 , first sidewall 88 , second sidewall 94 , base 98 , and joining members 103 form an internal cavity 102 within the hose box 12 . the internal cavity 102 provides enough clearance to allow a folded hose 101 , e . g ., about 25 feet in length , having a hydrant connector c to be inserted into hose box 12 . the folded hose 101 is inserted into the hose box 12 through a movable gate 104 . the gate 104 has a first side 106 and a second side 108 and is positioned adjacent the second end 86 of the hose box 12 . in the preferred embodiment , the second side 108 of the gate 104 is pivotally connected adjacent the bottom portion 98 of the hose box 12 , with the first side 106 pivotally movable away from the top portion 96 of the hose box 12 into an open position . the gate 104 is held in a closed position by a movable latch 110 positioned adjacent the first side 106 of the gate 104 . in a second embodiment , the first side 106 of the gate 104 is pivotally connected adjacent the top portion 96 of the hose box 12 . the gate 104 is lifted into an open position with the assistance of a graspable gate knob 112 . as shown in fig1 and 6 - 8 , the first end 84 of the hose box 12 may contain a dual hose connector 114 positioned adjacent the first end 84 of the hose box 12 for connecting the supply hose 14 to the hose box 12 and then hose box 12 , i . e ., the hose 101 , to a hydrant or other water source . fig6 and 7 show an optional battery powered light 116 positioned in a protected area of the hose box 12 . the light 116 is connected to a light switch 24 ( not shown ) that activates upon release of the hose box 12 from the ejection mount 10 . the protected area is preferably adjacent the top portion of the hose box 12 . fig1 and 7 - 8 show tool clamps 27 attached to the sides of hose box 12 to allow the attachment of various firefighting tools 120 , such as a hydrant wrench . in a second embodiment of the hose box 12 , shown in detail in fig9 the hose box 12 does not have joining members 103 adjacent the top portion 96 of the hose box 12 . instead , the top portion 96 of the hose box 12 is open , allowing a four - way hydrant valve 122 to be inserted into the internal cavity 102 of the hose box 12 . in this embodiment , shown in fig9 the four - way hydrant valve 122 replaces the dual hose connector 114 . the supply hose 14 is still adjacent the hose box 12 , but the supply hose 4 is connected directly to the four - way hydrant valve 122 . slack in the supply hose 14 can be provided by connecting the supply hose 14 to the four - way hydrant valve 122 , placing the four - way hydrant valve 122 in the hose box 12 , and pulling a folded layer of supply hose 14 through the first end 84 of the hose box 12 and looping a portion of the hose around or over a transverse support member 107 . once the hose box 12 has been deployed from the ejection mount 10 , the four - way hydrant valve 122 can be lifted out of the hose box 12 , through the open top portion 96 of the hose box 12 and carried to the nearest hydrant , fire truck , or other water source . the looped portion of the hose provides the slack to permit movement of the hydrant valve 122 . the hydrant valve 122 can be secured in the hose box 12 in any conventional manner , such as straps , quick release devices , etc . in either the first or second embodiments , hose box 12 should be durable enough to withstand a drop from a fire truck , yet light enough for one person to lift . moreover , hose box 12 should be designed to survive an impact with concrete or other paved surface . steel is the preferred construction material , but other metals or composites may be used . operation begins by attaching an ejection mount 10 to a fire truck , positioning or connecting a supply hose 14 to a releasable hose box 12 , connecting the releasable hose box 12 to the ejection mount 10 , releasing the hose box 12 from an ejection mount 10 , moving a fire truck in a forward motion away from the hose box 12 , and paying the supply hose 14 from the hose bed of the fire truck . to accomplish these steps , any one of the aforementioned embodiments of the hose box 12 is attached to the ejection mount 10 , as shown generally in fig1 - 3 , by moving the pivot wall 38 of the ejection mount 10 into the loaded position . the obtuse shaped members 92 on the hose box 12 slide upwardly between the pivot wall 38 and box guide rails 40 , 44 . when the hose box 12 is seated in the ejection mount 10 , a pressure release knob 61 is activated and the pivot wall 38 is manually pressed toward the back wall 26 . as shown in fig1 the hose box 12 then rests on the box support legs 34 and is held in place by the box guide rails 40 , 44 on the pivot wall 38 . a safety interlock prevents the hose box 12 from being removed from the ejection mount 10 until the activation switch is energized . moreover , a second interlock prevents a hose box 12 from being deployed while the ejection mount 10 , if equipped with a swing out hinge mount 78 , is pivoted away from a rear portion of the fire truck . the actuator assembly 50 is preferably powered by a fluid , such as air . to deploy any embodiment of the hose box 12 , an operator stops a rear portion of the fire truck near a hydrant or other water source and activates the actuator assembly 50 , preferably by energizing the activation switch from inside of the passenger compartment of the truck . shown generally in fig3 - 5 , tripping the activation switch causes the fluid routing switch 56 to open , and a fluid such as air is directed into jack 58 and the pressure release valve 60 . as pressure builds in the jack 58 , the jack extension 64 extends away from the jack body 62 , depressing the attached lever 66 . the downward motion of lever 66 causes the chain 68 to rotate the sprocket 74 . the bias spring 70 , connected to the chain 68 and the spring mount 72 , creates tension in the chain 68 . the rotation of the sprocket 74 attached to pivot wall shaft 36 causes a lower end of pivot wall 38 to move in a forwardly direction , pivotally away from back wall 26 . when the pivot wall 38 is completely extended and clear of the box support legs 34 , as shown in fig4 the hose box 12 slides along the box guide rails , preferably lined with a low friction material such as plastic 124 , past the ejection mount 10 , and onto the ground or other surface . it should be appreciated that any activator means can be employed to pivot the pivot wall 38 . while an air driven means are preferred , any suitable fluid can be used . in addition , other mechanical or electrical devices , such as cables , mechanical linkages , levers or motors can be used to rotate pivot wall shaft 36 . in the preferred embodiment , the supply hose 14 is connected to the hose box 12 via the dual hose connector 114 and unrolls a length approximately equal to the height of the hose box 12 above the ground . once the hose box 12 impacts the ground , the weight of the hose box 12 allows the supply hose 14 to pay out as the truck resumes its forward motion . optional light 116 activates , warning of the deployment of hose box 12 and the payed supply hose 14 . additional safety precautions include positioning reflective tape 126 on the hose box 12 and painting the hose box 12 a bright color , such as yellow . it should be noted that the truck does not need to come to a complete stop before discharging the hose box 12 , but this is the preferred method . the hose 101 is removed and the hydrant connector c attached to a hydrant to allow water to flow from the hydrant through the hose 101 and dual hose connector 114 into the supply hose 14 and hence to a conventional firefighting nozzle . in a second embodiment , the hose box 12 contains a conventional four - way hydrant valve 122 instead of a 25 - foot folded hose 101 section . in this embodiment , the hose box 12 is discharged in the same manner as described in the preferred embodiment . however , the hose box 12 may be discharged further than 25 feet from the hydrant , provided there is more than 25 feet of supply hose 14 doubled over itself . the hydrant valve 122 may then be removed from the hose box 12 and carried to the hydrant . thus , the present invention provides an expedient , safe way for paying fire engine supply hose . hose can be deposited at a precise location from inside the fire truck without consuming a firefighter &# 39 ; s valuable time or exposing the firefighter to non - fire related safety risks . moreover , once the hose has been deployed , its exact location can be determined by motorists , pedestrians and emergency personnel . the invention has been described with reference to the preferred embodiment . obvious modifications and alterations will occur to others upon reading and understanding the preceding detailed description . it is intended that the invention be construed as including all such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof .

US-37120099-A

apparatus for applying a biocide liquid composition to billets formed from sugar cane stalks in one embodiment of the invention , the apparatus is comprised of a container for containing the liquid composition , a conduit in fluid communication with the container , and one or more nozzles in fluid communication with the conduit , the apparatus being sized and configured for connection to a billet - type sugar cane harvester so that the nozzles are disposed to direct the liquid composition onto the billets either before or as they are received by a hopper configured to receive the billets dispensed from the harvester during operation of the harvester . related improvements to harvesters and methods of inhibiting microbial degradation of sugar cane .

as will now be appreciated , the present invention facilitates the application of microbiocide directly to chopped sugarcane only seconds after it is cut . one of the several advantages provided by this aspect of the present invention is the fact that cane mills and cane growers will immediately benefit from deterrence of inversion of sugarcane juice and dextran formation , which reduces sugar yield in a very direct way . another advantage is increased sugar mill efficiency through reduction in the presence of polysaccharides ( produced during microbial activity upon the cane ), which are believed to be detrimental to the processing of sugar throughout the mill . in the practice of this invention , the sugar cane billets pull the microbiocide into the tissue of the cane , along with the infectious bacteria . in this way , the microbiocide fights the infection at the point of infection . still another advantage offered by the present invention arises from the fact that billet cane harvesters can also harvest down and lodged cane . yields continue to rise now that down and severely lodged cane is not as difficult to harvest as with the previous harvesters , e . g ., the soldier harvester . more cane will continue to fall down with ever increasing higher - yielding varieties . during this falling and twisting , growth cracks become more prevalent , which allows large colonies of bacteria to enter into these cracks . these down sugarcane areas are harvested along with the standing sugarcane and increase the infection of the entire sugarcane field even when the milling time from cut to grind is short . the application of microbiocide from the billet harvester will also help with the basic problem of purchasing cane by tonnage . this application will raise the overall quality of field sugarcane delivered to the mill . turning now to the drawings , fig1 illustrates one preferred embodiment of this invention . this illustration shows a billet - type sugar cane harvester 10 . harvester 10 includes a billet conveyor 12 which conveys cut segments of sugar cane stalks , i . e ., billets , along with other cut parts of the sugar cane vegetation , away from the cutting portion ( not shown ) of harvester 10 toward a conveyor chute 14 . chute 14 includes a fan ( not shown ) which pulls a sufficient vacuum to cause undesirable portions of the vegetation to be separated from the desired cane billets and to be ejected from the chute through a blower passage 16 . the desired billets and any vegetation or dirt not removed and ejected through blower passage 16 then falls out of chute 14 into a container . such a container is illustrated in fig2 as a hopper h which is being towed along side harvester 10 by a tractor t . while these figures illustrate one typical billet - type sugar cane harvester , there are several other designs of billet - type sugar cane harvesters which exist , and persons of skill in the art will appreciate that all such harvesters are within the scope of the present invention as long as they harvest sugar cane so as to produce a volume of cut stalks of sugar cane to be used in subsequent milling to produce an end product . in a preferred embodiment of this invention illustrated in fig2 , the harvester 10 of fig1 has been adapted to apply a microbiocide solution to the harvested billets . specifically , harvester 10 has been adapted to include a microbiocide container in the form of a tank 20 in fluid communication with a pump p which , in turn , is in fluid communication with a fluid conduit in the form of a tube 22 which conveys the pressurized solution toward chute 14 . at chute 14 , tube 22 is configured for attachment to and fluid communication with a series of spray nozzles 24 suspended near the normal flow path of billets coming off of conveyor 12 . in this way , billets falling through chute 14 fall through a spray zone in which the microbiocide solution is applied to the billets before they fall into hopper h . preferably , the spray nozzles 24 are disposed under the billet chute so as to form a spray zone below a horizontal plane occupied by a top portion x of the billet conveyor belt , in order to minimize the amount of microbiocide solution which might be pulled up and out of the chute by the vacuum created by the fan which typically resides near the top of the conveyor chute . the spray zone formed by the spray nozzles preferably is sufficient to provide a biocidally effective level of coating to the billets . of course , the level of coating which is biocidally effective will depend upon other factors , including but not limited to the concentration of the microbiocidal solution , the level of infection within the billets , the type of microbe ( s ) involved , and the microbiocide employed . the level of coating provided is typically at least enough to result in a deposit of from about 5 to about 20 ppm by weight of biocide on the cane , with or without any surfactant washing aid or other additive . harvester 10 of fig2 has been adapted to apply microbiocide to harvested billets using a preferred adapter illustrated in fig3 . there it will be seen that the adapter is comprised of a box frame 30 which is formed by three walls 31 , 32 and 33 and a square support frame 34 , which walls and frame are place together to form a box - like structure in frame 30 . the structure is configured to be connected to chute 14 ( see fig1 and 2 ) by being bolted thereto at four flanges 36 . box frame 30 is configured to permit conveyor 12 to convey billets into the space defined by frame 30 . a divider baffle 38 extends across the lower portion of frame 30 and into a billet flow path illustrated with arrow a . divider baffle 38 divides the billet flow path into two separate flow paths illustrated by arrows b and c . billets following these separate flow paths enter respective spray zones into which microbiocide is sprayed via spray nozzles 24 . box frame 30 is sized to be deep enough so that the spray zone created by the spray from spray nozzles 24 remains effective notwithstanding any vacuum created by normal use of the conveyor 12 and and the fan ( not shown ) in the upper portion of chute 14 . box frame 30 has an open side opposite from conveyor 12 to accommodate a rubber flap 40 ( fig4 only ) which , in some billet harvesters , extends downwardly from chute 14 and which may or may not be elevated using mechanical or hydraulic controls to adjust the position of the flap and to control the ejection of vegetation from the chute , if desired . fig4 illustrates the adapter of fig3 as installed on chute 14 of harvester 10 . the view illustrated is from the side of chute 14 opposite of the side illustrated in fig2 . rubber flap 40 extends down the rear end of chute 14 to cover the open side of box frame 30 . of course , it will be appreciated that the particular shape of or material used to make , the adapter of this invention is not limited to the exemplary version illustrated in these figures . these aspects of the adapter of the invention will , to at least some extent , be determined by the configuration of the harvester to which the adapter is being attached , the type and / or height of the hopper into which the billets are placed , and the size and condition of the billets produced by the harvester . suitable biocide solutions for use in the present invention will comprise any biocide which is permitted for the intended use in the relevant legal jurisdiction , used at a aqueous concentration effective to achieve the desired level of microbiocidal activity in the vegetation to be harvested . non - limiting examples of a suitable biocide solution components may comprise carbamates , carbonates , diamines , and quaternary ammonium compounds , as well as derivatives thereof or combinations of any two or more of the foregoing . the concentrations employed will vary with the particular biocide used in the liquid solution . as an example , a typical concentration for a carbamate microbiocide might be in the range of about 5 to about 20 ppm by weight . the microbiocide in aqueous solution may also be in the presence of other additives which might provide additional advantages in the use of the solution . for example , a surfactant may be added to the solution in order to assist in the subsequent cleansing of the billets during sugar mill processing . non - limiting examples of suitable surfactants might include non - ionic surfactants , and the like . other various additives , e . g ., fragrance to eliminate biocide odor , might be considered suitable or desirable for inclusion in the microbiocide solution . a 200 - gallon solution tank , filled with a carbamate microbiocide solution , is mounted on a billet - type sugar cane harvester . a mechanical pump directs the solution from the tank into a set of spray tips that are directed downward from the harvester and sprays the cane as it falls from the billet conveyor of the harvester . an automatic electric shutoff valve only allows the microbiocide to be sprayed while the sugarcane is falling into the cart , preventing the microbiocide solution from being accidentally left on and spraying the end of the sugarcane row or in a ditch or body of water . this limits exposure to the environment and keeps the microbiocide on target . the automatic switch is wired to the loader control on the billet harvester . a red light in the operator &# 39 ; s cab comes on when the pump is running and the flow of microbocide is supplied to the tips . a hooded shield is positioned around the spray tips to prevent wind drift of the microbiocide . the hooded shield has a cross bar divider to mix the microbiocide with the sugarcane as the cane falls into the pick up cart . upon filling the cart , the cart is hauled out of the field and the billets are transported to storage or directly to a mill , and samples of the billets may be cultured to verify the efficacy of the biocide over time . by including surfactant in the solution applied to the billets so that wash water is not needed at the mill prior to milling , this application also reduces or totally eliminates the need for additional microbiocide application in the mill , resulting in additional savings . it will also be appreciated that the biocide used in the present invention could be applied to the billets from different points along the harvesting process employed by the billet - type harvester , e . g ., from one or more sprayers disposed at or near the harvester cane cutters , or disposed on or near the hopper into which the billets are conveyed , but the illustrated application configuration has advantages over these alternatives . for example , application in accordance with the preferred embodiment depicted in the drawings reduces biocide waste and increases coating coverage by applying biocide to the billets after at least some of the undesired vegetation has been removed from the product . in addition , application in the manner illustrated enables the use of a single biocide storage tank and adapter , while use of an applicator attached to the hopper would require more storage tanks and nozzle assemblies to be attached to each hopper employed , thereby increasing the overall cost of the system . each and every patent , patent application and printed publication referred to above is incorporated herein by reference in toto to the fullest extent permitted as a matter of law . it should be appreciated that , while specific embodiments are described hereinafter , several other applications of the presently described invention may be contemplated by those of skill in the art in view of this disclosure . for example , while the accompanying drawings illustrate particular configurations for a biocide applicator , other configurations may be envisioned by those of ordinary skill in the art which still fall within the scope of this invention . accordingly , the scope of this invention is not limited to the specific embodiments described in detail hereinafter . rather , what is intended to be covered is as set forth in the ensuing claims and the equivalents thereof permitted as a matter of law . as used in this specification , means - plus - function clauses , if any , are intended to cover the structures described herein as performing the cited function and not only structural equivalents but also equivalent structures .

US-61905903-A

a disposable diaper is provided on the inner surface of a crotch region with a pair of barrier cuffs opposed to each other about a longitudinal center line . each of the barrier cuffs includes inner and outer sheet strips in the form of sheet strips provided separately of each other . the first and second sheet strips include bottom side edges fixed to the inner surface of the diaper and top side edges left free from the inner surface in the crotch region . the bottom side edge of the first sheet strip is spaced aside from the bottom side edge of the second sheet strip toward the center line . the first and second sheet strips are collapsed onto the inner surface of the diaper and overlap to each other in such collapsed state . the first and second sheet strips are locally bonded to each other in a part of the overlapping area of these sheet strips . one of the first and second sheet strips has its top side edge placed aside from the top side edge of the other sheet strip toward the center line and provided with an elastic member .

details of a disposable diaper according to the present invention will be more fully understood from the description given hereunder with reference to the accompanying drawings . fig1 is a partially cutaway plan view showing a disposable diaper 1 and fig2 is a plan view showing a circled part ii of fig1 in an enlarged scale . the diaper 1 comprises a liquid - pervious topsheet 2 defining an inner surface put in contact with the wearer &# 39 ; s skin , a liquid - impervious backsheet 3 defining an outer surface put in contact with clothes and a body fluid absorbent core 4 sandwiched between these two sheets 2 , 3 . the diaper 1 has a longitudinal direction l and a transverse direction w , defining a front waist region 6 , a rear waist region 7 and a crotch region 8 extending between these two waist regions 6 , 7 in the back - and - front direction l . the front and rear waist regions 6 , 7 are respectively provided along respective ends 11 , 12 thereof with waist elastic members 13 , 14 sandwiched between the top - and backsheets 2 , 3 and bonded in a stretched state to at least one of these sheets 2 , 3 . the crotch region 8 is provided along its transversely opposite side edges 16 with leg elastic members 17 sandwiched between the topsheet 2 and the backsheet 3 and bonded in a stretched state to at least one of these sheets 2 , 3 . the rear waist region 7 is provided on its transversely opposite side edges 18 with tape fasteners 19 used to connect the front and rear waist regions 6 , 7 with each other . paired barrier cuff 20 is laid on the inner surface of the diaper 1 on both sides of a center line c - c bisecting a width of the diaper 1 , respectively . each of the barrier cuffs 20 comprises inner and outer sheets 21 , 22 provided separately of each other placed upon each other and extending in the longitudinal direction l as seen in fig1 . the inner sheet 21 is of preferably liquid - impervious nature and bonded along front and rear ends 26 , 27 and an outer side edge 28 thereof to the topsheet 2 by means of hot melt adhesive 24 . an inner side edge 29 as well as an intermediate section 31 extending between the inner side edge 29 and the outer side edge 28 is not bonded to the topsheet 2 and an elastic member 32 exclusively for the intermediate section 31 extending in the longitudinal direction l is attached in a stretched state to the intermediate section 31 by means of hot melt adhesive ( not shown ). the outer sheet 22 also is preferably of liquid - impervious nature and bonded along front and rear ends 36 , 37 and an outer side edge 38 thereof to the topsheet 2 and / or the inner sheet 21 overlapping the outer sheet 22 by means of hot melt adhesive 34 . while the inner side edge 39 of the outer sheet 22 is bonded neither to the topsheet 2 nor to the inner sheet 21 , an intermediate section 41 extending between the inner side edge 39 and the outer side edge 38 is bonded to the inner side edge 29 of the inner sheet 21 by means of hot melt adhesive 43 . an elastic member 42 exclusively for the inner side edge 39 is attached in a stretched state to the inner side edge 39 by means of hot melt adhesive ( not shown ). fig3 is a sectional view taken along the line iii - iii in fig1 . for better understanding of the cross - sectional shape in question , the barrier cuff 20 is shown to be slightly raised from the topsheet 2 with the outer sheet 22 being slightly spaced from the inner sheet 21 . the outer side edge 28 of the inner sheet 21 fixed to the topsheet 2 by means of adhesive 24 is placed aside toward the center line c ( see fig1 ) with respect to the outer side edge 38 of the outer sheet 22 fixed to the topsheet 2 by means of adhesive 34 . the inner side edge 29 of the inner sheet 21 is bonded to the intermediate section 41 of the outer sheet 22 and the inner side edge 39 of the outer sheet 22 extends inward beyond the inner side edge 29 of the inner sheet 21 toward the center line c . such barrier cuff 20 forms a space 51 surrounded by the inner sheet 21 , the outer sheet 22 and the topsheet 2 . as shown , the topsheet 2 and the backsheet 3 are bonded to the core 4 by means of hot melt adhesive 52 , 53 , respectively , and portions of these sheets 2 , 3 extending outward beyond peripheral edge of the core 4 are bonded to each other by means of hot melt adhesive 54 . fig4 is a view similar to fig3 , showing a posture taken by one of the barrier cuffs 20 when the disposable diaper 1 of fig1 bows in the longitudinal direction with the topsheet 2 inside . the barrier cuff 20 comes into the state substantially as shown when the diaper 1 is put on the wearer &# 39 ; s body . both the elastic member 42 exclusively for the inner side edge and the elastic member 32 exclusively for the intermediate section contract as the diaper 1 bows . in response to contraction of these elastic members 42 , 32 , the barrier cuff 20 is fully raised up from the topsheet 2 to maximize the space 51 as shown . in this state , the inner sheet 21 and the outer sheet 22 cooperate with each other to form the double wall structure . with the barrier cuff 20 fully raised up in this manner , the outer side edge 28 of the inner sheet 21 cooperates with the outer side edge 38 of the outer sheet 22 to define a bottom side edge , the inner side edge 39 of the outer sheet 22 defines a top side edge , and the inner side edge 29 of the inner sheet 21 defines a joint to the outer sheet 22 . the barrier cuff 20 taking such posture effectively banks up body fluid flowing outward in the transverse direction of the diaper 1 . even if the inner sheet 21 is soiled with body fluid , the outer sheet 22 functions to conceal such soil from being highly visible . in addition , even if body fluid permeate the inner sheet 21 , it is unlikely that such body fluid might leak out from the diaper 1 since such body fluid is reliably held by the outer sheet 22 within the space 51 . with the diaper 1 put on the wearer &# 39 ; s body , the inner sheet 21 and the outer sheet 22 always move integrally with each other and therefore it is unlikely that the space 51 might disappear . consequentially , the outer sheet 22 can reliably conceal soil and , at the same time , prevent leakage of body fluid . the elastic member 42 exclusively for the inner side edge causes the inner side edge 39 of the outer sheet 22 to be shrunk and thereby to be formed with gathers ( not shown ). the elastic member 32 exclusively for the intermediate section causes the intermediate section 31 of the inner sheet 21 to be shrunk and thereby to be formed with gathers ( not shown ). these gathers function to prevent the inner and outer sheets 21 , 22 from coming in close contact with each other when these sheets 21 , 22 move closer to each other . the contamination concealing effect provided by the outer sheet 22 is ensured so far as these two sheets 21 , 22 are kept to be spaced from each other . a height of such barrier cuff 20 can be easily increased by expanding a width dimension of the outer sheet 22 . with the diaper 1 put on the wearer &# 39 ; s body , a dimension m by which the inner sheet 21 and the outer sheet 22 are spaced from each other on the topsheet 2 is preferably in a range of 3 to 30 mm and a dimension n by which the barrier cuff 20 is raised up from the topsheet 2 , i . e ., a height from the topsheet 2 to the inner side edge 39 of the outer sheet 22 in fig4 is preferably in a range of 10 to 100 mm . fig5 and 7 show other embodiment of the present invention , of which fig5 is a view similar to fig1 , fig6 is a sectional view taken along the line vi - vi in fig5 and fig7 is a view similar to fig4 , showing a posture taken by one of the barrier cuffs 20 when the disposable diaper 1 of fig5 bows . as will be apparent from fig5 and 6 , the inner sheet 21 of the barrier cuff 20 has its inner side edge 29 extends toward the center line c beyond the inner side edge 39 of the outer sheet 22 in the rear waist region 7 and the crotch region 8 . it should be noted here that the inner sheet 21 extends obliquely with respect to the center line c as will be apparent from fig5 so that a dimension by which the opposite inner side edges 29 , 29 are spaced from each other may be maximized in a urination zone extending from the crotch region into the front waist region . the inner and outer sheets 21 , 22 are bonded to each other in the respective intermediate sections 31 , 41 by means of hot melt adhesive 57 while a second elastic member 56 exclusively for the inner side edge 29 is attached in a stretched state to the inner side edge 29 of the inner sheet 21 . it should be noted here that the inner sheet 21 according to this embodiment is not provided with the elastic member 32 exclusively for the intermediate section 31 as seen in fig3 . the inner side edge 39 of the outer sheet 22 is provided with the elastic member 42 exclusively for the inner side edge 39 similar to that as seen in fig3 . the first mentioned elastic member 42 exclusively for the inner side edge 39 as well as the second elastic member 56 exclusively for the inner side edge 29 contracts so as to raise up the barrier cuffs 20 as shown in fig6 when the diaper 1 bows . consequently , the respective inner side edges 29 , 39 come in close contact with the wearer &# 39 ; s skin under the effect of these elastic members 42 , 56 . as has previously been described , the dimension by which the inner side edges 29 , 29 of the respective inner sheets 21 , 21 is maximized in the urination zone ( see fig5 ) so that urine discharged from the wearer can be reliably absorbed by the core 4 between the barrier cuffs 20 . in this regard , it is possible without departing from the scope of the present invention to adopt , in the diaper 1 of fig5 , a pair of barrier cuffs arranged in a manner that the inner side edges 29 , 29 extend not obliquely with respect to the center line c but in parallel to each other . the diaper 1 of such construction may be exploited using stock materials as will be described . the liquid - pervious topsheet 2 may be formed from a stock material selected from the group including a nonwoven fabric and a perforated plastic film . the liquid - impervious backsheet 3 may be formed from a stock material selected from the group including a plastic film , a nonwoven fabric and a composite sheet comprising a plastic film and a nonwoven fabric laminated together . the core 4 may be formed from a stock material fluff pulp fibers or a mixture of fluff pulp fibers and super - absorbent polymer particles , in any case , wrapped with a sheet having a high liquid - permeability such as a tissue paper or a nonwoven fabric or a sheet having a high liquid - permeability as well as a high liquid - spreadability . the inner sheet 21 as well as the outer sheet 22 constituting the barrier cuff 20 may be formed from a water - repellent , preferably water - repellent and liquid - impervious sheet in the form of nonwoven fabric or plastic film . in the case of one embodiment wherein sheet material having an air - permeability higher than that of the inner sheet 21 is used as the outer sheet 22 , it is also possible without departing from the scope of the present invention to use the inner and outer sheets 21 , 22 which are different from each other in terms of an air - permeability , a flexibility and the other properties . furthermore , it is possible without departing from the scope of the present invention to weld the sheets together instead of bonding them by means of adhesive or vice versa . it is also possible to exploit the present invention not only in the form of the open - type diaper as illustrated but also in the form of the pants - type or pull - on diaper . the present invention allows it possible to make the disposable diaper wherein a height of the double wall barrier cuffs can be easily increased . the entire discloses of japanese patent application no . 2005 - 322567 filed on nov . 7 , 2005 including specification , drawings and abstract are herein incorporated by reference in its entirety .

US-54884006-A

a spring core includes a plurality of helically wound springs . at least two of the springs include a bulging at least at one of two end regions of each of the at least two springs in a direction of a longitudinal axis of the at least two springs .

fig1 shows a helically wound spring 1 of a spring core , according to an embodiment of the present disclosure . spring 1 is shaped as or includes a bulging 2 , 3 , for example , at its two end regions 11 , while a center part situated in - between bulging 2 , 3 is a throat 4 having a reduced diameter . starting from a relatively smaller diameter of windings of the spring 1 , this relatively smaller diameter increases and then decreases and changes into a region of the throat 4 in order to then expand again and finally decrease . a new shape is thus obtained which is shown in fig2 . with respect to a transverse axis of the spring 1 , springs 1 have a mirror - symmetrical shape . fig2 shows springs 1 which are disposed side - by - side and are enveloped by pockets 5 . these pockets 5 include a textile material and combine a row of individual springs 1 disposed side - by - side to form a strand or a row . pockets 5 are formed in that two fabric strips covering individual springs 1 on both sides between two individual springs are mutually connected by ultrasonic sealing , such as sealing seam 7 shown in fig3 . fig3 also shows an elastic intermediate layer 6 , which may include a foamed material . intermediate layer 6 is arranged between two spring strands , which intermediate layer 6 is glued to two adjacent spring strands and thereby forms a connection element . in their entirety , the intermediate layers 6 result in a completion of the spring core . a mutual spacing of the individual spring strands changes depending on the width of the intermediate layer 6 , which results in a change of the spring characteristic of the spring core . instead of such an intermediate layer 6 , which extends along an entire length of the spring strands , individual spacers can be used to fill spaces formed between two spring strands . the spacers are also connected with adjoining springs 1 or their pockets 5 . such spacers may also be formed of a foamed material , but may include springs 1 , which may be barrel springs . the barrel springs rest laterally against the throats 4 of the adjoining springs 1 . in an embodiment shown in fig4 , the spring 1 has a bulging 2 at only one end region , while the tapered portion , that is , the throat 4 , is continued into the other end region . corresponding to this shaping - out , barrel spring 9 rests against a region of the throat 4 , which barrel spring 9 is constructed as a pocket spring and whose pocket is connected with the pocket of the spring 1 , which connection may be by a gluing - together . in this case , the barrel spring 9 projects over the spring 1 , on a side situated opposite the bulging 2 , so that , for example , a turner mattress is formed whose spring characteristic differs on the two sides . the rows can be connected , for example , by cover layers 10 which include a nonwoven covering and are connected on one side with the bulging - out springs 1 and , on the other side , with the barrel springs 9 . by different spring characteristics of the two usage sides , different lying characteristics are obtained so that individual wishes can be taken into account . fig5 and 6 show a connection region as an individual unit , by which the fabric strips covering the individual springs 1 on both sides are connected with one another between two springs 1 . in this manner , the pockets 5 are formed . as shown in fig5 and 6 , the sealing seams 7 are arranged such that the springs 1 are firmly clamped into the pockets 5 , so that a lateral deflection is virtually excluded . while an intermediate region between the two exterior sealing seams 7 , which each bound a pocket 5 as shown in fig5 , is reinforced by additional sealing seams 7 , in the embodiment shown in fig6 , this intermediate region is free of such additional sealing seams 7 . a combination with other types of springs is also conceivable , depending on which lying characteristics are desired . although the present disclosure has been described and illustrated in detail , it is to be clearly understood that this is done by way of illustration and example only and is not to be taken by way of limitation . the scope of the present disclosure is to be limited only by the terms of the appended claims .

US-59307806-A

this invention is a necklace or bracelet with provisions to prevent the bunching of baubles , bangles and beads which are strung on the necklace or bracelet . bunching is prevented by keepers which are removably attached to bands fixed at intervals on the strands of the necklaces or bracelets . two types of keepers are disclosed , one of which has internal threads which interact with a threaded bands , and one which uses a clamshell structure to secure the keeper on a band . the keepers may have a variety of shapes for decorative effects , such as cylindrical , spherical , cubical , or pyramid - shaped .

in this patent application body adornments such as necklaces , bracelets , anklets , waist chains are termed “ necklaces ”. flexible chains , wire cables , bands , filaments , cords , strings , which are a component of the necklaces are termed “ strands ”. baubles , bangles , pendants , trinkets , and beads which are strung on a strand are termed “ beads ”. [ 0042 ] fig1 shows a necklace 10 of this invention . the ends of the strand 60 may be connected by the interaction of a loop connector 12 with a hook connector 15 . the loop connector 12 is comprised of a cylindrical loop threaded end 13 which is fixed to a first end 62 of the strand 60 . a loop connector loop 14 is connected to the loop threaded end 13 . loop connector threads 11 are cut into the surface of the loop threaded end 13 . the loop connector 12 outer diameter 22 is small enough to allow passage of the threaded connector 30 bore ( not visible in fig1 ) and bead 70 bore ( not visible in fig1 ) over the loop connector 12 , thereby allowing stringing of the threaded keeper 30 and bead 70 over the strand 60 . the hook connector 15 is comprised of a hook threaded end 16 which is fixed to a second end 64 of the strand 60 . a hook connector ring 17 is attached to the hook threaded end 16 . a hook connector hook 18 is connected to the hook connector ring 17 . visible on the hook connector hook 18 is the movable hook connector latch 19 and the hook connector latch handle 20 . any suitable connectors which enable the connection of the first and second ends of the strand may be used provided that at least one connector has a diameter small enough to allow the passage over that connector of beads 70 and threaded keepers 30 . beads 70 having a cylindrical bore ( not visible in fig1 ) are strung on the strand 60 and are free to slide back and forth on the strand . the movement of beads 70 is restrained by a threaded keeper 30 and a hinged keeper 40 . the keepers are removably fixed on bands ( not visible in fig1 ) which are fixedly attached to the strand 60 . the function of the threaded keeper 30 and hinged keeper 40 is to restrain the free movement of the beads 70 on the strand 60 , thereby preventing bunching and keeping the beads in a desirable distribution on the necklace . the threaded keeper 30 has a distinctive ornamental pattern 38 on the outer surface . the hinged keeper 40 has a distinctive ornamental pattern 48 on the outer surface which is easily distinguished from the ornamental pattern 38 of the threaded keeper 30 . the distinct ornamental patterns allow the necklace wearer to easily distinguish between the threaded and hinged keepers when the necklace is being assembled or in use . the beads 70 have a cylindrical bore ( not visible in fig1 ) which is large enough to pass over the loop connector 12 . any desirable number and type of beads may be used . any desirable number of bands can be fixed on the strand and any desired number of threaded keepers and or hinged keepers may be used with the necklace . [ 0047 ] fig2 is a cross sectional view of the threaded keeper 30 taken along line 2 - 2 in fig1 . visible in fig2 is the threaded keeper bore 32 which is of adequate size to pass over a threaded band ( not visible in fig2 ) and over at least one of the connectors , ( 12 and 15 in fig1 ). the interior of the bore 32 is threaded 34 with a thread capable of interaction with and passage over the threaded keeper ( not visible in fig2 ) and the threaded portion of at least one of the connectors by rotation . alternatively , the threaded keeper is mounted on and retained by the threaded band or threaded portion of at least one of the connectors when it is not rotated . the threaded keeper decoration 38 in the example in fig2 is grooves which encompass the circumference of the cylindrical threaded connector 30 . the outer dimension , in this example , the diameter of the threaded keeper 36 , is larger than the bore of the beads ( not shown in fig2 ). fixation of the threaded keeper 30 on a threaded band therefore restricts the movement of the beads on the strand and prevents bunching of the beads on the strand . although the threaded keeper 30 shown in fig1 and 2 is cylindrical , threaded keepers may be spherical , or have the shape of any geometric solid having three dimensions , providing the threaded bore and outer dimension has the characteristics described above . [ 0049 ] fig3 a is a perspective view of the hinged keeper 40 in the open position . the hinged keeper 40 is comprised of a left shell 42 and a right shell 43 which are linked together by a hinge 44 . the left shell 42 is comprised of a front wall 47 having a hemispheric front wall notch 41 , a back wall 52 having a hemispheric back wall notch 51 , a web 49 connecting the front wall 47 and back wall 52 , and a top wall 50 which covers the u - shaped structure formed by the ends of the front wall 47 , web 49 and back wall 52 . the hemispheric front and back wall notches 41 and 51 , respectively , have a diameter slightly larger than one half the diameter of the strand . the right shell 43 is a mirror image of left shell 42 except that the right shell has a friction latch 45 connected to the right shell top wall . the friction latch 45 interacts with the left shell top wall 50 when the hinged keeper 40 is in the closed position and reversibly retains the hinged keeper 40 in the closed position . the hinged keeper decoration element 48 on the outer surface of the hinged keeper is shown in fig3 a . [ 0050 ] fig3 b is a plan view of the hinged keeper 40 in the closed position . visible in fig3 b is the left shell 42 , hinge 44 , right shell 43 , and hinged keeper decoration element 48 . the hinged keeper 40 is retained in the closed position by the friction latch 45 . the user can open the closed hinged keeper by inserting two fingernails into the junction between the left shell and right shell at the friction latch . when the hinged keeper is in the closed position , the left shell hemispheric front wall notch 41 and the right shell hemispheric front wall notch 52 together form a hinged keeper bore 53 having a diameter which is slightly larger than the diameter of the strand but smaller than the diameter of a band ( not shown in fig3 b ). the outer dimension of the hinged keeper , in this example , the diameter of the hinged keeper when closed 46 , is larger than the bore of the beads ( not shown in fig2 ). closure of the hinged keeper 40 on a band , threaded or unthreaded , which is attached to a strand , therefore restricts the movement of beads on the strand and prevents bunching of the beads . although the hinged keeper 40 shown in fig1 a and 3 b is cylindrical , hinged keepers may be spherical , or have the shape of any geometric solid having three dimensions , providing bore and outer dimension have the characteristics described above . [ 0052 ] fig4 is a plan view of the necklace with the keepers and beads in cross section taken along the plane of the necklace . visible in fig4 are the strand 60 , loop connector 12 , and hook connector 15 . a threaded band 71 having threads 72 on the outer surface is shown fixed to the strand 60 . the diameter and thread dimensions of the threaded band 70 are suitable for the threaded fixation of the threaded keeper 30 by its threads 34 . the bore 32 of the threaded keeper 30 is large enough to enable the threaded keeper to be moved over the threaded band 71 by rotation of the threaded keeper 30 . the bore 32 of the threaded keeper 30 is large enough to allow passage of the threaded keeper 30 over an unthreaded band 76 . a hinged keeper 40 is shown in fig4 in the closed position closed over an unthreaded keeper 76 . the bore 53 of the hinged keeper 40 is small enough to prevent movement of the hinged keeper 40 when the hinged keeper 40 is closed over an unthreaded band 76 . also shown in fig4 are beads 70 which are strung on the strand 60 . the bores 78 of the beads 70 are large enough to allow movement of the beads 70 over at least one of the connectors 12 and 15 , over the threaded bands 71 , and over the unthreaded bands 76 . the bores 78 of the beads 70 are not large enough to allow passage over the threaded keepers 30 and hinged keepers 40 when they are attached to the threaded bands 71 and unthreaded bands 76 , respectively . [ 0053 ] fig5 shows the necklace without beads and without keepers . visible in fig5 are the strand 60 , loop connector 12 , and hook connector 15 . a threaded band 71 having threads 72 on the outer surface is shown fixed to the strand 60 . the diameter and thread dimensions of the threaded band 70 are suitable for the threaded fixation of the threaded keeper 30 by its threads 34 . the bore 32 of the threaded keeper is large enough to pass over the threaded keeper if the threaded keeper is manually rotated against the threaded band . a threaded keeper may be moved over a threaded band by rotating the threaded keeper against a threaded band thereby engaging the band and keeper threads and then disengaging the band and keeper threads . an unthreaded band 76 is shown fixed to the strand . the bore 53 of the hinged keeper is smaller than the diameter of the band . a hinged keeper 40 may be removably fixed to either an unthreaded or threaded band . a band , threaded or unthreaded , is fixed to the strand preferably by compression on the strand , by interaction with the links of a chain , or by adhesive , or any other suitable means of fixation of a band on a strand . the diameter the threaded band is larger than the bore of the threaded and hinged keepers , thus preventing the movement of a threaded keeper past a threaded band unless the threaded keeper is rotated into engagement of the band and keeper threads , and preventing the movement of a closed hinged keeper past a threaded band . the diameter of an unthreaded band is large enough to prevent the movement of a closed hinged keeper past an unthreaded band but small enough to allow the movement of a threaded keeper past the unthreaded band . [ 0055 ] fig6 a is a front view of a spherical threaded keeper 100 . the threaded keeper bore 132 is oriented at either end of the front view of the spherical threaded keeper 100 . [ 0056 ] fig6 b is a side view of a spherical threaded keeper 100 . the bore 132 is visible in the side of the spherical threaded keeper 100 . [ 0057 ] fig7 a is a front view of a spherical hinged keeper 200 . the hinged keeper bore 253 is oriented at either end of the front view of the spherical threaded keeper 200 . the intersection 290 between the upper and lower shells is shown in fig7 a . [ 0058 ] fig7 b is a side view of a spherical hinged keeper 200 . the bore 253 is visible between the upper and lower shells and the intersection 290 between the upper and lower shells and the hinge 644 connecting the upper and lower shells are shown in fig7 b . [ 0059 ] fig8 a is a front view of a cubical threaded keeper 300 . the threaded keeper bore 332 is oriented at either end of the front view of the spherical threaded keeper 300 . [ 0060 ] fig8 b is a side view of a cubical threaded keeper 300 . the bore 332 is visible in the side of the cubical threaded keeper 300 . [ 0061 ] fig9 a is a front view of a cubical hinged keeper 400 . the hinged keeper bore 453 is oriented at either end of the front view of the spherical threaded keeper 400 . the intersection 490 between the upper and lower shells is shown in fig9 a . [ 0062 ] fig9 b is a side view of a cubical hinged keeper 400 . the bore 453 is visible between the upper and lower shells and the intersection 490 between the upper and lower shells shells and the hinge 444 connecting the upper and lower shells are shown in fig9 b . [ 0063 ] fig1 a is a front view of a pyramid - shaped threaded keeper 500 . the threaded keeper bore 532 is oriented at either end of the front view of the pyramid - shaped threaded keeper 500 . [ 0064 ] fig1 b is a side view of a pyramid - shaped threaded keeper 500 . the bore 532 is visible in the side of the pyramid - shaped threaded keeper 500 . [ 0065 ] fig1 a is a front view of a pyramid - shaped hinged keeper 600 . the hinged keeper bore 653 is oriented at either end of the front view of the pyramid - shaped threaded keeper 600 . [ 0066 ] fig1 b is a side view of a pyramid - shaped hinged keeper 600 . the bore 653 is visible between the upper and lower shells and the intersection 690 between the upper and lower shells and the hinge 644 connecting the upper and lower shells are shown in fig7 b . in use , the wearer strings beads and one or more threaded keepers on a strand having one or more threaded bands . the order of the beads and keepers is chosen in order to provide the desired distribution of beads on the necklace . the use of a hinged keeper provides additional flexibility for the wearer , as the hinged connector can be attached after the beads and the threaded keeper have been strung . the arrangement of beads and keepers may be altered by simply restringing the components on the strand . any suitable strong , flexible material may be used for the strand , or rigid material may be used in the form of a chain . a preferred material of construction is silver . other suitable materials include bronze , steel , copper , plastic , and silk . any suitable strong , hard material may be used for construction of the bands . a preferred material of construction is silver . other suitable materials include stainless steel , copper , and plastic . any suitable strong , hard material may be used for the keepers . a preferred material of construction is silver . other suitable materials include bronze , steel , copper , and plastic . it will be apparent to those skilled in the art that the examples and embodiments described herein are by way of illustration and not of limitation , and that other examples may be used without departing from the spirit and scope of the present invention , as set forth in the appended claims .

US-62364103-A

this invention is a huggable picture frame in the form of a person or doll , with an audio playback and recording unit . the shape of the invention is preferably a human shape in a soft sculpture , with a frame capable of holding a photograph . the audio playback and recording unit is activated by at least one remote button . the audio playback and recording unit contains a microphone or other audio input device and a speaker or other audio output device . the audio playback and recording unit and power supply are enclosed within the soft sculpture with sufficient cushioning that the presence of such relatively hard objects is not easily felt while the soft sculpture is hugged or squeezed . the overall impression of the picture frame is a huggable doll , which with a selected photograph , presents a reminder of a particular person to the user of the picture frame .

the invention preferably consists of a human shaped doll 10 , with an audio recording and playback device 40 , audio input means 42 , audio output means 41 , power supply 43 , activation buttons 30 and 31 , wiring 50 and 51 , and a picture frame 20 on the face of the human shaped doll 10 . the overall shape of the invention is preferably similar in construction to the design shown in commonly owned u . s . design pat . no . des . 429 , 780 , which is incorporated herein by reference , but may be of any configuration , including animal or abstract shapes . the main body of the invention is soft and filled with a stuffing well known in the art of soft sculpture and stuffed toys . the audio recording and playback device 40 includes audio input and output means and recording media for storing recorded audio , as are well known in the art . the audio input means 42 may be a separate microphone and the audio output means 41 may be a separate speaker , or the two may be combined into a single input and output device . the recording media may be any read - write capable media including but not limited to flash memory , optical or magnetic media . in the preferred embodiment , the recording media is fixed within the audio recording and playback device 40 , but it may be removable and replaceable . preferably , the audio recording and playback device will retain a recording between 5 and 30 seconds . the audio recording and playback device 40 preferably includes a locking button or switch 45 to alternatively enable and disable the recording function , to preserve the recorded audio for a desired period of time , or otherwise prevent inadvertent recording over a desired message . locking button or switch 45 , electrically connected to the audio recording and playback device 40 , is shown in the drawings as integral to audio recording and playback device 40 , but may also be located along the arm of the human shaped doll 10 or in the head of the human shaped doll 10 . the audio recording and playback device 40 is contained in a single unit with a power supply 43 and is preferably located in the head portion of the human shaped doll 10 , but can also be located in the torso section . in one embodiment , the audio recording and playback device 40 is contained in a concealed pocket 23 on the back of the head of the invention . the concealed pocket 23 is secured by a velcro strip , preferably dyed to match the color of the head of human shaped doll 10 . by putting the audio recording and playback device 40 in a separate pocket 23 on the back of the head of human shaped doll 10 , upon playing recorded audio , the invention provides the appearance of speaking out of the mouth of the human shaped doll 10 . the power supply 43 for the audio recording and playback device 40 is powered by conventional 1 . 5 volt watch / photo batteries or other power sources known in the art . fig2 and 3 show the use of a aa - sized battery for ease of understanding the invention . the pocket 23 in the head allows for easy access to change the batteries . the batteries may be included with the invention along with a protective plastic strip inserted during production to prevent battery leakage or power loss / drainage of the batteries . the clear plastic strip is easily accessible on the power supply 43 , as is known in the art , and is preferably easily removable . this strip inside the power supply 43 is usually placed between any two of the batteries or between a battery and terminal connection , thereby interrupting the current flow and preventing operation of the audio recording and playback device 40 . removal of the strip completes the power circuit , and activates the audio recording and playback device 40 for operation . the playback and recording functions of the audio recording and playback device 40 are be activated by at least one button or switch . in one embodiment , there are two buttons or switches , a first button or switch 30 for initiating recording of audio and a second button or switch 31 for initiating playback of audio . the two buttons or switches are usually not located adjacent to each other , to prevent inadvertent activation . in one embodiment , the first button or switch 30 is located at the end of one arm of the human shaped doll 10 and the second button or switch 31 is located at the end of the other arm of the human shaped doll 10 , each at or near the “ hand ” of the appropriate arm . the exterior design of the invention preferably includes a symbol of a mouth embroidered on the one hand of the human shaped doll 10 , referred to throughout as the left hand . the first button or switch 30 is located inside the left hand , under the mouth symbol . a set of wires 50 extends down the left arm of the human shaped doll 10 to electrically connect the first button or switch 30 with the audio recording and playback device 40 . by pressing on the mouth icon on the left hand , the user will depress the first button or switch 30 located therein . pressure on the first button or switch 30 will initiate the recording function of the audio recording and playback device 40 . in one embodiment , continued pressure on the first button or switch 30 will enable the recording function , so that slight contact with the first button or switch 30 would not accidentally overwrite a recording . releasing the first button or switch 30 would stop the recording function . the user would speak in the direction of the audio input means 42 within human shaped doll 10 . the exterior design of invention also preferably includes a symbol of an ear embroidered on the right hand of the human shaped doll 10 , referred to throughout as the right hand . the second button or switch 31 is located inside the right hand , under the ear symbol . a second set of wires 51 extends down the right arm of the human shaped doll 10 to electrically connect the second button or switch 31 with the audio recording and playback device 40 . by pressing on the ear icon on the right hand , the user will depress the second button or switch 31 located therein . pressure on the second button or switch 31 will initiate the playback function of the audio recording and playback device 40 . unlike the first button 30 , the second button or switch 31 could activate with a single touch and preferably would not require continued or extended pressure . alternative buttons or activation switches may be utilized as is known in the art for the operation of electronic devices , including remote activation mechanisms such as infrared and radio transmitters . the wires 50 and 51 and buttons or switches 30 and 31 are hidden from the user &# 39 ; s view , being contained within the arms of the human shaped doll 10 . use of soft stuffing and soft exterior materials are preferably incorporated within the human shaped doll 10 to prevent or limit the user &# 39 ; s awareness of the wires and buttons or switches . the embodiments noted above may also be reversed , namely that the right hand may be used for recording and the left hand used for playback . alternatively , the buttons or activation switches may be located in the legs and feet , or any other location on the invention . the invention is manufactured to be safe for all ages . the pocket containing the audio recording and playback device is secured with a fastener such as velcro ®, such that more than minor force would be required to open the pocket . the wires are preferably heavily coated to prevent inadvertent electrical discharge . the recording function preferably includes a high - quality microphone 42 so that audio may be recorded directly or over a telephone . the ability to record audio from over a telephone enables the invention to be utilized for recording messages from individuals remote from the invention . the invention is capable of holding a picture in a clear pocket or picture frame 20 that is attached on the head of the human shaped doll 10 , preferably in the location where a face might be found on a person . the picture frame 20 for the face is sewn and then sewn onto the head of the human shaped doll 10 . a clear cover 21 is located within picture frame 20 , forming a pocket through which an inserted photograph or other item may be seen . in one embodiment , the head of the human shaped doll 10 has an embroidered face so even when a real picture is not inserted , the invention provides a human - like appearance . additional pockets may be provided on any part of the invention , such as on the torso of the human shaped doll 10 for displaying additional pictures or storing items . in a preferred embodiment , the invention presents a photograph or image of an individual , with the individual &# 39 ; s voice recorded on the audio recording and playback device 40 . activation of the playback function results in the individual &# 39 ; s voice to appear to come out of the head or mouth of the human shaped doll 10 , giving the illusion that the individual is physically present . such “ virtual ” presence would be of some comfort or reassurance to a user of the invention . the size of the overall invention may range from as small as 4 ″ to any larger size . one embodiment measures between 11 ″ to 17 ″ from top to bottom . the picture can be of one person , many persons or the user can put just the face of a single person to make the human shaped doll 10 look like the person . the invention was created to be a huggable frame not to actually look like the person but can be used for any photograph , image or drawing . the invention is able to record any message a user would want and to be allow a user to record over the message as often as desired . one embodiment of invention would hold any picture a user would want , for example , sized to 2 ″× 3 ″. the invention is designed to be used by speakers of any language , not just english speakers . the body of the invention is a soft plush doll , capable of being hugged or held by children or adults . a similar shaped huggable picture frame , embodying the design of the above referenced u . s . design patent has been used by individuals of all ages and all genders in a variety of settings including hospitals , military families and others . by designing the invention in a human form , a user can easily hug it with great comfort and can clearly hear their loved one speaking through the audio recording and playback device 40 . by placing the speaker / recorder in an accessible pocket on the back of the head , the body of the invention remains soft and huggable , an improvement over prior art soft recordable dolls , which prior art devices placed the recording capabilities in the body of the doll . the body of the invention is preferably covered with a hypoallergenic , stain resistant and spot cleanable fabric . such fabric would make the invention safe for children with asthma , cancer or any other illness . being well cushioned , the invention travels easily as it can be rolled it up or squeezed without breaking . while certain novel features of the present invention have been shown and described , it will be understood that various omissions , substitutions and changes in the forms and details of the device illustrated and in its operation can be made by those skilled in the art without departing from the spirit of the invention .

US-201213562286-A

a system for dispersing a scent and marking a trail useful in hunting and other outdoor endeavors is provided , the system providing for easily positioning a self - fastening scent dispenser and marker to a preselected structure as well as the person and apparel of a user . the apparatus includes a camouflage cover so that the apparatus can easily be concealed when in use . a reflector can also be included , however , so that the apparatus can be located in the dark using a generated light beam , while also protecting the user by identifying the user to other hunters in the area . methods are also provided to permit a hunter or hiker to readily attach the self - fastening scent dispenser and trail marker as the user moves along a trail during a hunt , hike , or other outdoor excursion .

the present invention will now be described more fully hereinafter with reference to the accompanying drawings which illustrate preferred embodiments of the invention . the invention , however , may be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete and fully convey the scope of the invention to those skilled in the art . like numbers refer to like elements throughout . the prime notation , if used , indicates similar elements in alternative embodiments . fig1 - 12 illustrate an apparatus 30 for use by a hunter 32 to readily attach to and detach from a selected environmental structure a scent dispenser 34 that can also be used to mark the hunter &# 39 ; s trail as well as indicate the hunter &# 39 ; s presence to other hunters in the vicinity . as shown in fig1 the apparatus 30 can be used to readily attach a scent dispenser 34 to the limb of a tree or bush . alternatively , as illustrated in fig2 the apparatus 30 can be readily attached to the hunter &# 39 ; s person , such as also permits the hunter 32 to readily attach the scent dispenser 34 to the hunter &# 39 ; s own person such as around the hunter &# 39 ; s wrist , as well as , for example , around the hunter &# 39 ; s ankle or arm . just as readily , the apparatus 30 can be attached to the hunter &# 39 ; s equipment or apparel , such as , for example , the hunter &# 39 ; s cap or the laces of the hunter &# 39 ; s boot . ( see fig3 and 4 ). as will be well appreciated by those skilled in the art , the scent dispenser 34 can be formed efficiently using an absorbent material such as a fibrous strip or a portion of a sponge that will readily absorb a scented substance . alternatively , as also will be readily understood by those skilled in the art , the scent dispenser 34 instead can be formed from a rigid , scented substance such as wax or plastic . as explained below , the apparatus 30 according to the present , invention can accommodate any of the varied types of scent dispensers commonly employed by hunters . the scent itself can be any type of agent for attracting a hunted animal , such as a deer lure , or alternatively , a scent blocker meant to mask the scent of the hunter 32 and the hunter &# 39 ; s apparel and equipment . as perhaps best illustrated in fig5 the apparatus 30 is readily attached to a pre - selected object by striking the pre - selected object with a scent dispenser attachment 36 to which the scent dispenser 34 is connected . thus , the scent dispenser attachment 36 is adapted to receive and hold thereto the scent dispenser 34 and to self - fasten onto a pre - selected object against which the scent dispenser attachment 36 is struck using a moderate amount of force . preferably , the scent dispenser attachment 36 is a generally rectangular strip biased to take on and remain in a coiled alignment unless stretched out into a substantially elongate shape . more specifically , as illustrated in fig6 a - 6c , the scent dispenser attachment 36 comprises a substantially elongate body 38 , preferably formed of a semi - rigid material . the substantially elongate body 38 of the scent dispenser attachment 36 has a substantially convex first surface 40 , the direction of curvature of the convex surface being substantially perpendicular to the direction of elongation of the substantially elongate body 38 , and a substantially concave second surface 42 , the second surface 42 being opposite the first surface 40 and the direction of curvature of the concave surface , again , being substantially perpendicular to the direction of elongation of the substantially elongate body 38 . because the substantially elongate body 38 is intentionally formed with a bias toward a coiled alignment , the body 38 naturally possesses potential energy when stretched to its fully elongated shape . the convex first surface 40 and the concave second surface 42 , however , impart a curvature along and , preferably , substantially centered around the longitudinal axis of the body 38 . thus formed , the scent dispenser attachment 36 , despite its bias toward a coiled alignment can be stretched into a substantially elongate alignment with the convex and concave surfaces of the elongate body 38 supplying resistance to the body &# 39 ; s natural tendency to coil . that is , despite the body &# 39 ; s potential energy when stretched longitudinally , the curvature supplied by the shape of the convex surface 40 and the concave surface 42 allow the body 38 to remain in equilibrium . ( see fig6 a ). when struck against a pre - selected object , however , the body &# 39 ; s tendency to coil is not impeded , as the force of the blow tends to flatten out the convex and concave surfaces 40 , 42 . ( see fig6 b ). to attach the apparatus 30 , therefore , the user need only strike the scent dispenser attachment 36 against the pre - selected object with enough force to overcome the obstacle posed by the curvature around the longitudinal axis formed as a result of the convexity of the first surface 40 and concavity of the second surface 42 . as the respective surfaces flatten out , the released potential energy is made available to drive the body 38 into a more stable equilibrium : a coiled alignment . ( see fig6 c ). thus , when struck against the pre - selected object , the scent dispenser attachment 36 self - fastens by coiling substantially around the object against which it has struck . ( see fig6 b - 6 c ). alternatively , the attachment can have an elongated body having a hollow portion that admits air and expels air by means , for example , of a squeeze bulb attached at an end of the elongated body . air can be squeezed into the hollow portion so as to extend the otherwise coiled body . in the extended position , the device can be positioned adjacent a tree limb or similar object . then , when the air is expelled ( e . g ., by release of pressure on the squeeze bulb described above ), the body fastens to the limb or other object by returning to a coiled position . the self - fastening capability of the scent dispenser attachment 36 provides the apparatus 30 considerable advantages . among these are the ability of the user to be able to single handedly attach the scent dispenser 34 to a pre - selected object by simply tapping the scent dispenser 36 attachment against the pre - selected object with a modest amount of force . during a typical hunting excursion , the hunter 32 can move through a wooded area and , at selected points , stop and draw from his or her jacket a scent dispenser 34 connected to the scent dispenser attachment 36 . ( fig7 ). quietly , the hunter 32 can gently strike a tree limb or branch and thereby easily and quickly attach thereto the scent dispenser 34 , the scent dispenser 34 having a deer lure or other animal - attracting agent . thus , the hunter 32 can lay out a scent line leading directly to the hunter &# 39 ; s stand . when the hunter 32 reaches his or her stand , another scent dispenser 34 can be attached using the scent dispenser attachment 36 to a rung on the ladder leading to the stand perched off the ground . the same apparatus 30 can just as readily be used with a scent blocker already described , in which case the scent dispenser 34 can be attached using the scent dispenser attachment 36 by threading it under the laces of the hunter &# 39 ; s boot , tapping it against the hunter &# 39 ; s ankle or wrist , or even wrapping it over the adjustment band of the hunter &# 39 ; s cap . ( fig1 - 4 ). the body of the scent dispenser attachment 36 can be formed of any semi - rigid material such as a plastic or lightweight metal . preferably , is formed of a lightweight metal such as carbonized steel . the body of the attachment 36 , moreover , can serve dual functions , that of attaching to an object and also holding a scent , for example , by dousing a portion of the body in a scented substance such as a liquid scent . alternatively , the scent dispenser 34 can be connected directly to the body , for example , by applying a strip having a first portion that is made of an absorbent material on which a scent is disposed and a second portion having an adhesive layer that adheres directly to the body formed of a lightweight metal or plastic . preferably , however , the apparatus 30 further includes a cover 44 that at least partially extends over the body of the scent dispenser attachment 36 . more preferably , the cover 44 is formed of a material having a predetermined surface pattern . for example , the pattern can be a blend of colors that , depending on the season during which and the environment in which the apparatus 30 is to be used , will mimic the colors of the environment in which the hunter 32 is employing the apparatus 30 . this permits the apparatus 30 to be easily camouflaged so as not to cause the hunter 32 to standout if he is wearing or carrying the apparatus 30 . at the same time , the camouflage pattern masks the device so as not to ward off a hunter &# 39 ; s prey if the apparatus 30 is positioned on a tree limb , ladder rung , or other object . a typical outdoor or hunting environment , for example , is a wooded or heavily foliaged area . an appropriate pattern for the cover 44 in order to effectively camouflage the apparatus 30 , then , would be a mix of hues of green and brown that correspond to the colors of the foliage . more specifically , theories of the psychology and physics of the human visual system ( hvs ) explain that the human eye can perceive three attributes of color : brightness , hue , and saturation . these three attributes correspond , respectively , to the luminance ( or intensity ) of the color , the predominant wavelength of reflected electromagnetic radiation associated with the color , and the purity of the color . thus , in order to camouflage the apparatus 30 , the cover 44 , preferably , has a pre - selected patter comprising at least some green and some brown . in terms of the hvs , then , the color attributes of a first portion of the preselected pattern of the cover 44 include a hue of that portion of the visible spectrum of electromagnetic radiation of between about four hundred eighty five nanometers ( 490 nm ) and about five hundred seventy five nanometers ( 570 nm ). this provides green coloring to the cover 44 , but it is also preferable to have mixed therewith some brown as well . accordingly , the color attributes of a second portion of the preselected pattern of the cover 44 include a low to moderate saturation and a hue of that portion of the visible spectrum of electromagnetic radiation of between about five hundred seventy nanometers ( 570 nm ) and seven hundred fifty nanometers ( 750 nm ). other color patterns , of course , could also be employed for different environments . for example , in a desert environment , the mix of colors of the cover 44 can be more predominantly brown or a mixed pattern , portions of which having color attributes of low to moderate saturation and a hue from that portion of the visible spectrum of electromagnetic radiation of a between about five hundred seventy nanometers ( 570 nm ) and seven hundred fifty nanometers ( 750 nm ) along with some beige or tan hues . so too , for hunting in a winter environment , the pattern of the color would be exclusively or predominately white ; that is , of a chromatic color of a surface reflecting electromagnetic radiation of each wavelength in the visible spectrum . in conjunction with the camouflage pattern , the cover 44 preferably also includes as well at least one limited - size marker or indicator such as a highly visible orange spot 43 . ( see fig8 ). this mark or indicator can serve two important purposes . first , it can alert another hunter 32 in the area to the presence of the hunter 32 using the apparatus 30 . likewise , it can mark - off for the hunter 32 , the perimeter of his or her field of fire . relatedly , the pattern can be one chosen so as to convey other information , such as range , so that the hunter 32 can gauge the range of fire from his or her stand to a selected position within the field of fire . thus , the cover 44 , depending on the selected pattern of the material used in forming it , can perform a variety of functions for the hunter 32 . in the same vein , the cover 44 also can include a light reflective portion 45 so that the apparatus 30 can be located in the dark using light generated , for example , by a flashlight . ( see fig9 ). in a first embodiment of the apparatus 30 , the scent dispenser 34 connects directly to the cover 44 . preferably , scent dispenser 34 is an absorbent portion fixedly connected to or integrally formed as part of the cover 44 and to which a liquid scent can be applied . ( see fig1 - 6 a ). alternatively , however , a scent dispenser can be removably connected to the attachment 36 . for example , the cover 44 can include a connective surface portion . the scent dispenser , then , can be formed of a material that readily intertwines with the connective surface portion . an example of this would be if the materials were of a hook - and - loop type such as sold under the velcro name and well - understood by those skilled in the art . in a second embodiment of the apparatus 130 as shown in fig1 , the cover 144 includes a pouch 148 within which may be held , for example , a scented wax or other solid or semi - solid scent dispenser 134 having a scent that is released into the surroundings as the scent dispenser is held within the pouch 148 . the pouch 148 can be integrally formed with the remainder of the cover 144 that substantially surrounds the body 138 of the scent dispenser attachment , or alternatively , it can detachably be connected by strips of the complementary materials ( e . g ., hook - and - loop fastening materials ) already described . in yet a third embodiment of the apparatus 230 as shown in fig1 , the cover could include a series of small pockets or loops 248 for retaining several capsules or other scent dispensers 234 in the fashion of a bandolier . in still a fourth embodiment of the apparatus 330 as shown in fig1 , the scent dispenser 334 can be integrally formed with the cover 344 substantially covering the body of the scent dispenser attachment 336 . in this embodiment , the scent dispenser comprises an absorbent material that adheres ( e . g ., using hook - and - loop fastening ) to a portion formed as part of the cover ( e . g ., also being a type of hook - and - loop material ) as well as being adapted to absorb a preselected scented substance . the cover 44 preferably also includes a signal responsive portion 45 . the hunter 32 or another person in the vicinity can thus detect the location of the apparatus 30 by sending out a signal , such as a beam of light generated by a flashlight , to which the apparatus responds ( e . g ., by reflecting the light ) so that the locations of the apparatus 30 and the hunter 32 , if the hunter is near the apparatus 30 , are made known . the signal responsive portion 45 can be a reflector and , preferably , is a reflective strip positioned along a border of the body of the attachment 36 . ( see fig9 ). the reflector or reflective strip 36 is responsive to a beam of light such as that generated by a flashlight . this permits the hunter to locate the apparatus in the dark using the beam of a flashlight . likewise , another hunter in the area can be warned of the hunter &# 39 ; s presence in the vicinity if the apparatus 30 is attached to the person or an article of apparel of the hunter . similarly , given the increasing use of dirt bikes by hunters , the apparatus 30 also could be attached to a part of a bike at night so that a hunter riding the bike could be seen in the headlights of a driver driving a vehicle in the vicinity of the hunter . so too , the same use could be made of the apparatus 30 by a jogger or bicyclist traveling along a road at night . the present invention further provides a system for dispensing a scent , providing a scent blocker , and marking a trail . the system , according to the present invention , permits a hunter to carry a plurality of scent dispensers 34 as he or she moves through an environment during a hunting excursion . as noted above , the hunter is able to draw one of the plurality of scent dispensers and , at a series of selected points along a trail , readily attach the scent dispenser to a pre - selected object ( e . g . tree limb , ladder rung , fence ) so as to provide a prolonged source of scent conveyance with the scent dispenser 34 attached via the scent dispenser attachment 36 to the pre - selected object . ( see fig7 ). at the same time , the covers 44 substantially covering the bodies of the distributed scent attachments to which each of the scent dispensers is attached can serve various other functions , including marking the hunter &# 39 ; s trail , marking the perimeter of the field of fire , and providing fire range gauges , as also noted above . furthermore , according to the system provided by the present invention , the hunter 32 is later able to move back along the trail finding his or her way by reference to the markings on the cover substantially covering the scent dispensing attachment . by looking for the bright mark 43 ( e . g ., orange spot ) in daylight or the seeing the light reflected by the light reflector 45 in the dark , the hunter is able not only to find his or her original trail but also to located and retrieve each of the combination scent dispenser - markers so that the scent dispenser can be replenished and the system re - used during the hunter &# 39 ; s next hunting excursion . fig1 through 10 also illustrate the various method aspects of the present invention . the present invention provides a method for use by a hunter in dispensing a scent . specifically , the method includes providing at least one scent dispenser 34 along with at least one scent dispenser attachment 36 . according to the method of the present invention , the scent dispenser attachment is especially adapted to receive and hold a scent dispenser 34 . moreover , the at least one scent dispenser attachment 36 is capable of self - fastening to a pre - selected structure and a person and apparel of the person whenever a method user strikes the at least one scent dispenser attachment against an object . the method , moreover , includes camouflaging the at least one scent dispenser 34 and scent dispenser attachment 36 by at least partially covering each with a patterned material wherein the pattern substantially resembles the environment in which the scent dispenser and scent attachment are deployed to thereby substantially camouflage both . in addition , the method also includes positioning a reflector 45 responsive to light on the scent dispenser attachment 36 to thereby permit the scent dispenser 34 and scent dispenser attachment 36 to be located in the dark with a generated beam of light . the present invention further provides a method for marking a trail . the method specifically includes providing a plurality of self - fastening markers 30 each of which contains a highly visible marking 43 that can permit the method user to readily locate by sight each of the plurality of markers 30 . in the drawings and specification , there have been disclosed a typical preferred embodiment of the invention , and although specific terms are employed , the terms are used in a descriptive sense only and not for purposes of limitation . the invention has been described in considerable detail with specific reference to these illustrated embodiments . it will be apparent , however , that various modifications and changes can be made within the spirit and scope of the invention as described in the foregoing specification and as defined in the appended claims .

US-93337001-A

a portable folding support structure for safely tethering an individual comprises a portable cart sized to fit through a residential doorway , having wheels and a motor that actuates at least one of the wheels . a hand - operated throttle and steering device control the cart . the cart comprises an extendable anchoring plate to prevent rolling . a substantially horizontal jib with the cart comprises a harness point for receiving a safety cable to which an individual is attached to allow safe cleaning practices and to minimize fall risk . a foldable outrigger provides stability to the cart and an anchoring pad attaches to a distal region of the outrigger to promote stability . a textile liquid - absorbing surface is positionable about an outer surface of a glass balcony to inhibit cleaning liquids from spilling below the level of the liquid - absorbing surface .

in the summary of the invention above and in the detailed description of the invention and in the accompanying drawings , reference is made to particular features ( including method steps ) of the invention . it is to be understood that the disclosure of the invention in this specification includes all possible combinations of such particular features . for example , where a particular feature is disclosed in the context of a particular aspect or embodiment of the invention , that feature can also be used , to the extent possible , in combination with and / or in the context of other particular aspects and embodiments of the invention , and in the invention generally . the term “ comprises ” is used herein to mean that other ingredients , elements , steps , etc . are optionally present . when reference is made herein to a method comprising two or more defined steps , the steps can be carried in any order or simultaneously ( except where the context excludes that possibility ), and the method can include one or more steps which are carried out before any of the defined steps , between two of the defined steps , or after all of the defined steps ( except where the context excludes that possibility ). in this section , the present invention will be described more fully with reference to the accompanying drawings , in which preferred embodiments of the invention are shown . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein . rather , these embodiments are provided so that this disclosure will be thorough and complete , and will convey the scope of the invention to those skilled in the art . referring initially to fig1 , a portable folding support structure provides the requisite ballast and support to safely tether a worker so that he may safely lean over a balcony to clean glass or perform maintenance . a preferred embodiment of the support structure is a cart 10 . the cart 10 has a base 12 that provides a platform to which wheels 14 are mounted . the base 12 is preferably rectangular or square , but can be any contemplated shape . the base 12 is a size that allows the cart 10 to fit through a residential doorway . the base 12 is preferably made of metal , such as steel for example , due to strength , the ability to weld other structures of the cart 10 to the base 12 , and for added weight that provides the additional ballast for the support structure to optimally function . other materials , such as wood , plastics , composites , and other engineered materials are also contemplated . a drive wheel 16 is attached to propulsion means 18 . the propulsion means 18 is preferably an electric motor , but an internal combustion engine is also contemplated . the electric motor is preferably powered by on - board batteries , but an external ac electricity source is also contemplated . in one especially preferred embodiment , external ac electricity is used to charge and recharge batteries that power the electric motor , yet the ac source also provides power to the motor when the cart 10 is plugged in to the ac source . as depicted in fig1 and 2 , a control panel 20 provides an interface between a user and the cart 10 . controls 22 on the control panel 20 are used by the user to control the motion of the cart 10 . in one embodiment , handlebars 24 are used to steer the cart 10 , and also act as a turn throttle to control the speed of the motor . the controls 22 and handlebars 24 are preferably operated by a user &# 39 ; s hands , and are thus situated at approximately hand level for a user of average height . turning again to fig1 , the cart 10 also has an anchoring plate 26 that is deployed below the cart . the anchoring plate 26 is an extendable brace that is lowered onto the floor below the cart 10 to lift the cart 10 sufficiently to prevent the cart 10 from rolling for the purpose of stabilization . the anchoring plate 26 remains in an unextended configuration when not in use . when a user desires to stabilize the cart 10 , the user extends the anchoring plate 26 away from the cart 10 to contact the ground , and this is done through a mechanical linkage . in a preferred embodiment , the mechanical linkage is an automatic screw jack , scissor jack , or hydraulic jack positioned between the anchoring plate 26 and the base 12 . the control panel 20 also has appropriate controls 22 to raise and lower the anchoring plate 26 . for example , a screw jack has a motor that actuates a threaded rod integral to such a jack , and the motor is activated by related controls 22 . similarly , for example , a hydraulic pump is activated by the controls 22 to extend or retract a hydraulic jack connected to the anchoring plate 26 . fig4 illustrates a motion path ( mp ) the anchoring plate 26 travels to go from the extended to contracted position . with continuing reference to fig1 and 2 , a jib 28 extends from the cart 10 . the jib 28 is a rigid member that is secured in a desired position with a mechanical securing device . in a preferred embodiment , holes 30 defined by the jib 28 receive a clevis pin 32 to secure the jib 28 in a configuration desired by the user . this provides the user with the ability to extend the jib 28 to protrude from the cart 10 a desired length . in one embodiment , the jib 28 is attached to a mast 34 , and preferably at a joint that pivots , yet can be secured to prevent pivoting should a user desire . the jib 28 has a harness point 36 on its end for receiving a safety cable . fig1 and 2 illustrate outriggers 38 that pivotingly extend away from the cart 10 to engage a surface upon which the cart 10 is situated . the outriggers 38 create a wide footprint and a more stable support structure for safely tethering a user . between one and six outriggers 38 are used to provide stability with the preferred number of outriggers 38 being four . fig3 illustrates the outriggers 38 in a folded configuration . this is the configuration the cart 10 would take to navigate through doorways . fig4 indicates the path ( p ) that the outriggers 38 take to go from the folded position to the extended position . once in the extended position , the outrigger 38 is lockable in that position . in a preferred embodiment , the outrigger is locked with cotter pins 40 that engage both the outrigger 38 and a securing point 42 ( fig3 ) with the cart 10 , however any conventional locking mechanism is contemplated . fig1 - 4 illustrate anchoring pads 44 that attach to the outriggers 38 . the anchoring pads 44 are removably attached a distal region 46 of the outriggers when in the extended position . the anchoring pads 44 provide a relatively large footprint for the cart 10 that results in greater stability . the anchoring pads 44 also provide additional ballast . the anchoring pads are made of a relatively heavy material such as metal , concrete , and combinations thereof . in fig3 , the anchoring pads 44 are placed upon the base 12 when not in use and the outriggers 38 are in the folded position . returning again to fig1 , the cart 10 also has , in one embodiment , a liquid - absorbing surface 48 for the purpose of catching drips and leftover cleaning fluids is provided . the liquid - absorbing surface 48 is made from acrylics , bamboo , cellulose materials , cotton , high density polyethylene , low density polyethylene , polyester , polyolefins , polyurethanes , polyurethane - polyurea copolymers , rayons , superabsorbent polymers , wools , and blends of these materials . for example , the liquid - absorbing surface 48 can be a textile surface such as industrial felt , and may be placed proximate an exterior side of a glass balcony during the cleaning process . as a user cleans the glass , excess water and cleaning solution runoff is caught by the liquid - absorbing surface 48 and therefore prevented from reaching surfaces on the units that are below the glass being cleaned . in one embodiment , extension arms 50 are configured to secure the liquid - absorbing surface 48 . in particular , each extension arm has an ascending portion 52 that attaches to an outrigger 38 and a descending portion 54 that attaches to the liquid - absorbing surface 48 . the extension arm 50 is configured in approximately an upsidedown “ u ” shape so that the arm 50 can extend up and over a glass balcony while the descending portion 54 projects downward so that the liquid - absorbing surface 48 is placed below or near the bottom region of glass balcony surface being cleaned , the liquid - absorbing surface 48 being supported between two extension arms 50 , and defining an outwardly projecting substantially horizontal surface . in a related embodiment , the liquid - absorbing surface 48 is able to be mechanically raised and lowered about a balcony surface . the extension arms 50 ascending portions 52 are attached to extendable projections 56 . the extendable projections 56 raise the extensions arms 50 so that the extension arms 50 clear the top edge of a glass balcony top , and then lower the extension arms over the glass balcony top . the extendable projections 56 are , for example without limitation , linear actuators , screw - type jacks , and hydraulic rams . the raising and lowering of the extension arms 50 is controlled by the controls 22 of the control panel 20 . the controls 22 communicate with the extension arms 50 using connections 58 secured to the outriggers 38 . the invention also contemplates a method of maintaining an exterior building surface . fig5 illustrates a person using the cart 10 as a secure point of tethering . the method includes positioning the cart 10 proximate and exterior surface in need of maintenance . in the illustration , the person is maintaining the structure by washing balcony glass . the cart 10 has a sufficient mass to act as a counterweight so that the person tethered to the cart 10 will be prevented from falling over the balcony . the outriggers 38 are unfolded to stabilize the cart . a line ( l ) is attached to a harness point 36 on the jib 28 , and the person in need of an anchor attaches the line ( l ) to himself . a liquid - absorbing surface 48 may optionally be deployed , as described herein . many modifications and other embodiments of the invention will come to the mind of one skilled in the art having the benefit of the teachings presented in the foregoing descriptions and the associated drawings . therefore , it is understood that the invention is not to be limited to the specific embodiments disclosed , and that modifications and embodiments are intended to be included within the scope of the appended claims .

US-201213617937-A

a breast - bounce inhibitor has a bounce - prevention strap articulated for suspension laterally over tops of a woman &# 39 ; s breasts . it has bounce - resistant resilience in directions of back - strap attachments . the bounce - resistant resilience can be adjustable and the bounce - prevention strap can be joinable intermediate the breasts . a back strap can include a conventional bra back strap . the bounce - prevention strap can be integrated into a bra .

listed numerically below with reference to the drawings are terms used to describe features of this invention . these terms and numbers assigned to them designate the same features throughout this description . 1 . bounce - prevention strap 9 . zippered - length adjusters 2 . breasts 10 . fastener 3 . first back - strap attachment 11 . fastened - length adjusters 4 . second back - strap attachment 12 . fastener materials 5 . back strap 13 . material - end adjusters 6 . buckle 14 . bra back strap 7 . buckled - length adjusters 15 . bra 8 . zipper 16 . bra material referring to fig1 - 3 , a breast - bounce inhibitor has a bounce - prevention strap 1 that is articulated for suspension laterally over tops of a woman &# 39 ; s breasts 2 . a first back - strap attachment 3 on a first end of the bounce - prevention strap 1 and a second back - strap attachment 4 on a second end of the bounce - prevention strap 1 are attachable to a back strap 5 which can be a bra back strap of a bra . the bounce - prevention strap 1 has bounce - resistance resilience intermediate the first back - strap attachment 3 and the second back - strap attachment 4 . referring to fig2 - 8 , articulation for suspension laterally over tops of a woman &# 39 ; s breasts 2 can include variable - direction resilience and shaping in addition to straight - line strap resilience that is shown for two - dimensional illustration . consequently , the bounce - prevention strap 1 can have contoured shapes and resilience intermediate the breasts 2 and the back strap 5 . optionally also with intended contour and resilience , the bounce - prevention strap 1 can be made to back - tie with a buckle 6 or other fastener as shown in fig3 or to front - tie between breasts 2 with the buckle 6 or other fastener as shown in fig2 and 4 - 8 . some embodiments can be simpler for short - time and convenience use in comparison to other embodiments that are contoured , sized and shaped for particular breast configurations and sizes . front - tie , preferably between the breasts 2 can include the buckle 6 with buckled - length adjusters 7 for adjustment of resilience as shown in fig4 . shown in fig5 can be a zipper 8 for wide bounce - prevention straps 1 having zippered - length adjusters 9 for adjustment of resilience . shown in fig6 can be a fastener 10 having fastened - length adjusters 11 for adjustment of resilience . shown in fig7 can be a fastener materials 12 , including “ velcro ”, having material - end adjusters 13 for adjustment of resilience . optionally as shown in fig8 the bounce - prevention strap 1 can be pre - sized or back - tied not to have front - tie . optionally as described in relation to fig9 - 14 , the first back - strap attachment 3 can be affixed to or attached removably to a bra back strap 14 of a bra 15 . oppositely disposed correspondingly , the second back - strap attachment 4 can be affixed to or attached removably to the bra back strap 14 of the bra 15 . further optionally as described in relation to fig9 and 13 , the first back - strap attachment 3 can be affixed to or attached removably to an outside periphery of the first side of the bra back strap 14 for outside positioning on the bra 15 . oppositely disposed correspondingly , the second back - strap attachment 4 can be affixed to or attached removably to the outside periphery of the bra back strap 14 for outside positioning on the bra 15 . for the outside positioning , bra material 16 is positioned between the breast 2 and the bounce - prevention strap 1 . additionally optional as described in relation to fig1 , 12 and 14 , the first back - strap attachment 3 can be affixed to or attached removably to an inside periphery of the first side of the bra back strap 14 for inside positioning under the bra 15 . oppositely disposed correspondingly , the second back - strap attachment 4 can be affixed to or attached removably to the inside periphery of the bra back strap 14 for inside positioning under the bra 15 . for the inside positioning , the bounce - prevention strap 1 is positioned between the breast 2 and bra material 16 . for integration of the breast - bounce inhibitor into the bra 15 , the first back - strap attachment 3 can be a bra - strap extension on a first side of the bra back strap 14 and the second back - strap attachment 4 can be a bra - strap extension on a second side of the bra back strap 14 . a new and useful breast - bounce inhibitor having been described , all such foreseeable modifications , adaptations , substitutions of equivalents , mathematical possibilities of combinations of parts , pluralities of parts , applications and forms thereof as described by the following claims and not precluded by prior art are included in this invention .

US-88294401-A

the present invention pertains to recombinant genes coding for oleosin proteins in cacao and to polypeptides encoded by said genes . in particular , the present invention relates to the use of such genes and gene products for the manufacture of emulsifiers , encapsulating agents , and flavor components useful in the food , pharmaceutical , and cosmetic industries .

during the extensive studies leading to the present invention the present inventors have found that contrary to the general belief ( leprince et al ., supra ) cacao does contain at least two different small molecular weight oleosin proteins . the oleosin proteins are synthesized in cacao seed and have a calculated molecular weight of about 16 . 9 kda and 15 . 8 kda , respectively . upon identifying the dna sequence and the putative protein sequence the cacao oleosin proteins could be shown to contain regions of both high hydrophobicity and high hydrophilicity , as derived from a kyte doolittle plot ( see fig2 and fig3 ). during a degradative process , such as is prevailing during the fermentation of cacao , said oleosin proteins will give rise to a number of different peptides and hydrophobic amino acids , which will contribute to an enhanced cacao flavor during the manufacture of cocoa products . the cacao oleosin genes may therefore be used for expressing or overexpressing , respectively , the gene in a suitable system thus being able to provide cacao flavor precursors . the oleosin genes may be expressed in a variety of different ways known to the skilled person . such , an expression cassette may be prepared harboring one or more copies of an oleosin gene according to the present invention and containing a promotor , suitable to express the gene in a given system . the promotor will be selected according to the requirements of the system , in which the oleosin gene is to be expressed . such systems include bacterial cells , such as e . g . e . coli , or yeast or insect cells . for each of the various expression systems appropriate vectors are known to the skilled person . the oleosin proteins produced in such systems may then be isolated from the cells or , in case the protein is secreted into the medium , from the culture medium itself . according to a preferred embodiment the oleosin gene is expressed in a plant cell , more preferably in cacao itself . to this end one or more copies of an oleosin gene of the present invention may be introduced into the respective plant cells , which genes may be under the control of its endogeneous promotor or under the control of an exogeneous promotor . accordingly , an increased expression of oleosin in the plant cell will be possible . in case the oleosin gene is synthesized in cacao itself said cacao may be directly used for the preparation of cacao flavor precursors with the result that less raw material will be required for obtaining the same degree of flavor precursors as compared to conventional cacao raw material . as methods for introducing constructs , containing the oleosin gene operably linked with an appropiate promotor , into plant cells , there may be mentioned electroporation of protoplasts , use of bombardment with dna coated particles or use of known bacterial vectors for plant transformation , such as the vectors used with the bacterium agrobacterium tumefacians . after the plant cells are transformed , they may then be regenerated into plants according to conventional methods such as is e . g . described in mccormick et al ., plant cell rep . 5 ( 1986 ), 81 – 84 . several generations may be grown and either pollinated with the same transformed strain or a different strain , while ensuring that the desired phenotypic trait is maintained . according to a preferred embodiment cacao trees may be eventually obtained , that exhibit a high content of oleosin proteins in their seeds that may serve as a precursor pool for flavor . the oleosin proteins obtained as detailed above may also be used as an emulsifier or making use of their inherent properties to stabilize small oil droplets in a cacao cell , they may be used as an encapsulating agent for oil soluble molecules . as examples for the use of the cacao oleosin proteins there may be mentioned their use in the food industry for preparing standard food emulsions , such as cheese , yogurt , margarine , mayonnaise , vinaigrette , ice cream , salad dressing , baking products etc ., or their use in the cosmetic industry for producing e . g . soaps , skin creams , facial creams , tooth pastes , lipstick , make up etc . the present invention will now be described by means of examples , which are not construed to limit the same thereto . for the isolation of cacao seed oil bodies , the cacao seeds used were from ripe pods of cacao variety eet 95 grown in the green house under open pollination conditions . the procedure used was a modified version of an oil body isolation procedure developed by millichip et al . ( 1996 ) biochem . j . vol . 314 , 333 – 337 ). eight mature and ungerminated eet 95 seeds were taken and their testa and radical were removed . each seed was then chopped into small pieces with a sharp blade at room temperature and the material was immediately put into two falcon tubes on ice that each had 30 mls of grind buffer ( 0 . 1 m potassium phosphate buffer , 25 mm β - mercaptoethanol , 10 mm ascorbic acid , 0 . 3 m sucrose ; final ph to 7 . 2 with koh ). the chopped seeds were then homogenized for 45 seconds on ice with an ultra - turrax t - 25 and the larger n - 18g head ( janke & amp ; kunkel gmbh & amp ; co kg ). the homogenized material was quickly filtered through a 500 μm mesh screen keeping the filtrate on ice as much has possible . the material remaining on the screen was washed twice with 20 ml of grind buffer ( supra ). the filtrate was subsequently put in 4 clear polycarbonate corex tubes ( 30 ml ) and centrifuged at 16 , 000 rpm ( 20 , 000 g ) at 10 ° c . for 20 minutes . after centrifugation , the top “ floating material ” ( oil bodies ) was taken off the four tubes with a spatula to new corex tubes with fresh grinding buffer . the remaining “ floating ” material , which becomes suspended at the top of the supernatant during handling , was collected as well using a pipette and was transferred into fresh grinding buffer . for this first grind buffer wash , the volume was reduced to approximately 40 – 50 ml and put into two corex tubes . the “ floating ” material was resuspended by homogenization in the corex tubes on ice for 45 seconds with the ultra turrax ( smaller head n - 10g ) and respun ( 20 minutes , 16 , 000 rpm , 10 ° c .). the top layer was again collected and transferred to a new tube as described above , which contained urea wash buffer ( 50 mm tris - hcl , 9 m urea , 10 mm β - mercatoethanol , final ph 7 . 2 ). this partial urea wash mix was again resuspended by homogenization and centrifuged as in the previous wash step . the “ floating ” material formed after centrifugation in the urea wash buffer was again transferred to a new corex tube with urea wash buffer at room temperature and this mix was homogenized as described above . the homogenized material was agitated at high speed at room temperature for 5 minutes , and then centrifuged for 20 minutes at 16 , 000 rpm , at 20 ° c . after this centrifugation step , the relatively clear wash solution was completely removed by pipetting from the corex tube with minimal loss of floating material and fresh urea wash solution was added to the same corex tubes . this method maximized the recovery of the oil bodies as the material binds to the tube walls and is lost if a new tube is used for each washing step . the floating material was rehomogenized , agitated for 15 minutes at room temperature and then centrifuged for 20 minutes at 16 , 000 rpm , at 20 ° c . ( first 100 % urea wash ). this last wash step at 100 % urea wash buffer was repeated three times . following the last washing step , the floating material that remained in the two corex tubes after removing the urea wash buffer was recovered in 10 mls of urea wash buffer plus 0 . 025 % triton x - 100 and aliquoted to six 2 ml microcentrifuge tubes . these tubes were spun at 10 , 000 rpm for ten minutes and the solution below the “ floating ” oil bodies was removed . to remove the fat from these oil body preparations , 1 ml of acetone was added to the oil bodies in each tube . this mixture was then vortexed vigorously and then sonicated 2 – 4 minutes at room temperature . the tubes were then spun at room temperature for 5 minutes at 10 , 000 rpm . the supernatants were removed and the acetone extraction procedure was repeated 4 times . finally , the pellets recovered were dried under vacuum in a speed - vac ( savant ). isolation and analysis of a cacao oil body protein by sds - page and peptide sequence analysis 60 μl of sds - page gel loading buffer ( 62 . 5 mm tris - hcl ph 6 . 8 , 12 . 5 % glycerol , 2 % sds , 715 mm β - mercaptoethanol , 0 . 025 % bromophenol blue ) were added to two microcentrifuge tubes containing acetone extracted oil bodies prepared as described in example 1 . this material was heated to 50 ° c ., sonicated twice for 5 minutes , vortexed , and then centrifuged . the supernatants were combined and then run in three wells of a freshly prepared 20 cm 15 % sds - page gel prepared with duracryl ( esa chelmsford , mass . u . s . a .). after migration , the gel was fixed twice for 20 minutes in 50 % methanol , 10 % acetic acid , and water . the gel was stained over night with a solution of 45 % methanol , 10 % acetic acid , and water with 3 mg amido black per 100 ml . then , the gel was rinsed with milli q purified water several times . fig1 shows a picture of the stained sds page gel from which it becomes obvious that several proteins could be enriched during the oil body isolation procedure . the protein profile demonstrates that there has been a substantial enrichment of two bands around the size expected for oleosins , a major band with an apparent molecular weight of 16 . 1 kda and a less intense band with an apparent molecular weight of 15 . 0 kda . a larger amount of the same sample was then run on a long preparatory sds page gel . the major band at around 16 . 1 kda was cut out , subjected to trypsin hydrolysis by incubating the gel slice in 200 ul tris - hcl 0 . 05 m ph 8 . 6 , 0 . 01 % tween 20 and 0 . 2 μg sequencing grade trypsin for 18 hours at 30 ° c . the peptides thus obtained were separated on an in - line combination deae - c18 hplc column ( deae - aquapore , 7 um 2 . 1 × 30 mm from perkin elmer ; c - 18 column catalogue # 218tp52 2 . 1 × 250 mm from vydac ) using a gradient of 2 %– 45 % acetonitrile in 0 . 1 % tfa . one large peptide peak was chosen for n - terminal sequence analysis . the peptide sequence was performed on a 494 abi sequencer using edman degradation chemistry according to the manufacturer , and yielded the following sequence as identified by seq id no : 5 met gln asp met val gly tyr val gly gln lys surprisingly , the sequence obtained showed a high homology to a sequence found in the 16 . 4 kda oleosin of gossypium hirsutum ( cotton , hughes , d . w ., wang , h . y . and galau , g . a . ( 1993 ) plant physiol . 101 , 697 – 698 ), supporting the assumption that the cacao oil body protein investigated was indeed an oleosin protein . the mrna used for the cdna library construction was isolated from seeds of an immature mostly green pod of eet 95 grown in the green house under open pollination conditions . the matrix tissue encasing these seeds was solid and the seeds displayed two very distinct developmental stages . one type of seed appeared relatively mature , i . e . the seeds were purple with only small amounts of white gelatinous matrix tissue in seed folds , the other seeds were significantly less mature , with seeds having both white and pink sections and significant amounts of the gelatinous matrix material in the seed folds . for rna isolation , small pieces of 3 of the more mature seeds and small pieces of 2 of the less mature seeds were taken as the seeds were freed from the matrix and immediately frozen in liquid nitrogen . this material was then ground to a powder in a mortar and pestle in the presence of liquid nitrogen . the liquid nitrogen + cacao powder was put in a 50 ml falcon tube and the liquid nitrogen was allowed to evaporate . as the powder warmed towards 0 ° c ., 28 ml of solution a was added ( 14 ml 100 mm tris - hcl ph 8 + 14 ml aqua phenol ( appligene / oncor )+ 0 . 1 % hydroxyquinoline + 140 μl 10 % sds ,+ 110 μl β - mercaptoethanol ). this mixture was homogenized with a glass dounce homogenizer on ice . the resulting solution was spun for 10 minutes at 8 , 000 rpm . the aqueous phase was recovered and was manually mixed with 7 ml phenol + 7 ml chloroform / isoamyl alcohol ( ready red , appligene / oncor ). the extraction was then spun at 8 , 000 rpm for 10 minutes . after this stage great care was taken to avoid any contamination of the sample with rnase . the aqueous phase recovered was re - extracted twice with 14 ml chloroform / isoamyl alcohol . the final aqueous phase obtained was adjusted to 0 . 3 m na acetate and 2 volumes of etoh were added . subsequently , the tube &# 39 ; s content was mixed and put at − 20 ° c . for 1 hour , at − 80 ° c . for 15 minutes , and was then spun 30 minutes at 8 , 000 rpm . the nucleic acid pellet recovered was slowly resuspended in 10 ml of 100 mm tris - hcl ph 8 . then , 3 ml of 8 m lithium chloride were added ( 2 m final ) followed by 2 volumes of ethanol . this mixture was put 1 hour at − 20 ° c . followed by 15 minutes at − 80 ° c . the nucleic acid precipitate formed was recovered by centrifugation at 8 , 000 rpm for 30 minutes . this pellet was resuspended in 600 μl rnase free h 2 o and aliquoted into small samples of 200 μl which were frozen at − 80 ° c . the purity of the isolated rna was verified by spectral analysis at between 220 nm and 300 nm and its integrity was demonstrated by showing the integrity of the ribosomal rna sample after running a sample on an rna gel under the appropriate conditions . poly a + rna was prepared using an oligotex kit ( qiagen ) and total cacao seed rna prepared as described in example 3 . the procedure employed was as described in the instruction leaflet for 250 – 500 μg total rna . in the final step , the mrna was eluted with 25 μl preheated elution buffer , and the column was then washed with 80 μl preheated elution buffer . the eluted material was pooled , adjusted to 0 . 3 m na - acetate and the rna was precipitated by adding two volumes of ethanol at a temperature of − 20 ° c . for one hour and − 80 ° c . for 20 minutes . the rna was pelleted by spinning 15 minutes at 13 , 000 rpm and the pellet was washed with 70 % ethanol and dried under vacuum in a speed vac . the final pellet was resuspended in 10 μl of rnase free water , and the concentration of rna present was found to be 5 – 10 ng / ul using nucleic acid “ quicksticks ” ( clontech ). the synthesis of cdna from the poly a + mrna was carried out using a smart pcr cdna synthesis kit ( clontech ). the method used was as described in the kit instructions . for the first strand cdna synthesis step , 4 μl ( 20 – 40 ng ) of poly a + mrna was used and as advised in the smart protocol , 200 units of gibco brl superscript ii mmlv reverse transcriptase was used . the pcr step of the smart protocol was also set up as directed in the kit instructions , with the proviso that merely 2 μl of the first strand reaction were added . first , 18 cycles of a pcr were run , then , 35 μl was taken out of the total reaction ( 100 μl ) and this 35 μl was subjected to a further 5 cycles of pcr . a pool of the two pcr reactions was then prepared , 40 μl of the 18 cycle pcr reaction and 15 μl of the 23 cycle pcr reaction . 2 . 5 μl protease k ( boehringer mannheim , nuclease free , 14 μg / μl ) was added to this cdna / pcr mixture and the reaction was incubated at 45 ° c . for one hour . after a brief spin , the reaction was stopped by heating the mixture to 90 ° c . for 8 minutes . the mix was then chilled on ice , and 5 μl of t4 dna polymerase was added ( 3 units / μl ) and the reaction was incubated at 14 – 16 ° c . for 30 minutes . then , 25 μl of milli q purified water , 25 μl phenol (“ aqua phenol ”), and 25 μl choloroform / isoamyl - alcohol (“ ready red ”) was added . this mixture was vortexed , spun , and the top aqueous layer was taken . the phenol layer was reextracted with 50 μl of h 2 o . the two resulting aqueous layers were then pooled and re - extracted with chloroform / isoamyl - alcohol (“ ready red ”). the dna in aqueous layer recovered was precipitated by adding ethanol and chilling as described above . the dried dna obtained was resuspended in te buffer ( 10 mm tris - hcl ph 8 , 1 mm edta ) and its concentration was calculated to be approximately 75 ng / μl using the “ quicksticks ” from clontech . the cdna was then prepared for blunt end ligation into the pcr - script amp sk (+) cloning vector of stratagene . the method used was as described in the pcr - script amp cloning kit ( stratagene ). first , the “ polishing ” reaction was carried out as described in the stratagene pcr - script amp cloning kit using the cloned thermostable pfu dna polymerase included in the kit . this was achieved to ensure that the cdna were blunt ended before the ligation reaction . the dna thus treated was subsequently purified using the strataprep pcr purification kit ( stratagene ). the dna was eluted from the column with 50 μl of milli q purified water , the dna was lyophilyzed to dryness , and 6 μl of water were added . one μl of this dna solution was used to assess the final recovery of the cdna . then the following ligation components of the pcr - script amp kit were added to the remaining 5 μl of purified cdna in the tube in which the dna was dried : 2 μl of ppcr - script amp sk (+) cloning vector ( 20 ng ), 1 μl pcr - script 10x reaction buffer , 0 . 5 μl 10 mm ratp , 1 μl sfr1 restriction enzyme ( 5 u / μl ), and 1 μl t4 dna ligase ( 4 u / μl ). this mixture was incubated at room temperature for 1 hour , then heated to 65 ° c . for 10 minutes . two μl of the ligated dna were transformed into ultracompetent cells xl - 2 blue ( stratagene ) as described in the instruction manual for these cells . the peptide sequence obtained from the gel purified oil body protein ( see example 2 ) was used to synthesize one set of degenerate primers that correspond to two overlapping regions of the cacoa oleosin peptide sequence . the primers have the following sequences as identified by seq id no : 6 and seq id no : 7 , respectively , where n is deoxy inosine : another set of degenerate primers was designed from two different regions of the 16 . 4 kda cotton oleosin protein sequence . the two peptide sequences chosen were located n - terminal to the region of the 16 . 4 kda cotton oleosin that has high homology to the cocao oleosin peptide sequence described here . these two sets of primers were synthesized for the screening step . different pairs of these degenerate primers were the tested with pcr amplified cdna derived from immature seeds of t . cacao variety larringa . one primer set was found to specifically amplify a fragment of approximately 300 – 400 bp from the cacao seed cdna . an initial screen of the cdna library using degenerate primers indicated that the cocao oleosin cdna clone was highly represented in this library . therefore , plasmid preparations from 19 isolated transformants were screened directly with the degenerate primer set in fig2 , and three positive clones were selected for further study . two clones 1cdtc - 25 and 1cdtc - 47 had inserts of approximately 0 . 850 – 0 . 950 kb and one clone 1cdtc - 42 had an insert of approximately 1 – 1 . 1 kb . clone 1cdtc - 42 was chosen for further analysis by dna sequencing . double strand dna sequencing showed that clone 1cdtc - 42 contained a full length insert of 934 base pairs ( seq id no 1 ). the open reading frame of this insert encodes a protein with a predicted molecular weight of 16 , 885 daltons ( seq id no 3 ). analysis of the 16 . 9 kda cacao oleosin cdna open reading frame showed that this protein is similar to other oleosins having a very long central hydrophobic domain surrounded by hydrophilic n - terminal and c - terminal regions ( fig2 ), and that it is a very basic protein with an isoelectric point of 9 . 734 . sequencing of 13 other randomly chosen cdna clones from this cdna library also led to the independent discovery of the 16 . 9 kda cacao oleosin cdna . furthermore , during this random sequencing experiment another cacao oleosin sequence of 775 base pairs was found ( seq 2 ). this cdna has an open reading frame that encodes a protein with a calculated molecular weight of 15 . 8 kda ( seq id no 4 ), and encodes the oil body protein with an apparent molecular weight of 15 . 0 kda that is seen in fig1 . the 15 . 8 kda cacao oleosin protein sequence also has a very long central hydrophobic domain surrounded by hydrophilic n - terminal and c - terminal regions ( fig2 ), and is a very basic protein with an isoelectric point of 9 . 34 . comparative sequence analysis ( fig4 ) shows that the 15 . 8 kda cacao cdna oleosin protein sequence is quite distinct from the 16 . 9 kda cacao oleosin protein sequence , showing only 43 . 4 % sequence identity with between the two 5 proteins . it should be understood that various changes and modifications to the presently preferred embodiments described herein will be apparent to those skilled in the art . such changes and modifications can be made without departing from the spirit and scope of the present invention and without diminishing its intended advantages . it is therefore intended that such changes and modifications be covered by the appended claims .

US-12972002-A

method and laser processing device to process tissue . in a general aspect , the method to process tissue may include applying a photosensitizer into an area surrounding a region of the tissue to be processed , and irradiating the region of the tissue to be processed with the pulsed processing laser beam , the laser beam emitting laser pulses with a temporal full width at half maximum in a range between about 100 femtosecond and about 1 nanosecond . in another general aspect , the laser processing device to process tissue may include a laser radiation source to provide a pulsed processing laser beam providing emitting laser pulses , a laser beam decoupling unit to decouple the laser beam towards a region of the tissue to be processed , and an output device to output a photosensitizer in a direction of an area surrounding the region of the tissue to be processed , the output device being connected to the decoupling unit .

fig1 illustrates one embodiment of a laser processing device for processing biological tissue , but not to true scale . fig1 shows a dental laser processing device for processing , abrading or ablating dentin , particularly carious dentin . however , the laser processing device may be any other kind of medical laser processing device for processing some other kind of biological tissue . for example , ophthalmology can be another potential field of application . the laser processing device 100 comprises a laser radiation source 1 that may emit a pulsed laser beam 50 with a laser pulse ranging between 100 fs and 1 ns ( full width half maximum ). the laser beam may be focused on a patient &# 39 ; s tooth 4 . it may be necessary to first deflect the laser beam with an optical deflection unit 3 such as a mirror or deviation prism . the laser radiation source 1 may generate the laser pulses so that the energy per pulse does not exceed 100 μj . in this case , the focusing of the laser beam can be set in such a way that the processing laser beam 50 on the surface of the tooth 4 has a focus with a focal diameter in a range from 1 μm to 100 μm . the laser radiation source 1 may emit the laser pulses with a repetition rate range from 1 hz to 10 mhz . the laser processing device 100 further comprises an output device 5 to output a photosensitizer in the direction of the tooth 4 . as shown in fig1 , the output device 5 may include a storage chamber 5 a to house the photosensitizer where the storage chamber 5 a may be connected to a supply line . the photosensitizer may be erythrosine which can be efficiently activated by two - photon absorption of the laser beam of a nd : yag laser ( 1064 nm ) or by one - photon absorption of the frequency doubling component of the nd : yag laser ( 532 nm ). for example , photosensitizers may be methylene blue , photofrine , or metalorganic dendrimeres . it is understood that all other photosensitizers referenced in technical literatures even if those are still yet to be developed , may be used if the photosensitizer requires the laser wavelength to be adapted to the corresponding maximum absorption of the photosensitizer or at least in the ambience thereof . the photosensitizers may also be biochemical chromophors . the term photosensitizer may also cover such substances which are not photosensitizers by definition but which may feature properties typical for photosensitizers under defined physical - chemical conditions . some examples may be any gases , gas mixtures ( air ), or aerosols if those substances feature photosensitizer properties under defined physical - chemical conditions . the laser processing device 100 may also comprise a decoupling unit 6 for decoupling the laser beam 50 in the direction of the tooth 4 . as shown in fig1 as an example , the decoupling unit 6 may contain a deflection unit 3 and may be connected with the supply line of the output device 5 so that the photosensitizer , when being applied , may be jetted towards the tooth 4 from the distal end of the decoupling unit 6 from the supply line . fig2 illustrates another embodiment of a laser processing device , but not to true scale . the embodiment of a laser processing device 200 shown in fig2 comprises a laser radiation source 10 that may emit a pulsed laser beam 50 . in this exemplary embodiment , the laser radiation source 10 may be a nd : yag laser coupled to a transient or regenerative amplifier emitting laser pulses in a wavelength of 1064 nm . any other laser radiation source such as a nd : yvo4 or nd : gdvo4 laser may be used . the pulse duration of the laser pulses may be 10 ps , the repetition rate may range from 1 khz to 1000 khz , the energy of the laser pulses may amount to 40 μj , and whilst at a repetition rate of 100 khz the mean beam power may be 4 w . any other laser may be used as the laser beam source . for example , a diode laser or a diode laser array may be used . for example , the laser radiation source can be a diode laser or a diode laser array that can be accommodated in the handpiece in a particularly compact way . in particular , the output pulses of the laser radiation source can be used without further optical amplification . that is to say they can be fed to the handpiece or the decoupling unit . in the embodiment shown in fig2 , the laser beam 50 emitted from the laser radiation source 10 may be directed at an optical deflection unit 60 which may selectively divert the laser beam 50 at about 90 ° at the required wavelength of the laser beam 50 . diverted laser beam 50 may pass through a beam shaping unit 30 to generate a substantially rectangular or a top hat beam profile . then , the laser beam 50 may enter a decoupling unit configured as a handpiece fronted by a lens 2 as part of an autofocus unit 20 , which may ensure that the focal position created by the lens 2 always remains within the plane of the surface of the tooth 40 to be irradiated . the autofocus unit 20 may be combined with an optical sensing means that senses backscattered radiation from the surface of the tooth 40 to sense whether the surface is still in the focal position of the laser beam . if it is not , a control signal is communicated to the autofocus unit 20 for the laser beam to suitably result on the surface of the tooth 40 and return into the focal position of the laser beam by moving the lens 2 forwards or backwards along the propagation path of the laser beam 50 . the lens 2 may be moved by a fast stepper motor connected to a carriage mounting the lens 2 . however , it is just as possible to configure the lens 2 for its refraction to be tweaked . fig2 also illustrates how the lens 2 may be arranged so that it focuses the beam on the surface of the tooth 40 with a focal diameter of 40 μm . the laser pulse energy as recited above may result in an energy density of 3 . 18 j / cm 2 which may produce a pulse peak intensity of 3 . 18 · 10 11 w / cm 2 corresponding to a photon flux density of 1 . 7 · 10 3 ° photons · cm 2 · s − 1 . the electric field strength of the alternating electromagnetic field may be 1 . 55 · 10 7 v / cm and the median electron oscillation energy in the alternating electromagnetic field may amount to 0 . 021 ev . it is understood that the beam shaping unit 30 may also be located in the beam path downstream of the lens 2 , particularly in the handpiece 70 although it is just as possible to combine the autofocus unit 20 and beam shaping unit 30 , especially the lens 2 and beam shaping unit 30 into a common optical component . the decoupling unit may also include a scanning unit 80 that may scan over a defined region of the surface of the tooth 40 with the laser beam 50 or a diagnostic laser beam by two rotating mirrors , each facing the other . also , a deflection unit 90 such as a diverting prism or a reflective mirror may be included to divert the laser beam 50 or a diagnostic laser beam in the direction of the tooth 40 . it is understood that although the scanning unit 80 is arranged in the handpiece in this embodiment , other embodiments may locate the scanning unit in the beam path upstream of the handpiece , i . e . particularly within an arm hinging the mirror or at the input thereto upstream of the handpiece . the decoupling unit configured as a handpiece may need to be held directed on the tooth being irradiated by the physician . in maintaining the position of the distal end of the decoupling unit constant relative to the tooth 40 , a funnel - shaped fixing element 150 is secured to the distal end of the decoupling unit and can be suitably located on the tooth 40 during lasering as illustrated in fig3 to 6 . a cofferdam or rubber clamp may be placed by the physician to encapsulate the tooth in isolating it from the remaining pharyngeal space . the laser processing device 200 may further comprise an output device 25 for outputting a photosensitizer in the direction of the tooth 40 . the output device 25 may contain a storage chamber 25 a that is connected to a supply hose 25 b . the supply hose 25 b may be ported into the decoupling unit and guided within the decoupling unit into the fixing element 150 . the optical or acoustical signals generated from the irradiated region of the tooth 40 surface or from the ambience thereof can be detected and used for diagnostic purposes . as explained already , the optical signals may be based , for example , either on the plasma radiation or second harmonic generated ( shg ) or higher harmonic generated electromagnetic radiation acting on the dentin involved in lasering . the exemplary aspect as shown in fig2 will now be explained with an example of detecting a shg signal . in this mode of diagnosis , a diagnostic laser beam may be emitted like the lasering beam is pulsed for diagnosing whether the sub - region of the dentin is carious or not . here , the energy or energy density is below the threshold for generating ablation or plasma so that no lasering occurs with the diagnostic laser beam . if not , energy or energy density furnishes a higher shg signal than carious dentin . at least some part of the radiation having doubled frequency and being generated from the tooth surface may pass through the laser beam path in the opposite direction , as described above . in other words , the radiation may be diverted by the deflection unit 90 and pass through the scanning unit 80 and the autofocus unit 20 with the lens 2 to finally incident the optical deflection unit 60 , such as a beam splitter . here , the beam splitter may be transparent for the wavelength of the shg signal so that the frequency doubled radiation can be input in an detector 110 . the detector 110 may be a simple photo detector detecting the intensity of the shg radiation . it is just as possible to use a more complex system such as a spectrometer , ccd camera , or cmos image sensor as the detector 110 . such detectors may suitably be used in combination with the autofocus unit 20 , as already indicated above . likewise , the deflection unit 90 may be engineered to transmit the frequency - doubled radiation generated from the tooth surface and to direct the radiation to the detector 110 with , for example , a glass fiber located downstream of the deflection unit 90 . this may reduce the complexity of the optical beam in transmitting the frequency - doubled radiation since the optics 80 , 20 , 60 , 2 are not designed for several different wavelengths , making them to be coated if necessary . in order to effectively couple the frequency - doubled light , an optical component can be inserted between the deflection unit 90 and the glass fiber to focus the frequency - doubled light onto the glass fiber . this optical component can be engineered as a microoptical component . the shg radiation values detected by the detector 110 are converted into a signal 115 and transmitted into a combined analyzer / controller 120 , which may also be a computer system for this embodiment . in principle , any other type of control system may be compatible , for instance , memory - programmable controllers , micro controllers , or analog closed - loop controls . the analyzer / controller 120 can receive a signal containing data as to the operation status of the analyzer / controller 120 from the laser radiation source 10 . the analyzer / controller may output a control signal to the laser radiation source 10 in switching the laser radiation source 10 , for example , from an standby mode to a operating mode . here , the analyzer / controller may function upon receiving the signal 115 communicated by the detector 110 . the embodiment shown in fig2 may comprise a laser radiation source 10 which is nimble in mode switching “ out ” ( standby mode ), “ diagnostics ”, and “ therapy ” ( processing ) treatment . in this embodiment , the laser radiation source 10 may emit both the laser beam required during the “ therapy ” mode and the diagnostic laser beam required during the “ diagnosis ” mode with a substantially different energy density per pulse applied to the tooth in w / cm 2 . here , the energy density applied to the surface of the tooth needs to be reliably below the ablation threshold in the “ diagnosis ” mode while the energy density is above this threshold in the “ therapy ” mode . in a diagnostic mode as described above , a certain surface region of the tooth 40 is scanned with the diagnostic laser beam and the backscattered shg signal is received and analyzed . this may allow the surface region can be mapped to a certain extent in identifying a portion of the surface to be irradiated or ablated . as implementing the diagnostic mode , the analyzer / controller 120 may output a signal to the output device 25 and this signal may allow the supply hose 25 b and end portion of the controllable nozzle to jet the photosensitizer towards the portion of the tooth surface to be ablated . fig3 illustrates another example embodiment for a diagnosis . the embodiment illustrated in fig3 includes a decoupling unit in the form of a handpiece shown in cross - section . with this particular embodiment , healthy dentin may be distinguished from unhealthy one by means of a marker rather than using a shg signal . the mark may indicate a characteristic stain when it is in contact with the unhealthy dentin . this marker can be applied to the tissue via a supply hose 72 that may also be incorporated within the handpiece as shown in fig3 . once the carious portions of a tissue surface are detected preferably by means of optical imaging with subsequent analysis thereof , photosensitizer is applied to these portions via the supply hose 71 for subsequent ablation by the laser beam 50 . accordingly , in this example embodiment , there is no diagnostic laser beam , switching of the laser beam source , or shg detection . the two supply hoses 71 and 72 can be used to connect the nozzles 71 . 1 and 72 . 1 respectively for a controlled orientation in jetting the materials pin - pointed to the surface of the tissue . it is to be noted that the embodiment as shown in fig3 may depict a laser beam decoupling unit as a stand - alone embodiment . this laser beam decoupling unit may comprise a handpiece 70 , a deflection unit 90 for deflecting a lasering beam 50 and / or a diagnostic laser beam , and an attachment 250 for locating the handpiece 70 on an ambience of the tissue to be irradiated . in this arrangement , the handpiece 70 may be configured so that a photosensitizer can be applied via the supply hose 71 incorporated in the handpiece 70 and , where necessary , marker can be jetted via additional supply hose 72 on a portion of the tissue to be irradiated or diagnosed . it is understood that this separate embodiment can also be combined with any of the other embodiments as described in this application and / or sophisticated with any of the features cited in this application , including also leading devices such as a laser processing device incorporating a laser beam decoupling unit as described above . referring now to fig4 , a decoupling unit in the form of a handpiece , shown in cross - section , illustrates another example embodiment . here , at least one led 73 is integrated within the handpiece 70 . as shown in the embodiment of fig4 , several leds 73 may also be incorporated within the handpiece 70 that may serve a physician to illuminate the pharyngeal space when the attachment 250 is still to be affixed in place . this may allow the physician to optimally position the attachment 250 in relation to the tooth 40 being treated . in addition , these leds may also serve to activate a marker applied to the surface of the tooth being treated so that the carious locations may indicate a characteristic stain . the image created by the marker in this way can be scanned by the same optics used to incouple the laser beam 50 . on the basis of this imaging , the photosensitizer can be applied to the regions to be irradiated or ablated . the leds 73 may be arranged on a horizontal end portion of the handpiece 70 . for example , the leds 73 may be arranged in a circle to achieve illumination as best possible homogenous and rotationally symmetrical . the leds 72 may be connected by leads ( not shown ) integrated within the handpiece 70 for powering the led 73 . the leds 73 may be leds emitting light in a single color , for example , red , such as quasi - monochromatic leds . however , white light leds could be used for a better illumination of the pharyngeal space and circumstances so that a larger choice of markers for activation at differing wavelengths is available . it is to be noted that the embodiment as shown in fig4 may depict a laser beam decoupling unit as a stand - alone embodiment . this laser beam decoupling unit may comprise a handpiece 70 , a deflection unit 90 for deflecting a laser beam 50 and / or a diagnostic laser beam , and an attachment 250 for locating the handpiece 70 on an ambience of the tissue to be irradiated . this laser beam decoupling unit may further comprise at least one led 73 for illuminating and / or activating a marker or photosensitizer . it is understood that this separate embodiment can also be combined with any of the other embodiments as described in this application and / or sophisticated with any of the features cited in this application , including also leading devices such as a laser processing device incorporating a laser beam decoupling unit as described above . referring now to fig5 , a decoupling unit in the form of a handpiece 70 , shown in cross - section , illustrates another example embodiment . here , the handpiece 70 may feature an attachment 350 having an encapsulating function in addition to a locating function of the tooth 40 . as illustrated in the exemplary embodiment of fig5 , the seal 350 . 1 may be applied to the bottom rim of the attachment 350 . here , the seal 350 . 1 is indicated simply symbolically and not necessarily to be appreciated as being technically realistic . one object of such an attachment may be to encapsulate the direct vicinity of the tooth 40 being treated at best air - and gas - tight from the remaining pharyngeal space . such an encapsulated location of this kind may allow to optimize the treatment of the tooth in a wide variety of ways as will now be explained with the following example aspects . for example , an aspirator may be integrated within the handpiece 70 to allow the attachment to seal off the region from the outside and this may result efficient and reliable removal of the ablated debris . in addition , a controlled atmosphere can be created surrounding the tooth 40 . it is to be noted that the embodiment as shown in fig5 may depict a laser beam decoupling unit as a stand - alone embodiment . this laser beam decoupling unit may comprise a handpiece 70 , a deflection unit 90 for deflecting a lasering beam 50 and / or a diagnostic laser beam , and an attachment 350 to locate the handpiece 70 on an ambience of the tissue to be irradiated . in this arrangement , the attachment 350 may be designed to seal and encapsulate a tissue region to be irradiated . it is understood that this separate embodiment can also be combined with any of the other embodiments as described in this application and / or sophisticated with any of the features cited in this application , including also leading devices such as a laser processing device incorporating a laser beam decoupling unit as described above . referring now to fig6 , a decoupling unit in the form of a handpiece 70 , shown in cross - section , illustrates another exemplary embodiment . here , the handpiece 70 may mount an attachment 250 and may be configured to integrate an aspirator duct 80 for efficient aspiration of the ablated debris in tissue treatment . the aspirator duct 80 may be connected to an aspirator system ( not shown ) integrated in the handpiece 70 . an open end of the aspirator duct protruding into the attachment 250 such that it is directed at the region being irradiated to aspirate the ablated debris materializing in lasering . the end of the aspirator duct 80 may be mounted movable , for example by user &# 39 ; s control and orientation . this also includes varying spacing between the aspirator duct 80 and the region being irradiated . it is to be noted that the embodiment as shown in fig6 may depict a laser beam decoupling unit as a stand - alone embodiment . this laser beam decoupling unit may comprise a handpiece 70 , a deflection unit 90 for deflecting a lasering beam 50 and / or a diagnostic laser beam , and an attachment 250 for locating the handpiece 70 on an ambience of the tissue to be irradiated . here , the handpiece 70 and attachment 350 may be configured so that an aspirator duct 80 is integrated therein and the end of the duct can be directed at the tissue region being irradiated . it is understood that this separate embodiment can also be combined with any of the other embodiments as described in this application and / or sophisticated with any of the features cited in this application , including also leading devices such as a laser processing device incorporating a laser beam decoupling unit as described above . especially , a combination of the embodiments as illustrated in fig5 and 6 , i . e . an encapsulated sealed attachment to an aspirator system may allow potentially toxic lasering . for example , the ablation of amalgam fillings can be performed , in which case the gas - tight encapsulation may make it safe to remove the ablated debris , essentially elementary mercury with practically no remainders . as described in this application , laser ablation of the amalgam filling could be performed with the assistance of a photosensitizer . thus , this embodiment may allow performing amalgam removal by lasering in compliance with the maximum workplace concentration ( mak ) as required by law for mercury vapors . fig7 illustrates a further embodiment of a laser processing device not shown true to scale . the embodiment of a laser processing device 300 shown in fig7 comprises substantially the same components as the components of exemplary embodiment described in fig2 which are identified with the same reference numerals . however , unlike the laser processing device illustrated in fig2 , the laser processing device 300 may feature a generator unit 325 comprising a generator unit 325 a connected to the handpiece 70 by a line 325 b . the line 325 b may be integrated through the handpiece to the fixing element 150 and may feature an orifice directed at the tooth being irradiated at the end of the supply hose . here , the generator unit 325 shown in fig7 does not illustrate its detailed features but the generator unit 325 may have various functions . for example , the generator unit 325 may serve predominantly to create a certain atmosphere in the ambience of the tooth 40 being treated . in one simple variant , vacuum atmosphere can be generated by the generator unit 325 comprising a vacuum pump . in this example , the fixing element 150 , like the attachment 350 of the embodiment described in fig5 , may be configured as an encapsulating attachment . in addition , the fixing element 150 may be — when wanted or necessary — sealed off from the handpiece 70 by disposing a window transparent to the lasering beam 50 between the handpiece 70 and the fixing element 150 . in a somewhat less complicated variant , when vacuum atmospheres are needed to be created above the tooth 40 , there may be no seal or at least none - complete seal provided between the handpiece 70 and the fixing element 150 . the generator unit 325 may also be designed to create a positive pressure . furthermore , the generator unit 325 may be designed to create a specific gas atmosphere in the ambience of the tooth 40 such as furnishing a gas such as o 2 , n 2 , h 2 o ( water vapor ) or some rare gas . especially when ablating amalgam fillings , utilizing the generator can be advantageous in binding the ablated mercury in a certain way to remove amalgam fillings from the ambience of the tooth 40 . the generator unit 325 may also be designed to cool the tooth 40 by generating a cooling medium by jetting cooling air on to the ablated surface region . the generator unit 325 may also be designed as an aerosol generator that may generate a gas in which particles such as microscopic ( nano ) or macroscopic particles are dispersed in handling certain functions for the ablation . these particles may have a cooling function . in addition to this , the analyzer / controller 120 and the detector 110 of the embodiment described in fig2 may be included in this particular embodiment described in fig7 . here , the analyzer / controller 120 may also be connected to the generator unit 325 so that the analyzer / controller 120 may control the generator unit 325 . it is to be noted that the embodiment as shown in fig7 may depict a laser processing device as a stand - alone embodiment . this laser processing device may comprise a source 10 to furnish a lasering beam 50 , a decoupling unit to decouple the lasering beam 50 in the direction of the tissue region being irradiated , and a generator unit 325 for generating or furnishing an atmosphere in an ambience of the tissue being irradiated . it is understood that this stand - alone embodiment can also be combined with any of the other embodiments as described in this application and / or sophisticated with any of the features cited in this application . fig8 illustrates a flow chart for one example of methods of an automated combination ablation and diagnostic process when using a marker . in operation s 1 , a marker may be applied ( s 1 ). then , it is established whether a change in stain has been occurred , indicating damaged tissue ( s 2 ). if no change in stain is detected , the process may be discontinued . the changes in stain may be detected with a spatial resolution of the surface being imaged on a detector such as a ccd or cmos element . here , the changes may be detected by scanning the image and electronically storing the result of the spatial resolution . then , the marker may be removed and a photosensitizer may be applied to the regions detected as damaged ( s 4 ). the , the ablation may be done by the laser beam ( s 5 ). here , the parameters such as , but not limited to , duration or power of the lasering may be previously set by the user . after this , the process may repeat from s 1 . now , fig9 illustrates a flow chart for one example of methods of an automated combination ablation and diagnostic process using libs technology . in operation s 1 , a region may be scanned with a diagnostic laser beam and simultaneously the detection of a shg signal may be performed as described for the embodiment illustrated in fig2 ( s 1 ). then , it is established which regions may be viewed as healthy by detecting a backscattered shg signal from the region . when an shg signal is returned from all of the surface , the process may be discontinued . thus , establishing which regions are healthy may be performed with a spatial resolution . here , the complementary regions can be electronically stored as being diseased and a photosensitizer may be applied to such regions ( s 4 ). then , the ablation is performed with the laser beam ( s 5 ). here , the parameters such as , but not limited to , duration or power of the lasering may be previously set by the user . after this , an libs analysis may be repeated from s 1 . it is to be noted that the embodiments as shown in fig8 and 9 may depict a combined lasering and diagnosis process as a stand - alone embodiment . the embodiments may comprise the operations : detecting diseased regions by means of marker or libs , applying a photosensitizer to the diseased regions , ablating the diseased regions by means of a laser beam , and repeating detection of any remaining disease and application of photosensitizer until no more disease is detected . it is understood that each of these stand - alone embodiments can also be combined with any of the other embodiments as described herein and / or sophisticated with any of the features cited herein . it is again to be understood that all features described in the embodiments and stand - alone embodiments may also be applicable to any other embodiments and stand - alone embodiments as described . also , it may be pointed out that the above embodiments are exemplary , and that the invention disclosure content herein also covers the combinations of features which are described in different exemplary embodiments , to the extent that this is technically possible .

US-201113097834-A

a twist board exercising device is provided which permits the exercising person to be seated upon a stool within a framework of adjustable height . opposed arm rests and associated hand grips enable the person to limit the amount of twisting movement . a backrest portion , joined to the framework , is adjustably positionable with respect to elevation and angle of inclination .

referring to fig1 - 4 , an embodiment of the exercise device of the present invention is shown comprised of framework 10 which embraces rotatable platform 11 and stool 12 mounted upon said platform . framework 10 is shown to be of generally tubular construction , having opposed upright side portions comprised of lower tubes 13 and upper rods 14 telescopically positionable within said lower tubes . rods 14 are provided with a series of apertures 15 that may be aligned with apertures 16 located adjacent the upper extremities of corresponding tubes 13 . by inserting a removable locking pin 17 through aligned apertures 15 and 16 , the elevation of rods 14 is secured . an upper transverse bar 18 extends between the upper extremities of rods 14 . a lower transverse tube 19 extends between the lower extremities of tubes 13 . upper transverse bar 18 and corresponding rods 14 may in fact be fabricated of a single piece of metal rod stock bent to the appropriate shape . likewise , lower transverse tube 19 and associated tubes 13 may be fabricated of a single piece of metal tube stock bent to appropriate shape . a bottom portion of framework 10 , in the form of connection tube 20 joins said lower transverse tubes 19 at their midpoints a rear portion of framework 10 in the form of upper connecting rod 21 joins opposed rods 14 adjacent their uppermost extremity . platform 11 , of circular configuration , is mounted upon connecting tube 20 in a manner to rotate in a horizontal plane about vertical center axis 25 . as shown more clearly in fig4 the platform is comprised of an upper panel 22 supported by ball bearings 23 above stationary base 24 . stool 12 is comprised of upright support post 26 rising vertically from upper panel 22 along axis 25 , and a seating portion 27 affixed to the upper extremity of said post . the elevation of said seating portion is below upper transverse bars 18 . in a preferred embodiment , post 26 may be removable from the platform to facilitate dismantling of the exercise device to a small volume for expeditious storage and shipment . arm rests 28 are positioned atop upper transverse bars 18 , and accordingly can be positioned at desired elevations . a handgrip 29 is associated with each arm rest the particular construction of handgrips exemplified is comprised of a base tube 30 pivotably attached to the arm rest , and an interior member 31 having a shaft 32 slidably positionable within tube 30 and a handle portion 33 disposed at the free upper extremity of said shaft . a back rest panel 34 is supported by upper connecting rod 21 in a manner permitting tilting movement in a vertical path . by virtue of its association with connecting rod 21 joined to upper rods 14 , the back rest panel can be further positioned with respect to elevation above seating portion 27 . the tilted position of back rest panel 34 is secured by means of paired telescoping braces comprised of pivoted upper cylinder 39 and pivoted penetrating post 37 . aligned holes in said cylinder 39 and post 37 permit securement by means of a pin such as locking pin 17 . paired foot engaging means in the form of straps 35 and interactive buckles 36 are disposed upon upper panel 22 of the platform in opposed relationship about support post 26 . in preferred embodiments , the straps or buckles are equipped with resilient features which cause snug fit of the user &# 39 ; s feet . depressions or cups 38 disposed upon panel 22 may also be employed to secure the feet of the user . ln operation , the exercising person will sit upon the stool , 5 adjust the height of the arm rests and disposition of the handgrips to comfortable positions , and will insert his feet into the foot engaging means . a repetitious alternating twisting movement is then initiated where the lower part of the body twists while the upper part of the body remains essentially motionless by virtue of the restraint effected by the handgrips . in such manner , the intensity of the exercise activity is concentrated into the waist region of the user . means may be provided to adjust the force required to twist the stool . electronic monitoring devices may be associated with the exercising device to count and display the rate of twisting movement and calories burned per minute of use . while particular examples of the present invention have been shown and described , it is apparent that changes and modifications may be made therein without departing from the invention in its broadest aspects . the aim of the appended claims , therefore , is to cover all such changes and modifications as fall within the true spirit and scope of the invention .

US-40728889-A

a system for maintaining a desired spinal curvature of a user suffering from improper alignment of the vertebrae of the spine . in it &# 39 ; s broad aspects , it comprises a sensor feedback system and electrodes . the sensor feedback system measures spinal curvature , determines whether selected conditions have been met warranting the application of electrical stimulation and provides information regarding the determination to an electronic stimulator . the electrodes are spaceably mounted on selected portions of the user &# 39 ; s back . they are in electrical communication with the electronic stimulator for causing contraction of the back muscles at selected levels , thus providing alignment of the spinal vertebrae . the sensor feedback system includes a sensor assembly which comprises an upper elongated rigid segment , a lower elongated rigid segment and a sensor . the upper elongated rigid segment is positionable adjacent the user &# 39 ; s upper spine . the lower elongated rigid segment is positionable adjacent the posterior pelvic region . the sensor is mounted on a flexible middle segment between the upper segment and the lower segment . the sensor is so positioned as to measure lordosis .

referring now to the drawings and the characters of reference marked thereon , fig1 illustrates a preferred embodiment of the present invention , designated generally as 10 . the present system 10 includes a sensor feedback system , designated generally 12 , for measuring spinal curvature . the sensor feedback system 12 includes an elastic sleeve assembly 14 which is sized to securely fit over the user &# 39 ; s back and pelvis . the elastic sleeve is preferably formed of spandex ™ or similar material . it includes elongated pockets 16 , 18 . elongated pockets 16 , 18 contain a sensor assembly including an upper elongated rigid segment 20 and lower elongated rigid segment 22 , respectively . upper segment 20 is positionable adjacent the user &# 39 ; s upper spine . the lower segment 22 is positionable adjacent the posterior pelvic region . a sensor 24 is operably mounted on a middle segment 23 between the upper segment 20 and lower segment 22 . sensor 24 comprises a position sensor for measuring lordosis . an example of a position sensor includes a strain gauge assembly . an electrical conduit 26 attaches to a connector 28 on the elastic sleeve 14 . the connector 28 may comprise one half of a male / female plug . this connector is attached , via cable 30 , to an electrical stimulator 32 . additional electrical connections or conduits 34 , 36 are also connected to connector 28 . the other ends are connected to upper and lower pairs of electrodes 38 , 40 . electrodes 38 , 40 may be of the type comprising carbon impregnated rubber or gel covered foils which are generally used with commercial muscle stimulation devices . they preferably have surface areas of approximately 30 - 45 cm 2 , each , adjusted according to the patient &# 39 ; s size . the elastic sleeve 14 preferably includes pairs of rectangular window cut - outs 50 at the desirable locations of the electrodes , an upper pair 38 being positioned over an upper portion of the user &# 39 ; s erector spinae muscles and a lower pair being positioned over a lower portion of the user &# 39 ; s erector spinae muscles . straps 52 are each stitched on one end thereof , to the elastic sleeve 14 . the other end of each strap 52 contains a strip of adhesive material 56 , commonly marketed under the trademark velcro ™. the straps may cover each rectangular window 50 . each electrode 40 is mounted on the interior of a respective strap 52 . complementary velcro ™ strips 54 secured to the elastic sleeve 14 provide secure attachment of each strap 52 to the sleeve 14 . each strip 52 can be flipped over its associated rectangular window 50 and fastened to velcro ™ strips 54 , allowing the electrode 40 , to cover it while in direct contact with the skin &# 39 ; s surface . when the sensor 24 determines that selected conditions have been met , i . e . a selected degree of improper alignment of the spinal vertebrae , the voltage signal from the sensor 24 is perceived by a calibration circuit controlling a switch which is normally &# 34 ; off .&# 34 ; voltage signals which indicate smaller angles trigger the switch to the &# 34 ; on &# 34 ; condition and will activate the stimulator . current pulses from the stimulator are conducted to the electrodes via the conduits and are passed to the muscles , causing them to contract mildly and provide forces to the vertebrae , thus providing the desired alignment . the calibration circuit allows the patient to fine - tune the exact angle at which he desires the stimulator to be triggered into the &# 34 ; on &# 34 ; condition , thereby allowing any possible anatomical variation from person to person to be implemented . furthermore , the stimulator 32 preferably has two adjustment knobs to control stimulation pulse intensity and pulse frequency , respectively . this allows different patients with different degrees of misalignment levels to adjust the amount of force applied . generally patients with severe misalignments choose higher pulse intensities and frequencies that will elicit larger forces . referring now to fig2 and 3 , the system 10 is shown applied to the body of the user 46 suffering from lower back pain . the electric stimulator 32 may be mounted on a belt 48 . a preferred stimulator 32 generally generates rectangular , charge balanced current pulses in the intensity range of 0 - 200 ma . the pulse frequency ranges from 20 to 2 , 000 hz . both pulse intensity and frequency are adjustable to allow the patient to calibrate the most comfortable range according to the severity of the misalignment and the level of contraction needed to prevent or correct the misalignment . in general , patients with severe misalignment may prefer higher intensities and frequencies of stimulation as compared to patients with milder misalignment . referring now to fig4 and 5 , a preferred embodiment of a sensor assembly , designated generally as 60 , is illustrated . the sensor assembly 60 comprises an elongated plastic member 62 of sufficient length to extend from the user &# 39 ; s upper spine to over the posterior pelvic region . the plastic member 62 is shaped , as emphasized in fig3 to match the shape of the upper spine and posterior pelvic region . plastic strips 64 , 66 are mounted at upper and lower segments of the elongated plastic member 62 . the use of this double layering at the upper and lower segments increases the stiffness of these ( upper and lower ) segments , causing most of the bending to occur in the middle segment 68 . this is desired because the middle segment 68 mounts the strain gauge assembly 70 . the strain gauge assembly 70 comprises a strain - gauge bridge mounted with cement on the middle segment 68 . the middle segment 68 matches the natural spinal curvature of the lower back ( i . e . lordosis ). the elongated member 62 is preferably , but not exclusively , formed of plastic material of about 1 . 5 - 2 mm thick and about 1 cm wide . the length will depend on the patient &# 39 ; s size . taller individuals require longer elastic sleeves as well as longer rigid members . referring now to fig6 implementation of a sensor feedback system 12 , of the present invention is illustrated . the sensor system 12 is interfaced with the patient &# 39 ; s physiology as a feedback system that will assist and correct any undesirable spine posture which the patient is not capable of correcting or controlling voluntarily . the overall patient / sensor feedback system is designated 71 in fig6 . voluntary control of the spine curvature is initiated by the brain structures 73 , which generate electrical pulses transmitted via the spinal cord and then via peripheral nerves to the paraspinal muscles 75 . the paraspinal muscles will respond to the nerve signals by contracting at appropriate levels and generating the forces necessary to create the correct alignment of the spine 77 . when the patient neglects to generate the appropriate nerve signals , and the spine thus assumes an incorrect and undesirable posture , the sensor feedback system 12 , detects the undesirable posture and consequently activate the muscles in order to correct the posture as described below and shown in fig7 . while a variety of sensors could be used to detect the deflection of the central portion of the plastic bars , strain gages are shown used , by way of example . referring now to fig7 an example of a sensor feedback system is illustrated , designated generally as 80 . the strain gages from the two plastic bars are mounted in the signal conditioning section 82 in a wheatstone configuration to linearize their output electrical signal with respect to the deflection angle of the two bars . the activation power for the strain gages is supplied from the signal conditioning section 82 as well as the amplification of the wheatstone bridge &# 39 ; s current / voltage output by an operational amplifier . the changes in the current / voltage output of the wheatstone bridge is analyzed by a threshold circuit 84 comprising an electronic comparator . the exact voltage level , corresponding to the desirable lordosis angle at which the action of the stimulator is required , can , for example , be manually set by a calibration set - up 86 including a potentiometer with an external knob , which is adjustable by the prescribing physician or the patient himself . the function of the calibration 86 and threshold circuit 84 is to remain silent as long as the patient maintains a correct posture , and to generate a voltage when the spine curvature departs from the desirable normal angle . the voltage generated when the spine curvature becomes undesirable triggers a switch 88 that , in turn , activates the stimulator 90 and delivers pulses of sufficient magnitude to the electrodes , thereby stimulating and contracting the paraspinal muscles and causing the spine to return to the normal curvature . as the patient maintains the desirable , correct posture / curvature of the spine , the threshold circuit 84 will not generate a voltage output , and the stimulator 90 will not be active . several variations to this control strategy are apparent and could be implemented , all of which revolve around the concept described above . one such variation is the addition of a timer between the switch and stimulator networks . upon the appearance of the voltage from the switch indicating incorrect spinal posture , the timer will maintain , say , five minutes of continuous cycles stimulation ( 10 seconds on and five seconds off ), regardless of the spinal posture . this can assist a group of patients with relatively weak muscles in strengthening these muscles in the early stages of rehabilitation . another practical variation is the addition of an externally and manually controlled timer that will provide 10 seconds of stimulation and five seconds rest , cycling over 10 minutes at a time when desired by the patient or when prescribed by a physician . such a mode will provide an exercise program to the patient , strengthening his muscles and thereby allowing him better voluntary control of his spinal curvature . an individual will benefit from wearing the present system during occupational activities requiring prolonged exposure to the same posture . upon detection of undesirable posture of the spine , the stimulator will be activated and apply electrical pulses to the muscles . the muscles will contract and correct the deficiency in the posture by preventing misalignment . the sensor will then detect the corrected posture and de - activate the stimulator . in addition to the modes discussed above , the system can operate in various other different modes in order to accommodate the needs of various individuals suffering from lower back pain due to postural difficulties , examples provided below : mode 1 : as the sensor detects an abnormal lordosis angle of the spine , it activates the stimulator which , in turn , will stimulate the paraspinal muscles and correct the angle . as the angle is corrected , the sensor signal will decrease below threshold and deactivate the stimulator until such time as the lordosis angle becomes abnormal again . this mode is &# 34 ; on demand &# 34 ; mode , insuring that the spinal posture is kept in the normal range at all times . mode 2 : upon detection of an abnormal lordosis angle , the sensor will generate a signal which will turn on the stimulator and will keep it on for one full minute during which the sensor signal will be ignored . after the minute has elapsed , the stimulator will turn off . if the sensor detects an abnormal lordosis angle again , the process will be repeated . this mode allows for one - minute exercise which will strengthen the paraspinal muscles and allow them to gradually become effective in performing their functions . mode 3 : as an abnormal lordosis angle is detected , the sensor will initiate a signal to the stimulator which will turn it on and provide a brief 1 - 2 seconds of stimulation . the stimulation will contract the muscles and will remind the wearer to continue to maintain his spine in the correct position using his voluntary action . this is a &# 34 ; reminder &# 34 ; mode , bringing the spine to the correct angle and allowing the patient to keep it there on his own ( without stimulator assistance ). mode 4 : another example of an &# 34 ; exercise &# 34 ; mode . the wearer will put the stimulator in the exercise mode which will trigger 5 minutes of cycled stimulation 2 seconds &# 34 ; on &# 34 ; and two seconds &# 34 ; off .&# 34 ; this will provide strengthening of the spinal muscles during work time and allow the muscles to reverse their atrophy and resume their normal function of maintaining the correct lordosis angle . obviously , many modifications and variations of the present invention are possible in light of the above teachings . it is , therefore , to be understood that within the scope of the appended claims , the invention may be practiced otherwise than as specifically described .

US-54595895-A

a board game simulating football play is set forth , wherein a rigid planar board supports a playing field demarcated in representative one hundred yard simulation defining a first and second end zone at opposed first and second ends of the playing field , with spaced first and second side line borders including slots for receiving slidable yardage markers therewithin . each player is provided a container including a matrix of compartments therewithin to receive plural pairs of dice . the dice include three pairs of dice , each of various numerations for use in simulating advance along the playing field by an offensive team , with further plural pairs of dice selectively utilized by an opposing player for simulating defensive yardage gains against an opponent . further , plural pairs of dice are provided for use in simulating field goals , kick - offs , and punt returns . a timing mechanism is provided for simulating four quarters of a representative game , wherein a highest score attained by a player defines a winner in play of the game apparatus .

with reference now to the drawings , and in particular to fig1 to 17 thereof , a new and improved football board game embodying the principles and concepts of the present invention and generally designated by the reference numeral 10 will be described . fig1 is an isometric illustration of a prior art football - type board game 1 , wherein a board surface 2 includes a yardage accounting portion 3 in association with various cards 4 for directing movement about the playing field of the board game . fig2 illustrates a further prior art football - type board game 5 , wherein the board game 6 includes a simulated playing field with a variety of decks of cards 7 to direct play throughout the simulated playing field of the board game . more specifically , the football board game 10 of the instant invention essentially comprises a rigid board member 9 defining a planar upper surface including a playing field 11 directed over a majority of the surface , with a score board 20 utilized in conventional or led ( light emitting diode ) circuitry . the score board 20 is arranged orthogonally at an upper or second end of the playing field adjacent the second end zone border 13 . the first end zone border 12 is arranged at an opposed end of the playing field , with the playing field divided to simulate and divide the playing field into representative one hundred one yard increments , including a ten yard line 11a arranged orthogonally across the playing field at each representative ten yard increment . a first side line border 14 is arranged coextensively with a first side of the playing field , and a second side line border 15 is arranged at an opposed side line of the playing field coextensively therewith . a first slot 16 is directed coextensively along the playing field with the yard markers , and includes a first yardage marker 17 slidably mounted within the first slot 16 utilizing an indicator for positioning and pointing of first yardage positioning by a first player of the game . similarly , a second slot 18 is arranged parallel to the playing field as the first slot 16 is coextensive with the one hundred yard demarcations , and includes a second yardage marker 19 with an associated indicator arrow arranged orthogonally relative to the second slot , as the first yardage marker indicator arrows is arranged orthogonally relative to the first slot for indication of an associated yardage position of a respective second player . the score board 20 includes a first team score button 21 associated with a first team score display 27 for indication of point total of a first team or player . a second team score button 22 is arranged for effecting display of a second team score display 29 . a quarter indicator display 22 indicates a particular quarter of play , ( i . e . one through four ) and utilizes an associated quarter indicator display button 28a for effecting display of a first through fourth quarter . a reset button 23 directs a time indicator screen 30 to reset to a fifteen minute interval in association with each quarter of play , wherein each quarter of play is directed at fifteen minutes . an offensive play button 24 is provided that is depressed with each offensive play of an associated game to remove twenty - five seconds from the fifteen minute display of the time indicator screen 30 , wherein the offensive play button 24 is depressed prior to commencement of an offensive play by one of the players in an offensive mode directing play towards an opposing goal . a punt and field goal button 25 is depressed prior to a punt or field goal being initiated within the playing of the game and removes ten seconds from the time indicator screen 30 . a time - out button 26 when depressed removes five seconds from the time indicator screen 30 . each player is at the outset of the game awarded three time - out tokens 43 ( see fig1 ) and each player may utilize up to there tokens during each half , or consecutive two quarters of play ( i . e . quarters one and two , or quarters three and four ). the time - out tokens are utilized to minimize usage of playing time during play of the game for associated simulation of a real football game scenario . each player is provided a compartmentalized player container 31 including a matrix of compartments therewithin . particularly , twelve compartments are provided . three offensive die pair compartments 32 of the twelve compartments include three separate die pair for use in directing offensive play throughout a game . three defensive die pair compartments 33 each include a defensive die pair . the offensive and defensive die pairs are illustrated in fig4 - 9 respectively , with fig4 - 6 indicating the use and indicia utilized by the three individual die pairs , wherein fig7 - 9 indicate the use of the three individual die pairs for defensive play . compartment 34 includes a kick - off die pair compartment illustrated in fig1 . fig1 illustrates a punt die pair for positioning within a punt die pair compartment 35 . a kick return die pair 36 compartment is provided for reception of a die pair , as illustrated in fig1 , and a field goal die pair compartment 37 receives a die pair , as illustrated in fig1 . further , a chance die compartment 38 is provided for optional play by an individual when two players are not available . the chance die ( not illustrated ) is provided to direct use of one of the three respective offensive and defensive die pair 44 - 46 and 47 - 49 . the chance die pair would for example be a six - sided die in a manner as the remainder of the die , and include two number ones , two number twos , and two number threes for indication of use of a respective first , second , or third associated offensive or defensive die pair . each player container 31 includes a lid 40 hingedly mounted about a pivot hinge 41 to obscure vision of die pair selection from an opposing player , whereupon a defensive player selection of an associated die pair 47 - 49 is not dependent upon visual observation of the opposing defensive die selection 44 - 46 . each player is provided a throwing tray 42 , as illustrated in fig1 for example , wherein the throwing tray 42 includes vertical walls in surrounding relationship to a floor , wherein the die pair are directed to permit directing the die pair onto the playing field to inadvertently impact with a respective first or second yardage marker 17 or 19 , or impact with an opposing player &# 39 ; s die and thereby contain movement of the thrown die pair within the associated throwing 42 . the first offensive die pair 44 each include the digits three , five , seven , eight , ten , and eleven . each die of the second offensive die pair 45 each include the digits zero , four , six , eight , twelve , and fifteen . each die of the third offensive die pair 46 include the digits zero , zero , six , ten , fifteen , and twenty . each die of the first defensive die pair 48 include the digits two , four , five , seven , eight , and ten . each die of the second defensive die pair 47 include the digits zero , three , five , seven , ten , and twelve . each die of the third defensive die pair 49 include the digits zero , zero , seven , nine , twelve , and fifteen . it is noted that the die pair of the offensive and defensive die pair with the largest digits , i . e . die pair three of the offensive and defensive die pairs , also include the greater number of zeros , wherein the die pair including digits of a medial range such as the first die pair of each offensive and defensive die pair ensure a medial total and thereby ensure a simulated yard total for offensive and defensive player while not providing a greater potential yardage total when a player risks the zero digits of the second and third die pair of the offensive and defensive die pair . in a similar manner , the kick - off yardage die pair 50 indicates a total yardage by a player in a kick - off position , wherein each die of the kick - off yardage die pair include the numbers twenty - five , twenty - five , thirty , thirty , thirty - five , and thirty - five . accordingly , a total kick - off yardage will range from fifty to seventy yards . the punt yardage die pair 51 each include a die including the digits ten , fifteen , twenty , twenty - five , thirty , and thirty - five . the return yardage die pair 52 include die each including the digits two , four , six , ten , twelve , and sixteen . the die pair 44 - 52 accordingly indicate a total yardage to be awarded . the field goal die pair 53 each include a die with the digits ten , fifteen , twenty , twenty - five , thirty , and thirty - five . a coin is tossed by one player of the opposing first and second players , whereupon in this example , the second player chooses and a correct choice by the second player affords that player the opportunity of choosing an offensive or defense posture in initiating play of the game . accordingly , the kicking team or offensive mode of a player , initiates play from their own thirty - five yard line along the playing field . the second player for example then will roll the kick - off die pair 50 to determine how far the ball will be directed along the playing field . for example , should the second player roll a thirty on one die and a thirty on the other die , a total of sixty yards is directed . the opposing player at that juncture rolls the return yardage die pair 52 , where for example a six and a sixteen may be rolled , whereupon twenty - two yards is substracted from the sixty yards . alternatively , the kicking player directs the kicked ball to the opposing player &# 39 ; s five yard line , whereupon the twenty - two yards directed by the return yardage die pair 52 ( i . e . twenty - two yards ) is added to the five yard line , whereupon play is begun at yhe twenty - seven yard line . accordingly , the offensive player begins with a first down and a ten at the twenty - seven yard line . the kick - offs take ten seconds from the clock so the time remaining in the first quarter will be fourteen minutes and fifty seconds . the offensive player selects a number three offensive , or the third offensive die pair 46 . the defensive player selects the number three defensive or the third defensive die pair 49 . the offensive player rolls a six and a twenty for twenty - six , wherein the defensive playe rolls a seven and a nine for sixteen . accordingly , sixteen yards is deducted from twenty - six yards for a net gain of ten yards by the offensive player to the thirty - seven yard line for a first down . this sequence is repeated until an offensive player attains a touchdown or is directed to punt the ball or kick the field goal . in attempting a punt , the offensive player for example may have the ball on a fourth down and one yard to go at the forty - six yard line . in deciding to punt , the offensive team directs the punt yardage die pair 51 into an associated throwing tray 42 , wherein for example , when 5 labeling fig1 missing a punt is attempted a 20 and 25 are rolled equaling 45 wherein 45 yards from the player &# 39 ; s own 46 leaves the ball on the nine yard line . the return team rolls a 10 and 12 equaling 22 and moves the ball to the 31 yard line to effect a first down and ten yards to go . it should be noted that if the punt had traversed into the end zone , the new offensive player could have either put the fictitious ball at his own twenty yard line as an alternative to throwing the return yardage die pair 52 . a punt and a return each deduct five seconds from the time indicator screen 30 . to attempt a field goal , if an offensive team for example positions the ball at the twenty - three yard line of an opposing player and decides to attempt a field goal , the field goal die pair 53 are directed into the throwing tray 42 and for example may obtain a fifteen and twenty - five to equal forty . the field goal or three points is awarded that player . in a field goal scenario , ten yards is added to the position of the offensive team , wherein accordingly the ball by the example being on the twenty - three yard line with ten yards added requires a total of thirty - three or greater , whereupon the aforenoted example of forty being obtained provides for an acceptable field goal attempt . should the point total have been less than thirty - three , the field goal would not have been awarded . it is contemplated that contrasting colors be awarded each opposing team for ease of recognition of various die pair and yardage markers utilized . accordingly , a color coordination could be set forth such as black and yellow for a first team and red and white for an opposing team as an example . as to the manner of usage and operation of the instant invention , the same should be apparent from the above disclosure , and accordingly no further discussion relative to the manner of usage and operation of the instant invention shall be provided . with respect to the above description then , it is to be realized that the optimum dimensional relationships for the parts of the invention , to include variations in size , materials , shape , form , function and manner of operation , assembly and use , are deemed readily apparent and obvious to one skilled in the art , and all equivalent relationships to those illustrated in the drawings and described in the specification are intended to be encompassed by the present invention . therefore , the foregoing is considered as illustrative only of the principles of the invention . further , since numerous modifications and changes will readily occur to those skilled in the art , it is not desired to limit the invention to the exact construction and operation shown and described , and accordingly , all suitable modifications and equivalents may be resorted to , falling within the scope of the invention .

US-51980490-A

a thermoplastic polyurethaneurea having free amino groups is the reaction product of a diisocyanate , a fluorinated polyol , a non - fluorinated polyol and a polyamine . the invention includes a shaped polymeric support structure having the thermoplastic polyurethaneurea coated thereon and a medical article comprising the coated support and heparin covalently bonded to the free amino groups of the coated support . in another aspect of the invention , a method for preparing the heparinized medical article is provided .

while this invention is satisfied by embodiments in many different forms , there will herein be described in detail preferred embodiments of the invention , with the understanding that the present disclosure is to be considered as exemplary of the principles of the invention and is not intended to limit the invention to the embodiments described . the scope of the invention will be measured by the appended claims and their equivalents . the fpuu coatings of the invention which are suitable for heparinization include three essential components , a diisocyanate , an fpg and a polyamine . preferred coatings additionally contain a nonfluorinated polyol . suitable diisocyanates are aromatic diisocyanates such as mdi , 3 , 3 &# 39 ;- diphenylmethanediisocyanate , alicyclic diisocyanates such as isophorone diisocyanate and 4 - 4 &# 39 ;- dicyclohexylmethanediisocyanate , and aliphatic diisocyanates , as , for example , hexamethylene diisocyanate . the most preferred diisocyanate is mdi . the quantity of isocyanate which may be used may be expressed in terms of the conventional isocyanate index . the index is preferably kept below 100 to maximize the number of free amino end groups retained on the fpuu for heparin attachment . thus , the isocyanate index may be about 40 - 99 , preferably about 65 to 95 , most preferably about 75 to 90 . any polyether glycol having from about 10 to 70 % fluorine by weight may serve as the fpg . all percentages herein are by weight unless otherwise stated . preferred fpgs have from about 30 - 60 % by weight of fluorine in pendant perfluoroalkyl groups and are of the following general formula : ## str1 ## wherein r may be a perfluorinated alkyl group having from about 1 to 12 carbon atoms , x may be from about 1 to 4 , y may be from about 0 to 20 and z may be from about 2 to 5 . in preferred fpgs , r may be from about 4 to 10 carbon atoms . most preferably , r is a perfluorohexyl group . fluorinated polyols of the invention are available from e . i . dupont de nemours co ., wilmington , del . the pao may be , for example , polyethylene glycol , polypropylene glycol , ptmeg and the like or mixtures thereof . preferred polyols are ptmeg having a molecular weight of from about 500 to about 5000 . the most preferred pao is a ptmeg having a molecular weight of about 1000 to 2000 . such polyols are commercially available from dupont as terathane 1000 and 2000 respectively . if it is desired to include a polyester glycol in the nonfluorinated glycol component of the fpuu , suitable glycols are , for example , polyethylene adipate and polycaprolactone . the percentage of the fpg in the total glycol content may be about 0 . 1 % to 100 %. preferably the weight percentage of the fpg is about 5 to 40 %. the polyamine component may be any material or mixture of materials which confers free amino end groups to the fpuu of the invention . suitable polyamines are , for example , diamines of about 2 to 20 carbon atoms . exemplary of suitable diamines are hexamethylenediamine , octamethylenediamine , dodecamethylenediamine and 2 - methylpentamethylenediamine . diaminopolyethers may also be used . exemplary of suitable diaminopolyethers is jeffamine ed 600 , a poly ( oxyethylene ) based diamine available from texaco chemical co ., ( bellair , tex . 77401 ). the weight percentage of the polyamine in the fpuu may be from about 1 to 70 , preferably about 5 to 30 % of the total weight of the fpuu . the fpuu of the invention may be prepared by a one - step polymerization method or , preferably by a two - step method proceeding through a prepolymer . in the one - step method , the glycol mixture and polyamine are combined and , with vigorous agitation , the diisocyanate is added all at once . in the prepolymer method , the glycol mixture is reacted with the diisocyanate to give a prepolymer having terminal isocyanate groups . the isocyanate - terminated prepolymer may then be reacted with the diamine to give an fpuu having amino end groups , or preferably , as described below , the prepolymer may be coated onto the polymeric support structure prior to amination . it is readily seen that , by either procedure , the fluorine atoms are part of the polyurethaneurea chains in contrast to prior art formulations in which the fluorine atoms are only on the surface of the polymer chains . the polymeric materials used in the invention as the solid support structure may be selected from a wide range of polymeric materials . the surface of the solid support may or may not be modified depending on each of the individual materials . illustrative plastic materials useful as the support structure may be selected from the group consisting of polyethylene , polypropylene , polyurethane , polyurethane - silicone copolymer , polyurethaneurea , polycarbonate , silicone rubber , polyester , nylon , natural rubber , polyvinyl chloride , acrylic , polystyrene , copolymers of polycarbonate and silicone rubber and mixtures thereof . the preferred support structure is a polyurethane or polyurethaneurea . the particular form of the solid support structure does not constitute a critical aspect of this invention other than to serve as a support for further treatment according to the inventive process . preferably , the support structure is molded , cast or extruded to the desired shape of the final device prior to applying the coating of amine - rich fpuu or isocyanate terminated prepolymer . most preferably , the support structure is molded into the shape of a catheter , vascular graft or vascular prosthesis . any suitable process may be used to coat the polymeric support structure with the amine - rich fpuu . for example , the amine - rich fpuu may be brushed or sprayed onto the support structure . a preferred method is to prepare a solution of the amine - rich fpuu in a suitable solvent , as , for example , alcohol , methylene chloride , tetrahydrofuran , dimethyl sulfoxide n - methylpyrrolidone or dimethyl formamide or mixtures thereof . the support structure may then be dipped or steeped in the solution for about 0 . 5 to 30 minutes at a temperature of about 0 ° c . up to the boiling point of the solvent , preferably for about 0 . 5 to 5 minutes at room temperature . the coating thereby bonds to the support structure surface , and the amino groups provide a site for covalent attachment of the antithrombogenic agent . most preferably , the preferred polyurethane or polyurethaneurea support structure is coated by dipping , for about 5 to 30 minutes at a temperature of about 25 ° to 75 ° c ., preferably about 30 ° to 70 ° c ., into a solvent solution of the prepolymer having terminal isocyanate groups . in this sequence of reaction steps , bonding of the fpuu to the support structure is enhanced by reaction of some of the isocyanate groups of the prepolymer with the support structure . the coated support structure may then be dipped into a solvent solution of the polyamine for about 15 to 35 minutes at a temperature of about 25 ° to 60 ° c ., preferably about 40 ° to 50 ° c ., to react the remaining isocyanate groups with the polyamine to give a support structure having amino end groups for attachment of the antithrombogenic agent . the support structure coated with amine - rich fpuu as described above may be treated with the antithrombogenic agent . the term antithrombogenic agent as used herein refers to any material which inhibits thrombus formation on the surface of the support structure , such as by reducing platelet aggregation , dissolving fibrin , enhancing passivating protein deposition , or inhibiting one or more steps within the coagulation cascade . illustrative antithrombogenic materials may be selected from the group consisting of heparin , prostaglandins , sulfated polysaccharides , and mixtures thereof . heparin is preferred . preferably , the antithrombogenic agent may be chemically modified to introduce a functional group for enhancement of covalent bonding to the free amino groups of the fpuu . activation of the antithrombogenic agent may be performed in various ways , preferably by chemical modification with oxidizing or reducing agents . most preferably , heparin may be oxidized to give an aldelyde - modified heparin . reaction of the aldehyde group with the free amino group of the fpuu gives a schiff &# 39 ; s base which may be reduced to covalently bond the heparin to the fpuu . the aldehyde group of the activated heparin and the amino groups may conveniently be reacted by steeping the support having the amine - rich fpuu thereon in a solution of the activated heparin and the reducing agent . preferably , the support may be maintained at about 20 ° to 50 ° c . in an aqueous solution of about 0 . 1 to 15 % by weight of the aldehyde - modified heparin containing about 1 to 30 % sodium cyanoborohydride for about 0 . 5 to 35 hours . upon completion of the antithrombogenic coupling reaction , the surface may be washed with water to remove loosely bound or unreacted antithrombogenic agent . washing may be optionally performed with an isotonic solution . the quantity of heparin thereby covalently bound to the substrate surface may be from about 10 to 80 μg / cm 2 . it is believed , although not yet substantiated , that the enhanced antithrombogenic activity of the heparinized device of the invention is due to an enhanced hydrophobic character imparted to the fpuu surface by the fluorine atoms . thus , the fluorine atoms minimize the interaction of the hydrophilic antithrombogenic group ( e . g ., heparin molecules ) causing the latter to stay extended outwardly from the substrate surface , thereby making them more available for contacting blood and consequently more active in preventing thrombus formation . it should be recognized that the products of this invention are useable in a wide variety of devices designed for contacting body fluids . exemplary articles which can be in contact with body fluids such as blood , include artificial organs , vascular grafts , probes , cannulas , catheters , hemodialysis tubing , hyperalimentation catheters and other long - indwelling vascular catheters , and the like . a particularly preferred application , of the products of the invention is in catheter type devices wherein the inventive compositions are coated on either or both of the interior and exterior surfaces of the catheter . the invention will be further illustrated by the following non - limiting examples . fluorinated polyol was first dissolved in methylene chloride . mdi was then added to the mixture . after fifteen minutes agitation , another polyol , such as polyethylene glycol , polypropylene glycol or polytetramethylene glycol , was added . the temperature of the reaction was controlled at 70 °± 10 ° c . an additional increment of mdi was added to the above mixture with continuous stirring . after two hours agitation , the resin mixture was cooled . depending on the proportions of polyol and mdi employed , the prepolymer as prepared above may have from about 1 to 20 % free isocyanate . samples of polyurethane tubing were dipped into a 40 % by weight solution of a prepolymer having 9 . 5 % free isocyanate prepared in accordance with example i from ptmeg of molecular weight 2000 . the tubing was maintained in contact with the prepolymer for 15 minutes under a nitrogen atmosphere , then removed from the solution and the solvent flashed off . the tubing coated with isocyanate - terminated prepolymer from example ii was placed in a 25 ° c . enclosed environment for 30 minutes to flash the solvent . during the flash - off period , the atmosphere was continuously flushed with nitrogen . after 30 minutes , the tubing was transferred to a 20 % solution of hexamethylenediamine at 50 ° c . after five minutes the tubing was removed and placed in a continuous flow water rinse for up to 48 hours to remove any non - covalently bound diamine . one hundred - fifty ( 150 ) mls of methylene chloride was used to dissolve 19 grams of fluoropolyether glycol . in another container , 10 . 5 grams of mdi was added to 100 ml of 1 - methyl - 2 - pyrrolidinone . the latter was then added to the former . after 15 minutes , 188 grams of ptmo was added . an additional 43 grams of mdi was added and stirred coninuously . after two hours of agitation , the reaction mixture was cooled to about 25 ° c . 1 , 6 - hexanediamine in 400 ml of 1 - methyl - 2 - pyrrolidinone was added slowly to the above mixture . an additional 400 ml of 1 - methyl - 2 - pyrrolidinone was then added and the mixture mixed to homogeneiety . a polyurethane tubing was dipped into the homogeneous mixture for one minute , withdrawn and the solvent removed . seventy - five ( 75 ) mls of water were added to a beaker which contained 150 mls of 1 % 3 h - heparin solution . then 1 . 5 grams of sodium acetate was transferred to the beaker . the ph of this solution was adjusted to 4 . 5 with glacial acetic acid . sodium periodate ( naio 4 ) in the amount of 0 . 075 grams was added and the solution was reacted for 20 minutes in a light protected reaction vessel with constant stirring . at the end of the reaction , 2 . 26 grams of glycerin was added to neutralize any remaining periodate . the solution was dried down overnight under nitrogen . then the solution was reconstituted to 2 % and the ph of the solution was adjusted to 6 . 6 by the dropwise addition of 10 n naoh . the aldehyde activated 3 h - heparin solution was ready for bonding to the amine compound . it should be noted that other types of radioactive labeled heparin other than 3 h are useful . 7 . 5 grams of heparin was dissolved in 1125 mls of distilled water . three ( 3 . 0 ) grams of sodium acetate was weighed and transferred to the heparin solution . the ph of this solution was then adjusted to 4 . 5 with glacial acetic acid . sodium periodate ( naio 4 ) was added in the amount of 0 . 375 grams and the solution was reacted for 20 minutes in a light protected reaction vessel with constant stirring . at the end of the reaction , 11 . 30 grams of glycerin was added to neutralize any remaining periodate . then the solution was reconstituted to 2 %. the ph of the solution was adjusted to 6 . 6 by the dropwise addition of 10 n naoh . the aldehyde activated heparin solution was ready for bonding to the amine compound . the amine rich substrate from example iii was immersed in a stirred 2 % aqueous solution of aldehyde - activated heparin containing 0 . 025 g of sodium cyanoborohydride at ph 6 ° and 50 ° c . for 2 hours . the samples were removed from the bath and placed in a 3 m saline solution for one hour to remove any loosely bonded or absorbed heparin . by conducting an identical experiment with radiolabeled heparin , the quantity of covalently bound heparin may easily be determined .

US-36801389-A

a large capacity elevator - type napkin dispenser comprising an elongated supporting structure or cage composed of a series of spaced rod - like vertical supports . a stack of folded napkins is supported on a pressure plate that is mounted on a carriage adapted to slide vertically within the cage . the pressure plate is supported from the carriage by a plurality of compression springs which enable the pressure plate to float and accommodate the varying thickness of the stack of folded napkins . a cover is mounted on the upper end of the cage and has an opening through which the napkins are dispensed . the pressure plate and stack of napkins are urged upwardly toward the undersurface of the cover by a biasing mechanism that includes a pair of extension springs . the springs have a varying spring rate so that the force of the springs will be greatest when the pressure plate is fully loaded with napkins .

the drawings show a free - standing or floor model type of napkin dispenser such as that used in fast food establishments or cafeterias . the dispenser includes a weighted base 1 which rests in the ground , and a sheet metal base plate 2 is secured to the base 1 by screws 3 . as shown in fig2 the base plate 2 is provided with an upstanding peripheral flange 4 . a vertical wire cage , indicated generally by 5 , is supported on the base plate 2 , and the cage is composed of a pair of rod - like , generally u - shaped cross members 6 and a pair of similar u - shaped longitudinal members 7 . to secure the members 6 and 7 to the base plate 2 , a bracket 8 is positioned centrally of the base plate and the horizontal portions of the cross members 6 are positioned against the side edges of the bracket , while the horizontal portions of the longitudinal member 7 rest across the horizontal sections of members 6 and are received within the edge channels 9 of the bracket . the bracket 8 is secured to the base plate through a bolt 10 to thereby position the vertical legs of members 6 and 7 of cage 5 in the proper spaced relationship . located inwardly of each end of the base plate 2 is a support plate 11 , and each end of each guide support is provided with a pair of upstanding tabs 12 which are spaced from the flange 4 on the base plate 2 . the support plate 11 is welded or otherwise secured to the base plate and the central portion 13 of each support plate 11 is offset upwardly and is provided with a hole 14 which receives the lower end of a cylindrical guide rod 15 . the cage 5 also includes an upper rectangular support 16 to which the upper ends of the members 6 and 7 are attached . as best shown in fig6 the upper support 16 has a generally channel - shaped cross section , and the upper free ends of the members 6 and 7 are received within notches 17 formed in the lower flange of the support 16 and are secured to the web portion of the support 16 by welding or other fastening means . the vertical guide rods 15 are offset outward of the vertical legs of the members 7 , as shown in fig7 and to connect the upper ends of the guide rods to support member 16 , the ends of the support member are provided with outwardly facing channel sections 18 and the upper end of each guide rod extends through a hole 19 in the lower flange of the channel section 18 to retain the guide rod in position . the cage 5 is enclosed by an outer housing which is composed of four vertical corner members 20 , and four side panels 21 . the lower ends of the corner members are received within the spaces between the upstanding flange 4 on the base plate and the tabs 12 on the supports 11 , and the vertical side edges of the corner members 20 are formed with slots 22 which receive the side edges of the panels 21 . as illustrated in fig6 the upper ends of the corner members 20 and the upper edges of the panels 21 are secured to the upper support 16 through a collar 23 , which is connected to the support member through a plurality of screws . a cover 24 is hinged to one of the side edges of collar 23 by hinge 25 , and the cover 24 is provided with a central opening 26 through which the napkins are to be dispensed . to lock the cover 24 to the collar 23 , one edge of the collar is provided with an upstanding flange 27 , and a detent 28 , which is carried by one end of a leaf spring 29 that is secured to the inner surface of the flange 27 , extends through an opening in the flange and is adapted to be received within a hole 30 in the peripheral edge of the cover . as the cover is closed , the rounded outer end of the detent 28 will ride against the edge of the cover , depressing the detent against the force of the spring 29 , and the detent which will then snap into engagement with the hole 30 to lock the cover to the collar . in accordance with the invention , a stack of napkins 31 are supported by a floating pressure plate 32 which is guided for movement within the vertical legs of the members 6 and 7 of cage 5 . the pressure plate 32 is supported above a channel - shaped carriage 33 by a pair of coil springs 34 . plate 32 is provided with two pair of punched out tabs 35 which receive the upper ends of springs 34 and similarly , the web portion 36 of carriage 33 is provided with punched out tabs 37 which receive and secure the lower end of springs 34 . as the springs 34 constitute the sole support for the pressure plate 32 , the pressure plate can float within the cage in order to accommodate the varying thickness of the stack of napkins . each individual napkin will vary in thickness from end - to - end and side - to - side depending upon the number and nature of folds . because of this , there can be a considerable different in thickness of the stack from side - to - side or end - to - end and the floating pressure plate 32 will accommodate this variation in stack thickness . the carriage is mounted for sliding movement on the guide rods 15 by a pair of vertically spaced wire forms 38 . each wire form 38 is provided with a central rod - like section 39 which terminates at each end in a ring 40 which receives the respective guide rods . each rod - like section 39 is formed with a pair of flat areas 41 which can be secured to the vertical flange of the channel - shaped carriage 33 . as shown in fig6 one of the wire forms 38 is secured to one of the side flanges of the carriage , while the other wire form is secured to the opposite flange in order to provide a balanced effect and prevent jamming of the rings 40 on the guide rods 15 , as the carriage 33 is raised and lowered . holes 14 and 19 are oversized so that the guide rods can move freely within the holes in a lateral direction to prevent binding of the carriage . the invention includes a mechanism to bias the pressure plate 32 to an upper position , and as the pressure plate is lowered by the insertion of a stack of napkins , the pressure plate will be locked in the lowered position . as the dispenser is designed to contain approximately 800 napkins , the locking mechanism enables the operator , with the cover 24 open , to place a stack of napkins on the pressure plate and depress the pressure plate , and the pressure plate will be held in the depressed position until the operator can place a second stack of napkins on the original stack . thus , the dispenser is loaded in increments , and the pressure plate and carriage will be automatically locked as the pressure plate is lowered . to bias the pressure plate 32 upwardly toward the opening 26 in the cover 24 , a pair of cables 42 are secured on each side of the carriage to tabs 43 on extensions 44 that extends outwardly from the side flanges of the carriage 33 . each cable 42 extends upwardly over a pulley 45 that is mounted for rotation on the upper support member 16 , and then downwardly around a second pulley 46 and is dead - ended on tab 47 on the upper support member 16 . as best illustrated in fig2 the pulley 46 is mounted on a bracket 48 , and an extension spring 49 is connected between the bracket 48 and the lower support plate 11 . thus , the force of the springs 49 will act to urge the carriage 33 and pressure plate 32 upwardly . springs 49 are designed with a varying spring rate so that the force of the springs will be greatest when they are in an extended condition when the pressure plate is at its lowermost position within the cage 5 . as the pressure plate 32 is raised , the springs 49 will contract so that the spring force will be at its smallest magnitude when the pressure plate is at its uppermost position within the cage . to automatically lock the pressure plate in position as it is lowered by the insertion of a stack of napkins , the wire or cable 42 passes between a pair of clamping jaws 50 and 51 . the jaw 50 is fixed to the upper support member 16 , and extends generally parallel to the cable 42 . jaw 51 has a generally curved configuration and is located at the outer end of a bracket 52 which is pivoted to the upper support member 16 at pivot 53 . the clamping surface of jaw 51 is knurled or roughened so that it can effectively grip the cable 42 . as the jaw 51 is pivoted counterclockwise or downwardly , as shown in fig6 the jaw 51 will be brought into engagement with the cable to grip the cable with a camming or wedging action . pivotal movement of the jaw 51 in the opposite or clockwise direction will release the clamping action . this construction provides a one - way lock to permit the cable 42 to move upwardly between the closed jaws 50 and 51 as the pressure plate 32 is lowered , but prevents the cable from moving in the opposite direction under the force of the spring 49 so that the pressure plate will be locked in the lowered position . thus , as each small stack or bundle of napkins is placed on the pressure plate and the pressure plate is lowered , the cable will freely pass between the jaws 50 and 51 to permit lowering of the pressure plate . when manual pressure is released , the cable will not be able to move in the opposite direction so the pressure plate will be retained in its lowered position . the jaw 51 is automatically moved to a release position on closing of the cover . in this regard , a pair of latches 54 are mounted for sliding movement relative to the upper support member 16 . as shown in fig6 the upper end of each latch 54 is formed with a flange 55 while the lower diagonal edge 56 of each latch is disposed in engagement with the flange 57 on the respective pivot bracket 52 . to mount the latch 54 for sliding movement relative to the upper support member 16 , a rivet 58 is connected to the latch and extends through a vertical slot 59 in the web portion of the support member 16 . as the cover 24 is moved to its closed position , abutments 60 located at diagonally opposite locations on the undersurface of the cover will engage the respective flanges 55 of latches 54 to move the latches downwardly , thereby pivoting each bracket upwardly , as shown by the phantom position in fig6 and moving the respective jaw 51 to the release position . with the jaw 51 released , the springs 49 will then act to urge the pressure plate upwardly to a position where the uppermost napkin in the stack will engage the undersurface of the cover . as the napkins are progressively withdrawn through the opening 26 , the force of the spring will continuously urge the napkins against the undersurface of the cover . while the above description has shown the napkin dispenser as a free standing floor model , it is also contemplated that the dispenser can be used as a countertop model in which the cage 5 , with or without the outer housing , can be located within an opening in the counter . in this case , the weighted base 1 would not be required and the collar 23 would be provided with an outwardly extending flange which would be secured to the upper surface of the counter . fig9 and 10 illustrate a modified form of the invention in which the cover is provided with hinged lid sections . as shown in fig9 the collar 62 , which corresponds to the collar 23 of the first embodiment , is provided with a central opening 63 bordered by an upstanding flange 64 . a pair of cover sections 65 are hinged to the opposite portions of the flange 64 , in a manner such that the cover sections can be pivoted inwardly as a bundle of napkins is inserted into the dispenser . more specifically , each cover section 65 is provided with a central plate 66 , a rear flange 67 and a pair of side tabs 68 . as shown in fig9 the side tabs 68 are pivoted to the flange 64 by pins 69 . to urge each cover section 65 to an upper or closed position , a torsion spring 70 is utilized , and one end of each spring bears against the flange 64 of collar 62 , while the opposite end of the spring bears against the undersurface of the cover section 66 , thereby urging the cover section to an upward position . engagement of the lower end of the rear flange 67 with the upper surface of the collar limits the upper or closed position of the cover section , as shown in fig1 . to insert a bundle of napkins into the dispenser , the operator pushes downwardly against the cover sections 65 , causing the cover sections to pivot inwardly to an open position , as shown by the phantom lines in fig1 . when the operator withdraws his hand , the cover sections will pivot back to their original closed position under the force of the torsion springs 70 to hold the napkins within the dispenser . the dispenser of the embodiment shown in fig9 to 10 , utilizes the identical biasing arrangement as shown in the first embodiment in which the springs 49 will urge the pressure plate 32 upwardly toward the undersurface of the cover sections 65 . however , this embodiment does not require the locking mechanism , such as provided by jaws 50 and 51 , due to the fact that the cover section itself will provide a stop to prevent the stack of napkins being ejected from the dispenser under the force of the spring . the embodiment shown in fig9 to 19 also utilizes the identical cage and frame construction as described with respect to the first embodiment . the dispenser of the invention is adapted to contain a substantial quantity of napkins , generally around 800 , depending on the size of the napkins . because of this , the dispenser has particular application for use in fast food establishments and cafeterias . the guide system , as utilized in the dispenser of the invention , provides a smooth and more dependable sliding operation for the pressure plate than that utilized by prior types of dispensers . the pressure plate is supported solely by the coil springs 34 which provide a free floating action for the pressure plate to accommodate for variations in the napkin thickness . furthermore , the springs 49 are provided with a varying spring rate , so that the force of the springs will progressively decrease as the pressure plate moves upwardly with a decreasing load of napkins . the locking mechanism provided by jaws 50 and 51 , as illustrated in the first embodiment , provides an infinite degree of locking . in prior art types of dispensers , locking was provided through the use of ratchet teeth which were spaced along the length of the locking member and the ratchet tooth system provides only a limited number of locking positions for the pressure plate . in contrast , the present device provides a positive lock at all positions of the pressure plate , thereby eliminating any tendency for the pressure plate to jump under the force of the springs until it finds a locking position . the wire cage frame construction is a less expensive framework than that employed in prior types of dispensers and due to the cylindrical or rod - like nature of the frame members 6 and 7 , provides less frictional resistance to the movement of the stack of napkins . further , the cage is adaptable for various sizes of folded napkins . various modes of carrying out the invention are contemplated as being within the scope of the following claims particularly pointing out and distinctly claiming the subject matter which is regarded as the invention .

US-5678279-A

the invention relates to the field of connectors for connecting a container with a fluid preparation device for preparing a fluid , in particular a container with a concentrate for the preparation of dialysis fluid . in order to simplify the handling during both the manufacturing process of such containers and the connection of such containers to the fluid preparation devices , the invention proposes a design of a connector for connecting a first and second fluid line of the container with a third and fourth fluid line of the fluid preparation device with two lateraly spaced - apart mounting means which each incorporate one of two orifices terminating the first and second fluid lines . the invention also concerns a corresponding container and fluid preparation device .

further scope of applicability of the present invention will become apparent from the detailed description given hereinafter . however , it should be understood that the detailed description and specific examples , while indicating preferred embodiments of the invention , are given by way of illustration only , since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description . in fig1 an embodiment of a connector according to the invention is shown in a perspective view . the connector 1 has two bar - like , laterally spaced - apart connecting parts or mounting means 2 and 4 . such mounting means may easily be mounted to a mating mounting means by insertion in an axial direction . the interior of the mounting means 2 an 4 is hollow thus defining first and second orifices 3 and 5 . the connector 1 has a boat - like cross - section with a wide middle part 6 and two wing - like projections 7 and 8 on opposing sides of the middle part 6 . the boat - like cross - section simplifies the joining of the connector to a containment portion of a container like a flexible tube bag considerably , as is known in the art of manufacturing flexible bags . for welding purposes there may therefore be provided a rip structure 19 at the lower end 16 of the connector 1 . the middle part 6 of the boat - like cross - section shows a fifth orifice 11 which extends from the upper end 17 to the lower end 16 . the orifice 11 may be used for prefilling the containment portion to be joined to the connector during the manufacturing process with a substance . the mounting means 2 and 4 protrude from the wing - like projections 7 and 8 by protrusions 28 and 29 in a direction which is perpendicular to the axes of the mounting means 2 and 4 and thus also to the axes of the orifices 3 , 5 and 11 , which are all parallel . in the embodiment shown in fig1 , the protrusions 28 and 29 are tangential to one side of the wing - like projections 7 and 8 . furthermore , a first end 13 of a handle 12 is joined to the first mounting means 2 and a second end 14 of the handle 12 is joined to the second mounting means 4 . to ease the use of the handle 12 the ends 13 and 14 may comprise flexible film joints . the connector 1 also comprises a ledge 15 which joins the second mounting means 4 with the middle part 6 of the connector 1 . this ledge 15 , as will be outlined below , serves as a counterpart for a detector means at the mating connectors site for confirming the correct mount of the connector . in fig2 a sectional view of the container 1 is shown where the middle part 6 and the wing - like projections 7 and 8 are cut along their middle , and the view is from the back as seen in fig1 . the connector 1 extends from the lower end 16 to the upper end 17 . in the middle part the continuous orifice 11 for enabling an easy prefilling of the containment portion to be joined to the lower end 16 of the container is seen . in the first wing - like projection 7 there is also a continuous third orifice 9 and in the second wing - like projection 8 a continuous fourth orifice 10 . though the third and fourth orifice 9 and 10 have a varying cross - section along their extensions from the lower end 16 to the upper 17 of the container 1 , this has no influence on the fact that a fluid communication is established along these extensions . the third orifice 9 extents to a first distribution chamber 20 and the fourth orifice 10 to a second distribution chamber 21 . as can be seen in fig1 the distribution chambers 20 and 21 are in fluid communication with the first and second orifices 3 and 5 by slots 22 and 23 , respectively . by mounting the connector 1 in a mating mounting means to be described below , fluid communication is thus established from the first orifice 3 to the third orifice 9 which hence constitutes a first fluid line , and from the second orifice 5 to the fourth orifice 10 which constitutes a second fluid line . fig3 shows a further sectional view along the line a — a as indicated in fig2 . in this view the protrusions 28 and 29 of the two mounting means 2 and 4 and thus the first and second orifices 3 and 5 in a direction perpendicular to the vertical extension of the wing - like projections 7 and 8 and the middle part 6 of the connector 1 are displayed more clearly . in an embodiment of a container according to the invention the connector 1 shown in fig1 to 3 is representing the connector portion , the lower end 16 to be joined to a containment portion of the container . for this purpose the upper end 17 is sealed along the circumference 26 — which is also encircling and thus sealing the fifth orifice 11 — by a flexible sheet 18 by welding or similiar known joining techniques . it is worth noting that due to the design of the connector the flow paths for the first and second fluid lines are not blocked by this seal . the flexible sheet 18 is indicated in fig2 . this embodiment of the container is shown in fig4 . the containment portion 31 of the container 30 is made from a tube bag which is sealed at the lower end 32 and joined by welding or similar techniques in a leak - proof manner at the upper end 33 to the lower end 16 of the connector 1 . in the embodiment shown in fig4 the container 30 is furthermore prefilled with a powdered concentrate 34 of a substance to be dissolved for final usage . the substance may be provided in any other condition , solid or fluid , whatever may be useful for the particular purpose . for maintaining sterility before usage the lower ends 24 and 25 of the orifices 3 and 5 may be sealed in an appropriate way so that the interior of the container 30 is completely sealed to the exterior . as an example a single flap - like seal 27 is shown in fig8 which is sealing both orifices 3 and 5 . the seal 27 may be removed by a user before usage by peeling off the seal as shown in fig8 . furthermore , not shown tubes and / or filters may be provided in the container 30 which are placed in the first and / or second fluid line in order to filter passing fluid flowing in and / or out the bag and / or extend the lines to a particular site within the containment portion 31 . if it is desired to withdraw a saturated solution of a substance to be dissolved it may prove useful to introduce the flushing and hence dissolving fluid like water close to the upper end 33 of the containment portion 31 and to withdraw the saturated solution close to the lower end 32 of the containment portion 30 . in fig4 there is also shown a part 50 of an embodiment for a fluid preparation device according to the invention which has mating first and second mounting means 53 and 54 for mounting the connector 1 and thus container 30 . these mating first and second mounting means are formed by first and second insertion chambers 53 and 54 which have a complementary cross - section such that the first and second bar - like mounting means 2 and 4 can be mounted by insertion into these chambers . any cross - section may be used , but a circular cross - section as shown in this embodiment is advantageous in view of improved rinsing and disinfection properties . the first insertion chamber 53 is in fluid communication with a third fluid line 51 , the flushing fluid line , which is connected to a flushing fluid source ( not shown ) for the delivery of flushing fluid . this flushing fluid is required during use of the container 30 in order to prepare the prepared fluid from the prefilled substance and the flushing fluid — the latter being in most cases simply water . correspondingly the second insertion chamber 54 is in fluid communication with a fourth fluid line 52 , the prepared fluid line , which enables the delivery of the prepared fluid to a place where it is required . this may still be within the fluid preparation device or by means of a suitable outlet for the delivery to somewhere else . the part 50 of the fluid preparation device also comprises a detector means 58 which in this embodiment is a mechanical microswitch . upon mounting the container 30 and thus the connector 1 , the ledge 15 presses the switch 58 which by a not shown electronic evaluation circuit of the fluid preparation device enables the device to confirm the correct mount of the connector 1 . it may be possible that this evaluation circuit causes any actuators to block the flow of any flushing fluid into the first insertion chamber 53 until such confirmation has taken place . the part 50 of the fluid preparation device further comprises a lid 59 . the lid 59 is turnable around a joint 65 from a first , open position which is shown in fig4 , to a third , closed and preferable locked position which will be described below . between the first and the third position , the lid is arrestable , preferably lockable , in a second position with the container 30 being mounted as will also be explained below . the lid 59 has first and second closure parts 60 and 61 which are suitable to close the first and second insertion chambers 53 and 54 , respectively , when the lid 59 is in the third position . fig5 shows the same view as fig4 with the connector 1 and thus the container 30 being mounted to the part 50 of the fluid preparation device . the first and second mounting means 2 and 4 are inserted in the first and second insertion chambers 53 and 54 . furthermore , there are two proximity detectors 63 and 64 on the part 50 which detect the presence of the lid 59 in either the second or the third position . these proximity sensors may be non - mechanical sensors like hall sensors which notice the close position of certain parts of the lid 59 . these sensors may as well comprise mechanical switching means which are actuated by movable counterparts ( not shown ) of the lid which at the time serve to lock the lid 59 in the second or third position . fig6 shows a first sectional view of the arrangement shown in fig5 with the lid 59 being in the second position , arresting the connector 1 in its mounted position by pushing with the closure parts 60 and 61 onto the connector 1 . the sectional view is taken along the flushing fluid line 51 and the first insertion chamber 53 looking from left to right in fig5 . the prepared fluid line 52 and the second insertion chamber 54 have a symmetric design . within the first insertion chamber 53 there is first male connector element 55 which terminates the flushing fluid line 51 within the first insertion chamber 53 . the first male connector element 55 is joined to the housing of part 50 with a flexible sealing and compensation element 57 which may be made of any suitable material , e . g . rubber . the sealing and compensation element 57 enables movements of the first male connector element 55 relative to the housing in order to compensate tolerances which may exist for the relevant counterparts of the connector 1 . in the arrangement displayed in fig6 the first orifice 3 and hence the first fluid line of the connector 1 and container 30 are now in fluid communication with the flushing fluid line 51 . the orifice 3 is limited by first sealing lips 66 at the lower circumference of the first mounting means 2 . the sealing lips 66 may easily be created by injection molding . the lips 66 assure a leak - proofed connection to the first male connector element 55 which they encompass at its outer circumference . the first mounting means 2 is inserted into the first insertion chamber 53 until a first steplike projection 69 of the first mounting means 2 is touching the housing of the part 50 of the fluid preparation device . from the first insertion chamber 53 there also branches off a fifth fluid line 62 . when the connector 1 is mounted this fifth fluid line 62 will be sealed by the first sealing lips 66 , i . e . there is no fluid communication to the connected first and third fluid lines , that latter being the flushing fluid line 51 . for the connection of the second and fourth fluid lines there are corresponding elements , i . e . a second male connector element , a second sealing and compensation element , second sealing lips , a second step - like projection and a branching sixth fluid line . the purpose of the fifth and sixth fluid lines becomes apparent from fig7 . this figure shows a second sectional view of the part 50 of the fluid preparation device . it differs from fig6 by the fact that no connector 1 is mounted and that the lid 59 is in the closed , third position . the first insertion chamber 53 is now closed by the first closure part 60 which is a part of the lid 59 . the closure is sealed by sealing means 67 on the outer circumference of the first closure part 60 , which here is accomplished by an o - ring gasket . on the inner side of the first closure part 60 there is a first opening 68 which has a larger diameter than the outer diameter of the first male connector element 55 . in this configuration the fluid lines of the part 50 of the fluid preparation device may easily be rinsed with any fluid like water or disinfection fluid . as the second closure part 61 is sealing the second insertion chamber 54 in a similar way , the rinsing fluid may be provided by the third fluid line , i . e . the flushing fluid line 51 . the flushing fluid then enters the first insertion chamber 53 and leaves it via the fifth line 62 . in this embodiment the fifth and sixth lines are joined ( not shown ). the rinsing fluid hence enters the second insertion chamber 54 by the sixth fluid line and leaves it by the fourth fluid line , i . e . the prepared fluid line 52 . by this configuration an easy and effective rinsing and / or disinfection of all relevant parts of the fluid preparation device in the mating connector area is accomplished . any parts which are above the gasket 67 are not reached by the rinsing fluid , but these parts will not be part of the fluid path if a connector 1 is connected either . the connector 1 or container 30 , respectively , may be designed as a disposable article for single - use purposes . hence special solutions for their disinfection have not to be found . in this case a sensitive part like the sealing lips 66 is automatically exhanged from one use to another without affording any extra parts or expensive maintenance procedures . the detector means 63 and 64 sense the lid 59 in the second or the third position . the electronic evaluation circuitry of the fluid preparation device is monitoring the signals provided by these detector means in order to confirm an expected position of the lid 59 during specific modes of the fluid preparation device like disinfection or online fluid preparation . it is worth noting that the boat - like cross section of the connector 1 represents a preferred embodiment . any other shape of the connector which still meets the concept of the invention as outlined by the claims would nevertheless enable an easy handling of the connector system during use . as is apparent from fig4 to 7 the shape of this part of the connector hardly has any influence on the connection steps themselves . the invention is hence providing easy to handle and reliable components for a fluid preparation system consisting of a container with a special connector and a fluid preparation device . the container may be prefilled with a substance , but also applications are possible where an initially empty container is used which will be filled and / or emptied during use . the container can be of any type , rigid or flexible . a flexible bag represents however a preferred embodiment . the components of the inventive system are particularly useful in the medical field where the handling is especially sensitive to sterility conditions . at the same time the invention provides inexpensive solutions which is not of lesser interest . the invention has proven particularly useful in the field of dialysis where the fluid preparation device is part of the dialysis device . the prepared fluid may represent only a part of the complete dialysis fluid like bicarbonate , or the complete dialysis fluid . it may be applied to any type of dialysis like hemodialysis or peritoneal dialysis . the invention being thus described , it will be apparent that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be recognized by one skilled in the art are intended to be included within the scope of the following claims .

US-38473203-A

a method for mechanically assisting the pumping action of the heart . a catheter is provided comprising an elongate member having a proximal end , a distal region , an expandable member attached in the distal region , and an inflatable member in the distal region and attached distal the expandable member . the catheter is advanced into the aorta . the expandable member is expanded to at least partially obstruct the aorta . the inflatable member is inflated during diastole . the inflatable member is then deflated during the ejection phase of the left ventricle while expansion of the expandable member is maintained . the pumping action of the heart is thereby mechanically assisted . cerebral perfusion augmentation may also be achieved by use of combined coarctation - counterpulsation devices and methods . devices for practicing methods with increased volume - displacement efficiency are also described .

an embodiment of the intraaortic balloon pump catheter having improved volume - displacement efficiency is shown in fig1 a and 1b . catheter 1 comprises elongate tubular member 10 having lumen 15 extending between distal end 11 and proximal end 12 . first balloon 21 is attached to catheter 1 at the distal region . second balloon 22 ( typically made from a thin film of polyurethane because of its strength and antithrombotic properties ) is attached to catheter 1 distal to first balloon 21 . lumen 15 of the catheter communicates with balloon 22 for inflation of the second balloon . similarly , lumen 16 of the catheter communicates with balloon 21 for inflation of the first balloon . pressure lumen or manometer 19 , adapted for measuring blood pressure between balloons 21 and 22 , is located distal to balloon 21 . pressure lumen or manometer 20 , adapted for measuring blood pressure upstream balloon 22 , is located distal balloon 22 . at proximal end 12 of catheter 1 as depicted in fig1 b , port 24 , port 25 , and port 26 are housed within catheter hub 28 . port 25 communicates with lumen 15 and is adapted for connecting to a console that synchronizes inflation and deflation of balloon 22 with cardiac cycle and makes automatic adjustments for changes in the heart rate and rhythm . port 26 is adapted for connecting to a console that allows inflation and deflation of balloon 21 independent of cardiac cycle and balloon 22 . port 24 , which communicates with manometers 19 and 20 , is adapted for connecting to a blood pressure monitor . where pressure lumens 19 and 20 are present , these lumens communicate separately and independently with separate and independent ports 24 a and 24 b , which in turn are connected to external manometers . the proximal end of the catheter also includes suture flanges 29 for securing the catheter in place after insertion . another embodiment of the intraaortic balloon pump catheter having a third lumen adapted for insertion of interventional catheters is shown in fig2 a and 2b . lumen 17 communicates proximally with port 27 and distally with port 30 . interventional catheters , such as an angioplasty catheter , an angiography catheter , a stent deployment catheter , a thrombectomy catheter , an embolectomy catheter , an electrophysiology study catheter , a blood filter , or an intravascular ultrasound catheter , may be introduced through port 27 , lumen 17 , and port 30 to perform desired interventional procedures upstream of catheter 1 when placed in the descending aorta . a further embodiment of an intraaortic balloon pump catheter is depicted in fig3 . catheter 1 includes first balloon 21 that communicates with inflation lumen 37 . second balloon 22 is mounted distal balloon 21 , and communicates with inflation lumen 36 . third balloon 33 is mounted distal second balloon 22 , and communicates with inflation lumen 35 . pressure lumen or manometer 19 is mounted distal first balloon 21 for obtaining aortic blood pressure readings upstream balloon 21 . second pressure lumen or second manometer 20 is mounted distal third balloon 33 for obtaining aortic blood pressure readings upstream balloon 33 . a cross section through section line a - a of catheter 1 is shown in fig3 a . inflation lumens 35 , 36 , and 37 are depicted , as well as pressure lumen or manometer lumen 40 . it will be understood that where the catheter includes pressure lumens 19 and 20 each communicating at a proximal end with an external manometer , pressure lumen 40 will actually be comprised of two separate and independent pressure lumens 40 a and 40 b ( see fig4 a ), each of which communicates with a separate and independent proximal port 24 a and 24 b , each of which is connected to a separate and independent external manometer . in another embodiment , catheter 1 is equipped with four balloons , as shown in fig4 . catheter 1 includes first balloon 21 communicating with inflation lumen 37 . second balloon 22 is mounted distal first balloon 21 , and communicates with inflation lumen 36 . third balloon 33 is mounted distal second balloon 22 , and communicates with inflation lumen 35 . fourth balloon 44 is mounted distal third balloon 33 , and communicates with inflation lumen 38 . pressure lumen or manometer 19 is mounted distal first balloon 21 for obtaining aortic blood pressure readings upstream balloon 21 . second pressure lumen or second manometer 20 is mounted distal fourth balloon 44 for obtaining aortic blood pressure readings upstream balloon 44 . a cross section through section line a - a of catheter 1 is shown in fig4 a . inflation lumens 35 , 36 , 37 , and 38 are depicted , as well as pressure lumens 40 a and 40 b which communicate separately with pressure elements 19 and 20 , respectively . catheter 1 of fig4 also includes lumen 50 shown in fig4 a for passing an interventional or diagnostic catheter to a location ( coronary arteries , carotid arteries , mitral valve , aortic valve , or other arteries of the bead and neck ) upstream catheter 1 . in use , the catheter is deployed though a femoral artery as shown in fig5 a and 5b . after the right groin is sterile prepared , needle 60 is inserted into right femoral artery 55 . guidewire 61 is inserted through needle 60 , and is advanced into right femoral artery 55 and then into aorta 99 where it will be positioned in the thoracic aorta . needle 60 is then removed and dilator / introducer 62 is inserted over guidewire 61 as shown in fig5 b , or alternatively , catheter 1 may be inserted over the guidewire without the use of a dilator / introducer 62 . catheter 1 is then advanced over guidewire 61 and through introducer / dilator 62 . the catheter is then advanced under fluoroscopy ( to visualize one or more radio - opaque markers mounted on the distal region of catheter 1 ) until the distal end of the catheter is positioned approximately 2 centimeters downstream of the orifice of the left subclavian artery ( 98 in fig6 a ). the guidewire may then be withdrawn from the patient , or alternatively the guidewire may be left in place to be used during a later interventional catheterization . with the catheter now in place as shown in fig6 a , the inflation lumen for balloon 22 is connected proximally to a console that synchronizes inflation and deflation with the cardiac cycle and makes automatic adjustment for changes in heart rate and rhythm . balloon 21 is then expanded to partially or fully obstruct aorta 99 . balloon 21 will be maintained expanded to 60 % or more , 70 % or more , 80 % or more , 90 % or luminal obstruction to achieve coarctation and enhancement of cerebral blood flow that is highly advantageous in a patient suffering a cerebral vascular accident . in this regard , barbut et al ., u . s . application ser . no . 09 / 841 , 929 , filed apr . 24 , 2001 , is incorporated herein by reference in its entirety as if fully set forth herein . maintenance of balloon 21 in an expanded state also enhances the efficiency of counterpulsation balloon 22 . balloon 22 is then expanded during diastole ( fig6 a ) to enhance coronary perfusion , and deflated during systole ( fig6 b ) to reduce afterload in the manner described herein above . throughout the procedure , blood pressure upstream second balloon 22 may be monitored by readings from pressure lumen or manometer 20 and blood pressure between second balloon 22 and first balloon 21 may be monitored by readings from pressure lumen or manometer 19 . in using the intraaortic balloon pump catheter of fig4 , placement in the thoracic aorta is accomplished as described herein above , as shown in fig7 a through 7e . the lumens of balloons 22 , 33 , and 44 are connected proximally to a console that synchronizes inflation and deflation with the cardiac cycle and makes automatic adjustment for changes in heart rate and rhythm . balloon 21 is then expanded to partially or fully obstruct aorta 99 . balloon 21 will be maintained expanded to 60 % or more , 70 % or more , 80 % or more , 90 % or more luminal obstruction to achieve coarctation and enhancement of cerebral blood flow which is highly advantageous in a patient suffering a cerebral vascular accident . maintenance of balloon 21 in an expanded state also enhances the efficiency of counterpulsation balloons 22 , 33 , and 44 . as shown in fig7 a , the inflation cycle begins with counterpulsation balloon 22 during diastole . volume displacement occurs predominantly upstream because balloon 21 blocks volume displacement downstream . the expansion of balloon 22 is followed immediately by expansion of balloon 33 as shown in fig7 b . again volume displacement occurs predominantly upstream , enhancing coronary perfusion and myocardial oxygenation . expansion of balloon 33 is followed immediately by expansion of balloon 44 as shown in fig7 c . once again volume displacement occurs predominantly upstream . the diastolic phase of the cardiac cycle is followed by the systolic phase of the cardiac cycle in which blood is ejected from the left ventricle following left ventricular contraction . during this phase of the cardiac cycle , the balloons of catheter 1 are deflated to cause in reduction of left ventricular afterload and systemic vascular resistance . as shown in fig7 d , balloon 44 is first deflated to cause downstream volume reduction . deflation of balloon 44 is followed immediately by deflation of balloon 33 . volume reduction again draws blood from the left ventricle downstream . deflation of balloon 33 is followed immediately by deflation of balloon 22 as shown in fig7 e . the sequential deflation of balloon 44 , 33 , and 22 is accomplished while balloon 21 is maintained in an expanded state so that volume reduction pulls blood downstream from the left ventricle , not upstream from the peripheral vasculature . while intraaortic balloon pumping is being conducted using any of the devices described herein , it may be desirable to advance an interventional therapeutic or diagnostic catheter through a lumen of catheter 1 and beyond the distal tip in order to access a coronary obstruction , a diseased heart valve , a perforated septum , a ventricular thrombus , a stenosed carotid artery , arrythmiogenic myocardial tissue , and other lesions affecting the arteries of the head and neck . the catheters in accordance with the devices described herein will typically have a length between approximately 75 - 150 cm , preferably approximately 80 - 110 cm . balloon inflation volume will typically be approximately 10 - 40 cc for each balloon , preferably approximately 20 - 25 cc . the foregoing ranges are set forth solely for the purpose of illustrating typical device dimensions . the actual dimensions of a device constructed according to the principles of the present invention may obviously vary outside of the listed ranges without departing from those basic principles . although the foregoing invention has , for the purposes of clarity and understanding , been described in some detail by way of illustration and example , it will be obvious that certain changes and modifications may be practiced which will still fall within the scope of the appended claims .

US-87333207-A

a method and system for detecting an ineffective effort of a patient being mechanically ventilated by a ventilator comprises monitoring a respiratory flow of air of the patient after said ventilator has cycled ; creating a signal indicative of said flow ; removing artefact from said signal ; monitoring said signal for perturbations ; and determining that an ineffective effort has occurred when said perturbation is significant .

while the following embodiments may be explained in terms of a sequential process , it is understood that the process can be carried out using a non - linear , non - sequential , or non - staged process , or the order of the process may be changed . also while the following describes an entire process , aspects of the invention may relate to only a subset of that process . one aspect of the invention is directed to a method for improving patient - ventilator synchrony , and eliminates the need for external sensors , measuring intrinsic peep ( or by analogy ), or modifying / complicating the triggering sensitivity algorithm internal to the ventilator . rather , it identifies unsupported patient effort exhibited as a specific feature in the flow or pressure signal , indexes their occurrences , and optionally uses the output as an error function that is forced to minimize over time by adjusting various ventilator / environmental parameters . these adjustments are either manual or servo - regulated , and may involve peep and / or tidal volume delivery ( to counterbalance peep and reduce dynamic hyperinflation ), as well as trigger sensitivity . in one embodiment , an algorithm is provided for detecting missed triggers corresponding to patient effort without the benefit of a direct effort sensor . only patient flow and airway pressure signals are processed to determine this . as shown in fig2 , unsupported efforts accompany significant and unique perturbations in the flow signal [ 4 ] and this is a common phenomenon . these perturbations : occur during expiration after the ventilator cycles and before it next triggers , i . e . in the absence of successful inspiratory assistance ; are not necessarily characterized by positive - directional flow , but rather by retarded negative flow . are ‘ significant ’ in that they are distinguishable from noise or other low amplitude phenomena such as secretions , or cardiogenic oscillation , etc . are ‘ unique ’ in that they may be distinguishable from significant perturbations caused by other physiological phenomena such as swallowing or cough . several features on the flow signal can be identified as characteristic of an individual ineffective effort , shown in fig3 . together in sequence they form a feature set . during uninterrupted expiration , and after achieving the peak expiratory flow , the flow profile accelerates towards zero . this trend may be exponential for normal subjects , or approaching a linear decay for expiratory flow limited subjects . when an ineffective effort occurs on the expiratory curve there may or may not be a short , rapid ( relative to the expiratory baseline ) deceleration in negative flow corresponding to the onset in muscle effort , but always a local maximum [ 1 ] and a short , fairly rapid declivity [ 2 ] back to the baseline of the expiratory flow profile punctuated with a local minimum [ 3 ]. one aspect of the invention relates to the identification of expiration on the flow signal , as well as significant and unique perturbations on this portion of the signal pertaining to ineffective efforts . this involves identification of at least the local maximum , and furthermore the declivity in succession . in addition , an aspect of the invention encapsulates a general classifier of perturbations on the flow signal during expiration relating them to their physiological cause , including swallowing , coughing and cardiogenic oscillation , such that ineffective efforts can be uniquely distinguished with greater confidence . refer to fig4 for a high - level flow chart description . one embodiment of the invention that detects ineffective efforts as significant local maxima occurring during expiration may be implemented as follows . a flow chart of the process is included in fig5 . 1 ) two signals are recorded from a ventilated patient using a logging device including a data - acquisition system and memory , which may be the ventilator itself . these signals are airflow ( q ) and airway pressure at the mouth ( p ). 2 ) the flow and airway pressure signals are passed through a smoothing / noise filter to minimize noise . one such example is a butterworth low pass filter with low order to minimize phase lag and a cut - off frequency of 1 hz . 3 ) an unintentional leak compensation algorithm is applied to the flow signal such as that described in u . s . pat . no . 6 , 152 , 129 ( berthon - jones ). 4 ) the first derivative ( q ′) of the flow signal is calculated . 5 ) the second derivative ( q ″) of the flow signal is calculated . 1 ) an indicator of expiratory phase . this can be achieved using any number of means for example classifying respiratory phase based on the polarity of the flow ( fig6 ( a )) or alternatively based on determining the state of therapy delivery using the trigger and cycle events ( fig6 ( b )), or testing the pressure signal against a phase transition threshold ( fig6 ( c )) ( e . g . (( ipap or maximum pressure )−( epap or minimum pressure ))* 50 %, depending upon type of assistance ). the resultant control signal , c exp , may be true during expiration . 2 ) an index that indicates the zero - crossings in the first derivative flow signal . the resultant control signal , c q ′ is true when q ′= 0 , and identifies inflections in the flow signal . 3 ) a control signal that ensures a ) the inflections identified by step 2 are maxima ; and b ) the inflections have significant rise to qualify as a feature , distinguished from noise or cardiogenic flow . this may be achieved by testing the second derivative flow signal against an impartial negative , non - zero threshold α , for example , but not limited to , its own standard deviation or percentage thereof , defined as : the resultant control signal , c q ″ , is true when less than − α . the above control signals are logically and - ed to derive the resultant index where index = true for every detected ineffective effort . another embodiment of the invention detects ineffective efforts as a feature set occurring during expiration and comprising a significant local maximum and successive declivity , that also has parameters unique to its physiological cause . it may be implemented as follows . 1 ) two signals are recorded from a ventilated patient using a logging device including a data - acquisition system and memory , which may be the ventilator itself . these signals are airflow ( q ) and airway pressure at the mouth ( p ). 2 ) the flow and airway pressure signals are passed through a smoothing / noise filter to minimize noise . one such example is a butterworth low pass filter with low order to minimize phase lag and a cut - off frequency of 1 hz . 3 ) an unintentional leak compensation algorithm is applied to the flow signal such as that described in u . s . pat . no . 6 , 152 , 129 ( berthon - jones ). 4 ) the first derivative ( q ′) of the flow signal is calculated . 5 ) the second derivative ( q ″) of the flow signal is calculated . an indicator of expiratory phase is determined . this can be achieved using any number of means for example classifying respiratory phase based on the polarity of the flow ( fig6 ( a )) or alternatively based on determining the state of therapy delivery using the trigger and cycle events ( fig6 ( b )), or testing the pressure signal against a phase transition threshold ( fig6 ( c )) ( e . g . (( ipap or maximum pressure )−( epap or minimum pressure ))* 50 %, depending upon type of assistance ). the resultant control signal , c exp , may be true during expiration . the combined perturbation feature set detection and pattern classifier is described by the following and shown in the flow chart of fig5 . features referred to have been described and are illustrated in fig3 . the expiratory phase control signal is checked for true to indicate whether to process the flow for perturbation detection [ 1 ]; 1 . max detected — indicates whether a local maximum has occurred 2 . t ie — elapsed time since onset of most recent local maximum i . e . onset of patient effort decay 3 . potential_swallow — indicates whether the patient may be swallowing 4 . t sa — elapsed time since the onset of a potential swallow 5 . dec_detected — indicates whether a significant declivity has yet been detected . peak expiratory flow ( pef ) occurs early in uninterrupted expiration and is calculated prior to perturbation detection [ 3 ] by : where i indicates the sample sequence . in the case that pef exceeds a threshold of approximately 200 lmin − 1 , a cough is considered to have occurred and pef is assigned a null value . detection of the local maximum feature is given priority [ 4 ], and is determined by the occurrence of either a falling zero - crossing or exactly zero slope on the first derivative : upon detection of a local maximum , the max detected state variable is asserted and t ie reset . the value of flow at the local maximum is stored as the variable q a [ 5 ]. q a is tested for near - zero value to identify a possible swallow event [ 6 ]. a swallow occurring in mid - expiration may be a perturbation with a similar feature set as an ineffective effort . it may be distinguished however as a temporary occlusion of the airway and hence period of apnea or zero flow . the expected duration of swallowing apnea is considered to be at least 500 ms . if this test proves true the state variable potential swallow is asserted and the swallow apnea timer t sa is incremented by the sample time . until a significant declivity is detected , incoming flow samples are processed in this set of loops , that firstly identify a local maximum and start an ineffective effort timer , and secondly identify the potential for a swallow to be occurring and if so , start a swallow apnea timer . both timers are incremented each iteration by an amount equal to the sample time . a significant declivity is identified [ 7 ] by the occurrence of a maximum in the rate of change of decreasing flow ( q ″= 0 ) such that its value is greater than an impartial negative , non - zero threshold α , for example but not limited to , a percentage ( e . g . 33 %) of the standard deviation , defined as : and n is the number of samples in a long window or circular buffer that progressively shifts with incoming flow . to indicate detection of this significant declivity feature , the state variable dec_detected is asserted [ 8 ]. to classify whether or not the declivity is the result of a swallow , the swallow apnea timer is checked if greater than the minimum expected swallow period , 500 ms [ 9 ], and if so , the feature detection process is reset including all state variables and timers . if a declivity has been detected that is not the result of a swallow , the next local minimum is ascertained by the occurrence of a rising zero - crossing on the first derivative :. upon detection of this local minimum , the total duration of the declivity and thus the decay in patient effort is given by the timer value t ie . for values greater than 500 ms the feature set is considered unfeasible as an ineffective effort and is disregarded [ 11 ]. the value of flow at the local maximum is stored as the variable q b and the amplitude of the declivity is defined [ 12 ] as : the amplitude of the declivity is used to classify the feature set in terms of its physiological cause . other than ineffective efforts , the most common physiological explanations of significant perturbations , and more precisely declivities , that occur during expiration , are secretions , coughs and cardiogenic oscillations ( cgo ). secretions in the patient may be observed on a high - resolution flow signal as high frequency crackle shortly after the onset of expiration . down - sampling or noise filtering the signal may eliminate the presence of this crackle , without eliminating the higher frequency components of the ineffective effort . in accordance with the filtering techniques in the present embodiments , secretions have little or no effect . a cough is a sudden , spasmodic contraction of the thoracic cavity , resulting in violent release of air from the lungs . in mid - expiration , the flow achieved can be greater than 200 l / min , extending well beyond the peak expiratory flow . these thresholds are used to test the amplitude of the declivity [ 13 ]. in obstructive patients with high resistance and low lung compliance , cgo are not well propagated , if at all , to the mouth . their presence may be damped by down - sampling or noise - filtering , or suppressed using techniques such as adaptive filtering using a cardiac - gated signal such as an ecg or pulse plethysmograph . in cases where cgo is present on the flow signal and has not been suppressed , it is possible to distinguish them from ineffective efforts , based on their smaller peak - trough or declivity amplitude . a threshold of 4 l / min is used in this embodiment [ 14 ]. if the amplitude of the declivity is within the overall constraints , an ineffective effort is said to have occurred . a wait period is imposed after the detection of an ineffective effort and before the detection of a new local maximum that corresponds to a successive ineffective effort [ 16 ]. this is based on the expectation that the minimum neural time , and hence effort , for attempted inspiration is 500 ms . the output of an embodiment of the invention is shown in fig8 . two unsupported inspiratory efforts matched with significant perturbations in the flow signal are evident , [ 1 ] and [ 2 ], and these have been recognized and logged by the algorithm shortly afterwards in time . these embodiments are exemplary of the feasibility of the invention , and such descriptions are not to be taken as limitations . another aspect of the invention relates to using an index of ineffective efforts to estimate true patient respiratory rate . in one form this is done by summing the number of ineffective efforts detected as described above together with the number of ventilator delivered breaths in a time period . another aspect of the invention relates to improving patient - ventilator asynchrony . a cumulative sum of the algorithm output over periodic intervals or for a set number of respiratory cycles ( an index statistic ) can be used as an indicator of therapeutic efficacy . in the case of high missed triggers as a result of the patient &# 39 ; s condition ( high peepi , acute exacerbation ), or incorrect ventilator settings , the metric can facilitate an alarm for the clinician to take responsive action ( drug administration or peep / pressure support / tidal volume delivery adjustment ), and also measure the effectiveness of that action with reference to the index statistic prior to it . extending this concept , responsive action to the index statistic i . e . adjustment of ventilator settings peep / pressure support / tidal volume delivery may be automated in the ventilator itself . furthermore , continuous assessment of the efficacy of these adjustments and thus servo - regulation of therapy would be enabled . while the invention has been described in connection with what are presently considered to be the most practical and preferred embodiments , it is to be understood that the invention is not to be limited to the disclosed embodiments , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the invention . also , the various embodiments described above may be implemented in conjunction with other embodiments , e . g ., aspects of one embodiment may be combined with aspects of another embodiment to realize yet other embodiments . for example , instead of a flow signal being monitored , a pressure signal is monitored at the entrance to the patient &# 39 ; s airways . one form of feature set applicable for a pressure signal is inversely related to the feature set described above in relation to flow . for example , instead of a declivity being detected , the pressure signal is monitored for a sharp increase following a local minimum . in addition , while the invention has particular application to patients who suffer from copd , it is to be appreciated that patients who suffer from other illnesses ( e . g ., congestive heart failure , diabetes , morbid obesity , stroke , barriatric surgery , etc .) can derive benefit from the above teachings .

US-201314073337-A

this invention relates to a gel formulation for nasal administration of a controlled release formulation of hormones to the systemic circulation and / or to the brain . the special lipophilic or partly lipophilic system of the invention leads to higher bioavailability of the active ingredient caused by sustained serum levels in plasma but also leads to a more favorable serum level profile . the special lipophilic or partly lipophilic system also allows for the modulation of brain functioning . the invention also relates to the nasal administration of steroid hormones for treatment of female sexual dysfunction or female arousal disorder .

the formulation of the invention is chemically and physically stable and can be in the form of a suspension or a solution of the pharmacologically active substance . the formulation of the invention may be filled into a preservative - free device able to accurately deliver doses of the above formulation , even at higher viscosities . after nasal application of the formulation of the invention , the active ingredient or active ingredient particles are efficiently trapped at the deposition site and are absorbed at a predictable rate across the mucous membrane of the patient , thereby limiting possible deactivation by metabolizing enzymes and / or protein - binding . it will also be understood that the terms and expressions used herein have the ordinary meaning as is accorded to such terms and expressions with respect to their corresponding respective areas of inquiry and study except where specific meanings have otherwise been set forth herein . the term “ higher availability ” shall mean that after a single application a serum level of hormone significantly higher than baseline is maintained for six hours , more preferably for eight hours and most preferably for at least ten hours . the term “ higher availability ” shall also mean that , after a single application , a cerebral spinal fluid ( csf ) level significantly higher than baseline can be achieved and maintained long enough to exert the desired action . the term “ hormone ” shall mean polypeptide hormones , oligopeptide hormones , amine hormones , steroid hormones ( such as sexual hormones , including testosterone ), and lipid and phospholipids - derived hormones . the term “ sexual hormone drug ” shall mean a sexual hormone ( such as testosterone ), a biologic pro - drug of a sexual hormone ( such as androstenedione , progesterone , 17 - α - hydroxyprogesterone ), a derivative of a sexual hormone ( such as mestanolone and 4 - chloro - 1 - dehydromethyltestosterone ), or a combination thereof . the inventive formulation for nasal application comprises ( a ) at least one active ingredient ; ( b ) at least one lipophilic or partly lipophilic carrier ; and ( c ) a compound or mixture of compounds having surface tension decreasing activity in an amount effective for in situ generation of an emulsion upon contact of the formulation with water . the active ingredient is generally a hormone drug . preferably , the hormone drug is comprised within the formulation in an amount up to about 0 . 2 to about 6 % by weight , preferably 0 . 2 to 4 % by weight . in one aspect of the invention , the hormone drug is a sexual hormone drug . preferably , the sexual hormone drug is testosterone . in one aspect , the active ingredient may be introduced into the formulation in a processed form , such as nano - or microparticles , liposomes , bilayer vesicles , and micelles , among others . the formulation of the invention also comprises at least one lipophilic or partly lipophilic carrier . the formulation of the invention comprises oil in a range of about 30 % to about 98 % by weight , preferably about 60 to about 98 % by weight , more preferably about 75 % to about 95 % by weight , even more preferably about 85 % to about 95 % by weight , and most preferably about 90 % by weight . in a preferable aspect , the lipophilic carrier comprises an oil or a mixture of oils , such as a vegetable oil , such as castor oil , soybean oil , sesame oil , or peanut oil , fatty acid esters such as ethyl - and oleyloleat , isopropylmyristate , medium chain triglycerides , glycerol esters of fatty acids , or polyethylene glycol , phospholipids , white soft paraffin , hydrogenated castor oil , or a mixture thereof . more preferably , the oil is a vegetable oil . most preferably , the oil is castor oil . in one aspect , the lipophilic carrier may comprise a mixture of oils . in a preferable aspect , the vegetable oil is castor oil . the formulation of the invention also comprises a compound or mixture of compounds having surface tension decreasing activity in an amount effective for in situ generation of an emulsion upon contact of the formulation with water in an amount of about 1 to about 20 % by weight , preferably about 1 to about 10 % by weight , more preferably about 1 to about 5 % by weight , and most preferably at about 4 % by weight . the surface tension decreasing component generally comprises at least one surfactant selected from the group consisting of anionic , cationic , amphoteric , and non - ionic surfactants , including , but not limited to , lecithin , fatty acid ester of polyvalent alcohols , fatty acid ester of sorbitanes , fatty acid ester of polyoxyethylensorbitans , fatty acid ester of polyoxyethylene , fatty acid ester of sucrose , fatty acid ester of polyglycerol , oleoyl macrogolglycerides , and / or at least one humectant such as sorbitol , glycerine , polyethylene glycol , macrogol glycerol fatty acid ester , or mixture thereof . preferably , the surface tension decreasing component is an oleoyl macrogolglyceride ( such as labrafil ® m 1944 cs , as available from gattefossé ( saint - priest , france )). in another aspect , the surface tension decreasing component may comprise a surfactant mixture . in a preferable aspect , the surface tension decreasing component comprises an oleoyl macrogolglyceride or a mixture of oleoyl macrogolglycerides . the particular amount of surface tension decreasing component that constitutes an effective amount is dependent on the particular oil or oil mixture used in the formulation . generally , depending on the carrier component selected for the formulation , particularly where the carrier component is an oil or oil mixture , it is necessary to select surfactants with compatible hydrophilic / lipophilic balance ( hlbf ) values to form the most stable emulsions . while it is not practical to enumerate specific amounts of surface tension decreasing components for use with a variety of different carrier components , table 1 below provides a general guide for providing the formulation of the invention . the formulation may optionally further comprise a viscosity regulating agent , such as a thickener or gelling agent . while the amount of the viscosity regulating agent used in the formulation is dependent on the carrier used in the formulation , the formulation generally comprises the viscosity regulating agent in an amount of from about 0 . 5 to about 10 % by weight , preferably about 0 . 5 to about 7 % by weight , more preferably about 1 to about 4 % by weight , and most preferably about 4 % by weight . examples of viscosity regulating agents include , but are not limited to , cellulose and derivatives thereof , polysaccharides , carbomers , polyvinyl alcohol , povidone , colloidal silicon dioxide , cetyl alcohols , stearic acid , beeswax , petrolatum , triglycerides , lanolin , the like , or mixture thereof . a preferred viscosity regulating agent is colloidal silicon dioxide ( such as acrosil 200 ®, as available from degussa ). in another aspect of the invention , the formulation may optionally comprise a viscosity regulating agent in an amount of from about 0 . 5 to about 10 % by weight , preferably about 0 . 5 to about 7 % by weight , more preferably about 1 to about 4 % by weight , and most preferably about 4 % by weight . preferably , the viscosity regulating agent comprises a thickener or gelling agent , such as cellulose and cellulose derivatives , polysaccharides , carbomers , polyvinyl alcohol , povidone , colloidal silicon dioxide , cetyl alcohols , stearic acid , beeswax , petrolatum , triglycerides and lanolin , or a mixture thereof . more preferably , the viscosity regulating agent is colloidal silicon dioxide . in another aspect , the viscosity regulating agent may comprise a mixture of viscosity regulating agents . in a preferred aspect , the mixture of viscosity regulating agents together with an ointment base such as oleo gel or peg -, lanolin alcohol -, or petrolatum - ointment and about 0 . 5 to about 40 % ( w / w ) of lanolin , hydroxypropyl methylcellulose , petrolatum , peg 300 - 6000 , glyceryl monostearate , beeswax , or carbopol ® ( noveon , inc ). processing . generally , the formulation of the invention can be prepared very easily . the lipophilic carrier and surface tension decreasing component are filled into a stirrer vessel and about 75 % of the viscosity regulating agent is mixed in . the active ingredient is added under stirring to obtain a homogenous dispersion of the active ingredient . next , the formulation is adjusted to the necessary viscosity with the remainder of the viscosity regulating agent . the formulation is preferably filled into a preservative - free unit - dose container . because some hormones have lower levels of solubility in water , liberation from the formulation is the speed - limiting step for adsorption . it has been surprisingly found that the incorporation of a hormone drug such as testosterone in the oily formulation of the invention containing a suitable surfactant leads to physiologic serum levels and to a steady , sustained action of the hormone over time , as well as to increased levels in the csf . it is believed that the special release of the hormone is due to the oily carrier and because the formulation remains on the mucous membrane for a prolonged period of time due to its viscosity . upon contact of the formulation with the humidity of the mucous membrane , precipitation of the active ingredient is hindered by the ability of the surface tension decreasing component to form oil drops containing the active ingredient . thus , by adding a surface tension decreasing component to the formulation , the dissolution pattern of the active ingredient becomes more favorable and effective because there is no big variability in dissolution , which ensures bioequivalence . treatment . the steroid hormone testosterone exerts its effects in tissues before or after testosterone is reduced by 5 - alpha reductase to dihydrotestosterone ( dht ). since dht has stronger binding properties than testosterone , dht produces different actions in the body . as shown in fig1 , although the testosterone level in serum of hypogonadal men is comparable , application of the nasal gel of the invention results in a much lower level of dht as compared to application of a dermal gel on the market . formulations resulting in low levels of dht are particularly desired because there is some evidence that dht promotes cell growth in the prostate gland and is linked to promoting the spread and growth of prostate cancer cells . the formulation described below in table 2 was selected for treatment of hypogonadism because of the serum / csf level achieved for the active ingredient but also because of skin care properties , such as moistening of the nasal membrane , which are important for long term applications . in another aspect of the invention , the formulation according to the invention may also be processed into powder form , such as by lyophilization or spray - drying . referring now to fig2 and the preferred formulation containing testosterone described above in table 2 , c max is clearly decreased in the special formulation of the invention , which is desirable in view of toxicological considerations . further the level of unbound testosterone is very constant over at least ten hours , which mimics the physiologic daily rhythm of testosterone release . the dotted line shows the serum level after application of one spray per nostril of the preferred formulation . it can be concluded that the inventive formulation for nasal application is different from conventional formulations , especially those designed for sustained release , because the inventive formulation mimics the physiologic daily rhythm of testosterone release . the invention also avoids supra - and sub - normal testosterone levels , which is easier for the patient to tolerate and , importantly , is suitable for hormone replacement therapy . as shown in fig2 ( upper line ), a simple nasal spray containing testosterone is unsatisfactory in this sense . as shown in fig3 , application of testosterone in the inventive nasal gel formulation to women results in peak level ( c max ) after about fifteen and before at least seventy - five minutes . previous data regarding other forms of testosterone administration indicate : ( 1 ) a testosterone patch provides peak levels of testosterone at 24 - 36 hours ( advisory committee briefing document , 2 dec . 2004 , p & amp ; g , p . 128 ); ( 2 ) a transdermal spray administered to the abdomen or forearm results in a peak level at 14 - 18 hours ( humberstone , a . j ., et al ., poster no . p2 - 218 ; ( 3 ) a vaginal gel results in peak level at 5 . 5 hours ( apperloo et al . ); and ( 4 ) an oral capsule of testosterone results in peak level at 5 - 7 hours ( houwing , n . s ., et al ., pharmacotherapy 23 ( 10 ): 1257 - 65 ( 2003 )). the following examples are intended to further illustrate , and not limit , embodiments in accordance with the invention . the rapid and relatively high peak concentration of testosterone after application of testosterone was shown to correspond to a signal in the brain . fourteen healthy , premenopausal women , between thirty - five and forty - five years of age during early follicular phase and who were not taking hormonal contraceptives , received the inventive nasal gel containing 0 . 9 mg testosterone or a placebo forty minutes before scanning . scanning was done with functional magnetic resonance imaging ( mri ) using a 1 . 5 t siemens sonata mr scanner ( tr 2 . 29 s , te 30 ms , 3 . 5 × 3 . 5 × 3 . 5 mm voxels ) to investigate the regional cerebral blood flow . during scanning , the subjects had to match the emotional expression with faces of different individuals expressing either anger or fear . as shown in fig4 , the fmri data shows that application of the nasal testosterone gel formulation produces rapid effects on the neural emotion circuitry . although not wishing to be bound by theory , it is believed that the rapid effects on the neural emotion circuitry are mediated by non - genomic mechanisms . previous data has shown that the amygdala response is important to sexual arousal . karama et al ., hum . brain . mapp . 16 : 1 - 13 ( 2002 ), has shown that female sexual arousal is associated with increased amygdala activation and baird et al ., ann . neurol . 55 : 87 - 96 ( 2004 ), has shown that increased sexual drive is associated with larger amygdala volume . as shown in fig4 , the nasally applied testosterone gel formulation leads to an amygdala response after not more than forty minutes . the fmri results show that a single dose of nasal administration of the inventive formulation is able to restore the activation of amygdala region . the nasally applied testosterone gel formulation therefore is useful for the treatment of female sexual dysfunction ( fsd ) or female sexual arousal disorder . as shown in fig5 , young women between nineteen to thirty years of age have a higher amygdala response than that seen in middle - aged women between thirty - five to forty - five years of age when both groups are given placebos . a comparison of fig4 with fig5 demonstrates that treatment with the testosterone nasal gel of the invention increases the emotional reactivity of the middle - aged women to a level similar to that seen with the young women in the placebo group . in addition to the fast response seen in the brain , the nasal gel formulation also triggers a long lasting effect . further fmri data and serum concentration levels , as shown in fig6 , show that the response lasts for 2 . 5 hours . therefore , both genomic and non - genomic signaling mechanisms can be assumed . because it is not sufficient for a neurotherapeutic agent to cross the blood - brain barrier ( the neurotherapeutic agent must also stay in the brain long enough to exert its action ), a prolonged serum level is desirable for the action in the periphery . it was also found that an intermittent nasal application of the inventive gel promotes female sexual proceptivity , which , for safety reasons , is extremely favorable in women . effects of nasal administered testosterone on the sexual behavior of female capuchin monkeys ( cebus apella ) the objective of the study was to investigate the effects of nasal administered testosterone on the sexual behavior of female capuchin monkeys ( cebus apella ). ten brown tufted capuchins ( cebus apella ) were used as subjects as focal animals in this study . animals were all adult females (& gt ; 5 years old ). all animals were weighted prior to and following the experimental procedures as described in table 1 . the ten subjects were assigned to the two groups based on age and on the housing condition . they never had experienced exogenous testosterone before . females were randomly assigned to the treatment and placebo group , comprising five animals , see table 3 . the monkeys were housed and tested at the primate center of the university of brasilia , brazil , under natural light , temperature and humidity conditions . the primate center is located within the grounds of an ecological reserve , such that home cages are surrounded by nearby native tropical semideciduos gallery forest . subjects were housed in the cebus colony room of the primate center , which contains two species of cebids : brown tufted capuchins — cebus apella and squirrel monkeys — saimiri ustus . the colony room consists of two rows of 6 cages ( 4 m length , 2 , 9 width , × 2 m height , each cage respectively ) consist of two concrete walls , separating adjacent cages , and a wire mesh front , back and ceiling forming an outdoor / semi - indoor housing system . each cage consist of two concrete walls , separating adjacent cages , and a wire mesh front , back and ceiling forming an outdoor / semi - indoor housing system . each home cage contains a suspended wood nest - box , several wood perches at different heights , a food tray ( where food bowl is placed ) and a thick layer of natural dry leaves and twigs on the floor . olfactory and acoustic contact is possible between all members of the colony , but not visual contact . food is provided once a day at 7 : 30 am ., remaining in the home cages until 5 : 30 pm . the provisions include a variety of fresh fruits and vegetables . dry pellets and fresh water are available ad libitum . animals are weighted and clinically evaluated by a veterinary once a month . the study was a randomized , double - blinded , cross - over with a non - treatment run - in . the experimental procedure was divided into 23 days in 4 consecutive phases : the study started with a no - treatment run - in . in this study phase , the non - influenced ( sexual ) behavior of the female capuchin monkeys was observed and recorded as baseline . behavioral observations were carried out daily during 23 experimental days ( between 8 am and 5 pm ). during all the phases , the behavior of the females &# 39 ; capuchin monkeys was individually observed throughout the day by four experienced observers . the behaviors were scored using a combination of continuous recording and instantaneous sampling ( point samples every 7 minutes ), ( martin and bateson , 1986 ). the description of sexual behaviors is based on studies on capuchins sexual behavior , ( carosi et al ., 1999 ; carosi and visalberghi , 2002 ). all behaviors were scored manually on spreadsheets and chronometers . each animal was observed four times a day ( two sessions in the morning and two sessions in the afternoon ). each observation session lasted 14 min ( 7 min for instantaneous sampling and 7 min for continuous recording ). the total amount of hours observed throughout the four phases of the experiment were 214 , 6 . reliability for behavior identifications was assessed using data from three observations &# 39 ; days previous to the beginning of the study . interaobserver ( between the four observers ) and intraobserver reliability were calculated as the sum of agreements between observers divided by the sum of disagreements . the concordance &# 39 ; index was up to 85 %. the behaviors observed were classified in sexual : eyebrow raising , mutual gaze , head cocking , chest rubbing , masturbation , extended arms ), body touching mounting attempt , mounting , courtship , and non - sexual behaviors : resting , repetitive behavior , grooming , activity , and agonistic . their operational definitions are presented in table 4 . the daily dose of the respective study drug was administered in the morning by study staff using the original recipient for a single dose . the test drug and the placebo were administered at the same interval time in the morning by the same experimenter in all days during the treatment 1 and 2 . the drug was administered after the blood has been collected by the same experimenter in both nostrils of each animal . the study staff filled out a treatment protocol for each animal and confirmed the administration with date and signature . in order to obtain the blood samples during all the phases of experience , the animals were captured by a caretaker with the aid of a net , removed with leather gloves , anesthetized with isoflurano nasal and then transported to a table where the procedure was done . the order of capture of the females was maintained for all the days of the experiment . time between the capture , blood collection and recovery of the females varies from 5 to 30 minutes depending on the animal . blood samples were drawn between 08 : 15 to 10 : 40 a . m . six times throughout the total time of experiment during the baseline , wash - out and treatment phases ( days =− 5 , 2 , 5 , 10 , 12 and 15 , respectively ). the isoflurano 1 ml was administered nasally in a cotton ball placed at the nose of the animals until that sedation effect was observed . once the animal is anesthetized , 1 . 5 ml of the venous blood was drawn from each female . on day 10 th we could not get a blood sample of the female number 4 , drica . the transport of the analytical samples ( plasma samples ) from the primate center to the analytical laboratory at the pharmacology department at the university of brasilia , was performed in thermo - isolated boxes contained dry ice . the temperature during the transport was not warmer than − 20 ° c . each blood sample containing heparin was immediately centrifuged at 2000 rpm for 10 minutes . the plasma was separated and put in duplicate test tubes labeled with the protocol number , study period , animal number , animal name , date and time of sampling . the test tubes with the blood were safely closed . the plasma samples were safely racked and immediately frozen for storage at − 80 ° c . samples were stored in labeled tubes containing heparin as anticoagulant . the label of the blood collecting tubes contained information about protocol number , study period , animal number , animal name , date and time of sampling . phase 1 : baseline . this first phase consisted of 8 consecutive days ( from − 7 to 0 day ) where the baseline values of sexual and non - sexual female behaviors were recorded for 10 animals . during this phase , the non - influenced ( sexual ) behavior of the females &# 39 ; capuchin monkeys was individually observed through the day by 04 independent observers . the behaviors were scored using focal animal &# 39 ; s continuous recording and focal instantaneous sampling methods . on the day − 5 , the first blood sample was collected for each female . after the blood has been collected , the animal was placed back into their home cage and released . phase 2 : treatment 1 ( a ). this phase consisted of 5 consecutive days ( day 1 to day 5 ) with the nasal administration as single doses of 0 . 48 mg of testosterone ( noseafix ®) 0 . 48 mg of testosterone ( 0 . 24 mg per nostril ), once daily for 5 female capuchin monkeys ( animal numbers 3 , 6 , 7 , 9 and 10 ) as presented in table 3 . the 5 other females received gel for nasal administration with content identical to noseafix . on day 2 and 5 , blood samples were collected for the animals . sexual and non - sexual behavior were recorded by the same observers of the previous phase for all days and according to the behavior categories described before . the blood samples were obtained using the same procedure described in the general description of protocol . phase 3 : wash out . during five consecutive days ( day 6 to day 10 ), sexual and non - sexual behavior were recorded by the same observers of the previous phases using the same behavioral categories already described . on day 10 th for nine females we draw 1 . 5 ml of venous blood . it was not possible to get a blood sample of the animal 4 on this day . phase 4 : treatment 2 ( b ). this phase was equal to the treatment 1 except by the fact that the animals that got drug received placebo and vice - versus . all the procedures to capture the animals , collect blood , administer the drug or placebo and recording the behavior were the same as described previously . on the days 12 th and 15 th , new sample blood were taken from all the capuchin females . pharmaceutical form : gel for nasal administration content : active ingredient : testosterone excipients : according to the analytical certificate mode of administration : nasal , as single doses of 0 . 48 mg of testoterone ( 0 . 24 mg per nostril ), once daily for 5 days manufacturer : holopack gmbh — abtsgmünd / germany for mattem research ag - stans / switzerland pharmaceutical form : gel for nasal administration content : identical to the gel base of noseafix ® mode of administration : nasal , single dose ( same volume as measured for noseafix ®), once daily for 5 days manufacturer : holopack gmbh — abtsgmünd / germany for mattern research ag - stans / switzerland behavioral analysis . behavioral raw data were transformed for the analysis as a function of the length of time of the observational sessions . individually daily frequencies or durations were divided by the duration ( in seconds ) of each observational session . thus , rates and percentages of time spent in each behavior were obtained . daily scores of the behaviors sampled with the instantaneous technique were expressed as a proportion of the total number of point samples of the sessions . data are expressed as the mean ± sem results are based in two - tailed statistical tests significance level was set at p ≦ 0 , 05 comparisons were done within each group to evaluate if the variables measured for each behavior were significantly modified by the treatment . with this purpose , we carried out one - way analysis of variance ( anova ), taking each behavior as dependent variable , and the experiment &# 39 ; s phase as independent variable , followed by post hoc analysis with tukey &# 39 ; s all - pair wise comparisons when applicable . the results are presented separately for data collected using the scan and the continuous recording methods . eyebrow raising . in female tufted capuchins “ eyebrow raising ”, “ touching and running ”, “ nuzzling ”, and , to a lesser extent , “ headcocking ” are displays strongly correlated to the periovulatory phase and represent female proceptivity ( carossi , et al ., 1999 ). statistical comparisons within group 1 ( placebo in the treatment 1 phase — noseafix in the treatment 2 phase ) indicated significant differences between treatments [ f 3 , 366 = 3 , 692 , p = 0 , 012 ] ( see fig7 ). post hoc tests demonstrated differences between treatment 1 and treatment 2 [ p = 0 , 029 ], and between wash - out phase and treatment 2 [ p = 0 , 022 ]. these results indicate that animals treated with noseafix at treatment phase 2 showed increased frequency of “ eyebrow raising ” when compared to treatmeant phase 1 ( placebo ). also , comparisons within group 2 ( noseafix - placebo ) treatments showed significant difference between phases [ f 3 , 454 = 2 , 786 , p = 0 , 040 ]. post hoc analysis indicated an increase of the frequency of this behavior during the treatment phase 1 ( noseafix ), although not significant , the wash - out phase when compared with baseline [ p = 0 , 022 ] ( fig7 a ), and during the treatment phase 2 ( noseafix ). it is interesting to note that these increases reach significance during the wash - out phase which could be interpreted as a long lasting effect of noseafix . the frequency of eyebrow raising behavior was not different between groups during baseline [ t = 1 , 691 , p = 0 , 093 ] ( fig8 a ), treatment 1 [ t = 1 , 916 , p = 0 , 057 ] ( fig8 b ) and treatment 2 [ t =− 1 , 140 , p = 0 , 256 ] ( fig8 d ). during the wash - out phase ( fig8 c ) the groups differed significantly [ t = 2 , 972 , p = 0 , 004 ], where group 2 shown more frequently this behavior than the group 1 . these results suggest a long lasting effect of noseafix treatment . chest rubbing . this behavior in capuchin monkeys has been reported as one of the most prominent indication of female courtship ( carosi and visalberghi , 2002 ). when multiple comparison within group 2 ( noseafix - placebo ) were done , differences between phases were observed [ f 3 , 454 = 3 , 439 , p = 0 , 017 ] ( see fig7 b ). post hoc tests showed a significant increase during treatment 1 phase when compared to both baseline [ p = 0 , 049 ] and treatment 2 [ p = 0 , 02 ]. multiple comparisons within group 1 did not show any significant difference due to the experimental phase [ f 3 , 366 = 0 , 652 ] ( fig7 b ). these results indicate an effect of noseafix treatment increasing the “ chest rubbing ” behavior . the placebo treatment had no effect at all . during baseline [ t = 0 , 505 , p = 0 , 614 ] and treatment 2 [ t =− 1 , 186 , p = 0 , 239 ], the frequency of the chest rubbing behavior ( fig8 a and 8d ) did not differ between the groups . group 2 had a greater frequency for this behavior compared to group 1 in both treatment 1 [ t =− 2 , 046 , p = 0 , 043 ] and wash - out [ t =− 2 , 811 , p = 0 , 006 ] phases ( fig8 b and 8c ). these results again indicate an increase of “ chest rubbing ” by noseafix . moreover , the incidence of this behavior during the wash - out phase suggests a long lasting effect of the compound . masturbation . female capuchin monkeys perform mounting on adult males lasting from a few seconds up to 1 - 2 min . they usually stay on the male back in a position resembling that of an infant on its mother . however , the female can also take up a more proper mounting position , perform pelvic thrusts , and rub her genitals on the male &# 39 ; s fur , as if masturbating . she can also perform a masturbation - like behavior by rubbing her genitals with the hands . this type of behavior typically occurs when the female is proceptive and she persistently solicits the male ( carosi and visalberghi , 2002 ). multiple comparisons within each group did not find differences in group 1 [ f3 , 366 = 0 , 822 , p = 0 , 482 ]. however , comparisons within group 2 revealed differences due to phase [ f3 , 454 = 3 , 329 , p = 0 , 020 ]. post hoc analysis indicated differences between baseline and treatment 1 [ p = 0 , 049 ], where during treatment 1 an increase of the frequency of this behavior was found ( fig7 c ). this result suggests an effect of noseafix treatment on the frequency of this behavior . no significant increase of masturbation was observed during treatment with placebo . comparisons for this behavior within phases between groups did not show significant differences [ baseline : t = 1 , 467 , p = 0 , 145 ; treatment 1 : t = 0 , 721 , p = 0 , 472 ; wash - out : t = 0 , 925 , p = 0 , 358 ; treatment 2 : t = 0 , 894 , p = 0 , 373 ] ( fig8 a to 8d ). head cocking . this behavior is characterized by the head tilted to one side ( approximately45 °). the head may gently switch side every few seconds . the actor is constantly gazing at the recipient while cocking the head . this is performed by both sexes . head cocking is performed by several prosimian and platyrrhine species during explorative activities , such as visual inspection of objects and unfamiliar persons ( possibly to improve visual and auditory perception ). the head cocking observed during capuchins &# 39 ; sexual interactions is unlikely to be related to the functions reported in other species ( carosi and visalberghi , 2002 ). multiple comparisons within each group for the different phases , neither comparisons between the two groups within each phase showed any significant difference in the frequency of this behavior [ group 1 : f 3 , 366 = 0 , 508 , p = 0 , 677 ; group 2 : f 3 , 454 = 0 , 891 , p = 0 , 446 ] ( fig7 d ), [ baseline : t = 0 , 011 , p = 991 ; treatment 1 : t =− 0 , 894 , p = 0 , 373 ; w - o : the behavior was not observed ; treatment 2 : t = 0 , 791 , p = 0 , 430 ] ( fig8 a to 8d ). mutual gaze . the monkeys may move repeatedly closer and farther apart while mutual gazing . regardless of the distance between them , they try to regain mutual gaze . the mutual gaze usually lasts for several minutes , with occasional interruptions of a few seconds . it is usually accompanied by one or all of the following behavioral patterns : eyebrow raising with grin and vocalizations , head cocking , and chest rubbing ( carosi and visalberghi , 2002 ). comparisons for mutual gaze behavior between phases within each group did not show any significant difference [ group 1 : f 3 , 365 = 0 , 837 , p = 0 , 474 ; group 2 : f 3 , 454 = 1 , 264 , p = 0 , 268 ] ( fig7 e ). comparisons between groups within each phase also did not show significant differences for this behavior [ baseline : t = 1 , 779 , p = 0 , 078 ; treatment 1 : t =− 1 , 388 , p = 0 , 168 ; wash - out : t =− 0 , 652 , p = 0 , 515 ; treatment 2 : t =− 0 , 459 , p = 0 , 647 ] ( fig8 a to 8d ). grooming . differences between treatment phases were observed within group 1 [ f 3 , 366 = 3 , 246 , p = 0 , 022 ]. post hoc analysis demonstrated significant difference between baseline and treatment 2 [ p = 0 , 017 ], due to an increase of this behavior during treatment 2 ( when the subjects were under noseafix treatment , see fig9 a ). no such differences were observed within group 2 [ f 3 , 454 = 2 , 153 , p = 0 , 093 ]. comparisons within each phase did not show any difference in the time spent in grooming between groups [ baseline : t = 0 , 7 , p = 0 , 485 ; treatment 1 : t = 0 , 674 , p = 0 , 501 ; wash - out : t = 0 , 138 , p = 0 , 89 ; treatment 2 : t = 1 , 131 , p = 0 , 259 ] ( fig1 a to 10d ). courtship . this category includes the following behaviors : extended arm ( s ), sexual display , body touching , courtship and mounting . multiple comparisons within each group between phases revealed significant differences for group 1 [ f3 , 366 = 5 , 71 , p = 0 , 001 ] during treatment 2 due to an increase of this category when compared to baseline [ p = 0 , 03 ], treatment 1 [ p = 0 , 005 ] and wash - out [ 0 , 001 ]; and for group 2 [ f3 , 454 = 2 , 455 , p = 0 , 063 ] between baseline and wash - out [ p = 0 , 043 ] ( fig9 b ). these results indicate that treatment with noseafix increase courtship in female capuchin monkeys . comparisons of the time spent in courtship behaviors within each phase between groups shown significant differences during treatment 1 [ t =− 2 , 007 , p = 0 , 047 ] and during wash - out [ t =− 3 , 08 , p = 0 , 003 ]. in both situations group 2 spent more time than group 1 ( fig1 b and 10c ). during baseline [ t = 0 , 975 , p = 0 , 33 ] and treatment 2 [ t =− 1 , 654 , p = 0 , 101 ] no differences were observed between groups ( fig1 a and 10c ). stereotypy . differences in the time spent in stereotyped behavior between phases within each group were not found [ group 1 : f3 , 366 = 1 , 878 , p = 0 , 133 ; group 2 : f3 , 454 = 0 , 549 , p = 0 , 649 ] ( data not shown in figures ). comparisons between groups within each phase demonstrated that group 1 shown significantly higher percentage of time in this behavior than group 2 in all the phases [ baseline : t = 3 , 138 , p = 0 , 002 ; treatment 1 : t = 3 , 538 , p = 0 , 001 ; wash - out : t = 4 , 379 , p & lt ; 0 , 001 ; treatment 2 : t =− 3 , 188 , p = 0 , 002 ] ( data not shown in figures ). agonistic behavior . ( chase away ). multiple comparisons between phases within each group did not show significant differences in the observation time [ group 1 : f3 , 366 = 0 , 079 , p = 0 , 971 ; group 2 : f3 , 454 = 1 , 703 , p = 0 , 166 ] ( fig9 c ). comparisons of agonistic behavior within each phase between groups shown significant difference between them during the wash - out phase [ t =− 2 , 356 , p = 0 , 02 ], where the group 2 shown more agonistic behavior than group 1 ( fig1 c ). for the remaining phases significant differences were not observed [ baseline : t =− 1 , 719 , p = 0 , 087 ; treatment 1 : t =− 0 , 859 , p = 0 , 391 ; treatment 2 : t = 0 , 265 , p = 0 , 792 ] ( fig1 a , 10b and 10d ). it is worth to mention that this chase away behavior was observed only in one animal , although during a long time . it is not possible to be sure that this behavior observed during the wash - out period was elicited by the effect of testosterone ( noseafix ) administered during treatment 1 phase ( long lasting effect ). however , it seems not likely since in capuchin monkeys , high levels of testosterone were not associated with aggressive behavior ( lynch , et al ., 2002 ). fig1 shows the plasma testosterone levels in different phases of the study for the animals treated with placebo ( blue squares ) and noseafix ( red squares ). as can be observed , the administration of noseafix induced an increase in plasma testosterone level . it is interesting to observe that the high magnitude effect was observed when the animals were at the wash - out phase . this effect fits perfectly with the higher frequency of sexual arousal behaviors observed during the wash - out phase . therefore , behavioral and plasma testosterone level shows a close relationship . the two yellow squares in the figure — treatment 2 phase , illustrates the “ possible ” residual effect of noseafix treatment during treatment 1 phase . it would be interesting in other study to introduce a second wash - out phase ( after treatment 2 ) in order to confirm this residual ( long lasting ) effects of noseafix treatment on plasma testosterone levels and the proceptivity of female capuchin monkeys . in summary , the results obtained indicate that administration of noseafix seem to promote female sexual proceptivity in the tufted capuchin monkey ( cebus apella ), which characterizes this species mating system . these effects are in close relationship to the plasma testosterone levels measured during this study . the following aspects summarize the major findings and the results that corroborate this conclusion : the frequency of eyebrow raising , chest rubbing and masturbation were enhanced by the administration of noseafix . these behaviors are an indicative of female &# 39 ; s sexual solicitation and are frequent displayed during the preiovulatory period ( fig1 ). it is important to mention that none of these behaviors were significantly observed in animals under placebo administration . therefore , the females &# 39 ; proceptivity can not be related to the natural ovulatory cycle , although we can not rule out a possible interaction between noseafix and ovulatory cycle in some animals . in order to exclude this possibility would be necessary to conduct another experiment in females where the natural cycle is blocked by the administration of a contraconceptive drug . the female sexual appetitive activities such as invitational patterns and active initiative in approaching , investigating , and sexually soliciting the male were only observed in animals under noseafix treatment ( fig7 to 10 ). it is worth to mention that some of these behaviors were also observed during the wash - out phase , but only for the animals that have received noseafix before . therefore , it is possible that noseafix has a long lasting effect . since we did not do a pk study , it is not possible to know how long are the noseafix effects in capuchin monkeys . moreover , a second wash - out phase , after treatment 2 , would be interesting to observe possible occurrence of sexual display behaviors in animals treated with noseafix during treatment 2 phase . the compound tested did not exert a significant effect upon the frequency of exploratory activity or stereotyped behaviors in the monkeys tested . therefore , the effects of noseafix were not due to changes int he subject &# 39 ; s level of activity . the features disclosed in the foregoing description , in the claims and / or in the drawings may , both separately and in any combination thereof , be material for realizing the invention in diverse forms thereof .

US-201514965137-A

a novel soybean cultivar designated j604217 with high yield potential , late group 1 maturity , and resistance to races 3 and 14 of soybean cyst nematode , further including the plants and seeds of the cultivar j604217 , and methods for producing a soybean plant by crossing the cultivar j604217 with itself or another soybean plant . the invention also relates to soybean cultivar j604217 further comprising one or more single gene traits , and to methods of producing a soybean having such traits by transformation or mutagenesis . the invention also includes using the soybean cultivar j604217 to produce other soybean cultivars or breeding lines .

a soybean cultivar needs to be highly homogeneous , homozygous and reproducible to be useful as a commercial cultivar . there are many analytical methods available to determine the homozygotic and phenotypic stability of these cultivars . the oldest and most traditional method of analysis is the observation of phenotypic traits . the data is usually collected in field experiments over the life of the soybean plants to be examined . phenotypic characteristics most often observed are for traits associated with seed yield , lodging resistance , disease resistance , emergence , maturity , plant height , shattering , flower color , pubescence color , pod color and hilum color . in addition to phenotypic observations , the genotype of a plant can also be examined . there are many laboratory - based techniques available for the analysis , comparison and characterization of plant genotype ; among these are isozyme electrophoresis , restriction fragment length polymorphisms ( rflps ), randomly amplified polymorphic dnas ( rapds ), arbitrarily primed polymerase chain reaction ( ap - pcr ), dna amplification fingerprinting ( daf ), sequence characterized amplified regions ( scars ), amplified fragment length polymorphisms ( aflps ), single nucleotide polymorphisms ( snps ), and simple sequence repeats ( ssrs ) which are also referred to as microsatellites . the cultivar of the invention has shown uniformity and stability for all traits , as described in the following cultivar description information . it has been self - pollinated a sufficient number of generations , with careful attention to uniformity of plant type to ensure homozygosity and phenotypic stability . the line has been increased with continued observation for uniformity . no variant traits have been observed or are expected in j604217 . soybean cultivar j604217 , being substantially homozygous , can be reproduced by planting seeds of the line , growing the resulting soybean plants under self - pollinating or sib - pollinating conditions , and harvesting the resulting seed , using techniques familiar to the agricultural arts . publications useful as references in interpreting the data presented below include : caldwell , b . e . ed . 1973 . “ soybeans : improvement , production , and uses ” amer . soc . agron . monograph no . 16 ; buttery , b . r ., and r . i . buzzell 1968 . “ peroxidase activity in seed of soybean varieties ” crop sci . 8 : 722 - 725 ; hymowitz , t . 1973 . “ electrophoretic analysis of sbti - a2 in the usda soybean germplasm collection ” crop sci ., 13 : 420 - 421 ; payne r . c ., and l . f . morris , 1976 . “ differentiation of soybean varieties by seedling pigmentation patterns ” j . seed . technol . 1 : 1 - 19 . the disclosures of which are each incorporated by reference in their entirety . the invention also encompasses plants of cultivar j604217 and parts thereof further comprising one or more specific , single gene transferred traits . such traits are introgressed into cultivar j604217 from another soybean cultivar or are directly transformed into cultivar j604217 . preferably , one or more new traits are transferred to cultivar j604217 , or , alternatively , one or more traits of cultivar j604217 are altered or substituted . the introgression of the trait ( s ) into cultivar j604217 is for example achieved by recurrent selection breeding , for example by backcrossing . the goal of a backcross protocol is to alter of substitute a single trait or characteristic in the original inbred . in one embodiment of the present invention , cultivar j604217 ( the recurrent parent ) is first crossed to a donor inbred ( the non - recurrent parent ) that carries the appropriate gene ( s ) for the trait ( s ) in question . the progeny of this cross is then mated back to the recurrent parent followed by selection in the resultant progeny for the desired trait ( s ) to be transferred from the non - recurrent parent . after three , preferably four , more preferably five or more generations of backcrosses with the recurrent parent with selection for the desired trait ( s ), the progeny will be heterozygous for loci controlling the trait ( s ) being transferred , but will be like the recurrent parent for most or almost all other genes , i . e ., will be like the recurrent parent for essentially all of the recurrent parent &# 39 ; s physiological and morphological characteristics . ( see , for example , poehlman & amp ; sleper ( 1995 ) breeding field crops , 4th ed ., 172 - 175 ; fehr ( 1987 ) principles of cultivar development , vol . 1 : theory and technique , 360 - 376 ). the laboratory - based techniques described above , in particular rflp and ssr , can be used in such backcrosses to identify the progenies having the highest degree of genetic identity with the recurrent parent . this permits one to accelerate the production of soybean cultivars having at least 90 %, preferably at least 95 %, more preferably at least 99 % genetic identity with the recurrent parent , yet more preferably genetically identical to the recurrent parent , and further comprising the trait ( s ) introgressed from the donor patent . such determination of genetic identity can be based on molecular markers used in the laboratory - based techniques described above . the last backcross generation is then selfed to give pure breeding progeny for the gene ( s ) being transferred . the resulting plants have essentially all of the morphological and physiological characteristics of cultivar j604217 , in addition to the single gene trait ( s ) transferred to the inbred . the exact backcrossing protocol will depend on the trait being altered to determine an appropriate testing protocol . although backcrossing methods are simplified when the trait being transferred is a dominant allele , a recessive allele may also be transferred . in this instance it may be necessary to introduce a test of the progeny to determine if the desired trait has been successfully transferred . the cultivar of the invention can also be used for transformation where exogenous genes are introduced and expressed by the cultivar of the invention . genetic variants created either through traditional breeding methods using cultivar j604217 or through transformation of cultivar j604217 by any of a number of protocols known to those of skill in the art are intended to be within the scope of this invention ( see e . g . trick et al . ( 1997 ) recent advances in soybean transformation , in plant tissue culture and biotechnology , 3 : 9 - 26 , incorporated herein by reference ). production of a genetically modified plant tissue by transformation combines teachings of the present disclosure with a variety of techniques and expedients known in the art . in most instances alternate expedients exist for each stage of the overall process . the choice of expedients depends on the variables such as the plasmid vector system chosen for the cloning and introduction of the desired recombinant dna molecule , as well as the particular structural gene , promoter elements and upstream elements used . persons skilled in the art are able to select and use appropriate alternatives to achieve functionality . culture conditions for expressing desired structural genes and cultured cells are known in the art . also as known in the art , soybeans are transformable and regenerable such that whole plants containing and expressing desired genes under regulatory control may be obtained . general descriptions of plant expression vectors and reporter genes and transformation protocols can be found in gruber , et al ., “ vectors for plant transformation , in methods in plant molecular biology & amp ; biotechnology ” in glich et al ., ( eds . pp . 89 - 119 , crc press , 1993 ). moreover gus expression vectors and gus gene cassettes are available from clone tech laboratories , inc ., palo alto , calif . while luciferase expression vectors and luciferase gene cassettes are available from pro mega corp . ( madison , wis .). general methods of culturing plant tissues are provided for example by maki et al . “ procedures for introducing foreign dna into plants ” in methods in plant molecular biology & amp ; biotechnology , glich et al . ( eds . pp . 67 - 88 crc press , 1993 ); and by phillips et al . “ cell - tissue culture and in - vitro manipulation ” in soybean & amp ; soybean improvement , 3rd edition sprague et al . ( eds . pp . 345 - 387 ) american society of agronomy inc . et al . 1988 . methods of introducing desired recombinant dna molecule into plant tissue include the direct infection or co - cultivation of plant cells with agrobacterium tumefaciens , horsch et al ., science , 227 : 1229 ( 1985 ). descriptions of agrobacterium vector systems and methods for agrobacterium - mediated gene transfer provided by gruber , et al . supra . other useful methods include but are not limited to expression vectors introduced into plant tissues using a direct gene transfer method such as microprojectile - mediated delivery , dna injection , electroporation and the like . more preferably expression vectors are introduced into plant tissues using the biolistic microprojectile delivery or agrobacterium - medicated transformation . transformed plants obtained via protoplast transformation are also intended to be within the scope of this invention . many traits have been identified that are not regularly selected for in the development of a new cultivar but that can be improved e . g . by backcrossing techniques or by genetic transformation . using materials and methods well known to those persons skilled in the art , traits that are capable of being transferred , to cultivar j604217 include , but are not limited to , herbicide tolerance , resistance for bacterial , fungal , or viral disease , nematode resistance , insect resistance , enhanced nutritional quality , such as oil , starch and protein content or quality , improved performance in an industrial process , altered reproductive capability , such as male sterility or male fertility , yield stability and yield enhancement . other traits transferred to cultivar j604217 are for the production of commercially valuable enzymes or metabolites in plants of cultivar j604217 . traits capable of being transferred to soybean cultivar j604217 are naturally occurring soybean traits or transgenic traits . transgenes are directly introduced into cultivar j604217 using genetic engineering and transformation techniques well known in the art , some of which are described above , or are originally introduced into a donor , non - recurrent parent using genetic engineering and transformation techniques , which are then introgressed into cultivar j604217 , for example by backcrossing . a transgene typically comprises a nucleotide sequence whose expression is responsible or contributes to the trait , under the control of a promoter capable of directing the expression of the nucleotide sequence at the desired time in the desired tissue or part of the plant . constitutive , tissue - specific or inducible promoters preferably are used . the transgene may also comprise other regulatory elements such as for example translation enhancers or termination signals . in one embodiment of the present invention , the transgene nucleotide sequence in the cultivar j604217 includes a coding sequence that is transcribed and translated into a protein . in another embodiment of the invention , the nucleotide sequence encodes an antisense rna or a sense rna that is not translated or only partially translated . where more than one trait are introgressed into cultivar j604217 , it is preferred that the specific genes are all located at the same genomic locus in the donor , non - recurrent parent , preferably , in the case of transgenes , as part of a single dna construct integrated into the donor &# 39 ; s genome . alternatively , if the genes are located at different genomic loci in the donor , non - recurrent parent , backcrossing allows to recover essentially all of the morphological and physiological characteristics of cultivar j604217 in addition to the multiple genes in the resulting soybean cultivar . the genes responsible for a specific , single gene trait are generally inherited through the nucleus . known exceptions are , e . g . the genes for male sterility , some of which are inherited cytoplasmically , but still act as single gene traits . in a preferred embodiment , a transgene to be introgressed into cultivar j604217 is integrated into the nuclear genome of the donor , non - recurrent parent or the transgene is directly transformed into the nuclear genome of cultivar j604217 . in another preferred embodiment , a transgene to be introgressed into cultivar j604217 is integrated into the plastid genome of the donor , non - recurrent parent or the transgene is directly transformed into the plastid genome of cultivar j604217 . in a preferred embodiment , a plastid transgene comprises one gene transcribed from a single promoter or two or more genes transcribed from a single promoter . a non - exclusive list of traits or nucleotide sequences capable of being transferred into cultivar j604217 , using material and methods well known to those persons skilled in the art are as follows : genetic factor ( s ) responsible for resistance to brown stem rot ( u . s . pat . no . 5 , 689 , 035 ) or resistance to cyst nematodes ( u . s . pat . no . 5 , 491 , 081 ); a transgene encoding an insecticidal protein , such as , for example , a crystal protein of bacillus thuringiensis or a vegetative insecticidal protein from bacillus cereus , such as vip3 ( see for example estruch et al . nat biotechnol ( 1997 ) 15 : 137 - 41 ; a herbicide tolerance transgene whose expression renders plants of cultivar j604217 tolerant to the herbicide , for example , expression of an altered acetohydroxyacid synthase ( ahas ) enzyme confers upon plants tolerance to various imidazolinone or sulfonamide herbicides ( u . s . pat . no . 4 , 761 , 373 ). other such traits include , for example , a non - transgenic trait conferring to cultivar j604217 tolerance to imidazolinones or sulfonylurea herbicides ; a transgene encoding a mutant acetolactate synthase ( als ) that render the plants resistant to inhibition by sulfonylurea herbicides ( u . s . pat . no . 5 , 013 , 659 ); a gene encoding a mutant glutamine synthetase ( gs ) resistant to inhibition by herbicides that are known to inhibit gs , e . g . phosphinothricin and methionine sulfoximine ( u . s . pat . no . 4 , 975 , 374 ); and a streptomyces bar gene encoding a phosphinothricin acetyl transferase resulting in tolerance to the herbicide phosphinothricin or glufosinate ( u . s . pat . no . 5 , 489 , 520 ). other traits capable of being transferred to the cultivar j604217 of the invention include toleration to inhibition by cyclohexanedione and aryloxyphenoxypropanoic acid herbicides ( u . s . pat . no . 5 , 162 , 602 ), which is conferred by an altered acetyl coenzyme a carboxylase ( accase ); transgenic glyphosate tolerant plants , which tolerance is conferred by an altered 5 - enolpyruvyl - 3 - phosphoshikimate ( epsp ) synthase gene ; and tolerance to a protoporphyrinogen oxidase inhibitor , which is achieved by expression of a tolerant protoporphyrinogen oxidase enzyme in plants ( u . s . pat . no . 5 , 767 , 373 ). in yet another embodiment of the present invention , a transgene introgressed into cultivar j604217 comprises a gene conferring tolerance to a herbicide and at least another nucleotide sequence for another trait , such as for example , insect resistance or tolerance to another herbicide . direct selection may be applied where the trait acts as a dominant trait . an example of a dominant trait is herbicide tolerance . for this selection process , the progeny of the initial cross are sprayed with the herbicide prior to the backcrossing . the spraying eliminates any plant which do not have the desired herbicide tolerance characteristic , and only those plants which have the herbicide tolerance gene are used in the subsequent backcross . this process is then repeated for the additional backcross generations . this invention is also directed to methods for producing a soybean plant by crossing a first parent soybean plant with a second parent soybean plant , wherein the first or second soybean plant is the soybean plant from the line j604217 . further , both first and second parent soybean plants may be from the cultivar j604217 . therefore , any methods using the cultivar j604217 are part of this invention : selfing , backcrosses , hybrid breeding , and crosses to populations . any plants produced using cultivar j604217 or cultivar j604217 further comprising one or more specific , single gene traits as a parent are within the scope of this invention . for example , the soybean cultivar j604217 or cultivar j604217 further comprising one or more specific , single gene traits are used in crosses with other , different , soybean plants to produce first generation ( f1 ) soybean hybrid seeds and plants with superior characteristics . for example , a method to produce a hybrid soybean seed comprises the steps of planting , preferably in pollinating proximity , seeds of soybean cultivar j604217 or seeds of soybean cultivar j604217 further comprising one or more specific , single gene traits and another soybean cultivar , cultivating the soybean plants resulting from said seeds until said plants bear flowers , emasculating the plants of either one or the other soybean cultivar , inducing cross pollination to occur between said soybean cultivars and harvesting seeds produced on said emasculated plants of the cultivar line . as used herein , the term “ plant ” includes plant cells , plant protoplasts , plant cells of tissue culture from which soybean plants can be regenerated , plant calli , plant clumps , and plant cells that are intact in plants or parts of plants , such as pollen , flowers , seeds , pods , leaves , stems , and the like . thus , another aspect of this invention is to provide for cells that upon growth and differentiation produce the cultivar j604217 . further reproduction of the cultivar can occur by tissue culture and regeneration . tissue culture of various tissues of soybeans and regeneration of plants therefrom is well known and widely published . for example , reference may be had to komatsuda , t . et al ., “ genotype x sucrose interactions for somatic embryogenesis in soybean ,” crop sci . 31 : 333 - 337 ( 1991 ); stephens , p . a . et al ., “ agronomic evaluation of tissue - culture - derived soybean plants ,” theor . appl . genet . ( 1991 ) 82 : 633 - 635 ; komatsuda , t . et al ., “ maturation and germination of somatic embryos as affected by sucrose and plant growth regulators in soybeans glycine gracilis skvortz and glycine max ( l .) merr .,” plant cell , tissue and organ culture , 28 : 103 - 113 ( 1992 ); dhir , s . et al ., “ regeneration of fertile plants from protoplasts of soybean ( glycine max l . merr . ): genotypic differences in culture response ,” plant cell reports ( 1992 ) 11 : 285 - 289 ; pandey , p . et al ., “ plant regeneration from leaf and hypocotyl explants of glycine wightii ( w . and a .) verdc . var longicauda ,” japan j . breed . 42 : 1 - 5 ( 1992 ); and shetty , k ., et al ., “ stimulation of in vitro shoot organogenesis in glycine max ( merrill .) by allantoin and amides ,” plant science 81 :( 1992 ) 245 - 251 ; as well as u . s . pat . no . 5 , 024 , 944 , issued jun . 18 , 1991 to collins et al . and u . s . pat . no . 5 , 008 , 200 , issued apr . 16 , 1991 to ranch et al . thus , another aspect of this invention is to provide cells which upon growth and differentiation produce soybean plants having all or essentially all the physiological and morphological characteristics of cultivar j604217 . the disclosures , publications , and patents which are disclosed herein are all hereby incorporated herein in their entirety by reference . the seed of soybean cultivar j604217 further comprising one or more specific , single gene traits , the plant produced from the seed , the hybrid soybean plant produced from the crossing of the cultivar with any other soybean plant , hybrid seed , and various parts of the hybrid soybean plant can be utilized for human food , livestock feed , and as a raw material in industry . soybean is the world &# 39 ; s leading source of vegetable oil and protein meal . the oil extracted from soybeans is used for cooking oil , margarine , and salad dressings . soybean oil is composed of saturated , monounsaturated and polyunsaturated fatty acids . it has a typical composition of 11 % palmitic , 4 % stearic , 25 % oleic , 50 % linoleic and 9 % linolenic fatty acid content (“ economic implications of modified soybean traits summary report ”, iowa soybean promotion board & amp ; american soybean association special report 92s , may 1990 . changes in fatty acid composition for improved oxidative stability and nutrition are constantly sought after . industrial uses of soybean oil which is subjected to further processing include ingredients for paints , plastics , fibers , detergents , cosmetics , and lubricants . soybean oil may be split , inter - esterified , sulfurized , epoxidized , polymerized , ethoxylated , or cleaved . designing and producing soybean oil derivatives with improved functionality , oliochemistry , is a rapidly growing field . the typical mixture of triglycerides is usually split and separated into pure fatty acids , which are then combined with petroleum - derived alcohols or acids , nitrogen , sulfonates , chlorine , or with fatty alcohols derived from fats and oils . soybean is also used as a food source for both animals and humans . soybean is widely used as a source of protein for animal feeds for poultry , swine and cattle . during processing of whole soybeans , the fibrous hull is removed and the oil is extracted . the remaining soybean meal is a combination of carbohydrates and approximately 50 % protein . for human consumption soybean meal is made into soybean flour which is processed to protein concentrates used for meat extenders or specialty pet foods . production of edible protein ingredients from soybean offers a healthy , less expensive replacement for animal protein in meats as well as dairy - type products . table comparisons between j604217 and syngenta s20 - f8 , syngenta s19 - t9 , monsanto ag2101 , and syngenta s18 - 11 sudden brown stem cultivar / trait yield maturity lodging height death syn . rot shatter j604217 55 . 7 9 - 14 3 . 2 74 1 . 0 2 . 4 2 . 9 syngenta 55 . 4 9 . 15 3 . 8 83 4 . 0 4 . 7 2 . 4 s20 - f8 syngenta 53 . 8 9 - 16 2 . 4 76 3 . 0 3 . 6 2 . 3 s19 - t9 monsanto 51 . 0 9 - 16 2 . 3 78 5 . 5 3 . 5 4 . 7 ag2101 syngenta 51 . 6 9 - 13 3 . 0 70 3 . 0 2 . 5 4 . 5 s18 - 11 grand mean 52 . 5 9 - 15 3 . 0 74 3 . 2 4 . 1 3 . 5 no . of tests 43 25 22 5 1 5 5 lsd ( 0 . 05 ) 1 . 5 1 0 . 4 5 2 . 9 1 . 4 1 . 1 applicants have made a deposit of at least 2500 seeds of the cultivar of the present invention with the american type culture collection ( atcc ), manassas , va ., 20110 - 2209 u . s . a ., atcc accession number no : ______ . this deposit of cultivar j604217 will be maintained in the atcc depository , which is a public depository , for a period of 30 years , or 5 years after the most recent request , or for the effective life of the patent , whichever is longer , and will be replaced if it becomes nonviable during that period . additionally , applicants have satisfied all the requirements of 37 c . f . r . §§ 1 . 801 - 1 . 809 , including providing an indication of the viability of the sample . applicants impose no restrictions on the availability of the deposited material from the atcc ; however , applicants have no authority to waive any restrictions imposed by law on the transfer of biological material or its transportation in commerce . applicants do not waive any infringement of its rights granted under this patent or under the plant variety protection act ( 7 usc 2321 et seq .). the foregoing invention has been described in detail by way of illustration and example for purposes of clarity and understanding . however , it will be obvious that certain changes and modifications such as single gene modifications and mutations , somaclonal variants , variant individuals selected from large populations of the plants of the instant inbred and the like may be practiced within the scope of the invention , as limited only by the scope of the appended claims .

US-87463901-A

a method of treating leukemia which includes administering an effective amount of composition comprising suramin and a biological response modifier , wherein the suramin and the biological response modifier show synergistic or additive anti - leukemic activity . a pharmaceutical composition is also disclosed .

retinoid compounds ( vitamin a derivatives ) when used in conjunction with pharmacologic antigrowth factor agents ( suramin and analogs ) can result in synergistic activities against myeloid leukemias . objectives of the invention include in vitro testing using human leukemic cell lines derived from patients with acute promyelocytic leukemia ( nb4 ) and acute myeloid leukemia ( hl - 60 ) to first ascertain the most advantageous combinations to inhibit these leukemia cell lines . compounds tested include all - trans retinoic acid ( atra ), in combination with suramin or its most potent analog , nf110 . other analogues include nf032 , nf201 , nf023 , nf103 and the class of compounds known as azo dyes . the invention allows for a treatment of leukemia and expands the use of retinoids into other forms of leukemia other than acute promyelocytic leukemia , which is the form of leukemia which has seen the greatest usefulness of retinoids . this is directly relevant to the role of vitamin nutrients in the treatment of certain malignancies , in this case leukemias , and allows for treatment of malignancy by drugs with better activity and which do not have the side effects of standard chemotherapy . the retinoids are vitamin a analogs that play a critical role in normal differentiation and growth ( 1 ). the oxidized form of vitamin a is important in maintaining epithelial cellular integrity ( 2 ). retinoid therapy of some hematopoietic and non - hematopoietic models inhibits carcinogenesis ( 3 ). the greatest therapeutic triumph of retinoid analogs rests with the use of all - trans retinoic acid ( atra ) in acute promyelocytic leukemia ( apl ) ( 4 ). this compound stimulates the clonal growth of normal hematopoietic progenitors yet inhibits the growth of hl - 60 and nb4 cells ( acute myeloid and acute promyelocytic leukemia cell lines , respectively ) ( 5 ). its usage as a single agent results in complete remission rates in apl of 70 % or better ( 4 , 6 ). the remarkable activity of atra in this particular leukemia is known to correspond to the specific chromosomal translocation t ( 15 , 17 ) which results in the fusion product , pml / rara ( promyelocytic leukemia / retinoic acid receptor - a ). the pml / rara chimeric protein appears to function as a &# 34 ; dominant - negative &# 34 ; retinoid receptor , thus blocking the normal maturation of promyelocytes ( 7 ). the precise function of pml / rara is being intensively studied , and it appears that , atra clinically restores the capacity of apl cells to terminally differentiate with resultant apoptosis and hence disappearance of leukemic blasts . this maturation process of apl cells is associated with the &# 34 ; atra syndrome &# 34 ; in a subset of patients ( 5 - 20 %) reported . this is characterized by fever , respiratory distress and chest x - ray abnormalities , and weight gain ( 4 ). several important caveats of atra responses in apl are critical in the long - term prognosis . first , atra remissions are brief ( 8 ). this is an interesting phenomenon and may relate to altered pharmacokinetics with prolonged therapy ( 9 ) or to the development of intrinsic cellular resistance ( 10 ). a proportion of patients ( 60 %) may enjoy long term remissions when atra treatment is followed by chemotherapy ( 6 ). however , 30 - 40 % of patients are either resistant to atra at diagnosis or relapse , and are thus unlikely of being cured by conventional therapy . other clinical oncology trials of retinoids include their use ( 13 - cis retinoic acid or atra ) in the myelodysplastic syndrome with mixed results ( 11 , 12 ), in chronic myelogenous leukemia ( vitamin a ) with a significant improvement in overall survival when used in conjunction with chemotherapy ( 6 ), and pilot trials ( 13 - cis retinoic acid ) in cervical cancer used in conjunction with interferon - α ( 13 , 14 ). the combination trials are accompanied by some in vitro laboratory data which indicate that retinoids may have efficacy if used in combination with appropriately chosen agents that render not additive , but rather synergistic activity ( 15 ). one such combination approach involving retinoids , which down - regulate certain cytokine receptors on tumor cells , coupled with antigrowth factor agents which block cytokine - receptor interaction and hence both work to interrupt malignant cell autocrine growth factor loops ( 16 ). such autocrine mechanisms exist in leukemias ( and certain solid tumors ) and would be a novel approach to improving cure rates in apl therapy and reduce the incidence of the development of resistance which has been correlated with new leukemia cell cytokine production ( 17 ). appropriate combination therapies may also be useful in expanding retinoid efficacy in other leukemias in which autocrine growth mechanisms have been proposed . granulocyte / macrophage - colony stimulating factor ( gm - csf ) is a cytokine which has a broad range of proliferative , differentiating , and activating effects upon inflammatory cells and their precursors ( 18 , 19 ). recent work in our laboratories has resulted in the description of previously unknown nucleotide binding interactions with several cytokines , specifically interleukin ( il )- 2 ( 20 ), interleukin - 1 ( 21 ), acidic fgf ( 22 ), and gm - csf ( 23 ). the nucleotide binding site for gm - csf appears by virtue of saturation and competitive binding studies to have specificity for adenosine nucleotide probes . our work has revealed that the antigrowth factor agent suramin strongly interacts with this binding site ( 24 ) and our data support our hypothesis that this interaction may be central to its inhibitory activity on cellular proliferation . suramin &# 39 ; s history dates to the early german organic chemical industry ( 25 ) and the discovery that it was an active antitrypanosomal agent ( 26 ). hawking noted that the drug could bind to and inhibit many enzymes without an apparent underlying unifying theme ( 27 ). interest sharpened with the discovery of inhibition of reverse transcriptase and several growth factors , the latter leading to clinical trials in prostate cancer ( 28 ). growth factors ( cytokines ) have been shown to act as autocrine stimulators of a variety of normal hematopoietic cell types and acute leukemias ( 2931 ). subsequent research proceeded on the hope that certain malignant tumors would be more sensitive than normal tissues ( 28 ). an important , perhaps central , feature of suramin is its capacity to interfere with cytokine - receptor binding . in the class of hematopoietic cytokines , il - 2 and il - 6 , share this effect ( 32 , 33 ). the precise mechanism is controversial with conflicting reports of altered cytokine quaternary structure with changes of deoligomerization ( tnf - a ) on the one hand ( 34 ), and aggregation ( fgf and pdgf ) on the other ( 35 ). other activities upon a wide variety of cellular enzymes have been described ( 36 - 40 ) and , paradoxically in relation to its anti - growth factor action , an increase in protein tyrosine phosphorylation has been reported ( 41 ). it should be noted however that all of these studies involved cell culture and not isolated enzyme systems ; the mechanism and pathways by which suramin affected each of these enzymes is unclear . in sum , the antigrowth factor activity via cytokine - receptor blockade , which agrees with our data on gm - csf , appears to be a constant theme across multiple cytokines . in spite of the demonstrated autocrine growth promoting role of cytokines such as gm - csf and il - 1 in leukemia ( 31 , 42 - 45 ), little work has been published with suramin &# 39 ; s use for hematopoietic malignancies . in one study , five of nine evaluable follicular lymphoma patients achieved a partial remission of their disease with suramin ( 46 ). however , with the exception of four patients with agnogenic myeloid metaplasia ( a chronic myeloproliferative disorder ) ( 47 ), medline search revealed no suramin trials in myeloid leukemia . suramin does strongly suppress in vitro the proliferation of the hl - 60 acute leukemic cell line ( 48 ) and the work of orchard ( 49 ) agrees with our finding of suramin inhibition of gm - csf dependent cell growth ( 24 ). autocrine growth factor loops involving cytokines have been implicated as important in the growth of certain tumors and leukemias . the work of the inventors has shown that suramin is a potent agent against leukemic cells in vivo and has been expanded to include several suramin analogs . due to the toxicities of suramin , the effectiveness of suramin used in combination with biologic agents specifically , all trans - retinoic acid ( atra ) has been studied . the goal was to ascertain if such combinations are merely additive or are synergistic . all trans - retinoic acid has been found to be an effective agent for induction of remission when used as a single agent in acute promyelocytic leukemia and other retinoids are under study both as maintenance agents in acute leukemia and in other solid tumors . the possibility that such combinations are synergistic assists in dosing patients with suramin at levels which are less toxic and yet result in greater activity . cell lines which have been selected for atra resistance are utilized to examine if synergism remains or is abrogated with these retinoid resistant cell lines . cell lines chosen for this study include the atra sensitive human acute leukemia hl - 60 and atra sensitive apl line , nb4 , both of which have been extensively studied . an atra resistant sub clone , hl - 60r was obtained from dr . steve collins . while originally described as an acute promyelocytic cell line , more recent work categorizes this line as an acute myelogenous leukemia . therefore , a second atra resistant line ( nb4 . 306 ) which is derived from the nb4 cell line from a patient with acute promyelocytic leukemia was obtained . the nb4tnb4 . 306 lines contain the t ( ls , 17 ) typical of apl . the sensitivity of these cell lines to atra and suramin ( or nf110 ) as single agents is assessed . atra dose response curves ( 10 - 5 - 10 - 9m ) are generated as are suramin / analogue dose response curves ( 10 - 4 - 10 - 8m ). these data for each individual cell line allow description of describe ic50 concentrations for the individual agents , and in the case of suramin analogues , permit comparison of efficacy . assays of proliferation consist of cell proliferation ( 3h - thymidine ) assay as previously described or the mtt assay after 3 - 5 days of exposure to the agents . cell proliferation is assayed using a modification of the original mtt calorimetric assay described by mosmann ( 53 ). to better delineate the issues of proliferation ( and inhibition thereof ) versus differentiation , which is induced by certain of the agents being proposed for testing , an alternative method would utilize simple cell counting ( courter , inc .) of aliquots at 3 and 5 days of continuous exposure with concomitant analysis of induced differentiation by cell morphology ( nbt - positive ) conducted . the percentage of differentiated cells in liquid culture determined by the nbt reduction test ( as described , ( 54 ) allows for an estimate of the total number of cells which are still blast cells and therefore considered capable of continued leukemogenic growth . the most promising combinations are used to examine de novo acute myeloid leukemia patient samples in like fashion . a scid mouse host system is utilized and the most promising agent combinations are examined to determine the response of human leukemic cell lines in these host animals . finally , the potential mechanisms of the atra / suramin synergistic activity as it relates to cytokine receptor density on treated human leukemia cell lines is examined . mechanisms of action and clinically relevant studies with retinoids in combination with antigrowth factor agents to improve the therapeutic index or expand the use of retinoids into other myeloid leukemias other than acute promyelocytic leukemia . the work has direct relevance to the role of vitamin nutrients in the treatment of selected malignancies , in this case myeloid leukemias , and broadens the applications of retinoids by proving the theoretical unexpected advantage of combination usage with antigrowth factor agents . the antigrowth factor activity of suramin was tested alone and in combination with all - trans retinoic acid ( atra ) against the human leukemic line hl - 60 or its atra resistant subclone , hl - 60r , to assess if an agent with the ability to interrupt putative autocrine driven leukemic cell growth could reestablish sensitivity to atra . using the mtt cytotoxicity assay , comparison of ed50 values of suramin alone revealed hl - 60 cells to be more resistant than hl60r ( 38 . 7 vs . 1 3 . 4 , um ). synergy or antagonism between combinations was then assessed using a combination - index ci - isobolo gram method . combinations of suramin ( 3 . 5 - 56 μm ) and atra ( 0 . 001 - 0 . 16 μm ) at a ratio of 350 : 1 showed synergy with a mean ci value of 0 . 72 + 0 . 06 sd ( 0 . 61 - 0 . 79 ) with the hl - 60 cell line . however with hl - 60 r cells , these combinations were antagonistic with ci values of 1 . 40 + 0 . 21 ( 1 . 13 - 1 . 63 ) despite greater sensitivity to suramin alone . combination studies with suramin and cytosine arabinoside were not synergistic with hl - 60 cells , but did show additive activity . while suramin addition was not useful in restoring atra sensitivity , the combination was synergistic with atra sensitive hl - 60 leukemic cells . in this human leukemia model , suramin in combination with the differentiating agent atra offers a novel treatment approach . cell lines chosen for this study include the atra sensitive human acute leukemia hl - 60 and the atra resistant subclone , hl - 60r . while originally described as an acute promyelocytic cell line , more recent work categorizes this line as an acute myelogenous leukemia . the sensitivity of these cell lines to atra and suramin alone as single agents has been assessed . these data permit the description of the ic50 concentrations for the individual agents . the assays of proliferation consist of cell proliferation after 3 - 5 days of exposure to the agents . cell proliferation is assayed using a modification of the original mtt calorimetric assay described by mossman , et al . in similar fashion , a dose response curve to cytosine arabinoside has been generated . using the ic50 values for each agent alone allows selection of reasonable drug combinations . the data software program , &# 34 ; dose effect analysis with microcomputers &# 34 ; ( biosoft , inc .) developed by dr . chou , et al . is utilized . this computer analysis program allows the assessment of drug combinations for synergistic , additive , or antagonistic interactions . compounds related to vitamin a when used together with drugs that inhibit growth factor related tumor cell growth result in greatly increased activity against certain forms of leukemia . the compounds which are related to vitamin a are known as retinoids and the drug which inhibits growth factor related tumor cell growth is known as suramin . the inventors observe the growth of human leukemia cell lines in laboratory culture which were originally obtained from patients with diseases known as acute promyelocytic leukemia and acute myeloid leukemia to first discover the most useful combinations of retinoids plus suramin to inhibit the leukemia cell lines . each of several retinoid compounds are tested in combination with suramin or a very potent analog , nf110 . leukemia cell lines which are resistant to retinoids are tested to see if they remain sensitive to the combination or are resistant also to the combination of retinoids with suramin . the most promising combinations are tested against fresh acute leukemia patient samples . all of the testing which has been done in laboratory culture are examined in an animal model system of human leukemia cell growth . finally , possible mechanisms of why retinoids plus suramin have such greatly increased activities is studied . the invention combines certain vitamin analogs ( retinoids ), when used in conjunction with anti - growth factor agents ( suramin and analogs ), and can result in synergistic activities against certain myeloid leukemias . to define these activities , the rationale for such synergism , and preclinical models to examine the potential for anti - leukemic treatment include ; 1 . utilizing in vitro human leukemia models , define the capacity for synergism between retinoids and suramin / analogs and the most advantageous doses and sequencing . a .) utilizing retinoic acid sensitive human leukemic cell lines ( nb4 ) derived from an acute promyelocytic leukemia ( apl ) patient , examine the activity of all - trans retinoic acid ( atra ), 9 - cis retinoic acid , and 13 - cis retinoic acid in combination with suramin or its most potent analog ( see section h ), nf110 . b ) utilizing a retinoic acid sensitive human myeloid leukemic cell line ( hl60 ) derived from an acute myeloid leukemia ( aml ) patient , examine in like fashion the retinoids ( as above ) in combination with suramin / nf110 . c ) examine in the above models if sequential therapy ( retinoids followed by the addition of suramin , or the converse ) is superior to simple combination therapy . d ) utilizing cell lines selected for retinoid resistance ( nb4 . 306 , hl - 60r ) examine if synergism with combination therapy is retained or abrogated . e ) take the most promising combination as defined above , and examine the in vitro activity against de novo acute myeloid leukemia patient samples . 2 . utilizing the scid mouse host system , take the most promising agent combinations and examine the response of human leukemia cell lines in the scid mouse hosts . 3 . investigate potential mechanisms of the atra / suramin synergistic activity as they relate to cytokine receptor availability on treated human leukemia cell lines . previous publications disclose a novel nucleotide binding site on murine and human granulocyte / macrophage - colony stimulating factor ( gm - csf ) which is critical to the biologic activity of this cytokine . the inventors have subsequently shown that a pharmacologic antigrowth factor agent , suramin , interacts with the gm - csf binding site and inhibits gm - csf dependent cell growth . acute myeloid leukemic ( aml ) cells produce cytokines , possess their receptors , and in 70 % of patients with aml have evidence of in vitro autonomous growth related to autocrine growth factor loops , particularly with gm - csf ( 31 ) and il - 1 ( 42 - 45 ). the effect of suramin on hl - 60 human leukemic cells was examined and inhibition resulted as has been previously noted ( 48 ). a graphical correlation was then generated which shows a very agreeable correlation as regards rank ordering of inhibition of both nucleotide binding and leukemia proliferation ( table 1 ). nf110 has been discovered to have a greatly enhanced activity ( 5 - 10 fold ) against hl - 60 and the hl - 60r ( trans retinoic acid resistant ) cell line ( fig1 ). table 1______________________________________inhibitory potency of suramin and suramin analogs : competition curves for nucleotide , photoprobe incorporation into rhgm - csf gave half - maximal inhibitions of photoprobe incorporation as compared to control . similarly , cell proliferating of gm - csf dependent ( mo7e ) and autonomously proliferation ( gm - csf independent ) human leukemia cells ( hl - 60 ) gave half - maximal inhibition of growth . results are expressed as micromolar concentrations . half - maximal half - maximal inhibition half - maximal inhibition of of hl - 60 inhibition of mo / 7e growth growth ( gm - nucleotide ( gm - csf csf compound binding dependent ) independent ) ______________________________________nf110 1 . 5 52 6 suramin 2 . 5 68 38 nf302 2 . 0 76 80 nf201 2 . 3 76 155 nf023 5 . 0 102 175 nf103 16 . 0 141 not reached______________________________________ suramin plus atra strongly inhibited hl - 60 and hl - 60r growth . the data software program , &# 34 ; dose effect analysis with microcomputers &# 34 ; ( biosoft , inc .) ( 50 - 52 ) has analyzed a number of experiments utilizing combinations of atra and suramin . the analysis utilizing the software program now reveals that this activity is a truly synergistic one ( fig2 ). table 2 displays the fractional inhibition by each agent singly and in combination against hl - 60 . single drug dose - effect relationship parameters ( dm , m , and r ) were calculated for suramin ( d1 ) and atra ( d2 ). table 2______________________________________example of experimental design and dose - effect relationship of suramin and all - trans retionoic acid ( atra ) and their combination on the growth of hl60 cells after 5 days exposure : the parameters m , dm , and r are the slope , antilog of x - intercept , and the linear correlation coefficient of the median - effect plot , which signifies the shape of the dose - effect curve , the potency ( ic . sub . 50 ), and conformity of the data to the mass - action law , respectively . dm and m values are used for calculating the ci values . ci & lt ; 1 , ci = 1 , and ci & gt ; 1 indicate synergism , additivity , and antagonism , respectively . as based on the classic isobologram equations , ci can be calculated by the equation ci = [( d ). sub . 1 /( d . sub . x ). sub . 1 ] + [( d ). sub . 2 /( d . sub . x ). sub . 2 ], where d . sub . x = dm [ fa / 1 - fa )]. sup . 1 , and where fa = fractional inhibition . hl 60 cells suramin atra fractional ( μm ) ( μm ) inhibition m dm r ci______________________________________3 . 5 . 020 7 . 0 . 047 14 . 0 . 093 28 . 0 . 419 56 . 0 . 678 1 . 725 38 . 6658 . 98606 . 001 . 561 . 01 . 777 . 02 . 790 . 04 . 823 . 08 . 826 . 16 . 835 . 2729 . 00022 . 95094d . sub . 1 + d . sub . 2 ( 350 : 1 ) 3 . 5 . 01 . 764 . 69631 7 . 0 . 02 . 806 . 6175 14 . 0 . 04 . 831 . 75907 28 . 0 . 08 . 867 . 72063 56 . 0 . 16 . 897 . 3505 . 12781 . 996 . 78735______________________________________ from studies of single drug , the dose ranges were selected to cover the concentrations above and below the ic - 50 values of each agent . this led to the generation of the combination indices ( ci ) based on the classic isobologram equation . results showed definite synergism ( ci values less than 1 ) with the hl - 60 cell line and this combination ( table 2 , fig2 ). atra plus suramin also inhibited hl - 60r ( fig3 ), synergism was encountered only at the higher doses per the computer analysis . in similar fashion , α - interfereon given in combination with suramin inhibits the proligeration of hl - 60 cellls in a synergistic fashion ( fig4 ). in a related experiment , when interferon was given for the initial 48 hours of incubation followed by an additional 72 hours during which both interferon and suramin were present , the results were not only synergistic , but showed greater activity than the simeple combination together ( fig5 ). synergism with the combination of α - interferon and suramin were also noted against the hl - 60r cell line at doses greater than 25 mm suramin and 5 , 000 units / ml α - interferon ( fig6 ). finally , the addition of suramin and interferon together for a 5 - day incubation showed additive activity against hl - 60 ( fig7 ), and for suramin and ara - c ( fig8 ). the capacity to perform the detailed dose - effect combination drug analyses which support our hypothesis regarding potential synergism of the suramin class agents with retinoid compounds . differentiation agents , specifically atra , are used in the treatment of acute promyelocytic leukemia ( apl ) and other retinoids are in clinical trials with other acute myeloid leukemias ( 7 , 8 ). the efficacy of atra to induce terminal differentiation ( thus depleting the leukemic blast population ) is proven ; however , recrudescence of leukemia after a short period of complete remission is common and new autocrine growth factor loops have been proposed as one mechanism of resistance ( 1 ). suramin has anti - growth factor activity against hl - 60 , a human acute leukemia cell line sensitive to atra ( 48 ). the possibility that agents with anti - growth factor activity can provide additive or synergistic effects upon atra sensitive and atra resistant leukemia cell lines was explored . the mainstay of therapy for acute leukemia remains chemotherapy . however , for adults , a 60 - 70 % initial complete remission rate results in only 20 - 25 % long - term survivorship ( excepting apl with 60 % long - term survivorship with atra plus chemotherapy ). alternatively , direct assessment of cells capable of forming colonies , colony forming unit , leukemia ( cfu - l ) are examined as a measure of cells capable of continued leukemic growth . approximately 25 microliters of cell suspension are taken from each sample and plated in wells containing culture medium consisting of imdm + 10 % fbs +( difco ). for colony assay , aggregates of at least 40 cells and clusters ( 4 - 39 cells ) are scored after 12 - 14 days of culture . the number of cfu - l are expressed as the number of colonies derived from the original suspension culture ( s5 ). finally , the results seen with leukemic cell lines are correlated with selected agents and combinations of agents , against de novo acute leukemia cells . therapeutic apheresis results in the removal of large quantities of leukemia cells from patients presenting with a high degree of leukocytosis ( generally blast count greater than 100 , 000 / cc3 ). these large numbers of cells are frozen in liquid nitrogen with dmso in the usual fashion in aliquots . this allows for repeated examinations from the same patient source and allow for some control regarding the reproducibility of results . the procedures for measurement of inhibition of proliferation or the induction of differentiation , etc ., are as described above for the leukemic cell lines noted . these techniques have been utilized in other studies and are well established in the literature ( 31 ). as noted above , ic50 values for each agent alone are established for comparison purposes . the data software program , dose effect analysis with microcomputers &# 34 ; ( biosoft , inc .) ( 51 ) analyzed a number of experiments to date utilizing combinations of atra and suramin . this computer analysis program has been utilized to assess and has been validated by multiple laboratories ( 50 - 52 ). information derived from the prior experiments described above leads to examination of retinoids and anti - growth factor ( suramin and nf110 ) agents alone and in combination utilizing a scid mouse model of human leukemia proliferation . efficacy of therapeutic agents is a predictor of in vivo effects . a relevant animal model system exists for in vivo testing of agents and combinations of agents . scid mice weighing greater than 25 grams are utilized as host animals for human acute leukemia cell lines which have been established in in - vitro culture ( 56 ). 1 × 10 cells are injected either intravenously or subcutaneously as appropriate to the experiment . as 2 of the cell lines ( nb4 and nb4 . 306 ) must be grown in scid mice , the number of cells to be injected may vary and a cell dose compatible with leukemic cell engraftment are established for those cell lines separately . immune deficient scid mice are utilized . cells are inoculated into animals with minimal numbers of animals consisting of 5 per control / treatment group . the cell lines are inoculated either intravenously ( 56 ) or subcutaneously ( 57 ) at a dose of from 10 6 to 10 8 per animal as established for engraftment for the individual cell lines being utilized . mice receiving intravenous inoculations are pre - treated one to two days prior to injection with 200 reds of sub - lethal irradiation to enhance marrow engraftment of the leukemic cell line as per published procedures ( 56 ). this sub - lethal dose may enhance acceptance of xenografts by diminishing any natural killer cell activity . subsequent to leukemic cell engraftment , treatment of the animals commences 1 week after leukemia cell injection . treatment is daily for 5 days and dosages conform to atra work or derived from in vitro concentrations from the experiments above and pharmacokinetic information on suramin ( 58 ). atra is administered orally through a gavage needle . suramin is administered by intravenous or intraperitoneal injection . these mice are examined at least once and usually twice daily and premorbid signs such as hunching , lack of mobility , or other clear signs of animal distress result in the animal being sacrificed by cervical dislocation ( 59 ). alternatively , the animals injected by the subcutaneous route have their tumors measured on a daily basis and when such tumors reach 1 . 5 centimeters in size , these animals are sacrificed ( 57 ). tissues are obtained at the time of animal sacrifice from representative animals include blood specimen for blood smear and assessment of leukemic cell growth , one femur from which bone marrow smears will be made and examined , and in the case of the subcutaneously injected animals , the resulting tumor are surgically excised and touch preps made and examined . the histologic examinations assure that the animal indeed did have engraftment of the human acute leukemia cell line and that it was responsible for the animal &# 39 ; s death . outcomes of groups of animals per control or treatment group are used to derive mean + standard error of the mean as regards survival . in the case of subcutaneous leukemic cell injection , bidimensional tumor measurements ( by calibers ) on a set day post injection ( defined by how well the individual lines engraft and grow ) are compared similarly between groups . comparison of treatment groups versus control are analyzed . potential mechanisms of atra / suramin synergistic activity are investigated as they relate to cytokine receptor density on treated human leukemia cells . data indicates synergism , i . e ., supra - additive activity , of atra plus suramin . synergism is often obtained when two agents are interfering with a common metabolic pathway . in this case , it is believe that atra may diminish gm - csf receptors on the surface of leukemia cells in a fashion analogous to down regulation of il - 6 receptors ( 60 ) and tnf receptors ( 61 ) on myeloma and lymphoma cells , respectively . this theoretically potentiates the cytokine ( gm - csf )-- receptor blockade which is believed to be a major mechanism of suramin activity . methods : human leukemic cell lines ( nb4 , hl - 60 ) are treated with a selected retinoid , suramin , or a combination for 8 - 24 hours . these cells are analyzed by flow analysis ( facs scar , becton dickenson ) for gm - csf receptors after application of monoclonal antibodies directed against either gm - csfrα or gm - csfβ ( santa cruz biotech , inc .) with labeled fitc / anti - mouse second antibody . these analyses are conducted by the cancer center &# 39 ; s flow analysis core facility and follow previously published methodology . results of treatment is compared to appropriately matched control samples . testing of selected agents / combinations against fresh human leukemia samples to confirm cell line results is anticipated . comparisons of relative receptor density between treated and matched control samples are analyzed to ascertain statistical differences . 1 . suramin is active against hl60 ( as previously reported by others also ) and is also active against hl - 60r and nb4 . 2 . the combination of atra and suramin is synergistic against hl - 60 ; this is found in the hl60r cells at higer atra concentrations tested . 3 . the combination of suramin and ara - c is additive using this methodology , as well as γ interferon and suramin . 4 . synergism between suramin and atra is believed to relates to their mode of action . suramin interacts with cytokines and thus may interrupt autocrine growth factor loops which have been described for acute leukemia . atra , along with its activity in the nucleus , results in the reduction of cytokine receptors . it is believed that both of these agents are therefore interacting against autocrine signal transduction pathways , one by interfering with cytokine - receptor interaction and the other , by down modulating the number of receptors available . further , the composition of the present invention is useful in pharmaceutical formulation for systemic administration to humans and animals in unit dosage forms , such as tablets , capsules , pills , powders , granules , suppositories , sterile parenteral solutions or suspensions , sterile non - parenteral solutions or suspensions oral solutions or suspensions , oil in water or water in oil emulsions and the like , containing suitable quantities of an active ingredient . topical application can be in the form of ointments , creams , lotions , jellies , sprays , douches , and the like . for oral administration either solid or fluid unit dosage forms can be prepared with the compositions of the invention . the compositions are useful in pharmaceutical compositions ( wt %) of the active ingredient with a carrier or vehicle in the composition in about 1 to 20 % and preferably about 5 to 15 %. either fluid or solid unit dosage forms can be readily prepared for oral administration . for example , the composition of the invention can be mixed with conventional ingredients such as dicalciumphosphate , magnesium aluminum silicate , magnesium stearate , calcium sulfate , starch , talc , lactose , acacia , methyl cellulose and functionally similar materials as pharmaceutical excipients or carriers . a sustained release formulation may optionally be used . capsules may be formulated by mixing the compound with a pharmaceutical diluent which is inert and inserting this mixture into a hard gelatin capsule having the appropriate size . if soft capsules are desired a slurry of the compound with an acceptable vegetable , light petroleum , or other inert oil can be encapsulated by machine into a gelatin capsule . suspensions , syrups and elixers may be used for oral administration of fluid unit dosage forms . a fluid preparation including oil may be used for oil soluble forms . a vegetable oil such as corn oil , peanut oil or safflower oil , for example , together with flavoring agents , sweeteners and any preservatives produces an acceptable fluid preparation . a surfactant may be added to water to form a syrup for fluid unit dosages . hydro - alcoholic pharmaceutical preparations may be used having an acceptable sweetener such as sugar , saccharine or a biological sweetener and a flavoring agent in the form of an elixer . pharmaceutical compositions for parenteral and suppository administration can also be obtained using techniques standard in the art . the above parenteral solutions or suspensions may be administered transdermally and , if desired a more concentrated slow release form may be administered . accordingly , incorporation of the active compounds in a slow release matrix may be implemented for administering transdermally . the compounds may be administered transdermally at about 1 to 20 % of the composition and preferably about 5 to 15 % wt % of the active ingredient in the vehicle or carrier . transdermal therapeutic systems are self - contained dosage forms that , when applied to intact skin , deliver drug ( s ) at a controlled rate to the systemic circulation . advantages of using the transdermal routing include : enhanced therapeutic efficacy , reduction in the frequency of dosing , reduction of side effects due to optimization of the blood - concentration versus time profile , increased patient compliance due to elimination of multiple dosing schedules , bypassing the hepatic &# 34 ; first - pass &# 34 ; metabolism , avoiding gastrointestinal incompatibilities and providing a predictable and extended duration of activity . however , the main function of the skin is to act as a barrier to entering compounds . as a consequence , transdermal therapy has so far been restricted to a limited number of drugs that possess the desirable physicochemical properties for diffusion across the skin barrier . one effective method of overcoming the barrier function of the skin is to include a penetration enhancer in the formulation of a transdermal therapeutic system . see barry , brian w . : dermatological formulations : percutaneous absorption ( dekker , new york , 1983 ); bronough et al , percutaneous absorption , mechanisms - methodology - drug delivery , ( marcel dekker , new york , ny 1985 ); and monkhouse et al , transdermal drug deliver - problems and promises . drug dev . ind . pharm ., 14 , 183 - 209 ( 1988 ). a penetration enhancer is a chemical compound that , when included in a formulation , temporarily increases the permeability of the skin to a drug allowing more of the drug to be absorbed in a shorter period of time . several different types of penetration enhancers have been reported such as dimethylsulfoxide , n - decyl methyl sulfoxide , n , n - dimethylacetamide , n & lt ; ni - dimethylformamide , 1 - dodecylazacycloheptan - 2 - one ( azone ), propylene glycol , ethanol , pyrrolidones such as n - methyl - 2 - pyrrrolidone ( nmp ) and surfactants . see bronough et al , supra , and stoughton et al , azone : a new non - toxic enhancer of percutaneous penetration . drug dev . inc . pharm ., 9 , 725 - 744 ( 1983 ). n - methyl - 2 - pyrrolidone is a versatile solvent which is miscible with water , ethyl alcohol , ether , chloroform , benzene , ethyl acetate and carbon disulfide . n - methylpyrrolidone has been widely used as a solvent in industrial processes such as petroleum refining , gaf corp . : &# 34 ; m - pyrol ( n - methyl - 2 - pyrrolidone ) handbook .&# 34 ;, gaf corp ., new york , 1972 . it is currently used as a solubilizing agent in topical and parenteral veterinary pharmaceuticals and is now under consideration for use in products intended for humans , wells , d . a . et al : disposition and metabolism of double - labeled [ 3 h and 14 c ] n - methyl - 2 - pyrrolidone in the rat . drug met . disps ., 16 , 243 - 249 ( 1988 ). animal and human experiments have shown very little irritation or sensitization potential . ames type assays and chronic exposure studies have not revealed any significant toxicity , wells et al , mutagenicity and cytotoxicity of n - methyl - 2 - p [ yrrolidone and 4 -( methyl amino ) butanoic acid in the salmonella / microsome assay . j . appl . tox ., 8 , 135 - 139 ( 1988 ). n - methylpyrrolidone has also been shown to be an effective penetration enhancer . barry et al , optimization and bioavailability of topical steroids : penetration enhancers under occlusion . j . inv . derm ., 82 , 49 - 52 ( 1984 ); effect of dose variation , deposited drug films , occlusion and the penetration enhancer n - methyl - 2 - pyrrolidone . j . pharm . pharmacol ., 37 , 27 - 37 ( 1984 ); holegaard et al , vesical effect on topical drug delivery iv . effect of n - methylpyrrolidone and polar lipids on percutaneous transport . int . j . pharm ., 43 , 233 - 240 ( 1988 ); sugibayashi et al , effect of several penetration enhancers on the percutaneous absorption of indomethacin in hairless rat . chem . pharm . bull ., 36 , 1519 - 1529 ( 1988 ); bennett et al , optimization of bioavailability of topical steroids : non - occluded penetration enhancers under thermodynamic control . j . pharm . pharmacol ., 37 , 298 - 304 ( 1985 ); sasaki et al , enhancing effect of pyrrolidone derivatives on transderman drug delivery . 1 . ing . j . pharm ., 44 , 14 - 24 ( 1988 ); lee et al , toxicity of n - methyl - 2 - pyrrolidone ( nmp ): tetratogenic , subchronic and two - year inhalation studies , fund . appl ., tox ., 9 , 222 - 235 ( 1987 ). the above and other drugs can be present in the reservoir alone or in combination form with pharmaceutical carriers . the pharmaceutical carriers acceptable for the purpose of this invention are the art known carriers that do not adversely affect the drug , the host , or the material comprising the drug delivery device . suitable pharmaceutical carriers include sterile water ; saline , dextrose ; dextrose in water or saline ; condensation products of castor oil and ethylene oxide combining about 30 to about 35 moles of ethylene oxide per mole of castor oil ; liquid acid ; lower alkanols ; oils such as corn oil ; peanut oil , sesame oil and the like , with emulsifiers such as mono - or di - glyceride of a fatty acid , or a phosphatide , e . g ., lecithin , and the like ; glycols ; polyalkylene glycols ; aqueous media in the presence of a suspending agent , for example , sodium carboxymethylcellulose ; sodium alginate ; poly ( vinylpyrolidone ); and the like , alone , or with suitable dispensing agents such as lecithin ; polyoxyethylene stearate ; and the like . the carrier may also contain adjuvants such as preserving stabilizing , wetting , emulsifying agents and the like together with the penetration enhancer of this invention . the effective dosage for mammals may vary due to such factors as age , weight activity level or condition of the subject being treated . typically , an effective dosage of a compound according to the present invention is about 45mg / m 2 / d / po for atra , 200 - 1100 mg m 2 / d / iv ; and 3 - 10 million units / d subcutaneous for α - interferon daily , or preferably about three times per week . 1 . rubertea e , kastner p , dolle p , krust a , leroy p , mendelsohn c , et al . retinoic acid receptors in the embryo . semin dev biol 2 : 153 - 9 , 1991 . 2 . deluca l , retinoids and their receptors in differentiation , embryogenesis and neoplasia . faseb j 5 : 2924 - 33 , 1991 . 3 . frankel s r , warrell r p . retinoids in leukemia and myelodysplastic syndromes . in : hong w k , lotan r . ( eds .) retinoids in oncology . new york . marcel , dekker . pp . 147 - 78 , 1993 . 4 . degos l dombret h , chornienne c , daniel m - t , micler j - m , chastang c , castaigne s , fenaux p . all - trans - retinoic acid as a differentiating agent in the treatment of acute promyelocytic leukemia . blood 85 : 2643 - 53 , 1995 . 5 . tobler a , dawson m i , and koeffler h p . structure - function relationship in normal and leukemic hematopoiesis in vitro . j clin invest 78 : 303 - 309 , 1986 . 6 . personal communication , k . kopecky and f . appelbaum 1995 . please note : dr . doukas ( pi ) is a member of the south west oncology group leukemia and leukemia biology committees . 7 . early e . and dmitrovsky e . acute promyelocytic leukemia : retinoic acid response and resistance . j investig med 43 : 337 - 344 , 1995 . 8 . warrell r p , de the , h , wang z - y , and degos l review article . acute promyelocytic leukemia . nejm 329 ( 3 ): 177 - 189 , 1993 ( july 15 ). 9 . muindi j , frankel s r , miller w h jr . continuous treatment with all - trans retinoic acid causes a progressive reduction in plasma drug concentrations : implications for relapse and retinoid &# 34 ; resistance &# 34 ; in patients with acute promyelocytic leukemia . blood 79 : 299 - 303 , 1992 . 10 . comic m , delva l guidez f , balitrand n , degos l chomienne c . induction of retinoic acid - binding protein in normal and malignant human myeloid cells by retinoic acid in acute promyelocytic leukemia patients . cancer res 52 : 3329 - 34 , 1992 . 11 . gold e j , mertelsman l m , itri t , gee z , arlin s , kempin b , clarkson b , moore m a s . phase i clinical trial of 13 - cis retinoic acid in myelodysplastic syndromes . cancer treat rep 67 : 981 - 986 , 1983 . 12 . aul c , runde v , gatterman n . all - trans retinoic acid in patients with myelodysplastic syndromes : results of a pilot study . blood 82 : 2967 -, 4 , 1993 . 13 . eisenhauer e a , lippman s m , kavanagh j j , parades - espinoza m , arnold a , hong w k , massimini g , schleuniger u , bollag w , holdener e e , and krakoff i . combination 13 - cis - retinoic acid and interferon - α in the therapy of solid tumors . leukemia 8 ( sup 3 ): s38 - s41 , 1994 . 14 . lippman sm , kavanagh j j , paredes - espinoza m . delgadillo - madrueno f , paredescasillas p , hong wk , holdener e , krakoff i h . 13 - cis - retinoic acid plus interferon - α 2a : highly active systemic therapy for squamous cell carcinoma of the cervix . j natl cancer inst 84 : 241 - 245 , 1992 . 15 . grant s , bhalla k , weinstein b , pestka s , mileno m d , and fisher p b . recombinant human interferon sensitizes resistant myeloid leukemic cells to induction of terminal differentiation . biochem and biophys res commun 130 ( 1 ): 379 - 388 , 1985 . 16 . taetle r , dos santos b , akamatsu k , koishihara y , and ohsuagi y . effects of alltrans retinoic acid and anti - growth factor receptor antibodies on growth and programmed cell death of human myeloma cells . blood 86 : 743a , 1995 . 17 . dubois c , schlageter m h , de gentile : hematopoietic growth factor expression and atra sensitivity in acute promyelocytic blast cells . blood 83 : 3264 - 3270 , 1994 . 18 . metcalfe , d . the molecular biology and functions of the granulocyte - macrophage colony - stimulating factors . blood 67 : 257 - 267 , 1986 . 19 . metcalfe d ., begley c g ., johnson g r : biologic properties in vitro of a recombinant human granulocyte - macrophage colony - stimulating factor . blood 67 : 37 - 45 , 1986 . 20 . campbell s ., kim h ., doukas m a , haley be . : photoaffinity labeling of atp and nad + binding sites on recombinant human interleukin - 2 . proc natl acad sci 87 : 1243 - 1246 , 1990 . 21 . heistand d m . dissertation &# 34 ; a study of the nucleotide binding properties of interleukin - lb and tumor necrosis factor - a .&# 34 ; director : dr . boyd haley . the graduate school , university of kentucky , 1994 . 22 . chavan a j , haley b e interaction of nucleotides with acidic fibroblast growth factor ( fgf - 1 ). biochem 33 : 7193 - 7202 , 1994 . 23 . doukas m a , chavan a j , gass c , boone t , and haley b e : identification and description of a nucleotide binding site on recombinant murine granulocyte / macrophage - colony stimulating factor . bioconj chem 3 : 484 - 492 , 1992 . 24 . doukas m . a ., chavan a ., gass c ., boone t ., & amp ; haley b . e . : inhibition of gm - csf activity by suramin and suramin analogs is correlated to interaction with the gm - csf nucleotide binding site . cancer research 55 : 5161 - 5163 , 1995 . 25 . borken , j . the crime and punishment of i . g . farben , p5 . new york : the free press , 1978 . 26 . heymann b , angew : uber chemotherapevtisch wirksame organische verbindungen , insbesondere ubayer 205n . chem . 32 : 585 - 589 , 1924 . 27 . hawking , f : suramin : with special reference to onchocerciasis . adv . pharmacol . chemother . 15 : 289 - 322 . 1978 . 28 . stein , c : suramin : a novel antineoplastic agent with multiple potential mechanisms of action . canc res 53 : 2239 - 2248 , 1993 . 29 . pech n , hennine o , goldwasser e : further study of internal autocrine regulation of multipotent hematopoietic cells . blood 82 : 1502 - 1506 , 1993 . 30 . freedman m h , grunberger t , correa p , axelrad a a , dube i d , cohen a : autocrine and paracrine growth control by granulocyte - monocyte colony - stimulating factor of acute lymphoblastic leukemia cells . blood 81 : 3068 - 3075 , 1993 . 31 . rogers s y , bradbury d , kozlowski r , russell n h : evidence for internal autocrine regulation of growth in acute myeloblastic leukemia cells . exper hernatol 22 : 593 - 598 , 1994 . 32 . strassman g , fong m , freter c e : suramin interferes with il - 6 receptor binding i vitro and inhibits colon - 26 - mediated experimental cancer cachexia in vivo . j clin invest 92 : 2152 - 2159 , 1993 . 33 . mills g b , zhang n , may c , hill m , chung a : suramin prevents binding of 1l - 2 to its cell surface receptor : a possible mechanism for immunosuppression . canc res 50 : 30363042 , 1990 . 34 . alzoni r , corti a , grazioli l surarnin induces deoligomerization of human tumor neaosis factor alpha . j biol chem 268 : 12526 - 12529 , 1993 . 35 . middaugh c r , mach h , burke c j : nature of the interaction of growth factors with suramin . biochem 31 : 9016 - 9024 , 1992 . 36 . jindal h . k , anderson c . w ., davis r . g ., and vishwanattha j . k . : suramin effects dna synthesis in hela cells by inhibition of dna polymerases . cancer res ., 50 : 7754 - 7757 , 1 990 . 37 . bojanowski k , lelievre s ., markovits j ., couprie j ., jacqupmin - sablon , and larsen a . k . : suramin is an inhibitor of dna topoisomerase in vitro and in chinese hamster fibrosarcoma cells . proc . natl . acad . sci . usa , 89 : 3025 - 3029 , 1992 . 38 . barret j . m ., ernould a . p ., rouillon m . h ., ferry g ., genton a ., and boutin j a . : studies of the potency of protein kinase inhibitors on atpase activities . che -- biol . interact . 86 : 17 - 27 , 1993 . 39 . hensey c . e , bosboinik d ., and azzi a . : suramin , an anticancer drug , inhibits protein kinase c and induces differentiadon in neuroblastoma cell cl one nb 2a . febs lett . 258 : 156 - 158 , 1989 . 40 . kopp r , and pfeiffer a . : suramin alters phosphoinositide synthesis and inhibits growth factor receptor binding in ht - 29 cells . cancer res ., 50 : 6490 - 6496 , 1990 . 41 . sartor , o , mclellan , c a , myers , c e , borner , m m : suramin rapidly alters cellular tyrosine phosphorylation in prostate cancer cell lines . j clin invest 90 : 2166 - 2174 , 1992 . 42 . estrov z , kurzrock r , wetzler m , kantarjian h , blake m , harris d , gutterman j u , talpaz m . suppression of chronic myelogenous leukemia colony growth by interleukin - 1 ( il - 1 ) receptor antagonist and soluble il - 1 recpetors : a novel application for inhibitors of activity . blood 78 : 1476 - 1484 , 1991 . 43 . estrov z , kurzock r , estey e , wetzler m , ferrajoli a , harris d , blake m , gutterman j u , talpaz m . inhibition of acute myelogenous leukemia blast proliferation by interleukin - 1 ( il - 1 ) receptor antagonist and soluble il - 1 receptors . blood 79 : 1938 - 1945 , 1992 . 44 . strassmann g , d &# 39 ; alessandro f , fong m , nordan r p , nickel p , chizzonite r . surarnin blocks the binding of interleukin - 1 to its receptor and neutralizes il - 1 biological activities . int j immunopharmac 16 : 921 - 939 , 1994 . 45 . estrov z , talpaz m , estey e h , strassmann g . role of suramin as an il - 1 inhibitor in suppresison of acute myelogenous leukemia progenitor proliferation . exper hematol 23 : 1080 - 1087 , 1995 . 46 . larocca r v , cooper m r , stein c a : a pilot study of suramin in the treatment of progressive refractory follicular lymphomas . ann oncol 3 : 571 - 573 , 1992 . 47 . tefferi a , silverstein m n , plurnhoff e a : suramin toxicity and efficacy in agnogenic myeloid metaplasia . j natl canc instit 85 : 1520 - 1522 , 1993 . 48 . bai l , nacmoto y , miyazaki m . orita k , and numba m : antiproliferative effects of surarnin on human cancer cells in vitro and in vivo . acta med okayama 46 ( 6 ): 457 - 463 , 1992 . 49 . orchard p j , mcivor r s , singh h a , blazar b r . gm - csf - induced internal autocrine proliferation occurs in a compartment outside of the endoplasmic reticulum . exper hematol 23 : 573 - 582 , 1995 . 50 . chou t c , motzer r j , tong y , bosl g j : computerized quantitation of synergism and antagonism of taxol , topotecan , a rational approach to clinical protocol design . j nat &# 39 ; l can inst 86 ( 20 ): 1517 - 1524 . 1994 . 51 . chou t c , talalay p : quantitative analysis of dose - effect relationships : the combined effects of multiple drugs or enzyme inhibitors . adv enzyme regul 22 : 2755 , 1984 . 52 . chang t t , gulati s c , chou t c , vega r , gandola v l ezzat ibrahim s m , yopp j , colvin m , and clarkson b d : synergistic effect of 4 - hydroperoxycyclophosph ˜ mide and etoposide on a human promyelocytic leukpmia cell line ( hl - 60 ) demonstrated by computer analysis . cancer research 45 : 2434 - 2439 , 1985 . 53 . mosmann &# 39 ; t . rapid calorimetric assay for cellular growth and survival : application to proliferation and cytotoxicity assays . j . immunol . meth , 65 : 55 - 63 , 1983 . 54 . breitman t r , selonick s e , collins s j : induction of differentiation of the human promyelocytic leukemia cell line ( hl - 60 ) by retinoic acid . proc natl acad sci 77 : 2936 - 2940 , 1980 . 55 . nakae , h and asada , s : synergistic antiproliferative effect of interferons and azidothymidine on hl60 cells . chem pharm bull . 40 ( 3 ): 821 - 822 , 1992 . 56 . delord c , clutterbuck r , titley j . : growth of primary human acute leukemia in scid mice . exp hematol 19 : 991 - 993 , 1991 . 57 . pirrucello s j , jackson j d , lang m s : oma - aml - 1 : a leukemic myeloid cell line with cd34 + progenitor and cd15 + spontaneously differentiating cell compartments . blood 80 : 1026 - 1032 , 1992 . 58 . namikawa r , ueda r , kyoizluni s : growth of human myeloid leukemias in the human marrow environment of scid - hu mice . blood 82 : 2s26 - 2536 . 59 . beran m , piza p , o &# 39 ; brien s . : biologic properties and growth in scid mice of a new myelogenous leukemia cell line ( kbm - 5 ) derived from chronic myelogenous leukemia cells in the blastic phase . canc . res . 53 : 3603 - 3610 , 1993 . 60 . ogata a , nishimoto n , shima y , yoshizaki k , and kishimoto t . inhibitory effect of all - trans retinoic acid on the growth of freshly isolated myeloma cells via interference with interleukin - 6 signal transduction . blood 84 ( 9 ): 304 - 3046 , 1994 ( november 1 ). 61 . totpal k , chaturvedi m m , iapushin r , and aggarwal b b . retinoids downregulate both p60 and p80 forms of tumor necrosis factor receptors in human histiocytic lymphoma u937 cells . blood 85 ( 12 ): 3547 - 3555 , 1995 ( june 15 ). the purpose of the above description and examples is to illustrate some embodiments of the present invention without implying any limitation . it will be apparent to those of skill in the art that various modifications and variations may be made to the composition and method of the present invention without departing from the spirit or scope of the invention . all patents and publications cited herein are incorporated by reference in their entireties .

US-3103798-A

a hockey sock is provided , constructed as a tube . the tube includes an outer textile layer and an inner lining including an ultra - high molecular weight polyethylene yarn that confers cut - resistance to the hockey sock . the inner lining may be configured as a knit half - cardigan fabric that is disposed generally in a floating relationship with the outer textile layer such that the two are connected only at their respective top and bottom , and / or a select number of locations such as point connections , seams , or other connections that permit a sliding relationship between the layers .

embodiments are described with reference to the drawings in which like elements are generally referred to by like numerals . the relationship and functioning of the various elements of the embodiments may better be understood by reference to the following detailed description . however , embodiments are not limited to those illustrated in the drawings . it should be understood that the drawings are not necessarily to scale , and in certain instances details may have been omitted that are not necessary for an understanding of embodiments of the present invention , such as — for example — conventional fabrication and assembly . the present invention now will be described more fully hereinafter . this invention may , however , be embodied in many different forms and should not be construed as limited to the embodiments set forth herein ; rather , these embodiments are provided so that this disclosure will be thorough and complete , and will fully convey the scope of the invention to those skilled in the art . as used in this specification and the claims , the singular forms “ a ,” “ an ,” and “ the ” include plural referents unless the context clearly dictates otherwise . fig1 shows a pair of hockey socks 100 of the present invention , including a multi - colored striped pattern on its exterior , although the sock may be solid color or any combination of solid color ( s ) and / or pattern ( s ). fig2 shows a side view of a single hockey sock 100 . the sock 100 is open at its top end 102 and at its bottom end 104 , forming a tapered tube or generally tube - like shape configured and dimensioned to accommodate and fit to a player &# 39 ; s leg , including any underlying equipment ( e . g ., shin guards , thigh pads , etc .). a smaller - diameter portion near the bottom end 104 may allow a player to tuck the sock 100 into his skate or to have it closely fit around the skate &# 39 ; s exterior . the visible outer layer 110 may include or completely be constructed of , for example , a textured polyester fiber , cotton , spun polyester , or a combination thereof , as well as any other appropriate knitted , woven , or non - woven textile material . in some embodiments , an inward - facing surface of the outer layer may include spun polyester , which provides desirable strength , low weight , and low moisture absorption ( e . g ., as compared to cotton ). in preferred embodiments , the outer layer 110 may be dyed during and / or after construction , and / or may incorporate dyed or otherwise colored yarn and / or other construction materials that will be useful and likely to be used by players desiring ( or — subject to rules — needing ) to have certain colors in their hockey socks . for example , the sock may include colored material selected to provide a desired color scheme such as official team colors , or some other pre - determined color and / or color - combination . fig3 shows an upper portion of the sock 100 of fig3 , viewed along a lateral section taken across line 3 - 3 of fig2 . the outer layer 110 surrounds an inner layer 112 . the inner layer 112 includes an ultra - high molecular weight polyethylene yarn ( uhmw — ultra - high molecular weight fiber ). one preferred material is commercially available under the trade name dyneema ®. in various embodiments , the liner / inner layer 112 may include , consist of , or consist essentially of the ultra - high molecular weight polyethylene yarn , which may be woven or may be knit , for example , as a half - cardigan fabric . cut - resistant fibers including non - uhmw materials such as , for example , para - aramid synthetic fibers ( e . g ., poly paraphenylene terephthalamide , available as kevlar ®) high - density polyethylene ( hdpe ) fibers , and / or other materials may be used with or in addition to uhmw materials ). the liner 112 may be woven , knit , or any combination thereof . a tubular knit construction , of which half - cardigan is one example , may be preferred in many embodiments for the inner layer 112 . fig4 shows the hockey sock of fig2 , with an intermediate portion of the outer layer 110 removed for illustrative purposes only to show the liner 112 . in the embodiment shown , the liner 112 is attached to the outer layer 110 only along a circumferential upper seam 106 near the upper end 102 and / or a circumferential lower seam 108 near the lower end 104 . at least one or more other points and / or seams of contact between the liner 112 and the outer layer 110 may be provided in other embodiments between near the upper end and near the lower end , but with a significant surface portion of each of the outer layer 110 and the liner 112 being disposed in a “ floating ” relationship between contact regions . each of the outer layer 110 and the liner 112 preferably will include at least one layer of material , but each of the outer layer 110 and the liner 112 may include more than one layer of material . in embodiments where the outer layer 110 and / or the liner 112 includes more than one layer of material , those other layers may include the same or different construction and composition than each other . stated differently , a first layer 110 will include at least one layer of material , but may — in other embodiments that will readily be understood — include a plurality of layers , each of which may differ from the others . in like manner , a second , inner , layer 112 will include at least one layer of the cut - resistant material described above , but may — in other embodiments that will readily be understood — include a plurality of layers , each of which may differ from the others . as such , each of the outer layer 110 and the liner 112 may include multilayer construction . those of skill in the art will readily appreciate that the floating construction and other construction features described above with reference to two - layer - only embodiment will readily apply to such further multilayer embodiments , within the scope of the present disclosure . this construction may enhance the cut - resistance feature of the hockey sock 100 . the liner fabric 112 made of ultra - high molecular weight polyethylene yarn most preferably will have cut - resistant properties inherent in the yarn and aided by the knit or woven nature of the fabric , such that it is configured to resist significant cutting penetration by a hockey skate blade . the “ floating ” relationship between a significant surface portion of each of the outer layer 110 and the liner 112 may provide for extra energy absorption and redirection in the kind of glancing blow that may commonly be expected when a skate blade contacts the hockey sock 100 being worn by a player during skating / game - play conditions . although no standardized test is known for measuring cut - resistance of hockey socks being contacted by skate blades , exemplary embodiments have been tested under conditions believed to approximate those that could be encountered in a skating / game - play situation . for each test , a sock specimen was mounted onto a legform ( as used for testing under “ bs en 13061 , protective clothing ; shin guards for association football players requirements and test ”). a rubber pad , 1 . 27 cm ( 0 . 5 inches ) thick was placed over the legform to simulate muscle and skin of a human leg . the sharpened edge standard hockey skate blade was directed into the simulated leg using a tracked drop tower . in the control tests , the simulated leg was sheathed in a standard single - layer hockey sock made of a knit cotton polyester blend . the blade penetrated through the sock and through the 0 . 5 inches of material at an average velocity of 6 . 28 m / sec . however , in the tests of the test embodiment of a lined sock of the type described above with reference to fig1 - 4 ( specifically embodied with an outer layer of a knit textured polyester and recycled cotton and an inner layer of dyneema ® yarn knitted as a half - cardigan fabric , or formed as another tubular knit construction ), even skate speeds in excess of 8 . 2 m / sec did not cut through the 0 . 5 inches of material ( a & gt ; 30 % increase in the speed / energy of blade attack , which was the maximum velocity attainable on the testing equipment used ). in each of the experimental operations using the legform sheathed with a lined hockey sock 100 , the liner remained intact or substantially intact . those of skill in the art will appreciate that embodiments not expressly illustrated herein may be practiced within the scope of the present invention , including that features described herein for different embodiments may be combined with each other and / or with currently - known or future - developed technologies while remaining within the scope of the claims presented here . although specific terms are employed herein , they are used in a generic and descriptive sense only and not for purposes of limitation . it is therefore intended that the foregoing detailed description be regarded as illustrative rather than limiting . and , it should be understood that the following claims , including all equivalents , are intended to define the spirit and scope of this invention . furthermore , the advantages described above are not necessarily the only advantages of the invention , and it is not necessarily expected that all of the described advantages will be achieved with every embodiment of the invention .

US-201113223822-A

longitudinally extensible and shortenable pump poles designed for hand and arm action in dual - action exercise apparatus such as cross country ski exercises and dual - action climbers , treadmills and the like , such pump poles being fixedly attached to the apparatus base rearwardly thereof and manipulated concurrently with or independently of reciprocating leg action . each pump pole has inner and outer telescoping tubes and an air pressurizable chamber providing greater resistance to pole shortening movement than occurs during pole lengthening movement . hand and arm movement by the user when reciprocating the pole handles simulates the hand and arm movement of a person actually moving over ground .

the dual - action ski exerciser shown in fig1 - 4 is of generally conventional construction and mode of operation except for its ski pole simulating poles . thus , foot engaged supports 20 , 22 are arranged in a known manner to reciprocate on tracks 24 , 26 which are supported by base members 28 , 30 , in a manner similar to the foot engaged pads and parallel rails on base members in the apparatus shown in marshall u . s . pat . no . 4 , 743 , 015 . also , in a manner conventional per se , the foot engaged pedals 20 , 22 are reciprocably linked together through belting 32 maintained under tension by spring means 34 , with a resistance loading on the cable means which is magnetically selectively variable by means of flywheel 36 on which a variable braking effect is exerted by pivotally movable magnets 38 , such movement being through lengthwise movement of belt 40 which is maintained taut by tension spring 42 , the movement of belt 40 being responsive to rotation of knob 44 on post 46 , all in a manner conventional per se such as shown in saarinen u . s . pat . no . 5 , 031 , 901 . post 46 carries fixed handholds as at 48 and a waist engageable support 50 for use by the user as desired . in accordance with the invention , the skiing simulated exercise apparatus shown in fig1 - 4 includes a pair of ski pole simulating pole members , the left hand one of which is indicated generally in fig1 at p , and the lower portions of which are shown at p in fig2 which pole members are fixedly mounted at the lower end fixtures 52 thereof on rear base member 28 . the construction of each pole member p , as shown in detail in fig5 involves an inner tube 54 and an outer tube 56 in telescoped relation , the inner tube 54 being connected at its lower end by pin 58 to a plug 60 threaded in its lower portion to rigidly engage the upper end of coil spring 62 which at its lower end is in turn threaded to attachment fixture 52 which is in turn attached by a bolt ( not shown ) engaging threads 64 in fixture 52 . inner tube 54 at its upper end comprises a piston 66 and a u - cup seal 68 . cooperating with the u - cup seal to form a pressurized air chamber 70 is spring - loaded valve 72 and valve seat 74 . rotatable knob 76 is in threaded engagement with the outer tube 56 at the top thereof and is provided with an air exhaust hole 78 . in the upper portion of the outer tube 56 , a hand grip 80 , engageable by the user &# 39 ; s hand , encircles the outer tube 56 . the outer tube 56 is provided at its lower end with an end cap 82 which is configured to leave a cylindrical gap at 84 between it and the inner tube 54 . as wi 11 be apparent , the construction provides for a telescoping movement between the outer tube 56 and inner tube 5 4 and an air pumping action very similar to that of a conventional bicycle pump . upon extension or elongation of the pole by upward movement of the hand grip 80 and outer tube 56 , ambient air is drawn in through the gap 84 and through the space between the outer tube 56 and inner tube 5 4 and the space between piston 66 and outer tube 56 and past the u - cup seal 68 into the air pressure chamber 70 , all with relatively low resistance . then , upon downward , shortening movement of the outer tube 56 relative to the inner tube 5 4 , the u - cup seal 68 , by reason of the relatively high pressure incurred by the reduction of volume of the air pressure chamber 70 , seals against the outer tube 56 and the pressure and consequent resistance to further movement increases in the air pressure chamber 70 until the pressure is sufficient to upset the valve 72 from its seat 74 and permit escape of some air past the valve seat 74 and out the exhaust opening 78 . then , upon renewed extension movement of the outer tube 56 relative to the inner tube 54 , the valve 72 reseats and air is again brought into the pressure chamber 70 past the u - cup seal 68 in the same manner as during the first extension stroke . as will be understood , repeated telescopic movement of the upper portion of the pole by hand and arm action occurs in a generally rectilinear manner by reason of the pole being fixedly attached at its lower end to the base member and it is this action with primary resistance occurring during the downward and pole shortening movement which simulates a polling action as it occurs during actual movement over ground . while the telescoping action is essentially rectilinear , slight variations in the position of the upper end of the pole and angularly relative to the base member can occur incident to the pumping action and in the embodiment of the invention shown are accommodated by a coil spring 62 which is rigidly interconnected with both the fined fixture 52 and the lower end plug 60 of inner tube 54 but which can flex to a degree without bending or breakage of the pole tubes . spring 62 is of sufficient rigidity to render the pole self - supporting when standing free such as shown in fig1 . as will be recognized , the telescopable , pump action exercise pole of the present invention is readily adaptable to usages with exercise apparatus other than the ski simulating exerciser apparatus illustrated and discussed specifically above . thus , by way of other examples , poles like poles p , which for simplicity can be termed six , ply pump poles , can be employed for hand and arm action and mounted rearwardly on the base of climbers , treadmills and the like which are intended to be operated in a stationary manner but which enable the user to simulate movement over or relative to the ground with a polling movement of the hands and arms relative to the ground . thus , for example , poles p are mountable on the rear portion of base member 28 &# 39 ; of an otherwise conventional stairclimber as shown in fig6 and rearwardly on the base 28 &# 34 ; of an otherwise conventional treadmill , as shown in fig7 . since each pole member p is independently actuatable by the user , it is also evident that poles can be purchased separately and are readily added to existing apparatus such as single - action climbers or treadmills to provide a dual - action mode of operation thereof , as desired . from the foregoing , these and other variations , adaptations and modifications of the construction shown and described , consistent with the invention will occur to those skilled in the art to which the invention is addressed , within the scope of the following claims .

US-1034893-A

an organizational treatment device and method for the treatment of obstructive pulmonary disease comprising both controller and rescue medications such that the need for rescue medication and consequent need for controller medication can be more certainly determined than at present .

the preferred embodiment ( s ) of the present invention are illustrated in fig1 - 4 . fig1 illustrates a support package 10 that houses first and second topical controller medications 20 , 22 in multi - dosage aerosol units and a topical rescue medication 26 also in multi - dosage aerosol units . identifying indicia 30 is included with each respective medication . an instruction bearing portion 40 provides instructions for use of the controller medications 20 , 22 and rescue medication 26 as a regimen . support package 10 includes a bottom portion 12 and a top portion 14 . bottom portion 12 has a clasp portion 16 , and top portion 14 has a clasp portion 18 . clasp portion 16 and clasp portion 18 can be secured together when package 10 is folded along fold 60 . an example of such a treatment kit that may be suitable for an adult with moderately severe asthma is exemplified by example 1 , which contains two individual topical controller medications and a topical rescue medication where first controller medication 20 is controller medication # 1 and second controller medication 22 is controller medication # 2 . example 1 controller controller medication # 1 medication # 2 rescue medication serevent ® inhalation flovent ® 110 mcg ventolin ® inhalation aerosol inhalation aerosol aerosol 2 sprays twice - daily 2 sprays twice - daily 2 sprays every 4 - 6 hours ( each actuation not to exceed 8 sprays delivering 25 mcg of per 24 hours ( each salmeterol base ) actuation delivering 100 mcg albuterol , usp ) the controller medication # 1 is serevent ® ( salmeterol xinafoate ) inhalation aerosol which is indicated for long - term maintenance of bronchodilitation in patients 12 years of age and older . the usual dosage is two inhalations twice daily , morning and evening at approximately 12 hour intervals . its fda approved dosing recommendation states that “ adverse effects are more likely to occur with higher doses and more frequent administration or administration of a larger number of inhalations is not recommended .” the controller medication # 2 contains a corticosteroid , fluticasone propionate , and is provided by the manufacturer in 44 mcg , 110 mcg and 220 mcg strengths under the trademark flovent ®. the rescue medication contains albuterol usp and is available under the trademark ventolin ®. the present invention provides a method for helping to select the concentration and to optimize dosing of the controller medication # 2 . infrequent need for the rescue medication 26 would provide an objective parameter for lowering controller medication by reducing the number of controller medication # 2 inhalations and / or concentration . conversely , frequent rescue medication use indicates continued and increased need for controller medication # 2 either by increased inhalations and / or strength to control symptoms . fig1 is in schematic conformation with this regimen . turning now to fig2 there is illustrated another embodiment of the present invention . fig2 illustrates a support package 10 that houses first and second topical controller medications 20 , 22 in multi - dosage aerosol units and a topical rescue medication 26 also in multi - dosage aerosol units . identifying indicia 30 is provided aligned with each respective medication . an instruction bearing portion 40 provides instructions for use of the controller medications 20 , 22 and rescue medication 26 as a regimen . an actuation counter 50 is provided that can be placed on a counter receiving portion 27 of rescue medication 26 . support package 10 includes a bottom portion 12 and a top portion 14 . bottom portion 12 has a clasp portion 16 , and top portion 14 has a clasp portion 18 . clasp portion 16 and clasp portion 18 can be secured together when package 10 is folded along fold 60 . the medication regimens of fig2 are the same as those provided in fig1 . turning now to fig3 there is illustrated another embodiment of the present invention . this embodiment also includes a support package 10 having a bottom portion 12 and a top portion 14 with clasp portions 16 , 18 , respectively . support package 10 houses a first topical controller medication 20 in a multi - dosage aerosol unit , a second oral controller medication 23 for systemic dosing , and a topical rescue medication 26 also in multi - dosage aerosol units . oral controller medication is depicted in the form of tablets on a blistered card . however , other oral dosage forms such as capsules , caplets , liquids , and other containers such as bottles as are known in the art may be used in the present invention . identifying indicia 30 is illustrated aligned with each respective medication . indicia to distinguish each medication within the unifying container of the present invention might alternatively or additionally be on the surface of the inhalers , blister cards , or bottles of the medications themselves , or other printed surface within the container rather than on the surface of the unifying container as illustrated . an instruction bearing portion 40 provides instructions for use of the controller medications 20 , 23 and rescue medication 26 as a treatment regime . an actuation counter 50 is provided that can be placed on a counter receiving portion 27 of rescue medication 26 . the following example 2 includes one topical controller medication 20 , one oral controller medication 23 and a topical rescue medication 26 . example 2 controller controller medication # 1 medication # 2 rescue medication flovent ® 44 mcg singulair ® tablets ventolin ® inhalation inhalation aerosol ( 10 mg montelukast aerosol sodium ) 2 sprays twice - daily 1 tablet at bedtime 2 sprays every 4 - 6 hours not to exceed 8 sprays per 24 hours ( each actuation delivering 100 mcg albuterol , usp ) the regimen in example 2 differs from the regimen in example 1 by employing an oral controller medication 23 , which is montelukast sodium and available under the trademark singulair ®, and exemplifying a lower dose of the inhaled corticosteroid controller medication 20 available under the trademark flovent ®. singulair ® is a selective leukotriene receptor antagonist and represents a unique class of controller medication that may allow for lower dosing and use of corticosteroid medications . the approved dosage for singulair ® montelukast sodium for the prophylaxis and chronic treatment of asthma is a fixed dosage of 10 mg in adolescents and adults 15 years of age and older , 5 mg for ages 6 to 14 , and 4 mg for ages 2 to 5 . this fixed dose is recommended to be taken once a day in the evening . as stated in example 2 , the need for ventolin ®, the rescue medication 26 , can be assessed according to the actuation counter 50 provides an objective parameter for dosing of the controller medication flovent ®. fig3 is in schematic conformation with this regimen . [ 0042 ] fig4 illustrates yet another embodiment of the present invention . this embodiment includes a support package 100 having a bottom portion 112 and a top portion 114 with clasp portions 116 , 118 , respectively . support package 100 houses a first topical controller medication 120 in a multi - dosage , dry powder aerosol unit and a topical rescue medication 126 in a multi - dosage , liquid medication aerosol unit that incorporates an actuation counting monitor 150 . identifying indicia 130 is provided aligned with each respective medication . an instruction bearing portion 140 provides instructions for use of the controller medication 120 and rescue medication 126 as a treatment regime . the following example 3 includes one topical controller medication 120 and a topical rescue medication 126 . example 3 controller medication rescue medication advair ™ discus ® ventolin ® inhalation 250 / 50 aerosol 1 inhalation twice - 2 sprays every 4 - 6 hours daily not to exceed 8 sprays per 24 hours ( each actuation delivering 100 mcg albuterol , usp ) the regimen in example 3 differs from the regimen in example 1 by employing a single controller medication 120 containing a beta - adrenergic agent and a corticosteroid in fixed relationship . controller medication 120 is available under the trademark advair diskus ® 250 / 50 and is delivered as an aerosolized powder , each inhalation containing fluticasone propionate ( 250 mcg ) and salmeterol xinafoate ( 50 mcg ). advair diskus ® is recommended for regular one inhalation , twice - a - day dosing . adjustment in dose can be made by selecting from three available strengths of advair ™ containing 100 , 250 and 500 mcg of fluticasone per inhalation . all contain the same dosage of salmeterol xinafoate , which if given at higher dose is known to have a risk of adrenergic stimulatory side effects . the actuation counter 150 on rescue medication 126 records the number of times the user employs the rescue medication , ventolin ®. actuation counter 150 provides an objective parameter for selection of the appropriate strength of advair ™. fig4 is in schematic conformation with the regimen of example 3 . although the preferred embodiments of the present invention have been described herein , the above descriptions are merely illustrative . further modification of the invention herein disclosed will occur to those skilled in the respective arts and all such modifications are deemed to be within the scope of the invention as defined by the appended claims .

US-46119803-A

the pain relief device used to relieve pain and promote faster healing in the bodies of humans and animals safely . a positive electrode touches the skin at the site of an injury and a negative electrode completely shielded with insulation is place on the skin at a spaced distance form the positive electrode . a low voltage direct current power source supplies a positive voltage to the positive electrode and a negative voltage to the negative electrode . electrical stimulation occurs harmlessly , because the shielded negatively charged electrode or insulated pad , being an insulated sheet of aluminum foil produces an electric field in the body that is strong enough to cause a current to flow into the body at the site of the positive electrode . however , no current can flow at the site of the negative electrode because it is insulated and therefore no burns to the skin .

reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . referring now to the drawings , reference numeral 10 generally designates a pain relief device of the present invention . the device creates a type of electro - therapy for humans or animals for safely relieving pain and speeding recovery of an injury . the injury may be a sore joint or muscle . as shown in fig1 the device includes two pad - type electrodes one being a thin flexible conducting pad 12 , the second being a thin flexible insulted pad 14 , a first insulated wire 16 , a second insulated wire 18 and a low voltage direct current ( dc ) power source 20 having a positive (+) pole 22 and a negative (−) pole 24 . the low voltage dc power source 20 may be any type of battery or multiple batteries , such as , conventional a , aa , aaa type batteries having a positive (+) pole 22 and a negative (−) pole 24 . the voltages being used for the device range from 0 . 0 volts up to 7 . 0 volts dc as an example the power source 20 can provide 1 . 5 to 7 . 0 volts . when in use both the conducting pad 12 and the insulated pad 14 will have the same voltage applied to them . referring to fig1 - 4 , the conducting pad 14 includes a thin flexible sheet of conductive material 26 and a layer of insulation 28 covering one side of the conductive material and leaving one side of the conductive material exposed . the layer of insulation 28 is used for structurally supporting and strengthening the sheet of thin flexible conductive material 26 . the conductive material 26 of the conducting pad 14 is attached to the low voltage power source 20 by the first insulated wire 16 . one end of the first insulated wire 16 is connected to the conductive material 26 of the conducting pad 12 and a second end of the wire is connected to the positive (+) pole 22 of the power source 20 . additionally , fig1 - 4 show the insulated pad 14 including a core 30 made of a thin flexible sheet of conductive material , a first layer of insulation 32 covering one side of the core and a second layer 34 of insulation covering a second side of the core . the negative pole 24 of the same power source 20 that is connected to the conducting pad 12 is connected to the insulated pad 14 by the second insulated wire 18 . one end of the second insulated wire 18 is connected to the core 30 of the insulated pad 14 and a second end of the wire connects to the negative (−) pole 24 of the power source 20 . the second insulted wire 18 is connected to the core 30 of the insulated pad 14 in such a way that no conductive material or electrical contact is exposed . the size and shape of the conducting and insulated pads 12 , 14 may be of any size and shaped which covers the injured part of the body and may even be a point electrode . the conductive material 26 and core 30 for both the conducting pad 12 and the insulated pad 14 is preferably made of aluminum but may be any type of thin flexible conductive material such as copper , silver , gold , platinum , or any other alloy of these or other metals shaped into a foil or screen or multiple thin layers . the layers of insulation 28 , 32 , 34 used for both the conducting and insulation pads 12 , 14 may be any flexible insulating material such as vinyl , latex , plastic , duct tape , fabric , cloth , leather , paper or felt . the conducting pad 12 is placed on the skin of the body at the site of the injury . the conducting pad 12 is sized large enough to completely cover the area of the injury . the exposed side of the conducting pad 12 is placed in direct contact on the skin so the exposed conductive material 26 is in direct contact with the skin of the body at the site of the injury . the sheet of conductive material 26 is converted into a flat sheet like electrode after it is electrically connected to the positive (+) pole 22 of the power source 20 by the first insulated wire 16 . when on the body , in full contact with the skin of the injured area , and wired as above , the positive (+) charge of the power source 20 is distributed equally throughout the sheet of conductive material 26 . where the conductive material 26 , thus charged up , is in contact with the skin , the positive (+) charge of the conductive material 26 sets up a positive charge on the skin around the site of the injury . the insulated pad 14 is placed on the skin of the body at a position opposite side of the injury and the conducting pad 12 . the insulated pad 14 is roughly the same size or is larger than the conducting pad 12 . if a location opposite the placement of the conducting pad 12 is unavailable or difficult for the placement of the insulating pad 14 , the device will also work if the insulated pad is placed against the skin of the abdomen even though the injury may be the shoulder , neck etc . the devices will work as long as the conductive material 26 of the conducting pad 12 is connected to the positive (+) pole 22 of power source 20 and is in contact with the injured area and the core 30 of the insulated pad 14 is connected to the negative (−) pole 24 of the same power source and the insulated pad 14 is placed on another part of the body preferably but not necessarily opposite to the placement of the conducting pad . the core 30 of the insulated pad is converted into a flat sheet like electrode after it is electrically connected to the negative (−) pole 24 of the power source 20 by the second insulated wire 18 . when the insulated pad 14 is placed on the skin of the body , it produces a negatively (−) charged electric field in the body centered at the location of the insulated pad and radiates outward through the body . no current can flow at the site of the negatively charged core 30 of the insulated pad 14 because it is insulated and therefore the skin of the body can does not burn . when the conducting pad 12 and insulated pad 14 , wired as above , are placed on the body simultaneously , an electric field is set up flowing through the body from the positively (+) charged conducting pad to the negatively (−) charged insulated pad . at the location of the insulated pad 14 , no current can flow from the body to the negatively charged core 30 within , as it is completely electrically insulated . the negative (−) electric field created by the core 30 will still , however , flow through the insulation 32 , 34 and flow throughout the body . when the positively (+) charged conducting pad 12 is placed on the skin on the injured region of a body when it is being charged by an insulated pad 14 from the opposite side of the body from the injury , there is an interaction of the electric fields at the site of the conducting pad . the excess positive (+) charge build up in the conducting pad 12 is drawn to the negative (−) field in the body produced by the insulated pad 14 . when this negatively (−) charged field is set up in the body , charged particles in the body will be attracted to the oppositely charged electrodes , or pads 12 , 14 . although , none of these charged particles can pass from the body through the skin into the insulated pad 14 , there is nothing to stop the oppositely charged particles from passing through the skin of the body at the location of the conducting pad 12 as it is a bare conducting material on exposed , bare , skin . this minute flow of current at the site of the conducting pad 12 creates an environment that relieves pain and promotes faster healing in the joint or muscle being treated . the effectiveness of the device will vary depending on the voltage used , the surface area of the pads 12 , 14 and the placement of the pads on the body , all which will affect the electric field set up between the two pads through the body . the best results occur when the pads 12 , 14 are as close as they can be to each other on the body while being on the opposite side of the body from each other . the electric field is perpendicular to the surface created by the flat pads 12 , 14 . having the pads 12 , 14 directly facing each other from opposite sides of the body is ideal . the reason for this is because we are trying to focus the electric field so that it flows through the location of the injury to maximize the affect of the conducting pad 12 . additionally , a large insulated pad 14 placed on the stomach can be used to create the negative (−) field in the body . from the stomach , it will cause a negatively (−) charged electric field to flow throughout the whole body . if the conducting pad 12 is placed elsewhere on the body , ( back , knee , elbow , hip , shoulder , etc . ), to treat an injury , the electric field produced by the insulated pad 14 on the stomach will produce an electric current in the conducting pad and produce a positive therapeutic affect on the injury being treated . once the pads 12 , 14 are positioned on the body as described above they should be left in this manner as long as is possible and comfortable to the subject , until the pain goes away . fig4 - 7 demonstrates the placement , configuration , and general dimensions of a device designed to treat lower back pain as one of many examples . as an example , if the lower back is injured and one wishes to treat it with this device using this principle . the pads 12 , 14 of the device and the electrical wiring would be constructed and put together exactly as described and seen in fig1 - 3c . this example is for a 200 lb . human 36 of average height , the x - y and x ′- y ′ dimensions of the respective pads 12 , 14 shown in fig4 , would be 5 in . by 14 in . for both the conducting material 26 of the conducting pad 12 and the core 30 of the insulated pad 14 . this particular device uses two aa batteries in a battery pack wired in series providing approximately 3 volts dc . this device can be affixed easily to the human 36 if the pads 12 , 14 and power source 20 wired as above are held in place by a wide belt 38 , shown in fig4 - 7 . the exposed conductive material 26 of the conducting pad 12 is placed against the skin of the lower back 40 while the insulated pad 14 is placed against the skin of the stomach or abdomen 42 as in fig5 - 7 . this configuration will relieve pain in the lower back and promote faster healing . rather than using a separate belt , a large belt made from the same type of insulating material can be used instead of separate pieces of insulation for each pad 12 , 14 . devices based on this principal have been adapted to ease pain and speed healing in the knee , shoulder , wrist , elbow , ankle , feet , and neck with positive results . indeed any injured or strained muscle or joint in the body could benefit from this treatment . it has been used to treat the sore hip of a dog as well using a metal brush type adapter for the conducting pad 12 with each tooth of the brush charged with the same voltage used in the insulated pad 14 . the brush is used so that the fur on the animal can be penetrated so that the electrodes in the brush are in contact with the animal &# 39 ; s skin . there is no reason why this technology wouldn &# 39 ; t work just as well on any other mammal . a number of embodiments of the present invention have been described . nevertheless , it will be understood that various modifications may be made without departing from the spirit and scope of the invention . accordingly , other embodiments are within the scope of the following claims .

US-6101808-A

a control valve for the hydraulic system of a round bale wagon is disclosed wherein the valve spool is selectively positionable between a cross conveyor mode and a pusher mode and also provides a hydraulic interlock for the operation of the load bed to pivotally rotate for the unloading of bales therefrom . movement of the valve spool between the cross conveyor and the pusher modes effects a selection of the operation of the bale handling mechanism to either convey bales laterally across the load bed or rearwardly on the load bed . the provision of a hydraulic interlock prevents the operation of the load bed to pivotally rotate the forward end above the frame of the bale wagon and unload accumulated bales therefrom , unless both the cross conveyor and the bale pickup are in a position that would not interfere with the movement of the load bed and , therefore , prevent damage thereto . although the pusher advance mechanism could be positioned in an interferring position with respect to the tilting load bed , the massive size of these two members prevents any substantial damage , should they impact with one another ; however , the pusher advance mechanism is positionable in a non - interferring position relative to the load bed .

referring now to the drawings and , particularly , to fig1 a plan view of a round bale wagon incorporating the principles of the instant invention can be seen . left and right references are used as a matter of convenience and are determined by standing at the rear of the machine facing the forward end , the direction of travel . a general description of the machine depicted in the drawings can be found in co - pending u . s . ser . no . 161 , 719 . this bale wagon is of the self - propelled type ; however , the primary source of power and some of the drive mechanism have been removed to simplify the drawing for purposes of clarity . the round bale wagon 10 is designed to pick up and transport large round bales , such as processed by the apparatus disclosed in u . s . pat . no . 3 , 827 , 223 . the round bale wagon 10 has the ability to function as an off - highway agricultural vehicle capable of good maneuverability and low speed for picking up round bales , yet transport over the road from field to field . the round bale wagon 10 , depicted in the drawings , can handle approximately eight - six foot diameter round bales or 10 - four foot diameter round bales . the round bale wagon 10 includes a wheeled frame 11 on which is mounted an operator &# 39 ; s cab 12 , offset to the left side and at the forward end of the wagon 10 for good visibility during both operation and transort . a load bed 20 includes a sub - frame 21 pivotally connected at pivot 22 to the frame 11 and supporting a floor 23 . the load bed 20 is provided with side rails 24 which are laterally adjustable to accommodate different sized bales 14 and for minimizing the width of the wagon 10 during transport . a pair of hydraulic cylinders 26 operatively interconnect the wheeled frame 11 and the frame 21 of the load bed 20 to selectively effect a pivotal movement of the load bed 20 about the pivot 22 relative to the frame 11 to move the forward end 28 of the load bed 20 above the frame 11 and the rearward end 29 closer to the ground g for the discharge of bales 14 from the load bed 20 . the hydraulic cylinders 26 are connected through hoses 27 to a hydraulic system that can be actuated by controls located in the cab 12 , as will be described in further detail later . a load rack 30 is positioned at the forward end of the load bed 20 to provide a means for guiding and retaining round bales 14 loaded thereon . the load rack 30 includes a forwardly positioned recessed cradle portion 31 for receiving round bales 14 deposited thereon by the pickup mechanism 40 and for guiding round bales 14 conveyed by the cross conveyor means 60 , as will be described below . the load rack 30 also includes a raised planar portion 32 extending rearwardly from the recessed cradle portion 31 and terminating in an edge 33 raised above the floor 23 to form a stop 34 to prevent bales 14 positioned in row b from moving forwardly and interfering with the positioning of bales 14 in row a on the recessed cradle portion 31 . a slot 36 is also provided in the load rack 30 for the operation of the pusher advance means 80 , also further described below . a bale pickup means 40 includes a subframe 42 , which is pivotally connected at pivot 41 to the wheeled frame 11 adjacent the forward end 28 of the load bed 20 and to the right of the cab 12 . the bale pickup 40 is pivotally movable in the fore - and - aft direction about pivot 41 and is operable to pick up a round bale 14 lying on the ground g , and to despoit it in the recessed cradle portion 31 of the load rack 30 immediately rearwardly thereof . the subframe 42 includes a cross member 43 interconnecting two forwardly extending arms 44 , 45 . the cross member 43 can be telescopically constructed so as to be selectively adjustable to vary the distance between the two forwardly extending arms 44 , 45 to accommodate various size bales 14 . the forwardly extending arm 44 is fixed with respect to the cross member 43 and includes an enlarged pad - like member 47 for engaging a substantially planar side of a round bale 14 . the other forwardly extending arm 45 is pivotally connected at pivot 46 to the cross member 43 to be movable toward and away from the fixed arm 44 . the pivotal movement of the squeeze arm 45 is effected by a hydraulic cylinder 48 , which is connected to the central hydraulic system by the hose 49 . the squeeze arm 45 also includes a pad - like member 47 for engaging a substantially planar side of a round bale 14 . a pair of hydraulic cylinders 51 , connected to the central hydraulic system by the hose connection 52 , operably interconnect the subframe 42 of the bale pickup means 40 and the main frame 11 of the round bale wagon 10 for pivotally moving the bale pickup means 40 between a pickup position , seen in fig1 and 2 , wherein a bale 14 is engaged between the forwardly extending arms 44 , 45 while still on the ground g , and a loading position , wherein the bale pickup means 40 deposits a round bale 14 in the recessed cradle portion 31 in row a immediately rearwardly of the bale pickup means 40 . the hydraulic cylinder 48 is operable to pivotally move the squeeze arm 45 toward any away from the fixed arm 44 so as to releasably squeeze a round bale 14 therebetween , enabling the bale pickup means 40 to pick up a round bale 14 off the ground g and deposit it in the recessed cradle portion 31 . at the rearward end 29 of the load bed 20 a tailgate 55 is pivotally connected to the frame 21 of the load bed 20 at pivot 56 . a hydraulic cylinder 58 , connected to the central hydraulic system by means of the hose connection 59 , is connected between the load bed 20 and the tailgate 55 and is operable to pivotally move the tailgate 55 between an upright position seen in fig2 wherein the round bales 14 in row d are prevented from rolling off the load bed 20 , and an extended position , not shown , wherein the round bales 14 are permitted to roll off the load bed 20 over the tailgate 55 . a further explanation of the function and operation of the tailgate can be found below . a cross conveyor means 60 is provided for laterally moving a round bale 14 in a row a along the recessed cradle portion 31 from a position immediately rearwardly of the bale pickup means 40 to a position immediately rearwardly of the cab 12 and is described in greater detail in co - pending u . s . ser . no . 187 , 012 . in general , a linkage 62 pivotally interconnects the main frame 11 and a cross conveyor arm 64 , which has a frame - like member 65 mounted thereon for engaging a round bale 14 and moving it laterally along the recessed cradle portion 31 . the cross conveyor means 60 is operatively powered by a hydraulic cylinder 68 , that is in operative communication with the central hydraulic system via the hose connection 69 , and interconnects the main frame 11 and the cross conveyor linkage 62 to cause the frame - like member 65 to engage a round bale 14 and move it laterally across the recessed cradle portion 31 before returning to the outboard , home position . the cross conveyor means 60 is provided with a retaining means 70 , which is operable to hold the cross conveyor arm 64 and attached frame - like bale engaging member 65 in a position inboard of the side rails 24 , so as to reduce the overall width of the round bale wagon 10 during transport thereof over public roads . the retaining means 70 is depicted in fig1 and 13 in the form of a valve 72 in operative communication with the hose 69 . the valve 72 seen in fig1 and 13 includes a manual shut off control 74 ; however , one skilled in the art will readily realize that other similar devices , such as a solenoid valve , could be substituted . the valve 72 is operable to prevent the flow of hydraulic fluid through the hose 69 to or from the hydraulic cylinder 68 and , thereby , prevent the hydraulic cylinder 68 from pivotally moving the cross conveyor linkage 62 . accordingly , if the valve 72 is closed after the hydraulic cylinder 68 has moved the cross conveyor arm 64 and attached bale engaging member 65 inboard of the side rails 24 , the cross conveyor means 60 will be locked at that inboard position to minimize the transport width of the wagon 10 . a pusher advance means 80 is pivotally connected to the main frame 11 at pivot 81 and is operable to advance round bales 14 rearwardly from row a , positioned in the recessed cradle portion 31 , over the raised planar portion 32 of the load rack 30 to row b rearwardly thereof . the bale pusher mechanism 80 includes a transverse pusher bar 82 fixed to a support arm 84 , which in turn is pivotally connected to the main frame 11 at pivot 81 . the transverse pusher bar 82 is of sufficient size to engage all of the round bales 14 in row a and advance them rearwardly to row b . although not shown in the drawings , the transverse pusher bar 82 can be constructed to be telescopically adjustable to accommodate various sized bales 14 being loaded into recessed cradle portion 31 . the pusher advance means 80 is operatively powered by a hydraulic cylinder 88 interconnecting the main frame 11 and the support arm 84 . the hydraulic cylinder 88 is connected to the central hydraulic system by means of hose connections 89 . in operation , the round bale wagon 10 is maneuvered over the ground surface g until a round bale 14 is positioned between the forwardly extending arms 44 , 45 of the bale pickup means 40 with the planar ends of the cylindrical round bale 14 positioned adjacent to the respective forwardly extending arms 44 , 45 . the squeeze arm 45 is then pivotally moved by manipulation of the hydraulic cylinder 48 until both the fixed arm 44 and the squeeze arm 45 have engaged the sides of the round bale 14 and is squeezed therebetween . manipulation of the hydraulic cylinder 51 pivotally rotates the bale pickup means 40 until the bale 14 is positioned in the recessed cradle portion 31 of the load rack 30 immediately rearwardly thereof . subsequent manipulation of the hydraulic cylinder 48 to move the squeeze arm 45 away from the fixed arm 44 releases the round bale 14 and deposits it on the load rack 30 . after the round bale 14 has been deposited in the recessed cradle portion 31 of the load rack 30 rearwardly of the bale pickup means 40 , the hydraulic cylinder 68 is manipulated to cause the cross conveyor means 60 to laterally move the round bale 14 across the recessed cradle portion 31 from a position immediately rearwardly of the bale pickup means 40 to a position immediately rearwardly of the cab 12 . upon the return of the cross conveyor arm 64 and the attached bale engaging member 65 to the outboard , home position , a second bale can be picked up by the bale pickup means 40 and deposited in the recessed cradle portion 31 , at which point , the recessed cradle portion 31 of the load rack 30 would be filled . a manipulation of the hydraulic cylinder 88 to effect a rotation of the support arm 84 about the pivot 81 , causes the transverse pusher bar 82 to engage the bales 14 in row a and advance them rearwardly over the planar portion 32 of the load rack 30 until positioned in row b . after the pusher advance means 80 has returned to its home position , as seen in fig1 and 2 , the bale pickup means 40 can deposit another bale on the recessed cradle portion 31 of the load rack 30 to initiate another cycle to ultimately fill the recessed cradle portion 31 with round bales 14 in row a . at this time the pusher advance means 80 is actuated again to advance the bales in row a rearwardly to row b , causing the bales 14 previously in row b to move rearwardly to row c . this sequence is repeated until all rows a , b , c and d are filled with round bales 14 . the bale wagon 10 is then driven to a selected storage area where the load of bales 14 is dumped by actuating the hydraulic cylinder 26 to pivot the load bed 20 about the pivot 22 . the tailgate 55 is preferably maintained in the upright position seen in fig2 until the forward end 28 of the load bed 20 is sufficiently high above the frame 11 to impart sufficient energy to the bales 14 to allow them to easily slide or roll off the floor 23 of the load bed 20 . at this time , the hydraulic cylinder 58 is actuated to cause the tailgate 55 to pivotally move from its upright position to an extended position and permit the round bales 14 to freely move off the load bed 20 . although the description above is directed to the drawings depicting a load of four rows of round bales 14 positioned two across in each row , one skilled in the art would readily realize that smaller or larger sized bales 14 would likely result in more or less rows of bales . furthermore , one skilled in the art should also realize that some modification to the linkages and controls described herein could be made to provide rows of bales having one , two or more bales in each row . from the description of the operation of the bale wagon 10 above , it should be noted that a number of hydraulically powered devices sequentially operate to fully load and subsequently discharge the load bed 20 with round bales 14 . although each hydraulic cylinder having a function in this sequential flow of events could have a separate control lever located in the cab 12 for manipulation by the operator , it is desirable that a single control lever be used to operate all the hydraulic functions of the loading process . accordingly , fig3 through 13 depict a control linkage 90 for mechanically sequentially controlling the lateral cross conveying of the bales 14 along the recessed cradle portion 31 of the load rack 30 and the rearward advance of the bales from the load rack 30 by the pusher advance means 80 in conjunction with the raising and lowering of the bale pickup means 40 . referring now to fig3 , 5 and 6 , a partial cross sectional view of the bale wagon 10 through the cab 12 and beneath the load bed 20 to reveal the hydraulic control linkage 90 can be seen . each respective hydraulic cylinder 26 , 48 , 51 , 58 , 68 and 88 has a separate control valve connected by hoses 27 , 49 , 52 , 59 , 69 and 89 , respectively , to control the operation thereof . control valve 91 is connected to hydraulic cylinder 26 via hose 27 to control the tilting of the load bed 20 about the pivot 22 . control valve 93 is connected to hydraulic cylinder 48 via hose 49 to control the manipulation of the squeeze arm 45 . control valve 95 is connected to hydraulic cylinder 51 via hoses 52 to control the lifting of round bales 14 from the ground g to deposit them on the recessed cradle portion 31 of the load rack 30 via the pivotal rotation of the pickup subframe 42 about the pivot 41 . control valve 96 is connected to hydraulic cylinder 58 via hose 59 to control the operation of the tailgate 55 . control valve 97 is situated within the hydraulic circuit to effect a delay of the operation of the cross conveyor means 60 until the bale pickup means 40 has rotated forwardly a sufficient distance to prevent interference therebetween . control valve 99 is operable to control the operation of both the cross conveyor means 60 and the pusher advance means 80 via a sequential manipulation of hydraulic cylinders 68 and 88 , as will be described in further detail below . a single lever 100 is located within the cab 12 for control of both the lift and squeeze functions of the bale pickup means 40 . lever 100 is rotatably mounted upon shaft 101 and extends upwardly through a slot 102 having quadrants n , l , o , c and r in a control panel 103 within the cab 12 . a connecting link 105 interconnects the control lever 100 with a cross link 106 interconnecting control valves 93 and 95 . as best seen in fig4 the valves 93 and 95 are mounted on the main frame 11 in a spaced relationship to one another . the connecting link 105 is connected to the cross link 106 at a point closer to valve 93 than to valve 95 . accordingly , manipulation of the lever 100 will effect a movement of the spool 93a in control valve 93 before effecting a movement of spool 95a in control valve 95 when moving from the neutral position . referring again to fig3 and 5 , movement of the lever 100 from the neutral position at quadrant 102 - n to quadrant 102 - o would cause a corresponding movement of the control link 105 and effect a movement of spool 93a and operate the hydraulic cylinder 48 to move the squeeze arm 45 away from the fixed arm 44 . a further movement of lever 100 to quadrant 102 - l would finally effect a movement of spool 95a and manipulate the hydraulic cylinder 51 and lower the bale pickup means 40 into a position to engage a bale 14 on the ground g . as can be seen in fig1 and as described in further detail below , movement of spool 95a from its neutral position to either its innermost or outermost position shuts off the flow of fluid to control valve 93 and &# 34 ; freezes &# 34 ; the hydraulic cylinder 48 in whatever position it is in until spool 95a is returned to the center , neutral position , whereupon fluid flow returns to valve 93 for manipulation of hydraulic cylinder 48 . a subsequent movement of the lever 100 to quadrant 102 - c would first return spool 95a to its neutral position , then return spool 93a to its neutral position , by virtue of the spring loading of valve spools 93a and 95a , and finally effect a movement of the spool 93a to cause a hydraulic cylinder 48 to move the squeeze arm 45 toward the fixed arm 44 and clamp or squeeze a bale 14 . a further movement of lever 100 to quadrant 102 - r would then effect movement of spool 95a to cause the hydraulic cylinder 51 to rotate the subframe 42 of the bale pickup means 40 about the pivot 41 and deposit the clamped bale 14 in the recessed cradle portion 31 of the load rack 30 . movement then of lever 100 to quadrant 102 - o would again cause movement of spools 93a and 95a , as noted above , to manipulate hydraulic cylinder 48 and release the bale 14 and start another cycle for the bale pickup means 40 . referring now to fig3 and 5 , control lever 110 is also rotatably mounted on shaft 101 and extends upwardly through a slot 112 having quadrants 112 - n , 112 - l and 112 - r in the control panel 103 . control lever 110 is connected through links 114 directly to valve 91 , such that a manipulation of the lever 110 between quadrants 112 - n and 112 - l or 112 - r will cause a movement of the spool 91a to effect the operation of hydraulic cylinder 26 to pivotally rotate load bed 20 about pivot 22 and lower and raise , respectively , the forward end 28 to dump the load of the bales 14 therefrom . control lever 115 is pivotally mounted to the cab 12 and extends upwardly through a slot 117 in the control panel 103 . control lever 115 is connected via a connecting link 118 directly to a double selector valve 119 , whose sole function is to divert hydraulic fluid to or from the control valves noted above . movement of control lever 115 to the stop position as seen in fig5 causes the valve 119 to divert oil from the pump directly back to the reservoir without being circulated to any of the valves noted above . further reference can be made to fig1 a and 15b , wherein a schematic diagram of the hydraulic system is shown . referring now to fig3 and 6 , the control linkage 120 for automatically manipulating the movements of the cross conveyor means 60 and pusher advance means 80 can be seen . manipulation of the control valve 99 to selectively effect operation of the hydraulic cylinders 68 and 88 is controlled through the movements of the pickup subframe 42 about the pivot 41 when the bale pickup means 40 alternates between a lowered bale pickup position and a raised bale loading position . as can be best seen in fig6 and 10 , a trip 122 is rotatably connected to pivot 41 and is movable independently of the pickup subframe 42 . a stop 123 mounted on the main frame 11 limits the amount of movement of the trip 122 in a forward direction . a connecting link 125 is connected to the trip 122 and extends rearwardly therefrom through a mounting bracket 126 for connection to the spool 97a of delay valve 97 . a spring 127 biases the connecting link 125 to urge the trip 122 in a forward direction against the stop 123 . connecting link 125 is shown in fig6 to be of a known two piece construction with spring 128 providing protection for valve 97 in case the connecting link 125 is moved rearwardly further than the spool 97a can move . when the bale pickup means 40 rotates rearwardly to deposit a bale 14 on the load rack 30 , the pickup subframe 42 rotates about pivot 41 and causes the subframe member 129 to engage the trip 122 . further rotative movement of the subframe 42 rearwardly causes the cross member 129 to move the trip 122 rearwardly , as best seen in fig1 , and effect a corresponding movement of the connecting link 125 . this movement provides for the sequential operation of both the cross conveyor means 60 and the pusher advance means 80 through the associated linkages and valves as further described below . the automatic linkage 120 includes a first link 131 pivotally connected at one end at pivot 132 to the main frame 11 and at point 133 intermediate its ends to the spool 99a for actuation thereof between a pusher mode and a cross conveyor mode . the first link 131 is pivotally connected at pivot 134 to a second link 135 . the second link 135 is connected to both the spool 97a and the connecting link 125 at point 136 intermediate its ends . as can best be seen in fig8 and 9 , the second link 135 has a free end 137 that projects through a guide slot 138 in a bracket 139 to be engageable with an over - center mechanism 140 . the over - center mechanism 140 is best seen in fig6 - 9 . in general , the function of the over - center mechanism 140 is to control the movement of the free end 137 of the second link 135 , which in turn controls the actuation of the control valve 99 between the pusher and cross conveyor modes , as will be described in detail below . a fixed stop 142 is positioned adjacent the guide slot 138 of the bracket 139 so as to restrict the movement of the free end 137 of the second link 135 in a rearward direction . the fixed stop 142 is depicted in the drawings in the form of a bolt 143 adjustably mounted in a bracket 144 . the over - center mechanism 140 is rotatably mounted about an axis defined by the shaft 145 . a movable stop 147 is fixedly attached to the shaft 145 and rotatable therewith between an open position 148 , as seen in fig6 and 9 , in which the movable stop 147 is spaced somewhat from the free end 137 of the second link 135 , and a closed position 149 , as seen in fig7 and 8 , in which the movable stop 147 is positioned adjacent to the free end 137 of the second link 135 to trap it against the fixed stop 142 and prevent it from moving within the guide slot 138 . an over - center link 151 is pivotally connected at pivot 152 to the movable stop 147 and also connected at the opposing end 153 to a spring 154 . the spring 154 , which is attached to the main frame 11 , biases the movable stop 147 from either side of the axis of rotation defined by the shaft 145 , depending upon the position of the over - center link 151 . when the movable stop 147 is in the open position 148 , the spring 154 urges the movable stop 147 toward the open position 148 by reason that the line of force exerted by the spring 154 passes to the right of the shaft 145 . when the movable stop 147 is moved into the closed position 149 , the line of force exerted by the spring 154 is to the left of the shaft 145 and , therefore , urges the movable stop 147 into the closed position 149 . the over - center link 151 is curved to permit the line of force exerted by the spring 154 to be positioned on either side of the shaft 145 depending upon the position of the movable stop 147 . the bracket 139 and the elongaged member 156 serve as limits to the amount of movement of the movable stop 147 between the open position 148 and the closed position 149 . to actuate the movement of the movable stop 147 from the open position 148 to the closed position 149 , a first actuating means 160 operatively communicates between the over - center mechanism 140 and the cross conveyor linkage 62 . a first arm 162 is affixed to the shaft 145 and rotatable therewith , so that there is no relative movement between the first arm 162 and the movable stop 147 . a first actuating link 163 pivotally interconnects the first arm 162 and a first trip means 165 . the first trip means 165 is best seen in fig6 and 13 and includes an elongated pivot bar 166 pivotally connected to a bracket 167 mounted on the main frame 11 . the pivot bar 166 is connected to the first actuating link 163 by a pin 168 that rides within the lost motion slot 164 . the spring 161 biases the pivot bar 166 in a counterclockwise direction , as viewed in phantom in fig6 . the pivot bar 166 further includes a trip pin 169 projecting from the plane of the pivot bar 166 for engagement with a trip arm 66 connected to the cross conveyor linkage 62 . although the operation of the first actuating means 160 will be described in further detail below , the trip arm 66 engages the trip pin 169 , when the cross conveyor means 60 returns to the outboard , home position after conveying a round bale 14 along the recessed cradle portion 31 , to pivotally rotate the pivot bar 166 in a counterclockwise direction , as seen in fig6 and causse a corresponding movement of the first actuating link 163 to the right and , therefore , rotate the over - center mechanism 140 and place the movable stop 147 in the closed position 149 . to actuate the movement of the movable stop 147 from the closed position 149 to the open position 148 , a second actuating means 170 is provided . the second actuating means 170 is best seen in fig6 , 8 , 9 and 12 . a second arm 17 is affixed to the shaft 145 and rotatable therewith , such that there is no relative movement between the second arm 172 and the movable stop 147 . a second actuating link 173 pivotally interconnects the second arm 172 and a second trip means 175 . the second trip means 175 includes a pivot link 176 pivotally connected to a bracket 177 mounted on the main frame 11 . the pivot link 176 is connected to the second actuating link 173 by a pin 178 riding within the lost motion slot 174 in the link 173 . the pivot link 176 further includes a trip pin 179 projecting from the pivot link 176 , so as to be engageable with a trip arm 86 affixed to the pusher advance means 80 . although the operation of the second actuating means will be described in further detail below , in general , the trip arm 86 engages the trip pin 179 when the pusher advance means 80 returns to the forward , home position and effects a forward movement of the second actuating link 173 to rotate the over - center mechanism 140 so as to move the movable stop 147 from the closed position 149 to the open position 148 . to initiate the operation of the round bale wagon 10 to pick up round bales 14 lying on the ground g and load them on the load bed 20 , the mechanism described above must be cycled so that the bale engaging member 65 on the cross conveyor arm 64 of the cross conveyor means 60 is positioned at its outboard , home position to the right side of the load bed 20 and the pusher advance means 80 is positioned such that the pusher bar 82 is at its rearwardmost position , while the bale pickup means 40 is in a pickup position adjacent the ground g ready to engage a round bale 14 . the round bale wagon 10 is then guided so that the pickup means is positioned adjacent the first bale 14 to be loaded with the fixed arm 44 and the squeeze arm 45 adjacent opposing substantially planar sides of the cylindrical round bale 14 . the operator would then move the control lever 100 to slot quadrant 102 - c to actuate the control valve 93 , through the connecting link 105 and cross link 106 , as described above , and cause the hydraulic cylinder 48 to move the squeeze arm 45 toward the fixed arm 44 and firmly engage the round bale 14 therebetween . the operator would then move the control lever 100 to slot quadrant 102 - r whereby the control valve 95 would be actuated to cause the hydraulic lift cylinders 51 to rotate the pickup frame 42 about the pivot 41 and , thereby , raise the engaged round bale 14 to a position in the recessed cradle portion 31 of the load rack 30 immediately rearwardly of the bale pickup means 40 . as will be seen through the description of the sequential cycling of the linkage as found below , the starting position described above would result in the over - center mechanism 140 being positioned such that the movable stop 147 is in its closed position 149 . as the pusher advance means 80 returns to its home position , as described above with respect to fig1 , the trip arm 86 engages the second trip means 175 to cause the second actuating link 173 to move forwardly , rotating the over - center mechanism 140 about the shaft 145 and positioning the movable stop 147 into the open position 148 . as the frame 42 of the bale pickup means 40 rotates upwardly about the pivot 41 , as described above with respect to fig1 , the subframe member 129 engages the trip 122 and causes the connecting link 125 to move rearwardly . since the free end 137 of the second link 135 is limited in its rearward movement by the fixed stop 142 , the entire linkage 120 , including the first link 131 and the second link 135 , pivots about the free end 137 of the second link 135 , thereby pushing both spools 97a and 99a inwardly . although the operation of the hydraulic system is described in further detail below , this inward movement of spool 99a causes the control valve 99 to shift into the cross conveyor mode . when the frame 42 of the bale pickup means 40 is rotated downwardly about pivot 41 , the biasing spring 127 causes the connecting link 125 to move forwardly until the trip 122 engages the stop 123 . since the movable stop 147 of the over - center mechanism 140 has been moved into the open position 148 by the operation of the second actuating means 170 , the free end 137 of the second link 135 is free to slide forwardly within the guide slot 138 of the bracket 139 . as a result , the spool 97a of the delay valve 97 is pulled into its outward position and the second link 135 pivots about the connection 134 without affecting any movement of the first link 131 or the spool 99a . valve 97 is operable to delay movement of the cross conveyor means 60 when the spool 97a is in its inward position until the pickup means 40 has rotated forwardly out of interference with the frame - like member 65 and , thereby , moving the spool 97a to its outermost position to permit the hydraulic cylinder 68 to be actuated . since the control valve 99 is in the cross conveyor mode , for the reasons described below with respect to the description of the hydraulic system , the hydraulic cylinder 68 retracts to cause the bale engaging member 65 on the cross conveyor arm 64 to engage the bale 14 positioned within the recessed cradle portion 31 by the bale pickup means 40 and slide it across the load rack 30 to a position immediately rearwardly of the cab 12 . when the over - center mechanism 140 was rotated to cause the movable stop 147 to move to its open position 148 , the first actuating link 163 of the first actuating means 160 was pulled to the left such that the pin connection 168 with the first actuating link 163 was positioned at the right end of the lost motion slot 164 . accordingly , when the cross conveyor means 60 slides the bale 14 across the recessed cradle portion 31 , the trip arm 66 engages the trip pin 169 to pivotally move the pivot bar 166 and slide the pin 168 within the lost motion slot 164 without causing any movement to the first actuating link 163 . after the trip arm 66 has moved past the trip pin 169 , the biasing spring 161 returns the pivot bar 166 to a position where the pin 168 is again located at the right end of the lost motion slot 164 . when a second bale 14 has been engaged by the bale pickup means 40 between the fixed arm 44 and the squeeze arm 45 , the hydraulic lift cylinders 51 are again actuated to cause the pickup frame 42 to rotate upwardly about the pivot 41 . as will be described below with respect to the description of the hydraulic system , the positioning of spool 95a to cause the hydraulic lift cylinders 51 to rotate the bale pickup means 40 upwardly automatically causes the cross conveyor means 60 to return to its outboard , home position with the frame - like bale engaging member 65 along the right side of the load bed 20 . the movement of the cross conveyor linkage 62 to its home position causes the trip arm 66 to engage the trip pin 169 and pivotally rotate the pivot bar 166 in a counterclockwise direction , as viewed in fig6 thereby causing the pin 168 to move the first actuating link 163 to the right to rotate the over - center mechanism 140 so that the movable stop 147 is positioned in the closed position 149 . as described above , the upwardly rotative movement of the pickup frame 42 about the pivot 41 causes the subframe member 129 to engage the trip 122 and move the connecting link 125 rearwardly , causing the spool 97a to move to its inward position . since the spool 99a is already in its inward position and , therefore , in the cross conveyor mode , movement of the spool 99a would not be affected . after the second bale 14 has been deposited in the recessed cradle portion 31 of the load rack 30 by the bale pickup means 40 , the spool 95a is manipulated to cause the hydraulic lift cylinders 51 to rotate the pickup frame 42 downwardly about the pivot 41 . as the pickup frame 42 rotates downwardly , the biasing spring 127 pushes the connecting link 125 forwardly until the trip 122 engages the stop 123 . since the free end 137 of second link 135 is now trapped between the fixed stop 142 and the movable stop 147 , the forward movement of the connecting link 125 causes the second link 135 to pivot about its free end 137 , thereby causing the pivotal connection 134 between the first link 131 and the second link 135 to move forwardly and , therefore , pivot the first link 131 about its pivotal connection 132 with the frame 11 and move the spool 99a outwardly so as to shift the control valve 99 into the pusher mode . as will be described in further detail below , the movement of the control valve 99 to the pusher mode and the disengagement of the delay valve 97 permits the hydraulic cylinder 88 to be actuated , causing the pusher advance means 80 to move the round bales 14 from row a to row b . when the over - center mechanism 140 was rotated to position the movable stop 147 in its closed position 149 , the second actuating link 173 was moved rearwardly such that the pin 178 connecting the second actuating link 173 with the pivot link 176 is at the forward end of the lost motion slot 174 . the movement of support arm 84 rearwardly about the pivot 81 causes the trip arm 86 to engage the trip pin 179 and rotate pivot link 176 rearwardly . however , the pin 178 is free to move rearwardly within the lost motion slot 174 until the trip arm 86 is disengaged from the trip pin 179 ; whereupon the pivot link 176 is free to rotate by gravity until the pin 178 is again at the forward end of the lost motion slot 174 for subsequent engagement by the trip arm 86 to move the second actuating link 173 forwardly and rotate the over - center mechanism 140 . at this point , the bale wagon 10 is at the starting position as described above . further recycling of the events enumerated above will finally result in the load bed 20 being filled with round bales 14 . once the load bed 20 is filled with round bales 14 , the wagon 10 is driven to a selected location where the bales 14 are to be stored . to empty the load of bales from the load bed 20 , the operator moves the control lever 110 to slot quadrant 112 - r and , thereby , moving the connecting link 114 forwardly to shift the spool 91a of the control valve 91 and actuate the hydraulic cylinders 26 and rotate the frame 21 of the load bed 20 about its pivotal connection 22 with the main frame 11 , raising the forward end 28 . it should be noted that a hydraulic interlock is provided so that the forward end 28 of the load bed 20 cannot be raised unless both the cross conveyor 60 and the pusher advance means 80 are cycled to their respective home positions and the bale pickup means 40 is lowered to a position where the pusher advance means 80 just begins to move rearwardly . it is desirable that the tailgate 55 remains in its upright position with respect to the load bed 20 , as seen in fig2 until the load bed 20 is positioned at an approximate 35 degree angle with respect to the main frame 11 , at which time the tailgate 55 should release to permit the round bales 14 to slide and / or roll off . referring now to fig2 and 14 , the actuating mechanism 180 for automatically releasing the tailgate 55 from its upright position can be seen . the actuating mechanism 180 includes a bracket 182 mounted to the frame 21 of the load bed 20 to be movable therewith and supporting the control valve 96 which is mounted thereon . an actuating link 184 interconnects the spool 96a and a pivot link 185 , which is pivotally mounted on the load bed frame 21 . the actuating link 184 is of a two piece construction , similar to the connecting link 125 , and includes both a biasing spring 187 and a protection spring 188 , as well as being pivotally connected to the pivot link 185 . the biasing spring 187 pivotally rotates the pivot link 185 forwardly into engagement with the stop 186 . the pivot link 185 also includes a trip member 189 affixed thereto and extending for engagement with the main frame 11 . in operation , when the hydraulic cylinders 26 are actuated to cause the forward end 28 of the load bed 20 to rotate upwardly , the trip member 189 engages the main frame 11 and causes the pivot link 185 to rotate relative to the frame 21 of the load bed 20 . as a result , the actuating link 184 ultimately shifts the spool 96a to actuate the hydraulic cylinder 58 and rotate the tailgate 55 about its pivotal connection 56 with the load bed 20 . the length of the actuating link 184 and the position of the trip member 189 relative to the frame 11 permit the spool 96a to shift and , thereby , actuate the hydraulic cylinder 58 , when the load bed 20 has been raised to an angle of approximately 35 degrees relative to the main frame 11 . retaining the tailgate 55 in its upright position until the load bed 20 has been raised to approximately this point prevents the bales 14 from moving until they have sufficient height to freely and easily move off the load bed 20 . referring now to fig1 a and 15b , a somewhat simplified schematic diagram of the hydraulic system for the round bale wagon 10 can be seen . valves 91 , 93 and 95 , operating the load bed 20 , the squeeze arm 45 and the pickup means 40 , respectively , have three position spools and are spring loaded to the central , neutral position . valves 96 and 97 , corresponding to the tailgate 55 and the delay for the cross conveyor means 60 , respectively , are shown as having three position spools which are spring loaded to be biased in one direction only . valves 99 and 119 need only have two position spools , without any spring bias , so as to be only externally actuatable . hydraulic cylinders 26 , 48 , 51 , 58 , 68 and 88 are schematically shown in fig1 b . it should be noted that fig1 a and 15b are combinable along a match line located along at the right of fig1 a and at the left of fig1 b . the central hydraulic system 200 includes a reservoir 202 containing a supply of hydraulic fluid and a pump 204 which places the fluid under pressure through the inlet line 203 as the primary source of power for the components in the hydraulic system 200 . a flow divider 206 draws fluid from the inlet line 203 to provide power for an assortment of hydraulically powered devices , such as power steering , which are diagrammatically shown as being housed in box 207 . a return manifold 209 collects the hydraulic fluid after being circulated and returns it to the reservoir 202 to complete the circuit . hydraulic fluid flows initially through line 211 to the double selector valve 119 . the position of the valve spool 119a is manually controlled by the operator through manipulation of control lever 115 and connecting link 118 . if the valve spool 119a is shifted out , the oil flows from port 119b to port 119f and directly back to the return manifold 209 without being circulated to any of the other valves . when the valve spool 119a is shifted in , as depicted in fig1 a , the oil flows from port 19b to port 119c and then onwardly through line 213 , after passing through a pressure check 214 , to port 95b of valve 95 . simply stated , the double selector valve 119 operates only to divert the flow of hydraulic fluid to or away from the remaining valves . when the valve spool 95a is in the central , neutral position , fluid flows into port 95b and back out port 95c and through line 215 to port 93b of valve 93 . when valve 93 is in the central , neutral position , fluid flows into port 93b and back out port 93c and onward through line 217 to port 91b of valve 91 . when valve spool 91a is in the central , neutral position , fluid flows into port 91b and back out port 91c through line 219 to port 119d , then through valve spool 119a , out port 119e and through line 221 back to the return manifold 209 . it is from this basic flow pattern that the various hydraulic cylinders are operated . it should be noted that , with reference to fig4 movement of the connecting link 105 in either a forward or rearward direction will always actuate valve 93 before actuating valve 95 ; however , because both valve spools 93a and 95a are spring loaded to the central , neutral position , valve spool 93a will not shift from an extreme inward position to an extreme outward position until both valve spools 95a and 93a have moved to the central , neutral position . for example , when control lever 100 is in slot quadrant 102 - n both valve spools 93a and 95a are in the neutral position . when control lever 100 is shifted to slot quadrant 102 - c , valve spool 93a is shifted to the innermost position to operate hydraulic cylinder 48 through lines 216 and 218 , while valve spool 95a remains in the neutral position . as noted above and further described below , hydraulic fluid will not flow to valve 93 unless valve spool 95a is in the neutral position . accordingly , when control lever 100 is shifted from slot quadrant 102 - r back to 102 - n valve spool 95a moves to the central , neutral position , followed by valve spool 93a moving to the central , neutral position , at which time hydraulic fluid can flow on to the hydraulic cylinder 48 through the valve 93 because valve 95 is then in the neutral position . with reference to the starting position as enumerated above , the bale pickup means 40 has been lowered with the pusher advance means 80 in its rearwardmost position . control lever 100 is positioned in slot quadrant 102 - c shifting the valve spool 93a to its innermost position and causing hydraulic fluid to flow from port 93b to port 93d and onwardly to the hydraulic cylinder 48 to extend it and move the squeeze arm 45 toward the fixed arm 44 . movement of control lever 100 to slot quadrant 102 - r shifts spool 95a to its innermost position to cause hydraulic fluid to flow from port 95b to port 95d and onwardly through lines 220 to the hydraulic lift cylinders 51 to cause extension thereof and rotate the subframe 42 about the pivot 41 . hydraulic fluid leaving hydraulic cylinders 51 flows through line 223 to the cross connection 224 . the fluid then flows through line 222 to retract the hydraulic cylinder 88 because of the flow path available at the cross connection 224 , line 222 presenting the path of least resistance . hydraulic fluid leaving hydraulic cylinder 88 through line 225 proceeds to the t connection 226 and becomes divided to flow through both lines 227 and 229 . hydraulic fluid flowing through line 229 ultimately returns back to port 119d of valve 119 , exiting port 119e and returning via line 221 to the return manifold 209 . hydraulic fluid flowing through line 227 enters port 99f of valve 99 and exits port 99b , because valve 99 has been positioned in its outermost position , which is the pusher mode , via the automatic linkage 120 . hydraulic fluid will then flow from port 99b to a pressure relief valve 230 via line 231 and back to port 95e via line 233 , whereupon the flow exits valve 95 at port 95f , then flows through line 235 to line 219 and ultimately back to the return manifold 209 . once the hydraulic cylinder 88 has been completely retracted , fluid flowing from the cross connection 224 through the line 222 builds up sufficient pressure to open the relief valve 240 to permit the fluid to flow through line 237 and back to the return manifold 209 . it should be noted that the block valve , as labeled at the bottom of fig1 b , has no specific function other than to house a multitude of check valves , orifices , relief valves , a flow divider and t connections . these various hydraulic parts would normally have individual housings and be distributed throughout the system ; however , it has been found to be convenient to house them in one central location . it has been found that with an open center hydraulic system , as depicted in fig1 a and 15b , having a pump that will deliver a flow of 30 . 5 gallons per minute to provide a pressure of 2 , 000 pounds per square inch along line 211 to the double selector valve 119 , setting the relief valve 230 at 1 , 900 pounds per square inch provides relief for the system when either the cross conveyor means 60 or the pusher advance means 80 has been advanced to its respective extreme position by the hydraulic cylinder 68 and 88 , respectively , while setting the relief valve 240 at 1 , 000 pounds per square inch provides adequate relief for the system when either the cross conveyor means 60 or the pusher advance means 80 reaches the respective home position . with regard to the operation of valve 97 to effect a delay in the operation of the cross conveyor means 60 , it should be noted that whenever the connecting link 125 has been moved rearwardly by the engagement between member 129 and the trip 122 , thereby shifting spool 97a to its innermost position , the valve spool 95a is necessarily at its innermost position to effect an extension of the hydraulic cylinders 51 . hydraulic fluid is flowing from the double selector valve 119 to port 95b and exiting port 95e to travel through line 233 to relief valve 230 . the flow of hydraulic fluid continues from the relief valve 230 through line 231 to port 99b , exiting port 99c , because the automatic linkage 120 always shifts valve spool 99a to its innermost position when the connecting link 125 is moved rearwardly , to flow through line 239 and line 241 to port 97b of the delay valve 97 , due to the positioning of the check valve 242 . by exiting the fluid through port 97c , the delay valve diverts hydraulic fluid away from hydraulic cylinder 68 through line 243 into the block valve and back out through line 223 to the hydraulic cylinders 51 to cause retraction thereof and lower the bale pickup means 40 . fluid leaving the hydraulic cylinders 51 returns through the line 220 to port 95d , exiting port 95f , because the valve spool 95a has been shifted to its outermost condition by the control lever 100 being positioned in slot quadrant 102 - l , to travel through line 235 to line 219 and back to the return manifold 209 through valve 119 . once the bale pickup means 40 has been lowered to a position whereby the valve spool 97a is shifted to its outermost position , hydraulic fluid arriving at valve 97 through line 241 enters port 97b and exits port 97d to flow through line 245 into a flow diverter 246 located in the block valve . the flow diverter 246 permits fluid to flow through line 247 and the manual shut - off valve 72 to the hydraulic cylinder 68 to cause a retraction thereof and actuate the cross conveyor means 60 to slide a bale 14 across the recessed cradle portion 31 . hydraulic fluid leaving the hydraulic cylinder 68 returns over lines 244 and 223 to the hydraulic cylinders 51 , to continue operation thereof to lower the bale pickup means 40 , and ultimately back to the return manifold through lines 220 , 235 , 219 and 221 . the flow diverter 246 also permits hydraulic fluid to flow directly to the hydraulic cylinders 51 over line 248 , through the cross connection 224 and line 223 . hydraulic fluid can pass through line 249 to line 237 and back to the return manifold 209 , to relieve pressure in line 247 when there is no flow in line 244 . when the hydraulic cylinder 68 has reached the end of its retraction stroke , the relief valve 230 opens to permit hydraulic fluid to flow directly from line 233 to line 248 and via line 223 to the lift cylinders 51 . the hydraulic cylinders 26 for pivotally raising the forward end 28 of the load bed 20 can only be actuated through valve 91 when both valves 93 and 95 are in the central , neutral position and the interlock selector valve 99 has its spool 99a positioned at its outermost position , the pusher mode . hydraulic fluid entering valve 91 via line 217 from valve 93 enters port 91b and exits port 91d , by reason that valve spool 91a has been moved to its outermost position through placement of the control level 110 in slot quadrant 112 - r . fluid exiting toward 91d flows through line 251 into port 99d , exiting port 99e , by reason that valve 99 is in the pusher mode , and travels through line 238 to hydraulic cylinders 26 to cause extension thereof . fluid leaving the hydraulic cylinders 26 through line 253 arrives at the t connection 254 , where the flow enters port 91e . fluid entering port 91e exits port 91c and is returned to the return manifold 209 . relief valve 250 provides for a return of the hydraulic fluid from cylinder 58 to line 219 and ultimately the return manifold 209 , if cylinder 58 becomes overloaded . as the forward end 28 of the load bed 20 is raised and the tailgate actuating mechanism 180 shifts the spool 96a partially inwardly , hydraulic fluid entering port 96b exits port 96d and travels through line 255 to line 219 and ultimately the return manifold 209 , the fluid entering port 96c is blocked off to maintain pressure to the hydraulic cylinder 58 . when the load bed 20 has reached approximately a 35 degree angle with respect to the main frame 11 , the valve spool 96a is shifted to its innermost position to permit hydraulic fluid to escape the hydraulic cylinder 58 through line 252 to enter port 96c and exit port 96d and ultimately to the return manifold 209 , the pressure exerted on the tailgate 55 by the round bales 14 providing sufficient power for extending the hydraulic cylinder 58 . when the control lever 110 is positioned in slot quadrant 112 - l , the spool 91a is shifted to its innermost position to cause a reversing of the flow of hydraulic fluid through lines 253 and 238 and cause a retraction of the hydraulic cylinder 26 . when the load bed 20 has reached a position with respect to the main frame 11 that the tailgate actuating mechanism 180 permits the spool 96a to reach its outermost position , hydraulic fluid reaching the t connection 254 from the valve port 91e can enter port 96b and exit port 96c to travel through line 252 and effect a retraction of the hydraulic cylinder 58 and reposition the tailgate 55 in its upright position . it will be understood that changes in the details , material , steps and arrangement of parts which have been described and illustrated to explain the nature of the invention will occur to and may be made by those skilled in the art upon a reading of this disclosure within the principals and scope of the invention . the foregoing description illustrates the preferred embodiments of the invention . however , concepts , as based upon such description , may be employed in other embodiments without departing from the scope of the invention . accordingly , the following claims are intended to protect the invention broadly as well as in the specific form shown herein .

US-27657181-A

the plant - mobile is a rotating plant hanger which includes a rotatable frame adapted to support a number of hanging plants . embodiments of the plant - mobile are adapted to be moutned either from a wall or a ceiling , and the plant - mobile includes an associated ceiling or wall mounting means . the rotatable frame includes round balls or hooks from which potted plants may be hung . in addition , the rotatable frame includes radial members which may be used to support the shoots of climbing plants or vines .

referring now to fig1 a perspective view of a wall - mounted plant - mobile 10 is shown . the plant - mobile 10 comprises a rotatable frame 12 , a top view of which is shown in fig2 . the rotatable frame 12 comprises a series of coaxial annular members 14 , 16 , 18 which are attached to one another by radial members 20 , 22 , 24 , 26 , 30 , 32 , 34 . some of the radial members 22 , 26 , 30 , 34 extend to a central support portion 36 . the central support portion 36 of the preferred embodiment of the plant - mobile 10 comprises a pair of metal washers 38 , 40 . in the embodiment 10 , shown in fig1 the first washer 38 is attached to radial members 22 , 26 , 30 , 34 . the second washer 40 has its central hole aligned with the central hole of the first washer 38 . the second washer 40 is supported by offset members 42 which are in turn supported by radial members 22 , 26 , 30 , 34 . in the preferred embodiment of the invention , the various elements of the rotatable frame 12 described above are made of iron , and the elements are welded together . accordingly , the sides of the offset members 42 are welded to the sides of the radial members 22 , 26 , 30 , 34 as shown in fig1 and 2 . also , the washers 38 , 40 are welded to the radial members 22 , 26 , 30 , 34 and to the offset members 42 so that the central hole 44 of the second washer 40 is aligned with an identical hole in the first washer 38 . the rotatable frame 12 further comprises a series of plant supports 46 which are spaced uniformly around the outer annular member 18 and around the adjacent annular member 16 . in the preferred embodiment of the invention 10 , the plant supports 46 are comprised of iron balls welded to the annular members . it should be obvious , though , that the number and location of the plant supports 46 and their precise shape may vary without departing from the invention . thus , the plant supports may be comprised of hooks rather than the balls 46 of the preferred embodiment 10 . with reference to fig1 a series of potted plants 48 is shown . each plant is in a pot 50 which is suspended from one of the plant supports 46 by a length of nylon monofilament 52 in the preferred embodiment of the invention 10 . the use of nylon monofilament 52 enhances the floating effect which the plants are given by the plant - mobile 10 , however other hanging means , such as macrame plant hangers , may be used . some plants which are used for decorative purposes , such as spider plants , have shoots 54 sometimes called &# 34 ; babies &# 34 ; or &# 34 ; spider babies &# 34 ; which extend away from the plant . the &# 34 ; spider babies &# 34 ; 54 may be hung over the radial members or over the annular members for support and decoration . climbing plants or vines may also be hung from the plant - mobile 10 and they may also use the radial members and annular members for support . in use , the rotatable frame 12 is supported from a mounting means , such as the wall bracket 56 , as shown in fig1 and 4 , or the ceiling bracket 58 , as shown in fig3 . the wall bracket 56 comprises a support structure having means , such as iron washers 60 , which are used in the preferred embodiment of the invention 10 , through which bolts , screws , or nails may be inserted to hold the bracket 56 to a wall . the bracket 56 further comprises a pair of horizontal support arms 62 which are longer than the radius of the rotatable frame 12 and which are braced by diagonal arms 64 . the bracket 56 further comprises a shaft 66 which preferably extends down vertically from the horizontal support arms 62 . at the lower end of the shaft 66 there is a hole 68 through which a cotter pin 70 may be inserted after the washers 38 , 40 of the rotatable frame 12 are inserted over the shaft 66 . when the plant - mobile is thus assembled with the bracket 56 mounted on a wall , the rotatable frame 12 may be rotated as desired for adding , removing , or watering plants , or to allow different plants to receive light from different angles . similarly , a ceiling bracket 58 , shown in fig3 comprises a horizontal plate 72 having a pair of holes 74 therein through which screws , bolts , or nails may be inserted to secure the ceiling bracket 58 to a ceiling or other horizontal surface . a shaft 76 having a hole 78 bored therethrough is securely attached to the horizontal plate 72 and is used in the same manner as the shaft 66 and holes 68 of the wall bracket 56 which has already been described . while the preferred embodiment of the plant - mobile 10 has been described , a number of obvious changes can be made in the plant - mobile without departing from the spirit or scope of the invention . in particular , the inventor contemplates that a method of rotatably mounting the rotatable frame 12 to either a wall bracket 56 or a ceiling bracket 58 without the use of a cotter pin can be employed . for example , the ends of the shaft 66 can be threaded and a threaded cap or a threaded nut 178 of the type shown in fig5 used to hold a ceiling light fixture in place could be used . also , while the preferred embodiment of the plant - mobile 10 was made using welded iron , other materials , such as other metals or plastics could be used . the inventor also contemplates the inclusion of a motorized mount capable of slowly rotating the rotatable frame 12 in order to provide the various plants with uniform lighting conditions or for decorative purposes . such embodiment would be made by mounting a motor , such as the electric motor 180 shown in fig5 having a shaft in place of the shafts 66 , 76 , described herein and then mounting the rotatable frame 12 from the motor &# 39 ; s shaft . in such an embodiment , the rotatable frame 12 would be secured to the motor &# 39 ; s shaft , as by a set screw , in order to have the frame 12 rotate when the motor &# 39 ; s shaft rotates . the inventor also conceives of the inclusion of lighting means , either incandescent or fluorescent , as part of the mounting bracket holding the rotatable frame 12 . for example , a ceiling bracket 158 could be modified to include an annular &# 34 ; halo &# 34 ; fluorescent light 160 as shown in fig5 with the shaft 176 extending through the light fixture so that the rotatable frame is hung below the fluorescent bulb and the plants receive light therefrom . it should also be recognized that the radius of the rotatable frame may be altered as can the number of radial members or annular members without departing from the spirit or scope of the invention .

US-89501578-A

there is disclosed a pareve liquid coffee whitener characterized by having freeze - thaw stability , which comprises an aqueous emulsion of vegetable fat , vegetable protein , carbohydrates , and emulsifiers therefor , said emulsifiers consisting essentially of monoglycerides , partial fatty acid esters of hexitol , ethoxylated partial fatty acid esters of hexitol , and stearoyl - 2 - lactylic acid .

as indicated earlier , the pareve coffee whitener of the present invention is made all of non - animal ingredients . the freeze - thaw stability and whiteness are believed to be attributed to the emulsifier components described in detail herein . these are ( a ) monoglyceride , ( b ) a partial fatty acid ester of hexitol , ( c ) an ethoxylated partial fatty acid ester of hexitol , and ( d ) stearoyl - 2 - lactylic acid . the amounts for these different emulsifier components are varied within the following ranges : a . monoglycerides from 0 . 3 to 0 . 6 % by weight based on the total weight of the whitener &# 39 ; s composition . by monoglycerides we mean the partial fatty acid esters of glycerol , including the diglycerides . of importance , is the fact that the term monoglycerides referred to in commerce does not denote pure monoglycerides . generally , commercial grades of monoglycerides contain about 40 to 45 % by weight of α - monoglycerides with the remainder being diglycerides ( 40 - 45 %), triglycerides and unreacted glycerol . nevertheless , for the coffee whitener of the present invention the α - monoglycerides should not be below 40 % by weight . of course , distilled monoglycerides containing a minimum of 90 % by weight α - monoglycerides can be used with advantage . the fatty acid component of the monoglyceride can have from 14 to 18 carbon atoms . of the fatty acids in this range , stearic acid is preferred . b . the partial fatty acid ester of hexitol can be utilized from about 0 . 05 % to about 0 . 2 % by weight . hexitol refers primarily to sorbitol or mannitol with the former being preferred for efficiency and economy . a typical ester is sorbitan monostearate . c . as to the ethoxylated esters of hexitol , they comprise the condensation reaction product of the partial fatty acid ester with ethylene oxide or the esterified product of ethoxylated hexitol . the extent of ethoxylation can range from the equivalent of 4 to 5 ethylene oxide units up to 80 - 100 units . preferably , the hexitol is sorbitol and the amount of ethylene oxide condensed therewith is an average of 20 units . the fatty acid component can have from 14 to 18 carbon atoms , but typified with stearic acid . thus , a preferred ethoxylated ester of hexitol is ethoxylated sorbitan monostearate . commercially available products of these esters are known as &# 34 ; durfax 60 &# 34 ;, a trademark of scm corporation , of &# 34 ; tween &# 34 ;, a trademark of atlas industries . one or more of these ethoxylated products can be utilized within the range of from about 0 . 1 to about 0 . 3 % by weight , preferably about 0 . 2 %. d . the stearoyl - 2 - lactylic acid , also known as , marvic acid , a trademark of scm corporation , is used from about 0 . 05 to about 0 . 6 % by weight , preferably in the range 0 . 2 to 0 . 4 % by weight . at this juncture , it should be noted that the salts ( alkali metal or alkaline earth metal salts ) of marvic acid have not shown to be as effective as the acid itself . experiments have shown that pareve coffee whiteners formulated with marvic acid were more stable , as far as freeze - thaw stability , than those formulated with marvic acid salts , such as calcium or sodium salts . also , the presence of marvic acid appears to contribute to the whitening power of the whitener of the present invention . coffee whiteners , also , include other additives or adjuvants for the purpose of improving the viscosity , body , dispersibility , or other properties of the particular coffee whitener . of note are the various thickening agents or gums , the various stabilizing salts as well as known preservatives . typical gums include , but not limited to , locust been gum , guar gum , algin , carageenan , xanthan , and the like , bean can be used in proportions ranging from about 0 . 01 to about 3 . 0 % by weight . similarly , dispersing agents of the phosphate and hydrate types are used in about 0 . 1 % by weight . common stabilizing and / or buffering salts for this use are sodium citrate , dipotassium phosphate , tetra sodium pyrophosphate , and so forth . a wide variety of coffee whitener formulations is known and can be used in conjunction with the emulsifiers of the present inventions . generally , pareve coffee whiteners comprise emulsifiers , stabilizers , and thickeners , vegetable fat and vegetable proteins , as well as sweeteners ( carbohydrates ), flavorants , and colorants . these various components provide a considerable number of variations depending on the desired quality . for example , fat contents and sweetness can be altered within a wide range even though the tendency has been toward minimal amounts for reasons of economy and reduction in caloric content . the proportion of vegetable fat used in preparing the coffee whitener can vary from about 5 to 18 % by weight . it is usually present in a proportion of about 10 %. the fat should have a low melting point and narrow plastic range as these provide for easy blending and dispersibility in hot coffee . examples of fats for coffee whiteners are hydrogenated coconut and hydrogenated refined fractions of soybean oil . hard butters such as those from coconut and soybean - cottonseed oil fractions are also adapted for making the coffee whitener . the vegetable protein used in preparing pareve coffee whiteners should be present in a proportion of about 1 to 3 % by weight . it serves to increase viscosity and whitening power and helps give desired body characteristics . the vegetable proteinate commonly used for pareve whiteners is soybean proteinate . the carbohydrate used in the liquid coffee whitener is present in a proportion of about 5 to 15 % by weight to act also as a bodying agent and to add some sweetness . it consists generally of corn syrup solids , or sucrose . sometimes a mixture of the two are used together , but more often , it is preferred to use corn syrups as the carbohydrate . the following examples are provided to illustrate the invention and how certain variations in the emulsifier components can be made . all parts and percentages are by weight unless otherwise specified . a pareve coffee whitener was prepared from the ingredients listed below with their respective amounts . ______________________________________ingredient % by weight______________________________________vegetable fat c &# 34 ; paramount c &# 34 ;, a trademark ofscm corporation ) comprising re - arranged blendsof hydrogenated palm kernel oil and coconut 10 . 0oil , with lecithin . 36d corn syrup 12 . 0soybean proteinate isolate 1 . 0monoglyceride (&# 34 ; dur - em 117 &# 34 ;, a trademark ofscm corporation ) comprising a minimum of 40 % by weight α - monoglyceride ( glycerol mono - stearate ) 0 . 45polyoxyethylene sorbitan monostearate (&# 34 ; durfax 60 &# 34 ;, a trademark of scm corpora - 0 . 10tion ) sorbitan monostearate 0 . 15dipotassium phosphate ( stabilizing salt ) 0 . 30marvic acid ( stearoyl - 2 - lactylate ) 0 . 20water 75 . 80 100 . 00______________________________________ first , the stabilizing salt , soybean proteinate , and corn syrup solids were added to a vessel containing the water and mixed to dissolve the solids . the resultant aqueous mixture is heated to 120 ° f . in another vessel , the &# 34 ; paramount c &# 34 ; and the emulsifiers ; i . e ., monoglyceride , sorbitan monostearate , polyoxyethylene sorbitan monostearate , and marvic acid were melted and blended . this blend was added to the vessel containing the aqueous mixture and the entire contents were mixed . after complete mixing and blending at 120 ° f ., the contents then were pasteurized at a temperature of 160 ° f . for about 30 minutes . a highly unique feature is that the mix may also be pasteurized aspectically by processing it at ultra high temperatures such as 265 ° f . for 3 seconds . then to completely emulsify the mix for forming a stable emulsion , the mix was passed through a two - stage homogenizer , the first step being operated at a pressure of about 2500 psig and the second at 500 psig . the second stage is used to break up any agglomerates formed in the first stage . the above coffee whitener was frozen to - 20 ° f . and then allowed to thaw to a temperature of 40 ° f . and observed for emulsion stability . the cycle is repeated for 5 times ; ( freezing at 0 ° f .). after the five freeze - thaw cycles , the emulsion on examination was stable by showing no separation or phase breakdown . the emulsion stability was observed visually and by inserting a stainless spatula into the thawed whitener to examine the homogeneity and / or particulate matter which indicates a broken emulsion . of course , an essential property of the coffee whitener is to whiten coffee . to check the effectiveness of the whitener in this respect , the following test was devised and run on all preparations . to 0 . 9 ounce of the whitener described above placed in a beaker , 6 ounces of coffee ( 1 . 65 grams of chase and sanborn instant coffee per 6 ounces of water ) at about 190 ° f . were added . the whiteness of the coffee - whitener mixture was measured in an instrument called agtron ( model m - 400 - a made by magnuson engineers of san jose , california ). the whitened coffee was poured into an agtron cup ( supplied with the instrument ) up to 3 / 4 full , and the cup was placed in the instrument reflectance colorimeter which had been standardized with the 07 and 44 discs using the green filter . the temperature and agtron reading of the above whitened coffee were recorded to be 150 ° f . and 43 . 0 , respectively . the above whitener was put through 5 cycles of freeze - thaw , and its reflectance in coffee was measured after the first , second , and fifth cycles . these numbers were 43 . 0 , 41 . 5 , and 42 . 0 , respectively , indicating excellent stability and maintained whitening property . five additional formulations of the whitener described in example i were prepared wherein all the ingredients were the same except for marvic acid which varied as follows : 0 . 0 %, 0 . 1 %, 0 . 4 %, 0 . 6 %, and 0 . 8 % ( water content and buffer were changed slightly to compensate for the changes in marvic acid ). subjecting the foregoing formulations to freeze - thaw cycling and reflectance measurements resulted in that the samples containing 0 . 0 %, 0 . 1 %, 0 . 4 %, and 0 . 6 % showed stability as to emulsion breakdown , whereas the sample containing 0 . 8 % broke down after one cycle . as to the reflectance data after first , second , and fifth cycles , the readings were as follows : % marvic acid agtron readings______________________________________ first second fifth cycles 0 37 . 5 36 . 5 36 . 00 . 1 41 . 0 39 . 0 37 . 50 . 4 43 . 5 43 . 0 42 . 00 . 6 44 . 0 43 . 0 42 . 00 . 8 46 . 5 -- -- ______________________________________ from the above , it can be seen that the marvic acid contributes significantly to the whitening property of the composition . for clarity , it should be noted that in the same series of reflectance readings difference of 5 units or more is considered significant . the compositions containing 0 . 4 and 0 . 6 % marvic acid showed a slight increase in viscosity . comparative freeze - thaw stability tests were run on coffee whiteners prepared in a manner exactly the same as example i , varying only the emulsifier used in preparing the coffee whitener . the level of emulsifier was essentially the same as the level of emulsifier in example i . the table below represents the result of the freeze - thaw stability : coffee emulsifiers freeze - thawwhitener percent stability______________________________________a 0 . 48 triglycerol monostearate 1 cycle - emul - 0 . 20 stearoyl - 2 - lactylic acid sion broke on second cycleb 0 . 48 hexaglycerol monostearate &# 34 ; 0 . 20 stearoyl - 2 - lactylic acidc 0 . 48 decaglycerol decaoleate 0 . 20 stearoyl - 2 - lactylic acid &# 34 ; d 0 . 48 decaglycerol monostearate 0 . 20 stearoyl - 2 - lactylic acid &# 34 ; ______________________________________ the above results show that the coffee whiteners employing polyglycerol esters in combination with marvic acid , a trademark for stearoyl - 2 - lactylic acid , did not produce the emulsion stability that the four - compound emulsifier system as disclosed herein . emulsion stability was acceptable for one freeze - thaw cycle only . a coffee whitener was made in accordance with the procedures of example i using the ingredients set forth below : ingredient percent______________________________________water 74 . 20 &# 34 ; paramount c &# 34 ; w / lecithin (&# 34 ; paramount cis palm kernel and coconut oil ) 12 . 0036 d . e . corn syrup solids 10 . 00supro 7 ( soybean proteinate ) 0 . 90sodium citrate 0 . 40dipotassium phosphate 0 . 22monopotassium phosphate 0 . 10sugar 1 . 00carboxymethyl cellulose 0 . 10glycerol mono - and distearate 1 . 00 ( 40 % α - monoglycerides ) polyoxyethylene sorbitan monostearate 0 . 08 100 . 00______________________________________ the formulation shown in example iii was changed to contain : 0 . 1 % sorbitan monostearate , 0 . 2 % polyethylene sorbitan monostearate , and the reduced amount of monoglycerides 0 . 5 %, in addition to 0 . 2 % marvic acid . the resultant whitener was excellent . it was stable for five freeze - thaw cycles and had reflectance readings between 41 and 42 which are quite acceptable .

US-47968474-A

the force resistance device of the present invention enables the muscle groups which rotate the humerus about its axis to be safely and adequately developed . a base provides a series of rollers in a radial configuration which enables the humerus to rotate about its own axis . the device protectingly surrounds the elbow and lies adjacent the radius and ulna portions of the arm . tension cords which may be selected based upon number and individual tension characteristics extend from an elongate portion to the base portion and about the curved portion which protects the elbow .

the description and operation of the invention will be best described with reference to fig1 . fig1 is a perspective view of an exercise device 21 as it would be viewed by a human approaching the device 21 to exercise the right arm . the exercise device 21 has a fixed base 23 having an upper surface 25 , side surfaces 27 , and a back surface 29 . the fixed base 23 pivotally supports a pivoting member 31 . pivoting member 31 has an elongate portion 33 and a curved portion 35 . pivoting member is designed to pivot about an axis at the center of the area partially curvingly enclosed by the curved portion 35 . atop elongate portion 33 is a hand grip 37 . a slanted back wall 39 opens to a hand opening 41 to enable the human hand to enter the hand opening and the fingers to grasp the hand grip 37 . accommodation of the hand with the slanted back wall 39 , and a straight portion 43 enables the radius and ulna portions of the arm , and the back of the hand to be maximally supported once the human arm is placed within the confines of the pivoting member 31 . just beneath , and continuous with the straight portion 43 is the arm - rest curved portion 45 . arm - rest curved portion 45 defines the space into which the lower portion of the humerus is placed and ensures that the human arm will be stabilized and unable to shift from a position in which the axis of the humerus coincides with the axis of pivot of the pivoting member 31 . all of the structures of the pivoting member 31 , including the hand grip 37 , slanted back wall 39 , straight portion 43 , and arm rest curved portion 45 are bound by a first side flange 47 and a second side flange 49 . the side flanges 47 and 49 fix the pivoting member 31 , with respect to movement in the axis of pivot , relative to the fixed base 23 . also shown in fig1 is a portion of a radially outward surface 51 which is the outside of the arm - rest curved portion 45 . this surface will experience the bulk of the bearing force placed upon the pivoting member 31 as it is pivoted with respect to fixed base 23 . referring to fig2 an overall exploded view of the exercise device 21 is shown . as can be seen , the pivoting member 31 is generally formed into a single piece . a first handle screw 55 and a second handle screw 57 extend through the side flanges 47 and 49 to fix the hand grip 37 with respect to the pivoting member 31 . referring to the lowermost portion of fig2 a base elastic rope bracket 61 is shown detached from the fixed base 23 . the elastic rope bracket 61 may be welded or bolted to the base 23 , or attached by any manner sufficient to secure the forces to which it will be subjected . also visible , and shown in broken fashion , are a set of elastic cord lower ends 63 . elastic cord lower ends 63 extend to a broken line indication of discontinuity in order to simplify the appearance of the exploded view of fig2 . although not shown , the lengths of the elastic cords are intended to bear against a set of lower elastic cord rollers 65 . the set of lower elastic cord rollers 65 are commonly and rotatably supported by a lower elastic cord roller axle 67 . the lower elastic cord rollers 65 will preferably be made of teflon or some other low friction material . the material should be designed with the lower elastic cord roller axle 67 in mind to give long service with minimum wear . also now visible on the fixed base 23 is the lower elastic cord roller axle apertures 69 . the apertures 69 support and fix the axle 67 with respect to the fixed base 23 . axle 67 may be fixed by press fitting or with the use of screws or bolts ( not shown ). shown displaced slightly upwardly and to the left of the fixed base 23 are a set of three roller bearings , namely lower roller bearing 71 , middle roller bearing 73 and upper roller bearing 75 . each of the roller bearings 71 , 73 and 75 are supported by an associated one of the roller bearing axles 77 shown adjacent them . the roller bearing axles 77 engage the roller bearing axle apertures 79 in the sides of the fixed base 23 . again , the roller bearings 71 , 73 , and 75 will preferably be made of teflon or some other low friction material . the roller bearing material should be designed with the roller bearing axles 77 in mind to give long service with minimum wear . on the fixed base 23 , and in particular the side surfaces 27 , a pair of upwardly disposed curved surfaces 81 are shown . the curvature of the curved surfaces 81 matches the radially outward surface 51 on the pivoting member 31 . in the middle portion of fig2 and slightly above the fixed base 23 is an upper elastic cord roller axle 85 shown to engage a set of upper elastic cord rollers 87 . the lengths of the elastic cords are intended to also bear against the upper elastic cord rollers 87 . as was the case for the lower elastic cord rollers 65 , the upper elastic cord rollers will preferably be made of teflon or some other low friction material , and designed with the upper elastic cord roller axle 85 in mind to give long service with minimum wear . also now visible on the fixed base 23 is the upper elastic cord roller axle apertures 89 . the apertures 89 support and fix the axle 85 with respect to the fixed base 23 . as was the case for axle 67 , axle 85 may be fixed by press fitting or with the use of screws or bolts ( not shown ). at the upper portion of fig2 is the elongate portion elastic rope bracket 91 . bracket 91 is similar to bracket 61 , and is affixed to the pivoting member 31 in a manner similar to that to which the bracket 61 was affixed to the fixed base 23 . shown adjacent to bracket 91 are the elastic cord upper ends 93 . the length of the elastic cords ( not shown in their entirety ) extend between the upper ends 93 and the lower ends 63 . five cord ends , both upper cord ends 93 and lower cord ends 63 are shown , however it is understood that the exercise device 21 of the present invention may be built to accommodate a greater or lesser number of the elastic cords . further , not all of the elastic cords need be utilized in the exercise device 21 , and it is contemplated that both the number and strength of the cords may be selectively employed to yield the desired resistance characteristics . the rear side of the pivoting member 31 is shown fitted with a cover plate 95 to isolate the elastic rope bracket 91 from view and to protect it from interference with outer structures . the bottom of fixed base 23 may optionally also be covered with a cover plate , but since it is not in view during the use or storage of the exercise device 21 , such is not considered necessary . as can be seen on fixed base 23 there is a first base radiused slot 97 and a second base radiused slot 99 . both the first and second radiused slots 97 and 99 may generally follow the curvature of the pair of upwardly disposed curved surfaces 81 . as is shown in connection with the pivoting member 31 , a pair of bearing screws , bolts , or rivets , which will hereafter be referred to as screws , namely first radiused slot bearing screw 101 and second radiused slot bearing screw 103 engage the first and second side flanges 47 and 49 . when the first and second radiused slot bearing screws 101 and 103 engage the side flanges 47 and 49 while the pivoting member 31 is in engaged position with the fixed base 23 , the ends of the first and second radiused slot bearing screws 101 and 103 will extend through and laterally engage the first and second base radiused slots 97 and 99 . this engagement of the first and second radiused slot bearing screws 101 and 103 with respect to the first and second base radiused slots 97 and 99 act to both hold the pivoting member 31 in place with respect to the fixed base 23 and to guide the pivoting action of the pivoting member 31 . the exercise device 21 is tolleranced such that downward force on the pivoting member is borne by the radially outward surface 51 on the lower , middle , and upper roller bearings 71 , 73 , and 75 rather than upon the first and second radiused slot bearing screws 101 and 103 . the only force which should be experienced by the first and second radiused slot bearing screws 101 and 103 will be only the force necessary to keep the pivoting member 31 from lifting away from the fixed base 23 . the tip ends of the first and second radiused slot bearing screws 101 and 103 should be made to move within the first and second radiused slots 97 and 99 in a manner which is as friction free as possible . one possible manner to accomplish this would be to use small , precision roller bearings 105 at the ends of the bearing screws 101 and 103 , to roll against the radiused slot 97 and 99 . the tip portions of the screws 101 and 103 may be fitted with threads to accept the bearings 105 , and a stop , in the form of a stepped land , as is shown in fig2 to form the maximum extend of threaded engagement . other solutions may involve low friction interface materials . referring to fig2 a , an expanded view of the pivoting member 31 and its associated structures are shown , which were discussed and shown in fig1 . in particular , the upper elastic rope bracket 91 is shown as having particular shaped notches 107 . these notches 107 open significantly wider than the width of the elastic cord portion of the associated elastic cord upper ends 93 , but narrow sufficiently to hold the elastic cord upper ends 93 in place . the elastic cord upper ends 93 , like the elastic cord lower ends 63 have expanded diameter portions which may consist of an attached member , or simply a knot . referring to fig2 b , an expanded view of the base member 23 and its associated structures which were discussed and shown in fig1 are illustrated . in particular , the lower elastic rope bracket 61 is shown as having particular shaped notches 109 , similar to the notches 107 . referring to fig3 a sectional view taken along line 3 -- 3 of fig1 is illustrated . now seen in complete view , between the elastic cord upper ends 93 and the elastic cord lower ends 63 , are the elastic cords 111 . the view of fig3 also illustrates the extent of the pivot of the pivoting member 31 . the rest position is shown in solid line while the position of maximum force displacement is shown in phantom . as can be seen , in the maximum force displacement position , the elastic cord 111 is in its maximum length displacement . as can also be seen , in the maximum length displacement , the cords 111 have some contact with radially outward surface 51 . because the cords 111 extend based upon a generally constant radius of extension , the force of opposition of the pivoting member 31 is more evenly proportional to the angular displacement of the pivoting member 31 . the view looking into fig3 is a view along the axis of the human arm humerus . thus it can be seen that the lower humerus and elbow will be protected as the pivoting member 31 is angularly displaced with respect to the base member 23 . also more clearly seen is hand opening 41 between hand grip 37 and slanted back wall 39 . while the present invention has been described in terms of an exercise and physical therapy device , one skilled in the art will realize that the structure and techniques herein can be applied to many such appliances . the present invention may be applied in situations where muscles and tendons associated with the axial angular displacement of a limb are needed to be strengthened . although the invention has been derived with reference to particular illustrative embodiments thereof , many changes and modifications of the invention may become apparent to those skilled in the art without departing from the spirit and scope of the invention . therefore , included within the patent warranted hereon are all such changes and modifications as may reasonably and properly be included within the scope of this contribution to the art .

US-26470894-A

a ham product and method for production thereof described herein separate bone - in hams into smaller pieces . accordingly , pieces of bone - in ham , even those spirally - sliced , will be available to consumers in smaller portions . unlike conventional methods , however , the ham product provides three or four pieces of essentially equal size that each have a nearly equal meat - to - bone ratio . furthermore , when a spiral cut ham is separated into pieces , each piece includes a portion of the femur and retains attachment of the slices to the femur so that the slices stay intact during handling and packaging and so that the pieces retain the natural shape and easy handling desired by consumers .

reference will now be made in detail to the preferred embodiments of the present invention , examples of which are illustrated in the accompanying drawings . referring to fig1 a , a short - shank ham is shown according to an exemplary embodiment of the present invention . a person of ordinary skill in the art recognizes that the short - shank ham 100 is not drawn to scale and may have any configuration of the bones contained therein , as known to one of ordinary skill in the art . short - shank ham 100 typically comprises three bones : a shank bone 170 , a femur bone 130 , and an aitch bone 140 . the aitch bone 140 is positioned substantially at the butt end 150 of the short - shank ham 100 . the shank bone 170 extends substantially from a shank tip 160 of the short - shank ham 100 to the femur bone 130 , which is positioned at a different angle from the shank bone 170 . at the butt end 150 of the short - shank ham 100 , the femur bone 130 is proximate to the aitch bone 140 . in an exemplary embodiment of the present invention , the short - shank ham may be spirally - sliced 120 substantially the length of the short - shank ham 100 and substantially centered about the femur bone 130 . a short - shank ham 100 may be separated along a transverse plane 110 , resulting in a butt - end piece 101 and a shank - end piece 102 . referring also to fig1 b and 1 c , shown are views of the cut faces of the butt - end piece 101 and shank - end piece 102 , respectively , according to an exemplary embodiment of the present invention . the aitch bone 140 and shank bone 170 are shown crosshatched to indicate that they are inside the meat and thus would not be visible on the cut faces . a separation along the transverse plane 110 separates the femur bone 130 into the butt - end piece of the femur 131 and the shank - end piece of the femur 132 . in an exemplary embodiment of the present invention , the ham may be spirally sliced and the separation along transverse plane 110 may separate a short - shank ham 100 between spiral slices 120 . in another exemplary embodiment of the invention , a ham that is not spirally sliced may be separated along the transverse plane 110 . in an embodiment of the invention , the butt - end piece 101 comprises between approximately 35 % and approximately 55 % by weight of the short - shank ham 100 . in another embodiment of the invention , the butt - end piece 101 comprises between approximately 40 % and approximately 50 % by weight of the short - shank ham 100 . in yet another embodiment of the invention , the butt - end piece 101 comprises between approximately 43 % and approximately 47 % by weight of the short - shank ham 100 . in still another embodiment of the invention , the butt - end piece 101 comprises approximately 45 % by weight of the short - shank ham 100 . referring now to fig1 b , 1 d and 1 e , pieces of a short - shank ham may be made according to an exemplary embodiment of the invention by separating the butt - end piece 101 . the butt - end piece 101 may be separated along the longitudinal plane 111 , resulting in a first piece 103 and a second piece 104 . the separation along longitudinal plane 111 is made such that the aitch bone is divided into pieces of substantially equal weight . the longitudinal plane 111 is substantially perpendicular to the cut face of the butt - end piece 101 . according to an embodiment of the invention , the angle between the longitudinal plane 111 and the long axis of the butt - end piece 112 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the longitudinal plane 111 and the long axis of the butt - end piece 112 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the longitudinal plane 111 and the long axis of the butt - end piece 112 is approximately 45 degrees . separation of the butt - end piece 101 along the longitudinal plane 111 divides the aitch bone 140 into a first aitch bone piece 141 and a second aitch bone piece 142 . in an embodiment of the invention , the weights of the first aitch bone piece 141 and the second aitch bone piece 142 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. separation of the butt - end piece 101 along the longitudinal plane 111 also divides the butt - end piece of the femur 131 into a first butt - end piece of the femur 133 and a second butt - end piece of the femur 134 . in an embodiment of the invention , the weights of the first butt - end piece of the femur 133 and the second butt - end piece of the femur 134 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring now to fig1 c , 1 f and 1 g , pieces of a short - shank ham may be made according to an exemplary embodiment of the invention by separating the shank - end piece 102 . the shank bone 170 is shown crosshatched to indicate that it is inside the meat and thus would not be visible on the cut face . the shank - end piece 102 may be separated along a first longitudinal plane 113 or a second longitudinal plane 114 , resulting in a first piece 103 and a second piece 104 . the plane along which the separation is made is substantially perpendicular to the cut face of the shank - end piece 102 . according to an embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 115 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 115 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 115 is approximately 45 degrees . according to another exemplary embodiment of the present invention , the shank - end piece 102 may instead be separated along the long axis of the shank piece 115 , in which case the shank bone would also be divided between the resultant pieces . in an embodiment of the invention , the weights of two pieces of the shank bone would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. whether the shank - end piece 102 is separated along the first longitudinal plane 113 , the second longitudinal plane 114 , or the long axis 115 of the shank piece , separation of the shank - end piece 102 divides the shank - end piece of the femur 132 into a first shank - end piece of the femur 135 and a second shank - end piece of the femur 136 . in an embodiment of the invention , the weights of the first shank - end piece of the femur 135 and the second shank - end piece of the femur 136 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig1 d , 1 e , 1 f , and 1 g , a short - shank ham is shown divided into four pieces according to an exemplary embodiment of the invention . in an embodiment of the invention , in the pieces made from a single ham the weights of the heaviest and the lightest pieces differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in another embodiment of the invention , in the pieces made from a single ham the total weight of bone in the piece having the most bone and the piece having the least bone differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in yet another embodiment of the invention , in the pieces made from a single ham the ratio of meat to bone in the piece having the highest ratio of meat - to - bone and the piece having the lowest ratio of meat - to - bone would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig2 a , a shank bone out ( sbo ) ham is shown according to an exemplary embodiment of the present invention . a person of ordinary skill in the art recognizes that the sbo ham 200 is not drawn to scale and may have any configuration of the bones contained therein , as known to one of ordinary skill in the art . sbo ham 200 typically comprises two bones : a femur bone 230 , and an aitch bone 240 . the aitch bone 240 is positioned substantially at the butt end 250 of the sbo ham 200 . at the butt end 250 of the sbo ham 200 , the femur bone 230 is proximate to the aitch bone 240 . in an exemplary embodiment of the present invention , the sbo ham may be spirally - sliced 220 substantially the length of the sbo ham 200 and substantially centered about the femur bone 230 . a sbo ham 200 may be separated along a transverse plane 210 , resulting in a butt - end piece 201 and a shank - end piece 202 . referring also to fig2 b and 2 c , shown are views of the cut faces of the butt - end piece 201 and shank - end piece 202 , respectively , according to an exemplary embodiment of the present invention . the aitch bone 240 is shown crosshatched to indicate that it is inside the meat and thus would not be visible on the cut face . a separation along the transverse plane 210 separates the femur bone 230 into the butt - end piece of the femur 231 and the shank - end piece of the femur 232 . in an exemplary embodiment of the present invention , the ham may be spirally sliced and the separation along transverse plane 210 may separate a sbo ham 200 between spiral slices 220 . in another exemplary embodiment of the invention , a ham that is not spirally sliced may be separated along the transverse plane 210 . in an embodiment of the invention , the butt - end piece 201 comprises between approximately 35 % and approximately 55 % by weight of the sbo ham 200 . in another embodiment of the invention , the butt - end piece 201 comprises between approximately 40 % and approximately 50 % by weight of the sbo ham 200 . in yet another embodiment of the invention , the butt - end piece 201 comprises between approximately 43 % and approximately 47 % by weight of the sbo ham 200 . in still another embodiment of the invention , the butt - end piece 201 comprises approximately 45 % by weight of the sbo ham 200 . referring now to fig2 b , 2 d and 2 e , pieces of a sbo ham may be made according to an exemplary embodiment of the invention by separating the butt - end piece 201 . the butt - end piece 201 may be separated along the longitudinal plane 211 , resulting in a first piece 203 and a second piece 204 . the separation along longitudinal plane 211 is made such that the aitch bone is divided into pieces of substantially equal weight . the longitudinal plane 211 is substantially perpendicular to the cut face of the butt - end piece 201 . according to an embodiment of the invention , the angle between the longitudinal plane 211 and the long axis of the butt - end piece 212 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the longitudinal plane 211 and the long axis of the butt - end piece 212 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the longitudinal plane 211 and the long axis of the butt - end piece 212 is approximately 45 degrees . separation of the butt - end piece 201 along the longitudinal plane 211 divides the aitch bone 240 into a first aitch bone piece 241 and a second aitch bone piece 242 . in an embodiment of the invention , the weights of the first aitch bone piece 241 and the second aitch bone piece 242 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. separation of the butt - end piece 201 along the longitudinal plane 211 also divides the butt - end piece of the femur 231 into a first butt - end piece of the femur 233 and a second butt - end piece of the femur 234 . in an embodiment of the invention , the weights of the first butt - end piece of the femur 233 and the second butt - end piece of the femur 234 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring now to fig2 c , 2 f and 2 g , pieces of a sbo ham may be made according to an exemplary embodiment of the invention by separating the shank - end piece 202 . the shank - end piece 202 may be separated along a first longitudinal plane 213 or a second longitudinal plane 214 , resulting in a first piece 203 and a second piece 204 . the plane along which the separation is made is substantially perpendicular to the cut face of the shank - end piece 202 . according to an embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 215 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 215 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the plane along which the separation is made and the long axis of the shank - end piece 215 is approximately 45 degrees . according to another exemplary embodiment of the present invention , the shank - end piece 202 may instead be separated substantially along the long axis of the shank piece 215 . whether the shank - end piece 202 is separated along the first longitudinal plane 213 , the second longitudinal plane 214 , or the long axis 215 of the shank piece , separation of the shank - end piece 202 divides the shank - end piece of the femur 232 into a first shank - end piece of the femur 235 and a second shank - end piece of the femur 236 . in an embodiment of the invention , the weights of the first shank - end piece of the femur 235 and the second shank - end piece of the femur 236 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig2 d , 2 e , 2 f , and 2 g , a sbo ham is shown divided into four pieces according to an exemplary embodiment of the invention . in an embodiment of the invention , in the pieces made from a single ham the weights of the heaviest and the lightest pieces differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in another embodiment of the invention , in the pieces made from a single ham the total weight of bone in the piece having the most bone and the piece having the least bone differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in yet another embodiment of the invention , in the pieces made from a single ham the ratio of meat to bone in the piece having the highest ratio of meat - to - bone and the piece having the lowest ratio of meat - to - bone would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig3 a , a short - shank ham is shown according to an exemplary embodiment of the present invention . a person of ordinary skill in the art recognizes that the short - shank ham 300 is not drawn to scale and may have any configuration of the bones contained therein , as known to one of ordinary skill in the art . short - shank ham 300 typically comprises three bones : a shank bone 370 , a femur bone 330 , and an aitch bone 340 . the aitch bone 340 is positioned substantially at the butt end 350 of the short - shank ham 300 . the shank bone 370 extends substantially from a shank tip 360 of the short - shank ham 300 to the femur bone 330 , which is positioned at a different angle from the shank bone 370 . at the butt end 350 of the short - shank ham 300 , the femur bone 330 is proximate to the aitch bone 340 . in an exemplary embodiment of the present invention , the short - shank ham may be spirally - sliced 320 substantially the length of the short - shank ham 300 and substantially centered about the femur bone 330 . a short - shank ham 300 may be separated along a transverse plane 310 , resulting in a butt - end piece 301 and a shank - end piece 302 . referring also to fig3 b and 3 c , shown are views of the cut faces of the butt - end piece 301 and shank - end piece 302 , respectively , according to an exemplary embodiment of the present invention . referring also to fig3 f , shown is a side view of shank - end piece 302 . the aitch bone 340 and shank bone 370 are shown crosshatched to indicate that they are inside the meat and thus would not be visible on the cut faces . a separation along the transverse plane 310 separates the femur bone 330 into the butt - end piece of the femur 331 and the shank - end piece of the femur 332 . in an exemplary embodiment of the present invention , the ham may be spirally sliced and the separation along transverse plane 310 may separate a short - shank ham 300 between spiral slices 320 . in another exemplary embodiment of the invention , a ham that is not spirally sliced may be separated along the transverse plane 310 . in an embodiment of the invention , the butt - end piece 301 comprises approximately 55 % to 75 % by weight of the short - shank ham 300 . in another embodiment of the invention , the butt - end piece 301 comprises approximately 60 % to 70 % by weight of the short - shank ham 300 . in yet another embodiment of the invention , the butt - end piece 301 comprises approximately 63 % to 67 % by weight of the short - shank ham 300 . in still another embodiment of the invention , the butt - end piece 301 comprises approximately 65 % by weight of the short - shank ham 300 . referring now to fig3 b , 3 d and 3 e , pieces of a short - shank ham may be made according to an exemplary embodiment of the invention by separating the butt - end piece 301 . the butt - end piece 301 may be separated along the longitudinal plane 311 , resulting in a first piece 303 and a second piece 304 . the separation along longitudinal plane 311 is made such that the aitch bone is divided into pieces of substantially equal weight . the longitudinal plane 311 is substantially perpendicular to the cut face of the butt - end piece 301 . according to an embodiment of the invention , the angle between the longitudinal plane 311 and the long axis of the butt - end piece 312 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the longitudinal plane 311 and the long axis of the butt - end piece 312 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the longitudinal plane 311 and the long axis of the butt - end piece 312 is approximately 45 degrees . separation of the butt - end piece 301 along the longitudinal plane 311 divides the aitch bone 340 into a first aitch bone piece 341 and a second aitch bone piece 342 . in an embodiment of the invention , the weights of the first aitch bone piece 341 and the second aitch bone piece 342 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. separation of the butt - end piece 301 along the longitudinal plane 311 also divides the butt - end piece of the femur 331 into a first butt - end piece of the femur 333 and a second butt - end piece of the femur 334 . in an embodiment of the invention , the weights of the first butt - end piece of the femur 333 and the second butt - end piece of the femur 334 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig3 d , 3 e , and 3 f , a short - shank ham is shown divided into three pieces according to an exemplary embodiment of the invention . in an embodiment of the invention , in the pieces made from a single ham the weights of the heaviest and the lightest pieces differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in another embodiment of the invention , in the pieces made from a single ham the total weight of bone in the piece having the most bone and the piece having the least bone differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in yet another embodiment of the invention , in the pieces made from a single ham the ratio of meat to bone in the piece having the highest ratio of meat - to - bone and the piece having the lowest ratio of meat - to - bone would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig4 a , a shank bone out ( sbo ) ham is shown according to an exemplary embodiment of the present invention . a person of ordinary skill in the art recognizes that the sbo ham 400 is not drawn to scale and may have any configuration of the bones contained therein , as known to one of ordinary skill in the art . sbo ham 400 typically comprises two bones : a femur bone 430 , and an aitch bone 440 . the aitch bone 440 is positioned substantially at the butt end 450 of the sbo ham 400 . at the butt end 450 of the sbo ham 400 , the femur bone 430 is proximate to the aitch bone 440 . in an exemplary embodiment of the present invention , the sbo ham may be spirally - sliced 420 substantially the length of the sbo ham 400 and substantially centered about the femur bone 430 . a sbo ham 400 may be separated along a transverse plane 410 , resulting in a butt - end piece 401 and a shank - end piece 402 . referring also to fig4 b and 4 c , shown are views of the cut faces of the butt - end piece 401 and shank - end piece 402 , respectively , according to an exemplary embodiment of the present invention . referring also to fig4 f , shown is a side view of shank - end piece 402 . the aitch bone 440 is shown crosshatched to indicate that it is inside the meat and thus would not be visible on the cut face . a separation along the transverse plane 410 separates the femur bone 430 into the butt - end piece of the femur 431 and the shank - end piece of the femur 432 . in an exemplary embodiment of the present invention , the ham may be spirally sliced and the separation along transverse plane 410 may separate a sbo ham 400 between spiral slices 420 . in another exemplary embodiment of the invention , a ham that is not spirally sliced may be separated along the transverse plane 410 . in an embodiment of the invention , the butt - end piece 401 comprises approximately 35 % to 55 % by weight of the sbo ham 400 . in another embodiment of the invention , the butt - end piece 401 comprises approximately 40 % to 50 % by weight of the sbo ham 400 . in yet another embodiment of the invention , the butt - end piece 401 comprises approximately 43 % to 47 % by weight of the sbo ham 400 . in still another embodiment of the invention , the butt - end piece 401 comprises approximately 45 % by weight of the sbo ham 400 . referring now to fig4 b , 4 d and 4 e , pieces of a sbo ham may be made according to an exemplary embodiment of the invention by separating the butt - end piece 401 . the butt - end piece 401 may be separated along the longitudinal plane 411 , resulting in a first piece 403 and a second piece 404 . the separation along longitudinal plane 411 is made such that the aitch bone is divided into pieces of substantially equal weight . the longitudinal plane 411 is substantially perpendicular to the cut face of the butt - end piece 401 . according to an embodiment of the invention , the angle between the longitudinal plane 411 and the long axis of the butt - end piece 412 is between approximately 40 degrees and approximately 50 degrees . according to another embodiment of the invention , the angle between the longitudinal plane 411 and the long axis of the butt - end piece 412 is between approximately 43 degrees and approximately 47 degrees . according to yet another embodiment of the invention , the angle between the longitudinal plane 411 and the long axis of the butt - end piece 412 is approximately 45 degrees . separation of the butt - end piece 401 along the longitudinal plane 411 divides the aitch bone 440 into a first aitch bone piece 441 and a second aitch bone piece 442 . in an embodiment of the invention , the weights of the first aitch bone piece 441 and the second aitch bone piece 442 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. separation of the butt - end piece 401 along the longitudinal plane 411 also divides the butt - end piece of the femur 431 into a first butt - end piece of the femur 433 and a second butt - end piece of the femur 434 . in an embodiment of the invention , the weights of the first butt - end piece of the femur 433 and the second butt - end piece of the femur 434 would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. referring to fig4 d , 4 e , and 4 f , a sbo ham is shown divided into three pieces according to an exemplary embodiment of the invention . in an embodiment of the invention , in the pieces made from a single ham the weights of the heaviest and the lightest pieces differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. in yet another embodiment of the invention , in the pieces made from a single ham the ratio of meat to bone in the piece having the highest ratio of meat - to - bone and the piece having the lowest ratio of meat - to - bone would differ , for example , by less than approximately 25 %, or in another embodiment by less than approximately 20 %, or in another embodiment by less than approximately 15 %, or in another embodiment by less than approximately 10 %, or in yet another embodiment by less than approximately 5 %, and in still another embodiment by less than approximately 1 %. the invention is not limited to making separations in any particular order . for example , without intention to be limited thereto , the present invention contemplates spiral slicing before or after separating a ham into pieces , or making the separations that divide the femur longitudinally before or after making the separations that divide the femur transversely . in an exemplary embodiment , the bone - in ham 100 , 200 , 300 , 400 is spirally - sliced substantially about the femur bone 130 , 230 , 330 , 430 . methods for spiral - slicing bone - in hams are known to one of ordinary skill in the art . for example , the bone - in ham 100 , 200 , 300 , 400 can be spirally - sliced according to the methods disclosed in u . s . pat . nos . 2 , 470 , 078 and 2 , 599 , 328 to hoenselaar , which are hereby incorporated by reference in their entirety . the spiral - sliced meat of the bone - in ham 100 , 200 , 300 , 400 can extend up to the femur bone 130 , 230 , 330 , 430 , substantially near the femur bone 130 , 230 , 330 , 430 , or any distance from the femur bone 130 , 230 , 330 , 430 . the spiral slicing can extend from one end of the bone - in ham 100 , 200 , 300 , 400 to the other end , or any variation of length and configuration therebetween . separating portions of the bone - in ham along the longitudinal or transverse planes can be accomplished by any means known to one of ordinary skill in the art . in an embodiment of the invention , separating is performed by cutting with a serrated instrument . in another embodiment of the invention , a bone - in ham can be cut with any suitable instrument such as a knife , saw , bandsaw , table saw , blade , or other cutting instruments , or combinations thereof . in another embodiment of the invention , each of the cuts may be made with a different instrument or a different type of instrument , or one or more of the cuts may be made using the same instrument or same type of instrument . although this description uses the term “ quarter ,” it is not intended to be limited to an exact quarter portion of a bone - in ham . in fact , the term is used to reflect that an approximate half of a bone - in ham has been further separated in approximately half . if each approximate half were separated substantially in half , then four substantial quarters are produced . similarly , although this description uses the term “ third ,” it is not intended to be limited to an exact third portion of a bone - in ham . in fact , the term is used to reflect that a bone - in ham has been separated into an approximate two - thirds and an approximate one - third . if the approximate two - thirds was separated substantially in half , then three substantial thirds are produced . the embodiments described above are intended to be exemplary . one skilled in the art recognizes that numerous alternative components and embodiments that may be substituted for the particular examples described herein and still fall within the scope of the invention .

US-201113290540-A

systems and methods to encourage a patient to use an incentive spirometer device according to the schedule prescribed by a clinician are described . the systems and methods for a clinician - programmable is device that can automatically monitor patient usage , and , in the event of non - compliance , effect an automatic shutdown of an entertainment device , such as a television in the patient &# 39 ; s room . the programmable is device can provide feedback to the patient when the device is used properly , warnings when the device is under - utilized , and can also save information regarding is usage history to a storage medium for later review and analysis .

the following description is directed to systems and methods for increasing patient compliance in the use of prescribed is devices . patients are motivated to comply by the negative consequence of loss of entertainment ( e . g ., television viewing ) when the is device is not used according to physician orders . in the following detailed description , reference is made to the accompanying drawings which form a part hereof , and in which are shown by way of illustration embodiments that may be practiced . it is to be understood that other embodiments may be utilized and structural or logical changes may be made without departing from the scope . therefore , the following detailed description is not to be taken in a limiting sense , and the scope of embodiments is defined by the appended claims and their equivalents . the description may use the terms “ embodiment ” or “ embodiments ,” which may each refer to one or more of the same or different embodiments . as will be understood by one of ordinary skill in the art , each embodiment disclosed herein can comprise , consist essentially of or consist of its particular stated element , step , ingredient or component . thus , the terms “ include ” or “ including ” should be interpreted to recite : “ comprise , consist of , or consist essentially of .” the transition term “ comprise ” or “ comprises ” means includes , but is not limited to , and allows for the inclusion of unspecified elements , steps , ingredients , or components , even in major amounts . the transitional phrase “ consisting of ” excludes any element , step , ingredient or component not specified . the transition phrase “ consisting essentially of ” limits the scope of the embodiment to the specified elements , steps , ingredients or components and to those that do not materially affect the embodiment . a material effect would cause a statistically - significant reduction in improved patient compliance as described herein . the terms “ coupled ” and “ connected ,” along with their derivatives , may be used . it should be understood that these terms are not intended as synonyms for each other . rather , in particular embodiments , “ connected ” may be used to indicate that two or more elements are in direct physical or electrical contact with each other . “ coupled ” may mean that two or more elements are in direct physical or electrical contact . however , “ coupled ” may also mean that two or more elements are not in direct contact with each other , but yet still cooperate or interact with each other . as described previously , is devices are regularly prescribed as part of a postsurgical therapy regimen to promote the recovery of lung function and prevent postoperative complications such as atelectasis or pneumonia . disclosed herein are systems and methods to augment a standard is device so that patient usage of the is is monitored and a corrective action initiated in the event that the is goes unused or under - used for a given period of time . as disclosed herein , the corrective action entails the removal of patient access to a form of entertainment ( e . g ., television viewing , radio listening , drawn curtains for outside viewing ) as a means to motivate the patient to use said is device . fig1 shows an example of a standard disposable is device 100 that might be supplied to a patient recovering from surgery . as depicted , the is device 100 includes a main body 110 with handles 120 on the left and right sides , and an integrated graduated hollow cylindrical column 130 within which a float 140 is housed . an inhalation tube 150 is connected to the main body 110 of the is device . the float 140 can be made to rise within the graduated column 130 when the patient draws a breath through the inhalation tube 150 via a mouthpiece 160 connected to the tube 150 . the disclosed system , herein termed a “ telecentive spirometer ,” is incorporated into a standard is device such that the function of the is is augmented to include capabilities for monitoring device usage and for interrupting entertainment in the event that the device is not being used as prescribed . fig2 shows a schematic embodiment of a telecentive spirometer system 200 , wherein an airflow detection component 210 is connected in - line with the inhalation tube of an is device ( for instance , between the inhalation tube 150 and the main body 110 of a standard is device 100 , or between the mouthpiece 160 and the inhalation tube 150 ). the airflow detection component 210 includes components capable of transducing inhalation - induced air flow into an electrical signal that is detectable by a microcontroller 220 or other circuitry acting as a processing unit that has been programmed to monitor output signals from the airflow detection component 210 . the microcontroller 220 also contains functionality to track , for example , the quality of an inhalation effort or the number of ‘ good ’ inhalations over a given time interval , and output a signal to a status / warning indicator 240 to alert the patient that a given amount of time has elapsed . the microcontroller can also be accessed through a programming interface 225 to allow a clinician to specify program parameters ( e . g ., number of inhalations to be performed by the patient over a given length of time ). this programming interface 225 can also allow access to parameters governing the detection and analysis of signals received from the airflow detection component 220 , so that device sensitivity can be adjusted to ensure proper detection of device usage events ( for example , one might adjust threshold values associated with signal amplitude and signal duration to specify requirements for an inhalation event to qualify as ‘ good ’ and , therefore , be counted as a use of the device ). in particular embodiments , this programming interface can include physical input components on the device 200 such as switches , dials , buttons , touchscreen interfaces , and keypads . in particular embodiments , the programming interface can include access to the microcontroller 220 through a wired or wireless connection to a device having a user interface , for example , a computer , a tablet , a remote control , or a mobile computing device such as a mobile telephone . the microcontroller 220 further contains functionality to pass signals to one or more communication modules 230 configured to particular embodiments , this communication module 230 is designed to convey a shut - off instruction to an entertainment modality shutoff unit 250 configured to accept such instruction . in particular embodiments the communication module 230 can be designed to convey patient usage data to a data storage unit 260 for archival purposes or for further processing and analysis . this data storage unit 260 can be physically integrated into the telecentive spirometer device or exist separately and configured to receive data through the communication module 220 . examples of patient usage data include the time history of signals from the airflow detection component 210 , time - stamped event data , number and durations of inhalations within a given time period , summary statistics of device usage , or other relevant data . in particular embodiments , the type of patient usage data to be output from the system 200 and the destination for that data can be specified though a programming interface 225 so that the type of output data may be tailored to clinician or patient needs . in particular embodiments the airflow detection component 210 includes any suitable device for measuring air flow within a tube and transducing that measurement into an electrical signal . examples of such devices include anemometer - based devices which measure temperature change or heat transfer from an electrically heated wire , or a turbine - based device configured to detect the number of revolutions per unit time under flow conditions ( e . g ., using an optoelectronic counter to detect light interruptions at each turn of the turbine blades ). alternatively , the airflow detection component 210 includes a device that induces a pressure change across a given axial length during air flow in combination with another component capable of detecting and transducing said pressure change into an electrical signal . in particular embodiments described below , such a pressure - based airflow detection system may be implemented by connecting the ports of a differential pressure sensor to the pressure taps of a venturi tube placed in - line with the inhalation airflow path . further examples of pressure - based flow detection systems include fleish and lilly pneumotachometers , wherein an element with known fixed resistance is placed in the flow path to produce a pressure drop across said element that is proportional to flow velocity . in particular embodiments , the entertainment shutoff procedure is enacted by the microcontroller 220 component first analyzing the time history of the spirometer usage ( e . g ., by a timer function ), and then , if necessary , sending an appropriate shutoff signal to the entertainment shutoff unit 250 via a communication module 230 . in particular embodiments , the communication of this signal can be implemented using a hardwire connection , for example , between the telecentive spirometer &# 39 ; s communication module 230 and an entertainment modality remote control or to a separate entertainment modality shutoff unit . in addition , wireless methods can be used by the communication module 230 to convey shutoff signals from the telecentive spirometer system . examples of such wireless signal protocols include radio frequency signals , infrared signals , bluetooth , and wifi - based protocols , including those used in home - automation systems . in particular embodiments , shutoff signals can be sent directly to the entertainment modality , to a remote control associated with the entertainment modality , or to an intermediate device capable of disrupting operation of the entertainment modality ( e . g ., by disrupting the power to the entertainment modality or disrupting the entertainment modality signal ). in particular embodiments described below , the bluetooth wireless communication protocol is used to transmit a shutoff signal to a relay switch - based device which resides between the entertainment modality and the wall power outlet , enabling a method to physically interrupt and restore power to the television based on spirometer usage . prior to sending a shutoff signal , the microcontroller 220 can also be configured , in particular embodiments , to provide a reminder to the patient to use the is through a status / warning indicator 240 subsystem . this patient reminder system can be implemented as hardware integrated into the telecentive spirometer , for example , as an indicator light , a multicolor led , a countdown timer , or a speaker capable of emitting a warning sound . alternatively , the status / warning indicator 240 can be configured to communicate with an external device to provide a reminder to the patient to use the is . examples of such communication can include a message displayed on the television , a text message sent to a cellphone , or other appropriate notification . it is to be understood that the configurations and / or approaches described herein are exemplary in nature , and that these specific embodiments or examples are not to be considered in a limiting sense , because numerous variations are possible . the subject matter of the present disclosure includes all novel and nonobvious combinations and subcombinations of the various processes , systems and configurations , and other features , functions , acts , and / or properties disclosed herein , as well as any and all equivalents thereof . the following examples are illustrative of the disclosed systems and methods . in light of this disclosure , those skilled in the art will recognize that variations of these examples and other examples of the disclosed systems and method would be possible without undue experimentation . an example embodiment of a telecentive spirometer is disclosed below . briefly , the design utilizes a venturi tube connected in - line with the inhalation tube of the is to induce a pressure differential during a sustained inhalation effort . an electronic differential pressure sensor attached across the ports of the venturi tube transduces airflow into an electrical signal which is sent to a microcontroller . two bluetooth modules are incorporated into the design : one to communicate with a cell phone device , and a second to communicate with a television shutoff unit . the shutoff unit is a standalone component that resides between an electrical wall outlet and the television . the shutoff unit houses a circuit including a relay switch , a microcontroller , and a bluetooth module configured to either disrupt or restore electrical connection to the wall outlet . the system is programmed to monitor device usage ( i . e ., inhalation effort by the patient ) and if the spirometer device is not used within a given period of time ( e . g ., at nine minutes ), emit a warning beep . after an additional period of time ( e . g ., at ten minutes ), the system shuts off the television . telecentive spirometer system architecture . fig3 shows a system diagram for a prototype telecentive spirometer described herein . a differential pressure sensor ( mpxz7007dp - nd ) receives two pressure inputs from a custom - fabricated venturi tube ( see below ) and transduces the differential pressure into a voltage signal and passes that signal to a microcontroller . in the prototype described herein , the atxmega64a4u microcontroller was chosen specifically for its advanced adc ( analog - to - digital converter ) features , multiple timer capability , gpio ( general - purpose input / output ) functionality , and the multiple usarts ( universal synchronous asynchronous receiver transmitters ) that are available to communicate with multiple bluetooth modules . the microcontroller is responsible for taking samples of the input from the differential pressure sensor and converting them to digital signals via the adc . the microcontroller is also responsible for sending rs - 232 signals to the bluetooth modules . lastly , the microcontroller provides output to the status and timer led . venturi tube for airflow detection . fig4 a - 4c show an example of a venturi tube that was custom fabricated for inline placement with the inhalation tube of the spirometer . as shown in the computer - aided - design models of fig4 a and fig4 b , the venturi tube was designed to accommodate two pressure ports for connection to the mpxz7007dp - nd differential pressure sensor . fig4 c shows a picture of the fabricated venturi tube inserted into one end of the spirometer inhalation tube . status and timer led . the microcontroller drives one multicolored led to visually inform the patient of the status of the unit . the led also provides visual warnings of when to use the spirometer , as well as an indication if the use was a good use or a bad use . in the prototype describe herein , six separate led states were programmed to provide feedback to the patient . a brief description of these states is provided in table 1 . software architecture . a state machine approach was adopted to program the microcontroller functions for the prototype described herein . fig5 shows the state diagram used in the disclosed prototype . briefly , the main software loop instantiates the data structures and creates pointers to these structures . a watchdog timer is also evaluated . the watchdog signal is sent to the shutoff unit every two seconds . this ensures that if power is removed from the main spirometer unit , the watchdog will fail , and the shutoff unit will remove power from the television . after evaluating the watchdog timer , the state machine will be updated and actions will be performed based on the state . the seven states depicted in fig5 are described below . initialization state . the initialization state configures peripherals and prepares the spirometer for use by performing a number of actions as shown in the flowchart of fig6 . these action include enabling the system clock and interrupts , and initializing timers associated with television shutoff , spirometer “ in use ,” and watchdog timer . the adc , usart , and gpio functions of the microcontroller are configured and enabled to accept input from the differential pressure sensor , communicate with the bluetooth modules , and receive inputs from the spirometer mode switch , respectively . finally , a function is called to calibrate the differential pressure sensor and the led status is initialized to green . after initialization is complete , the state is changed to the idle state . idle state . fig7 shows a flowchart of the idle state of operation . the idle state evaluates whether the spirometer mode switch has changed . if so , the use parameters are changed accordingly . the idle state also monitors the adc to determine if the patient is using the spirometer . the status led is updated in the idle state to inform the patient of 5 minutes ( led blinking yellow ) and 1 minute ( led blinking red ) remaining to complete the required spirometer usage before power is removed from the television . measure inhalation state . fig8 shows a flowchart of the measure inhalation state . this state is active if the input from the dp sensor has exceeded the threshold set to determine if the spirometer is in use . the adc is continuously monitored in this state while the patient is inhaling . if the patient meets the minimum requirement of a successful inhalation ( e . g ., inhalation for greater that 0 . 5 seconds ) then a flag is set marking the use as a good inhalation . the led is turned off during the measure inhalation state . evaluate inhalation state . fig9 shows a flowchart of the evaluate inhalation state . this state will inform the patient if the spirometer use has met the minimum requirement . the led will blink green 5 × if the use was sufficient and blink red 5 × if the use was not sufficient . if the use was sufficient , a signal will be sent through bluetooth to turn on power to the television . send data state . this state follows the evaluate inhalation state and is used send inhalation data to bluetooth module # 2 . this allows a device that is paired with bluetooth module # 2 ( e . g ., a computer , cell phone , storage device ) to collect inhalation data . fig1 shows a flowchart of the evaluate use state . this state will evaluate if the minimum uses per prescribed time interval have been completed . if so , the timers and counters will be reset to restart the evaluation of use period . if the minimum spirometer uses have not been completed , the signal to shut off the television will be sent through bluetooth to the shutoff unit , and the timeout error flag will be set . error state . fig1 shows a flowchart of the error state . the error state will update the led to either solid yellow ( adc error ) or solid red ( timeout error ). the only way to transition out of the error state is to successfully perform a spirometer inhalation . when the patient attempts to the use the spirometer , the timeout error will be set to a retry error value . this allows the software to transition through the necessary states in order to measure an inhalation , and still remain in an error state if the inhalation does not meet the minimum time requirement for a good inhalation effort ( e . g ., inhalation for 0 . 5 seconds ). shutoff unit hardware design . a prototype bluetooth - controlled shutoff unit was designed to work with the telecentive spirometer to turn off a patient &# 39 ; s television when the required breaths from the spirometer are not met . fig1 shows a block diagram of this prototype shutoff unit . as depicted , a three - prong male plug from a 120 vac wall outlet is connected to the shutoff enclosure . inside the enclosure , the 120 vac line is split to supply power for the control circuitry and to the relay switch . the 120 vac voltage is stepped down to 6 vac for the control circuitry and converted to direct current ( i . e ., 6 vdc ). this voltage is further split to supply the power requirements of the relay circuit , bluetooth module , and microcontroller . in order to actually turn off the television , a bluetooth signal is sent to the shutoff unit , received by the bluetooth module in the shutoff unit , and then the information is sent through transmit and receive signals ( tx / rx ) to the microcontroller . the microcontroller sends the “ turn on ” or “ shut off ” signals through a control input signal to the relay . the output side of the relay has a 120 vac line exiting the casing of the shutoff unit , and terminating in a three - prong female plug for the television . shutoff unit software design . a flowchart of the code used to program the microcontroller for the shutoff unit is shown in fig1 . the algorithm for the code starts by setting the control signal for the relay low ( television off ) to ensure the user uses the spirometer device before the television turns on , and the internal timer is initialized to 0 . the code then goes into a continuous loop . in the loop , the microprocessor first checks to see if the timer is greater than 10 seconds . if this is true , the control input to the relay is set low ( television off ) and the timer is reset . the timer is used to ensure that a patient does not turn off the main telecentive spirometer unit to avoid the television turning off . if the user does turn off the main unit , the television shuts off after 10 seconds . if the timer is less than 10 seconds , the usart rx bit is checked for a complete received character . if this statement is false , the microprocessor starts the loop over . if the statement is true and a bluetooth character has been sent , the character is stored in a variable called received byte . if the received byte is the character ‘ 1 ’, the control signal for the relay is set high ( television on ) otherwise a second check is performed . if the received byte contains the character ‘ 2 ’, the control signal for the relay is set low ( television off ). if a character has been sent but it is not a ‘ 1 ’ or ‘ 2 ’, this means a watchdog signal was sent to confirm the main unit and shutoff unit are connected . if any of the three characters are sent , the internal timer is reset before returning to the top of the loop .

US-201715481258-A

a method for the prophylaxis or treatment of infectious diseases caused by helicobacter pyloir , by administering a pharmacologically effective amount of a 1 - methoylcarbapenem coumpund of formula or a pharmacologically acceptable salt or ester thereof : r 1 represents a group of the following formula : r 2 is a hydrogen atom or a c 1 - c 6 alkyl group , and r 3 is a hydrogen atom or a c 1 - c 6 alkyl group .

in the above formula ( i ), examples of the c 1 - c 6 alkyl group of r 2 or r 3 include methyl , ethyl , propyl , isopropyl , butyl , isobutyl , s - butyl t - butyl , pentyl and hexyl groups , preferably the c 1 - c 4 alkyl groups , more preferably the methyl or ethyl group and most preferably the methyl group . the oxopyrrolidinyl part of the group of the formula ( la ) is preferably a 2 - oxo - 3 - pyrrolidinyl or 2 - oxo - 4 - pyrolidinyl group and most preferably the 2 - oxo4 - pyrrolidinyl group . the thioxopyrrolidinyl part of the group of the formula ( iid ) is preferably a 2 - thioxo - 3 - pyrrolidinyl or 2 - thioxo - 4 - pyrrolidinyl group , and most preferably the 2 - thioxo4 - pyrrolidinyl group . the pharmacologically acceptable salts of compound ( i ) which are also an active ingredient of the present invention are salts of compound ( i ) which exhibit antibacterial activity and are usable as a medicament when administered to a living body . examples include inorganic salts such as lithium salts , sodium salts , potassium salts , calcium salts and magnesium salts ; ammonium salts ; and organic amine salts such as triethylamine salts , diisopropylamine salts and cyclohexylamine salts ; preferably lithium salts , sodium salts and potassium salts ; more preferably sodium salts and potassium salts ; and most preferably sodium salts . the pharmacologically acceptable esters of compound ( i ) which are also an active ingredient of the present invention are esters of the compound ( i ) which exhibit antibacterial activity and are usable as a medicament when administered to a living body ; and preferably esters which can be hydrolyzed in vivo and converted to the corresponding carboxylic acids . specific examples include : c 1 - c 4 alkyl esters ( preferably , methyl and ethyl esters ), c 1 - c 4 alkoxycarbonyloxy -( c 1 - c 4 alkyl ) esters [ for example , methoxycarbonyloxymethyl esters , 1 -( methoxycarbonyloxy ) ethyl esters , ethoxycarbonyloxymethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , propoxycarbonyloxymethyl esters , 1 -( propoxycarbonyloxy ) ethyl esters , isopropoxycarbonyloxymethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , butoxycarbonyloxymethyl esters , 1 -( butoxycarbonyloxy ) ethyl esters , isobutoxycarbonyloxymethyl esters , 1 -( isobutoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters , 1 -( t - butoxycarbonyloxy ) ethyl esters , 1 -( t - butoxycarboyloxy ) propyl esters and 1 -( t - butoxycarbonyloxy ) butyl esters , of which the methoxycarbonyloxymethyl esters , 1 -( methoxycarbonyloxy ) ethyl esters , ethoxycarbonyloxymethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , isopropoxycarbonyloxymethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters or 1 -( t - butoxycarbonyloxy ) ethyl esters are preferred , the 1 -( methoxycarbonyloxy ) ethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters and 1 -( t - butoxycarbonyloxy ) ethyl esters being more preferred and the 1 -( isopropoxycarbonyloxy ) ethyl esters being most preferred ], c 5 - c 6 cycloalkyloxycarbonyloxy -( c 1 - c 4 alkyl ) esters [ for example , cyclopentyloxycarbonyloxymethyl esters , 1 -( cyclopentyloxycarbonyloxy ) ethyl esters , cyclohexyloxycarbonyloxymethyl esters , 1 -( cyclohexyloxycarbonyloxy ) ethyl esters , 1 -( cyclohexyloxycarbonyloxy ) propyl esters and 1 -( cyclohexyloxycarbonyloxy ) butyl esters , of which the cyclopentyloxycarbonyloxymethyl esters , 1 -( cyclopentyloxycarbonyloxy ) ethyl esters , cyclohexyloxycarbonyloxymethyl esters and 1 -( cyclohexyloxycarbonyloxy ) ethyl esters are preferred , the 1 -( cyclopentyloxycarbonyloxy ) ethyl esters and 1 -( cyclohexyloxycarbonyloxy ) ethyl esters being more preferred , and the 1 -( cyclohexyloxycarbonyloxy ) ethyl esters being most preferred ; c 2 - c 5 alkanoyloxy -( c 1 - c 4 alkyl ) esters [ for example , acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , 1 -( acetoxy ) propyl esters , 1 -( acetoxy ) butyl esters , propionyloxymethyl esters , 1 -( propionyloxy ) ethyl esters , butyryloxymethyl esters , 1 -( butyryloxy ) ethyl esters , isobutyryloxymethyl esters , 1 -( isobutyryloxy ) ethyl esters , 1 -( isobutyryloxy ) propyl esters , 1 -( isobutyryloxy ) butyl esters , pivaloyloxymethyl esters , 1 -( pivaloyloxy ) ethyl esters , 1 -( pivaloyloxy ) propyl ester and 1 -( pivaloyloxy ) butyl esters , of which the acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , propionyloxymethyl esters , 1 -( propionyloxy ) ethyl esters , butyryloxymethyl esters , 1 -( butyryloxy ) ethyl esters , isobutyryloxymethyl esters , 1 -( isobutyryloxy ) ethyl esters , pivaloyloxymethyl esters and 1 -( pivaloyloxy ) ethyl esters are preferred , the acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , isobutyryloxymethyl esters , 1 -( isobutyryloxy ) ethyl esters , pivaloyloxymethyl esters and 1 -( pivaloyloxy ) ethyl esters being more preferred , and the pivaloyloxymethyl esters being most preferred ]; ( c 5 - c 6 cycloalkylcarbonyloxy )- or ( 1 - alkyl - c 5 - c 6 cycloalkylcarbonyloxy )-( c 1 - c 4 alkyl ) esters [ for example , cyclopentylcarbonyloxymethyl esters , 1 -( cyclopentylcarbonyloxy ) ethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , 1 -( 1 - methylcyclopentylcarbonylxoy ) ethyl esters , 1 - ethylcyclopentylcarbonyl - oxymethyl esters , 1 ( 1 - ethylcyclopentylcarbonyloxy ) ethyl esters , cyclohexylcarbonyloxymethyl esters , 1 -( cyclohexylcarbonyloxy ) ethyl esters , 1 -( cyclohexylcarbonyloxy ) propyl esters , 1 -( cyclohexylcarbonyloxy ) butyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl esters , 1 -( 1 - methylcyclohexylcarbonyloxy ) propyl esters , 1 -( 1 - methylcyclohexylcarboyloxy ) butyl esters , 1 - ethylcyclohexylcarbonyloxymethyl esters , 1 -( 1 - ethylcyclohexylcarbonyloxy ) ethyl esters , 1 ( 1 - propylcyclohexylcarbonyloxymethyl esters and 1 - butylcyclohexylcarbonyloxymethyl esters , of which the cyclopentylcarbonyloxymethyl esters , 1 -( cyclopentylcarbonyloxy ) ethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , 1 -( 1 - methylcyclopentylcarbonyloxy ) ethyl esters , 1 - ethylcyclopentylcarbonyloxymethyl esters , cyclohexylcarbonyloxymethyl esters , 1 -( cyclohexylcarbonyloxy ) ethyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl esters and 1 - ethylcyclohexylcarbonyloxymethyl esters are preferred , the cyclopentylcarbonyloxymethyl esters , 1 -( cyclopentylcarbonyloxy ) ethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , 1 ( 1 - methylcyclopentylcarbonyloxy ) ethyl esters , cyclohexylcarbonyloxymethyl esters , 1 -( cyclohexylcarbonyloxy ) ethyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters and 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl esters being more preferred , the cyclopentylcarbonyloxymethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , cyclohexylcarbonyloxymethyl esters and 1 - methylcyclohexylcarbonyloxymethyl esters being much more preferred , and the 1 - methylcyclohexylcarbonyloxymethyl esters being most preferred ]; 5 -( c 1 - c 4 alkyl - or phenyl -)- 2 - oxo - 1 , 3 - dioxolen 4ylmethyl esters [ for example , 5 - methyl - 2 - oxo - 1 , 3 - dioxoleno - 4 - ylmethyl esters , 5 - ethyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters , 5 - propyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters , 5 - butyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters and 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters , of which the 5 - methyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl esters , 5 - ethyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters and 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl esters are preferred , the 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters and 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters being more preferred , and the 5 - methyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl esters being most preferred ]. among these esters , the methoxycarbonyloxymethyl esters , 1 -( methoxycarbonyloxy ) ethyl esters , ethoxycarbonyloxymethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , isopropoxycarbonyloxymethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters , 1 - butoxycarbonyloxy ) ethyl esters , cyclopentyloxycarbonyloxymethyl esters , 1 -( cyclopentyloxycarbonyloxy ) ethyl esters , cyclohexyloxycarbonyloxymethyl esters , 1 -( cyclohexyloxycarbonyloxy ) ethyl esters , acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , propionyloxymethyl esters , 1 -( propionyloxy ) ethyl esters , butyryloxymethyl esters , 1 -( butyryloxy ) ethyl esters , isobutyryloxymethyl esters , 1 -( isobutyryloxy ) ethyl esters , pivaloyloxymethyl esters , 1 -( pivaloyloxy ) ethyl esters , cyclopentylcarbonyloxymethyl esters , 1 -( cyclopentylcarbonyloxy ) ethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , 1 -( 1 - methylcyclopentylcarbonyloxy ) ethyl esters , 1 - ethylcyclopentylcarbonyloxymethyl esters , cyclohexylcarbonyloxymethyl esters , 1 -( cyclohexylcarbonyloxy ) ethyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl esters , 1 - ethylcyclohexylcarbonyloxymethyl esters , phthalidyl esters , 5 - methyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl esters , 5 - ethyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters and 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters are preferred ; the 1 -( methoxycarbonyloxy ) ethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters , 1 -( t - butoxycarbonyloxy ) ethyl esters , 1 -( cyclopentyloxycarbonyloxy ) ethyl esters , 1 -( cyclohexyloxycarbonyloxy ) ethyl esters , acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , isobutyryloxymethyl esters , 1 - isobutyryloxy ) ethyl esters , pivaloyloxymethyl esters , 1 -( pivaloyloxy ) ethyl esters , cyclopentylcarbonyloxymethyl esters , 1 -( cyclopentylcarbonyloxy ) ethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , 1 -( 1 - methylcyclopentylcarbonyloxy ) ethyl esters , cyclohexylcarbonyloxymethyl esters , 1 -( cyclohexylcarbonyloxy ) ethyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl esters , phthalidyl esters , 5 - methyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl esters and 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters are more preferred ; the 1 -( methoxycarbonyloxy ) ethyl esters , 1 -( ethoxycarbonyloxy ) ethyl esters , 1 -( isopropoxycarbonyloxy ) ethyl esters , t - butoxycarbonyloxymethyl esters , 1 -( t - butoxycarbonyloxy ) ethyl esters , 1 -( cyclopentyloxycarbonyloxy ) ethyl esters , 1 -( cyclohexyloxycarbonyloxy ) ethyl esters , acetoxymethyl esters , 1 -( acetoxy ) ethyl esters , isobutyryloxymethyl esters , 1 -( isobutyryloxy ) ethyl esters , pivaloyloxymethyl esters , 1 -( pivaloyloxy ) ethyl esters , cyclopentylcarbonyloxymethyl esters , 1 - methylcyclopentylcarbonyloxymethyl esters , cyclohexylcarbonyloxymethyl esters , 1 - methylcyclohexylcarbonyloxymethyl esters , phthalidyl esters and 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl esters are still more preferred ; the 1 -( isopropoxycarbonyloxy ) ethyl esters , 1 -( cyclohexyloxycarbonyloxy ) ethyl esters , pivaloyloxymethyl esters , 1 - methylcyclohexylcarboyloxymethyl esters and 5 - methyl - 2 - oxo - 1 , 3 - dioxolen 4ylmethyl esters are particularly preferred ; and compound ( i ) which is an active ingredient of the present invention contains asymmetric carbons in its molecule and therefore has various isomers with respect to them . the present application embraces various isomers of compound ( i ) and mixtures of these isomers , of which the isomers having a ( 1r , 5s , 6s ) configuration and an r configuration for the hydroxyl group at the α - position of the 6 - substituent in the carbapenem skeleton , are preferred . the present application also embraces hydrated products of compound ( i ) and its salts and esters . ( 1 ) a compound wherein r 1 represents a group of formula ( iia ) ( in which r 2 represents a hydrogen atom or a c 1 - c 4 alkyl group ), a group of formula ( iib ), a group of formula ( iic ) or a group of formula ( iid ) ( in which r 3 represents a hydrogen atom or a methyl group ), ( 2 ) a compound wherein r 1 represents a group of formula ( iia ) ( in which r 2 represents a hydrogen atom or a methyl group ), ( 3 ) a compound wherein r 1 represents a 2 - oxo - 3 - pyrrolidinyl , 1 - methyl - 2 - oxo - 3 - pyrrolidinyl , 2 - oxo - 4 - pyrrolidinyl or 1 - methyl - 2 - oxo4 - pyrrolidinyl group , ( 4 ) a compound wherein r 1 represents a 2 - oxo4 - pyrrolidinyl or 1 - methyl - 2 - oxo - 4 - pyrrolidinyl group , ( 6 ) a compound wherein the configuration in the carbapenem skeleton is a ( 1r , 5s , 6s ) configuration , ( 7 ) a compound wherein the configuration of the hydroxyl group at the α - position of the 6 - substituent in the carbapenem skeleton is a r configuration , ( 8 ) a compound whose pharmacologically acceptable salt is a lithium salt , sodium salt or potassium salt , ( 9 ) a compound whose pharmacologically acceptable salt is a sodium salt or potassium salt , ( 11 ) a compound whose pharmacologically acceptable ester can be hydrolyzed in vivo and converted into the corresponding carboxylic acid , ( 12 ) a compound whose pharmacologically acceptable ester is a 1 -( methoxycarbonyloxy ) ethyl ester , 1 -( ethoxycarbonyloxy ) ethyl ester , 1 -( isopropoxycarbonyloxy ) ethyl ester , t - butoxycarbonyloxymethyl ester , 1 -( t - butoxycarbonyloxy ) ethyl ester , 1 -( cyclopentyloxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , acetoxymethyl ester , 1 -( acetoxy ) ethyl ester , isobutyryloxymethyl ester , 1 -( isobutyryloxy ) ethyl ester , pivaloyloxymethyl ester , 1 -( pivaloyloxy ) ethyl ester , cyclopentylcarbonyloxymethyl ester , 1 -( cyclopentylcarbonyloxy ) ethyl ester , 1 - methylcyclopentylcarbonyloxymethyl ester , 1 -( 1 - methylcyclopentylcarbonyloxy ) ethyl ester , cyclohexylcarbonyloxymethyl ester , 1 -( cyclohexylcarbonyloxy ) ethyl ester , 1 - methylcyclohexylcarbonyloxymethyl ester , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl ester , phthalidyl ester , 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester or 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl ester , ( 13 ) a compound whose pharmacologically acceptable ester is a 1 -( methoxycarbonyloxy ) ethyl ester , 1 -( ethoxycarbonyloxy ) ethyl ester , 1 -( isopropoxycarbonyloxy ) ethyl ester , t - butoxycarbonyloxymethyl ester , 1 -( t - butoxycarbonyloxy ) ethyl ester , 1 -( cyclopentyloxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , acetoxymethyl ester , 1 -( acetoxy ) ethyl ester , isobutyryloxymethyl ester , 1 -( isobutyryloxy ) ethyl ester , pivaloyloxymethyl ester , 1 -( pivaloyloxy ) ethyl ester , cyclopentylcarbonyloxymethyl ester , 1 - methylcyclopentylcarbonyloxymethyl ester , cyclohexylcarbonyloxymethyl ester , 1 - methylcyclohexylcarboyloxymethyl ester , phthalidyl ester or 5 - methyl - 2 - oxo - 1 , 3 - dioxolen4 - ylmethyl ester , ( 14 ) a compound whose pharmacologically acceptable ester is a 1 -( isopropoxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , pivaloyloxymethyl ester , 1 - methylcyclohexylcarbonyloxymethyl ester or 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester , and ( 15 ) a compound whose pharmacologically acceptable ester is a 1 -( isopropoxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester or pivaloyloxymethyl ester . in each of the groups ( 1 ) to ( 5 ), ( 8 ) to ( 10 ) and ( 11 ) to ( 15 ), the larger the number is , the more preferred the compound is . in addition , compounds obtained by selecting r 1 from the group ( 1 ) to ( 5 ), a configuration from ( 6 ) or ( 7 ), a salt from the group ( 8 ) to ( 10 ) and an ester from the group ( 11 ) to ( 15 ) and by using these in any combination are preferred . examples of such compounds are as follows : ( 16 ) a compound wherein r 1 represents a group of formula ( ila ) ( in which r 2 represents a hydrogen atom or a c 1 - c 4 alkyl group ), group of formula ( iib ), group of formula ( iic ) or group of formula ( iid ) ( in which r 3 represents a hydrogen atom or a methyl group ), the configuration of the hydroxyl group at the α - position of the 6 - substituent in the carbapenem skeleton is a r configuration , the pharmacologically acceptable salt is a lithium salt , sodium salt or potassium salt , and the pharmacologically acceptable ester is one which can be hydrolyzed in vivo and converted into the corresponding carboxylic acid . ( 17 ) a compound wherein r 1 represents a group of formula ( iia ) ( in which r 2 represents a hydrogen atom or a methyl group ), the configuration of the hydroxyl group at the α - position of the 6 - substituent in the carbapenem skeleton is a r configuration , the pharmacologically acceptable salt is a sodium salt or potassium salt , and the pharmacologically acceptable ester is a 1 -( methoxycarbonyloxy ) ethyl ester , 1 -( ethoxycarbonyloxy ) ethyl ester , 1 -( isopropoxycarbonyloxy ) ethyl ester , t - butoxycarbonyloxymethyl ester , 1 -( t - butoxycarbonyloxy ) ethyl ester , 1 -( cyclopentyloxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , acetoxymethyl ester , 1 -( acetoxy ) ethyl ester , isobutyryloxymethyl ester , 1 -( isobutyryloxy ) ethyl ester , pivaloyloxymethyl ester , 1 -( pivaloyloxy ) ethyl ester , cyclopentylcarbonyloxymethyl ester , 1 -( cyclopentylcarbonyloxy ) ethyl ester , 1 - methylcyclopentylcarbonyloxymethyl ester , 1 -( 1 - methylcyclopentylcarbonyloxy ) ethyl ester , cyclohexylcarbonyloxymethyl ester , 1 -( cyclohexylcarbonyloxy ) ethyl ester , 1 - methylcyclohexylcarbonyloxymethyl ester , 1 -( 1 - methylcyclohexylcarbonyloxy ) ethyl ester , phthalidyl ester , 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester or 5 - phenyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester , ( 18 ) a compound wherein r 1 represents a 2 - oxo - 3 - pyrrolidinyl group , 1 - methyl - 2 - oxo - 3 - pyrrolidinyl group , 2 - oxo - 4 - pyrrolidinyl group or 1 - methyl - 2 - oxo - 4 - pyrrolidinyl group , the configuration of the hydroxyl group at the α - position of the 6 - substituent in the carbapenem skeleton is a r configuration , the pharmacologically acceptable salt is a sodium salt or potassium salt , and the pharmacologically acceptable ester is a 1 -( methoxycarbonyloxy ) ethyl ester , 1 -( ethoxycarbonyloxy ) ethyl ester , 1 -( isopropoxycarbonyloxy ) ethyl ester , t - butoxycarbonyloxymethyl ester , 1 -( t - butoxycarbonyloxy ) ethyl ester , 1 -( cyclopentyloxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , acetoxymethyl ester , 1 - acetoxy ) ethyl ester , isobutyryloxymethyl ester , 1 -( isobutyryloxy ) ethyl ester , pivaloyloxymethyl ester , 1 -( pivaloyloxy ) ethyl ester , cyclopentylcarbonyloxymethyl ester , 1 - methylcyclopentylcarbonyloxymethyl ester , cyclohexylcarbonyloxymethyl ester , 1 - methylcyclohexylcarboyloxymethyl ester , phthalidyl ester or 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester , ( 19 ) compounds wherein r 1 represents a 2 - oxo - 4 - pyrrolidinyl group or 1 - methyl - 2 - oxo - 4 - pyrrolidinyl group , the configuration of the hydroxyl group at the a - position of the 6 - substituent in the carbapenem skeleton is a r configuration , the pharmacologically acceptable salt is a sodium salt or potassium salt , and the pharmacologically acceptable ester is a 1 - isopropoxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester , pivaloyloxymethyl ester , 1 - methylcyclohexylcarbonyloxymethyl ester or 5 - methyl - 2 - oxo - 1 , 3 - dioxolen - 4 - ylmethyl ester , and the configuration of the hydroxyl group at the a - position of the 6 - substituent in the carbapenem skeleton is r a configuration , the pharmacologically acceptable ester is a 1 -( isopropoxycarbonyloxy ) ethyl ester , 1 -( cyclohexyloxycarbonyloxy ) ethyl ester or pivaloyloxymethyl ester . specific examples of the compounds represented by the formula ( i ) can be exemplified in table 1 . compounds ( i ), each of which is an active ingredient of the present invention , are known or can be prepared easily by a known method ( for example japanese patent application kokai no . hei 7 - 165759 , japanese patent application kokai no . hei 2 - 223587 , japanese patent application kokai no . hei 8 - 53453 , japanese patent application kokai no . hei 4 - 279588 , etc .). the 1 - methylcarbapenem derivatives of formula ( i ), active ingredients of the present invention , have excellent anti - bacterial activity against various helicobacter pylori and lower toxicity , and so they are useful as an anti - bacterial agent for the treatment or prevention ( particularly , treatment ) of infectious diseases caused by helicobacter pylori . when the compound ( i ) is used as an anti - bacterial agent , compound ( i ) by itself or a mixture with a pharmacologically acceptable excipient , diluent , etc ., can be administered orally in the form of tablets , capsules , granules , powders or syrups or parenterally in the form of injections . of these , oral administration is recommended . the above formulations can be prepared in a known manner by using additives . examples of the additives include an excipient ( for example sugar derivatives such as lactose , sucrose , dextrose , mannitol and sorbitol ; starch derivatives such as corn starch , potato starch , α - starch , dextrin and carboxymethyl starch ; cellulose derivatives such as crystalline cellulose , low - substituted hydroxypropyl cellulose , hydroxypropylmethyl cellulose , carboxymethyl cellulose , carboxymethyl cellulose calcium and internally - crosslinked carboxymethyl cellulose sodium ; gum arabic ; dextran ; pullulan ; silicate derivatives such as soft silicic acid anhydride , synthetic aluminum silicate and magnesium aluminate metasilicate ; phosphate derivatives such as calcium phosphate ; carbonate derivatives such as calcium carbonate ; and sulfate derivatives such as calcium sulfate ), a binder ( for example the above - exemplified excipients , gelatin , polyvinyl pyrrolidone and macrogol ), a disintegrator ( for example the above - exemplified excipients , chemically - modified starch or cellulose derivatives such as croscarmellose sodium , carboxymethyl starch sodium and crosslinked polyvinyl pyrrolidone ), a lubricant ( for example talc , stearic acid , metal salts of stearic acid such as calcium stearate and magnesium stearate ; colloidal silica ; waxes such as veegum and spermaceti ; boric acid ; glycol ; carboxylic acids such as fumaric acid and adipic acid ; sodium carboxylates such as sodium benzoate ; sulfates such as sodium sulfate ; leucine ; lauryl sulfates such as sodium lauryl sulfate and magnesium lauryl sulfate ; silicic acids such as silicic acid anhydride and silicic acid hydrate ; and the same starch derivatives as those exemplified for the excipient ), a stabilizer ( for example paraoxybenzoates such as methyl paraben and propyl paraben ; alcohols such as chlorobutanol benzyl alcohol and phenylethyl alcohol ; benzalkonium chloride ; phenol derivatives such as phenol and cresol ; thimerosal ; acetic anhydride ; and sorbic acid ), a corrigent ( for example , ordinarily - employed sweeteners , acidifiers and flavors ), a diluent and a solution - forming agent for injections ( for example , water , ethanol and glycerin ). the dose of compound ( i ) will vary depending upon the condition and age of the patient and the like . orally , it is administered in an amount of 30 mg ( preferably 50 mg ) in a single dose as a lower limit and 5000 mg ( preferably 300 mg ) in a single dose as an upper limit , and intravenously , it is administered in an amount of 10 mg ( preferably 30 mg ) in a single dose as a lower limit and 3000 mg ( preferably 200 mg ) in a single dose as an upper limit . it is desirable to be administered one to six times per day depending upon the conditions of the patient , i . e ., the person being treated . the anti - helicobacter pylori agent which contains compound ( i ) of the present invention as an active ingredient may contain one or more other medicaments in addition . any medicament that does not have adverse effects on compound ( i ) of the present invention can be used . examples include bismuth preparations ( such as bismuth citrate and bismuth salicylate ), nitroimidazole compounds ( such as metronidazole ), h 2 blocker type anti - ulcereratives ( such as cimetidine , ranitidine hydrochloride , famotidine , roxatidine acetate hydrochloride and nizatidine ), proton - pump inhibitor type anti - ulceratives ( such as omeprazole , lansoprazole , rabeprazole , reminoprazole and saviprazole ), mucous membrane protective factor enhancer type anti - ulceratives ( such as plaunotol , teprenone and sofalcone ), anti - bacterials ( such as clarithromycin , azithromycin , erythromycin , roxithromycin and amoxicillin ) and synthetic anti - bacterials ( such as ofloxacin , levofloxacin , ciprofloxacin ); preferably the bismuth preparations , nitroimidazole compounds , h 2 blocker type anti - ulceratives , proton - pump anti - ulceratives and mucous membrane protective factor enhancer type anti - ulceratives ; more preferably , cimetidine , ranitidine hydrochloride , famotidine , roxatidine acetate hydrochloride , nizatidine , omeprazole , lansoprazole , rabeprazole , reminoprazole and saviprazole ; and most preferably cimetidine , ranitidine hydrochloride , famotidine , omeprazole and lansoprazole . the present invention will hereinafter be described more specifically by tests and preparation examples . it should , however , be understood that the present invention is not limited by these examples . helicobacter pylori ( h . pylori ) from storage was smeared on a 7 %- equine - defibrinated - blood - added brain heart infusion agar ( bhia ) plate and cultured at 37 ° c . for 72 hours under microaerophilic and wet conditions . the colonies thus grown were picked and suspended in physiological saline to prepare a culture solution of 10 8 cfu / ml ( viable microbe cell number per ml ). the resulting culture solution was diluted to 10 to 50 - fold with physiological saline , and one spot ( about 10 μl ) of the solution was inoculated on each of medicament - containing and medicament - free bhia plates . each of the plates was cultured at 37 ° c . for 72 hours under microaerophilic and wet conditions and the minimum inhibitory concentration ( mic : μg / ml ) at which the growth of the colonies was inhibited was measured . the results are shown in table 2 . bacteria ( helicobacter pylori 9470 strain ) used for the test , which were cultured for 48 hours in a 2 %- fetal - calf - serum - added brucella broth , were centrifuged . after removal of the supernatant , the residue was re - suspended in a { fraction ( 1 / 10 )} amount of a brucella broth . the resulting suspended solution was orally administered to each of three to five nude mice in an amount of 1 . 5 ml per mouse . 10 days after the infection , administration of a medicament was started . a 0 . 5 % tragacanth suspension of a medicament was orally administered for 4 days through an oral catheter at a dose of 0 . 3 ml / mouse , once a day . on the day after the final administration , the stomach was extirpated , homogenized and then diluted . the viable microbe cell number ( cfu / stomach ) was measured and the results are shown in fig1 . in fig1 medicament a is a control group , medicaments b ( 1 ) and b ( 2 ) are cam ( clarithromycin : 1 mg / kg ) and cam ( 10 mg / kg ), respectively , and medicaments c ( 1 ) and c ( 2 ) are compound 4 , that is , pivaloyloxymethyl ( 1r , 5s , 6s )- 2 -[( 4r )- 2 - oxo - 4 - pyrrolidinylthio ]- 6 -[( 1r )- 1 - hydroxyethyl ]- 1 - methyl - 1 - carbapen - 2 - em - 3 - carboxylate ( 1 mg / kg ) and compound 4 ( 10 mg / kg ), respectively . the significant difference of medicament b ( 2 ), medicament c ( 1 ) or c ( 2 ) is p & lt ; 0 . 01 ( vs the control group ). the above - described ingredients in powdery form were mixed , shifted through a 60 - mesh sieve and used to fill a 250 - mg no . 3 gelatin capsule to give a capsule .

US-18768098-A

a device for organizing the administration of pills at predetermined time intervals , characterized in that it has a main body used as an individual tissue ring with an opening , through which tissues can be inserted , and that the main body includes at least one compartment , which can hold at least one pill , covered by at least one lid .

fig1 shows how the device 1 consists of a cylindrical main body 2 with an opening 3 into which a napkin may be inserted 9 . the main body 2 would ideally be equipped with an element of support 8 to ensure that the device 1 rests in a stable manner . it is not essential for purposes of this invention for the body 2 to be completely closed , nor for the main body 2 to be cylindrical . it is sufficient for the napkin to merely be securely held in place . it should also be mentioned that , for the purposes of this invention , it is irrelevant whether the napkin is made from cloth or a single - use material . fig2 and 3 show that the top of the main body 2 is equipped with three separate 5 , 5 ′, 5 ″ lids , each of which individually closes each compartment 4 , 4 ′, 4 ″, which is capable of holding at least one pill . alternatively , on a simpler version , the inner half of the main body 2 could be equipped with the same three compartments 4 , 4 ′, 4 ″ and the outer half of the main body 2 could slide over the inner half along the longitudinal axis of the main body 2 , serving as a lid for all three compartments . referring once again to the example shown in the figures , in this case , compartment 4 corresponds to breakfast , compartment 4 ′ corresponds to lunch , and finally , compartment 4 ″ corresponds to dinner . therefore , to organize the timed administration of pills , the user of the device 1 , whether a patient or a caregiver , need only be concerned with filling the device 1 in the morning before breakfast . when the patient sits down at the table , he will immediately associate the napkin 9 with the time to take the medication . this reduces the risk of forgetting to take a pill . the device 1 may also be optionally equipped with additional compartments for cases where the patient must take medication along with an afternoon snack . in addition , the device 1 shown in the figures includes a means of representing the patient 6 in the form of a screen 7 . the screen 7 is controlled electronically ( not shown ) and can be programmed , for example , through a usb - type input port 11 or any other standard input port to perform various functions . alternatively , the device 1 may be programmed using a selection button 12 to avoid having to connect the device to a computer . on the screen 7 , it is possible to display a photograph 10 of the user that identifies him in an unequivocal manner . the screen 7 may also be used to display alphanumeric messages , such as the person &# 39 ; s name , the time or reminders for the patient to take the medication corresponding to that particular time of day . likewise , the screen 7 can display a visual alarm activated by the electronic system when an internal clock has been programmed accordingly . optionally , the device 1 may include a means of providing a warning sound through a built - in speaker , which may also serve as an alarm . an optimal version of the device 1 could be equipped with an opening system ( not shown ) assigned to each of the lids 5 , 5 ′ 5 ″, which would control when they open . these opening systems could be as simple as an electronically - controlled inside latch and a spring that control the opening of the corresponding lid . in this manner , the device 1 can be set so that the lock releases the corresponding lid 5 , 5 ′, 5 ″ at a certain time . it would open automatically as the result of the spring action . this further improves the safety while using the device 1 , since the patient can only access those pills he should really take at any given time .

US-201013147136-A

embodiments of the invention relate generally to protein extraction and , more generally , to bone protein extraction methods that do not require demineralization . in one embodiment , the invention provides a method comprising : mixing a bone sample and a quantity of an extraction buffer comprising : ammonium phosphate dibasic ; or ammonium phosphate dibasic and ammonium bicarbonate ; or ammonium phosphate dibasic , ammonium bicarbonate , and guanidine hcl ; or sodium phosphate dibasic and sodium bicarbonate ; or sodium phosphate dibasic , sodium bicarbonate , and guanidine hcl ; or potassium phosphate dibasic and potassium bicarbonate ; or potassium phosphate dibasic , potassium bicarbonate , and guanidine hcl ; and incubating the bone sample / extraction buffer mixture .

in hydroxyapatite chromatography , proteins are eluted from the hydroxyapatite column with increasing phosphate concentration . because bone is a composite of hydroxyapatite and protein , the use of higher concentration phosphate buffers similar to the final concentrations used in hydroxyapatite chromatography in bone protein extraction methods allows higher and more complete protein yields than has been achievable using other extraction methods that do not include a demineralization step . specifically , extraction buffers comprising ammonium phosphate dibasic ( typically at a concentration between about 400 mm and about 1 m ) or ammonium phosphate dibasic and ammonium bicarbonate ( typically at a concentration of about 200 mm ) were employed according to some embodiments of the invention . in other embodiments , extraction buffers comprising ammonium phosphate dibasic , ammonium bicarbonate , and guanidine hcl ( at a concentration of about 4m ) were employed . the example below illustrates illustrative methods and extraction buffers according to embodiments of the invention , as well as the results of the mass spectrometry of proteins extracted using these methods and buffers . one skilled in the art will recognize , of course , that various modifications of the methods and extraction buffers described are possible and such modifications are within the scope of the invention . tibial cortical bone samples were sampled from seven caucasian cadavers ( 23f , 25m , 48m , 56m , 79m , 81f , 82m ). all samples were previously diagnosed to be free from metabolic bone diseases , hiv , and hepatitis b . no live human subjects were involved in this research study . utilizing phosphate elution principles from hydroxyapatite chromatography , extraction buffers comprising either 400 mm ammonium phosphate dibasic or 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate were prepared . to determine differences between the two extraction solutions , a number of initial tests were performed on bone obtained from a 48 - year - old male . bone samples ( 100 mg each ; fragmented to ˜ 1 mm 3 ) were extracted in 600 μl of solutions of 400 mm ammonium phosphate dibasic or 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate after homogenization using stainless steel beads in a bullet blender . because this is a tube based homogenization method , particle size was not measured . aliquots were taken at 4 , 8 , and 24 hrs to evaluate the amount of time necessary to extract protein for each solution . after initial set of tests , the extraction was repeated on ˜ 50 mg of bone with 400 mm ammonium phosphate , 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate , 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4m guanidine hcl ( guhcl ) for a fixed period of 24 hours only . temperature was varied at 4 ° c ., room temperature , or 75 ° c . to determine the effects of temperature on extraction . finally , an additional ˜ 50 mg of bone was extracted at 75 ° c . with 200 mm ammonium bicarbonate for 24 hrs for comparison to the ammonium phosphate extractions . the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4m guhcl extraction was only tested at 75 ° c . after establishing the method with the highest yields , ˜ 50 mg of bone from other cadaveric donors were extracted using the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate extraction for 24 hrs at 75 ° c . protein concentration was determined using coomassie ( bradford ) assay kit ( thermo - scientific ) with bsa as a protein standard , and all samples were desalted using micro dialysis ( 3500 mwco regenerated cellulose ; fisher scientific ) against nanopure water for 4 days . to evaluate if proteolysis occurs during the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate or the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4m guhcl extraction process , additional 50 mg aliquots of the 48m samples were homogenized with the inclusion of 10 μg / ml halt ™ protease inhibitor ( thermo - scientific ) and incubated for 24 hr at 75 ° c . the 400 mm ammonium phosphate dibasic extraction and all 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate samples were reduced with 10 mm dithiothreitol for 1 hour at room temperature followed by alkylation using 30 mm iodoacetamide for 1 hour in the dark . proteins were digested overnight with trypsin gold ( promega ) at 37 ° c . ( 1 : 100 trypsin : protein ). peptide samples were prepared for mass spectrometry using a c18 stage tip . after binding to the c18 disk , samples were washed with 50 μl of 0 . 1 % formic acid and eluted using 20 μl of 80 % acetonitrile , 0 . 1 % formic acid . samples were partially dried in air to remove excess acetonitrile and resuspended to a final volume of 15 μl in 0 . 1 % formic acid . prepared peptides were separated using an agilent 1200 series hplc with a thermo scientific biobasic c18 ( 2 . 1 mm id , 100 mm column length , 5 μm particle size ) for 75 minutes using either of the following gradients : 1 ) 2 % b 0 - 5 min , 30 % b 5 - 15 min , 60 % b 15 - 60 min , 95 % b 60 . 01 - 64 min , 2 % b 64 . 01 - 75 min or 2 ) 2 % b 0 - 5 min , 30 % b 5 - 35 min , 60 % b 35 - 60 min , 95 % b 60 . 01 - 64 min , 2 % b 64 . 01 - 75 min where a is 0 . 1 % formic acid and b is 100 acetonitrile , 0 . 1 % formic acid . eluted peptides were characterized on a ltq - orbitrap xl ( thermo scientific ). the top 2 peaks were fragmented using either collision induced dissociation ( cid ) or higher energy collisional dissociation ( hcd ) in the orbitrap or the top 5 peaks were fragmented with cid and analyzed in the ion trap . all samples were analyzed by mass spectrometry in triplicate . peak lists ( mgf ) were created in massmatrix mass spectrometric file conversion tools v . 3 . 2 . peak lists were searched against swissprot and a decoy database using mascot 2 . 3 ( matrix science ). the following parameters were set for each search : taxonomy was set to homo sapiens ; enzyme = trypsin ; up to 3 missed cleavages ; variable modifications : carbamidomethyl ( c ), deamidation ( nq ), carboxy ( e ), oxidation ( mkp ); static modifications : none ; peptide tolerance = 10 ppm ; fragment tolerance = 0 . 5 da ; and peptide charge = 2 +, 3 +, 4 +. peptide results were filtered using percolator at p & lt ; 0 . 05 . peptides with nonsensical post - translational modifications ( e . g ., carboxyglutamic acid ( gla ) on non - gla containing proteins ) were filtered by hand . to evaluate the differences in protein yield between extraction types , one - way anova was performed in sigmastat for windows 2 . 03 ( spss inc .). significance was set at p & lt ; 0 . 05 . the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate had a significantly greater yield than 400 mm ammonium phosphate dibasic alone for all times ( p & lt ; 0 . 001 ), as shown in fig1 . in the figures , * is p & lt ; 0 . 05 , ** is p & lt ; 0 . 01 , and *** is p & lt ; 0 . 0001 . no variation in yield was observed between times . temperature change resulted in a significant increase ( p & lt ; 0 . 001 ) in protein concentration for both the 400 mm ammonium phosphate dibasic and 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate solutions ( fig2 ). very little yield ( 1 . 05 ± 0 . 16 mg of protein / g bone ) was detected after extraction with 200 mm ammonium bicarbonate at 75 ° c . ( fig3 ); much less than either ammonium phosphate extraction ( p & lt ; 0 . 001 ). the highest yield was obtained with the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4m guhcl extraction ( p & lt ; 0 . 001 ). extractions from bones obtained from the other cadaveric donors resulted in yields between 3 . 53 ± 0 . 42 and 7 . 79 ± 0 . 23 mg protein per gram of bone ( fig4 ). for both extractions from the 48 - year - old donor , peptides from collagen i were the most abundantly detected . osteocalcin and ceruloplasmin were only detected in the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate extractions using the top 2 cid method , and actin , serum albumin , and apolipoprotein a - 1 were only detected in the 400 mm ammonium phosphate dibasic extraction also only using the top 2 cid method . hemoglobin , vimentin , and fibrinogen gamma chain peptides were detected for both 400 mm ammonium phosphate dibasic and 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate . osteocalcin was detected in the 400 mm ammonium phosphate dibasic extraction when using the top 5 cid fragmentation method . while as few as four hours of extraction was found sufficient for the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate method , 24 hours was used for the individual ages to maximize the amount and types of protein extracted for mass spectrometry . in all samples for the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate extraction fragmented using the top 5 method , collagen i alpha - 2 and alpha - 1 were consistently the most abundant and second most abundant protein chains detected , respectively . osteocalcin was detected by mascot for all samples . several other proteins were also detected ( e . g ., vitronectin , lumican , biglycan ). for all samples , 7 . 3 ± 2 . 4 proteins , 939 . 1 ± 185 . 8 total peptides , and 128 . 4 ± 19 . 1 unique peptides were detected using this extraction and mass spectrometry method . after using protease inhibitors , 9 proteins were identified for the 48m sample whereas only 5 were identified in the non - inhibited sample . the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4m guhcl extraction resulted in the greatest number of protein identifications ( as many at 20 unique accession numbers ). collagen i alpha 1 and 2 and osteocalcin were the highest scoring proteins for this extraction , consistent with the other 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate extraction . other matrix proteins ( e . g ., lumican , biglycan , collagen iii , vitronectin , osteomodulin ) were also detected . a number of useful conclusions may be drawn from the results reported in the example above . first , incubation for as little as four hours using either of the extraction buffers ( 400 mm ammonium phosphate dibasic or 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate ) resulted in complete protein yields . that is , as can be seen in fig1 , longer incubation times ( eight hours or 24 hours ) did not increase protein yield using either buffer . second , increased temperature alone may be sufficient , in some cases , to achieve acceptable protein yields . referring to fig2 again , it can be seen that while the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate buffer was consistent in achieving higher yields than the 400 mm ammonium phosphate dibasic buffer at both room temperature and at 75 ° c ., the 400 mm ammonium phosphate dibasic buffer at 75 ° c . had a higher yield than did the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate at room temperature . third , the addition of 200 mm ammonium bicarbonate to the extraction buffer significantly increased protein yield over the use of 400 mm ammonium phosphate dibasic alone . this result was consistent regardless of the temperature at which the bone sample / extraction buffer was incubated , as shown in fig3 , or the age of the sample donor , as shown in fig4 . fourth , the proteins extracted were different for each of these two buffers . table 1 below shows the proteins detected from the bone sample of the 48 year - old male for all temperatures and incubation times using the 400 mm ammonium phosphate dibasic buffer and the 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate buffer . together , these results demonstrate the ability to tailor both the protein yields and protein types to be extracted by varying the composition of the extraction buffer , the incubation temperature , or both . it must also be recognized that the addition of a denaturing agent ( 4 m guanidine hcl ) did significantly increase the total protein yield over the 400 mm ammonium phosphate / 200 mm ammonium bicarbonate alone , as shown in fig3 . this also resulted in the extraction of a number of proteins ( lumican , biglycan , collagen iii , vitronectin , and osteomodulin ) that were not extracted using either 400 mm ammonium phosphate alone or 400 mm ammonium phosphate / 200 mm ammonium bicarbonate alone . this is a result of an increase in the solubility of matrix proteins that may not be soluble without denaturation and suggests an additional degree of flexibility in tailoring the protein yields and types extracted according to embodiments of the invention . osteocalcin and osteomodulin were the only mineral specific proteins detected using the methods and buffers of the invention . however , this result suggests that these methods and buffers can interact with the hydroxyapatite surface sufficiently to dissociate mineral proteins . osteocalcin was only detected consistently in extractions that employed ammonium bicarbonate , suggesting that bicarbonate can disrupt the carboxyl interaction between osteocalcin and the mineral surface . the addition of a protease inhibitor allowed for the extraction and identification of additional proteins ( e . g ., collagen alpha - 1 ( xxviii ) chain ). this may be critical to the wider characterization of the bone proteome . protease inhibitors suitable for use in accordance with embodiments of the invention include , for example , sodium fluoride , sodium orthovanadate , sodium pyrophosphage , beta - glycerophosphate , and mixtures thereof . table 2 below summarizes some of the proteins extracted using each of four extraction buffers according to various embodiments of the invention . in table 2 , buffer a comprises 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate , buffer b comprises 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4 m guanidine hcl , buffer c comprises 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 10 μg / ml halt ™ protease inhibitor , and buffer d is 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4 m guanidine hcl / 10 μg / ml halt ™ protease inhibitor . applicant further found that the volume of extraction buffer for a given mass of bone sample affected the total protein yield . for example , fig5 shows the protein yields for four extractions of bone samples of the same mass and source . in fig5 , buffer b comprises 400 mm ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4 m guanidine hcl and buffer b - 1 comprises 1 m ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4 m guanidine hcl . as can be seen in fig5 , the increased concentration of ammonium phosphate dibasic increased total protein yield using both 600 μl and 1 ml of extraction buffer . at the same time , the 1 ml extractions with both buffers had higher total protein yields than did their 600 μl counterparts . protein concentration was also found to increase with increasing mass of the bone sample extracted . fig6 shows a plot of protein concentration ( kg / ml ) as a function of bone mass ( mg ) for a total of 34 extractions using extraction buffers according to embodiments of the invention . although not linear , the increase in protein concentration is steady through bone masses of about 90 mg . this suggests that the extraction methods of the invention are effective across a wide range of sample mass . it was also found that extraction buffers employing other cations were similarly effective in terms of protein yield . fig7 , for example , shows the plots of protein yields of six extraction buffers according to the invention as compared to both 4 m guanidine hcl ( guhcl ) alone and hydrochloric acid ( hcl ) alone . hcl is a commonly - used demineralization agent . all extractions were of 60 mg bone samples from the same source . all other parameters were the same among the extractions . in fig7 , buffer e comprises 400 mm sodium phosphate dibasic / 200 mm sodium bicarbonate / 4 m guanidine hcl , buffer f comprises 1 m sodium phosphate dibasic / 200 mm sodium bicarbonate / 4 m guanidine hcl , buffer g comprises 400 mm potassium phosphate dibasic / 200 mm potassium bicarbonate / 4 m guanidine hcl , buffer h comprises 1 m potassium phosphate dibasic / 200 mm potassium bicarbonate / 4 m guanidine hcl , and buffers b and b - 1 are as described above with respect to fig5 . as can be seen sodium phosphate dibasic / sodium bicarbonate buffers and potassium phosphate dibasic / potassium bicarbonate buffers resulted in protein yields similar to the ammonium phosphate dibasic / ammonium bicarbonate buffers described above . guanidine hcl alone and hcl alone resulted in the lowest protein yields . the types of proteins extracted using other cation - based buffers were similar to those using the ammonium - based buffers described above . table 3 below summarizes some of the proteins extracted using four different buffers according to embodiments of the invention . in table 3 , buffer f and buffer h are as described above with respect to fig7 , guhcl is guanidine hcl alone , and buffer b - 2 comprises 1 m ammonium phosphate dibasic / 200 mm ammonium bicarbonate / 4 m guanidine hcl / 0 . 015 m phenacylthiazolium bromide ( ptb ). ptb is reagent that can help enhance protein recovery by breaking advanced glycation end - product crosslinks . as can be seen in table 3 , buffer b - 2 , containing ptb , is the only buffer tested that enabled the extraction of cathepsin k . guanidine hcl alone enabled the extraction of several proteins that the other buffers did not , although the overall protein yield was lower , as shown in fig7 . the addition of ptb to extraction buffers of the invention results in an increase in total protein yield , particularly with increased incubation , even at a low temperature . fig8 , for example , shows plots of total protein yield for two buffers according to the invention , each after two incubation periods . in fig8 , buffer b - 3 comprises 400 mm ammonium phosphate / 200 mm ammonium bicarbonate / 4 m guanidine hcl 0 . 015 m ptb and buffer b - 2 is as described above with respect to table 3 . extractions following incubation for 20 hours at 4 ° c . increased the total protein yield for both buffers , as compared to yields obtained upon immediate extraction . in both cases , the yields for buffer b - 3 were higher than for buffer b - 2 . as used herein , the singular forms “ a ,” “ an ,” and “ the ” are intended to include the plural forms as well , unless the context clearly indicates otherwise . it will be further understood that the terms “ comprises ” and / or “ comprising ,” when used in this specification , specify the presence of stated features , integers , steps , operations , elements , and / or components , but do not preclude the presence or addition of one or more other features , integers , steps , operations , elements , components , and / or groups thereof . this written description uses examples to disclose the invention , including the best mode , and also to enable any person skilled in the art to practice the invention , including making and using any devices or systems and performing any related or incorporated methods . the patentable scope of the invention is defined by the claims , and may include other examples that occur to those skilled in the art . such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims , or if they include equivalent structural elements with insubstantial differences from the literal language of the claims .

US-201515533652-A

drug products in the form of modified release formulations comprising the drug substance -- 4 - hydroxy - 4m - tolylethynyl - octahydro - indole - 1 - carboxylic acid methyl ester , as well as processes for making such drug products are provided . the drug products are useful in treating patients with parkinson &# 39 ; s disease and exhibiting l - dopa induced dyskinesia .

the present invention provides drug products in the form of modified - release formulations of afq056 , which alter the pharmacokinetic profile of afq056 , resulting in effective and sustained drug concentration over a longer period of time , reducing the peak to trough ratio . the modified release formulations of the present invention have a positive food effect with increased cmax compared to the fasted state . a modified release form is a solid oral dosage form that permits the release of the active ingredient over an extended period of time to maintain therapeutically effective plasma levels . the modified release formulation may be a controlled release formulation , one that exhibits substantially zero order release kinetics . it may also be a sustained release formulation , which exhibits first order kinetics . an immediate release form is a solid oral dosage form that permits the release of most or all of the active ingredient over a short period of time , such as 60 minutes or less , and make rapid absorption of the drug possible . dose dumping is an unintended , rapid drug release in a short period of time of the entire amount or of a significant fraction of the active drug substance retained in a release dosage form . the solubility pattern of afq056 was examined ( fig1 ). afq056 is hardly soluble in water but soluble in organic solvents such as ethanol . in pure aqueous solutions the solubility of afq056 steadily increases with raising ethanol concentrations . the solubility pattern of afq056 in a ldao water - ethanol solution is distinct from the solubility pattern of afq056 in a pure aqueous solution only up to an amount of 20 % ethanol present in the solution . it was observed that the increase in solubility of afq056 by raising the presence of ethanol is even steeper than the solubility of a comparable drug such as aspirin ( roberts et al . ; int . journal of pharmaceutics 2007 , 332 , p . 31 - 37 ). solubilities of afq056 are about 0 . 02 mg / ml in water and raise up to about 53 mg / ml ( factor 2500x solubility increase ) in ethanol at room temperature . this is in contrast to 8 . 4 mg / ml for aspirin in water raising up to about 237 mg / ml in ethanol ( factor 28x solubility increase ). it was observed that high concentrations of ethanol significantly raise the dissolution rate and thus have an impact on the pharmacokinetic parameters . fig5 and 6 show that the predicted pharmacokinetic parameters of afq056 immediate release forms ( 50 mg afq056 capsule and 400 mg afq056 capsule ) change dramatically in the presence of ethanol . tmax is reached faster and both cmax and auc 48h are higher for an immediate relase form in the presence of ethanol . immediate release forms of afq056 have therefore the inherent risk of dose dumping and can create severe consequences for the patient if ethanol - containing beverages are consumed in parallel . particle size distribution is also an important factor influencing the dissolution of a drug substance and is known to influence the drug release from matrix tablets . description of the dynamics of getting afq056 into solution is finally related to various factors such as the intrinsic properties of afq056 , the composition of the described dissolution media , specific properties of hpmc ( hypromellose ) influencing solubility / dissolution rate of afq056 and the resulting viscosity in the surrounding of the solids to be dissolved . despite the solubility characteristics of afq056 ( factor 2500x solubility increase in ethanol compared to water ) it was surprisingly found that the release rate of the modified release formulations of the present invention is similar or even slower in ethanol than that in water . fig3 and fig4 illustrate the release pattern of the present formulations in ethanol containing solutions . it is speculated that the combination of several factors such as the presence of hypromellose , the particle size and the size distribution of the drug substance result in the observed release pattern of the afq056 modified release formulations . surprisingly the predicted pharmacokinetic parameters of the modified release formulation remain almost equal in the presence of ethanol ( fig7 ). it is therefore shown that the modified release form is dose dumping resistant in the presence of ethanol . afq056 may be prepared as described in wo 03 / 047581 , the contents of which are incorporated by reference . in the modified release formulations of the present invention , afq056 is present as free base . excipients that may be used in the formulations of the present invention are standard excipients commonly used for tablet dosage forms and include but are not limited to fillers , modified release agents , disintegrants , lubricants , glidants , solvents , viscosity agents , emulsifiers , binding agents , buffers , bulking agents , coloring agents , taste - improving agents , flow agents , fillers , absorbents and water soluble coatings . examples of fillers which may be used in the formulations of the present invention include but are not limited to lactose monohydrate , dibasic calcium phosphate , calcium carbonate , sugar alcohols ( e . g . mannitol ), microcrystalline cellulose and starch . preferably , lactose monohydrate is used as a filler . examples of modified release agents which may be used in the formulations of the present invention without being resistant to dose dumping in the presence of ethanol include but are not limited to hydroxy propyl methylcellulose ( hpmc ), also known as hypromellose , ( a ) hydrophilic carbohydrate macromolecules ( acacia , agar , alginic acid , carboxymethylcellulose , carrageenans , dextrin , gellan gum , guar gum , hydroxyethyl cellulose , hydroxypropyl cellulose , hypromellose , maltodextrin , methylcellulose , pectin , propylene glycol alginate , sodium alginate , starch , tragacanth , and xanthan gum ) and ( b ) noncarbohydrate hydrophilic macromolecules , including gelatin , povidone carbomers , polyethylene oxide , and polyvinyl alcohol . modified release agents which may be used in formulations of the present invention that are dose dumping resistant in the presence of ethanol are preferably , hypromellose such as hypromellose type 2208 and type 2910 is used . more preferably , methocel k100 premium lv cr , methocel k4m premium cr , methocel k15m premium cr , methocel k100m premium cr , methocel e4m premium cr , and methocel e10m premium cr is used , in sum characterized by viscosities between about 80 to about 120000 cp ( 20 ° c .). examples of binders which may be used in the formulations of the present invention include but are not limited to cellulose derivatives ( e . g . hypromellose , hydroxypropylcellulose , methylcellulose ), gelatin , polyvinylpyrrolidone , copovidone , starch , sucrose and polyethylene glycol . in a preferred embodiment hypromellose , type 2910 , is used . various glidants may be used in the formulations of the present invention and include e . g . silicon dioxide asprecipitated silica and as colloidal silica , colloidal silicon dioxide . preferably colloidal silicon dioxide e . g ., aerosil ® is used . various disintegrants may be used in the formulations of the present invention , including , but not limited to , sodium starch glycolate , carboxymethylcellulose sodium / croscarmellose sodium , crospovidone / cross - linked polyvinylpyrrolidone , starches , celluloses and pullulan . preferably , sodium starch glycolate is used . examples of lubricants which may be used in the formulations of the present invention , include but are not limited to magnesium stearate , calcium stearate , zinc stearate , stearic acid , sodium benzoate , sodium stearyl fumarate , sodium lauryl sulfate , hydrogenated vegetable oil , glycerides ( glyceryl behenate and distearate ). in a preferred embodiment , magnesium stearate is used as lubricant . coatings which may be used in the formulations of the present invention include but are not limited to hypromellose , hydroxypropyl cellulose , methylcellulose , povidone , polyvinyl alcohol , macrogol poly ( vinyl alcohol ) grafted copolymer and starches . in a preferred embodiment hypromellose , macrogol 4000 / polyethylene glycol 4000 , talc , iron oxide ( red , yellow , black ), and titanium dioxide is used . the modified release formulations of the present invention may be made by mixing , aqueous granulation , screening , drying , tablet compression and film - coating steps , all of which are well known in the art . for example , the modified release formulations are made by mixing afq056 , filler , binder and disintegrant in a high shear granulator for approximately 5 minutes . purified water is added under mixing and the mixture kneaded in a high shear granulator . the granulate is then passed through a screen using a screening mill and dried in a fluid bed dryer . after drying , the granulate is mixed with filler , modified release agent and glidant , followed by consecutive sieving using a screening mill and mixing in a diffusion mixer ( tumble ). a lubricant is sieved and then added to the mixture from the diffusion mixer . the composition is then formed by final mixing . the resulting granules of the composition may have a diameter from a few microns to a few hundred microns ; e . g ., diameters of at most about 450 microns , e . g ., 20 to 450 microns , preferably 50 - 200 μm , most preferably , 100 - 200 μm . a narrow particle size distribution is preferred . for example , a preferred particle size distribution is x10 ≦ 50 μm , x50 ≦ 100 - 150 μm and x90 ≦ 200 - 450 μm , i . e ., 10 % of particles are smaller than 50 μm , 50 % of particles are smaller than 150 μm , and 90 % of particles are smaller than 450 μm . the blend is then compressed into tablet cores using a rotary tablet press . a coating mixture in purified water is dispersed and the tablet cores are film coated in a pan coater with perforated coating system . preferably , the modified release formulations are made by mixing afq056 , lactose monohydrate , hypromellose ( type 2208 ) and sodium starch glycolate in a high shear granulator for approximately 5 minutes . purified water is added under mixing and the mixture kneaded in a high shear granulator . the granulate is then passed through a screen using a screening mill and dried in a fluid bed dyer . after drying , the granulate is mixed with hypromellose ( type 2208 ), lactose monohydrate and colloidal silicon dioxide followed by consecutive sieving using a screening mill and mixing in a diffusion mixer ( tumble ). the magnesium stearate is sieved and then added to the mixture from the diffusion mixer . the composition is formed by final mixing . the blend is then compressed into tablet cores using a rotary tablet press . a coating mixture in purified water is dispersed and the tablet cores are film coated in a pan coater with perforated coating system . the modified release formulations of the present invention are useful in treating parkinson &# 39 ; s disease ( pd ) and effective amounts of such formulations are administered to such patients . the phrases “ effective amount ”, “ amount effective ” or “ amounts effective ” describe concentrations or amounts of the drug substance according to the present invention , which may be used to produce a favorable change in l - dopa induced motor complications such as dyskinesias ( lids ). the total daily effective amount ( s ) can be administered in divided doses ( e . g ., multiple capsules or tablets ). preferably , the total daily effective amount is delivered in a single dosage form ( e . g ., one tablet ), which in total , delivers an effective amount of afq056 . thus , the drug products of the present invention may be administered multiple times a day , twice a day ( b . i . d .) or once a day ( o . d .). a once a day dose is preferable since it may lead to increased patient compliance . in accordance with the present invention , a single dosage form of the modified release formulation of the present invention provides afq056 in an amount of about 25 mg to about 250 mg . preferably , a single dosage form of the modified release formulation of the present invention provides afq056 in an amount of about 50 to about 200 mg . the drug products of the present invention may be used to treat nervous system disorders mediated in full or in part by mglur5 . such disorders include parkinson &# 39 ; s disease l - dopa induced dyskinesia , fragile x syndrome ( martin - bell syndrome ), dyskinesia in fragile x syndrome , obsessive compulsory disorders , autism , cystitis , acute , traumatic and chronic degenerative diseases of the nervous system such as parkinson &# 39 ; s disease , senile dementia , alzheimer &# 39 ; s disease , huntington &# 39 ; s chorea , amyotrophic lateral sclerosis and multiple sclerosis , psychiatric diseases such as schizophrenia and anxiety , depression , pain , itch and drug abuse , e . g . alcohol and nicotine abuse and cocaine use disorders . the drug products of the present invention may be used in the manufacture of a medicament for the treatment of parkinson &# 39 ; s disease l - dopa induced dyskinesia , fragile x syndrome ( martin - bell syndrome ), dyskinesia in fragile x syndrome , obsessive compulsory disorders , autism , cystitis , and for the treatment , prevention or delay of progression of acute , traumatic and chronic degenerative processes of the nervous system , such as parkinson &# 39 ; s disease , senile dementia , alzheimer &# 39 ; s disease , huntington &# 39 ; s chorea , amyotrophic lateral sclerosis and multiple sclerosis , psychiatric diseases such as schizophrenia and anxiety , depression , pain , itch and drug abuse such as alcohol and nicotine abuse and cocaine use disorders . in a preferred embodiment , the drug products of the present invention are used to treat parkinson &# 39 ; s disease - levodopa induced dyskinesia ( pd - lid ). the following examples further illustrate the invention , which are not meant in any way to limit the scope thereof . since previous oral formulations have exhibited an increased exposure upon concomitant intake of a high - fat meal , the extent of which has been found to be formulation - dependent , this study is designed to assess the food - effect ( by administration of a high fat breakfast ) on the pk of the modified release forms . the effect of a high - fat breakfast on the pharmacokinetics and relative bioavailability of three prolonged release formulations of afq056 at a single dose of - 100 mg ( with reference to the fasted state pk ) is assessed . in addition , the tolerability of three different prolonged release formulations of afq056 at a single dose of 100 mg under fasted and fed conditions is tested an open - label , randomized , five periods , seven treatments cross - over study in healthy subjects is conducted . a total of forty five ( 45 ) subjects are enrolled to obtain data on at least 30 completers . each subject receives a total of 5 single doses of afq056 ; three doses under fasted conditions and two doses under fed conditions . the study consists of a screening period ( up to 27 days ), 5 baseline periods , 4 wash out periods of 7 - 2 days inclusive . 5 treatment periods followed by a study completion evaluation 5 - 10 days ( inclusive ) after the last drug administration . subjects who meet the eligibility criteria at screening are admitted to baseline evaluations for treatment period 1 . subjects are admitted to the study site at least 12 hours prior to dosing in each period for baseline evaluations . all baseline safety evaluation results must be available prior to dosing . after an overnight fast , subjects are randomized to one of the treatment sequence ( table 2 ). following each single dose of afq056 , pharmacokinetic assessments are made up to 72 h post dose . a wash - out period of 7 ± 2 days inclusive separates each treatment period . the washout period is calculated between dose to dose and baseline of subsequent period can overlap with the 5 th day after dosing . the total study duration for each subject lasts a minimum of 53 days and a maximum of 70 days from screening to study completion . subject are domiciled for approximately 20 days in total ( 4 days for each period ) for all sequences . the study has a 3 - latin , 5 - sequences × 5 - period open - label design that is suitable for comparing the pharmacokinetics including relative bioavailability of three modified release formulations of afq056 . the immediate release capsule formulation ( size o , ir ) is used as a reference to enable comparisons with data obtained in previously completed trials . this study design allows the comparison of pharmacokinetic profile of afq056 from three modified release ( mr ) formulations relative to the ir formulation under fasted conditions , and to assess the food effect on the pharmacokinetics of the three mr forms . latin - square design is selected as it offers maximum precision of comparison across different treatments with minimum number of study subjects . the cross - over design permits investigation of all five treatment conditions within each subject and is used to account for interindividual variability . a wash out period of at least 5 days ensures complete washout of afq056 based on a half life of 7 to 17 hours for 50 mg and for 100 mg doses . sampling for 72 hours post dose is considered sufficient for characterizing the pk profiles of all formulations , including the mr forms . comparisons of the concentration - time profile for the fasted and fed conditions for all formulations are provided in fig9 . mean ( sd ) plasma concentration - time profile of selected modified release formulation form b , fasted versus fed , is depicted in fig1 . the results of the non - compartmental pk analysis are summarized in table 3 . for better comparability the pk parameters were normalized to dose where necessary . results indicate that modified release ( mr ) forms show a decrease in cmax ( at tmax ) with very little loss of auc . cmax / auc ratios are favorable for all modified release forms over the intermediate release ( ir ) form with the best ratio for form b and c . all mr forms have a positive food effect with increased cmax compared to the fasted state . the tablet core is formulated using common excipients for such pharmaceutical dosage forms . release of the drug substance from the tablet core occurs through an erosion and diffusion mechanism , and is controlled by the hypromellose ( type 2208 ) content of the formulated product . a pharmacokinetic study is performed using different 100 mg modified release tablet formulations in order to evaluate the impact of delaying release of the active ingredient . the same ratio of excipients in the 100 mg tablet core is used to create the additional dosage strengths . the lower dosage strengths e . g . 25 mg , 50 mg and 75 mg use lactose monohydrate as compensation for drug substance in order to maintain the tablet weight and size . the tablet cores of dosage strengths less than or equal to 100 mg are compressed to round tablets possessing a diameter of 8 mm . for the higher dosage strengths e . g . 150 mg , 200 mg and 250 mg , the tablet weight and size are increased . the same formulation principle is applied i . e . using lactose monohydrate as compensation for drug substance . the tablet cores of dosage strengths more than 100 mg are compressed to round tablets possessing a diameter of 11 mm . table 4 summarizes the tablet core composition of the different dosage strengths . dissolution of afq056 modified release film - coated tablets occurs through an erosion and diffusion mechanism , with a target release time of approximately 6 to 7 hours for & gt ; 80 % of the active ingredient ( table 5 ). the dissolution method uses dissolution apparatus 2 ( paddle ) at 100 rpm with 900 ml of water + 0 . 5 % ldao . comparative dissolution profiles for afq056 modified release film - coated tablets are provided in fig8 . particle size distribution is an important factor in dissolution of the modified release forms of the present invention . the following experiments are performed to in order to determine how particle size effects dissolution at various time points . fig1 graphically depicts the percentage of afq056 dissolved after 45 minutes versus particle size at x90 . as can be discerned from the figure , particle size distribution is a key factor in dissolution rate and thus the performance of the mr form . the drug substance has a particle size distribution of x10 ≦ 50 μm , x50 ≦ 100 μm and x90 ≦ 200 μm .

US-201414897439-A

the present invention is related to a 3d ventilation device for separating body skin from clothes including an elastic meshed fabric , an elastic framework and a fixing device , wherein the 3d elastic framework which supports and holds the elastic meshed fabric , is fixed by the fixing device to locate between the skin and the clothes , so as to form a ventilative chamber for achieving the separation . here , the elastic framework can be bent to adapt to different body shapes or portions and adjusted to provide most comfortable wearing angle , so that a proper air flowing can be achieved between the skin or the body portion and the clothes , thereby keeping the skin dry .

the present invention provides a 3d ventilation device for separating body skin from the cloth . as shown in fig1 , the 3d ventilation device 1 a includes an elastic meshed fabric 2 , an elastic framework 3 and a fixing device 4 , wherein : the elastic meshed fabric 2 is a spaced - knitted meshed fabric for providing proper air flow . the elastic framework 3 has a 3d structure with elasticity which can be made of elastic hard polymer or bent metal lines covered by soft material such as cloth or sponge . the elastic framework 3 includes a frame 30 and interior lines 31 , wherein the frame 30 provides the supporting tension for the elastic framework 3 , and the whole 3d structure of the elastic framework 3 is formed by the combination of the frame 30 and the interior lines 31 . a 3d hollow chamber 32 with an opening 321 is formed inside the elastic framework 3 , and the chamber 32 is used to provide the ventilative space . besides , the frame 30 of the elastic framework 3 is covered by the propped elastic meshed fabric 2 so as to provide a soft and comfortable contact with the skin through the 3d ventilation device 1 a . the fixing device 4 is connected with the elastic framework 3 , for tying or fixing the 3d ventilation device 1 a . the applying examples for the present invention are respectively shown in fig3 , fig7 and fig1 . the present invention is mainly used to separate the sensitive part of human body from the clothes and / or prevent from the muggy and wet situation therebetween . for example , the 3d ventilation device 1 a can be located between the breast 51 and the brassiere 52 , the 3d ventilation device 1 b can be located between the testicle 61 and the underpants 62 , and the 3d ventilation device 1 c can be located between the affected part 71 and the clothes 72 , which are respectively described below . please refer to fig1 , fig2 , fig3 and fig4 . the 3d ventilation device 1 a of the present invention is applied to provide buffer , protection and ventilation for woman &# 39 ; s breast 51 . here , the elastic framework 3 is formed to be a double - layered 3d bowl shape and have an inner framework 301 and an outer framework 302 . the inner and outer frameworks 301 , 302 both hold a curved surface , and the curved surface held by the inner framework 301 is smaller than that held by the outer framework 302 , so that between the inner and the outer frameworks 301 , 302 , a separated hollow chamber 32 is formed . furthermore , the elastic meshed fabric 2 is fixed on and held by the frame of the elastic framework 3 , so that the heat produced from the skin can be outputted through the opening 321 of the hollow chamber 32 , thereby dispersing heat and keeping dry . besides , the fixing device 4 which will not damage the cloth is connected to the outer edge of the outer framework 302 of the elastic framework 3 . here , the fixing device 4 can be connected by velcro , button and sewing , or can be tightly located between the lower edge and inwardly concave portion of the brassiere 52 and the breast 51 , without influencing the appearance and function of the brassiere 52 . as shown in fig3 and fig4 , the 3d ventilation device 1 a is placed at the inner side of the brassiere 52 first , and then , both are worn on . here , the elastic meshed fabric 2 on the inner framework 301 can support the breast 51 , and the outer framework 302 can contact with the brassiere 52 and fix the position of the 3d ventilation device 1 a . therefore , the chamber 32 formed between the inner framework 301 and the outer framework 302 can facilitate the exhaust of heat and sweat , thereby achieving the effects of ventilation and heat dispersing . please further refer to fig5 , fig6 and fig7 which show a second preferred embodiment of the present invention , wherein the 3d ventilation device 1 b is used to provide protection , ventilation and heat dispersing for man &# 39 ; s testicle 61 . here , the frame 30 of the elastic framework 3 is formed to have a cross shape , wherein the central portion of the cross shape is supported by plural interior lines 31 , and the upper portion of the cross shape is a protruded fixing piece 303 for preventing the 3d ventilation device 1 b from being lifted up owing to the body movement . moreover , the elastic meshed fabric 2 is held by the frame 30 of the elastic framework 3 to form a cross surface , and two ends of the elastic framework 3 are respectively connected with the fixing device 4 , which can be elastic tape or elastic belt . as shown in fig7 , fig8 and fig9 , first , the 3d ventilation device 1 b is placed and fixed on the hip through the fixing device 4 and then the underpants 62 is put on , so that the 3d ventilation device 1 b is located between the testicle 61 and the underpants 62 . here , the user can freely adjust the angle of the elastic framework 3 for adapting to the body shape , and the lower edge of the frame 30 of the elastic framework 3 can be bent upwardly for propping up the underpants 62 , which originally stays close to the testicle 61 , so as to form the chamber 32 for allowing ventilation and the free moving of the penis 63 . besides , it also can be the penis 63 is moved upward and supported by the elastic meshed fabric 2 , so as to increase the circulation space in the chamber 32 , thereby achieving an even better ventilation and heat dispersing effect . then , when calling the nature , since the fixing device 4 is an elastic belt , the 3d ventilation device 1 b can be easily moved away and back without inconvenience . please refer to fig1 , fig1 , fig1 and fig1 , which show a third preferred embodiment of the present invention for medical purposes . the frame 30 of the elastic framework 3 of the 3d ventilation device 1 c is covered on the skin around the affected part 71 , and the interior lines 31 are interwoven with each other to form a supportable spaced - knitted meshed surface , so as to form the hollow chamber 32 inside the 3d ventilation device 1 c for separating the affected part from the clothes 72 . furthermore , the fixing device 4 is connected to two sides of the 3d ventilation device 1 c for fixing thereof on the limb 74 or the joint 75 aside the affected part 71 . here , the fixing device 4 can be elastic tape or elastic belt . therefore , the 3d ventilation device 1 c can avoid the affected part 71 or the dressing 73 from rubbing against the clothes 72 , so that the affected part 71 can easily stay uncontaminated and keep dry for facilitating recovery . it is to be understood , however , that even though numerous characteristics and advantages of the present invention have been set forth in the foregoing description , together with details of the structure and function of the invention , the disclosure is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts within the principles of the invention to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .

US-32967408-A

the present invention relates to isolated porphyromonas gingivalis polypeptides and nucleotides . the polypeptides include an amino acid sequence selected from the group consisting of : seq . id . no . 110 ; seq . id . no . 111 ; seq . id . no . 112 ; seq . id . no . 113 ; seq id no : 120 ; seq . id . no . 123 ; seq . id . no . 124 ; seq . id . no . 125 ; seq . id . no . 130 ; seq . id . no . 131 ; seq . id . no . 132 ; seq . id . no . 133 ; seq . id . no . 135 ; seq . id . no . 136 ; seq . id . no . 137 ; seq . id . no . 138 ; seq . id . no . 143 ; seq . id . no . 144 ; seq . id . no . 145 ; seq . id . no . 146 ; seq . id . no . 147 ; seq . id . no . 148 ; and amino acid sequences at least 95 % identical thereto .

a purified or isolated polypeptide or a substantially pure preparation of a polypeptide are used interchangeably herein and , as used herein , mean a polypeptide that has been separated from other proteins , lipids , and nucleic acids with which it naturally occurs . preferably , the polypeptide is also separated from substances , e . g ., antibodies or gel matrix , e . g ., polyacrylamide , which are used to purify it . preferably , the polypeptide constitutes at least 10 , 20 , 50 70 , 80 or 95 % dry weight of the purified preparation . preferably , the preparation contains : sufficient polypeptide to allow protein sequencing ; at least 1 , 10 , or 100 mg of the polypeptide . a purified preparation of cells refers to , in the case of plant or animal cells , an in vitro preparation of cells and not an entire intact plant or animal . in the case of cultured cells or microbial cells , it consists of a preparation of at least 10 % and more preferably 50 % of the subject cells . a purified or isolated or a substantially pure nucleic acid , e . g ., a substantially pure dna , ( are terms used interchangeably herein ) is a nucleic acid which is one or both of the following : not immediately contiguous with both of the coding sequences with which it is immediately contiguous ( i . e ., one at the 5 ′ end and one at the 3 ′ end ) in the naturally occurring genome of the organism from which the nucleic acid is derived ; or which is substantially free of a nucleic acid with which it occurs in the organism from which the nucleic acid is derived . the term includes , for example , a recombinant dna which is incorporated into a vector , e . g ., into an autonomously replicating plasmid or virus , or into the genomic dna of a prokaryote or eukaryote , or which exists as a separate molecule ( e . g ., a cdna or a genomic dna fragment produced by pcr or restriction endonuclease treatment ) independent of other dna sequences . substantially pure dna also includes a recombinant dna which is part of a hybrid gene encoding additional p . gingivalis dna sequence . a “ contig ” as used herein is a nucleic acid representing a continuous stretch of genomic sequence of an organism . an “ open reading frame ”, also referred to herein as orf , is a region of nucleic acid which encodes a polypeptide . this region may represent a portion of a coding sequence or a total sequence and can be determined from a stop to stop codon or from a start to stop codon . as used herein , a “ coding sequence ” is a nucleic acid which is transcribed into messenger rna and / or translated into a polypeptide when placed under the control of appropriate regulatory sequences . the boundaries of the coding sequence are determined by a translation start codon at the five prime terminus and a translation stop code at the three prime terminus . a coding sequence can include but is not limited to messenger rna synthetic dna , and recombinant nucleic acid sequences . a “ complement ” of a nucleic acid as used herein refers to an anti - parallel or antisense sequence that participates in watson - crick base - pairing with the original sequence . a “ gene product ” is a protein or structural rna which is specifically encoded by a gene . as used herein , the term “ probe ” refers to a nucleic acid , peptide or other chemical entity which specifically binds to a molecule of interest . probes are often associated with or capable of associating with a label . a label is a chemical moiety capable of detection . typical labels comprise dyes , radioisotopes , luminescent and chemiluminescent moieties , fluorophores , enzymes , precipitating agents , amplification sequences , and the like . similarly , a nucleic acid , peptide or other chemical entity which specifically binds to a molecule of interest and immobilizes such molecule is referred herein as a “ capture ligand ”. capture ligands are typically associated with or capable of associating with a support such as nitro - cellulose , glass , nylon membranes , beads , particles and the like . the specificity of hybridization is dependent on conditions such as the base pair composition of the nucleotides , and the temperature and salt concentration of the reaction . these conditions are readily discernible to one of ordinary skill in the art using routine experimentation . homologous refers to the sequence similarity or sequence identity between two polypeptides or between two nucleic acid molecules . when a position in both of the two compared sequences is occupied by the same base or amino acid monomer subunit , e . g ., if a position in each of two dna molecules is occupied by adenine , then the molecules are homologous at that position . the percent of homology between two sequences is a function of the number of matching or homologous positions shared by the two sequences divided by the number of positions compared × 100 . an “ immunogenic component ” as used herein is a moiety , such as an p . gingivalis polypeptide , analog or fragment thereof , that is capable of eliciting a humoral and / or cellular immune response in a host animal . an “ antigenic component ” as used herein is a moiety , such as p . gingivalis polypeptide , analog or fragment thereof , that is capable of binding to a specific antibody with sufficiently high affinity to form a detectable antigen - antibody complex . as used herein , the term “ cell - specific promoter ” means a dna sequence that serves as a promoter , i . e ., regulates expression of a selected dna sequence operably linked to the promoter , and which effects expression of the selected dna sequence in specific cells of a tissue . the term also covers so - called “ leaky ” promoters , which regulate expression of a selected dna primarily in one tissue , but cause expression in other tissues as well . as used herein , the term “ control sequence ” refers to a nucleic acid having a base sequence which is recognized by the host organism to effect the expression of encoded sequences to which they are ligated . the nature of such control sequences differs depending upon the host organism ; in prokaryotes , such control sequences generally include a promoter , ribosomal binding site , terminators , and in some cases operators ; in eukaryotes , generally such control sequences include promoters , terminators and in some instances , enhancers . the term control sequence is intended to include at a minimum , all components whose presence is necessary for expression , and may also include additional components whose presence is advantageous , for example , leader sequences . as used herein , the term “ operably linked ” refers to sequences joined or ligated to function in their intended manner . for example , a control sequence is operably linked to coding sequence by ligation in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequence and host cell . a “ sample ” as used herein refers to a biological sample , such as , for example , tissue or fluid isolated from an individual ( including without limitation plasma . serum , cerebrospinal fluid , lymph , tears , saliva and tissue sections ) or from in vitro cell culture constituents , as well as samples from the environment . the practice of the invention will employ , unless otherwise indicated , conventional techniques of chemistry , molecular biology , microbiology , recombinant dna , and immunology well known to those skilled in the art . such techniques are described and explained throughout the literature in sources such as , j . perbal , a practical guide to molecular cloning , john wiley and sons ( 1984 ), j . sambrook et al ., molecular cloning : a laboratory manual , cold spring harbour laboratory press ( 1989 ), t . a . brown ( editor ), essential molecular biology : a practical approach , volumes 1 and 2 , irl press ( 1991 ), d . m . glover and b . d . hames ( editors ), dna cloning : a practical approach , volumes 1 - 4 , irl press ( 1995 and 1996 ), and f . m . ausubel et al . ( editors ), current protocols in molecular biology , greene pub . associates and wiley - interscience ( 1988 , including all updates until present ). the disclosure of these texts are incorporated herein by reference . the antibodies , polypeptides and dna of the present invention can be included in compositions which include a carrier or diluent . these compositions include pharmaceutical compositions where the carrier or diluent will be pharmaceutically acceptable . pharmaceutically acceptable carriers or diluents include those used in compositions suitable for oral , rectal , nasal , topical ( including buccal and sublingual ), vaginal , parenteral ( including subcutaneous , intramuscular , intravenous , intradermal , intrathecal and epidural ) administration . they are non - toxic to recipients at the dosages and concentrations employed . representative examples of pharmaceutically acceptable carriers or diluents include , but are not limited to ; water , isotonic solutions which are preferably buffered at a physiological ph ( such as phosphate - buffered saline or tris - buffered saline ) and can also contain one or more of , mannitol , lactose , trehalose , dextrose , glycerol , ethanol or polypeptides ( such as human serum albumin ). the compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy . as will be well understood by those skilled in the art alterations may be made to the amino acid sequences set out in the sequence listings . these alterations may be deletions , insertions , or substitutions of amino acid residues . the altered polypeptides can be either naturally occurring ( that is to say , purified or isolated from a natural source ) or synthetic ( for example , by performing site - directed metagenesis on the encoding dna ). it is intended that such altered polypeptides which have at least 85 %, preferably at least 95 % identity with the sequences set out in the sequence listing are within the scope of the present invention . antibodies raised against these altered polypeptides will also bind to the polypeptides having one of the sequences set out in the sequence listings . the level of % identity is to be calculated as set out above . protein sequences are homologous if they are related by divergence from a common ancestor . consequently , a species homologue of the protein will be the equivalent protein which occurs naturally in another species . within any one species a homologue may exist as numerous allelic variants , and these will be considered homologues of the protein . allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art . an allelic variant will be a variant that is naturally occurring within an individual organism . mutant polynucleotides will possess one or more mutations which are deletions , insertions , or substitutions of nucleotide residues . mutants can be either naturally occurring ( that is to say , isolated from a natural source ) or synthetic ( for example , by performing site - directed metagenesis on the dna ). it is thus apparent that polynucleotides of the invention can be either naturally occurring or recombinant ( that is to say prepared using recombinant dna techniques ). an allelic variant will be a variant that is naturally occurring within an individual organism . nucleotide sequences are homologous if they are related by divergence from a common ancestor . consequently , a species homologue of the polynucleotide will be the equivalent polynucleotide which occurs naturally in another species . within any one species a homologue may exist as numerous allelic variants , and these will be considered homologues of the polynucleotide . allelic variants and species homologues can be obtained by following standard techniques known to those skilled in the art . antibodies , either polyclonal or monoclonal , which are specific for a polypeptide of the present invention can be produced by a person skilled in the art using standard techniques such as , but not limited to , those described by harlow et al . antibodies : a laboratory manual , cold springs harbor laboratory press ( 1988 ), and d . catty ( editor ), antibodies : a practical approach , irl press ( 1988 ). various procedures known in the art may be used for the production of polyclonal antibodies to epitopes of a protein . for the production of polyclonal antibodies , a number of host animals are acceptable for the generation of antibodies by immunization with one or more injections of a polypeptide preparation , including but not limited to rabbits , mice , rats , etc . various adjuvants may be used to increase the immunological response in the host animal , depending on the host species , including but not limited to freund &# 39 ; s ( complete and incomplete ), mineral gels such as aluminium hydroxide , surface active substances such as lysolecithin , pluronic polyols , polyanions , oil emulsions , keyhole lympet hemocyanins , dinitrophenol , and potentially useful human adjuvants such as bcg ( bacille calmette - guerin ) and corynebacterium parvum . a monoclonal antibody to an epitope of a protein may be prepared by using any technique which provides for the production of antibody molecules by continuous cell lines in culture . these include but are not limited to the hybridoma technique originally described by kohler and milstein ( 1975 , nature 256 , 493 - 497 ), and the more recent human b - cell hybridoma technique ( kesber et al . 1983 , immunology today 4 : 72 ) and ebv - hybridoma technique ( cole et al . 1985 , monoclonal antibodies and cancer therapy , alan r . liss , inc . pp . 77 - 96 ). in addition , techniques developed for the production of “ chimeric antibodies ” by splicing the genes from antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity may be used ( mornison et al . 1984 , proc . natl . acad . sci ., 81 : 6851 - 6855 ; neuberger et al . 1984 nature 312 : 604 - 608 ; takeda et al . 1985 nature 31 : 452 - 454 ). alternatively , techniques described for the production of single chain antibodies ( u . s . pat . no . 4 , 946 , 778 ) can be adapted to produce 4 - specific single chain antibodies . recombinant human or humanized versions of monoclonal antibodies are a preferred embodiment for human therapeutic applications . humanized antibodies may be prepared according to procedures in the literature ( e . g . jones et al . 1986 , nature 321 : 522 - 25 ; reichman et al . 1988 nature 332 : 323 - 27 ; verhoeyen et al . 1988 , science 239 : 1534 - 36 ). the recently described “ gene conversion metagenesis ” strategy for the production of humanized monoclonal antibody may also be employed in the production of humanized antibodies ( carter et al . 1992 proc . natl . acad . sci . u . s . a . 89 : 4285 - 89 ). alternatively , techniques for generating the recombinant phase library of random combinations of heavy and light regions may be used to prepare recombinant antibodies ( e . g . huse et al . 1989 science 246 : 1275 - 81 ). antibody fragments which contain the idiotype of the molecule such as fu f ( ab1 ) and f ( ab2 ) may be generated by known techniques . for example , such fragments include but are not limited to : the f ( ab ) e2 fragment which can be produced by pepsin digestion of the intact antibody molecule ; the fab ′ fragments which can be generated by reducing the disulfide bridges of the f ( ab ′) 2 fragment , and the two fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent . alternatively , fab expression libraries may be constructed ( huse et al . 1989 , science 246 : 1275 - 1281 ) to allow rapid and easy identification of monoclonal fab fragment with the desired specificity to a protein . “ adjuvant ” means a composition comprised of one or more substances that enhances the immunogenicity and efficacy of a vaccine composition . non - limiting examples of suitable adjuvants include squalane and squalene ( or other oils of animal origin ); block copolymers ; detergents such as tween ®- 80 ; quil ® a , mineral oils such as drakeol or marcol , vegetable oils such as peanut oil ; corynebacterium - derived adjuvants such as corynebacterium parvum ; propionibacterium - derived adjuvants such as propionibacterium acne ; mycobacterium bovis ( bacillus calmetic and guerinn or bcg ); interleukins such as interleukin 2 and interleukin - 12 ; monokines such as interleukin 1 ; tumour necrosis factor ; interferons such as gamma interferon ; combinations such as saponin - aluminium hydroxide or quil - a aluminium hydroxide ; liposomes ; iscom adjuvant ; mycobacterial cell wall extract ; synthetic glycopeptides such as muramyl dipeptides or other derivatives ; avridine ; lipid a ; dextran sulfate ; deae - dextran or dhae - dextran with aluminium phosphate ; carboxypolymethylene such as carbopol &# 39 ; ema ; acrylic copolymer emulsions such as neocryl a640 ( e . g . u . s . pat . no . 5 , 047 , 238 ); vaccinia or animal posvirus proteins ; sub - viral particle adjuvants such as cholera toxin , or mixtures thereof . as used herein , stringent conditions are those that ( 1 ) employ low ionic strength and high temperature for washing , for example , 0 . 015 m nacl / 0 . 0015 m sodium citrate / 0 . 1 % nadodso4 at 50 ° c . ; ( 2 ) employ during hybridisation a denaturing agent such as formamide , for example , 50 % ( vol / vol ) formamide with 0 . 1 % bovine serum albumin , 0 . 1 % ficoll , 0 . 1 % polyvinylpyrrolidone , 50 mm sodium phosphate buffer at ph 6 . 5 with 750 mm nacl , 75 mm sodium citrate at 42 ° c . ; or ( 3 ) employ 50 % formamide , 5 × ssc ( 0 . 75 m nacl , 0 . 075 m sodium citrate ), 50 mm sodium phosphate ( ph 6 . 8 ), 0 . 1 % sodium pyrophosphate , 5 × denhardt &# 39 ; s solution , sonicated salmon sperm dna ( 50 μg / ml ), 0 . 1 % sds and 10 % dextran sulfate at 42 ° c . in 0 . 2 × ssc and 0 . 1 % sds as will be understood the present invention includes within its scope dna vaccination . further information regarding dna vaccination may be found in donnelly et al , journal of immunological methods 176 ( 1994 ) 145 - 152 , the disclosure of which is incorporated herein by reference . throughout this specification the word “ comprise ”, or variations such as “ comprises ” or “ comprising ”, will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer , or group of elements or integers . to determine the dna sequence of p . gingivalis genomic dna was isolated from p . gingivalis strain w50 ( atcc 53978 ) essentially by the method described by mamur j . ( j . mol . biol . 3 , 208 - 218 , 1961 ). cloning of dna fragments was performed essentially as described by fleischmann et al ., ( science ; 269 , 496 - 512 , 1995 )( 2 ). briefly , purified genomic dna from p . gingivalis was nebulized to fragment the dna and was treated with bal31 nuclease to create blunt ends then run twice through preparative 1 % agarose gels . dna fragments of 1 . 6 - 2 . 0 kb were excised from the gel and the dna recovered . this dna was then ligated to the vector puc18 ( smai digested and dephosphorylated ; pharmacia ) and electrophoresed through a 1 % preparative agarose gel . the fragment comprising linear vector plus one insert was excised , purified and this process repeated to reduce any vector without insert contamination . the recovered vector plus insert dna was blunt - ended with t4 dna polymerase , then a final ligation to produce circular dna was performed . aliquots of epicurian coli electroporation - competent cells ( stratagene ) were transformed with the ligated dna and plated out on sob agar antibiotic diffusion plates containing x - gal and incubated at 37 ° c . overnight . colonies with inserts appeared white and those without inserts ( vector alone ) appeared blue . plates were stored at 4 ° c . until the white clones were picked and expanded for the extraction of plasmid dna for sequencing . plasmid dna was prepared by picking bacterial colonies into 1 . 5 ml of lb , tb or sob broth supplemented with 50 - 100 ug / ml ampicillin in 96 deep well plates . plasmid dna was isolated using the qiaprep spin or qiaprep 96 turbo miniprep kits ( qiagen gmbh , germany ). dna was eluted into a 96 well gridded array and stored at − 20 c . sequencing reactions were performed using abi prism dye terminator and abi prism bigdye terminator cycle sequencing ready reaction kits with amplitaq dna polymerase fs ( pe applied biosystems , foster city , calif .) using the m13 universal forward and reverse sequencing primers . sequence reactions were conducted on either a perkin - elmer geneamp 9700 ( pe applied biosystems ) or hybaid pcr express ( hybaid , uk ) thermal cyclers . sequencing reactions were analysed on abi prism 377 dna sequencers ( pe applied biosystems ). the sequences obtained are set out below . the relationship between these sequences is set out in table 1 . the initiation codon was calculated using a combination of sequence homology alignment ( fasta ), signal sequence prediction ( psort , signalp ) or orf prediction ( genemark ). dna files in fasta format were converted to gcg format files and imported into a database . the dna files were translated into amino acid files using the program flip obtained from angis ( australian genomic information service , university of sydney , australia ). a series of bioinformatic analyses were performed on the proteins in order to select potential vaccine candidates . the programs used were fasta homology searching ( 1 ), psort ( 2 , 3 ), signalp ( 4 ), toppred ( 5 ), and genemark ( 6 ). the proteins and their bioinformatic results were stored in the custom written database for search and retrieval of proteins with the desired characteristics the fasta homology results for these proteins were then examined for any alignment with a protein suggesting surface location or vaccine efficacy . all proteins were searched for homology against a non - redundant bacterial protein database compiled by angis using the fasta algorithm . the settings used for the fasta searches were ktup = 2 , gap creation penalty =− 12 , gap extension penalty =− 2 , width for deriving alignment in opt = 16 and the blosum 50 scoring matrix . individual fasta search results were examined for significant homology by statistical probability and amino acid alignments . the results are set out in table 2 . protein files were then trimmed to the first , second , third , fourth and fifth methionine residues using a protein trimming program ( angis ). the trimmed proteins were then subjected to psort analysis for the detection of signal sequences and the prediction of cell location . proteins exhibiting a psort probability of outer membrane & gt ; 0 . 8 were considered to indicate surface localisation . a second signal sequence detection program signalp was also performed and , in certain instances , this program detected signals not identified with psort . all proteins identified by other methods were also analysed by psort and signalp . previously , the c - terminal amino acid of bacterial outer membrane proteins has been shown to be important for the assembly of the protein on the outer membrane ( 7 ). a typical structure definition for outer membrane proteins has been determined as the presence of a signal sequence at the n - terminus and a tyrosine or phenylalanine at the c - terminus . a number of the selected proteins exhibit this characteristic structure . the program toppred was used to determine the presence and number of membrane spanning domains ( msds ) and the presence of such sequences indicates a preference to be attached to membranes such as the outer membrane . the results of psort , signalp and toppred analyses with the c - terminal amino acids of the selected proteins are set out in table 3 . the 70 amino acids from the c - terminus of a number of p . gingivalis outer membrane proteins share 50 - 100 % protein sequence identity . these proteins included rgp1 , rgp2 , kgp , haga , hagc , hagd , prth and prtt . this conserved motif may be involved in the attachment or sorting of proteins to the outer membrane . the protein data set was searched using fasta homology as described above and a number of novel proteins were identified which demonstrate similar motifs at their c - termini . the results are listed in table 4 the tonbiii box is a 30 amino acid motif present within tonb outer membrane receptors in a wide variety of bacteria . the tonbiii box of p . gingivalis ( 8 ) was used to search the protein data set for homology by fasta as described above . those proteins demonstrating significant homology are listed in table 5 . oligonucleotides to the 5 ′ and 3 ′ regions of the deduced protein were used to amplify the gene of interest from a preparation of p . gingivalis w50 genomic dna using the taqplus precision pcr system ( stratagene ) and a ptc - 100 ( mj research ) thermal cycler or similar device . the 5 ′ oligonucleotide primer sequence was gcgccatatgctggccgaaccggcc ( seq id no : 149 ) the 3 ′ oligonucleotide primer sequence was gcgcctcgagtcaattcatttccttatagag ( seq id no : 150 ). the pcr fragment was purified , digested with nde i , xho i restriction enzymes ( promega ) and ligated into the corresponding sites of the plasmid pproex - 1 ( gibco - brl ) and transformed into e . coli er1793 cells ( a gift from elizabeth raleigh , new england biolabs ). a resulting clone expressing the correct insert was selected and induced with or without 0 . 1 mm iptg ( promega ) for expression of the recombinant protein . expression of the recombinant protein was determined by sds - page analysis and western blot using the one of the rabbit antisera described above or an anti - hexahistidine antibody ( clontech ) that detects the hexahistidine tag that was fused to the p . gingivalis recombinant protein . pg1 was purified by disruption of the e . coli cells by sonication in binding buffer ( novagen ) and solubilisation by the addition of sarkosyl ( n - lauroyl sarcosine ) to a 1 % final concentration . there after the preparation was diluted to 0 . 1 % sarkosyl in binding buffer , bound to a nickel - nitrilotriacetic acid column ( ni - nta ; qiagen ), after washing bound proteins were eluted with 1m imidazole in elution buffer ( novagen ) according to the qiagen recommendations with 0 . 1 % sarkosyl added to all buffers . following purification samples were dialysed against 500 mm nacl , 20 mm tris , 0 . 1 % sarkosyl at ph7 . 4 to remove the imidazole , concentrated as required and stored at 4 ° c . until used . purity and antigenicity were assessed by sds - page and western blot using selected antisera ( from those described above ) and the protein concentration was determined by the bca assay ( pierce ). the methods used for pg2 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcggtatacatgaaaagaatgacgc ( seq id no : 151 ), the 3 ′ oligonucleotide primer sequence was cgcgagatctgaaagacaactgaatacc ( seq id no : 152 ) and the pcr product was cloned into pgex - stop rbs ( iv ) ( patent application wo9619496 , j c cox , s e edwards , i frazer and e a webb . variants of human papilloma virus antigens ) using the bstz 171 and bgl ii restriction sites . 2 % sarkosyl was used to solubilise pg2 and 8m urea was added to the solubilisation buffer and to all other buffers . urea was removed from the purified protein by sequential dialysis ( 4m then 2m then 1m then 0 . 5m then 0m urea all in 50 mm tris , 500 mm nacl , 0 . 1 % sarkosyl , ph7 . 4 ). purified protein was stored at 4 ° c . until required . the methods used for pg3 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgcgtatacatgaagaaatcaagtgtag ( seq id no : 153 ), the 3 ′ oligonucleotide primer sequence was gcgcagatctcttcagcgtaccttgctgtg ( seq id no : 154 ) and dna was amplified with pfu dna polymerase ( stratagene ). the pcr product was cloned directly into pcr - blunt and transformed into e . coli top10f ′( invitrogen ) before subcloning into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli bl21de3 ( pharmacia biotech ). the following modifications were made to the purification of pg3 from the pg1 method . cells expressing the recombinant protein were disrupted by sonication in binding buffer and the insoluble inclusion bodies concentrated by centrifugation . inclusion bodies were then solubilised in 6m urea ( sigma ) in binding buffer and eluted with 6m urea added to the elution buffer . in some instances 6m guanidine hydrochloride ( sigma ) was used instead of urea for these steps . urea ( or guanidine hydrochloride when it was substituted ) was removed from the purified protein by sequential dialysis against reducing levels of urea ( 3m then 1 . 5m then 0 . 5m then 0m urea all in 50 mm tris , 500 mm nacl , 8 % glycerol , ph7 . 4 ). purified protein was stored frozen at − 80 ° c . until required . protein concentration was determined by the coomassie plus protein assay ( pierce ). the methods used for pg4 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cttctgtatacttacagcggacatcataaaatc ( seq id no : 155 ), the 3 ′ oligonucleotide primer sequence was ttccaggagggtaccacgcaactcttcttcgat ( seq id no : 156 ) and dna was amplified with the tth xl pcr kit ( perkin elmer ). the pcr product was cloned into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and kpn i restriction sites and transformed into e . coli er1793 . the methods used for pg5 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was ttgcaacatatgatcagaacgatactttca ( seq id no : 157 ) the 3 ′ oligonucleotide primer sequence was agcaatctcgagcggttcatgagccaaagc ( seq id no : 158 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24 ( novagen ) using the nde i and xho i restriction sites and transformed into e . coli bl21 ( pharmacia biotech ). removal of urea was not proceeded past 1m urea as the protein was insoluble at lower concentrations of urea . purified protein was stored at 4 ° c . until required . the methods used for pg6 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was taaacatatgtgcctcgaacccataattgctccg ( seq id no : 159 ), the 3 ′ oligonucleotide primer sequence was cgtccgcggaagctttgatcggccattgctact ( seq id no : 160 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the nde i and hind iii restriction sites and transformed into e . coli bl21 . the methods used for pg8 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcggtatacatggagttcaagattgtg ( seq id no : 161 ), the 3 ′ oligonucleotide primer sequence was cgcgagatctgttttctgaaagcttttc ( seq id no : 162 ) and dna was amplified with the taqplus precision pcr system . the pcr product was cloned into the expression plasmid pproex - 1 using the nde i and xho i restriction sites and transformed into e . coli er1793 . pg8a is a shortened version of pg8 and has the first 173 amino acids removed . the methods used for pg8a were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcggtatacatggaaaacttaaagaac ( seq id no : 163 ), the 3 ′ oligonucleotide primer sequence was cgcgagatctgttttctgaaagcttttc ( seq id no : 164 ) and dna was amplified with the taqplus precision pcr system . the pcr product was cloned into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli er1793 . prior to dialysis of the purified protein edta ( sigma ) was added to a final concentration of 10 mm . the methods used for pg10 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcggatatcatggataaagtgagctatgc ( seq id no : 165 ), the 3 ′ oligonucleotide primer sequence was cgcgagatcttttgttgatactcaataattc ( seq id no : 166 ) and dna was amplified with the taqplus precision pcr system . the pcr product was digested with eco rv and bgl ii and ligated into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli er1793 . the methods used for pg11 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgcgtatacatgagagcaaacatttggcagatactttccg ( seq id no : 167 ), the 3 ′ oligonucleotide primer sequence was gcgcagatctgcgcaagcgcagtatatcgcc ( seq id no : 168 ) and dna was amplified with tli dna polymerase ( promega ). the pcr product was cloned into pcr - blunt and transformed into e . coli top10f ′ before subcloning into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli er1793 . pg11 was purified by solubilisation of e . coli cells with 2 % sarkosyl in binding buffer ( qiagen ) which was diluted to 0 . 1 % sarkosyl in binding buffer , bound to a nickel - nitrilotriacetic acid column ( ni — nta ; qiagen ), after washing bound proteins were eluted with 1m imidazole ( 0 . 7 % chaps ( sigma ) in elution buffer ; qiagen ) according to the qiagen recommendations . following purification samples were dialysed against 500 mm nacl , 20 mm tris , 0 . 7 % chaps , 20 % glycerol ( sigma ) at ph7 . 4 to remove the imidazole , concentrated as required and stored at 4 ° c . until used . the methods used for pg12 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgcgtatacatgaatagcagacatctgacaatcacaatcattgccgg ( seq id no : 169 ), the 3 ′ oligonucleotide primer sequence was gcgcagatctgctgttctgtgagtgcagttgtttaagtg ( seq id no : 170 ) and dna was amplified with tli dna polymerase . the pcr product was cloned into pcr - blunt and transformed into e . coli top10f ′ cells before subcloning into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli bl21 . purification of the recombinant protein was essentially the same as pg11 except 0 . 5 % dhpc ( 1 , 2 - diheptanoyl - sn - glycero - 3 - phosphocholine ; avanti ) in 50 mm tris , 50 mm nacl , ph8 . 0 was used to solubilise the inclusion bodies instead of sarkosyl and the dhpc was diluted to 0 . 1 % before addition to the ni — nta and 0 . 1 % dhpc was added to all buffers . the methods used for pg13 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgccatatgcggacaaaaactatcttttttgcg ( seq id no : 171 ), the 3 ′ oligonucleotide primer sequence was gcgcctcgaggttgttgaatcgaatcgctatttgagc ( seq id no : 172 ) and dna was amplified with tli dna polymerase . the pcr product was cloned the expression plasmid pet24b using the nde i and xho i restriction sites and transformed into e . coli bl21 . purification of the recombinant protein was essentially the same as pg3 using 6m urea and 1 % nog ( n - octyl glucoside ; sigma ) was added to the dialysis buffer . removal of urea was not proceeded past 2m urea as the protein was insoluble at lower concentrations of urea . purified protein was stored at 4 ° c . until required . the methods used for pg12 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgcggcgccatgacggacaacaaacaacgtaatatcg ( seq id no : 173 ), the 3 ′ oligonucleotide primer sequence was gcgcctcgagttacttgcgtatgatcacggacataccc ( seq id no : 174 ) and dna was amplified with tli dna polymerase . the pcr product was cloned the expression plasmid pproex - 1 using the ehe i and xho i restriction sites and transformed into e . coli bl21 . purification of the recombinant protein was essentially the same as pg12 . the methods used for pg22 were essentially the same as for pg1 with the following exceptions . the 5 ′ oligonucleotide primer sequence was ccccggatccgatgcgactgatcaaggc ( seq id no : 175 ), the 3 ′ oligonucleotide primer sequence was ccccctcgagcggaacggggtcatagcc ( seq id no : 176 ) and dna was amplified with the taqplus precision pcr system . the pcr product was cloned into the expression plasmid pet24b using the bam hi and xho i restriction sites and transformed into e . coli bl21de3 . once pg22 was purified dialysis was performed in the same manner as for pg1 but in the presence of 1m imidazole . the methods used for pg24 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcggtatacatgaattacctgtacatac ( seq id no : 177 ), the 3 ′ oligonucleotide primer sequence was cgcgggatccgttcgattggtcgtcgatgg ( seq id no : 178 ) and dna was amplified with the taqplus precision pcr system . the pcr product was digested with bst z171 and bam hi and ligated into the expression plasmid pgex - stop rbs ( iv ) using the bst z171 and bgl ii restriction sites and transformed into e . coli er1793 . due to the low level of expression of pg24 purification was not proceeded with except on small scale . a modified version of pg24 was also cloned and expressed . pg24a is the same as pg24 with the predicted n - terminal sequence removed . the methods used for pg24a were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was cgcgcatatggagattgctttcctttcttcg ( seq id no : 179 ), the 3 ′ oligonucleotide primer sequence was cgcgctcgagttagttcgattggtcgtcg ( seq id no : 180 ) and dna was amplified with the taqplus precision pcr system . the pcr product was cloned into the expression plasmid pproex - 1 using the nde i and xho i restriction sites and transformed into e . coli er1793 . purification of the recombinant protein was essentially the same as pg3 except 8m urea was used to solubilise the inclusion bodies and in the buffers used for the ni — nta column purification . urea was removed by sequential dialysis ( 4m then 2m , then 1m then 0 . 5m then 0m urea all in 50 mm tris , 500 mm nacl , 8 % glycerol , ph7 . 4 ). purified protein was stored frozen at − 80 ° c . until required . the methods used for pg29 were essentially the same as for pg3 with the following exceptions . the 5 ′ oligonucleotide primer sequence was gcgcgatatcgctagcatgaaaaagctatttctc ( seq id no : 181 ), the 3 ′ oligonucleotide primer sequence was gcgcagatctctcgagtttgccatcggattgcggattg ( seq id no : 182 ) and dna was amplified with pfu dna polymerase being used . the pcr product was cloned into pcr - blunt ( invitrogen ) and transformed into e . coli top10f ′ before subcloning into the expression plasmid pgex - stop rbs ( iv ) using the ecor v and bgl ii restriction sites and transformed into e . coli bl21 . 6m urea was used throughout the purification process . the methods used for pg54 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was cgctgaattccagatttcgttcggaggggaaccc ( seq id no : 183 ), the 3 ′ oligonucleotide primer sequence was ctatgcggccgcctgcttcacgatcttttggctca ( seq id no : 184 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg57 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was tgctggatcccaagagatctcaggcatgaatgca ( seq id no : 185 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctcggcctctttatctctaccttttc ( seq id no : 186 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the bam hi and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg68 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was gcttgcggccgcccttatgaaagatttgcagat ( seq id no : 187 ), the 3 ′ oligonucleotide primer sequence was ggtgctcgagtatactcaacaagcaccttatgcac ( seq id no : 188 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the not i and xho i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg75 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was ggcgggatccgctcaggagcaactgaatgtggta ( seq id no : 189 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctgtggaacaaattgcgcaatccatc ( seq id no : 190 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the bam hi and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg76 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was agcagaattcggaaacgcacagagcttttgggaa ( seq id no : 191 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgcttacctgcaccttatgactgaatac ( seq id no : 192 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg91 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was tgctgaattccagacgatgggaggagatgatgtc ( seq id no : 193 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctttccacgatgagcttctctacgaa ( seq id no : 194 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg94 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was ggccgagctccaagaggaaggtatttggaatacc ( seq id no : 195 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctttgtcctaccacgatcattttctt ( seq id no : 196 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg96 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was tgctgagctccaaacgcaaatgcaagcagaccga ( seq id no : 197 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgcttttgagaattttcattgtctcacg ( seq id no : 198 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the sac i and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg97 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was ggcgggatcccagtttgttccggctcccaccaca ( seq id no : 199 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctctgtttgatgagcttagtggtata ( seq id no : 200 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the bam hi and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg98 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was agcagaattccaagaaagagtcgatgaaaaagta ( seq id no : 201 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgcttagctgtgtaacattaagttttttattgat ( seq id no : 202 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg99 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was tgctgaattcaaggacaattcttcttacaaacct ( seq id no : 203 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgcttcgaatcacgacttttctcacaaa ( seq id no : 204 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg100 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was ggcagaattccagtctttgagcacaatcaaagta ( seq id no : 205 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctgatagccagcttgatgctcttagc ( seq id no : 206 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg102 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was ggccgaattccagatggatattggtggagacgat ( seq id no : 207 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgctctctacaatgattttttccacgaa ( seq id no : 208 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the eco ri and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . the methods used for pg104 were essentially the same as for pg3 with the following exceptions . the predicted n - terminal signal sequence was removed from the recombinant protein . the 5 ′ oligonucleotide primer sequence was gaacggatccaacgtgtctgctcagtcaccccga ( seq id no : 209 ), the 3 ′ oligonucleotide primer sequence was gagtgcggccgcttctgagcgatacttttgcacgtat ( seq id no : 210 ) and dna was amplified with the tth xl pcr kit . the pcr product was cloned into the expression plasmid pet24a using the bam hi and not i restriction sites and transformed into e . coli bl21de3 . expression studies and immunoreactivity studies were carried out on whole e . coli lysates . purification was not done for these studies . various antisera were raised for detecting the expression and refolding of the recombinant p . gingivalis proteins . a whole cell antisera was raised by injecting new zealand white rabbits with 3 doses of sonicated p . gingivalis ( strain w50 ) containing approximately 2 mg of protein . the first dose was given in freunds complete adjuvant ( fca ) and the second and third doses were given in freunds incomplete adjuvant ( ifa ) at 3 week intervals . doses ( 1 ml ) were given intramuscularly into the hind legs and rabbits bled 7 days after the last dose , the blood clotted and serum removed and stored at − 20 ° c . until required . a second rabbit antisera was produced in a similar manner but using a sarkosyl insoluble fraction ( each dose was 0 . 69 mg of protein ) derived from p . gingivalis w50 according to the method of doidg and trust t . et al 1994 as the immunogen . a third rabbit antisera was produced in a similar manner to the first only the sarkosyl soluble fraction ( 1 mg of protein per dose ) derived from p . gingivalis w50 cells according to the method of doidg p . and trust t j . ( 1994 infect immun 62 : 4526 - 33 ) was used as the immunogen . a “ protected rat serum ” pool was also used in these studies and was obtained from rats immunised with formalin killed whole p . gingivalis cells in fia ( strain atcc 33277 ; 2 doses of 2 × 10 9 cells , 3 weeks apart ). rats were then challenged 2 weeks after their last dose with live p . gingivalis cells ( strain 33277 ) given orally as previously described ( klaussen b . et al . 1991 , oral microbiol immunol 6 : 193 - 201 ) and the serum obtained from these rats 6 weeks after the final challenge inoculation at the time of sacrifice . human sera were obtained from adult patients undergoing treatment or assessment for periodontitis at an outpatient clinic . these patients had at least 6 teeth with 6 mm attachment loss and had p . gingivalis present in their sub - gingival plaque as detected using a p . gingivalis specific dna probe . sera was pooled from these patients and compared to a pool of sera from periodontally healthy patients . the mouse abscess model was used to assess the efficacy of immunising mice with recombinant p . gingivalis proteins in protecting mice from formation of a subcutaneous abscess . this model has been used by others as a predictor of potential vaccines against periodontal disease ( bird p s , et al . 1995 j . periodontol . 66 : 351 - 362 . balb / c mice 6 - 8 weeks old were immunised by subcutaneously injecting them with 0 . 1 ml containing either 10 or 20 μg of recombinant p . gingivalis protein , 20 μg of e . coli lysate protein , 2 × 10 9 formalin killed cells of p . gingivalis strain 33277 emulsified in incomplete freund &# 39 ; s adjuvant ( ifa ; sigma ) on day 0 . at day 21 mice were re - injected with the same dose and then bled 1 week later and evaluated for antibody levels . at day 35 mice all mice were challenged with approximately 2 × 10 9 cells of live p . gingivalis ( atcc 33277 ) by subcutaneous injection in the abdomen . following challenge mice were monitored daily for weight loss and the size of the lesion measured for the next 10 days . lesion sizes were measured by length and width and expressed as mm 2 . groups were statistically analysed using a kruskal - wallis one - way anova and were also individually examined using the unpaired t test or mann - whitney rank sum test using the instat statistical package . fig1 shows the results of one experiment at day 4 after challenge ( lesions were at maximum size at this time point ). control mice immunised with e . coli lysate showed large lesions while mice immunised with killed cells of p . gingivalis strain 33277 were fully protected . this indicates that whole cells provide protection against p . gingivalis while e . coli protein immunised mice were not protected . mice given the various pg recombinant proteins showed significant levels of protection for pg2 , pg22 , pg24 and pg29 ( p & lt ; 0 . 05 unpaired t test ) while pg8a was not quite significantly different ( p = 0 . 07 ) compared to the e . coli control group . fig2 shows the results of a separate experiment using combinations of recombinant proteins . mice given pg1 + pg2 showed a significant level of protection compared to control mice give e . coli lysate ( p & lt ; 0 . 026 unpaired t test ). cloned candidates were cultured in 15 ml of terrific broth , induced with iptg and sampled at 4 h post - induction . one ml of culture was removed , pelleted and the cells resuspended in a volume of pbs determined by dividing the od a 600nm of the culture by 8 . an aliquot of lysate ( 100 μl ) was added to 100 μl of 2 × sample reducing buffer ( 125 mm tris ph 6 . 8 , 20 % glycerol , 4 % sds , 80 mm dtt , 0 . 03 % bromophenol blue ) and boiled for 10 min . sds - page was performed according to the method of laemmli uk . 1970 ( nature 227 : 680 - 685 ) using 4 - 20 % 1 . 0 mm tris - glycine gels ( novex ) according to the manufacturers recommendations . proteins were transferred onto hybond - c extra nitrocellulose membranes ( amersham ) by transblotting and the membranes were then blocked for 2 h at room temperature ( rt ) in 5 % skim milk in 20 mm tris , 0 . 5m nacl , 0 . 05 % tween - 20 , ph 7 . 5 ( ttbs ). immunoscreening was performed separately with the rabbit anti - p . gingivalis whole cell serum , the rat protective serum , a pool of human periodontal patients serum , and in many cases an anti - t7 - tag antibody hrp conjugate ( novagen ). prior to use , the rabbit , rat and human sera were diluted 1 / 5000 , 1 / 1000 and 1 / 500 respectively in 5 % skim milk in ttbs and absorbed with 100 μl ( for the rabbit serum ) or 250 μl ( for the rat and human sera ) e . coli extract ( 20 mg / ml ; promega ) for 6 h at rt . membranes were incubated overnight at rt with the absorbed antisera , or for 1 hr at rt with 1 / 5000 diluted anti - t7 - tag conjugate . following 3 × 10 min washes with ttbs , hrp - conjugated anti - rabbit ( silenus ), anti - mouse ( silenus ) or anti - human ( kpl ) antibody , diluted 1 / 5000 in 5 % skim milk in ttbs , was added for 1 h at rt . membranes were washed as before , prior to addition of tmb membrane peroxidase substrate ( kpl ) for detection of immunoreactive proteins . results of reactivity for the recombinant p . gingivalis proteins is shown in table 7 . in addition some of the sera ( pooled sera diluted 1 / 1000 ) from the mice immunised with p . gingivalis recombinant proteins ( prior to challenge ) were analysed for their reactivity against western blots of whole native w50 p . gingivalis proteins using similar techniques as those outlined above . pg2 , pg8a , pg29 and pg3 all showed bands at a similar molecular weight to that of the recombinant pg protein in the native w50 blot . this indicates that pg proteins are expressed in the w50 strain and that the recombinant proteins have at least some identical immunogenicity to the native proteins . p . gingivalis w50 cells ( 150 ml culture ) were grown anaerobically to mid log phase ( od a 600 = 0 . 18 ) mixed with 50 % glycerol and stored at − 70 ° c . until rna extraction . cells were pelleted by centrifugation at 6000 g , and resuspended in 8 ml ase ( 20 mm naoac , 0 . 5 % sds , 1 mm edta ). an equal volume of 20 mm naoac ( ph 4 . 5 )- saturated phenol was added and mixed by shaking for 30 seconds , incubated at 65 ° c . for 5 minutes , followed by a further 5 second shaking and repeated incubation . after cooling , 2 ml chloroform was added and mixed by shaking for 5 seconds , and the mixture spun at 10000 g for 10 minutes at 4 ° c . the top aqueous phase was transferred and re - extracted by repeating the phenol and chloroform steps . the aqueous phase was transferred again and 100 u rnase inhibitor ( rnasin ; promega ) were added . rna was precipitated with 3 volumes 100 % ethanol at − 20 ° c . overnight . the rna precipitate was recovered by centrifugation at 10000 g at 4 ° c . for 15 minutes , then washed with 100 % ethanol , dried and resuspended in 600 μl sterile , deionised , dh 2 o with 1 μl of fresh rnase inhibitor . rna was aliquoted and stored at − 70 ° c . the rna concentration was determined spectrophotometrically . a formaldehyde rna gel confirmed rna integrity ( sambrook j . et al . 1989 , molecular cloning . a laboratory manual . cold spring laboratory press , new york . 2nd edition ). the isolated rna was used as a template for reverse transcription ( rt ) to produce cdna . varying rna concentrations were used for the rt as each rna transcript was potentially present at different levels . subsequent amplification of the cdna was performed using polymerase chain reaction ( pcr ). rt - pcr was performed using geneamp ® rna pcr kit ( perkin elmer ) according to the manufacturer &# 39 ; s protocol with the following exception to the pcr ; 35 cycles were performed as follows : melt phase 95 ° c . for 30 seconds , anneal phase varied between 50 - 60 ° c . for 30 seconds , extension phase 72 ° c . for 1 minute . amplification was performed in a ptc - 100 programable thermal controller ( mj research inc .). as a control to demonstrate that the amplified product did not arise from contaminating dna , reverse transcriptase ( rtase ) was omitted from a parallel tube . the pcr products were examined against dna markers ( gibco 1 kb ladder ) on a 1 % agarose gel stained with ethidium bromide . rt - pcr results are shown in table 6 using the oligonucleotide primers as used in “ cloning , expression and purification of recombinant p . gingivalis genes ” section described above , except for the following changes . for pg1 the 3 ′ reverse primer used was gcgcctcgagattcatttccttatagag ( seq id no : 211 ), for pg4 the 5 ′ forward primer was cttcttgtcgactacagcggacatcataaaatc ( seq id no : 212 ) and the 3 ′ reverse primer was ttccacctcgagttaacgcaactcttcttcgat ( seq id no : 213 ), for pg6 the 5 ′ forward primer was taaagaattctgcctcgaacccataattgctccg ( seq id no : 214 ), for pg10 the 5 ′ forward primer was cgcgcatatggataaagtgagctatgc ( seq id no : 215 ) and the 3 ′ reverse primer was cgcgctcgagtttgttgatactcaataattc ( seq id no : 216 ), for pg13 the 5 ′ forward primer was gcccggcgccatgcggacaaaaactatcttttttgcg ( seq id no : 217 ) and the 3 ′ reverse primer was gcccggcgccttagttgttgaatcgaatcgctatttgagc ( seq id no : 218 ). amplification of p . gingivalis transcripts is a likely indication that rna for a specific candidate is present and that the protein is produced . however , where there is no amplification achieved this does not indicate that this gene is never transcribed and may be the result of the culture conditions or the state of the cells when harvested . it will be appreciated by persons skilled in the art that numerous variations and / or modifications may be made to the invention as shown in the specific embodiments without departing from the spirit or scope of the invention as broadly described . the present embodiments are , therefore , to be considered in all respects as illustrative and not restrictive . 1 . lipman d j , pearson w r . 1985 . rapid and sensitive protein similarity searches . science 277 : 1435 - 1441 . 2 . horton , p . and nakai , k . ( 1996 ). a probabilistic classification system for predicting the cellular localization sites of proteins . intellig . syst . mol . biol . 4 : 109 - 115 . 3 . nakai k , kanehisa m . 1991 . expert systems for predicting protein localization sites in gram - negative bacteria . proteins : structure , function , and genetics 11 : 95 - 110 . 4 . nielsen h , engelbrecht j , brunak s and von heijne g . 1997 . identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites . protein engineering 10 , 1 - 6 . 5 . claros m g and g von heijne . ( 1994 ). toppred ii : an improved software for membrane protein structure predictions . comput . appl . biosci . 10 : 685 - 686 . 6 . borodovsky m , rudd k e , and e v koonin . ( 1994 ). intrinsic and extrinsic approaches for detecting genes in a bacterial genome . nucleic acids res . 22 : 4756 - 4767 . 7 . struvye m , moons m , tommassen j . 1991 . carboxy - terminal phenylalanine is essential for the correct assembly of a bacterial outer membrane protein j . mol . biol . 218 : 141 - 148 . 8 . aduse - opoku j , slaney j m , rangarajan m , muir j , young k a , curtis m a . 1997 . the t1a receptor protein of porphyromonas gingivalis w50 : a homolog of the ri precursor ( prpri ) is an outer membrane receptor required for growth on low levels of hemin . j . bacteriol . 179 : 4778 - 4788 . 9 . needleman s b , munsch c d . 1970 . ageneral method applicable to the search of similarity in the amino acid sequence of two proteins . j . molec . biol . 48 : 443 - 453 .

US-38284509-A

antagonists of cation - independent mannose 6 - phosphate / insulin - like growth factor - ii receptor are provided for attenuation of ctgf signaling in a method of down - regulation of receptor signaling and downstream decreased signaling of connective tissue growth factor in ocular disorders involving inappropriate ctgf signaling . ocular disorders involving inappropriate ctgf signaling include ocular hypertension , glaucoma , glaucomatous retinopathy , optic neuropathy , macular degeneration , diabetic retinopathy , choroidal neovascularization , and proliferative vitreoretinopathy , for example . such disorders are treated by administering antagonists of the present invention .

mammalian cells possess two types of m6p receptors : the cation independent ( ci ) mannose 6 - phosphate receptor , also known as the insulin - like growth factor receptor ii ( igf - iir ) and the cation - dependent mannose 6 - phosphate receptor . embodiments of the present invention relate to antagonizing ctgf signaling activity mediated via the cation - independent mannose 6 - phosphate / insulin - like growth factor - ii receptor for the prevention and treatment of ctgf - related ocular disorders . ci - m6p / igf2r is an oligomeric ≈ 250 - 300 - kda multifunctional transmembrane glycoprotein having binding sites for a variety of ligands including mannose - 6 - phosphate , igf2 , urokinase - type plasminogen activator ( upa ) receptor , plasminogen , latent tgfβ , retinoic acid , and granzyme b . the receptor has a signal sequence , an extra - cytoplasmic domain including 15 conserved regions , a transmembrane region , and a cytoplasmic domain . the receptors are primarily present intracellularly and the rest are present at the cell surface . the extracellular receptors bind extracellular ligands , such as igf2 thereby mediating endocytosis of igf2 , for example . the intracellular receptors are involved in the sorting and transporting of m6p - bearing glycoproteins from the trans - golgi network to endosomes . in the absence of m6p receptors , m6p - containing glycoproteins are generally secreted from the cell . the ci - m6p / igf2r also participates in activation of latent transforming growth factor possibly via uptake of upa , which may mediate conversion of plasminogen to plasmin , resulting in the activation of tgfβ . further contributing to the multifunctional nature of the ci - m6p / igf2r is the reported identification of the ctgf receptor in corneal fibroblasts as the type ii igf receptor ( t . blalock , ph . d . thesis , univ . of florida , august 2003 ). tgfβ is known to increase the expression of ctgf ( xin et al ., jbc , vol . 279 ( 34 ): 35255 - 35262 , 2004 ; katsuma et al ., febs letters , vol . 579 : 2576 - 2582 , 2005 ), a protein that appears to be a key player in the glaucoma process ( international patent application no . pct / us2003 / 012521 to fleenor et al . published nov . 13 , 2003 as wo 03 / 092584 and assigned to alcon , inc .). significantly higher levels of tgfβ2 isoform has been found in aqueous humor collected from glaucomatous human eyes as compared to “ normal ” eyes ( tripathi et al ., exp eye res , vol . 59 ( 6 ): 723 - 727 , 1994 ; inatani et al ., graefes arch clin exp ophthalmol , vol . 239 ( 2 ): 109 - 113 , 2001 ; picht et al ., graefes arch clin exp ophthalmol , vol . 239 ( 3 ): 199 - 207 , 2001 ; ochiai et al ., japan j ophthalmol , vol . 46 ( 3 ): 249 - 253 , 2002 ). furthermore , tgfβ2 is able to provoke substantial increases in iop in a perfused human anterior segment model ( fleenor et al ., invest ophthalmol vis sci , vol . 47 ( 1 ): 226 - 234 , 2006 ). therefore , tgfβ , in particular tgfβ2 , appears to have a causative role in iop - related disorders such as glaucoma . the present inventors provide herein methods for targeting the downstream effects of ctgf action in ocular disorders such as glaucoma by interfering with the binding of ctgf to the ci - m6p / igf2r or interfering with the subsequent signaling of the complex . while not wanting to be bound by theory , a feedback scheme for signaling is provided as follows . ctgf may interact with ci - m6p / igf2r either on the cell surface or intracellularly in the er - golgi . inhibition of ctgf binding and / or signaling via the ci - m6p / igf2r is provided herein as decreasing levels of active tgfβ , thereby interfering with the positive feedback in the scheme provided supra , and is useful in ocular disorders having inappropriate ctgf signaling such as in glaucoma , cnv , amd , and dr , particularly proliferative dr . inhibition of igf2 binding and / or signaling via the ci - m6p / igf2r is also provided since igf2 binds to the receptor , albeit to a different domain . antagonists of cation - independent mannose 6 - phosphate / insulin - like growth factor - ii receptor ( ci - m6p / igfii - r ): antagonists of the cation - independent mannose 6 - phosphate / insulin - like growth factor - ii receptor include agents that attenuate binding affinity or specificity between the receptor and its binding ligands , ctgf , igf - 2 , or latent tgfβ2 . antagonists include a mannose 6 - phosphate analog , fructose - 1 - phosphate , a fructose - 1 - phosphate analog , a polysulfonated naphthylurea such as suramin ( most commonly available as the hexasodium salt ), a polynucleotide , peptide , peptidomimetic , antibody , or biologically active fragment thereof having binding specificity and affinity for the ci - m6p / igfii receptor or one of its binding ligands , ctgf , igf - 2 , or latent tgfβ2 ; or a pharmaceutically acceptable salt or prodrug of an antagonist . antagonists may cause an inhibition of the constitutive activity of the receptor ; such drugs are not technically antagonists but are agonists with a negative intrinsic activity . these drugs are called inverse agonists and are included in the term “ antagonist ,” as used herein . that is , an antagonist may be an agent that stabilizes an inactive form of the ci - m6p / igf2r and thereby prevents signaling of the basal or the ligand - bound receptor . as used herein , a “ pharmaceutically acceptable salt ” refers to a salt of an antagonist that retains the function of the ci - m6p / igfii receptor antagonist and that is compatible with administration as desired . a salt may be formed from an acid or a base depending upon the nature of the antagonist . a salt may be formed with an acid such as acetic acid , benzoic acid , cinnamic acid , citric acid , ethanesulfonic acid , fumaric acid , glycolic acid , hydrobromic acid , hydrochloric acid , maleic acid , malonic acid , mandelic acid , methanesulfonic acid , nitric acid , oxalic acid , phosphoric acid , propionic acid , pyruvic acid , salicylic acid , succinic acid , sulfuric acid , tartaric acid , p - toluenesulfonic acid , trifluoroacetic acid , and the like . a salt may be formed with a base such as a primary , secondary , or tertiary amine , aluminum , ammonium , calcium , copper , iron , lithium , magnesium , manganese , potassium , sodium , zinc , and the like . as used herein , the term “ prodrug ” refers to a derivative of an antagonist that has minimal therapeutic activity until it is converted to its desired biologically active form . a prodrug is an antagonist having one or more functional groups or carriers covalently bound thereto , which functional groups or carriers are removed from the compound by metabolic processes within the body to form the respective bioactive antagonist . prodrugs of antagonists of the present invention are prepared by modifying functional groups present in the antagonists in such a way that the modifications are hydrolyzed , oxidized , or otherwise reacted , either in routine manipulation or in vivo , to yield the desired antagonist . prodrugs include alcohols , amides , amines , carbamates , carbonates , esters , nitrites , nitrates , nitroso , sulfates , sulfites , sulfhydryl , ureides , and phosphate derivatives , for example . in an embodiment of the invention , the antagonist is a mannose - 6 - phosphate analog having structure i : r 1 is c 1 - c 3 alkyl , c 1 - c 3 hydroxyalkyl , c 1 - c 3 haloalkyl , c 2 - c 3 alkenyl , c 2 - c 3 alkoxy or c 2 - c 3 haloalkenyl ; x 1 is phosphonate , phosphate analog , sulfate , sulfonate , carboxy , di - carboxy or monoester thereof , and r 2 is hydroxy , cyano ; or optionally substituted c 2 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 2 - c 20 alkoxy , aryl , heteroaryl , aryl ( c 1 - c 20 ) alkyl , heteroaryl ( c 1 - c 20 ) alkyl , ( c 1 - c 20 ) oxyalkyl , ( c 1 - c 20 ) alkylamido , ( c 1 - c 20 ) alkylamino , or ( c 1 - c 20 ) alkylcarboxy . the dotted lines of structure i indicate that r 2 is axial or equatorial . in one embodiment of the invention , the antagonist has structure i where r 1 is c 1 - c 2 alkyl , x 1 is phosphonate or carboxy , and r 2 is hydroxy or methoxy . in another embodiment of the invention r 1 is c 2 haloalkyl , c 1 hydroxyalkyl , c 2 alkenyl or c 2 haloalkenyl ; x 1 is phosphonate ; and r 2 is hydroxyl or methoxy . in another embodiment of the invention , the antagonist is fructose 1 - phosphate , or a fructose - 1 - phosphate analog having structure ii : r 1 is c 1 - c 3 alkyl , c 1 - c 3 hydroxyalkyl , c 1 - c 3 haloalkyl , c 2 - c 3 alkenyl , c 2 - c 3 alkoxy or c 2 - c 3 haloalkenyl ; x 1 is phosphonate , phosphate analog , sulfate , sulfonate , carboxy , di - carboxy or monoester thereof , and r 2 is hydroxy , cyano ; or optionally substituted c 2 - c 20 alkyl , c 2 - c 20 alkenyl , c 2 - c 20 alkynyl , c 2 - c 20 alkoxy , aryl , heteroaryl , aryl ( c 1 - c 20 ) alkyl , heteroaryl ( c 1 - c 20 ) alkyl , ( c 1 - c 20 ) oxyalkyl , ( c 1 - c 20 ) alkylamido , ( c 1 - c 20 ) alkylamino , or ( c 1 - c 20 ) alkylcarboxy . the dotted lines of structure ii indicate that r 1 x 1 and r 2 may be axial or equatorial . one of ordinary skill in the art would realize that fructose derivatives may adopt a 5 - membered ring configuration in addition to the 6 - membered ring configuration shown above . as used herein “ phosphate analog ” includes the terms phosphorothioate , - dithioate , - selenoate , - diselenoate , - anilothioate , - anilidate , - amidate , or boron phosphate , for example . representative examples of alkyl , alkenyl , and alkynyl groups include straight - chain , branched or cyclic isomers . a substituted alkyl has one or more functional groups as substituents . among the halo substituents , fluoro , chloro , and bromo are particularly contemplated herein . the term “ hydroxyalkyl ” is meant to include alcohols , glycols and diols of alkyls . representative examples of alkoxy groups include the alkyl groups as herein described having ether linkages . an assay for identifying further antagonists of ci - m6p / igf2 receptor uses a competitive binding assay which may comprise combining a candidate antagonist , labeled ctgf or igf - 2 , ci - m6p / igf2 receptor and measuring the amount of labeled material associated with the receptor . the result is compared with the amount of labeled material associated with the receptor using the same assay in the absence of the candidate antagonist . the candidate antagonist has antagonist activity when the level of labeled material associated with the receptor is lower than when the candidate is not present . further assays may include assays for inhibition of receptor specific antibody binding by a candidate antagonist , reduced accumulation of a ctgf - induced mrna by a candidate antagonist , or reduced accumulation of a ctgf - induced protein by a candidate antagonist . phosphonate analogues are synthesized using methods known in the art , for example , methods described by ferguson et al . ( u . s . pat . no . 6 , 140 , 307 issued oct . 31 , 2000 , which patent is incorporated by reference herein ). methods of synthesis for difluorovinylphosphonates , related monofluorophosphonates , and hydroxyphosphonates are described by berkowitz , j . org . chem , vol . 65 : 4498 , 2000 . methods of synthesis of gluco epimers of fluorovinylphosphonates are described by gross , tetrahedron letters , vol . 34 : 7197 , 1993 . phosphate analogs , sulfates , and sulfonates are synthesized in a similar manner using the appropriate reactants as is readily determined by one of ordinary skill in the art of organic synthesis . sulfate and carboxylate analogues are synthesized using , for example , methods as set forth by vidal et al ., bioorganic & amp ; medicinal chemistry , vol . 10 : 4051 , 2002 , clavel et al ., il farmaco , vol . 60 : 721 - 725 , 2005 , and jeanjean et al ., bioorganic & amp ; medicinal chemistry , vol . 14 : 3375 , 2006 . vidil , eur . j . org . chem , vol . 2 : 477 , 1999 details the synthesis of o - methyl glycosides . further analogues are synthesized as described in u . s . patent application 2003 / 0176363 published sep . 18 , 2003 ( u . s . ser . no . 10 / 338 , 679 filed jan . 9 , 2003 ) and international pct application published as wo 2004 / 104015 , dec . 2 , 2004 ( pct / us2004 / 015876 to cowden et al .) which applications are incorporated by reference herein in their entirety . antibodies having binding specificity and affinity for the ci - m6p / igf2 receptor are available commercially , for example , catalog no . ab2733 that recognizes an epitope in the extracellular domain of the receptor ( mouse monoclonal 2g11 ), catalog no . ab12894 ( rabbit polyclonal ), and catalog no . ab32815 ( rabbit polyclonal ); all from abcam ® (# ab13210 , cambridge , mass .). peptides having antagonistic activity include a synthetic peptide derived from residues 700 - 800 of the human ci - m6p / igf2r that competitively binds ctgf , for example , available from abcam ® (# ab13210 , cambridge , mass .). antagonism of ci - m6p / igf2 receptors and resultant inhibition of ctgf signaling is also inferred in a human or mammal by observing an improvement in an ocular disorder . for example , in age - related macular degeneration a slowing or reversal of vision loss indicates inhibition of ctgf signaling and , in glaucoma patients , lowered intraocular pressure and a delay or prevention of the onset of symptoms in a subject at risk for developing glaucoma indicates inhibition of ctgf signaling . antagonists of the present invention may be used in combination with other agents for treating ocular disorders where ctgf accumulation or activity is inappropriate such as , for example , agents described by u . s . published patent application no . 2005 / 0234075 to fleenor et al ., published oct . 20 , 2005 , previously incorporated by reference herein . mode of administration : the antagonist may be delivered directly to the eye ( for example : topical ocular drops or ointments ; slow release devices in the cul - de - sac or implanted adjacent to the sclera ( transscleral ) or within the eye ; periocular , conjunctival , sub - tenons , intracameral , intravitreal , sub - retinal , retrobulbar , or intracanalicular injections ) or systemically ( for example : oral ; intravenous , subcutaneous or intramuscular injections ; parenterally , dermal delivery ) using techniques well known by those skilled in the art . it is further contemplated that the antagonists of the invention may be formulated in a placement device such as a retinal pellet , intraocular insert , catheter , suppository or an implant device comprising a porous , non - porous , or gelatinous material . intracameral injection may be through the cornea into the anterior chamber to allow the agent to reach the trabecular meshwork . intracanalicular injection may be into the venous collector channels draining schlemm &# 39 ; s canal or into schlemm &# 39 ; s canal . subject : a subject in need of treatment for an ocular disorder or at risk for developing an ocular disorder is a human or other mammal having a condition or at risk of having a condition associated with inappropriate signaling by ctgf . such an ocular disorder may include , for example , ocular hypertension , glaucoma , macular degeneration , diabetic retinopathy , choroidal neovascularization , proliferative vitreoretinopathy , and conditions with endothelial cell proliferation , or fibroproliferation . ocular structures associated with such disorders may include the retina , choroid , lens , trabecular meshwork , rod , cone , rpe , ganglia , macula , iris , sclera , aqueous chamber , vitreous chamber , ciliary body , optic disc , optic nerve , papilla , or fovea , for example . formulations and dosage : pharmaceutical formulations comprise an antagonist , or salt thereof , as set forth herein up to 99 % by weight mixed with a physiologically acceptable ophthalmic carrier medium such as water , buffer , saline , glycine , hyaluronic acid , mannitol , and the like . examples of possible formulations embodied by aspects of the invention are as follows . in a further embodiment , the ophthalmic compositions are formulated to provide for an intraocular concentration of about 0 . 1 - 100 micromolar ( μm ) or , in a further embodiment , 1 - 100 nm of the antagonist . topical compositions are delivered to the surface of the eye one to four times per day according to the routine discretion of a skilled clinician . the ph of the formulation should be ph 4 - ph 9 , or about ph 4 . 5 to about ph 7 . 4 . systemic formulations may contain about 10 to 1000 mg of the antagonist . an “ effective amount ” refers to that amount of ci - m6p / igf2 receptor antagonist that is able to disrupt binding and / or subsequent signaling between the ci - m6p / igf2 receptor and ctgf via the feedback loop cited supra . such disruption leads to lowered ctgf signaling activity , and resultant lessening of symptoms in ocular disorders in a subject . such disruption delays or prevents the onset of symptoms in a subject at risk for developing ocular disorders as set forth herein . the effective amount of a formulation may depend on factors such as the age , race , and sex of the subject , or the severity of the ocular condition , for example . in one embodiment , the antagonist is delivered topically to the eye and reaches the trabecular meshwork , retina or optic nerve head at a therapeutic dose thereby ameliorating the ocular disease process . acceptable carriers : an ophthalmically acceptable carrier refers to those carriers that cause at most , little to no ocular irritation , provide suitable preservation if needed , and deliver one or more ci - m6p / igf2r antagonists of the present invention in a homogenous dosage . for ophthalmic delivery , a ci - m6p / igf2r antagonist may be combined with ophthalmologically acceptable preservatives , co - solvents , surfactants , viscosity enhancers , penetration enhancers , buffers , sodium chloride , or water to form an aqueous , sterile ophthalmic suspension or solution . ophthalmic solution formulations may be prepared by dissolving the antagonist in a physiologically acceptable isotonic aqueous buffer . further , the ophthalmic solution may include an ophthalmologically acceptable surfactant to assist in dissolving the antagonist . viscosity building agents , such as hydroxymethyl cellulose , hydroxyethyl cellulose , methylcellulose , polyvinylpyrrolidone , or the like , may be added to the compositions of the present invention to improve the retention of the compound . in order to prepare a sterile ophthalmic ointment formulation , the ci - m6p / igf2r antagonist is combined with a preservative in an appropriate vehicle , such as mineral oil , liquid lanolin , or white petrolatum . sterile ophthalmic gel formulations may be prepared by suspending the ci - m6p / igf2r antagonist in a hydrophilic base prepared from the combination of , for example , carbopol ®- 940 ( bf goodrich , charlotte , n . c . ), or the like , according to methods known in the art for other ophthalmic formulations . viscoat ® ( alcon laboratories , inc ., fort worth , tex .) may be used for intraocular injection , for example . other compositions of the present invention may contain penetration enhancing agents such as cremophor and tween ® 80 ( polyoxyethylene sorbitan monolaureate , sigma aldrich , st . louis , mo . ), in the event the ci - m6p / igf2r antagonists are less penetrating in the eye . kits : embodiments of the present invention provide a kit that includes antagonists for attenuating ctgf - mediated ci - m6p / igf2r receptor signaling in a cell . the kit contains in close confinement one or more containers containing an antagonist of the present invention , a pharmaceutically acceptable carrier and , optionally , printed instructions for use . the effect of ci - m6p / igf2 receptor antagonism on expression of extracellular matrix - related proteins by cultured human trabecular meshwork cells is determined as follows . human tm cell cultures are split into replicate and / or experimental and / or control groups to which are then added control solutions or experimental solutions comprising diluent vehicle ( s ) ( as controls ) and / or ctgf ( as stimulatory agent ) and / or ci - m6p / igf2 receptor antagonists . levels of extracellular matrix - related proteins , such as fibronectin , plasminogen activator inhibitor i ( pai - 1 ), collagens , fibrillin , vitronectin , laminin , thrombospondin i , proteoglycans , or integrins , are then measured in each cell culture group via standard enzyme - linked immunoabsorbent assays ( elisa ). such assays are well - known to those skilled in the art and are sensitive immunoassays which utilize an enzyme linked to an antibody or antigen as a marker for the detection of a specific protein . by these means , levels of various extracellular matrix - related proteins can then be compared between the groups in order to determine the effect of ci - m6p / igf2r antagonists . the references cited herein , to the extent that they provide exemplary procedural or other details supplementary to those set forth herein , are specifically incorporated by reference . those of skill in the art , in light of the present disclosure , will appreciate that obvious modifications of the embodiments disclosed herein can be made without departing from the spirit and scope of the invention . all of the embodiments disclosed herein can be made and executed without undue experimentation in light of the present disclosure . the full scope of the invention is set out in the disclosure and equivalent embodiments thereof . the specification should not be construed to unduly narrow the full scope of protection to which the present invention is entitled . as used herein and unless otherwise indicated , the terms “ a ” and “ an ” are taken to mean “ one ”, “ at least one ” or “ one or more .”

US-84752307-A

a modular pneumatic type tobacco separator apparatus employs a separation chamber which receives a threshed tobacco mixture at a feed trough at an upper elevation , and receives an upwardly directed air stream at a lower elevation . the air stream separates the mixture into lamina material , which is blown upwardly and removed by way of a screening separator , and stem material which falls to the bottom of the chamber , and is removed by an upwardly inclined conveyor belt . the configuration of the apparatus is such that , when two units of the apparatus are placed interactively together , the stem material emergent from a first unit drops by gravity into the feed trough of the next successive downstream unit of the apparatus .

referring to fig1 - 5 , an embodiment of the separator apparatus of this invention is shown having a generally upright separation chamber 10 defined in part by opposed side panels 11 , opposed front and rear panels 12 and 13 , respectively , and upper and lower closure structure 14 and 15 , respectively . said panels and closure structure may be fabricated of sheet metal which is fitted together to provide a chamber which is air tight except for functional openings . transparent panels may be employed in part to permit visual observation of the interior of the chamber . chamber 10 and other components of the apparatus are supported by exterior framework 33 . the distance between side panels 11 is considered to be the width of the chamber . said width will be about 5 feed for &# 34 ; narrow &# 34 ; separator machines , and will range from five feet to 12 feet for &# 34 ; wide &# 34 ; separator machines . a horizontally elongated feed trough 16 is attached to front panel 12 at an elevation adjacent upper closure structure 14 . a rotary paddle wheel 17 is disposed within 16 trough for the dual purpose of advancing threshed tobacco mixture into chamber 10 , and preventing outflow of air therefrom . a screening separator 18 elongated between lateral extremities 28 is disposed rearwardly of rear panel 13 and adjacent upper closure structure 14 . screening separator 18 operates on a centrifugal blower principle wherein air and suspended tobacco particles emergent from upper closure structure 14 of chamber 10 enter entrance port 19 of said screening separator . a screen device within separator 18 removes air - suspended lamina tobacco particles , which fall downwardly by gravity into a rotary air lock device 20 and thence downwardly past discharge extremity 21 . the lamina emergent from separator 18 are received by substantially horizontally disposed conveyor belt 22 which transports the lamina away from the apparatus in a direction transverse to side panels 11 of chamber 10 . screening separator 18 is preferably provided with a dual lip flexible seal which provides assurance against malfunction by way of a torn or worn sealing lip . return conduits 24 are attached at their upper extremities 25 to the air exit port 26 at both lateral extremities of screening separator 18 . each conduit 24 terminates in a downstream lowermost extremity 27 . paired centrifugal blowers 54 are disposed forwardly of chamber 10 and positioned between the vertical planes of side panels 11 . said blowers are driven by the single motor 29 . each blower has an axially directed inlet port 30 coupled to the lower extremity 27 of a corresponding return conduit , and a tangentially directed exit port 31 . the paired blowers are particularly beneficial on wide separator machines . on narrow separator machines , a centrally positioned single blower may be employed . a feed conduit 32 is coupled to the exit port 31 of each blower . the conduit is initially forwardly and downwardly directed , then proceeds through a major bend 57 bent at an angle a of over 90 degrees of angle with respect to horizontal , and thence proceeds through a horizontal portion 35 to a second , lesser bend 34 bent at an angle b of between about 40 and 90 degrees of angle . within horizontal portion 35 , conduit 32 is configured to have a progressively increased cross - sectional area . said feed conduit terminates in an upwardly directed exit extremity 36 positioned within chamber 10 adjacent lower closure structure 15 . the aforesaid arrangement of components establishes a circulating , substantially closed path of movement of a stream of air within the apparatus . a series of adjustable vanes 37 is positioned within horizontal portion 35 of conduit 32 . a first series of fixed vanes 38 is positioned within conduit 32 at lesser bend 34 . a diffuser plate 39 and a second series of fixed vanes 40 are disposed within conduit 32 just prior to exit extremity 36 . a self - cleaning slide plate 55 is disposed upon exit extremity 36 to control the flow of air emergent from conduit 32 and to aid the downward and rearward movement of heavy stem material . as shown in greater detail in fig4 and 5 , slide plate 55 is comprised of a grate of parallel longitudinal members such as bars 58 . an upwardly inclined conveyer belt 41 has a lower portion 42 disposed within chamber 10 adjacent lower closure structure 15 and rearwardly displaced from exit extremity 36 of conduit 32 . said lower portion 42 is positioned to receive stem material transported by slide plate 55 . the upper extremity 43 of belt 41 is located behind chamber 10 at an elevation above feed trough 16 . conveyer belt 41 , which may have a series of cleats 60 , functions to convey stem material upwardly out of chamber 10 . said conveyor belt is enclosed within rectangular housing 44 whose bottom surface 45 is provided with an exit spout 46 positioned below upper extremity 43 of belt 41 , and through which the stem material falls . as shown in fig3 the configuration and dimensions of the apparatus of this invention are such that stem material falling through spout 46 is caused to enter the feed trough 16 of the next adjacent similar separator apparatus . the apparatus of this invention can accordingly be said to be of modular design because a number of units of the apparatus can easily be operatively assembled without need of auxiliary equipment . an air bleed outlet 47 is positioned in exit port 31 of each blower adjacent the outer perimeter 48 of blower housing 49 . the positioning of outlet 47 is such as to facilitate removal of fine air borne particles which are flung in centrifugal action toward the outer perimeter of the blower housing . the venting of air through outlet 47 also causes the pressure within chamber 10 to be desirably below the pressure of the ambient surrounding air . a connecting conduit 50 receives the airstream emergent from outlet 47 , and delivers it forwardly to the underside 51 of conveyor belt 41 of the next preceding unit of the apparatus of this invention . said bleed air stream is caused to sweep transversely across said underside 51 , and thereby serves to dislodge any tobacco particles still clinging to the belt . any particles thereby dislodged are transported to a dust collection facility . in fig2 the general paths of the light and heavy pieces of tobacco , and the air paths are generally indicated by directional arrows . a winnower roll 52 having the shape of an elongated paddlewheel is mounted adjacent the rear panel of chamber 10 , and serves to propel pieces of tobacco into repeat contact with the upwardly moving airstream . the combination of the dual blowers associated with the relatively long and widened feed conduits 32 having double bends promotes uniform lateral distribution of the air stream . this is particularly useful for wide separator machines . the combined effects of adjustable vanes 37 , fixed vanes 38 and 40 , and diffuser plate 39 is to produce a laminar upward flow of air into chamber 10 , said flow being of substantially uniform velocity throughout the chamber . such flow characteristics produce highly efficient separation of tobacco pieces . the fact that the apparatus contains its own blowers and blower motor means that multiple units of the apparatus can be assembled without concern for the construction of separate conduits to supply air from a remote blower . by minimizing the total length of pneumatic conduits , such as conduit lengths that usually extend between tobacco separators of prior art construction , there is a savings in energy requirements and reduced noise level . it is to be further noted that the blowers and downwardly directed portions of the feed conduits are sloped to match the upward slope of housing 44 . this permits close - fitting abutment of adjacent units of the apparatus of this invention , thereby minimizing floor space requirements . while particular examples of the present invention have been shown and described , it is apparent that changes and modifications may be made therein without departing from the invention in its broadest aspects . the aim of the appended claims , therefore , is to cover all such changes and modifications as fall within the true spirit and scope of the invention .

US-32659594-A

a striking instrument and struck object monitoring system including at least two shutterable camera units which view a field of view each of which cameras receives light patterns from each and every one of a plurality of contrasting areas on the instrument and the object in rapid successive sequence . a computer receives the signals generated by the light patterns as received by each camera unit which computer discriminates between such signals to determine the instrument &# 39 ; s movement and orientation , and the conditions at impact with the object . the striking instrument may be any selected golf club which club is initially scanned by the system to determine it &# 39 ; s proper striking location prior to the club being swung through the field of view .

there are five ( 5 ) conditions of golf clubhead movement which determine the flight of the ball as impacted by the clubhead . they are : 1 . &# 34 ; clubhead speed &# 34 ; which affects ball speed and in turn distance ( approximately 21 / 2 yards of distance is gained for every mph of club speed ). 2 . &# 34 ; clubhead path &# 34 ; measured in a horizontal plane which affects the direction the ball will travel . 3 . &# 34 ; clubhead attack angle &# 34 ; measured in a vertical plane which affects the launch angle and the backspin of a golf ball . ( a ) squareness measured with respect to a horizontal line perpendicular to intended line of flight which affects the hook / slice spin on the golf ball . location of ball contact effects ball flight in that it affects launch angle and spin rate . fig1 ( a )- 1 ( i ) illustrate various clubhead paths in horizontal planes and face orientations at impact . the clubhead path p is angle a measured in degrees from the intended initial line of flight of the ball l i . the face orientation angle is angle b measured between the line of flight l i and clubhead face direction indicated by arrow f . turning in particular to fig1 ( a ), club path p is from outside - to - inside at impact producing a negative a angle and the face is closed producing a negative angle b . the result is a pull hook shot . fig1 ( b ) shows the clubhead path p along line l i and the clubhead closed with a negative angle b which conditions produce a hook ; fig1 ( c ) shows the clubhead path p such that angle a is positive while a closed face creates a negative angle b for a push hook shot ; fig1 ( d ) shows the p and f coinciding at an angle to l i producing a pull shot ; fig1 ( g ) whose conditions that result in a pull slice shot ; fig1 ( h ) shows the clubhead path p along the line 1 , but with the club face open to produce a slice ; and turning now to fig2 a - c , clubhead iron unit 7 is shown having a level attack angle el ; descending attack angle d ; and rising attack angle u producing ball flights of bf . in fig3 a - 3b , wooden club 1 produces backspin bs when striking ball 2 at the center of gravity cg of the clubhead 1a . overspin os is generated when the ball is struck above the cg and the clubface has zero loft angle . now referring to the fig4 - 8 , system 3 includes camera housing unit 4 , computer 5 , sensor 6 and teed golf ball 8 . camera unit 4 includes housing frame 11 and support feet 12a , 12b engageable with tracks 14 , 16 so that the unit 4 can be adjusted relative to teed ball 8 . camera unit 4 further includes two electro - optical spaced - part cameras 18 , 19 , which cameras have light - receiving apertures 18a , 19a , shutters ( not shown ) and light sensitive silicon panels 18p , 19p ( see fig8 ). ccd cameras are preferred but tv - type cameras are also useful . the angle between lines a and b on fig4 may be in the range of 10 °- 30 ° with 22 ° being preferable . turning to fig5 golf clubhead 7a and attached hosel 7b which together comprise clubhead unit 7 have three ( 3 ) reflective spaced - apart round areas or dots 20a - c placed thereon . round dots 20a - c having diameters of one - tenth ( 1 / 10 ) to one - eighth ( 1 / 8 ) of an inch are preferred but other size and shaped areas can be used . dots 20a - c are preferably made of reflective material which is adhered to the clubhead 7a and hosel 7b surface . teed ball 8 has similar dots 25g - l . the &# 34 ; scotchlite &# 34 ; brand beaded material made by minnesota mining and manufacturing ( 3m ) is preferred for forming the dots . corner - reflective retroflectors may also be used . alternatively , painted spots can be used that define contrasting areas . the number of dots or areas may be as few as three ( 3 ) up to six ( 6 ) or more of the clubhead and for the ball provided each dot or area reflects light in club positions a and b and teed ball position . camera 18 is capable of receiving light from each and every dot 20a - c and dots 25g - l and camera 19 is likewise capable of receiving light from each and every one of such dots . reflective materials as compared with the coated surface of the golf ball and metallic or wooden surfaces of golf clubs are as high as nine hundred ( 900 ) times brighter where the divergence angle between the beam of light striking the dots 20a - c and dots 25g - l the beam of light from such dots to the camera aperture is zero or close to zero . as the divergence angle increases , the ratio of brightness of such dots 20a - c and dot 25g - l to the background decreases . it will be appreciated that infra red lighting may be used to make the flash light invisible to the golfer . referring back to fig4 adjacent to camera 18 are two flash lamps 21 , 22 and adjacent to camera 19 are two additional flash lamps 23 , 24 . lamps 21 , 22 , 23 and 24 are placed as close to the operative of camera 18 , 19 as possible to minimize the divergence angle and this increases the ability of cameras 18 , 19 to receive light from dots a - c and 25g - l and distinguish that light from light received from other portions of the clubhead unit 7 , ball surface 8 and other background light . alternatively , gating or shuttering can be accomplished by controlling the periods of time in which the light sensitive panels 18p , 19p will receive light and be activated by such light . a camera in which shuttering or gating is accomplished by operation of the sensor panels is a gated charge intensified camera . in this alternative , the light source is always on the camera shutters always open , thus employing the panels 18p , 19p to accomplish gating by gathering light only at a plurality of time periods separated by 800 microseconds . a second alternative utilizes a ferroelectric liquid crystal shutter which opens and closes in 100 microseconds . in this alternative , a constant light source is used and shuttering occurs twice before the ball has been hit . in the operation of the system , the initial step is calibration of the cameras 18 , 19 . the cameras 18 , 19 are calibrated to a coordinate system fixed in space . to accomplish this calibration , fixture 30 of fig6 is physically located just behind the location where the teed ball 8 will be placed . the fixture includes twenty ( 20 ) retro - dots 30a - t of 1 / 4 &# 34 ; in diameter . fixture 30 defines the global coordinate system by its three dimensional structure . the location of fixture 30 and spacing of cameras 18 , 19 from the fixture 30 or each other need not be precise since the fixture 30 locates these when it determines the eleven constants for each camera 18 , 19 . further , calibration of clubhead unit 7 is accomplished by adhering attachment 32 to club face 7f . vertical orientation line 32v and horizontal line 32h are used to orient and locate attachment 32 on clubhead face 7f having club face grooves 10a , b etc . line 32h is parallel to a face grooves 10a , b etc . attachment 32 including the clubhead unit 7 attachment 32 are placed adjacent ball 8 . attachment 32 includes three ( 3 ) retro - dots 31a - c and clubhead 7a has retro - dots 20a - b with each reto - dot about 1 / 4 &# 34 ; in diameter . attachment 32 provides the system with information to locate the geometric center of face 7f which center is the proper location for ball impact . attachment 32 forms a plane defining an axis system centered at the center of the clubface 7f ( fig7 ). by aligning the upper and lower dots on the such clubcalibration attachment 32 perpendicular to the grooves of club head 7 unit , the vector between these two points defines the x - axis of a local face coordinate system . the vector normal to the plane of the three calibration points defines the y - axis direction and is parallel to the grooves . the normal to the x and the y axis vector defines the third rectangular direction called the z - axis which is a direction normal to the clubface 7f the system is operated by reflecting light off dot 31a - c to camera panels 18p , 19p . from solving the unique rotational and translational relationship between the three dots 20a - c on the club head unit 7 and the three ( 3 ) dots 31a , b , c , the intended point of impact on the club ( the sweet spot ) can uniquely be found at any location of the swing in the field through reflective light from the dots 20a - c on the club unit 7 . attachment 32 is then removed from clubs face 7a . the eleven constants determine the focal length , orientation and position of each camera 18 , 19 given the premeasured points on fixture 30 and the twenty u and v coordinates digitized on each camera &# 39 ; s sensor panels 18p , 19p . sensor panels 18p , 19p which receive successive light pattern contain 240 lines of data and 510 pixels per line . the grid of fig8 is merely illustrative in that it does not have 240 lines . a computer algorithm is used for centroid detection of each dot 25g - l and 20a - c . centroid detection of a dot is the location of the center area of the dot for greater accuracy and resolution . each image received from dots 25a - l ; 20a - c results in an apparent x and y center position of each dot . where light is low in the field of vision due to gating , an image intensifier may be used in conjunction with the sensor panels . an image intensifier is a device which produces an output image brighter than the input image . the x , y and z coordinates of the center of each dot 30a - t which are arranged in a three - dimensional pattern were premeasured to accuracy of one of one - ten thousandth of an inch on a digitizing table and stored in the computer . an image of the calibration fixture 30 is taken by the two cameras 18 , 19 . this image determines the eleven ( 11 ) constants relating image space coordinates u and v to the known twenty x , y and z positions on the calibration fixture 30 . the equations relating the calibrated x ( i ), y ( i ), z ( i ) spaced points with the v i . sup . ( j ), v i . sup . ( j ) image points are : ## equ1 ## the eleven constants , di1 ( i = 1 , 11 ) for camera 18 and the eleven constants , di2 ( i = 1 , 11 ) for camera 19 are solved from knowing x ( i ), y ( i ), z ( i ) at the 20 locations and the 20 u i j , v i j coordinates measured in the calibration photo for the two cameras . with calibration completed , ball 8 is teed up about 30 inches from cameras 18 and 19 , club head unit 7 placed behind ball 8 at address and club head unit 7 ( on a shaft not shown ) is swung through three - dimensional field of view 35 ( fig5 ). about six inches before the striking of the ball , a laser beam breakage transmits a signal to open the shutter of camera 18 and camera 19 and to expose the image sensor panel in camera 18 and camera 19 to light from the three ( 3 ) club unit 7 dots 20a - c and six ( 6 ) stationary ball dots 25g - l . this illumination occurs when the club unit 7 is a position a ( fig5 ). eight ( 8 ) hundred microseconds later , flash light 22 and light 23 fires a flash of light which again illuminates the three ( 3 ) club unit 7 dots 20a - c and six ( 6 ) ball dots 25g - l . this occurs when the club unit 7 is a position b ( fig5 ). flashes of light are between one - ten thousandth and a few millionths of a second in duration . very small apertures are used in cameras 18 and 19 to reduce ambient light and enhance strobe light . as light reflects off dots 20a - c in their two positions , it reaches sensor panels 18p , 19p in corresponding panel areas 25a - l ( fig8 ). using the known time between camera operation and the known geometric relationships between the cameras , the external computing circuits are able to calculate the x , y and z positions of each enhanced dot in a common coordinate system at the time of each snapshot . from the position information and the known data , the external computing circuits are able to calculate the clubhead velocity and spin ( or rotation ) in three dimensions during the immediate preimpact ball 8 launch time period which pre impact condition is determined by calculation based on data from clubhead positions a and b data and the known position of stationery ball 8 from position b . in addition , the path direction , attack angle , and hit location are calculable from the positional information provided by the three reflective dots 30u , v , y on club unit 7 . as a golfer swings clubhead unit 7 through field 35 , the system electronic images are seen through the cameras 18 , 19 as shown on panels 18a , 19a in fig8 . the right hand field of view of camera 18 will differ slightly from the left hand field of view of camera 19 due to the 20 ° angle difference in camera orientation . the resulting equations to be solved given the camera coordinates , u i j , v i . sup . ( j ) for the three club dots , i , and two cameras j are as follows : ## equ2 ## with the known coordinates x ( i ), y ( i ), z ( i ) i = l , 3 for the club head unit 7 in position a , computer 5 further analyzes the positions of x ( i ), y ( i ), z ( i ), i = l , 3 at the second position b in fig5 . in addition , the electronic image contains the location of six dots 25g - l on golf ball 8 . the triangulation from the data of cameras 18 , 19 allows us to locate the position of six dots 25g - l on the surface of the ball . with information as to the six dots 25g - l on the surface and radius of ball 8 , the center of ball 8 , xc , yc , zc are calculated by solving the six ( 6 ) equations : with the positional information of dots 20a - c on the club head unit 7 known , the location of the center of the clubface 7f ( c x , c y , c z ) and its local coordinate system are found at the two strobed position a and b prior to impact with the ball 8 through the club calibration procedure previously described . the velocity components of the center of clubface unit 7 along the three axis of the coordinate system are then computed from the formulas : ## equ3 ## in which dt is the time interval between strobe firings . the clubhead spin components result from the matrix of direction cosines relating the orientations of dots 20a - c on the clubhead unit 7 in one orientation to those in the second orientation . if we denote this matrix by a with elements aij ( i = 1 , 3 ; j = 1 , 3 ) then the magnitude , θ , of the angle of rotation vector of the two clubhead orientations during the time increment dt is given by : ## equ4 ## the three orthogonal components of spin rate wx , wy , wz are given by : wx = θl /( rdt ) from calculating the distance between the center of ball 8 and the center of the clubface 7f minus the radius of ball 8 and the velocity of the center of club face 7f , the time is calculated that it would take the last position of the clubface 7f to contact the surface of ball 8 . knowing this time , the position of the three clubhead unit 7 dots 20a - c can be calculated assuming the velocity of face 7f remains constant up until it reaches position c when impacting ball 8 . with these club face 7f positions calculated at impact , the position of ball 8 relative to the center of the club face 7f can be calculated by finding the point of intersection of a line through the center of ball 8 and the normal to club face 7f plane found by using the three extrapolated club face points 31a - c . the path angle and attack angle are found from the components of velocity measured at the center of the face ( v x , v y , v z ). they are defined as follows : with the automatic location of club velocity , path angle , attack angle and face hit location , the golfer receives quantitative information on his swing for teaching and club fitting purposes . in addition , the direction of the clubface plane can be calculated at impact . after calibration as described above a golfer swung a driver through field 35 striking balls 8 in two successive series of five ( 5 ) shots per series . the following data was obtained for the first series : ______________________________________type of average of standardmeasurement five shots deviation______________________________________clubhead speed 1 . 7 mph 0 . 80perpendicular tointended line offlight of ballclubhead speed in - 0 . 2 mph 2 . 25vertical directionclubhead speed in 81 . 8 mph 5 . 02intended line offlightclubhead spin rate - 18 rpm 77around axisperpendicular tointended line offlightclubhead spin rate 343 rpm 39around vertical axisclubhead spin rate 41 rpm 18around intended lineof flight as axislocation of impact + 0 . 35 inches 0 . 245horizontal fromgeometric center ofclub face ( minusindicates toward toeand plus toward heel ) distance vertically - 0 . 47 inches 0 . 360from geometric centerof club face ( minusis below and plusabove ) path angle - 1 . 2 ° . 059attack angle - 0 . 1 ° 1 . 52loft angle 15 . 3 ° 2 . 35open angle 10 . 2 ° 2 . 12______________________________________ based on the above information the golfer is advised to swing the golf club lower and to close the golf club face sooner before impact . in a second series of shots the following data was obtained : ______________________________________type of average of standardmeasurement five shots deviation______________________________________clubhead speed 3 . 7 mph 2 . 74perpendicular tointended line offlight of ballclubhead speed in 1 . 5 mph 0 . 56vertical directionclubhead speed in 85 . 0 mph 1 . 43intended line offlightclubhead spin rate - 32 rpm 134around axisperpendicular tointended line offlightclubhead spin rate 359 rpm 52around vertical axisclubhead spin rate 45 rpm 66around intended lineof flight as axislocation of impact -. 35 inches 0 . 527horizontal fromgeometric center ofclub face ( minusindicates toward toeand plus toward heel ) distance vertically + 0 . 22 inches 0 . 309from geometric centerof club face ( minusis below and plusabove ) path angle - 2 . 5 ° 1 . 80attack angle 1 . 0 ° 0 . 37loft angle 14 . 0 ° 3 . 61open angle 7 . 2 ° 3 . 17______________________________________

US-75144796-A

a method is provided for the discrimination of cells from other particles , as well as of different types of cells in raw milk samples by impedance microflow cytometry . a method is provided of analysing the quality of raw milk in terms of its bacterial and somatic cell content without the need to pre - treat the milk sample , such that the analysis can take place directly at the production site . one advantage is discriminating and counting somatic cells from milk particles by high - frequency impedance analysis directly performed on untreated raw milk . another advantage is that the method allows diagnosing the status of a mastitis infection directly after milking according to the analysis of the somatic cell count . another advantage is to allow a fast method for determining the bacterial cell count in raw milk directly after milking . in addition , viability of both somatic and bacterial cells can be determined without the need of any cell label . a further advantage is , that the analysis can be obtained in real - time , directly after the raw milk has passed the micro channel of the microfluidic device .

the analysis according to fig1 was performed with a chip with 40 × 40 μm sensing channel dimensions . bright bar represent healthy , dark bar infected samples . the histograms show the mean values and standard deviations of the absolute impedance amplitudes in kω , which depend on the channel dimensions . the figure shows that the impedance values of raw milk with higher sccs have lower impedance amplitudes . thus , low impedance values of raw milk provide first qualitative indications of increased somatic cell count . as opposed to conventional impedance analysis performed with coulter counters , not only the amplitude of the signal is recorded , but also the phase φ . triggering against the real part of the impedance signals and plotting them on a phase - amplitude diagram , in which each dot represents the signal of one single cell or milk particle , leads to the data depicted in fig2 . the dot plots are complemented with the relative histograms ( amplitude for y - axis , phase for x - axis ). fig2 a shows the analysis of raw milk performed at 0 . 5 mhz and fig2 b the same sample with the same particles and cells measured at 10 mhz . the discrimination of milk particles and somatic cells is as expected more distinct at 10 mhz than at lower frequencies ( arrow in fig2 b indicates somatic cell population ). the main differentiation parameter is the phase angle of the impedance signal , a parameter that is not determined with conventional coulter counters . by increasing the bandwidth of the electronics a better discrimination can be achieved with measurements at higher frequencies ( up to 30 mhz ) and thus full separation of particles and cells without the need of any calibration prior to analysis can be obtained . with the use of commercially available software tools , the somatic cell population can be easily gated out with linear or polygonal functions , separated from the milk particles and counted , as shown in fig2 b . fig2 c to 2e provide further evidence that the discrimination of milk particles from somatic cells is achievable with the selection of appropriate gating functions , which supply cell counts comparable to those obtained with conventional or more complex , optical state - of - the - art technologies . fig2 f shows such a correlation by comparing ssc determined by impedance flow cytometry ( ifc ) and using dna labelling dyes ( pi = propidium iodide ) and subsequent optical counting using a microspcope . alternatively , triggering can directly occur as mentioned above using a specific formula combining the measured impedance values . according to this invention the method allows for diagnosing the status of a mastitis infection directly after milking according to the analysis of the scc . fig3 shows the outcome of such an analysis for raw milk of two infected cows . for this purpose a larger sample of raw milk is analysed ( about 50 , 000 to 100 , 000 cells ). again , before passing the sample through the micro fluidic device , it is first filtered with a 15 - 30 μm . triggering occurs as described above . impedance analysis of raw milk using the described method allows for further differentiation of somatic cell sub - populations , consisting mainly of lymphocytes ( i ), granulocytes ( ii ) and monocytes / macrophages ( iii ). these cell types show differences in their signal amplitudes ( reflecting size ), but also in their signal phase information . the latter is an important criterion for the differentiation of lymphocytes and granulocytes , which have overlapping dimensions . it is generally known that the first reaction to an infection leads to an increase of granulocytes , followed in a later stage by an increase of monocytes / macrophages . the examples in fig3 show the raw milk analysis of two different cows with mastitis , fig3 a revealing the milk of a cow with a late infection according to the high count of macrophages , and fig3 b representing the milk of a cow in an earlier infection stage due to its high count of granulocytes . thus , this cow - site method provides the opportunity for a veterinary doctor to determine the relative ratio of the somatic cell sub - populations and therefore to rapidly assess the infection status of a mastitis as well as to monitor the effects of therapies , and consequently to take at - site decisions instead of waiting for long - lasting analyses in his or other analytical laboratories . the fact that the impedance value of raw milk can vary as a consequence of its scc , but also from other natural constituents of milk ( fat content , urea , lactose , water , etc . ), can impinge on the need for automation in a routine process . in order to use reliable trigger and gating parameters for the determination of the scc as well as of its sub - populations , an internal calibration of the impedance value becomes necessary . usually , the adjustment is minimal and can be done as soon as raw milk flows through the micro fluidic chip . the extent of this adjustment can be considered in analogy to the absolute impedance value of the liquid as a preliminary indication of the scc . the internal calibration can also compensate potential chip - to - chip variations , which might become evident when the chips need to be replaced during a routine analysis . as scc increases normally in response to pathogenic bacteria , it is also important to quantify the bacterial cell count ( bcc ) in raw milk . bacterial infections result from external contaminations , such as scarce cleaning of the milk transport equipment or of the cow &# 39 ; s teats prior to milking . accepted bcc values for human consumption vary from country to country and range from 100 , 000 to 1 , 000 , 000 cells / ml . nowadays , bcc is not determined at the production site , because its requirement of a well - equipped laboratory instrumentation . optical imaging instruments fail because of the rather small cell dimensions ( around 1 μm ). impedance - based technologies , on the other hand , cannot separate the cells from milk particles . quantification is therefore performed with expensive flow cytometers in large analytical laboratories , or with conventional plate cultures in laboratories of dairy product manufacturers or veterinary doctors . usually , therefore , bcc values are available only a few days after milking . further , this invention allows a fast method for determining the bcc in raw milk directly after milking . similar to the determination of scc , raw milk is first filtered using a mesh size of max . 5 - 10 μm , which will remove large non - cellular particles and a part of the somatic cells . bacterial cells are then passed through a micro fluidic chip with channel dimensions of 5 × 5 μm or 10 × 10 μm for an increased sensitivity of the device , and counted as described above applying the best trigger parameter . fig4 shows an example of the potential of high - frequency impedance analysis . raw milk was skimmed ( centrifugation ) in order to better illustrate the resolution of various cell types . to the milk sample , which was 14 days old and quite acidic due to bacterial growth , dead and living yeast cells , as well as dead lactobacilli were added for demonstration purposes . it is clearly visible that bacteria and yeast have higher phase signals than milk particles ( as already shown for somatic cells ) and that the phase angle of dead cells normally decreases ( as shown by david et al . in viability and membrane potential analysis of bacillus megaterium cells by impedanceflow cytometry , biotechnology and bioengineering ( 2012 ), 109 ( 2 ), 483 - 492 ). simultaneous scc and bcc can be achieved by sequential filtering of the milk sample coupled to the measurement with the appropriate chip , for example by filtering first with a 30 μm filter with subsequent analysis using a chip with 20 μm channel dimensions and then , in the same flow , implementing a filtration with a 10 μm filter with subsequent analysis using a chip with 5 μm channel dimensions . alternatively , the sensitivity ( signal - to - noise ratio ) of the chip - based impedance analysis can be increased , for example by reducing the bandwidth of the electronics to a smaller frequency range , i . e . from 10 to 20 mhz , which allows for simultaneous analysis of scc and bcc in a chip with 30 μm channel dimensions and one single filtration step . in fig5 the principle of the method is depicted in a block diagram . it shows that raw milk is filtered by appropriate filter means 16 having a mesh size depending on the channel size . the mesh size for filtration can be 5 , 15 , 30 μm or any other appropriate size smaller than the sensing channel of the chip . subsequently means 17 for impedance measurement of the milk perform a respective measurement by providing respective channels 4 ( fig6 ) being a given amount or percentage larger that the size of the particles passing the filter means 16 . the means 17 further comprise means for frequency selection , which chose frequencies for trigger and / or measurement . the trigger frequency is used for calibration with reference numeral 18 . the calibration is used for impedance correction depending on the size of the micro channels 4 for impedance measurement of particles as depicted in block 19 and / or depending on the measured fluid impedance . for impedance measurement of the particles a selection of single trigger parameters for the r -, i -, and a - values , or of a trigger formula ( f ) combining these values and also including the phase value φ of the impedance is performed . the result of the measurement is recorded with respective recording means 20 and then according to respective gating and analysing performed by respective means 21 and completed as shown in block 22 . block 22 includes the results , which can be obtained by the method and apparatus . it comprises the already mentioned fluid impedance values received without using calibration directly after the selection of measurement frequencies in block 17 and the impedance correction after calibration according to block 18 . further , block 22 includes the results of gating and analysis of block 21 , which are : milk particle count , scc , bcc , somatic cell sub - populations , somatic / bacterial cell viabilities . fig6 shows the principle in connection with a chip 1 having an inlet 2 and an outlet 3 with a micro channel 4 there between . a filter 5 is arranged before the inlet 2 . the filter 5 can be part of a complete apparatus or a separate device . the mesh size of the filter 5 depends on the size of the particles , which shall be analysed , and the diameter of the micro channel 4 . the micro channel 5 comprises electrodes 6 and 7 for generating an electrical ac field 8 in between . particles 9 of the raw milk pass through the filter 5 into the micro channel 4 . between the electrodes 6 and 7 the particle influences the electrical field and the impedance or the change of the impedance is measured by applying a high frequency voltage 10 . fig6 shows the electrical field lines between the electrodes 6 and 7 and a particle 9 between the electrodes 6 and 7 . the figure shows the effect of a low - frequency field with numeral 10 and a high - frequency field with numeral 11 on a model cell , whose membrane behaves electrically different at higher frequencies . with the chip single cells can be discriminated from non - cellular milk particles according to the different dielectric properties . in addition , integration of specific trigger parameters can simplify cell discrimination and provide the required automation possibilities needed for a routine - based analysis . fig7 a shows the principle arrangement of two measurement possibilities . the apparatus 40 receives a sample of raw milk 15 from the udder of the cow . in the figure that is exemplarily depicted only with drops . the apparatus has a touch screen , which serves as input means of 32 and monitoring means 33 . the other possibility is to analyse directly the raw milk from the udder 23 during its way via conduits 42 to the pipeline 43 of a milking plant . the result of the analysis here is transmitted by a mobile analysis unit 41 to the farmer &# 39 ; s control station for further data handling . fig7 b shows a block diagram of the elements of the apparatus for forming the method as explained above for the automatic real - time determination and analysis of milk of any animal comprising . a filter 5 is necessary to avoid clogging of the micro channels of the micro fluidic device 1 of fig6 , however , the filter may be a part of the apparatus 40 or a separate component . the apparatus 40 comprises besides the micro fluidic device 1 as described in connection with fig6 control means 30 for generating a high frequency voltage at the electrodes 6 , 7 and measuring the impedance between the electrodes 6 , 7 with and without particles 9 between the electrodes 6 , 7 . further , there are input 32 and monitoring 31 means . the control means 30 comprise means 33 being adapted to determine the impedance value of the milk and to calibrate the micro fluidic device on said impedance value , if necessary , means 34 being adapted to count the particles and measure the impedance of the particles , means 35 to determine a trigger parameter for noise extraction and particle recognition , respectively , means 36 being adapted to determine a trigger parameter for discrimination of cells from non - cellular milk particles , means 37 being adapted to analyse the impedance values depending on the amplitude values and the phase angle values , and means 38 being adapted to select the cells and / or non - cellular milk particles according their amplitude and / or phase angle values . further included are means 39 being adapted to determinate the impedance value of the analysed milk , and / or to determinate the somatic cell sub - populations , and / or to determinate the milk particle content , and / or to determinate the viability of somatic or bacterial cells . although the invention has been shown and described with respect to certain preferred embodiments , it is obvious that equivalents and modifications will occur to others skilled in the art upon the reading and understanding of the specification . the present invention includes all such equivalents and modifications , and is limited only by the scope of the following claims .

US-201414580524-A

in an island type refrigeration display cabinet , a top aperture containing two oppositely disposed louvers for discharging oppositely directed coplanar air curtain sections , to form a single air curtain of multiple section in the top aperture of the display cabinet . preferably , the cabinet also includes means for withdrawing air from the interior display space of the cabinet and forcing the air through a bifurcated conduit . each bifurcation of the conduit is flowably connected to one of the respective louvers in the top opening of the display cabinet . each bifurcation of the conduit also includes means for refrigerating the air flowing through the conduit to the louvers .

an island - type refrigeration display cabinet generally denoted by reference numeral 10 is shown in fig1 . the cabinet 10 is preferably rectilinear in form , having a top wall 20 , four side walls 22 , and a bottom 24 . an access opening 30 is provided in the top wall . the access opening 30 is rectilinear , described by four sides 32 which are parallel to the respective side walls 22 but of relatively smaller dimension . thus , for example , if the exterior dimensions of the cabinet 10 defined by side walls 22 is 5 feet by 8 feet , then the dimensions of the access opening walls 32 will be on the order of 4 feet by 71 / 2 feet . preferably , the refrigeration display cabinet will have an overall height of the side walls 22 within the range of 28 to 40 inches , to permit a person standing beside the display cabinet 10 to easily reach through the access opening 30 . the side walls should also be insulated with a foam insulation 26 to enhance the thermal efficiency of the cabinet 10 by reducing heat transfer through the exterior walls 20 , 22 and 24 . the display cabinet 10 further includes an interior display space 40 . this display space 40 is defined by four interior side walls 42 and an interior bottom panel 44 . the dimensions of the interior side wall 42 will preferably correspond to the dimensions of the access opening walls 32 . the interior bottom panel 44 is parallel to the bottom 24 and top wall 20 , and is recessed within the cabinet 10 from the top wall 20 to a depth preferably within the range of 12 to 26 inches . a number of return air aperture 46 , preferably a series of holes or elongate slots , are provided in interior side walls 42 for air flow communication from the interior display space 40 . in the space defined between the interior side walls 42 and the side walls 22 are intermediate side panels 52 in parallel spaced relationship . an intermediate bottom panel 54 is disposed in spaced , parallel relationship with the bottom panel 44 and the bottom 24 of the cabinet 10 . the intermediate side panels 52 and the intermediate bottom panel 54 are connected to define a return air conduit 60 between the interior side walls 42 , the interior bottom panel 44 , the intermediate side panels 52 and the intermediate bottom panel 54 . the return air conduit 60 is in air flow communication with the interior display space 40 through the return air apertures 46 . the intermediate side panels 52 , the intermediate bottom panel 54 , the side walls 22 and cabinet bottom 24 cooperate to define a bifurcated air supply conduit . at least one aperture 64 is provided in the intermediate bottom panel 54 for permitting air flow communication from the return air conduit 60 to the bifurcated conduit 62 . turning now to fig2 for a more detailed view of the cabinet 10 , it can be seen that the bifurcated conduit 62 includes flow paths 62a and 62b . the bifurcated conduit portion 62a is defined by the cooperation of side wall 22a and intermediate side panel 52a and the bifurcated conduit portion 62b is defined by the side wall 22b and intermediate side panel 52b . a first evaporator 70a is disposed in the bifurcated conduit portion 62a and a second evaporator 70b is disposed in the second bifurcated conduit portion 62b as air passes through the bifurcated conduit 62 , it passes through the evaporator 70 and is refrigerated . each portion of the bifurcated conduit 62 extends to the top wall 20 of the cabinet 10 , and terminates in a louver 80 . each louver 80 is comprised of a plurality of spaced parallel vanes 82 , which may be horizontal tubular or planar elements . the louver 80a terminating the bifurcated conduit portion 62a is coplanar with the louver 80b terminating the bifurcated conduit portion 62b . preferably , crossflow fan 90 is rotatably disposed within the intermediate bottom panel aperture 64 for drawing air from the return air conduit 60 and forcing the air into the bifurcated supply air conduit 62 . the crossflow fan 90 is connected to and driven in rotation by an electric motor 92 , which in turn is secured by a support structure 94 to the bottom 24 of the cabinet 10 . it would also be possible to include a plurality of fans 90 , each having its own actuating electric motor 92 , in a corresponding plurality of intermediate bottom panel apertures 64 . including a plurality of fans 90 would improve the operating reliability of the refrigeration display cabinet 10 be enabling continuous air flow in the event of the failure of one or more of the electric motors 92 . furthermore , a controller ( not shown ) may be included to permit selective actuation of one or more of the fans 90 by its corresponding electric motor 92 if desirable . the construction and operational details specific to the fan 90 , the electric motor 92 and the support structure 94 are not discussed in depth , as it is believed that these are well known in the art and not necessary to an understanding of the present invention . however , the crossflow fan 90 would generally include a plurality of vanes or blades affixed to an axle . the axle of the fan 90 , in turn , would be secured to the rotor of the electric motor 92 , a single or three phase motor as desired . the support structure 94 could be suitably formed from one or more pieces of sheet steel or aluminum , and secured to the motor 92 and the cabinet 10 by welding or by screws . in operation , the electric motor 90 is actuated , rotating the fan 90 and withdrawing air from the interior display space 40 through the return air apertures into the return air conduit 60 as defined by the interior side walls 42 and the intermediate side panels 52 . the fan 90 then forces the air through the intermediate bottom panel aperture 64 and into the branches of the bifurcated supply air conduit 62a and 62b . air traversing the bifurcated conduit portion 62a is forced through and cooled in evaporator 70a , then discharged from the louver 80a in a planar strata directed toward the louver 80b , while air traversing the bifurcated conduit portion 62b is forced through and cooled in evaporator 70b , then discharged from the louver 80b in a planar strata directed toward the louver 80a . the two oppositely directed planar strata each comprising section of the resulting single air curtain then is drawn into the interior display space 40 to replace the air withdrawn at the beginning of the cycle and simultaneously cool the comestibles contained therein . it should be noted that when the same part or feature is shown in more than one of the figures , it will be labeled with the corresponding reference numeral to aid in the understanding of the subject invention . furthermore , reference should be had to all of the figures necessary to aid in the understanding of the specification even where a particular figure is referenced , as all reference numerals are not displayed in all figures in order to minimize confusion . when the same part of feature appears in a figure representing or disclosing an alternative embodiment of that part or feature , it is again labeled with the same reference numeral , followed by a numeric suffix to correspond with the designation of that alternative embodiment in the specification . the numeric suffix is intended to aid in the understanding of the embodiment and not to denote its value or order of preference . finally , it will be noted that since the display cabinet 10 is an island - type , the delineation of front and rear is arbitrary , and hence is denoted herein by suffixes &# 34 ; a &# 34 ; and &# 34 ; b &# 34 ;, respectively . a first alternative embodiment is shown in fig3 . at least two centrifugal fans 90a - 1 and 90b - 1 are shown disposed in respective bifurcated conduit portions 62a - 1 and 62b - 1 . the centrifugal fan 90a - 1 is located in the corner of the bifurcated conduit 62a - 1 formed by the juncture of the exterior cabinet side wall 22a - 1 and the cabinet bottom 24 - 1 , while the centrifugal fan 90b - 1 is located in the corner of the bifurcated conduit 62b - 1 formed by the juncture of the exterior cabinet side wall 22b - 1 and the cabinet bottom 24 - 1 . a baffle 27 - 1 is included in the conduit 62 - 1 to cause the air to be drawn into the fans 90 - 1 and to prevent backflow of air within the conduit 62 - 1 . the baffle 27 - 1 is preferably co - planar with the intermediate bottom panel 54 - 1 . the centrifugal fans 90a - 1 and 90b - 1 are thus readily accessible through access panels 29 - 1 in the exterior side walls 22 - 1 . in the event of the operational failure of one fan 90 - 1 , the other fan 90 - 1 could provide a continued air flow within the cabinet 10 - 1 to maintain the temperature within the cabinet 10 - 1 while maintenance of the failed fan 90 - 1 could be completed . operation of the cabinet 10 - 1 is substantially the same in all other respects as that of the preferred embodiment . fig4 shows another alternative embodiment of the subject invention in a cabinet 10 - 2 . the cabinet 10 - 2 includes two primary air return slots 100 - 2 , one primary air return slot 100a - 2 defined in the interior side wall 42a - 2 adjacent to louver 80a - 2 and a second primary air return slot 100b - 2 defined in the interior side wall 42b - 2 adjacent to louver 80b - 2 . these primary air return slots 100 - 2 provide an enhanced air return capability in the cabinet 10 - 2 when the interior display space 40 - 2 is filled . operation of the cabinet 10 - 2 is substantially the same in all other respects as that of the preferred embodiment . a third alternative embodiment of the display cabinet 10 - 3 is shown in fig5 . this embodiment incorporates a single evaporator 70 - 3 disposed immediately adjacent the intermediate bottom panel aperture 64 - 3 . the fan 90 - 3 is disposed in the aperture 64 - 3 as in the preferred embodiment , but the electric motor 92 - 3 and the corresponding support structure 94 - 3 depend from the interior bottom panel 44 or , alternatively , from the intermediate bottom panel 54 ( not shown ). in operation , the single evaporator 70 - 3 refrigerates air forced through the intermediate bottom panel aperture 64 - 3 and divides the airflow into the bifurcated conduits 62a - 3 . this provides the advantage of utilizing a single evaporator 70 - 3 to obtain the same advantages as that of the preferred embodiment in operation while reducing manufacturing costs and the number of components in the cabinet 10 - 3 . fig6 shows in schematic representation a typical refrigeration system suitable for use in a cabinet 10 embodying the subject invention . the evaporators 70 are in flow communication with a compressor 72 for compressing refrigerant from the evaporator 70 and directing the refrigerant to at least one condenser 73 . as heat is lost from the refrigerant in the condenser 73 , the refrigerant changes from the gaseous state to the liquid state and flows from the condenser 73 to an expansion valve 74 . in the expansion valve 74 , the refrigerant is expanded and then directed to the evaporators 70a and 70b which are disposed for parallel flow of the refrigerant . a shut off valve 75 is connected to each respective evaporator 70a and 70b for selectively preventing flow through each of the evaporators 70 . preferably , a controller 76 is included in the refrigeration system to operate the shut off valves 75a and 75b . when the shut off valves 75 are in the closed , flow preventing condition , the evaporator 70a and 70b may then be defrosted by operating the fan 90 to force air through the evaporators . only the evaporators 70 and a portion of the piping ( not shown ) for connecting the evaporators 70 need be emplaced in the cabinet 10 , as such refrigeration systems as described herein typically include condensor 73 and compressor 72 racks remotely installed from the cabinet 10 which serve a number of similar refrigerated cabinets . such installations need not be described in detail , as it is believed that they are well known to those acquainted with the art . in the preferred embodiment , defrosting the evaporators 70 involves simple operating the fan 90 when the refrigeration system is not operating or when the shut off valves 75 are closed to refrigerant flow . this is most suitable for low temperature applications of the display cabinet 10 , such as when displaying frozen food articles . for medium temperature applications of the display cabinet 10 , such as displaying meat or the like , defrost of the evaporator 70a and 70b is accomplished by alternately closing valve 75a and 75b to prevent flow of refrigerant through only evaporator 70a or 70b alternately . thus , when the fan 90 is operated , air flow through the evaporator 70 in which refrigerant flow is prevented will cause that evaporator 70 to be defrosted . in the alternative embodiment shown in fig3 defrost may be additionally enhanced by selectively operating a fan 90a to cause defrost in evaporator 70a while maintaining fan 90b in a non - operational condition . defrost of evaporator 70b may be accomplished in the same manner by operating fan 90b while maintaining the fan 90a in a non - operating condition . it is understood that defrost of the evaporators 70 may be accomplished by the operation of the fans 90 when the refrigeration system is in the non - operating condition , and that the shut off valve 75a and 75b and the controller 76 are not necessary to the operation of the subject invention , but rather illustrate advantageous methods of defrosting the evaporators 70a and 70b . other methods of advantageously causing defrost of the evaporator 70a and 70b will be readily apparent to those skilled in the art of refrigeration systems . it is readily apparent that the subject invention offers the advantages of simplicity of construction and operation . the subject invention is also economical in operation , as the multisectional air curtain entrains a relatively smaller amount of environmental air and moisture as compared to a single air curtain flowing from louver 80a to 80b or vice - versa . this reduces the defrost requirement and increases the relative operational time per cycle . it will be appreciated , that although the design of the refrigeration display case in the subject invention appears relatively straight forward , it provides substantial advantages over the known prior art . modifications to the preferred embodiment of the subject invention will be apparent to those skilled in the art within the scope of the claims that follow hereinbelow .

US-24754388-A

a disinfectant transfer system , which is essentially vapor tight , for transferring toxic and / or noxious fluid from a container to a reservoir without releasing fumes including : a transfer cap for securing onto a mouth of a container containing toxic and / or noxious fluid , the transfer cap having a first opening for letting a gas in through a valve , the transfer cap further having a second opening for allowing toxic and / or noxious fluid to be forced out of the container when the toxic and / or noxious fluid is displaced by the gas entering through the first opening , the gas forces the toxic and / or noxious fluid within the container to enter and flow through a first conduit , which is connected to the bottom of the second opening and leads to the bottom of the container , and to continue to flow through a second conduit which is connected to the top of the second opening and leads to a reservoir into which the toxic and / or noxious fluid can enter .

referring now to the drawings , wherein like reference numerals refer to like parts , there are shown representations of reprocessing systems and methods suitable for using conventional reprocessing protocols to reprocess devices having internal passageways , such as medical instruments . an example of such a reprocessing protocol is disclosed in u . s . pat . no . 5 , 761 , 069 , issued to weber , et . al ., which is incorporated by reference herein . fig1 shows a top view of a prior art reprocessing unit 10 , wherein a cover ( not shown ) is disposed in an open position . the reprocessing unit 10 includes a reprocessing basin 12 , the instrument carrier 14 , and a chemical disinfectant reservoir 16 . the instrument carrier 14 is shown seated within the reprocessing basin 12 . the instrument carrier 14 can be generally rectangular in shape and comprises a mesh - like bottom 18 which is arranged to hold the surgical instruments 15 during reprocessing , wherein the surgical instruments 15 each include a single passageway therethrough requiring reprocessing . the reprocessing basin 12 is also provided with a plurality of spray nozzles 26 for use during the rinse cycle . the instrument carrier 14 includes a manifold assembly 20 having a plurality of ports 20 a - f , each of which is shown applied to an internal passageway of a respective surgical instrument 15 . in order to reprocess the surgical instruments 15 having a single passageway within the reprocessing unit 10 , the surgical instruments 15 are disposed on the instrument carrier 14 for coupling to the ports 20 a - f . since the surgical instruments 15 have a single passageway , only a single one of the ports 20 a - f is required for each surgical instrument 15 . the manifold assembly 20 is connected to a port 22 by means of a tubing segment 24 , which conducts fluid flow from the port 22 to the manifold assembly 20 for distribution by way of the ports 20 a - f . the fluid flow of the port 22 is driven by an oscillating pump ( not shown ). the oscillating pump operates to draw fluid , e . g ., wash water , rinse water or chemical disinfectant , from the reprocessing basin 12 , circulate that fluid through the ports 20 a - f and the manifold assembly 20 , and through the respective passageways of the surgical instruments 15 disposed on the instrument carrier 14 , to effect the decontamination process during the wash , rinse and chemical immersion phases of the reprocessing protocol . in this manner , the pressure delivered to each of the passageways of the surgical instruments 15 can be substantially equal in the reprocessing unit 10 . reprocessing unit 10 is thus suitable for reprocessing a plurality of surgical instruments 15 requiring such a single pressure to be applied to all of the passageways of the surgical instruments 15 . however , many surgical instruments are provided with passageways of differing diameters . such surgical instruments require differing pressures , corresponding to the differing diameters , for providing the required circulation of wash water , rinse water and chemical disinfectants through the passageways . referring now to fig2 , there is shown a reprocessing unit 83 suitable for use with the system and method for reprocessing of a device , and a view of a reprocessing basin 12 within the reprocessing unit 83 . the reprocessing basin 12 holds a device 96 having internal passageways 98 a - e for reprocessing of the device 96 by the reprocessing unit 83 . in a preferred embodiment , the device 96 being reprocessed by the reprocessing unit 83 can be a medical instrument 96 . in particular , the system and method for reprocessing of a device are well suited for application to medical instruments including flexible scopes such as endoscopes that are used for upper and lower gastrointestinal studies . the reprocessing unit 83 includes a keyboard 40 , a monitor 28 , a printer 32 , and an associated personal computer ( not shown ) for permitting a user of the reprocessing unit 83 to communicate with and control the reprocessing unit 83 . the reservoir 16 of the reprocessing unit 83 includes the sensors 34 , 36 , 38 for controlling devices such as a heater , a pump and a vacuum device ( not shown ) in order to protect against failure conditions such as overflow conditions in the reservoir 16 . a removable door 42 within the reprocessing basin 12 covers additional sensors ( not shown ) for providing further operational capability and safety protection during the operation of the reprocessing unit 83 . the door stops 30 are provided to stop the motion of the rotatable doors 31 covering the reservoir 16 and the reprocessing basin 12 when they are opened . in the preferred embodiment , the reprocessing basin 12 can hold more than one device 96 upon a mesh for reprocessing of the internal passageways 98 a - e thereof according to conventional reprocessing protocols . the reprocessing unit 83 is adapted to provide fluid flows of differing pressures to the device 96 or devices 96 being reprocessed when the internal passageways 98 a - e have differing diameters . the reprocessing unit 83 is adapted to perform the multi - pressure reprocessing operations using a single pump ( not shown ), and to provide an indication of an obstruction in any of the internal passageways 98 a - e of the device or devices 96 as described in more detail below . the single pump of the reprocessing unit 83 can be a diaphragm pump , an oscillating pump , or any other type of pump known to those skilled in the art . alternatively , the reprocessing unit 83 can be adapted to perform the multi - pressure reprocessing operations using more than one pump . these pumps could supply pressurized fluid flows of differing pressures to the inputs ports 253 , 255 of the pressure distribution manifold 250 . the reprocessing basin 12 includes the supply ports 123 a - l that can be selectively used to apply fluids at different fluid flow rates to the medical instruments 96 for reprocessing of the medical instruments 96 . for example , the supply port 123 j can be capped and reserved for use when needed . the supply port 123 a can be used to blow off a fluid flow which is unusable due to difficulty in regulating and measuring their flow rates , as described in more detail below . in this example , at least the supply ports 123 a - l that are not capped or blown off can be vented into the reprocessing basin 12 or coupled to the internal passageways 98 a - e of a medical instrument 96 as needed for example , an internal biopsy passageway 98 a of the medical instrument 96 can be coupled to the supply port 123 b by way of the tubing segment 132 b , and an internal water channel passageway 98 b of the medical instrument 96 can be coupled to the supply port 123 c by way of the tubing segment 132 c . the internal passageway 98 c can be coupled to the supply port 123 d by way of the tubing segment 132 d , and the internal suction passageway 98 d can be coupled to the supply port 123 e by way of the tubing segment 132 e . the internal elevator water channel passageway 98 e can be coupled to the supply port 1231 by way of the tubing segment 1321 . the fluid applied in the reprocessing method can be either liquid or gas . gases that are used for the reprocessing of a medical device include , but are not limited to , ethylene oxide , hydrogen peroxide , and plasma gases . the disk filters 94 and their tubing extensions can be disposed in line with the selected passageways 98 a - e for preventing debris from reaching the medical instrument 96 . for example , the disk filters 94 can be provided in the tubing segments 132 c , d , e . the device for coupling the selected tubing segments 132 a - l to the tubing extensions of the disc filters as shown can be the well known lure lock type of coupling . typical diameters for some of the passageways 98 a - e can be 0 . 508 millimeters to 4 . 8 millimeters . referring now to fig4 a - c , there is shown a pressure differentiation device 252 for providing fluid flows of differing pressures from the output of a single conventional pump that provides a single pump output pressure . it is the different output pressures at the output of the pressure differentiation device 252 that are applied by way of the selected supply ports 123 a - l to the internal passageways 98 a - e of the medical instrument 96 for reprocessing the medical instrument 96 or any other device 96 having such passageways 98 a - e . the single pump applied to the pressure differentiation device 252 can be a conventional diaphragm type pump , an oscillating pump , or any other type of pump known to those skilled in the art . the pressure differentiation device 252 can be a conventional t - manifold that is known to those skilled in the art . the single pump output pressure is applied to the pressure differentiation device 252 at an input port 251 a for application to the two output ports 251 b , c of the pressure differentiation device 252 . the output ports 251 b , c threadably receive and secure different pressure control devices which can have openings of different diameters , as described in more detail below . the pressure control devices secured in the output ports 251 b , c permit the pressure differentiation device 252 to provide two different pressures for the internal passageways 98 a - e of the medical instruments 96 . in the preferred embodiment the outport port 251 b can be a high pressure output port and the output port 251 c can be a low pressure output port . in a typical embodiment , the higher pressure of the high pressure output port 251 b of the pressure differentiation device 252 can be approximately 25 to 50 pounds per square inch . the lower pressure of the low pressure output port 251 c can be approximately 2 to 20 pounds per square inch . the pressures at the output ports 251 b , c can fluctuate within these ranges depending on factors such as the number of medical instruments 96 coupled to the reprocessing unit 83 . it will be understood by those skilled in the art that a pressure differentiation device 252 having additional output ports with different pressure control devices can be used for reprocessing systems 83 requiring more than two differing pressures . referring now to fig5 a - d , there are shown the pressure control devices 257 , 259 of the pressure differentiation device 252 for providing the two different pressures to the internal passageways 98 a - e of the medical instrument 96 . the pressure control devices 257 , 259 can be conventional pressure control orifice fittings 257 , 259 that are threadably received and secured in the output ports 251 b , c of the pressure differentiation device 252 . the two different pressures are provided at the output ports 25 l b , c when a single pressure is applied to the input port 251 a of the pressure differentiation device 252 because of the different diameters of the openings within the pressure control orifice fittings 257 , 259 . the pressure control orifice fitting 257 is a high pressure orifice fitting and the pressure control orifice fitting 259 is a low pressure orifice fitting . in the preferred embodiment , the pressure differentiation device 252 can be formed with an entrance 260 for permitting an fda approved liquid chemical sterilant as well as alcohol to be injected into the fluid stream passing through the device 252 for transmission through the selected supply ports 123 a - l of the reprocessing basin 12 to the medical instruments 96 . a disinfectant injection bulkhead communicating with the entrance 260 can be located on the exterior of the reprocessing unit 83 for convenience . additionally , a filter ( not shown ) can be disposed in a conduit from the pump to the input port 251 a of the device 252 for filtering fluid in transit to the internal passageways 98 a - e . the filter can be , for example , a one - hundredth micron filter . referring now to fig6 a - c , there are shown representations of the pressure distribution manifold 250 of the reprocessing unit 83 , including the manifold input ports 253 , 255 , and the manifold output ports 121 a - l . the pressure distribution manifold 250 can be a conventional air manifold understood by those skilled in the art . it is adapted to receive the fluid flows of the two different pressures from the output ports 251 b , c of the pressure differentiation device 252 by way of the manifold input ports 253 , 255 . the fluid flows from the pressure distribution manifold 250 are applied by way of the manifold output ports 121 a - l directly to the corresponding supply ports 123 a - l of the reprocessing unit basin 12 . therefrom , they are selectively applied to the devices 96 such as the medical instruments 96 . in the preferred embodiment , the manifold output ports 121 a - j are low pressure ports and the manifold output ports 121 k , l are high pressure ports . a high pressure fluid flow is received at the high pressure manifold input port 253 of the pressure distribution manifold 250 from the orifice port 251 b of the pressure differentiation device 252 . a short longitudinal bore hole 140 , opening at the high pressure manifold input port 253 , is provided at one end of the pressure distribution manifold 250 . the pressure distribution manifold 250 is bored transversely from each of the high pressure manifold output ports 121 k , l to the longitudinal high pressure bore hole 140 in order to permit the high pressure output ports 121 k , l to communicate with the high pressure bore hole 140 . thus , a high pressure fluid flow applied to the input port 253 of the pressure distribution manifold 250 is distributed to the high pressure , or narrower inner diameter , passageways of the medical instruments 96 by way of the high pressure bore hole 140 and the manifold output ports 121 k , l . a low pressure fluid flow is received at the low pressure input port 255 of the pressure distribution manifold 250 from the output port 251 c of the pressure differentiation device 252 . a long longitudinal bore hole 142 , opening at the low pressure manifold input port 255 , is provided within the pressure distribution manifold 250 . substantially as described with respect to the high pressure output ports 121 k , l , transverse bore holes extending from the low pressure output ports 121 a - j to the longitudinal low pressure bore hole 142 are provided . thus , the low pressure manifold output ports 121 a - j communicate with the low pressure bore hole 142 . in this manner , a low pressure fluid flow applied to the low pressure input port 255 of the pressure distribution manifold 250 is distributed to the low pressure passageways of the medical instruments 96 byway of the low pressure bore hole 142 and the manifold output ports 121 a - j . those skilled in the art will understand that possible turbulence at the distal end of the pressure distribution manifold 250 , in the region of the manifold output port 121 a can make the flow rates difficult to measure and / or difficult to control . therefore , in the preferred embodiment , the fluid flows provided by way of the supply port 123 a can be blown off into the reprocessing basin 12 , rather than applied to a medical instrument 96 . the pressure measurement openings 144 on the side of the pressure distribution manifold 250 individually communicate with the longitudinal bore holes 140 , 142 . the presence of the pressure measurement openings 144 on the pressure distribution manifold 250 permits measurement of the pressures within the bore holes 140 , 142 , as described in more detail below . referring now to fig7 , there is shown a block diagram representation of a process flow 95 for performing a reprocessing protocol within the reprocessing unit 83 suitable for reprocessing devices such as the medical instruments 96 . during a fill step of the process flow 95 , a solenoid - type water valve 230 is placed in an open position to enable water to flow from an outside hot / cold water source 232 through a water line 234 , into the reprocessing basin 12 to immerse the medical instrument 96 . the reprocessing basin 12 is provided with a drain 44 ( shown in fig2 ) located in the bottom of the reprocessing basin 12 . the drain 44 is connected to a drain line 212 . during the fill step , as wash water flows into the reprocessing basin 12 it begins to drain through the drain line 212 . a drain valve 164 , provided below the drain line 212 is normally in a closed state to prevent the draining of the water out of the system . this action enables the filling of the reprocessing basin 12 . a flow probe 220 is located adjacent the drain line 212 and is operative to detect the presence of liquid as wash water begins to fill the drain line 212 during filling of the reprocessing basin 12 . once the probe 220 detects the presence of moisture , the probe 220 sends a signal indicative thereof to a system controller which provides an indication to the user that the reprocessing basin 12 is filling with water . additionally , an operational float ( not shown ) is located within the reprocessing basin 12 . during filling , the operational float is buoyed upwardly and eventually reaches a predetermined height corresponding to a particular volume of wash water being present in the reprocessing basin 12 . when the operational float reaches this predetermined level , the reprocessing unit 83 indicates to the user that the reprocessing basin 12 has been filled and that the washing step can begin . thereafter , the water valve 230 is closed so that no additional wash water enters the reprocessing basin 12 . as wash water fills into the reprocessing basin 12 over the immersed medical instruments 96 , a solenoid - type detergent valve 262 and a detergent pump 266 operate to withdraw a predetermined amount , e . g ., three ounces , of detergent 254 from a detergent container 258 located adjacent the reprocessing unit 83 and inject the predetermined amount of detergent into the reprocessing basin 12 through a detergent line 264 . the detergent 254 may be of any suitable composition . one particularly effective type of detergent is sold under the trademark tergal 800 by custom ultrasonics , inc . during the wash step , a pump 246 , such as a diaphragm pump , is activated to draw the water / detergent mixture contained in the reprocessing basin 12 through an intake valve 240 and to circulate the mixture through the circular reprocessing basin 12 , the output ports 121 a - i of the pressure distribution manifold 250 , the tubing segments 132 a - l , and through the internal passageways 98 a - e of the immersed medical instrument 96 . any unused output ports 121 a - l can be blown off into the basin 12 . the pump 246 is a single output pressure pump . in this manner fluid is recirculated through the immersed medical instrument 96 for a predetermined period of time in order to reprocess the internal passageways of the internal medical instrument 96 in accordance with a predetermined reprocessing protocol . referring now to fig8 a - b , there is shown a flowmeter 256 for selectively coupling to the manifold output ports 121 a - l and individually measuring the flow rates of the fluids within the manifold output ports 121 a - l of the reprocessing unit 83 coupled thereto . the flowmeter 256 can be any conventional flow sensor suitable for measuring the flow rate through the ports 121 a - l , and thereby through the tubing segments 132 a - l . for example , the flowmeter 256 can be an in line straight - through flow tube sensor that uses ultrasonic sensing technology to measure the rate of flow of a fluid passing therethrough , such as the m - 1500 series provided by malema flow sensors . the flowmeter 256 can be omitted from any unselected output ports 121 a - l not supplying fluid to any internal passageways , for example the output ports 121 a which is blown off into the reprocessing basin 12 . an ultrasonic sensing flowmeter 256 is preferred because it is non intrusive , thereby permitting the fluid flow to the internal passageways 98 a - e of the medical instruments 96 to be measured without interference by the flowmeter 256 . ultrasonic sensing flowmeters 256 of this type are believed to be accurate from one - half cubic centimeter per minute to infinity for a multiple number of outputs . the flowmeter 256 provides a flow rate signal according to the measured flow rate , for example by tripping a switch within the flowmeter 256 when the flow rate falls below a predetermined value . in another embodiment , the flowmeters 256 can be of the well know piston type , wherein the force of the fluid flow through the flowmeter 256 raises and suspends a piston therein , until the flow rate falls below a predetermined value . when the flow rate falls below the predetermined value , the piston falls and a switch within the flowmeter 256 is tripped . the tripping of the switch within the flowmeter 256 indicates that the predetermined flow rate through the flowmeter 256 has not been maintained . it is believed that a flowmeter 256 of this type is not as accurate the ultrasonic type since it can interfere with the fluid flow being measured . in one preferred embodiment , the minimum flow rate through the high pressure ports 121 k , l can be approximately one cubic centimeter per minute . the minimum flow rate through the two lower pressure ports 121 a , b at the distal end of the pressure distribution manifold 250 can be approximately fifty cubic centimeters per minute . the minimum flow rate through the remaining low pressure ports 121 c - j can be 0 . 05 gallons per minute . thus , the flowmeters 256 disposed in line with the internal passageways 98 a - e provide an indication to the user of the reprocessing system 83 when the flow through any of the passageways 98 a - e of the surgical instruments 96 coupled to the reprocessing unit 83 is obstructed . when any of the internal passageways 98 a - e is determined to be obstructed in this manner , the reprocessing operation set forth in the process flow 95 is aborted , and the abort condition is communicated to the user of the reprocessing unit 83 . this feature prevents the inadvertent reuse of any device 96 that has not been completely reprocessed due to an obstruction in any of the internal passageways 98 a - e being reprocessed . without such a feature the operator can be left with a false sense of security regarding the success of the reprocessing operation . in the preferred embodiment , individual indicator lights ( not shown ) corresponding to each flowmeter 256 coupled to the pressure distribution manifold 250 are mounted on the exterior of the reprocessing unit 83 . the indicator lights permit an easy visual determination of which internal passageway 98 a - e is obstructed when the reprocessing operation is aborted . additionally , in one preferred embodiment , a lag time of approximately ten seconds can be provided between the detection of an obstruction by a flowmeter 256 and the abort of the reprocessing operation to allow for the breaking up of an obstruction due to back pressure provided by the pump . referring now to fig9 a - c , there are shown representations of the pressure sensing switch 320 of the reprocessing unit 83 . the pressure sensing switch 320 is adapted to measure the pressure of the longitudinal bore holes 140 , 142 within the pressure distribution manifold 250 , and to provide an electrical pressure signal according to the measured pressure of the bore holes 140 , 142 . in an alternate embodiment ( not shown ) a flowmeter 256 coupled to a manifold output port 121 a - l of the pressure distribution manifold 250 can be omitted . in such an embodiment , the pressure sensing switch 230 is mounted in a pressure measurement opening 144 communicating with a longitudinal bore 140 , 142 of the pressure distribution manifold 250 . for example , the flowmeters 256 can be removed from the manifold output ports 121 k , l , and the high pressure flow rate can be measured by a pressure sensing switch 320 mounted in the pressure measurement opening 144 disposed in communication with the longitudinal bore hole 140 . thus , the pressure of the manifold output ports 121 k , l is monitored using the pressure sensing switch 320 rather than measuring the fluid flow rate using a flowmeter 256 . in this alternate embodiment , an obstruction within a high pressure passageway of the medical instrument 96 is detected by sensing a change in pressure rather than a change in flow rate . thus , the reprocessing of the instrument 96 is aborted according to the pressure measured by the pressure sensing switch 320 rather than a direct measurement of flow rate . in one embodiment the pressure sensing switch 320 can be adapted to provide an electrical pressure signal when the measured pressure is at a level in the range of 1 . 5 to 15 psi . referring now to fig1 , there is shown a portion of the reprocessing unit 350 . the reprocessing unit 350 is an alternate embodiment wherein the flow paths 125 a - j transmit fluid from the manifold output ports 121 a - j of the distribution manifold 250 to the supply ports 123 a - j . the flow paths 125 a - j can be , for example , tubing segments . each flow path 125 a - j is provided with two pressure sensors 60 a - j , 61 a - j . the two pressure sensors 60 a - j , 61 a - j of each flow path 125 a - j are spaced apart and mounted at two points on each of the flow paths 125 a - j . the flowmeters 256 can be omitted in this embodiment , as flow is monitored using the pressure sensors 60 a - j , 61 a - j . in a preferred embodiment , the pressure sensors 60 a - j , 61 a - j will measure two pressure values for each output port 121 a - j . these values can then be used to determine the flow rates through the flow paths 125 a - j . this calculation can easily be performed by one skilled in the art . for example , the two pressures can be applied to the well - known bernoulli equation to calculate the flow through the output ports 121 a - j . preferably , the pressure sensors 60 a - j , 61 a - j should be positioned not to obstruct or restrict the flow path . this will ensure a more accurate pressure reading . additionally , in a preferred embodiment the flow through the flow paths 125 a - j should be as close to laminar as possible . this also will increase the accuracy of the pressure readings . preferably , the distribution manifold 250 is designed to achieve laminar flow . in this embodiment , the reprocessing of the instrument or device 96 is aborted according to the flow rate determined from the two measured pressures on each output port 121 a - j . preferably , signals representing the pressure values detected by the pressure sensors 60 a - j , 61 a - j are transmitted to a computer equipped with software designed to process the signals . the software will translate the pressure values into flow rates , for example , by using the bernoulli equation . when the pressure differential signifies no flow or minimum flow , according to predetermined minimum flow levels , the cycle is aborted . the reprocessing unit can include a plurality of pumps ( not shown ) and associated tubing systems 132 a - l , wherein each pump provides one of the differing pressures required to reprocess the differing passageways of the devices 96 . each individual tube of the tubing assembly can have its flow monitored separately by flow determining sensors on each tube . the flow determining sensors can be pressure sensors , or flow meters ( piston type or ultrasonic ). in another embodiment , the reprocessing unit can include individual pumps ( not shown ) associated with each individual flow path 125 a - j . the single pump 246 with the pressure differentiation device 252 would be omitted , as well as the pressure distribution manifold 250 . in this embodiment , the fluid is pulled from within the reprocessing basin 124 , through the purge intake filter 240 , feeding the inputs of the individual pumps ( not shown ). each pump then supplies a flow path 125 a - j , for example tubing segments , to the supply ports 123 a - j located on the reprocessing basin 124 at a predetermined flow and / or pressure rate . this predetermined flow and / or pressure rate is monitored separately by flow determining sensors . the flow determining sensors can be pressure sensors , or flow meters ( piston type or ultrasonic ). in the preferred embodiment , individual indicator lights ( not shown ) corresponding to each pair of pressure sensors 60 a - j , 61 a - j mounted to the pressure distribution manifold 250 are mounted on the exterior of the reprocessing unit . the indicator lights permit an easy visual determination of which internal passageway 98 a - e is obstructed when the reprocessing operation is aborted . additionally , in one preferred embodiment , an adjustable lag time can be provided between the detection of an obstruction by the pressure differential and the abort of the reprocessing operation to allow for the breaking up of an obstruction due to back pressure provided by the pump . in another alternate embodiment ( not shown ) of the reprocessing unit 83 an ultrasonic flow sensor such as the flowmeter 256 can be mounted on the pressure distribution manifold 250 , for example , at the input end of the pressure distribution manifold 250 . this type of ultrasonic measurement of flow rate is extremely sensitive , allowing the detection of changes in flow rate as small as a few drops per minute . the reprocessing operations of the process flow 95 are aborted when the flow detected by such an ultrasonic measurement device mounted on the pressure distribution manifold 250 in this manner is below the predetermined level . once the water / detergent mixture has passed through the internal passageways 98 a - e of the immersed medical instrument 96 , it flows back into the reprocessing basin 12 where it is again recirculated by the pump 246 for a predetermined minimum period of time based upon guidelines provided by the detergent manufacturer , e . g ., one - hundred eighty seconds . during the wash step , the ultrasonic crystals 282 located below the reprocessing basin are activated . when activated , the ultrasonic crystals 282 generate ultrasonic vibrations that act in combination with the detergent - water mixture to cause a cleansing action that breaks down , loosens and removes contaminants from the exterior and interior surfaces of the flexible medical instrument 96 to provide enhanced cleaning . once the predetermined time period for the wash step has elapsed , the drain step begins . during the drain step , the drain valve 164 is opened and the drain pump 216 is activated . while the pump 246 continues to pump the water / detergent mixture through the medical instrument 96 , the mixture begins to drain out of the reprocessing basin 12 by means of the drain pump 216 which pumps the water / detergent mixture down the drain line 212 and into a t - assembly 217 . the mixture travels through drain valve 164 , through a standpipe 165 and into a sewer drain 167 . once the flow probe 220 detects the absence of moisture in the drain line 212 , the drain pump 216 is shut off and the drain valve 164 is returned to its closed position . after the drain pump 216 is shut off , an air pump 224 is activated and a solenoid - type air valve 226 is opened . by use of the air pump 224 forced air is directed through the pump 246 , the manifold assembly 250 , the tubing segments 132 a - e , and through the internal channels of the medical instrument 96 . the forced air acts to purge and clear away any residual water / detergent mixture remaining in the interior channels of the medical instrument 96 . the purged residual water / detergent mixture flows down the drain line 212 located below the reprocessing basin 12 and collects in the bottom of the t - assembly 217 located below the drain line 212 . the purged residual water / detergent mixture is removed from the bottom of the t - assembly 217 by means of a residual drain line 310 and a residual drain pump 314 that is activated simultaneously with the air pump 224 . the first rinse cycle comprises the steps of fill , rinse and drain steps . during the fill step , water is introduced into the reprocessing basin 12 from the outside source 232 by means of water valve 230 and water line 234 . since this is a rinse cycle , as opposed to a wash cycle , no detergent 254 is introduced during the fill step . during the rinse step of the process flow 95 , the pump 246 draws the rinse water contained in the reprocessing basin 12 through the intake valve 240 and recirculates the rinse water for a predetermined minimum period of time in a manner as previously described above in connection with the wash step . also , during the rinse step , the ultrasonic crystals 282 are activated . thereafter , the drain step begins . during the drain step , rinse water is pumped out of the reprocessing basin 12 by the drain pump 216 . the water travels down the drain line 212 through the drain pump 216 and into the t - assembly 217 . because the drain valve 164 is in the opened position , the water travels through drain valve 164 and through standpipe 165 and into a sewer drain 167 . once the flow probe 220 detects the absence of moisture in the drain line 212 , the drain pump 216 is shut off . some residual water remains in the bottom of the t - assembly 217 that cannot be removed by the drain pump 216 . this residual rinse water is removed from the bottom of the t - assembly 217 by means of the residual drain line 310 and the residual drain pump 314 in the manner previously described . by removing all residual rinse water from the t - assembly 217 , chemical disinfectant introduced in the next step of the protocol will not become diluted with any residual rinse water . once the drain step 141 is complete and all residual rinse water has been removed from the t - assembly 217 , the next fill step begins and a chemical disinfectant 288 is introduced into the reprocessing basin 12 . one particularly effective type of chemical disinfectant is 2 % or 3 % glutaraldehyde which is marketed by a number of different companies under various brand names such as cidex manufactured by johnson & amp ; johnson . the introduction of the disinfectant 288 is effected by opening a reservoir feed valve 298 to cause a reservoir pump 294 to pump the chemical disinfectant 288 from a chemical disinfectant reservoir 290 through a chemical line 306 into the reprocessing basin 12 . the chemical disinfectant 288 enters and fills the reprocessing basin 12 to a predetermined height as previously described . once the reprocessing basin 12 has been filled with the chemical disinfectant 288 to the predetermined level , the pump 246 is activated to draw the chemical disinfectant 288 contained in the reprocessing basin 12 through the intake valve 240 . this action circulates the chemical disinfectant 288 through the ports of the manifold 250 , the tubing segments 132 a - e and through the internal passageways 98 a - e of the immersed medical instrument 96 . once the chemical disinfectant 288 has passed through the internal passageways of 98 a - l of the immersed medical instrument 96 , it flows back into the reprocessing basin 12 where it is recirculated by the pump 246 for a predetermined minimum period of time based upon guidelines provided by the manufacturer of the chemical disinfectant 288 . once the predetermined minimum time period for the chemical immersion step has elapsed , the pump 246 is turned off . thereafter , the chemical disinfectant 288 is returned to the chemical disinfectant reservoir 290 for reuse . to enable the return of the chemical disinfectant 288 to the reservoir 290 , the drain valve 164 is closed and the reservoir return valve 302 is opened . the drain pump 216 is activated and the chemical disinfectant 288 is pumped through the chemical line 306 , through the reservoir return valve 302 and back into the chemical reservoir 290 . once the flow probe 220 detects the absence of moisture in the drain line 212 , the drain pump 216 is tuned off . thereafter , two additional rinse cycles are performed . the first rinse cycle comprises a first rinse and a drain phase . the rinse cycle is performed in a manner similar to the rinse cycle previously described . however , this rinse cycle does not include use of the residual drain line 310 and residual drain pump 314 . the ultrasonic crystals 282 are activated during the rinse step of this rinse cycle . the second rinse cycle comprises fill , second rinse and drain phases . this rinse cycle is performed in a manner similar to the rinse cycle previously described , i . e ., fill , rinse and drain phases , and includes use of the residual drain line 310 and residual drain pump 314 . the ultrasonic crystals 282 are activated during the rinse step of this rinse cycle . once this rinse cycle has been completed , the reprocessing protocol is complete and the instrument may be removed from the reprocessing chamber for reuse . referring now to fig1 and 12 , there is shown a disinfectant transfer system according to the invention . a transfer cap 500 is fitted onto a bottle 502 containing a chemical disinfectant 288 . the transfer cap 500 has a first opening 504 for letting air , or some other gas , in through a valve 506 which is inserted in the first opening 504 . a second opening 508 on the transfer cap 500 is provided for allowing the chemical disinfectant 288 to exit the bottle 502 when the chemical disinfectant 288 is displaced by air entering through the valve 506 in the first opening 504 . preferably the valve 506 is a spring loaded self - closing locking valve of a type well known to those skilled in the art . a first conduit 510 connected to the bottom of the second opening 508 and extending to the bottom of the bottle 502 , allows for a pathway by which the chemical disinfectant 288 can exit the bottle 502 . from the first conduit 510 the chemical disinfectant can then enter a second conduit 512 , which is connected to the top of the second opening 508 , and flow into a reservoir 290 into which the chemical disinfectant 288 can enter . in a preferred embodiment , a manifold 250 linked to the first opening 504 by a third conduit 514 can be used to supply the air which enters the bottle 502 through the first opening 504 . however , any source of air can be used . additionally , in a preferred embodiment an o - ring 516 is fitted between the second opening 508 and the second conduit 512 to assist in creating an essentially vapor tight seal . still furthermore , in a preferred embodiment the valve 506 is a one - way check valve for only allowing air to enter the bottle 502 . it should be appreciated that the disinfectant transfer system described is a closed system from inside of the bottle , or other suitable container , to inside of the reservoir . therefore , essentially no fumes escape during the transfer of the disinfectant from the bottle to the reservoir . if should further be appreciated that the transfer cap detachably attaches onto the bottle , or other suitable container , and can therefore be removed and detachably attached onto another bottle , or other suitable container . as a result , disinfectant contained in multiple bottles , or other suitable containers , can be easily transferred to a reservoir through the closed system . without further elaboration , the foregoing will so fully illustrate the invention that others may , by applying current or future knowledge , readily adapt the same for use under the various conditions of service .

US-26766605-A

an animal trap of the type which precipitates an animal into a disposal chamber through a disposal opening , characterized by having a pyramidal bait chamber , with an entrance and non - grip internal surfaces , around the disposal opening , and a pivoted shutter that normally closes the disposal opening , but is actuated by the weight of the animal to not only unclose the disposal opening , but also close the entrance .

a trap according to my invention comprises a platform 10 supporting a bait chamber 11 and resting on a disposal chamber 12 : access to platform 10 by mice is provided by a ramp 13 . chamber 11 tapers upwardly and is constructed of first and second opposite tapering sides 21 and 22 , a third side 23 , a fourth side 24 opposite side 23 , and a top 25 movably secured to side 22 by hinges 26 , and to side 23 by a fastener 27 . top 25 may be provided with a carrying handle 30 , and a bait carrier 31 of any desired sort is secured to the under surface of top 25 . side 23 of chamber 11 is open for a distance d above platform 10 , to provide an entrance 32 to the chamber . sides 21 and 22 and top 25 extend outward beyond side 23 to comprises an open ended approach 33 to entrance 32 . side 24 is constructed of an upper portion 34 and a lower portion 35 separated to provide a slot 36 . this enables circulation of air through bait chamber 11 , to spread the aroma of bait in the environment , and to increase with willingness of a rodent to enter the bait chamber , since rodents are somewhat reluctant to enter closed spaces . slot 36 is not wide enough , however , to permit the escape of a rodent therethrough . the inner surfaces of bait chamber 11 are smoothly covered with metal . a large opening 40 is provided in the middle of platform 10 , and a shaft 41 extends across aperture 40 near the end thereof adjacent to entrance 32 . a shutter 42 is pivoted on shaft 41 , and has first and second portions 43 and 44 extending in opposite directions from the shaft . the shutter moves between first and second extreme positions shown in fig7 in solid and broken lines respectively . in the first position portion 43 closes opening 40 and portion 44 overlies platform 10 : in the second position portion 44 engages wall 23 at a bumper 48 to close entrance 32 , and portion 43 is tilted steeply downward from shaft 41 . the shutter is preferably made of metal on which the rodent &# 39 ; s feet can take no purchase . a layer of suitable thin material such as plywood is applied to the upper surface of portion 44 to act as a counterweight 45 , so that shutter 42 is normally maintained firmly in its first position , but the arrangement is such that when a mouse advances over counterweight 45 and onto portion 43 its weight is sufficient to overcome counterweight 45 , and the shutter tilts quickly to its second position . if desired , disposal chamber 12 may be filled with a liquid 46 such as crankcase oil or water , with antifreeze if necessary , to a level just below the lower limit of travel of portion 43 of shutter 42 . preferably the rim of chamber 12 is inturned and platform 10 covers the open end of chamber 12 completely , to prevent all egress therefrom . as a practical matter shutter 42 is most conveniently made of metal , although ramp 13 , platform 10 , and chamber 11 may be of less expensive material , such as wood , except for the nongrip lining of the bait chamber . a rodent approaching bait holder 31 would encounter wooden footing until it reaches the inner end of counterweight 45 , where the footing would change to metal . this change of footing is enough to prevent some rodents from taking the few further steps toward the bait holder , and they abandon the bait at this point . we have found that if the edge of platform 10 nearest ramp 13 and aperture 33 is overlaid by a strip 47 of like metal , which is not in a confined space and can safely be investigated , the rodents are thereafter less affected by a second change of footing as they step off counterweight 45 . we have also found that shutter 42 and strip 46 should be coated with paint to prevent the rodents from being kept away by high or low temperatures conducted to their sensitive feet in summer or winter . to use the rodent trap , disposal chamber 12 is filled with a desired liquid to a desired level , if the rodents are to be disposed of by drowning . fastener 27 is undone , top 25 is opened , and bait is placed in holder 31 after which top 25 is again secured . since the rodents do not actually reach holder 31 , replacement of bait is seldom needed . the disposal chamber is placed in a desired location , the assembly of platform 10 and bait chamber 11 is positioned thereon to entirely cover the rim of chamber 12 , and when ramp 13 is positioned to give access to platform 10 , the trap is set . the aroma of the bait pervades the environment , aided by air circulation suggested by the solid arrows in fig7 . when a hungry rodent detects the bait he mounts ramp 13 , crosses strip 47 , enters approach 33 , and crosses counterweight 45 , to pass through entrance 32 under wall 23 . as he moves about the bait chamber attempting to reach the bait , his weight overcomes counterweight 45 , and the shutter moves gravitationally from its first to its second position , as suggested by the broken arrow in fig7 . depriving the rodent of support . the movement of the shutter is not instaneous . the rodent can sense this movement , be alarmed thereby , and attempt to retrace its steps or to cling to shutter 42 or the walls of bait chamber 11 . the outward angulation of the walls and their metal linings , as well as the metallic nature of shutter 42 , give the rodent little purchase to accelerate his attempted departure , and portion 44 of the shutter quickly closes entrance 32 to such an extent that egress is no longer possible there . the rodent must drop into the disposal chamber 12 for destruction . counterweight 45 now returns shutter 42 to its first position , and the trap is immediately ready to receive and dispose of another rodent : the operation of the trap is free from loud snaps or other sounds tending to frighten other rodents away . it is only necessary that the owner of the trap ocassionally empty the disposal container and recharge it with liquid as desired : the bait can be renewed at the same time . actual experience with this trap over a single 14 day period resulted in the trapping of 99 mice . from the foregoing it will be evident that we have invented a new mousetrap characterized by a tapering bait chamber structure , a plurality of nongrip surfaces , and a shutter that not only opens a disposal aperture but closes the normal access opening , to prevent rodent egress . numerous characteristics and advantages of our invention have been set forth in the foregoing description , together with details of the structure and function of the invention , and the novel features thereof are pointed out in the appended claims . the disclosure , however , is illustrative only , and changes may be made in detail , especially in matters of shape , size , and arrangement of parts , within the principle of the invention , to the full extent indicated by the broad general meaning of the terms in which the appended claims are expressed .

US-1631779-A

a method of texturing a soft prosthetic implant shell , such as a silicone breast implant shell . a soft prosthetic implant with a textured external surface layer of silicone elastomer and having an open - cell structure is made by adhering and then dissolving round salt crystals . the resulting roughened surface has enhanced physical properties relative to surfaces formed with angular salt crystals . an implant having such a textured external surface layer is expected to help prevent capsular contraction , to help prevent scar formation , and to help in anchoring the implant within the body .

the present invention provides a saline - or gel - filled soft implant for prostheses and tissue expanders . the implant generally comprises a shell , for example , a silicone elastomer shell , with a textured surface . the primary application for such soft implants is to reconstruct or augment the female breast . other potential applications are implants for the buttocks , testes , or calf , among other body regions . fig1 a - 1c illustrate one process for forming flexible implant shells for implantable prostheses and tissue expanders , involving dipping a suitably shaped mandrel 20 into a silicone elastomer dispersion 22 . many such dispersions are used in the field . basically they contain a silicone elastomer and a solvent . the silicone elastomer is typically polydimethylsiloxane , polydiphenyl - siloxane or some combination of these two elastomers . typical solvents include xylene or trichloromethane . different manufacturers vary the type and amount of the ingredients in the dispersion , the viscosity of the dispersion and the solid content of the dispersion . nonetheless , the present invention is expected to be adaptable to have utility with a wide variety of silicone rubber dispersions . the mandrel 20 is withdrawn from the dispersion and the excess silicone elastomer dispersion is allowed to drain from the mandrel . after the excess dispersion has drained from the mandrel at least a portion of the solvent is allowed to volatilize or evaporate . normally this is accomplished by flowing air over the coated mandrel at a controlled temperature and humidity . different manufacturers use various quantities , velocities or directions of air flow and set the temperature and humidity of the air at different values . however , the desired result , driving off the solvent , remains the same . it is also common for prostheses manufacturers to repeat this dip and volatilize procedure a number of times so that a number of layers are built up on the mandrel to reach a desired shell thickness . a layered structure like most current silicone elastomer shells can be made by sequentially dipping the mandrel in different dispersions . alternatively , the steps may be repeated in a single dispersion 22 so that the finished product is a single homogenous material or layer . that is , the dipping process may be done in multiple stages or steps , each step adding more material , yet the finished product exhibits no distinct layers and the entire shell wall is homogenous or uniform in composition . fig2 illustrates in cross - section a portion of a textured multi - layered implant of the present invention . a primary barrier to fluid passage through the shell wall is provided by an inner barrier layer 30 . two base coat layers 32 , 34 lie radially inward from the barrier layer 30 . in some cases a single base coat layer may be used . on the outer side of the barrier layer 30 , three further base coat layers 36 , 38 , 40 are provided , although again a single outer layer may be used . furthermore , outside of the outer base coat layers 30 - 40 , a tack coat layer 42 , a layer of textured crystals 44 , and an overcoat layer 48 are provided . the absolute thickness of the implant wall may vary but an exemplary average thickness is about 0 . 456 mm ( 0 . 018inches ). the overall thickness of the textured implant wall is somewhat greater than a similar smooth - walled shell because of the extra layers . alternatively , fig3 illustrates a cross - section of textured single - layered implant shell wall 50 that is a homogeneous silicone elastomer made entirely of a barrier material that sterically retards permeation of the silicone gel through the shell . the outer surface 52 of the barrier layer 50 is textured . the implants made with the single layer 50 may be for implant in the breast such that the entire flexible outer shell is shaped accordingly , for instance in with a more flattened posterior side and rounded anterior side . in addition to the aforementioned dipping process , the flexible shell for the prosthetic implant may be formed using a molding process . for example , a rotational molding process such as described in schuessler , u . s . pat . no . 6 , 602 , 452 , may be used . the process for forming texturing on the exterior surface is preferably done using a dipping technique , but the formation of the flexible shell may then be accomplished by one of a number of methods . an exemplary process for forming a textured outer surface on either a multi - layered shell as in fig2 or a single - layered shell as in fig3 will now be described . after the mandrel 20 of fig1 a - 1c is raised out of the dispersion with what is to be the final layer adhering thereto , this layer is allowed to stabilize . that is , it is held until the final coating no longer flows freely . this occurs as some of the solvent evaporates from the final coating , raising its viscosity . again , it should be understood that alternative methods are contemplated for forming the flexible shell prior to the texturing process . the dip molding process advantageously results in the flexible shell pre - mounted on a dipping mandrel , which can then be used for the texturing process . however , if the flexible shell is made by another technique , such as by rotational molding , it can subsequently be mounted on a dipping mandrel and the process continued in the same manner . once the flexible shell has been stabilized and mounted on the mandrel , any loose fibers or particles are blown off of the exterior of the shell with an anti - static air gun . a tack coat layer is then applied . the tack coat layer may be sprayed on , or may be applied by dipping the flexible shell on the mandrel into a tack coat material , for example , a tack coat dispersion . the operator immerses the flexible shell into the dispersion and returns the mandrel to a rack for stabilization . the time required for stabilization typically varies between about 5 and about 20 minutes . a suitable tack coat layer may be made using the same material employed in the base layers . after tack coat layer has been applied , rounded salt particles are applied substantially evenly over the entire surface . the solid particles may be applied manually by sprinkling them over the surface while the mandrel is manipulated , or a machine operating like a bead blaster or sand blaster could be used to deliver a steady stream of solid particles at an adequate velocity to the coating on the mandrel . in one embodiment , the coated mandrel is dipped into a body of the particles . in another embodiment , particle application is accomplished by exposing the coated mandrel to a liquid dispersion of the particles . it should be understood that the present invention is not intended to be restricted to any one particular method of applying the particles . in one embodiment , a salt bath for coating the tacky flexible shells is prepared by first procuring a quantity of rounded salt crystals and sorting the crystals into a desired size range . for example , unsorted rounded salt crystals are placed in a shaker having a first sieve size ( e . g . coarse sieve ) and a second sieve size ( e . g . fine sieve ). larger salt crystals will be stopped by the coarse sieve at the inlet of the salt shaker , while smaller salt crystals will continue through both of the sieves . crystals in the desired size range are trapped between the sieves . in a specific embodiment , the first sieve is a 14 mesh sieve and the second sieve is a 20 mesh sieve . in another embodiment , the first sieve is a 20 mesh sieve and the second sieve is a 40 mesh sieve . in yet another embodiment , the first sieve is a 40 mesh sieve and the second sieve is a 80 mesh sieve . in one embodiment , the rounded particles used in accordance with the invention have a substantially uniform particle size of between about 150 microns and about 1450 microns . in one embodiment , the rounded particles comprise or consist of relatively fine grained particles . for example , in one embodiment , the rounded particles have a maximum particle size of at least about 150 microns , for example , the particles have a maximum particle size in a range of between about 180 microns and about 425 microns . for example , about 90 % of the rounded particles will be retained between a sieve having mesh size 80 and a sieve having mesh size 40 . in another embodiment , the rounded particles comprise or consist of relatively medium grained particles . for example , in one embodiment , the rounded particles have a maximum particle size of at least about 300 microns , for example , the particles have a maximum particle size in a range of between about 425 microns and about 850 microns . for example , about 90 % of the particles will be retained between a sieve having mesh size 40 and a sieve having mesh size 20 . in yet another embodiment , the rounded particles comprise or consist of relatively large grained particles . for example , in one embodiment , the rounded particles have a maximum particle size of at least about 800 microns , for example , the particles have a maximum particle size in a range of between about 850 microns and about 1450 microns . for example , about 90 % of the particles will be retained between a sieve having mesh size 20 and a sieve having mesh size 14 . the size of the salt crystals can be selected by sorting a bulk quantity of rounded salt crystals using a series of gradually smaller meshes . in accordance with one embodiment of the invention , the salt crystals , for example , those having a particular size distribution are then added to an aqueous salt bath prior to being applied to the shell . the tacky flexible shells are immersed in the salt bath , rotated for even coverage , removed , and then allowed to stabilize . after a suitable period of stabilization , such as between about 5 minutes and about 20 minutes , the flexible shells may be dipped into an overcoat dispersion . a suitable overcoat dispersion may also be made using the same material employed in the base layers . the flexible shells on the mandrels are then mounted on a rack and allowed to volatilize for a sufficient time , such as , for example , about 15 minutes . in one embodiment , the entire silicone elastomer shell structure is vulcanized or cured in an oven at elevated temperatures . for example , the temperature of the oven is maintained at a temperature between about 200 ° f . and about 350 ° f . for a curing time preferably between about 20 minutes and about 1 hour , 40 minutes . upon removal from the oven , the mandrel / shell assembly is placed in a solvent for the solid particles , and the solid particles are allowed to dissolve . the solvent is a material that does not affect the structure or integrity of the silicone elastomer . when the solid particles have dissolved , the assembly is removed from the solvent and the solvent evaporated . the shell is then removed from the mandrel . at this point , it is preferable to place the shell in a solvent for the solid particles and gently agitate it to ensure complete dissolution of all the solid particles . once the shell has been removed from the solvent , the solvent evaporates or otherwise is removed from the shell . dissolving the solid particles leaves behind open pores , voids or spaces in the surface of the shell . when applied , some of the solid particles are partially exposed so that they can be acted upon by the solvent . these exposed solid particles also provide a way for the solvent to reach those solid particles beneath the surface to dissolve them in turn . the result is an interconnected structure of cells , some of which are open to the surface , in the outer layer of the shell . the process described above produces a shell like that shown in either fig2 or 3 . the shell has a thin outer wall made of silicone elastomer with an opening therein at the point where a support member connected to the mandrel 20 , which opening will subsequently be covered with a patch . the present invention diverges from previous processes in the make - up of the salt crystals used in the dispersion 22 . namely , as seen in fig4 , rounded salt crystals 60 are shown over a reference scale 62 . in contrast to regular crystalline sodium chloride 70 , as seen against a scale 72 in fig5 , the rounded salt crystals 60 have been appropriately processed to smooth any sharp or non - rounded edges that are typically found on standard sodium chloride crystals 70 ( sometimes , termed “ cubic salt crystals ”). fig6 a and 6b illustrate in magnified cross - section and plan view , respectively , an implant shell 80 of the prior art having texturing formed using conventional cubic salt crystals . the shell 80 includes an inner wall 82 and an outer textured surface 84 . this textured surface 84 is formed by applying cubic salt crystals and then dissolving those crystals to leave an open - celled porous surface . the relatively rough surface 84 is partly the result of the angular salt crystals used in the formation process . the particular texture illustrated is sold under the tradename biocell ® surface texture by allergan , inc . of irvine , calif . fig7 a and 7b illustrate in magnified cross - section and plan view , respectively , another implant shell 90 of the prior art having texturing formed using conventional cubic salt crystals . the shell 90 includes an inner wall 92 and an outer textured surface 94 . this textured surface 94 is formed by an embossing process that imprints the texture on uncured silicone material . the particular texture illustrated is sold under the tradename siltex ® surface texture by mentor corp . of santa barbara , calif . now with references to fig8 a and 8b , a magnified cross - section and plan view of an implant shell 100 of the present invention having texturing formed using rounded salt crystals is illustrated . the shell 100 includes an inner wall 102 and an outer textured surface 104 exhibiting an undulating topography . this textured surface 104 is formed by applying rounded salt crystals and then dissolving those crystals to leave an open - celled , porous , textured surface , as explained above . the textured surface 104 is somewhat smoother than those made with angular salt crystals , as seen in fig6 and 7 . although not shown in great detail , the pores or openings in the open - celled surface 104 have smoother dividing walls and fewer angular discontinuities than the pores or openings in conventionally manufactured shells that are otherwise identical but use angular salt crystals rather than rounded salt crystals . as will be shown , this difference surprisingly leads to statistically significant changes in overall shell strength . in one embodiment , the rounded salt crystals are applied so as to achieve a depth ranging from a portion of one crystal diameter to a multiple of many crystal diameters . the crystals may be embedded in the surface of the shell to a depth of from about one to about three times the diameter of the crystals . penetration of the solid crystals depends upon the size of the crystals , the thickness of the final uncured layer , the viscosity of the uncured layer and the force with which the crystals are applied . these parameters can be controlled to achieve a desired depth of penetration . for example , if the last layer is relatively thick and low in viscosity , less external force will be required on the solid crystals to produce an acceptable pore depth . although standard sodium chloride is preferably used for the rounded salt crystals , other salts may be suitable based on several factors : ( 1 ) the salt should be economically available in the desired particle sizes ; ( 2 ) the salt should be nontoxic in case some remains in the surface of the prosthesis ; and ( 3 ) the salt should be readily soluble in a solvent that is economically available , nontoxic and does not dissolve the silicone elastomer . in one embodiment , the rounded salt particles are sodium chloride crystals which are readily available in granulated form , and can be processed into round crystals , for example , by an industrial milling facility , including central salt & amp ; marine chemicals research institute of bhavnagar , india , a subsidiary of the council of scientific & amp ; industrial research ( csir ), a publicly funded industrial r & amp ; d organization in india . when crystalline sodium chloride is used in accordance with the invention , the solvent may comprise pure water . a person of ordinary skill in the art will understand that a number of solid and solvent pairs could be chosen in accordance with various embodiments of the invention . after finishing the shell according to the steps described above , additional processing steps may be performed . for example , the opening left by the dip molding process may be patched with unvulcanized sheeting , for example , uncured silicone elastomer sheeting . if the prosthesis is to be filled with silicone gel , this gel may be added and cured , the filled prosthesis packaged , and the packaged prosthesis sterilized . if the prosthesis is to be inflated with a saline solution , a one - way valve is assembled and installed , the prosthesis is post cured if required , and the prosthesis is then cleaned , packaged and sterilized . a combination breast implant prosthesis can also be made wherein a gel - filled sac is positioned inside the shell to be surrounded by saline solution . as mentioned above , the properties of an implant shell having a texture formed with round salt crystals are statistically superior to those formed using cubic salt crystals . this is believed to be due to a reduction in stress concentrations , which may be seen at the sharp corners formed using cubic salt crystals . to compare the different shells , standard tensile strength specimens were cut from the shells and subjected to stress tests . the comparison shell was a standard commercial textured shell of the prior art sold under the tradename inamed ® biocell ® saline - or silicone - filled breast implants , by allergan , inc . of irvine , calif . more specifically , random biocell ® shells formed using the process described with reference to fig6 a and 6b were used for comparison . sixty specimens from this group were cut using an h2 die and tested for tensile strength . table i below illustrates the results . likewise , sixty specimens from a group of shells formed using the process of the present invention were cut using an h2 die and tested for tensile strength . table ii below illustrates the results . these data show that test samples of similar thickness formed by the methods of the present invention experience lower stresses during elongation while the break force , ultimate elongation , and tensile strengths are significantly higher . specifically , the mean thickness of the test samples formed in accordance with present invention was 0 . 0214 inches , while the mean thickness of the prior art test samples was 0 . 0209 inches , or around a 2 . 3 % difference . however , the mean ultimate break force for samples of the present invention was more than 5 % greater , the mean ultimate elongation was more than 6 % greater , and the mean ultimate tensile strength was nearly 3 % greater than samples of the prior art . given the number of samples ( n = 60 ), these differences are somewhat surprising given the similar technique for forming the shells and similar thicknesses . applicants believe that the rounded salt crystals form a smoother open - cell structure on the exterior of the shells which reduces stress concentrations . as such , the test results indicate other than an expected linear relationship proportional to the difference in thickness . it is also important to note the improvement in ultimate elongation . the resulting 662 % mean elongation for the sixty shells tested is well past the level required by various regulatory bodies around the word . in particular , the u . s . standard is 350 % from astm f703 , standard specification for implantable breast prostheses . in europe and elsewhere , the standard for elongation is set at 450 % by iso 14607 . the implant shells formed by the lost material technique and rounded salt crystals satisfy these standards with greater margins of confidence than ever before . it is believed that changing from a cubic crystal with sharp corners and edges to the rounded crystals where stress concentrations are more evenly distributed helps statistically meet consensus performance breast standards . in addition , tests were conducted on shells that were formed using the texturing process of the present invention both with conventional cubic salt crystals and with the rounded salt crystals disclosed herein . that is , instead of comparing the shells of the present invention with existing commercial shells , new shells were formed using the same process but with conventional angular or cubic salt crystals . specifically , five shells textured with regular cubic salt crystals were dip molded , and five shells textured with rounded salt crystals were also dip molded . all the shells were subjected to gel curing at 145 ° c . for 8 hours , and then subjected to a simulated sterilization at 127 ° c . for 20 . 5 hours . sixty tensile strength specimens from each batch were cut with an h2 die and tested . these results are shown in the following tables iii and iv . again , these data show that test samples of similar thickness formed by the methods of the present invention experience lower stresses during elongation while the break force , ultimate elongation , and tensile strengths are significantly higher . specifically , the mean thickness of the test samples formed in accordance with present invention was 0 . 0196 inches , while the mean thickness of the prior art test samples was 0 . 0197 inches , or around a 0 . 05 % difference , with the samples made in accordance with the present invention being thinner on average . however , the mean ultimate break force for samples of the present invention was more than 5 % greater , the mean ultimate elongation was more than 3 % greater ( and sufficient to meet global standards ), and the mean ultimate tensile strength was nearly 6 % greater than samples of the prior art . given the number of samples ( n = 60 ) and the fact that the shells were identically formed except for the shape of the salt crystals , these differences are even more surprising than the previous comparison . once again , the test results indicate a non - linear relationship relative to the difference in thickness . although the invention has been described and illustrated with a certain degree of particularity , it is understood that the present disclosure has been made only by way of example , and that numerous changes in the combination and arrangement of parts can be resorted to by those skilled in the art without departing from the scope of the invention , as hereinafter claimed .

US-26193908-A

an intraoral x - ray sensor with embedded standard computer interface . the sensor includes a data transfer cable . in one embodiment , the cable is quad - twisted usb cable and includes two data lines , a ground line , and fillers twisted within a metallic sheath . the cable is symmetrically organized about a centerline . the symmetric cable has an improved life due to the ability to withstand mechanical stress . the sensor includes a processor and a housing with an inner metallization layer . the sheath is coupled to the inner metallization layer to transfer heat generated by the processor from the inner metallization layer to the sheath .

before any embodiments of the invention are explained in detail , it is to be understood that the invention is not limited in its application to the details of construction and the arrangement of components set forth in the following description or illustrated in the following drawings . the invention is capable of other embodiments and of being practiced or of being carried out in various ways . fig1 illustrates a dental x - ray system 10 . the system includes an x - ray source 12 . in the embodiment shown , the source is located on an end 13 of a mechanical arm 15 . when activated , the x - ray source 12 generates an x - ray stream 16 that has a generally circular cross - section . ( of course , x - rays are generally invisible , but a representation of a stream is illustrated to facilitate understanding of the invention .) in many applications , a collimator is used to reduce the size of the stream and generate a smaller x - ray stream having a rectangular cross - section . a collimator may be used with a mechanical positioning device to help align the x - ray stream with an x - ray sensor . as shown in fig1 , x - ray source 12 is positioned ( e . g ., by an operator ) so that the x - ray stream 16 is directed to an intraoral sensor 20 . the intraoral sensor 20 is shown located in the mouth of a patient 21 . in some embodiments , the intraoral sensor 20 includes a scintillator that coverts x - ray radiation to visible light . in other embodiments , the sensor 20 is configured to convert x - rays into electric charge without a scintillator . unless otherwise specified , the term pixel refers both to a pixel in the array of pixels that converts x - rays to electrons without a scintillator and a pixel in the array of pixels and its associated scintillator or portion of a scintillator . as best seen by reference to fig1 a , the sensor 20 also includes an array of pixels 22 . the components of fig1 a , including the array of pixels 22 , are not drawn to scale relative to the outline of the sensor 20 . each pixel produces an electric signal in response to light ( from the scintillator ) or x - ray radiation impinged upon it . in one embodiment , the sensor 20 includes one or more “ on - board ” analog - to - digital converters to covert analog signals generated by the pixels to digital signals . these signals are provided to a processor 23 ( such as a programmable , electronic microprocessor , field programmable gate array , erasable programmable logic device ( s ), or similar device ( s )). in the embodiment shown , the processor 23 is connected to memory 24 ( rom and ram ) and an input - output interface 25 . the sensor 20 also includes one or more electronic circuits for power supply , driving the array of pixels , and driving the output ( e . g ., circuits located in the i / o interface 25 ). in some embodiments , the i / o interface 25 is a universal serial bus (“ usb ”) interface . in some embodiments , the processor 23 controls image capture or triggering of the sensor 20 . in other embodiments , the x - ray source 12 is coupled to the sensor 20 , e . g ., via computer 30 , such that when the x - ray source 12 is activated , a command is sent ( simultaneously or nearly simultaneously ) to the sensor 20 to perform an image capture . thus , it is possible to generate a burst of x - ray radiation and be assured that an image will be captured by the sensor 20 during the relatively short period of x - ray exposure either through automatic triggering or via a specific capture command sent to the intraoral sensor 20 . referring back to fig1 , a wire , cable , or similar connecter 27 of the sensor 20 connects the sensor 20 to a computer 30 . the computer 30 includes various components , including a processor or similar electronic device 32 , an input / output interface 34 , and memory 36 ( e . g ., ram and rom ). in some embodiments , the input / output interface 34 is a usb connection and the cable 27 is a usb cable . fig1 illustrates that image data captured by the sensor 20 and processed by the computer 30 is sent to a display 38 and viewed as image 40 . ( image 40 is drawn more distinctly than an x - ray image would typically appear .) the location of the intraoral sensor 20 in the patient &# 39 ; s mouth determines what part of the patient &# 39 ; s anatomy can be imaged ( e . g ., the upper jaw versus the lower jaw or the incisors versus the molars .) an x - ray operator places ( or assists the patient in placing ) the intraoral sensor 20 at a desired location with the patient &# 39 ; s mouth . various sensor holders ( including those that are used with or that include a collimator ) may be used to keep the sensor 20 in the desired location until an image is created or captured . for example , some holders are designed so that the patient bites the holder with his or her teeth and maintain the position of the sensor 20 by maintaining a bite on the holder . after the sensor 20 is positioned behind the desired anatomical structure , and the x - ray field to be generated by the x - ray source 12 is aligned with the sensor 20 , it is possible that the source 12 and sensor 20 will , nevertheless , become misaligned . misalignment can be caused by the patient moving his or her head , moving the intraoral sensor 20 ( by re - biting the holder , moving his or her tongue , etc . ), and other causes . fig2 depicts an exploded view of the intraoral sensor 20 . the sensor 20 includes a housing 45 . the housing 45 has a top portion 50 and a bottom portion 55 . within the housing 45 is an insulator 60 , a printed circuit board (“ pcb ”) 65 , a silicon detecting layer 67 , an x - ray converter 70 , and a cushioning layer 71 , which protects against mechanical shocks . some embodiments of the sensor 20 do not include the cushioning layer 71 . the top portion 50 includes a dome 75 that receives cable 27 . the dome 75 has a shape that approximates an elliptical paraboloid divided in half by the surface 76 of the top portion 50 ( a partial , elliptical paraboloid shape ). other dome shapes are contemplated for use in embodiments of the invention . the dome 75 includes a face with an approximately circular opening through which the cable 27 passes . the cable 27 includes connectors ( e . g ., wires ), a portion of which pass through an opening 79 of the insulator 60 to connect to the pcb 65 . in some embodiments , a ribbon or other connector passes through the opening 79 to couple the wires of cable 27 to the pcb 65 . the insulator 60 provide electrical isolation between the pcb 65 and the housing 45 of the sensor 20 . in some embodiments , the insulator 60 also secures the pcb 65 and x - ray converter 70 in position and protects each against mechanical shocks . although the insulator 60 resists conducting electricity it is a conductor of heat , which assists in transferring heat away from the pcb 65 . the pcb 65 , silicon detecting layer 67 , and converter 70 include the components of the sensor 20 illustrated in fig1 a , namely the array of pixels 22 , the processor 23 , the memory 24 , and i / o interface 25 . in the embodiment depicted in fig2 , the array of pixels 22 includes a plurality of pixels , each pixel including a converting portion ( i . e ., a portion of converter 70 ) and a detecting portion ( i . e ., a portion of silicon detecting layer 67 ). the pcb 65 supports the silicon detecting layer 67 ( e . g ., a cmos die ) and converter 70 , with the silicon detecting layer 67 being secured , e . g ., using a glue or epoxy , to the pcb 65 . the converter 70 converts x - rays received through the bottom portion 55 into light . the light travels to the silicon detecting layer 67 , which converts the received light into charge . the charge is integrated at each pixel and the quantity of charge integrated represents the amount of x - rays received ( although some of the integrated charge is attributable to noise and dark current ). during a read - out of the array of pixels 22 , the processor 23 determines the quantity of charge integrated at each pixel in the array of pixels 22 . in some embodiments , the converter 70 and silicon detecting layer 67 include a fiber optic with scintillator . in some embodiments , the array of pixels 22 converts x - rays directly to charge without an intermediate step of converting x - ray to light . in such embodiments , among other possible alterations , an additional insulator ( similar to insulator 60 ) is positioned in place of converter 70 , and is used to provide electrical isolation between the housing 45 and the pcb 65 and help transfer heat away from the pcb 65 . fig3 depicts a cross section of the sensor 20 along line a as shown in fig4 . the top portion 50 is secured to the bottom portion 55 for instance , using ultrasonic welding and machining . the welding bonds the top portion 50 to the bottom portion 55 , and machining smoothes the surface . additionally , the top portion 50 and bottom portion 55 include interlocking portions 56 . the converter 70 , pcb 65 , silicon detecting layer 67 , and insulator 60 are shown within the housing 45 . also depicted is the cable 27 including stress relief portion 77 . the stress relief portion 77 is secured to the cable 27 , for instance , using an adhesive . additionally , the stress relief portion 77 includes a circumferential notch 80 that matches up with ridge 85 on the dome 75 . the stress relief portion 77 is secured to the dome 75 using the interlocking notch 80 and ridge 85 . an adhesive may also be used to secure stress relief portion 77 to the dome 75 . the stress relief portion 77 alleviates mechanical stress on the cable - to - housing coupling 81 created from twisting , pulling , and other forces on cable 27 and housing 45 . thus , the stress relief portion 77 extends the life of the cable - to - housing coupling 81 , preventing or delaying malfunction of the sensor 20 caused by breaking the connection between the cable 27 and the housing 45 . fig4 depicts a top view of the sensor 20 and a usb connector 82 at the end of cable 27 . fig5 a depicts a cross section of a standard universal serial bus ( usb ) cable 100 capable of high speed usb version 2 . 0 communication . the standard usb cable 100 includes four main wires : data line 105 ( d +), data line 110 ( d −), power line 115 , and ground line 120 . additionally , surrounding the four main wires is an isolating jacket 125 , an outer shield 130 made of 65 % interwoven tinned copper braid , and an inner shield 135 made of aluminum metallized polyester . the isolating jacket 125 is made of polyvinyl chloride ( pvc ) in some embodiments . running lengthwise along with wire between the inner shield 135 and the outer shield 130 is a copper drain wire 140 . the standard usb cable 100 is not symmetrical . rather , the standard usb cable 100 has an internal , non - circular , oval structure , although fillers and plastic ( not shown ) may be used to create an external , circular shape of the cable . the external , circular shape can be approximately 4 mm in diameter . fig5 b depicts a wiring diagram of the standard usb cable 100 . as illustrated , the standard usb cable 100 has one twisted signaling pair including the data line 105 ( d +) and data line 110 ( d −). in some implementations , the power line 115 and ground line 120 are twisted ( possibly to a lesser extent ) or , as shown in fig5 b , not twisted at all . fig6 a depicts a cross section of a cable 150 according to embodiments of the invention . the cable 150 includes four main wires 210 and four fillers 175 a - d . the four main wires 210 include data line 155 ( d +), data line 160 ( d −), power line 165 , and ground line 170 , which provide data transmission , power transmission , and grounding , respectively . the data line 155 ( d +), data line 160 ( d −), power line 165 , and ground line 170 each include a metal conductor encapsulated by a co - axial insulator . the four fillers 175 a - d are made of plastic and are twisted along with the four main wires 210 to form a twisted quad cable . the four mains wires 210 and four fillers 175 a - d are surrounded by three layers that run the length of the cable 150 . the three layers include polytetrafluoroethylene (“ ptfe ”) tape 180 , a braided shield 185 , and a polyurethane jacket 190 . in some embodiments , other materials are used for the jacket 190 and the tape 180 ( e . g ., another material similar to ptfe with a low surface roughness ). the braided shield 185 is made up of , for instance , tinned copper wires with 0 . 08 mm diameter ( 40 awg ). as will be discussed further below , in some embodiments , the braided shield 185 is a heat conductor . in some embodiments , the polyurethane jacket 190 is approximately 0 . 432 mm thick . the total diameter of the cable 150 is less than 3 . 0 mm . in some embodiments , additional or fewer layers surround the four main wires 210 and fillers 175 a - d used within cable 27 . the wiring diagram of fig6 b illustrates the main wires 210 and fillers 175 a - d twisted together to form a single bundle 195 . although not shown in fig6 b , the (“ ptfe ”) tape 180 , a braided shield 185 , and a polyurethane jacket 190 encapsulate the single bundle 195 as shown in fig6 a . the twisted quad cable is symmetrical about center line 197 , as shown in fig6 a . the symmetrical characteristic of the cable 150 provides increased strength and resistance to mechanical stress with a lower outside diameter , relative to the standard usb cable . that is , the cable 150 is less susceptible to damage from twisting , pulling , and other forces on the cable 150 , despite the reduced diameter of the cable 150 . in particular , the cable 150 is less susceptible to damage due to rotational mechanical stress , which is often present during use of an intraoral sensor cable . fig7 depicts the inside 200 of the top portion 50 . the inside 200 includes a metallization layer 205 . the cable 27 is shown inserted into the dome 75 . the four main wires 210 ( i . e ., the data line 155 ( d +), data line 160 ( d −), power line 165 , and ground line 170 ) are attached to a pcb connector 215 , which is connected to the pcb 65 . in some embodiments , the four main wires 210 are coupled or soldered directly to the pcb 65 . the braided shield 185 is coupled to the metallization layer 205 via a heat conducting wire 220 . the heat conducting wire 220 is coupled to the braided shield 185 and metallization layer 205 by , for instance , soldering . as the pcb 65 generates heat while in operation , a substantial portion of the generated heat is transferred through the insulator 60 to the metallization layer 205 . the portion of generated heat is then transferred to the braided shield 185 via the heat conducting wire 220 . the level of thermal resistance may vary by application . for instance , the more heat the pcb 65 generates in a particular embodiment , the lower the thermal resistances are of the materials chosen for the metallization layer 205 , heat conducting wire 220 , and insulator 60 . in general , however , the insulator 60 and heat conducting wire 220 have a thermal resistance that is lower than the thermal resistance of air ( which is approximately 1 / 0 . 025 w /( mk ) at 20 degrees celsius ). additionally , the metallization layer 205 has a thermal resistance that is less than the thermal resistance of the top portion 50 of the housing 45 and less than the thermal resistance of air . thus , the sensor 20 provides improved heat transfer away from the sensor 20 along the cable 27 . although not shown , in some embodiments the inside of the bottom portion 55 also includes a metallization layer , which is similar to the metallization layer 205 in form and function . the bottom metallization layer is coupled to the braided shield 185 as well . in some embodiments , the coupling is provided by an additional heat conductor connection between the bottom metallization layer and either the braided shield 185 or the metallization layer 205 . in other embodiments , the coupling is provided by direct contact between the bottom metallization layer and the metallization layer 205 . thus , the invention provides , among other things , an intraoral sensor with a cable providing greater resistance to mechanical stress . additionally , the invention provides an intraoral sensor with improved heat transfer . various features and advantages of the invention are set forth in the following claims .

US-201213611572-A

an infuser which is primarily intended for use in making coffee can be constructed utilizing a container having a bottom inlet . a filter element is located within the interior of the container in such a manner that the position of the filter element relative to the bottom of the container can be adjusted . the outlet for the container comprises a tube slidably mounted in the bottom of the container and spring biased upwardly so that the upper end of the tube is in communication with an opening through the filter at all times that the filter is in place within the interior of the container . the container preferably includes a lid which seals off the interior of the container and which carries a threaded shaft and a nut type structure for linearly moving the shaft . the shaft is secured to the filter so that as the nut is rotated the position of the filter within the container can be varied .

in the drawing there is shown a complete coffee maker 10 which is constructed so as to include as a part of this coffee maker an infuser 12 in accordance with this invention . if desired the infuser 12 can , in and of itself , be referred to as a coffee maker . this coffee maker 10 includes various parts which are not necessary to an understanding of the present invention and which are not described herein . it does , however , include a unit or means 14 for heating water which is intended to supply hot water at an appropriate , common desired temperature through a tube 16 to the infuser 12 . because the means 14 for heating water can be constructed in a number of different manners -- including various known manners -- it is not considered necessary to describe it in detail herein . the coffee maker 10 includes a housing 18 which is provided with a generally cup - shaped receptacle 20 for use in holding the infuser 12 generally above a platform 22 which may be utilized to hold a container ( not shown ) for receiving finished coffee produced by the infuser 12 . if desired this platform 22 may be heated in a conventional manner . the infuser 12 employs a generally cup - shaped container 24 having a top edge 26 . a lid 28 fits against this top edge 26 for the obvious purpose of closing off the container 24 so as to prevent vapors from escaping from the container 24 as the infuser 12 is used . preferably a conventional sealing ring 30 is carried by the lid 28 so as to fit against the top edge 26 . the lid 28 is provided with a peripheral flange 32 containing a series of equally spaced , elongated slots 34 which are adapted to receive a series of equally spaced projections 36 so that the lid 28 may be secured in place against movement upon the container 24 . these slots 34 and the projections 36 are not described nor illustrated in detail because they are of a conventional , known type such as are commonly used for what may be referred to as a bayonet type connection . obviously other equivalent mechanical means can be employed in mounting the lid 28 on the container 24 . the lid 28 utilized has an elongated bar - like handle 38 which may be used in manipulating the lid 28 into or out of position on the container 24 . within the handle 38 there is an internal cavity 40 which serves as a retainer for a more or less nut - like knob 42 . this knob 42 is retained in place through the use of a cylindrical extension 44 on it fitting within a correspondingly shaped depression 46 in the center of the lid 28 . a conventional seal 48 may be located around the extension 44 within the depression 46 so as to minimize the possibility of vapor leakage . preferably a hollow interior 50 within the knob 42 is sealed off by a flat plate 52 having an upwardly extending projection 54 which fits within a corresponding cavity ( not separately numbered ) in the handle 38 . the projection 54 helps stabilize the knob 42 . within the interior 50 of the knob 42 there is located an internal thread - like projection 56 which fits within a corresponding thread - like groove 58 in an elongated shaft 60 . this shaft 60 extends from the interior 50 of the knob 42 downwardly through a centrally located opening 62 in the depression 46 into the interior of the container 24 . rotation of the shaft 60 is prevented by a projection 63 in the opening 62 fitting within a slot 65 in the shaft 60 . within the interior of this container 24 the shaft 60 carries a series of radially extending arms 64 which connect the shaft 60 to a circular rim 66 of slightly smaller external diameter than the internal diameter of the container 24 . this rim 66 is provided with a peripheral groove 68 carrying an extending sealing member 70 which makes contact with and seals against the interior of the container 24 . the shaft 60 also carries a centrally located hollow bushing 72 which extends downwardly from the shaft 60 beneath the various arms 64 . a plurality of upper openings 74 are provided so as to lead into the interior of the bushing 72 from between the various different arms 64 . a peripheral flange 76 is located on the bushing 72 immediately beneath these openings 74 . this flange 76 and the rim 66 are secured to and support a disk - like filter element 78 having a centrally located opening 80 in such a manner that the arms 64 tend to reinforce this element 78 against upward bowing as the infuser 12 is used . if desired the filter element 78 may be directly secured or attached to the arms 64 . it will be realized that the precise nature of the filter element 78 is essentially a matter of choice . it is considered that it is preferable for this element to be a comparatively perforate screen formed out of a relatively inert material . when the element 78 is formed out of such a screen it is considered desirable to use it in connection with a replaceable filter paper disk 82 which fits closely up against the element 78 and the rim 66 and which fits closely around the bushing 72 . the use of such a disk 82 is considered to be essentially a matter of individual option . the inlet ( not separately numbered ) for the container 24 includes a hollow nipple 84 extending downwardly from the bottom 86 of this container 24 . this nipple 84 preferably contains a known elastomeric duck - bill or thomas type check valve 88 serving to prevent flow from the interior of the container 24 through the nipple 84 but permitting flow into the interior of the container 24 . water is conveyed to the container 24 through the use of a small more or less cup - shaped extension 90 on the receptacle 20 . this extension 90 is provided with another nipple 92 connected by a tube 16 to the unit 14 for heating water . leakage between the interior of the extension 90 and the exterior of the nipple 94 may conveniently be prevented through the use of a sealing washer 96 or through the use of any equivalent structure . if desired the valve 88 can be constructed so as to not only serve as a valve but in addition so as to serve as the sealing washer 96 . the top of the nipple 84 is closed off by a plate 98 and side openings 100 are provided in the nipple 84 immediately adjacent to this plate 98 . these openings 100 lead to an annular groove 102 leading around the bottom 86 which serves to distribute water so that such water may flow upwardly past another filter element 104 into the container 24 as the infuser 12 is used . this filter element 104 can , of course , be constructed in a number of different manners as indicated in the preceding discussion relative to the filter element 78 . preferably it includes solid rings 105 which are integral with a perforate screen 107 . preferably this element 104 is formed as a separate unit which may be taken out of the container 24 for cleaning purposes . a cup 106 fits closely around and is secured to a centrally located cylindrical boss 108 which extends upwardly from the center of the bottom 86 . this boss 108 is provided with a downwardly extending , centrally located discharge tubular housing 110 which extends through an opening 112 in the receptacle 20 to above the platform 22 . within the housing 110 there is located an upwardly extending , probe - like guide 114 having a series of peripheral grooves 116 leading to discharge openings 118 located in the lowermost end 120 of the housing 110 . this guide 114 is employed for the purpose of retaining an elongated coil spring 122 so that such a spring 122 extends upwardly from the end 120 through the interior of a hollow tube 124 serving as the outlet for the container 24 . this tube 124 extends upwardly from the housing 110 into the interior of the container 24 through an opening 126 in the retaining cup 106 . a seal is preferably formed around the exterior of the tube 124 through the use of a conventional sealing ring 128 which is held in place by the retaining cup 106 . if desired the lower end 130 of the tube 124 may be outwardly beveled as shown so as to limit the upward movement of the tube 124 . preferably the upper end 132 of the tube 124 serving as an entrance into the tube 124 is inwardly beveled so as to retain the spring 122 in such a manner that the spring 122 effectively exercises the upwardly biasing function in the preceding . it will be apparent from a consideration of fig4 of the drawing that the bushing 72 is dimensioned so as to be capable of fitting closely within the end 132 and the spring 122 during the utilization of the infuser 12 . as the infuser 12 is to be utilized the lid 28 is of course removed from the container 24 and this container 24 is located within the receptacle 20 with the filter element 104 in place . at this point because of the action of the spring 122 the tube 124 will be biased well upwardly toward the top edge 26 . material 134 to be used in forming an infusion such as ground , roasted coffee beans will next be located within the container 24 upon the filter element 104 . the quantity of such material 134 will normally vary depending upon the quantity of the infusion such as the beverage coffee to be made , and depending upon the desired concentration of the infusion . next , the lid 28 with , of course , the attached shaft 60 and various elements as indicated in the preceding as carried by this shaft will be located on the container 24 and locked in place through the use of the slots 34 and the projections 36 . as this occurs the bushing 72 will be inserted within the tube 124 . depending upon the precise dimension of the various parts used and the relative position of the shaft 60 , the tube 124 may be pushed downwardly to some limited extent as the lid 28 is located in place . next the knob 42 will be turned so as to move the shaft 60 downwardly until such time as the material 134 located within the container 24 is held against relative movement . the degree of compression applied to such material may be varied somewhat . in general , however , it is considered that such material 134 should be compressed adequately so that there will be no relative movement of such material 134 within the container 24 as the infuser 12 is used . this can normally be accomplished by merely turning the knob 42 through the use of the hand until a resistance to further turning can be felt . this will normally provide adequate room for expansion of the material 134 as an infusion is prepared . as the shaft 60 is moved in this manner the bushing 72 will apply pressure to the tube 124 moving this tube 124 downwardly . this will create a comparatively tight fit between the end 132 and the flange 76 serving to prevent any significant leakage between these parts . also the pressure exerted against the material 134 will serve to bias the projections 36 in the slots 34 so as to securely hold the lid 28 in place . at this point the infuser 12 is ready to use . as water is supplied to it through the tube 94 this water will be distributed through the grooves 102 so that it will tend to rise in the manner indicated by the arrows in fig2 in a substantially uniform manner around the interior of the container 24 . because the material 134 being infused is held in a &# 34 ; packed &# 34 ; state of compression this material 134 will not move significantly as the water rises in this manner and there will be substantially no channelization of flow within this material 134 . the rate at which the water will move through the material 134 will depend upon the degree of compaction of this material 134 . the liquid which moves upwardly through the material will , of course , pass through the disk 82 and the filter element 80 and then will move or flow inwardly toward the opening 74 and then downwardly through the bushing 72 of the tube 124 and out through the opening 118 . after a desired quantity of infusion is prepared in this manner water is no longer supplied through the tube 94 and the lid 28 is removed from the container 24 . the entire infuser 12 may then be removed for cleaning purposes .

US-90805378-A

a fluid dispensing device , particularly suited to medicine but also having many other applications . the device selectively dispenses any of one or more fluids contained within the device . adapters on the dispensing end of the unit permit the device to be effectively used for intra - venous , intra - dermal or intra - muscular injections , gasses , colloids , gels , liquids or other fluids . adapters on the head of the unit permit the device to be used with or without electrical power and to varying degrees of automatic control for timing , sequence , volume of fluid dispensed and other features .

referring now to the drawings , where the present invention is generally referred to with numeral 10 , it can be observed in fig1 that in this embodiment it basically includes a manual head assembly 100 , a case assembly 500 and an apical assembly 600 . referring to fig1 an embodiment of said manual head assembly 100 is shown to comprise , inter alia , a handle assembly 152 and a head cap assembly 154 . said handle assembly 152 , comprises , inter alia , a handle 102 , a cocking lever 104 , a trigger 106 , a trigger guard 108 , an indicator 110 . said cocking lever 104 is drawn away from said manual head assembly 100 to input energy into the invention to be subsequently used to dispense fluid from the device . said trigger 106 is depressed to activate the dispensing of a fluid . the trigger 106 is protected from inadvertent activation by the protective trigger guard 108 . said handle 102 generally conforms to the shape of a human hand to facilitate ergonomic use of the device . as an optional feature , said handle 102 may be open to form a loop that can be used to lighten the device as well as provide a feature to secure the device in storage or while in use . for example , the invention could be hung onto a hook through the handle 102 for storage . still referring to fig1 , said head cap assembly 154 is comprised of , inter alia , a crown 116 with a knurled grip 112 . the handle assembly 152 is rotatably connected to the head cap assembly 154 . as described in more detail below , a fluid contained inside the device can be selected for output by applying force to the handle assembly 152 through the handle 102 effecting rotation of the handle assembly 152 relative to the head cap assembly 154 . an indicator 110 affixed to a turntable 114 that is part of the handle assembly 152 provides an aid to determine which fluid is selected for dispensing . the knurled grip 112 of the head cap assembly 154 aids the user assemble the device by providing a gripping surface to thread the manual head assembly 100 onto said case assembly 500 thus forming a unitary body . yet referring to fig1 , said case assembly 500 is comprised of , inter alia , a case 502 , one or more viewing ports 504 and a thumb lock assembly 548 that is further comprised of , inter alia , a thumb lock 508 , an indicator 510 and a guide 512 , each described in more detail below . in one contemplated embodiment , the case assembly 500 contains a vessel 514 that can be partially seen in fig1 through one or more viewing ports 504 to show graduations 506 to determine the volume of fluid contained in the vessel ( s ) 514 . again referring to fig1 , exterior portions of one of several contemplated embodiments of an apical assembly 600 is shown to comprise , inter alia , an apical cap 602 , a fluid port 604 , a knurled grip 606 and another fluid port 608 , each described in more detail below . now referring to fig2 where the underside of the manual head assembly 100 is shown in more detail . in this embodiment of the device the handle assembly 152 is affixed to the turntable 114 by means of a bolt 136 , but other means could similarly be used . for example , the handle assembly 152 could be welded to the turntable 114 or be formed from the same unitary material as the turntable 114 . also shown in fig2 is a knurled grip 112 to provide greater grip when the user assembles or disassembles the device . threads 118 provide a means to connect the manual head assembly 100 to the case assembly 500 . other means to connect the manual head assembly ( or the other head assemblies described below ) could include , inter alia , any of a wide variety of known and commonly used clips , snaps , brackets , straps , adhesives , welds , rivets , screws or other similar means . a key 126 is located in a predetermined position superior to the threads 118 and engages into a key slot 530 ( shown on fig4 ) on the case assembly 500 to ensure that the mechanics of the mechanical head assembly 100 align with the case assembly 500 with adequate precision . still referring to fig2 , a plunger 120 affixed to a shaft 122 is shown . the shaft 122 is movable axially through the turntable 114 . said shaft 122 and plunger 120 are part of the handle assembly 152 . one of the handle assembly &# 39 ; s 152 functions is to provide a means to move the shaft 122 , and thereby the plunger 120 , axially through the turntable 114 . in this embodiment the shaft 122 also has a stop 124 that interacts with the thumb lock assembly 548 ( shown in more detail in fig1 and described below ) as one of the contemplated means to regulate the volume of fluid dispensed . yet referring to fig2 , a spring button 128 and a notch 132 , among other components , interact to provide a means to affirmatively select the rotational position of the turntable 114 , and thereby the handle assembly 152 , relative to the key 126 on the crown 116 . as the turntable 114 rotates relative to the crown 116 the spring button 128 encounters and frictionally engages a notch 132 . one or more notches 132 are arranged at predetermined positions on the turntable 114 to provide precise alignment of the plunger 120 relative to the key 126 . this is but one way to affirmatively select a position . other suitable means to affirmatively select a position are commonly used in industry . fig3 illustrates one embodiment of the case assembly 500 with a cartridge assembly 522 fitted inside the case assembly 500 . in this view of the cartridge assembly a vessel 514 , a piston 524 and a key 518 are visible . the vessel 514 is generally cylindrical and is seen through a viewing port 504 on the side of the case assembly 500 . the piston 524 is generally cylindrical and slidably engaged inside of the vessel 514 . the vessel 514 is sealed by the piston 524 . in one contemplated embodiment the vessel 514 and piston 524 is similar to a commonly used medical syringe . when the device is dispensing fluid the plunger 120 ( illustrated in fig2 ) applies force to the surface of the piston 524 and the piston 524 is forced downward axially along the interior of the vessel 514 . the key 518 on the cartridge assembly 522 mates with a key slot 530 of the case assembly 500 to ensure proper orientation of the cartridge assembly 522 to the case assembly 500 . still referring to fig3 , some features of the case assembly are visible including , inter alia , the case 502 , a seat 526 , threads 520 , a key slot 530 , an indicator 510 , a thumb lock 508 , a guide 512 and threads 516 . the threads 520 engage the threads on the manual head assembly 100 or other embodiments of various head assemblies , infra . said manual head assembly 100 contacts the case assembly at said seat 526 . the threads 516 engage the threads 616 on the apical assembly 600 ( shown in fig6 ) or other embodiments of various apical assemblies , infra . fig4 depicts the case assembly 500 without the cartridge assembly 522 as is present in fig3 . with the cartridge assembly removed the viewing ports 504 are shown around the periphery of the case assembly 500 . the number of viewing ports 504 would typically be commensurate with the number of vessels 514 ( absent in fig4 and shown in fig5 ). fig5 is an illustration of one contemplated embodiment of a cartridge assembly 522 that comprises , inter alia , a frame 528 , a vessel 514 , graduations 506 , piston 524 , vessel port 532 and key 518 . said frame 528 provides the structure to hold one or more vessels 514 fixed relative to one another . said key 518 is positioned at a predetermined location on the frame 528 and is dimensioned to engage the key slot 530 on the cartridge assembly 522 ( shown on fig4 ) at a precise relative orientation . an optional , but desirable , feature on each vessel 514 are graduations 506 to aid the user to more precisely measure the volume of fluid dispensed . generally , the graduations 506 are readable through a viewing port 504 ( as shown in fig3 ). the graduations 506 would typically show the remaining volume of fluid contained in the vessel 514 in milliliters or cubic centimeters as indicated by reading the position of the bottom of the piston 524 relative to the graduations 506 . said vessel port 532 is the path by which the fluid contained in the vessel 514 exits the vessel 514 during dispensing . vessel port 532 can also be where fluid is drawn back into the vessel 514 when refilling the vessel 514 . in one of the preferred embodiments the vessel 514 is a common syringe and the vessel port 532 is a common hypodermic needle affixed to the lower end of the vessel 514 . referring now to fig6 where one of the embodiments of an apical assembly 600 is shown that is comprised of , inter alia , an apical cap 602 , a fluid port 604 , a knurled grip 606 , a fluid port 608 , a key slot 610 , a septum 614 , threads 616 , a seat 618 and an apical cartridge assembly 612 . when in typical use said apical assembly 600 is threaded onto the case assembly 500 by means of threads 616 on the apical assembly 600 engaging the threads 516 on the case assembly 500 and rests on the seat 618 . a knurled grip 606 aids the user when threading the pieces together . other contemplated means to secure the case assembly 500 to the apical assembly 600 ( or other embodiments of apical assemblies ) could include , inter alia , any of a wide variety of known and commonly used clips , snaps , brackets , straps , adhesives , welds , rivets , screws or other similar means . still referring to fig6 , the apical cartridge assembly 612 is nested in the apical assembly 600 . the orientation of the apical cartridge assembly 612 with the apical cap 602 is maintained by aligning a key 628 on the apical cartridge assembly 612 in the key slot 610 on the apical assembly 600 . the top of the apical cartridge assembly 612 may have a septum 614 capable of receiving said vessel port 532 ( shown in fig5 ) and making a leak resistant union . for example , if the vessel port 532 was similar in form to a common hypodermic needle then the septum 614 could be made of a rubber - like material that a hypodermic needle could readily puncture and maintain a leak - resistant seal . other means to connect the apical cartridge assembly 612 to cartridge assembly can be easily improvised from a wide variety of medical and industrial connectors readily available . fig7 shows an embodiment of the apical assembly 600 without the apical cartridge assembly 612 . shown in this view is , inter alia , the knurled grip 606 to give the user better grip when attaching the apical assembly 600 to the case assembly 500 by means of the threads 616 on the apical assembly 600 and the threads on the case assembly 516 . other contemplated means to secure the case assembly 500 to the apical assembly 600 ( or other embodiments of an apical assembly ) could include , inter alia , any of a wide variety of known and commonly used clips , snaps , brackets , straps , adhesives , welds , rivets , screws or other similar means . a seat 618 provides a stable surface for the case assembly 500 to contact the apical assembly 600 . fig8 is an illustration of one embodiment of an apical cartridge assembly 612 removed from the apical cap 602 ( shown in fig7 ). the structure of the apical cartridge assembly 612 is supported by a frame 622 . on the superior side of said frame is one or more septa 614 . typically , one septum 614 would be provided for each vessel 514 ( shown on fig5 ). each vessel port 532 on the cartridge assembly 522 mates with the corresponding septum 614 on the apical cartridge assembly 612 to form a pressure - resistant seal . in one embodiment the vessel port 532 is similar to a hypodermic needle and the septum 614 is a rubber - like material and when the vessel port 532 is mated with the septum 614 the hypodermic needle pierces the rubber - like material creating a pressure - resistant union . other suitable means of connecting the cartridge assembly 522 to the apical cartridge assembly 612 have been considered and may include , inter alia , clips , nipples , clamps and other connectors . still referring to fig8 , in this embodiment each septum 614 is integrally connected to a conduit 630 that conducts the fluid to an apical chamber 626 . the apical chamber 626 is generally hollow and has a predetermined interior volume specific to the application . for example , in some applications it is preferable to avoid commingling of the various fluids as they are dispensed in succession and therefore a minimal volume is desired . in other applications a greater volume of the apical chamber and / or an agitator inside the apical chamber 626 may be desired to promote mixing of the fluids as the fluids are dispensed . optionally , a valve 632 that prevents back - flow of fluid into the conduit 630 is inserted between all or each conduit 630 and the apical chamber 626 . a key 628 may be used to ensure consistent orientation of the apical cartridge assembly 612 with the apical cap 602 when engaged into key slot 610 . a port 624 in the frame 622 provides an egress for the fluid port 608 . in the embodiment of the apical cartridge assembly 612 demonstrated in fig8 there is a fluid port 604 that receives fluid from a source external to the device and a fluid port 608 where any fluids finally exit the device . one of the contemplated applications that this embodiment of the apical cartridge assembly would be well suited is for intra - venous injections . in this application it is possible that the fluids , in this example drugs , dispensed should not be mixed or commingle . to remedy this potential issue a sterile saline solution source can be connected to the fluid port 604 . after or as one of the drugs is delivered from the vessel 514 , through the vessel port 532 , septum 614 and conduit 630 into the apical chamber 626 the sterile saline solution is introduced through the fluid port 604 to flush the drug out of the apical chamber 626 and through a fluid port 608 where the drug exits the device and is pushed toward a patient by the sterile saline flow . fig9 is a cross - sectional view of the handle assembly 152 and shows an embodiment of the internal components of the manual head assembly 100 . this embodiment comprises , inter alia , a handle 102 , a cocking lever 104 , a trigger 106 , a trigger guard 108 , a turntable 114 , a plunger 120 , a shaft 122 , a stop 124 , a guide 138 , a fulcrum 140 , a spring 142 , a spring 144 , a stop 146 , a stop 148 and a catch 150 . when preparing the device for use the user manually pulls on the cocking lever 104 to compress the spring 144 that is held in place on the shaft 122 by the stop 146 . when the spring 144 is adequately compressed the catch 150 contacts the stop 148 to hold the spring 144 under compression . the catch 150 is biased toward and engages the stop 148 by means of a spring 142 . when the user desires to dispense a fluid the trigger 106 is pulled and the trigger pivots at the fulcrum 140 , compresses the spring 142 and the catch 150 clears the stop 148 freeing the spring 144 to push against the stop 146 and thereby push the shaft 122 and plunger 120 . the force of the spring 144 is transferred to the piston 524 ( shown in fig5 ) to initiate dispensing a fluid contained in the vessel 514 ( shown in fig5 ). the shaft 122 maintains axial alignment by means of a guide 138 . a trigger guard 108 is provided to prevent inadvertently pressing the trigger 106 . fig1 , 11 and 12 show in more detail one of the embodiments of the thumb lock assembly 548 that is utilized to limit the travel of the piston 524 effectively stopping the dispensing of fluid . in this embodiment of the device the thumb lock assembly comprises , inter alia , a rod 540 , an indicator 510 , a stop 546 , teeth 534 , thumb lock 508 , threads 536 and threads 542 . the indicator 510 , thumb lock 508 and threads 536 are outside of the case 502 while the stop 546 , rod 540 and teeth 534 are inside the case 502 for normal operation . the thumb lock 508 has internal threads 542 corresponding to threads 536 on the rod 540 . when the thumb lock assembly 548 is locked the thumb lock 508 is threaded onto threads 536 and the thumb lock 508 contacts the exterior of the case 502 while the teeth 534 contact the interior of the case 502 with such firmness as to prevent movement of the thumb lock assembly 548 relative to the case 502 . a knurled grip 544 on the thumb lock 508 may be provided to improve the users grip on the thumb lock 508 . to adjust the thumb lock assembly 548 the thumb lock 508 is loosened and the thumb lock assembly 548 is freed to travel along the guide 512 , also shown in fig4 . the indicator 510 can be viewed by the user on the exterior of the case 502 adjacent to the viewing port 504 . when the thumb lock assembly 548 is locked and the plunger 120 is in motion dispensing fluid and the piston 524 has traveled to the point indicated by the indicator 510 the stop 124 on the shaft 122 contacts the stop 546 on the thumb lock assembly 548 preventing the shaft 122 and plunger 120 from traveling further thus stopping dispensing more fluid . the dimensions of the thumb lock assembly 548 are such that when the indicator 510 is adjacent to the graduations 506 seen through the viewing port 504 the piston 524 will not travel further than the indicated level inside the vessel 514 . fig1 shows another alternative embodiment of an apical cap 670 with features that are comprised of , inter alia , a key slot 634 , a seat 636 , threads 638 , a knurled grip 642 and a port 640 . this embodiment is attached to the case assembly 500 by means of threads 638 screwed onto threads 516 with the assistance of the knurled grip 642 until the seat 636 contacts the case 502 . as alternatives to the threads 638 the apical cap 670 could be attached to the case 502 by many commonly available means such as clips , welds , adhesives , brackets or other means . a key slot 634 ensures proper alignment of the apical cap 670 relative to an apical cartridge assembly 672 ( shown in fig1 ). fig1 and 15 depict an embodiment of an apical cartridge assembly 672 removed from the apical cap 670 . the apical cartridge assembly 672 is generally supported by a frame 648 . on the superior side of said frame is one or more septa 644 . typically , one septum 644 would be provided for each vessel 514 ( shown on fig5 ). each vessel port 532 on the cartridge assembly 522 mates with the corresponding septum 644 on the apical cartridge assembly 672 to form a pressure - resistant seal . in one embodiment the vessel port 532 is similar to a hypodermic needle and the septum 644 is a rubber - like material and when the vessel port 532 is mated with the septum 644 the hypodermic needle pierces the rubber - like material creating a pressure - resistant union . other suitable means of connecting the cartridge assembly 522 to the apical cartridge assembly 672 have been considered and may include , inter alia , clips , nipples , clamps and other connectors . still referring to fig1 and 15 , in this embodiment each septum 644 is integrally connected to a conduit 658 that conducts the fluid to an apical chamber 656 . the apical chamber 656 is generally hollow and has a predetermined interior volume specific to the application . for example , in some applications it is preferable to avoid commingling of the various fluids as they are dispensed in succession and therefore a minimal volume is desired . in other applications a greater volume of the apical chamber and / or an agitator inside the apical chamber 656 may be desired to promote mixing of the fluids as the fluids are dispensed . optionally , a valve that prevents back - flow of fluid into the conduit 658 is inserted between all or each conduit 658 and the apical chamber 656 . a key 646 may be used to ensure consistent orientation of the apical cartridge assembly 672 with the apical cap 670 when the key 646 is engaged into key slot 634 . a port 676 in the frame 648 provides an egress for a conduit 678 . on said conduit 678 are threads 652 and threads 650 . threads 652 extend below and have a smaller diameter than the threads 650 . a needle 654 or other delivery device is threaded onto the threads 652 on the conduit 678 . a guide assembly 674 comprised of , inter alia , a knurled grip 660 , a guide 662 , threads 664 and a shaft 668 is placed over the needle 654 and threaded via threads 664 onto threads 650 . the guide assembly 674 can be threaded onto threads 650 to varying depths thus exposing more or less of the tip of the needle 654 . this feature controls the precise depth that the needle 654 can penetrate , for example into a patient . one of the contemplated applications that this embodiment of the apical cartridge assembly would be well suited for is for intra - dermal or intra - muscular injections . in this application it is not typically suitable to utilize a flushing saline solution as described above for the apical cartridge assembly 612 shown in fig8 because too great a volume of fluid would be dispensed under the skin or into the muscles of the patient . in this embodiment of the apical cartridge assembly 672 it may be preferred to have minimum interior volume of the apical chamber 656 . now referring to fig1 where an embodiment of a pneumatic head assembly 400 is shown . the pneumatic head assembly is housed in a case 402 made of a durable material to provide structure and protection for the contents of the case 402 . a base 405 is affixed to the bottom side of the case 402 . a threaded ring 407 with knurled edges is at the base of the case 402 and is used to thread the pneumatic head assembly 400 to the case assembly 500 at threads 520 ( shown in fig3 ). a turntable 404 is in the interior of the case 402 and is rotatable relative to the base 405 . the turntable 404 has a plurality of teeth 406 around its periphery . the force for rotating the turntable 404 is provided by a motor 426 connected to a gear 430 . the gear 430 engages the teeth 406 thereby transferring the force of the motor 426 to cause a rotation of the turntable 404 relative to the base 405 . a variety of types of gears have been contemplated that would be equally effective alternative for gear 430 that include , inter alia , a worm - type gear if the axis of the motor 426 is perpendicular to the axis of the turntable 404 or a traditional circular gear if the axis of the motor 426 is parallel to the axis of the turntable 404 . the motor 426 is connected to the cpu 412 by a cable 432 . in the preferred embodiment of the pneumatic head assembly 400 the motor 426 is a stepping motor . the motor 426 and the rest of the pneumatic head assembly 400 can be controlled by a cpu 412 ( central processing unit ) that is powered by a battery 408 or other power source such as regular alternating current , photo - voltaic cells , fuel cells or any other available power source . the battery 408 is connected to the cpu 412 by wires 458 . the cpu 412 receives input from an input device 462 that may be comprised of , for example , a keypad , buttons , knobs , dials or any other input means . the cpu 412 is connected to the input device 462 by a cable 410 . optionally , the cpu 412 may also utilize a display 460 to show the user relevant information as to the operation of the device . for example , the display 460 could show the user a variety of menus to aid in programming the cpu 412 for a particular purpose , the status of the device , time , pressure , volume of fluid remaining or dispensed by the device , battery power , identification of fluid or any of a wide variety of information relevant to the user of the device . the cpu 412 is connected to the display 460 by a cable 410 or other means . the cpu 412 may also control , inter alia , a valve 416 , a valve 418 , a valve 434 and a valve 436 each mounted onto a cylinder 466 . valve 416 and valve 418 are connected to the cpu 412 by a cable 414 . valve 434 and valve 436 are connected to and controlled by the cpu 412 through cable 438 . valve 416 , valve 418 , valve 434 and valve 436 control pressurized fluid passing into and out of the interior of the cylinder 466 . in one of the preferred embodiments of the pneumatic head assembly 400 a pressure vessel 446 is secured by a mount 444 onto the turntable 404 . the pressure vessel 446 is connected to a receiver 448 and held into place by a tap 450 that is in turn secured by a mount 454 . a handle 456 aids the user in securing the tap 450 to the pressure vessel 446 creating a pressure resistant seal . a conduit 452 carries fluid under pressure to valve 416 and valve 436 . a conduit 420 is connected to valve 418 and provides a pathway for exhaust to escape out of the cylinder 466 and exit the device through a muffler 422 . a conduit 424 is connected to valve 434 and provides a pathway for exhaust to escape out of the cylinder 466 and exit the device through the muffler 422 . in the preferred embodiment the pressure vessel 446 is a common carbon dioxide cartridge such as are commonly used in pellet guns . still referring to fig1 , an alternate embodiment of the pneumatic head assembly 400 consists of , inter alia , substituting a hydraulic pump ( not depicted ) instead of the pressure vessel 446 . the hydraulic pump is controlled by cpu 412 and powered by a battery 408 . conduit 452 carries hydraulic fluid to valve 416 and valve 436 . now referring to fig1 where a partial cutaway view of an embodiment of the pneumatic head assembly 400 ( as shown in fig1 ) showing a cross section of said cylinder 466 . said pressure vessel 446 is mounted securely by said mount 444 to said turntable 404 . said tap 450 is secured to the turntable 404 by mount 454 . said conduit 452 is secured to the pressure vessel 446 at the receiver 448 to form a pressure resistant seal by tightening the handle 456 thereby securing the union between the receiver 448 and the pressure vessel 446 . still referring to fig1 , on the interior of the cylinder 466 is a piston 468 connected to a shaft 440 that passes though the floor of the cylinder 466 at a seal 470 and terminates in a plunger 442 that retractably extends through and below said turntable 404 . to move the plunger 442 down , the valve 416 is opened and valve 418 is closed thereby permitting the fluid in the pressure vessel 446 to flow through the conduit 452 into the cylinder 466 creating high pressure above the piston 468 while at the same time valve 436 is closed and valve 434 opens so that the volume inside the cylinder 466 below the piston 468 is open to ambient pressure through the conduit 424 and muffler 422 . to raise the plunger 442 the inverse must occur : the valve 436 is opened and valve 434 is closed thereby permitting the fluid in the pressure vessel 446 to flow through the conduit 452 into the cylinder 466 creating high pressure below the piston 468 at the same time valve 416 is closed and valve 418 opens the volume inside the cylinder 466 above the piston 468 to ambient pressure through the conduit 420 and muffler 422 . returning now to fig1 this embodiment of a pneumatic head assembly 400 is typically used in conjunction with a case assembly 500 as shown in fig3 and an apical assembly 600 as shown in fig6 . both the pneumatic head assembly 400 and apical assembly 600 are connected to the respective ends of the case assembly 500 to form a single unit . when the device is used the plunger 442 comes into contact with the piston 524 on the top of the vessel 514 and pushes any fluid contained in the vessel 514 out of the device through the apical assembly 600 . now referring to fig1 where an embodiment of an electronic head assembly 300 is shown . the structure of the electronic head assembly 300 is provided by a case 301 . at the base of said case 301 is a threaded ring 334 that is used to connect the electronic head assembly 300 to a case assembly 500 at threads 520 ( shown on fig3 ). the electronic head assembly 300 is controlled by a central processing unit 302 ( cpu ) and powered by a battery 348 and connected to said battery 348 by a cable 350 . the cpu 302 has an input device 354 that serves as an interface between the user and the invention . the input device 354 may consist of , inter alia , a keypad , dials , buttons or other similar means . the cpu 302 is also connected to a display 352 such as a liquid crystal display ( lcd ), light emitting diodes ( led ) or other suitable means of display that are commonly used . the display 352 shows information to the user such as status , programs , power supply , fluid dispensed or remaining and any other relevant information . a socket 306 is optionally present and provides a means to connect a computer device to control , program or monitor said cpu 302 . said socket 306 is connected to said cpu 302 by a cable 304 said cpu 302 is connected to a motor 310 by a cable 308 . said motor 310 is connected to a gear 314 that interfaces with teeth 316 around the circumference of a turntable 324 . said cpu 302 controls and activates said motor 310 that in turn rotates said gear 314 that in turn rotates said turntable 324 about its axis . in the preferred embodiment said motor 310 is a stepping motor . still referring to fig1 , in a preferred embodiment a lineal actuator 328 is fixed onto said turntable 324 . said lineal actuator 328 extends and retracts a shaft 330 that terminates in plunger 332 extendable below said turntable 324 . said lineal actuator 328 is controlled by said cpu 302 and is connected to said cpu 302 by cable 346 connected to terminals 326 on the lineal actuator 328 . yet referring to fig1 , a sensor 320 is connected to said cpu 302 by a cable 318 . said sensor 320 is fixed relative to the case 301 . a marker 322 is fixed onto the turntable 324 . when said turntable 324 rotates the marker 322 past the sensor 320 an input into the cpu 302 is generated to calibrate the precise angular position of the turntable 324 , and therefore necessarily the lineal actuator 328 , relative to the case 301 . the sensor 320 ensures that the plunger 332 is oriented directly over the proper vessel 514 ( shown in fig3 ) when the electronic head assembly 300 is attached to the case assembly 500 as shown in fig1 . the preferred embodiment of the sensor 320 is a hall effect sensor with a magnet as the marker 322 , but other sensors , such as a contact switch , would be equally effective . fig1 shows the assembled invention with the electronic head assembly 300 . when the invention is in use the electronic head assembly 300 is secured to a case assembly 500 that is in turn connected to an apical assembly 600 . the apical assembly as shown in fig1 , 14 and 15 may be substituted for the apical assembly 600 when it is suitable to the application of the invention , for example when the invention is used to administer intra - muscular or intra - dermal injections . fig2 shows an example of a circuit configuration 700 utilized with , and contained inside , the electronic head assembly 300 as shown in fig1 . a processor 708 is the main controller and may also comprise a logic array and is powered by a battery 720 . the circuit configuration 700 is powered up by switch 718 . an input device 702 feeds user input through a decoder 704 into the processor 708 . in the preferred embodiment the input device 702 may be , for example , a keyboard , numeric pad , buttons , switches or other commonly used input devices . said processor 708 optionally may also be connected to a port 710 to connect the circuit configuration 700 to an external computer that may perform such functions as programming , monitoring and / or controlling the circuit configuration 700 . a display 706 is optionally connected to the processor 708 to show information to the user such as the device status , fluid to be dispensed , fluid remaining , programming sequence , battery supply or any other relevant information . still referring to fig2 , a sensor 726 and marker 728 also provide an input into the processor 708 to aid in calibration of the position a lineal actuator 716 relative to the dispensed vessel 514 as described above in the discussion on fig1 where sensor 320 is analogous to sensor 726 , marker 322 is analogous to marker 728 and lineal actuator 328 is analogous to lineal actuator 716 . in the preferred embodiment the sensor 726 is a hall effect sensor that produces a signal when a magnet , shown as marker 728 , passes next to the sensor 726 . as an alternative , the sensor 726 may be a contact switch or other suitable means to indicate to the processor 708 when the sensor 726 is positioned next to the marker 728 . said processor 708 gives input to a driver 714 that in turn activates a motor 722 . in the preferred embodiment the motor 722 is a stepping motor . said motor 722 is analogous to the motor 310 in fig1 and performs to rotate the turntable 324 relative to the case 301 , also shown in fig1 . in the preferred embodiment the driver 714 is a translator and power driver circuit . the driver 714 is connected to battery 720 with a positive potential to turn the motor in one direction and also connected to battery 724 with a negative potential to turn the motor 722 in the opposite direction . said processor 708 also controls a driver 712 that in turn activates a lineal actuator 716 as also shown in fig1 as the lineal actuator 328 . as described in the discussion on fig1 , above , the lineal actuator 716 provides the force to dispense fluid contained in a vessel 514 , as shown in fig3 , when the shaft 330 and plunger 332 , as shown in fig1 , extend and press upon the piston 524 , as shown in fig3 . now referring to fig2 that shows a circuit configuration 800 for the pneumatic head assembly 400 , as shown in fig1 and described above . said circuit configuration 800 is typically contained inside the pneumatic head assembly 400 as shown in fig1 . a processor 808 is the main controller and may also comprise a logic array and is powered by a battery 820 . the circuit configuration 800 is powered up by switch 818 . an input device 802 feeds user input through a decoder 804 into the processor 808 . in the preferred embodiment the input device 802 may be , for example , a keyboard , numeric pad , buttons , switches or other commonly used input devices . said processor 808 optionally may also be connected to a port ( not depicted ) to connect the circuit configuration 800 to an external computer that may perform such functions as programming , monitoring and / or controlling the circuit configuration 800 , similar to port 710 described in the discussion of fig2 , above . a display 806 is optionally connected to the processor 808 to show information to the user such as the device status , fluid to be dispensed , fluid remaining , programming sequence , battery supply or any other relevant information . still referring to fig2 , a sensor and marker ( neither depicted in fig2 ) similar to the sensor 320 and marker 322 shown on the electronic head assembly 300 as shown in fig1 and described above may also be present to aid in calibration of the invention . in the preferred embodiment the sensor 320 is a hall effect sensor that produces a signal when a magnet , shown as marker 322 , passes next to the sensor 320 . as an alternative , the sensor 320 may be a contact switch or other suitable means to indicate to the processor 808 when the sensor 320 is positioned next to the marker 322 . said processor 808 gives input to a driver 826 that in turn activates a motor 824 . in the preferred embodiment the motor 824 is a stepping motor . said motor 824 is analogous to the motor 426 in fig1 and performs to rotate the turntable 404 relative to the case 402 , also shown in fig1 . in the preferred embodiment the driver 826 is a translator and power driver circuit . the driver 826 is connected to battery 820 . said processor 708 also controls a driver 828 and a driver 830 . said driver 828 operates to either close or open both a valve 814 and a valve 816 simultaneously . said valve 814 and said valve 816 are analogous to valve 416 and valve 434 , respectively , shown in fig1 . said driver 830 operates to close or open both a valve 810 and a valve 812 simultaneously . said valve 810 and valve 812 are analogous to valve 418 and valve 436 , respectively , shown in fig1 . valve 810 , valve 812 , valve 814 and valve 816 operate in concert as described for the respective valves as shown in fig1 and described above in the discussion on fig1 to move said piston 468 , shaft 440 and plunger 442 up and down . said circuit configuration 800 includes a pump 822 to supply a pressure source as an alternative to the pressure vessel 446 as shown in fig1 . the pump 822 supplies a pressure greater than ambient pressure to valve 814 and valve 812 . the foregoing description conveys the best understanding of the objectives and advantages of the present invention . different embodiments may be made of the inventive concept of this invention . it is to be understood that all matter disclosed herein is to be interpreted merely as illustrative , and not in a limiting sense .

US-61093006-A

an insole for ventilating shoes or boots comprising an air intake passage , an inflatable elastic bladder , an air exhaust passage , a ventilating capillary , and valve means . the bladder is formed along the peripheral area of the heel portion of the insole . periodic application and release of pressure to the bladder causes air to flow out of the ventilating capillaries , thus cooling and drying the foot .

referring now to the drawings , and particularly to fig1 , and 4 , there is illustrated one embodiment of a ventilating insole 20 . although the ventilating insole 20 is shown in fig1 inserted into a standard walking shoe 10 , the insole can be used with a variety of other walking devices , including athletic shoes and work boots . the shoe 10 comprises an upper 16 having a heel portion 18 , and has an inner environment 12 and an outer environment 14 . the insole 20 comprises fore 30 , arch 40 , and heel 50 portions . the heel portion 50 includes a generally centrally located heel support area 51 , a peripheral edge 52 , and a peripheral area 53 extending therebetween . the fore portion 30 includes an upper surface 34 , and the arch portion 40 includes an inner edge 42 . an inflatable elastic bladder 60 is formed primarily along the peripheral area 53 of the heel portion 50 . the bladder 60 is preferably formed substantially along the rear 54 and inner 58 peripheral portions of the peripheral area 53 and is preferably of a kidney shape in a generally horizontal plane of the insole , extending through the peripheral edge 52 of the heel portion 50 of the insole 20 . however , those skilled in the art will recognize that a variety of shapes formed along the peripheral area 53 of the heel portion 50 could be employed . the inflatable elastic bladder 60 includes an inlet port 61 and a discharge port 62 . however , it will be understood by those skilled in the art that a number of inlet 61 or discharge 62 ports could be added . the inlet port 61 is preferably located at the outer side 56 of the rear peripheral portion 54 , and the discharge port 62 is preferably located at the foremost end of the inflatable elastic bladder 60 . an air intake passage 64 extends to the inflatable elastic bladder 60 proximate the inlet port 61 and provides fluid communication between the air intake passage 64 and the bladder 60 . although the air intake passage 64 could take a variety of shapes and sizes , the preferred embodiment employs an air intake tube 65 . the air intake tube 65 extends through the base of the upper 60 via a pressure fit . it is then generally vertically disposed along the outer wall of the heel portion 18 of the upper 60 . the air intake tube 65 is preferably disposed from the outer side 56 of the rear peripheral portion 54 of the insole 20 . this location is chosen to reduce the possibility of pinching off inlet air flow , while maintaining wearer comfort . in the preferred embodiment , an air exhaust passage 66 , in fluid communication with the inflatable elastic bladder 60 proximate the discharge port 62 , extends to the inner edge 42 of the arch portion 40 . those skilled in the art will recognize that the air exhaust passage 66 can include a plurality of branches , as illustrated by the second preferred embodiment 100 in fig3 which may also split into successive branches . the air exhaust passages 66 can also take a variety of shapes and sizes other than the channels employed in the preferred embodiment . in the preferred embodiment of the present invention , a ventilating capillary 68 opens from the air exhaust passage 66 to the inner environment 12 of the shoe 10 . the ventilating capillaries 68 can open from the terminus of an air exhaust passage 66 , as illustrated by the first preferred embodiment 20 in fig2 or they may open at various points along an air exhaust passage 66 , as illustrated by the second preferred embodiment 100 in fig3 . in the preferred embodiment an inlet valve 72 and a discharge valve 74 are employed to control air flow from the outer environment 14 to the ventilating capillaries 68 . the inlet valve 72 is preferably positioned in the inlet port 61 of the bladder 60 and the discharge valve 74 is preferably positioned in the discharge port 62 of the bladder 60 . those skilled in the art , however , will recognize that the inlet 72 and discharge 74 valves can be positioned in a variety of locations along the air intake passage 64 and the air exhaust passage 66 , respectively . the valves 72 , 74 are preferably one - way valves . it will be understood that a single one - way valve 70 could be employed , although with less efficient functioning of the ventilating insole 20 . moreover , the ventilating insole 20 can function without any valves by using physics principles to restrict air flow at different stages of the walking step . the one - way valves 70 used in the preferred embodiment are flapper valves . those skilled in the art , however , will recognize that a variety of other one - way valves 70 could be employed . the basic operation of the preferred embodiment of the ventilating insole 20 is as follows . air is sucked into the bladder 60 through the air intake tube 65 . after the heel strikes the ground the air inlet valve 72 closes and air is rolled by the natural motion of the foot toward the air discharge port 62 where the discharge valve 74 has opened under pressure . air is expelled through the air exhaust passages 66 and out the ventilating capillaries 68 as the bladder 60 deflates . the increased air pressure inside the shoe 10 forces moist air out through the semipermeable upper 16 , replenishing the inner environment 12 of the shoe 10 with fresh air . as the foot is lifted and pressure is removed from the bladder 60 , the vacuum created by the reexpanding bladder 60 closes the discharge valve 74 and opens the inlet valve 72 to allow more fresh air to enter the bladder 60 . in the preferred embodiment , the inflatable elastic bladder 60 and air exhaust passages 66 are formed between a semi - rigid lower layer 80 and a flexible layer 90 . those skilled in the art , however , will recognize that the bladder 60 and the air exhaust passages 66 can be formed in a variety of ways within the insole 20 , such as employing a balloon - type sack or tubing , respectively . in the preferred embodiment , the semi - rigid layer 80 has bladder 84 and passage 86 depressions in its upper surface 82 . the flexible layer 90 is glued to the upper surface 82 of the semi - rigid layer 80 , forming the inflatable elastic bladder 60 and the exhaust passages 66 . the flexible layer 90 is made of a sponge - like material which elastically reverts to its normal shape after decompression , causing reinflation of the bladder 60 between successive compressions . the semi - rigid layer 80 is preferably manufactured from a dense polyether urethane , such as blown as urethane , and the flexible layer 90 is preferably made of a polyether urethane foam , such as poron 4000 . however , those skilled in the art will recognize that a variety of materials with similar properties could be substituted . the flapper valves 70 employed in the preferred embodiment are thin l - shaped pieces of rubber . they are glued in place between the semi - rigid 80 and flexible 90 layers . the air intake tube 65 in the preferred embodiment consists of capillary tubing which is cemented between the semi - rigid 80 and flexible 90 layers proximate the air inlet port 61 . finally , a sock lining of woven nylon , such as cambrelle , could be added to the upper surface of the flexible layer 90 to control perspiration between the foot and the flexible layer 90 . the ventilating insole 20 of the present invention is replaceable , should it loose its ventilating capability . the air intake tube 65 can be removed along with the insole 20 which can then be replaced with a new insole . it will be understood by those skilled in the art that the present invention is not limited to the examples discussed above , which are illustrative only . changes may be made in detail , especially in matters of shape , size , arrangement of parts , and material of components within the principles of the invention , to the full extent indicated by the broad general meanings of the terms in which the appended claims are expressed .

US-1696493-A

methods comprise contacting apatite - forming - systems with partially alkylated xanthines . the methods include pharmaceutical applications of partially alkylated xanthines to mitigate the effects of hard tissue diseases . products comprise apatite formed from apatite - forming - systems contacted with partially alkylated xanthines .

in the following experiments , the present inventors have demonstrated the effects of partially alkylated xanthines on 4 apatite - forming - systems , one in vitro and three in vivo . the apatite - forming - systems and parameters examined include ( 1 ) crystallite size of apatite crystallized from dilute salt solution ; ( 2 ) dissolution rates , crystallite size , and chemical composition of apatite formed in the first molars of suckling ( 22 day ) rats ; ( 3 ) mechanical strength , electron micrographs , and chemical composition of femurs from 29 day rats ; ( 4 ) crystallite size of bone apatite formed in ovariectomized rats ( 69 days ). it is evident from the attached results that methylxanthines , except caffeine , enhance crystallinity of apatite grown in vitro . in vivo , our results indicate that theobromine also enhances crystallinity , mechanical strength , and dissolution resistance of apatite . our results do not indicate a more intense mineralization of either bone or tooth material . evidently , no additional apatite material is deposited in either bones or teeth , but the crystallite size is increased in animals exposed to theobromine , making the apatite less easily dissolved . application of these compounds may have profound effects on the health of human bone and teeth . the present unique discovery may have application in combating bone and dental disease by taking the proper amount of these methylxanthines at the appropriate time . our present discovery of methylxanthines &# 39 ; role in calcification is unique and could lead to an enormous commercial advantage for various types of industry . the amount of theobromine added to the diet in the present study was minute , and this is a further advantage of these methylxanthines . from these experimental results , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the appended claims . more specifically , it will be apparent to one of ordinary skill in the art that partially alkylated xanthines may be used to modify any apatite - forming - system , including but not limited to , those described herein . the development and use of the ovariectomized rat model is described by kalu , d . n . ( 1991 ) ( the ovariectomized rat model of postmenopausal bone loss . bone and mineral , 15 : 175 - 192 ). the age of the animals chosen for an experiment is a significant factor in the model . in general , young animals exhibit more turnover in bone structure , and thus the effects of any drugs administered tends to be faster and higher when young animals are used . having now generally described the present invention , the same will be more readily understood through reference to the following examples which are provided by way of illustration , and are not intended to be limiting of the present invention . in vitro experiments of growing apatite from dilute solutions of cacl 2 and na 3 po 4 were performed . all solutions contained 0 . 01 molar cacl 2 and na 3 po 4 . several sets of experiments were performed with the addition of each of the methylxanthines or uric acid at two concentrations , 50 mg and 200 mg / liter . the effect of the xanthine compounds was compared with a control solution containing cacl 2 and na 3 po 4 only . solutions were mixed at 25 ° c . and the ph adjusted to 9 - 9 . 5 with 0 . 1 molar naoh and left to crystallize for 20 days . the crystalline precipitate was washed 5 times with distilled water and prepared for x - ray diffraction which was performed on a “ scintag xds 2000 ”™ x - ray diffractometer . the instrument was operated at 40 kv potential and 20 ma current . scans were performed using step scan mode with 0 . 02 step increments and 3 seconds dwell time . the ( 300 ) reflection was scanned to investigate crystallinity . the following results in terms of fwhm ( full width - half maximum peak height ) divided by maximum peak height ( fwhm / m ) and for the ( 300 ) reflection is given in table 1 for the control and the xanthine compounds . from the data , it appears that the experiments run with theobromine ( fig5 , & amp ; 7 ) or 3 - methyl xanthine ( fig8 ) show the most pronounced increases in crystallinity , compated to controls ( fig3 & amp ; 4 ). this is evident from lower values of the ratios fwhm / m compared to the control ( table 1 ). lower values of this ratio indicate better crystallinity . all of the methylated xanthines , except caffeine , increased the crystallinity of the precipitating apatite . in every case , the crystallinity increased with xanthine concentration . caffeine and uric acid decreased the cystallinity of the apatite , also in a dose - dependent manner . the overall plan of examples 2 , 3 , and 4 is depicted in fig1 . timed pregnant sprague - dawley rats were purchased from the breeder ( holtzman strain ). they were maintained on a 12 hour light / dark cycle and fed laboratory chow and water ad lib . at term , litters delivered within an 8 h period were combined and designated as day 1 ; eight pups were randomly assigned to each dam . then , the dams with the recombined litters were divided into two groups . dams from group 1 ( n = 8 ) were fed a 20 % protein diet . those from group 2 ( n = 8 ) were fed a 20 % protein diet supplemented with theobromine . the composition of the 20 % protein diet is casein , 200 g ; dextrose , 191 g ; sucrose , 178 g ; dextrin , 192 g ; mazola corn oil , 150 ml ; mineral mix (“ rogers - harper mineral mix ”™), 40 g ; choline chloride 50 % ( w / v ), 4 ml ; cellulose , 35 g ; and vitamin mix (“ ain vitamin mixture 76 ”™), 10 g . the theobromine supplementation was 1 mg / 100 of the dam &# 39 ; s body weight until weaning at day 22 , and 1 mg / 100 g of the offspring &# 39 ; s body weight after weaning . we adjusted the theobromine supplement in the maternal and offspring &# 39 ; s diets based upon their weight and food intake in order to maintain a constant ratio of theobromine ( 1 mg / 100 g body weight ). theobromine supplementation in the diet was followed in exactly the same way as caffeine supplementation in the diet in out previous studies ( see nakamoto , t . and shaye , r . protein - energy malnutrition in rats during pregnancy modifies the effect of caffeine on fetal bones . j . nutr . 116 : 633 - 640 , 1986 ). the amount of theobromine supplemented to the maternal diet corresponded to approximately 8 . 8 mg / 100 g diet or 0 . 0088 % for days 1 - 14 ; for days 14 - 22 , it was 5 . 9 mg / 100 g diet or 0 . 0059 %. after weaning , theobromine added to the offspring &# 39 ; s diet was 8 . 9 mg / 100 g diet or 0 . 0089 % for days 22 - 29 . the theobromine intake by the dams during lactation and the growing period of the offspring per day was comparable to approximately one to seven 1 - oz milk chocolate bar by a 65 kg human , after adjustment for size and pharmacokinetics ( tarka , s . m ., zoumas , b . l . and gans , j . h . short - term effects of graded levels of theobromine in laboratory rodents . toxicol . appl . pharmcol . 49 : 127 - 149 , 1979 ). note that the intake of theobromine by the suckling offspring was much lower than that of the dams , since the only source of theobromine intake by the pups came from the dam &# 39 ; s milk , at least up to day 15 . from day 15 to day 22 the pups start nibbling the dam &# 39 ; s food which contains theobromine . the amount of theobromine that rats consumed in this experiment has an equivalent human consumption , in proportion to body weight and pharmacokinetic differences . for the most accurate estimate , the extrapolation should be adjusted either for the pharmacokinetics of theobromine metabolism ( resman , b . h ., blumenthal , h . p ., and jusko , w . j . breast milk distribution of theobromine from chocolate . j . pediat . 91 : 477 - 480 ( 1977 ); drouillard , d . d ., vesell , e . s ., and dvorchick , b . n . studies on theobromine disposition in normal subjects . clin . pharmacol . ther . 23 : 296 - 302 ( 1978 ), or metabolic body size . in humans , the half life of theobromine in plasma is about 6 hours ; in rats , it is about three hours ( welch , r . m ., hsu , s . y ., and deangeles , r . l . effect of araclor 1254 , phenobarbitol and polycyclic aromatic hydrocarbons on the plasma clearance of caffeine in the rat . clin . pharmacol . ther . 22 : 791 - 798 ). the amount of theobromine used in the current experiment ( 1 mg / 100 g body weight ) is equivalent to human dose of 650 mg / kg . assuming that the theobromine content of a one oz . bar of milk chocolate is 45 to 105 mg as stated previously , approximate intake of theobromine becomes three to seven bars of one oz . milk chocolate , when extrapolated using pharmacokinetics of theobromine metabolism . when the conversion is based on the metabolic body weight ( kg 0 . 75 ), ( kleiber , m . in : the fire of life , an introduction to animal energetics . new york wiley andsons , p . 177 - 216 ( 1961 )) the present dosage ( 1 mg / 100 g body weight ) in rats is equivalent to 129 mg / 65 kg 0 . 75 . this corresponds approximately to slightly more than one to three bars of one oz . milk chocolate for a 65 kg human . on day 22 , maternal milk and blood were collected . then randomly selected pups were killed ; their blood was collected ; and first molars of the mandible and maxilla were removed . randomly selected first molars were mounted with a sticky wax on a small plastic block in order to study the acid solubility on the enamel . surface . first molars were examined later by electron microprobe analysis and x - ray diffractometry ( fig2 ). fig9 - 11 show the statistical significance between control and experimental groups of the minerals dissolved from 1st molars . calcium and phosphorus concentrations were determined in enamel of first molars extracted from theobromine exposed rats or control rats by an “ arl ”™ electron microprobe analysis . the instrument was operated at an acceleration potential of 15 kv and a beam current of 1 . 0 × 10 − 7 a . a fluorapatite from cerro de mercado , mexico , was used as a standard . the results obtained are shown in table 2 . x - ray diffractometry results depicted in fig2 and other measurements show a consistent relationship of higher crystlinity , i . e . larger crystallites , in the whole first molars of animals exposed to theobromine , compared to the control group . from the data of table 2 , the overall contents of cao and p 2 o 5 appear comparable within the expected margin of error . this suggests that composition of crystallites of the enamel between control and experimental groups are the same . on day 29 , the remaining offspring were killed , blood was collected , and the femur removed . femurs were cleaned and dried overnight at 85 ° c . crystalline phases in the femurs were examined by scanning electron microscopy . an “ amray 1820 ”™ digital scanning electron microscope was used in the study . the instrument was operated at an acceleration potential of 15 kv , a working distance of 18 mm , a 300 micron final aperture was used , and a spot size of 4 . 0 was employed in the study . flat polished and etched ( 3 percent acetic acid , 20 seconds each time ) cross sections of femur were investigated . it was noted that etching was generally more intense in the control group . remnant structures in the bone appeared coarser in the experimental group ( fig1 ) than in the control group ( fig1 ). higher magnifications are shown ( fig1 ). femurs were removed , powdered and examined with a “ scintag xds 2000 ”™ x - ray diffractometer . x - ray diffractometry ( fig1 ) of a female femur at 29 days showed larger crystallites in the experimental group than in the control . this figure illustrates the increased crystallinity , as shown by the smaller fwhm / m , of the experimental group relative to the control group . x - ray diffraction procedures can be used to obtain information on crystallite - size of a sample within a limited range . a method of measuring this is to obtain measurements of reflection width / reflection height ratios . this is typically referred to as the “ full width - half maximum ” ( fwhm ) value , calculated by measuring the peak breadth at half the peak height . a sample of a crystalline compound with a crystallite or particle size of about 10 − 3 cm will produce the sharpest peaks with smallest “ fwhm ” values ; whereas , a sample with a particle size of 10 − 6 cm will produce far broader , more diffuse peaks . thus , if crystallite size of a material is a size range of approximately 0 - 1000 ångstrøoms , it is possible to estimate or compare crystallite sizes of the material by measuring the fwhm values . the mathematical relationship is as follows : where b is the broadening of the diffraction line measured at half its maximum intensity q is the glancing angle of the x - ray beam with the crystal lattice plane in question . it is relatively simple to directly compare the crystallinity of two compounds by comparing one or more reflections of the material &# 39 ; s spectrum . for apatite , the reflection of the plane ( 300 ) is commonly used for this purpose . in many cases , the ratio of fwhm / m ( m = peak intensity or peak height ) is used for reporting crystallinity . table 3 shows various parameters measured at day 22 and 29 . table 4 shows the femur &# 39 ; s wet weight and length . there was no significant difference ( student t - test ) between the control and theobromine group on any parameter measured ( p & gt ; 0 . 05 ). this is important since there was no indication in any parameters of the theobromine group of any adverse effects . we have concentrated on the plasma levels of cu and zn to see if any changes between the group occurred , since our studies on caffeine show decreased zn and cu concentrations in the plasma . b at day 22 pups were weaned . one male and one female pup were removed from each dam ; however , we could not obtain one male pup from one dam at day 22 . c dam &# 39 ; s food intake was averaged until day 22 . around day 15 pups started nibbling dam &# 39 ; s food . e each sample is pooled blood from the same litter . we could not measure one sample from the theobromine group for cu determination due to shortage of blood plasma . f there was no significant difference between male and female plasma values of zn and cu ; therefore , data were combined . pup &# 39 ; s blood samples had to be pooled due to a shortage of blood plasma . the polished femurs of 29 day old rats also were analyzed on the microprobe following this procedure : areas of highest apatite density were determined by scanning the beam over a large area of bone . these highest ca and p areas were then analyzed . this procedure was used to avoid analyzing organic materials . the results are shown in table 5 . from these results it is evident that there is little difference in the actual composition of the bone material between the experimental and control groups . the femurs from 29 day old female animals in the control and experimental groups were subjected to a mechanical property study . the femurs , which were kept in air tight glass bottles in the freezer , were defrosted . mechanical properties were measured using an “ unstring ”™ universal testing instrument . yield stress in megapascals ( mpa ) was found to be 43653 ± 2361 ( mean ± sem ), in the control group ( n = 10 ) and 48040 ± 2660 in the experimental group ( n = 7 ). the experimental group showed an approximate 10 % increase . maximum ( failure ) stress was 21362 ± 766 in the control ( n = 10 ) and 23577 ± 1040 in the experimental group ( n = 7 ). the experimental group showed a 9 % increase . young &# 39 ; s modulus of elasticity ( map ) was 893837 ± 79285 in the control ( n = 10 ) and 1081796 ± 99123 in the experimental group ( n = 7 ). this showed about a 21 % increase in the experimental group over the control . when yield stress , maximum stress and young &# 39 ; s modulus of elasticity are considered , one can conclude that female femurs in the experimental group were stronger and stiffer and show relatively less deformation under applied loading . femur volume ( ml ) was 0 . 273 ± 0 . 019 in the control ( n = 11 ) and 0 . 286 ± 0 . 014 in the experimental group ( n = 7 ). this was about a 5 % increase in the experimental group over the control . for male , yield stress ( map ) was 51388 ± 3307 in the control ( n = 6 ) and 46212 ± 2422 in the experimental group ( n = 8 ). this was about 10 % decrease in the experimental group . maximum stress was 22830 ± 1775 in the control ( n = 6 ) and 21235 ± 847 in the experimental group ( n = 8 ). this was about 7 % decrease in the experimental group . young &# 39 ; s modulus of elasticity ( map ) was 1075678 ± 8403 in the control ( n = 6 ) 1043988 ± 43453 in the experimental group ( n = 8 ). this was about 3 % decrease in the experimental group . these results indicate that male femurs in the experimental group are relatively weaker and less stiff and show greater deformation under applied loading . female rats were ovariectomized at day 30 and then those in the experimental group were fed a diet with the same amount of substance as previously used . the females in the control group were fed the diet without experimental substance . both groups of animals were killed at day 69 or 70 . femurs were removed , powdered and examined with a “ scintag xds 2000 ”™ x - ray diffractometer . this x - ray diffractometry of the female femurs showed larger crystallites in the experimental group ( upper tracing ) than in the control ( fig1 ). it is evident from the attached results that partially methylated xanthines enhance crystallinity in apatite grown in vitro . our results indicate that theobromine enhances crystallinity in vivo , as well . the results of x - ray diffraction studies of bone and teeth indicate larger crystallite size , as noted by sharpening of the ( 300 ) reflections . microprobe results do not indicate a more intense mineralization of either bone or tooth material . scanning electron microscopy in vitro shows coarser apatite crystallites in the theobromine and 3 - methyl xanthine group than in the control group . evidently , no additional apatite material is deposited in either bones or teeth but the crystallite size is increased in the partially methylated xanthines , making such material less easily dissolved . application of these compounds may have profound effects on the health of human bone and teeth . all references cited herein , including journal articles or abstracts , published or corresponding u . s . or foreign patent applications , issued u . s . or foreign patents , or any other references , are entirely incorporated by reference herein , including all data , tables , figures , and text presented in the cited references . additionally , the entire contents of the references cited within the references cited herein are also entirely incorporated by reference . reference to known method steps , conventional methods steps , known methods or conventional methods is not in any way an admission that any aspect , description or embodiment of the present invention is disclosed , taught or suggested in the relevant art . the foregoing description of the specific embodiments will so fully reveal the general nature of the present invention that others can , by applying knowledge within the skill of the art ( including the contents of the references cited herein ), readily modify and / or adapt for various applications such specific embodiments , without undue experimentation , without departing from the general concept of the present invention . therefore , such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed embodiments , based on the teaching and guidance presented herein . it is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation , such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance presented herein , in combination with the knowledge of one of ordinary skill in the art .

US-57912195-A

cigarettes are manufactured on a machine that includes a filter tip attachment comprising a train of rollers with peripheral suction grooves , each proportioned to hold a single cigarette . the grooves are set parallel to the axis of rotation of the relative rollers and combine to establish a feed path along which the cigarettes are attracted and released , passing from one roller to the next and advancing through a succession of processing stations . to optimize the attraction and release steps , the cigarettes themselves are exploited in such a way as to create a chamber in each groove , compassed between the cylindrical surface of the cigarette and the bottom surface of the groove it occupies , and connected to the pneumatic circuits generating the suction .

with reference to fig1 of the accompanying drawings , 1 denotes a portion , in its entirety , of a machine known as a filter tip attachment , used in the manufacture of filter cigarettes . an infeed 2 of the attachment is coupled to the outfeed 3 of a beam 4 from which double length cigarette sticks 5 are directed in succession by a transfer unit 6 to the infeed 2 of the attachment , which will be seen to consist in a train of rollers rotatable about mutually parallel axes and furnished each with a plurality of suction grooves . in the interests of simplicity , the rollers are denoted r generically , except where identified by a specific numeral , and all the grooves are denoted 8 . the infeed 2 coincides with a first roller 7 set in rotation at a constant angular velocity , turning clockwise as viewed in fig1 about a relative axis extending parallel to the predominating axis of the beam 4 , by which the double length cigarette sticks 5 are taken up in grooves 8 lying parallel to the axis of rotation . the sticks 5 are thereupon advanced transversely to their longitudinal axes and transferred in succession to relative grooves 8 afforded by the periphery of a second roller 9 set in rotation counterclockwise as viewed in fig1 . the double length sticks 5 are advanced by the second roller 9 , again transversely to their axes , toward a cutting unit 10 where each is divided in conventional manner to produce two single sticks 5 a of length corresponding to the length of a normal cigarette ; the two sticks 5 a are then advanced in axial alignment and transferred to the grooves 8 of a third roller 11 , rotating clockwise , on which they will be distanced axially one from another . the separated sticks 5 a are transferred to a fourth roller 12 forming part of a conventional assembly station 13 that also comprises a feed roller 14 conveying double length filter plugs 15 . as discernible in fig1 the feed roller 14 is positioned substantially tangential to the fourth roller 12 , rotating in the opposite direction and at the same peripheral speed , and is designed to place each successive double length filter plug 15 in a central portion of a relative groove 8 offered by the fourth roller 12 . each plug 15 transferred thus to a relative groove 8 of the fourth roller 12 will assume a position in between and in alignment with two single cigarette sticks 5 a transferred to the selfsame groove 8 , thus forming an assembly 5 b on the roller 12 composed of two axially aligned cigarette sticks 5 a separated by one double length filter plug 15 . these assemblies 5 b are then fed in succession from the fourth roller 12 to a fifth roller 16 coinciding with the infeed station of a finishing unit 17 of the type disclosed and claimed in italian patent n o 1 200 229 , to which reference can be made for a full description . besides the fifth roller 16 , as illustrated in fig1 the finishing unit 17 comprises a feed roller 18 positioned to supply tipping papers 19 separated from a continuous strip 20 by a cutting unit 21 , of which the function is to join together the two cigarette sticks 5 a and the double length filter plug 15 making up each assembly 5 b . forming a part of this same unit 17 is a rolling unit 22 , including a respective roller 23 , designed to take up each successive assembly 5 b together with the relative tipping paper 19 from the fifth roller 16 and thereupon roll the tipping paper 19 around the double length filter plug 15 and the corresponding ends of the two cigarette sticks 5 a to fashion a double length cigarette , denoted 5 c . the double length cigarettes 5 c pass in succession from the tipping roller 23 to a sixth roller 24 coinciding with the outfeed of the finishing unit 17 . at a given point while occupying the grooves 8 of the sixth roller 24 , each successive double length cigarette 5 c is directed through a cutting unit 25 positioned to engage the double filter plug 15 , in such a manner as to generate respective pairs of axially aligned single cigarettes 26 that are then transferred from this same roller 24 onto further rollers 27 and 28 , thence to other machine units of the filter tip attachment indicated schematically by a block denoted 29 . one of the steps performed by these further units will be to order the cut cigarettes 26 in single file . [ 0032 ] fig2 and 7 show a portion of a typical roller r illustrating the relative grooves 8 , each of which presents an arcuate profile with a concave face directed away from the axis of rotation of the roller r . more exactly , the groove 8 is fashioned with two mutually opposed flank faces 30 joined to a bottom surface 31 affording at least two holes 32 connected by way of radial ducts 33 to a source of negative pressure ( conventional in embodiment , and not illustrated ). as already intimated , each groove 8 of a given roller r is designed to accommodate a double length cigarette stick 5 , or a single cigarette stick 5 a , or an assembly 5 c composed of two single sticks 5 a separated by a double length filter plug 15 ; in the interests of simplicity however , reference will be made hereinafter simply to cigarettes 26 . with reference in particular to fig3 the two flank faces 30 are flat and rectilinear , so that the groove 8 presents a cross - sectional profile of substantially shallow “ u ” outline . moreover , the groove 8 is proportioned ( see fig3 ) so that a relative cigarette 26 will come to rest with two longitudinal areas 34 of its cylindrical surface offered in contact to two respective longitudinal areas of the flank faces 30 , in such a way as to create at least one chamber 35 between the bottom surface 31 of the groove 8 and a portion 26 a of the cylindrical surface of the cigarette 26 directed toward the bottom surface 31 . thus , the chamber 35 is compassed between the part of the cylindrical surface of the cigarette 26 delimited by the two longitudinal areas 34 of contact , and the part of the surface of the groove 8 delimited by these same two areas 34 of contact . the chamber 35 is connected to the aforementioned source of negative pressure by way of the relative holes 32 which , as discernible from fig7 are located at points near to the two opposite ends of the groove 8 in such a way that the partial vacuum generated within the chamber 35 will be stronger in the central part , extending between the two suction holes 32 , than at the two endmost parts ; thus , the part of the cigarette 26 exposed to the greatest force of attraction will be , correspondingly , that part of the portion 26 a of the cylindrical surface extending between the two holes 32 . in the example of fig8 and 9 , the two flank faces 30 of each groove 8 are joined to a bottom surface 36 presenting a cross - sectional profile of squarish outline , comprising a flat bottom face 37 extending between two flank walls 38 normal to the bottom face 37 and merged with the flank faces 30 . in this instance the chamber 35 is enlarged , and whilst the contact made between the cigarette 26 and the flank faces 30 remains the same as in the first example described , the distance separating the portion 26 a of the cylindrical surface of the cigarette 26 from the bottom face 37 of the groove is increased , so that if tobacco particles are shed from the end of the cigarette 26 , this will not occasion any loss of grip between the cigarette 26 and the flank faces 30 . the groove 8 illustrated in fig1 , 11 and 12 is fashioned with a bottom surface 39 presenting a longitudinal rib 40 positioned to make contact with an intermediate band 26 b on the portion 26 a of the cylindrical surface of the cigarette 26 directed toward the bottom surface 39 , and combining with the selfsame portion 26 a of the cylindrical surface to create two half - chambers 35 a , as discernible in fig1 . observing fig1 in particular , the rib 40 in question presents transverse notches 41 , coinciding with the suction holes 32 , by which the holes 32 are connected with both half - chambers 35 a . [ 0038 ] fig4 and 6 illustrate the steps by which a cigarette is transferred , in the portion 1 of the machine shown in fig1 from a typical releasing roller r , rotating clockwise and indicated on the left in the three drawings , to a typical receiving roller r rotating counterclockwise . more precisely , fig4 illustrates the mutual positions of two grooves 8 , releasing and receiving respectively , at a moment immediately preceding the transfer from left to right , in which the cigarette 26 is held by the partial vacuum generated in the chamber 35 of the groove 8 presented by the releasing roller r . fig5 illustrates the mutual positions of the same two grooves 8 during the subsequent transfer step , in which the cigarette 26 remains in contact simultaneously with the two flank faces 30 of the releasing groove 8 and with the two flank faces 30 of the receiving groove 8 , along the respective longitudinal areas 34 and through a predetermined angular distance typically of 6 °, as the rollers r rotate about their relative axes . accordingly , the cigarette 26 makes contact simultaneously with four faces 30 of the two respective grooves 8 along four longitudinal areas 34 of its cylindrical surface . at a given point during the transfer sequence , suction is deactivated initially in the chamber 35 of the releasing groove 8 , through the agency of conventional valve means not shown in the drawings , and simultaneously activated in the chamber 35 of the receiving groove 8 . in this way , the transfer of a cigarette 26 from a releasing groove 8 to a receiving groove 8 , which concludes as illustrated in fig6 can be effected gradually and without causing the cigarette 26 to be propelled through a radial flight between the two grooves 8 that might damage it in any way . to the end of ensuring that the position of the cigarettes 26 is correctly controlled throughout the entire operation of effecting a transfer from one roller r to the next , and as discernible in particular from fig5 the diagonally opposed pairs of flank faces 30 presented respectively by the releasing and receiving grooves 8 are set apart one from another by a distance marginally less than the diameter of a single cigarette 26 , so that the selfsame cigarette will be lightly compressed along the four longitudinal areas 34 of contact with the four corresponding faces 30 . where the grooves of two contiguous rollers r are embodied as in the example of fig1 , 11 and 12 , the cigarette 26 will be held not only along the aforementioned four longitudinal areas 34 of contact during the transfer step , but also along the portions 26 b in contact with the ribs 40 , so that there are six points of contact between the cylindrical surface and the grooves , four of which coinciding with the longitudinal areas 34 along the flank faces 30 , and two coinciding with areas 42 of the ribs 40 offered to the cigarette 26 . in the example of fig1 and 14 , the flank faces 30 of each groove 8 are joined to a bottom surface 39 presenting a cross - sectional profile of squarish outline , comprising a flat bottom face 43 and two flank walls 44 substantially perpendicular to the bottom face 43 . the solution is therefore similar to that illustrated in fig8 and 9 , though with the difference that the cigarette 26 is offered in contact both to the two flank faces 30 and to the flat bottom face 43 , thereby creating two half - chambers 35 a . each hole 32 presents a countersunk mouth 45 communicating with both the half - chambers 35 a . it will be observed , in the examples of fig7 to 14 , that the two opposite ends of the groove 8 can be embodied either as illustrated in fig3 or in familiar manner with a portion , denoted 46 , contoured in such a way as to minimize any loss of suction force from the chambers 35 or 35 a . in the examples of 15 , 16 and 17 , the ends of the groove 8 are shaped in such a manner that the cigarette 26 engages fully in contact with the portions 46 lying between the two flank faces 30 . finally , in the examples of fig1 to 21 , the single groove 8 is fashioned in such a manner that a cigarette 26 positioned on the bottom surface , denoted 48 , will enter into contact only with a substantially central area 49 . the central area 49 in question lies between two channels 50 presented by the bottom surface 48 and extending practically the full length of the groove 8 . the purpose of the channels 50 is to establish two half - chambers 47 a of a chamber , denoted 47 in its entirety , created between the bottom surface 48 and the cylindrical surface of the cigarette 26 . the connection between the chamber 47 and the aforementioned source of negative pressure is provided by way of holes 32 in the bottom surface 48 located to coincide with the central area 49 of contact . each hole 32 presents a countersunk mouth 52 communicating with both the channels 50 . the channels 50 might be fashioned with various cross - sectional profiles : the example of fig1 shows a profile of squarish outline similar to that of fig1 , whilst the example of fig2 shows a curved outline similar to that of fig1 , 11 and 12 . it will be observed in the examples of fig1 to 21 that the partial vacuum is generated within a chamber 47 that has open sides , unlike the chamber denoted 35 . accordingly , the inclusion of the two end portions 46 in the manner described above will be particularly advantageous in this instance , with the end in view of minimizing any loss of suction force from the chamber 47 .

US-44579703-A

a device and method are set forth to assist in providing artificial respiration and at the same time avoid intimate contact . included is a conduit defining an airway with an outwardly projecting flange portion to be received in the person &# 39 ; s mouth and seal against the inside surface of the lips about the mouth opening . a check valve prevents reverse flow of air through the device . the device may be adapted to also define a tongue depressor . the person providing artificial respiration blows through the device to supply respiring air to the person receiving the same .

turning to fig1 one embodiment of device 10 according to the present invention is shown . device 10 includes a conduit 12 which may be circular in cross - section or any other suitable shape and any desired length and fashioned from any desired material . conduit 12 defines an airway 14 through which respiring air will pass from the person providing artificial respiration ( respiring person ) to the person receiving the same ( respired person ). conduit 12 has a first end 16 adapted to be received into the mouth 18 of the respired person and a second end 19 upon which the respiring person places his / her mouth . device 10 further includes a flange 20 which as shown in fig1 is received through mouth opening 32 and into the mouth 18 of the respired person and is adapted to be located in the space or pocket 22 defined between the teeth 24 and gums 26 and upper and lower lips 28a and 28b . for this purpose , flange 20 may be semicylindrical or semispherical and , as shown in fig2 have an overall oval profile in end view . accordingly , with the device 10 thusly inserted into mouth 18 of the respired person , flange 20 nests in pockets 22 holding device 10 in position . to provide a seal for the device 10 , flange 20 or at least the margin thereof , defines a surface 30 which is adapted to mate with the inside surface of the upper and lower lips 28a , 28b and the entire area inside mouth 18 about mouth opening 32 . surface 30 may be smooth to so mate with the inside of the lips about the mouth opening 32 providing a surface - to - surface seal . with the saliva present , the seal between surface 30 and the inside of the mouth opening 32 is enhanced . to prevent reverse flow of respiring air , which would also raise concerns regarding the transmission of disease , the device 10 further includes means for preventing the reverse flow of air through airway 14 . as illustrated in fig1 and 2 , these means may be embodied as a flapper - type check valve 34 disposed in conduit 12 . check valve 34 is adapted to permit the flow of respiring air in only the direction of arrow 37 rough airway 14 and into mouth 18 of the respired person . accordingly , to provide artificial respiration with device 10 , the respired person is placed on his / her back and his / her mouth is opened such that the first end 16 of device 10 is inserted through mouth opening 32 to locate the flange 20 in pockets 22 and generally within and about the inside of mouth opening 32 . in this position , device 10 is retained by so locating the flange and a seal is defined between flange surface 30 and the inside surfaces of the lips about mouth opening 32 . flange 20 interacts with pockets 22 to retain the mouth 18 open as shown in fig1 . saliva within mouth 18 enhances the aforementioned seal ; alternatively , surface 30 may be appropriately coated with a viscous or otherwise sealing material for enhancing the seal . thereafter , the respiring person closes the nostrils of the person being respired with , for example , the thumb and forefinger of the right hand and thereafter blows through the second end 19 into airway 14 through check valve 34 and into mouth 18 and lungs of the person being respired . thereafter , the person releases the nostrils permitting the respired person to exhale through their nose and repeats the process as required until breathing is restored or help arrives . as can be appreciated , by using device 10 , the respiring person need not make mouth - to - mouth contact with the person being respired and therefore need not be concerned about contracting disease . further , there is no passing of air from the respired person to the respiring person . turning to fig2 an additional feature according to the present invention is shown . to secure the seal between surface 30 and the lips about mouth opening 32 , flange 20 may include means for urging flange 24 forwardly of teeth or gums 24 , 26 . these means may include protuberances 36 which are adapted to come in contact with gums 26 or teeth 24 and to urge the flange 24 forwardly to assure that surface 30 makes a sealing and mating contact with the inside of the lips about mouth opening 32 . protuberances 36 may be constructed of resilient material . with reference to fig3 device 10 may further be fashioned to include an accordion like segment 38 of conduit 12 about which conduit 12 may be flexed , extended or collapsed . an additional feature includes a peripheral ring 40 about conduit 12 adjacent second end 19 providing a gripping surface for holding device 10 during positioning and artificial respiration . with reference to fig4 and 5 , still further embodiments of a device according to the present invention is shown . like parts carry like reference numbers . device 10 &# 39 ; according to this embodiment has a first end 16 &# 39 ; which is generally tapered as best shown in fig5 to define a tongue depressor 42 . conduit 12 may reduce down to define tongue depressor 42 , as shown in fig5 or tongue depressor 42 may be incorporated as a separate component affixed within conduit 12 . airway 14 extends from second end 19 through conduit 12 and tongue depressor 42 to pass air through device 10 &# 39 ;. accordingly , when device 10 &# 39 ; is inserted through mouth opening 32 , tongue depressor 42 is located to depress the respirated person &# 39 ; s tongue and assure that the tongue does not close the air passage during respiration . of course , while tongue depressor 42 is shown as being rectangular in cross section , it can have any suitable shape . additionally , tongue depressor 42 may , instead of defining a duct or airway , may simply be a tongue depressing surface extending from device 10 &# 39 ;. the device hereinabove described may be constructed from plastic or any other suitable material and may be made flexible or collapsible . further the conduit second end 19 may be adapted to be coupled with a collapsable bag of the type used to provide artificial respiration . accordingly upon arrival of medical assistance or even at a medical care facility the device and collapsible bag may be used . while i have shown and described certain embodiments of the present invention , it is to be understood that it is subject to modifications without departing from the spirit and scope thereof .

US-15265188-A

an electromechanical actuator for an implantable hearing aid device including a mechanical output structure that has a first portion and a second portion , wherein the first portion is a mechanical attachment structure to attach a stapes prosthesis , and wherein the second portion is a wire - like member coupling the mechanical attachment structure to a magnetically permeable armature shaft assembly .

referring now to fig1 and 2 , there are shown perspective and composite views depicting the components of an implantable hearing aid device 100 incorporating an electromechanical actuator 50 according to a first embodiment of the present invention . hearing aid device 100 includes a housing 1 formed from titanium tubing that is substantially cylindrical and of circular cross section . hearing aid device 100 further comprises a titanium diaphragm 6 , a titanium ring 21 and a multi - pin feedthrough 9 which are joined by hermetic laser welds . coupling rod 7 , which is part of the moving mechanical output structure of electromechanical actuator 50 , is placed in ring 21 and is hermetically welded to it . this assembly provides a hermetically closed housing 1 that is suitable for implantation in the human body . lead 11 which provides the input signal to electromechanical actuator 50 is connected to feedthrough 9 . to protect the connection site of the lead 11 , electromechanical actuator 50 may be covered by a silicone filled titanium cap 10 . in this embodiment directed to a hearing aid device , the titanium cap 10 provides multiple flat surface regions to allow secure manipulation of the device during implantation with surgical tweezers or little tongs . the titanium cap 10 also has a conical shape that provides mechanical transition between the small diameter of the lead 11 and larger diameter of the titanium tube 1 . referring now to fig3 , there is shown an elevation view in longitudinal diametric section of the first embodiment of electromechanical actuator 50 of the present invention incorporating a low reluctance transverse gap . armature 2 , shaft 12 and coupling rod 7 form the moving part of the actuator 50 . as armature 2 and shaft 12 form part of the magnetic circuits which drive electromechanical actuator 50 they are made of soft magnetic alloys . however , as would be understood by those skilled in the art , other suitable materials having the desired magnetic permeability properties may also be used . shaft 12 is made of titanium to enable hermetic closing of the actuator by welding it to a ring 21 . the resulting moving structure is elastically supported at one side by a diaphragm 6 , which performs the function of a restoring spring . as such , diaphragm 6 prevents magnetic snap over . on the other side , shaft 12 is supported in the longitudinal direction by a spring bearing 5 having a spring constant sufficient to provoke , together with diaphragm 6 , the demanded dynamic characteristic of this spring - mass structure . the armature 2 is centred between two permanent magnets 3 a and 3 b thereby forming two working gaps 17 a and 17 b . both magnets 3 a and 3 b are polarized in the same direction substantially in parallel to the actuator axis and the direction of movement of shaft 12 , and provide polarizing flux in working gaps 17 a and 17 b that extends through the armature 2 . this first magnetic circuit is closed through the magnet supports 16 a and 16 b and the short sleeve 15 which are again fabricated from soft magnetic alloys . a second magnetic circuit comprises signal coil 4 , coil core 13 , long sleeve 14 , the magnet support 16 b , the armature 2 and the shaft 12 . signal coil 4 includes two input coil wires 23 which are connected to lead 11 by virtue of feedthrough 9 . preferably , all elements forming the second magnetic circuit other than the signal coil 4 are made of soft magnetic alloys to conduct the signal flux generated by coil 4 . this magnetic signal circuit includes two air gaps : the working gap 17 b and a transverse gap 18 formed between the coil core 13 and the shaft 12 . the transverse gap 18 between the coil core 13 and shaft 12 has been minimized in order to provide a low reluctance thereby minimize losses in the magnetic circuit . in operation , the signal flux passing through the working gap 17 b has the effect of modulating the polarizing flux generated by the magnets 3 a and 3 b in the process either increasing or decreasing the flux in the working gap 17 b depending on the direction of the current passing through the signal coil 4 . this in turn increases or decreases the attractive force in gap 17 b compared to the constant polarizing flux in gap 17 a which results in a net force pulling the armature upwards or downwards . in this manner , small changes in the signal flux generated by coil 4 will result in corresponding actuation of shaft 12 thereby providing an electromechanical actuator of enhanced sensitivity . referring now to fig4 , there is shown an elevation view in longitudinal diametric section of a second embodiment of an electromechanical actuator 55 . the main structure of the electromechanical actuator 55 is the same as shown in fig3 , however , the spring bearing 5 and the transverse gap 18 of the fig3 embodiment are replaced by flux conducting spring members 25 in this second embodiment . flux conducting spring members 25 are preferably made of soft magnetic alloys providing reduced reluctance to overcome the losses resulting from the increased air gap 18 when compared to the air gap between the shaft 12 and coil core 13 in the first embodiment . the use of multiple spring members 25 separated by flux conducting spacers 26 increases the sectional area that can be passed by the magnetic flux to further reduce the overall reluctance of the magnetic circuit . compared to one spring that is simply increased in thickness , the multiple springs provide higher compliance . referring now to fig5 , there is shown an elevation view in longitudinal diametric section of the first embodiment of the electromechanical actuator 55 showing the attachment of the coil wires 23 and lead 11 . coil wires 23 are attached to feedthrough pins 24 by , for example , brazing , welding or gluing with an electrically conductive glue . to prevent coil wires 23 from coming into contact with moving shaft 12 or spring bearing 5 , a cover 20 is placed between the coil wires and the shaft . the terminals 27 of lead 11 are inserted in a crimping tube 31 that is welded to the feedthrough pin 24 . crimping the tube 31 mechanically attaches lead terminal 27 and establishes a low - impedance electrical connection . in this embodiment , a cap 10 protects the whole connection site . the cavity 32 formed by the cap 10 is filled up with silicone to provide a firm mechanical attachment of the lead 11 . to enable proper sterilization of the silicone , the cap 10 provides multiple openings 28 . referring now to fig6 , there is shown an elevation view in longitudinal diametric section of the moving mechanical output structure 110 forming part of the implantable hearing aid device 100 illustrated in fig1 and 2 . mechanical output structure 110 comprises a coupling rod 7 and an artificial incus 8 , both made of titanium and , in this embodiment , welded together . a silicone coating 38 covers artificial incus 8 . the artificial incus 8 closely emulates the long process of the incus of the human middle ear , and is placed next to it during implantation . the length of the coupling rod 7 , measured from the outer surface of the diaphragm 6 to the end of the coupling rod 7 , is chosen in the range from approximately 3 mm to approximately 20 mm , and preferably in the range from approximately 5 mm to approximately 8 mm , to place the artificial incus 8 in the intended location . the angle formed by the axis of the coupling rod 7 and the axis of the artificial incus 8 is chosen in the range from 80 ° to 150 °, preferably in the range from 115 ° to 125 °, in order to correctly orientate the artificial incus 8 according to the anatomical conditions in the human middle ear . the cross sectional profile of the artificial incus 8 is elliptical with a numeric eccentricity in the range from 0 to 0 . 5 in order to provide reliable mechanical connection of the stapes prosthesis by crimping . additionally , the artificial incus 8 is covered with a silicone coating 38 that has a thickness chosen in the range from 0 . 05 mm to 0 . 2 mm in order to allow proper stapes prosthesis attachment and crimping . it should be appreciated that the above dimensions and distances are approximate and that other dimensions may be established in alternative embodiments . referring now to fig7 , there is shown a schematic diagram of one embodiment of the mechanical output structure of fig6 with an attached stapes prosthesis 33 . referring now to fig8 , there is shown another embodiment of the mechanical output structure having a ball joint 35 between coupling rod 39 and artificial incus 40 to allow intra - operative adjustment of the angle between the coupling rod 39 and the artificial incus 40 . referring now to fig9 , there is shown yet another embodiment of the mechanical output structure having a bendable coupling rod 41 to allow intra - operative adjustment of the orientation and the location of the artificial incus 8 . fig1 shows yet another embodiment of the mechanical output structure having a two part coupling rod , a stiff part 42 next to actuator 50 , 55 and a bendable part 36 next to the artificial incus 8 to allow intra - operative adjustment of the orientation and the location of the artificial incus 8 . referring now to fig1 , there is shown a further embodiment of the mechanical output structure having a stapes prosthesis 34 directly attached to the artificial incus 43 via a ball joint 37 to allow intra - operative adjustment of the insertion angle of the stapes prosthesis 34 . referring now to fig1 , there is shown implantable hearing aid device 1200 implementing an electromechanical actuator 1210 according to a preferred embodiment of the present invention . in this preferred embodiment , implantable hearing aid device 1200 is a totally implantable cochlear ™ prosthesis ( also referred to as a cochlear ™ implant system , cochlear ™ prosthetic device and the like ) which functions as an implantable stimulation device for stimulating the inner ear by employing an electromechanical actuator responsive to an auditory signal . as would be apparent to those skilled in the art , the electromechanical actuator of the present invention can be utilized in current or future implantable medical devices . these implantable medical devices can be either partially or totally implanted in an individual , and such implantation may be temporary or permanent . hearing aid device 1200 comprises external component assembly 1242 which is directly or indirectly attached to the body of the recipient , and an internal component assembly 1244 which is temporarily or permanently implanted in the recipient . external assembly 1242 typically comprises audio pickup devices 1220 for detecting sound , a speech processing unit 1216 , a power source ( not shown ), and an external transmitter unit 1206 comprising an external coil 1208 . speech processing unit 1216 processes the output of audio pickup devices 1220 that are positioned by the ear 1222 of the recipient . speech processing unit 1216 generates coded signals which are provided to external transmitter unit 1206 via cable 1218 . internal components 1244 comprise an internal receiver unit 1212 , a stimulator unit 1226 , and a moving electromechanical actuator 1210 according to a preferred embodiment of the present invention . internal receiver unit 1212 , which comprises an internal transcutaneous transfer coil 1224 , and stimulator unit 1226 are hermetically sealed within a housing 1228 . collectively , transmitter antenna coil 1208 and receiver antenna coil 1224 form an inductively - coupled coil system used to transfer data and power via a radio frequency ( rf ) link 114 . a cable 1230 extends from stimulator unit 1226 to actuator 1210 . actuator 1210 is coupled to the inner ear fluids via artificial incus 8 extending through a cochleostomy . signals generated by stimulator unit 1226 are applied by mechanical actuator 1210 to inner ear fluids . it should be appreciated that the arrangement shown in fig1 is a schematic representation only , and that embodiments of the electromechanical actuator 1210 of the present invention may be positioned in a variety of locations to provide the desired stimulative effect . for example , in the embodiment shown in fig1 , actuator 1210 is coupled to the inner ear fluids via artificial incus 8 . however , a variety of stapes prostheses may be attached to artificial incus 8 in alternative embodiments , as described above . it should also be appreciated that electromechanical actuator 1210 may be secured to the recipient utilizing a variety of techniques now or later developed . in one embodiment , electromechanical actuator 1210 is configured to be implanted in a recipient utilizing an embodiment of a fixation system described in commonly owned u . s . provisional patent application no . 60 / 631 , 512 entitled “ implantable fixation system for anchorage of medical devices ,” filed 30 nov . 2004 , which is hereby incorporated by reference herein in its entirety . a brief consideration of the above described embodiments will indicate that the invention may be employed to remedy any source of conductive hearing loss . additionally , these embodiments of the electromechanical actuator may be configured to provide sufficiently high output levels to treat severe sensorineural hearing loss while being sufficiently small to completely fit into a human mastoid . it should also be appreciated that cochlear ™ implant system 1200 described above is just one exemplary system in which the electromechanical actuator of the present invention may be implemented . the electromechanical actuator of the present invention may be implemented in a myriad of embodiments of a cochlear implant system , hearing aid or other medical devices or systems now or later developed . advantageously , the dimensions and shape of embodiments of the electromechanical actuator of the present invention may be selected to take into account the anatomy of the implantation site . for example , for an actuator that is to be placed in a hole drilled into the human mastoid , an elongated cylindrical shape such as that described above has been found to be advantageous . in addition , in the above or other application , embodiments of the actuator may have a diameter and a length which are sufficiently small to allow placement of the actuator in narrow anatomical locations as required . a further advantage of embodiments of the present invention directed to hearing aid devices is that they are able to deliver sufficiently high output levels to manage progressive hearing loss in order to prevent revision surgeries . a still further advantage is that certain embodiments of the actuator are highly energy efficient thereby minimizing power consumption and facilitating autonomy . although a preferred embodiment of the method and system of the present invention has been described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiment disclosed , but is capable of numerous rearrangements , modifications and substitutions without departing from the scope of the invention as set forth and defined by the following claims . it will be understood that the term “ comprise ” and any of its derivatives ( eg . comprises , comprising ) as used in this specification is to be taken to be inclusive of features to which it refers , and is not meant to exclude the presence of any additional features unless otherwise stated or implied .

US-201514711315-A

a medical guidewire system for guiding thereon a medical implement includes an end effector , an actuation guidewire having a distal end permanently connected to the end effector , and a control assembly . the assembly has a handle , a shaft receiving the guidewire . the shaft has a proximal end permanently connected to the handle and a distal end temporarily connected to the end effector . a first actuator is movably connected to the handle and operatively connected to the guidewire to actuate the end effector . a second actuator is movably connected to the handle and operatively connected to a portion of the guidewire to disconnect the guidewire from the handle when actuated and , thereby , permit removal of the control assembly from the end effector and guidewire . when the control assembly is removed , the end effector and the guidewire form a surgical exchange or guidewire for guiding thereon the medical implement .

aspects of the invention are disclosed in the following description and related drawings directed to specific embodiments of the invention . alternate embodiments may be devised without departing from the spirit or the scope of the invention . additionally , well - known elements of exemplary embodiments of the invention will not be described in detail or will be omitted so as not to obscure the relevant details of the invention . before the present invention is disclosed and described , it is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting . it must be noted that , as used in the specification and the appended claims , the singular forms “ a ,” “ an ,” and “ the ” include plural references unless the context clearly dictates otherwise . while the specification concludes with claims defining the features of the invention that are regarded as novel , it is believed that the invention will be better understood from a consideration of the following description in conjunction with the drawing figures , in which like reference numerals are carried forward . the figures of the drawings are not drawn to scale . further , it is noted that the figures have been created using a computer - aided design computer program . this program at times removes certain structural lines and / or surfaces when switching from a shaded or colored view to a wireframe view . accordingly , the views should be considered as only illustrative . referring now to the figures of the drawings in detail and first , particularly to fig1 thereof , there is shown a first exemplary embodiment of a medical device handle 1 according to the invention . the present application applies the medical device handle to a blunt dissection device for ease of understanding only . the invention is not limited to such dissection devices and can be applied to any medical device that has an end effector operated by a single actuation wire or an end effector operated by a single actuation wire and co - axially guided by an integrated guidewire . the device handle 1 of fig1 to 2 includes a body casing 10 , a purge valve 20 , a trigger link 30 , a trigger 40 , a rotating distal nose 50 , a nose lock - out assembly 60 , and an actuation wire 70 ( which is surrounded by a coil 220 , an outer sheath 222 , a strain relief portion 224 , and , possibly , an inner sheath 210 , the combination of which is only illustrated diagrammatically by dashed lines in fig1 ). it is noted that a lubricious coating on the actuation wire 70 , such as teflon ptfe , can be used to perform the same function as the inner sheath 210 . the coil can be made from , for example , stainless steel , and the sheath can be made from , for example , fluoropolymers , polyolefins ( e . g ., ptfe , hdpe , or fep ). the strain relief can be made from , for example , a heat - shrinkable material such as polyurethane or polyolefin . in the exemplary embodiment of the body casing 10 shown , there are two halves 12 , 13 , the right half 12 only being illustrated in fig2 . the halves 12 , 13 can be connected together in any manner , such as through solvent bonding , crush welding , and screws , to name a few . an alternative configuration to the handle 1 of fig1 to 2 is the configuration shown in fig3 to 12 and 27 to 31 , fig2 can also be used with reference to this second configuration . this second handle 100 also has a body casing 110 , a purge valve 120 , a trigger link 130 , a trigger 140 , a rotating distal nose 150 , a nose lock - out assembly 160 , and an actuation wire 170 . the handle 100 further has an integral guidewire assembly 180 . with such an assembly 180 , a guidewire 182 can be inserted through a fluid - tight port 184 ( e . g ., a touhy - borst connector ) in a portion of the handle 100 ( without compromising the interior filled with saline , for example ) and can exit from a distal end of the device 100 where an end effector 200 , for example , is located . as will be described in detail below , the rotating nose 50 , 150 is decoupled from the handle body 10 , 110 and , therefore , the guidewire assembly 180 is connected to the nose 150 and not to the handle body 110 . the progression of fig3 to 11 illustrates a rotating distal nose 150 that includes this guidewire assembly 180 . the cross - section of fig2 to 2 illustrates the interior fluid passage of the purge valve 20 , 120 . the upstream portion 22 , 122 of the valve 20 , 120 extending transverse to the longitudinal axis of the casing 10 , 110 can be a standard medical female luer fitting , as illustrated . the downstream portion — valve body 24 , 124 — is contained within a valve chamber 14 , 114 of the body casing 10 , 110 . the valve body 24 , 124 has a longitudinal fluid cavity 242 , 1242 through which projects the actuation wire 170 and a transverse fluid cavity 244 , 1244 fluidically connected to the longitudinal fluid cavity 242 , 1242 . it is noted that some of the figures of the drawings illustrate the actuation wire 70 , 170 not centered at various portions of the handle . it is to be understood that the actuation wire 70 , 170 is centrally disposed and aligned within the cavities of the handle and shaft and any figures illustrating an offset of the actuation wire should be deemed merely as an approximation of the device . when the upstream portion 22 , 122 of the purge valve 20 , 120 is fluid - tightly connected to the valve body 24 , 124 , the fluid passage 222 , 1222 is in fluidic communication with the transverse fluid cavity 244 , 1244 ( in this embodiment , the two passages 222 , 1222 and 244 , 1244 are coaxial ). therefore , when fluid ( such as saline ) is injected into the upstream port 224 , 1224 of this configuration , it passes therethrough and , then , through the transverse fluid cavity 244 , 1244 and the longitudinal fluid cavity 242 , 1242 , respectively . to prevent such fluid from passing anywhere proximal of the valve body 24 , 124 ( with respect to the longitudinal axis of the handle 1 , 100 ): a seal disk 72 , 172 is disposed at the proximal inside of the valve body 24 , 124 and fluid tightly seals the space between the guidewire 70 , 170 and walls of the longitudinal fluid cavity 242 , 1242 . the seal disk 72 , 172 can be made of , for example , a silicone rubber disk that is held in place with a seal cap 73 , 173 ; and an o - ring 74 , 174 is disposed at the distal outside of the valve body 24 , 124 and fluid tightly seals the space between the exterior surface of the valve body 24 , 124 and the interior surface of a rear chamber of the nose 50 , 150 , which is rotatably disposed within the valve chamber 14 , 114 . the o - ring 74 , 174 can be made of , for example , silicone rubber . in this way , any injectate entering the upstream opening of the upstream portion 22 , 122 travels out the distal opening 52 , 152 of the nose 50 , 150 and along the actuation wire 70 , 170 ( which is sealed within the coil 220 and the outer sheath 222 shown only diagrammatically with dashed lines in fig1 ) until the fluid exits at the end effector 200 . fig2 illustrates the interior of the device handle 1 with the left half 13 removed to permit view of the rotational and fluid - tight connection between the nose 50 , 150 and the valve body 24 , 124 and body casing 10 , 110 . the valve chamber 14 , 114 is cylindrical . the o - ring 74 , 174 is circular and , when installed within an o - ring groove 246 , 1246 , projects sufficiently far outside the groove 246 , 1246 to fluid - tightly seal the interposed space between the outside of the valve body 24 , 124 and the interior circular proximal chamber 54 , 154 of the nose 50 , 150 , but not too far such that it presses the proximal end of the nose 50 , 150 against the interior of the distal portion of the valve chamber 14 , 114 that holds the nose 50 , 150 therein . more specifically , the proximal end of the nose 50 , 150 forms a circular tongue 56 , 156 that fits , rotatably , within a circular - disc - shaped hollow groove 126 , 1126 within the distal interior of the valve chamber 14 , 114 . also provided on the proximal - most end of the nose 50 , 150 is a castellated ring 59 , 159 , which is apparent in fig3 , for example . as will be discussed in detail below , the spaces between the castellations are used as a keyhole for receiving a locking tab 68 , 168 that prevents the nose 50 , 150 from rotating about its axis when the locking tab 68 , 168 is positioned in one of the spaces between two castellations . as will be described in further detail below , the end effector 200 , the actuation wire 70 , 170 , the outer sheath 222 and the coil 220 surrounding the actuation wire 70 , 170 are desired to turn together as one . when the sheath 222 and coil 220 are fastened to the nose 50 , 150 , for example , by bonding , these features will turn with the nose 50 , 150 directly . the actuation wire 70 , 170 and the inner sheath 210 , however , are not coupled to either the nose 50 , 150 , the outer sheath 222 , or the coil 220 because longitudinal uncoupling must be ensured to permit longitudinal movement of the actuation wire 70 , 170 for end effector actuation . to effect such a rotational coupling but provide the longitudinal uncoupling , a first embodiment of a torque couple is provided and is illustrated in fig2 and , especially , in fig6 to 8 . more specifically , a torque puck 76 , 176 ( see fig1 ) is fastened to the actuation wire 70 , 170 so that it rotates with the actuation wire 70 , 170 and vice - versa — rotation of the puck 76 , 176 causes rotation of the actuation wire 70 , 170 . in the exemplary embodiment , the puck 76 , 176 has a rectangular cross - section . a torque groove 58 , 158 within the nose 50 , 150 has a corresponding shape but is slightly larger than the puck 76 , 176 so that longitudinal movement of the puck 76 , 176 within the groove 58 , 58 is unhindered by the nose 50 , 150 . in such a configuration , when the nose 50 , 150 is rotated with respect to the actuation wire 70 , 170 , the inside surfaces of the torque groove 58 , 158 act against the puck 76 , 176 to rotate the puck 76 , 176 along with the nose 50 , 150 . an alternative embodiment of this connection is illustrated and described below with respect to fig1 to 19 . fig1 illustrates the separation of the guidewire 182 and the actuation wire 170 within the guidewire assembly 180 and the rotating nose 150 . as can be seen in the progression of fig3 to 8 , the guidewire 182 and the actuation wire 170 remain separate and traverse through separate passages at an angle to one another . fig1 to 11 show that these two wires 170 , 182 become parallel and enter a two - lumen tube 190 before exiting the distal opening 152 of the nose 150 . fig9 clearly shows that the two - lumen tube 190 begins at a point at an angle to the actuation wire 70 , 170 and fig1 specifically illustrates the tube 190 extending along the guidewire 182 over a distance that does not include the actuation wire 170 . there are various ways to permit the actuation wire 170 to enter the second of the two lumens at a point distal of the proximal opening 192 . one such configuration creates a hole slightly larger than the actuation wire 170 at an entry point 194 shown in fig1 . another such configuration cuts a groove between the second lumen and the outer circumference of the two - lumen tube 190 from the proximal opening 192 all the way to the entry point 194 . the latter configuration is easier to manufacture because the portion of the second lumen that is peeled open can act as a guiding groove through which the actuation wire 170 can be threaded . fig1 to 15 illustrate the movement of the trigger 40 , 140 to cause proximal movement of the actuation wire 70 , 170 in both of the handle configurations 1 , 100 . as can be seen in these figures and in fig1 to 17 , the trigger 40 , 140 is associated with a nose lock - out assembly 60 , 160 at the pivot point of the trigger 40 , 140 . it is noted that the pivot pin attaching the trigger link 30 , 130 to the trigger piston 34 , 134 is not illustrated in fig1 to 15 . fig1 illustrates the trigger 40 , 140 in the opened position . this opened position is ensured and maintained when the trigger 40 , 140 is not actuated by the presence of a trigger biasing device 32 , 132 . in the exemplary embodiment shown , this biasing device 32 , 132 is a compression spring that is pre - biased in compression and exerts a distally directed force against a trigger piston 34 , 134 that is pivotally connected to the proximal end of the trigger link 30 , 130 . thus , to depress the trigger 40 , 140 , the prebiasing force of the spring 32 , 132 must be overcome by the user . the proximal end of the trigger link 30 , 130 is pivotally connected to the proximal end of the trigger piston 34 , 134 and the distal end of the trigger link 30 , 130 is pivotally connected to the end of the trigger 40 , 140 opposite the pivot point of the trigger 40 , 140 . thus , depression of the trigger 40 , 140 causes the cylindrical trigger piston 34 , 134 to move proximally within the correspondingly cylindrical piston chamber 16 , 116 and , when longitudinally connected to the actuation wire 70 , 170 , to actuate the actuation wire 70 , 170 by moving it in the proximal direction . it is noted that the described configuration provides a trigger that applies a non - linear force to the trigger piston 34 , 134 . in other words , the squeeze lever linkage provides a non - linear , increasing mechanical advantage as the lever 40 , 140 is squeezed by the user . as can be seen in fig1 to 15 , the link between the actuation wire 70 , 170 and the trigger piston 34 , 134 is not direct . instead , as mentioned above , the actuation wire 70 , 170 is rotationally disconnected from the actuation wire 70 , 170 . in handles such as the devices 1 , 100 of the present invention , it is desirable to rotate the end effector 200 without rotating the handle body casing 10 , 110 . thus , the rotating nose 50 , 150 is provided . also provided for this particular connection is a slider 36 , 136 that is similarly cylindrical and slides within the piston chamber 16 , 116 longitudinally . the slider 36 , 136 is rotationally and longitudinally fastened to the actuation wire 70 , 170 by , for example , a set screw that presses against the actuation wire 70 , 170 when thread through a central bore of the slider 36 , 136 . in such a configuration , both the slider 36 , 136 and the actuation wire 70 , 170 remain centered within the piston chamber 16 , 116 but still longitudinally and rotationally movable therein . the proximal end of the slider 36 , 136 and the distal end of the trigger piston 34 , 134 form the longitudinally fixed but rotationally free connection between the piston 34 , 134 and the actuation wire 70 , 170 . however , as is apparent from the progression of fig1 to 14 , there exists a space ( or play ) 38 , 138 preventing movement of the slider 36 , 136 for a short distance when the trigger 40 , 140 is first depressed . this connection can be embodied in any way to carry out the function . the connection is illustrated in an exemplary embodiment in the figures of the drawings as a u - shaped fork extending distally with tines pointing downwards ( as viewed in the figures ) from the distal end of the trigger piston 34 , 134 around a mushroom - shaped boss extending proximally from the proximal end of the slider 36 , 136 . ( see , in particular , the cross - section of fig1 .) with the inside diameter of the fork being slightly larger than the outer diameter of the mushroom shaft , the slider 36 , 136 can rotate freely within the tines of the fork but remains longitudinally connected after the piston closes the space 38 , 138 . the space 38 , 138 is provided to assist the nose lock - out assembly 60 , 160 . while the assembly 60 , 160 is apparent in fig1 , it is highlighted in the enlarged views shown in fig1 to 17 . the lock - out assembly 60 , 160 includes a pivoting key 62 , 162 that rotates about the same pivot axis as the trigger 40 , 140 but is not rotationally fixed with respect to the trigger 40 , 140 . the key 62 , 162 has a tab that is connected to one end of a bias device 64 , 164 ( a tension spring in the illustrated exemplary embodiment ) and the other end of the bias device 64 , 164 is connected to a boss 38 , 138 on the inside of the trigger 40 , 140 . in such a configuration , the key 62 , 162 is biased to rotate in a clockwise direction with respect to fig1 to 17 . a key stop 66 , 166 is positioned on the inside of the trigger 40 , 140 to prevent the key from so rotating when the trigger 40 , 140 is in the open ( rest ) position ( shown , for example , in fig1 ). thus , when the trigger 40 , 140 is unactuated , the nose 50 , 150 can rotate freely . the key 62 , 162 also has a locking tab 68 , 168 that performs a locking function when inserted in between the castellations of the castellated ring 59 , 159 . the key 62 , 162 is positioned next to the castellated ring 59 , 159 so that the initial depression of the trigger 40 , 140 will allow the key 62 , 162 to rotate about its axis and press the locking tab 68 , 168 against the castellated ring 59 , 159 . if one of the spaces between the castellations happens to be resting in line with the locking tab 68 , 168 so that the tab 68 , 168 enters the space , the locking assembly 60 , 160 will have performed its locking function and prevent any rotation of the nose 50 , 150 while the actuation wire 70 , 170 is moved . alternatively , if no space between the castellations is in line with the locking tab 68 , 168 , the clockwise force acting upon the key 62 , 162 remains throughout the time of trigger stroke ; thus , any small rotation of the nose 50 , 150 in either direction when the trigger 40 , 140 is depressed will force the locking tab 68 , 168 to enter the space most adjacent to the locking tab 68 , 168 . as such , the lock - out assembly 60 , 160 prevents any rotation of the nose 50 , 150 when the end effector 200 is being actuated or only allows a small amount of rotation of the nose 50 , 150 — the amount being insignificant to adversely affect the procedure that is being carried out by the end effector 200 . selection of the castellation size and , therefore , the spacing between the spaces , will determine the permitted rotation of the nose 50 , 150 when the trigger 40 , 140 is depressed . the illustrated embodiment of eight spaces is only exemplary and can be any desired amount . in this embodiment , the centerpoints of adjacent spaces are 45 degrees apart from one another . assuming that the width of the locking tab 68 , 168 is substantially equal to the width of the spaces , the most that the nose 50 , 150 could rotate if the locking tab 68 , 168 was not within a space is , therefore , less than 45 degrees . the locking tab 68 , 168 is , however , envisioned to be substantially thinner than the width of the spaces between the castellations . therefore , the amount of possible nose rotation when the trigger 40 , 140 is depressed is substantially less than 45 degrees in an 8 - space castellated embodiment . the longitudinal space 38 , 138 between the fork of the trigger piston 134 and the mushroom boss of the slider 36 , 136 is sized to be greater than the initial depression of the trigger 40 , 140 sufficient to move the locking tab 68 , 168 into its locking position before the actuation wire 70 , 170 moves longitudinally in any amount . fig1 and illustrates the trigger 40 , 140 in the open ( rest ) position and the key stop 66 , 166 preventing clockwise movement of the key 62 , 162 . in comparison , fig1 illustrates the trigger in the fully depressed position so that the key 62 , 162 is in the orientation where it is pressing against the castellated ring 159 and is ready to enter any one of the two adjacent spaces when the nose 50 , 150 is rotated in either direction . fig1 to 19 illustrate a second exemplary embodiment of the connection and rotational coupling features of the actuation wire 70 , 170 . here , the torque puck 76 , 176 is replaced by a bend 78 , 178 in the actuation wire 70 , 170 . the height of the torque groove 58 , 158 is dependent upon the transverse height of the bend 78 , 178 and is sized to be larger than this transverse height so that there is no or no significant friction between the bend 78 , 178 and the torque groove 58 , 158 . in such a configuration , as the wire 70 , 170 is rotated , the nose 50 , 150 will rotate and , conversely , as the nose 50 , 150 is rotated , the wire 70 , 170 rotates correspondingly . fig1 to 18 also reveal a second exemplary embodiment of the connection between the proximal end of actuation wire 70 , 170 and the slider 36 , 136 . a tab 362 , 1362 with a through - bore is disposed on the distal end of the slider 36 , 136 to receive a z - bend of the proximal end of the actuation wire 70 , 170 . in this embodiment , the freely rotating slider 36 , 136 can be connected to the actuation wire 70 , 170 in a rotatingly fixed manner without impairing the rotatability of the slider 36 , 136 . the progression of fig1 to 19 shows the trigger 40 , 140 in its two extreme positions : open / unactuated ( fig1 ) and closed / fully actuated ( fig1 ). like fig1 , fig1 shows the key 62 , 162 in the locked orientation but not in one of the spaces of the castellated ring 59 , 159 ; a small rotation of the nose 50 , 150 will cause the key 62 , 162 to drop into one of the two adjacent spaces . fig2 illustrates the sub - assembly associated with the nose 50 , 150 and a diagrammatic illustration of an end effector 200 . fig2 to 26 illustrate a first exemplary embodiment of an end effector 300 . attachment of this end effector 300 to the handle 1 , 100 of the present invention is illustrated in fig2 . as can be seen therein , the actuation wire 70 , 170 tapers from a relatively thicker diameter proximally to a relatively thinner diameter distally . this taper can begin and end at any point along the actuation wire 70 , 170 . having a thinner diameter at the distal end near the end effector 200 allows the area of thinness to be more flexible . having the thinner diameter throughout most of the shaft length up to the end effector 200 increases the torqueability of the end effector 200 with respect to the handle 1 , 100 . also visible in fig2 is an inner sheath 210 disposed between the actuation wire 70 , 170 and the coil 220 . the inner sheath 210 can be provided to reduce or limit the friction that could be caused by rubbing against the interior of the coil 220 . as such , the inner sheath 210 is made from a friction reducing material , such as teflon ® or ptfe . the outer sheath 222 is illustrated diagrammatically by dashed lines in fig2 . this outer sheath 222 is made of a material such as polyurethane or pebax ™. fig2 shows the entire end effector 300 having a clevis 310 , a clevis pivot pin 320 , and two jaws 330 . the hidden line view of fig2 shows the actuator cam 340 and one of two cam pins 342 , each of which slides respectively within a cam surface 332 of one of the jaws 330 , the cam surface 332 being a curved groove in the tang 334 of each jaw 330 . the view of fig2 shows the jaws 330 in an open position with the cam pin 342 at the other extreme of the cam surface 332 . the cross - sectional views of fig2 to 26 reveals other features of the actuator cam 340 . for example , the actuator cam 340 has a cam surface 342 in the shape of a linear longitudinal groove surrounding the clevis pivot pin 320 that causes the jaws 330 to open when the actuator cam 340 is moved in a proximal direction and to close when the actuator cam 340 is moved in a distal direction . fig2 to 31 illustrate a second exemplary embodiment of an end effector 400 that is used with the guidewire 182 . attachment of this end effector 400 to the handle 1 , 100 of the present invention can be similar to that illustrated in fig2 . fig2 shows the entirety of the end effector 400 , which includes a clevis 410 , a clevis pivot pin 420 , and two jaws 430 . the view of fig2 shows the actuator cam 440 and one of two cam pins 444 ( the lower cam pin 444 is not illustrated ). as illustrated in fig3 , each of the cam pins 444 slides respectively within a cam surface 432 of one of the jaws 430 . the cam surface 432 is , in this exemplary embodiment , a linear groove in the tang 434 of each jaw 430 . the groove is disposed at an angle to the axis of the actuation wire 70 , 170 so that travel of the pin 444 within the cam surface 432 causes the respective jaw to pivot out of alignment with the axis of the end effector 400 ( i . e ., opening of the jaw ). the view of fig2 shows the jaws 430 in this open position . the cross - sectional views of fig2 to 30 reveal other features of the actuator cam 440 . for example , the actuator cam 440 includes a cam surface 442 shaped as a linear longitudinal groove in which is disposed the circular clevis pivot pin 420 . the actuator cam 440 also includes a cam pin 444 for each of the jaws 430 , which pin 444 travels within the cam surface 432 of the respective jaw 430 . this configuration of cam pins and surfaces in the jaws 430 and the actuator cam 440 allow the jaws 430 to open when the actuator cam 440 is moved in a proximal direction and to close when the actuator cam 440 is moved in a distal direction ( the distal - most position of the cam 440 being shown in fig2 to 30 ). in this second embodiment , the jaws 430 each define one half of a guidewire recess 450 . because both the actuation wire 70 , 170 and the guidewire 182 are parallel within the two - lumen tube 90 , 190 , neither of the wires are centrally disposed within the two - lumen tube 90 , 190 ( although one can be if desired ). accordingly , the guidewire recess 450 is not aligned with the central axis of the end effector 400 . the two lumens 92 , 94 for receiving , respectively , the guidewire 182 and the actuation wire 70 , 170 are apparent in fig2 and 31 . in some applications , it is desirable to eliminate the need of threading a guidewire to the site at which the end effector is to be applied in addition to having the shaft ( e . g ., two - lumen tube 190 , inner sheath 210 , coil 220 , outer sheath 222 ) of the actuation device at the operation site . if the end effector 200 is already at the site , it is desirable to keep the end effector 200 in place and to use that placement , along with a portion of the shaft of the device , to guide separate devices to the site with the shaft portion serving as the guidewire or exchange wire . the present invention provides various alternatives for removably fixing the end effector 200 to the distal end of the device . an exemplary embodiment for disengaging the end effector 200 , 300 , 400 , 500 from the distal end of the shaft has the actuation wire 70 , 170 continues toward ( or even out of ) the proximal end 18 , 118 of the body casing 10 , 110 . in a configuration where the proximal end of wire 70 , 170 is contained entirely within the handle , the wire 70 , 170 wraps around a boss in the body casing 10 , 110 in a 180 degree bend to form a proximally extending portion 71 , 171 . in a configuration where the wire 70 , 170 exits the proximal end of the body casing 10 , 100 , then the wire 70 , 170 is looped 180 degrees so that a user can place a hand or finger within the center of the loop . the wire 71 , 171 , then , continues back in the distal direction all the way through the handle and the shaft until it makes contact with the clevis 310 , 410 of the end effector 200 , 300 , 400 , 500 as shown in fig3 . contact with the clevis 310 , 410 is removable and removal can be effected by applying a proximally directed force to the proximally extending portion 71 , 171 sufficient to break the contact . the portion of the wire 71 , 171 adjacent a distal portion 312 , 412 of the clevis 310 , 410 is narrowed considerably as compared to the width of the actuation wire 70 , 170 . as such , when the proximally directed force is applied , the break - away portion 71 , 170 is broken instead of the actuation portion 70 , 170 . the break - away portion 71 , 171 is , then , removed entirely from the shaft and the handle 1 , 100 . because the tension of the folded wire 70 , 71 , 170 , 171 holding the clevis 310 , 410 inside the distal end of the shaft is no longer present , the shaft and handle 1 , 100 can be entirely removed from the connected end effector 200 and actuation wire 70 , 170 . the length of the actuation wire 70 , 71 , 170 , 171 can , now , be used as a guidewire or exchange wire for conducting procedures at the operation site . in the internal loop embodiment , a lever or other mechanical device is connected to the boss and , when breaking of the connection is desired , the lever is moved to place a proximally directed force on the wire 70 , 71 , 170 , 171 and break the contact at the reduced diameter portion 71 , 171 . in the external loop embodiment , the user places a finger or hand inside the loop and pulls proximally . this force breaks the contact at the reduced diameter portion 71 , 171 . fig3 to 42 illustrate a second exemplary embodiment for disengaging the end effector 500 from the distal end of the shaft . some of the features of this embodiment are similar to the end effector 300 described above . therefore , the description of similar features will not be repeated for the sake of brevity . fig3 shows the end effector 500 with a clevis 510 , a clevis pivot pin 520 , and two jaws 530 . each of the jaws 530 has an l - shaped cam surface 532 within its tang 534 for receiving therein a cam pin 544 . the distal portion of the cam surface 532 is similar to the cam surface 532 and is utilized for opening and closing the jaws 530 . the proximal portion of the cam surface 532 is added and used for separating the end effector 500 from the shaft , as will be described in further detail below . the actuator cam 540 in this embodiment has , at its proximal end , a hollow fracture piston 550 that surrounds the actuation wire 70 , 170 . as can be seen best in fig4 , protruding from the proximal end of the clevis 510 is a cylindrical , hollow barb 512 . a cylindrical hollow fracture tube 560 has an interior cylindrical cavity 562 shaped to fit snugly therein the barb 512 . a frangible portion 564 protrudes inwardly from an intermediate location of the interior cylindrical cavity 562 . when the fracture tube 560 is at its distal - most position surrounding the barb 512 , as shown in fig3 to 36 , and most particularly in fig3 , the frangible portion 564 is in line with and protrudes into a groove 514 located between the barb head 516 and barb shaft 518 . fig3 illustrates the orientation of the fracture piston 550 when the jaws 530 are in the closed position of the end effector 500 and fig3 to 37 illustrate the orientation of the fracture piston 550 when the jaws 530 are in the open position of the end effector 500 . in the open position illustrated in fig3 to 37 , the location of the cam pin 544 corresponds to the jaws - open position within the l - shaped cam surface 532 . in this position , the cam pin 544 rests at the angle / middle point of the cam surface 532 . the clevis 510 is removed in fig3 to better reveal the features of the jaws 530 and the actuator cam 540 disposed therein . the fracture tube 560 is removed in fig3 to better reveal the features of the fracture piston 550 and its spring catch 552 . fig3 shows the alignment of the features of the fracture tube 560 , the fracture piston 550 before the proximal end of the fracture piston 550 hits the proximal transverse wall 566 , which is the stop limit for proximal movement of the fracture piston 550 within the fracture tube 560 . the proximal transverse wall 566 is best illustrated in fig4 . removal of the end effector 500 will be described with primary reference to fig3 to 42 . when the user desires to remove the end effector 500 from the distal end of the shaft , a proximally directed force will be imparted on the actuation wire 70 , 170 to move the actuation wire 70 , 170 further than the position it would be in when the jaws 530 are in the open position , shown in fig3 to 37 . one exemplary embodiment for so moving the actuation wire 70 , 170 can be a pivoting lever 600 ( see fig2 ) that is attached to the trigger piston 34 , 134 to move the trigger piston 34 , 134 against the bias of the spring 32 , 132 further proximal in the handle than the proximal - most position of the piston 34 , 134 ( when the trigger 40 , 140 is fully depressed as shown , for example , in fig1 ). another embodiment can be a screw 700 ( see fig1 ) threaded into the proximal end of the trigger piston 34 , 134 that is screwed to , thereby , move the trigger piston 34 , 134 in a similar proximal manner . in any configuration , the actuation wire 70 , 170 is caused to move the proximal transverse wall 554 of the fracture piston 550 against the proximal transverse wall 566 inside the cavity 562 of the fracture tube 560 and further than the location of the proximal transverse wall 566 shown in fig3 to 36 and 38 . when the fracture piston 550 bottoms out against the proximal transverse wall 566 of the fracture tube 560 , a significant proximally directed force is imparted on the fracture tube 560 . as shown in fig3 in highlighted cross - section , the only feature preventing the fracture tube 560 from moving in the proximal direction is the frangible portion 564 . because the removal force is significantly greater than the shear strength of the frangible portion 564 , the frangible portion 564 shears off from the fracture tube and is left within the barb groove 514 as the remainder of the fracture tube 560 moves proximally . fig3 illustrates the fracture tube 560 as the frangible portion is being sheared off and fig4 to 41 illustrate the fracture tube 560 after the frangible portion is sheared off and is being removed from the barb 512 into the inside of the coil 220 . it is noted at this point that the fracture tube 560 is no longer attached to the clevis 510 or to the shaft . being in this unattached state , it is possible for the fracture tube 560 to impermissibly drop into the volume of the operation site of the end effector 500 . to prevent this occurrence , the outer diameter of the fracture tube 560 is selected to be slightly larger than the inner diameter of the coil 220 . because the fracture tube 560 is made of a material that is significantly softer than the coil 200 , and due to the fact that the proximal removal force is sufficient to deform the outer surface of the fracture tube 560 , the removal force creates an interference fit between the coil 220 and the fracture tube 560 sufficient to ensure that the fracture tube 560 is retained within the coil 220 . at this point , the handle 1 , 100 and the shaft , along with the fracture tube 560 , can be removed from the end effector 500 that is longitudinally fixed to the actuation wire 70 , 170 . in such a state , the actuation wire 70 , 170 becomes a guidewire that can be used to guide ( from the proximal end thereof ) other devices along the actuation wire 70 , 170 up to the end effector 500 . fig4 illustrates the fracture tube 560 in a position proximal of the barb 512 and with the frangible portion 564 sheared off ( indicated by cross - section lines ). once the distal edge of the spring catch 552 passes the proximal - most exterior surface of the barb 512 , as shown in fig4 to 41 , the spring catch 552 springs outward to prevent any later distal movement of the fracture piston 550 into the clevis 510 . the foregoing description and accompanying drawings illustrate the principles , preferred embodiments and modes of operation of the invention . however , the invention should not be construed as being limited to the particular embodiments discussed above . additional variations of the embodiments discussed above will be appreciated by those skilled in the art . therefore , the above - described embodiments should be regarded as illustrative rather than restrictive . accordingly , it should be appreciated that variations to those embodiments can be made by those skilled in the art without departing from the scope of the invention as defined by the following claims .

US-63732906-A

an apparatus that is particularly useful in a hospital environment when cleaning bedpans and other objects which contain potentially dangerous materials . the apparatus comprises a generally transparent member that is provided with one or more openings for a person &# 39 ; s arms , and means for mounting the member so as to locate the transparent member between the basin of the cleaning station and the person .

while this invention is susceptible of embodiment in many different forms , there is shown in the drawings and will herein be described in detail several preferred embodiments of the invention . it should be understood , however , that the present disclosure is to be considered as exemplifications of the principles of the invention , and is not intended to limit the invention to the specific embodiments illustrated . turning to fig1 there is illustrated a typical hospital cleaning station 10 of the type often used for cleaning bedpans and similar objects . specifically , the cleaning station 10 comprises a tub - like basin 12 which is located adjacent to one or more walls 14 and 16 , and a floor 18 . the basin 12 may be floor mounted or wall mounted . in some hospitals , the basin 12 resembles a large commode , often referred to as a &# 34 ; hopper &# 34 ;. the basin 12 of the cleaning station 10 is often the bowl of a commode . in either situation , a source of water 20 is provided to facilitate rinsing and cleaning of objects placed above or within the interior 22 of the basin 12 . for example , in the case of a basin 12 formed from the bowl of a commode , the water source comprises a pivotally mounted arm 24 which is joined to a shower - like nozzle 26 . the arm 24 is pivotally mounted at one end 25 to a wall 16 and comprises a pipe which supplies water to the nozzle 26 . the pipe - like arm is disposed generally upwardly and in a vertical position when it is not in use . when used for cleaning , the arm 24 is moved ( see arrow 27 ) generally horizontal and downwardly toward the interior 22 of the basin 12 . valves 28 and 30 provide cold and hot water to the nozzle head 26 to facilitate cleaning and rinsing . fig1 illustrates a basic embodiment of the apparatus that forms the present invention . specifically , the invention comprises a generally transparent member 32 which is hingedly mounted to an adjacent wall 14 . the member 32 may be formed from a strong plastic , such as lexon . the member 32 is shown to be generally rectangular in shape and is disposed generally vertically in front of the basin 12 . in this particular embodiment , the member 32 is hingedly mounted by a pair of hinges 34 and 36 to a short partial extension 38 of the adjacent left wall 14 . the transparent member 32 is provided with two hand - holes or apertures 40l and 40r . these apertures are shown to be generally rectangular in shape ; however , they may be of any convenient shape . the apertures 40r and 40l should be sufficiently large so that a user &# 39 ; s arms 90 may be inserted therein ( see fig . ia ). the apertures should be sufficiently vertically spaced and laterally separated that both arms 90 can pass through , and at least one arm can be placed close to the interior 22 of the basin 12 . preferably , the transparent member 32 is located sufficiently close to the source of water 20 , that the valves 28 and 30 and the pivotally mounted arm 24 can be easily manipulated by at least one hand . the lower edge 42 of the transparent member is preferably sufficiently low that it extends below the upper edge 44 of the basin 12 . preferably , the upper edge 46 of the transparent member 32 is sufficiently high to cover the top of the user &# 39 ; s head 92 when the user &# 39 ; s arms 90 are extended through the apertures 40r and 40l . hinges 34 and 36 allow the transparent member 32 to be swung ( see arrow 37 ) from an &# 34 ; operational &# 34 ; position adjacent the front of the basin 12 to a &# 34 ; stowed &# 34 ; position wherein the member is positioned away from the front of the basin . this allows the basin 12 to be used for other purposes and to be easily serviced or cleaned . fig2 a is a plane view of another embodiment of the invention . in this particular embodiment , the transparent member 32 &# 39 ; has a left - hand aperture 40l which is located completely interior of the member , and a right - hand , three - sided aperture or recess 40r &# 39 ; which is located along the right - hand edge 48 of the member . depending upon the location of the basin 12 relative to the surrounding walls 14 and 16 , it may be convenient , in some situations , to provide access to the basin by allowing one arm ( i . e ., the right arm according to orientation of fig2 ), to reach around the transparent member 32 &# 39 ;, rather than reaching through it . fig2 b illustrates an embodiment having a rounded top edge 46 . other shapes may be used and may be especially advantageous considering the wide variety of cleaning stations in which the invention may be used . fig3 illustrates still another embodiment of the present invention . in this embodiment of the invention , the transparent member 52 is mounted or attached below the pipe arm 24 . the transparent member has two apertures 60l and 60r through which the user &# 39 ; s arms may be inserted . another aperture 60c is provided at the interior of the transparent member 52 , such that the nozzle 26 can pass through the transparent member ( see fig3 a ). thus , that side 50 ( i . e ., the inside face ) of the transparent member 52 facing towards the interior 22 of the basin 12 will receive any splashing or spraying while the other side 51 ( i . e ., the outside face ) has disposed against its surface the pipe - like arm 24 . the arm 24 is secured to the outside face 51 of the transparent member 52 by brackets 54 . an arrangement whereby the invention fits over the arm 24 so that attachment of the arm is to the inside face of the transparent member 52 would also be considered within the claims of the invention . such an arrangement , however , is not the preferred embodiment as it would present a greater problem of cleaning the transparent member itself . at this point , it is worth noting that the brackets 54 and the hinges 34 and 36 are preferably made from an easy to clean , corrosion resistant substance , such as plastic or stainless steel . fig3 b illustrates a transparent member 52 &# 39 ; similar to that shown in fig3 with the exception that the right - hand and left - hand apertures 60r &# 39 ; and 60l &# 39 ; are three sided recesses along the right and left hand edges 55 and 56 of the transparent member 52 &# 39 ;. turning now to fig3 c , there is shown yet another embodiment of the present invention . in this embodiment , the transparent member 52 &# 34 ; has a plan view that is generally the same as the top 70 of a commode except that left - hand and right - hand apertures 60l &# 34 ; and 60r &# 34 ; as recesses along the left and right - hand edges 55 &# 39 ; and 56 &# 39 ; of the transparent member 52 &# 34 ; are provided . fig3 d illustrates a transparent member 52 &# 39 ;&# 34 ; generally similar to that of fig3 with the exception that the interior surface 50 &# 39 ;&# 34 ; is concave toward the interior of the basin 12 . this arrangement facilitates the drainage of any splashed or sprayed materials back into the basin . heretofore , the embodiments illustrated were mounted to or otherwise carried by the walls 14 and 16 of the cleaning station 10 or an object ( i . e ., the pivotally mounted arm 24 ) which is carried by one of the walls . fig4 a , 4b , and 4c illustrate transparent members 72 , 82 and 82 &# 34 ;, respectively , which are supported by the floor 18 . in fig4 a , the transparent member 72 is not in the form of a flat plane ; it is curved and provided with ridges 80 along one or more of its edges 75 , 76 , and 78 . the ridges may be necessary to add to the rigidity of the transparent member , if it is not otherwise supported . in fig4 b , the transparent member 82 is generally flat and is supported by a set of feet 86 . in fig4 c , the feet 86 &# 39 ; hold the lower edge 84 &# 39 ; of the transparent member 82 &# 39 ; at a higher distance from the floor than that shown in fig4 b . for purpose of illustration , the feet 86 and 86 &# 39 ; shown in fig4 b and 4c , respectively , are generally flat - like members ; rollers or wheels may also be installed to facilitate moving the transparent member 92 from a stowed location or to an operational position , which is located immediately adjacent the basin 12 . fig5 illustrates an embodiment of the invention wherein the transparent member 82 is mounted on the front lip 44 of a commode by means of one or more form fitting brackets 98 . such an embodiment may be particularly useful in a home environment where the cleaning shield can be conveniently installed at the front edge of an ordinary commode . the transparent member may be mounted further inwardly ( item 99 ) to facilitate drainage . fig6 illustrates yet another embodiment of the invention wherein the transparent member 132 having left and right hand apertures , 140l and 140r , respectively , is mounted on the front and side lips of the commode by means of a screw clamp assembly . such screw clamp assembly includes a plate 103 on the outside face of the transparent member and a &# 34 ; j &# 34 ; shaped member 101 , the crook of which fits about the inside lip of the commode , and the stem of which is threaded at its free end . the threaded free end of the &# 34 ; j &# 34 ; shaped member fits through an opening 104 in the transparent member which opening is contiguous with an opening in the plate 103 . a nut , wing nut or the like which is compatible with the threaded end of the member is tightened so as to tighten the screw clamp assembly against the lips of the commode and thus fasten said transparent member to the front and side lips of the commode . from the foregoing , it will be observed that numerous variations and modifications may be equally effective without departing from the true spirit and scope of the novel concept of the invention . for example , while the transparent member has been shown to be generally rigid and non - self supporting , or mounted from the wall or floor of a cleaning station , the transparent member can be supported from the ceiling and need not necessarily be perfectly rigid . similarly , although the apertures and recesses have been shown to be generally rectangular in form , they may be in any shape and may be provided with peripheral seals to reduce the potential for liquid to pass from one side of the shield to the other and through the apertures . thus , it is to be understood that no limitation with respect to the specific apparatus illustrated herein is intended or should be inferred . it is , of course , intended to cover by the appended claims all such modifications as fall within the scope of claims .

US-20827088-A

this is a surgical device that , in particular , is for forming a vasoocclusion or embolism . typically , it is a helically wound coil in which the helix is wound in such a way as to have multiple axially offset , longitudinal or focal axes . another important facet of the invention is the presence of small diameter secondary coil windings adjacent large diameter coil windings . the device is sufficiently flexible and small that it may be delivered to a site within the vasculature of the human body using a pusher and a catheter . the device is generally linear when within the catheter but relaxes to form the multi - focal form after delivery from the distal end of the catheter lumen . various mechanical connections may also be used to discharge the inventive coil from its pusher . similarly , the coil may be attached to a pusher using a sacrificial joint , which sacrificial joint is dissolved by imposition of a small voltage within the human body . the device may be used alone or in conjunction with other coils or with a fibrous thrombotic attachments or the substrate to localize subsequent infusion of tissue adhesives , other particulate embolization devices , or chemotherapeutic agents in abnormal blood vessels and tissues .

this invention deals with vasoocclusive coils which are wound in such a way as to have multiple axes or focal lines . the devices are fairly straightforward in that they are typically formed by wrapping or winding a fine filament or wire typically having a diameter between about 0 . 0025 inches and 0 . 005 inches , most preferably about 0 . 002 to 0 . 004 inches . the vasoocclusive coils may be made out of a variety of materials . some portion of the coils should be radiopaque so that its position may be readily monitored within the human body . suitable materials include biocompatible metals , polymers , and alloys . for instance , biocompatible , radiopaque metals include platinum , palladium , rhodium , gold , silver , tungsten , iridium , and various stainless steels . alloys such as platinum and tungsten ( preferably 92 - 94 % platinum and the remaining tungsten ) are suitable and , indeed , are quite preferred . most desirable platinum - tungsten alloys desirably have a tensile strength of at least about 180 kpsi and , for a wire of a nominal 0 . 001 inches diameter , have a breaking load of 0 . 17 lbs . with a minimum elongation of 2 % measured at a speed of 1 . 0 inches / minute . various biocompatible polymers including polyethylene , polyurethane , polypropylene , and the like are suitable for use in these devices , but because of their lack of radiopacity , usually must be teamed with a radiopaque marker or filled with a radiopaque filler to allow proper positioning of the coil within the body . similarly , other inorganic materials such as fibrous carbon are suitable and may be used in the invention . it is also contemplated that the coils described herein be manufactured and used in conjunction with thrombotic materials such as various fibrous attachments , e . g ., dacron , attached to the interior , exterior , or braided to the vasoocclusive coil in some fashion . fig1 and 2 show a typical coil made according to the invention specifically for the purpose of describing the conventions used in describing the coils of this invention . fig1 shows a vasoocclusive coil ( 100 ) having three &# 34 ; focal axes &# 34 ; ( 102 ). these focal axes are generally parallel to the vascular lumen into which they are eventually placed . although the vasoocclusive coil ( 100 ) shown in fig1 is in a so called &# 34 ; relaxed &# 34 ; condition -- that is to say that it has been allowed to unwind from its linear condition in an unconfined space so to illustrate the shape of that unconfined coil -- it should be understood that these focal axes may not bear a true relationship to the interior lumen of an artery or vein in that once they are confined , there may be some twisting or compression of the shape which will distort the unconfined shape into something quite different . nevertheless , for purposes of description , the concept of focal axes ( 102 ) is instructive for describing the device . a focal axis is simply an axis about which a small helical coil has been wrapped . the focus ( 104 ) of this axis may be seen from an end view in fig2 of the device . central to this invention is the presence of at least two of these focal axes ( 102 ). it is the presence of these at - rest focal axes which creates a three - dimensional space in the vasoocclusive coil which results in a large area or region of open but occluding structure in a vascular lumen . another concept which is instructive in understanding this invention is that of a repeating unit ( 106 ) found in fig1 . a repeating unit is simply the space in a vasoocclusive coil such as ( 100 ) in which the wound coil returns to a similar point on a specific focal axis . finally , as shown in fig2 there are two other concepts which are of interest in describing this inventive device . they are the major effective diameter ( 108 ) and the minor effective diameter ( 110 ). the major effective diameter ( 108 ) is simply the widest relaxed dimension generally perpendicular to the focal axis ( 102 ) measured in a relaxed condition . the minor effective diameter ( 110 ) is the smallest diameter measured perpendicular to a focal axis ( 102 ) measured when the vasoocclusive coil is in a relaxed condition . again , the central concept of this invention is the creation of multiple focal axes in a vasoocclusive coil so to produce a vasoocclusive coil which may be introduced in a linear manner through a catheter and once that coil is ejected from the catheter , resulting in a coil having a high , typically regular , three - dimensional component once so ejected . fig3 shows a variation of the inventive coil ( 112 ) similar to that shown in fig2 having three focal points . fig3 is an end view of the device and is one of the more simple of the inventive vasoocclusive coils made according to this invention . the relaxed shape seen in fig3 typically would not be present in the depicted form within the vascular lumen . more likely , the three foci ( 104 ) would be in more of a triangular shape , allowing some modest amount of pressure against the vascular lumen wall . fig4 shows how vasoocclusive coil ( 112 ) might be situated in the lumen of an artery ( 114 ). the straight portions of coil ( 112 ) (( 116 ) in fig3 ) are slightly deformed in fig4 to result in the pressure against the vascular lumen wall . the device ( 112 ) shown in fig3 and 4 clearly would have multiple repeating units ( such as ( 106 ) in fig1 ) which may not be seen because of the perspective of fig3 and 4 . because of the shape and the short length of a typical repeating unit for such a device , it would be expected that the device have a sufficient number of repeating units to at least equal the major diameter of the device ( as ( 108 ) in fig2 ). that is to say that the length of any of the focal axes in a fig3 and 4 device would be generally as long as the major diameter of the device . although this is not a requirement of the invention , from a practical viewpoint , it may be necessary to ensure that the vasoocclusive coil stay in a position within a lumen . fig5 shows another variation of the inventive vasoocclusive coil ( 118 ) in which there are four foci ( 104 ). other than this difference in the number of foci ( 104 ), the device is similar in construction to that of the coil found in fig3 and 4 . the loops about the foci ( 104 ) are small and produce long straight sections ( 116 ) between those loops . fig6 shows still another variation of the inventive vasoocclusive coil . in this instance , the coil ( 120 ) is made up of a repeating unit having a large loop ( 122 ) and a smaller loop ( 124 ). the device has two foci ( 104 ). this variation , as well as those shown in relation to the discussions to the figures above , results in a structure having a large cage - like structure which , depending upon the usage to which the vasoocclusive coils are placed , may be used either as a &# 34 ; framework &# 34 ; for placement of other coils such as those described in u . s . patent application ser . no . 07 / 978 , 320 , filed nov . 18 , 1992 entitled &# 34 ; ultrasoft embolism producing coils and process for using them &# 34 ;, pending , the entirety of which is incorporated by reference . it should be apparent that the smaller of the diameter of the coil turns about the various focal axes and the shorter the distance between those focal axes , e . g ., as shown by the distance ( 116 ) as shown in fig3 and 5 , the more densely packed will be the resulting vasoocclusive coil once it is deployed into the vascular space . fig7 shows yet another three foci ( 104 ) variation of the inventive vasoocclusive coil ( 126 ). the central turn ( 128 ) in this variation is small and the outerlying turns ( 130 ) are both somewhat larger . as may be conceptualized from fig8 this variation ( 126 ) produces a form within a blood vessel ( 114 ) which can provide additional force against the inner wall of that vessel ( 114 ). this is so in that two extended portions ( 128 ) of larger loop ( 130 ) exert a force against the inner lumen when placed as shown in fig8 . for vasoocclusive coil ( 126 ) wound in a similar material and spacing as compared to the coil shown in fig3 and 4 , the fig7 and 8 variation would provide an added measure of hydrodynamic stability . fig9 and 10 , respectively , show end views of vasoocclusive coils having four and five foci . the added number of smaller coil turns about these foci , in combination with the high number of foci ( 104 ), provide variations in which the coils as deployed are quite dense . both the fig9 coil ( 134 ) having four foci ( 104 ) and the fig1 coil ( 136 ) having five foci ( 104 ) are fairly &# 34 ; soft &# 34 ; in their deployment in that they are an indeterminate structure . it is possible and sometimes desirable to weave the devices made according to this invention in such a way that they would be determinate structures and less likely to deform within a vessel lumen . the study of &# 34 ; determinancy &# 34 ; is well known in structural engineering and no further comment need be made about it here for a complete description . each of the devices shown in fig2 through 10 may have a significant number of repeating units , e . g ., four to sixteen or more . fig1 and 12 show a specific device having particular use in occluding vascular aneurysms . when the coils of the invention are introduced into aneurysms having a large neck , there is a modest risk that the coil will not seat well or completely within the aneurysm space . the coil may &# 34 ; pop out &# 34 ; during the step of insertion or later . the coil ( 140 ) has two sections -- a section of comparatively larger diameter ( 142 ) and a section of comparatively smaller diameter ( 144 ). the small diameter axis ( 146 ) and the larger diameter axis ( 148 ) are shown both in fig1 and in fig1 . the smaller diameter section ( 144 ) may be as small as one - half to one turn of the primary coil . desirably , the diameter of the smaller diameter section ( 144 ) is no more than about 75 % of that of the comparatively larger diameter section ( 142 ). indeed , when used with less than one turn in the smaller diameter , the smaller diameter portion of the assembly is often placed within the interior of the larger coil section . this prevents the end of the coil from being a site for occlusion in an artery when the coil assembly is intended to be in an aneurysm . the device of fig1 and 12 may be inserted from either end . the smaller diameter section ( 144 ), when inserted into the aneurysm first helps prevent the stiffer portion of the coil -- the larger diameter section ( 142 )-- from traversing the inner periphery of the aneurysm and out the aneurysm neck into the parent artery . when the larger diameter section ( 142 ) of the coil is inserted first into the aneurysm , a cage may be formed and the smaller diameter section follows into the cavity . the smaller diameter section helps to infill the cage and further provides anchoring for the assembly . as noted elsewhere , each of these devices may be pushed into the selected body site using typical pushers as are disclosed in ritchart et al . alternatively , the coils may be pushed from the deployment catheter and released using joints between the coil and pusher which joints have positive releasing features . for instance , fig1 shows a highly desirable electrolytically detachable joint assembly suitable for use with the coils of the invention . the severable joint region ( 141 ) is typically the extension of the core wire / pusher ( 149 ) which delivers the coil assembly ( 143 ) to the selected site in the human body . the severable joint region ( 141 ) is completely insulated ( as is the exterior of the pusher assembly ( 145 ) except for a small band ( 147 ) which is often stripped of electrical insulation after the assembly is coated . the severable joint ( 147 ) erodes in the presence of blood when a small voltage is applied to the core wire ( 149 ). the severable joint ( 147 ) erodes in preference to the coil ( 143 ) because of the difference in the electronegativity between the less noble material of the joint ( 147 )-- often stainless steel -- and the more noble material of the coil -- often a platinum alloy . once the joint ( 147 ) is eroded away , the coil may then stay as a implant and the pusher portion ( 145 ) may be removed from the body . details of the electrolytically detachable coil ( more commonly known as the guglielmi detachable coil or &# 34 ; gdc &# 34 ;) are described in detail in u . s . pat . no . 5 , 122 , 136 , issued jun . 16 , 1992 , and in u . s . pat . no . 5 , 354 , 295 , issued oct . 11 , 1994 , both to guglielmi and sepetka . improvements on the gdc joint are found in u . s . pat . no . 5 , 423 , 829 , to pham et al and in u . s . patent application ser . no . 08 / 431 , 827 , filed apr . 28 , 1995 , pending , also to pham et al . fig1 shows a variation of the invention in which the connective joint is a mechanically detachable joint . the depicted joint has a clasp section ( 153 ) which remains with the core wire or pusher ( 155 ) when the sheath ( 157 ) is retracted proximally . the other clasp section ( 151 ) remains with the coil ( 159 ) when the coil ( 159 ) is left in the body . other mechanically detachable joints suitable for use with the inventive device are described in : u . s . pat . no . 5 , 234 , 437 , to sepetka , ( shows a method of unscrewing a helically wound coil from a pusher having interlocking surfaces ). u . s . pat . no . 5 , 250 , 071 , to palermo , ( shows an embolic coil assembly using interlocking clasps mounted both on the pusher and on the embolic coil ) u . s . pat . no . 5 , 261 , 916 , to engelson , ( shows a detachable pusher - vaso - occlusive coil assembly having an interlocking ball and keyway - type coupling ) u . s . pat . no . 5 , 304 , 195 , to twyford et al . ( shows a pusher - vaso - occlusive coil assembly having an affixed , proximally extending wire carrying a ball on its proximal end and a pusher having a similar end , which two ends are interlocked and disengage when expelled from the distal tip of the catheter ) u . s . pat . no . 5 , 312 , 415 , to palermo ( also shows a method for discharging numerous coils from a single pusher by use of a guidewire which has a section capable of interconnecting with the interior of the helically wound coil ). u . s . pat . no . 5 , 350 , 397 , to palermo et al . ( shows a pusher having a throat at its distal end and a pusher through its axis . the pusher sheath will hold onto the end of an embolic coil and will then be released upon pushing the axially placed pusher wire against the member found on the proximal end of the vaso - occlusive coil ). fig1 a , 15b , and 15c show a procedure for making coils according to this invention . fig1 b , in particular , shows a method of making the fig6 variation and fig1 c shows the final step ( after the fig1 b step ) of making the fig2 variation of the inventive vasoocclusive coil . again , this is a very straightforward method once the concepts are explained . vasoocclusive coils having secondary structures , such as are discussed in ritchart et al . above , may be made using the winding step shown in fig1 a . that is to say that a coil ( 150 ) made , e . g ., of a platinum / tungsten alloy having a primary helical structure , is wound onto a first mandrel ( 152 ). this mandrel should be reasonably heat - tolerant in that a modest amount of annealing will take place in the later production steps of the method described here . if a coil having merely this simple single focal axis shape as shown in fig1 a is desired , the coil ( 150 ) may be wound reasonably tightly over the mandrel ( 152 ) and subjected to a short heat treatment step at 350 °- 1100 ° f . for a short period of time to allow the coil to be set into the noted form . once the heat treatment is completed and the desired secondary shape has been infused into the coil , the coil may be removed from the mandrel and placed in a suitable delivery device . many such coils are delivered using cannula which may be sterilized with relative ease . the procedure shown in fig1 a may be used as the first step for producing coils having multiple focal axes . fig1 shows the manner in which coil ( 150 ) is threaded with a second mandrel ( 154 ). should the device having the configuration shown in fig6 be desired , the coil having mandrels ( 152 ) and ( 154 ) inserted therein would be then transported to the annealing oven for further treatment as noted above . fig1 b also shows the path taken by the third mandrel ( 158 ) as depicted in fig1 c . the addition of mandrel ( 158 ) to the configuration of coil ( 150 ) as shown in fig1 c will produce a device as shown in fig1 and in fig2 . other procedures for introducing mandrels and turns should be apparent in producing the devices shown in the remainder of the drawings as well as in other multi - focal axis coils in accordance with this invention . fig1 a , 16b , and 16c show a procedure for introducing a vasoocclusive coil of the type described herein into an artery or other vascular site . this procedure is similar in many ways to the procedure described in ritchart et al ., mentioned above . the procedure is simply that a delivery catheter ( 170 ) is introduced into a region , e . g ., an artery ( 172 ), until a desired site is reached . as is the case with most delivery catheters , a radiopaque marker ( 174 ) is included so that proper assessment of the site may be had . the coil of this invention ( 176 ) is shown within the distal portion of catheter ( 170 ). a pusher ( 178 ) is shown proximal of coil ( 176 ). once the desired site is attained , pusher ( 178 ) is advanced as shown in fig1 b . the coil ( 176 ), which until being ejected from the distal tip of catheter ( 170 ) has been in a linear configuration , relaxes to form the multi - focal configuration shown in fig1 b . fig1 c shows the withdrawal of catheter ( 170 ) and pusher ( 178 ) with the inventive coil ( 176 ) stationary within the lumen of artery ( 172 ). many alterations and modifications may be made by those of ordinary skill in this art without departing from the spirit and scope of the invention . the illustrated embodiments have been shown only for purposes of clarity and the examples should not be taken as limiting the invention as defined in the following claims , which are intended to include all equivalents , whether now or later devised .

US-53855795-A

a vehicle wheel assembly is provided which includes a vehicle frame having a first axle , a wheel assembly having a housing with an aperture engaging the first axle and enabling the wheel assembly to pivot in a first plane about a first axis formed by the first axle . a cylindrical member is carried by the housing of the wheel assembly , the cylindrical member and housing are arranged perpendicular to the first axle . a first wheel is pivotably connected to a first portion of the cylindrical member and a second wheel is pivotably connected to a second portion of the cylindrical member . the first wheel and second wheel independently pivot in a second plane about a second axis formed by the cylindrical member . the first axis is arranged perpendicular to the second axis and the first plane is arranged perpendicular to the second plane .

shown generally in the figures is an improved utility cart 200 for use in association with an improved folding and stacking agricultural implement frame 300 . the utility cart is suitable for being pulled behind a tractor or other similar pulling vehicle . with respect to the figures , right and left designations refer to viewing the cart 200 and implement frame 300 from the rear looking in the direction of travel . the right and left side of this design are mirrored images of each other ; therefore , the description will concentrate primarily on the right side . the implement frame 300 is the type that has wings 25 , 26 that fold outward to extend transversely to the direction of travel of the tractor so that several rows of crops can be worked on with a single pass . fig1 shows a top view of the cart 200 and implement frame 300 combination with a right wing 25 in working position and the left wing 26 still in folded position . implement frame 300 can have various implements attached for numerous uses such as fertilizer spraying , pesticide spraying , planting , and other uses . for these illustrations , planter units 202 are shown . the wings 25 , 26 can be varied in length to accommodate different row spacings and number of rows . as best seen in fig2 , the wings 25 , 26 comprise a wing tool bar 204 and a wing support bar 206 . the planter units 202 , or other implements , attach to the wing tool bar 204 . according the embodiment shown in fig2 , a rear tool bar 78 is attached to the rear of the cart 200 to permit attachment of implements . when in full working position , both wings 25 , 26 are folded out or back perpendicular to the main lift arms 56 , 57 and in line or parallel to plane of the rear tool bar 78 . alternatively , the rear tool bar 78 may be eliminated , and the left and right wings 25 , 26 can be extended inboard . ( fig1 a ). in planting position , wing lock arms 29 , 30 are unfolded and held in a straight or slightly overcentered position by the wing lock arm hydraulic cylinder 28 . front wing lock arm 30 is attached to a ball swivel in a plate 33 extending from front wing hold assembly 51 . ball swivel and plate 33 are almost directly in a direct line with the pin 19 in the wing pivot assembly 90 . this allows the entire wing 25 to go up and down following the terrain without binding . the raised / lowered position is controlled by two hydraulic cylinders 67 , 68 which extend and raise main lift arms 56 , 57 . ( fig1 ). the right 67 and left 68 main lift cylinders are attached to main frame rails 60 , 61 by plates of steel 69 , 70 on each side of the cylinder with pin 71 placed in holes in plates 69 , 70 and through round sleeve on butt of cylinder forming a pivot . ram of cylinders 67 , 68 attach to a pivot plate 81 , fig1 & amp ; 11 , which is optional and could be attached directly to main lift arms 56 , 57 . but pivot plate 81 acts as a manual extra flex in uneven terrain . raising and lowering can be accomplished by placing a lift wheel behind rear main support frame 1 and / or rear tool bar 78 in many different configurations . wheel lift assemblies 400 ( shown in fig1 a and further detailed in fig1 ) are placed on the outboard end of wings 25 , 26 . placing of assembly or type of assembly can vary . the wheel assembly ( fig1 ) preferably raises and lowers simultaneously with main frame . these wheel lift assemblies are described in greater detail below . to get to transport position , wings 25 , 26 are folded in . the left side is shown in folded position in fig2 . hydraulic wing fold cylinder 23 ( fig1 ), is retracted , wing 25 is pivoted on pin 17 of wing pivot assembly 90 . pin 17 also extends through wing pivot support assembly 22 to form a pivot . part of wing pivot assembly 90 is wing flex sleeve 21 ( fig1 and 16 ). pin 19 extends through sleeve 20 and through wing flex sleeve 21 and through round sleeve 39 in wing 25 ( fig1 ). this allows wing to pivot up and down to follow contours of land or whatever application requires . before hydraulic wing fold cylinder 23 can retract , the wing lock arm hydraulic cylinder 28 has to retract and begin folding the lock arms 29 , 30 inboard . a hinge allows lock arm 29 , 30 to pivot in a horizontal plane with wing 25 ( fig2 ). the wing fold cylinder 23 attaches to a plate extending out from wing pivot assembly 90 ( fig1 ). the cleaves end of the butt of the cylinder attaches to a welded ball swivel 82 in the plate . this allows for the wing to flex up and down . the ram end of the cylinder attaches to a ball swivel in flex arm 24 which pivots on a pin 84 which is between two plates of steel with holes forming hinge . this also allows for wing flex without the cylinder extending or retracting during field operations , which is optional in the design . when cylinder 23 is fully refracted , the wing frame 25 is over and up to notch in front wing hold assembly 51 . this can have many different designs to hold wings to the assembly 51 but had to be able to lift the wing 25 in an arcing vertical movement . ( fig6 and 12 ). when wing 25 is on the front wing hold assembly 51 the wing lock arms 29 , 30 are fully inverted by the wing lock hydraulic cylinder 28 so they are parallel or close to parallel to the wing 25 . then the stacking hydraulic cylinders 15 , 50 can be extended simultaneously using rephasing cylinders or master slave cylinder . the butt end of cylinder has a sleeve or cleaves so it may pivot as cylinder is actuated . it is held by a pin 9 , 53 which passes through a sleeve or holes in the inboard ends of the rear and front bottom stacking arm 4 , 75 and also through holes or bushings in the steel plates that form rear and front main support frames 1 , 2 . the cylinder ram pivot 87 , 88 is at the end of the ram of the stacking cylinders 15 , 50 . it can be a sleeve or cleaves which is held by a pin 38 , 54 which passes through welded sleeves 36 , 37 and 44 , 45 which are attached by metal plates welded to the top of the stacking arm 3 , 74 shown best in fig3 , 6 and 7 . the top stack arms 3 , 74 are attached by pin 10 , 52 which extends through sleeve or holes in the stack arms 3 , 74 and through a hole or bushing in the upright plates of steel that form the main support frame 1 , 2 . the outboard ends of both the top and bottom stack arms , front 74 , 75 and rear 3 , 4 have round sleeves and 11 , 13 and 12 , 14 or holes which pins 34 , 35 , 55 , and 89 extend through . in the front , stack arms 74 , 75 pin 55 , 89 also extend through holes or bushings in the front wing hold assembly 51 fig6 & amp ; 7 . the rear stack arms 3 , 4 are similar to the front . pin 34 , 35 extends through hole or bushings in the wing support pivot assembly 22 . both front and rear , top and bottom stack arms 3 , 4 and 74 , 75 are similar in length and hole or bushings in main support frames 1 , 2 and front wing hold assembly 51 and wing pivot support assembly 22 are matched in these illustrations which keep the wing frame 25 perpendicular to the main frame through the entire vertical arc of the stacking movement . by varying the length between the pivot points , frame , top stack and bottom stacking arms , the angle of the wing frame could be pitched up or down through the vertical arc of the stacking arm and would accomplish the same basic principle . when the stack cylinders 15 , 50 are extending close to the top of the arc , they continue to pass top of center and over center ( fig5 and 9 ). gravity helps to keep the wings 25 , 26 in the transport position even though there is still pressure via trapped oil within the stack cylinder which will also hold wings 25 , 26 in transport position ( fig1 ). going over center is not totally necessary and in some uses other frames may not be designed this way , which would increase the distance between the wings 25 , 26 in transport position or to narrow main support frame so that total transport width may be narrower . unstacking the wings 25 , 26 is performed by applying pressure to the hydraulic oil on the ram side of the stack cylinder 15 , 50 so that they retract simultaneously until they are totally retracted and the stack arms 74 , 75 and 3 , 4 are horizontal ( fig4 & amp ; 7 ). the bottom stack arms 75 , 4 rest on the retracted stack cylinder 15 , 51 and also steel plate 72 , 73 that extend out from the bottom of the main support frame 1 , 2 ( fig1 , 13 ). also , the tube that connects both sides of stack arms may be welded in a manner that they rest on the vertical plates that form main support frame 1 , 2 , but in an area where they do not conflict with the stack cylinders 15 , 51 in any of their range of arc . the front wing hold assembly 51 must be slightly lower than the height of the wing frame 25 at the point where they connect ( fig7 ). now pressure can be applied to the hydraulic oil on the ram side of the wing fold cylinder 23 which extends it out and pushes the flex arm 24 against the unfolding stop 27 which is made by welding steel plates to the wing frame 25 . as the wing fold cylinder 23 continues to extend , the wing 25 pivots on pin 17 in the welded sleeves 18 of the wing pivot assembly 90 ( fig1 ). the wing pivot assembly 90 is also connected by pin 17 to the wing pivot support assembly 22 . the wing lock cylinder 28 is also extending at the same time as wing fold cylinder 23 . when the wing 25 is in the working position ( fig2 ) shown perpendicular to main lift arm 56 the wing lock cylinder 28 is fully extended and front lock arm 30 and rear lock arm 29 at center lock arm hinge 32 are straight or slightly past center . the unfolding of the wings 25 , 26 should be performed with the planting units off the ground so not to create more resistance . the main frame has many parts . the base frame 60 , 61 rest on the frame rails 65 , 66 of the utility cart . as an alternative , these frame rails 65 , 66 may be mounted so that their tops are angled slightly inwardly . the base frame members 60 , 61 must be correspondingly angled in this instance , as shown in fig2 and 21 . angling the frame rails inward facilitates mounting the base frame 60 , 61 because it will help align the frame rails with the base frame 60 , 61 if they are slightly off alignment . the leading edges of the frame rails 65 , 66 may be similar angled in order to help base frame 60 , 61 align both side - to - side and front - to - rear . when using a removable cart assembly ( these drawings use a tracked cart for the carriage ) the base frame 60 , 61 and frame rails 65 , 66 could be combined for the purpose of a permanent carriage . the base frame 60 , 61 is attached to the front main support frame 2 by pins 79 , 92 which extend through plates of steel welded to the bottom of the main support frame . pins 79 , 92 extend through holes in plates of steel and then through a hole or sleeve in the base frame 60 , 61 . this forms a pivot or hinge . ( fig1 , 12 ). the front main support frame 2 is attached to the main lift arms 56 , 57 near the front of frame . these positions can be varied to meet different lengths of wings or different carriage lengths or many other needs . the rear main support frame 1 is mounted at the rear main lift arms 56 , 57 ( fig1 , 11 ). the main support frames 1 , 2 must be parallel . further , their vertical planes must be parallel [ though not necessarily perpendicular to main lift arms 56 , 57 or base frame 60 , 61 ] so that front 74 , 75 and rear 3 , 4 stacking arms in their arcing movement remain parallel . the main lift arms 56 , 57 and base frame 60 , 61 can be designed in many different ways and the design shown in fig1 is not the only pertinent design . the main lift arm 56 , 57 must be strong enough to carry all the weight of the wing frames 25 , 26 and attachments to the wings . behind the rear main support frame , this design uses an implement tube 78 for mounting units . the base frame 60 rests on the cart frame 65 and is attached as previously described . extending down parallel from base frame rail 60 is a plate of steel which extends down to the sleeve 91 ( fig1 ) on the butt end of the main lift cylinder 67 . welded to this plate is another plate which is perpendicular to the first . welded to this plate is another plate perpendicular to the last that forms a “ u ” shape . this assembly forms a support for the main lift cylinder 67 . pin 71 extends through holes or bushings 69 , 70 in the steel plates and through the sleeve 91 on the butt end of the main lift cylinder 67 . pin 71 is at a 90 degree angle to the base frame allowing the main lift cylinder to pivot parallel to the base frame 60 . on the extended plate that is 90 degrees from the base frame rail , a horizontal plate should be welded in a manner that it rest and gain support from the rear main carriage axle 58 . also sleeve 91 should be slightly oversized to allow for some side to side sway . the above described supporting of the main lift arm cylinders 67 , 68 can be accomplished by other methods . the wing wheel lift assembly illustrated in fig1 a - d is unique and is well suited for this tool bar design but is not the only acceptable method of raising and lowering the wing frame 25 , 26 . the wing wheel lift assemblies for wings 25 , 26 are identical , so only one will be described here . the leading wheel 141 and the trailing wheel 142 both caster or swivel 360 degrees in either direction . the leading and trailing wheels 141 , 142 are illustrated using a standard fork type mounting 143 , 144 . a single offset arm and spindle caster could be used . the leading wheel 141 and fork 143 swivels on a vertical shaft 145 that extends through a round sleeve 147 which is attached to an outboard bracket 151 . the outboard and inboard brackets 151 , 152 are mirror images and both are somewhat “ u ” shaped . this allows the leading wheel hydraulic cylinder 154 space for its movement . these brackets 151 , 152 are connected to upper and lower parallel link arms 149 , 150 by pins 153 a - d which extend through holes or round sleeves in the ends of the parallel link arms 149 , 150 and through holes in the outboard and inboard brackets 151 , 152 . in these illustrations , the butt end of the leading wheel hydraulic cylinder 154 pivots on pin 153 d and the ram end pivots on pin 153 b . the end of the cylinder could be attached and pivot on separate pins and still conform to this design . this type design uses parallel link arms to keep the caster wheel at a constant vertical angle which is not unique . what is unique is that the inboard bracket 152 also pivots or swings in and out perpendicular to the frame on pin 153 d . ( this pivot could be placed in a different pin or sleeve but still conform to this design .) ( fig1 a & amp ; b ). pin 153 d extends through holes in plates of steel which are vertical and are outside of upper and lower parallel link arms 149 , 150 and are spaced far enough apart and in front of wing frame 25 , 26 that it can pivot or swing inward in an arcing movement perpendicular to the wing frame 25 , 26 . these plates of steel are part of the wing wheel lift bracket 163 ( fig1 d ). the bottom of the inboard bracket 152 is attached by pin 162 to bracket 167 which is attached to the back or inboard side of inboard bracket 152 by pin 162 which extends through a hole in wheel tucking link arm 165 forming a pivot . the other end of the wheel tucking link arm 165 is attached to the wheel tucking lever 164 by pin 160 which extends through holes in both 164 , 165 which also forms a pivot . ( fig1 c ). the wheel tucking lever 164 is attached to the wing wheel lift bracket 163 by pin 161 which extends through brackets 168 a & amp ; b that are attached to wing w heel lift bracket 163 and through a hole at the bottom of the wheel tucking lever 164 forming a pivot . at the top of the wheel tucking lever 164 is another hole where the butt end of the trailing wheel hydraulic cylinder 156 is attached by pin 159 . the ram end of the trailing wheel hydraulic cylinder 156 is attached to a plate or plates of steel extending vertically from the trailing wheel arm 155 by pin 158 which extends through holes in the plates of steel and through the yoke or sleeve 170 at the end of the ram . ( fig1 a - c ) the inboard bottom end of the trailing wheel arm 155 is attached by and pivots on pin 157 which extends through holes in the outboard ends of the wing wheel lift bracket 163 and in a round sleeve 169 attached to trailing wheel arm 155 . this allows the trailing wheel arm 155 a vertical arc perpendicular to the wing frame 25 , 26 . at the outboard end of the trailing wheel arm 155 is a round sleeve 148 which is attached in a way that the vertical caster shaft 146 extends through the round sleeve 148 and is for the most part straight up and down when the wing 25 , 26 is in the up working position . like the leading caster wheel 141 the trailing wheel 142 can swivel 360 degrees in either direction . the leading and trailing wheel 141 , 142 run in the same path in a straight route of travel reducing the total width of wheel tracks and also reduces the amount of drag caused by wheels running in loose soil . the hydraulic cylinders leading 154 and trailing 156 receive hydraulic oil from the ram side of the right or left main lift cylinder 67 , 68 . this hydraulic oil is trapped and flows in and out of the butt ends of the leading 154 and trailing 156 hydraulic cylinders . in these illustrations , the bore and stroke of the hydraulic cylinder 154 , 156 are different sizes , but the volume of hydraulic oil it takes to move the leading and trailing wheels 141 , 142 is the same . in the working positions up or down on level ground the rams of neither the leading or trailing hydraulic cylinders 154 , 156 are fully retracted or extended . this allows for movement of the wheels up and down so to traverse uneven ground keeping the wing frame 25 , 26 from being jarred or bounced over bumps . when the leading wheel 141 rolls over a rock or bump , hydraulic oil is displaced from the leading hydraulic cylinder 154 to the butt end of the trailing hydraulic cylinder 156 and it moves down the same amount that the leading wheel 141 moves up . it works a similar way when the lead wheel 141 passes through a hole or dip because this puts more pressure on the trailing wheel , it pushes the ram in and displaces oil from the butt of the trailing hydraulic cylinder 156 to the leading wheel hydraulic cylinder 154 because of the reduced pressure in the hydraulic cylinder 154 . all this creates a hydraulic walking tandem type situation . the unique operation of this wing wheel lift assembly is the wheel tucking for transportation in the stacked position ( fig9 & amp ; 17d ). in the working position ( fig1 a & amp ; b ) the wheel tucking lever 164 is held against the stop adjustment bolt 166 by the pressure of the trailing wheel arm 155 . this pressure , caused by leverage , holds the inboard bracket 152 of the leading wheel assembly in a vertical position by pressure transfer from the wheel tucking lever 164 to the wheel tucking link arm 165 . when the wing frames 25 , 26 are being stacked , the pressure is taken off the wheels as the wing frame rises . the trailing wheel arm swings down and in pulling the wheel tucking arm 164 back . at the same time this pulls the inboard bracket 152 back and up . this causes the lead caster wheel 141 to be tucked under the wing frame 25 , 26 ( fig1 d ). this may also create a suction effect by further pulling the leading wheel hydraulic cylinder 154 in because the weight of the trailing wheel will pull the ram of the trailing wheel hydraulic cylinder 156 out , creating a need for additional hydraulic oil in the butt side of the hydraulic cylinder which should suck the oil out of the butt end of the leading wheel hydraulic cylinder 154 . in unstacking , the trailing wheel 142 makes contact with the ground first . as the wing frame 25 , 26 gets closer to the ground the trailing wheel arm 155 pushes the ram of the trailing wheel hydraulic cylinder 156 in , displacing oil to the leading wheel hydraulic cylinder ( 154 also pushing the wheel tucking lever 164 inward towards the stop bolt 166 . this through the wheel tucking link arm 165 pushes the inboard bracket 152 of the leading wheel assembly down and forward back to the vertical position . this frame design is not limited to a utility cart , more so a tracked or belted cart , though due to the ability of the tracked vehicle to carry large loads , a tracked utility cart was used in all of the drawings . in fig1 a plain top view of the cart shows the left side ( as determined by viewing from the rear looking in the direction of travel ) with the belts cut out so that the front 122 a & amp ; b , rear 123 a & amp ; b and idler 124 a - h wheels can be shown . the right side is a minor image of the left . also shown are the front hubs 101 a & amp ; b , rear hubs 103 a & amp ; b and idler hubs 102 a - h . the hubs run on shafts that have spindles machined on both ends to form a short axle . fig1 a shows a close up view of the front axle spindle 112 , which extends through holes or round sleeve 116 a in the top left tandem arm 120 . this top tandem arm 120 is parallel with the cart frame 66 and pivots on pin 111 , which extends through a round sleeve 11 0 or holes . the rear of the front top tandem arm 120 extends down to another pivot formed by pin 129 and round sleeve 115 . ( fig1 a ). pin 129 , 129 a extends through holes in steel plates that extend up from the left front lower tandem arm 118 and then through round sleeve 115 in the bottom of the front top tandem arm . a preferred design for the lower tandem arms 118 , 119 is shown in fig2 . each tandem arm includes an upper portion 208 that pivotally mounts to the top tandem arms 120 , 121 . attached below the upper portion 208 is an outer roll tube 210 . an inner roll tube 212 slides into the outer roll tube 210 , and is free to rotate within the outer tube 210 . a first axle attachment member 214 is fixedly attached to one end of the inner roll tube 212 , as by welding . a second axle attachment member 216 is pivotally attached to the opposite end of the inner roll tube 212 , and held in place by end cap 218 , so that the first and second axle attachment members 214 , 216 can pivot with respect to each other about the axis of the inner roll tube 212 . idler hub spindle axles 113 a & amp ; b are attached to the first and second axle attachment members 214 , 216 . an alternative design for the tandem arms 118 , 119 , which does not allow for roll along a longitudinal axis is also possible . according to this simpler design , at each end of the front lower tandem arm 118 are holes or round sleeves ( 117 a & amp ; b which the idler hub spindle axles 113 a & amp ; b extend through . the rear lower tandem arm 119 is identical to the front lower tandem arm 118 using round sleeves 117 c & amp ; d and idler hub spindle axles 113 c & amp ; d . the left rear top tandem arm 121 and rear lower tandem arm 119 are connected at pivot formed by pin 129 b and round sleeve 115 b . the left rear top tandem arm 121 also like the front top tandem arm 120 pivots on pin 111 which extends through round sleeve 137 . at the opposite end from round sleeve 115 b in the left rear top tandem arm is round sleeve 116 b which the left rear hub spindle axle 138 extends through . all of the before mentioned pivots follow the arms to move in the same vertical plane ( fig2 & amp ; 21 ) which runs parallel to cart frame 66 . this allows for the inner sides of the pairs of wheels front 122 a & amp ; b , rear 123 a & amp ; b , idlers 124 a & amp ; b , 124 c & amp ; d , 124 e & amp ; f , 124 g & amp ; h to form guides for the guide blocks 139 a - d ( fig2 & amp ; 21 ) which are aligned down the center and all the way around the inside of the belts which is somewhat standard on belts . because of the multiple pivot in the vertical plane the pairs of wheels can move up and down traversing the ground with more equal weight distribution and still guide the belts . the top tandem arms 120 , 121 are connected to the main cart pivot axles , front 59 and rear 58 by pins 111 and 132 . both pins are held in round sleeves , front 109 and rear 131 . a bolt or pin may be placed in a hole drilled through the pin and sleeve or pin 111 and pin 13 2 may be directly fastened to the main cart pivot axles 58 , 59 . fig2 shows top view , fig2 and 21 show front and back elevation . the cart frame rails 65 , 66 can be attached in many different ways such as bolt or welded to main cart pivot axles 58 , 59 or bolted indirectly so to use load cells for a weigh scale . the method that will be described and illustrated uses additional pivots to allow for smoother load transporting in uneven terrain . also this design allows the same weight to be transferred to or from the draw bar of the vehicle pulling it by moving the front frame pivot assemblies 127 , 128 forward or backward on the adjustable hitch load plates 125 , 126 . the adjustable hitch load plates 125 , 126 have holes drilled in them so to allow the front frame pivot assembly 127 , 128 to be bolted in incremental positions but staying perpendicular to main cart frame rail 65 , 66 . ( fig1 & amp ; 20 ) the front frame pivot assemblies 127 , 128 are connected to the front load pivot assembly 96 by pin 106 , 107 forming a pivot in round sleeve in the front frame pivot assemblies 127 , 128 . these round sleeves are perpendicular to the main cart frame rails 65 , 66 . the pins 106 , 107 also extend through round sleeves 104 , 105 which may be drilled and bolted securing the pins 106 , 107 . it would possible to substitute a single long rod for pins 106 and 107 . the pins 106 , 107 may be fastened directly to the front load pivot assembly 96 ( fig1 & amp ; 20 ). the side elevation in fig2 also shows all of this in a cut away view . the front load pivot assembly 96 can slide forward and backward on the front slide pivot axle 95 . in this design the pull is transferred from the hitch 62 to the front main pivot axle 59 to the front top tandem arm 120 to the front wheels 122 a , b which pull the belts 63 , 64 and the rest of the cart rides on the belts 63 , 64 . this helps the belts to track or guide easier . this is not totally necessary and may be designed differently . the front slide pivot axle 95 extends through a hole or round sleeve 94 in the hitch cross member 100 and round sleeve 108 in the front load pivot assembly 96 and into a hole or round sleeve 93 attached to front main cart pivot axle 59 . the front slide pivot axle 95 is centered between and parallel to the main cart frame rails 65 , 66 ( fig1 ). this design permits the weight distribution to be adjusted between the cart and the pulling vehicle . by adjusting the location of the front frame pivot assemblies 127 , 128 forward or rearward on the adjustable hitch load plates 125 , 126 , the distribution of the weight can be shifted forward or rearward . as an alternative , it would be possible to add an additional cross member ( not shown ) to the hitch 62 , similar to cross member 100 , and mount the front slide pivot axle 95 between the two cross members instead of between cross member 100 and the front main cart pivot axle 59 . the hitch 62 ( which can be varied in length ) is attached to the front main cart pivot axle 59 and extends forward . illustrated in fig1 & amp ; 19 is the adjustable length hitch , where an outside hitch tube 97 is incorporated in the design of the hitch 62 and internal hitch tube 98 can be extended or retracted to different lengths . the rear main cart pivot axle 58 can be attached in many ways to the main cart frame rails 65 , 66 . if using a design similar to this and using a front pivot , the main frame rails 65 , 66 should be mounted in a ridged way . shown in fig2 a frame cross member 133 helps support the main cart frame rails 65 , 66 . fig2 illustrates a necessity of design which is a belt tension assembly . this may be designed in a different way and placed in a different position . it serves to keep tension on the belts and to keep them guided between the wheels of the carriage . it should extend between the front and rear main cart pivot axles 58 , 59 . this illustration and design shows arms ( plates of steel ) extending from a round tube , and pin 132 extending through holes in the plate or round sleeve 140 a & amp ; b . this assembly is the external belt tension tube 134 . in the same manner , the internal belt tension tube 135 is built and pivots in hole or round sleeves on pin 111 which is attached to the front main cart pivot axle 59 . the arms of both the internal and external belt tension tubes 135 , 134 straddle the front and rear top tandem arms 120 , 121 . these tension tubes 134 , 135 do not have to straddle the top tandem arms 120 , 121 and may be placed on either side and may be pinned directly to the front and rear main cart pivot axles 58 , 59 . when the belts are tensioned , a clamp 136 or some type of stop must be placed on the section of internal tension tube 135 sticking out of or past the end of the external tension tube 134 . these tubes must be able to rotate inside each other to allow for the uneven movement up and down of the main cart pivot axles 58 , 59 . this cart design could be built using only one top and bottom tandem arm or two top and one bottom tandem arms with a single axle attached at the bottom of the top tandem arm . this would allow for a shorter cart base . when using only one top and bottom tandem arm , one main cart pivot axle would extend out and attach to a hub and spindle which would attach to both the inboard and outboard ( front or back ) wheels .

US-201414287794-A

a bandage for restricting movement of an arm of a person is disclosed . at least one body panel formed of an elastic breathable material , where the at least one body panel has a left end , a right end and a bottom end , where the left end has a first closure mechanism , where the right end has a second closure mechanism . the at least one body panel is configured to wrap around a torso of the person , where the first closure mechanism and the second closure mechanism connects to each other to hold the at least one body panel onto the torso of the person . a sleeve formed of an elastic breathable material coupled to the bottom end of the at least one body panel , where the sleeve is configured to receive an arm of the person , where the arm is held in place by the sleeve .

the presently preferred embodiments of the invention are described with reference to the drawings , where like components are identified with the same numerals . the descriptions of the preferred embodiments are exemplary and are not intended to limit the scope of the invention . fig1 a is a perspective view of an arm restricting bandage laid open . the arm restricting bandage 100 has a main body panel 102 that is made of a first body panel 101 , second body panel 103 and a third body panel 105 . even though there are three body panels 101 , 103 and 105 utilized in this invention there may be 1 , 2 , 4 , 5 , 10 up to 100 or more body panels that make up the main body panel 102 . the first body panel 101 , second body panel 103 and the third body panel 105 have a generally elongated rectangular shape when they are laid open as shown . in another embodiment of the invention , the first body panel 101 , second body panel 103 and third body panel 105 may have any shape such as a square shape , circular shape , triangular shape , elliptical shape or any type of shape . the main body panel 102 including first body panel 101 , second body panel 103 and third body panel 105 may be made of any suitable elastic or non - elastic , breathable material such as an ace bandage . ace is a registered trademark of 3m corporation having corporate headquarters in st . paul , minn . main body panel 102 , first body panel 101 , second body panel 103 and third body panel 105 are used for body core stabilization . core stabilization refers to the trunk of the body core being strong and able to support the rest of the muscles as they move . if the core is not stable because the muscles are weak , then one may lose balance more easily . the main muscles involved in core stability are the inner core muscles of the abdomen and pelvis . these muscles mostly support the spine and body while other muscles do the work of moving the rest of the body . first body panel 101 , second body panel 103 and third body panel 105 have a length in the range of 12 - 40 inches and a width in the range of 5 - 20 inches . the first body panel 101 has a left end 101 a , a right end 101 b , and a bottom end 101 c . second body panel 103 has a left end 103 a , a right end 103 b , a top end 103 c and a bottom end 103 d . bottom end 101 d is connected to the top end 103 c by stitching these two ends together . even though stitching is utilized to connect the bottom end 101 d to the top end 103 c any other method of connecting these ends together such as a hook / loop feature may be utilized . third body panel 105 has a left end 105 a , a right end 105 b , a top end 105 c and a bottom end 105 d . bottom end 103 d is connected to the top end 105 c by stitching these two ends together . left end 101 a , left end 103 a and left end 105 a all include a vertical strip 107 . right end 101 b , right end 103 b and right end 105 b all include a loop material 109 . even though stitching is utilized to connect the bottom end 103 d to the top end 105 c any other method of connecting these ends together such as a hook / loop feature may be utilized . a sleeve 111 is connected to the bottom end 105 d where the sleeve 111 is stitched to the bottom end 105 d of the third body panel 105 . the sleeve 111 has an opening 111 a that goes through the entire sleeve 111 where a person can insert his or her arm consisting of his or her hands , wrist and forearm through the sleeve 111 . opening 111 a has a range of 4 - 15 inches circumferentially from the bottom end 105 d to fit the hand , wrist and the forearm . this sleeve 111 includes a first portion 113 a , second portion 113 b , third portion 113 c and fourth portion 113 d elastic breathable bandages that are circularly connected to the bottom end 105 d to form the opening 111 a . first portion 113 a , second portion 113 b , third portion 113 c and fourth portion 113 d have a total length in a range of 6 - 16 inches to fit the hand , wrist and the forearm . the person can insert her arm into the sleeve 111 but she can still move her hand . sleeve 111 that holds the arm is sewn to the bandage of the third body panel 105 of the main body panel 100 on the body core so it only allows you to move the arm minimally away ( out , up and / down ) from the body where a sling does not limit the arm from moving it from your body . fig1 b is a perspective view of the arm restricting bandage of fig1 a in an overlapping position of the loop material disposed over the vertical strip . main body panel 102 is in an overlapping position where the left end 101 a left end 103 and left end 105 a include the vertical strip 107 . vertical strip 107 may be referred to as a first closure mechanism 107 . ( fig1 a ). in another embodiment of the invention , the vertical strip 107 may be a horizontal strip 107 of a hook material . the right end 101 b , right end 103 b and right end 105 b include the loop material 109 . ( fig1 a ). loop material may also be referred to as a second closure mechanism 109 . when the vertical strip 107 is connected with the loop material 109 in the overlapping position it becomes a hook and loop fastener such as the trademark velcro used to secure the main body panel 102 onto a torso 117 of a person 115 ( fig1 c ). velcro is a trademark of velcro usa , located at 406 brown avenue , manchester , n . h . 03103 . in another embodiment of the invention , any type of conventional fasteners may be used in place of the vertical strip 107 and the loop material 109 . fig1 c is an embodiment of the arm restricting bandage of fig1 b wrapped around a torso of a person in accordance with the invention . a person 115 has the arm restricting badge 100 wrapped around her torso 117 onto the side of the person 115 . person 115 would be an adult that can adjust the hook 107 and loop 109 material . person 115 would be able to place her arm 119 consisting of her hands , wrists and forearm through the opening 111 a of sleeve 111 where the hands , wrists and forearm would be immobilized in the sleeve 111 . fig1 d is an embodiment of the arm restricting bandage of fig1 b showing a back portion wrapped around a torso of a person in accordance with the invention . person 115 has the arm restricting bandage 100 wrapped around her torso 117 . the person 115 would be a child who would need another person to put the hook 107 on top of the loop 109 . on a back 121 of the person the hook 107 and 109 loop feature is shown . another person adjusts the hook 107 and loop 109 to comfortably fit around her torso 117 . fig2 a is a perspective view of another arm restricting bandage in a laid open position in accordance with the invention . the arm restricting bandage 200 has a main body panel 201 that has generally elongated rectangular shape when laid open as shown . in another embodiment of the invention , the main body panel 201 may have any shape such as a square shape , circular shape , triangular shape , elliptical shape or any type of shape . the main body panel 201 may be made of any suitable elastic or non - elastic , breathable material , such as an ace bandage . the main body panel 102 may be used for body core stabilization . main body panel 201 has a length in the range of 12 - 40 inches and a width in the range of 5 - 20 inches . left end 201 a includes a vertical strip 205 . right end 201 b includes a loop material 203 . the main body panel 201 has a left end 201 a , a right end 201 b , and a bottom end 201 c . a sleeve 211 is connected to the bottom end 201 c where the sleeve 211 is stitched to the bottom end 201 c of the main body panel 201 . the sleeve 211 has an opening 211 a that goes through the entire sleeve 211 where a person can insert his or her arm including hands , wrist and forearm through the sleeve 211 . opening 211 a has range of 4 - 15 inches circumferentially from the bottom end 201 c to fit the hand , wrist and the forearm in addition , this sleeve 211 includes a first portion 207 a and a second portion 207 b consisting of elastic breathable bandages that are circularly connected to the bottom end 201 c to form the opening 211 a . first portion 207 a and the second portion 207 b have a total length in a range of 6 - 16 inches to fit the hand , wrist and the forearm . sleeve 211 that holds the arm is sewn to the bandage of the main body panel 201 on the body core so it only allows you to move the arm minimally away ( out , up and / down ) from the body where a sling does not limit the arm from moving it from your body . fig2 b is a perspective view of the arm restricting bandage of fig2 a in an overlapping position of the loop material disposed over the vertical strip in accordance with the invention . main body panel 201 is in a wrapped position where the left end 201 a includes a vertical strip 205 . ( fig2 a ). vertical strip 205 may be referred to as a first closure mechanism 205 . in another embodiment of the invention , the vertical strip 205 may be a horizontal strip 205 or a hook material . the right end 201 b includes a loop material 203 . ( fig2 a ). loop material may also be referred to as a second closure mechanism 203 . when the vertical strip 205 is connected with the loop material 203 it becomes a hook and loop fastener such as the trademark velcro used to secure the main body panel onto a torso of a person . in another embodiment of the invention , any type of conventional fasteners may be used in place of the vertical strip 205 and the loop material 203 . as stated above , sleeve 211 includes the first portion 207 a and the second portion 207 b consisting of elastic breathable bandages that are circularly connected to the bottom end 201 c to form the opening 211 a . fig2 c is an embodiment of the arm restricting bandage of fig2 b wrapped around a torso of a person in accordance with the invention . a person 215 has the arm restricting badge 200 wrapped around her torso 213 . the person 215 would be able to place her arm 209 consisting of her hands , wrists and forearm through the opening 211 a of sleeve 211 where the hands , wrists and forearm would be immobilized in the sleeve 211 . also , the person 215 would be an adult that adjusts the hook 205 and the loop 203 material to comfortably fit on her torso 213 . fig2 d is an embodiment of the arm restricting bandage of fig2 b showing a back portion wrapped around a torso of a person . person 215 has the arm restricting bandage 200 wrapped around her torso 213 . on the back 217 of the person 215 the hook 205 and loop 203 feature is shown . another person would be able to adjust the hook 205 and loop 203 to comfortably fit around the torso 213 of the person 215 . the person 215 would be able to place her arm 209 consisting of her hands , wrists and forearm through the opening 211 a of the sleeve 211 where the hands , wrists and forearm would be immobilized in the sleeve 211 . this invention provides a simple and effective bandage and method to immobilize an arm of a person , such as the person &# 39 ; s hand , wrist and forearm . the bandage allows a person to simply immobilize a portion of his or her body that does not allow large movement of the arm away from the body . in addition , this bandage prevents a child from slipping her arm out of the bandage herself , while not causing his or her neck to be out of alignment . the person is able to utilize a flexible arm restricting bandage that is elastic , breathable and flexible so she can accomplish normal everyday tasks while still keeping her arm immobilized sufficient for it to heal properly . although the present invention has been described above in terms of specific embodiments , many modifications and variations of this invention can be made as will be obvious to those of ordinary skill in the art , without departing from its spirit and scope as set forth in the following claims .

US-201314043956-A

the present discussion generally describes a liquid fuel burning device such as an oil lamp having a reservoir for holding the liquid fuel and a flange substantially covering the liquid fuel holding area of the reservoir . the flange is sized and located to provide an opening between a perimeter of the flange and an inner surface of the reservoir . the opening permits a level of the liquid fuel to be monitored and / or checked during filling of the reservoir . thus , the chance of having an overflow of liquid fuel or an under - filled reservoir is substantially reduced . the flange is configured with a downward slope to allow liquid fuel to drain toward the opening , if liquid fuel gets on the flange during filling of the device .

in the following description , certain specific details are set forth in order to provide a thorough understanding of various embodiments of the invention . however , one skilled in the art will understand that the invention may be practiced without these details . in other instances , well - known structures associated with lamps ( e . g ., oil lamps ), lanterns , camping stoves , wicks , and other similar devices may not be shown or described in detail to avoid unnecessarily obscuring descriptions of the embodiments of the invention . unless the context requires otherwise , throughout the specification and claims which follow , the word “ comprise ” and variations thereof , such as , “ comprises ” and “ comprising ” are to be construed in an open , inclusive sense , that is as “ including , but not limited to .” the headings provided herein are for convenience only and do not interpret the scope or meaning of the claimed invention . fig1 shows an oil lamp 10 having a reservoir 12 and a lid 14 according to one illustrated embodiment . the reservoir 12 is bowl shaped with an inner surface 12 a and an outer surface 12 b . the inner surface 12 a forms a reservoir to receive fuel , for example a liquid fuel such as oil ( with or without fragrance ), citronella ( lemon odor ), citronellol ( rose - like odor ), or any other like fuel that is slow burning and permissible in a liquid - fueled lamp . the reservoir 12 has a rim 12 c that forms an opening to at an upper end thereof to receive liquid fuel . a flange 16 and a wick holder 18 are positioned within the reservoir 12 . the reservoir 12 can be made out of metal ( e . g ., stainless steel , aluminum , bronze , copper , etc . ), ceramic , or some other flame resistant , opaque material . the lid 14 and the flange 16 can be made out of the same or an equivalent material . in the illustrated embodiment , the reservoir 12 , lid 14 , and flange 16 are made out of stainless steel and the wick holder 18 is made from bronze . it is appreciated and understood that the reservoir 12 , the lid 14 , flange 16 , and wick holder 18 can vary in size and shape and the illustrated configuration is exemplary . the lid 14 may include a decorative handle 14 a to allow for easy removal and replacement of the lid 14 . when the oil lamp 10 is lit , the lid 14 can be used to cover the reservoir 12 and wick holder 18 to substantially starve the flame for oxygen and ultimately extinguish the flame . in addition , leaving the lid 14 on when the oil lamp 10 is not in operation helps keep the oil from evaporating . fig2 a shows the reservoir 12 of the oil lamp 10 with oil 20 that is filled to an oil level 20 a . in the illustrated embodiment , the reservoir 12 is approximately semi - hemispherical and configured with a substantially flat bottom surface 22 , which permits the oil lamp 10 to be placed in a stable configuration on a flat surface such as a coffee table , counter top , or shelf , for example . alternatively , the oil lamp 10 may be supported by a holder such as a wrought iron base , for example . the wick holder 18 is supported on the inner surface 12 a of the reservoir 12 . although the wick holder 18 can simply rest on the inner surface 12 a , such would not be as desirable as a wick holder 18 that is held stationary in the reservoir 12 . in the illustrated embodiment , the wick holder 18 is mechanically coupled with the reservoir 12 to keep the wick holder 18 at least temporarily fixed . there are a variety ways to fixedly or removably mechanical couple the wick holder 18 to the reservoir 12 , for example by complementary threads , complementary clipping elements , etc . the wick holder 18 includes a first protuberance 24 that complementarily recesses into a clip 26 extending from the reservoir 12 . the wick holder 18 can be snapped or twisted into place . in an alternate embodiment shown in fig2 b , the wick holder 18 and an inner ring 28 are configured with complementary , helical threads that permits the wick holder 18 to selectively be rotationally engaged and disengaged from the reservoir 12 . referring back to fig2 a , the wick holder 18 further includes a second protuberance 30 . the second protuberance 30 supports the flange 16 . the flange 16 is provided with an opening 16 a sized to fit around the perimeter of the wick holder 18 while not sliding down over the second protuberance 30 . in fig2 a and 2c , the flange 16 has a first height “ a ” and a second height “ b ,” both relative to the bottom surface 22 of the reservoir 12 . the first height “ a ” is greater than the second height “ b ,” which means that the flange 16 is configured to slope downward from its support location on the wick holder 18 toward the inner surface 12 a of the reservoir 12 . as shown in the illustrated embodiment , the flange 16 may even have a slight , concave curvature . the downward slope , with or without the curvature , encourages oil that is spilled onto or otherwise contacts the flange 16 to run off the flange and into the reservoir 12 . the flange 16 further includes an outer perimeter 16 b sized to fit within the reservoir 12 . in one embodiment , a cross - sectional area of the reservoir 12 , taken parallel to the horizontal , may continually increase as one follows the contour of the inner surface 12 a of the reservoir 12 upward . one skilled in the art will appreciate and understand that cross - sectional area of the reservoir 12 increases exponentially as a function of the diameter ( d ) of the inner surface 12 a ( area = π * d 2 / 4 ). the outer perimeter 16 b of the flange 16 is sized to form an opening or gap 32 with respect to the inner surface 12 a of the reservoir 12 . thus , the flange 16 will have a smaller radius and outer perimeter 16 b where the flange 16 is situated at a low elevation in the reservoir 12 , while the flange 16 will have a larger radius and outer perimeter 16 b where the flange 16 is situated at a high elevation in the reservoir 12 . in any case , the outer perimeter 16 b of the flange 16 is smaller than the perimeter of the inner surface 12 a of the reservoir 12 at a location on the inner surface 12 a opposed to the outer perimeter 16 b . the gap 32 is large enough to receive the oil 20 during the filling or refilling process without causing the oil 20 to substantially back - up when the oil 20 is poured into the reservoir 12 at reasonable rate . in one embodiment , the oil 20 is poured directly onto the flange 16 , but away from the wick holder 18 , where the oil 20 then runs down the flange 16 , through the gap 32 , and into the reservoir 12 . fig2 c illustrates an alternate embodiment in which an upper edge 18 a of the wick holder 18 is flush with an inner portion 16 c of the flange 16 . in other words , the wick holder 18 is truncated to be flush with the inner portion 16 c of the flange 16 . one advantage of the gap 32 is that it allows the level 20 a of the oil 20 to be observed during the filling / refilling process without removing the wick 34 or any associated components . it should be understood that the level 20 a may not be visible at all times during the refilling process , but as the level 20 a increases , the level 20 a will become observable through the gap 32 to a user pouring oil 20 into the oil lamp 10 . in addition , due to the increasing cross - sectional area of the reservoir 12 , as described above , the fill rate ( i . e ., the rate at which the level 20 a rises within the reservoir 12 ) actually decreases as long as a volumetric input rate of the oil 20 being added remains substantially constant during the filling or refilling process . hence , a user can refill the reservoir by adding oil 20 at a relatively constant rate with much less concern that the oil 20 will suddenly overflow the rim 12 c of the reservoir 12 . in short , observing the oil level 20 a through the gap 32 during the filling or refilling process significantly reduces the risk of both overflowing and under filling the reservoir 12 . another advantage is that the gap 32 provides a region around the flange 16 where the fragrance molecules of the oil 20 can be directly dispersed into the air . this eliminates the need for special diffusers or other devices . yet another advantage is that the gap 32 permits the reservoir 12 to be filled without removing the wick and / or without special tools . fig3 shows the wick holder 18 with wick material 34 placed in the wick holder 18 . the wick holder 18 includes a plurality of openings 36 to receive the oil 20 in the reservoir 12 . as previously discussed , the oil 20 wets the wicking material 34 through capillary action . the openings 36 can be located and spaced around the bottom portion of the wick holder 18 or can be formed in the wick holder 18 slightly above the bottom region . the openings 36 can also correspond and align with any openings that are formed in the clips 26 or inner ring 28 used to secure the wick holder with the reservoir 12 , as discussed above and illustrated in fig2 a , 2b , and 2 c . although specific embodiments of and examples for the oil lamp and method of filling the oil lamp are described herein for illustrative purposes , various equivalent modifications can be made without departing from the spirit and scope of the invention , as will be recognized by those skilled in the relevant art . the teachings can apply to any type of oil lamp or other lamp , lantern , or device that uses a combustible liquid for fuel . additionally , any method described above may include additional steps , omit some steps , and perform some steps in a different order than illustrated and / or otherwise described . the various embodiments described above can be combined to provide further embodiments . all of the above u . s . patents , patent applications and publications referred to in this specification are incorporated herein by reference . aspects of the invention can be modified , if necessary , to employ devices , features , and concepts of the various patents , applications and publications to provide yet further embodiments of the invention . these and other changes can be made to the invention in light of the above detailed description . in general , in the following claims , the terms used should not be construed to limit the invention to the specific embodiments disclosed in the specification and the claims , but should be construed to include all reusable card configurations and methods that operate in accordance with the claims . accordingly , the invention is not limited by the disclosure , but instead its scope is to be determined entirely by the following claims .

US-6006005-A

respiratory gas is humidified by flowing it along a flowpath at least a portion of whose wall is formed of a barrier material which is pervious to water vapor and impervious to water while the side of said wall opposite the flowpath is subjected to one or both of water and water vapor . production of such a flowpath can be accomplished by compressing and bonding together selected portions of a resilient , open - celled material which is disposed as a layer between layers of water impermeable material at least one of which layers is permeable by water vapor .

one major advantage of the invention is that it can be embodied in a wide variety of structural forms in which spacial orientation forms is not critical . one of those forms , a form now preferred , is shown in the figures of the drawing . it is shown in assembled condition , partly filled with water and is designated 10 in fig1 and 2 . the body of water is numbered 12 in fig2 . it is introduced into the unit at a &# 34 ; zip lock &# 34 ; seal 14 which is visible in fig1 . the packet 16 , which lies at the bottom of the body of water and through which water flows with ease , contains any selected one of the chemicals which reacts exothermaly with water . use of chemical heating is an optional feature of the invention . an alternative is to use an electric heater element either adjacent to the humidifier or within it . however , chemical heating is preferred . like the body of water the chemical container moves to the bottom of the unit in any orientation of the humidifier so it is always in water unless there is no water in which case there is no heating . thus the system is fail safe . the numeral 18 identifies the inlet tube , and the numeral 20 identifies the outlet tube , for respiratory gas . the other components of the unit are shown in fig3 , 5 and 6 . all are transparent in the preferred form . the front wall 22 and rear wall 24 are formed of pliant sheets of plastic . the inner side of those walls is shown in fig3 and 4 , respectively . the labyrinth assembly is seen in fig5 and 6 to comprise a rectangular sheet of plastic 26 whose lower edge is bonded at 28 over its entire length to the upper edge at the rear layer 30 of a foam sandwich 32 . the front layer of the sandwich is designated 34 and the intermediate foam layer is designated 36 . all of the components are formed of &# 34 ; medically safe &# 34 ; plastics which can be bonded by a convenient process such , for example , as sonic welding or radio frequency bonding . all are impervious to water . the walls of the sandwich member 32 , at least the rear wall 30 , are made of a gas permeable material through which water vapor flows with ease . the foam layer 36 is open celled such that it permits the flow of respiratory gas therethrough with little resistance . in this embodiment the sides 22 and 24 are formed of polyvinyl chloride . the foam 36 is an open celled , resilient polyurathane . open celled , resilient vinyl foam is equally useful . the rear face 30 of the foam sandwich is formed by a layer of porus teflon which may be bonded to the foam 36 at one side and is covered by a layer of polyester support material at its other side . the rectangular piece 26 is made of polyvinyl chloride material . it is possible by compressing the foam 36 and applying bonding energy along a given line or area , as by heating or ultrasonic welding , to form a barrier against the flow of gas through the foam 36 from one portion of the sandwich to another . that is done in the invention preferably by sonic welding . the sandwich 32 is compressed and welded , as best shown in fig8 along lines that define a labyrinth through which may flow from an inlet to an outlet . in this embodiment the weld lines 38 , 40 and 42 form a barrier to gas flow along the side and bottom edges of the foam sandwich 32 . vertical weld lines 44 and 46 divide the area of the sandwich into three parts . the legs 48 , 50 and 52 of the m - shaped weld line 54 extend into those three parts and divide them to confine flow to an inlet 56 for flow and a flowpath including five direction reversals to an outlet at 58 . the dashed lines across inlet 56 and outlet 58 represent the weld line 28 best shown in fig5 . the structure which results from formation of those weld lines , or bond lines if another bonding process is used , will permit a ready flow of respiratory gas along the labyrinth of foam . the outer wall or coating of porus plastic permits water vapor to flow into the foam passageway through the porus wall while precluding the flow of water into the foam passageway . respiratory gas can flow through the porus wall out of the passageway and that occurs until the partial pressure of respiratory gas outside the sandwich equals the partial pressure of that gas inside the flowpath . the sandwich structure is confined in a container for water which container is impervious to both gas and water . when the partial pressure of respiratory gas in the ullage space of the container rises to the partial pressure in the flowpath , no more respiratory gas escapes from the flowpath to the ullage space . that loss is insignificant because the water container is designed to contain all of that portion of the respiratory gas flowpath which has a gas pervious wall . in addition to containing the gas pervious part of the flowpath , the preferred embodiment of the invention provides an impervious port structure for conducting gas to and from the pervious portion of the path and the port structure is formed integrally with the water container . the subassembly 32 is placed on one of the water container walls 22 or 24 as shown in fig8 with the extension portion 26 at the side away from the water container wall , in this case wall 22 . it is placed such that the extension 26 overlies the portion of the container wall adjacent to , and below both sides of , the part 60 of the water container wall which is to be bonded to the inlet port tube . it is convenient to bond the subassembly 32 to the water container wall to insure the subassembly is properly positioned during the remainder of the assembly process . to that end the subassembly is bonded to the wall 22 in the step of forming the bond lines that define the flowpath labyrinth . thus , in this embodiment the subassembly 32 and wall 22 are joined along bond lines 38 through 54 as best shown in fig7 . the result is that the surface of the flowpath at the side toward wall 22 is foreclosed from exposure to the water and ullage space of the water container in the final assembly . in alternate designs the subassembly is bonded to the water container walls only at extension 26 or not at all prior to final assembly . assembly is completed by positioning inlet and outlet tubes 18 and 20 so they overlie parts 60 and 62 , respectively , of wall 22 . tube 18 is placed between wall 22 and the extension 26 . the other wall 24 of the water container is placed over wall 22 and the tubes 18 and 20 and subassembly 32 edge to edge with wall 22 . the margins of walls 22 and 24 are bonded to the inlet and outlet tubes and to the upper margin of extension 26 and to one another , except at the &# 34 ; zip lock &# 34 ; area 14 to form a container for water which is sealed when the &# 34 ; zip lock &# 34 ; is closed . the marginal bond is numbered 64 in the drawing at fig1 . in addition , the walls 22 and 24 and extension are bonded together at lines 66 , 68 , 70 and 72 in fig1 . those bond lines extend from the marginal bond 64 to the bond line 28 by which the foam sandwich is fixed to extension 26 . another bond line 74 extends from marginal bond 64 to bond line 28 and joins wall 22 to wall 24 . those several bond lines divide the upper portion of the final assembly into a compartment 76 which defines a flow path from inlet tube 18 to the labyrinth inlet 56 and a compartment 78 which defines a flowpath from the labyrinth outlet 58 to outlet tube 20 . walls 22 and 24 form the walls of compartment 78 . wall 22 and extension 26 form the walls of compartment 76 . water and the heater chemical , if any , are introduced into the water container at &# 34 ; zip lock &# 34 ; 14 . when closed the &# 34 ; zip lock &# 34 ; forms a seal against loss of water or gas . there is a complete exclusion of water from the respiratory gas flowpath . those factors , coupled with the fact that the ullage space in the water container will be filled with water vapor and the fact that water vapor passes through the porus wall of the labyrinth both from the water and from the ullage space , permit humidification of respiratory gas which flows along the flowpath efficiently and in equal degree regardless of the spacial orientation of the unit or the amount of water in the container except when the container is empty of water . because the water and any heater chemical will move together to the lowest part of the container in any orientation , the chemical is simply inserted into the container . no mounting or special placement is required . because the labyrinth wall is impervious to bacteria , there is no requirement that the water be sterilized . the only real limitation is that the reaction of the heater chemical with water produce no substance which is both harmful and capable of penetrating into the respiratory gas flowpath . it will be apparent that the flowpath need not be a labyrinth of the shape shown or even a labyrinth . the only requirement is that the gas be exposed to a gas permeable section of flowpath long enough to insure mixture with enough water vapor to achieve the desired degree of humidification . the physical form is not critical . none the less , formation of the gas permeable flowpath by compressing and bonding a layer of open - celled material to water impermeable outer layers at least one of which is gas permeable offer distinct functional and cost advantages including the advantage that those flowpath materials may be readily bonded to materials that are well suited for the construction of the water container and flow port structures . one of the other special features of the invention is that it permits construction of humidifiers with materials that are flexible to the point of being pliant . that simplifies problems in packaging , storage , mounting and disposal . in accordance with the rules , the best mode now known for practicing the invention has been shown in the accompanying drawing and described in the specification above . however , it is to be understood that other embodiments and variations of the invention are possible and that the invention is to be limited by what is defined in the appended claims rather than by what has been shown .

US-7254387-A

a cutting blade holder for a microsurgical cutting arrangement , in particular a cutting arrangement for refractive eye surgery , comprises a receptacle into which a cutting blade unit together with a cutting blade can be inserted . for the sideways guidance of the cutting blade unit in the receptacle the cutting blade holder comprises guide means , which in one embodiment include a plurality of guide bars arranged on both sides of the plane of the blade of the cutting blade , by means of which a relatively friction - free linear contact with the cutting blade is produced .

the cutting blade holder shown in section in fig1 , and generally identified there by the reference numeral 10 , is movably guidedly held or can be held in a manner known per se on a suction ring unit of an ophthalmological microkeratome , which is not shown in more detail . after the suction ring unit has been placed on the eye to be operated on and held there under suction by means of a vacuum , the cutting blade holder can be moved by means of an electric motor drive , likewise not shown in more detail , in a feed direction over the cornea of the eye , whereby a cutting blade 12 ( in particular fig2 ) separates a surface flap from the cornea . as can be seen in fig2 , the cutting blade 12 is part of a cutting blade unit 14 , which includes in addition to the actual cutting blade 12 an attachment 16 on one of the flat sides of the blade . the attachment 16 is firmly connected to the cutting blade 12 , preferably by an interlocking - type or frictional - type connection . a material - to - material connection using an adhesive is also conceivable . the attachment 16 simplifies the manipulation of the cutting blade unit 14 . on its upper side remote from the blade the attachment has an elongated depression 18 , in which an eccentric pin of a drive shaft of the aforementioned electric motor drive engages during operation of the microkeratome . the cutting blade unit 14 on rotation of the motor drive shaft is thereby caused to execute laterally oscillating movements ( transverse to the feed direction ), which improves the cutting action . the cutting blade 12 forms a cutting edge 20 on a straight front blade edge . blunt lateral blade edges 22 adjoin the front blade edge and transform in the rear region of the cutting blade 12 into a rear blade edge 24 . the rear blade edge 24 is designed having two rounded bearing sections 26 , 28 spaced apart from one another , between which is arranged a blade edge section 30 that is set back . the cutting blade holder 10 comprises a base body 32 , in which is formed a receptacle shaft 34 for the cutting blade unit 14 . the receptacle shaft 34 is open on one side of the cutting blade holder 10 , so that the cutting blade unit 14 can be inserted , transversely to the longitudinal direction of the blade ( the longitudinal direction of the blade runs in this connection between the cutting edge 20 and the rear blade edge 24 ), into the receptacle shaft 34 and can be removed therefrom after use . the receptacle shaft 34 has two slit - shaped sections 36 , 38 , between which is located an enlarged section 40 . when the cutting blade unit 14 is inserted into the receptacle shaft 34 the attachment 16 extends into the enlarged section 40 , while the blade regions in front and behind the attachment 16 extend into the slit - shaped shaft sections 36 , 38 . if the cutting blade unit 14 is inserted correctly into the receptacle shaft 34 , as indicated by the dotted lines in fig1 , then the cutting blade 12 with its cutting edge 20 projects from the cutting blade holder 10 . at the same time the cutting blade 12 with its rear edge sections 26 , 28 is supported on a guide bearing bar 42 held in the base body 32 . the guide bearing bar 42 shown by way of example in fig1 and 2 has a circular cross - section and with its outer circumferential surface consequently forms a convex guide bearing surface for the sections 26 , 28 of the rear blade edge 24 . in order to provide a convex , arcuately curved guide bearing surface the guide bearing bar 42 can also have a cross - sectional shape other than a circular shape , and can for example be elliptical or oval . on account of the rounded shape of the bearing sections 26 , 28 the contact between the cutting blade and the guide bearing bar 42 is virtually punctiform . this ensures a particularly low degree of friction when the cutting blade 14 oscillates laterally during operation of the microkeratome . the small amount of friction is also promoted by the convex shape of the guide bearing surface formed by the guide bearing bar 42 . instead of an arcuately curved contour of the guide bearing surface , it is even conceivable for the guide bearing surface to have an approximately cone - shaped contour seen in a cross - section perpendicular to the transverse direction of the blade . this possibility will be discussed again at a later point . in fig2 it can be seen that the attachment 16 is designed with two spring tongues , which are intended and designed to co - operate with a front boundary wall 46 of the enlarged shaft section 40 . the spring tongues 44 pretension the cutting blade unit 14 in the rearwards direction , i . e . against the guide bearing bar 42 , when the cutting blade unit 14 is correctly inserted into the receptacle 34 . an undercut t - shaped groove 48 , with which an actuating rod ( not shown in more detail ) can be brought into feed - transmitting and tensile force - transmitting engagement , is formed on the side of the attachment 16 , which for example can be injection moulded from plastics material but can also be made from metal or a ceramic material . by means of such an actuating rod the cutting blade unit 14 can be inserted without any problem into the receptacle 14 and / or removed from the latter . in the embodiment illustrated in fig1 and 2 , two pairs of guide bars 50 , 52 and 54 , 56 , which are incorporated in the base body 32 of the blade cutting holder 10 parallel to the guide bearing bar 42 , i . e . in the direction of the lateral oscillation of the cutting blade unit 14 , serve for the relatively low - friction but at the same time precise guidance of the cutting blade 12 in its oscillatory movement . the guide bars 50 - 56 form in each case a guide formation within the meaning of the invention and , like the guide bearing bar 42 , are made of a particularly abrasion - resistant material , which has a greater hardness than the material of the base body 32 . preferably the bars 42 and 50 - 56 are hard metal bars . the base body 32 of the cutting blade holder can on the other hand be made for example of stainless steel or titanium . the guide bars 50 - 56 are arranged in the region of the slit - shaped shaft sections 36 , 38 specifically in such a way that with each of these slit - shaped sections 36 , 38 there is associated a pair of bars lying substantially opposite one another . although it is not immediately clear from fig1 , the guide bars 50 - 56 on part of their circumference extend to some extent into the slit - shaped shaft sections 36 , 38 , so that the cutting blade 12 comes into contact on its flat sides alone with the outer circumferential surfaces of the guide bars 50 - 56 , but not with the upper and lower boundary walls of the slit - shaped shaft sections 36 , 38 . the contact between the guide bars 50 - 56 and the flat sides of the cutting blade 12 is in this case linear in the technical sense ( in contrast to a planar bearing ), which ensures a low degree of friction . as fig1 and 2 show , one pair of guide bars , namely the pair 54 , 56 , is arranged behind the attachment 16 of the cutting blade 12 , while the other pair of bars , i . e . the pair 50 , 52 , is arranged in front of the attachment 16 . the bars 50 - 56 and also the guide bearing bar 42 can be inserted in correspondingly shaped channels of the base body 32 . to produce the aforementioned linear contact with the cutting blade 12 , the guide bars 50 - 56 have convex guide surfaces , which project into the slit - shaped shaft sections 36 , 38 . in the example illustrated in fig1 and 2 the guide bars 50 - 56 are designed so as to form these convex guide surfaces with a circular cross - section . it is understood that other cross - sectional shapes can be chosen for the guide bars 50 - 56 , so long as they have a convex shape in the bearing region of the cutting blade 12 . for example , an elliptical or oval cross - sectional shape can be chosen for the guide bars 50 - 56 ; they can however also have a cone - shaped cross - sectional contour in the region of the contact with the cutting blade 12 . in a modification of the embodiment shown in fig1 and 2 , the base body 32 itself can be designed having ribs formed in one piece , which replace the segments of the guide bars 50 - 56 projecting into the slit - shaped shaft sections 36 , 38 . also , the convex guide bearing surface formed from the guide bearing bar 42 for the rear blade edge 24 of the cutting blade 12 can if required be formed in one piece on the base body 32 . the provision of separate bars for the guidance of the cutting blade 12 is however advantageous insofar as the bars can be replaceably incorporated in the cutting blade holder 10 , so that individual rods can be replaced when worn out . reference will now be made to the modifications shown diagrammatically in fig3 to 5 . in these figures components having the same effect are identified by the same reference numerals as before , but with the addition of a lower case letter . in a variant of fig3 the guide bars 50 a - 56 a as well as the guide bearing bar 42 a are formed in each case having a cone - shaped contour in the region of the contact with the cutting blade 12 a . apart from the cross - sectional shape of the bars illustrated in this figure , the bars can for example also have a triangular or rectangular cross - sectional shape . fig4 and 5 show variants in which several guide formations for the cutting blade are formed in each case on a common guide body . in fig4 two guide plates 58 b , 60 b are arranged above and below the cutting blade 12 b . the guide plates 58 b , 60 b replace the guide bars 50 - 56 of the embodiment shown in fig1 and 2 . the plates are designed with rib - shaped guide bearing sections 62 b on their plate side facing towards the cutting blade 12 b , these sections appearing round when viewed as in fig4 , i . e . viewed in a cross - section transverse to the transverse direction of the blade . on account of the round contour of the guide bearing sections 62 b an approximately linear contact with the flat sides of the cutting blade 12 b is in turn formed . in the variant of fig4 the two guide plates 58 b , 60 b have in each case a total of three guide bearing sections 62 b , these sections lying opposite one another in pairs . the guide plates 58 b , 60 b can for example be inserted in suitable recesses of the base body of the cutting blade holder . the variant of fig5 differs from that of fig4 in that the guide plates 58 c , 60 c comprise in each case only two guide bearing sections 62 c , and that these guide bearing sections 62 c have a cone - shaped contour in the contact region with the cutting blade 12 c . it is understood that embodiments are also conceivable in which one or more guide bars are provided on one side of the cutting blade , while a guide body is provided on the other side of the cutting blade , the said body carrying a plurality of guide formations arranged space apart from one another , such as for example the guide plates of fig4 and 5 . also , in the embodiment of fig6 and 7 identical components or components having the same effect are again identified with the same reference numerals as before , but in each case with the addition of a lower case letter d . in this embodiment the cutting blade holder 10 d is provided on both sides of the plane of the cutting blade 12 d with in each case a plurality of guide ribs 62 d , which run parallel to one another and extend in the transverse direction of the blade . the guide ribs 62 d are , as can readily be seen in fig6 , arranged alternately on both sides of the plane of the blade , and in fact in such a way that a guide rib 62 d on one side of the plane of the blade lies substantially centrally between two guide ribs 62 d on the other side of the plane of the blade . the guide ribs 62 d can be formed in one part with the base body 32 d of the cutting blade holder 10 d . alternatively , the guide ribs 62 d can be formed on separate guide bodies , which are mounted on the base body 32 d . these guide bodies can be joined to the base body 32 d in a permanent manner , for example by bonding or pressing in . it is however also conceivable to attach the base bodies in a replaceable manner to the base body 32 d , so that they can be replaced due to wear . as already mentioned above in connection with the variants of fig4 and 5 , such guide bodies can for example be in the form of thin plates , from which the guide ribs stand proud in one piece . in fig7 , in which the cutting blade 12 d is indicated by dotted lines in a middle position , it can be seen that the length of the guide ribs 62 d is less than the width of the cutting blade 12 d . the lateral oscillation stroke of the cutting blade 12 d is in this connection adjusted so that the lateral blade edges 22 d do not reach beyond the guide ribs 62 d in the cutting operation of the blade . in this way a potential chip abrasion on the side edges 22 d of the blade can be avoided . for the sake of completeness it should be mentioned that , in the illustration of fig7 , the lower part of the base body 32 d recognisable in fig6 has been omitted for the sake of clarity .

US-6359206-A

photosensitive compounds for use in a method of treating a disease or condition are described . the photosensitive compounds have the formula r — y , wherein r is a ruthenium complex and y is at least one sulphur - containing photoreleasable group , and the compounds comprise at least one ruthenium - sulphur bond ; or a pharmaceutically acceptable salt , solvate , ester or amide , such that upon influence of visible or near infra - red light in vivo , said at least one ruthenium - sulphur bond is broken , thereby generating a pharmacologically active compound .

herein , we consider ligand photosubstitution reactions of [ ru ( terpy )( bpy )( y )] 2 + complexes at the water - bilayer interface of a liposome . by covalent linkage of a monodentate ligand y ( here a thioether ) to a membrane intercalator like 3β , 5α - cholestanol , and coordination of the sulfur ligand to ruthenium , liposomes are decorated with ruthenium complexes , which can be cleaved from the bilayer by visible light irradiation . acetone was dried on potassium carbonate and distilled prior to use . kno 3 was used as a saturated aqueous solution , aqueous kpf 6 was 40 g · l − 1 . 1 h ( 300 . 1 / 400 . 0 mhz ) and 13 c ( 75 . 5 / 100 . 6 mhz ) nmr spectra were recorded on a varian inova 300 mhz or 400 mhz spectrometer ; 31 p { 1 h } ( 121 . 5 mhz ) and 19 f ( 376 mhz ) nmr spectra were recorded on a varian inova 400 mhz spectrometer . chemical shift values are reported in ppm ( δ ) relative to me 4 si ( 1 h and 13 c nmr ). ms measurements were carried out on an applied biosystems voyager de - str maldi - tof ms . elemental analyses were performed by h . kolbe microanalysis laboratories , wilheim , germany . uv - vis absorption spectra were taken on a cary 5 spectrophotometer from varian . for column chromatography , merck silica gel 60 ( 230 - 400 mesh ) was used . all standards reagents were purchased from acros organics and aldrich chemical co . inc , and used as received . [ ru ( terpy )( bpy )( oh 2 )]( bf 4 ) 2 13 and [ ru ( terpy )( bpy )( cl )]( cl ) 13 were obtained as described in the literature . cholesterol , bromoacetylchloride , sodium thiomethoxide , acetic acid were from commercial sources and used as received . 1 , 2 - dimyristoyl - sn - glycero - 3 - phosphoglycerol ( dmpg ) and 1 , 2 - dimyristoyl - sn - glycero - 3 - phosphocholine ( dmpc ) were obtained from avanti polar lipids and stored at − 18 ° c . a chloride - free buffer solution was prepared by mixing kh 2 po 4 ( 313 mg , 2 . 3 mmol ), k 2 hpo 4 . 3h 2 o ( 593 mg , 2 . 6 mmol ), k 2 so 4 ( 849 mg , 4 . 87 mmol ) in a 500 ml volumetric flask and dissolving with milliq water ( ph = 7 . 03 at 23 ° c .). all photosensitive solutions were protected from light by aluminum foil . compound 2 was obtained by hydrogenation of cholesterol . to a solution of 1 ( 7 . 73 g , 20 mmol ) in tetrahydrofuran ( 20 ml ) were added palladium on charcoal ( 400 mg , 10 %) and acetic acid ( 1 . 7 ml ). this mixture was transferred in a parr apparatus and subjected to hydrogenation at 60 ° c . under 5 bars of h 2 until consumption of h 2 ceased (˜ 45 min ). the cooled mixture was filtered on celite , the celite washed twice with thf ( 30 ml ), the gathered organic phase evaporated to dryness , and the crude product recrystallized from hot hexane ( 30 ml ) down to 4 ° c . to give 5α - cholestan - 3β - ol ( compound 2 , 5 . 90 g , 76 %). to a solution of 2 ( 5 . 90 g , 15 . 2 mmol ) in dry tetrahydrofuran ( 100 ml ) was added bromoacetylchloride ( 4 . 5 ml , 53 . 1 mmol ). the solution was heated to reflux for 2 h , the solvent evaporated on a rotary evaporator , and the minimum amount of hot hexane was added to dissolve the crude product . after cooling down to room temperature the hexane solution was left in the fridge overnight to yield after filtration and drying bromoacetyl 5α - cholestan - 3β - oate as a pale green crystalline solid ( compound 3 , 5 . 48 g , 71 %). 1 h nmr ( 400 mhz , δ in cdcl 3 ): 4 . 75 ( m , 1h , choco ), 3 . 79 ( s , 2h , ch 2 br ), 1 . 97 ( dt , 1h , j 3 . 3 , 12 . 4 ), 1 . 90 - 0 . 90 ( m , 29h ), 0 . 89 ( d , 3h , j 6 . 5 ), 0 . 87 ( d , 3h , j 6 . 6 ), 0 . 85 ( d , 3h , j 6 . 6 ), 0 . 82 ( s , 3h ), 0 . 65 ( s + m , 4h ). 13 c nmr ( 101 mhz , δ in cdcl 3 ): 166 . 92 , 77 . 48 , 77 . 16 , 76 . 84 , 76 . 13 , 56 . 54 , 56 . 41 , 54 . 32 , 44 . 76 , 42 . 73 , 40 . 11 , 39 . 66 , 36 . 80 , 36 . 31 , 35 . 94 , 35 . 60 , 35 . 58 , 33 . 83 , 32 . 10 , 28 . 72 , 28 . 38 , 28 . 15 , 27 . 35 , 26 . 58 , 24 . 34 , 23 . 98 , 22 . 96 , 22 . 71 , 21 . 36 , 18 . 82 , 12 . 37 , 12 . 21 . esi ms exp ( calc ): 531 . 26 ( 531 . 28 , [ m + na ] + ), 1041 . 4 ( 1041 . 6 , [ 2m + na ] + ), 1551 . 4 ( 1551 . 9 , [ 3m + na ] + ). c , h , n exp : 68 . 45 / 9 . 75 / 0 . 00 ; calc : 68 . 35 / 9 . 69 / 0 . 0 for c 29 h 49 bro 2 . compound 3 ( 1 . 02 g , 2 . 0 mmol ) and sodium thiomethoxide ( 289 mg , 4 . 12 mmol ) were weighed in a round - bottom flask and put under n 2 . dry tetrahydrofuran ( 50 ml ) was cannulated under n 2 and the suspension was heated to reflux for 2 h . thf was removed under vacuum , 100 ml of water were added and the product extracted with et 2 o ( 3 × 75 ml ). the combined ether fractions were washed with water , brine , dried with mgso 4 , filtered and evaporated to dryness . column chromatography on silica gel ( 200 ml ) using pentane : dichloromethane mixtures ( 8 : 3 to 1 : 1 ) afforded ligand 4 as a white solid ( 785 mg , 82 %). 1 h nmr ( 400 mhz , δ in cdcl 3 ): 4 . 74 ( m , 1h , 3α ), 3 . 14 ( s , 2h , sch 2 o ), 2 . 20 ( s , 3h , ch 3 s ), 2 . 0 - 0 . 93 ( m , 25h ), 0 . 89 ( d , 3h ), 0 . 85 ( dd , 6h ), 0 . 82 ( s + m , 4h ). 13 c nmr ( 100 . 6 mhz , δ in cdcl 3 ): 169 . 95 ( coo ), 74 . 93 ( ch α o ), 56 . 54 , 56 . 41 , 54 . 34 , 44 . 80 , 42 . 72 , 40 . 11 , 39 . 65 , 36 . 86 , 36 . 30 , 36 . 15 , 35 . 93 , 35 . 60 , 34 . 09 , 32 . 12 , 28 . 74 , 28 . 38 , 28 . 14 , 27 . 58 , 24 . 34 , 23 . 98 , 22 . 96 , 22 . 70 , 21 . 35 , 18 . 81 , 16 . 37 , 12 . 38 , 12 . 21 . esi ms exp ( calc ): 499 . 355 ( 499 . 359 , [ m + na ] + ), 975 . 67 ( 975 . 72 , [ 2m + na ] + ), 1451 . 8 ( 1452 . 1 , [ 3m + na ] + ). c , h , n exp : 75 . 69 / 11 . 00 / 0 . 00 ; calc 75 . 57 / 10 . 99 / 0 . 0 or c 30 h 52 o 2 s . [ ru ( terpy )( bpy )( cl )]( cl ) ( 150 mg , 0 . 27 mmol ) and ligand 4 ( 138 mg , 0 . 29 mmol ) were weighed in a round - bottom flask and put under n 2 . dry , degassed acetone was added ( 20 ml ), and an acetone solution of agbf 4 ( 113 mg , 0 . 58 mmol ) was cannulated under n 2 . the reaction mixture was heated at reflux overnight ( 16 h ), cooled to room temperature , filtered over celite , and acetone removed under vacuum . the crude product was purified by chromatography on silica gel ( 200 ml ) using an acetone / water / kno 3sat mixture ( 100 : 10 : 1 ). the bright orange fraction was collected , 50 ml of aqueous kpf 6 were added , acetone was removed on a rotary evaporator , and the precipitate filtered on glass filter , washed thoroughly with water , et 2 o , and dried under vacuum . yield : 94 mg of compound 4 as a bright orange solid ( 50 %). 1 h nmr ( 400 mhz , δ in acetone - d 6 ): 10 . 1 ( dd , 1h , a2 ), 8 . 94 ( d , 3h ), 8 . 74 ( d , 2h ), 8 . 71 ( d , 1h ), 8 . 52 ( m , 2h ), 8 . 20 ( m , 3h ), 8 . 01 ( m , 3h ), 7 . 53 ( m , 3h ), 7 . 31 ( m , 1h ), 4 . 45 ( m , 1h , ch α o ), 3 . 00 ( s , 2h , sch 2 o ), 1 . 62 ( s , 3h , ch 3 s ), 2 . 02 - 0 . 82 ( m , 39h ), 0 . 78 ( s , 3h ), 0 . 67 ( s + m , 4h ). 13 c nmr ( 100 . 6 mhz , δ in acetone - d 6 ): 166 . 9 , 159 . 1 , 158 . 4 , 157 . 74 , 157 . 66 , 154 . 7 , 153 . 3 , 150 . 9 , 140 . 0 , 139 . 3 , 138 . 2 , 129 . 5 , 128 . 7 , 128 . 3 , 126 . 1 , 125 . 7 , 125 . 4 , 124 . 9 ( 18 c arom ), 76 . 5 ( ch 2 o ), 57 . 28 , 57 . 15 , 55 . 01 , 45 . 24 , 43 . 35 , 40 . 84 , 40 . 23 , 37 . 24 , 36 . 92 , 36 . 89 , 36 . 58 , 36 . 25 , 36 . 08 , 34 . 52 , 32 . 69 , 29 . 22 , 28 . 89 , 28 . 67 , 27 . 95 , 24 . 83 , 24 . 51 , 23 . 06 , 22 . 82 , 21 . 89 , 19 . 07 , 15 . 58 , 12 . 46 , 12 . 41 ( sme + 27 c alkyl ). 19 f nmr ( 376 . 3 mhz , δ in acetone - d 6 ): − 72 . 9 ( d , j f - p = 707 . 8 hz ). uv - vis : λ max in nm ( ε in cm · m − 1 ): 454 ( 7760 ), 328 ( 15900 ), 332 ( 15900 ). esi ms exp ( calc ): 483 . 709 ( 483 . 719 for c 57 h 75 n 5 o 3 rus , [ m - 2pf 6 ] 2 + ). c , h , n exp : 52 . 59 / 5 . 69 / 5 . 32 ; calc : 52 . 54 / 5 . 69 / 5 . 57 for c 55 h 71 f 12 n 5 o 2 p 2 rus . aliquots of phospholipids ( 0 . 00 □ mmol ) and ligand 4 or complex [ 5 ]( pf 6 ) 2 ( 1 - 25 mol %, see table 1 ) were mixed from chloroform stock solutions and dried under a flow of nitrogen for a few hours . they were subsequently placed under vacuum to remove traces of chloroform . then the lipid mixtures were hydrated in a chloride - free buffer containing 10 mm of phosphates and 40 mm of k 2 so 4 ( total ionic strength 50 mm ), at ph = 7 . 0 . the final concentration of the lipids was 2 . 5 mm . the lipid suspensions were freeze - thawed ten times ( from liquid n 2 temperature to + 50 ° c . ), and then extruded ten times ( at + 50 ° c .) through 200 nm polycarbonate filters . the vesicle - containing samples were conserved in the dark at 4 ° c . and used within 5 days . vesicle size was determined by dynamic light scattering in a zetasizer ( malvern instruments ltd ., u . k . ), operated at a wavelength of 633 nm . white light irradiations were performed using the 150 w halogen lamp of a microscope ; the sample to irradiate was placed in a water bath at 25 ° c . to filter ir and uv radiations , and the reaction was followed by uv - vis spectroscopy . for quantum yields determination the continuous beam of a 1000 w xenon arc lamp from lot was filtered by a water filter of 15 cm diameter followed by an andover 452fs10 - 50 interference filter from lot oriel ( λ ex = 452 nm ). 3 ml samples containing the vesicles ( 1 . 25 mm ) functionalized with 5 mol % of [ 5 ]( pf 6 ) 2 were put in a closed , uv - vis quartz cell ( path length : 1 cm ) under an air atmosphere , and stirred in a water bath at 25 ° c . under these conditions , a light intensity of 6 . 4 ( 3 )· 10 − 8 einstein · s − 1 was measured using standard ferrioxalate actinometry ( see supporting information ). 14 the extinction coefficients of [ ru ( terpy )( bpy )( oh 2 )] 2 + at the excitation wavelength ( 452 nm ), and in presence of the ligand - functionalized vesicles , were determined by adding known amounts of the complex to vesicle solutions containing 5 mol % of ligand 4 ( values found : ε 452 = 10800 cm · m − 1 for dmpg and 9750 cm · m − 1 for dmpc ). from the evolution of the uv - vis spectra of the vesicle - containing solution , the variation of c t , the concentration in complex [ 5 ] 2 + , was determined as a function of irradiation time t , and a linear regression of ln ( c t / c 0 ) as a function of t gave a pseudo first - order rate constant of 2 . 34 · 10 − 3 s − 1 for dpmg , and 2 . 27 · 10 − 3 s − 1 for dpmc . the quantum yield for the photosubstitution of ligand 4 by h 2 o at vesicles was calculated to be 0 . 0074 ( 8 ) for dmpg and 0 . 0073 ( 8 ) for dmpc . the uv - visible spectrum of a freshly prepared vesicle sample was first measured between 250 and 800 nm . 1 . 0 ml of the sample was ultracentrifuged at 25 ° c . and 100 krpm ( rcf 35 500 g ) for one hour . 0 . 70 ml of the supernatant was pipetted out , and its uv - visible , spectrum was measured . the lipid content of the supernatant was measured by a rouser assay 15 after bligh and dyer extraction . 16 the bligh and dyer method was used to extract the phospholipids from the aqueous phase as follows : to each sample ( 0 . 4 ml ) was added methanol ( 1 . 2 ml ) and chloroform ( 0 . 5 ml ), and the mixture was homogenized . it was then extracted 3 times by adding chloroform ( 0 . 5 ml ), mixing , centrifugation at 3000 rpm ( rcf 1620 g ) for 3 min , and removal of the chloroform phase . the combined organic fractions were evaporated under a flow of n 2 for one hour , and dried under vacuum for 30 min . the rouser assay consists of a spectrophotometric titration of the phosphate concentration using a molybdate salt : each extracted sample was decomposed with hclo 4 ( 0 . 3 ml , 70 - 72 %) at 180 ° c . for 1 h . after cooling of the samples to room temperature water ( 1 ml ) was added , followed by ammonium heptamolybdate ( 0 . 4 ml , 1 . 25 % w / v ) and ascorbic acid ( 0 . 4 ml , 5 % w / v ), and the samples were cooked 5 min in boiling water , using marbles as stoppers to prevent evaporation . the absorbance of the solution at 797 nm was measured and compared to a calibration curve obtained using 6 samples containing 0 , 10 , 20 , 30 , 40 , 50 nmol of phosphate and prepared in exactly the same conditions . typical linear regression coefficients r 2 = 0 . 9997 were found , and the amount of lipids found in the supernatant after ultracentrifugation was calculated accordingly . the three - step synthesis of ligand 4 is shown in scheme 6 : hydrogenation of cholesterol was achieved first , followed by esterification with bromoacetylchloride , and nucleophilic substitution of the bromide by a methanethiolate group . coordination of 4 to ruthenium was realized by reacting it with [ ru ( terpy )( bpy )( cl )]( cl ) in presence of 2 equivalents of agbf 4 in acetone , followed by column chromatography ( see scheme 7 ). anion exchange using kpf 6 in excess yielded the water - insoluble orange complex [ 5 ]( pf 6 ) 2 , which was characterized by 1 h , 19 f and 13 c nmr , mass spectrometry ( esi - ms ), elemental analysis , and uv - visible spectroscopy . coordination of the sulfur atom of 4 to the ruthenium atom in complex [ 5 ]( pf 6 ) 2 is characterized by an absorption maximum at 454 nm in acetone , 17 as well as by a low - field shifted doublet for the a2 proton on the bipyridine in 1 h nmr spectroscopy ( δ = 10 . 1 ppm in acetone - d 6 , see scheme 7 for notations ). 18 large unilamellar vesicles ( luvs ) including 1 mol % of either complex [ 5 ]( pf 6 ) 2 or ligand 4 , were prepared as described in the experimental part . eight types of samples were prepared as indicated in table 1 . although [ 5 ]( pf 6 ) 2 is not water - soluble , upon incorporation into the vesicles transparent yellow suspensions were obtained for sample c and f ( i . e ., those containing 1 mol % of [ 5 ]( pf 6 ) 2 ). the uv - visible spectrum of the vesicle solutions showed the characteristic weak 3 mlct absorption bands of [ 5 ] 2 + in the visible region ( absorption maximum at 450 nm ), and several more intense bands in the uv region . the size distribution of the vesicles was measured by dynamic light scattering ( see table 1 ). a narrow distribution centered between 140 nm and 180 nm was obtained , which is consistent with the nominal size of the filter holes used in the preparation ( ø 200 nm ). in order to obtain more insight into the morphology of the vesicles , cryo - transmission electron microscopy ( cryo - tem ) was performed by vitrification above t m on samples a - f ( see fig2 ). with anionic lipids ( dmpg , samples a - c ) a relatively low concentration of vesicles was observed on the negatively charged support , probably due to repulsive electrostatic interactions . samples of type a and b contained only unilamellar vesicles with a size compatible with dls measurements (˜ 150 nm ). sample c also contained unilamellar vesicles , but another type of structure was observed as well , which appeared as dark lines , ovoids or discs with a uniform contrast ( see black arrow in fig2 c ). finally some of these unilamellar vesicles appeared facetted or as open bilayer fragments . on average , the diameter of the particles is roughly ˜ 150 nm , which is consistent with dls measurements . the bilayer thickness was 7 ± 1 nm , which corresponds to the expected value for a single bilayer . pixel size of the images was in the range of 1 nm , which limited the accuracy of the measurements . when neutral dmpc lipids were used ( samples d to f ) a much higher number of vesicles was observed ( see fig2 d - f ), as there was no repulsive interaction with the negatively charged carbon support . although the vesicles were mostly unfacetted and unilamellar , a significant number of multilamellar vesicles were also present . contrary to dmpg samples no uniform discs were observed . the size of the vesicles was consistent with the dls measurements (˜ 50 - 200 nm ), and the bilayer thickness was 7 ± 1 nm . when the ruthenium - functionalized vesicles ( samples c and f ) are irradiated with white light at 25 ° c ., a gradual color change from yellow to red is observed . at any point of the experiment if the irradiation is stopped the spectrum of the solution also stops to evolve , which shows the thermal inertness of the ruthenium complex in the dark . fig1 a shows the evolution of the uv - visible spectrum of sample c as a function of irradiation time . clear isosbestic points are observed at 458 , 386 , 332 , 311 , 297 and 288 nm , showing that a single photoreaction is taking place . the initial absorption band at 457 nm gradually vanishes to give rise to a new species characterized by an absorption band at 492 nm . the absorption spectrum in the end of the photoreaction is very close to that of sample b ′, in which [ ru ( terpy )( bpy )( oh 2 )] 2 + was added to vesicles functionalized with ligand 4 ( see fig1 b ). it is also close to that of [ ru ( terpy )( bpy )( oh 2 )] 2 + in water ; we attribute the small differences between vesicle - containing and vesicle - free samples to the interaction between the aqua complex and the membrane . similar results were obtained with dmpc vesicles : the uv - vis spectrum of sample f after irradiation was found nearly identical to that of sample e ′ ( data not shown ). as shown in the insert of fig1 a , a pseudo first - order kinetics is observed for the photoreaction using white light ( ln ( c t / c 0 )=− k × t ), where c 0 and c t are the concentration of [ 5 ] 2 + before irradiation and after an irradiation time t , respectively ). the quantum yield of the process was measured at 25 ° c . using monochromatic light set at the wavelength of the isosbestic point ( λ ex = 452 nm ). in the conditions of the experiment the quantum yield for the photosubstitution of 4 by an aqua ligand at the ruthenium center was found to be 0 . 0074 ( 8 ) for dmpg and 0 . 0073 ( 8 ) for dmpc vesicles . samples c and f were subjected to ultracentrifugation , before and after irradiation . the absorbance of the supernatant was quantitatively measured at the absorption maximum of the ruthenium complex ( 454 nm before irradiation and 492 nm after ), and compared to the absorbance before centrifugation ( see table 3 ). with both dmpg and dmpc vesicles , the pellets obtained by ultracentrifugation before irradiation are yellow , and the absorbance of the supernatant low , thus showing attachment of the ruthenium complex to the lipid vesicles . after irradiation the situation is more contrasted ( see table 2 and table 3 ): for anionic dmpg vesicles red pellets are observed , and according to the uv - visible spectrum of the supernatant only ˜ 15 % of the initial absorbance is retained . thus , ˜ 85 % of the photochemically produced [ ru ( terpy )( bpy )( oh 2 )] 2 + complexes are contained in the pellet . on the contrary , for neutral dmpc vesicles the lipid pellets obtained after ultracentrifugation are colorless , and the absorbance at 492 nm is identical before and after centrifugation . thus , in this case the released [ ru ( terpy )( bpy )( oh 2 )] 2 + is essentially non - interacting with the lipid bilayer . for sample b ′ and e ′, after ultracentrifugation the pellets were found red and colorless , respectively ( see table 2 ), and the supernatant showed similarly low ( 16 %) and high ( 75 %) ruthenium content , which is comparable to sample c and f after irradiation ( see table 3 ). in all cases , a rouser assay showed that the supernatant did not contain significant amounts of lipids , as the phosphate content was lower than 2 % ( see table 3 ). table 3 percentages of immobilization of ruthenium at dmpg and dmpc vesicles before and after irradiation . absorbance at absorbance remaining remaining λ max at λ max ru in lipid in before after supernatant c supernatant d sample centrifugation centrifugation (%) (%) a ′ a 0 . 292 0 . 050 17 & lt ; 0 . 8 b ′ 0 . 282 0 . 045 16 & lt ; 2 . 1 c 0 . 314 0 . 044 14 & lt ; 1 . 8 irradiated c 0 . 239 0 . 059 25 & lt ; 1 . 4 d ′ a 0 . 273 0 . 283 103 b & lt ; 0 . 3 e ′ 0 . 350 0 . 262 75 & lt ; 0 . 2 f 0 . 258 0 . 277 107 b & lt ; 0 . 1 irradiated f 0 . 226 0 . 126 56 & lt ; 0 . 1 a obtained by adding 1 mol % of [ ru ( terpy )( bpy )( oh 2 )]( bf 4 ) 2 to sample a ( a ′) or d ( d ′). b with dmpc samples ( d ′, e ′, f and f irradiated ) light scattering was found to be large , which significantly increased the absorbance of the baseline , hence the errors during application of the beer - lambert law . estimated absolute errors on these values are 10 - 20 %. c according to uv - vis spectroscopy . d according to rouser assays . typically , metal - steroid conjugates have been considered as protein targeting tools because steroids are protein substrates , 19 - 23 or for their ability to insert into biological membranes . 24 - 26 by covalently binding a 5α - cholestan - 3β - ol fragment to a monodentate thioether ligand and subsequently coordinating ligand 4 to ruthenium , we aimed at decorating unilamellar vesicles with ruthenium polypyridyl complexes . uv = visible spectra of the functionalized dmpg and dmpc vesicles were comparable to the spectrum of [ 5 ] 2 + in acetone . in addition , the yellow color due to the presence of the sulfur - bonded ruthenium complex significantly diminished upon spinning down the lipid vesicles . thus , we can conclude that the ruthenium complexes were attached to dmpg and dmpc membrane via 1 ) direct coordination of the sulfur atom to ruthenium , and 2 ) supramolecular insertion of the cholestanol moiety into the lipid bilayer . interestingly , a small ( 25 %) to medium ( 56 %) fraction of s - bound ruthenium complex was also found in the supernatant before irradiation for samples c and f , respectively . as a rouser assay of the supernatant excludes small unilamellar vesicles that would not be spun down by centrifugation , such minor fraction might be caused by 1 ) partial hydrolysis of the ester bond in complex [ 5 ] 2 + , which would liberate the partially water - soluble complex [ ru ( terpy )( bpy )( s ( me ) ch 2 cooh )] 2 + , or 2 ) exchange of the counter anion of complex [ 5 ] 2 + . indeed , the solubility of complex [ 5 ] 2 + in water highly depends on its counter anion . during the purification of compound [ 5 ] 2 + by chromatography for example , evaporation of acetone from the acetone / water / kno 3 fractions ([ no 3 ] − ≈ 0 . 032 m ) does not lead to precipitation of the orange complex , unless large amounts of saturated aqueous kpf 6 solution are added . thus , compound [ 5 ] 2 + in the nitrate form , i . e ., [ 5 ]( no 3 ) 2 , is partly soluble in aqueous solution in spite of its long apolar tail , whereas [ 5 ]( pf 6 ) 2 is not . thus , the lipophilic hexafluorophosphate anions of the complex initially introduced in the vesicle - containing samples might gradually be exchanged by the more hydrophilic hydrogenophosphates or sulfates anions present in the buffer , thus increasing the solubility of complex [ 5 ] 2 + in aqueous solution , which might explain the amount of complex still present in the supernatant after centrifugation . the photochemistry of [ ru ( terpy )( n 1 — n 1 )( y )] 2 + , where n 1 — n 1 is a bidentate imine ligand and y is a monodentate ligand , has been studied thoroughly in ( wet ) organic solvents . 27 - 31 we study here the selective photosubstitution of y by an aqua ligand in purely aqueous solution . the presence of clear isosbestic points during irradiation shows that a single photoreaction is taking place . the first - order kinetics also correspond to previous work , where it was shown that upon ligand photoexpulsion coordination of a solvent molecule is taking place . 32 uv - vis spectroscopy , tem , and centrifugation experiments all converge to a great similarity between samples c after irradiation and sample b ′ on the one hand , and between sample f after irradiation and sample e ′ on the other hand ( see table 1 ). thus , we conclude that the following reaction is taking place at the membrane : as the cholestanol fragment of ligand 4 is inserted in the membrane , the above reaction should lead to the detachment of the ruthenium complex from the bilayer . quantum yield measurements show that the efficiency of the photocleavage of the ruthenium complexes from the vesicles is similar to related homogeneous systems , 27 , 32 and according to dls and cryo - tem analysis it does not change the size or shape of the vesicles themselves . agpf 6 , n - acetyl - l - methionine , d - biotin , l - methionine , and 2 - methylthioethan - 1 - ol were purchased from sigma - aldrich and used as such . all manipulations for the synthesis of [ 6 ]( cl ) 2 , [ 7 ]( cl ) 2 , [ 8 ]( cl ) 2 and [ 9 ]( cl ) 2 were performed in the absence of light . for nmr spectra a bruker 300 mhz nmr spectrometer was used , for es ms a thermoquest finnagen aqa spectrometer and for uv - vis measurements a cary varian uv - visible spectrometer . [ ru ( tpy )( bpy )( h 2 o )]( pf 6 ) 2 was synthesised according to a modified literature procedure : 13 [ ru ( tpy )( bpy )( cl )]( cl ) 13 ( 150 mg , 0 . 267 mmol ) and agpf 6 ( 135 mg , 0 . 534 mmol ) were dissolved in acetone / water ( 3 : 1 , 20 ml ). the reaction mixture was refluxed under argon for 2 hours at 80 ° c . the white suspension was filtered hot over celite . the acetone was slowly evaporated with a rotary evaporator under vacuum , which led to precipitation of [ ru ( tpy )( bpy )( h 2 o )]( pf 6 ) 2 . the suspension was put in the fridge for 4 days to ensure complete precipitation . yield : 66 % ( 141 mg , 0 . 177 mmol ). [ ru ( tpy )( bpy )( cl )]( cl ) ( 200 mg , 0 . 356 mmol ) and n - acetyl - l - methionine ( 68 . 1 mg , 0 . 356 mmol ) were dissolved in distilled water ( 20 ml ). the reaction mixture was refluxed under argon for one day at 80 ° c . water was evaporated under vacuum with a rotary evaporator at 70 ° c . compound [ 6 ]( cl ) 2 was purified by column chromatography ( silica , acetone / h 2 o / hcl ( 1m ), 16 : 4 : 1 ). the acetone was evaporated under vacuum with a rotary evaporator at 30 ° c . water and hcl were removed by freeze - drying . finally , the complex was recrystallised from meoh / et 2 o as an orange powder . yield : 56 % ( 151 mg , 0 . 201 mmol ). 1 h - nmr ( 300 mhz , cd 3 od , 298 k ), δ ( ppm ): 9 . 93 - 9 . 74 ( m , j = 7 . 1 hz , 1h , h1 ), 8 . 95 - 8 . 74 ( m , 3h , h4 + h17 ), 8 . 73 - 8 . 50 ( m , j = 14 . 7 , 8 . 0 hz , 3h , h14 + h7 ), 8 . 51 - 8 . 32 ( m , 2h , h18 + h3 ), 8 . 22 - 8 . 02 ( m , 3h , h13 + h2 ), 7 . 95 ( td , j = 8 . 2 , 1 . 6 hz , 1h , h8 ), 7 . 85 - 7 . 71 ( m , 2h , h11 ), 7 . 47 ( ddt , j = 7 . 6 , 5 . 4 , 1 . 1 hz , 2h , h12 ), 7 . 34 - 7 . 13 ( m , 2h , h10 + h9 ), 4 . 38 ( dd , j = 9 . 1 , 4 . 9 hz , 1h , h22 ), 2 . 01 - 1 . 84 ( m , 3h , h19 or h25 ), 1 . 87 - 1 . 55 ( m , 4h , h20 + h21 ), 1 . 44 - 1 . 29 ( m , 3h , h19 or h25 ). 13 c - nmr ( 300 mhz , cd 3 od , 298 k ), δ ( ppm ): 172 . 09 ( c23 or c24 ), 158 . 35 + 157 . 75 + 157 . 13 + 156 . 99 ( c5 + c6 + c15 + c16 ), 153 . 36 ( c11 ), 152 . 35 ( cl ), 149 . 73 ( c10 ), 139 . 20 ( c13 ), 138 . 56 ( c8 ), 138 . 49 + 137 . 29 ( c3 + c18 ), 128 . 82 ( c12 ), 128 . 09 ( c2 ), 127 . 44 ( c9 ), 125 . 34 + 124 . 96 ( c7 + c14 ), 124 . 53 + 124 . 18 ( c4 + c17 ), 50 . 57 ( c22 ), 30 . 31 + 28 . 59 ( c20 + c21 ), 21 . 49 + 13 . 22 ( c19 + c25 ). es ms m / z ( calc ): 680 . 95 ( 680 . 77 [ m - 2cl — h ] + ), 526 . 01 ( 525 . 59 [ m - 2cl - bpy ] + ), 348 . 82 ( 348 . 40 [ m - 2cl + ch 3 ] 2 + ), 261 . 41 ( 261 . 28 [ m - 2cl — n - acetylmethionine + meoh ] 2 + ), 245 . 61 ( 245 . 26 [ m - 2cl — n - acetylmethionine ] 2 + ). uv - vis : λ max ( ε in l · mol − 1 · cm − 1 ) in h 2 o : 452 nm ( 5 . 35 × 10 3 ). [ ru ( tpy )( bpy )( cl )]( cl ) ( 200 mg , 0 . 356 mmol ) and d - biotin ( 87 . 0 mg , 0 . 356 mmol ) were dissolved in distilled water ( 30 ml ). the reaction mixture was refluxed under argon for one day at 80 ° c . water was evaporated under vacuum at 70 ° c . with a rotary evaporator . compound [ 7 ]( cl ) 2 was purified by column chromatography ( silica gel , acetone / h 2 o / hcl ( 1m ), 16 : 4 : 1 ). acetone was evaporated under vacuum with a rotary evaporator at 30 ° c . water and hcl were removed by freeze - drying . finally , the complex was recrystallised from etoh / et 2 o as an orange powder . yield : 32 % ( 92 . 0 mg , 0 . 114 mmol ). 1 h - nmr ( 300 mhz , cd 3 od , 298k ), δ ( ppm ): 9 . 87 ( d , j = 5 . 1 hz , 1h , h1 ), 8 . 88 ( d , j = 8 . 1 hz , 3h , h4 + h17 ), 8 . 78 - 8 . 55 ( m , 3h , h14 + h7 ), 8 . 56 - 8 . 32 ( m , 2h , h18 + h3 ), 8 . 11 ( dd , j = 16 . 4 , 7 . 6 hz , 3h , h13 + h2 ), 7 . 95 ( dd , j = 14 . 1 , 6 . 0 hz , 2h , h8 + h11 or h11 ′), 7 . 81 ( d , j = 4 . 9 hz , 1h , h11 or h11 ′), 7 . 48 ( dd , j = 12 . 4 , 6 . 8 hz , 2h , h12 + h13 ), 7 . 26 ( d , j = 8 . 1 hz , 2h , h10 + h9 ), 4 . 18 ( s , 2h , h19 or h27 ), 2 . 34 ( d , j = 9 . 0 hz , 1h , h20 or h22 or h23 ), 2 . 27 - 2 . 07 ( m , 2h , h19 or h27 ), 1 . 91 ( t , j = 19 . 9 hz , 1h , h20 or h22 or h23 ), 1 . 78 ( d , j = 10 . 4 hz , 1h , h20 or h22 or h23 ), 1 . 54 - 0 . 97 ( m , 6h , h24 + h25 + h26 ). 13 c - nmr ( 300 mhz , cd 3 od , 298k ), δ ( ppm ): 159 . 56 , 159 . 35 , 158 . 65 , 158 . 58 , 158 . 14 , 158 . 09 , 154 . 85 , 154 . 46 , 153 . 15 , 150 . 68 , 140 . 51 , 140 . 47 , 139 . 82 , 139 . 69 , 138 . 63 , 129 . 88 , 129 . 76 , 129 . 09 , 128 . 61 , 126 . 67 , 126 . 50 , 126 . 21 , 125 . 92 , 125 . 83 , 125 . 32 , 60 . 25 , 58 . 56 , 57 . 55 , 40 . 65 , 34 . 16 , 28 . 12 , 27 . 82 , 25 . 39 . es ms m / z ( calc ): 748 . 94 ( 748 . 86 [ m - 2cl — h + ch 3 ] + ), 525 . 97 ( 525 . 98 [ m - cl - biotin ] + ), 374 . 64 ( 374 . 43 [ m - 2cl — h + ch 3 ] 2 + ), 261 . 39 ( 261 . 28 [ m - 2cl - biotin + meoh ] 2 + ), 245 . 13 ( 245 . 26 [ m - 2cl − - biotin ] 2 + ), 244 . 03 ( 244 . 31 [ biotin ] + ). uv - vis : λ max ( ε in l · mol − 1 · cm − 1 ) in h 2 o : 444 nm ( 5 . 01 × 10 3 ). [ ru ( tpy )( bpy )( oh 2 )]( bf 4 ) 2 ( 68 mg , 0 . 100 mmol ) and l - methionine ( 16 . 5 mg , 0 . 110 mmol ) were dissolved in distilled water ( 30 ml ). the reaction mixture was heated under argon for two days at 80 ° c ., cooled down to room temperature and filtered under celite . compound [ 8 ]( cl ) 2 was purified by high performance liquid chromatography using water / methanol as eluents . the first fractions were collected , and the solvents were removed by rotavap ( methanol ) and freeze - drying ( water ) to yield 45 mg of an orange - red solid . yield : 82 %. 1 h nmr ( 400 mhz , cd 3 od ) δ ( ppm ): 9 . 86 ( d , j = 5 . 5 hz , 1h ), 8 . 84 ( d , j = 8 . 2 hz , 1h ), 8 . 80 ( d , j = 8 . 1 hz , 2h ), 8 . 65 ( d , j = 8 . 1 hz , 2h ), 8 . 62 ( d , j = 8 . 3 hz , 1h ), 8 . 41 ( td , j = 8 . 0 , 5 . 1 hz , 2h ), 8 . 15 - 8 . 06 ( m , 3h ), 7 . 98 - 7 . 91 ( m , 1h ), 7 . 79 ( d , j = 5 . 5 hz , 2h ), 7 . 49 - 7 . 43 ( m , 2h ), 7 . 28 ( d , j = 4 . 7 hz , 1h ), 7 . 26 - 7 . 21 ( m , 1h ), 1 . 92 - 1 . 80 ( m , 3h , ch + ch 2 s ), 1 . 73 ( m , 2h , ch 2 ), 1 . 37 ( s , 3h , mes ). 13 c nmr ( 101 mhz , cd 3 od ) δ ( ppm ): 174 . 86 ( s ), 158 . 11 ( d , j = 1 . 1 hz ), 157 . 56 ( s ), 157 . 03 ( s ), 156 . 69 ( s ), 153 . 13 ( s ), 152 . 55 ( s ), 149 . 49 ( s ), 139 . 03 ( d , j = 2 . 7 hz ), 138 . 23 ( d , j = 3 . 1 hz ), 137 . 11 ( s ), 128 . 64 ( d , j = 1 . 5 hz ), 128 . 06 ( s ), 127 . 18 ( s ), 125 . 16 ( s ), 124 . 66 ( s ), 124 . 33 ( s ), 123 . 94 ( s ), 53 . 64 ( s ), 30 . 46 ( s ), 29 . 82 ( s ), 12 . 98 ( s ). high resolution es ms m / z ( calc ): 320 . 0543 ( 320 . 0597 [ m - 2bf 4 ] 2 + ). [ ru ( tpy )( bpy )( oh 2 )]( bf 4 ) 2 ( 35 mg , 0 . 052 mmol ) and 2 - methylthioethan - 1 - ol ( 44 mg , 0 . 447 mmol ) were dissolved in distilled water ( 6 ml ). the reaction mixture was heated under argon overnight ( 16 h ) at 80 ° c ., cooled down to room temperature and freeze - dried . the excess of ligand was washed away with diethylether to quantitatively afford compound [ 9 ]( bf 4 ) 2 as an orange solid . 1 h nmr ( 400 mhz , d 2 o ) δ ( ppm ): 9 . 81 ( d , j = 5 . 4 hz , 1h ), 8 . 70 ( d , j = 8 . 1 hz , 1h ), 8 . 66 ( d , j = 8 . 2 hz , 2h ), 8 . 50 ( d , j = 8 . 1 hz , 2h ), 8 . 44 ( d , j = 8 . 2 hz , 1h ), 8 . 36 ( t , j = 8 . 1 hz , 2h ), 8 . 03 ( dd , j = 14 . 5 , 6 . 7 hz , 3h ), 7 . 88 ( t , j = 8 . 2 hz , 1h ), 7 . 81 ( d , j = 5 . 3 hz , 2h ), 7 . 42 - 7 . 31 ( m , 2h ), 7 . 28 ( d , j = 5 . 5 hz , 1h ), 7 . 11 ( t , j = 7 . 0 hz , 1h ), 3 . 45 ( t , j = 5 . 7 hz , 2h , ch 2 o ), 1 . 83 ( t , j = 5 . 7 hz , 2h , ch 2 s ), 1 . 36 ( s , 3h , sme ). [ ru ( terpy )( bpy )( cl )]( cl ) ( 2 . 23 mg , 3 . 97 μmol ), compound [ 6 ]( cl ) 2 ( 2 . 14 mg , 2 . 84 μmol ) and compound [ 7 ]( cl ) 2 ( 2 . 18 mg , 2 . 71 μmol ) were weighed separately into three different nmr tubes . d 2 o ( 0 . 80 ml ) was added to each of the nmr tubes and 1 h nmr spectra were taken . the nmr tubes were put into closed pressure tubes and kept in the dark at 37 ° c . to check the stability of the ru — cl and ru — s bond . 1 h nmr spectra of each of the tubes were taken after 4 hours , 1 day , 3 days and 3 weeks . the nmr tubes were kept in an ice bath during transport in order to temporarily freeze the reaction . in the case of [ ru ( terpy )( bpy )( cl )]( cl ), an equilibrium had been reached after four hours , characterized by 10 % of [ ru ( terpy )( bpy )( cl )]( cl ) and 90 % of [ ru ( terpy )( bpy )( h 2 o )]( cl ) 2 . the bond between ruthenium and the sulfur atom proved to be much more stable . after three weeks , compound [ 6 ]( cl ) 2 had not been converted to [ ru ( terpy )( bpy )( h 2 o )]( cl ) 2 at all . for compound [ 7 ]( cl ) 2 , no changes were observed after the first day . after three days , however , there was a few percent of [ ru ( terpy )( bpy )( h 2 o )]( cl ) 2 . after three weeks at 37 ° c ., the ratio between compound [ 7 ]( cl ) 2 and [ ru ( terpy )( bpy )( h 2 o )]( cl ) 2 was 7 : 3 . a cary varian uv - visible spectrometer was used for measuring uv - visible spectra . all sample preparations were performed under deemed light , protecting sample from light by aluminium foil . for irradiation , a lot 1000 w xenon arc lamp , fitted with a water filter and an interference filter ( 452 nm , λ 1 / 2 = 20 nm , andover 450f510 - 50 ), was used . in these conditions , the photon flux was measured by standard potassium ferrioxalate actinometry 14 to be 5 . 94 × 10 − 8 einstein · s − 1 . a 1 . 0 ml volume of a 0 . 50 mm solution of compound [ 6 ]( cl ) 2 or [ 7 ]( cl ) 2 in deionized water was transferred with a pipette into a quartz cuvette with a path length of 1 . 00 cm , and 2 . 0 ml of water was added . a first spectrum was taken between 400 nm and 600 nm in order to determine the extinction coefficient . then , the sample was irradiated for 10 minutes and after each minute of irradiation a uv - vis spectrum was taken between 400 nm and 600 nm . finally , the sample was irradiated for an additional 60 and 75 minutes in order to achieve a photochemical steady state and verify the two last spectra were identical . the time evolution of the advancement n / n 0 of the photochemical reaction was calculated ; a linear regression of ln ( n / n 0 )= f ( t ) afforded the quantum yield of the photoreaction ; the final numerical values are 0 . 018 ( 4 ) for compound [ 6 ]( cl ) 2 and 0 . 011 ( 3 ) for compound [ 7 ]( cl ) 2 . scheme 8 shows the chemical structures of compounds [ 6 ]( cl ) 2 , [ 7 ]( cl ) 2 , [ 8 ]( bf 4 ) 2 , and [ 9 ]( bf 4 ) 2 . [ ru ( terpy )( bpy )( n - acetyl - l - methionine )]( cl ) 2 ( compound [ 6 ]( cl ) 2 ) and [ ru ( terpy )( bpy )( d - biotin )]( cl ) 2 ( compound [ 7 ]( cl ) 2 ) are synthesised by directly reacting [ ru ( terpy )( bpy )( cl )]( cl ) with the corresponding thioether ligand in water at 80 ° c ., followed by chromatography separation on silica gel . thus , due to the stronger ru — s bond compared to ru — cl in water there is no need to trap the chloride ions with silver salts . [ ru ( terpy )( bpy )( l - methionine )]( bf 4 ) 2 ( compound [ 8 ]( bf 4 ) 2 ) and [ ru ( terpy )( bpy )( mte )]( bf 4 ) 2 ( compound [ 9 ]( bf 4 ) 2 , mte = 2 - methylthioethan - 1 - ol ) were synthesized by the conventional method , which consists in heating [ ru ( terpy )( bpy )( oh 2 )]( bf 4 ) 2 and the corresponding ligand in water at 80 ° c . compound [ 8 ]( bf 4 ) 2 ) was purified by hplc using water / methanol mixtures as eluent . compound [ 9 ]( bf 4 ) 2 was freeze - dried and washed with diethylether to remove the excess of 2 - methylthioethan - 1 - ol . the monodentate sulfur ligand of compounds [ 6 ]( cl ) 2 , [ 7 ]( cl ) 2 , [ 8 ]( bf 4 ) 2 and [ 9 ]( bf 4 ) 2 is photosubstituted by an aqua ligand upon irradiation with white light in aqueous solution : according to the stability measurements of compounds [ 6 ]( cl ) 2 and [ 7 ]( cl ) 2 in water , this substitution reaction does not take place thermally at body temperature within a day when srr ′ is d - biotin or n - acetyl - l - methionine . the photosubstitution quantum yields were determined to be 0 . 018 ( 4 ) for compounds [ 6 ]( cl ) 2 and 0 . 011 ( 3 ) for compounds [ 7 ]( cl ) 2 , using monochromatic blue light ( excitation at 452 nm ). water - soluble thioether ligands such as l - methionine and 2 - methylthioethan - 1 - ol ( mte ) react cleanly with [ ru ( terpy )( bpy )( oh 2 ]( bf 4 ) 2 in water to afford the corresponding compounds [ 8 ]( bf 4 ) 2 and [ 9 ]( bf 4 ) 2 . with l - methionine , removal of the highly polar amino acid is difficult and requires hplc separation , leading to lower preparative yields . with mte however , simple washing of the crude mixture with diethylether allows complete removal of the excess of ligand to afford [ 9 ]( bf 4 ) 2 quantitatively . alternatively , it is also possible to directly react the chlorido compound [ ru ( terpy )( bpy )( cl )]( cl ) with thioether ligands , as the ru — cl bond is labile in water whereas the ru — s bond is not . thus , compounds [ 6 ]( cl ) 2 and [ 7 ]( cl ) 2 are synthesised by directly reacting [ ru ( terpy )( bpy )( cl )]( cl ) with the corresponding thioether ligand in water at 80 ° c . overnight . separation of the sulfur - bonded ruthenium product from the starting materials is achieved by column chromatography on silica gel using acetone / water / hcl mixtures as eluent . acetone should be removed with a rotary evaporator , and water and hydrochloric acid by freeze - drying . reprecipitation from methanol / diethylether is necessary to completely remove the last traces of hcl . the preparative yield was 56 % for compound [ 6 ]( cl ) 2 and 32 % for compound [ 7 ]( cl ) 2 . the lower yield for compound [ 7 ]( cl ) 2 might be explained by the higher steric hindrance of biotin . in situ 1 h nmr studies show that it is possible to get 100 % conversion in both cases if a five times excess of ligand is used . in this case , the reaction is also finished more quickly . however , it is more difficult to isolate the ruthenium compound from the excess of ligand . compound [ 7 ]( cl ) 2 is obtained as a single isomer , but compound [ 6 ]( cl ) 2 seem to appear as a mixture of a major and a minor isomer . the 1 h nmr spectrum shows two partially overlapping a2 doublet with one major and one minor species ( see scheme 7 for nmr notation of the bpy ligand ). mass spectrometry does not show any sign of ruthenium - bound sulfoxide or ruthenium - methionine complex with an hydrolyzed acetyl group , so that the minor species must correspond to an isomer of the main product . n - acetylmethionine might also coordinate through the oxygen atom of the carboxylic acid group to ruthenium . however , biotin should show the same feature as it also has an acid group . as it is not the case , the chirality of n - acetylmethionine has to be considered : two diastereomers are formed when each of the two diastereotopic lone pairs of the sulfur atom coordinates to ruthenium . this explanation accounts for the very similar chemical shift of the a2 protons for both species by 1 h nmr ( see fig2 ), which suggests chemically very similar monodentate ligands . dft calculations predict an energy difference of 12 . 5 kj · mol − 1 for both diastereoisomers , which is consistent with a few percent of the minor isomer , thus to the experiment . although biotin is also chiral , the energy difference between both possible isomers of [ 7 ]( cl ) 2 was calculated to be 35 . 1 kj · mol − 1 , i . e ., there is virtually one isomer only in that case . stereoselective coordination of d - biotin to first - row transition metal complexes has been suggested by sigel et al . 33 the thermal stability of compound [ 6 ]( cl ) 2 and compound [ 7 ]( cl ) 2 in water is very important , since this invention focuses on using monodentate thioethers as inorganic protecting groups , which can be selectively removed by irradiation . the thermal instability of ru — cl in aqueous solution is known . after a few hours at 37 ° c . an equilibrium was reached , characterised by 10 % of [ ru ( terpy )( bpy )( cl )]( cl ) and 90 % of [ ru ( terpy )( bpy )( oh 2 )]( cl ) 2 . compound [ 6 ]( cl ) 2 and [ 7 ]( cl ) 2 are both a lot more stable at human body temperature than [ ru ( terpy )( bpy )( cl )]( cl ). after three weeks at 37 ° c . in aqueous solution , compound [ 6 ]( cl ) 2 shows no trace of [ ru ( terpy )( bpy )( oh 2 )]( cl ) 2 , whereas compound [ 7 ]( cl ) 2 liberated a few percents of [ ru ( terpy )( bpy )( oh 2 )]( cl ) 2 . since the general residence time of a drug in the body is 24 to 48 hours , the amount of thermally released aqua complex is negligible , and biotin can also be used as a thermally stable inorganic protecting group for ruthenium - based polypyridyl anticancer complexes . replacing a weakly bound chloride ligand by a strongly bound sulphur ligand diminishes the cytotoxicity of ruthenium polypyridyl compounds in the dark hepg2 cancer cells were grown in rpmi 1640 medium containing (−) l - glutamine at 37 ° c . and in an atmosphere of 95 % o 2 and 5 % co 2 . [ ru ( tpy )( bpy ) cl ] cl or [ ru ( tpy )( bpy )( amet )] cl 2 ( compound [ 7 ]( cl ) 2 ) was added to the cells and incubated for 30 min in the dark ( concentration : 1 . 7 mm ), after which a wst - 1 cell viability test ( normalized to protein content ) was performed on each well . the cell survival was reduced by 49 % in presence of [ ru ( tpy )( bpy ) cl ] cl , whereas it was not reduced ( within experimental errors ) in presence of compound [ 7 ]( cl ) 2 . in this experiment , the difference in water solubility between the chlorido and thioether complexes might also play a role , as uptake might be different for both compounds . cholesterol ( 200 mg , 0 . 52 mmol ) and n - acetyl - l - methionine ( 100 mg , 0 . 52 mmol ) were dissolved in anhydrous benzene ( 10 ml ) under argon atmosphere . dcc ( 140 mg , 0 . 68 mmol ) and dmap ( 2 mg , 0 . 02 mmol , 3 %) were added and the mixture was stirred vigorously for 12 hours , after which the solution was filtered to remove insoluble materials . the solvent was evaporated under vacuum by rotary evaporation at 30 ° c . the crude product was purified by column chromatography on silica gel ( petroleum ether / etoac , 70 : 30 ). the solvents were evaporated by rotary evaporation at 30 ° c ., and compound 10 was obtained as a white sticky solid . yield : 50 % ( 150 mg , 0 . 26 mmol ). 1 h nmr ( 300 mhz , cdcl 3 ) δ 6 . 13 ( d , j = 8 . 18 hz , 1h , δ ), 5 . 38 ( d , j = 4 . 09 hz , 1h , 6 ), 4 . 70 - 4 . 64 ( m , 3h , 3 , γ ), 3 . 44 ( m , 1h , ε ), 2 . 33 ( m , 2h , β ), 2 . 10 ( s , 3h , α ), 2 . 03 ( s , 2h , 4 ). 13 c nmr ( 75 mhz , cdcl 3 ) δ 171 . 70 ( cχ ), 169 . 96 ( cη ), 139 . 30 ( c5 ), 125 . 31 , 123 . 18 ( c6 ), 75 . 65 ( c3 ), 56 . 79 , 56 . 24 , 51 . 90 ( cγ ), 50 . 11 , 49 . 66 , 42 . 42 , 39 . 81 , 39 . 62 , 38 . 11 , 38 . 07 ( cβ ), 36 . 98 , 36 . 68 , 36 . 29 , 35 . 89 , 37 . 70 , 33 . 73 , 32 . 22 , 32 . 01 , 31 . 93 ( cα ), 30 . 05 , 29 . 81 , 28 . 33 , 28 . 12 , 27 . 82 , 27 . 79 , 25 . 60 , 24 . 93 , 24 . 83 , 24 . 38 , 23 . 93 , 23 . 36 , 22 . 93 , 22 . 67 , 21 . 14 ( c4 ), 19 . 42 , 18 . 83 , 18 . 74 , 15 . 67 , 11 . 96 . es ms m / z ( calc ): 560 . 1 ( 560 . 4 , [ m + h ] + ), 369 . 2 ( 369 . 4 , [ m - amet ] + ). elemental analysis (%) for c 34 h 57 no 3 s + h 2 o : c , 70 . 66 ; h , 10 . 30 ; n , 2 . 43 , s , 5 . 54 . found : c , 70 . 45 ; h , 9 . 99 ; n , 2 . 99 ; s , 5 . 46 . [ ru ( terpy )( azpy )( cl )]( cl ) ( 35 mg , 0 . 06 mmol ), ligand 10 ( 50 mg , 0 . 09 mmol ) and agbf 4 ( 25 mg , 0 . 13 mmol ) were dissolved in anhydrous acetone ( 20 ml ) in the dark . the mixture was refluxed under argon for 48 hours . the solution was then filtered over celite to remove insoluble materials . the solvent was evaporated under vacuum by rotary evaporation at room temperature . the complex was purified by column chromatography on silica gel ( dcm / meoh 80 : 20 ). the solvent was evaporated under vacuum by rotary evaporation at 35 ° c . finally , [ 11 ]( bf 4 ) 2 was reprecipitated from meoh / et 2 o as a purple solid . yield : 9 % ( 7 mg , 0 . 005 mmol ). 1 h nmr ( 300 mhz , acetone ) δ 9 . 90 ( d , j = 6 . 25 hz , 1h , 6a ), 9 . 06 ( d , j = 8 . 75 hz , 1h , 3a ), 8 . 74 - 8 . 65 ( m , 5h , 5t , 3t ′, 5a ), 8 . 44 - 8 . 30 ( m , 4h , 4a , 4t ′, 4t ), 7 . 81 ( m , 2h , 6t ), 7 . 67 ( m , 2h , 3t ), 7 . 32 ( m , 1h , 12a ), 7 . 19 - 7 . 11 ( m , 3h , 11a , 13a , 6 ), 6 . 35 ( d , j = 8 . 75 hz , 2h , 10a , 14a ), 5 . 34 ( s , 2h , 4 ), 4 . 43 - 4 . 36 ( m , 3h , γ , β ). uv - vis : λ max in nm ( ε in l · mol − 1 · cm − 1 ) in chcl 3 : 509 nm ( 7980 ). es ms m / z ( calc ): 1164 . 7 ( 1164 . 5 , [ m -( bf 4 )] + ), 708 . 1 ( 708 . 1 , [ m - cholesterol - 2 ( bf 4 )] 2 + ), 605 . 0 ( 605 . 1 , [ m - l -( bf 4 )] + ), 538 . 8 ( 538 . 8 , [ m - 2 ( bf 4 )] 2 + ). [ ru ( terpy )( bpy )( cl )]( cl ) ( 45 mg , 0 . 08 mmol ) and agbf 4 ( 30 mg , 0 . 15 mmol ) were dissolved in anhydrous acetone ( 20 ml ) in the dark . the mixture was refluxed under argon for 1 hour . ligand 10 ( 70 mg , 0 . 12 mmol ) was added and the mixture was refluxed under for 48 hours . the solution was filtered hot over celite to remove insoluble materials . the solvent was evaporated under vacuum by rotary evaporation at room temperature . the complex was purified by column chromatography on silica gel ( acetone / h 2 o / kpf 6 , 100 : 10 : 1 . 5 , second band , r f = 0 . 28 ). the acetone was evaporated under vacuum at 30 ° c ., upon which the product [ 12 ]( pf 6 ) 2 precipitated as an orange solid . finally [ 12 ]( pf 6 ) 2 was filtered , washed with water and dried under vacuum at 40 ° c . yield : 28 % ( 30 mg , 0 . 022 mmol ). 1 h nmr ( 300 mhz , acetone - d 6 ) δ 9 . 98 ( d , j = 7 . 5 hz , 1h , 6a ), 8 . 95 ( m , 3h , 3t ′, 3a ), 8 . 78 ( d , j = 7 . 5 hz , 2h , 6t ), 8 . 71 ( d , j = 7 . 5 hz , 1h , 6b ), 8 . 56 - 8 . 47 ( m , 2h , 4t ′, 4a ), 8 . 23 - 8 . 13 ( m , 3h , 5t , 5a ), 8 . 04 - 8 . 00 ( m , 3h , 3t , 5b ), 7 . 57 - 7 . 54 ( m , 3h , 3b , 4t ), 7 . 31 ( m , 1h , 4b ), 7 . 17 ( d , j = 7 . 5 , 1h , δ ), 5 . 35 ( m , 1h , 6 ), 4 . 45 - 4 . 42 ( m , 2h , γ , 3 ). 13 c nmr ( 75 mhz , acetone ) δ 171 . 21 ( cχ ), 170 . 47 ( cη ), 159 . 01 , 158 . 43 , 157 . 79 , 157 . 67 , 154 . 43 , 154 . 41 , 153 . 35 , 151 . 01 , 140 . 40 ( c5 ), 139 . 99 , 139 . 95 , 139 . 24 , 139 . 19 , 138 . 05 , 129 . 60 , 129 . 56 , 128 . 90 , 128 . 25 , 126 . 06 , 125 . 68 , 125 . 35 , 124 . 84 , 123 . 46 ( c6 ), 75 . 67 ( c3 ), 57 . 57 , 57 . 06 , 51 . 32 ( cγ ), 51 . 01 , 43 . 11 , 40 . 61 , 40 . 26 , 38 . 68 ( cβ ), 37 . 66 , 37 . 33 , 36 . 96 , 36 . 59 , 32 . 70 ( cα ), 32 . 59 , 31 . 12 , 30 . 61 , 28 . 69 , 28 . 35 , 24 . 92 , 24 . 53 , 23 . 07 , 22 . 83 , 21 . 74 ( c4 ), 19 . 65 , 19 . 14 , 14 . 04 , 12 . 23 . uv - vis : λ max in nm ( ε in l · mol − 1 · cm − 1 ) in chcl 3 : 460 nm ( 8310 ). es ms m / z ( calc ): 1195 . 9 ( 1195 . 4 , [ m - pf 6 ] + ), 681 . 2 ( 681 . 1 , [ m -( cholest - 5 - en )- 2 ( pf 6 )] + ), 525 . 7 ( 525 . 2 , [ m - 2 ( pf 6 )] 2 + ). [ ru ( terpy )( apy )( cl )]( cl ) ( 100 mg , 0 . 170 mmol ) and n - acetyl - l - methionine ( 169 mg , 0 . 867 mmol ) were dissolved in water ( 40 ml ). the reaction mixture was heated with stirring under argon for 2 hours at 80 ° c . h 2 o was removed by freeze drying . the complex was purified by chromatography column ( silica , acetone / h 2 o / hcl ( 1m ), 16 : 4 : 1 ). acetone was evaporated under vacuum at 25 ° c . h 2 o and hcl were removed by freeze drying . compound [ 13 ]( cl ) 2 was reprecipitated from meoh / et 2 o and obtained as a purple solid . yield : 35 % ( 46 . 0 mg , 0 . 059 mmol ). 1 h nmr ( 300 mhz , d 2 o , 298 k ): δ ( ppm ): 9 . 77 ( d , j = 5 . 6 hz , 1h , 6a ), 8 . 99 ( d , j = 7 . 8 hz , 1h , 3a ), 8 . 55 ( t , j = 7 . 2 hz , 1h , 4a ), 8 . 44 ( t , j = 6 . 3 hz , 4h , 3t , 3t ′), 8 . 28 ( m , 2h , 5a , 4t ′), 8 . 13 ( t , j = 7 . 8 hz , 2h , 4t ), 7 . 94 ( d , j = 3 . 6 hz , 1h ), 7 . 90 ( t , j = 7 . 1 hz , 1h , 6a ′), 7 . 66 ( m , 1h , 4a ′), 7 . 50 ( m , 4h , 5t , 6t ), 7 . 32 ( m , 1h , 5a ′), 6 . 99 ( d , j = 8 . 0 hz , 1h , 3a ′), 4 . 02 ( s , 1h , ε ), 1 . 88 ( s , 3h , φ ), 1 . 78 - 1 . 57 ( m , 4h , γ , β , δ ), 1 . 53 ( s , 3h , α ). 13 c nmr ( 75 mhz , d 2 o ) δ 174 . 73 , 173 . 67 , 165 . 46 , 161 . 21 , 157 . 44 , 155 . 17 , 153 . 64 , 152 . 62 , 149 . 99 , 148 . 44 , 140 . 49 , 140 . 48 - 139 . 55 , 138 . 56 , 129 . 94 , 129 . 53 , 128 . 72 , 128 . 71 - 127 . 77 , 125 . 88 , 125 . 01 , 124 . 17 , 123 . 83 , 123 . 01 , 115 . 63 , 50 . 98 , 29 . 85 , 27 . 62 , 21 . 78 , 13 . 86 . es ms m / z : 554 . 0 ( 554 . 0 [ m − l − cl ] + ), 261 . 5 ( 259 . 3 [ m - l - 2cl − ] 2 + ). thermal stability of the ru — s bond of [ 13 ]( cl ) 2 in the dark compared to that of the ru — cl bond the thermal stability of the ru — s bond in the dark is a critical parameter of the proposed new compounds , as a stable ru — s bond means a drug that cannot coordinate to dna or proteins , thus a drug that will have a lower toxicity . the stability of the ru — s bond was measured at human body temperature and in the dark . to do so , compound [ ru ( tpy )( apy ) cl ] cl , and [ ru ( tpy )( apy )( amet )] cl 2 , ( compound [ 13 ]( cl ) 2 ) were dissolved in d 2 o and kept in the dark at 37 ° c . the release of the aqua species was measured by 1 h nmr after 4 hours , 1 days , and 3 weeks . as seen in table 4 , after 4 hours there is no sign of cleavage of the ru — s bond for both thioether compounds , whereas for its chlorido precursor the equilibrium between [ ru — cl ] and [ ru — oh 2 ] is already reached . the stability of the ru — s bond depends on the nature of the polypyridyl ligands ( see example 2 ), but in general it is much higher than that of the ru — cl bond . as shown in example 2 visible light irradiation of [ ru ( tpy )( bpy )( amet )] cl 2 ( compound [ 6 ]( cl ) 2 ) or [ ru ( tpy )( bpy )( biotin )] cl 2 ( compound [ 7 ]( cl ) 2 ) cleaves the ru — s bond , thus releasing the free amet or biotin ligand and the aqua complex [ ru (( tpy )( bpy )( oh 2 )] 2 + . similarly , 1 h nmr studies realized for [ ru ( tpy )( apy )( amet )] cl 2 show that the initial doublet observed at 9 . 77 ppm ( in d 2 o ) is gradually converted upon visible light irradiation into doublets at 9 . 80 and 9 . 54 ppm , characteristic for [ ru ( tpy )( apy )( cl )] + and [ ru ( tpy )( apy )( oh 2 )] 2 + , respectively . thin layer chromatography ( eluent : acetone : water : hcl mixture ) also concludes to the total disappearance of the starting compound . thus , the ruthenium - sulfur bond of compound [ 13 ]( cl ) 2 is also photochemically labile , whereas it is thermally quite stable in the dark . a suspension of sodium hydride ( 0 . 22 g , 9 . 17 mmol ) in dry tetrahydrofuran ( 40 ml ) was prepared under argon . while stirring cholesterol ( 1 . 20 g , 3 . 10 mmol ) was added to the flask . after 30 min , compound 15 ( 1 . 32 g , 3 . 95 mmol ) in dry tetrahydrofuran ( 5 ml ) was added to the mixture , which was then refluxed under argon for 48 h . the flask was cooled to room temperature , 60 ml a mixture of water and hcl ( 1 m ) ( 50 : 50 ) was added , and the product was extracted three times with 40 ml diethylether and petroleum ether ( 1 : 15 ( v / v )). the combined organic layers were washed once with 30 ml hcl ( 1 m ), dried with mgso 4 , and evaporated to give compound 16 as a sticky white solid ( 1 . 31 gr , 76 %). 1 h nmr ( 300 mhz , δ in cdcl 3 ): 5 . 34 ( d , j = 5 . 1 hz , 1h , 6 ), 3 . 74 - 3 . 57 ( m , 10h , α + β + γ + δ + ε ), 3 . 17 ( m , 1h , 3 ), 2 . 69 ( t , j = 6 . 9 hz , 2h , ζ ) 2 . 42 - 2 . 19 ( m , 2h ), 2 . 14 ( s , 3h , η ), 2 . 05 - 0 . 81 ( m , 42h ), 0 . 67 ( s , 3h ). 13 c nmr ( 75 mhz , δ in cdcl 3 ): 141 . 17 ( c5 ), 121 . 70 ( c6 ), 79 . 67 ( c3 ), 71 . 58 + 71 . 13 + 70 . 81 + 70 . 51 ( α + β + γ + δ ), 67 . 48 ( ε ), 56 . 96 , 56 . 34 , 50 . 37 , 42 . 49 , 39 . 97 , 39 . 68 , 39 . 25 , 37 . 42 , 37 . 04 , 36 . 36 , 35 . 94 , 33 . 61 , 32 . 12 ( ζ ), 32 . 07 , 28 . 54 , 28 . 39 , 28 . 17 , 24 . 45 , 23 . 99 , 22 . 96 , 22 . 71 , 21 . 24 , 19 . 54 , 18 . 88 , 16 . 20 ( η ), 12 . 02 . high resolution es ms m / z exp ( calc ): 549 . 43413 ( 549 . 43413 , [ m + h ] + ), 566 . 46068 ( 566 . 45998 , [ m + nh 4 ] + ), 571 . 41608 ( 571 . 41482 , [ m + na ] + ). c , h , n , s expt 74 . 39 / 11 . 02 / 0 . 00 / 5 . 84 ; calc 74 . 39 / 11 . 16 / 0 . 0 / 5 . 85 for c 34 h 60 o 3 s dmpc liposomes are suitable carriers to transport cationic ru complexes into cancer cells neutral dimyristoylphosphatidylcholine ( dmpc ) or anionic dimyristoylphosphatidylglycerol ( dmpg ) liposomes including 0 , 5 , or 10 mol % of compound [ 5 ]( pf 6 ) 2 were prepared . the procedure was the same as in example 1 , but the liposomes also included 5 mol % of a fluorescently labelled lipid ( dppc - nbd ). hepg2 cancer cells were incubated for 1 h with such liposomes at 37 ° c . under an atmosphere of 5 % co 2 and 95 % air . after washing , confocal microscopy images were taken to evaluate liposome uptake . as shown in fig5 there is negligible uptake of dmpc liposomes in absence of ru ( a ), whereas in presence of ru liposome uptake is excellent ( b & amp ; c ). on the contrary , the negatively charged dmpg liposomes without ru are well taken up , but addition of the ru complexes quenches fully ( e ) of partially ( f ) liposome uptake . this experiment shows that charges at the lipid bilayer surface strongly influence liposome uptake , and that cationic ru complexes promote the uptake of neutral liposomes by cancer cells . thus , neutral liposomes are a suitable means for transporting ru prodrugs into cancer cells . 2 . novakova , o . ; kasparova , j . ; vrana , o . ; van vliet , p . m . ; reedijk , j . ; brabec , v ., biochemistry 1995 , 34 , 12369 . 3 . hotze , a . c . g . ; bacac , m . ; velders , a . h . ; jansen , b . a . j . ; kooijman , h . ; spek , a . l . ; haasnoot , j . g . ; reedijk , j ., j . med . chem . 2003 , 46 , 1743 . 4 . corral , e . ; hotze , a . c . g . ; den dulk , h . ; leczkowska , a . ; rodger , a . ; hannon , m . j . ; reedijk , j ., j . biol . inorg . chem . 2009 , 14 , 439 . 5 . witczak , z . ; culhane , j ., appl . microbiol . biotechnol . 2005 , 69 , 237 . 7 . sheldrick , w . s . ; exner , r ., j . organomet . chem . 1990 , 386 , 375 . 8 . collin , j .- p . ; jouvenot , d . ; koizumi , m . ; sauvage , j .- p ., inorg . chim . acta 2007 , 360 , 923 . 9 . nikolenko , v . ; yuste , r . ; zayat , l . ; baraldo , l . m . ; etchenique , r ., chem . commun . 2005 , 1752 . 13 . takeuchi , k . j . ; thompson , m . s . ; pipes , d . w . ; meyer , t . j ., inorg . chem . 1984 , 23 , 1845 . 14 . calvert , j . g . ; pitts , j . n ., chemical actinometer for the determination of ultraviolet light intensities . in photochemistry , wiley and sons : new york , 1967 ; pp 780 . 15 . rouser , g . ; fleische . s ; yamamoto , a ., lipids 1970 , 5 , 494 . 16 . bligh , e . g . ; dyer , w . j ., can . j . biochem . physiol . 1959 , 37 , 911 . 17 . root , m . j . ; deutsch , e ., inorg . chem . 1985 , 24 , 1464 . 18 . bonnet , s . ; collin , j . ; gruber , n . ; sauvage , j . ; schofield , e ., dalton trans . 2003 , 4654 . 19 . jackson , a . ; davis , j . ; pither , r . ; rodger , a ., inorg . chem . 2001 , 40 , 3964 . 20 . buil , m . l . ; esteruelas , m . a . ; garces , k . ; onate , e ., organometallics 2009 , 28 , 5691 . 21 . jaouen , g . ; vessieres , a . ; butler , i ., acc . chem . res . 1993 , 26 , 361 . 22 . lo , k . k .- w . ; tsang , k . h .- k . ; sze , k .- s . ; chung , c .- k . ; lee , t . k .- m . ; zhang , k . y . ; hui , w .- k . ; li , c .- k . ; lau , j . s .- y . ; ng , d . c .- m . ; zhu , n ., coord . chem . rev . 2007 , 251 , 2292 . 23 . schobert , r . ; bernhardt , g . ; biersack , b . ; bollwein , s . ; fallahi , m . ; grotemeier , a . ; hammond , g . l ., chem . med . chem . 2007 , 2 , 333 . 24 . d &# 39 ; hardemare , a . d . ; torelli , s . ; serratrice , g . ; pierre , j . l ., biometals 2006 , 19 , 349 . 25 . jiang , h . ; smith , b . d ., chem . commun . 2006 , 1407 . 26 . doyle , e . l . ; hunter , c . a . ; phillips , h . c . ; webb , s . j . ; williams , n . h ., j . am . chem . soc . 2003 , 125 , 4593 . 27 . hecker , c . r . ; fanwick , p . e . ; mcmillin , d . r ., inorg . chem . 1991 , 30 , 659 . 28 . laemmel , a . ; collin , j . ; sauvage , j ., cr . acad . sci . paris llc 2000 , 3 , 43 . 29 . bonnet , s . ; collin , j . ; sauvage , p ., inorg . chem . 2006 , 45 , 4024 . 30 . ossipov , d . ; gohil , s . ; chattopadhyaya , j ., j . am . chem . soc . 2002 , 124 , 13416 . 31 . schofield , e . ; collin , j . ; gruber , n . ; sauvage , j ., chem . commun . 2003 , 188 . 32 . bonnet , s . ; collin , j . ; sauvage , j . ; schofield , e ., inorg . chem . 2004 , 43 , 8346 . 33 . sigel , h . ; mccormic , d . ; griesser , r . ; prijs , b . ; wright , l ., biochemistry 1969 , 8 , 2687 .

US-201113880253-A

a system and method for capturing and sharing console gaming data is described . embodiments capture gameplay data directly at the gaming console , without the need for external hardware . this allows users to easily capture rich console gaming experiences and share them across a variety of outlets . in one embodiment , the methods described herein can be implemented with a patch or driver on the operating system of the user device , rendering it unnecessary to heavily modify the source code of the game .

a system and method for capturing and sharing console gaming data is described . in the following description , for purposes of explanation , numerous specific details are set forth in order to provide a thorough understanding of the exemplary embodiments . it is apparent to one skilled in the art , however , that embodiments can be practiced without these specific details or with an equivalent arrangement . in some instances , well - known structures and devices are shown in block diagram form in order to avoid unnecessarily obscuring the embodiments . referring now to the drawings , wherein like reference numerals designate identical or corresponding parts throughout the several views , fig1 is a flowchart illustrating a method for storing gameplay according to one embodiment . at processing block 110 , gameplay is executed . gameplay can be executed by the operating system of a game console in response to a user request , which can come in the form of a standard file operation with respect to a set of data associated with the desired gameplay . the request can be transmitted from an application associated with a game . the gameplay can comprise , for example , video content , audio content and / or static visual content , including wall papers , themes , “ add - on ” content , or any other type of content associated with a game . it is contemplated that such content can be user - or developer - generated , free or paid , full or trial , and / or for sale or for rent . at processing block 120 , a first portion of the gameplay is buffered , i . e ., stored temporarily . for example , the previous 15 seconds , the previously completed level , or the previous action within the gameplay can be stored temporarily , as described further herein . the term “ portion ” used herein can correspond to any part of the gameplay that is divisible into any related or arbitrary groups of single or multiple bits or bytes of data . for example , “ portions ” of gameplay may correspond to levels , chapters , scenes , acts , characters , backgrounds , textures , courses , actions , songs , themes , durations , sizes , files , parts thereof , and combinations thereof . further , portions of gameplay can comprise screenshots or prescribed durations of video capture . at processing block 130 , a request to capture a second portion of the gameplay is received . the request to capture the second portion of the gameplay can be a user request , which can come in the form of a standard file operation with respect to a set of data associated with the gameplay to be captured . a user can request to capture a second portion of the gameplay by , for example , selecting a button on a game controller , as described further herein . the second portion of the gameplay reflects gameplay subsequent to the first portion of the gameplay . in other words , the first portion of the gameplay reflects gameplay that occurred prior to receipt of the user request to capture the second portion of the gameplay . the second portion of the gameplay reflects gameplay that occurred after receipt of the user request to capture the second portion of the gameplay . thus , the first portion of the gameplay is a past portion of the gameplay that has already been played , while the second portion of the gameplay begins with a current portion of the gameplay that is being executed . at processing block 140 , the second portion of the gameplay is captured . in one embodiment , the second portion of the gameplay is captured according to the user &# 39 ; s request . for example , if the user taps a capture button on the game controller , a screenshot or still picture can be taken . if the user holds down a capture button on a game controller , a video can be taken for the length of time the button is being held down . in other words , if the button is held down for 5 seconds , 5 seconds of the gameplay can be captured as the second portion of gameplay ; if the button is held down for 10 seconds , 10 seconds of the gameplay can be captured ; and so on . in another example , a screenshot or still picture can be taken if the user holds down a capture button , and a video can be taken if the user taps a capture button twice consecutively : once to start the capture , and again to end the capture . at processing block 150 , the first and second portions of the gameplay are stored . in an embodiment in which the first and second portions of the gameplay are videos , the first portion of the gameplay can be attached to the second portion of the gameplay , such that a single video without interruption is created . in one embodiment , the first and second portions of the gameplay can be stored locally on the game console in either temporary or permanent storage . alternatively or additionally , the first and second portions of the gameplay can be transmitted over a network and stored remotely . for example , the first and second portions of the gameplay can be transmitted over a wireless or wired network to another computing device , to another game console , or to a remote server . such remote servers may include social media servers . optionally , portions of the gameplay not retrieved from the buffer or portions of the gameplay outside a particular gaming interval ( e . g ., a particular duration , level , chapter , course , etc .) can be removed from the buffer . this removal process can be completed using standard file operations on the operating system . at optional processing block 160 , the first and second portions of the gameplay are displayed . the first and second portions of the gameplay can be displayed on any of a number of display devices having access to the stored gameplay . for example , the stored gameplay can be displayed on a television set connected to the game console from which the gameplay was captured . in another example , the stored gameplay can be displayed on a computer to which the stored gameplay was transmitted . the stored gameplay can be displayed alone or in conjunction with other information , such as on a social media website . in one embodiment , the first and second portions of the gameplay are displayed by another game console associated with a user other than the user that buffered or captured the gameplay . according to this embodiment , the first and second portions of the gameplay may show a ball being thrown from a first user to a second user , from the point of view of the first user . the first and second portions of gameplay can then be transmitted to the game console of the second user . thus , the second user can then view the gameplay from the point of view of the first user . the second user can also have third and fourth portions of gameplay stored showing the ball being thrown by the first user and caught by the second user , from the point of view of the second user . in this embodiment , the second user can review the gameplay from both the point of view of the first user and the point of view of the second user . still further , the third and fourth portions of the gameplay can be transmitted to the game console of the first user , so that the first user may review the gameplay from two points of view . this embodiment can apply to any number of users having any number of points of view , so that gameplay can be reviewed from any number of different perspectives . with respect to storage , transmission and / or display of the first and second portions of the gameplay as described herein , it is contemplated that the first and second portions of the gameplay can be stored , transmitted and displayed as image or video data . in another embodiment , however , the first and second portions of the gameplay can be stored and transmitted as telemetry or metadata representative of the image or video data , and can be recreated as images or video by a game console or other device prior to display . in some embodiments , the first portion of the gameplay has a predetermined relationship with the executed gameplay . for example , the first portion of the gameplay can correspond to a certain amount of gameplay prior to the currently executing gameplay , such as the previous 10 seconds of gameplay . in another embodiment , the first portion of the gameplay has a predetermined relationship with the second portion of the gameplay . for example , the first portion of the gameplay can correspond to a certain amount of gameplay prior to receipt of a request to capture the second portion of gameplay , such as the 10 seconds of gameplay prior to selection of the capture button . in each of these embodiments , the amount of gameplay buffered prior to the current gameplay or the requested gameplay can be configured and adjusted by the user according to his or her particular preferences . in other embodiments , the buffer is “ smart ” or “ elastic ”, such that it captures gameplay according to variables without regard to time . in one such embodiment , the first portion of the gameplay has a predetermined relationship with an event related to the gameplay . for example , the first portion of the gameplay may be buffered to include a statistical anomaly , such as a high score being reached , the gathering of a large number of points in a short amount of time , the multiple selections of buttons on a controller , and other rare events . such statistical anomalies can be determined by comparing gameplay metrics to average metrics for a particular game or scene , or for all games generally . such average metrics can be stored locally or remotely for comparison . for example , a game console can track local high scores for a particular game , and buffer gameplay in which a user approaches and surpasses that high score . in another example , a remote server can track global high scores for a particular game , and can communicate that information to the game console , which buffers gameplay in which the user approaches and surpasses that high score . in another example , the first portion of the gameplay can be buffered to include an achievement , such as a trophy being attained or other landmark being reached . such trophies or landmarks memorialize any goal or gaming achievement , such as a certain number of points being attained , a certain level being reached , and the like . for example , gameplay can be buffered to include the awarding of a trophy for reaching level 10 , for reaching 100 , 000 points , etc . similarly , progress toward reaching an event , in addition to the actual attainment of the trophy or statistical anomaly , can be buffered to be included in the first portion of the gameplay . for example , a screenshot can be taken at each of levels 1 through 10 , creating a photo album to memorialize the receipt of a trophy for reaching level 10 . in another example , a video can be taken of a user winning a race for the first through fifth times , where a trophy is awarded for 5 wins . thus , according to the embodiment illustrated in fig1 , at least a portion of executed gameplay can always be kept in a running buffer . in other words , when a request to capture a portion of the gameplay is received , a portion of the prior gameplay can already be captured to include previous footage . for example , if a request to capture gameplay is received after a user crosses the finish line in a racing game , the buffered gameplay can include footage of the user crossing the finish line . in other words , a user will be able to capture moments occurring before a request is made to capture the gameplay . fig2 is a flowchart illustrating a method for embedding information such as links into stored gameplay in accordance with one embodiment . at processing block 210 , stored gameplay and its associated gameplay metadata is retrieved . the stored gameplay may be gameplay or portions thereof stored on any medium . in one embodiment , the stored gameplay comprises the first and second portions of gameplay discussed above with respect to fig1 . gameplay metadata may include , for example , the game title , game publisher , game developer , game distributor , game platform , game release date , game rating , game characters , game genre , game expansions , gameplay level or scene , length of stored gameplay , gameplay storage date , accessories used during gameplay , number of players , user id of the user that captured the stored gameplay , user ids of other users identified in the stored gameplay , and the like . at processing block 220 , relevant links are identified based on the gameplay metadata . relevant links may be hyperlinks , for example . in one embodiment , relevant links are automatically created and generated based on the gameplay metadata . this embodiment can be implemented where websites are named according to a particular naming convention . for example , if a game &# 39 ; s website address is assigned according to http :// us . playstation . com / games - and - media / games / title - of - game - platform . html , where title - of - game is replaced with the game &# 39 ; s title and platform is replaced with the game &# 39 ; s platform , the method according to this embodiment could pull the title of the game and the game platform from the gameplay metadata , and insert the data into the web site address to generate a link . for example , for a game entitled “ sample game ” available on the ps3 , the following link could be automatically generated : http :// us . playstation . com / games - and - media / games / sample - game - ps3 . html . in another embodiment , relevant links are identified from a plurality of links provided by or available from the game console , the game itself , the gaming network , or a third party server . in this embodiment , relevant links can be selected based on their commonalities with the gameplay metadata . for example , relevant links could include links to the game title &# 39 ; s store or purchase page , to the user profiles of other users identified in the stored gameplay , to an informational website about the game title , to a community website dedicated to the game title , to the user &# 39 ; s trophy information , to downloadable content or game expansions used in the stored gameplay , to other videos of the same game title and / or game level , to other gameplay captured by the same user , to trailers of upcoming games in the same genre , to clan data , to contests , to advertisements , and the like . at processing block 230 , one or more of the relevant links are embedded into the stored gameplay . in one embodiment , the relevant links are graphically or textually embedded into or overlaid on the screenshot or video itself . in another embodiment , the relevant links are embedded as text accompanying the screenshot or video . at processing block 240 , the link - embedded gameplay is stored . in one embodiment , the link - embedded gameplay is stored locally on a game console in either temporary or permanent storage . alternatively or additionally , the link - embedded gameplay can be transmitted over a network and stored remotely . for example , the link - embedded gameplay can be transmitted over a wireless or wired network to another computing device , to another game console , or to a remote server . such remote servers may include social media servers . at optional processing block 240 , the link - embedded gameplay is displayed . the link - embedded gameplay can be displayed on any of a number of display devices having access to and capability to display the link - embedded gameplay . for example , the link - embedded gameplay can be displayed on a television set connected to the game console from which the gameplay was captured . in another example , the link - embedded gameplay can be displayed on a computer to which the stored gameplay was transmitted . the link - embedded gameplay can be displayed alone or in conjunction with other information , such as on a social media website . in one embodiment , the “ sharing ” of link - embedded gameplay by users can be encouraged by providing an incentive program . for example , the number of clicks of the relevant links can be tracked . in another example , where the link - embedded gameplay contains a link to a purchase website for the game , the number of game purchases can be tracked . these numbers can then be used to reward users for sharing and distributing link - embedded gameplay . in still another example where the link - embedded gameplay contains a link to a purchase website for the game , a discount on the game can be provided to those users clicking through link - embedded gameplay to encourage purchase of the game and distribution of the link - embedded gameplay . fig3 is a flowchart illustrating a method for embedding information such as user ids into stored gameplay in accordance with one embodiment . at processing block 310 , stored gameplay and gameplay metadata is retrieved . the stored gameplay may be gameplay or portions thereof stored on any medium . in one embodiment , the stored gameplay comprises the first and second portions of gameplay discussed above with respect to fig1 . in another embodiment , the stored gameplay is the gameplay embedded with relevant links discussed above with respect to fig2 . gameplay metadata according to this embodiment includes at least one of the user id of the user that captured the stored gameplay , and the user id ( s ) of other user ( s ) present in the captured gameplay . the other user ( s ) present in the captured gameplay can be local users , such as a second user in a two player game connected to the same game console as the first user , or can be remote users , such as networked users connected to a different game console than the first user participating in a partially - or fully - online implemented game . at processing block 320 , user ids are identified from the gameplay metadata . at processing block 330 , the user ids are embedded into the stored gameplay . in one embodiment , the user ids are graphically or textually embedded into or overlaid on the screenshot or video itself . in this embodiment , the user ids can be embedded into or overlaid on their associated graphical representations . for example , if user_1 is represented by a red car in the stored gameplay , and user_2 is represented by a blue car in the stored gameplay , the tag “ user_1 ” can be overlaid on or otherwise associated with the red car , and the tag “ user_2 ” can be overlaid on or otherwise associated with the blue car . in another embodiment , the user ids are embedded as text accompanying the screenshot or video . in the latter embodiment , the accompanying text can be text intended to be displayed , such as a description or title , or can be text intended to be invisible upon display , such as embedded gameplay metadata . it is contemplated that the accompanying text can be searchable . at processing block 340 , the id - embedded gameplay is stored . in one embodiment , the id - embedded gameplay is stored locally on a game console in either temporary or permanent storage . alternatively or additionally , the id - embedded gameplay can be transmitted over a network and stored remotely . for example , the id - embedded gameplay can be transmitted over a wireless or wired network to another computing device , to another game console , or to a remote server . such remote servers may include social media servers . at processing block 350 , the id - embedded gameplay is displayed . the id - embedded gameplay can be displayed on any of a number of display devices having access and capability to display the id - embedded gameplay . for example , the id - embedded gameplay can be displayed on a television set connected to the game console from which the gameplay was captured . in another example , the id - embedded gameplay can be displayed on a computer to which the stored gameplay was transmitted . the id - embedded gameplay can be displayed alone or in conjunction with other information , such as on a social media website . when displayed on a social media website , it is contemplated that the user tags can be compatible with the websites , such that the tags carry over to the social media website . thus , according to the embodiment described with respect to fig3 , the need to manually tag gameplay media with user id &# 39 ; s is eliminated by making the process automatic . fig4 illustrates a system for effecting the acts of one or more of the methodologies described herein . server 410 is connected over network 440 to a user device 450 . server 410 includes processor 420 and memory 430 , which are in communication with one another . server 410 is typically a computer system , and may be an http ( hypertext transfer protocol ) server , such as an apache server . it is contemplated , however , that server 410 can be a single or multiple modules or devices hosting downloadable content or portions thereof . further , server 410 can be a dedicated server , a shared server , or combinations thereof . for example , server 410 can be a server associated with the developer , publisher or distributor of the application 460 , or a third - party server , such as a peer device in a peer - to - peer ( p2p ) network . in addition , server 410 can comprise a virtual market or online shopping - based service offering the application 460 . in this embodiment , server 410 ( alone or in combination with other devices ) can process and perform various commercial transactions , such as billing , in addition to those acts described herein . user device 450 includes application 460 , input device 465 , operating system 470 , processor 480 , and memory 490 , which are in communication with one another . in one embodiment , user device 450 is a game console . in that embodiment , application 460 may be a game , and input device 465 may be a controller . server 410 and user device 450 are characterized in that they are capable of being connected to network 440 . network 440 can be wired or wireless , and can include a local area network ( lan ), wide area network ( wan ), a telephone network ( such as the public switched telephone network ( pstn )), a radio network , a cellular or mobile phone network ( such as gsm , gprs , cdma , ev - co , edge , 3gsm , dect , is - 136 / tda , iden , and the like ), intranet , the internet , or combinations thereof . memory 430 and memory 490 may be any type of storage media that may be volatile or non - volatile memory that includes , for example , read - only memory ( rom ), random access memory ( ram ), magnetic disk storage media , optical storage media , flash memory devices , zip drives , and combinations thereof . memory 430 and memory 490 can be capable of permanent or temporary storage , or both ; and can be internal , external , or both . in use , application 460 makes calls to operating system 470 to load and access data stored in memory 490 , using standard file operations . application 460 can be any software and / or hardware that provides an interface between a user of user device 450 ( via input device 465 ) and operating system 470 . the standard file operations include , for example , “ open ” ( i . e ., specifying which file is to be accessed ), “ seek ” ( i . e ., specifying what position to go to in the file to read data ), “ read ” ( i . e ., requesting that data be read from the file and copied to application 460 ), and “ close ” ( i . e ., requesting that the file be closed for now ). fig5 shows a diagrammatic representation of machine in the exemplary form of computer system 500 within which a set of instructions , for causing the machine to perform any one or more of the methodologies discussed herein , may be executed . in alternative embodiments , the machine operates as a standalone device or may be connected ( e . g ., networked ) to other machines . in a networked deployment , the machine may operate in the capacity of a server or a client machine in server - client network environment , as a host machine , or as a peer machine in a peer - to - peer ( or distributed ) network environment . the machine may be a personal computer ( pc ), a tablet , a set - top box ( stb ), a personal digital assistant ( pda ), a cellular telephone , a web appliance , a network router , switch or bridge , a game console , a television , a cd player , a dvd player , a bd player , an e - reader , or any machine capable of executing a set of instructions ( sequential or otherwise ) that specify actions to be taken by that machine . further , while only a single machine is illustrated , the term “ machine ” shall also be taken to include any collection of machines that individually or jointly execute a set ( or multiple sets ) of instructions to perform any one or more of the methodologies discussed herein . according to some embodiments , computer system 500 comprises processor 550 ( e . g ., a central processing unit ( cpu ), a graphics processing unit ( gpu ) or both ), main memory 560 ( e . g ., read only memory ( rom ), flash memory , dynamic random access memory ( dram ) such as synchronous dram ( sdram ) or rambus dram ( rdram ), etc .) and / or static memory 570 ( e . g ., flash memory , static random access memory ( sram ), etc . ), which communicate with each other via bus 595 . according to some embodiments , computer system 500 may further comprise video display unit 510 ( e . g ., a liquid crystal display ( lcd ), a light - emitting diode display ( led ), an electroluminescent display ( eld ), plasma display panels ( pdp ), an organic light - emitting diode display ( oled ), a surface - conduction electron - emitted display ( sed ), a nanocrystal display , a 3d display , or a cathode ray tube ( crt )). according to some embodiments , computer system 500 also may comprise alphanumeric input device 515 ( e . g ., a keyboard ), cursor control device 520 ( e . g ., a controller or mouse ), disk drive unit 530 , signal generation device 540 ( e . g ., a speaker ), and / or network interface device 580 . disk drive unit 530 includes computer - readable medium 534 on which is stored one or more sets of instructions ( e . g ., software 536 ) embodying any one or more of the methodologies or functions described herein . software 536 may also reside , completely or at least partially , within main memory 560 and / or within processor 550 during execution thereof by computer system 500 , main memory 560 and processor 550 . processor 550 and main memory 560 can also constitute computer - readable media having instructions 554 and 564 , respectively . software 536 may further be transmitted or received over network 590 via network interface device 580 . while computer - readable medium 534 is shown in an exemplary embodiment to be a single medium , the term “ computer - readable medium ” should be taken to include a single medium or multiple media ( e . g ., a centralized or distributed database , and / or associated caches and servers ) that store the one or more sets of instructions . the term “ computer - readable medium ” shall also be taken to include any medium that is capable of storing , encoding or carrying a set of instructions for execution by the machine and that cause the machine to perform any one or more of the methodologies of the disclosed embodiments . the term “ computer - readable medium ” shall accordingly be taken to include , but not be limited to , solid - state memories , and optical and magnetic media . it should be understood that processes and techniques described herein are not inherently related to any particular apparatus and may be implemented by any suitable combination of components . further , various types of general purpose devices may be used in accordance with the teachings described herein . it may also prove advantageous to construct a specialized apparatus to perform the methods described herein . those skilled in the art will appreciate that many different combinations of hardware , software , and firmware will be suitable for practicing the disclosed embodiments . embodiments have been described in relation to particular examples , which are intended in all respects to be illustrative rather than restrictive . further , while embodiments have been described in connection with a number of examples and implementations , it is understood that various modifications and equivalent arrangements can be made to the examples while remaining within the scope of the inventive embodiments . other embodiments will be apparent to those skilled in the art from consideration of the specification and practice of the embodiments disclosed herein . various aspects and / or components of the described embodiments may be used singly or in any combination . it is intended that the specification and examples be considered as exemplary only , with a true scope and spirit of the disclosure being indicated by the following claims .

US-201715703395-A

this invention concerns nutritive and restorative hair care compositions which are distinctive in that they contain probiotic bacteria and other ingredients found in yogurt . both water - based and anhydrous embodiments are described . the compositions are designed to moisturize , soften , condition , straighten , strengthen and repair hair in addition to promoting a healthy scalp .

the components of this invention can also be mixed with other cosmetically or pharmaceutically acceptable excipients , as is understandable to a one skilled in the art . other aims , characteristics and advantages of the invention will emerge in light of the explanatory description which will be made with reference to several examples of compositions as well as various tests which have been carried out . in the examples , all the percentages are given by weight and the temperature is ambient temperature and the pressure is atmospheric , unless otherwise indicated . the first embodiment is an anhydrous formulation with ingredients and percent weight as set forth in table 1 . the process of making the anhydrous formulation is as follows : in stainless steel , jacketed kettle , equip with lightnin &# 39 ; type ( propeller with adjustable rate ) agitation and sweep agitation , combine seq . 1 materials and begin heating under lightnin &# 39 ; type agitation to 80 - 82 c . so all ingredients melt into the mixture . when batch is uniform , begin cooling under agitation to 42 c . switch to sweep when necessary or as batch thickens . at 42 c . begin adding seq . # 2 materials one at a time under adequate mixing , being sure each is well mix before continuing . cool to 25 c . add seq . # 3 bacteria complex and mix batch until uniform . the final anhydrous formulation &# 39 ; s initial viscosity as measured using a brookfield lvt spindle # 4 @ 6 rpm &# 39 ; s for 1 minute = 53 , 200 cps dial reading 55 %. it appears as a white to off white opaque cream and has an odor that is a slightly floral with citrus note . its specific gravity measures 0 . 927 (+/− 0 . 03 ) when measured using a stainless steel grease pychnometer @ 25 degrees centigrade . the second embodiment is a water - based formulation . it is made by mixing certain ingredients in stages . probiotic bacteria will be found in the fermented milk extract and whey protein concentrate but it is contemplated that additional specific probiotic bacteria will be supplemented in the final step in dry form : part a is made by dry - blending the cellosize hec 52000h , whey protein , and kytamer p . c . in a powder blender using vigorous agitation to disperse . the powder is then mixed with the di water in a suitable kettle . this is then mixed for twenty ( 20 ) to thirty ( 30 ) minutes at room temperature . while mixing , heat water to 73 c .- 77 c . cover the vessel . maintain temperature and decrease speed of mechanical mixing ( avoid excessive air tramping ). once polymers are completely hydrated and a free lumps viscous gel is obtained slowly add glucquat 125 . mix to uniformity . separately , to create part b , heat promulgen d , stearyl alcohol , cetyl alcohol , lambent f - 100 , incroquat behemyl tms , abil osw - 12 and brij 72 to 75 - 80 c . this procedure requires the use of high - torque impeller . once free lumps gel is obtained heat part a at 75 - 80 c . when part a & amp ; b are at 75 c .- 80 c ., emulsify by adding part b into a . mix to uniformity . maintain temperature and mixing conditions for 15 minutes approximately . cover the main batch in order to avoid loose water for evaporation . when the emulsion is completed start decreasing the mechanical mixing speed . mix and cool the batch to 35 c .- 40 c . slowly add one by one ingredients tritisol , cetylsil basics , d . c . 929 cationic emulsion , fm . extract and dmdm . hydantoin to the batch . mix well to uniformity . when a uniform product is obtained , mix and cool the main batch below 35 c . continue mixing and add natural yogurt fragrance . mix well . q . s . the batch to final weight . mix to uniformity . note : using a very slow mechanical mixing makers the mixing and cooling process to avoid air tramping . during the preparation of part a ( polymers hydration ) it is important to control temperature to prevent burning and denaturalization of the whey protein . the ingredients listed in examples 1 and 2 are the preferred embodiments of the invention . however , other ingredients are contemplated and may be substituted for the specific ingredients selected . those of skill in the art of hair product formulation reference the international cosmetic ingredient handbook for approved ingredients in the various categories of ingredients used to formulate hair products for consumer use . for example , peg 200 , behentrimonium chloride , steapyrium chloride , stearalkonium chloride , cetrimonium chloride , polyquaternium - 7 , polyquaternium - 11 , quaternium - 79 hydrolyzed wheat ( natural from wheat ), quaternium - 79 hydrolyzed soy ( natural from soy ), and stearamidopropyl dimethylamine are conditioning agents . other conditioning agents that would be suitable and easily formulated without undue experimentation by those in the art are acetamide mea , alfalfa , ceteth - 2 , cetyl alcohol , cetrimonium bromide or chloride , cetyldimonium chloride , cocamide dea , cocamidopropyl betaine , cocamidopropyl hydroxysultaine , caprylyl pyrrolidone , colaquat l - 35 , dimethicone , dicetyldimonium chloride , dimethyl lauramine isostearate , dimethyl stearamine , guar hydroxypropyltrimonium chloride , hydrolyzed wheat amino acids , keratin protein , lineolamido propyl ethydimonium ethosulfate , palm kernelamide dea and mea , panthenol , sage extract , sodium myristoyl sarcosinate , surfactant , polyquaternium - 4 , polyquaternium - 10 and other compounds in the polyquaternium family . the examples of conditioning agents above are by no means a complete list of all contemplated potential conditioning agents — other similar compounds would be known to those of skill in the art . certain emulsifying agents were also selected such as glyceryl stearate and peg - 100 stearate , cetyl esters , glycol distearate , cetearyl alcohol and ceteareth - 20 , cetyl alcohol , stearyl alcohol , trideceth - 10 phosphate and behenyl alcohol . other emulsifying agents that would be suitable and easily formulated without undue experimentation by those in the art are behenyl dimethylamine oxide , cetearyl alcohol , dimethyl lauramine isostearate , dimethyl stearamine , glyceryl monostearate , polysorbate 80 and other compounds in the polyethylene glycol family . the examples of emulsifying agents above is by no means a complete list of all contemplated potential emulsifying agents — other similar compounds would be known to those of skill in the art . olea europaea ( olive ) fruit oil was selected as an emollient in the preferred embodiment . other emollients that would be suitable and easily formulated without undue experimentation by those in the art are ceteareth — 5 , prunus amygdalus dulcis ( sweet almond oil ), buxus chinensis ( jojoba oil ), laureth — 3 , lecithin , lime oil , methyl glucceth - 20 , peg - 40 and castor oil , avocado oil , safflower oil ( carthamus tinctorius ), emu oil , soybean oil and sesame oil . the examples of emollients above is by no means a complete list of all contemplated potential emollients — other similar compounds would be known to those of skill in the art . certain preservatives were also selected such as methylparaben , propylparaben and phenoxyethanol . other preservatives that would be suitable and easily formulated without undue experimentation by those in the art are diazolidinyl urea , isopropylparaben , isobutylparaben , methylisothiazolinone and methylchloroisothiazolinone . this is by no means a complete list of all contemplated preservatives — other similar compounds would be known to those of skill in the art . the antistatic agents polyquaternium - 7 , quaternium - 79 hydrolyzed soy and quaterinium - 79 hydrolyzed wheat were used in the preparation of the preferred embodiment . other antistatic agents that would be suitable and easily formulated without undue experimentation by those in the art are cocamidopropyl hydroxysultaine , lineolamido propyl ethydimonium ethosulfate , myristalkoniuum chloride , quaternium compounds , sodium isoethionate and other compounds in the polyquaternium family . this is by no means complete — other similar compounds would be known to those of skill in the art . disodium edta was chosen as the chelating agent . other chelating agents that would be suitable and easily formulated without undue experimentation by those in the art are sodium edta , trisodium edta , tetrasodium edta and hampene na . this is by no means complete — other similar compounds would be known to those of skill in the art . repair agents are contemplated as possible components of the invented haircare compositions and could be included and easily formulated without undue experimentation by those in the art . such ingredients are guar hydroxypropyltrimonium chloride and hydrolyzed wheat protein with wheat oligosaccharides . this is by no means complete — other similar compounds would be known to those of skill in the art . water , glycerin and panthenyl hydroxypropyl steardimonium chloride were also chosen as the humectants in the preferred embodiments . other humectants that would be suitable and easily formulated without undue experimentation by those in the art are butylene glycol , hyaluronic acid , panthenol , panthenyl ethyl ether , sodium pca and sorbitol . this is by no means complete — other similar compounds would be known to those of skill in the art . the viscosity agents cetearyl alcohol and ceteareth - 20 , cetyl esters and polyquaternium - 11 were also selected . other viscosity or volume enhancing agents that would be suitable and easily formulated without undue experimentation by those in the art are ammonium xylene sulfonate , cocamide dea , sodium chloride and tea - dodecylbenzenesulfonate . this is by no means complete — other similar compounds would be known to those of skill in the art . the preferred embodiment also contains the shine agent amiodimethicone and tridecth - 12 and cetrimonium chloride . other shine agents that would be suitable and easily formulated without undue experimentation by those in the art are aloe vera gel , lavender oil and peg - 40 and castor oil . this is by no means complete — other similar compounds would be known to those of skill in the art . dimethylpabamidopropyl laurdimonium tosylate and glycol stearate was added as a sunscreening agent . other sunscreens that would be suitable and easily formulated without undue experimentation by those in the art are benzophenone - 3 , benzophenone - 4 , octyl dimethyl paba and geranium oil . this is by no means complete — other similar compounds would be known to those of skill in the art . acetamide mea was added as a component to exfoliate hair follicles . another exfoliating agent that would be suitable and easily formulated without undue experimentation by those in the art is lactic acid . this is by no means complete — other similar compounds would be known to those of skill in the art . the protein - cleaving enzyme papain was used in place of traditional surfactants . surfactants that would be suitable and easily formulated without undue experimentation by those in the art are sodium lauryl sulfate , ammonium lauryl sulfate , ammonium cocoyl isothionate , disodium laureth sulfosuccinate and sodium isostearoyl lactylate . this is by no means complete — other similar compounds would be known to those of skill in the art . any known fragrance — natural or synthetic — could be substituted for the fragrance elements set forth in the embodiments . the probiotic bacteria lactobacillus rhamnosus , lactobacillus casei , lactobacillus plantarum , lactobacillus acidophilus , bifidobacterium longum , bifidobacterium breve , pediococcus , acidilactici and lactococcus diacetylactis were selected as supplemental probiotic bacteria in the anhydrous embodiment . other probiotic bacteria are contemplated as part of the invention and could be easily add to a disclosed formulation without undue experimentation by those in the art . these include other strains from the lactobacillus family including l . brevis , l . bulgaricus , l . fermentum , l . caucasicus , l . helveticus , l . lactis , l . plantarum and l . reuteri ; from the bifidobacterium family including b . bifidum ( lactis ) b . infantis , b . licheniformis and b . subtilus ; from the streptococcus family including s . cremoris , s . faecium , s . infantis and s . thermophilus ; and other strains including enterococcus faecium , leuconostoc cremoris , saccharomyces florentinus . this invention also contemplates the use of “ prebiotics ” to assist in sustaining the probiotic bacteria by including suitable ingredients to maintain a nutritive environment in the composition . such ingredients are known and include soy oligosaccharides , fructo - oligosaccharides , isomalto - oligosaccharides , xylo - oligosaccharides , transgalacto - oligosaccharides , pyrodextrins , lactulose , isomalto - oligosaccharides , and insulins . hair care compositions as set forth in the above embodiments have been subjected to a range of testing by numerous individuals with a variety of hair types . testing included comparisons to other commercially successful hair care products . tests were conducted on both a blind and non - blind basis . participant &# 39 ; s , ( and in some cases , on - hand stylist &# 39 ; s ) comments were recorded and the following results were evidenced . trial number 1 is a test between the anhydrous embodiment composition ( example 1 above ) and a leading commercially available luxury hair care treatment ( sample b ). to ensure accuracy of the results , the samples were tested blind so as to avoid any branding bias . the objective of the test was to compare the performance and effectiveness of the samples on hair both during and after application and styling ( i . e . blow drying , air drying , curling , straightening , etc .). prior to testing , the hair was thoroughly washed with a commercially successful clarifying shampoo and towel dried . a hair stylist then applied embodiment hair care composition ( example 1 ) to one side of the participant &# 39 ; s head and the commercially available luxury hair care treatment ( sample b ) to the other side of the head . each product was evenly distributed on its respective side paying careful attention to maintaining the separation of the samples . both products were allowed to remain in the hair for 20 minutes before the participant was instructed to rinse , comb and self - style hair in the usual manner . participants were asked to compare hair characteristics for both the left and right side of the head throughout the test process . a product &# 39 ; s quality was determined by comparing responses to questions focusing on the following : overall look and feel of each product sample before application ; application on wet , cleansed hair ; texture and feel of each product on scalp and hair ; rinse - ability of each product ; ease during styling , overall impressions post styling ( i . e . comparison of each product &# 39 ; s ability to , eliminate frizz and fly - aways , promote shine and overall appearance of vitality and body in the hair ). initially , sample b exhibited a more favorable response , while hair treated with example 1 was described as greasy and thick in texture , hair treated with sample b was much lighter . however , perception changed upon the wetting and rinsing of each side of the head . at this stage , the side treated with sample b remains lighter and cleaner , but this effect is no longer preferred . example 1 &# 39 ; s substantial texturing effect has become the desired effect , due its ability to enhance the body and style of the hair . the side treated with example 1 also resulted in sleeker hair with less fly - aways . in the end , both participant &# 39 ; s and stylist &# 39 ; s evaluations and comments suggested that example 1 ( embodiment haircare composition ) outperformed sample b ( commercially available luxury hair care treatment ). trial number 2 was also a comparison of an embodiment hair care composition ( example 1 ) and a leading hair care treatment ( sample c ). to ensure the accuracy of the results , participants were given unmarked samples and instructions guiding them how to apply each sample . the objective of the test was to compare the performance and effectiveness of the samples on an individual &# 39 ; s hair both during and after application . prior to testing , the hair was thoroughly washed with a commercially successful clarifying shampoo and towel dried . participant then applied embodiment hair care composition ( example 1 ) to one side of her head and the commercially available luxury hair care treatment ( sample c ) to the other side of her head . participants were instructed to leave in the hair for 20 minutes before rinsing , combing and self - styling hair in their usual manner . participants were asked questions focusing on the following : overall look and feel of each product sample before application ; application on wet , cleansed hair ; texture and feel of each product on scalp and hair ; rinse - ability of each product ; ease during styling , overall impressions post styling ( i . e . comparison of each product &# 39 ; s ability to , eliminate frizz and fly - aways , promote shine and overall appearance of vitality and body in the hair ). in the majority of instances , sample c was described as pleasant , light , creamy and easy to apply , while example 1 was described as thick in texture and substantive but often , greasy , goopy or sticky and more difficult to apply than sample c . overall , example 1 was perceived as harder to rinse out well . however , after rinsing and styling , participant &# 39 ; s overwhelmingly claimed example 1 more successful in many respects including : repairing split ends , smoothing hair , producing shine , silkiness , body and fullness and creating an especially appealing texturizing effect . for several weeks participants alternated using the anhydrous embodiment ( example 1 ) in the following ways : a ) on dry hair .— participant applied a quarter sized amount of the composition on dry , unwashed hair , massaged onto the scalp , coating the entire length of the hair shaft from root to end and combing through . the composition was left on the hair for a minimum of five minutes and a maximum of 30 minutes . hair was then washed with a leading commercially available shampoo and then blown dry using finger tousle and a hairbrush . results were exceptionally favorable and showed healthy , shiny hair without the presence of flyaways . the concentrated quality of the composition was found quite appealing as less of it was required for use . b ) on dampened hair — similar to a ) above , participant applied a quarter sized amount of the composition but on wetted hair , massaged onto the scalp , coating the entire length of the hair shaft from root to end and combing through . the composition was left on the hair for a minimum of five minutes and a maximum of 30 minutes . hair was then washed with a leading commercially available shampoo and then blown dry using finger tousle and a hairbrush . results were also favorable , showing shiny hair without the presence of flyaways . the composition was found quite appealing as less of it was required for use . test 2 . as an intensive , post - shampoo nutritive treatment .— as in previous tests , embodiment haircare composition was left on the hair for 10 - 20 minutes after cleansing with a leading commercially available shampoo . it was then rinsed styled in the usual manner . again , results were favorable . upon application , the embodiment formulation seemed to bond well to the hair , melt easily into it and to detangle and smooth immediately . the longer the embodiment formulation remained on the hair , the more apparent were the results . often , almost half the usual amount of time was required to blow hair dry and hair was easier and quicker to run a straight iron through . hair was found to be very soft , pliable and silky when air - dried and especially after being blown straight . overall , hair was described as soft , smooth , very shiny , full and thicker with less flyways than usual . test 3 . as a post shampoo , leave - in , nutritive aid styling aid .— the composition was applied intermittently over several weeks as a styling aid . a dime size amount of the compositions was applied to washed , styled hair and finger combed through . sometimes repeated applications of the product were used before the hair was washed . in this test , the composition performed well as a pomade / texturizer / protective coating in the hair , reportedly growing less dirt this trial was a take - home test using a variety of usage methods and comparing the anhydrous embodiment composition ( example 1 ) with the commercially available hair care treatments of each participant &# 39 ; s choice . the objectives of these tests were 1 ) to illustrate the utility and performance of example 1 when applied to hair treated with different commercially available shampoos , and 2 ) to illustrate the utility and performance of example 1 with varied application . test 1 : embodiment haircare composition with color - treat shampoo — this test utilized commercially successful shampoos designed for color treated hair . participants thoroughly cleansed their hair with ther selected shampoo . hair was towel dried and combed to remove tangles . example 1 was then applied liberally to hair beginning with the ends and ending with a vigorous massage into the scalp . hair was covered with a towel or plastic cap and example 1 remained in the hair for 20 minutes . hair was thoroughly rinsed and dried styled as usual . at this stage some participants experienced a warm tingling sensation of the scalp . after air - dry / finger - comb styling — test results were described as softer , shinier , and fuller with less fly - aways . a similar result occurred with blow - dry styling with slightly less fullness described . test 2 : after both shampoo and conditioner — this test utilized both a commercially successful shampoo and a daily conditioner of each participant &# 39 ; s choice prior to application of embodiment haircare composition ( example 1 ). hair was cleansed with the shampoo . the daily conditioner was applied to wet hair and rinsed after 5 minutes . after shampooing and conditioning , a quarter size amount of example 1 was applied to the hair . product was left on uncovered hair for 1 hour . hair was thoroughly rinsed , dried and either air or blow dried . results were the same as test 1 . test 3 : embodiment haircare composition as a pre - treatment — in this test example 1 was applied as a pre - treatment product as opposed to the previous two tests where it was used in a post treatment context . the unwashed hair air was slightly dampened ( unlike the previous tests where hair was saturated with water ). a quarter size amount of example 1 was applied to hair starting at the root and working through to the ends . example 1 remained on uncovered hair for approximately 20 to 45 minutes before being washed and conditioned with commercially successful hair care products . hair was blown dry either with a brush or using finger tousle , or was air dried . applying example 1 prior to shampoo and conditioner was preferred to the post - treatment application method used in tests 1 and 2 . hair exhibited no tangles and was incredibly smooth and shiny without the presence of fly - aways . in this trial the hydrous embodiment ( example 2 ) was used as a post - shampoo treatment . participant cleansed hair with their shampoo of choice and then applied composition and left it on the hair for 10 to 30 minutes . hair was then rinsed and blown or towel / air dried . during application , less of the coating and detangling effects occurred than with the anhydrous composition . however , after drying hair was noticeably softer .

US-84593104-A

a mechanism for manually and automatically adjusting the front support drum of an endless conveyor within the feederhouse of an agricultural combine . the front drum is rotatably affixed to the remote end of a pivot arm that is pivotably affixed to the side sheet of the feederhouse . the relative position of the drum to the floor of the feederhouse is manually adjustable by manipulation of a cam that moves the pivot arm toward and away from the floor to preset positions . in combination with the adjustment mechanism , is a pivot mounting for the pivot arm that allows the drum to move upwardly and rearwardly when a bulk or lump of crop material enters the opening between the drum and the floor , thereby preventing damage to the components of the feederhouse .

referring to the drawings , it is possible to observe the major elements and general operation of the present invention . left and right references are used as a matter of convenience and are determined by standing at the rear of the combine and facing the forward end in the normal direction of travel . likewise , forward and rearward are determined by normal direction of travel of the combine . upward or downward orientations are relative to the ground or operating surface . horizontal or vertical planes are also relative to ground . as seen in fig1 the invention is located on a typical twin rotor combine 1 having a pair of front wheels 8 ( only one shown ) and a pair of rear wheels 9 ( only one shown ) for providing movement over the ground . at the front of the combine is a header 12 for cutting a crop . as the combine 1 and header 12 are moved forward , the header 12 cuts the grain and stalk . the header 12 moves the grain into an auger trough 14 . a transverse auger 15 pushes the grain and stalk in the auger trough 14 to the center of the header . the header 12 illustrated in fig1 is a wheat or similar small grain header . the header 12 may be positioned and re - positioned relative to the ground . the header 12 may also be tilted to the left or right or may be positioned relatively high or low to the ground . these features are constantly being adjusted depending on the terrain and crop conditions . the header reel 13 may also be positioned relative to the header 12 . the position and rotation of the header reel 13 , again depends on the terrain and crop conditions . moveable headers and header reels are well known and established in the art . located at the center of the header is the feederhouse 21 or elevator . the feederhouse 21 moves the grain and stalks rearward into the threshing 3 , separation 4 and cleaning systems of the combine 1 . after processing and separation , the processed grain is stored in a grain tank 5 located near the top of the combine 1 . the grain is removed from the grain tank 5 by an unloading auger ( not shown ) through the grain tank unload tube 6 . usually during the harvesting operations , the unloading auger remains off and the grain tank unload tube 6 remains positioned by the grain tank 5 . however , the combine can be unloaded ‘ on the go ’. a separate vehicle such as a truck or tractor - pulled grain cart follows the operator . the processed grain is discharged while the combine and separate vehicles are moving . after sufficient grain has been accumulated in the grain tank 5 , the operator activates the unload tube 7 . the operator 11 then positions the end of the unload tube 6 over a receptacle . unloading augers and unload auger grain tubes are well known and established in the art . the trash or chaff is ejected from the rear of the combine by a chaff spreader 10 . the operator 11 controls the combine 1 from the cab 2 located behind the header 12 and at the front of the combine . from the cab the operator can observe most the various combine functions . the cab 2 usually has a large glass window or several windows which afford the operator the maximum ability to monitor the header 12 . the combine 1 and various systems are powered by an engine 7 generally positioned at the rear of the combine 1 . most of the major systems in a combine are discussed and well known in the prior art . the invention is located proximate to the feederhouse 21 of the combine 1 . the pivoting faceplate 40 can be seen generally in fig2 and more specifically in fig3 and 4 . the pivoting faceplate 40 is located between the feederhouse 21 and the header 12 . the pivoting faceplate 40 allows the header 12 to be repositioned relative to the ground . this is illustrated by observing the position of the auger trough 15 and sicklebar cutter 17 relative to the ground as viewed in fig3 and 4 . the description of the faceplate 40 that follows is oriented towards the left side of the feederhouse 21 , however an identical structure exists on the right side . for brevity purposes only the one side is discussed . the faceplate 40 is pivotally attached to the sidewall 25 of the feederhouse 21 by a pivot 44 . the faceplate 40 can rotate about the pivot 44 and relative to the sidewall 25 . there are a series of clamping means 43 which in this embodiment is a threaded bolt that are inserted into an arcuate slot 47 . there are several arcuate slots 47 positioned on the sidewall 25 of the feederhouse . the curved nature of these slots relative to the pivot 44 allows for the faceplate to be adjusted to a variety of positions and clamped into a desirable angle . to properly adjust the faceplate 40 , there is a faceplate adjustment rod 46 . this rod 46 has an end pivotally affixed to the faceplate 40 . the opposite end of the rod 46 inserted through a bracket affixed to the sidewall 46 . in the illustrated preferred embodiment , the rod 46 is threaded and a matching nut is affixed to the bracket on the sidewall 25 . after loosening the clamping means 43 , the faceplate adjustment rod 46 may be rotated to adjust the position of the faceplate 40 . also present on the faceplate 40 is an indicator aperture 45 . on the sidewall 25 there are a series of faceplate position indicia 48 . a single indicia 48 can be viewed through the indicator aperture 45 when the aperture 45 is aligned with an indicia 48 on the sidewall . this allows an operator to easily determine the position of the faceplate 40 relative to the feederhouse 21 . the indicia 48 illustrated in fig2 and 4 are the numerals 1 through 5 , however other descriptive indicia could be used . attached at the front of the feederhouse 21 and pivoting faceplate 40 is the header 12 . the faceplate 40 has a header cradle 41 supporting the top frame 18 of the header 12 . a trough pin attach 42 on the faceplate 40 attaches to a trough pin 20 . the trough pin 20 is affixed to the header frame 16 . attached to the header frame 41 are the trough frame and the auger trough 14 . attached to the auger trough is the previously mentioned sicklebar cutter 17 . above the auger trough 14 is the previously discussed transverse auger 15 . while the header described is a small grain or wheat header , other types of header such a corn header can be used with the pivoting faceplate 40 without any significant modification to the header cradle 41 or trough pin attach 42 . to adjust the position of the faceplate 40 , the clamping means 43 are loosened . the adjustment rod 46 and nut are adjusted allowing the faceplate to rotate about the pivot 44 . the operator can observe the position of the faceplate 40 by viewing the faceplate position indicia 48 through the indicator aperture 45 . when a proper position indicia 48 is observed through the indicator aperture 45 , the clamping means are tightened thus securing the faceplate 40 in a desirable position . the front drum adjustment mechanism 60 can be generally observed in fig2 and specifically seen in fig5 , 7 and 8 . the front drum adjustment mechanism 60 allows the front drum and the conveyor chain 23 to be positioned either closer or further to the feederhouse floor 25 a . the front drum adjustment mechanism also has a drum arm spring 69 which acts to allow slight movement in the position of the front drum 22 to adjust to various inconsistencies in the crop flow moving through the feederhouse 21 . the front drum adjustment mechanism 60 consists of a drum arm 67 that is pivotally attached to the sidewall 25 of the feederhouse 21 . the front drum 22 is rotationally attached to the drum arm 67 . to adjust the position of the drum arm 67 there is a cam 61 attached to the sidewall 25 by a cam bolt 63 . the cam contacts an adjustment plate 54 . the adjustment plate 54 is attached to the drum arm 67 . by rotating the cam , the adjustment plate 64 alters the position of the drum arm 64 . by raising or lowering the drum arm 64 , the front drum 22 is repositioned . there are additional features and components that will be described in greater detail later . opposite from the front drum 22 on the drum arm 67 is the arm pivot mount 68 . as seen in fig8 the drum arm 67 has an arm pivot 69 . the arm pivot 69 passes through the pivot aperture 75 and through the wall plate aperture 72 a . the arm pivot 69 is rotationally attached to the pivot plate 73 . the pivot plate is affixed to the wall plate 72 . the wall plate 72 is affixed to the sidewall 25 . inserted into the pivot plate 73 is the threaded spring bolt 71 which secured by a nut . the spring bolt 71 also passes through the tension bracket 76 . between the tension bracket 76 and the end of the spring bolt 71 is the drum arm spring 69 . the spring bolt 71 allows the arm pivot mount 68 to adjust to minor inconsistencies in the crop flow which would otherwise damage the front drum 22 or conveyor chain 23 . if the front drum 23 or conveyor chain was to shift , the pivot plate 73 could move to either the left or right ( when viewed fig5 ). the drum arm spring 69 would allow this brief position change and then return the arm pivot 69 to its normal position . if a more permanent adjustment is desired , the cam 61 can be adjusted . the cam 61 has several cam position indicia 62 . it the preferred embodiment , the number 1 - 8 are used as indicia 62 . however , other symbols may be used . furthermore , the cam 61 is eight - sided , but the shape of the cam 61 may be varied . the cam 61 is secured to the sidewall 25 by a cam bolt 63 which is inserted into the nut 61 b welded to the sidewall 25 . there is a bolt guide 61 a ( seen in fig6 ) which allows the easy insertion of the cam bolt 63 into the cam without marring the cam position indicia 62 . the edge of the cam 61 slideably contacts the adjustment plate lip 64 . the adjustment plate lip 64 is integral with the adjustment plate 64 . the adjustment plate 64 is secured to the drum arm 67 by a plate attach means 63 . in this embodiment , the attach means 63 is a threaded bolt inserted in the plate nut 65 . the plate nut 65 b is welded to the drum arm 67 . the plate nut 65 and plate attach means 65 are inserted through the adjustment aperture 74 in the sidewall 25 . obviously , there are several means available to affix the adjustment plate to the drum arm 67 . to insure that the adjustment plate 64 remains in slideable contact with the cam 61 , there is a tensioning spring 66 secured to the adjustment plate lip 64 a and the sidewall 25 . the tensioning spring 66 forces the adjustment plate 64 into contact with the cam 61 . to adjust the front drum position , the cam bolt 61 is loosened and the cam 61 is rotated to align a single cam position indicia 62 with the adjustment plate lip 64 a on the adjustment plate 64 . in the present embodiment , a single side of eight - sided cam 61 is brought into flush contact with the lip 64 a . the cam bolt is then tightened . while the front drum adjustment mechanism 60 described and illustrated above is located on the left side of the feederhouse 21 , there is the identical mechanism on the right side . for brevity purposes , only the mechanism on the left side has been discussed . the stone roll mount plate 80 can be generally observed in fig2 and specifically seen in fig9 and 10 . attached to the stone roll mount plate 80 is the stone roll 27 . by raising or lowering the stone roll mount plate , the stone roll 27 is positioned either further or closer to the feederhouse floor 25 a . the position of the stone roll 27 will adjust the size of a stone 30 which is pushed by the stone roll 27 through the stone trap door 26 . the stone roll mount plate is affixed on the sidewall 25 by a series of plate bolts 84 . a plate bolt 84 is inserted through a plate slot 82 in the stone roll mount plate 80 . in the preferred embodiment , there are six plate slots which each receive a single plate bolt 84 . the stone roll mount plate 80 covers the stone roll aperture 86 in the sidewall 25 . the stone roll 27 is inserted through the stone roll aperture 86 and is rotationally attached to the stone roll mount plate 80 . there is a roll adjust rod 81 which adjusts the position of the stone roll mount plate 80 and the attached stone roll 27 . the rod 81 is threaded and inserted into a roll nut 81 b . the roll nut 81 b is welded to the stone roll mount plate 80 . the opposite end of the rod 81 is attached to the sidewall 25 by the roll bracket 81 a . as mentioned previously , the stone roll 27 deflects the conveyor chain 23 . when a stone 30 which is too large to pass between the compressed conveyor chain 23 and the feederhouse floor 25 a , the stone trap door 26 pivots open discharging the stone 30 ( as seen in fig9 ). the stone trap door 26 is pivotally attached to the feederhouse 21 beneath the sidewall 25 . there is a door linkage attached to the stone door pivot 26 a . the door linkage 28 is controlled by the door spring linkage 29 . one end of this linkage 29 is attached to the door linkage 28 and the sidewall 29 . the stone roll 27 forces the stone 30 out of the feederhouse 21 , the door linkage 28 and door spring linkage 29 pull the stone trap door 26 shut . to help adjust the position of the stone roll 27 , there are a series of stone roll position indicia 87 affixed on the sidewall 25 . in the preferred embodiment , the indicia are the numerals 1 through 7 . however , several different indicia are possible . on the upper left corner of the stone roll mount plate 80 is a pointer 83 . the pointer could also be re - configured to be an aperture as the indicator aperture 45 on the pivoting faceplate . to adjust the position of the stone roll 27 , the operator loosens the plate bolts securing the stone roll mount plate 80 to the sidewall 25 . the roll adjust rod 81 is rotated so as to align the pointer 83 with a single stone roll position indicia 87 . when the proper adjustment is complete , the plate bolts are tightened so as to secure the stone roll mount plate 80 to the sidewall 25 . again , the stone roll mount plate 80 discussed and illustrated is viewed from the left side of the feederhouse 25 . however , identical components exist on the right side . for brevity only the left is discussed . it will be obvious to those skilled in the art that various changes may be made without departing from the scope of the invention and the invention is not to be considered limited to what illustrated in the drawings and described in the specification .

US-56187700-A

a system for providing neural stimulation , including an activity monitor to sense activity and provide a signal indicative of the activity and a neural stimulator . the neural stimulator includes a pulse generator to provide a neural stimulation signal adapted to provide a neural stimulation therapy , and a modulator to receive the signal indicative of the activity and modulate the neural stimulation signal based on the signal indicative of the activity to change the neural stimulation therapy .

the following detailed description should be read with reference to the drawings in which similar elements in different drawings are numbered the same . the drawings , which are not necessarily to scale , depict illustrative embodiments and are not intended to limit the scope of the invention . to better understand the present invention , it may be useful to explain some of the basic vascular anatomy associated with the cardiovascular system . refer to fig1 which is a schematic illustration of the upper torso of a human body 10 showing some of the major arteries and veins of the cardiovascular system . the left ventricle of the heart 11 pumps oxygenated blood up into the aortic arch 12 . the right subclavian artery 13 , the right common carotid artery 14 , the left common carotid artery 15 and the left subclavian artery 16 branch off the aortic arch 12 proximal of the descending thoracic aorta 17 . although relatively short , a distinct vascular segment referred to as the brachiocephalic artery 22 connects the right subclavian artery 13 and the right common carotid artery 14 to the aortic arch 12 . the right carotid artery 14 bifurcates into the right external carotid artery 18 and the right internal carotid artery 19 at the right carotid sinus 20 . although not shown for purposes of clarity only , the left carotid artery 15 similarly bifurcates into the left external carotid artery and the left internal carotid artery at the left carotid sinus . from the aortic arch 12 , oxygenated blood flows into the carotid arteries 18 / 19 and the subclavian arteries 13 / 16 . from the carotid arteries 18 / 19 , oxygenated blood circulates through the head and cerebral vasculature and oxygen depleted blood returns to the heart 11 by way of the jugular veins , of which only the right internal jugular vein 21 is shown for sake of clarity . from the sub clavian arteries 13 / 16 , oxygenated blood circulates through the upper peripheral vasculature and oxygen depleted blood returns to the heart by way of the subclavian veins , of which only the right subclavian vein 23 is shown , also for sake of clarity . the heart 11 pumps the oxygen depleted blood through the pulmonary system where it is reoxygenated . the re - oxygenated blood returns to the heart 11 which pumps the re - oxygenated blood into the aortic arch as described above , and the cycle repeats . within the arterial walls of the aortic arch 12 , common carotid arteries 14 / 15 ( near the right carotid sinus 20 and left carotid sinus ), subclavian arteries 13 / 16 and brachiocephalic artery 22 there are baroreceptors 30 . for example , as best seen in fig2 a , baroreceptors 30 reside within the vascular walls of the carotid sinus 20 . baroreceptors 30 are a type of stretch receptor used by the body to sense blood pressure . an increase in blood pressure causes the arterial wall to stretch , and a decrease in blood pressure causes the arterial wall to return to its original size . such a cycle is repeated with each beat of the heart . because baroreceptors 30 are located within the arterial wall , they are able to sense deformation of the adjacent tissue , which is indicative of a change in blood pressure . the baroreceptors 30 located in the right carotid sinus 20 , the left carotid sinus and the aortic arch 12 play the most significant role in sensing blood pressure that affects the baroreflex system 50 , which is described in more detail with reference to fig2 b . refer now to fig2 b , which shows a schematic illustration of baroreceptors 30 disposed in a generic vascular wall 40 and a schematic flow chart of the baroreflex system 50 . baroreceptors 30 are profusely distributed within the arterial walls 40 of the major arteries discussed previously , and generally form an arbor 32 . the baroreceptor arbor 32 comprises a plurality of baroreceptors 30 , each of which transmits baroreceptor signals to the brain 52 via nerve 38 . the baroreceptors 30 are so profusely distributed and arborized within the vascular wall 40 that discrete baroreceptor arbors 32 are not readily discernable . to this end , those skilled in the art will appreciate that the baroreceptors 30 shown in fig2 b are primarily schematic for purposes of illustration and discussion . baroreceptor signals are used to activate a number of body systems which collectively may be referred to as the baroreflex system 50 . baroreceptors 30 are connected to the brain 52 via the nervous system 51 . thus , the brain 52 is able to detect changes in blood pressure , which is indicative of cardiac output . if cardiac output is insufficient to meet demand ( i . e ., the heart 11 is unable to pump sufficient blood ), the baroreflex system 50 activates a number of body systems , including the heart 11 , kidneys 53 , vessels 54 , and other organs / tissues . such activation of the baroreflex system 50 generally corresponds to an increase in neurohormonal activity . specifically , the baroreflex system 50 initiates a neurohormonal sequence that signals the heart 11 to increase heart rate and increase contraction force in order to increase cardiac output , signals the kidneys 53 to increase blood volume by retaining sodium and water , and signals the vessels 54 to constrict to elevate blood pressure . the cardiac , renal and vascular responses increase blood pressure and cardiac output 55 , and thus increase the workload of the heart 11 . in a patient with heart failure , this further accelerates myocardial damage and exacerbates the heart failure state . to address the problems of hypertension , heart failure , other cardiovascular disorders and renal disorders , the present invention basically provides a number of devices , systems and methods by which the baroreflex system 50 is activated to reduce excessive blood pressure , autonomic nervous system activity and neurohormonal activation . in particular , the present invention provides a number of devices , systems and methods by which baroreceptors 30 may be activated , thereby indicating an increase in blood pressure and signaling the brain 52 to reduce the body &# 39 ; s blood pressure and level of sympathetic nervous system and neurohormonal activation , and increase parasypathetic nervous system activation , thus having a beneficial effect on the cardiovascular system and other body systems . with reference to fig3 , the present invention generally provides a system including a control system 60 , a baroreceptor activation device 70 , and a sensor 80 ( optional ), which generally operate in the following manner . the sensor ( s ) 80 optionally senses and / or monitors a parameter ( e . g ., cardiovascular function ) indicative of the need to modify the baroreflex system and generates a signal indicative of the parameter . the control system 60 generates a control signal as a function of the received sensor signal . the control signal activates , deactivates or otherwise modulates the baroreceptor activation device 70 . typically , activation of the device 70 results in activation of the baroreceptors 30 . alternatively , deactivation or modulation of the baroreceptor activation device 70 may cause or modify activation of the baroreceptors 30 . the baroreceptor activation device 70 may comprise a wide variety of devices which utilize electrical means to activate baroreceptors 30 . thus , when the sensor 80 detects a parameter indicative of the need to modify the baroreflex system activity ( e . g ., excessive blood pressure ), the control system 60 generates a control signal to modulate ( e . g . activate ) the baroreceptor activation device 70 thereby inducing a baroreceptor 30 signal that is perceived by the brain 52 to be apparent excessive blood pressure . when the sensor 80 detects a parameter indicative of normal body function ( e . g ., normal blood pressure ), the control system 60 generates a control signal to modulate ( e . g ., deactivate ) the baroreceptor activation device 70 . as mentioned previously , the baroreceptor activation device 70 may comprise a wide variety of devices which utilize electrical means to activate the baroreceptors 30 . the baroreceptor activation device 70 of the present invention comprises an electrode structure which directly activates one or more baroreceptors 30 by changing the electrical potential across the baroreceptors 30 . it is possible that changing the electrical potential across the tissue surrounding the baroreceptors 30 may cause the surrounding tissue to stretch or otherwise deform , thus mechanically activating the baroreceptors 30 , in which case the stretchable and elastic electrode structures of the present invention may provide significant advantages . all of the specific embodiments of the electrode structures of the present invention are suitable for implantation , and are preferably implanted using a minimally invasive surgical approach . the baroreceptor activation device 70 may be positioned anywhere baroreceptors 30 are present . such potential implantation sites are numerous , such as the aortic arch 12 , in the common carotid arteries 18 / 19 near the carotid sinus 20 , in the subclavian arteries 13 / 16 , in the brachiocephalic artery 22 , or in other arterial or venous locations . the electrode structures of the present invention will be implanted such that they are positioned on or over a vascular structure immediately adjacent the baroreceptors 30 . preferably , the electrode structure of the baroreceptor activation device 70 is implanted near the right carotid sinus 20 and / or the left carotid sinus ( near the bifurcation of the common carotid artery ) and / or the aortic arch 12 , where baroreceptors 30 have a significant impact on the baroreflex system 50 . for purposes of illustration only , the present invention is described with reference to baroreceptor activation device 70 positioned near the carotid sinus 20 . the optional sensor 80 is operably coupled to the control system 60 by electric sensor cable or lead 82 . the sensor 80 may comprise any suitable device that measures or monitors a parameter indicative of the need to modify the activity of the baroreflex system . for example , the sensor 80 may comprise a physiologic transducer or gauge that measures ecg , blood pressure ( systolic , diastolic , average or pulse pressure ), blood volumetric flow rate , blood flow velocity , blood ph , o2 or co2 content , mixed venous oxygen saturation ( svo2 ), vasoactivity , nerve activity , tissue activity , body movement , activity levels , respiration , or composition . examples of suitable transducers or gauges for the sensor 80 include ecg electrodes , a piezoelectric pressure transducer , an ultrasonic flow velocity transducer , an ultrasonic volumetric flow rate transducer , a thermodilution flow velocity transducer , a capacitive pressure transducer , a membrane ph electrode , an optical detector ( svo2 ), tissue impedance ( electrical ), or a strain gauge . although only one sensor 80 is shown , multiple sensors 80 of the same or different type at the same or different locations may be utilized . an example of an implantable blood pressure measurement device that may be disposed about a blood vessel is disclosed in u . s . pat . no . 6 , 106 , 477 to miesel et al ., the entire disclosure of which is incorporated herein by reference . an example of a subcutaneous ecg monitor is available from medtronic under the trade name reveal ilr and is disclosed in pct publication no . wo 98 / 02209 , the entire disclosure of which is incorporated herein by reference . other examples are disclosed in u . s . pat . nos . 5 , 987 , 352 and 5 , 331 , 966 , the entire disclosures of which are incorporated herein by reference . examples of devices and methods for measuring absolute blood pressure utilizing an ambient pressure reference are disclosed in u . s . pat . no . 5 , 810 , 735 to halperin et al ., u . s . pat . no . 5 , 904 , 708 to goedeke , and pct publication no . wo 00 / 16686 to brockway et al ., the entire disclosures of which are incorporated herein by reference . the sensor 80 described herein may take the form of any of these devices or other devices that generally serve the same purpose . the sensor 80 is preferably positioned in a chamber of the heart 11 , or in / on a major artery such as the aortic arch 12 , a common carotid artery 14 / 15 , a subclavian artery 13 / 16 or the brachiocephalic artery 22 , such that the parameter of interest may be readily ascertained . the sensor 80 may be disposed inside the body such as in or on an artery , a vein or a nerve ( e . g . vagus nerve ), or disposed outside the body , depending on the type of transducer or gauge utilized . the sensor 80 may be separate from the baroreceptor activation device 70 or combined therewith . for purposes of illustration only , the sensor 80 is shown positioned on the right subclavian artery 13 . by way of example , the control system 60 includes a control block 61 comprising a processor 63 and a memory 62 . control system 60 is connected to the sensor 80 by way of sensor cable 82 . control system 60 is also connected to the baroreceptor activation device 70 by way of electric control cable 72 . thus , the control system 60 receives a sensor signal from the sensor 80 by way of sensor cable 82 , and transmits a control signal to the baroreceptor activation device 70 by way of control cable 72 . the system components 60 / 70 / 80 may be directly linked via cables 72 / 82 or by indirect means such as rf signal transceivers , ultrasonic transceivers or galvanic couplings . examples of such indirect interconnection devices are disclosed in u . s . pat . no . 4 , 987 , 897 to funke and u . s . pat . no . 5 , 113 , 859 to funke , the entire disclosures of which are incorporated herein by reference . the memory 62 may contain data related to the sensor signal , the control signal , and / or values and commands provided by the input device 64 . the memory 62 may also include software containing one or more algorithms defining one or more functions or relationships between the control signal and the sensor signal . the algorithm may dictate activation or deactivation control signals depending on the sensor signal or a mathematical derivative thereof the algorithm may dictate an activation or deactivation control signal when the sensor signal falls below a lower predetermined threshold value , rises above an upper predetermined threshold value or when the sensor signal indicates a specific physiologic event . the algorithm may dynamically alter the threshold value as determined by the sensor input values . as mentioned previously , the baroreceptor activation device 70 activates baroreceptors 30 electrically , optionally in combination with mechanical , thermal , chemical , biological or other co - activation . in some instances , the control system 60 includes a driver 66 to provide the desired power mode for the baroreceptor activation device 70 . for example , the driver 66 may comprise a power amplifier or the like and the cable 72 may comprise electrical lead ( s ). in other instances , the driver 66 may not be necessary , particularly if the processor 63 generates a sufficiently strong electrical signal for low level electrical actuation of the baroreceptor activation device 70 . the control system 60 may operate as a closed loop utilizing feedback from the sensor 80 , or other sensors , such as heart rate sensors which may be incorporated or the electrode assembly , or as an open loop utilizing reprogramming commands received by input device 64 . the closed loop operation of the control system 60 preferably utilizes some feedback from the transducer 80 , but may also operate in an open loop mode without feedback . programming commands received by the input device 64 may directly influence the control signal , the output activation parameters , or may alter the software and related algorithms contained in memory 62 . the treating physician and / or patient may provide commands to input device 64 . display 65 may be used to view the sensor signal , control signal and / or the software / data contained in memory 62 . the control signal generated by the control system 60 may be continuous , periodic , alternating , episodic or a combination thereof , as dictated by an algorithm contained in memory 62 . continuous control signals include a constant pulse , a constant train of pulses , a triggered pulse and a triggered train of pulses . examples of periodic control signals include each of the continuous control signals described above which have a designated start time ( e . g ., beginning of each period as designated by minutes , hours , or days in combinations of ) and a designated duration ( e . g ., seconds , minutes , hours , or days in combinations of ). examples of alternating control signals include each of the continuous control signals as described above which alternate between the right and left output channels . examples of episodic control signals include each of the continuous control signals described above which are triggered by an episode ( e . g ., activation by the physician / patient , an increase / decrease in blood pressure above a certain threshold , heart rate above / below certain levels , etc .). the stimulus regimen governed by the control system 60 may be selected to promote long term efficacy . it is theorized that uninterrupted or otherwise unchanging activation of the baroreceptors 30 may result in the baroreceptors and / or the baroreflex system becoming less responsive over time , thereby diminishing the long term effectiveness of the therapy . therefore , the stimulus regimen maybe selected to activate , deactivate or otherwise modulate the baroreceptor activation device 70 in such a way that therapeutic efficacy is maintained preferably for years . in addition to maintaining therapeutic efficacy over time , the stimulus regimens of the present invention may be selected reduce power requirement / consumption of the system 60 . as will be described in more detail hereinafter , the stimulus regimen may dictate that the baroreceptor activation device 70 be initially activated at a relatively higher energy and / or power level , and subsequently activated at a relatively lower energy and / or power level . the first level attains the desired initial therapeutic effect , and the second ( lower ) level sustains the desired therapeutic effect long term . by reducing the energy and / or power levels after the desired therapeutic effect is initially attained , the energy required or consumed by the activation device 70 is also reduced long term . this may correlate into systems having greater longevity and / or reduced size ( due to reductions in the size of the power supply and associated components ). a first general approach for a stimulus regimen which promotes long term efficacy and reduces power requirements / consumption involves generating a control signal to cause the baroreceptor activation device 70 to have a first output level of relatively higher energy and / or power , and subsequently changing the control signal to cause the baroreceptor activation device 70 to have a second output level of relatively lower energy and / or power . the first output level may be selected and maintained for sufficient time to attain the desired initial effect ( e . g ., reduced heart rate and / or blood pressure ), after which the output level may be reduced to the second level for sufficient time to sustain the desired effect for the desired period of time . for example , if the first output level has a power and / or energy value of x1 , the second output level may have a power and / or energy value of x2 , wherein x2 is less than x1 . in some instances , x2 may be equal to zero , such that the first level is “ on ” and the second level is “ off ”. it is recognized that power and energy refer to two different parameters , and in some cases , a change in one of the parameters ( power or energy ) may not correlate to the same or similar change in the other parameter . in the present invention , it is contemplated that a change in one or both of the parameters may be suitable to obtain the desired result of promoting long term efficacy . it is also contemplated that more than two levels may be used . each further level may increase the output energy or power to attain the desired effect , or decrease the output energy or power to retain the desired effect . for example , in some instances , it may be desirable to have further reductions in the output level if the desired effect may be sustained at lower power or energy levels . in other instances , particularly when the desired effect is diminishing or is otherwise not sustained , it may be desirable to increase the output level until the desired effect is reestablished , and subsequently decrease the output level to sustain the effect . the transition from each level may be a step function ( e . g ., a single step or a series of steps ), a gradual transition over a period of time , or a combination thereof . in addition , the signal levels may be continuous , periodic , alternating , or episodic as discussed previously . in electrical activation using a non modulated signal , the output ( power or energy ) level of the baroreceptor activation device 70 may be changed by adjusting the output signal voltage level , current level and / or signal duration . the output signal of the baroreceptor activation device 70 may be , for example , constant current or constant voltage . in electrical activation embodiments using a modulated signal , wherein the output signal comprises , for example , a series of pulses , several pulse characteristics may be changed individually or in combination to change the power or energy level of the output signal . such pulse characteristics include , but are not limited to : pulse amplitude ( pa ), pulse frequency ( pf ), pulse width or duration ( pw ), pulse waveform ( square , triangular , sinusoidal , etc . ), pulse polarity ( for bipolar electrodes ) and pulse phase ( monophasic , biphasic ). in electrical activation wherein the output signal comprises a pulse train , several other signal characteristics may be changed in addition to the pulse characteristics described above , as described in copending application ser . no . 09 / 964 , 079 , the full disclosure of which is incorporated herein by reference . fig4 a and 4b show schematic illustrations of a baroreceptor activation device 300 in the form of an extravascular electrically conductive structure or electrode 302 . the electrode structure 302 may comprise a coil , braid or other structure capable of surrounding the vascular wall . alternatively , the electrode structure 302 may comprise one or more electrode patches distributed around the outside surface of the vascular wall . because the electrode structure 302 is disposed on the outside surface of the vascular wall , intravascular delivery techniques may not be practical , but minimally invasive surgical techniques will suffice . the extravascular electrode structure 302 may receive electrical signals directly from the driver 66 of the control system 60 by way of electrical lead 304 , or indirectly by utilizing an inductor ( not shown ) as described in copending commonly assigned application ser . no . 10 / 402 , 393 ( attorney docket no . 21433 - 000420 ), filed on the same day as the present application , the full disclosure of which is incorporated herein by reference . refer now to fig5 a - 5f which show schematic illustrations of various possible arrangements of electrodes around the carotid sinus 20 for extravascular electrical activation embodiments , such as baroreceptor activation device 300 described with reference to fig4 a and 4b . the electrode designs illustrated and described hereinafter may be particularly suitable for connection to the carotid arteries at or near the carotid sinus , and may be designed to minimize extraneous tissue stimulation . in fig5 a - 5f , the carotid arteries are shown , including the common 14 , the external 18 and the internal 19 carotid arteries . the location of the carotid sinus 20 may be identified by a landmark bulge 21 , which is typically located on the internal carotid artery 19 just distal of the bifurcation , or extends across the bifurcation from the common carotid artery 14 to the internal carotid artery 19 . the carotid sinus 20 , and in particular the bulge 21 of the carotid sinus , may contain a relatively high density of baroreceptors 30 ( not shown ) in the vascular wall . for this reason , it may be desirable to position the electrodes 302 of the activation device 300 on and / or around the sinus bulge 21 to maximize baroreceptor responsiveness and to minimize extraneous tissue stimulation . it should be understood that the device 300 and electrodes 302 are merely schematic , and only a portion of which may be shown , for purposes of illustrating various positions of the electrodes 302 on and / or around the carotid sinus 20 and the sinus bulge 21 . in each of the embodiments described herein , the electrodes 302 may be monopolar , bipolar , or tripolar ( anode - cathode - anode or cathode - anode - cathode sets ). specific extravascular electrode designs are described in more detail hereinafter . in fig5 a , the electrodes 302 of the extravascular electrical activation device 300 extend around a portion or the entire circumference of the sinus 20 in a circular fashion . often , it would be desirable to reverse the illustrated electrode configuration in actual use . in fig5 b , the electrodes 302 of the extravascular electrical activation device 300 extend around a portion or the entire circumference of the sinus 20 in a helical fashion . in the helical arrangement shown in fig5 b , the electrodes 302 may wrap around the sinus 20 any number of times to establish the desired electrode 302 contact and coverage . in the circular arrangement shown in fig5 a , a single pair of electrodes 302 may wrap around the sinus 20 , or a plurality of electrode pairs 302 may be wrapped around the sinus 20 as shown in fig5 c to establish more electrode 302 contact and coverage . the plurality of electrode pairs 302 may extend from a point proximal of the sinus 20 or bulge 21 , to a point distal of the sinus 20 or bulge 21 to ensure activation of baroreceptors 30 throughout the sinus 20 region . the electrodes 302 may be connected to a single channel or multiple channels as discussed in more detail hereinafter . the plurality of electrode pairs 302 may be selectively activated for purposes of targeting a specific area of the sinus 20 to increase baroreceptor responsiveness , or for purposes of reducing the exposure of tissue areas to activation to maintain baroreceptor responsiveness long term . in fig5 d , the electrodes 302 extend around the entire circumference of the sinus 20 in a criss cross fashion . the criss cross arrangement of the electrodes 302 establishes contact with both the internal 19 and external 18 carotid arteries around the carotid sinus 20 . similarly , in fig5 e , the electrodes 302 extend around all or a portion of the circumference of the sinus 20 , including the internal 19 and external 18 carotid arteries at the bifurcation , and in some instances the common carotid artery 14 . in fig5 f , the electrodes 302 extend around all or a portion of the circumference of the sinus 20 , including the internal 19 and external 18 carotid arteries distal of the bifurcation . in fig5 e and 5f , the extravascular electrical activation devices 300 are shown to include a substrate or base structure 306 which may encapsulate and insulate the electrodes 302 and may provide a means for attachment to the sinus 20 as described in more detail hereinafter . from the foregoing discussion with reference to fig5 a - 5f , it should be apparent that there are a number of suitable arrangements for the electrodes 302 of the activation device 300 , relative to the carotid sinus 20 and associated anatomy . in each of the examples given above , the electrodes 302 are wrapped around a portion of the carotid structure , which may require deformation of the electrodes 302 from their relaxed geometry ( e . g ., straight ). to reduce or eliminate such deformation , the electrodes 302 and / or the base structure 306 may have a relaxed geometry that substantially conforms to the shape of the carotid anatomy at the point of attachment . in other words , the electrodes 302 and the base structure or backing 306 may be pre shaped to conform to the carotid anatomy in a substantially relaxed state . alternatively , the electrodes 302 may have a geometry and / or orientation that reduces the amount of electrode 302 strain . optionally , as described in more detail below , the backing or base structure 306 may be elastic or stretchable to facilitate wrapping of and conforming to the carotid sinus or other vascular structure . for example , in fig6 , the electrodes 302 are shown to have a serpentine or wavy shape . the serpentine shape of the electrodes 302 reduces the amount of strain seen by the electrode material when wrapped around a carotid structure . in addition , the serpentine shape of the electrodes increases the contact surface area of the electrode 302 with the carotid tissue . as an alternative , the electrodes 302 may be arranged to be substantially orthogonal to the wrap direction ( i . e ., substantially parallel to the axis of the carotid arteries ) as shown in fig7 . in this alternative , the electrodes 302 each have a length and a width or diameter , wherein the length is substantially greater than the width or diameter . the electrodes 302 each have a longitudinal axis parallel to the length thereof , wherein the longitudinal axis is orthogonal to the wrap direction and substantially parallel to the longitudinal axis of the carotid artery about which the device 300 is wrapped . as with the multiple electrode embodiments described previously , the electrodes 302 may be connected to a single channel or multiple channels as discussed in more detail hereinafter . refer now to fig8 - 11 which schematically illustrate various multi - channel electrodes for the extravascular electrical activation device 300 . fig8 illustrates a six ( 6 ) channel electrode assembly including six ( 6 ) separate elongate electrodes 302 extending adjacent to and parallel with each other . the electrodes 302 are each connected to multi - channel cable 304 . some of the electrodes 302 may be common , thereby reducing the number of conductors necessary in the cable 304 . base structure or substrate 306 may comprise a flexible and electrically insulating material suitable for implantation , such as silicone , perhaps reinforced with a flexible material such as polyester fabric . the base 306 may have a length suitable to wrap around all ( 360 . degree .) or a portion ( i . e ., less than 360 . degree .) of the circumference of one or more of the carotid arteries adjacent the carotid sinus 20 . the electrodes 302 may extend around a portion ( i . e ., less than 360 . degree . such as 270 . degree ., 180 . degree . or 90 . degree .) of the circumference of one or more of the carotid arteries adjacent the carotid sinus 20 . to this end , the electrodes 302 may have a length that is less than ( e . g ., 75 %, 50 % or 25 %) the length of the base 206 . the electrodes 302 may be parallel , orthogonal or oblique to the length of the base 306 , which is generally orthogonal to the axis of the carotid artery to which it is disposed about . preferably , the base structure or backing will be elastic ( i . e ., stretchable ), typically being composed of at least in part of silicone , latex , or other elastomer . if such elastic structures are reinforced , the reinforcement should be arranged so that it does not interfere with the ability of the base to stretch and conform to the vascular surface . the electrodes 302 may comprise round wire , rectangular ribbon or foil formed of an electrically conductive and radiopaque material such as platinum . the base structure 306 substantially encapsulates the electrodes 302 , leaving only an exposed area for electrical connection to extravascular carotid sinus tissue . for example , each electrode 302 may be partially recessed in the base 206 and may have one side exposed along all or a portion of its length for electrical connection to carotid tissue . electrical paths through the carotid tissues may be defined by one or more pairs of the elongate electrodes 302 . in all embodiments described with reference to fig8 - 11 , the multi - channel electrodes 302 may be selectively activated for purposes of mapping and targeting a specific area of the carotid sinus 20 to determine the best combination of electrodes 302 ( e . g ., individual pair , or groups of pairs ) to activate for maximum baroreceptor responsiveness , as described elsewhere herein . in addition , the multi - channel electrodes 302 may be selectively activated for purposes of reducing the exposure of tissue areas to activation to maintain long term efficacy as described , as described elsewhere herein . for these purposes , it may be useful to utilize more than two ( 2 ) electrode channels . alternatively , the electrodes 302 may be connected to a single channel whereby baroreceptors are uniformly activated throughout the sinus 20 region . an alternative multi - channel electrode design is illustrated in fig9 . in this embodiment , the device 300 includes sixteen ( 16 ) individual electrode pads 302 connected to 16 channel cable 304 via 4 channel connectors 303 . in this embodiment , the circular electrode pads 302 are partially encapsulated by the base structure 306 to leave one face of each button electrode 302 exposed for electrical connection to carotid tissues . with this arrangement , electrical paths through the carotid tissues may be defined by one or more pairs ( bipolar ) or groups ( tripolar ) of electrode pads 302 . a variation of the multi - channel pad type electrode design is illustrated in fig1 . in this embodiment , the device 300 includes sixteen ( 16 ) individual circular pad electrodes 302 surrounded by sixteen ( 16 ) rings 305 , which collectively may be referred to as concentric electrode pads 302 / 305 . pad electrodes 302 are connected to 17 channel cable 304 via 4 channel connectors 303 , and rings 305 are commonly connected to 17 channel cable 304 via a single channel connector 307 . in this embodiment , the circular shaped electrodes 302 and the rings 305 are partially encapsulated by the base structure 306 to leave one face of each pad electrode 302 and one side of each ring 305 exposed for electrical connection to carotid tissues . as an alternative , two rings 305 may surround each electrode 302 , with the rings 305 being commonly connected . with these arrangements , electrical paths through the carotid tissues may be defined between one or more pad electrode 302 / ring 305 sets to create localized electrical paths . another variation of the multi - channel pad electrode design is illustrated in fig1 . in this embodiment , the device 300 includes a control ic chip 310 connected to 3 channel cable 304 . the control chip 310 is also connected to sixteen ( 16 ) individual pad electrodes 302 via 4 channel connectors 303 . the control chip 310 permits the number of channels in cable 304 to be reduced by utilizing a coding system . the control system 60 sends a coded control signal which is received by chip 310 . the chip 310 converts the code and enables or disables selected electrode 302 pairs in accordance with the code . for example , the control signal may comprise a pulse wave form , wherein each pulse includes a different code . the code for each pulse causes the chip 310 to enable one or more pairs of electrodes , and to disable the remaining electrodes . thus , the pulse is only transmitted to the enabled electrode pair ( s ) corresponding to the code sent with that pulse . each subsequent pulse would have a different code than the preceding pulse , such that the chip 310 enables and disables a different set of electrodes 302 corresponding to the different code . thus , virtually any number of electrode pairs may be selectively activated using control chip 310 , without the need for a separate channel in cable 304 for each electrode 302 . by reducing the number of channels in cable 304 , the size and cost thereof may be reduced . optionally , the ic chip 310 may be connected to feedback sensor 80 , taking advantage of the same functions as described with reference to fig3 . in addition , one or more of the electrodes 302 may be used as feedback sensors when not enabled for activation . for example , such a feedback sensor electrode may be used to measure or monitor electrical conduction in the vascular wall to provide data analogous to an ecg . alternatively , such a feedback sensor electrode may be used to sense a change in impedance due to changes in blood volume during a pulse pressure to provide data indicative of heart rate , blood pressure , or other physiologic parameter . refer now to fig1 which schematically illustrates an extravascular electrical activation device 300 including a support collar or anchor 312 . in this embodiment , the activation device 300 is wrapped around the internal carotid artery 19 at the carotid sinus 20 , and the support collar 312 is wrapped around the common carotid artery 14 . the activation device 300 is connected to the support collar 312 by cables 304 , which act as a loose tether . with this arrangement , the collar 312 isolates the activation device from movements and forces transmitted by the cables 304 proximal of the support collar , such as may be encountered by movement of the control system 60 and / or driver 66 . as an alternative to support collar 312 , a strain relief ( not shown ) may be connected to the base structure 306 of the activation device 300 at the juncture between the cables 304 and the base 306 . with either approach , the position of the device 300 relative to the carotid anatomy may be better maintained despite movements of other parts of the system . in this embodiment , the base structure 306 of the activation device 300 may comprise molded tube , a tubular extrusion , or a sheet of material wrapped into a tube shape utilizing a suture flap 308 with sutures 309 as shown . the base structure 306 may be formed of a flexible and biocompatible material such as silicone , which may be reinforced with a flexible material such as polyester fabric available under the trade name dacron ® to form a composite structure . the inside diameter of the base structure 306 may correspond to the outside diameter of the carotid artery at the location of implantation , for example 6 to 8 mm . the wall thickness of the base structure 306 may be very thin to maintain flexibility and a low profile , for example less than 1 mm . if the device 300 is to be disposed about a sinus bulge 21 , a correspondingly shaped bulge may be formed into the base structure for added support and assistance in positioning . the electrodes 302 ( shown in phantom ) may comprise round wire , rectangular ribbon or foil , formed of an electrically conductive and radiopaque material such as platinum or platinum iridium . the electrodes may be molded into the base structure 306 or adhesively connected to the inside diameter thereof , leaving a portion of the electrode exposed for electrical connection to carotid tissues . the electrodes 302 may encompass less than the entire inside circumference ( e . g ., 300 . degree .) of the base structure 306 to avoid shorting . the electrodes 302 may have any of the shapes and arrangements described previously . for example , as shown in fig1 , two rectangular ribbon electrodes 302 may be used , each having a width of 1 mm spaced 1 . 5 mm apart . the support collar 312 may be formed similarly to base structure 306 . for example , the support collar may comprise molded tube , a tubular extrusion , or a sheet of material wrapped into a tube shape utilizing a suture flap 315 with sutures 313 as shown . the support collar 312 may be formed of a flexible and biocompatible material such as silicone , which may be reinforced to form a composite structure . the cables 304 are secured to the support collar 312 , leaving slack in the cables 304 between the support collar 312 and the activation device 300 . in all embodiments described herein , it may be desirable to secure the activation device to the vascular wall using sutures or other fixation means . for example , sutures 311 may be used to maintain the position of the electrical activation device 300 relative to the carotid anatomy ( or other vascular site containing baroreceptors ). such sutures 311 may be connected to base structure 306 , and pass through all or a portion of the vascular wall . for example , the sutures 311 may be threaded through the base structure 306 , through the adventitia of the vascular wall , and tied . if the base structure 306 comprises a patch or otherwise partially surrounds the carotid anatomy , the comers and / or ends of the base structure may be sutured , with additional sutures evenly distributed therebetween . in order to minimize the propagation of a hole or a tear through the base structure 306 , a reinforcement material such as polyester fabric may be embedded in the silicone material . in addition to sutures , other fixation means may be employed such as staples or a biocompatible adhesive , for example . refer now to fig1 which schematically illustrates an alternative extravascular electrical activation device 300 including one or more electrode ribs 316 interconnected by spine 317 . optionally , a support collar 312 having one or more ( non electrode ) ribs 316 may be used to isolate the activation device 300 from movements and forces transmitted by the cables 304 proximal of the support collar 312 . the ribs 316 of the activation device 300 are sized to fit about the carotid anatomy , such as the internal carotid artery 19 adjacent the carotid sinus 20 . similarly , the ribs 316 of the support collar 312 may be sized to fit about the carotid anatomy , such as the common carotid artery 14 proximal of the carotid sinus 20 . the ribs 316 may be separated , placed on a carotid artery , and closed thereabout to secure the device 300 to the carotid anatomy . each of the ribs 316 of the device 300 includes an electrode 302 on the inside surface thereof for electrical connection to carotid tissues . the ribs 316 provide insulating material around the electrodes 302 , leaving only an inside portion exposed to the vascular wall . the electrodes 302 are coupled to the multi - channel cable 304 through spine 317 . spine 317 also acts as a tether to ribs 316 of the support collar 312 , which do not include electrodes since their function is to provide support . the multi - channel electrode 302 functions discussed with reference to fig8 - 11 are equally applicable to this embodiment . the ends of the ribs 316 may be connected ( e . g ., sutured ) after being disposed about a carotid artery , or may remain open as shown . if the ends remain open , the ribs 316 may be formed of a relatively stiff material to ensure a mechanical lock around the carotid artery . for example , the ribs 316 may be formed of polyethylene , polypropylene , ptfe , or other similar insulating and biocompatible material . alternatively , the ribs 316 may be formed of a metal such as stainless steel or a nickel titanium alloy , as long as the metallic material was electrically isolated from the electrodes 302 . as a further alternative , the ribs 316 may comprise an insulating and biocompatible polymeric material with the structural integrity provided by metallic ( e . g ., stainless steel , nickel titanium alloy , etc .) reinforcement . in this latter alternative , the electrodes 302 may comprise the metallic reinforcement . refer now to fig1 which schematically illustrates a specific example of an electrode assembly for an extravascular electrical activation device 300 . in this specific example , the base structure 306 comprises a silicone sheet having a length of 5 . 0 inches , a thickness of 0 . 007 inches , and a width of 0 . 312 inches . the electrodes 302 comprise platinum ribbon having a length of 0 . 47 inches , a thickness of 0 . 0005 inches , and a width of 0 . 040 inches . the electrodes 302 are adhesively connected to one side of the silicone sheet 306 . the electrodes 302 are connected to a modified bipolar endocardial pacing lead , available under the trade name conifix from innomedica ( now biomec cardiovascular , inc . ), model number 501112 . the proximal end of the cable 304 is connected to the control system 60 or driver 66 as described previously . the pacing lead is modified by removing the pacing electrode to form the cable body 304 . the mp35 wires are extracted from the distal end thereof to form two coils 318 positioned side by side having a diameter of about 0 . 020 inches . the coils 318 are then attached to the electrodes utilizing 316 type stainless steel crimp terminals laser welded to one end of the platinum electrodes 302 . the distal end of the cable 304 and the connection between the coils 318 and the ends of the electrodes 302 are encapsulated by silicone . the cable 304 illustrated in fig1 comprises a coaxial type cable including two coaxially disposed coil leads separated into two separate coils 318 for attachment to the electrodes 302 . an alternative cable 304 construction is illustrated in fig1 . fig1 illustrates an alternative cable body 304 which may be formed in a curvilinear shape such as a sinusoidal configuration , prior to implantation . the curvilinear configuration readily accommodates a change in distance between the device 300 and the control system 60 or the driver 66 . such a change in distance may be encountered during flexion and / or extension of the neck of the patient after implantation . in this alternative embodiment , the cable body 304 may comprise two or more conductive wires 304 a arranged coaxially or collinearly as shown . each conductive wire 304 a may comprise a multifilament structure of suitable conductive material such as stainless steel or mp35n . an insulating material may surround the wire conductors 304 a individually and / or collectively . for purposes of illustration only , a pair of electrically conductive wires 304 a having an insulating material surrounding each wire 304 a individually is shown . the insulated wires 304 a may be connected by a spacer 304 b comprising , for example , an insulating material . an additional jacket of suitable insulating material may surround each of the conductors 304 a . the insulating jacket may be formed to have the same curvilinear shape of the insulated wires 304 a to help maintain the shape of the cable body 304 during implantation . if a sinusoidal configuration is chosen for the curvilinear shape , the amplitude ( a ) may range from 1 mm to 10 mm , and preferably ranges from 2 mm to 3 mm . the wavelength ( wl ) of the sinusoid may range from 2 mm to 20 mm , and preferably ranges from 4 mm to 10 mm . the curvilinear or sinusoidal shape may be formed by a heat setting procedure utilizing a fixture which holds the cable 304 in the desired shape while the cable is exposed to heat . sufficient heat is used to heat set the conductive wires 304 a and / or the surrounding insulating material . after cooling , the cable 304 may be removed from the fixture , and the cable 304 retains the desired shape . refer now to fig1 - 18 which illustrate various transducers that may be mounted to the wall of a vessel such as a carotid artery 14 to monitor wall expansion or contraction using strain , force and / or pressure gauges . an example of an implantable blood pressure measurement device that may be disposed about a blood vessel is disclosed in u . s . pat . no . 6 , 106 , 477 to miesel et al ., the entire disclosure of which is incorporated herein by reference . the output from such gauges may be correlated to blood pressure and / or heart rate , for example , and may be used to provide feedback to the control system 60 as described previously herein . in fig1 , an implantable pressure measuring assembly comprises a foil strain gauge or force sensing resistor device 740 disposed about an artery such as common carotid artery 14 . a transducer portion 742 may be mounted to a silicone base or backing 744 which is wrapped around and sutured or otherwise attached to the artery 14 . alternatively , the transducer 750 may be adhesively connected to the wall of the artery 14 using a biologically compatible adhesive such as cyanoacrylate as shown in fig1 . in this embodiment , the transducer 750 comprises a micro machined sensor ( mems ) that measures force or pressure . the mems transducer 750 includes a micro arm 752 ( shown in section in fig1 ) coupled to a silicon force sensor contained over an elastic base 754 . a cap 756 covers the arm 752 a top portion of the base 754 . the base 754 include an interior opening creating access from the vessel wall 14 to the arm 752 . an incompressible gel 756 fills the space between the arm 752 and the vessel wall 14 such that force is transmitted to the arm upon expansion and contraction of the vessel wall . in both cases , changes in blood pressure within the artery cause changes in vessel wall stress which are detected by the transducer and which may be correlated with the blood pressure . refer now to fig1 - 21 which illustrate an alternative extravascular electrical activation device 700 , which , may also be referred to as an electrode cuff device or more generally as an “ electrode assembly .” except as described herein and shown in the drawings , device 700 may be the same in design and function as extravascular electrical activation device 300 described previously . as seen in fig1 and 20 , electrode assembly or cuff device 700 includes coiled electrode conductors 702 / 704 embedded in a flexible support 706 . in the embodiment shown , an outer electrode coil 702 and an inner electrode coil 704 are used to provide a pseudo tripolar arrangement , but other polar arrangements are applicable as well as described previously . the coiled electrodes 702 / 704 may be formed of fine round , flat or ellipsoidal wire such as 0 . 002 inch diameter round ptir alloy wire wound into a coil form having a nominal diameter of 0 . 015 inches with a pitch of 0 . 004 inches , for example . the flexible support or base 706 may be formed of a biocompatible and flexible ( preferably elastic ) material such as silicone or other suitable thin walled elastomeric material having a wall thickness of 0 . 005 inches and a length ( e . g ., 2 . 95 inches ) sufficient to surround the carotid sinus , for example . each turn of the coil in the contact area of the electrodes 702 / 704 is exposed from the flexible support 706 and any adhesive to form a conductive path to the artery wall . the exposed electrodes 702 / 704 may have a length ( e . g ., 0 . 236 inches ) sufficient to extend around at least a portion of the carotid sinus , for example . the electrode cuff 700 is assembled flat with the contact surfaces of the coil electrodes 702 / 704 tangent to the inside plane of the flexible support 706 . when the electrode cuff 700 is wrapped around the artery , the inside contact surfaces of the coiled electrodes 702 / 704 are naturally forced to extend slightly above the adjacent surface of the flexible support , thereby improving contact to the artery wall . the ratio of the diameter of the coiled electrodes 702 / 704 to the wire diameter is preferably large enough to allow the coil to bend and elongate without significant bending stress or torsional stress in the wire . flexibility is a significant advantage of this design which allows the electrode cuff 700 to conform to the shape of the carotid artery and sinus , and permits expansion and contraction of the artery or sinus without encountering significant stress or fatigue . in particular , the flexible electrode cuff 700 may be wrapped around and stretched to conform to the shape of the carotid sinus and artery during implantation . this may be achieved without collapsing or distorting the shape of the artery and carotid sinus due to the compliance of the electrode cuff 700 . the flexible support 706 is able to flex and stretch with the conductor coils 702 / 704 because of the absence of fabric reinforcement in the electrode contact portion of the cuff 700 . by conforming to the artery shape , and by the edge of the flexible support 706 sealing against the artery wall , the amount of stray electrical field and extraneous stimulation will likely be reduced . the pitch of the coil electrodes 702 / 704 may be greater than the wire diameter in order to provide a space between each turn of the wire to thereby permit bending without necessarily requiring axial elongation thereof . for example , the pitch of the contact coils 702 / 704 may be 0 . 004 inches per turn with a 0 . 002 inch diameter wire , which allows for a 0 . 002 inch space between the wires in each turn . the inside of the coil may be filled with a flexible adhesive material such as silicone adhesive which may fill the spaces between adjacent wire turns . by filling the small spaces between the adjacent coil turns , the chance of pinching tissue between coil turns is minimized thereby avoiding abrasion to the artery wall . thus , the embedded coil electrodes 702 / 704 are mechanically captured and chemically bonded into the flexible support 706 . in the unlikely event that a coil electrode 702 / 704 comes loose from the support 706 , the diameter of the coil is large enough to be atraumatic to the artery wall . preferably , the centerline of the coil electrodes 702 / 704 lie near the neutral axis of electrode cuff structure 700 and the flexible support 706 comprises a material with isotropic elasticity such as silicone in order to minimize the shear forces on the adhesive bonds between the coil electrodes 702 / 704 and the support 706 . the electrode coils 702 / 704 are connected to corresponding conductive coils 712 / 714 , respectively , in an elongate lead 710 which is connected to the control system 60 . anchoring wings 718 may be provided on the lead 710 to tether the lead 710 to adjacent tissue and minimize the effects or relative movement between the lead 710 and the electrode cuff 700 . as seen in fig2 , the conductive coils 712 / 714 may be formed of 0 . 003 mp35n bifilar wires wound into 0 . 018 inch diameter coils which are electrically connected to electrode coils 702 / 704 by splice wires 716 . the conductive coils 712 / 714 may be individually covered by an insulating covering 718 such as silicone tubing and collectively covered by insulating covering 720 . the conductive material of the electrodes 702 / 704 may be a metal as described above or a conductive polymer such as a silicone material filled with metallic particles such as pt particles . in this latter embodiment , the polymeric electrodes may be integrally formed with the flexible support 706 with the electrode contacts comprising raised areas on the inside surface of the flexible support 706 electrically coupled to the lead 710 by wires or wire coils . the use of polymeric electrodes may be applied to other electrode design embodiments described elsewhere herein . reinforcement patches 708 such as dacron ® fabric may be selectively incorporated into the flexible support 706 . for example , reinforcement patches 708 may be incorporated into the ends or other areas of the flexible support 706 to accommodate suture anchors . the reinforcement patches 708 provide points where the electrode cuff 700 may be sutured to the vessel wall and may also provide tissue in growth to further anchor the device 700 to the exterior of the vessel wall . for example , the fabric reinforcement patches 708 may extend beyond the edge of the flexible support 706 so that tissue in growth may help anchor the electrode assembly or cuff 700 to the vessel wall and may reduce reliance on the sutures to retain the electrode assembly 700 in place . as a substitute for or in addition to the sutures and tissue in growth , bioadhesives such as cyanoacrylate may be employed to secure the device 700 to the vessel wall . in addition , an adhesive incorporating conductive particles such as pt coated micro spheres may be applied to the exposed inside surfaces of the electrodes 702 / 704 to enhance electrical conduction to the tissue and possibly limit conduction along one axis to limit extraneous tissue stimulation . the reinforcement patches 708 may also be incorporated into the flexible support 706 for strain relief purposes and to help retain the coils 702 / 704 to the support 706 where the leads 710 attach to the electrode assembly 700 as well as where the outer coil 702 loops back around the inner coil 704 . preferably , the patches 708 are selectively incorporated into the flexible support 706 to permit expansion and contraction of the device 700 , particularly in the area of the electrodes 702 / 704 . in particular , the flexible support 706 is only fabric reinforced in selected areas thereby maintaining the ability of the electrode cuff 700 to stretch . referring now to fig2 - 26 , the electrode assembly of fig1 - 21 can be modified to have “ flattened ” coil electrodes in the region of the assembly where the electrodes contact the extravascular tissue . as shown in fig2 , an electrode - carrying surface 801 of the electrode assembly , is located generally between parallel reinforcement strips or tabs 808 . the flattened coil section 810 will generally be exposed on a lower surface 803 of the base 806 ( fig2 ) and will be covered or encapsulated by a parylene or other polymeric structure or material 802 over an upper surface 805 thereof . the coil is formed with a generally circular periphery 809 , as best seen in fig2 and 26 , and may be mechanically flattened , typically over a silicone or other supporting insert 815 , as best seen in fig2 . the use of the flattened coil structure is particularly beneficial since it retains flexibility , allowing the electrodes to bend , stretch , and flex together with the elastomeric base 806 , while also increasing the flat electrode area available to contact the extravascular surface . referring now to fig2 - 30 , an additional electrode assembly 900 constructed in accordance with the principles of the present invention will be described . electrode assembly 900 comprises an electrode base , typically an elastic base 902 , typically formed from silicone or other elastomeric material , having an electrode - carrying surface 904 and a plurality of attachment tabs 906 ( 906 a , 906 b , 906 c , and 906 d ) extending from the electrode - carrying surface . the attachment tabs 906 are preferably formed from the same material as the electrode - carrying surface 904 of the base 902 , but could be formed from other elastomeric materials as well . in the latter case , the base will be molded , stretched or otherwise assembled from the various pieces . in the illustrated embodiment , the attachment tabs 906 are formed integrally with the remainder of the base 902 , i . e ., typically being cut from a single sheet of the elastomeric material . the geometry of the electrode assembly 900 , and in particular the geometry of the base 902 , is selected to permit a number of different attachment modes to the blood vessel . in particular , the geometry of the assembly 902 of fig2 is intended to permit attachment to various locations on the carotid arteries at or near the carotid sinus and carotid bifurcation . a number of reinforcement regions 910 ( 910 a , 910 b , 910 c , 910 d , and 910 e ) are attached to different locations on the base 902 to permit suturing , clipping , stapling , or other fastening of the attachment tabs 906 to each other and / or the electrode - carrying surface 904 of the base 902 . in the preferred embodiment intended for attachment at or around the carotid sinus , a first reinforcement strip 910 a is provided over an end of the base 902 opposite to the end which carries the attachment tabs . pairs of reinforcement strips 910 b and 910 c are provided on each of the axially aligned attachment tabs 906 a and 906 b , while similar pairs of reinforcement strips 910 d and 910 e are provided on each of the transversely angled attachment tabs 906 c and 906 d . in the illustrated embodiment , all attachment tabs will be provided on one side of the base , preferably emanating from adjacent comers of the rectangular electrode - carrying surface 904 . the structure of electrode assembly 900 permits the surgeon to implant the electrode assembly so that the electrodes 920 ( which are preferably stretchable , flat - coil electrodes as described in detail above ), are located at a preferred location relative to the target baroreceptors . the preferred location may be determined , for example , as described in copending application ser . no . 09 / 963 , 991 , filed on sep . 26 , 2001 , the full disclosure of which incorporated herein by reference . once the preferred location for the electrodes 920 of the electrode assembly 900 is determined , the surgeon may position the base 902 so that the electrodes 920 are located appropriately relative to the underlying baroreceptors . thus , the electrodes 920 may be positioned over the common carotid artery cc as shown in fig2 , or over the internal carotid artery ic , as shown in fig2 and 30 . in fig2 , the assembly 900 may be attached by stretching the base 902 and attachment tabs 906 a and 906 b over the exterior of the common carotid artery . the reinforcement tabs 906 a or 906 b may then be secured to the reinforcement strip 910 a , either by suturing , stapling , fastening , gluing , welding , or other well - known means . usually , the reinforcement tabs 906 c and 906 d will be cut off at their bases , as shown at 922 and 924 , respectively . in other cases , the bulge of the carotid sinus and the baroreceptors may be located differently with respect to the carotid bifurcation . for example , as shown in fig2 , the receptors may be located further up the internal carotid artery ic so that the placement of electrode assembly 900 as shown in fig2 will not work . the assembly 900 , however , may still be successfully attached by utilizing the transversely angled attachment tabs 906 c and 906 d rather than the central or axial tabs 906 a and 906 b . as shown in fig2 , the lower tab 906 d is wrapped around the common carotid artery cc , while the upper attachment tab 906 c is wrapped around the internal carotid artery ic . the axial attachment tabs 906 a and 906 b will usually be cut off ( at locations 926 ), although neither of them could in some instances also be wrapped around the internal carotid artery ic . again , the tabs which are used may be stretched and attached to reinforcement strip 910 a , as generally described above . referring to fig3 , in instances where the carotid bifurcation has less of an angle , the assembly 900 may be attached using the upper axial attachment tab 906 a and be lower transversely angled attachment tab 906 d . attachment tabs 906 b and 906 c may be cut off , as shown at locations 928 and 930 , respectively . in all instances , the elastic nature of the base 902 and the stretchable nature of the electrodes 920 permit the desired conformance and secure mounting of the electrode assembly over the carotid sinus . it would be appreciated that these or similar structures would also be useful for mounting electrode structures at other locations in the vascular system . in most activation device embodiments described herein , it may be desirable to incorporate anti - inflammatory agents ( e . g ., steroid eluting electrodes ) such as described in u . s . pat . no . 4 , 711 , 251 to stokes , u . s . pat . no . 5 , 522 , 874 to gates and u . s . pat . no . 4 , 972 , 848 to di domenico et al ., the entire disclosures of which are incorporated herein by reference . such agents reduce tissue inflammation at the chronic interface between the device ( e . g ., electrodes ) and the vascular wall tissue , to thereby increase the efficiency of stimulus transfer , reduce power consumption , and maintain activation efficiency , for example . those skilled in the art will recognize that the present invention may be manifested in a variety of forms other than the specific embodiments described and contemplated herein . accordingly , departures in form and detail may be made without departing from the scope and spirit of the present invention as described in the appended claims .

US-93326807-A

an exercise apparatus includes a base and an elongated upright pillar connected to the base . the pillar has a plurality of stop positions therealong . a surrounding member is slidably mounted on the pillar and is sufficiently oversized to permit relative lengthwise slidable movement therealong . an elongated horizontal support bar is fixedly connected to the surrounding member . the horizontal support bar and the surrounding member is moveable between an upper and lower limit positions on the pillar . the surrounding member is selectively fixed to the pillar at the stop positions . the surrounding member slides relative to the pillar between stop positions . a lifting force is applied to the surrounding member by a mechanical lifting aid to assist the surrounding member when sliding relative to the pillar .

shown in fig1 is a first embodiment of the mechanically aided exercise apparatus 9 . in general , this apparatus can be considered to include a pair of horizontally oriented handle members 80 and 82 . these handle members consist of elongated members 83 and 84 , which are parallel to one another projecting forward ; continuing with radius bends 88 and 89 turning outward generally at right angles and away from the midline ; continuing with members 92 and 93 , that project laterally from the midline and are oriented substantially parallel to the ground and perpendicular to elongated members 83 and 84 ; continuing to downward radius bends 90 and 94 , pointing downward at an angle of approximately 30 degrees ; continuing and terminating with members 95 and 96 sloping downward at approximately 30 degree angles to the ground . bored into the terminal ends of members 95 and 96 are elastic cord clip receptacle bores 48 and 49 . the length of members 83 and 84 should be such that their vertical plane of members 92 and 93 is rearward of the vertical plane of the distal ends of base members 150 and 151 . elongated members 83 and 84 extend forward from a horizontal supported bar 28 in a cantilevered arrangement . the horizontally disposed bar 28 is rigidly attached in this embodiment for example by a weldment arrangement , to sleeve 110 which is of such a dimension so as to allow the free sliding of itself and subsequently the entire pin locking mechanically aided vertical height adjustment mechanism assembly 30 to which it is rigidly attached , along the length of centrally located , vertically oriented pillar member 10 onto which sleeve 110 is slidably mounted . pillar 10 , base assembly 101 and bar 28 can be formed of any suitable material . for example , pillar 10 and base assembly 101 can be formed of three inch round steel tubing , two inch square or two inch by three inch rectangular , oval or triangular columnar steel lengths , and bar 28 could be of one inch square or one inch by two inch rectangular columnar steel . however , in some cases the selected material will dictate the use of the vertical adjustment mechanism modifications corresponding to the selected material as previously taught in my united states provisional patent application ser . no . 60 / 013 , 959 , filed in the u . s . patent and trademark office on mar . 15 , 1996 . in a preferred embodiment of the apparatus , the pillar 10 is formed of three inch square steel tubing . to insure that the pillar 10 can maintain support when subjected to the moment created by the cantilevered action of handles 80 and 82 , especially with the weight of an exerciser thereon , the pillar 10 is continuous with or rigidly attached to base assembly 101 ; interconnector buttress support 123 is securely attached at its terminal ends by mounting and pivot axis bolts and nut attachments 146 and 148 to base members 150 , 151 respectively and such nut and bolt attachment will provide a pivot for interconnector buttress support 123 when folding of the frame is desired and as will be taught below . interconnector buttress support 123 is rigidly connected at its midpoint by weldment arrangement to connector plate 116 , formed of flat or in this embodiment angled steel which is of a dimension so as to fit onto or snugly accept the outer dimension of base end of pillar 10 at location 97 and can be attached by screwmount attachment through bores 143 corresponding to aligning bores in pillar 10 at location 97 . pillar 10 is rigidly attached , such as by weldment arrangement , at its base end , to the center of base cross member 147 . rails 150 and 151 are rigidly attached to base cross member 147 by weldment arrangement or in this case , where a disassembling is desired , by connectors 44 and 45 , formed of angled steel , which are rigidly attached to the terminal ends of base cross member 147 and attached by a nut and bolt attachment to rails 150 and 151 through bore sets 157 and 158 and their corresponding aligning bores on rails 150 and 151 . connector anchor bar 51 is rigidly attached to the rear most ends of rails 150 and 151 respectively and has at its mid point bore 56 which is of such a dimension so as to accept connector ring 54 . ring 54 is attached to elastic cord 50 in a manner that is known to those skilled in the art . bore sets 62 and 64 are disposed at the forwardmost ends of rails 150 and 151 respectively and are of such a dimension so as to freely accept the clip end of an elastic cord assembly 66 that is known to those skilled in the art . foot plates 58 and 60 are rigidly connected to the forwardmost ends of rails 150 and 151 and are attached in a manner such as a weldment attachment . these foot plates are stood upon by the user when using elastic cord assembly 66 to perform an exercise such as a biceps curl exercise and prevent undesirable lifting of the apparatus 9 . so as to provide the free and unrestricted movement of and proper alignment of elastic cord 50 a pulley system is incorporated , in this case the use of two pulleys 74 and 76 . pulleys 74 and 76 are of a type that is known to those skilled in the art . pulleys 74 , 76 are disposed at the topmost end of pillar 10 and are of such a size so as to freely accept the dimension of elastic cord 50 into their respective grooves . pulleys 74 and 76 are in this case , mounted to the inside of pillar 10 by means of bolt and nut fasteners 124 which are of such a length that when inserted into bores 70 and 72 disposed in alignment with their mirror bores on the opposite sides of the upward end of pillar 10 and through the registered and aligning center axis bores of pulleys 74 and 76 extend completely through pillar 10 and provide full thread attachment of nuts . cord lock rod 78 is disposed at the topmost end of pillar 10 in such a manner so as to resist the disengaging of elastic cord 50 from the grooves of pulleys 74 and 76 . notch 102 and its mirror , notch 104 , are disposed at the top of the front and back sides of pillar 10 and are aligned in such a relationship with pulleys 74 and 76 so as to allow the pulleys to be somewhat recessed into the top of pillar 10 and , thus , allows the free and unobstructed movement of elastic cord 50 thereby reducing the vertical height of the apparatus 9 . connector ring 68 is attached to the upper terminal end of elastic cord 50 in any manner that is known to those skilled in the art . connector tab 66 is rigidly attached to one of the sides of sleeve assembly 30 , in this embodiment to the mid point of horizontal supported bar 28 by weldment arrangement , and includes bore 106 , which is of such a dimension so as to receive connector ring 68 . elastic cord assembly 108 is of such a length and tensile resistance so that when attached to bores 56 and 106 and disposed so as to freely glide over pulleys 74 and 76 it exerts a lifting force on pin locking mechanically aided vertical height adjustment mechanism assembly 30 thereby aiding in quick and smooth transitions between various vertical height positions along the length of pillar 10 . sleeve 110 has mounted to one of its sides , in this case the front , spring loaded adjusting pin assembly 78 , a pin assembly that is known to those skilled in the art . the central shaft of pin assembly 78 is of such a shape so as to freely seek and insert into bores 22 which are disposed along the vertical length , in this case down the front , of pillar 10 . such a relationship provides a locking mechanism that prevents unwanted sliding of pin locking mechanically aided vertical height adjustment mechanism assembly 30 down the length of pillar 10 . turning now to fig2 . in accordance with yet another aspect of the invention , as it is foreseeable that some users of the apparatus 9 may desire a means of conveniently folding the apparatus , described below is an embodiment of the apparatus that includes a unique means via a pivot folding configuration by which to fold the frame of apparatus 9 . although only one embodiment is taught below it should be understood that this description is not intended to limit the invention to this reference or this embodiment . on the contrary , it is intended to cover all alternatives , modifications and equivalents as may be within the spirit and scope of the invention and would be so obvious to those skilled in the art . base cross member 132 is formed of a circular steel tube that is rigidly attached to the base end of pillar 10 by weldment arrangement at the mid point of base cross member 132 . each corresponding end of base cross member 132 is of such a dimension so as to fit snugly into sleeves 160 and 162 respectively yet still allow free rotation of base cross member 132 . sleeves 160 and 162 are rigidly attached to connectors 44 and 45 by weldment arrangement . rear base cross member 170 is rigidly attached at it terminal ends to the rearward terminal ends of base members 150 and 151 and is attached by weldment arrangement but can be attached by means of a common bolt and nut configuration if more compact shipping of the apparatus 9 is desired . wheel assemblies 172 and 174 are of the type known to those skilled in the art and are attached to the rearward terminal ends of base rails 150 and 151 by weldment arrangement . connector bracket 98 is formed of angled steel which is of a dimension so as to snugly accept the outer dimension of pillar 10 at frame support position location 97 and is securely attached to pillar 10 by knobbed bolt and nut fasteners 176 which are of such a length that when inserted into bores 178 and 180 on connector bracket 98 and through registered and aligning bores 186 and 188 through the mirror bores of bores 186 and 188 on pillar 10 and through the mirror bores of 178 and 180 and they extend completely through plate connector bracket 98 , pillar 10 and provide full thread attachment of nuts . there is disclosed yet another such modification of the apparatus here in fig2 the front end of cord 114 is attached to connector ring 68 in any manner that is known to those skilled in the art and is in turn attached to tab 66 at bore 106 . the back end of cord 114 is attached to connector ring 116 in any manner that is known to those skilled in the art . cord 114 passes over and engages pulley 74 and connector ring 116 is now disposed down into the inside of pillar 10 where it is attached to the top end of spring 118 by any such means that is known to those skilled in the art . spring 118 is disposed inside pillar 10 , at a lower most portion thereof . connector ring 120 is attached to a lower most end of spring 118 and is in alignment and registration with bore 122 that is disposed through both parallel sides of pillar 10 . bolt and nut fastener 124 , which is of such a length that when inserted into bore 122 and through registered and aligning connector ring 120 and then through bore &# 39 ; s 122 mirror bore and then extends completely through pillar 10 to provide full thread attachment of nuts . spring cord assembly 119 is of such a tensile resistance so as to exert , via its connection to assembly 30 at tab 66 , sufficient mechanical aid to the lifting of assembly 30 throughout the vertical adjustment length of pillar 10 . in fig3 nubs 164 and 168 are disposed at each end of base cross member 132 respectively in such a manner so as to border the inner edge of sleeves 160 and 162 respectively so as to prevent unwanted horizontal sliding of base cross member 132 in sleeves 160 and 162 . similarly , nubs 166 and 167 are disposed at each end of base cross member respectively in such a location so as to border the outer edge of sleeves 160 and 162 respectively so as to prevent unwanted horizontal sliding of base cross member 132 in sleeves 160 and 162 . nubs 164 , 168 , 166 and 167 are attached in a screwmount arrangement . in fig4 the apparatus is shown in its folded arrangement . handle members 80 and 82 have been removed and relocated from their horizontal orientation to a vertical apparatus folding and storage orientation ; knobbed bolt and nut fasteners 176 have been removed from their frame support position at location 97 ; connector bracket 98 has been moved to frame folded and cached position at location 99 ; interconnector buttress support 123 , via its weldment attachment to connector bracket 98 and the pivot action of mounting and pivot axis bolts and nut attachments 146 and 148 is now in its frame folded and cached alignment ; pillar 10 has been rotated via the pivot axis of base cross member 132 and its relationship with sleeves 160 and 162 ; pillar 10 now in its frame folded and cached position and is now generally parallel to base rails 150 and 151 ; knobbed bolt and nut fasteners 176 have been inserted into bores 178 and 180 and extend through bracket 98 ; through registered and aligning bores 190 and 192 on pillar 10 , and extend completely through plate connector bracket 98 , pillar 10 and therefore provide full thread attachment of nuts thus securing the apparatus in its folded and cached position . apparatus 9 can now be easily moved to any convenient storage location by holding the upper end of pillar 10 and rolling the apparatus on the wheel assemblies 172 and 174 which can now engage the floor . turning now to fig6 . shown here is a modification of the mechanically aided lifting assembly . retractable cord assembly 194 is mounted to the inner surface of the upper end of pillar 10 in a screwmount arrangement and is a retractable cord device such as is employed in the use of a retractable dog leash or retractable tape measure , which are known to those skilled in the art . cord 196 is attached to connector ring 68 in any manner that is known to those skilled in the art , and is of such a length and under such a tensile resistance that when said cord is connected to mechanically aided vertical height adjustment mechanism assembly 30 , via its attachment to bore 106 of connector tab 66 , there is exerted a lifting force that aids in the lifting of assembly 30 throughout its entire vertical adjustment range on pillar 10 . in fig7 there is disclosed yet another such modification of the apparatus . pillar 10 , has disposed down and along its length on its rear , evenly spaced vertical adjustment locking holes 210 . holes 210 can be of round , square or other shape . vertical locking section 212 is rigidly attached , by weldment arrangement or other secure means , to the inside and topmost rear area of both parallel sides of sleeve assembly 214 and is oriented in a generally horizontal position clearly above the horizontal plane of bar 28 , thereby allowing for the rockering action of the sleeve assembly mechanism . locking section 212 has projecting from it &# 39 ; s inner surface shown in phantom is lock nub 216 . nub 216 is formed of steel or other like material and is rigidly fixed to the inner surface of section 212 by a weldment arrangement or other secure means . tab 216 is of such size and shape that , when in the locked position it engages into a hole 210 and thereby locks the sleeve assembly 214 into a locked position , thus preventing undesired downward migration of the assembly . although the drag and friction created on the contact surface of pillar 10 by the rockering action of sleeve assembly 214 can be adequate to resist downward migration of the assembly to insure a secure hold a locking mechanism , such as described herein , is preferably employed . sleeve 256 is of a size and shape so as to conform to pillar 10 yet allow free movement over pillar 10 during vertical position adjustments . retractable cord assembly 194 as disposed at the top end of pillar 10 is in this modification rearward facing . cord 196 is attached to connector ring 68 in any manner that is known to those skilled in the art , and is of such a length and under such a tensile resistance delivered by retractable cord assembly 194 that when cord 196 is connected to mechanically aided vertical height adjustment mechanism assembly 214 , via its attachment of connector ring 68 to bore 106 of connector tab 66 , there is exerted a lifting force that aids in the lifting of assembly 214 throughout its entire vertical adjustment range on pillar 10 . shown in fig8 is another modification of the mechanically aided lifting apparatus . elastic cord 202 is attached to connector ring 68 in any manner that is known to those skilled in the art and is in turn attached to tab 66 at bore 106 . elastic cord 202 passes over pulley 74 and down into the inside of pillar 10 . the base end of elastic cord 202 is attached to connector ring 200 and is disposed down inside pillar 10 to a point that connector ring 200 is in alignment and registration with bore 198 that is through both parallel sides of pillar 10 . bolt and nut fastener 176 which is of such a length that when inserted into bore 198 and through registered and aligning connector ring 200 , extend completely through pillar 10 and provide full thread attachment of nuts . elastic cord 202 is of such a tensile resistance so as to exert , via its connection to assembly 30 , sufficient mechanical aid to the lifting of assembly 30 throughout the vertical adjustment length of pillar 10 . directing your attention now to fig9 shown here is another modification of the mechanically aided lifting apparatus . cord 204 is attached to connector ring 68 in any manner that is known to those skilled in the art and is in turn attached to tab 68 at bore 106 . cord 204 passes over pulley 74 and down into the inside of pillar 10 . the end of cord 204 is laced through bore 208 which is disposed at the top of counterweight 206 . counterweight 206 is of such a dimension so as to move freely in a vertical manner inside the dimension of pillar 10 and is of such a weight so as to , via its connection to assembly 30 , provide sufficient mechanical aid to the lifting of assembly 30 throughout the vertical adjustment length of pillar 10 . turning now to fig1 - 13 . shown here is another aspect of a modification of the mechanically aided lifting apparatus . spring 100 is inserted down and into pillar 10 and rests securely on the top surface of base cross member 147 . spring 100 is of such a dimension so as to move freely within the inner dimension of pillar 10 . shown in fig1 is spring compression tab assembly 103 . tab 112 is formed of plate steel and is of such a width so that when horizontally aligned can move freely within the inner dimension of pillar 10 yet large enough to serve as a compression tab to spring 100 . tab 112 has welded to its edge threaded shaft 107 . shown in fig1 is bored track 111 which is disposed down the backside of pillar 10 and is of such a dimension so as to freely accept threaded shaft 107 . track 111 ends somewhat before the top end of pillar 10 creating stop edge 113 of pillar 10 . shown in fig1 is spring compression tab 103 having been inserted into and through track 111 from the inside out with the threaded end of shaft 107 projecting rearward and outside of pillar 10 . shaft 107 is of such a length that when inserted through track 111 extends completely through pillar 10 and provide full thread attachment of nut 109 thus rigidly attaching tab assembly 103 to sleeve 110 . with the downward adjustment of mechanically aided vertical height adjustment mechanism assembly 30 spring 100 is compressed by tab 112 and spring 100 creates such compression that there is exerted an adequate lifting force on pin locking mechanically aided vertical height adjustment mechanism assembly 30 to aid in quick and smooth transitions between various vertical height positions along the length of pillar 10 . turning now to fig1 , a pair of forearm pad assemblies 218 have a pad base 220 formed of a rigid wood , metal , plastic or like material , which has fixed to their top surface , in any manner known in the art , soft foam like pad 222 . these pads 222 can have a flat top surface or can be concave longitudinally so as to provide a more comfortable resting surface for the forearm . hand grip assembly 226 , is rigidly fixed to pad base 220 in any such manner as is known to those skilled in the art . such as by a screwmount arrangement as shown in fig1 with screws inserted through bores 230 on brackets 228 and into pad base for secure assembly . referring once again to fig1 , a pair of pad assemblies 218 are shown , one mounted in its locked functional position on handle 82 and one shown in its removed position over handle 80 . forearm pad 218 is shown with handle 224 end oriented forward , and locked upon , the approximate length of elongated member 84 , by means of forearm pad to handle rod 232 and angled forearm pad to handle rod 234 , so that the user &# 39 ; s forearms can be securely rested upon the pads . forearm pad to handle rod 232 and angled forearm pad to handle rod 234 are formed of steel and are attached to the bottom of handle grip support rail 227 in a weldment arrangement or other conventional means . hand grips length 224 is oriented upward at a 90 ° angle so as to be in a position to be held in the user &# 39 ; s hands to facilitate comfortable performance of knee raises and other like exercises . when certain other exercises are to be performed and the elongated members 83 and 84 are required to support the hands , it is necessary to remove the pads 218 as is shown with pad assembly 218 removed from elongated member 83 and above handle 80 . in accordance with yet another novel aspect of the invention , forearm pads 218 are removable . to remove the pads 218 , the front end of the pad assembly 218 is lifted thereby removing rod 232 from bore 240 which is disposed at the forward end of elongated members 83 or 84 and is bored completely through the diameter of elongated members 83 and 84 ; now the pad assembly 218 can be lifted in a forward direction thereby removing angled forearm pad to handle rod 234 from its position inside of elongated members 83 or 84 with elongated member 236 inside of , rearward facing and parallel with the elongated members 83 or 84 . in accordance with yet another aspect of the invention , as best seen in fig1 , a back support pad assembly 244 , illustrated here in transparent form , is provided . pad base 246 , formed of a rigid wood , metal , plastic or like material , has fixed to its front surface , by any means known to the art , a soft foam - like pad 248 . a pair of plates 250 , formed of steel , are rigidly fixed , and mirror each other , to the parallel sides of sleeve 110 by a weldment arrangement or other secure means ; pad attachment bracket 252 is continuous with the forward edge plate 250 and oriented at a 90 ° angle diagonally outwardly . pad base 220 is attached to bracket 252 in a common screwmount fashion through bores 254 . the angle of the pad also provides a comfortable and safe position for the lower back while performing knee raises and other like exercises and are used in concert with the forearm pads 218 to provide comfort and support while performing knee lift exercises that are known to those skilled in the art . turning know to fig1 - 22 , another embodiment of the present invention is illustrated . the mechanically aided exercise apparatus 9 illustrated in this embodiment is intended to rest against the floor by horizontal bar 268 and against an upstanding wall , which is typically perpendicular with respect to the floor , through substantially vertically oriented mounting pads 260 , 262 each of which is fixedly connected to pillar 10 . for example , pad 260 is fixedly connected to pillar 10 essentially adjacent to the radius bend 276 by connecting rod 264 . likewise , pad 262 is fixedly connected to the upper portion of pillar 10 by connecting rod 266 . pin locking mechanically aided vertical height adjustment mechanism assembly 30 can be made by any of the embodiments described herein . pillar 10 is connected to horizontal bar 268 by a selectively disconnectable connection between bar 284 and bar 278 for ease of assembly and disassembly of the apparatus and for small shipping size . more specifically , bar 278 includes a reduced stepped portion 282 that is matingly received within a blind bore 283 in bar member 284 . bar 284 is fixedly connected to horizontal bar 268 , preferably by a weldment or a bolt connection ( see fig2 ). as illustrated , reduced portion 282 and blind bore 283 have a correspondingly similar shape in cross section ( illustrated as being square ) to assure a mating connection between these two parts . of course , if desired a set screw or other mechanism may be used to selectively lock the connection between bar 278 and bar member 284 . the individual component differences of the mechanical lifting aids to a sleeved exercise device , modified base assemblies , pin locking mechanically aided vertical height adjustment mechanism assemblies and lever locking vertical height adjustment mechanism assemblies as shown and described herein , and the obvious variations not shown , but obvious to those skilled in the art , can be interchanged with one another in whole or in part and in numerous variations and combinations . it should , therefore , be noted that only preferred embodiments of the invention have been illustrated and described . it is realized that various modifications of the described embodiments are possible without departing from the aspect and scope of the invention . for example , the connection of the connector ring 68 on the end of the cord assembly to the horizonal bar 28 through connector tab 66 can be effected to the sides of the pillar or in back of the pillar .

US-15288398-A

a golf accessory comprises a ball retrieval tool on one end and a ball mark repair tool on the opposite end which facilitates use of both tools without requiring a golfer to bend down . the golf accessory may further comprise telescoping members inside a shaft for extending the golf accessory to various lengths away from a golfer desiring to use the tools on each end thereof .

referring now to the drawings , and particularly to fig1 thereof , there is shown a golf accessory 10 comprising a first embodiment of the present invention . the golf accessory 10 comprises shaft 12 having a ball mark repair tool 14 at one end and a ball retrieval tool 16 at the other end thereof . an optional spring - loaded clip 18 located near one end of the golf accessory providing means for supporting the golf accessory to the outside of a golf bag to preserve space in the golf bag and / or for easier access to the accessory 10 . the ball retrieval tool 16 used in conjunction with the golf accessory 10 is illustrated in u . s . design pat . no . d475 , 112 s . the ball retrieval tool 16 may be fabricated from a metal such as aluminum , a polymer material , or another suitable material known to those skilled in the art to resist rust or corrosion . the ball mark repair tool 14 used in conjunction with the golf accessory 10 is described in detail in u . s . pat . no . 6 , 048 , 274 . if used , the clip 18 facilitates the golf accessory to be secured snugly over a rim or other similar surface of a golf bag . the proximal end of the clip 18 secures to the shaft 12 by threaded fasteners , an adhesive , or any suitable fastening methods known to those skilled in the art of manufacturing golf accessories . the clip 18 is spring - loaded and may be fabricated from a metal such as aluminum , a polymer material , or another suitable material known to those skilled in the art to resist rust or corrosion . alternative to a rigid structure the clip 18 may be a flexible member enabling the clip 18 to be tightened onto the rim of a golf bag by pressing the distal end of the clip 18 toward the proximal end thereof . the shaft 12 comprises telescoping members 22 which extend the golf accessory 10 to facilitate balls to be retrieved from water hazards , sand traps , trees , and the like that cannot be easily accessed by a golfer . the present invention further includes an optional cover for the ball mark repair tool 14 of the golf accessory 10 . the cover may be formed from various flexible materials including leather , imitation leather , various plastics , etc . the cover may also be formed from a rigid material such as stainless steel , steel , brass , aluminum , other metals , and various plastics . either the flexible or the rigid version of the cover may be provided with a protective interior layer formed from a suitable material such as natural or artificial felt , etc . fig2 illustrates a second ball retrieval tool 16 a that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 a shown in fig2 is described in detail in u . s . pat . no . 5 , 184 , 859 and sold under the trademarked name of the hide - away retriever ®. fig3 illustrates a third ball retrieval tool 16 b that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 b shown in fig3 is described in detail in u . s . pat . no . 5 , 265 , 926 and sold under the trademarked name of gotcha ®. fig4 illustrates a fourth ball retrieval tool 16 c that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 c shown in fig4 is a generally conical solid structure comprising a receiving aperture 24 on the proximal end thereof for receiving the distal most telescoping member 22 or receiving the shaft 12 and a cup 26 for scooping a ball from a hole . the retrieval tool 16 c may be fabricated from rubber , a flexible polymer material , or other similar material known to those skilled in the art of manufacturing golf accessories . fig5 illustrates a fifth ball retrieval tool 16 d that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 d shown in fig5 is illustrated in u . s . design pat . no . des . 306 , 058 . fig6 illustrates a sixth ball retrieval tool 16 e that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 e shown in fig6 is described in detail in u . s . pat . no . 5 , 368 , 352 . fig7 illustrates a seventh ball retrieval tool 16 f that may be used in conjunction with the golf accessory 10 . the ball retrieval tool 16 f shown in fig7 is described in detail in u . s . pat . no . 4 , 310 , 189 . fig8 illustrates a golf accessory 40 comprising an alternate embodiment of the present invention . many of the component parts of the golf accessory 40 are substantially identical in construction and function to component parts of the golf accessory 10 illustrated in fig1 through 7 and described hereinabove in conjunction therewith . such identical component parts are designated in fig8 with the same reference numerals utilized above in the description of the golf accessory 10 , but are differentiated therefrom by means of a prime (′) designation . the golf accessory 40 differs from the golf accessory 10 of fig1 through 7 in that the golf accessory 40 does not include telescoping members . instead the golf accessory 40 comprises a shaft 12 ′ with a ball mark repair tool 14 ′ at and a ball retrieval tool 16 ′ at each end thereof . although the golf accessory 40 is illustrated using the ball retrieval tool 14 c shown in fig4 , the golf accessory 40 may also be used in conjunction with any of the ball retrieval tools 16 illustrated in fig1 through 7 . fig9 illustrates a golf accessory 50 comprising a variation of the golf accessory 10 illustrated in fig1 through 7 and described hereinabove in connection therewith . the golf accessory 50 is substantially identical in construction and function to the golf accessory 10 , except that the golf accessory 50 comprises only one telescoping member 22 . the golf accessory 50 is illustrated with the ball mark repair tool 14 inserted into a ground surface 52 . the golf accessory 50 comprising only one telescoping member 22 results in the golf accessory 50 having a more compact and lightweight shaft 12 for ease of use by golfers having back problems . fig1 illustrates the golf accessory 10 having a handle 60 with an optional flexible golf - bag engaging member 62 secured thereto . the handle 60 may be fabricated of rubber , plastic , or other similar materials suitable for a handle or grip application . if used , the flexible golf - bag engaging member 62 may be fabricated from materials such as plastic , metal or any other hard but pliable material known to those skilled in the art of manufacturing sporting accessories . during the play of golf , a golf bag is generally supported on a golf cart which the golfer must leave in order to access the greens of the golf course . the golf accessory of the present invention is carried along with a putter by a golfer as the golfer approaches the putting green in anticipation of retrieving the ball from the cup and the possibility that a ball mark will need repair . as shown in fig9 , the golf accessory of the present invention may be inserted into a ground surface adjacent to the green when not being used thereby preventing a golfer from having to bend over to retrieve the golf accessory . in addition to retrieving a golf ball from a cup , the golf accessory of the present invention as shown having a plurality of telescoping members may be used to retrieve balls from water hazards , sand traps , trees , and the like . fig1 illustrates the golf accessory 40 having a golf club leaned thereagainst and supported by the clip 18 . by utilizing the golf accessory 40 to support a golf club while not is use , the golfer is not required to bend over to retrieve the club from the ground surface 52 . fig1 illustrates the golf accessory 70 comprising a variation of the golf accessory 10 illustrated in fig1 through 10 and described hereinabove in connection therewith . the golf accessory 70 is substantially identical in construction and function to the golf accessory 10 , except that the golf accessory 70 comprises a support member 72 for supporting a golf club when not in use in lieu of supporting the club on the clip 18 . the support member 72 surrounds the shaft 12 and may be collapsed when not in use for more compact storage of the golf accessory 70 . fig1 illustrates an alternative to the support member 72 to be used in conjunction with the golf accessory . an indentation 78 is formed in the shaft 12 below the ball retrieval tool 16 for supporting a golf club leaned thereagainst . although preferred embodiments of the invention have been illustrated in the accompanying drawings and described in the foregoing detailed description , it will be understood that the invention is not limited to the embodiments disclosed , but is capable of numerous rearrangements , modifications , and substitutions of parts and elements without departing from the spirit of the invention .

US-27857006-A

a tree stand having improved comfort and utility features a unique seat design enabling the hunter to move the seat a confined distance while seated thereon and to swing the seat out of the way to the side of the stand if desired .

referring now to the accompanying drawings , fig1 comprises main stand platform 1 including base frame 2 of generally rectangular shape and adapted at one end for attachment of half moon gripper bar 3 on which gripper blades 4 and 5 are fixed and positioned for engagement with the tree . base frame platform 6 is joined to base frame 2 and supported by parallel support bar 7 and perpendicular support bar 8 . raised rigid rails 9 and 10 are fastened to base frame 2 and reinforced with support posts 11 and 12 . half hexagon gripper bar 13 is shaped for telescopic insertion in the open ends of raised rigid rails 9 and 10 and includes corner stress plates 14 and 15 and gripper blades 16 and 17 positioned for engagement with the tree . curved back rest bar 18 is attached and positioned about at the midpoint of the verticle portion of the raised rigid rails and may be padded for extra comfort . a pair of clip pins 19 and 20 are inserted through raised rigid rails 9 and 10 for holding and adjusting half hexagon gripper bar 13 against the tree . rigid rails 9 and 10 are further supported by stress bars 21 and 22 positioned at a 45 ° angle . in fig2 swing away seat 23 is shown in position for use resting on top of raised rigid rails 9 and 10 . seat swivel collar 24 is fastened to swing away seat 23 at one corner adjacent half hexagon gripper bar 13 with u - shaped half collars 25 , 26 and 27 positioned at the remaining three corners of swing away seat 23 on seat support rails 28 and 29 and with their open ends down to permit swing away seat to be moved forward toward the tree or backward away from the tree while the hunter is seated thereon . movement of swing away seat 23 is normally confined to a distance of about four inches , ( 10 . 16 centimeters ), this being the area between corner stress plate 14 and support post 11 . the exact movement distance will , of course , vary with the dimensions of main stand platform 1 . thus the hunter is able to shift his position from time to time while seated for long periods of time , enabling him to relieve muscular tension . fig3 shows swing away seat 23 in its storage position on main stand platform 1 suspended from raised rigid rail 9 and attached thereto by swivel collar 24 and anchored to raised rigid rail 9 by wing nuts . the tree stand is specifically designed for comfort and quietness . known tree stands have seats that cannot move once the hunter is seated thereon and this gets very uncomfortable after one has been sitting for 3 or 4 hours trying to keep quiet . the seat design of this invention enables the hunter to quietly slide the seat back and forth to relieve muscular tension while seated thereon . the seat will slide backward or forward a distance of about four inches ( 10 . 16 centimeters ) or more depending on design dimensions . although the invention has been described with respect to preferred embodiments , it is not to be so limited since various alterations , changes , deviations , modifications and departures may be made by those skilled in the art to the embodiments shown , and are within the spirit and intended scope of the present invention .

US-40048389-A

a traction system for use on conventional flexible footwear is provided that includes both toe and heel sections that are independently attached to a wearer &# 39 ; s footwear and are connected with a flexible linkage . the flexible linkage allows the traction system to move with the normal movement of the flexible footwear so as to provide a natural walking and running movement . the traction system provides numerous benefits over previously available crampon and other spiked traction systems , including flexibility , light weight , practical usability with a wide variety of footwear types — including highly flexible footwear such as running shoes , compactability , and ready adjustability between different sizes and types of footwear .

the present invention comprises a traction system that is adapted for use with common footwear , such a street shoes , running shoes and lightweight hiking boots , that can provide one or more of numerous benefits , such as : being quickly attached and removed from footwear ; being readily adaptable for use with different sizes and types of footwear ; being readily flexible along its length to allow for use with footwear with flexible footbeds ; being fully compactable for ease in carrying and storage when not in use ; and being durable enough to accommodate aggressive use , such as in extended walking , hiking and running activities . the traction system 10 of the present invention is illustrated in fig1 through 4 . the traction system 10 comprises a toe piece 12 in the forefoot region , a heel piece 14 , and a connecting extender bar 16 attaching the toe piece 12 and the heel piece 14 together . each of the toe piece 12 and heel piece 14 has attached thereto or integral therewith numerous points or teeth 18 a , 18 b , 18 c , 18 d , 18 e , and 18 f , and 20 a , 20 b , 20 c , and 20 d . the toe piece 12 is held to the forefoot of a wearer through the use of two or more straps 22 a , 22 b and a strap guide 24 . straps 22 a and 22 b are attached to the toe piece 12 by anchors , such as upwardly extending slotted tabs 26 a , and 26 b , and pass through slots in the strap guide 24 to produce two loose ends . as is explained in greater detail below , straps 22 a and 22 b are preferably formed from a flexible material , such as polypropylene or nylon . additional side support straps 22 c and 22 d attach to the toe piece through anchors such as slots 28 a and 28 b . straps 22 c and 22 d are each attached to rings 30 a , 30 b ( which can be circular , rectangular , triangular , oval , d - shaped , or other suitable shape ). although straps 22 c and 22 d may also be formed from flexible material , it has been determined that these straps are preferably formed from a relatively inflexible material , such as a metal or hard plastic , that can provide additional lateral support to the wearers foot during use . as is explained in greater detail below , depending on the width of footwear employed , these side support straps also can be adjusted to assume different orientations so as to provide either a wider supportive foot bed or more upright lateral support for the footwear . the loose ends of straps 22 a and 22 b form toe attachment straps 32 a and 32 b adapted to fit through each of the rings 30 a , 30 b and adjustably attach around the wearer &# 39 ; s foot , such as through the use of slide attachments ( e . g ., d - rings 34 as shown ), hook - and - loop attachments , buckle attachments , etc . the strap guide 24 includes openings 36 a through 36 f through which straps 22 a and 22 b are threaded to attached between slotted tabs 26 a and 26 b , rings 30 a and 30 b , and the attachments 34 . the length of each of the straps 22 is preferably independently adjustable , such as through the use of slides 38 a and 38 b or other means ( such as hook - and - loop fasteners , provision of multiple straps of different lengths , etc . ), so that the strap guide 24 can be re - positioned to accommodate different sizes and / or types of footwear . once properly positioned for a given footwear , the traction system can be quickly and easily applied . one or more additional adjustments may also be provided on the loose ends of straps 22 to add in the adjustment of the toe adjustment straps 32 a , 32 b . it is believed preferred that the strap guide 24 be adjusted to seat over the wearer &# 39 ; s foot just forward of the ball of the foot ( as is shown in fig1 through 14 ). however , the adjustability of the straps 22 and strap guide 24 allows each user to position attachment of the toe piece 12 in a personally preferable manner . it should be appreciated that the design of the present invention allows it to be readily adaptable to a wide variety of strap embodiments . for instance , the strap guide 24 may be attached to each of the slotted tabs 26 a , 26 b by separate straps ( which can be independently adjustable ). the toe adjustment straps 32 a and 32 b may then be formed from one or more separate straps independently attached to the strap guide 24 . the heel piece 14 is attached around a wearer &# 39 ; s ankle through a heel cup 40 mounted above the heel piece 14 through one or more heel bales 42 a , 42 b . the heel cup 40 attaches against the wearer &# 39 ; s achilles tendon through use of an adjustable heel attachment strap 44 attached to the heel cup through slots 46 a , 46 b . the heel strap 44 is preferably adjustable , such as through use of slide 47 and / or other means ( e . g ., hook - and - loop fasteners ) and / or adjustable buckle attachment 48 . the heel bales 42 are shaped to allow the heel support to fold forward fully yet offer rigid support by stopping at near vertical ( e . g ., about 95 - 110 degrees ) from the plane of the heel piece . the heel bales 42 are preferably attached to the heel piece 14 through openings 50 a , 50 b in such a manner that the heel bales 42 can be actuated downward ( that is , contacting against , and approximately parallel to the plane of , the heel piece ) so that the heel cup 40 folds compactly against the heel piece 14 when not is use ( as is shown in fig1 ). the extender bar 16 is preferably provided with means to adjust the distance between the toe piece 12 and the heel piece 14 to accommodate different lengths of footwear . this can be accomplished through a variety of methods , including providing multiple extender bars of different lengths or providing one or more of various clamping or locking means to fix the operative length of the extender bar . in the preferred embodiment shown , the extender bar 16 attaches to the toe piece 12 through one or more slots 52 . the extender bar 16 attaches to the heel piece 14 through one or more slots 54 . the operative length of the extender bar is maintained by provided it with multiple openings 56 along its length . a locking pin 58 is provided on either the heel or toe piece that engages one of the multiple openings 56 and maintains the position of the extender bar 16 . in the embodiment shown , the locking pin 58 is provided on the heel piece 14 and an actuatable spring clip 60 is provided to hold the locking pin in the desired opening 56 . it should be appreciated that the pin can be held in place through a variety of other means , including providing a threaded pin and threaded receptacle to hold it in place , providing a self - locking pin , etc . a lip 62 or other stopping means should be provided on the opposite end of the extender bar 16 to help hold it in place . by providing an extender bar 16 that can be locked in place along its entire length , as is shown in fig1 through 4 , the bar may be readily adjusted to a set operative length for any given footwear . as shown , the opposite end of the extender bar 16 can be freely moved through slot 52 to allow the toe piece and heel piece to compacted together when not in use ( as is shown in fig1 , described below ). by leaving the lip end 62 free to slide , the traction device can be quickly and easily compacted without the need to readjust the pre - set operative length when attaching to footwear . additionally or alternatively , the toe and heel pieces can be compacted together by actuating the extender bar 16 through the locking pin 54 , as previously described . details for each of the toe piece 12 , heel piece 14 , and strap guide 24 are shown in fig5 through 10 . the toe piece 12 is shown in detail in fig5 and 6 . a total of six teeth , 18 a through 18 f are provided , each preferably triangular in shape . the teeth preferably protrude between 0 . 6 and 0 . 8 inches from the platform of the toe piece 12 . this allows for good traction with minimal snagging . they are configured so the traction is “ under foot ” so there is less snagging and more control . the configuration also allow for minimal “ snow balling ” or snow packing by using the fewest teeth necessary and allowing maximum space for the snow to exit . the downwardly directed teeth provide the means to penetrate most slippery surfaces and gain traction . the number , shape , and orientation of the teeth can vary . for use on common footwear used for hiking or trail running it is desirable to minimize the risk of twisting an ankle , keep snow from packing in between teeth , and provide good support for the footwear that is otherwise somewhat flimsy . the front two teeth 18 a and 18 b are oriented nearly perpendicular to the length of the unit . this provides optimal traction when climbing straight uphill . as is described below , the traction is enhanced by the flexing of the unit with the footwear by allowing the teeth to maintain an advantageous angle . by contrast , if the footwear or unit were rigid , the angle of the teeth into the slope would be good at the beginning of the step but as the climber lifted his or her heel in forward motion , the teeth would move to become more parallel to the slope and less traction would result . this is why crampons for rigid boots have front points nearly parallel to the length of the unit and why they are rather ineffective for traction if flexed . the middle two teeth 18 c and 18 d are oriented to maximize traction while traversing a slope . they are located closer to the rear teeth than to the front teeth . this puts the teeth more “ under foot ” ( as opposed to being near the toes of the user ) and provides a sense of stability and control . the rear two teeth 18 e and 18 f are oriented to be as close to the rear of the toe piece as possible without increasing the overall size of the toe piece . again , these are located “ under foot ” ( i . e ., not far out by the edge , or beyond the edge , of most footwear and all the way to the rear of the toe piece ). as is explained in greater detail below , it is desirable that the teeth be constructed from a material that is durable , strong , relatively rigid , and sharpenable or re - shapable with a common file . the toe piece is shaped to enhance the feeling of uninhibited walking , hiking , or running by providing a slight curve in the vertical plane . this curve also helps reduce the occurrence “ snow balling ” ( that is , the packing of snow under foot ) by reducing the angle of the front and rear teeth slightly from 90 degrees . the heel piece 14 is shown in detail in fig7 and 8a . there are preferably four teeth 20 a , 20 b , 20 c , 20 d on the heel piece , again each triangular in shape . the teeth are configured to offer minimal risk of snagging and twisting an ankle or tripping . this is accomplished by designing the rear teeth shorter than the front teeth 18 ( e . g ., approximately 0 . 4 to 0 . 6 inches in length ) and keeping the overall size of the heel piece to a minimum . a pin slot 63 is provided to allow for actuation of the locking pin 58 through the heel piece . again , the teeth are preferably formed of a material that is durable , relatively rigid , and capable of being sharpened and re - shaped as needed . another embodiment of the heel piece 14 is illustrated in fig8 b showing an alternative embodiment of pin slot 63 comprising three openings 63 a , 63 b , 63 c . it is preferred that the toe piece and heel piece be constructed from a lightweight , relatively inflexible , yet durable material , such as stainless steel , aluminum , titanium , plastic , or composite material . due to cost constraints , the preferred material is aluminum alloy , such as 7075 tc aluminum , available from ami metals of califormia , approximately 0 . 14 to 0 . 17 inches thick . the strap guide 24 is shown in fig9 and 10 . the strap guide is preferably constructed from a strong yet flexible material , such as high density polyethylene ( hdpe ) or ultra - high molecular weight ( uhmw ) polyethylene . the preferred material comprises an uhmw polyethylene approximately 0 . 05 to 0 . 2 inches thick , and more preferably about 0 . 08 to 0 . 15 inches thick . the strap guide can be adjusted for varying sizes of footwear and keeps straps from shifting to an insecure position . an alternative way to solve this problem is to sew ( or otherwise bond ) the straps together at the crossover point . this works only for a limited size range of footwear unless a variable length feature is added between the support tab and the crossover point . this can be accomplished by allowing extra length of the strap at the slotted tabs 26 that can be used to extend this length . this may be less convenient to change than by use of the strap guide . furthermore , the strap guide provides a way of “ redirecting ” the strap to optimize the fit of the strap system . the strap angle can be changed slightly as the strap passes through the strap guide . the better fit is achieved because the straps do not cross in a symmetric “ x ” pattern and the “ redirecting ” of the straps helps account for that asymmetry . the strap guide can be designed to accommodate a range of geometries in the toe piece . further , the strap guide may be readily readjusted when the user changes to a different type of footwear that has a lower or higher toe profile . the strap guide is designed to provide enough friction on the strap to keep the crossover point from slipping forward into an insecure position . this is achieved by threading the strap through a series of slots . the strap material and dimensions used with the present invention may be varied for various applications . generally suitable materials include : various plastics ( such as polypropylene , nylon , kevlar ® polyimide ), leather , cotton , hemp , or any similar flexible strap material . polypropylene is preferred since it does not absorb water and freeze , as nylon and natural materials do , and is easier to process and cheaper than polyimide . the width dimensions can vary from about 0 . 25 to 1 . 25 inches , with a width of about 0 . 75 inches being generally preferred . thickness can vary from about 0 . 03 to 0 . 1 inches . “ heavy duty ” grade polypropylene has been shown to work well . constructed from reasonably priced light weight materials , the traction system of the present invention can readily attain a total weight per individual foot unit of about 0 . 7 lbs . or less , and more preferably a total weight of less than about 0 . 6 lbs . or even less than about 0 . 5 lbs . as is shown in fig1 through 14 , the traction system 10 of the present invention can be used in a variety of applications on a wide range of footwear products . fig1 demonstrates use of the traction system 10 on a trail running shoe 64 of a wearer 66 traversing snow . fig1 again shows the system 10 on a trail running shoe 64 . fig1 shows the system 10 on a lightweight hiking boot 68 . it should be noted that such boots 68 normally have relatively flexible soles that would not be suitable for attachment of mountaineering - type crampon devices . fig1 shows the system 10 attached to a pack boot 72 . again , pack boots 72 have relatively flexible soles that are not suitable for mountaineering - type crampons . as can be seen in fig1 through 14 , the side support straps 22 c assume different orientations to accommodate the different widths of each of these shoes . one of the important features of the traction system 10 of the present invention is its flexibility . by using a flexible material as the extender bar 16 , the system can be designed to mimic the flexibility of flexible footwear , making it suitable for use with street shoes as well as walking , running , and lightweight hiking footwear . however , the system can be equally well used with rigid soled shoes , such as stiff hiking or mountaineering boots . fig1 illustrates that the traction system 10 of the present invention can be readily shortened into a relatively small , compact unit by sliding the extender bar 16 through slots 52 . in this compacted form the traction system 10 of the present invention can be easily stored and transported . the extender bar 16 can then be readily slid into the open position until lip 62 engages with slot 52 in the fully open position . in this way once the unit is adjusted to fit a given shoe it can be compacted and returned to its full operational length without altering spring clip positions . shown in fig1 is a demonstration of the excellent flexibility of the system 10 of the present invention . using only minimal manual pressure , the toe piece 12 can be flexed up to 60 degrees or more from normal plane 72 without damaging or permanently deforming the system 10 . depending on the materials used , manual flexibilities of 10 , 15 , 20 , 25 , 30 , 35 , 40 , 45 , 50 , 55 , 60 , 65 , 70 , 75 , 80 , 85 , 90 , or more degrees can be readily achieved with the present invention . one method of achieving flexibility is to construct the extender bar 16 from a single layer of flexible material , such a spring steel , alloy , or plastic . as is shown in fig1 and 18 , flexibility can also be achieved or enhanced by forming the extender bar 16 from multiple layers ( e . g ., 2 , 3 , 4 , or more layers ) of material 74 a , 74 b that are attached together , such as through adhesion or welding at one or more discrete points 76 . this construction can provide excellent flexibility and durability with minimal weight , minimal thickness , and minimal strain applied to the extender bar during use . fig1 a and 19b illustrate how the side support straps 22 c and 22 d of the present invention can be adjusted to accommodate different widths of footwear . as is shown in fig1 a , side support strap 22 d is set in a relatively upright position that provides lateral stability and better fit against narrower footwear , such as the running shoe shown in fig1 . by contrast , the side support strap 22 d also can assume a flatter outward orientation , essentially extending the width of the footbed , as is shown in fig1 b . in this orientation the side support strap 22 d provides a wider and more stable footbed so as to support a much wider shoe , such as the pack boot shown in fig1 . two different embodiments of spring clips for use in the present invention are illustrated in detail in fig2 and 21 . fig2 a and 20b show in detail the spring clip embodiment previously shown and described with respect to fig1 through 4 . in this embodiment the locking pin 58 is oriented so as to be pointed upward into the openings in the extender bar 16 . fig2 a and 21b show in detail an alternative construction whereby the locking pin 58 is oriented so as to be pointed downward through the openings in the extender bar 16 . fig2 illustrates opening 50 b used to attach the heel bale to heel piece 14 of the present invention . preferably opening 50 b should be shaped so as to allow the heel bale to be actuated between an folded orientation and an upright operative orientation . without intending to limit the scope of the present invention , the following example illustrates how the present invention can be made . a traction system of the present invention has been constructed in accordance with the design illustrated in fig1 through 10 in the following manner from the following materials : flat aluminum blanks for the toe piece 12 and heel piece 14 are made from sheets of aluminum alloy . blanks can be made from 7075 aluminum ( t6 or t0 temper ) with a thickness of about 0 . 16 inch and can be milled or cut with laser or water jet . these blanks are formed in dies . the first die rounds over any burrs on the edges , the second bends the teeth and extender bar tabs down and front support tabs up . the third bends a “ rocker ” into the toe piece . if t6 temper is used , the blanks should be solutionized and quenched before forming . the plastic strap guide 24 and heel cup 40 are milled from uhmw polyethylene about 0 . 09 inches and about 0 . 125 inches thick , respectively . they are heated in an oven then formed and cooled . the extender bar 16 can be fabricated from a sheet of annealed heat treatable steel alloy , such as type 4130 or 4140 , about 0 . 06 - 0 . 07 inch thick , by shearing to size ( approximately 0 . 75 inches × 8 inches ), forming , drilling the holes , heat treating to a spring temper , and powder coating to finish . other steels can be used in place of the heat treatable alloys ( for example , type 1045 medium carbon steel ). alternatively , a multi - layer extender bar can be fabricated from two or more thinner members . for example , two layers of 301 full hard stainless steel , about 0 . 03 inches thick , can be fabricated from sheets or strips to approximately 0 . 75 inches × 8 inches and holes drilled . these members are then permanently joined by a single spot weld or other type of permanent bond . the side supports 22 c , 22 d on the toe piece can be a 316 stainless steel in the annealed condition of about 0 . 024 inch thickness . this material is cut to about 0 . 42 × 3 . 1 inches then formed . the formed piece is then spot welded to a “ d ”- ring on one end and the body of the toe piece on the other . the heel bale 42 is formed from a 0 . 204 inch diameter 316l ⅛ hard stainless steel round in a series of bending jigs . the plastic heel cup 40 is then assembled onto the bale 42 then the bale is assembled to the heel piece 14 using special tooling that allows the bale to be inserted and bent into its final position . the spring clip 60 is cut by water jet or laser into flat blanks from about 0 . 03 inch thick 301 fh stainless steel . the clip is formed in a jig to add about a 170 degree curve . the curve is then increased to about 180 or more degrees by a second clamping process that assures a snug fit to the heel piece 14 . once the spring clip is attached to the heel piece , the pin 58 is added by inserting the pin in the hole in the spring clip and hammering the pin with a pneumatic hammer into a bottoming hole . this expands the diameter of the pin and secures it in place . to assemble the entire unit , the extender bar 16 is inserted through the front tabs 52 and connected to the heel piece 14 by lifting the spring clip 60 and sliding the extender bar 16 into the rear tabs 54 . a strap 44 is added to the heel cup 40 by threading them through the slots 46 provided and fastening them with a releasable buckle 48 . two straps 22 a , 22 b are added to the toe piece 12 by attaching them to the front anchors 26 a , 26 b on the toe piece and threading them through the strap guide 24 and the ‘ d ’- rings 30 a , 30 b on the side supports 22 c , 22 d of the toe piece then a buckle 34 to hold straps snug on the footwear . the traction system constructed in this manner demonstrated excellent performance when worn with a variety of footwear , including running shoes , street shoes , light hiking boots , and pack boots . this traction system has provided excellent traction on loose dirt , loose snow , packed snow , and ice . the traction system manufactured in accordance with this example could be readily manually flexed in the manner shown in fig1 up to 60 degrees or more without damaging or permanently deforming the system . the traction system constructed in this manner weighed only about 1 . 2 lbs . for the pair . while particular embodiments of the present invention have been illustrated and described herein , the present invention should not be limited to such illustrations and descriptions . it should be apparent that changes and modifications may be incorporated and embodied as part of the present invention within the scope of the following claims .

US-5304902-A

a safety needle system has a sheath that is capable of reciprocally sliding over the exterior of a syringe to alternately cover and uncover the needle portion of the syringe . the sheath is locked over the needle by means of a locking slot and coiled spring . a dog on the needle hub engages the locking slot and is held in position in the locking slot by the coiled spring . the sheath is reciprocally slidable on the exterior of the needle of the syringe by twisting the sheath to disengage the dog from the slot and moves the dog into a guide slot so that the sheath can be moved manually to expose the needle .

a safety syringe 10 according to the present invention is shown in sectional view in fig1 . the system 10 shown in fig1 consists of sheath 12 and syringe 14 . the syringe includes a needle 16 and a hub 18 which mounts the needle and joins the syringe to the needle . an adaptor 20 is mounted on hub 18 and provides the mechanism for mounting sheath 12 on a retrofit basis for the safety syringe system . the sheath 12 has a diameter slightly larger than the diameter of the syringe 14 to permit reciprocal sliding movement along the barrel of the syringe . an elongated helical spring 28 is located interiorly of the sheath . attached to the proximal end of the sheath is a tail piece 22 which is attached to the base of the sheath and similarly has a diameter to permit sliding reciprocation along the barrel of the syringe . the sheath has a hollow interior which tapers at its distal end 24 to a narrow opening 26 which permits the needle 16 to pass when the sheath is retracted . an enlarged view of helical wire spring 28 is shown in fig2 . the wire spring is preferably made of a small diameter wire having a constant spring tension . as will be more fully described , wire spring 28 is attached at the end thereof adjacent the syringe to the adaptor and at its opposite end to the distal end of the sheath . wire spring 28 provides a circumferential biasing force as well as a longitudinal biasing force , as will be more fully discussed . a enlarged view of the needle adaptor 20 is shown in fig1 . a feature of the present invention is its ability to provide a safety sheath on a retrofit basis for various hypodermic needle systems , including terumo , monoject and becton - dickenson . since each needle syringe from each manufacturer has a slightly different configuration and dimensioning , the adaptor 20 is selected to be mounted on the needle hub for a specific model of needle and to thereafter to be fitted to the safety sheath as will be more clearly delineated in conjunction with the discussion of fig8 a to 8i . the structure in fig5 shows a safety sheath 12 having a guide slot 30 and a locking slot 32 . in the preferred embodiment of the sheath , three guide slots 30 and three locking slots 32 are provided at spaced intervals around the circumference of the sheath . as is shown in fig5 a tab 34 on the hub is sized and positioned so as to engage locking slot 32 and guide slot 30 when the sheath is put into operation . under the normal circumferential biasing force of wire spring 28 , sheath 12 is held and the syringe is twisted in a clockwise direction so as to cause tab 34 to engage locking slot 32 . when the needle is to be used , the syringe is twisted in a clockwise manner so that tab 34 moves into alignment with the guide slot 30 . upon retraction against the longitudinal biasing force of the wire spring 28 by the user , the tabs 34 engage guiding slots 30 , and the sheath is pulled back and held by the user to expose a needle and place the syringe in condition for permitting the injection to be made into the patient . as the elevational views in fig5 and 7 show , a tail piece 36 is attached to the proximal end of the sheath 12 . the tail piece is provided with a molded plastic leaf spring 38 at three intervals around the circumference of the tail piece . the leaf spring 38 provides permanent locking of the sheath after use of the syringe . this permanent locking is accomplished by allowing the sheath to be extended to its normal shielding position , completely encompassing the needle . in this condition , if the user releases the sheath , tab 34 slides into and locks the sheath in locking slots 32 . to provide a permanent lock of the sheath on the needle , the syringe is twisted clockwise and pulled longitudinally away from the sheath so as to compress leaf springs 38 into recesses 40 . further twisting of the sheath urges tab 34 into detent 42 on tail piece 36 providing clearance for leaf spring 38 to snap back into its uncompressed position and to engage tab 34 , thereby permanently locking tab 34 in detent 42 . the operation of the syringe will be further understood by reference to fig3 and 6 . as shown in fig3 and 6 , sheath 12 is in the fully retracted position exposing needle 16 for use with a patient . wire spring 28 is shown in fig6 as a heavy black line extending from an interior point at the beginning taper of sheath 12 to the point of attachment on adaptor 20 . as shown in fig3 and 6 , spring 28 is fully compressed . the interior tapered portion of the sheath rests and bears against the needle hub 18 in the fully retracted position . the fully compressed condition of spring 28 is shown in the enlarged exploded view of fig6 . as seen therein , tab 34 is located in guide slot 30 , and is likewise bearing against the distal end of the guide slot when the sheath is fully retracted and wire spring 28 fully compressed . the user holds the sheath between the fingers of one hand while inserting the needle into a bottle of medication to withdraw the measured quantity into the barrel of the syringe . the user continues to hold the sheath while the needle is brought into position with respect to the patient to administer the medication . similarly the sheath is held by the user in the retracted position when blood samples taken from a patient &# 39 ; s vein . the system according to the present invention is adaptable to many syringe designs currently available . as shown in fig8 a , 8b , 8c , an adaptor 60 shown therein is suitable for retrofitting a becton - dickenson syringe . similarly the adaptor 62 shown in fig8 d , 8e , 8f is designed to retrofit the safety sheath system of the present invention to a monoject syringe . as shown in fig8 g , 8h , 8i , the adaptor 64 is designed so as the retrofit a terumo syringe with the safety sheath according to the present invention . apertures 66 , 68 , 70 shown in fig8 a , 8c , 8d , 8f , 8g and 8i are the apertures engaged by the helical spring utilized with the safety sheath . as indicated above , the adaptor and sheath can be integrated into one structure as shown in fig9 a and 9b . in the elevation view of fig9 a , the adaptor and hub are molded in one piece 80 . an aperture 82 is provided for the syringe needle . locking tabs 84 are provided around the periphery of the hub and an aperture 86 is provided for securing the proximal end of the helical spring . finally as shown in fig1 a , 10b , 10c , 10d , the safety sheath system according to the present invention is shown fully integrated into the syringe design . in this embodiment the hub , adaptor and syringe barrel are molded in one piece . locking tabs and a helical coil spring aperture are also provided . thus , the invention provides an elegant and simple design of safety sheath for a safety needle system which can either be attached to a needle hub on a retrofit basis or can integrated with the needle hub on an original equipment manufacturer basis . in either event , positive locking of the shield in the extended position , and positive guiding of the sheath as it is being retracted and extended , is provided by the design of the present invention . the design provides for automatic return of the sheath to its locked position by utilization of the wire spring which provides both longitudinal biasing and circumferential biasing . finally , the minimal number of parts and the molded nature of the elements that are used in the safety sheath provide for a safety sheath system that is low in cost to manufacture and hence does not add significantly to the cost of the hypodermic needle thereby making it even more suitable for use in this day and age of constant danger of accidental needle stick infections .

US-93017692-A

a dispenser including a base unit with an actuation mechanism for dispensing liquid and a refill unit insertible into the base unit in an inverted configuration with its outlet lowermost for the supply of liquid to the base unit . the refill unit includes an annular wall projecting into the refill unit and defining an outlet from the refill unit , the annular wall being closable at its innermost end by a valve element biased onto the annular wall . the base unit includes a hollow spigot and an annular seal surrounding and spaced from the top of the spigot whereby insertion of the refill unit into the base unit causes the spigot to enter the annular wall and to lift the valve element from the annular wall to define a flow path from the refill unit , and the annular seal to seal between the spigot and the annular wall .

to facilitate an understanding of the principles and features of the various embodiments of the invention , various illustrative embodiments are explained below . although exemplary embodiments of the invention are explained in detail , it is to be understood that other embodiments are contemplated . accordingly , it is not intended that the invention is limited in its scope to the details of construction and arrangement of components set forth in the following description or illustrated in the drawings . the invention is capable of other embodiments and of being practiced or carried out in various ways . also , in describing the exemplary embodiments , specific terminology will be resorted to for the sake of clarity . it must also be noted that , as used in the specification and the appended claims , the singular forms “ a ,” “ an ” and “ the ” include plural references unless the context clearly dictates otherwise . for example , reference to a component is intended also to include composition of a plurality of components . references to a composition containing “ a ” constituent is intended to include other constituents in addition to the one named . also , in describing the exemplary embodiments , terminology will be resorted to for the sake of clarity . it is intended that each term contemplates its broadest meaning as understood by those skilled in the art and includes all technical equivalents which operate in a similar manner to accomplish a similar purpose . ranges may be expressed herein as from “ about ” or “ approximately ” or “ substantially ” one particular value and / or to “ about ” or “ approximately ” or “ substantially ” another particular value . when such a range is expressed , other exemplary embodiments include from the one particular value and / or to the other particular value . similarly , as used herein , “ substantially free ” of something , or “ substantially pure ”, and like characterizations , can include both being “ at least substantially free ” of something , or “ at least substantially pure ”, and being “ completely free ” of something , or “ completely pure ”. by “ comprising ” or “ containing ” or “ including ” is meant that at least the named compound , element , particle , or method step is present in the composition or article or method , but does not exclude the presence of other compounds , materials , particles , method steps , even if the other such compounds , material , particles , method steps have the same function as what is named . it is also to be understood that the mention of one or more method steps does not preclude the presence of additional method steps or intervening method steps between those steps expressly identified . similarly , it is also to be understood that the mention of one or more components in a composition does not preclude the presence of additional components than those expressly identified . the materials described as making up the various elements of the invention are intended to be illustrative and not restrictive . many suitable materials that would perform the same or a similar function as the materials described herein are intended to be embraced within the scope of the invention . such other materials not described herein can include , but are not limited to , for example , materials that are developed after the time of the development of the invention . the dispenser is a hands - free dispenser which is generally suitable for domestic use . the dispenser is primarily intended to dispense liquid soap , but may also be used to dispense other liquid or semi - liquid products ( ideally with a viscosity greater than water ), such as hand cream , body lotion , moisturizer , face cream , shampoo , shower gel , foaming hand wash , shaving cream , washing up liquid , toothpaste or a sanitizing agent such as alcohol gel . the dispenser comprises two main parts , namely a refill 1 and a base unit 2 . the refill 1 provides a reservoir of liquid to be dispensed and is fitted to the base unit 2 as set out below . the base has an interface 3 into which liquid is dispensed from the refill unit . the interface 3 is in fluid communication with a dispensing tube 4 . a pump 5 is selectively operable to pump a metered dose of the liquid along dispensing tube 4 and out of dispensing head 6 . the base has an infrared transmitter 7 a which transmits an infrared beam through a window 8 to a receiver 7 b to sense the presence of a user &# 39 ; s hands in the vicinity of the dispenser . control circuitry reacts to a signal from the proximity sensor to activate the pump . the illustrated sensor is a break beam sensor , but may also be a reflective sensor . although an infrared sensor is shown and described , this is replaced by a capacitive sensor in the present invention . the device may be mains powered or battery powered . the interface between the refill 1 and base unit 2 will now be described in greater detail with reference to fig2 to 10 . the base unit 2 comprises a cowling 10 which forms a cup - shaped housing surrounding a significant portion of the refill to protect and support it . a spigot 11 projects through the base of the cowling 10 and is sealed to the cowling 10 by an o - ring seal 12 . the spigot has a plurality of castellations 13 in its top surface . a second o - ring seal 14 surrounds the spigot 11 beneath the castellations 13 . the refill 1 comprises a bottle 20 to which a cap 21 is fixed . the bottle 20 has a neck 22 which fits over and seals with an annular flange 23 within the cap 21 . the cap 21 has an upwardly depending skirt 24 ( when in the inverted orientation shown in the drawings ) which forms the outer surface of the cap . working inwardly from the skirt 24 , the next feature of the cap is an outer annular wall 25 which is generally co - axial with the skirt 24 . this is shown in detail in fig5 to 10 . the outer annular wall 25 consists of a pair of retaining members 26 and a pair of support members 27 which alternate with one another and each extend for approximately a quarter of the circle as shown in fig5 , 6 , 8 and 10 . the profile of the support members 27 is as shown in fig2 . these members extend directly up from the lower wall of the cap , are parallel sided and have an inclined upper surface 28 . the profile of the retaining members 26 is shown in fig7 and 9 . unlike the support members 27 , these are not fixed to the wall of the cap . instead , they are fixed at either end to the support members 27 by frangible members 29 as best shown in fig6 and 8 . the retaining members 26 are parallel sided and have an inclined upper surface 35 as shown in fig7 and 9 . as shown in fig7 and 9 , the neck 22 of the bottle has an inclined outer surface 36 which is complimentary to the inclined surfaces 28 and 35 of the annular wall 25 . behind the inclined outer surface 36 is a shoulder 37 which faces the main body of the bottle 20 . this inclined outer surface 36 and shoulder 37 is only present in the vicinity of the retaining members 26 and not in the vicinity of the support members 27 . adjacent to the support members 27 , the neck 22 has a parallel sided configuration as shown in fig2 . in order to insert the bottle 20 into the cap 21 , the bottle 20 is pushed down with its neck fitting over the annular flange 23 . the inclined outer surface 36 of the bottle co - operates with the inclined surfaces 28 , 35 to displace the retaining members 26 radially outwardly until the shoulder 37 snaps into place behind the retaining members 26 as shown in fig7 . when the bottle 20 is pulled off of the cap 21 , the shoulders 37 bear against the retaining members 26 , thereby breaking frangible members 29 so that the retaining members 26 become detached from the cap 21 as shown in fig9 and 10 . once this has happened , it is no longer possible to retain the cap on a bottle , thereby preventing subsequent use of the refill 1 . it should be noted that it is not necessary for both of the retaining members 26 to become fully detached from the lid . it is possible that only one of these becomes detached , or that one or both are simply displaced to a location at which they can no longer engage with the neck of the bottle . returning now to fig2 to 4 , the liquid outlet and associated valve will now be described . the liquid outlet from the reservoir is provided by an annular wall 30 surrounding a central opening 31 . at the top of the annular wall 30 is an inclined surface 32 ( see fig4 ) which provides a valve seat for outlet valve element 33 . this is shown in the form of a u - shape cup - like member , but may equally be a solid member or a hollow ball - like member . the outlet valve element 33 is biased into its closed position by a plurality of biasing elements 34 . these are attached at their upper end towards the top of the valve element 33 and are attached at their lower ends at a location radially outward of the annular wall 30 and below the top of the annular wall 30 . they are preferably formed integrally with the valve element 33 . as shown in fig2 to 4 , when the refill 1 is lowered into the base unit 2 , the spigot 11 engages with the lower surface of the valve element 33 as shown in fig3 . further downward movement of the refill causes the valve element 33 to be lifted from its seat , and also brings the o - ring 14 into sealing engagement with the annular wall 30 . the valve element 33 is lifted to the position shown in fig4 . in this position , liquid in the bottle 20 can flow around the biasing elements 34 , and enter the spigot via the castellations 13 and hence flow into the base unit 2 . liquid is prevented from escaping between the spigot 11 and annular wall 30 by the o - ring seal 14 . this arrangement offers a simple and mess - free way for a consumer to insert a refill regardless of the fill level of the refill . in order to remove a refill , the consumer lifts it out of the base whereupon the biasing elements 34 cause the valve element 33 to return to the seat 32 . during this movement , the seal between the spigot 11 and annular wall 30 is maintained by the o - ring seal 14 . a spent refill is then replaced by a new one following the above procedure . the cap is provided with a pair of pressure relief valves 40 . each is formed by an annular boss 41 integral with the cap 21 . a pressure relief valve element 42 is seated on the top of the annular boss 41 and is biased in place by a pair of biasing elements 43 ( as shown , for example , in fig5 ). the biasing force is such that , under normal conditions , the pressure relief valve element 42 forms an air tight seal on the boss 41 . however , when the pressure within the bottle 20 drops below a certain level , the pressure differential across the relief valve element 42 is sufficient to overcome the force exerted by biasing elements 43 and to allow air into the bottle 20 . this reduces the pressure differential thereby restoring the air tight seal without leakage of fluid . each pressure relief valve 40 is surrounded by an annular barrier 44 which extends axially to a level axially above the level of the top of the annular wall 30 . thus , when the valve element 33 is open , any air entering the relief valve 40 will not become entrained in the outgoing liquid stream . in practice , this means that the relief valve can be placed closer to the outlet , thereby resulting in a more compact cap . although two relief valves are shown , a single valve , or more than two valves could be provided if necessary . the manner in which the cap is assembled is illustrated in fig5 and 6 . the assembly is a three - part structure consisting of the cap 21 , a valve plate 45 and a fixing plate 46 . the cap has a number of molded features including the annular flange 23 , annular wall 25 and annular bosses 41 . in addition , the cap 21 has a plurality of fixing posts 47 . the valve plate 45 is an elastomeric material and is integrally formed with the valve element 33 , biasing elements 34 , relief valve element 42 and biasing elements 43 . the valve plate has a plurality of locating holes 48 which correspond to the fixing posts 47 . the fixing plate 46 is made of a rigid plastics material and is integrally formed with the annular barrier 44 . as with the valve plate 45 , the fixing plate 46 is also provided with a plurality of locating holes 49 which correspond to the fixing posts 47 . to assemble the cap , the three components are placed on top of one another as shown in fig6 with the fixing posts entering the locating holes to ensure that the components are correctly aligned . heat or adhesive is then applied to the top of the fixing posts 47 to secure the fixing posts to the fixing plate 46 . the elastomeric valve plate 45 is thereby sandwiched between the cap 21 and fixing plate 46 which holds the valve elements 33 and 42 in position . a second example of a cap for a refill unit will now be described with reference to fig1 to 14 . the structure of the outlet valve element 33 in the second example is essentially the same as the first example , and will not be described again in relation to the second example . as can be seen from fig1 , the cap 21 is integrally molded with a number of features , such as the annular walls 25 and 30 and a conical part 50 of the pressure relief valve which will be described below . a resilient lip 53 ( described in more detail below ) for the pressure relief valve is provided integrally molded with the valve plate 45 . the fixing plate 46 is also provided with a shield 57 for the relief valve . this is equivalent to the barrier 44 in fig2 , but only extends around the side of the relief valve facing the outlet valve element 33 . the barrier 44 and shield 57 could be used interchangeably in the two examples . the cap assembly is assembled in the same manner as in the first example . the pressure relief valve 60 is illustrated in fig1 and 14 . the valve has the conical part 50 which is an integral part of the cap 21 as mentioned above . at the top of the conical part 50 is a cylindrical post 61 . the resilient lip 53 is effectively a hollow frustoconical extension of the valve plate 52 of resilient material which extends along the conical part 50 from which it diverges slightly and is a tight fit against the post 61 . at least one air inlet 62 ( also shown in fig1 ) passes through the wall of the conical part 50 and is normally covered by the resilient lip 53 as shown in fig1 . when the pressure in the bottle 20 falls as liquid is emptied the pressure differential across the resilient lip 53 will eventually become sufficient to displace the lip 53 to a sufficient degree to allow air a into the bottle 20 as shown by the arrows in fig8 . it should be noted that the degree to which the resilient lip 53 lifts from the conical element 50 has been exaggerated in fig8 and that , in practice , this will be almost imperceptible . instead of sealing against the post , the resilient lip 53 may seal against the conical part 50 . in this case , the lip will not diverge from the conical part as shown . instead , it would actually have an angle of incline less than the angle of the conical part 50 so as to be naturally biased onto the conical part . numerous characteristics and advantages have been set forth in the foregoing description , together with details of structure and function . while the invention has been disclosed in several forms , it will be apparent to those skilled in the art that many modifications , additions , and deletions , especially in matters of shape , size , and arrangement of parts , can be made therein without departing from the spirit and scope of the invention and its equivalents as set forth in the following claims . therefore , other modifications or embodiments as may be suggested by the teachings herein are particularly reserved as they fall within the breadth and scope of the claims here appended .

US-201314087433-A