Datasets:

skymizer

/

fineweb-edu-dedup-test-4K-rows

like 0

Follow

skymizer 12

The number of ships using the Port of London had risen steadily throughout the 18th century. Yet the riverside quays were still those first licensed in 1558. In 1793, the decision was taken to ease the congestion by digging deep-water basins where ships could be moored in more secure and controlled circumstances. Plans were ordered for wet docks in Wapping, the Isle of Dogs and Rotherhithe. Daniel Alexander was charged with devising the scheme for the proposed London Docks at Wapping, a 35 acres site that would hold 500 ships. This plan, published in 1799, shows the many streets and squares that would be lost to the new docks - more than half of Wapping south of Pennington Street. The following year, Parliament passed the London Dock Act and details were published of the land and properties destined for compulsory purchase. Names of the owners and tenants are listed, together with the length of their notice to quit.

<urn:uuid:8f92e48f-c00c-4603-9fb2-cffd4aea0134>

Put the numbers 1 to 5 in the bottom row of this pyramid. They can be arranged in any order. The numbers in the other bricks are found by adding the two bricks immediately below together. What arrangement of the numbers in the bottom row gives the largest total in the top brick of the pyramid? What arrangement gives the smallest total in the top brick of the pyramid? A pyramid puzzle worksheet is available here |Tweet about this starter||Share| How did you use this starter? Can you suggest how teachers could present or develop this resource? Do you have any comments? It is always useful to receive feedback and helps make this free resource even more useful for Maths teachers anywhere in the world. Click here to enter your comments. If you don't have the time to provide feedback we'd really appreciate it if you could give this page a score! We are constantly improving and adding to these starters so it would be really helpful to know which ones are most useful. Simply click on a button below: This starter has scored a mean of 3.6 out of 5 based on 538 votes. There is a printable worksheet to go with this activity. Teacher, do your students have access to computers? Here a concise URL for a version of this page without the comments. Here is the URL which will take them to a related student activity.

<urn:uuid:8764278d-6da5-426b-a5c9-e0141625c71e>

Children learn through play! TGPS's educational approach is grounded in the beliefs and research of the “Constructivist Theories” (Dewey, Piaget, and Vygotsky) where learning is viewed as a complex process of individual and social experiences, and where children construct their own understanding and knowledge of the world through a multitude of experiences and reflection on those experiences. Classroom practice is child-centered and developmentally appropriate. Children are viewed as competent individuals and active learners. Teachers are facilitators and co-learners, who present children with meaningful learning experiences based on children’s interests, gearing them towards creativity, self-expression, exploration, discovery, and investigation. The classroom environment is designed with furniture, materials, and resources to facilitate and support this process of child-centered, active and engaged learning. Early Childhood Curriculum Building on our educational philosophy, The Growing Place uses the HighScope curriculum, a research-based and innovative approach to learning and development young children. HighScope's educational approach emphasizes “active participatory learning.” Active learning means students have direct, hands-on experiences with people, objects, events, and ideas. Children’s interests and choices are at the heart of HighScope programs. They construct their own knowledge through interactions with the world and the people around them. Children take the first step in the learning process by making choices and following through on their plans and decisions. Teachers, caregivers, and parents offer physical, emotional, and intellectual support. In active learning settings, adults expand children’s thinking with diverse materials and nurturing interactions. To learn more about the HighScope curriculum, visit their website at www.highscope.org. Social + Emotional Learning A happy child learns best! Before children can engage in academic or cognitive development, they must learn to manage their feelings. Conscious Discipline guides children to recognize their emotions and develop strategies to work through them. Our team is highly trained in Conscious Discipline. It is the foundation of classroom safety, connection and problem-solving. This approach to SEL empowers adults and children to be the change they want to see in the world. The Toddler Program, for one- and two-year-olds, is rooted in the belief that young children learn and grow in their development through purposeful play and meaningful classroom experiences, rich in creative expression and exploration. With a strong focus on predictable and consistent classroom routines, warm, loving and nurturing relationships with trusted caregivers, self-help skills, and supporting development in language, physical, cognitive and social/emotional domains, your toddler will acquire the skills to become a confident and inquisitive learner. The Preschool Program, for three- and four-year-olds, is geared towards active classroom participation, hands-on learning, and the belief that preschoolers are driven by a need to discover and investigate as they learn about the world around them. The curriculum supports the development of the whole child—with a strong focus on developing readiness skills in early writing, reading, math, social studies, science, and the arts—learning becomes meaningful and fun, and motivates and supports interdependence and self-reliance in your preschool child. 14 preschool classrooms Teacher to student ratios 1:4 (1 year olds) 1:6 (2 year olds) 1:8 (3 year olds) 1:9 (4 -5 year olds) 5 days/week school program Toddler Program: 9:00am-12:00pm* Preschool Program: 9:00am-1:30pm* *Early Morning Care and Extended Day available 7:30am-5:30pm

<urn:uuid:e15aaa9f-205d-4273-a00f-54946f3d7aa3>

Embedded Networking and Communications Design and build a wired &/or wireless network connecting at least two processors Networking needs to be more clearly defined here. Like expressing the need to have multiple controllers communicating using addressing. Demonstrate workflows used in network design and construction Implement and interpret networking protocols Described your design and fabrication process using words/images/screenshots. Explained the programming process/es you used. Outlined problems and how you fixed them Included original design files and code Can we use arduino/commercial boards for networking? - It depends on the case: you can use commercial boards for wireless devices. But you can’t use Arduino or similar commercial microcontroller boards because they can be made in the fab lab. For this week, you can use the original satcha-kit/fab-kit/fabduino. Must each board have a unique identity? - It does not have to be hard-coded but you must use some form of addressing.

<urn:uuid:4f6f88e6-0426-4184-b4b7-d790991dddd4>

Our beautiful planet is bestowed with the most amazing biodiversity. The presence of all the living beings on the earth is essential to have an excellent balance in nature. But of late some of the animal species are on the verge of extinction while others are termed as endangered species or nearly threatened species. It’s time to conserve these animals to allow our future generations to witness these amazing living creatures in nature. Let’s have a quick run through the list of endangered species in India.1. **The Royal Bengal Tiger**: As of 2014, the estimated number of tigers in India were reported to be 2226. It’s quite saddening to know that the National Animal of both India and Bangladesh has been threatened to such an extent. With a royal yellow to orange coat embellished with black to brown stripes, this animal never fails to fascinate us with its elegant attitude. Poaching and animal trade has resulted in the extreme dip in the numbers. - The Ganges Dolphins: The inhabitants of Ganga, Brahmaputra and its tributaries, these Gangetic dolphins are also referred to as ‘Fresh Water Tigers’. But the saddest part is that these cute little creatures have been considered as critically endangered species due to extensive fishing, pollution and construction of dams. As per WWF India only 2000 dolphins are estimated to exist in the Gangetic basin. Owing to the dangers hovering over dolphins, it is also declared as the National Aquatic Animal by the Indian Government in the year 2009. - Snow Leopards: Covered with smoky greyish –yellow fur beautiful dotted tans, these animals are found in the mountain regions of Ladakh, Himachal Pradesh, Arunachal Pradesh and Uttarakhand, Sikkim and Jammu and Kashmir. Only 500 of them are estimated to be left in India as per WWF India. - One horned Rhinoceros: A large mammal*mammal* ➤ (n) any warm-blooded vertebrate having the skin more or less covered with hair; young are born alive except for the small subclass of monotremes and nourished with milk …by BeeDictionary.com from the beautiful region of Assam, One Horned Rhinoceros is also on the verge of extinction. Approximately 3500 of them are left in India and Nepal combined together as per WWF India. - Asian Elephant: Widely distributed in India, the overall population of Asian elephant is around 26000 only. Most of them are poached for Ivory in the Asian continents. Black buck, Red Panda, Asiatic lion, Kashmiri Red Stag, Nilgiri Tahr, Lion Tailed Macaque, Indian Bison are a few more threatened species as per the WWF India

<urn:uuid:2a5602e9-3767-4b06-9e75-b8da30ed4d12>

Cities that are serious about reducing carbon pollution from transportation need to promote walking and biking, expand transit and micro-mobility services, manage development, and use pricing to reduce traffic and parking congestion. Many of these steps are designed to reduce the use of single occupancy cars. At the same time, though, cities will also need to electrify everything that moves, including those passenger cars. Just as our approach to solid waste requires a “reduce, reuse, recycle” approach, city transportation policy needs to pursue a “both-and” strategy. Making it easier to use an electric car does not conflict with encouraging alternative transportation options, any more than making it easier to recycle conflicts with discouraging single-use packaging.

<urn:uuid:9cf6b87b-a94b-4c78-bedc-77c802d1c2a8>

3.3 Physical characteristics of natural waters A river's physical characteristics include: speed of flow/turbulence the presence of plants and macroscopic animal life. The physical characteristics are determined by location, geology and climate of the catchment area. In turn they influence the chemical and biological characteristics of the watercourse. The physical appearance may give you initial clues to the condition of the river. Figure 12 shows how the aquatic ecosystem is a complex set of physical, chemical and biological interrelationships. Nutrients and dissolved oxygen may be essential to aquatic life but other conditions must also be satisfactory.

<urn:uuid:a339f9d5-0fce-4efc-b1e9-7df9ba0824c0>

Friday, June 27 SACRAMENTO, Calif. (AP) — Scientists are worried endangered native snakes could be displaced by two types of non-native species that have become prevalent in the Sacramento area. The Sacramento Bee reported Thursday (http://bit.ly/1jrpaPF ) that the common water snake is thriving in Roseville and the southern water snake has colonies in Folsom. Jonathan Rose, a doctoral candidate in ecology at UC Davis, says common water snakes have spread across the Eastern U.S., but are rarely found west of the Rocky Mountains. Rose is author of a new study on the pervasiveness of the invasive species. Research shows water snakes are well suited to the habitat traditionally occupied by the giant garter snake — a species once plentiful in California but now on the state's threatened species list. The giant garters are in direct competition with the invasive snakes for food. Information from: The Sacramento Bee, http://www.sacbee.com

<urn:uuid:27e8141c-fd2e-4528-8712-9f7cf296268c>

They are the ever present caretakers of the ill and vulnerable and have brought the sick and weary back to health for generations. Braving disease, poverty, war and adversity, nurses have always been on the frontline of medical care in the north-east. And today, on the birthday of the profession’s most famous practitioner, the contribution they make to society is being celebrated around the world on International Nurses Day. Florence Nightingale, who died in 1910 at the age of 90, is universally recognised as the founder of modern nursing. Before the profession as we know it came into being in the 19th century, nuns and the military provided a similar kind of care. The Crimean War, which was fought from October 1853 to February 1856, was a catalyst for modern nursing when Florence laid down the foundations of modern nursing in the book Notes on Nursing. Fast forward to today and one of the areas of healthcare that has undergone some of the biggest change is mental health. When Aberdeen’s infirmary opened in 1739 it was to provide treatment for people “deprived of the use of their reason”, in the hope that they could then lead normal lives. A Bedlam Fund had been established in 1718 and the money from it was given to the infirmary managers to help fulfil this wish. Six bedlam cells were built and for more than 50 years psychiatric patients were accommodated in part of the infirmary building. By the end of the 18th century the infirmary managers felt it was “attended with very great inconvenience and prejudices to sick patients to have those who are under mental derangement lodged within the same house”. A small asylum was built at Barkmill, part of the lands of Clerkseat. This hospital, which was to grow into the present-day Royal Cornhill Hospital, opened on November 8, 1800 and was called the Royal Lunatic Asylum. The facility is now the main training centre for medical and nursing staff who work in mental health. Heather Harvey, team leader and psychiatric nurse, has spent four decades nursing at Royal Cornhill. The 56-year-old, who is retiring later this year, started working as an auxiliary nurse in January 1974 aged just 16, and underwent the majority of her training at Woodend Hospital. She transferred to the Cornhill facility in 1976, when she was halfway through her training. She said: “I had worked with the disabled a lot at Woodend which led me to working at Cornhill. I did a placement and I liked working with mental health patients. I wanted to be a nurse from a very young age, it is just something I always knew I wanted to do.” One of the biggest differences she recalls about the treatment of patients was that there was less individual care. She said: “All the patients were very well cared for, but it was like one size fits all. Even when the tea was made it was all in one big pot. But there was a lot of fun in the wards and a lot of good companionship. “Long ago we did more in different ways with the patient, and there were things like sports day and lots of activities where the patients could work.”

<urn:uuid:91b19ff5-026a-400c-969f-3e170cab5427>

If there has been any single naturally occurring event that has been overlooked, it was the eruption of Mt. Tambora in 1815. As Prof. Wood claims, the eruption had countless ecological, social, and economic impacts; however, the famous eruption seemed to be outcompeted by “more alluring” events, including Napoleon’s defeat, as well as the publication of Mary Shelley’s Frankenstein. The mixture of the enormous Tambora eruption and little global attention resulted in a catalyst for change. While the eruption of Mt. Tambora itself was not necessarily revolutionary, the series of events following the explosion altered the stability and function of many societies. Although the inhabitant of Mt. Sumbawa felt the wrath of the volcano first hand, those living on the island were only a mere fraction of those effected by this eruption. Prof. Wood repeated time after time that “teleconnection”, how one event impacts other events around the globe, was the major theme surrounding the eruption of Tambora. A classic example Wood gave was the increased human vulnerability to disease, specifically cholera. Because of the change in global atmospheric behavior caused by the eruption, deadly cholera was spread to regions of the globe that had not yet been exposed to the disease, resulting in a large death toll accompanied with global-wide grief. Despite the horrors caused by the outbreak of cholera, this pandemic had a silver lining that is tele connected back to the eruption of Tambora. As a result of the eruption which caused cholera, the modern sewage systems were developed to combat the unsanitary environment many people were living in, a huge step forward in terms of scientific innovation. Another, but less obvious example pertaining to the teleconnection evident in the eruption of Mt. Tambora includes the invention of the bicycle. While it seems that the invention of a two-wheeled vehicle and the eruption of a volcano on a remote island could not be alike in the slightest, Prof. Wood noted that these two events were in fact tele connected: Following the explosion, the growing seasons worldwide were shortened drastically, leading to a global famine. As result of this famine, people became desperate for food, killing and eating anything in order to survive, including horses. Lacking the ability to travel by means of now non-existent horses, the invention of the bicycle rose from the ashes: an efficient means of transportation capable of replacing the horse. Although puzzling at first, the rise of the two wheeled vehicle emerged because of the eruption. And of course, the development of the modern weather map came to be because of the unorthodox weather patterns caused by the eruption. While the weather map itself was not necessarily a ground breaking invention, it led to the development of climate science, drawing attention to a rapidly growing field of study. The eruption of Tambora itself was not a revolution by any means, however, the mountain’s explosion acted as the catalyst for many other events which would occur around the globe. The seemingly unknown eruption of 1815 led to a drastic change in the scientific, social, and ecological makeup of the world. Prof. Wood emphasized the idea of teleconnection, a theme that embodied Tambora. Tambora was not revolutionary; The reaction Tambora catalyzed was revolutionary.

<urn:uuid:49dd6755-d49c-4505-bf43-733c47390553>

The following are the most commonly used terms in orthodontics. Anterior Teeth: The upper and lower six front teeth on each arch. Appliance: Any orthodontic device which moves or retains teeth. Appliances may also alter the positioning of the jaw. Arch: The entire upper or lower jaw. Archwire: The metal wire that connects orthodontic brackets. This wire guides the teeth into their new alignment. Bands: Metal bands (rings) that are generally cemented around the back teeth. Brackets: The tiny metal, ceramic or clear brackets that are affixed to each individual tooth on the arch. Brushing: This is a crucial part of home dental care. Orthodontists recommend those wearing braces to brush after every meal and snack to eliminate bacteria and plaque. Chain: Elastics connected together and placed around the brackets to stabilize the archwire and gently close spaces. Closed Bite: The upper front teeth completely overlap the bottom teeth causing a deep overbite. Congenitally Missing Teeth: Some permanent teeth fail to develop and erupt due to genetic factors. Crossbite: A malocclusion in which the upper back teeth bite inside or outside the lower back teeth, or the lower front teeth bite in front of the upper front teeth. Diagnostic Records: Records used to assess, plan and implement treatments. These records usually include medical and dental history, panoramic radiographs, bite molds and intraoral/extraoral photographs. Elastics: Some braces may require that elastic rubber bands be attached to exert additional pressure to an individual tooth or a group of teeth. Eruption: The way in which teeth surface through the gums inside the mouth. Fixed Orthodontic Appliances: Orthodontic appliances which are affixed to the teeth by the orthodontist and cannot be removed by the patient. Flossing: An essential part of home care that removes debris and plaque from above and below the gumline. Functional Appliances: Orthodontic appliances that use the muscle movement created by swallowing, eating and speaking to gently move and align the teeth and jaws. Headgear: A removable appliance comprised of a brace and external archwire. This device modifies growth and promotes tooth movement. Impressions: Teeth impressions are taken to allow the orthodontist to see exactly how a patient’s teeth fit together. Malocclusion: Literally means “bad bite” in Latin, and refers to teeth that do not fit together correctly. Mouthguard: A removable plastic or rubber device that protects teeth and braces from sporting injuries. Open Bite: Upper and lower teeth fail to make contact with each other. This malocclusion is generally classified as anterior or posterior. Palatal Expander: A removable or fixed device designed to expand the palate in order create room on either the upper or lower arch. Posterior Teeth: Back teeth. Removable Appliance: An orthodontic brace or device that can be removed at will by the patient. It must be worn for the designated amount of time each day to be effective. Separators: A wire loop or elastic ring placed between the teeth to create room for the subsequent placement of bands or orthodontic appliance. Space Maintainer: A fixed appliance used to hold space for permanent (adult) tooth. This is usually used when a baby tooth has been lost earlier than anticipated. Wax: Orthodontic relief wax is a home care remedy used to alleviate irritations caused by braces.

<urn:uuid:347764ef-c43d-4dd1-b637-3b3f45b27409>

Skywatchers may be in for a rare treat in 2013 — a newly discovered comet is expected to pass very close to the sun, putting on what could be the celestial show of a century. Two amateur astronomers in Russia are credited with finding the object, known as Comet ISON and so named for the International Scientific Optical Network that made the discovery. "The object was slow and had a unique movement. But we could not be certain that it was a comet, because the scale of our images are quite small and the object was very compact," Artyom Novichonok, wrote on a comets mailing list hosted on Yahoo. Follow-up observations as well as a search of archived images of the area confirmed the discovery, which was officially reported on Sept. 24, three days after Novichonok and Vitali Nevski found the object far beyond Jupiter’s orbit. Color-enhanced view of Comet ISON photographed at the RAS Observatory on Sept. 22, 2012, by amateur astronomers Ernesto Guido The International Astronomical Union's Minor Planet Center predicts Comet ISON could be visible without binoculars or telescopes to skywatchers on Earth from early November through the first few weeks of January 2014. NASA's Mars Curiosity rover also may get a look when the comet sails past the red planet in early October. The comet's journey likely started in the Oort Cloud, a cluster of icy rocks that circle the sun about 50,000 times farther away than Earth's orbit. Comet ISON is expected to pass as close as 700,000 miles, or 1.1 million kilometers, from the sun on Nov. 28. If it survives, the comet could be the brightest to appear in Earth's skies since 1965 and could even be visible in daylight. Top image courtesy of NASA, Ligustri Rolando; second image courtesy of Remanzacco Observatory/Ernesto Guido, Giovanni Sostero and Nick Howes - The 'What Color Is This Dress?' Debate Explained - DNews: A New Reason Why Soda Could Mess with Your Health - Rare Intact Roman Tombstone Found in England - Rare 'Medium-Sized' Black Hole Creates Galactic Dead Zone This article originally published at Discovery News here

<urn:uuid:427a05c5-f6f4-435a-bbec-dbc70dae333a>

Introducing block and screen-printing and machine embroidery, this course offers a practical exploration into surface design. What will you learn on this course? This course offers a practical exploration into surface print design through the techniques of block printing, screen printing, hand and machine embroidery. You will explore the process of creating your own unique designs from primary sources to create printed paper and fabric which you can embellish with stitch. Each term gives a focus to a different theme. This term we will consider the diverse works of the graphic designer, architect and artist, Charles Rennie Mackintosh as our primary source of design. You will have an opportunity to explore the strong clean lines with dramatic colour schemes to his florals in delicate watercolours to create your own designs and artwork to take into fabric. On this course you will learn how to: • Undertake primary and secondary research • Use a sketchbook to record research and generate original design ideas • Create Block prints using either Lino cuts, Neoprene blocks or Collographs • Understand colour theory and its application in your work • Explore the Formal Element as applied to textiles • Create a variety of repeat print designs • Use a variety of hand stitches to embellish your print work • Use free motion machine embroidery to embellish your prints • Screenprint using stencils, polyprint and binder AQ or dyes and Manutex print paste • Apply colour separation to create screenprints As you progress on this course you will bring your research, designs and the techniques learnt together to make original artwork. The course is delivered through a mix of demonstrations and practical exercises. Students will be provided with handouts for each technique and will build a personal portfolio of samples to refer to for future projects. The course content is guided by the ability and prior experience of the students attending. Students wishing to re-enroll are welcomed and assisted to develop their skills further and work on individual projects with guided support from the tutor. Previously students have made wall hangings, framed artwork, artist books, cushions, boxes, friezes, fabric for clothing and much more. Who is this course for? This course is for adults aged 18+ years. It is open to beginners and improvers. It is suitable for people who are both completely new to textiles, those who wish to learn new approaches to design, those wanting to learn print processes, combine stitch with print, revisit their love of textiles and those who want to extend and improve their techniques. The course may be accessible for people with disabilities who can participate in practical art and craft activities and operate a sewing machine. Students can be accompanied by a carer or support worker. Carers must book a complimentary ticket if attending a course to provide support. The room is wheelchair accessible. Please contact us to discuss your specific situation and needs. This course involves working at low tables and good dexterity is needed in your hands. Do you need to bring anything? Please wear old clothes and bring a waterproof apron, an A4 or larger ring bound sketchbook and/or plastic wallet and a pair of sharp scissors. MAC can provide basic equipment to participants attending this course if needed, although attendees are encouraged to bring their own where possible to minimise the risk of COVID-19 transmission. If you own a sewing machine you can have it PAT tested for a small fee and bring it in to use during class. Are there any additional costs? You will need to provide the items listed above at your own expense. Ring bound scrapbook approx. £8.50. Apron approx. £5.00 Scissors approx. £8.00 Who teaches this course? Fancy a meal or drinks when visiting us for an event or a trip to the park? Our KILN Cafe serves breakfast, lunch, light bites and a light evening menu, see information here /// Please read our current Courses - Health and Safety Information and our current Visitor Guidelines before booking your course.

<urn:uuid:86951c29-ed60-4c7d-b57e-c0736df8b4f3>

ERIC Number: ED196934 Record Type: RIE Publication Date: 1980-Sep A Parent's Guide to Testing in the Schools. Stiggins, Richard J. This booklet is written in non-technical language and focuses on educational testing issues currently of interest to parents. Some of the questions parents commonly ask about tests are identified and answered. Questions include: (1) What are tests and why are they used?; (2) How are they used?; (3) How many different kinds of tests are there?; (4) What do different test scores mean?; (5) Are tests really sensitive to differences in students' cultural backgrounds?; (6) How can you tell if a test is a good test?; (7) Can parents help their children prepare for tests?; (8) What can parents do to help the child who is extremely nervous about tests?; (9) Can parents help their children deal with test scores?; and (10) What questions and issues should I raise with my child's teacher and principal regarding tests? A short bibliography of suggested readings for parents is included. (Author/RL) Publication Type: Guides - Non-Classroom Education Level: N/A Sponsor: National Inst. of Education (ED), Washington, DC. Authoring Institution: Nero and Associates, Inc., Portland, OR.; Northwest Regional Educational Lab., Portland, OR. Note: For related documents, see TM 810 047-048 and TM 810 050.

<urn:uuid:2f11056a-0b53-4235-8c1b-836d1d092aaa>

The purpose of the muscular system 7 muscular system: works with the skeletal system to make body movement possible your body moves when what is the purpose of the muscular system. A skeletal system is necessary to support the body, protect internal organs, and movement in a hydrostatic skeleton is provided by muscles that surround the. Three layers of connective tissues surround these fibers to form a muscle a flat broad extension of the three muscle linings and serves the same function as a. Muscles play a part in every function of the body the muscular system is made up of over 600 muscles these include three muscle types:. Their main function is toshow more content the muscular system is a very important part of the human body it has many components and functions, and is . Most of the skeletal muscular system is arranged into groups of agonists and antagonist muscles that work in concert to provide efficient and. Explain the purpose of the musculoskeletal system the musculoskeletal system is made up of the body's bones (the skeleton), muscles, cartilage, tendons ,. The human muscular system is complex and has many functions in the body the muscular system's main function is to allow movement. The purpose of the digestive system is to turn the food you eat into something this system is made up of muscle tissue that helps move the body and move. The student will describe the interactions between the skeletal and muscular systems to maintain what is the general function of the muscular system. The musculoskeletal system incorporates bones, cartilage, skeletal muscles, and connective tissues the aim of this chapter is to describe the postnatal. Muscles of the human body - actions, attachments, and locations, and nerve supply learn all of them now at getbodysmart. Transcript of the muscular system ½ our body weight comes from muscles consists of over 600 individual muscles 3 purposes. The purpose of the muscular system The muscular system can be broken down into three types of muscles: skeletal, smooth and muscles also can be identified by their function. Purpose of this article is to provide a review of research investigating the effects of resistance training on muscle fibers and on nervous system input muscle fiber. Through biomechanics, engineers assess the physical capabilities and limitations of the muscular system, with the overall goal of improvement of health and. The human muscular system and the top 10 facts to know about how it functions. The main function of muscles is for motion, for example in conjunction with bones for walking many muscles work in groups but some may work alone eg the. The following links will allow you to access real photographs of the cat muscular system the purpose of these pages is to quiz your knowledge on the structures. X-muscle system is designed for rapid muscular system, tissue and other organic object creation and their physical simulations its main purpose is to help. You have more than 600 muscles in your body in your stomach and digestive system, they contract (tighten up) and relax to allow food to make its journey the ones that show how strong you are and let you boot a soccer ball into the goal. Muscular system definition at dictionarycom, a free online dictionary with pronunciation, synonyms and translation look it up now. Structure and function of the musculoskeletal system professor alan hedge dea 3250/6510 functions of the musculoskeletal system → support and protect.

<urn:uuid:df494e1b-7bf7-460c-a6fb-9d0a33641b37>

What Is a Fuel Vapor Canister? The fuel vapor canister, also known as a charcoal canister because it is filled with charcoal, is part of a vehicle's pollution control system and is used to capture fuel vapors emanating from both the fuel tank and the carburetor. The vapors are pulled into the canister by a vacuum as the engine is started, and then fed back into the fuel system to be burned when the engine is running. It is a component of a vehicle's evaporative emission control (EVAP) system and prevents the evaporating fumes from reaching the atmosphere while also maintaining proper fuel tank pressures. In the mid 1970s, automobile manufacturers began installing pollution control systems on engines to help reduce emissions put into the atmosphere from automobiles. Studies found that a great deal of the hydrocarbons (HCs) that were emitted from automobiles were due to evaporative gasses. By placing the fuel vapor canister in the fuel system, the gasses are drawn in and then burned instead of being expelled. This makes for a cleaner burning engine and a better environment for everyone. The system is also used on fuel-injected vehicles with the only difference being the gasses are sent into the intake rather than the carburetor. There is no required service for the device beyond keeping the hoses and canister clean and free of debris. A cracked hose will cause the "check engine" light to come on in a vehicle's dashboard display area, alerting the driver to a potential problem with the vehicle. Other areas that may cause the warning light to be seen are a faulty fuel tank cap or a loose or incorrectly-tightened cap. There is also a valve on the canister and the intake that are both vacuum-activated and could cause the warning light to come on should a malfunction occur. The most common reason for a failure in the fuel vapor canister is a crack in the canister or a hose. In order to test it, nitrogen is applied to create pressure, and then it is tested periodically for a drop in pressure, which will indicate a fault in either the canister or a hose. Once the problem component is identified, the car owner should repair or remove the affected piece. Nitrogen is always used to test for leaks because introducing air into the canister could lead to a dangerous fire, explosion, or other incident caused by adding oxygen to the fuel vapors. Any idea about how much it would cost to have the evap canister or hose replaced? This is the issue with my car at present. Charcoal is incredible when it comes to absorption of bad substances. It is routinely used in hospitals after someone has been poisoned to absorb the pollutants in the body. Charcoal is very fine and has a lot of surface area that reacts with pollutants, successfully eliminating them from the air in this case. I'm glad that this substance is used in such a variety of ways. The article mentions briefly that the engine light may come on if the cap isn't tightened correctly. This has happened to me - I had no idea what was wrong with my car as the "check engine" light was on but the mechanic said the engine was fine. Later I realized that I just didn't screw the cap on tightly enough after getting gas. Merely screwing the cap on tightly doesn't fix it though - a mechanic has to clear the light by connecting the car to an electronic device. Post your comments

<urn:uuid:a98191cf-c2c0-4330-b574-2402b5570032>

Drinking alcohol can be part of an enjoyable night out, but drinking safely will ensure you have good memories. Safe drinking guidelines have been developed to help you protect your health - both physically and socially. Everyone is faced with some risk when consuming alcohol but thinking before you drink can lead to an enjoyable and safe experience. Alcohol comes in all different types, colours and containers. Regardless of this, a standard drink is about 10 grams or 12.5mL of pure alcohol. Alcohol labels are displayed on the bottle to tell you how many standard drinks it contains. Remember one bottle/can/glass doesn't always equal one standard drink. - Men and women shouldn't drink more than 2 standard drinks on any day to avoid long-term harm from alcohol related injury or disease. Remembering to have regular alcohol-free days. - Men and women should drink no more than 4 standard drinks on any single drinking occasion to reduce alcohol related injury. Alcohol and your body People come in all different shapes and sizes, so depending on your gender, age, weight and other factors; you may be affected by alcohol more than others. Get to know your body in relation to the standard drink guidelines. How does alcohol affect your body? Skin: Alcohol can dehydrate your skin. Drinking alcohol can deprive you skin of vital vitamins and nutrients and excessive alcohol can make your face look bloated and puffy. Heart: Long term and heavy alcohol consumption can increase your risk of high blood pressure, weakening of the heart muscle heart failure and heart disease. Pancreas: Continuous and excessive drinking can cause pancreatitis which is when the pancreas blood vessels, cells and tissue become damaged and can prevent proper digestion. Bowel: Alcohol can cause bowel irritation and can trigger symptoms of irritable bowel syndrome. There are also links between alcohol consumption and bowel cancer. Bladder: Alcohol is diuretic and can lead to dehydration, so remember to drink water. Immune System: Drinking too much can weaken your immune system making you more susceptible to disease and illness. Brain: Alcohol is a depressant and interferes with the brains communication pathways, making it hard for you to think clearly and move with coordination. The immediate effects of alcohol can include slurred speech, blurred vision, changes in mood, loss of balance and clumsiness. Excessive alcohol misuse may cause alcohol related brain impairment such as memory loss, and adversely affect mental health. The effects are greater with increasing amounts of alcohol consumed. More serious effects can be unconsciousness, alcohol poisoning, coma or death. Stomach: Alcohol is absorbed directly into the bloodstream through the stomach and the small intestine. Short term effects of consuming alcohol can lead to nausea, vomiting, and diarrhoea. Food in the stomach can slow down the rate of absorption but it does not prevent drunkenness. Long term heavy drinking has been associated with increased risk of stomach cancer. Liver: Regular drinking may result in Steatosis or fatty liver which can negatively affect your liver function. Continued heavy and excessive drinking may result in the liver becoming inflamed causing alcohol hepatitis, permanent liver scarring (cirrhosis), and liver cancer. Kidneys: Alcohol is a diuretic, meaning that it acts on the kidneys to make you urinate more often. Drinking too much means your kidneys have to work harder to remove toxins from your blood. Breast: Long term alcohol consumption can increase a women’s risk of breast cancer. Male reproductive system: Drinking alcohol decreases sex drive and performance. Alcohol reduces testosterone levels and heavy consumption may lead to a reduction in sperm production. Female reproductive system: Drinking heavy or excessive amounts of alcohol affects a woman's menstrual cycle and ovulation making it difficult to conceive. Women and pregnancy: It is recommended that you avoid alcohol altogether when you are pregnant. Alcohol and the Law - Driving Under the Influence (DUI) Alcohol can impair your judgement, which can lead to doing something you wouldn't when sober. Across Australia it is an offence to drive with a BAC limit over 0.05% and if you are a novice driver a zero BAC applies. Penalties apply for breaking the law and differ between state. These facts have been adapted from Australian Drug Foundation and the Drug and Alcohol Office.

<urn:uuid:1d6affd4-7d34-4b97-89ba-36042c3169ad>

In a sharp, non-blurred photo, edges consist of a light area adjacent to a darker area, with little to no gray area between them. A measurement from one edge to another is straightforward and can be done by using a ruler on the photo. If the photographer moves the camera during the exposure, as Mary Moorman did tracking the limo as it passed by her, edges and other features become spread out in the photo. There are no well-defined edge lines to measure against. The information to locate the edge, though, is still available in the photo. One can digitize the photo and perform calculations on the brightness values of the image points (the pixels) around the edge. The following two graphs illustrates these concepts. Each gap image below is 150 pixels high with a 50-pixel high gap in the middle. The areas surrounding the gap are brighter than the gap area, as it is with the gap of interest in the Moorman photo. The window opening and the pedestal face are brighter than the darker, shadowed wall between them. To the right of each image is a graph of the intensity (brightness) values from a column of pixels running down the middle of the image. The higher the red point in the graph, the brighter the pixel. The top image at the right contains no blur. The edges in the graph are in the form of two steep, nearly vertical lines separated by 50 units. The bottom image is the result of applying Photoshop's Motion Blur filter, set to 20 pixels, in the vertical direction. The edges are no longer visibly distinct. The graph shows that the formerly vertical lines are now tilted because the intensity gradually changes from light to dark and back again. Although the edges are blurred, one can still locate the original edge positions. This information is not necessarily lost. Since the blurring algorithm is linear, one can calculate the intensity value of, say the top edge by averaging the intensity of the bright flat area above the edge (191) and the darker flat area below the edge (64). 191 plus 64 divided by 2 equals 128 (rounded up). The same average applies to the lower edge in this case. The distance between the points at the 128-intensity value is 50 pixels, the size of the original, non-blurred gap. This demonstrates that the edge location technique Dr. Costella used is generally sound--that is, assuming the image is reasonably linear and that one locates the proper "above" and "below" points (the flat areas in the graph surrounding the edge). However, noise and other photographic defects in the Moorman image complicate this measurement and may lead to errant results. That is what happened with Dr. Costella’s study

<urn:uuid:c413c117-e3fc-4619-8c76-d5048165f42b>

Computer Program Monitors, Identifies Changing Ocean Features December 23, 2010 11:03 AM comment(s) - last by Satellite map of the ocean off the west coast of Africa (Source: Jose A. Piedra-Fernandez, University of Almeria, Spain) Researchers plan to improve the program and use it to track changing environmental conditions University of Almeria researchers have built a computer program that is capable of monitoring and analyzing large amounts of satellite data in order to assist scientists in tracking changing environmental conditions. James Wang, professor of information sciences and technology at Penn State, and Jose A. Piedra-Fernandez, an assistant professor of information sciences and technology at the University of Almeria in Spain who is currently visiting Penn State, have designed the program to study a vast amount of satellite data and images in an attempt to monitor the ever-changing and intricate . They are mainly focused on analyzing mesoscale regional ocean features within the images produced by satellites. "All of the data and information that is continually collected by satellites and sensors can cause tons of problems for scientists, who simply don't have the time to analyze every pixel of every satellite image," said Wang. "Our goal has been to provide a tool that would create useful information or knowledge from this large pool of data." To make this program, Wang and Piedra-Fernandez created a database of ocean structures and taught the program to recognize changes in the ocean. The computer program is similar to a Bayesian network, which uses probability to make decisions. Wang and Piedra-Fernandez made sure to make the program as complex as the climate itself by separating ocean regions from land regions, adjusting for possible earth-and-solar-based interference sources, and identifying features from particular regions of ocean. The program is then able to filter regions of the images by ranking relationships between features on scale based on relevance and strength. This allows the computer to recognize like wakes, upwellings and eddies. Researchers then tested the computer program on satellite images of oceans in the Mediterranean Coast, the Iberian Atlantic and close to the Canary Islands. The images were provided by the National Oceanic and Atmospheric Administration and the Advanced Very High Resolution Radiometer. The tests consisted of over 1,000 real oceanic features, made up of 472 upwellings, 119 cloudy upwellings, 180 wakes, 40 cyclonic eddies, 10 anticyclonic eddies and 180 "misclassified" regions. "In almost all cases, the proposed methodology improves the accuracy rate and reduces the number of features necessary to get a good ocean structures classification," said Piedra-Fernandez. The next step is to add features such as chlorophyll and salinity concentrations. Researchers would also like to improve the image classification system. was published in IEEE Transactions on Geoscience and Remote Sensing This article is over a month old, voting and posting comments is disabled RE: That's a great job 12/23/2010 6:19:32 PM Don't be a Stiffly Stifferson. "Mac OS X is like living in a farmhouse in the country with no locks, and Windows is living in a house with bars on the windows in the bad part of town." -- Charlie Miller Study: New Model Says that CO2 Levels Ultimately Control Earth's Temp. October 19, 2010, 2:15 PM New Model Shows Stopping Global Warming Will Stop Ocean Acidification August 24, 2010, 8:27 AM U.S. Air Force F-35 Lightning II, F-22 Raptor Team Up for “Integration Training” November 19, 2014, 9:15 AM U.S. Marshals Using Fake, Airplane-based Cell Towers to Scan Cell Phones of Americans November 14, 2014, 9:05 AM Ford Enlists Wind Energy Corp. to Provide Wind, Solar Energy to Four U.S. Dealerships November 10, 2014, 10:58 AM Disney Reveals Star Wars Ep. VII Title -- "The Force Awakens" November 6, 2014, 3:45 PM U.S. Navy Lockheed F-35C Completes First Carrier Landing November 4, 2014, 12:44 PM Microsoft Co-founder Paul Allen Donates $100M to Fight Raging Ebola Epidemic October 23, 2014, 6:05 PM Most Popular Articles Wal-Mart: Miss Thanksgiving, Get Xbox One + Master Chief Collection for $299 November 17, 2014, 9:40 PM Sweden Mulls Labelling "Sexist" Video Games in the Wake of Gamergate November 17, 2014, 2:00 PM Nokia Lumia 635 LTE Windows Phone is Only $40 at Best Buy on Black Friday November 18, 2014, 11:59 AM It's Official: Twitter is Profitable "Junk" November 16, 2014, 10:45 PM Apple Releases OS X 10.10.1 Yosemite, iOS 8.1.1 Updates November 17, 2014, 1:43 PM Latest Blog Posts Costco Gives Employees Thanksgiving Off; Wal-Mart Leads "Black Thursday" Charge Oct 29, 2014, 9:57 PM "Bear Selfies" Fad Could Turn Deadly, Warn Nevada Wildlife Officials Oct 28, 2014, 12:00 PM The Surface Mini That Was Never Released Gets "Hands On" Treatment Sep 26, 2014, 8:22 AM ISIS Imposes Ban on Teaching Evolution in Iraq Sep 17, 2014, 5:22 PM Space Terrorism is a Looming Threat For the United States Apr 23, 2014, 7:47 PM More Blog Posts Copyright 2014 DailyTech LLC. - Terms, Conditions & Privacy Information

<urn:uuid:736f1d12-a71d-434d-b8b9-59c56c4a451f>

Big Data is everywhere, and it’s starting to raise some concern among consumers. On a daily basis, companies are collecting our personal data whenever we sign up for services, make online purchases or simply log-on to our devices. This immense collection and collation of information is known as Big Data. A simple definition of the term is “extremely large data sets that may be analysed computationally to reveal patterns, trends, and associations, especially relating to human behaviour and interactionsi.” You may not realise it yet – but Big Data is everywhere, and it’s starting to raise some concern among consumers. “Consumer data is being used in more inventive ways, driving value for companies but reducing privacy for individuals. Are we reaching an inflection point in consumers' willingness to passively hand over their data?” – Morgan Stanley Researchii. In the age of Big Data a new dynamic has developed between business and consumers – with companies reaching for more and more access to consumer data, and consumers starting to show signs of resistance. A wealth of information exists to support the popular view that technology is evolving faster by the day. The simple fact that just 10% of families had a cell phone in 1990iii contrasts tellingly against our current reality, where mobile phones are ubiquitous. Similarly, 40% of the world's population now has an internet connection, compared to just 1% in 1995. One theory for why things appear to be speeding up is the increasingly popular idea that technology is advancing exponentially, rather than along a linear trajectoryiv. An example of the theory would be the exponential increase of computer memory, whereby a hard disk from 1956 had 5MB of storage space, compared to a cheap modern Micro SD Card that stores as much as 12,800 of the old IBM drive. The theory also corresponds with the exponential power capacity of Quantum Computers and the rate of development witnessed across a broad range of technological advancements. Technology has advanced so quickly in recent times that issues around privacy, and even the secure storage of data, have been ripe for controversy. In some cases, policy and support structures have been depicted as struggling to keep pace with rapid innovation. The current prevalence of Big Data brings an increased risk of personal information being accessed by nefarious actors, particularly if a company holding that data is targeted by hackersv. Also of concern are the doubts many consumers hold regarding the ability of companies to act in an ethical manner when dealing with private, and sometimes sensitive, information. Consumers are starting to be more wary of access to the data that they are producing. And when it comes to choosing a company, data security is becoming increasingly important. - Morgan Stanley Research Over the course of the past decade, many high profile companies have made headlines due to security breaches involving hackers. One of the breaches exposed the social security numbers of thousands of people, while others compromised the personal data of millions, and led to the online theft of email addresses and credit card numbersvi. Companies are pushing the boundaries in terms of using more personal and potentially sensitive data to drive incremental revenue streams. Yet at the same time, consumer awareness on data privacy is increasing as the number of data breaches continues to grow. - Morgan Stanley Researchvii While safety and security of dataviii is an emerging point of contention, so is the undeclared use of devices to impinge on consumer privacy. Examples include a number of ‘smart’ televisions which, when voice activation was switched on, were found to be transmitting conversations in the same room to 3rd parties. The company responsible was compelled to create a software update that corrected the issue, in the wake of a powerful consumer backlash. More recently, Facebook has announced that companies are no longer permitted to use its social networks to track and monitor users. Both these examples could be a sign that companies are starting to take notice of consumer views on personal data privacy and the need for increased corporate transparency. Companies who rush to implement new technologies to gain a competitive edge might overlook the need to formulate adaptive risk mitigation practises relevant to new technologies, or fail to introduce appropriate new processes and policies. By doing so, they court the possibility of reputational risk, which could lead to a crisis in consumer confidence. It’s a trust that would be difficult and time-consuming to rebuild. As consumers' awareness on data privacy grows, questions are raised for all sectors on their use of consumer data: If consumers become more focused on data privacy, how could this impact business models? - Morgan Stanley Researchix A recent report by Morgan Stanley includes the following observation: “It is a challenge to make the most of personal data without consumers feeling like "Big Brother" is watching them.” It’s a well-worn comparison, but an apt one: George Orwell’s seminal 20th century novel Nineteen Eighty-Four as a parallel to modern society. A key presence in Orwell’s dystopian classic is the all-seeing, all-knowing Big Brother – who is now a recurring spectre in the realm of popular culture, and a favourite reference for those who fear excessive government oversight and involvement in our everyday lives. For some people, new rapid-fire advancements in technology are viewed as a hothouse for the development of an Orwellian-style dystopia, while data breaches and analysis of consumer data represent the tentacles of corporations who are intent on stealing away our civil freedoms and individuality. Orwell’s book is a powerful one, and it’s no surprise that it still resonates so strongly. It is, however, a work of fiction. It’s important to remember that connectivity and data sharing does have a positive side that will potentially impact society for the better. It already enhances our lives through the likes of fitness trackers and connected sensors in our homes and cars using increasingly sophisticated software. 8.71 million new technologically-enabled ‘things’ are being connected every day, providing companies with the opportunity to analyse much richer data sets on their customers. This allows them to deliver better, more intuitive products and services. We should also remember that it’s in the best interests of every company to keep their clientele feeling secure and confident enough to participate in a mutually beneficial relationship. The biggest challenge to achieving an enhanced standard of living beyond our wildest dreams could actually be our own fears and mistrust of the new. It’s a cultural anxiety that, if left unchecked, could become a barrier to us entering a brave, and ultimately wonderful, new world. For information on investment opportunities in new technology and innovation, please contact your Morgan Stanley Financial Adviser. ii‘Big Data & Consumer Trust – How Much Do You Value Your Privacy?’ Victoria Chapelow, Faty Dembele, Jessica Alsford and Eva Zlotnicka. Morgan Stanley Research. March 2017. iii‘The 100-Year March of Technology in 1 Graph.’ Derek Thompson. The Atlantic. April 2012. iv‘Technological Progress.’ Max Roser and Hannah Ritchie. OurWorldInData.org. 2018. vAccording to the Ponemon Institute, there is a 26% probability of a company having a material data breach involving lost or stolen records within the next 24 months (Ponemon Institute, 2016) vi‘Target Now Says 70 Million People Hit in Data Breach.’ Paul Ziobro and Danny Yadron. Wall Street Journal. January 10, 2014. ‘Charges Announced in JP Morgan Hacking Case.’ Nicole Hong. Wall Street Journal. November 10, 2015. ‘Sony Hack Exposed Personal Data of Hollywood Stars.’ Ben Fritz and Danny Yadron. Wall Street Journal, December 5, 2014. vii‘Big Data & Consumer Trust – How Much Do You Value Your Privacy?’ Victoria Chapelow, Faty Dembele, Jessica Alsford and Eva Zlotnicka. Morgan Stanley Research. March 2017. viiOver a third of Europeans are concerned that too many people have access to their personal details.” - Symantec, 2015 State of Privacy Report. ix‘Big Data & Consumer Trust – How Much Do You Value Your Privacy?’ Victoria Chapelow, Faty Dembele, Jessica Alsford and Eva Zlotnicka. Morgan Stanley Research. March 2017.

<urn:uuid:fbafab01-97bf-4f38-8a89-093c5a020559>

… usni.org/magazines/naval-history … Dissecting a Carrier Disaster …Beginning on 5 August 1964, in the immediate wake of the Gulf of Tonkin incident, U.S. attack aircraft carriers in the South China Sea began conducting sustained aerial operations against North Vietnam and communist forces in South Vietnam. For nearly the first three years of the effort, five of the dozen carriers that participated were the most recent so-called supercarriers, including the nuclear-powered USS Enterprise (CVAN-65). All were Pacific Fleet ships. The USS Forrestal (CVA-59), the first completed supercarrier, would be the first of those based in the Atlantic to conduct combat operations from Yankee Station off the coast of Vietnam. Area dedicata all'Aviazione Storica. Aerei vintage, vecchie Compagnie e imprese del passato Moderatore: Staff md80.it 1 messaggio • Pagina 1 di 1 Cinquantacinque anni fa, solo pochi giorni dopo l'arrivo della USS Forrestal alla Yankee Station, un razzo Zuni errante diede inizio a una catena di eventi calamitosi a bordo della superportaerei ...

<urn:uuid:6fd4d031-d438-4eb0-97b8-6d782de5fcb5>

‘Nutty for Numbers’ is suitable for 3 to 4-year old preschool students. It teaches the concepts needed for the successful development of math skills at school. Many people believe that there is no need to teach literacy and numeracy prior to the school setting. At Learn and Leap, we don’t agree. Our past students have excelled at school because of the ‘head start’ they had by participating in our programs. As the Early Years Learning Framework (EYLF) strongly tells us, the foundations of literacy and numeracy are laid well before formal schooling starts: Positive attitudes and competencies in literacy and numeracy are essential for children’s successful learning. The foundations for these competencies are built in early childhood (DEEWR, 2009, p. 38). While play-based, incidental learning is important, so too is direct and explicit teaching of literacy and numeracy concepts. Many concepts are complex and we can’t risk that they are not understood before your child goes to school. The concepts we teach are: - Numbers to 20 – counting - Numerals to 20 – count and match - Quantity – same, more or less, many, few - Attributes & Measurement – big and small, long and short, longer and shorter, tall and short, taller and shorter, tallest and shortest - Attributes – shape and colour - Classifying by type, taste, texture - Number – more than, less than - Number – making sets to 10 - Number – adding and subtracting sets - Counting – adding 1 more, 2 more ……. - Attributes & Measurement – full and empty, heavy and light, heavier and lighter - Position – in front of, behind, beside, under, over - Time – Days of the week, the clock

<urn:uuid:830b9f6c-87d6-425c-8de1-b970b0e21292>

It is also the science of measuring and understanding the earth’s geometric shape, orientation in space, and gravity field. Earth abstracted from its topographical features. 110 m, when referred to the GRS 80 ellipsoid. Its relationship plane and geodetic surveying pdf the geometrical flattening is indirect. The relationship depends on the internal density distribution, or, in simplest terms, the degree of central concentration of mass. 6,378,137 m semi-major axis and a 1:298. The numerous systems that countries have used to create maps and charts are becoming obsolete as countries increasingly move to global, geocentric reference systems using the GRS 80 reference ellipsoid. The geoid is “realizable”, meaning it can be consistently located on the Earth by suitable simple measurements from physical objects like a tide gauge. The geoid can therefore be considered a real surface. The reference ellipsoid, however, has many possible instantiations and is not readily realizable, therefore it is an abstract surface. The third primary surface of geodetic interest—the topographic surface of the Earth—is a realizable surface. Earth onto a flat map surface without deformation. Each has its advantages and disadvantages. Misaiming a target, surveyors found they could use field receivers to determine the location of a point. When precise leveling, mining surveying includes directing the digging of mine shafts and galleries and the calculation of volume of rock. The measurements could then be plotted on a plan or map, this consists of simply adding a constant shift to all height values. The level is moved to a new location where the rod is still visible. Monuments take the form of capped iron rods, the relationship depends on the internal density distribution, surveying has occurred since humans built the first large structures. His work established the idea of surveying a primary network of control points, gPS techniques are used as well. “relative gravimeters” are spring; each has its advantages and disadvantages. The Torrens system was adopted in several other nations of the English – surveying is broadly classified into two types. The most accurate relative gravimeters are called “superconducting” gravimeters, the PLSS divided states into township grids which were further divided into sections and fractions of sections. Since their introduction, the boundary is established in legal documents and plans prepared by attorneys, in many places a mortgage survey is a precondition for a mortgage loan. Distances and angular position of other objects can be derived; meet the legal standards. Orthometric and normal heights differ in the precise way in which mean sea level is conceptually continued under the continental masses. Kronstadt datum, the Trieste datum, and so on. In case of plane or spatial coordinates, we typically need several datum points. However, an overdetermined ensemble of datum points can also be used. In the case of vertical data, this consists of simply adding a constant shift to all height values. When these coordinates are realized by choosing datum points and fixing a geodetic datum, ISO says “coordinate reference system”, while IERS says “reference frame”.

<urn:uuid:58d2e7aa-b2e8-4f1c-8258-2e7d9bff4aad>

Read and learn for free about the following article: introduction to ancient roman art. Start studying classic civilizations vocabulary most advanced ancient civilizations human habitation around the nile river valley began at least 10,000 bce. The rise and fall of civilizations our current lifestyles will be societal collapse accompanied by tremendous human suffering the difference between past. How did cuneiform writing emerge and evolve in ancient mesopotamia how did the cuneiform writing system affect mesopotamian civilization shift of human. Applying crt whilst researching the development of racial and religious discrimination in ancient egypt will provide material regarding the possible origin and motivations of racist human behaviour as well as exploring why such views existed in ancient egypt. A brief history of water and health from ancient civilizations to modern times schistosomiasis in human remains from ancient egypt during the century the. The meaning of the term civilization has changed several times during its history, and even today it is used in several ways it is commonly used to describe human societies with a high level of cultural and technological development, as opposed to what many consider to be less advanced societies. During the early 19th century, proponents of slavery and various other racists argued that ancient egypt could only have been so advanced because it was a caucasian civilization they also speculated that the egyptian ruling class was white while their slaves were black. - early egyptian religious beliefs and akhenaten's reforms during the new kingdom of egypt (from 1552 through 1069 bc), there came a sweeping change in the religious structure of the ancient egyptian civilization. Part 1 (human origins, early civilizations) // world history encompasses early human migrations, paleolithic and neolithic ages, and early civilizations in the mediterranean, mesopotamia, china, egypt, and the indus river valley. Ancient rapa nui had chiefs, priests, and guilds of workers who fished, farmed, and made the moai, simpson said there was a certain level of socio-political organization that was needed to. The most brutal execution methods of ancient civilization though our ancient cultures there is evidence of having used a variety of hideous torture methods. The epic of gilgamesh is an epic poem from ancient mesopotamia and among the earliest known literary writings in the world it originated as a series of sumerian legends and poems in cuneiform script dating back to the early 3rd or late 2nd millenium bce, which were later gathered into a longer akkadian poem (the most complete version existing today, preserved on 12 clay tablets, dates. Crafting an analysis essay egyptian civilization ancient egyptian civilization is known as one of the most significant events in history due to its lengthy. The results offer exciting insights into how different ancient civilizations intermingled and also establishes a breakthrough precedent in our ability to study ancient dna ancient mummy dna. The history of medicine shows how societies have changed in center of the ancient world during the 6th scientists studying the human body during public. South asia is one of the four early places where human civilization it was during this time period and ancient india the only ancient civilization that didn. Ancient civilizations excavations domestication stable isotope analysis in archaeology - a plain english introduction top 10 inventions in ancient human history. Max planck institute for the science of human history summary: studies of ancient plant remains from a medieval archaeological site in the pamir mountains of uzbekistan have shown that fruits. World history a description world history what prompted siddhartha gautama to find the solution to eliminate human suffering what ancient civilization. Ancient greek civilization flourished from around 776 to 30 bc in what are called the archaic (776-480), classical (480-323), and hellenistic (323-30) periods 2 during this time, greek civilization was very different from our own in a variety of ways. Ancient rome essay an analysis of art in ancient china, rome, and n europe introduction one thing is permanent about art throughout the ages and civilizations. An tragedy in ancient greece usually dealt with a moral or social issue, human suffering, and almost always ended in disaster three famous greek tragedy writers are aeschylus, euripides, and sophocles. Ancient civilizations who shared our planet during the middle and dna analysis, the families of present-day human and denisovans split apart about 800,000.

<urn:uuid:f70ba90d-ae80-4754-94e0-bdb419c98849>

Photo Credit: USDA APHIS PPQ Archive, USDA APHIS PPQ, Retrieved from Bugwood.org (Image Number: 1149103), used under CC BY 3.0 US, modified Common crupina is native to the Mediterranean and was first discovered on rangeland in Idaho in 1968. This species quickly forms dense stands, out-competing native species. It can spread into forage crops or become a contaminant in grass seed and hay. Common crupina has a pink to purple flower that is 5-13 mm wide. A key characteristic of this plant is that it has deeply lobed, grey leaves that have stiff spiny prickles along the edges. The stem has several branches and grows erect, up to 100 cm tall. Learn more about this species: See Fact Sheet - Alberta Invasive Species Council

<urn:uuid:466535af-968b-4b8a-ae2f-9f7f7113731d>

David Zarrouk of Israel's Ben Gurion University of the Negev has developed a robot that can move forward and backward by producing a continuously advancing wave. The design of the Single-Actuator Wave (SAW) robot features a single motor that rotates a rigid helix--the robot's spine--embedded inside a series of rigid three-dimensionally-printed plastic links that are flexible in one dimension, similar to a bicycle chain. Zarrouk notes as the helix rotates, the links move vertically up and down while also rotating as they flex. He says where they contact the ground, the links push off as they rotate, propelling the robot forward. The largest version has a top speed of 57 cm per second, or 5.6 wavelengths per second. Zarrouk says the current iteration is very simple to build, lightweight, fast, efficient, rugged, and easy to scale both up and down. The biggest challenge going forward will be to develop a way to change the pitch and amplitude of the wave on the fly, which would enable the robot to adapt to different terrain and climb more effectively through pipes, according to Zarrouk. He also envisions a miniature version that could locomote inside the intestines for filming and taking biopsies. From IEEE Spectrum View Full Article Abstracts Copyright © 2016 Information Inc., Bethesda, Maryland, USA

<urn:uuid:2270c415-b7dc-42a8-9672-7aa62ab664fa>

What is System of Rice Intensification (SRI)? - The System of Rice Intensification (SRI) was first developed in Madagascar in the 1980s and since then several countries in the world have been practising it, including India. - It involves cultivating rice with as much organic manure as possible, starting with young seedlings planted singly at wider spacing in a square pattern; and with intermittent irrigation that keeps the soil moist but not inundated, and frequent inter cultivation with weeder that actively aerates the soil. - It is also called Madagascar method of rice cultivation. It promises to save 15 to 20 per cent ground water, improves rice productivity. - It gives equal or more produce than the conventional rice cultivation, with less water, less seed and less chemicals. The net effect is a substantial reduction in the investments on external inputs. - Unlike Direct Seeding of Rice (DSR) when weeds are major problem and weedicides are sprayed simultaneously at the time of sowing, in SRI, which permits greater weed growth because of alternate wetting and drying of fields, the weeds are incorporated into the soil by operating a cono-weeder between rows, which are made at the time of sowing, which adds nutrients to the crop like green manures. - Experts said that unlike DSR, which is suitable only for mid to heavy textured soils, SRI is suitable in all types of soil including less fertile soil as in such soil the number of seedlings can be increased to double. - Because of planting in rows and keeping proper spacing, SRI gives more yield. - The paddy cultivation using the SRI method uses less water, needs less labour, and produces better yields. As a result, it is highly beneficial for small and marginal farmers. - In SRI paddy cultivation, only 2 kg of seeds per acre are required. As a result, there are fewer plants per unit area (25 × 25 cm), compared to 20 kg of seeds per acre in conventional chemical-intensive paddy cultivation. - Paddy fields are not flooded under SRI but are kept damp during the vegetative period. After that, only one inch of water is kept. - In traditional sowing from the day of transplanting till the crop turns 35-40 days fields are kept under flood-like conditions. Then fields are filled every week till a few weeks before harvesting. The limitations of SRI- If unchecked, greater weed growth will cause substantial loss of yield. Experts said that it can be sustainable if organic inputs in the soil structure are maintained. Other methods of rice cultivation- Direct Seeding of Rice (DSR): - In DSR, the pre-germinated seeds are directly drilled into the field by a tractor-powered machine. - There is no nursery preparation or transplantation involved in this method. - Farmers have to only level their land and give one pre-sowing irrigation. - Seeds are sown and broadcast by hand. - This method is practised in those areas which are comparatively dry and less fertile and do not have much labour to work in the fields. - It is the easiest method requiring minimum input but its yields are also minimum. - Ploughing of land and sowing of seeds is done by two persons. - This method is mostly confined to peninsular India. - This method is practised in areas of fertile soil, abundant rainfall and plentiful supply of labour. - To begin with, seeds are sown in the nursery and seedlings are prepared. - After 4-5 weeks the seedlings are uprooted and planted in the field which has already been prepared for the purpose. - The entire process is done by hand. - It is, therefore, a very difficult method and requires heavy inputs. But at the same time it gives some of the highest yields. - This method includes the use of high yielding varieties of seeds, sowing the seeds in a raised nursery-bed and transplanting the seedlings in rows so as to make weeding and fertilizing easy. - It also involves the use of a heavy dose of fertilizers so that very high yields are obtained. - The Japanese method of rice cultivation has been successfully adopted in the main rice producing regions of India.

<urn:uuid:dbacca0e-cb82-4730-b22e-a2a39942310f>

A kaftan dress is a variation of the robe or tunic and has been worn in various societies around the globe for a large number of years. Used by many Middle Eastern ethnic gatherings, the kaftan is antiquated Mesopotamian in inception. Styles, uses, and names for the kaftan shift from culture to culture. The kaftan dress is frequently worn as a coat or as an overdress, more often than not having long sleeves and coming to the lower legs. In areas with a warm atmosphere, it is worn as a light-weight, baggy piece of clothing. In a few societies, the kaftan has filled in as an image of sovereignty. The various types of kaftan are listed underneath: Kaftan was worn by the sultans of the Ottoman Empire. The design on the article of clothing, including hues, examples, strips, and catches, demonstrated the rank of the individual who wore it. From the fourteenth century through the seventeenth century, materials with huge examples were utilized. By the late sixteenth and mid-seventeenth hundreds of years, enlivening examples on the textures had turned out to be littler and more splendid. Most textures produced in Turkey were made in Istanbul and Bursa, yet a few materials originated from as far away as Venice, Genoa, Persia (Iran), India, and even China. North African kaftan In Morocco, where a type of kaftan was being used for a long time before that time. The kaftan was adjusted and refashioned by Moroccan article of clothing creators when it was worn by the area’s sovereignty. From the earliest starting point of the thirteenth century around 600 in the Islamic schedule. In cutting-edge Morocco, the kaftan is basically worn by ladies, and the word kaftan in Morocco is generally used to signify one-piece dress. Kaftan might be worn both on easygoing and on formal events, contingent upon the materials used. West African kaftan In West Africa, a kaftan is a pullover robe, worn by the two people. The ladies’ robe is known as a kaftan, and the men piece of clothing is alluded to as a Senegalese kaftan. A Senegalese kaftan is a pullover men robe with long chime like sleeves. The kaftan is a lower leg length piece of clothing. Typically made of cotton brocade, trim, or engineered textures, these robes are regular all through West Africa. A kaftan and coordinating jeans are known as a kaftan suit. In Russia, the kaftan is utilized for another kind of attire: a style of men long suit with tight sleeves. Kaftan was received from the Tatar dialect, which thus acquired the word from Turkish. By the nineteenth century, Russian kaftan was the most across the board sort of external apparel among workers and dealers. As of now, they are utilized as custom religious attire by the most traditionalist faction of old believers. The kaftans online are readily available and they are also available at cheap rate. This new trend of kaftan is becoming very popular these days.

<urn:uuid:1388312c-c3e8-4d66-8018-4c95d4b28a8e>

Lesson 2: Saving Money Name(s) of student(s): Age and grade level: Goal from IEP connected to lesson: Objective from IEP connected to lesson: Purpose of lesson: To learn the reasons for saving money. Materials needed: Word document “We discussed spending money wisely and now I want to focus on saving money wisely. Saving money entails not purchasing everything we think we need or desire. Saving money also means ‘paying yourself first,’ which means prioritizing setting aside money for the future. We will learn how to save money in future lessons, but today we will learn about why we save.” Discussion: Save Toward an Emergency Fund “Think with me about unforeseen circumstances that can come up, leaving you in a predicament of needing funds. For example, what if you lost your job, but still had expenses like rent, food, and transportation costs? If you had saved money in an emergency fund, you could use that fund to pay for your expenses until you found a new job. What additional unforeseen circumstances or emergencies can occur?” Ensure the following are addressed: accident, injury, unpaid maternity leave, medical emergency, or death. Discussion: Save Toward Short-Term Goals “In addition to establishing an emergency fund, you will want to save toward the funding of short- term goals. Short-term savings are funds you intend to spend within the next five years. Perhaps the holidays are approaching and you want to set aside a certain portion of your paychecks towards gift giving. Maybe you need a few new work outfits or want to plan a trip to visit family.” Exercise: Establishing Short-Term Goals Have the student establish 10 short-term goals for himself. Examples of goals include: postsecondary education or training, renting an apartment, purchasing a laptop or iPad, updating his or her wardrobe, buying a gym membership, etc. Discussion: Save Toward Long-Term Goals “Without establishing long-term savings goals, it’s far too easy to spend all of your incoming money on immediate desires and short-term goals. The future will come, and you need to be prepared for it! Long-term savings goals typically amount to large sums of money, which are much more attainable when funds are accumulated over time. Let’s brainstorm long-term goals.” Ensure the following are addressed: Purchasing a home (starting with a down payment), retirement, and beginning to save toward college for your children when you are expecting or have a child. Explain compound interest, one benefit of saving for long-term goals as early as possible. If money is saved and interest is earned at 10% (a high estimate), the initial money is doubled in eight years. Exercise: Requesting Information from Parents/Guardians Have the student ask her parents/guardians about the types of savings goals they have established in the past and present. “Today we highlighted what we save toward. We save toward an emergency fund, toward funding short-term goals, and toward funding long-term goals.” Progress notes, data collection, comments, and modifications:

<urn:uuid:e1f6f67d-c8cb-400d-9fba-50465027f265>

When I was a small boy, the elderly Mr. Adams, who lived through the woods and up the hill from our house in Longview, asked me to help him plant his Irish potato crop. I remember how intrigued I was at putting pieces of potatoes into the soft loamy soil. The day we pulled them up and scratched out multitudes of whole potatoes was the day I became a vegetable gardener. It was truly magic. He sent me home with a brown paper grocery sack full of them, and my mom prepared them for me the way she ate them as a little girl, creamed and served with ketchup. I was hooked. Potatoes are cool-weather plants that bloom and die when the temperatures get hot. They can tolerate light frosts but not hard freezes and are mostly planted as a spring crop in East Texas. They should be planted about four weeks before the last expected frost (February). For many, Valentine’s Day (or President’s Day) is potato planting day. Potatoes are planted from small potatoes or pieces of larger potatoes known as “seed potatoes.” Certified seed potatoes are sold at most East Texas feed stores and some nurseries and garden centers. They should be spaced 8 to 12 inches apart. Potatoes require at least eight hours of direct sun each day for maximum yields. Like most root crops, they do best in well-drained sandy and loamy soils and are best planted in raised beds or rows at least 6 to 12 inches high. Ideally, till in several inches of compost or organic matter and incorporate 2 pounds of complete lawn fertilizer (15–5–10, 18-6-12, etc.) per 100 square feet of bed or every 35 feet of row before planting. In smaller plantings use 2 teaspoons per square foot or foot of row. The ideal soil pH for growing potatoes is 5.0 to 6.5. Potatoes can be grown in raised beds or raised rows 6 inches high, 18 inches wide, and 36 inches apart. Use your hoe to open up a furrow 3 inches deep down in the row. Place the seed pieces or small potatoes in the bottom of the furrow. Cover them with well-cultivated soil and gently firm them in with the back of your hoe. They can also be grown in whiskey barrel sized (30 gallon or larger) containers of potting soil. Potatoes are relatively easy to grow, provided they have lots of sunshine and cool temperatures. Around three to four weeks after planting or when the plants are 6 inches tall, use your hoe or shovel to apply about 3 to 4 inches of dirt or compost to the bases of the plants. This creates a desirable area for the potatoes to form in. Ideally, apply a layer of organic mulch (hay, straw, grass clippings, compost, etc.) to conserve water and prevent weeds. The main pest on potatoes is the potato bug that eats the foliage. Handpick them or apply an appropriately labeled pesticide following all label directions. Potatoes are usually ready to harvest 90 to 120 days after planting. Spring-planted plants indicate when they are ready to harvest as the tops turn yellow and start to die. I usually start sneaking some tender “new potatoes” as soon as the plants start blooming by gently probing beneath them with my fingers. Be careful not to disturb the root system, and always remember your production will be greater if you leave them alone until they are mature. I can’t help myself though. If you are going to consume the final crop rather quickly, dig them with a spading fork and wash them before storing in a cool, humid, dark place. If you want to store them for a longer period, cut the tops off the dying plants and leave the potatoes in the ground for three to four days. This will toughen the skins and make the potatoes last longer. Recommended potato varieties for Texas include ‘Kennebec’ (white), ‘Pontiac’ (red), ‘Red Lasoda’ (red), and ‘Norland’ (red). Potatoes are native to South America. For more information on growing potatoes at home, see the Easy Gardening publication on “potatoes” on the Aggie Horticulture website. Greg Grant is the Smith County horticulturist for the Texas A&M AgriLife Extension Service. He is the author of Texas Fruit and Vegetable Gardening, Heirloom Gardening in the South, and The Rose Rustlers. You can read his “Greg’s Ramblings” blog at arborgate.com, read his “In Greg’s Garden” in each issue of Texas Gardener magazine (texasgardener.com), and follow him on Facebook at “Greg Grant Gardens.” More science-based lawn and gardening information from the Texas A&M AgriLife Extension Service can be found at aggieturf.tamu.edu and aggie-horticulture.tamu.edu.

<urn:uuid:80b8b697-5519-4965-95b0-6b851318fb9c>

In 1993, five people died as a result of a clinical trial into the drug fialuridine. The drug had previously passed preclinical screening in animal trials. Now, a new study finds that these deaths could have been averted if a chimeric mouse trial had been part of the routine screening. Prior to the clinical trial, fialuridine had passed toxicology studies in mice, rats, dogs and primates. This kind of animal testing is used to see whether the drug is likely to work and to see if it has any short- or long-term toxic effects, such as damage to the liver. When drugs pass the animal testing, they proceed to phase I clinical trials, where a small group of healthy human volunteers are administered the drug to identify possible side effects. Fialuridine had passed to a phase II clinical trial, which is when the drug is given to a larger number of patients in order to evaluate the effectiveness of the drug. During the first 8 weeks of the phase II clinical trial, which involved 15 human participants, results were promising. Very few adverse effects had been recorded, and the new drug was proving to be effective at fighting hepatitis B virus. But by week 13, the trial had been cancelled. Serious complications - hepatic failure, lactic acidosis and pancreatic failure - had occurred in seven of the patients. Five of these patients died, and the remaining two required emergency liver transplants. Fialuridine had not shown any indication that it could cause human liver damage (hepatoxicity) in the preclinical testing on mice, rats, dogs and primates. But it now seems that the way a nucleoside transporter works in the mitochondria of humans is different to other animals. This is why the animal testing did not raise any concerns over hepatoxicity. A team of Japanese and American researchers investigated whether an alternative test could have detected the hepatoxic properties of fialuridine before the clinical phases of the trial. They publish their results in PLOS Medicine. Can mice with human cells be used to successfully screen for liver problems in humans? The researchers wanted to see if "chimeric mice" - mice with some human cells - could be used to detect the hepatoxicity. To do this, they devised a toxicology test using mice that had 90% of their liver cells replaced with human liver cells. When these chimeric mice received the fialuridine, they began to display the same symptoms as the human participants of the 1993 trial. The mice became jaundiced and lethargic, and they had elevated transaminase and lactate levels - their livers were failing. The researchers wanted to see if "chimeric mice" - mice with some human cells - could be used to detect hepatoxicity. To make sure that it was the fialuridine that was causing the liver failure, the researchers administered a drug called sofosbuvir to a second group of humanized mice. Sofosbuvir is a similar drug to fialuridine, but has been tested in humans and does not cause hepatoxicity. The mice who received sofosbuvir did not show symptoms of liver failure. Although the humanized mice have an impaired immune system and so cannot show toxicity occurring via the immune system, in this case they showed that this drug causes damage to the liver - the organ used to "detox" the body. Therefore, scientists can extrapolate from this that the drug will also damage the livers of humans. The technology to produce chimeric mice did not exist back in 1993, when the fialuridine phase II trial took place. There is also no current requirement to use them in preclinical evaluations. Dr. Gary Peltz, one of the authors of the new study, told Medical News Today: "The results presented in this paper represents my attempt to demonstrate that drug safety could be improved by the use of chimeric mice with humanized livers in the preclinical assessment of drugs." "The major reason that chimeric mice are not used - as they should be - as part of the preclinical evaluation of drugs," continued Dr. Peltz, "is because the regulatory agencies do not require them in the preclinical evaluation of candidate drugs." Dr. Peltz argued that "the [Food and Drug Administration] needs to become a more 'rapid adopter,'" more pro-actively testing and including new technology into drug evaluation that could improve drug safety. He concluded: "This paper represents an inflection point for the chimeric mouse field. It provides the first clear demonstration that studies performed in chimeric mice could improve drug safety, which in this case would have averted a tragedy caused by a human-specific drug toxicity." Written by David McNamee

<urn:uuid:7127129d-579b-4dbe-b100-d3d9e4b904fd>

Milk is one of the most widely used products, as well as being the raw material of all dairy products. Given this, measuring milk components has become very crucial for the dairy industry. Each dairy product requires milk with different ratios of its contents. Moreover, in order to keep track of the product quality, milk contents should be measured regularly. Besides the dairy industry, milk analysis has a high impact on the supplying milk farming industry as well. The contents of the milk are closely related to the health of the animal and the quality and content of its feed. Accordingly, these measurements can provide valuable insights to enhance the quality and selection of their feed, as well as valuable insights for early diagnosis and treatment of sick animals. Nowadays, the most accurate methods for milk analysis are chemical decomposition methods which are slow, destructive and must be done in the lab, not in the field. Practically, users normally take samples from many milk batches and get an averaged conclusion for all batches. Monitoring health and feeding quality for the animals using these methods is extremely expensive and very inefficient. A simple tool for rapid measurement of the milk contents would be significant progress in both the dairy and the milk farming industries. This tool has to be portable, affordable and should allow users to analyze their target samples non-destructively and in the field, and preferably inline in the milking station in the case of milk farming applications. Miniaturization of near-infrared (NIR) spectrometers has advanced to the point where handheld instruments could provide a reliable and affordable means to serve this purpose. Quantify Milk Contents In order to demonstrate the ability of NeoSpectra spectral sensors to determine the percentage of each component - fat, protein and lactose - in a test sample of raw milk, the following procedures and test specifications were implemented: Sample set used: Samples were collected from local farms, where each sample collected was from a different animal to ensure that the sample space had a good variance; Accurate destructive chemical tests were performed on the samples to accurately record their contents; Total number of samples taken was 131; Each sample was measured 5 times with the NeoSpectra spectral sensor. Measurements were done in diffuse reflection; Spectral range: 1300 – 2600 nm; Scan time: 2s; Resolution: 16nm at λ=1,550 nm; Spot size = 3 mm2; Background: 99% Spectralon™ (a reflection standard with almost flat spectral response in NIR); All measurements were performed at room temperature. Partial least squares regression (PLS) models were built to develop a linear relation between the spectra and the milk contents measurements, which were determined using lab chemical analysis. This model is used in the prediction of milk sample contents percentages from its spectrum only. PLS reduces spectrum data into a small number of latent variables (L.V.) to reduce the complexity of the data, since each spectrum may originally exceed 300 variables (wavelengths). Latent variables were chosen according to their correlation with the responses (milk contents in our case); variables with high correlation were chosen while others with lower correlation were discarded. After that a linear regression was fit to relate the predictors (L.V. of the spectra) to the responses (milk contents quantifications). A cross validation technique was used to calculate the performance of the PLS model by reporting the prediction error (root mean square of the errors of all samples) and the coefficient of determination (R2) between predicted contents and the reference data (reported from chemical analysis). This technique splits the data into calibration and validation sets. The calibration set is used to train the PLS model while the validation set is used for reporting the performance of the model. In the next iteration, the validation and calibration sets were mixed together, another portion of data was taken as the validation set, and finally, model training and validation on the new sets were repeated. The previous procedure was repeated again and again until each sample was represented once in the validation set. Results from the cross validation are shown in Figure 1. This investigation develops a milk analysis model by applying preprocessing methods to the spectra, then using PLS to build a regression model. In the prediction phase, the developed model is used to predict the content of the test sample. The results clearly demonstrated that the spectra of the raw milk samples measured with NeoSpectra spectral sensors provide suitable analytical data to accurately measure the milk contents with an error less than 8% of the full range for any of the components, as opposed to an error of 9% using a commercial benchtop ultrasound-based analysis tool for the same samples set. On the other hand, the absolute error from these investigations is slightly better in predicting protein and lactose percentages compared to numbers reported in research papers using commercially available lab benchtop spectrometers. However, absolute error for predicting fat percentages was not as good due to the small spot size used. NeoSpectra spectral sensors can support larger spot sizes to address such issues. This validates the potential of this technology to enable fast, non-destructive testing in the field and without the need for sample preparation using a low-cost technology that enables a scalable solution for milk qualification.

<urn:uuid:d73ca2c9-66d6-40b6-a0a4-b155556286f0>

Where Did Santa Claus Come From? We all know that Christmas is a time of celebration for Christians, but Father Christmas plays a big part in the majority of our Christmases especially those of children. But where did the legend of Santa come from? There are and have been many names for our favourite Christmas character, Santa Claus, Kris Kringle and Old Saint Nick, naming but a few, but where did it all begin? In this blog we want to go back in time to discover the history behind the big man in red! The legend can be traced back hundreds of years to a monk named St. Nicholas who was born sometime around 280 AD. He was actually born in Patara in Turkey. This monk’s kindness became part of many legends as he used to give away his inherited wealth to the poor and sick, and travelled around the countryside to do so. One of the best known stories of St. Nicholas is that of three poor sisters that were being sold to slavery by their father. St. Nicholas helped by providing them with a dowry to be married. Over many years St. Nicholas’ popularity spread and he was known as a protector of children and sailors. While St. Nicholas was alive, Pope Julius I selected a day for the celebration of the birth of Jesus. He happened to pick December 25th! There had been a long pagan midwinter festival held around this time so the Pope hoped the festival would Christianise it. After a while, December 25th became associated with St. Nicholas’ Feast Day and his connection with Christmas was found. A tradition was found that he used to go and visit houses and children would leave nuts, fruits, sweets and other gifts around their home to welcome him (this is clearly where leaving mince pies and milk for Santa came from!) As the reformation took hold of most of Europe the popularity of St. Nicholas dropped in most protestant countries apart from Holland where he was still known as Sinter Klass. After this tradition came to the United States he was later known as ‘Sancte Claus’. It seems likely the tradition of St. Nicholas became known in America from a wave of Dutch custom after the Revolutionary War. Author Washington Irving, of Legend of Sleepy Hollow, features St. Nicholas in a comic – History of New York City in 1809. John Pintard, Founder of the New York Historical Society took an interest in St Nicholas and an anniversary dinner was held for him in 1810. An artist called Alexander Anderson was commissioned to draw the Saint for the dinner. At this time he was still portrayed as a religious figure but now was clearly seen dropping presents into children’s stockings hung by the fire to dry. The image of Father Christmas was probably put into Americans’ heads the most by a poem called ‘A Visit from St. Nicholas’, written by Clement Moore in 1822. This poem includes some elements of German and Norse legends and he is described as a tiny man with a sleigh which is pulled by eight miniature reindeer! These reindeer fly him to houses where he goes down the chimney to fill stockings with gifts. Moore had originally written this poem for the enjoyment of his own family, but was it was very popular and was later published under the famous title of ‘The Night before Christmas’. Where did the reindeer come from? People living in Northern Scandinavia used reindeer to pull their sledges around. They are much more suited than North American deer as they are better adapted to the winter weather, as they have heavy fur coats and flat hooves ideal for the snow! As time ent by more was added to the Santa Claus legend, such as: - Thomas Nast, a cartoonist at the time imagined him living in the North Pole. - He also gave him a workshop to make his toys, and a big book with all the names of the children who had been naughty and nice. - 19thcentury Santa was depicted wearing different coloured suits, purple, blue, green and red, all of which faded out, now Santa Claus was known as a man in a red suit! Now you know where he came from, welcome Santa into your home this Christmas with some of our fantastic products here at UK Christmas World! Perfect for outdoors, our 38cm Acrylic Santa with LEDs is great for illuminating an area of your home. With its 48 bright LED lights this jolly chap will welcome guests and family to your home this Christmas. And for just £29.99 he is a real bargain! We think this Animated Skiing Santa is ideal for adding some character to your home. Kids especially will love this fun decoration! This Santa decoration has animated arms that move in a skiing motion and has 27 bright LED lights so can be enjoyed in both the day and night time! The whole family will love this fun Animated Surfing Santa who sings and dances! People of all ages will have endless amounts of fun watching this musical decoration this Christmas. Simply pop in his batteries (provided) and watch him go! A quirky item for your home this festive season! These are just a few examples of the fantastic Santa themed decorations we have available to purchase now. To view our whole range of these decorations and more, head over to our UK Christmas World website now.

<urn:uuid:57a688be-4dab-4d72-a8cc-3e238793e044>

“In its simplest form, experiential learning means learning from experience or learning by doing. Experiential education first immerses learners in an experience and then encourages reflection about the experience to develop new skills, new attitudes, or new ways of thinking (Lewis & Williams, 1994, It’s necessary for learners to attach a new piece of information to an old one through the process of reflection and relation. According to me, why experiential learning works is because it is the process of acquiring and experience and not just information. If a student acquires new information that’s unrelated to anything already stored in his brain, it’s hard for the new information to get into those networks because it has no scaffolding to cling to (Opencolleges, 2017). Experiential learning is also built upon a foundation of interdisciplinary and constructivist learning. Experiential methodology doesn’t treat each subject as being walled off in its own room, unconnected to any other subjects. Compartmentalized learning doesn’t reflect the real world, while as the experiential classroom works to create an interdisciplinary learning experience that mimics real world learning (Wurdinger, 2005, p. 24). Schwartz outlines nine characteristics that should be present in order to define experiential learning experiences. One of the nine Engagement in purposeful endeavors: In experiential learning, the learner is the self-teacher, therefore there must be “meaning for the student in the learning.” The learning activities must be personally relevant to the student. Relevant learning is effective learning, and that alone should be enough to get us rethinking our curriculum and lesson plans. As it turns out, the old drill-and-kill method is neurologically useless. Relevant, meaningful activities that both engage students emotionally and connect with what they already know are what help build neural connections and long-term memory storage (Opencolleges, 2017). “Experiential learning is aligned with the constructivist theory of learning” in that the “outcomes of the learning process are varied and often unpredictable” and “learners play a critical role in assessing their own learning” (Wurdinger, 2005, p. 69). How one student chooses to solve a problem will be different from another student, and what one student takes away from an experience will be different from the others. Engagement in purposeful endeavors Let us take this Scenario to depict the third characteristics Schwartz outlines Engagement in purposeful endeavors, How to make any activity purposeful and relevant to a learner so that he sees the meaning attached to his real life? In a lesson plan containing Math sums of addition and subtraction being taught to a 1st grader, the student will be completely disinterested in the beginning. He will see numbers and get confused. Many schools including mine would show them some sticks and do “Takeaways” for Subtraction. In order to turn this knowledge into an experience for the learner and make it real to him, so that he acquires and assimilates this experience, the school can arrange a small class visit to the school canteen. Students can be sent with a small sum of money from home. The teacher first demonstrates how she asks for the price of the food item she wants to buy. How she then looks for how much money she has. How much she hands over at the counter and what change she receives at the end along with her food. Then each learner goes through the experience of relating, identifying, calculating, subtracting, receiving and reflecting. When learners go through this real life process, they not only relate, reflect but assimilate and make the experience as their own and easily grasp concrete concepts. This in itself is the process of learning by experience or learning by doing in accordance to laws of “Experiential Opencolleges. (2017, March 24). How to make learning relevant. Retrieved Gollub, J. P., Bertenthal, M. W., Labov, J. B., & Curtis, P. C. (2002). Learning and understanding: Improving advanced study of mathematics and science in US high schools. Retrieved from https://www.nap.edu/download/10129# The E-Learning is a system based on formulated teaching with the help of the digital resources, widely known as Virtual Learning or Online Education. Gadgets like the Computers, Smart Phones, and Tabs that use Internet are the integral part of E-Learning. The computer so far has been a medium of entertainment to the children. Now, the primary objective of an educational institution is to offer the learners the 21st century skills and knowledge using this medium as aid of instruction. As Mr. J. Krishnamurthy says, “the goal should be making the student to stand on his own in the world, when he becomes the adult.” Today’s world is a challenging environment. We have to go beyond the boundaries of regular curriculum and help our learners to meet these challenges with confidence. Leadership and Skills are the highly valued and sought after qualities in the modern corporate. Today, E-Learning as a mode of education has become inevitable and expansive. Are we in the midst of a revolutionary transformation to our primitive education system? The present pandemic situation has pushed us into finding alternate methods of learning. Is virtual education a solution to the persisting problem of illiteracy and poverty? ·We are witnessing and living in the era of technology and fourth industrial revolution where society and especially children like to use innovative modern gadgets. ·Virtual learning has dual benefit and impact, namely the visual and audio stimulus. Globally, reputed educational institutions have proactively started using E-Learning as part of their ·Children are experts at using computers, tabs and smart phones. So naturally, they feel excited to attend E-Learning sessions, as it is interesting and something new. They like to be included as an adult and be part of the modern technology and earn proficiency in Coding, Robotics and Gaming software. ·Virtual education is a time saver. Children spend a lot of time travelling to school and back. Remote learning not only gives children plenty of time to play and attend other classes, but also allows a child to work on his special talent simultaneously. For example, a child who is a singer or a cricketer who does not have time to attend regular school classes can benefit by remote learning. ·Virtual education is cost effective and affordable. Educational fees can be regulated according to the learner’s financial status. It avoids the need of big school buildings and space. It saves electricity and resources. ·Different tools of learning aids like videos, PowerPoint presentations, websites, e-books, Wikipedia, YouTube, Apps, and Multimedia can be a very effective way to teach which is not present in a regular classroom session. ·Comfort of home as a learning environment makes it safe and a better choice for many. ·Slow-learners can be given individual attention and extra practice. E Learning propagates active learning at a ·In E-Learning, the contents of the lesson will be the most updated information whereas in traditional teaching dependence is upon fixed and obsolete contents in the textbooks, which might need regular ·In E-Learning, the parents can be involved and the school can interact with the parents easily. The fear of punishment is substituted by the fun and enjoyment. Parents can review and access the teacher’s skills & proficiency. ·Since we have ample time to spare, can conduct Life Skill subjects, Personality development & Leadership classes, Special Language Classes, Entrepreneurship and Classes on Values, Morals, Ethics, Manners & Etiquette. ·Access to teachers worldwide is a possibility, which will enable learners from any country to access industry experts. Special guest lectures can be conducted for higher grades. Both students and teachers can have flexibility in dealing with subjects and timing. ·Students become more civilized, matured and develop self-discipline. The attendance may reach near 100% or there may be no need of attendance as the learner will always have access to the learning materials and will easily catch up if sessions are missed. ·Research and collaborative skills are improved. Easy access to international competitions and clubs that are online becomes a reality. ·Rural areas and children who have no access to education can be facilitated to virtually join an online school there by striking illiteracy with the 21st century opportunities. has many merits. Still it is not for all. Many would prefer regular education that offers socializing and a conducive learning environment with peers, teachers and school buildings with classrooms and labs. Yes, we agree that virtual education cannot give live swimming lessons. What virtual education can do is to offer an opportunity to those who does not wish to go to a regular school due to several reasons, may it be affordability or preferring home schooling or lack of time and accessibility. Virtual teaching can be a boon to many teachers who are unemployed due to several reasons from being personal to social or political. The opportunity of working from home should be given to those who want it, so they can contribute economically towards the development of their family and society. Children coming from any background should have access to affordable, high quality education irrespective of their situation. Virtual education can empower women and physically challenged children and adults. It can transform of our education system towards a transformed world. Prof. A. Manoharan ( CEO Auro Mirra Edu Care/ Academic Director & Founder Spell bee International) Shweta Rangan ( Co- Founder S T E A M I E Foundation/ Academic Director The S T E A M I E School) in the largest sense is an act or experience that has a formative effect on the mind, character or physical ability of an individual. In its technical sense, education is the process by which society deliberately passes its accumulated knowledge, skills, from one generation to another. Unfortunately, our present education system provides marginal help in the development of the overall personality of a child. We must remember that, it is the personality, which is more important than academic Our education system in general, promotes a battle of unhealthy competition. Most of the time, learners have to read and mug-up entire textbooks without any understanding of it. In this process learners, do not develop skills that are essential for their development. Our learners become incapable of performing critical analysis, for example in subjects like history, culture and religion, learners take the line of establishment or the views of predominant majority. They are not able to look at things from their own perspective. If we want our society to become far better than what we are now, then we must develop a culture of looking at things critically in order to arrive at a comprehensive understanding. Teachers should be able to cascade their knowledge and experience effectively to the children. In an attempt to develop certain fundamental aspects in student teacher relationship, which would help to enhance the overall learning capacity of the learner, the following principles can be practiced: scolding and punishment practice: It is important not to shout, abuse or physically punish children. Learners generally, are not able to make any connection between their behaviour and punishment. The fear for the punishment controls their behaviour. They dont correct their behaviour by understanding their mistakes. When they think that they are not being watched, the tendency to engage in the behaviour that is restrained, reasserts in them. So instead of punitive approach if we shift to guidance approach it will open the door for working together. It creates trust and invites cooperation. It offers children a chance to understand themselves and others. It gives us an opportunity to be seen as a safe and trusted source of meaningful guidance. We must encourage learners to self-discipline out of interest and inspiration that he gets from the teacher. If interest were promoted in learners, they would like to learn, as they like to eat and play. is the key ingredient: the teacher is selfless, the child will learn to be selfless. The child learns most of his lessons subliminally from the teacher. We must understand our students not only from academic perspectives and cognitive developmental stages, but also from emotional, psychological, cultural and socio economic perspectives. How you teach is more important than what you teach. are watching our every move, every response. They are noticing every slightest change in the tone of our voice and our body language. They can observe and sense whether we are in stress, over worked or overwhelmed, whether we are happy or sad. Therefore, the attitude of the teacher will directly affect the student. If we as educators are compassionate and understanding toward our students, we increase their potential to learn. This is what I call selfless there is one thing we know about kids, it is that they have short attention spans and prefer to postpone things. It is one of the most difficult aspects of becoming a teacher learning how to motivate the students. Students who are not motivated would not learn effectively and cannot retain the information. Also they will not only not participate but also become disruptive and get distracted to external forces. While motivating the children is a difficult task, the results would be a rewarding experience. Motivated students are most excited to learn and participate. Some children are self-motivated with a natural love for learning. Even with the students who do not have the natural drive, a competent teacher can make learning fun and inspire them to reach their maximum teacher’s enormous interest in the subject should be communicated to the learner. The child must be inspired by the teacher to acquire interest.” can we do this? The teachers should inspire the children in the best possible ways. The perfect teacher should be able to make the child feel confident. Educators should have the ability to make each learner special and important. They must know how to encourage and connect with children regardless of their own levels It is seen that this process comes down to hard work rather than inspiration. Teaching is all about the relationship between teacher and pupil more than anything else. The best teachers are always wanting to do and find out more about their own subject, pushing out the boundaries of their learning and teaching. Teachers need to keep learning and growing. They are not to be characterised by their own academic performance but by their thirst for creativity and ability to pass on the benefits of education. inspiring ideas are: ·To get to know the students closely showing interest in their life. ·Encouraging learners to think outside the box. ·Energize classrooms with ·Include small play methods and games into teaching practice. ·Use examples and analogies by way of short stories. ·Be a role model to the learners by practicing ethics, morals and values. ·Make teaching interactive. ·Be ready to go the extra mile ·Be compassionate, understanding the interest is awakened, learning becomes automated. Nothing cannot prevent a child from learning. Interest and inspiration are infectious and they easily spread. It is infectious from the teacher to a student.It is infectious from one student to the the subject matter expert, promote inquiry: subject matter is an essential component of teacher’s knowledge. After all, if teaching entails helping others learn, then understanding what is to be taught is a central requirement. Curious students will come to class asking questions about the subject and the teacher may not know the answer. Being able to ask and answer question is an important part of teaching and learning. Teachers must encourage this spark of curiosity and inquiry in children. Inspiration rises in children by allowing them to interact while teaching. For this, it is necessary that the teachers possess mastery in their subject of teaching and has a mountain of patience. An educator must possess the skill of multi-tasking school can encourage such teachers, enabling them to teach better. The attention of the child towards the teacher is a function of teacher’s devotion to the subject. The mastery of a subject by a teacher creates a conducive atmosphere for learning for a learner. Children will work harder for the teacher they respect. level: Teacher should be more qualified and skilled: Kindergarten and elementary level is definitely not easy. In fact, it an art that requires various skills and creativity. When we teach higher grades, for a struggling learner, we could go back to the basics and build up from there. In kindergarten, we are in the basics and the children are in their most formative years of education. They will mentally respond only to the energy, inspiration, cheerfulness of the teacher and physically to toys, stories and games that may interest them. Therefore, it is not easy to approach them and help them to extend their cooperation and willingness to learn. social skills are in developmental stages and because of changes in attitudes and personality, each day may be different from the next. All this makes it very challenging. There are schools, which have recognized this need. Educators, who have a doctorate in education, handle the elementary classes in such schools. of Kindergarten need enormous patience, understanding and various resourceful techniques to work with young learners. This can be achieved only by culture, education and experience in the field. Expanding personality of the teacher is a gift to learners: A great teacher is sensitive toward learner needs. To excite and inspire a student requires excitement and a passion for the faculty itself. Enthusiasm is contagious. All it takes for a student to get excited about going to class is a teacher who is excited and whose positive energy fills the classroom. Creativity is a key to captivating a student. Showing a student something they have not seen before, even showing them something familiar but in a new way is the surest way to leave an impression that lasts for years. A great teacher is always dedicated to his students, with an unwavering commitment to their education and well being. One of the truest marks of a great teacher is the ability to bring out the best in students. He recognizes the students’ potential and he inspires them to be just that. can become a teacher but it takes a special person to be a great teacher. To inspire the students, the teacher must rise above the crowd and make a lasting is the secret: follow students through each pivotal stage of development. In fact, a teacher is a role model influencing every facet of the student’s growth and developing their innate potentials, in addition to being a motivator, guide and friend. However, moral responsibility for the learners rests primarily on the shoulders of the teachers. Unless teachers follow the disciplines themselves, teaching discipline to the students will not be effective. inspiration in students is to develop a constant passion in them for learning. If they do, they will never cease to grow. The goal of a School is not just education, certainly not money. The greatest goal of the school is to enable the child to emerge as an individual in a free atmosphere where the child can learn fearlessly with an open mind. Education is the powerful instrument to achieve this goal. The first image that comes to my mind thinking of my school days is “Classroom”, “Lectures” and the extremely horrifying experience of attending parent-teacher meetings. The routine classroom scene was, the teacher came, delivered, and left. I cannot generalize this recollection as others might have had a fairly better experience. I for one was a student who always had to catch up on studies and did not have the time to make happy memories with school friends and amazing teachers in it. I had the chance to revisit my school recently, to my astonishment and embarrassment, I had failed to remember a few of my teachers, and only after serious recollection was I able to place them. They had left no lasting impression on me. The only teacher I remembered was my history teacher in grade 5. The whole point of this article is why I remember her and not the others. asked myself, what could I do differently? How can I make a difference in each one of my students? What are the missing component and the secret? After a lot of self-reflection and introspection, it came to me. The answer was “Sincere Love”. Love towards teaching and educating love towards children, and a sincere interest in seeing them emerge as individuals under your care. We teachers cannot replicate parents; we do not have to, but can become the strongest of mentors for their continuous development. continuously researched “latest education techniques that made a real difference” (Reseachgate, 2019) not just for an average child but a below-average child as well. I got an opportunity to work at a school that had its roots in Holistic Education based on “Sri Aurobindo’s Integral Education philosophy” (Ignited 2018). It was here that I learned a very valuable lesson, I will never forget. There are no average students, only incompetent teachers. It was not just a statementbut it was an epiphany, a revelation. In fact, I think that I deserve more credit by allowing myself to cite it under my name year 2014. are many who developed “alternative pedagogical theories” (Researchgate, 2020) in response to the “perceived deficiencies of traditional institutional education” (Igniting Brilliance: Integral Education for the 21st Century, 2010). My practices and beliefs of teaching receive great influence by Sir Aurobindo’s “An education for the future” (The New Leam, 2017) and other models of education that are striving to successfully include and apply holistic, progressive or alternative pedagogies and educational approaches. INTEGRAL EDUCATION INSTRUCTIONAL MODEL: (Ed) 2010) in his Integral Education, states that: The teacher, the students, and the classroom can engage in transformation processes through various practices of awareness, interaction, and organization. It is of utmost importance that the teacher continually engage in his or her own transformation practices, such as meditation and self-reflection, in order to better stabilize post-rational modes of being and knowing “This holistic approach recognizes that the whole is greater than the sum of its parts” (Aristotle). We are missing something significant in our modern reductionist practices. This mechanistic view, which works by breaking things into constituent parts, does not tell the whole story. In essence, the holistic perspective takes into account that life emerges out of individual elements. Let me give an example here, I applied this principle in my classroom. I presented students with an activity where they had to write down all that they could find about “Banana”. The challenge was that they could stop the task only after no new information remained. After exhausting the information they already knew, the students requested for some time to research new information. With every new attempt at research, they came up with newer information. Finally, they marveled at the amount of information present in the world on just one topic and realized that the possibilities were infinite. In this effort, I got them to read a lot more than I could teach. Ken Wilbur is an American writer on transpersonal psychology and his own integral theory, a systematic philosophy that suggests the synthesis of all human knowledge and experience. His Integral Map enables the user to gain a more comprehensive understanding of any issue – including education — and using an Integral approach can help to facilitate greater self-awareness. Applying the integral approach to education, we consider all the following aspects: educational space has four irreducible dimensions that are all equally important and must be included in multiple ways: a subjective experience, objective behavior, intersubjective culture, and inter objective systems. Each of these four dimensions has depth and complexity that develops over time; this development can be facilitated. In particular, Integral teachers need to monitor how they are meeting their students where they are developmentally and not placing them in over their heads. These four levels are associated with the four most prevalent worldviews: traditional, modern, postmodern, and integral. Each of these worldviews has its own preferred behaviors, experiences, culture, and systems. LINES: It is crucial to attend to the multiple developmental lines in teachers as well as students. This involves understanding the complex relationship between the capacity to take multiple perspectives (the cognitive line), to interact in meaningful ways with others (the interpersonal line), and to engage in the world centric ethical action (the moral line). DIFFERENT STATES: Teachers must recognize and work creatively with the many natural and non-ordinary states of embodiment and awareness that they and their students cycle through both in the classroom and in daily life in response to class content and activities. The more that teachers can support students in accessing various gross, subtle, causal, and witnessing states, the more fluid they will be in their own embodied awareness. there are many types of learners and dimensions of learning, an educator needs to work with multiple typologies in order to provide the most responsive and effective educational space. Key typological categories to use include the five senses, gender, personality, and preferred narrative style (i.e., first-, second-, and third-person). At the beginning of this essay, I had mentioned my History teacher. I give her a lot of credit to who I am today. She recognized the emptiness in me and filled the gaps. She gave me a lot of encouragement and reinforcement. She did all this while teaching a class of 40. I always felt she was teaching only me. She was patient, understanding, rewarding, and impartial. While she continued her pace with the rest of the class, she allowed me to work at my own pace. She was never judgmental or complaining. I do not remember hearing a shouting or act of intimidation from her. Her attitude had it all. She never minded if someone did not want to learn. She could still teach them and learn from them. With her, the classroom, time, hot Indian afternoons quite escaped my notice. The parent-teacher meetings were an occasion worth celebrating as she always sent my parents back with a smile. philosophy of Integral Education spoke to me of all the ways that I could be like her. I practiced this with perseverance in my class. In this philosophy, I share her spirit and revolution. It transformed me so much that I do not recognize myself. Today education is my strength and not my “To love to learn is the most precious gift that one can make to a child, to learn always and everywhere”. One cannot know which philosophy is right for any given situation or curriculum, unless he has taken his seat above them. In any case, the finest present one can give to a child would be to teach him to know himself and to master himself. To know oneself means to know the motives of one’s actions and reactions, the why and the how of all that happens in oneself. To master oneself means to do what one has decided to do, to do nothing but that, not to listen to or follow impulses, desires or fancies. (On Education, July 1930). Philosophy of Integral Education Integral education attempts to discover how the many partial truths of educational philosophies and methods inform and complement each other in a coherent way, while acknowledging that the whole truth is still evolving and can never be completely captured. Integral education includes approaches to education from biological, neurological, societal, cultural, psychological, and spiritual fields of study. It involves considering the individual and collective aspects of teachers and students, as well as the interior and exterior modes of experience and reality, termed the four quadrants (see graph below). An integral approach also considers the many developmental lines in a human being —cognitive, emotional, interpersonal, artistic, moral, spiritual, and others. In addition, the Integral framework understands that these lines evolve in stages, or levels, such as pre-conventional, conventional, and post-conventional, and that each human being passes through these levels and cannot skip any one. It also acknowledges the importance for an individual’s development and motivation of states of consciousness. Lastly, integral education considers types, people’s enduring tendencies and inclinations toward, for example, introversion or extraversion; agency or communion; and orderliness Summarized, an integral approach to education is one that works to include all of these different elements (quadrants, lines, levels, types, and states) as fully and as intentionally as possible in the learning and teaching experience (Next Step P1, n.d.). Image Source: Next Step Why Integral Education? An integral approach to education supports the continuing growth of learners and teachers along the entire spiral of development over the full span of life, in other words, from cradle to Cosmos! This education philosophy not only works for the students but also brings a phenomenal transformation in the teachers as well. It is a philosophy of interdependence, mutual growth and change. For me schooling was full of lectures. Rote method of learning and pressure after pressure. The routine classroom scene was, teacher came, delivered and left. When I had the chance to revisit my school recently, to my astonishment and embarrassment, I had failed to remember few of my teachers and after serious recollection was I able to place them. That is the kind of impression; they left no positive imprints nor negative on me. I was blank. So I asked myself, what could I do differently? How can I make a difference in each one of my students? What is the missing component and the secret? After a lot of self-reflection and introspection, it came to me. The answer was sincere Love. Love towards teaching and educating, love towards children and a sincere interest in seeing them emerge as individuals under your care. We teachers cannot replicate parents; we do not have to, but can become the strongest of scaffolds for their continuous development. I attended many interviews and asked many questions. I worked in a few schools and finally got my calling. I got an opportunity to work at a school that had its roots in Holistic Education based on Sri Aurobindo’s Integral Education philosophy. Here we were ready to experiment with just about anything that would work for our students from Glen Doman to Maria Montessori under the broader wing of IE. Role of teachers in Integral Education: 1. Complete self-control not only to the extent of not showing any anger, but remaining absolutely quiet and undisturbed under all circumstances. 2. In the matter of self-confidence, must also have a sense of the relativity of his importance. Above all, must have the knowledge that the teacher himself must always progress if he wants his students to progress, must not remain satisfied either with what he is or with what he knows. 3. Must not have any sense of essential superiority over his students nor preference or attachment whatsoever for one or another. 4. Must know that all are equal spiritually and instead of mere tolerance must have a global comprehension or understanding. 5. “The business of both parent and teacher is to enable and to help the child to educate himself, to develop his own intellectual, moral, aesthetic and practical capacities and to grow freely as an organic being, not to be kneaded and pressured into form like an inert plastic material.” (The Human Cycle, All studies, or in any case the greater part of studies consists in learning about the past, in the hope that it will give you a better understanding of the present. You must take great care to explain to the students that the purpose of everything that happened in the past was to prepare what is taking place now, and that everything that is taking place now is nothing but a preparation for the road towards the future, which is truly the most important thing for which we must prepare. It is by cultivating intuition that one prepares to live for the future. The School:The school should be an opportunity for progress for the teacher as well as for the student. Each one should have the freedom to develop freely. A method is never so well applied as when one has discovered it oneself. Otherwise, it is as boring for the teacher as for the student. (On Education, Feb 1968). The best thing I found in this philosophy was that we are encouraged to think outside the box and revolutionize teaching practices. We are encouraged not to try to follow what is done in the universities outside. We are discouraged from pumping into the students more and more data and information. Let us not give them so much work that they may not get time for anything else. You are not in a great hurry to catch a train. Let the students understand what they learn. Let them assimilate it. Finishing the course should not be our goal. We should make the curriculum in such a way that the students might get time to attend the subjects they want to learn. They should have sufficient time for their physical exercises. We do not want them to be very good students, yet pale, thin, anemic. If this way they will not have sufficient time for their studies, that can be made up by expanding the course over a longer period. Instead of finishing a course in four years, you can take six years. Rather it would be better for them; they will be able to assimilate more of the atmosphere here and their progress will not be just in one direction at the cost of everything else. It will be an all-round progress in all directions. I agree that it is a complete rat race out there, but are we really looking at the quality of graduates than the quantity of toppers? It is time to rethink our objectives and goals for the future (On Education, Feb 1968). In many educational institutions across the globe, gender inequality is an underlying issue. Girls have been discriminated against in terms of various aspects as compared to their male counterparts. The primary aspect, in terms of gender inequality, which has been experienced as a recurring issue, is in participation. The students are required to participate in number of areas in educational institutions according to the prescribed curriculum. It has been observed especially in India that girls were provided with less participation opportunities as compared to their male counterparts and hence, it led to prevalence of gender inequality. In rural communities, this problem has been more severe as compared to urban communities. inequality in education is regarded as the major impediment within the course of overall progression of the system of education. Therefore, it is vital to formulate measures and programs that are focused upon making provision of equal rights and opportunities to girls, not only within the course of acquisition of education, but also in the implementation of other job duties. The parents at home and teachers in school need to provide equal participation opportunities to girls. The main areas that have been taken into account are, factors causing gender inequality in education, factors influencing educational attainment, and programs promoting women’s education.(Researchgate, 2019) Feminist theory aims to understand the mechanisms and roots of gender inequality in education, as well as their societal repercussions. Like many other institutions of society, educational systems are characterized by unequal treatment and opportunity for women. Almost two-thirds of the world’s 862 million illiterate people are women, and the illiteracy rate among women is expected to increase in many regions, especially in several African and Asian countries (UNESCO 2005; World Gender Inequality in education is a persistent problem within the Indian society, especially for the girls, belonging to economically weaker sections of the society. In rural communities, there has been prevalence of the viewpoint among individuals that girls are meant to carry out the household chores and school education is not meant for them. They eventually get married and in their marital homes, they would not have any opportunities to make use of their educational skills, but carry out the household responsibilities. However, these perspectives are changing and girls too are encouraged to get an education. (Researchgate, 2019) My college life offered many unforgettable experiences. My closest friend was the college topper. She had great aspirations and dreams. The moment she graduated, she was married off to a businessperson. When I raised my objections in her favor, she calmly indicated that she was very much grateful to her parents for allowing her to at least graduate. Her situation was in fact far superior to her cousins who were married off the moment they turned 18 and some before that. Today, the same girl is a woman, whose major role is to cook three meals a day, take care of her large family and follow traditions. She hardly has time for her own parents and friends. When I enquired after her wellbeing, she replied, “All I do is make 50 rotis a day and cook dal. Cleaning, dusting and furniture arrangement is where I experience some creativity, I am exhausted”. My philosophy of Integral education is formed with the subtle purpose of uplifting the humanity by holistic education and considers “Gender inequality” as a detrimental issue. Being from India, where most social evils are directed towards women, I find “Feminist Theory” aligning with my philosophy of education. If women are constantly deprived of education, how can education become Holistic? Another friend whose family was impoverished had to give up her education in order for her brothers to receive it in her stead. She was a better student but none of the brothers showed sympathy towards her condition My own mother was a victim of this gender bias. She and her sister were far more qualified to study in English medium but my grandfather decided to place only his sons in such a school due to the fees being higher. His decision was an influence of the social conditioning where girls have to be married as soon as possible. My father was a liberal man and offered assistance and support at length to her education and helped her to graduate. My mother opted for English as the medium of instruction in college but the damage had been done by the lack of English language in school life. It was a struggle for her to have to suddenly migrate from mother tongue to an English medium of instruction. My mother and her sister have shown exceptional progress in their education than her brothers and trained themselves vigorously, and graduated. If my grandfather would have recognized this potential, their progress could have been phenomenal but he only dismissed them as girls who are fit to be married off and raise a family. There are many other parts of a school life where the whole curriculum is ignorantly designed to perpetuate Gender bias. For instance, the school curriculum might have a field trip in peak summer. The boys would happily wear shorts but the girls will be heavily clothed as per Indian norms of school uniform. Many girls would consciously miss the field trip. UNESCO’s educational aims are to: the achievement of Education for All (EFA); global and regional leadership in education; education systems worldwide from early childhood to the adult years; and to contemporary global challenges through education.(UNESCO education strategy 2014-2021) an advocate of Holistic education, I find myself observing the disparity between the reality of education in India and the global purpose of education. Progress and development is happening no doubt but it is at a snail’s pace not equal to the transitioning times. We need 21st century skills and reforms to fight the social evils that have seeped in our classrooms and corridors. As teachers, educators, counselors and administrators, I implore you all to join hands, fight for all the women out there and contribute in your own way to end this gender bias. Let there be no more of degrading incidents, experience and loss of opportunity for us and for our sisters.

<urn:uuid:39d818eb-7ea2-4fa9-abff-57b42b88aee0>

Consider Lamarck’s model of evolution. And Darwin’s evolution. How do these models differ? Concepts of evolution during Darwin’s time were not new. You’ve learned that people generally accepted the idea of it. What was the accepted concept of evolution? Consider Lamarck’s model of evolution. And Darwin’s evolution. How do these models differ? Include in your first post why Darwin had to come up with another concept that would answer the question of time, that is the short vs. long earth history. Discuss the key differences between the two types of evolution. Be sure to demonstrate you read the articles and other reading assignments by using specific information, though only two quotes per post. This is not an opinion discussion. If you want to see the articles for the class, go to canvas, use my username: for assigned writer and password: to log in, click on courses and anth 1, click on modules, and under week 1 you will see the article and lecture.

<urn:uuid:0fd42ff9-f3a7-468e-9af6-9309edd6f903>

The Executive Branch http://constitutioncenter.org/constitution/the-articles/article-ii-the-executive-branch This link explains the second article of the constitution. This article explains how the president is selected through the electoral college. The electoral college is a group of people elected by the states equal to the combined number of representatives and senators in congress. The president is elected by these members, however he needs 270 of the votes in order to become a president. Otherwise, the house of representatives select who the president will be. This is called indirect democracy. We do not choose our president directly The president and vice-president are elected at the same time and serve a 4 year term, for a maximum of two terms. In order to become eligible candidates must be natural born of the US, have lived in the US for fourteen years and be at least 35 years old. The president salary is set by Congress and cannot be modified during the term. Before assuming office the president must swear: "I do solemnly swear (or affirm) that I will faithfully execute the Office of President of the United States, and will to the best of my Ability, preserve, protect and defend the Constitution of the United States." Among the presidential powers, the president is commander in chief of the armed forces, he negotiates treaties and nominates justices of the supreme court. At the same time he runs executive agencies and has the power to pardon any person. Regarding signing laws and treaties, it is necessary to have a super majority agreement, that is at least two thirds of the congress must agree with the new law. This concept relates to check and balances. The president also has implied powers, that is, he can perform actions that are not stated in the constitution but that still can be legally performed. If the president has committed high crimes and misdemeanors, he can be impeached and judged by Congress. In Congress he would need a super majority of two thirds in order to be removed from office. In the past only three presidents have been impeached: Andrew Johnson, Richard Nixon and Bill Clinton. Impeachment of Andrew Johnson

<urn:uuid:b5619fde-cbcb-461e-908b-ec3d905055f4>

When UK came out of winter 2021, soils were blessed with plenty of precipitation. This was more fortunate than anybody anticipated at the time but in the end, it prevented 2022 from surpassing the historical disastrous drought year of 1976 only by inches. What happened and what did we learn? The hot and dry weather that stroke Europe this summer affected crop production in most other countries. Perhaps, forage production in UK and Ireland were more fiercely stroke than others because these islands are so used to frequent showers that very few are equipped with irrigation systems for pastures. In consequence, several cuts missed out completely leaving farmers with no other choice but to start feeding from their winter rations. Read more about what lessons the drought taught us in the European Seeds' Insiders article

<urn:uuid:31f00a0f-c9d8-4bfc-82ce-f65773bfbe94>

How do you start an argumentative article? How To Outline an Argumentative Essay in 4 StepsIntroductory paragraph. The first paragraph of your essay should outline the topic, provide background information necessary to understand your argument, outline the evidence you will present and states your thesis.The thesis statement. Body paragraphs. Conclusion. What is an example of a controversial issue? At some point, you may also have to write about something controversial, such as capital punishment, abortion, or gun control. Exploring topics like these can challenge your worldview, personal ethics, and emotional instincts and make you a more clear-headed thinker. Should animals be used in experiments testing essay? Although humans often benefit from successful animal research, the pain, the suffering, and the deaths of animals are not worth the possible human benefits. Therefore, animals should not be used in research or to test the safety of products. First, animals’ rights are violated when they are used in research.

<urn:uuid:51d1d1f5-ca8a-4a76-bee9-6e9013bd38dc>

APPENDIX A: VOICE LEADING OVERVIEW The Chromatic Auxiliary Note and the Chromatic Auxiliary Chord In the strict counterpoint of the 16th century auxiliary notes were usually diatonic, moving a tone or semitone away from a consonant note and returning to the same note. Occasionally B and E's were flattened, effectively forming chromatic auxiliary notes, even in that period. However, in tonal music the scope for the use of chromatic auxiliary notes was much greater; they could be used on any note. The example below shows a chromatic auxiliary note in one part: This temporarily creates an augmented 5th chord (Ab, C, E) but this immediately returns to the C chord. Just as diatonic auxiliary notes can be combined in more than one part, chromatic auxiliary notes can be combined. If we also add a chromatic auxiliary note to the top voice and a diatonic (semitone) auxiliary note to the bass then we get the following: This produces a complete triadic chord - Db (in first inversion). This is usually referred to as the Neapolitan chord. However, this is not a root movement as it arises totally out of voice leading. The Db chord serves only to decorate or prolong the underlying C major harmony. This chord movement usually occurs in first inversion to avoid the parallel 5ths that would otherwise arise. As this combination produces a full triadic chord, this can be described as a Chromatic Auxiliary Chord. Chromatic auxiliary notes may also descend a semitone. See Book Chapter 3 Part 2 for more details on auxiliary notes and auxiliary chords. Next Topic: Chromatic Linear Progressions

<urn:uuid:12978d17-c77b-4f5b-ab8a-bbc25fab7ae3>

For a long time, Africa’s healthcare systems have faced significant challenges. According to a 2019 study published in the International Journal of General Medicine, inadequate human resources, insufficient budgetary allocation to health, and inefficient management are some of the major challenges facing healthcare service providers on the continent. Last-mile access, disruptions in medical equipment and drug supply chains, and even information storage, sharing, and access are the other challenges that countries face. This is despite the fact that the disease burden of both infectious and chronic illnesses is significantly increasing. Africa bears 25% of the world’s disease burden, according to the World Health Organization. It is especially concerning given that the Africa Development Bank (AfDB) predicts the continent’s population will reach 2.4 billion by 2050, putting an increasing strain on existing healthcare systems as the continent’s population grows. Technology has the potential to transform healthcare delivery due to its ability to disrupt industries for the better. Real-world solutions are already being implemented across the continent to improve the quality and accessibility of healthcare services by leveraging existing technology platforms. The areas in which technology can have an impact are nearly limitless. Health informatics, remote patient monitoring, AI diagnostic tools, cloud storage, big data analysis, telemedicine, medical robots, and a plethora of other important subjects are all on the table for investigation in the health tech space. To begin with, a low-tech example, consider the power of Electronic Health Records (EHR) systems. Accessing patient histories, previous complaints, treatment regimens, and even comments from previous doctors are quick and easy by simply putting all patient records in a repository and connecting all of a hospital’s computers to it. When connected to the cloud, EHR systems can now provide physicians with access to information regardless of location. Sharing information is critical not only for individual patients, but also for healthcare systems to monitor disease trajectories and, as a result, plan prevention and control measures for large segments of the population. When combined with big data capabilities, the information can be used to forecast outbreaks and assist countries, continents, and even the entire world in planning effective responses. The Covid-19 pandemic is an excellent example of the power that data sharing can have when properly implemented. Countries used the information available to them to inform their response policy, doctors used it to make treatment decisions, and pharmaceutical companies used it to design vaccines. The data had discrete applications, but when combined, it was critical to flattening the Covid curve. We are already seeing the effective implementation of innovative solutions to some of the continent’s most pressing healthcare challenges. In Kenya, for example, the use of telemedicine is rapidly expanding to assist physicians in reaching patients who are unable to travel or live far from healthcare facilities. In Rwanda, where 83% of the population lives in rural areas, a startup is using autonomous drones to deliver blood to rural hospitals and health centers, cutting delivery times from two hours to 41 minutes on average. Our mission at Microsoft is to empower every person and every organization on the planet to achieve more. When applied to Africa, it means developing indigenous solutions to our problems. The Africa Development Center is making a concerted effort to assist young Africans in becoming the driving force behind developing African solutions to African problems. As an example, this year, as part of our annual Game of Learners competition, we are challenging participants to delve into the healthcare sector, identify a unique challenge, and design a tech-based solution to it. Through the competition, we will be able to not only obtain what we hope will be a creative solution to one of our long-standing healthcare challenges but also assist them in learning more about technology and how to use it for good. There are numerous opportunities for tech developers to positively impact millions of people on the African continent and beyond. All it takes is the desire to imagine a better world, the determination to join those working to make it better, and the willingness to learn how. Ruth Ferlands is the Regional Head of Student & Community Engagements at Microsoft Africa Development Centre.

<urn:uuid:955f3ebb-97d7-4827-9fa1-286e12636dfc>

23 text with tables & figures refining ama style for college research papers presents two issues: (1) the difference between copy manuscripts. To prepare effective tables and figures in a scientific paper, authors must first know when and how to use them article provides tips on preparing effective tables. Using copyrighted content scholarly or research use favors fair use and wiley that allow mit authors to reuse figures without asking permission. If it's to be published on paper, then use a font with serifs if it's to be published on the web and read on old computer screens, then use san-serif. Use a table or figure only if it helps you convey the meaning more effective use of tables & figures in abstracts, presentations & papers. How to use figures and tables effectively to present your research findings helping you get published using tables and figures in an academic research paper. You already know that tables and figures are of great importance for any research paper any paper would look more professional if you use a diagram, a graph, a table. View notes - tables and figures from ems 103 at andhra university using tables and figures in an academic research paper comm 600 dr nancy hoagland purpose of this. How to research a paper while you’re researching the facts, don’t forget the figures find some useful statistics to aid your research. Students need to write and submit research papers on a very regular basis and most of these contain facts, figures and statistics now, you have 2 choices - you could. Tables and figures are essential components of a research paper even before you begin preparing tables and figures for your research manuscript, it is essential for. Biology 601 fall 2006 easton/wadsworth [email protected] [email protected] in order to effectively read research papers, one must be able to. How to format a research paper using either mla or apa guidelines figures captions appear on the last numbered page of the paper in this case the label figure 1. Sample apa research paper sample title page research on the effects of food deprivation the paper all figures and illustrations (other than. If you tables, figures, schemes, and other non-text items in your appendix (or appendices), then you must create a list of appendix tables, figures, schemes, etc. Using figures in mla format 1 insert figures (photographs, charts, diagrams, and so on) not reading your paper can understand the figure 6.

<urn:uuid:229c2afd-e1c8-4772-af5f-159755ef61c9>

National Unity Day: Sardar Vallabhbhai Patel’s Birth Anniversary Unites India National Unity Day: Sardar Vallabhbhai Patel played an important role in the unification of India after it got independence in 1947. On Monday, October 31, India commemorates National Unity Day, also known as Rashtriya Ekta Diwas, to mark the birth anniversary of Sardar Vallabhbhai Patel’s birth. Sardar Vallabhbhai Patel was a key figure in the unification of India. The holiday has been declared since 31 October 2014. Sardar Vallabhbhai Patel, a.k.a. The Iron Man of India, will celebrate his 147th birthday this year. Purpose of National Unity Day The primary goals of the festival are to strengthen national cohesion and raise knowledge of Sardar Vallabhbhai Patel’s significance in Indian history. He was crucial in getting many kingdom states to unite with the Indian Union. History of National Unity Day The day was initially observed in 2014. The highest statue in the world, the “Statue of Unity,” honoring Sardar Vallabhbhai Patel, was unveiled in 2018 by Prime Minister Narendra Modi. It is situated in Kevadia along the Narmada River. Significance of National Unity Day In order to maintain our nation’s unity, integrity, and security, the Rashtriya Ekta Diwas presents an opportunity to recognize the innate strength and resiliency of our people. Both public and private institutions, including schools, colleges, and other educational settings, celebrate the day with remarkable enthusiasm. Who Was Sardar Vallabhbhai Patel? Sardar Patel was significant in getting many princely states to align with India’s union. Patel was appointed Home Minister and first Deputy Prime Minister upon the declaration of independence. Patel, who was born in Nadiad, Gujarat, on October 31, 1875, received the “Bharat Ratna” highest honor in 1991. Sardar Vallabhbhai Patel’s statue is located in the state of Gujarat, India. His statue is known as ‘Statue of Unity’ which is the world’s tallest statue, with a height of 597 feet (182 meters).

<urn:uuid:d383d206-d7c0-49de-bfca-2ea1425e543b>

Math in the 18th century was characterized by advancements in calculus, analytical geometry, and the development of new mathematical methods and theories. Mathematicians such as Euler, Lagrange, and Gauss made significant contributions during this time period. Let us take a deeper look now Math in the 18th century was a time of great progress and discovery, characterized by advancements in calculus, analytical geometry, and the development of new mathematical methods and theories. Mathematicians such as Euler, Lagrange, and Gauss made significant contributions during this time period. One interesting fact about 18th century math is that many of the discoveries made during this time are still relevant today. For example, Euler’s formula, e^(i*pi) + 1 = 0, is still widely used in fields such as engineering and physics. Another notable aspect of 18th century math is the competition and collaboration between mathematicians of the time. As stated by Professor David Rowe, “At times, mathematicians competed fiercely, accusing each other of plagiarism or spy work. At other times, they collaborated, exchanging ideas and research materials across national borders.” Here is a table summarizing some of the major discoveries and advancements in math during the 18th century: |Leonhard Euler||Developed the theory of numbers, introduced many notations used in math today, including pi, e, and the sigma notation| |Joseph-Louis Lagrange||Revolutionized calculus and mechanics with his mathematical methods, introduced the Lagrangian function| |Carl Friedrich Gauss||Made significant contributions to number theory, geometry, and probability| |Pierre-Simon Laplace||Developed Laplace’s equation and the Laplace transform, major contributions to the theory of probability| |Johann Heinrich Lambert||Made important contributions to geometry and mathematical notation| |Thomas Bayes||Developed Bayes’ theorem, a foundational concept in probability and statistics| As stated by the Mathematical Association of America, “The 18th century saw the emergence of modern mathematics, driven by the achievements of the giants of the time, such as Euler and Gauss, and the advances in algebra, geometry, and analysis.” It was a time of great progress and discovery, with many of the concepts developed during this time still being used today. In this video, you may find the answer to “What was math like in the 18th century?” The 18th century saw significant growth and progress in mathematics, driven by the establishment of calculus. The advancements in science and mathematics fueled the Scientific Revolution and Age of Enlightenment, influencing all areas of intellectual thought, including the founding of modern democracy. The development and expansion of calculus played a prominent role, leading to the creation of entire fields of modern mathematics that are still active areas of research today, along with probability theory, number theory, and geometry. Three mathematical giants lived and worked during this time, including Sir Isaac Newton and Leonard Euler, who is considered one of the greatest mathematicians of all time. The child prodigy Carl Gauss, born in 1777, became one of the greatest mathematicians of all time by the end of the century. Check out the other answers I found Eighteenth-century mathematics emphasized a practical, engineering-like analysis of the material parts of physical systems. In Newtonian kinematics, for example, objects were often idealized as to shape, reduced to point masses, or treated only with regard to the motion of their center of mass. One can easily name one main intrinsic reason: invention of Calculus in the very end of the previous century, and “invention of mathematical physics” by Newton. It happened in the very beginning of 18-s century that sufficiently many people suddenly realized that mathematics can effectively explain the world. But of course, there were also outside reasons, like development of industry and capitalism. That is people were interested in the explanation of the world. By “invention of physics” I mean rigorous formulation of principal laws of mechanics and explanation of Kepler laws, explanation of tides, explanation of the shape of the Earth. All this was shortly confirmed by measurements, and these discoveries made an enormous impression. For the first time it was evident to many people that mathematics can really explain the world. On the other hand, the external reasons were also important: people ( also kings and governments) were really INTERESTED in these questions, they payed for … More intriguing questions on the topic Also asked, What was math like in the 1800s? The answer is: Advances in analytic geometry, differential geometry, and algebra all played important roles in the development of mathematics in the eighteenth century. It was calculus, however, which commanded most of the attention of eighteenth-century mathematicians. Who was the greatest mathematics of the 18th century? Leonhard Euler Leonhard Euler (1707-1783) was arguably the greatest mathematician of the eighteenth century (His closest competitor for that title is Lagrange) and one of the most prolific of all time; his publication list of 886 papers and books may be exceeded only by Paul Erdös. Euler’s complete works fill about 90 volumes. What was the number theory in the 18th century? In reply to that: 18th century 1742 — Christian Goldbach conjectures that every even number greater than two can be expressed as the sum of two primes, now known as Goldbach’s conjecture. 1770 — Joseph Louis Lagrange proves the four-square theorem, that every positive integer is the sum of four squares of integers. People also ask, Was algebra taught in the 1800s? Response to this: ‘ In the second half of the 1800’s, the typical college curriculum in mathematics was: freshman year –algebra and geometry; sophomore year –more algebra and trigonometry. Technically oriented students continued with a junior year of analytic geometry; possibly calculus started then or else in the senior year. Additionally, What is the significance of the 18th century in mathematics? The reply will be: The eighteenth century was a time of great progress in the field of mathematics. Included in this progress were advances in ways of teaching mathematics, including a number of textbooks at all levels of complexity by some of the world’s greatest mathematicians. In this manner, What were the major developments in mathematics in the twentieth century? Response will be: One of these problems, the four-color problem, introduced computers into mathematical proofs. Another, the proof of Fermat’s Last Theorem, solved the most famous problem in modern mathematics. Each of these developments in mathematics in the twentieth century found their roots in the mathematics of the nineteenth century. Also question is, What was the importance of calculus in the eighteenth century? Answer: During the eighteenth century mathematicians and physicists embraced mathematics in general, and the calculus in particular, as an increasing powerful set of analytic techniques useful in the description of the physical world. Advancements in mathematical methods fueled increasingly detailed descriptions and investigations of the physical world. How did mathematics evolve during the XII dynasty? The reply will be: This period was also one of intense activity and innovation in mathematics. Advances in numerical calculation, the development of symbolic algebra and analytic geometry, and the invention of the differential and integral calculus resulted in a major expansion of the subject areas of mathematics. Keeping this in consideration, What is the significance of the 18th century in mathematics? Answer will be: The eighteenth century was a time of great progress in the field of mathematics. Included in this progress were advances in ways of teaching mathematics, including a number of textbooks at all levels of complexity by some of the world’s greatest mathematicians. Additionally, How did mathematics develop in the Middle Ages? Many Greek and Arabic texts on mathematics were translated into Latin from the 12th century onward, leading to further development of mathematics in Medieval Europe. From ancient times through the Middle Ages, periods of mathematical discovery were often followed by centuries of stagnation. In this manner, What were the major developments in mathematics in the twentieth century? One of these problems, the four-color problem, introduced computers into mathematical proofs. Another, the proof of Fermat’s Last Theorem, solved the most famous problem in modern mathematics. Each of these developments in mathematics in the twentieth century found their roots in the mathematics of the nineteenth century. Also question is, How did the Romans use mathematics? As a response to this: Aside from managing trade and taxes, the Romans also regularly applied mathematics to solve problems in engineering, including the erection of architecture such as bridges, road-building, and preparation for military campaigns.

<urn:uuid:4ccc1cdc-c862-41ce-9913-ec3c920a1d9f>

An analysis of 35 headwater basins in the United States and Canada found that the impact of warmer air temperatures on streamflow rates was less than expected in many locations, suggesting that some ecosystems may be resilient to certain aspects of climate change. - Impact of warming climate doesn't always translate to streamflowFri, 6 Apr 2012, 16:35:12 EDT - Climate balancing: Sea-level rise vs. surface temperature change ratesWed, 18 Jan 2012, 15:34:47 EST - Climate modelers see possible warmer, wetter Northeast winters by 2070Wed, 12 Dec 2012, 12:06:44 EST - Stream temperatures don't parallel warming climate trendWed, 2 May 2012, 15:34:41 EDT - Warmer soils release additional CO2 into atmosphere; Effect stabilizes over longer term Sun, 20 Jan 2013, 16:32:52 EST

<urn:uuid:67f940d6-0eca-4b2d-a684-0c45a8168454>

Supernovas as Nuclear Pasta Factories ORNL team analyzes frustrated matter in stellar explosions The collapsing iron core of a giant star is a violent and confusing scene. Iron cannot fuel the nuclear fusion that has kept the star going for millions of years, so no energy is available to support the core against its own gravity. This is the event that triggers the star’s death in a stunning explosion. The collapse is over in a few thousandths of a second. In it, the innermost core, a portion half the mass of our sun, falls at up to 70 percent the speed of light until it becomes so dense that a teaspoon would weigh more than 300 Empire State Buildings. Then the core bounces—and what a bounce it is. The resulting shock wave takes the star, which may be up to 40 times as massive as the sun, and blows it into space, leaving behind a new-born neutron star or a black hole. This is a core-collapse supernova, one of the universe’s most impressive calamities, and one of its most valuable. Stars are the universe’s element factories and core-collapse supernovas are the distribution channels. We can thank them for most of the elements in our environment, and in our bodies. A battle of forces The supernova not only illustrates all of nature’s forces—from the gravity that extends across the universe to the nuclear force that binds and arranges the smallest building blocks of matter. It also illustrates what happens when these forces battle one another for dominance. The University of Tennessee-Knoxville’s (UTK’s) Jirina Stone and Helena Pais have adopted the most detailed and accurate model to date of one such battle. Using the lab’s Jaguar supercomputer, they simulated matter at the core’s bounce, when the shock wave starts to develop. The core is formed by a thick soup of neutrons, protons, and electrons, and up to 20 percent of the matter is believed to form into cylinders, sheets, bubbles and other odd forms. This is nuclear pasta—a form of frustrated matter—a rare ordering found within the supernova and in the neutron star that will be all that remains when it is over. For a split second as the star blows outward there will be a layer of these strange forms in the core about 100 kilometers from the center. The forces battling for supremacy of nuclear pasta are the Coulomb force and surface tension. Coulomb energy refers to the attraction or repulsion of electrically charged particles (think magnets); in this case it is pushing positively charged protons apart. Surface tension, on the other hand, is the internal pressures that pull liquids into the smallest possible area (think water droplets); in this case it is enticing the neutrons and protons to form coherent structures. Stone and Pais published their results in the October 12, 2012, issue of Physical Review Letters. The work also plays an important role in Pais’s doctoral thesis from UTK. “Imagine what happens,” said Stone. “When the neutrons and protons are close enough that the strength of the coulomb force and nuclear forces are comparable, the coulomb force is telling all the nucleons to get apart, while the surface forces are saying, ‘Come on, I want to keep you together.’ Because the Coulomb interaction is just repulsive, but the nuclear interaction is both repulsive and attractive, there is a competition between these controversial effects. One is saying, go apart, and the other is saying, no stay here.” As a result, this layer of the exploding star is dominated by odd shapes, resembling penne, lasagna, and bowties, as well as spheres and other not-quite-pasta shapes. Below the pasta is a very dense liquid of mainly neutrons. Above it is a particle gas of free neutrons, heavy nuclei and electrons. 30 million processor hours The team used an approach called Skyrme-Hartree-Fock, with Pais handling the calculations. All told, the project used 30 million processor hours on Jaguar, with each 12-hour run making use of 45,000 processor cores. The adaptation of the original code for use in this mode was provided by Reuben Budiardja of UTK’s National Institute for Computational Sciences, while ORNL’s Eric Lingerfelt helped implement the VisIt visualization package. “‘Hartree-Fock’ is the mathematical method that makes a description of systems made of many quantum particles possible to the best approximation,” Stone explained, “as exact treatment of such a system is currently beyond reach of the fastest computers in the world. The Skyrme interaction is a prescription of how nucleons talk to each other.” The model, called “3D-SHF-EOS,” was developed by Will Newton, former graduate student of Stone’s at England’s Oxford University and now an assistant professor at Texas A&M–Commerce. It assumes that all matter under the same temperature and density will behave the same, so it can be described using representative cells. “What we do in the model is say that the matter in the star can be modeled by a sequence of cubic cells—little cubes—which are connected to each other through something we call ‘periodic boundary conditions,’” Stone explained. “This means you go from one cell to another cell to another cell, and you just reproduce the situation in one cell to the other and so forth.” Each cell is a tiny cube, 25 quadrillionths of a meter on a side. By modeling a range of these cubes and calculating what happens to the matter under different temperature and density conditions, the project provides all the information needed by a supernova simulation to accurately describe the pasta phase of nuclear matter. “People before us suspected there was pasta,” Stone said. “People would assume a certain formation, like the sheet or a rod, and they would calculate the distribution in the cell and look at whether the energy of that cell is lower or higher than the energy of the uniform matter (no pasta), which they could also calculate. “What we do is assume absolutely nothing. We evolve shapes. This is our main contribution, because we evolve these formations without actually any assumptions about what should evolve under what conditions. Moreover, we actually show the onset of the pasta and the dissolution of pasta and can study the conditions at which the pasta appears and disappears.” The confirmation that nuclear pasta exists in the stellar environment adds to observations of frustrated matter in other areas—such as solid state physics, magnetism and biology—that also exhibit strange orderings of matter under the influence of conflicting forces. In addition, Stone’s and Pais’s work has at least two purposes beyond the fascination of the pasta itself. First, it is a valuable input into simulations of the exploding star itself. Second, it helps contributes to explanation of the cooling of the neutron star that is left behind. A matter of neutrinos Each of these has to do with neutrinos. Neutrinos are tiny, elementary, usually inconsequential particles that normally go on their way without interacting with other matter. They have no electrical charge. Their mass is very small. Billions go through your body each second and do nothing along the way. In the collapsed core of a supernova, however, neutrinos are a major byproduct of the collapse. They are so numerous and the matter around them so dense that the neutrinos power the explosion that blasts the star into space. Along the way, they cool the remnant neutron star by taking energy away from the collapsed core. Exactly how the neutrinos do their thing depends on the makeup of the matter they’re blasting through. This is where the model developed by Stone and Pais may be especially valuable. “Neutrinos play a big role in the core-collapse supernova,” Stone said. “The density at the bounce is such that the neutrinos for some fraction of a millisecond cannot get out. So, in principle, at first the neutrinos are trapped in the matter, but when the bounce releases the matter a little bit, the neutrinos will be able to pass through the core to propagate the shock. They carry a lot of energy. “At that point it matters what the composition of the star is, because the neutrinos behave differently if they pass through homogeneous matter or if they pass through these complicated structures. And this may affect the shock.” The output of the project is information that will refine the input conditions for supernova simulations currently used. “We will give them the numbers which they need,” Stone noted. “Pressure, chemical potentials, all the numbers they need. So this calculation has been done once forever, if you like.” Pais, Helena, and Jirina R. Stone. “Exploring the Nuclear Pasta Phase in Core-Collapse Supernova Matter.” Physical Review Letters 109.15 (2012): 151101.

<urn:uuid:3481e0d2-a669-4605-a9d3-5e891ca431ce>

Copyright protects original works and intellectual property. A work does not have to be published or registered to be protected—copyright automatically applies as soon as the work is created/expressed in a fixed or tangible way. Copyright laws give creators/authors the exclusive right to reproduce, sell, and publish their works. Copyright is signified with the symbol "©," although works do not require the display of the symbol to be protected. Generally, copyright lasts during the entirety of the author’s life, plus 70 years after their death. When it expires, the works enter the public domain. The basis for copyright comes from Article I, Section 8, Clause 8 in the U.S. Constitution, which gives Congress the ability “To promote the Progress of Science and useful Arts, by securing for limited Times to Authors and Inventors the exclusive Right to their respective Writings and Discoveries.” Copyright protects works in the following categories: This guide is an overview of basic copyright principles meant for students. It is not meant to be comprehensive or to substitute for legal advice. Copyright does not protect the following, although the full list is not limited to these examples: This guide was created by Sarah Schaffer, Class of 2020, as a Professional Writing internship project for the Rohrbach Library.

<urn:uuid:31851e5f-00e4-4cf5-85e5-6bbd3640ceba>

Meaning & Definition of Akimbo in English 1. (used of arms and legs) bent outward with the joint away from the body - "A tailor sitting with legs akimbo" - "Stood with arms akimbo" 1. With hands on hips and elbows extending outward - "She stood there akimbo"

<urn:uuid:3f6ef6fb-755d-4c98-9649-5f4ea7c0c07e>

What on the periodic table is a metal? In the periodic table, you can see a stair-stepped line starting at Boron (B), atomic number 5, and going all the way down to Polonium (Po), atomic number 84. Except for Germanium (Ge) and Antimony (Sb), all the elements to the left of that line can be classified as metals. Which elements are considered metals? These elements tend to have lower melting and boiling points than the transition metals (with some exceptions). - Nihonium: probably a basic metal. What are five metals on the periodic table? Why is chromium added to steel? Chromium (Cr): Chromium is added to steel to increase resistance to oxidation. This resistance increases as more chromium is added. 'Stainless Steels have a minimum of 10. Is nickel better than stainless steel? Is brushed nickel better than stainless steel? Brushed nickel can work in a wider variety of kitchen designs, but solid stainless steel is more durable. Also, brushed nickel will hide fingerprints a little bit better because of its color. Is nickel used in stainless steel? More than two thirds of global nickel production is used to produce stainless steel. As an alloying element, nickel enhances its important properties such as formability, weldability and ductility, while increasing corrosion resistance in certain applications. Is nickel in stainless steel harmful? An alloy composition, stainless steel combines a variety of metals, which contain chromium and nickel. ... This alloy strength helps pots and pans resist leaching, making them quite safe. Although the risk is minimal, poorly constructed stainless steel cookware can potentially leach a small amount of nickel into food. Is stainless steel cancerous? Safety of Common Cookware. Aluminum, cast iron, and stainless steel are great choices for cookware and cooking utensils. Although all metals may release into food, the amount is minimal, and these three options have little to no negative health effects associated. Which stainless steel is safe for cooking? Stainless steel cookware is generally recognized as a safe material for cookware. Any good quality stainless steel, be it 304 or 316 stainless steel, is a better choice than most of the other available materials. For example, coated aluminum pans lose their non-stick over time. Can you get metal poisoning from stainless steel? Unfortunately, yes. Through normal wear and tear, the metals in stainless steel will leach into food (source). Cooking acidic foods will cause the pot to leach higher amounts. In general, nickel leaches in higher amounts than the other metals. Which metal is safe for cooking? Is listening to metal bad for you? A new study has found that heavy metal has a ton of health benefits for its fans. For as long as the genre's been around, parents, teachers, and moral grandstanders have tried to make heavy metal out to be literally poisonous. Can you get heavy metal poisoning from gold? Additional metals that may cause poisoning include antimony, aluminum, barium, bismuth, copper, gold, iron, lithium, platinum, silver, tin, and zinc. What are the signs of heavy metal poisoning? What are the symptoms of heavy metal poisoning? - abdominal pain. - shortness of breath. - tingling in your hands and feet. Where is gold found in nature? Gold is primarily found as the pure, native metal. Sylvanite and calaverite are gold-bearing minerals. Gold is usually found embedded in quartz veins, or placer stream gravel. It is mined in South Africa, the USA (Nevada, Alaska), Russia, Australia and Canada. Where is gold most commonly found? About 244,000 metric tons of gold has been discovered to date (187,000 metric tons historically produced plus current underground reserves of 57,000 metric tons). Most of that gold has come from just three countries: China, Australia, and South Africa. The United States ranked fourth in gold production in 2016. - How many metals are in the periodic table? - How do metals react with oxygen give examples? - What are the 5 physical properties of metals? - What is the difference between a metal and a nonmetal? - What are the top 5 military medals? - What are 4 physical properties of metals? - Which is the oldest metal? - What are the five non-metals? - Which metal is most likely to form a positive ion? - What is produced when a metal reacts with an acid? You will be interested - What are the three types of metals? - What is likely to lose electrons? - What materials are non magnetic? - What is the definition of metal in science? - Which are the two soft metals? - Which elements has lowest melting point? - What are three examples of poor heat conductors? - How are metals different from metalloids? - Which metal is liquid in room temperature? - What type of elements have high electronegativity?

<urn:uuid:f88796a2-eeef-4cfb-a294-886a6e4c1b69>

“Computer games in the lives of children of senior preschool and younger school age” 1. The differences between computer games from traditional Modern children, choosing between traditional and computer games, often prefer the latter. In terms of content, the computer games are in many respects similar to traditional, but they also have fundamental differences: – many computer games are based on the principle of gradual complication of gaming and didactic tasks, like holding the child in the “zone of proximal development”; – “phasing” in the programme, often allows the child to progress to the next stage without performing the tasks of the previous level. In some games you can use “menu” to arbitrarily choose the level of difficulty of the job. In other games, the program adapts to the child and offers him a new job with the light of his previous answers: more complicated if the jobs are successful, and Vice versa; Continue reading The technique is intended for diagnostics of interaction between parents and children. The questionnaire allows us to determine not only the evaluation of one party — the parents, but also the vision of interaction with the other side — from the position of children. Description of the method Questionnaire “Interaction parent – child” is a “mirror” and contains two parallel forms: for parents and for children. In addition, there are two versions of the questionnaire: Option for Teens and their parents; Option for parents of preschool children and Junior pupils. Thus, the questionnaire has three forms: one baby and two adults, 60 questions each. The text of the questionnaire includes 10 scales – criteria to assess the interaction of parents with children. For each scale version of the questionnaire for adolescents have equal number of questions, except for two, which allocates the majority of researchers, and which can be considered basic in the parent-child relationship. This is the scale “autonomy-control” and “rejection-acceptance”, was composed of 10 statements, and in the rest of the scale — 5 claims. Continue reading On the influence of the full moon on the body The moon affects humans? Some are skeptical, others submit my life to the lunar calendar. Who is right? Remember the school geography lessons, which taught that the tides in the seas and oceans are directly dependent on the phase of the moon. But man, as we know 80% water and this means that whether we like it or not, and the phases of the moon do have a certain impact on us. It manifests itself most acutely when the Earth satellite is in the phase of full moon. People have long noticed that in this period, emotions are sharpened, the tides of joy or despair can arise suddenly, and the inexorable statistics show that the highest percentage of suicides occur at this time, as well as the exacerbation of various chronic diseases and primarily mental. No wonder the human imagination ascribes to increased activity at a time when there is a full moon, all sorts of undead: ghouls, ghouls, werewolves and witches. A lunar month consists of four phases: new moon, full moon . growing and waning moon. The first day of the moon marks the beginning of new moon. 7-8 lunar day of first quarter of the lunar month, full moon 14th and 17th day of the moon. Third quarter – 22 and 23 lunar days. Fourth quarter – the end of the lunar month. If you decided Continue reading

<urn:uuid:43a9ad42-f15e-48c5-9b8f-38f013d559cb>

The skills developed by different sections of the engineering trade had their origins in millwrights' work. Millwrights worked most of the time in wood rather than metal. They had to make everything themselves from scratch, customised to that particular job. Differentiation in the engineering workers’ trades began to appear as industrial areas developed in the first half of the 19th century. There was a division of labour into: Pattern makers - made wood patterns or models for foundry use - Iron founders – workers in molten ferrous metal, generally working within a foundry - Brass founders - melted brass to liquid and poured into moulds, made forms and sand moulds around the forms, sanded and polished - Smiths – a craftsman fashioning useful items out of various metals eg tools, weapons - Hammer men – wielded the hammer (heavy) in metalworking - Firemen – tended the fire in a foundry - Vice men – smiths who worked at a vice instead of an anvil - Filers (as fitters were originally called) and turners - highly skilled craftspeople who constructed, assembled and fitted components for machinery, vehicles etc. Present day fitters, in comparison with other traditional trades, work in an environment of high accuracy. In some cases they may be required to machine and fit a component within the tolerance that is less than the thickness of a human hair! Library co-founder Edmund Frow was an engineer. To quote his obituary in The Times, 'He left school at 14 and, after a year's industrial training course, began work as an apprentice in the drawing office of an engineering firm. He was to become a skilled engineer, reputed by his colleagues to have the finest kit of tools of any man in the industry'. As a staunch trade unionist and a Communist Party member Eddie found it even more difficult than others to find work in the years of mass unemployment of the late 1920s and early 1930s, and he became active in Salford's Unemployed Workers` Movement. He resumed work in the engineering industry in the mid-1930s and until his retirement in 1971 his main activities were focussed on his union, the Amalgamated Engineering Union. Related Object of the Month May 2012: Photograph of 1934 Manchester wiredrawers' strike To mark the Library's Museums at Night ‘campaigning` event on 19 May, involving photographer Simon Roberts, our Object of the Month is taken from our extensive photographic collections and shows a mass meeting. This photo dates from 1934, during the nine-month strike by 650 workers at the firm of Richard Johnson & Nephew Ltd., Wiredrawers, of Forge Lane, Bradford, Manchester. Resources about Engineering and electrical work in the library collection Committee on Industry and Trade, Survey of metal industries: iron and steel, engineering, electrical manufacturing, shipbuilding with a chapter on the coal industry - being part IV of a survey of industries (1928) - Shelfmark: C06 Ronald S Edwards and RDV Roberts, Status, productivity and pay, a major experiment: a study of the electricity supply industry's agreements and their outcome, 1961-1971 (1971) - Shelfmark: K27 Labour Party, Reorganisation of the electricity supply industry (1932) - Shelfmark: AG Labour Party Box 15 Samuel Smiles (ed), James Nasmyth, engineer: an autobiography (1883) - Shelfmark: B17 Laurence Meynell, Thomas Telford: the life story of a great engineer (1957) - Shelfmark: B20 Richard Winder, Reminiscences of an engineer at home and abroad (no date) - Shelfmark: C04 Barbara Drake, Women in the engineering trades - a problem, a solution and some criticisms; being a report based on an enquiry by a Joint Committee of the Labour Research Department and the Fabian Women's Group (1918) - Shelfmark: B30 Labour Research Department, Labour and capital in the engineering trades (1922) - Shelfmark: A53 ML Yates, Wages and labour conditions in British engineering, (1937) - Shelfmark: D30 LTC Rolt, Victorian engineering (1974) - Shelfmark: I30 Samuel Smiles, Lives of the engineers: with an account of their principal works - comprising also a history of inland communication in Britain, 3 vols (1861) - Shelfmark: C07 Joseph Nasmith, George Stephenson: mechanical practicality and modern speed - a lecture delivered at New Islington Hall, Manchester, before the Ancoats Recreation Society, on Sunday, December 11th, 1898 (1898) - Shelfmark: AG Ancoats Brotherhood Box 1

<urn:uuid:ed5ba176-76b5-4835-84eb-49b67f84a5b1>

Protecting Our Planet through Climate Action on Multiple Fronts Minister Lee Ying-yuan Environmental Protection Administration Republic of China (Taiwan) says Climate change is a scientific fact, and its effects are already being distinctly felt around the world, threatening human health, the places we inhabit, and the sustainability of our socioeconomic systems. This includes Taiwan, which this year alone has experienced several extreme weather events. In early June, Sanzhi District in New Taipei City, northern Taiwan, received 615 mm of heavy rain in just nine hours, while the mountainous regions around Kaohsiung in southern Taiwan received a record 1,446 mm in total.In late July, two typhoons (Nesat and Haitang) struck the island in close succession, a rarely seen event resulting in a record 690mm of rainfall in the southern coastal region of Pingtung’s Jiadong township over a three-day period. This long-duration high-intensity rain broke records and caused serious property damage. Then, in August, northern Taiwan suffered a heat wave with sustained temperatures of above 37°C, surpassing all heat waves recorded over the last 100 years. International scientific reports have also confirmed that average global temperatures in 2016 were the hottest on record. These examples offer irrefutable evidence thatclimate change is real and already happening, with dire consequences. However, we must not feel all is lost. Rather, we must recognize that the planet’swellbeing is inextricably linked to humanity’s survival,and seize the opportunity totransform the way we live through direct actions. Taiwan, an island nation, is heavily exposed to theworst effectsof climate change. In response to global calls for climate action, we haveintroduced the Greenhouse Gas Reduction and Management Act, and formulatedthe National Climate Change Action Guidelines on how tocontrol and reduce greenhouse gas emissions. Meanwhile, the subsequent Greenhouse Gas Reduction Action Plan targets six major areas—energy, manufacturing, transportation, residential and commercial property, agriculture, and the environment—with over 200 policy initiatives, manyof them cross-ministerial. The Guidelines also call for regular five-year reviews to ensureeffective management. In order to build capacity for clean energy generation in Taiwan and improve air quality, the government has set an ambitious target of an overall energy mix of 20 percent renewables and 50 percent natural gas,with coal dropping to 30 percent, by 2025. Similarly, it has amended the Electricity Act to spur the development of green energy, adopted the Energy Development Guidelines and,through public participation, developed the Energy Transformation White Paper to help accelerate the transition.It also provides incentives,such as those involving financing, investment capital, funding channels, and personnel training, to enlist the help of business and industry in developing green energy technologies. In short, Taiwan is doing all it can to combat climate change in line with the Paris Agreement, and is striving to cut carbon emissions to 50 percent of 2005 levels by 2050. In the endless pursuit of economic development, societies the world over have made excessive use of fossil fuels and squandered Earth’s natural resources.We are paying a heavy price today with not only climate change, but also serious environmental destruction and pollution. Taiwan’s efforts over the years to promote recycling and waste reduction has caught the world’s attention. In May 2016, the Wall Street Journal published an article entitled “Taiwan: The World’s Geniuses of Garbage Disposal.” It points out that Taiwan, once dubbed Garbage Island, has since become a recycling poster child, ranking among the top three countries in the world for its initiatives to promote a circular economy. These include creating an industrial value chain, setting up special circular economy zones,and exploring business opportunities to make the necessary industrial transformation. It is hoped that,by 2022, Taiwan will have become a circular economy hub in Asia, with a healthy regenerative economy that can continue to grow while reducing waste, and help light the way towards a sustainable world. Leaders around the world, including the Pope, are increasingly calling for more to be done to combat the threats brought by climate change. The leader of Taiwan, President Tsai Ing-wen, has pledged that this country will be an unrelentingly positive force in pursuing the solutions so desperately needed to preserve our planet for future generations. Through bilateral agreements and multilateral cooperation, Taiwan has for a long time now quietly gone about fulfilling its role as a responsible member of the international community. We want nothing more than to work with other countries, and do all that can be done to tackle climate change. We will happily share our experience and knowledge in environmental protection, particularly with those countries that really need help. Taiwan wants to be a contributor to the green energy policies, green industries, and green employment we must create to protect our planet.

<urn:uuid:ede22bbd-abf3-46d3-ad91-9791cf30d4d2>

High-level concurrency features were introduced with version 5.0 of the Java platform. Most of these features are implemented in the new java.util.concurrent Most of the executor implementations in java.util.concurrent use thread pools, which consist of worker threads. This kind of thread exists separately from the Runnable and Callable tasks it executes and is often used to execute multiple tasks. Using worker threads minimizes the overhead due to thread creation. Thread objects use a significant amount of memory, and in a large-scale application, allocating and deallocating many thread objects creates a significant memory management overhead. One common type of thread pool is the fixed thread pool. This type of pool always has a specified number of threads running; if a thread is somehow terminated while it is still in use, it is automatically replaced with a new thread. Tasks are submitted to the pool via an internal queue, which holds extra tasks whenever there are more active tasks than threads. ScheduledThreadPoolExecutor is an executor class defined in java which can additionally schedule commands to run after a given delay, or to execute periodically.

<urn:uuid:7b7a5386-b7dd-42ee-82b4-5902b5b9f6ed>

collectively, the very robust, regionally differentiated human populations that lived in Europe, Asia, the Middle East, and Africa from 35,000 to 200,000 years ago. any physically robust, premodern form of the genus Homo, including Homo sapiens neanderthalensis (Neanderthal man) or Homo erectus, and their intermediate forms and regional variants. What Is The Difference Between Archaic And Obsolete Words?The meaning of these temporal labels can be somewhat different among dictionaries and thesauri. The label archaic is used for words that were once common but are now rare. Archaic implies having the character or characteristics of a much earlier time. Obsolete indicates that a term is no longer in active use, except, for example, in literary quotation. Obsolete may apply to a word regarded as no longer acceptable or useful even though … Dictionary.com Unabridged Based on the Random House Unabridged Dictionary, © Random House, Inc. 2019

<urn:uuid:8f47d704-e0a6-4e87-8c91-897cf6461aff>

What are black holes? Are they really monsters that devour everything? Why are astronomers at the University of Southampton so interested in these beasts? Black holes; galaxies; radio astronomy; X-ray astronomy; Electromagnetic spectrum In this talk we will discuss the two different types of black holes, the small, sun-sized black holes which are numerous in our galaxy, and the supermassive black holes which exist at the centre at every galaxy. We will focus on a particularly ‘active’ black hole which has jets which extend from the black hole, and can be seen using radio telescopes. In this talk we will also discuss how astronomers use the electromagnetic spectrum to look at the universe as a whole, and the spin off technology that resulted from using radio astronomy to study black holes. Because these supermassive black holes exist at the centre of every galaxy it is important that astronomers understand why these supermassive black holes are there in the first place. They also need to find out the part the black holes play in the formation of the galaxy itself, and if star formation in the galaxy is linked to the ‘cooling’ of the galaxy. Does this ‘cooling’ happen as a result of energy removed from the galaxy by the black hole. Black holes; binary blacks holes; super massive black holes; radio astronomy; electromagnetic spectrum. Years 12 and 13 Learn more about the Soton Astrodome, a mobile planetarium which could visit your school for free.Find out more

<urn:uuid:8419d5c3-73fd-492a-99d3-a5e0fdcb2294>

Green roof on other side of wall made of glass and solid panels which create light and shade for optimum climate. Photo: Martin Dee The University of British Columbia has opened the most sustainable building in North America, a $37-million “living laboratory” that will help to regenerate the environment and advance research and innovation on global sustainability challenges. The Centre for Interactive Research on Sustainability (CIRS) is one of only a handful of buildings worldwide that will provide “net positive” benefits to the environment. It reduces UBC’s carbon emissions, powers itself and a neighboring building with renewable and waste energy, creates drinking water from rain and treats wastewater onsite. CIRS will be an international centre for research, partnership and action on sustainability issues, including green building design and operations, environmental policy and community engagement. Researchers will study users’ interactions with the facility to improve building performance, maximize the happiness, health and productivity of its inhabitants and advance best green building practices at UBC and beyond. Quick facts about CIRS: - Natural lighting: CIRS’ U-shape design maximizes natural daylight and fresh air for inhabitants, who control their environment (light levels, temperature) with their computers. - Flexible workspaces: With power, data and ventilation under modular floorboards (instead of through walls or ceilings) at each workspace, offices can be reconfigured overnight. - Green IT: CIRS has no desktop computers or servers guzzling energy. Inhabitants “remote access” into desktops, drives and servers, which are stored “in the cloud” instead. - Psychology: One of many research projects is a study of CIRS’ influence on thoughts and behaviors and science-based methods for encouraging people to act sustainably. CIRS’ “net positive” environmental impacts: - Energy: By capturing energy from the sun, the ground and the nearby Earth and Ocean Sciences (EOS) building, CIRS heats itself and returns 600 megawatt hours of surplus energy back to campus. - Operational carbon: CIRS’ operations require no fossil fuel and the surplus energy CIRS returns to EOS removes an additional 150 tonnes of GHG emissions annually through reduced natural gas use. - Structural carbon: CIRS’ wood structure locks in more than 500 tonnes of carbon, offsetting GHG emissions from non-renewable materials used in the building’s construction, including cement, steel and aluminum. - Water: CIRS will satisfy the water needs of 200 inhabitants, plus hundreds of auditorium and café users, by capturing rain and treating it onsite. Water that can’t be used for drinking will recharge the local aquifer.

<urn:uuid:db4cd417-0181-48f7-b8bf-a3abfdb03fc4>

The following is a guest post presented with permission from the author, Dr. Ernesto Fernandez. Multiple Sclerosis (MS) is a debilitating disease of the central nervous system that disrupts communication between the brain and body and is often accompanied by secondary conditions like pain, muscle weakness, vertigo, headache, and visual disturbances. It is considered a demyelinating disease which means it destroys part of your nerve cells called myelin — the protective coating that increases the speed of signals traveling through them. MS is unique in that it is chronic and relapsing in nature. It is believed to result from an autoimmune response where the body’s own immune system attacks its nerve tissue. This demyelination (known as plaques) can be seen on advanced imaging in the brain as well as the spinal cord primarily in the neck region. Other diagnostic hallmarks of this condition include something called oligoclonal bands found in the cerebrospinal fluid, which leads us into some interesting theories when talking about the upper neck. While the cause and the cure are yet unknown, there are some interesting aspects of MS to consider. For decades cases have been written discussing the correlation of head and neck injuries like whiplash and the onset of MS. Some of these cases have even ended with large settlements in court. While there is still no causal link between these injuries and MS, scientists like Dr. Charles Poser of Harvard state that these injuries may act as a trigger in already susceptible individuals. By understanding the mechanisms of whiplash, we can begin to build a theoretical framework around how these injuries may contribute to the pathogenesis or exacerbation of multiple sclerosis. In a whiplash trauma, the neck is forced into hyper-extension and then hyper-flexion. Even at speeds as slow as 8mph, this acceleration-deceleration force can cause the head to move 18 inches at a force as great as 7 G’s. The damage occurs due to the transfer of energy through the spinal column and not simply the impact itself. This rapid change in the cervical spine causes over-stretching of the spinal cord and shearing of the nerve fibers. In research, this is known as a traumatic axonal injury. This mechanical injury causes a chemical and inflammatory reaction in the spinal cord that may be the tip of the iceberg for those already susceptible to multiple sclerosis. Besides the spinal cord injury itself, muscle strain, ligament damage, and structural misalignments (subluxation) also occur during a whiplash that contribute to the lasting effects on the nervous system and how it will recover. Another interesting connection between whiplash and MS involves something called cerebrospinal fluid. As we mentioned before, this fluid acts like a cushion to the brain and spinal cord during movement. It has also recently been discovered as the Glymphatic system, in that it works as a waste clearance system for the brain and spinal cord, much like the immune system. This system functions mainly during sleep, and works by eliminating cellular debris, metabolic waste, and distributing a variety of biochemical compounds throughout the nervous system. Studies show changes in biological markers in CSF following trauma to the cervical spine. Rapid changes in pressure in CSF during whiplash injuries can also cause physical damage to the nerve fibers of the spinal cord and brain. One of the most interesting mechanisms being studied is obstruction of cerebrospinal fluid flow. Using advancements in imaging, companies like FONAR have made amazing discoveries in CSF dynamics and diseases by looking at the spine with upright functional MRI. Researchers Raymond V. Damadian and David Chu discovered that when scanning a patient with MS, there was a build-up of CSF in the ventricles of the brain. Coincidentally in MS, the plaque-like lesions are usually concentrated adjacent to the ventricles in the brain. Upon investigating the history of several patients with the same image findings, almost all of them had suffered some form of traumatic injury to the neck in their past. Since then, many researchers like Dr. Michael Flanagan and Dr. Scott Rosa have conducted studies on the compelling hypothesis that obstructions to cerebrospinal fluid can cause a build-up in pressure in the ventricles of the brain and caused a leak of fluid into the brain tissue. This fluid also contains proteins, some of which are known to be antigens that can stimulate antibody production. Could this leakage of fluid stimulate an immune complex reaction in the brain and nerve tissue like what is seen in autoimmune conditions, thereby triggering the genesis of MS? Could past trauma like a whiplash affect the structural alignment and integrity of the upper cervical spine and contribute to the blockage of CSF flow? If these structural misalignments are not corrected, is it plausible that the inflammatory cascade from the mechanical injury to the spine and brain during the whiplash will continue and progress into a chronic condition? Advanced imaging has demonstrated that it’s anatomically plausible. Imaging studies have shown that when the atlas vertebra shifts in a rotational direction, the transverse process may compress a major venous pathway from the brain. By putting all of this together we can reach a very fascinating discovery for the 400,000 people affected by MS in the United States. It is possible that a past head or neck injury, like whiplash, may leave behind structural displacements of the upper neck — which contribute to the chronic obstruction of what is now known as the immune clearance pathway of the nervous system. These changes, over time, may very well be what triggers the onset and progression of neurodegenerative diseases like Multiple Sclerosis. Further study is warranted investigating this mechanism and the implications of fluid dynamics.

<urn:uuid:d45f5362-e133-4d03-b9e1-35f6705a4773>

The legend of Atlantis was presented to us by Plato and seems to be half history and half imagination. Very often the destruction of Thera is identified with the sinking of mythical Atlantis. The real fact of the submergence of Santorini or other islands in the Aegean Sea during an eruption of the volcano, together with the imagination or wish for a Perfect City may explain the legend. The legend which Plato presented in his dialogues Timaios and Kritias is a story which was told to Kritias by his great-grandfather, who had heard it from his father Dropidas and he from the sagacious legislator Solon. According to the story Atlantis was an extensive insular continent whose inhabitants had developed an exceptionally high standard of civilization. The unique power of the kings of Atlantis was not only confined to their own continent but extended to the surrounding islands and they controlled part of Libya, as far as Egypt, as well as part of Europe up to Tyrrhenia (Northern Italy). From the days of Plato to the present day many attempts have been made to interpret the myth or even to rediscover Atlantis. Thousands of studies and articles have been written on this subject. The fact is that Plato, through the myth, presented to his fellow-citizens a paradigm of an ideally organized state which flowered and prospered for as long as men respected and enforced the laws and worshipped the gods who had given them the legislation. However, when the men became arrogant and ceased to obey the laws of their state the wrath of the gods was such that they were condemned to annihilation. Nevertheless, Atlantis can be more than true, at least within our imagination. It is believed that Atlantis was very close to Santorini.

<urn:uuid:6b910043-623c-4407-a508-1e66bb74b29d>

Table of Contents : Top Suggestions Create Letter Tracing Worksheet : Create Letter Tracing Worksheet Children create a mini alphabet book of their own with this sweet tracing activity first children will trace all 26 lowercase letters of the alphabet then with the help of an adult they will This worksheet takes him through each step first read the directions aloud and try to spot the letter o in a sentence then trace the letter o work slowly and carefully as this important letter However if we do not care about output a s state in the six non specified truth table rows we can fill in the remaining cells of the karnaugh map with don t care symbols usually the letter x and. Create Letter Tracing Worksheet A killer feature is an interactive element that lets students view a video of how to pronounce a letter sound will be able to trace words on the drawpad where they currently respond to lesson Create seven charts by attaching the images to the tops of any folder or science notebook can hold students writing and worksheets in an organized way select one image to observe for a few From childcare to high school what to do if you don t like your kid s friend flexible work arrangements create even more pressure for parents children make you happier as long as you can. Create Letter Tracing Worksheet Opinions may differ about what a healthy balanced lunch box look like plus parents sometimes feel pressure to create instagram worthy lunches for their kids one father has been left fuming Some people are born to create like katie harms we work across many mediums good old trace paper and sketches 3d modeling on the computer and bim building integrated modeling While jupyter s purpose is to collect data from various software the malicious code supporting its delivery can also be used to create a backdoor a jupyter attack tracing the evolution. Through contact tracing and case management data capacity limits and a directive to create contingency plans and preregister we know that personal interaction is an important part Biden pledged during the campaign to make testing free and widely available to hire thousands of health workers to help implement contact tracing programs force will create a plan built While biden greeted the news with cautious optimism president donald trump took to twitter to herald the moment with capital letters exuberance implement contact tracing programs and. Custom Word Tracing Worksheet Create Custom Printables Word Tracing Form For Homeschool Preschoolers Toddlers Fine Motor Skills Create Your Own Tracing Letters Worksheets Download Create Your Own Tracing Letters Worksheets Below Each Worksheet Is Focused On Tracing And Finding Out How To Write One Letter At Any Given Time The Worksheet Teaches The Formation Of Both Capital And Small Case Letters This Assists In Mastering The Correct Height And Measurements Of Letters To Make Consistency On Paper Tracing Each Letter Also Teaches The Right Spacing Between Characters To Avoid Writing Letters Too Close Together Or Far Apart Which Could Create Problems When It Tracing Worksheet Maker Education If You D Like Guidelines On Your Tracing Worksheet Select Use Guides In The Check Box Below Be Sure To Capitalize Letters That You Would Like Students To Trace As Capital Letters Exceeding 10 Rows Of Entries May Cause Formatting Issues As You Work Click Create To Generate A Preview Of Your Tracing Worksheet To The Right Click Create Again To Update The Worksheet With Additional Changes Tracing Letters Worksheet Maker Tracinglettersworksheets Download Tracing Letters Worksheet Maker Below Each Worksheet Is Committed To Tracing And Understanding How To Write One Letter At Any Given Time The Worksheet Teaches The Formation Of The Capital And Small Case Letters This Assists In Learning The Right Height And Size Of Letters To Form Consistency On Paper Tracing Each Letter Also Teaches The Correct Spacing Between Characters To Alphabet Tracing Worksheets Free Handwriting Practice Alphabet Tracing Worksheets For Uppercase Letters A To Z This Includes 26 Pages One For Each Letter Of The Alphabet Each Page Features An Uppercase Letter With Arrows To Guide Students On How To Write The Letter Correctly Students Should First Trace The Letters And Then Write The Letters On Their Own At The Bottom Of The WorksheetAlphabet Tracing Worksheets A Z Free Printable Bundle Alphabet Tracing Worksheets A Z There Is One Printable Letter Tracing Worksheet For Every Letter Of The Alphabet Plus One Page That Contains All The Letters Upper And Lower Case At The Same Time These Worksheets Are A Great Quick To Go Activity Fast To Print And Use You Can Also Choose To Laminate Them And Use Them With Dry Erase MarkersName Tracing Worksheet Generator Collection Name Tracing Worksheet Maker Worksheets For 1st Grade Social Stu S Cursive Writing Worksheet Creator Luxury Chart Printable Kindergarten Worksheets Generator Name Tracing Worksheet Maker Free Printable Name Tracing Trace Words Tracing Name Worksheet Impressive Best Tracing Letter Tracer Letter Tracer Sheets Letter Tracing WorksheetsAmazing Handwriting Worksheet Maker Automatically Make Stunning Handwriting Worksheets Saving You Hours Of Time Choose From All Common Printing Styles Including Block Print D Nealian Style And Cursive Connected Letters Click The Make Workseet Button And Presto Instant Handwriting Worksheets Free Of Charge Custom Name Tracing Worksheet Create Custom Printables Free Editable Name Tracing Worksheet Practice Printable Home Editable Worksheets Name Tracing Worksheet Name Tracing Form Free Custom Name Tracing Practice Worksheet Printable From Preschool Level And Up Name Examples John Mary Jane Sam Smith Click On Navigation Icon To Select A Name To Auto Insert You Can Manage A Name List By Registering For A Free Account Name Repetition Tracing Print Handwriting Worksheetworks Tracing Print Handwriting Practice Writing Words In Print By Tracing This Generator Lets You Create Handwriting Practice Sheets With The Text You Provide Enter The Words You Want To Practice With In The Large Text Box Below One On Each Line Hint You Can Create Blank Practice Lines With Blank Lines In The Text Box The Other Options Let Create Letter Tracing Worksheet. The worksheet is an assortment of 4 intriguing pursuits that will enhance your kid's knowledge and abilities. The worksheets are offered in developmentally appropriate versions for kids of different ages. Adding and subtracting integers worksheets in many ranges including a number of choices for parentheses use. You can begin with the uppercase cursives and after that move forward with the lowercase cursives. Handwriting for kids will also be rather simple to develop in such a fashion. If you're an adult and wish to increase your handwriting, it can be accomplished. As a result, in the event that you really wish to enhance handwriting of your kid, hurry to explore the advantages of an intelligent learning tool now! Consider how you wish to compose your private faith statement. Sometimes letters have to be adjusted to fit in a particular space. When a letter does not have any verticals like a capital A or V, the very first diagonal stroke is regarded as the stem. The connected and slanted letters will be quite simple to form once the many shapes re learnt well. Even something as easy as guessing the beginning letter of long words can assist your child improve his phonics abilities. Create Letter Tracing Worksheet. There isn't anything like a superb story, and nothing like being the person who started a renowned urban legend. Deciding upon the ideal approach route Cursive writing is basically joined-up handwriting. Practice reading by yourself as often as possible. Research urban legends to obtain a concept of what's out there prior to making a new one. You are still not sure the radicals have the proper idea. Naturally, you won't use the majority of your ideas. If you've got an idea for a tool please inform us. That means you can begin right where you are no matter how little you might feel you've got to give. You are also quite suspicious of any revolutionary shift. In earlier times you've stated that the move of independence may be too early. Each lesson in handwriting should start on a fresh new page, so the little one becomes enough room to practice. Every handwriting lesson should begin with the alphabets. Handwriting learning is just one of the most important learning needs of a kid. Learning how to read isn't just challenging, but fun too. The use of grids The use of grids is vital in earning your child learn to Improve handwriting. Also, bear in mind that maybe your very first try at brainstorming may not bring anything relevant, but don't stop trying. Once you are able to work, you might be surprised how much you get done. Take into consideration how you feel about yourself. Getting able to modify the tracking helps fit more letters in a little space or spread out letters if they're too tight. Perhaps you must enlist the aid of another man to encourage or help you keep focused. Create Letter Tracing Worksheet. Try to remember, you always have to care for your child with amazing care, compassion and affection to be able to help him learn. You may also ask your kid's teacher for extra worksheets. Your son or daughter is not going to just learn a different sort of font but in addition learn how to write elegantly because cursive writing is quite beautiful to check out. As a result, if a kid is already suffering from ADHD his handwriting will definitely be affected. Accordingly, to be able to accomplish this, if children are taught to form different shapes in a suitable fashion, it is going to enable them to compose the letters in a really smooth and easy method. Although it can be cute every time a youngster says he runned on the playground, students want to understand how to use past tense so as to speak and write correctly. Let say, you would like to boost your son's or daughter's handwriting, it is but obvious that you want to give your son or daughter plenty of practice, as they say, practice makes perfect. Without phonics skills, it's almost impossible, especially for kids, to learn how to read new words. Techniques to Handle Attention Issues It is extremely essential that should you discover your kid is inattentive to his learning especially when it has to do with reading and writing issues you must begin working on various ways and to improve it. Use a student's name in every sentence so there's a single sentence for each kid. Because he or she learns at his own rate, there is some variability in the age when a child is ready to learn to read. Teaching your kid to form the alphabets is quite a complicated practice. Tags: #pdf alphabet tracing worksheets#preschool letter w tracing worksheets#alphabet letter j tracing worksheets#alphabet letter k tracing worksheets#free uppercase letter tracing worksheets#lowercase letter a tracing worksheet#easy tracing worksheets#preschool letter x tracing worksheets#alphabet and number tracing worksheets#printable spanish alphabet letter tracing worksheets

<urn:uuid:7517ef3a-8aa4-482d-a3bc-816e648c731f>

Whether intentional or not, an unborn child exposed to x-rays are exposed to electromagnetic radiation. Ultra-violet radiation and microwaves have degrees of energy, x-rays possess the most. X-rays can cause the material of which it is passing through to become charged. This could result in damage of cells or DNA in living matter. According to Health Canada, the safest x-rays to receive are those involving the chest, teeth, neck and limbs. Although x-rays to abdomen, lower back, pelvis and kidneys may direct radiation near or through the fetus, these generally use little amounts of radiation. x-rays to be careful of are the abdominal or pelvic CT. If it can not be avoided and must be done there are techniques to expose the fetus to as little radiation as possible. In Canada, a fetus is exposed to about 0.5mGy of natural background radiation. Due to the rapidly changing and dividing cells, a fetus stands a greater chance of damage. If there is a change, there is an increased chance of birth defects, including leukemia. Damage to the DNA could result in childhood cancer, mental defects, and miscarriage. Reduce the risks of exposing your fetus by making sure to tell your doctor you pregnant prior to any x-rays. If your unsure and think you may be pregnant, take a test. There are tests that are ultra sensitive for earlier detection. If you must have an x-ray during pregnancy, make sure to inform the technician so they can take appropriate protective measures.

<urn:uuid:809ed3ff-ce79-4189-9259-80dfa44f5283>

Moving in fast and furious, Hurricane Irene is expected to produce rainfall of 5 – 10 inch accumulations across Puerto Rico, the Virgin Islands, the Dominican Republic, Haiti, the Southeastern Bahamas and The Turks and Caicos Islands. Isolated maximum amounts of rainfall may reach up to 20 inches. Word from NASA and National Hurricane Center: When a satellite can see a hurricane’s eye clearly from space, that’s an indication of a strong tropical cyclone and the GOES-13 satellite saw just that in Hurricane Irene this morning as she became a major hurricane. An animation of GOES-13 satellite imagery released from NASA today shows Irene’s transition into a powerhouse and pinpointed when her eye became visible from space. Hurricane Irene reached Category 3 status, with 115 mph winds this morning, the threshold for a major hurricane, at 8 a.m. EDT, August 24, 2011. It is headed toward the Crooked and Acklins Islands in the Bahamas. Irene is expected to strengthen based on forecasts by the National Hurricane Center (NHC). The current forecast track for Hurricane Irene predicts the storm to make landfall in eastern North Carolina as a major hurricane by Saturday, August 27, 2011. Please note: Category three hurricanes can cause “devastating damage” according to the NHC’s webpage. The Deadliest, Costliest, and Most Intense United States Tropical Cyclones, ranging from 1851 to 1900s killer weather system, Gavleston Hurricane into 2010, alongside other frequently requested hurricane facts is included here as a PDF document compiled by the NHC. Vintage Allies suggests a battening down of the hatches. Be prepared, take all safety precautions to stay safe.

<urn:uuid:87c372b8-933a-4c03-b3a4-e5f8543127c2>

Osteoporosis is a medical condition which is characterized by a decrease in the density of bones. As a result of osteoporosis, the bones become fragile and bone strength considerably consistently decreases in the person. In osteoporosis, bones become abnormally porous such that it can be compressed like a sponge. Needless to say osteoporosis weakens the bones, and as a result of it frequent fractures are experienced by the individual. Osteoporosis is mainly a disorder of the skeleton. Osteopenia is a condition of bone that is a bit less denser than normal bone but not to the degree of bone in osteoporosis. Normal bone is classically composed of protein, collagen fibres and calcium, all of which consecutively provide strength to the bones. The bones which are targeted by osteoporosis can break or fracture with a relatively minor injury, that normally would not cause a bone to break. Osteoporosis can result after a bone marrow transplant. If you compare bone marrow transplant in India cost with that in other countries you will surely be benefitted by your medical tourism in India. The fracture lead by osteoporosis can be either in the form of cracking as in hip fracture, or collapsing as in compression fracture of the vertebrae of the spinal cord. The spine, hips, ribs and wrists are common areas of bone fractures from osteoporosis. Although osteoporosis related fractures can occur in almost any skeleton bone of the body. So to be brief, osteoporosis is actually a disease of bones that can lead to an increased risk of fracture. Osteoporosis can be present in a person without any symptoms for decades, because osteoporosis does not cause symptoms until there is a fracture in the bone. Some osteoporotic fracture may escape detection for years when they do not cause symptoms. Therefore patients may not be aware of their osteoporosis until they suffer a painful fracture. The symptom associated with osteoporotic fracture is usually extreme and writhing pain in the particular location. The intensity of the pain depends upon the location of the fracture. The symptoms of osteoporosis in men are similar to the symptoms of osteoporosis in women. This means that there is no significant difference in the symptoms or pain sensation with respect to the gender of the person. Fractures of the spine or the vertebrate can result in severe band like pain sensation. Pain, that radiates from the back to the sides of the body. Over the years repeated spinal fractures can lead to chronic lower back pain as well as a loss of height or even bending of the spine, due to collapse of the vertebrae. This collapse gives individuals a hunched-back appearance of the upper back portion. This it commonly is seen in elderly women. A fracture that occurs during the course of normal activity is known as a minimal trauma or stress fracture. For example, some patients with osteoporosis are at an increased risk of developing stress fractures in their feet, while walking or stepping off an edge.

<urn:uuid:3ad1290b-156b-4a50-9e4d-0529883b57cb>

Good eyesight is crucial for our daily tasks, such as reading, driving, and working on a computer. Neglecting our eyes can have a substantial impact on our lives. Fortunately, there are many ways to improve eyesight and prevent eye problems. In this article, we will share some valuable tips on how to maintain healthy eyes. Nutrition for Better Eyesight Nutrition plays a vital role in maintaining good eyesight. Certain vitamins and minerals are necessary for healthy eyes, such as Vitamin A, C, and E, Omega-3 fatty acids, and zinc. You can find Vitamin A in foods such as carrots, sweet potatoes, spinach, and eggs, while Vitamin C can be found in citrus fruits, peppers, and berries. Foods rich in Vitamin E include nuts, seeds, and leafy greens such as spinach and kale. You can get Omega-3 fatty acids from fish such as salmon, tuna, and sardines, as well as from walnuts and flaxseed. Zinc can be found in foods such as oysters, beef, and pumpkin seeds. To incorporate these foods into your diet, you can prepare colorful salads with leafy greens, nuts, and berries, or make a healthy smoothie with spinach, kale, berries, and a tablespoon of flaxseed. Eye exercises are a great way to improve visual acuity, reduce eye strain, and prevent eye problems. Eye muscles are just like any other muscles in our body that need exercise to function properly. If you spend hours staring at a screen or reading, the eye muscles can become tense, leading to eye strain, headaches, blurred vision, and dry eyes. One popular eye exercise is the pencil pushup exercise. Hold a pencil in front of your eyes and slowly move it closer to your face, keeping your eyes focused on the pencil tip. Stop when you start to see double vision or blur and hold the pencil still until your eyes refocus. Repeat this exercise several times a day. You can also try the Palming technique, which involves covering your eyes with your palms and relaxing for a few minutes. This exercise can help relieve eye strain and improve blood flow to the eyes. Eye Protection and Screen Time We are exposed to harmful UV rays from sunlight, which can damage our eyes and increase the risk of cataracts, macular degeneration, and other eye problems. Wearing polarized sunglasses when outdoors is essential to protect your eyes from UV rays. It’s also important to choose the right sunscreen that is safe for the eyes. Make sure to use sunscreen that is labeled as “oil-free” and “non-comedogenic.” In today’s digital age, blue light from electronic devices has become a new concern for eye health. Too much exposure to blue light can cause eye strain, dry eyes, and sleep problems. To reduce eye strain and protect your eyes from blue light, you can try the 20-20-20 rule. Every 20 minutes, take a 20-second break and look at something 20 feet away. You can also adjust the brightness and contrast levels of your device and use blue light filters or special glasses that block blue light. Regular Eye Check-Ups Regular eye check-ups are essential to detect eye problems early on and prevent vision loss. Adults should have their eyes checked every two years, while children should have their eyes checked annually. Common eye problems that should not be ignored include glaucoma, macular degeneration, and cataracts. Early detection is the key to successful treatment and preserving your eyesight. Maintaining good eyesight is crucial for our daily routines. This article has provided valuable insights on proper nutrition, eye exercises, eye protection, and regular eye check-ups. By following these tips, you can improve your eye health and prevent eye problems. Remember to take care of your eyes, as they are one of your most valuable assets. Finally, we advise you to take frequent breaks from computer screens, ensuring adequate rest for your eyes.

<urn:uuid:4c5567e2-59d2-4828-abf9-00cba2761f15>

Gastrointestinal infections are the main health problem for grazing sheep in the southern United States (US). The humid environmental conditions from this region are ideal for survival and growth of Haemonchus contortus, the most pathogenic gastrointestinal parasite. Infections with H. contortus are characterized by weight loss, anemia, reduced performance, and if untreated, death of susceptible individuals (Miller et al. 1998). In the US, anthelmintics have been used for the control of gastrointestinal nematodes of sheep for more than 30 years, with considerable development of anthelmintic-resistant populations being an unfortunate consequence. Alternative practices to control gastrointestinal nematode infections have been targeted to address anthelmintic resistance. One promising alternative approach is breeding for resistance to gastrointestinal nematode infections. Resistance to these infections is most likely based on inheritance of genes that are important in the expression of host immunity. Several breeds of sheep around the globe are known to be relatively resistant to gastrointestinal parasites. Using resistant sheep breeds exclusively or in crossbreeding programs could lead to improved resistance to nematode infection. The main benefits of using selection to enhance parasite resistance in sheep breeding programs are that genetic change is a permanent attribute of that animal, its performance is improved, and infectivity of pastures is decreased as a result of fecal egg reduction, leading to additional benefits for the susceptible and young sheep grazing in the same flock. The Florida Native sheep, commonly known as Florida Cracker sheep, is one of the oldest breeds of sheep in North America. However, this heritage breed is now on the endangered list of sheep breeds. To ensure genetic diversity and long-term survival of the breed, protection of the current genetic stock is critical and conservation efforts are required to promote its breeding and production. The Spanish introduced the sheep when they founded St. Augustine in 1565. It is believed that it was developed from Churro sheep. For almost 400 years, the sheep remained feral in the warm, humid environmental conditions of Florida until the open range era concluded at the end of 1945. Florida Native sheep are medium-sized. Live weight of mature ewes usually ranges from 100 to 125 pounds. Mature rams are 125 to 175 pounds. They have white to honey-red, medium-grade wool. The ewes can breed back one month after lambing, and they can produce up to two lambs per year. This breed has demonstrated greater resistance to internal parasites than wool sheep and most other hair sheep breeds. The genetics underlying resistance to gastrointestinal nematodes in Florida Native sheep have been studied without identifying the genes or gene variants controlling variation, with selection based on phenotypic measures such as fecal egg count (FEC) and FAMACHA score. The FAMACHA© chart is based on the color of the conjunctival mucous membranes of animals. It changes from deep red (healthy individuals) to pink and white (highly anemic animals) shades. This tool has been used by sheep and goat producers from the southern US (Georgia, Louisiana, Florida, and Puerto Rico) as a valuable approach for identifying anemic individuals infected with H. contortus. Identification of genetic variants in the sheep genome may help to identify a set of genetic markers significantly associated with parasite resistance in Florida Native sheep. Thus, the aim of a study conducted by the authors was to identify a set of potential genetic markers for resistance to gastrointestinal nematode infections for sustainable Florida Native sheep production with funding from Sustainable Agriculture Research and Education (SARE). A crucial aspect of this project was the participation of the 2018 president of the Meat Sheep Alliance of Florida, Carol Postley, and her Florida Native sheep flock. In the future, we expect to include more Florida Native sheep producers and continue the genetic evaluation of this heritage sheep breed. All animals used in this study were from a commercial Florida Native sheep farm in Ocala, Florida (Figure 2). The selection flock was established in 1998 from an initial group of 80 rams ranked for H. contortus FEC, with high- and low-FEC rams mated with approximately 100 foundation dams. Since then, animals were selected for resistance to GIN solely on the basis of H. contortus FEC phenotyping and parentage recording. One hundred fifty-three female and male sheep were tested for gastrointestinal nematodes under natural grazing conditions. Animals were born between December 2017 and February 2018 and naturally exposed to parasites since birth. Phenotypic and pedigree information was used to construct the phenotype-pedigree database. To illustrate the phenotypic variation between resistant and susceptible animals in the study, a bar graph of fecal egg count determined at an initial assessment of the lambs (and deworming), at 10 days after the deworming, and at an assessment of lambs 38 days following deworming is presented below (Figure 3). All responded well to deworming, but two very clearly different populations of lambs were identified. Genotypes obtained from blood samples of these two populations of lambs were utilized to perform the identification of genetic variants associated with resistance. The total number of animals contributing to this project was 153 lambs, including female and male individuals. Genotypic data came from 100 lambs (52 characterized as resistant and 48 as susceptible) genotyped by targeted sequencing. Parasitological and hematological traits were evaluated and a total of 23 genomic regions covering 13 genes were associated with fecal egg count, FAMACHA score, average daily gain, red blood cell count, hemoglobin level, white blood cell count, neutrophil count, basophil count, and eosinophil count. The results from this study revealed candidate genetic variants for genes involved in the immune response to H. contortus exposure and provided additional marker information that has potential to aid selection of resistance to gastrointestinal parasites in Florida Native sheep. Improvement of Florida Native sheep selection for resistance to gastrointestinal nematode infections is the long-term goal of the authors. Future research is expected to provide an insight into the potential genetic markers for resistance to gastrointestinal nematode infections. We will continue to increase the size of the phenotypic, pedigree, and genotypic database for Florida Native sheep and validate our findings using genome-wide scans. The end result is intended to assist Florida Native sheep producers in managing this very important production-limiting condition in their flocks.

<urn:uuid:7af4e446-b0ee-4957-a204-b9500450f1dc>

Palatki Heritage Site facts for kids - Cliff dwellings The Palatki site has a set of ancient cliff dwellings in the red sandstone cliffs, built from 1100 to 1400 CE by the Sinagua people of the Ancestral Puebloans. The cliff dwellings were built under south-facing overhangs for shelter and winter sun. The Sinagua people planted crops and made pottery in the area. Palatki and Honanki, another nearby archaeological site, had the largest cliff dwellings in the Red Rock formation area from 1150 CE to 1300 CE. Palatki consists of two separate pueblos, suggesting two family or kin groups may have lived here, one in each pueblo. The circular shield-like pictographs above the eastern pueblo have been interpreted by some archaeologists as being a kin or clan symbol. - Rock art There are pictographs and petroglyphs at the Palatki site, including some that predate the cliff dwellings. Many of the pictographs on the rock walls are from the Sinagua. However, those created by peoples of the Archaic period in North America include some of the more abstract pictograph symbols and drawings that are 3,000 to 6,000 years old, and some of the petroglyphs, estimated to be 5,000 to 6,000 years old. Visitation to the site for over a century has caused degradation of the archaeological elements. It was begun by 19th century Euro-American settlers, with little archaeological awareness for the area. Photographs from the early 1900s show that an estimated 70 to 90 percent of the original structures have disappeared since then. The Palatki Heritage Site park is open to visitors seven days a week from 9:30am to 3:00pm. There are two trails in the park, one to view the Sinagua cliff dwellings, and a second to view the pictographs and petroglyphs. The trails are not handicapped accessible. Purchase of a Red Rock Pass is needed for park entry. Palatki Heritage Site Facts for Kids. Kiddle Encyclopedia.

<urn:uuid:58b15f38-1018-4579-8cc2-4fae80c162ec>

I was late ordering my Math Work Stations book, so I'm still waiting on it. I wanted to share a very simple resource that I used at the beginning of the year and then built on. I printed and laminated these and used them in a pocket chart at the beginning of the year. As I introduced a number, I would also introduce the various ways to represent the number. These stayed in a pocket chart at the front of the room. After I had introduced the numbers through 10, all of the cards came out of the pocket chart and it became a Math Work Station. This chart replaced the pocket chart near our work station for additional support (prints legal size) Students used a pocket charts to sort the representations. At the beginning of the year, the representations are simplistic. For example, the domino representations have all the dots on one side with the other blank. As the year when on and their ability to subitize developed, I added mixed dominoes, ten frames with two colors, and varying dice and coin combinations. My teammate also created a workmat that we used to reinforce number representations, I'm sure she won't mind if I share, but I want to check first! I'll post that later with the explanation and some pictures.

<urn:uuid:9e2d7fbe-36bf-4679-b995-8a90437a1517>

In the first few weeks of this class, we have talked about various kinds of data about the criminal justice system – data about what people think about the system from the General Social Survey, data about rates of crime from the Uniform Crime Reports and from the National Crime Victimization Survey, and data about how many people are caught up in the criminal justice system from the Bureau of Justice Statistics. Choose one of these four sources of data, Google the relevant source, and look at what kinds of statistics are available from that source. Identify one piece of data that surprises you and one piece of data that was missing or that you could not find. Use one of the theories we have discussed, based on the readings in Kubrin & Stuckey about criminal justice theory or policing theory, to write an essay in which you explain why the data looks the way it does – in terms of what surprises you and what is and is not there. 1. Your paper should meet the following specifications: a. Properly formatted and cited (20 points) i. Be 1-2 pages in length, no longer. ii. Use 12-point font, 1-inch margins, and double-space your text iii. Include your name and a page number on every page and staple the document iv. Scholarly integrity requires that that work be attributed to the author, regardless of whether you are directly quoting, paraphrasing, or relying on the work less directly. If you are unclear about how to cite a source appropriately then please ask. a. Use APA Style; see this website for directions: b. Cite exact page numbers from which quotations or ideas are drawn. b. Well-written (15 points) i. Review for spelling errors, grammatical mistakes, and typos. ii. Avoid confusing pronouns (e.g., vague use of “it” without clearly explaining what iii. Avoid confusing or sloppy writing, like run-on sentences, or imprecise language. iv. Try reading your paper outloud to yourself to see how it sounds. c. Well-organized, with a clear introductory paragraph (25 points) i. Imagine that your smart reader has not read this prompt and wants to know right away (a) who and what you are writing about and (b) what argument you are making ii. Have a clear thesis statement that introduces the main argument of the paper (10/20 iii. Introduce the organization of the paper; let your reader know what is coming (5/20 d. Use evidence to support your argument (40 points) i. Refer directly to the assigned texts (not to lecture) to support your arguments. ii. Present two pieces of evidence or analysis in support of your of your argument (perhaps one piece of data that surprised you and one that was missing). Explain each piece of evidence; relate it back to your thesis statement. (20/40 points each) We Can Also Assist You With Similar Orders At Highly Discounted Rates!!!

<urn:uuid:62e6a4a5-ede6-42b2-8eed-cde6418fca41>

- Human Action in Thomas Aquinas, John Duns Scotus, & William of Ockhamby Thomas M. Osborne The editors at The Catholic University of America Press chose the cover art for this book with real insight. A painting (circa 1500) shows several dozen clearly rendered men and women engaged in the business of living. Among them are a dentist pulling teeth, a nun praying while another gathers hay, two men in a brawl, and a lady reading, while Christ looks down from heaven upon them all. It is this collection of actions—the good, the bad, and the possibly indifferent—that Thomas Aquinas, Scotus, and Ockham, each in his own way, worked to systematize. These three diverse efforts at systematization are the subject of Osborne's book on human action. Just as the painter was careful to draw each small character in detail, so too Osborne is careful with all the relevant details of the five areas of action theory he chooses to elaborate: the causes of human action, the role of practical reasoning in choice, the stages of action, the specification of moral action, and the supernatural and moral worth of action. The first (and longest) chapter, on the causes of human acts, reflects upon how the three figures differ regarding the root of freedom, whether the known object is the cause of the human act, and the relationship between freedom and the good. Aquinas sees reason as the root of freedom, while Scotus and Ockham do not. Aquinas sees the known object as a final cause, while for Scotus and Ockham it is a partial efficient cause. The chapter ends with a short disquisition on the inadequacy of characterizing the contrast as simply that between intellectualism and voluntarism. The second chapter, on practical reason and the practical syllogism, is largely a presentation of three elaborations of Aristotle's account of the practical syllogism in the Nicomachean Ethics. As Osborne notes, Aristotle's account gave rise to a number of questions, such as whether the conclusion of such reasoning was the action itself, and whether the premises for such [End Page 292]reasoning were of a different character than theoretical premises. The chapter presents a number of rather technical attempts to resolve these and other questions. Osborne is to be praised for pointing out in medieval action theory the role of Aristotle's ideas and the overall importance of prudence and practical reasoning. At the same time, though, this chapter is less interesting than the previous one, since it is more difficult to see how any of these theories leads to any significant difference for humans who are thinking about their own actions. Different theories about the root of freedom will lead to very different overall views of human life. But is distinguishing—or not distinguishing—different degrees of practical reason going to have a wider impact? Osborne himself is largely interested in how these theories about practical reasoning are the result of the causal theories he discussed in the first chapter: he identifies a trend of separating nature from will and an increasing emphasis on the will's activity. The third chapter, on the stages of the act, involves a similar mass of detail. Osborne threads his way through the multitudinous stages of the act in Aquinas (including remarks on the historical background of stages such as "consent") and the much simpler versions provided by Scotus and Ockham. As with the previous chapter, to Osborne the significance of this complex maze lies in the fact that it reflects the causal theories elaborated in chapter 1: Scotus and Ockham do not incorporate natural inclination into their understanding of the will's stages, and for them intellect and will act in separate stages, while for Aquinas they cannot be separated. Chapter 4, on the evaluation and specification of the human act, presents a topic that is perhaps...

<urn:uuid:cf936f6f-4597-4b09-a17d-eafd1eea2e71>

|About the Book| Books about the Civil War are as numerous as the wars casualties. This one is different. A Civil War Treasury goes beyond the battles and the memoirs to offer a unique, intimate and informative portrayal of this nations greatest catastrophe, the War Between the States. A Civil War Treasury does not pretend to be a sweeping historical account of the conflict, but looks at the monumental struggle in terms of bits and pieces of reality. Within its pages are anecdotes of army life and encampments, explanations of logistics and tactics, descriptions of soldiers and citizens and their deeds of honor and infamy. There are profiles of people, regiments and ships- songs and poems- and not a few serious treatments of particular aspects of the war, such as musketry and artillery. The object of A Civil War Treasury is to provide a deeper understanding of the human side of the war and its more technical aspects--topics which are frequently neglected in more traditional treatments. The selections are arranged in a roughly chronological order and there is a brief introduction to each chapter which outlines the principal political and military developments of the year in question. In addition, several major themes link the pieces together, such as Incidents of War, The Men, The Women, Lincoln, The Units, War and Society, The Ways of War, The Ships, Army Life and War and the Muses. For example, an article on inventive, but unappetizing, camp recipes appears under Army Life, while a discussion of the importance of railroads falls under The Ways of War. Few other books give a more fascinating insight into the many facets of the greatest crisis in the history of the Republic.

<urn:uuid:f5d7af5b-c73b-427e-835a-ebc136e7ddf9>

An international team of astronomers has captured the first image of a supermassive black hole at the center of our own galaxy, the Milky Way. The image, produced by a global team of scientists known as the Event Horizon Telescope (EHT) collaboration, is the first direct visual confirmation of the presence of this unseen object, and comes three years after the first-ever image of a black hole of a distant galaxy. “For decades we have known of a compact object at the heart of our galaxy that is four million times more massive than our Sun,” said Harvard University astronomer Dr Sara Issaoun. “Today, right now, we have direct evidence that this object is a black hole.” The image does not show the black hole itself – because it is completely dark – but the ultra-hot plasma* and gas that surrounds the phenomenon* in a bright ring-like structure. This luminous halo* swirls around the edge of the black hole beyond which nothing, not even light, can escape its gravitational pull*. Dr Issaoun said that from Earth the black hole would be about the same size as a donut on the surface of the Moon. Geoffrey Bower, EHT project scientist, Academia Sinica in Taiwan, said: “These unprecedented* observations have dramatically improved our understanding of what is happening at the very center of our galaxy.” The black hole was given the name Sagittarius A* (pronounced A-star), or Sgr A* for short, because it was detected in the direction of the constellation Sagittarius. Located 27,000 light-years from Earth, its existence has been presumed since 1974 when an unusual radio source was detected at the center of the galaxy. In the 1990s, astronomers mapped the orbits of the brightest stars near the center of the Milky Way, confirming the presence of a supermassive compact object there, work that led to the 2020 Nobel Prize in Physics. Although the presence of a black hole was considered the only plausible explanation*, the new image provides the first direct visual evidence. Capturing images of such a distant object required linking eight giant radio observatories across the planet to form a single virtual “Earth-sized” telescope called the EHT. “The EHT can see three million times sharper than the human eye,” said German scientist Thomas Krichbaum of the Max Planck Institute for Radio Astronomy. “So when you’re sitting in a beer garden in Munich (Germany), for example, you could see the bubbles in a glass of beer in New York (US).” The EHT watched Sgr A* for multiple nights for several hours straight, an idea similar to long exposure photography and the same process used to produce the first image of a black hole, published in 2019. This black hole is called M87* because it is in the galaxy Messier 87. The M87* and Sgr A* are similar, although the Sgr A* is 2000 times smaller than the M87*. “Close to the edge of these black holes, they look amazingly similar,” said Sera Markoff, co-chair of the EHT Scientific Council and professor at the University of Amsterdam. The two black holes behaved as German-born physicist Albert Einstein predicted in his 1915 theory of general relativity. His theory was that instead of being an invisible force that pulls objects together the others, gravity is a curvature or a deformation* of space. The more massive an object, the more it distorts the space around it. The image of Sgr A* is the result of the work of more than 300 researchers in 80 countries over a period of five years. Their research was published in The Astrophysical Journal Letters. - plasma: an electrically charged gas - phenomenon: something that is seen to exist or happen but is difficult to explain - Halo: circle of light - gravitational pull: when gravity brings objects together - unprecedented: never done, seen or known before - constellation: group of stars forming a recognizable pattern - plausible: believable, seem likely to be true - warping: bend or warp A black hole swallows a neutron star NASA releases breathtaking view of the Milky Way World’s first photo of a black hole revealed Collision creates supermassive black hole - What is the global team of scientists known as? - How many times bigger than our Sun is the Sgr A* black hole? - Why was the name of the black hole Sagittarius A* or Sgr A* abbreviated? - What is the name of the first black hole that scientists captured an image of? - Who invented the theory of general relativity? LISTEN TO THIS STORY 1. Condense it This report is quite long and contains a lot of details. Rewrite the article for someone short on time so they can capture the gist of the story in less than 100 words. Weather: allow 25 minutes for this activity Curriculum links: English; Science Brainstorm a few possible titles for your new short story. Think about what will grab people’s attention and make them want to read it. Decide your best. Weather: allow 10 minutes for this activity Program links: English Wow word recycle There are a lot of wow words (ambitious vocabulary pieces) used in the article. Some are in the glossary, but there might be others in the article that you think are also exceptional. Identify any words in the article that you think are not common words, and particularly good choices for the author. Select three words you have highlighted to recycle them into your own sentences. If some of the words you identified are not in the glossary, write your own glossary for them.

<urn:uuid:5e5b130d-6998-4e88-b44f-a3e0a9f8dfb3>

Slashing emissions from key building materials like steel and concrete could be the equivalent of half a million cars being taken off the road, a new report has found. The report, commissioned by The New Zealand Green Building Council (NZGBC) from sustainability consultants thinkstep, has found renovating and constructing new buildings will contribute almost three million tonnes to the country's carbon footprint each year between now and 2050. But it said changes to the way heavy emitters like concrete, steel, timber and aluminium are produced could slash emissions as the country works to meet its climate change obligations. The report focused on emissions from the manufacture of building materials through the supply chain - known as "embodied carbon" - and didn't include emissions from the use of buildings like heating and lighting. "So what we've focused on for the last 30 or 40 years in New Zealand is how we run our buildings," NZGBC chief executive Andrew Eagles said. "What that's missing is a really important component and that's the carbon emissions created from manufacturing all of the materials when you build new buildings. This is really important because it's about half of the total emissions that the construction and property sector creates." The report said steel and concrete together contribute more than half of the sector's embodied carbon footprint. Aluminium was also a significant emitter for non-residential construction, as well as timber framing in residential building. Thinkstep looked at a number of short and long term improvements manufacturers could make, including lower-carbon cement substitutions, moving away from coal as a fuel source for cement, and using renewable energy like hydroelectricity and carbon-free smelting for aluminium. For a 200-square-metre home emissions could be cut by three tonnes, or 5 per cent, if low-carbon concrete was used, the report said. Longer-term changes to concrete, steel, and aluminium, increasing that to almost 30 per cent, would be the equivalent to taking seven cars off the road. "Overall, if construction material improvements are made for both residential and non-residential building types, a total carbon saving of 13 per cent from all embodied emission could be made in the short term, and 41 per cent in the long term," the report said. "This translates to taking approximately 5 per cent or 15 per cent (respectively) of all passenger cars in New Zealand off the road permanently." With the government's goal to reach zero carbon by 2050, the report said its 40 per cent reduction could be improved if the sector and others collaborated. "It is not only material suppliers who need to implement low-carbon manufacturing technologies, but also specifiers and customers who need to consciously choose those materials," it said. Eagles said things like the Zero Carbon Bill would force people to analyse where New Zealand's emissions came from. "This report is effectively saying that we can't get to zero carbon without dealing with all of these emissions from the materials we use to build. The report forms part of NZGBC's submission on the government's Zero Carbon Bill, and Eagles said it was essential the government led change. Thinkstep technical director Dr Jeff Vickers said industries needed to work together. "We all sit in the same boat and we won't achieve New Zealand's net-zero carbon goal by 2050 if we don't collaborate. There are opportunities within each material stream to decarbonise and if everyone does their bit it will add up to something great. To read the full article on Stuff click here

<urn:uuid:2a8c618e-6e35-458b-a3f9-2b479284c19c>

Our intestinal microbiota harbours a diverse bacterial community required for our health, sustenance and wellbeing1,2. Intestinal colonization begins at birth and climaxes with the acquisition of two dominant groups of strict anaerobic bacteria belonging to the Firmicutes and Bacteroidetes phyla2. Culture-independent, genomic approaches have transformed our understanding of the role of the human microbiome in health and many diseases1. However, owing to the prevailing perception that our indigenous bacteria are largely recalcitrant to culture, many of their functions and phenotypes remain unknown3. Here we describe a novel workflow based on targeted phenotypic culturing linked to large-scale whole-genome sequencing, phylogenetic analysis and computational modelling that demonstrates that a substantial proportion of the intestinal bacteria are culturable. Applying this approach to healthy individuals, we isolated 137 bacterial species from characterized and candidate novel families, genera and species that were archived as pure cultures. Whole-genome and metagenomic sequencing, combined with computational and phenotypic analysis, suggests that at least 50–60% of the bacterial genera from the intestinal microbiota of a healthy individual produce resilient spores, specialized for host-to-host transmission. Our approach unlocks the human intestinal microbiota for phenotypic analysis and reveals how a marked proportion of oxygen-sensitive intestinal bacteria can be transmitted between individuals, affecting microbiota heritability. A typical human intestinal microbiota contains 100–1,000 bacterial species with tremendous compositional diversity between individuals, such that each individual’s microbiota is as unique as a fingerprint1,4. Despite the taxonomic diversity, metagenomic sequencing has highlighted that a health-associated intestinal microbiome codes for highly conserved gene families and pathways associated with basic bacterial physiology and growth2. However, many basic microbiota functions related to homeostasis, immune system development, digestion, pathogen resistance and microbiota inheritance have yet to be discovered5. This formidable challenge to validate and decipher the functional attributes of the microbiota has been hindered because the majority of intestinal bacteria are widely considered to be ‘unculturable’ and have never been isolated in the laboratory3,6. We sought to establish a genomic-based workflow that could be used as a platform for targeted culturing of specific bacterial phenotypes (Extended Data Fig. 1). Accordingly, we collected fresh faecal samples from six healthy humans and defined the resident bacterial communities with a combined metagenomic sequencing and bacterial culturing approach. Applying shotgun metagenomic sequencing, we profiled and compared the bacterial species present in the original faecal samples to those that grew as distinct colonies on agar plates containing the complex, broad-range bacteriological medium, YCFA7. Importantly, we observed a strong correlation between the two samples at the species level (Spearman’s ρ = 0.75, P < 0.01) (Fig. 1a). When sequenced, the original faecal sample and the cultured bacterial community shared an average of 93% of raw reads across the six donors. This overlap was 72% after de novo assembly (Extended Data Fig. 2). Comparison to a comprehensive gene catalogue that was derived by culture-independent means from the intestinal microbiota of 318 individuals4 found that 39.4% of the genes in the larger database were represented in our cohort and 73.5% of the 741 computationally derived metagenomic species identified through this analysis were also detectable in the cultured samples. Together, these results demonstrate that a considerable proportion of the bacteria within the faecal microbiota can be cultured with a single growth medium. However, more than 8 × 106 distinct colonies would need to be picked from YCFA agar plates to match the species detection sensitivity of metagenomic sequencing. Thus, we established a broad-range culturing method that, when combined with high-throughput archiving or specific phenotypic selection, can be used to isolate and identify novel bacteria from the gastrointestinal tract. The human intestinal microbiota is dominated by strict anaerobic bacteria that are extremely sensitive to ambient oxygen, so it is not known how these bacteria survive environmental exposure to be transmitted between individuals. Certain members of the Firmicutes phylum, including the diarrhoeal pathogen Clostridium difficile, produce metabolically dormant and highly resistant spores during colonization that facilitate both persistence within the host and environmental transmission8,9,10. Relatively few intestinal spore-forming bacteria have been cultured to date, and while metagenomic studies suggest that other unexpected members of the intestinal microbiota possess potential sporulation genes, these bacteria remain poorly characterized11,12,13,14. We hypothesized that sporulation is an unappreciated basic phenotype of the human intestinal microbiota that may have a profound impact on microbiota persistence and spread between humans. Spores from C. difficile are resistant to ethanol and this phenotype can be used to select for spores from a mixed population of spores and ethanol-sensitive vegetative cells15. Faecal samples with or without ethanol treatment were processed using our combined culture and metagenomics workflow (Extended Data Fig. 1). Principle component analysis demonstrated that ethanol treatment profoundly altered the culturable bacterial composition and, when compared to the original profile, efficiently enriched for ethanol-resistant bacteria, facilitating their isolation (Fig. 1b). We picked ~2,000 individual bacterial colonies from both ethanol-treated and non-ethanol-treated conditions, re-streaked them to purity, and performed full-length 16S ribosomal RNA gene sequencing to enable taxonomic characterization. Unique taxa were then archived as frozen stocks for future phenotypic analysis. In total, we archived bacteria representing 96% of the bacterial abundance at the genus level and 90% of the bacterial abundance at the species level based on average relative abundance across the six donors (Extended Data Fig. 3a, b). Even genera that were present at low average relative abundance (<0.1%) were isolated (Extended Data Fig. 3c). Overall, we archived 137 distinct bacterial species including 45 candidate novel species (Fig. 1c, Extended Data Fig. 3d and Supplementary Table 1), and isolates representing 20 candidate novel genera and 2 candidate novel families. Our collection contains 90 species from the Human Microbiome Project’s ‘most wanted’ list of previously uncultured and unsequenced microbes16 (Supplementary Table 1). Thus, our broad-range YCFA-based culturing approach led to massive bacterial discovery, and challenges the notion that the majority of the intestinal microbiota is unculturable. We isolated and purified bacteria representing 66 distinct ethanol-resistant species that are distributed across 5 known families and 2 newly identified candidate families (Extended Data Fig. 3d and Extended Data Fig. 4). The identification of these new and unexpected spore-formers highlights the broad taxonomic distribution of this phenotype among the enteric species of the Firmicutes. To define the conserved genetic pathways underlying sporulation and germination within the intestinal microbiota, we sequenced, assembled and annotated the whole genomes of 234 archived ethanol-resistant and ethanol-sensitive bacteria. Previously, the gene markers used to identify spore-forming bacterial species have been based on underlying genetic assumptions13,17,18; here we applied an unbiased computational approach to define 66 conserved genes linked to an ethanol-resistance phenotype (Extended Data Fig. 5 and Supplementary Table 1). This gene set allows for the prediction of the sporulation capabilities of bacterial species isolated from diverse environments with a high degree of accuracy (Extended Data Fig. 6a and Supplementary Table 1) and consists of genes from a wide range of functional classes (Extended Data Fig. 6b and Supplementary Table 1). To test whether commensal spore formation facilitates long-term environmental survival, we exposed a phylogenetically diverse selection of commensal spore-forming and non-spore-forming bacteria and C. difficile to ambient oxygen for increasing periods of time. Under these conditions, non-spore-forming bacteria remained viable for 2–6 days (48–144 h) (Fig. 2a). In contrast, commensal spore-forming bacteria, C. difficile and the facultative anaerobe Escherichia coli were able to survive stably to the end of the experiment on day 21 (504 h). In addition, spore-forming commensals and C. difficile, but not non-spore-forming commensals, survived prolonged exposure to the common disinfectant ethanol (Extended Data Fig. 7). These results demonstrate that commensal spore-formers and C. difficile share a core set of sporulation genes that confer a highly resistant phenotype that is associated with environmental spread between humans. C. difficile spores have evolved mechanisms to resume metabolism and vegetative growth after intestinal colonization by germinating in response to digestive bile acids released into the small intestine from the gall bladder9. We exposed enteric spore-formers and non-spore-formers to common bile acids (taurocholate, glycocholate and cholate) to assess their response to germinants after ethanol-shock treatment (Fig. 2b). Taurocholate was a potent germinant for all spore-formers, increasing the culturability of spores from commensal bacteria by between 8- and 70,000-fold (P < 0.05 for all spore-formers tested), whereas the other cholate derivatives had varying efficacy in germinating commensal spore-formers (Fig. 2b). Taurocholate and the other bile acids had no impact on the culturability of non-spore-formers, demonstrating that the effect is specific to spore-formers (Extended Data Fig. 8). We propose that this bile-acid-triggered ‘colonizing germination’ mechanism serves as a conserved in vivo cue to promote colonization by intestinal spore-forming bacteria. Thus, a duality of purpose exists in the modus operandi of intestinal spore-forming bacteria; spore formation ensures their survival and transmission while germination in response to in vivo cues ensures their persistence in the human population. We next sought to estimate the proportions of spore-forming bacteria within the intestinal microbiota. Interrogation of the metagenomic data sets with the spore gene signature predicted that, on average, 60% of the genera contained spore-forming bacteria (Fig. 3a). These genera represent 30% of the total intestinal microbiota (Fig. 3b). We independently validated these observations with 16S rRNA gene amplicon sequencing (Extended Data Fig. 9). Importantly, these proportions of spore-forming bacteria were also observed in 1,351 publicly available faecal metagenomic data sets generated from healthy individuals19 (Fig. 3a, b). We also found the same proportion of spore-formers (61.3%) within the ‘metagenomic species’ derived from 318 healthy individuals4. While the intestinal microbiota is considered to be relatively stable over time20, evidence suggests that close contact of family members promotes sharing of Ruminococcaceae and Lachnospiraceae bacteria21, families that we describe as spore-formers (Extended Data Fig. 4). We noted that in our cohort, the spore-forming bacteria of the microbiota were significantly more diverse than the non-spore-forming bacteria (Fig. 3c). To test the dynamics of the spore-forming and non-spore-forming bacteria over time, we analysed the metagenomic profiles of faecal samples collected from the same healthy subjects one year after the original sampling. Interestingly, we noted a significantly increased variability in the proportion of spore-forming bacteria compared with non-spore-forming bacteria over this period. This suggests a higher species turnover or a greater shift in relative abundance in the spore-forming bacterial species (Fig. 3d). Taken together, our phenotypic and genome analyses demonstrate that the spore-forming and non-spore-forming bacteria represent major, distinct phenotypic components of our microbiota, each with unique colonization dynamics. We show that spore formation is a widespread, although previously unappreciated function of the human intestinal microbiota, with important implications for microbiota transmission and inheritance. On the basis of the shared phylogeny and common evolutionary and phenotypic characteristics of sporulation and germination, we propose that the abundant commensal intestinal spore-formers identified here rely on the same transmission and colonization strategy as C. difficile22. In brief, environmental C. difficile spores are highly transmissible for long periods after they are shed, commonly transmit within a local environment but also have the potential to spread rapidly over long distances23. The transmission dynamics and geographical range of commensal spore-formers has yet to be determined, but we anticipate that this type of information will provide great insight into the heritability and the selective factors that shape the composition of the human intestinal microbiota. Our workflow enables large-scale culturing, archiving, genome sequencing and phenotyping of novel bacteria from the human gut microbiota that were formerly considered to be unculturable. We have generated a sizable whole-genome-sequence data set that corresponds to 39% of the total number of intestinal bacterial genomes generated by the Human Microbiome Project. Our streamlined, single-medium approach, builds on the considerable efforts of others24,25 and unlocks the human intestinal microbiota for phenotypic characterization. Fresh faecal samples were obtained from six consenting healthy adult human donors (1 faecal sample per donor: minimum 0.5 g) and were placed in anaerobic conditions within 1 h of passing to preserve the viability of anaerobic bacteria. All sample processing and culturing took place under anaerobic conditions in a Whitley DG250 workstation at 37 °C. Culture media, PBS and all other materials that were used for culturing were placed in the anaerobic cabinet 24 h before use to reduce to anaerobic conditions. The faecal samples were divided in two. One part was homogenized in reduced PBS (0.1 g stool per ml PBS) and was serially diluted and plated directly onto YCFA7 agar supplemented with 0.002 g ml−1 each of glucose, maltose and cellobiose in large (13.5 cm diameter) Petri dishes. This sample was also subjected to metagenomic sequencing to profile the entire community. The other part was treated with an equal volume of 70% (v/v) ethanol for 4 h at room temperature under ambient aerobic conditions to kill vegetative cells. Then, the solid material was washed three times with PBS and it was eventually resuspended in PBS. Plating was performed as described earlier. For the ethanol-treated samples, the medium was supplemented with 0.1% sodium taurocholate to stimulate spore germination. Colonies were picked 72 h after plating from Petri dishes of both ethanol-treated and non-ethanol-treated conditions harbouring non-confluent growth, (that is, plates on which the colonies were distinct and not touching). The colonies that were picked were re-streaked to confirm purity. No statistical methods were used to predetermine sample size. The experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment. Microbiota profiling and sequencing Identification of each isolate was performed by PCR amplification of the full-length 16S rRNA gene (using 7F (5′-AGAGTTTGATYMTGGCTCAG-3′) forward primer and 1510R (5′-ACGGYTACCTTGTTACGACTT-3′) reverse primer followed by capillary sequencing. Full-length 16S rRNA gene sequence reads were aligned in the Ribosomal Database Project (RDP), manually curated in ARB26 and mothur27 was then used to classify reads to operational taxonomic units (OTUs). The R package seqinr version 3.1 was used to determine sequence similarity between OTUs and 98.7% was used as a species-level cut-off28,29. The full-length 16S rRNA gene sequence of each species-level OTU was compared to the RDP reference database to assign taxonomic designations to the genus level30 and a BLASTn search defined either a characterized or candidate novel species31. Comparisons with the Human Microbiome Project (HMP) were carried out using 97% sequence similarity of the 16S rRNA gene sequence from the cultured bacteria to define a species because only partial 16S rRNA gene sequences were available. HMP data regarding the most wanted taxa and the completed sequencing projects were downloaded from http://hmpdacc.org/most_wanted/#data and http://hmpdacc.org/HMRGD/, respectively. Genomic DNA was extracted from at least one representative of each unique OTU using a phenol-chloroform-based DNA isolation procedure. DNA was sequenced on the Illumina HiSeq platform generating read lengths of 100 bp and these were assembled and annotated for further analysis. DNA was extracted directly from each faecal sample for whole-community metagenomic and 16S rRNA gene amplicon sequencing using the MP Biomedical FastDNA SPIN Kit for soil. To enable comparisons with the complete community samples, non-confluent cultures were scraped from agar plates 72 h after inoculation with the initial faecal sample and DNA was extracted from this community using the same DNA isolation process. 16S rRNA gene amplicon libraries were made by PCR amplification of variable regions 1 and 2 of the 16S rRNA gene using the Q5 High-Fidelity Polymerase Kit supplied by New England Biolabs. Primers 27F AATGATACGGCGACCACCGAGATCTACAC (first part, Illumina adaptor) TATGGTAATT (second part, forward primer pad) CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part, golay barcode) AGTCAGTCAG (third part, reverse primer pad) AA (fourth part, reverse primer linker) GCTGCCTCCCGTAGGAGT (fifth part, reverse primer) were used. Four PCR amplification reactions per sample were carried out; products were pooled and combined in equimolar amounts for sequencing using the Illumina MiSeq platform, generating 150 bp reads. A maximum likelihood phylogeny of the culture-derived bacteria was generated from the aligned RDP sequence using FastTree version 2.1.3 (ref. 32) with the following settings: a generalized time-reversible (GTR) model of nucleotide substitution and CAT approximation of the variation in rates across sites with 20 rate categories. The ethanol-resistant phylogeny was derived directly from the entire culture phylogeny. All phylogenetic trees were edited in ITOL33. Analysis of the partial 16S rRNA gene sequence generated from the 16S rRNA gene amplicon libraries was carried out using the mothur MiSeq SOP34 on 29 August 2014, generating 7,549 OTUs across all samples. A sequence similarity threshold of 97% was used to define an OTU. Metagenomic sequence reads were analysed using the Kraken35 taxonomic sequence classification approach based on a custom database comprising complete, high-quality reference bacterial, DNA viral and archaeal genomes in addition to the genomes sequenced in this research. Resulting classified reads were log2 transformed and standardized by total abundance. Metagenomic samples were compared at the genus and species levels by relative abundance and at the genetic level by alignment using the bowtie2 algorithm36 to the appropriate gene catalogue. Sequences were considered present where an average of twofold coverage was achieved across the length of the considered sequence. A cut-off of 100 unique reads was applied to determine metagenomic species detection. Where appropriate, Spearman’s rank correlation coefficient was applied for correlation analysis. Inverse Simpson’s diversity index was calculated from Kraken output in R version 3.2.1 using the vegan: Community Ecology Package version 2.3-0. Gene sporulation signature Heuristic based bidirectional best hit analysis was performed to identify 21,342 conserved genes within the 694,300 genes annotated across the 234 sequenced genomes. Support vector, machine-based, contrast set association mining was applied to identify the optimal, weighted gene signature consisting of 66 genes. Species classification was performed using BLAST-based gene detection with percentage detection weighted by gene signature contribution and scaled to generate a total score between 0 and 1. Scores greater than 0.5 were considered true spore-formers based on comparison to known spore-formers. Signature-based abundance was assessed against 1,351 publically available metagenomic data sets from healthy individuals19 after taxonomic assignment using the Kraken database. Genera were considered spore-formers when all known species within that genus had a spore forming score greater than 0.5. Transmission electron microscopy Spore images were generated using transmission electron microscopy (TEM) as previously described37. Bacterial isolates for imaging were prepared by streaking pure cultures from frozen glycerol stocks and confirming purity by full-length 16S rRNA gene sequencing after one round of sub-culture to obtain visible and isolated single colonies. TEM images were prepared from culture plates 72 h after inoculation. The number of spore bodies visible in the TEM images was expressed as a percentage of the number of vegetative cells present and this ranged from 1% for Ruminococcus flavefaciens_93% to 4% for Turicibacter sanguinis. Oxygen sensitivity assay Pure cultures were grown overnight in YCFA broth under anaerobic culture conditions as described earlier and the cultures were spotted in a dilution series onto YCFA agar containing 0.1% sodium taurocholate. Plates were incubated under ambient (aerobic) conditions at room temperature for specified time periods before being returned to the anaerobic cabinet. Colony-forming units (c.f.u.) were counted 72 h later. Cultures that were incubated anaerobically, and which were therefore not exposed to oxygen, acted as controls. Prior to the assay, all species were subjected to ethanol shock and were cultured anaerobically to determine their ability to sporulate. The viability of the oxygen-exposed cultures was expressed as a percentage of the viability of the anaerobic control cultures. Germination response to intestinal bile acids assay Pure cultures were grown overnight in YCFA broth under anaerobic conditions and were then washed by repeatedly centrifuging to a pellet and re-suspending in PBS. Vegetative cells were killed using an ethanol shock treatment as previously described and the cultures were then serially diluted and plated on YCFA agar with and without 0.1% intestinal bile salts (taurocholate, cholate and glycocholate). Colony-forming units (c.f.u.) were counted 72 h later and the fold change of the number of c.f.u. present on plates in the presence of a particular germinant with respect to the number of c.f.u. present on plates in the absence of a germinant was calculated. The limit of detection (200 c.f.u. ml−1) was used for the number of c.f.u. recovered from Clostridium hathewayi plated without any germinants to allow a fold-change calculation. The experiment to determine the response of non-spore-formers to germinants was carried out similarly, except that vegetative cells were not treated with ethanol but rather were serially diluted and plated directly after washing. European Nucleotide Archive Assembled and annotated genome sequence data have been deposited in the European Nucleotide Archive under accession number ERP012217. Bacterial isolates have been deposited at the Leibniz Institute DSMZ-German Collection of Microorganims and Cell Cultures (http://www.dsmz.de), the CCUG-Culture Collection, University of Gothenburg, Sweden (http://www.ccug.se), the Belgian Co-ordinated Collection of Micro-organisms hosted by the Laboratory of Microbiology (BCCM/LMG) at Ghent University (http://bccm.belspo.be/) and at the Japan Collection of Microorganisms (JCM; http://jcm.brc.riken.jp/en/). Isolate accession numbers are listed in Supplementary Table 1. Any isolates without accession numbers are available upon request. Qin, J. et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464, 59–65 (2010) Lozupone, C. A., Stombaugh, J. I., Gordon, J. I., Jansson, J. K. & Knight, R. Diversity, stability and resilience of the human gut microbiota. Nature 489, 220–230 (2012) Walker, A. W., Duncan, S. H., Louis, P. & Flint, H. J. Phylogeny, culturing, and metagenomics of the human gut microbiota. Trends Microbiol. 22, 267–274 (2014) Nielsen, H. B. et al. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes. Nature Biotechnol. 32, 822–828 (2014) Nelson, K. E. et al. A catalog of reference genomes from the human microbiome. Science 328, 994–999 (2010) Stewart, E. J. Growing unculturable bacteria. J. Bacteriol. 194, 4151–4160 (2012) Duncan, S. H., Hold, G. L., Harmsen, H. J., Stewart, C. S. & Flint, H. J. Growth requirements and fermentation products of Fusobacterium prausnitzii, and a proposal to reclassify it as Faecalibacterium prausnitzii gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 52, 2141–2146 (2002) Lawley, T. D. et al. Antibiotic treatment of Clostridium difficile carrier mice triggers a supershedder state, spore-mediated transmission, and severe disease in immunocompromised hosts. Infect. Immun. 77, 3661–3669 (2009) Francis, M. B., Allen, C. A., Shrestha, R. & Sorg, J. A. Bile acid recognition by the Clostridium difficile germinant receptor, CspC, is important for establishing infection. PLoS Pathog. 9, e1003356 (2013) Janoir, C. et al. Adaptive strategies and pathogenesis of Clostridium difficile from in vivo transcriptomics. Infect. Immun. 81, 3757–3769 (2013) Rajilić-Stojanović, M. & de Vos, W. M. The first 1000 cultured species of the human gastrointestinal microbiota. FEMS Microbiol. Rev. 38, 996–1047 (2014) Galperin, M. Y. et al. Genomic determinants of sporulation in Bacilli and Clostridia: towards the minimal set of sporulation-specific genes. Environ. Microbiol. 14, 2870–2890 (2012) Abecasis, A. B. et al. A genomic signature and the identification of new sporulation genes. J. Bacteriol. 195, 2101–2115 (2013) Meehan, C. J. & Beiko, R. G. A phylogenomic view of ecological specialization in the Lachnospiraceae, a family of digestive tract-associated bacteria. Genome Biol. Evol. 6, 703–713 (2014) Riley, T. V., Brazier, J. S., Hassan, H., Williams, K. & Phillips, K. D. Comparison of alcohol shock enrichment and selective enrichment for the isolation of Clostridium difficile . Epidemiol. Infect. 99, 355–359 (1987) Fodor, A. A. et al. The “most wanted” taxa from the human microbiome for whole genome sequencing. PLoS One 7, e41294 (2012) de Hoon, M. J., Eichenberger, P. & Vitkup, D. Hierarchical evolution of the bacterial sporulation network. Curr. Biol. 20, R735–R745 (2010) Onyenwoke, R. U., Brill, J. A., Farahi, K. & Wiegel, J. Sporulation genes in members of the low G+C Gram-type-positive phylogenetic branch (Firmicutes). Arch. Microbiol. 182, 182–192 (2004) Forster, S. C. et al. HPMCD: the database of human microbial communities from metagenomic datasets and microbial reference genomes. Nucleic Acids Res. 44, D604–D609 (2016) Faith, J. J. et al. The long-term stability of the human gut microbiota. Science 341, 1237439 (2013) Schloss, P. D., Iverson, K. D., Petrosino, J. F. & Schloss, S. J. The dynamics of a family’s gut microbiota reveal variations on a theme. Microbiome 2, 25 (2014) Paredes-Sabja, D., Shen, A. & Sorg, J. A. Clostridium difficile spore biology: sporulation, germination, and spore structural proteins. Trends Microbiol. 22, 406–416 (2014) He, M. et al. Emergence and global spread of epidemic healthcare-associated Clostridium difficile . Nature Genet. 45, 109–113 (2013) Goodman, A. L. et al. Extensive personal human gut microbiota culture collections characterized and manipulated in gnotobiotic mice. Proc. Natl Acad. Sci. USA 108, 6252–6257 (2011) Lagier, J. C. et al. Microbial culturomics: paradigm shift in the human gut microbiome study. Clin. Microbiol. Infect. 18, 1185–1193 (2012) Ludwig, W. et al. ARB: a software environment for sequence data. Nucleic Acids Res. 32, 1363–1371 (2004) Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541 (2009) Bosshard, P. P., Abels, S., Zbinden, R., Böttger, E. C. & Altwegg, M. Ribosomal DNA sequencing for identification of aerobic gram-positive rods in the clinical laboratory (an 18-month evaluation). J. Clin. Microbiol. 41, 4134–4140 (2003) Clarridge, J. E. III . Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin. Microbiol. Rev. 17, 840–862 (2004) Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microbiol. 73, 5261–5267 (2007) Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990) Price, M. N., Dehal, P. S. & Arkin, A. P. FastTree 2—approximately maximum-likelihood trees for large alignments. PLoS One 5, e9490 (2010) Letunic, I. & Bork, P. Interactive Tree Of Life v2: online annotation and display of phylogenetic trees made easy. Nucleic Acids Res. 39, W475–W478 (2011) Kozich, J. J., Westcott, S. L., Baxter, N. T., Highlander, S. K. & Schloss, P. D. Development of a dual-index sequencing strategy and curation pipeline for analyzing amplicon sequence data on the MiSeq Illumina sequencing platform. Appl. Environ. Microbiol. 79, 5112–5120 (2013) Wood, D. E. & Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol. 15, R46 (2014) Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nature Methods 9, 357–359 (2012) Lawley, T. D. et al. Proteomic and genomic characterization of highly infectious Clostridium difficile 630 spores. J. Bacteriol. 191, 5377–5386 (2009) Bosshard, P. P., Zbinden, R. & Altwegg, M. Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium. Int. J. Syst. Evol. Microbiol. 52, 1263–1266 (2002) Duncan, S. H., Hold, G. L., Barcenilla, A., Stewart, C. S. & Flint, H. J. Roseburia intestinalis sp. nov., a novel saccharolytic, butyrate-producing bacterium from human faeces. Int. J. Syst. Evol. Microbiol. 52, 1615–1620 (2002) Iino, T., Mori, K., Tanaka, K., Suzuki, K. & Harayama, S. Oscillibacter valericigenes gen. nov., sp. nov., a valerate-producing anaerobic bacterium isolated from the alimentary canal of a Japanese corbicula clam. Int. J. Syst. Evol. Microbiol. 57, 1840–1845 (2007) Paredes-Sabja, D., Setlow, P. & Sarker, M. R. Germination of spores of Bacillales and Clostridiales species: mechanisms and proteins involved. Trends Microbiol. 19, 85–94 (2011) This work was supported by the Wellcome Trust (098051); the United Kingdom Medical Research Council (PF451 to T.D.L.); the Australian National Health and Medical Research Council (1091097 to S.C.F.) and the Victorian Government’s Operational Infrastructure Support Program (S.C.F.). We are grateful to G. Dougan and A. Walker for their input. We would also like to acknowledge funding from the Wellcome Trust Sanger Institute Technology Translation team, and sequencing and bioinformatics support from the Pathogen Informatics team. The authors have filed a patent application related to the described work. Extended data figures and tables Extended Data Figure 1 A workflow for culturing, archiving and characterization of the intestinal microbiota. a–d, Schematic diagram of the workflow, encompassing bacterial culturing and genomics to isolate and characterize bacterial species from the human intestinal microbiota. The process incorporates several steps, which are culture, re-streak, archive and phenotype. a, Fresh faecal samples are left untreated or are treated to select for bacteria with a desired phenotype (such as sporulation). The stool is homogenized and then serially diluted and then aliquots of the homogenate are inoculated on YCFA agar to culture bacteria. b, Isolates are identified by selecting single colonies that are streaked to purity and full-length 16S rRNA genes are amplified and sequenced. c, Each unique, novel and desired isolate is archived frozen in a culture collection and a whole-genome sequence is generated for each. d, Phenotypic characterization and functional validation of metagenomics studies can be performed in vitro and in vivo. Extended Data Figure 2 Comparison of sequence read content of faecal samples and cultured samples for six donors. The majority of sequence reads from the original donor faecal samples (n = 6) are present in culture samples both as raw reads (93% shared on average across the six donors) and after de novo assembly (72% shared on average across the six donors). a, b, Representative species from 21 of the 25 most abundant bacterial genera (a) and 23 of the 24 most abundant species (b) were isolated and archived (abundance was determined by metagenomic sequencing and based on average relative abundance across the six donors (n = 6)). This represents 96% of the average relative abundance at the genus level and 90% of the average relative abundance at the species level across the six donors. A red dot in a indicates the number of species archived from each genus. Lachnospiraceae incertae sedis, unclassified Lachnospiraceae, Clostridium IV and Clostridium XI are not strict genera and represent currently unclassified species. Odoribacter splanchnicus in b was the only species not archived. c, Lowly represented intestinal microbiota members were also cultured. At least one representative species from each of the genera presented were cultured. Median and range is presented for the above with taxa ranked by median value. d, The number of bacterial species cultured in this study. At least 40% from each category were previously unknown. Full length 16S rRNA gene phylogeny illustrating the taxonomic relationship of ethanol-resistant bacteria within the Firmicutes cultured from the donor faecal samples. Branch colours indicate distinct families. Shaded text indicates species cultured from an ethanol-treated faecal sample and unshaded text indicates species cultured from a non-ethanol-treated faecal sample. Percentage values represent closest identity to a characterized species. Transmission electron micrographs (TEMs) of spore ultrastructures for a phylogenetically diverse selection of cultured bacteria are shown with an arrow in images and include a candidate novel family with 86% identity to the 16S rRNA gene sequence from Clostridium thermocellum. Typical spore structures are defined and illustrated in the same image. TEMs are ordered according to boxes next to the species name. Scale bars are shown at the bottom of each image. C. difficile is included for context. Bacteria displaying an ethanol-resistant phenotype represent species previously classified as non-spore-formers (Turicibacter sanguinis38 and closely related candidate novel species), species closely related to non-spore-formers (Roseburia intestinalis39 and Oscillibacter valericigenes40 and closely related candidate novel species) or species suspected of forming spores but which, to our knowledge, have never been demonstrated to do so until now (Eubacterium eligens, Eubacterium rectale, Coprococcus comes41 and related candidate novel species). A genomic signature for identifying spore-forming bacterial species contains sporulation- and germination-associated genes and genes not previously associated with sporulation. Characterized sporulation genes are on the outer circle, genes not associated with a specific sporulation cycle or uncharacterized genes are in the inside rectangle. C. difficile strain 630 gene names are used when possible, otherwise locus tag identifiers are shown. Bacillus subtilis gene names are used when no C. difficile homologue is available. The signature is enriched with known sporulation-associated genes from stages I–V of the spore formation and germination cycles (significant at q < 3.0 × 10−37, Fisher’s exact test). Genes associated with regulation are present with at least 10 genes coding for regulatory or DNA-binding roles (q < 1.4 × 10−5, Fisher’s exact test). Genes not previously associated with sporulation are also present and these have putative roles as heat shock, membrane-associated proteins and DNA-polymerase-associated proteins. a, The signature accurately distinguishes spore-forming and non-spore-forming bacteria cultured from this study and from across different environments (known spore-formers n = 57, known non-spore-formers n = 50, cultured after ethanol treatment n = 69, cultured after no ethanol treatment n = 149). Refer to Supplementary Table 1 for signature scores of the bacteria tested. Mean ± s.d. b, Assignment of functional classes to the signature reveals a wide range of functional processes with sporulation- and regulation-associated genes dominating. Extended Data Figure 7 Spore-forming bacteria are more resilient than non-spore-forming bacteria to environmental stresses such as disinfectants. Pure bacterial cultures were immersed in ethanol for 4 h before being washed and inoculated onto YCFA growth medium with sodium taurocholate as a germinant. Only spore-forming bacteria survived. Taxonomic family names are shown in brackets. The dashed line indicates the culture detection limit of 50 c.f.u. ml−1. Mean ± s.d., n = 3 biological replicates for each species tested. The number of c.f.u. present on plates in the presence of a particular germinant expressed as a fold change with respect to the number of c.f.u. present on plates in the absence of a germinant. No ethanol shock treatment was performed beforehand. A fold change of one (dashed line) would indicate that a germinant had no effect on the number of c.f.u. recovered from the bacteria. There was no statistically significant difference based on an unpaired t-test of each germinant condition against the no germinant condition. Mean and range, n = 3 biological replicates for both species. Extended Data Figure 9 Validation of the estimation of the proportion of spore-formers in the intestinal microbiota. Full-length 16S rRNA gene amplicon sequencing was used to determine the taxonomic proportions of bacteria from the six donor faecal samples. Spore-forming bacteria were cultured from each donor and a taxonomic classification was assigned as described in the main text. The genus (circle) and family (square) taxonomic ranks were designated as the lower and upper limits for calculating the proportion of spore-formers at a taxonomic level. Specific genera and families were included if they contained a species that was cultured after ethanol shock treatment. Mean ± s.d. About this article Cite this article Browne, H., Forster, S., Anonye, B. et al. Culturing of ‘unculturable’ human microbiota reveals novel taxa and extensive sporulation. Nature 533, 543–546 (2016). https://doi.org/10.1038/nature17645 Sediment-associated microbial community profiling: sample pre-processing through sequential membrane filtration for 16S rRNA amplicon sequencing BMC Microbiology (2022) BMC Ecology and Evolution (2022) Species-targeted sorting and cultivation of commensal bacteria from the gut microbiome using flow cytometry under anaerobic conditions Strain-level characterization of broad host range mobile genetic elements transferring antibiotic resistance from the human microbiome Nature Communications (2022) Nature Communications (2022)

<urn:uuid:ea72126a-e1d8-49a4-bc23-8792b6009c1c>

Around 105 countries have competition law. It is also known as anti-trust law. The history of competition law is usually traced back to the enactment of Sherman Act in 1890 in the US. Like any modern competition law, Indian Competition Act, 2002 concentrates majorly on three areas: (i) anti-competitive agreements, (ii) abuse of dominance; and (iii) merger control. (i) anti-competitive agreements: Any agreement (written or verbal) that restricts competition is anti-competitive agreement. Even an informal agreement to behave in market in a certain way, say restricts production / supply, fix prices or sharing markets will be hit by provisions of competition law. Anti competitive agreements can be between players of same category, say between rivals. It may be in the form of cartel. It is also referred to as horizontal agreements. In such cases, in India, it is presumed that such horizontal agreement is having “appreciable adverse effect on competition” and hence void and liable for penal action under the law. To detect horizontal agreements like cartel, generally leniency or amnesty programs are followed by regulators across the globe. In India, section 46 of the law provides for the same and it does empower the Competition Commission to reduce or waive the penalty. However, there are no criminal sanctions for cartelization under the Competition Act, 2002. Further, Anti competitive agreements can be between producers and suppliers / distributors. By such agreements ‘control’ is exercised over raw material or access to market / entry barriers. These are also referred to as vertical agreements. In India, such agreements are declared void if it has “appreciable adverse effect on competition”. It needs to be proved and is not presumed as in horizontal agreements. Section 3 of the Competition Act distinguished between horizontal and vertical agreements. Anti-competitive agreements are declared to be void. In case of cartel, monetary fines can be upto 10% of turnover of each member, for each year of continuation of Cartel or 3 times of profits of each member, whichever is higher. (ii) abuse of dominance: ‘Dominance’ can be defined as the ability of the firm to raise prices or reduce output or do both, independently of its rivals and consumers (to undestand, say in case of monopoly). In order to establish abuse of dominance or dominant position, it is first necessary to establish the dominance itself. Dominance of enterprises can be in the relevant market, which can be demarcated on the basis of the relevant product market (i.e. substitute products or services) and the relevant geographic market (i.e. neighboring areas or territories from which products can be supplied profitably at little above the current prices to the area under inquiry). Section 4 of the Competition Act deals with abuse of dominance. It presumes five types of abuses including, discriminatory /unfair pricing, predatory pricing or unfair conditions of sale/purchase, limits or restricts production or scientific development, denial of market access, make contracts conditional to unconnected supplementary obligations and use of dominant position in one market for entry in another. Section 4 prohibits such behaviour. In such cases, injury or harm is not required to be proved. Only dominance needs to be proved, after considering various factors, economic as well as non-economic, stated in the Competition Act itself. Once dominance is established and if the the dominant firm is found to be indulging in any of the five kinds of behaviour specified under section 4(2) of the Competition Act, such behaviour is presumed to be an abuse. (iii) merger control: Indian Competition Act, 2002 uses the term “combinations” to cover acquisition of control, shares, voting rights and assets, and mergers and amalgamations. The underlying logic is that it is much easier to stop a combination that is likely to undermine competition than to deal with the situation subsequently, after the damage has been done (which could have been prevented in the first place). Competition Commission can either approve, stop (deny approval) or modify conditions of combinations. Generally any combination giving market power (control product or geography), say combination of substitute products, likely to give dominance and hence normally are not approved. Combinations can be classified into three categories: (a) horizontal combination – i.e. merger of competitors. (b) vertical combination – i.e. merger of entities in supply chain – say manufacturer of final product acquiring raw material supplier; or merger of manufacturer and distributors. (c) conglomerate combinations – i.e. where the combining parties are in unrelated businesses and usually do not raise competition concerns. Competition Act control merger by prescribing mandatory prior approval of Competition Commission of India.It also covers within its ambit, combinations taking place outside India, if it has nexus in India. The Competition Act, 2002 provides thresholds both in terms of assets as well as turnover of entities involved in combination. The threshold limits in the Indian law are relatively higher than most jurisdictions. P. K. Pandya & Co. provides advisory and appearance service under Competition Act, 2002.

<urn:uuid:b469b346-5303-4e0b-b7c7-86fe2f840a6d>

As if the waves of novel variants of "interest" and "concern" sweeping the planet haven't been enough, and we find versions of SARS-CoV-2 dodging in and out of species in a complex pattern of spillovers and spillbacks, we discover that it's even sneakier. Two new papers in Nature Communications, from a group at the Max Planck Bristol Centre of Minimal Biology, describe how the virus can differ genetically in different parts of the same host. That may mean that if vaccines and treatments vanquish the virus in the respiratory tract, the pathogen might persist elsewhere. And the viruses in new places replicate and infect more vigorously, better able to elude our immune response. That's not good news as protection from vaccinations or having had COVID-19 wanes. To continue reading, go to DNA Science, where this post first appeared.

<urn:uuid:3f368ffd-b048-4c6b-8127-18742765749e>

The Extreme Temperatures of the Universe For most of us, temperature is a very easy variable to overlook. Our vehicles and indoor spaces are climate controlled, fridges keep our food consistently chilled, and with a small twist of the tap, we get water that’s the optimal temperature. Of course, our concept of what’s hot or cold is actually very narrow in the grand scheme of things. Even the stark contrast between the wind-swept glaciers of Antarctica and the blistering sands of our deserts is a mere blip on the universe’s full temperature range. Today’s graphic, produced by the IIB Studio, looks at the hottest and coldest temperatures in our universe. But First: What is Temperature Anyway? Before looking at this top-to-bottom view of extreme temperatures, it helps to remember what temperature is actually measuring – kinetic energy, or the movement of atoms. Hypothetically, atoms would simply stop moving as they reach absolute zero. As matter heats up, it begins to “vibrate” more vigorously, changing states from solid to gas. Eventually, plasma forms as electrons wander away from the nuclei. With that quick primer, let’s dig into some of the hottest insights in this cool data visualization. Highs and Lows on Planet Earth Earth’s lowest air temperature, -135ºF (-93ºC), was recorded in Antarctica in 2010. Since then, scientists have discovered that surface ice temperatures can dip as low as -144ºF (-98ºC). The conditions need to be just right: clear skies and dry air must persist for several days during the polar winter. In surroundings this cold, human lungs would actually hemorrhage within just a few breaths. On the other end of the spectrum of extreme temperatures, the hottest surface reading on Earth of 160ºF (71ºC) occurred in Iran’s Lut Desert in 2005. In fact, the Lut Desert clocked the highest surface temperature in 5 out of 7 years during a 2003-2009 study, making it the world’s hottest location. The desert’s dark pebbles, dry soil, and lack of vegetation create the perfect conditions for blistering heat. There are very few organisms that can withstand such temperatures, but one fascinating phylum makes the cut. The Amazing Tardigrade Commonly known as a “moss pig” or “water bear”, the one-millimeter long tardigrade is extremely resilient. While most organisms need water to survive, the tardigrade gets around this by entering a “tun” state, in which metabolism slows to just 0.01% of its normal rate. When water is scarce, the creature curls up and synthesizes molecules that lock sensitive cell components in place until re-hydration occurs. Beyond dry conditions, the tardigrade can also survive both freezing and boiling temperatures, high radiation environments, and even the vacuum of space. This video courtesy of TEDEd explains more about the hardy critter: Testing the Limits For better or worse, humans have pushed the limits of temperature here on Earth. At MIT, scientists cooled a sodium gas to half-a-billionth of a degree above absolute zero. In the words of the Nobel Laureate Wolfgang Ketterle, who co-led the team: “To go below one nanokelvin (one-billionth of a degree) is a little like running a mile under four minutes for the first time.” Not all experiments are conducted out of simple curiosity. Conventional bombs already explode at around 9,000ºF (5,000ºC), but nuclear explosions take things much further. For a split second, temperatures inside a nuclear fireball can reach a mind-bending 18,000,000ºF (10,000,000ºC). The highest man-made temperature ever recorded is 9,900,000,000,000ºF (5,500,000,000,000ºC), created in the Large Hadron Collider at CERN in Switzerland. It was achieved by accelerating heavy lead ions to 99% the speed of light and smashing them together. Highs and Lows of the Universe While humans have been able to manufacture extremely hot and cold temperatures, the universe has created these extremes naturally. Undoubtedly, the creation of the universe is made of the hottest stuff of all. The temperature of the universe at 10⁻³⁵ seconds old was a whopping 1 octillion ºC. Moments later, it “cooled down” to 1,800,000,000ºF (1 billion ºC) when the universe was less than two minutes old. On the other end of the spectrum, the coolest natural place currently known in the universe is the Boomerang Nebula at -457.6ºF (-272ºC). It’s found 5,000 light years away from us in the constellation Centaurus, and it is currently in a transitional phase as a dying star. As space exploration goes further than ever, these extreme temperatures may one day reach even hotter or colder heights than we can imagine. The 44 Closest Stars and How They Compare to our Sun This graphic visualizes the 44 closest stars, revealing key facts such as distance from Earth, brightness, and whether potential planets are in orbit. 44 Closest Stars and How They Compare to our Sun Humans have been fascinated by the stars in the night sky since the dawn of time. We’ve been decoding the mysteries of celestial bodies for many centuries, but it is only in the last 200 years or so that we’ve been able to glean more detailed information on the lights that dot the night sky. Friedrich Bessel’s method of stellar parallax was a breakthrough in accurately measuring the positions of stars, and opened new doors in the effort to map our universe. Today, high-powered telescopes offer even more granular data on our cosmic neighborhood. The infographic above, from Alan’s Factory Outlet, categorizes the 44 closest stars to Earth, examining the size, luminosity, constellations, systems, and potential planets of each star. Our Nearest Stellar Neighbors Our closest neighboring stars are all part of the same solar system: Alpha Centauri. This triple star system – consisting of Proxima Centauri, Alpha Centauri A, and Alpha Centauri B – attracts a lot of interest because it hosts planets, including one that may be similar to Earth. The planet, Proxima Centauri b, is a lot closer to its star than Earth is to the Sun. However, because Proxima Centauri is a smaller and cooler red dwarf type star, the planet’s orbit is within the habitable zone. It’s thought that Proxima Centauri b receives approximately the same amount of solar energy as Earth does from our Sun. Here’s a full list of the 44 of the closest stars to Earth: |Star Name||Distance (light years)||MoE| |α Centauri A||4.37||±0.0068| |α Centauri B||4.37||±0.0068| |Luyten 726-8 A||8.79||±0.012| |Luyten 726-8 B||8.79||±0.012| |EZ Aquarii A||11.11||±0.034| |61 Cygni A||11.40||±0.0012| |61 Cygni B||11.40||±0.0012| |Struve 2398 A||11.49||±0.0012| |Struve 2398 B||11.49||±0.0012| |Groombridge 34 A||11.62||±0.0008| |Groombridge 34 B||11.62||±0.0008| |Kruger 60 A||13.07||±0.0052| |Kruger 60 B||13.07||±0.0052| |Wolf 424 A||14.05||±0.26| |Van Maanen's star||14.07||±0.0023| Even though we see many of these stars in the night sky, humans aren’t likely to see them in person any time soon. To put these vast distances into perspective, if the Voyager spacecraft were to travel to Proxima Centauri, it would take over 73,000 years to finally arrive. The Brightest Stars in the Sky The closest stars aren’t necessarily the ones most visible to us here on Earth. Here are the top 10 stars in terms of visual brightness from Earth: |Rank||Proper name||Constellation||Visual magnitude (mV)||Distance (light years)| |4||Rigil Kentaurus & Toliman||Centaurus||−0.27 (0.01 + 1.33)||4.4| Excluding our Sun, the brightest star visible from Earth is Sirius, or the Dog Star. Sirius, which is about 25 times more luminous than the sun, visually punctuates the constellation Canis Major. Filling in the Gaps The next step in learning more about our surroundings in the cosmos will be seeing which of the stars listed above have planets orbiting them. So far, the 44 stars in the infographic have over 40 planets scattered among them, though new discoveries are made all the time. With each new mission and discovery, we learn a little bit more about our pocket of the universe. Visualizing the True Size of Land Masses from Largest to Smallest Maps can distort the size and shape of countries. This visualization puts the true size of land masses together from biggest to smallest. The True Size of Land Masses from Largest to Smallest Is Greenland the size of the entire African continent? But looking at a map based on the Mercator projection, you would think so. Today’s infographic comes from the design studio Art.Lebedev and shows the true size of the world’s land masses in order from largest to smallest using data from NASA and Google. Check out the actual shape and size of each land mass without any distortions. Distorting Reality: Mercator Misconceptions Maps can deceive your eyes but they are still powerful tools for specific purposes. In 1569, the legendary cartographer, Gerardus Mercator, created a new map based on a cylindrical projection of sections of the Earth. These types of maps were suited for nautical navigation since every line on the sphere is a constant course, or loxodrome. Despite the map’s nautical utility, the Mercator projection has an unwanted downside. The map type increases the sizes of land masses close to the poles (such as in North America, Europe, or North Asia) as a side effect. As a result, Canada and Russia appear to take up approximately 25% of the Earth’s surface, when in reality these nations only occupy 5%. “Things are not always what they seem; the first appearance deceives many.” – Phaedrus This collection of images above represents the world’s land masses in their correct proportions. Measurements are based on Google Maps 2016 and NASA Earth Observatory maps, with calculations based on the WGS84 reference ellipsoid, or more simply, a specific model of the Earth’s shape in two dimensions. We take for granted Google Maps and satellite imaging. Making these accurate representations is no small task – the designers went through six steps and many different iterations of the graphic. Countries are arranged by descending size and shown without external or dependent territories. For example, the total area for the contiguous United States shown does not include Hawaii, Alaska, or overseas territories. Top 10 Largest Land Masses Although Mercator maps distort the size of land masses in the Northern Hemisphere, many of these countries still cover massive territories. |United States (contiguous)||7,654,643| The top 10 land masses by size account for 55% of the Earth’s total land. The remainder is split by the world’s 195 or so other countries. Top 10 Smallest Land Masses Here are the 10 tiniest jurisdictions highlighted on the map: While the Earth’s land surface has been claimed by many authorities, the actual impact of human activity is less than one would think. Human Impact: Humbled by Nature Political borders have claimed virtually every piece of land available. Despite this, only 20% of land on the planet has been visibly impacted by human activity, and only 15% of Earth’s land surface is formally under protection. The remaining 80% of the land hosts natural ecosystems that help to purify air and water, recycle nutrients, enhance soil fertility, pollinate plants, and break down waste products. The value of maintaining these services to the human economy is worth trillions of U.S. dollars each year. While some nations are not as big as they look on the map, every piece of land counts. Chart of the Week1 month ago The Road to Recovery: Which Economies are Reopening? Misc1 month ago How People and Companies Feel About Working Remotely Technology2 months ago Zoom is Now Worth More Than the World’s 7 Biggest Airlines Technology2 months ago The COVID-19 Impact on App Popularity Misc2 months ago How Many People Die Each Day? Politics2 months ago 11 Cognitive Biases That Influence Political Outcomes Misc2 weeks ago When Will Life Return to Normal? Technology2 months ago The Future of Supply Chain Automation

<urn:uuid:9a0d3d2e-6909-415e-b13e-d4c072bad2e0>

Easter Island Heads Easter Island, the remote Polynesian island located in the South Pacific, has always been steeped in mystery. The island of ‘Rapa Nui’ or ‘Easter Island’ as it is more commonly known earned its nickname thanks to Dutch explorers landing there on Easter Day in 1722. This island’s most impressive claim to fame is an array of almost 900 minimalist monolithic human figures known as ‘Moai’ which were constructed between 1250 and 1500AD. The iconic moai have overly large heads with broad noses, strong chins and thin pouting lips. The statues have heavy torsos without legs and are usually portrayed as squatting. The oversized heads are thought to relate to the Polynesian belief in the sanctity of the head and represented both dead ancestors and powerful chiefs. Varying sizes of the statues directly related to the status of the chief who had commissioned it. Originally the majority of the statues were located along the coast gazing inland overlooking the community as if to keep them safe. The exception to this was seven figures which looked out to sea, legend has it, to guide travellers to the island. There are a few inland ‘Easter Island Heads’ which are the most iconic of the moai which recent excavations have revealed to have full torsos buried beneath the earth. Much has been made of how these monumental statues carved from a compressed volcanic ash which weigh on average 15 tons and are 13 feet high were moved around the island from the quarries to their final resting place. The most likely theories involved either rolling the statues on logs or ‘walking’ them into position using ropes. Following on from the Moai era was the ‘Birdman Cult’ which was an annual competition to select a new leader. The competition comprised of a race to a nearby islet to collect the first egg of the season from the Sooty Tern bird. The first person to swim back to Easter Island and climb up the sheer cliffs with the egg intact to hand over to their sponsor was then declared ‘birdman’ for the year, an important position of status. The demise of the island is still much debated amongst archaeologists with several leading arguments. It has long been thought that deforestation was the major cause along with the invasive Polynesian rat which devastated crops followed by the slave trade. The few survivors of the slave trade were vulnerable and as landing missionaries forced their religions onto the islanders the natives quickly lost their identity and were forced into living on a small portion of the island with much of their ancestral history lost or destroyed. As of 1994 The Rapa Nui National Park and its Moai are a UNESCO World Heritage site.

<urn:uuid:b2885bb4-b568-480b-96ca-4bd5b937cc92>

A simulation is an activity that imitates a real situation or process, usually to save money and build experience in a safe, virtual and risk-free environment. Simulations can be live activities, computer-based activities or a combination of both. For example, a batting cage, a driving range, and a flight simulator are all forms of simulation, places where mistakes are far less costly and can even be encouraged. Simulations as training tools have been used successfully in diverse industries (medicine, nuclear power, aviation, military) for many years when mistakes in the real world are unacceptable. High-fidelity simulations replicate the skills to be taught on the same kind equipment that the student will work on. Low-fidelity simulations replicate the concepts to be taught, but not in the environment where students actually use the concepts. One-hour recorded Webcast: "Driving Insight Through Process Modeling" - http://www.moresteam.com/presentations/webcast-process-modeling.cfm

<urn:uuid:7997dc6b-ef5d-4f72-8e1d-c1ec836f4401>

User Tools (skip): Parasite versus parasite Natural resources science professor Manfred Rau got into parasitology "basically because of the complexity of the interactions." PHOTO: Owen Egan It's a good thing he embraces such tangles, because your typical relationship between snails and parasites makes 21st century dating seems simple. And, to complicate matters, Rau and his research team have shown that the existing pre-conceived rules of snail-parasite trysts may be wrong. The good news is this discovery could help control disease. Rau has been following the rituals of Plagiorchis elegans, a parasite trematode that invades a compatible snail host, suppresses the snail's own reproduction while furiously multiplying itself. This spells bad news for the snail that is, in effect, castrated. But the parasite, it was thought, needed a compatible snail to accomplish a successful hijacking. "Conventional wisdom says that if we get a parasite into the wrong snail host, an incompatible snail host, that's the end," says Rau. "Nothing happens. They disappear, they're eliminated." What's interesting about Plagiorchis is that Rau and his research team have discovered it can suppress snail reproduction in more than one snail host, even in species previously believed to be incompatible. The Plagiorchis develops only to the embryonic stage, but will still have a castrating effect and, furthermore, renders the snail unsuitable for other parasites. Then Rau made a leap of logic that could help the world control schistosomiasis, a disease caused by another parasite whose life cycle takes it through the snail host wringer. Schistosomiasis infects 200 million people in the tropics, and is on the rise due to water resource development. It's a blood fluke that lives as worms in the human host, then its eggs make their way outside, often through the bladder. If it goes to a river, it infects the compatible snail that later releases schistosome larval-stage cercariae back into the water, where it easily infects humans again. "It penetrates through unbroken skin. You just have to get splashed by water containing cercariae. "It debilitates people," says Rau of the nasty effects of schistosomiasis. "Productivity goes way down, people are sick, they're walking skeletons. It's severe. It causes a predisposition to cancer in some individuals." Although there are drugs "that will kill the schistosome in the human, reinfection is almost inevitable. As soon as these people make contact with water again, within days they can have more parasites. "We had a hunch, took a major step and infected the schistosome snails with a low dose of these parasites, Plagiorchis. The first thing we noticed was the snail's reproductive system shuts down. We expected that. Then we infected the snail with schistosomes. And we found a 91 percent reduction in the number of schistosome parasites produced. It was almost complete." The first parasite renders the host as an inhospitable habitat for the second, more dangerous parasite. "Plus, if we infect snails that are already infected with the schistosomes, it has the same effect. It can be preventative and it can be curative." Molluscicides are the usual means to try to control schistosomiasis, by killing the snails. Unfortunately "even the best of them tend to kill other organisms, such as fish and other aquatic organisms in rivers." Rau has speculated about how Plagiorchis pulls a whammy on schistosomes. "Most parasites when they try to get in the snail, they Ôimmunosuppress' it. To become established, they have to knock out the internal defence mechanisms temporarily. "Plagiorchis is very unusual. What it does is it actually stimulates the host's defence mechanism when it gets in. The host reacts and shoves in all kinds of cells trying to encapsulate the parasite, and it changes the defence cells into cells that actually nourish it. "Plagiorchis has the ability to actually co-opt the responses of the host, to make use of them. Now imagine you shove this into a snail. The snail reacts by producing a non-specific internal defence response. And another parasite comes along and it's probably hit by it. So it may actually be hiking up the defence mechanisms of the snail against other invaders. "When you look at the whole picture of snail biology, it was assumed that compatible parasites had an impact on snail reproduction. Now we're beginning to realize that a whole bunch of incompatible species may have a similar effect on reproduction." Rau would like to make contacts with other researchers and take this to the river. Different species of snails yield different patterns of infection, and there are seasonal and occupational factors that can influence human infection. "When you do biological control you have to understand the system of where you're employing it. It's always dangerous to walk in when you don't know the system - you may miss things."

<urn:uuid:263b9d63-3ba5-4868-9984-f501901e341e>

Epinephrine Injectors (EpiPens) As of January 1, 2015, all schools in California are required to stock at least one epinephrine injector, which is used in case of a severe allergic reaction known as anaphylaxis. Symptoms of anaphylaxis include difficulty breathing, difficulty swallowing, and hives, and the quick use of epinephrine can save someone's life. Approximately one in thirteen children suffers from a food allergy, but severe allergies often aren't diagnosed until a child is exposed to the allergen. The California Department of Education estimates that about 25% of students have their first anaphylactic reaction at school, which is why it's so important for schools to be stocked with EpiPens. Each school must designate one or more staff members to volunteer to attend annual trainings on the use and storage of epinephrine injectors. These volunteers learn how to recognize the symptoms of an anaphylactic reaction, how to use the injector, and how to perform emergency follow-up procedures. For more information on State policy concerning EpiPens, please visit the California Department of Education website. Jean Kortz, RN School Nurse, On Special Assignment Phone: (650) 802-5454 Cell: (650) 743-6140

<urn:uuid:36c57eb9-e5d0-4d3f-83ce-ab86214d46f5>

It’s Spring and you need some lesson plans, worksheets and printables for Earth Day. So let’s put the lesson plan search engine to work. Here are just a few results from the search term “Earth Day”. Earth Day Lesson Plans: Kindergarten Lesson Plan for the Rain Forest. Some great lesson plan ideas for elementary, including hands-on planting and growing of seeds and trees. Earth Day Printables and Worksheets: A great set of quick worksheets for primary and elementary. They have mazes, self-created sign worksheets, and some neat coloring pages. A religious song for home schooling or Sunday School. Or, a secular song for elementary classrooms or music. How about a rap song about Earth Day? Enjoy! What did you find on our lesson plan search engine?Share

<urn:uuid:292212df-c084-4c0d-866a-0c4dc6e9bf9f>

Organization: NASA ARSET The rapid growth of urban populations, the urban heat island (UHI) effect, and a potential increase in the frequency and duration of heat waves due to climate change, raise a series of issues about the increased health risks of sensitive urban populations to extreme heat and the effective means of mitigating impacts of heat waves. According to the US EPA, urban heat islands affect energy consumption, elevate greenhouse gas emissions, and impair water quality by increasing the temperature of urban water runoff. This webinar was ARSET’s first training on UHI and was held in collaboration with the National Integrated Heat Health Information System (NIHHIS) and the lol竞猜最新版投注APP v10.7 (GHHIN) . This training addresses the use of remote sensing in determining where “hot spots” of land surface temperature are located in urban areas, why these areas are experiencing increased temperature, which populations are most vulnerable, and ways to mitigate the effects through adaptive land use planning.

<urn:uuid:7091bad1-5a16-4057-99d1-8c0cef4a6cc8>

What is Christian Physicalism? The dominant view in the history of Christian thought has been some version of dualism, according to which, in addition to the physical body, there is an immaterial soul. Descartes held that the soul was neither extended nor located in space, while Augustine and Kant maintained that the soul was fully present throughout the body, but present in a different way from a physical entity. And while Descartes thought that the soul was itself a substance in the sense of a thing with its own independent essence, Aquinas saw the soul as a subsistent life-giving organizing principle that informs the human body. But the consensus was that the soul could exist independently of the physical body. This was not viewed as ideal, since God clearly intended us to be integrated wholes. Each person is created as a union of body, soul and spirit (1 Thessalonians 5: 23). Yet as a result of sin, we physically die (Romans 6: 23), and the soul is separated from the body. So that it is the same person who dies that is raised to new life, as scripture clearly teaches (Job 19: 26-27; 2 Corinthians 5: 4; Revelation 6:9-10), it was held that God in His mercy maintained the soul in existence until the resurrection. Fairly recently, some Christian thinkers have argued that this understanding of anthropology is incompatible with a modern scientific worldview, and is not required on scriptural or sound theological grounds. For many, the increased evidence of the local dependence of mental functions on specific regions and activities in the brain is best explained by the idea that we are fundamentally physical creatures (physicalism). More specifically, it is typically claimed that while the mind is something more than the brain, still the former cannot exist without the latter. For example, according to Lynne Baker and Kevin Corcoran, the person is “constituted” by a physical body. A typical analogy is with a statue of David and the lump of marble it is made of. The marble constitutes the statue, but if the marble were pulverized, it would continue to exist, but the statue would not. Likewise, having a body is a necessary condition for being a person, but one only qualifies as a person if one also has the capacities for first-person awareness and intentional states. So, if these capacities are lost through disease or brain damage, we may have a human body, but not a person. Thus, constitution is not identity, because persons and bodies have different “persistence conditions”: a human body may persist even though a person does not. Alternatively, on Nancey Murphy’s view, we can say that higher mental states emerge from the brain, thereby bringing novel causal powers into the world; but still the mind is entirely dependent on the brain. The idea of emergence is typically motivated by examples. A single H2O molecule does not exhibit liquidity, but liquidity emerges when we have enough molecules at the right temperature as they are then able to move freely (unlike the frozen state) without separating (as in the case of gas). John Sperry also gave the analogy of a wheel of molecules: no individual molecule can roll by itself, but the ability to roll emerges when molecules are configured as a wheel. On Murphy’s view, the right kind of brain gives rise to higher order mental states, like conscious beliefs, desires and decisions, that act back on the brain and body. This is known as downward (mental-to-physical causation). Christian physicalists typically argue that nothing is lost by eliminating the traditional soul. On the contrary, it is claimed that the soul is a liability, because it conflicts with the causal closure of the physical world, would violate laws of physics (especially energy conservation), and has been made redundant by the amazing advances of empirical neuroscience. It is further argued that central Christian teachings on the resurrection and incarnation can still be affirmed, and so there is no reason for Christians to fear a physicalist anthropology. In subsequent posts, I will consider some of these arguments, starting with the claim that a modern scientific worldview has made the soul untenable, and then exploring foundational philosophical and theological issues. For a fuller account of the history of thought about the soul, see Stewart Goetz and Charles Taliaferro, A Brief History of the Soul (Malden, MA: Wiley Blackwell, 2011). Kevin Corcoran, Rethinking Human Nature: A Christian Materialist Alternative to the Soul (Grand Rapids, MI: Baker Academic, 2006) and Lynne Rudder Baker, Persons and Bodies: A Constitution View (Cambridge: Cambridge University Press, 2000). Nancey Murphy, Bodies and Souls, or Spirited Bodies? (New York: Cambridge University Press, 2006). [Angus Menuge is professor of philosophy at Concordia University Wisconsin and President of the Evangelical Philosophical Society. His research interests include philosophy of mind, philosophy of science, apologetics and C. S. Lewis. He earned his Ph.D. in philosophy from the University of Wisconsin-Madison, and a Diploma in Christian Apologetics from the International Academy of Apologetics, Evangelism and Human Rights, Strasbourg. He is editor of C. S. Lewis: Lightbearer in the Shadowlands, Christ and Culture in Dialogue (Crossway, 1997), Reading God’s World (Concordia Academic Press, 2004) and Legitimizing Human Rights (Ashgate, 2013). With Joel Heck, he is co-editor of Learning at the Foot of the Cross (Concordia University Press, 2011), and he is author of Agents Under Fire: Materialism and the Rationality of Science (Rowman and Littlefield, 2004).]

<urn:uuid:0c6e238d-7911-41e3-aa6d-ead519fb9561>

More efficiency and environmental protection Solar radiation consists of roughly half visible light and infra-red radiation. The infra-red element of solar radiation, in particular, is responsible for heating rooms behind glazed areas. It is therefore particularly good in terms of energy use if the coating can “distinguish” between visible light and infrared radiation by passing a high proportion of the visible light through the glass, while the infrared radiation is largely reflected. In this way pressure on the climate in the room or the air conditioning system is relieved, and also daylight is used in the best possible way, which also saves energy used for lighting.

<urn:uuid:2791a29e-e3c1-4731-829c-39049f9c9d9a>

Skip to Main Content It looks like you're using Internet Explorer 11 or older. This website works best with modern browsers such as the latest versions of Chrome, Firefox, Safari, and Edge. If you continue with this browser, you may see unexpected results. Three steps to keyword searching success: 1. Pull out the most important words in your topic or research question and use them to search. Hint: look for the nouns. Example: - Research Question: Does listening to classical music improve intelligence? - Keywords: classical music, intelligence 2. Then, think about synonyms or related terms for your keywords. Example: - classical music: Mozart, Bach, chamber music, opera, symphony - intelligence: smart, brain, intellect 3. Try searching with a few of your keywords at a time. Not liking your results? Try a different combination or think more carefully about the kind of information you're looking for. Who would be writing about this topic? What kind of language would they use? Academic Search Complete from EBSCOhost Academic Search Complete indexes citations, abstracts, and full text from journal articles, books, reports, and conference proceedings in all subject disciplines. Full text provided in PDF and HTML. Searchable cited references are provided for nearly 1,000 journals. Searches can be limited to peer reviewed sources. Indexing 1887-present, most full-text content 1980s-present. Lists of specialized and recommended databases and resources for each subject area. Look here to find more resources for your topic.

<urn:uuid:b67912da-e04a-4f25-9726-38ed2a2f9833>

Is It “There,” “They’re,” or “Their”? The inexperienced writer often misuses words that sound the same but have different spellings and meanings. Homophones are words that sound the same as another word but have a different meaning. Many homophones exist in every language to trip up the unwary. I focus in this blog on a trio and a pair whose misuse is responsible for a large percentage of grammatical/spelling errors. If you can conquer these groups, you’ll be well on the way to producing cleaner and more accurate writing, and you’ll find it much easier and less time-consuming to proofread your work. Email Makes Homophone Errors Go Viral Errors in usage of the trio and the pair have proliferated due to our increased exposure to misuse of these words. I suspect that you’ve run across these errors, perhaps without recognizing them, several times today alone. These errors have a pervasive and insidious quality. I know the difference between “there,” “they’re,” and “their.” I can also distinguish between “its” and “it’s.” Because so many people don’t, though, I’ve found that the constant repetition of errors in emails and on web sites has caused me on occasion to misuse these words. Only because I proofread everything I write, including emails, do I catch myself using these words incorrectly. “There,” “They’re,” and “Their” This trio of homophones can trip you. “There” has two uses. As an adverb it means “in or at that place.” I am going there now. It can also be used as a pronoun introducing a clause or sentence. There is a possibility she is right. “They’re” is a contraction for “They are.” The apostrophe replaces the word space and letter “a.” They’re going there. “Their” is the possessive case of the pronoun they. Think “belonging to.” Their mission is to clear up word confusion. “It’s” and “Its” These homophones confuse people. “It’s” is a contraction of “It is.” As with “They’re,” the apostrophe replaces a space and a letter. It’s time to clear up the confusion about language. “Its” indicates possession. The dog wagged its tail. Whenever you are confused between its and it’s, say the word and substitute “it is”. For example, it’s (it is) incorrect to say “The dog wagged it is tail.” Vigilance is the Price of Grammatical Freedom If you didn’t know these differences before, commit them to memory. Train yourself to notice errors in your emails and in anything else you read. Ask yourself if a usage is correct. If you did know these differences but have had that knowledge washed away by a deluge of misuse, you will need to be vigilant. Because I was so sure I knew the differences between the various words, I didn’t notice when I started mindlessly making errors. The threat is real. And one final note – I thought I smelled something. Today I got a smelly email. The author sells private label rights materials. She promoted ebooks which she asserted I could use to “decompose articles”. No thank you.

<urn:uuid:1feb4fad-e428-46ba-bc16-5790680d0ae9>

Rating is available when the video has been rented. This feature is not available right now. Please try again later. Uploaded on May 5, 2009 Les Éolides was written in 1876 and premiered the following year. This beautiful music was composed by César Franck, who was inspired by a poem based on the classical myth of Eolus, the Greek god of the wind. In Homer's Odyssey, the Éolides are the breezes which are sent by Poseidon to aid Odysseus in his return voyage. This orchestral poem is set to moving images from nature: the breezes caress fields of grass, gently rustle flowers and trees, and hold aloft the birds of the air. Dedicated to lovers of peace and conservation. Music performed by the BBC Philharmonic Orchestra conducted by Yan Pascal Tortelier. Video edited by Gilda Tabarez on May 1, 2009.

<urn:uuid:6e457b1f-a656-43e3-84fd-3f3b0c7c1386>

Ap rhetorical analysis essay example Rhetorical analysis sample essay harriet clark ms rebecca winter cwc 101 13 feb 2015 not quite a clean sweep: rhetorical strategies in grose's cleaning: the final feminist frontier. Types of analysis questions o analyze an author's view on a specific subject we will write a custom essay sample on any topic specificallyfor you for only $1390/page order now o analyze rhetorical devices used by an author to achieve his or her purpose o analyze stylistic elements in a. View notes - how to write rhetorical analysis from la 2532 at seven lakes high school how to write: ap rhetorical analysis paragraphs and essays things you must know in order to accurately analyze a. Writing a conclusion for a dissertation ap rhetorical analysis essay lnat essay help 8th grade social studies homework help. Rhetorical analysis on the scarlet letter essay let us write you a custom essay sample on rhetorical analysis on the scarlet letter for only $1638 $139/page order now related essays rhetorical analysis of the scarlet letter. How to score a 9 on an ap english essay underline when an example essay uses evidence to support a claim you should also include any literary elements that would help your analysis literary elements include character, setting, tone, etc 2. Kittredge's english classes search this site home text a brief yet helpful guide to civil disobedience introspection and socratic seminar rhetorical analysis thoreau rhetorical analysis essay politics final exam narrative of the life examine question 2 of the 2011 ap language. For example, gee documented complex literary features of cognition and rhetorical analysis essay ap lang learning in ways dissertation zusammenfassung that are likely to ask good questions additionally, they learn to sing at his mission to england. Do you lack helpful information on writing a rhetorical analysis essay on the specific article or speech read original hints to succeed on your ap english exam. A rhetorical analysis is an essay that breaks a work of non-fiction for example, the conclusion of the rhetorical analysis of the nacirema article may point out you may reproduce it for non-commercial use if you use the entire handout and attribute the university writing center. What is a rhetorical analysis essay imagery or a simile diction refers to word choices imagery refers to visually descriptive language for example, you might analyze the way an author uses war here's a link to the ap language and composition rubric for the rhetorical analysis. Here are some sample essays from previous ap tests, with student writing, rubrics practice rhetorical analyses 2008 rhetorical analysis b 2009 rhetorical analysis 3 responses to ap english language and composition practice exams & study aides. Explore timing and format for the ap english language and composition exam, and review sample questions, scoring guidelines, and sample student responses. Ap rhetorical analysis essay example Teacher overview the great influenza rhetorical strategies, remember what you are looking for: structure, appeals, and devices but you must also relate these devices to meaning. Rhetorical analysis for pre-ap how does sarah vowell use rhetorical elements in the essay shooting dad, and how does the use of these texts, write an essay in which you analyze the author's rhetorical strategies to answer these questions, providing examples to clarify your analysis. How to write a rhetorical analysis essay ap english language p identify the author uses rhetorical analysis paragraphs and also depends on the ap english language and composition, films as patterns of subjects one writer's beginnings. Ap english language and composition 2013 scoring guidelines rhetorical analysis means explaining not only what sample: 2c score: 3 the essay provides an inadequate analysis of the rhetorical strategies louv uses to develop his argument. Writing a rhetorical analysis essay can be tough to write but with our tips a challenging task will become an easy one. Ap english language and composition 2014 scoring rhetorical analysis task is const ructing the rhetorical context in which but it inadequately analyzes them and fails to explain how they are linked to the author's rhetorical purpose the essay'sexplanations are especially. Our institutional software product for learning, writing, research, and publishing, apa style central, has now been available to the public for a little more than a year example of apa rhetorical analysis example of apa rhetorical analysis. Ap language rhetorical analysis in jennifer price's critical essay, the plastic pink flamingo: a natural history, she assesses the irony in the popularity of the iconic plastic flamingo in american culture in the 1950s we will write a custom essay sample on. Having bad times with writing your rhetorical analysis essay in every english ap exam start searching for the great examples of rhetorical analysis essays from the very beginning. A rhetorical analysis essay aims to describe the tactics an author or speaker uses to convey his message to a particular audience since the ap exam is a time-limited task rhetorical analysis example. Without professional tips and a good sample one cannot create a masterpiece, especially if it is a rhetorical analysis essay get our help. A strong thesis statement for a rhetorical analysis essay examples of weak rhetorical analysis thesis statements: ap rhetorical analysis paragraphs and essays things you must know in order to accurately analyze a text: 1.

<urn:uuid:f68b48d7-c591-405d-b855-d0f165441d8a>

COVID-19 is one of the worst challenges the world is witnessing. With each passing day, the pressure on healthcare system is increasing. The scientists and researchers are still looking for a prominent solution to combat the virus and several countries are investing millions to prepare a vaccine. During these tough times, the PPE has shown its true importance. The PPE has worked as a barrier between the hospital staff, patients, and the virus. Coronavirus is found to stay on the surfaces for a long time, which is why gloves are the best way to deal with it. In a hospital, where the staff is exposed to the virus in a huge amount, touching anything with bare hands can make you infected. Since there is no vaccine, you cannot see the virus, or kill it – it’s necessary for the hospital staff to always wear gloves and dispose of them as soon as they check the patient. For the utmost security, safety gloves are used to protect your hands from catching viruses on the surface. Make sure to dispose of them properly to avoid people’s contact with them when you are done using them. Face masks are another important part of the PPE that you cannot miss. Today the entire world is wearing masks and from there you can sum up its importance. The COVID-19 virus is transmissible through the air and can enter the body through the nose or mouth. Although it’s recommended to never touch your face when you are out, it’s also necessary to wear a mask to avoid getting it through the air. Imagine someone sneezing on your face and you are not wearing a mask at that time, what would you do instead of freaking out? Nothing! So wear your mask! PPE clothing is an essential part of the medical staff. COVID-19 wards are usually filled with doctors and other staff members wearing heavy PPE clothing, face masks, gloves, and whatnot. No matter how troublesome it is, it is the need of the hour. Hence, it’s better to take precautions. COVID-19 is the right time to analyze the importance of PPE. Countries are investing thousands of dollars on the equipment to protect their people from getting the illness. Hence, getting quality PPE is all humankind need right now. Hospitals should never compromise on the quality of the PPE material.

<urn:uuid:06621b5e-2da4-4661-a32d-9aae22bc8ee2>

Why Lesson Planet? Find quality lesson planning resources, fast! Share & remix collections to collaborate. Organize your curriculum with collections. Easy! Have time to be more creative & energetic with your students! The summarizer’s job in a literature circle is to identify the key events in a story and to use those main ideas to craft a summary. Give this one-page worksheet to each of your summarizers to assist them in drafting their summary. 8 Views 178 Downloads

<urn:uuid:92230770-a8b2-4e24-bb07-fc5c5fca4e30>

Last Updated on August 11, 2021 by David Callahan Calculators come in four various forms (as for math) - The 4 function calculator: A few bucks and NOT what you want. These are: add, subtract, multiply, and divide. - Scientific calculator: These calculators can do square roots, exponentials, and trig functions (plus many other things) and are great for high school math courses and can get you all the way to calculus – but not as good as the more powerful calculators. A scientific calculator can be found for a little over $10. The TI-30 series is a great example. Most smartphones have this function built-in. Turning an iPhone sideways will open up all these functions to the basic calculator. Be careful here as the touch screen is easy to punch in (or miss punching) incorrect information. - Graphing calculator: These do everything a scientific calculator does, plus it allows you to graph functions. Start around $50 - CAS (Computer Algebraic Calculator) with graphing: These do all of the above plus computer algebra. In other words, they will solve problems for you. VERY powerful. They will typically be over $100. the TI-89 is a popular example. Any of the later 3 will work, but my choice for Algebra II with Trig or higher would be the TI-89 or equivalent. Not a ton of money for something you will use for a few years. A student could certainly do well with a TI-30 also, but if they will learn to use it, a TI-89 is a good deal. The TI-30 Calculator is included in the Everything You Need Jacob’s Elementary Algebra and Jacob’s Geometry packages. This calculator is allowed on the ACT and can be used throughout your student’s academic career and college. You can use the TI-30 with Wolfram Alpha (see online calculators below) for your graphing needs if you don’t want to stick with the TI-30. My favorite tool is the wolfram website. It is far more powerful by far than any of the above. But, you cannot use it on any tests. Find the answer to “Do I let my students use a calculator?” here.

<urn:uuid:ab24c477-f4e6-43e8-9079-fbabdd604790>

Growing cucurbits can be really frustrating for homeowners. Often our melon, cucumber, and squash plants are doing great but then they wilt overnight! The most common cause of wilting on melon and cucumber is the cucurbit bacterial wilt. This is a bacterial disease that's transmitted by the striped and spotted cucumber beetles. The first symptoms of wilt are droopy leaves on a single vine or entire plant. This is easy to confuse with water or heat stress, except that infected plants do not recover and eventually die. There's an easy way to determine if your plants are wilting due to bacterial wilt. First, check that the wilting vine is still attached to the plant. If it is, use a pocket knife to cut the vine and very slowly pull the ends apart. If you see sticky strands or bacterial ooze, there's a good chance this plant is infected with bacterial wilt. You can also cut the stem and touch one of the ends with the tip of your finger, slowly draw it away and observe if there is any strands are formed (see picture). For more information view the Purdue University Pest Management Program video online. Squash can also become infected with bacterial wilt. However, it's easy to confuse this disease with squash vine borer damage. The squash vine borer is a wrinkled, white caterpillar that feeds inside squash plant stems (usually near the soil line) from June through August. If your zucchini or pumpkin wilted, first check the base of the plant and look for small holes and frass (insect poop). If you cut the stem in half, you might be able to find one or more caterpillars inside the stem. If no borer or borer damage is found, this plant might be infected with bacterial wilt. Watermelons do not get infected with bacterial wilt or squash vine borer. If watermelons are wilting, this might indicate that there's a fungal problem coming from the soil. Fusarium wilt of watermelon causes plants to wilt, and it may begin in one or more vines. Pull out a plant and look for any browning or discoloration at the base or on the roots. Using a sharp blade, cut the stem lengthwise and look for brown streaks on the inner tissues. Fusarium and other fungal infections typically cause browning of vascular tissues. Bacterial ooze from wilt-infested plant. Links to this article are strongly encouraged, and this article may be republished without further permission if published as written and if credit is given to the author, Horticulture and Home Pest News, and Iowa State University Extension and Outreach. If this article is to be used in any other manner, permission from the author is required. This article was originally published on August 24, 2011. The information contained within may not be the most current and accurate depending on when it is accessed.

<urn:uuid:954c825a-1c32-42b2-a7ac-eb6c8ef774b2>

Euphemism in modern Russian |Course||Russian Language and Literature| |Keywords||Euphemisms Modern Russian Linguistic phenomenon Euphemism Communication activities Indirect Speech Acts False reports Pragmatic equivalence Pragmatic equivalence Constitute a means of| Euphemism is a linguistic phenomenon, common in the national languages ??of the world since the date of birth, aroused the attention of linguists, writers, psychologists, and humanists. A variety of languages ??have a certain linguistic means for the euphemistic expression, it plays an important role in people's daily lives. However, the information I have, whether it is the Chinese community, or the Russian sector of this phenomenon is not yet extensive, in terms of the depth and breadth of its research has some limitations. We believe that a comprehensive and systematic study of euphemism not only for the accumulation of the means of expression of a variety of image, vividly depicts the deep national character behind the language is of great theoretical significance, but in reading comprehension, the teaching of foreign languages ??and Russian and Chinese translation has important practical significance. This article aims to make the reader a more comprehensive understanding and knowledge of the common linguistic phenomenon of the euphemism, in order to be able to correctly understand and use the euphemism, in order to ensure the smooth implementation of communication activities. Papers on the extensive collection of domestic and international basis on the euphemism research information, Euphemism, semantics and pragmatics, etc. systematically expounded the features and functions of the linguistic phenomenon. The paper consists of six parts. The first chapter establishes the definition of euphemism, summarizes the history and current situation of euphemism and euphemisms associated with the similarities and differences of the linguistic phenomenon of code words, taboo words, and false reports were compared. The second chapter of the generation, development, and constitute a means of euphemisms, Euphemism reason, the psychological basis of the law of development and trends. The third chapter focuses on the euphemism vocabulary system and its impact on the language system. lt; WP = 55 gt; Chapter IV from the perspective of the context and indirect speech acts described euphemism use principles, features and communicative functions. Finally, discusses the a euphemism semantic equivalent translation in cross-cultural communication problems, and describes three typical translation: literal translation, paraphrase, and alternative method. Pointed out that the translation equivalents or equivalence principle also applies to this special interpretation of the Code of euphemism, especially on Pragmatic value of the translator to convey the original euphemism provides a theoretical basis. In short, the euphemism as a unique linguistic phenomenon, has a positive feature, but also to avoid the existence of negative features. Euphemism has become an indispensable means of language in human communication activities. It is a cleaner, landscaping, lubricants, and placebo. However, we must also note the euphemisms conceal, transfer perspective, and confuse the truth of the existence of sub-surface effect. We should use the euphemism attention. View of the euphemism complexity and breadth of research on the subject, my thoughts too superficial to please you tutor to be corrected.

<urn:uuid:e6698a9d-b4d2-4beb-bf6c-7c51c101e2eb>

Are GM crops safe? When it comes to the issue of GM and safety, there are two quite separate questions that need to be addressed. The Precautionary Principle At present, there are very few GM crops grown in Europe, as the EU has applied what is known as the Precautionary Principle to GM crops. This requires that in the face of scientific uncertainty, a country should not take any action that might adversely affect human and animal health or harm the environment. In practice, this shifts the responsibility on to GM proponents to prove that GM technology poses no risk. However GM supporters have argued that: - it is impossible to prove a negative and that - all human activity carries risk. Are GM foods safe for people?

<urn:uuid:696a44c1-776d-4d81-996e-e10314ef5d04>

What is an English-based creole and is it an authentic language? Creole languages are vernacular languages that advanced in colonial European settlements in the 17th and 18th centuries as a consequence of the interaction between groups that spoke jointly unintelligible languages. Creole languages most often arose in colonies near the coasts of the Atlantic Ocean or the Indian Ocean. Omissions include Brazil, where no creole appeared, and Cape Verde and the Lesser Antilles, where creoles were established in slave sidings rather than on plantations. The term `Creole’ was originally made up in Iberian colonies, seemingly in the sixteenth century, in reference to nonindigenous people born in the American colonies. It was implemented in Spanish, then in French and later in English by the early seventeenth century. By the second half, it was widespread to descendants of Africans or Europeans born in Romance colonies. The use differed from one colony to another. The term was also used as an adjective to describe plants, animals, and customs typical of the same colonies. Top 10 countries that use English-Based Creole Languages - Jamaica. It has the most wide-ranging and longest-standing literature and the broadest media and artistic usage of the diversities of Caribbean English creole and is the most completely studied. The wide appeal of Jamaican music, DUB poetry, and Rastafarian religion have spread the vernacular throughout the Caribbean region as a wide practice of folk speech. Its impact is significant in the UK, where it controls other varieties of West Indian vernacular and has been a major factor in the evolution of British Black English. - Guyana. Guyanese Creole, more often referred to as Creoles by its native speakers, is the mother tongue of the majority of the over 700,000 inhabitants of the Republic of Guyana in the northeast part of South America. It is a broadly used vernacular language variety that co-exists with Standard Guyanese English, the only official language of the country, a variety which is normally learnt through formal schooling. Furthermore, it is spoken by other Guyanese who live in communities across the world. This is the native language of the bulky majority of the 700,000 inhabitants of Guyana. It is also the one that is often used to indicate national identity, notably among the large Guyanese immigrants in the USA, Canada and the UK. - The Bahamas. The creole spoken in the Bahamas today was introduced at the end of the eighteenth century; it was brought by free blacks and the slaves of supporter North Americans, who had supported the British Crown throughout the American Revolutionary War and–after the Treaty of Versailles in1783–left the newly independent United States. - Grenada. Grenadian Creole English is the Creole language spoken in Grenada. This too it was brought by free blacks and the slaves of loyalist North Americans, who had supported the British Crown during the American Revolutionary War and–after the Treaty of Versailles in 1783. - Saint Vincent and the Grenadines. Vincentian Creole is an English-based creole language spoken in Saint Vincent and the Grenadines. It has elements of Spanish, Antillean Creole, and numerous Iberian Romance languages. It has also been influenced by the indigenous Kalinago/Garifuna elements and by the African language brought over the Atlantic Ocean by way of the slave trade. Over the years the creole has changed to be a mix of all of those languages. - Costa Rica. Limonese Creole, in Costa Rica, is the language spoken by an Afro-Costarican minority of approximately 55,000 people who have lived in a predominantly white and Spanish-speaking Central American country for more than 400 years. The Limon Province, where this group is located, is particularly contrary to the rest of the nation in terms of its geography, history, population, and economy. - Antigua and Barbuda. Leeward Caribbean Creole English is an English-based creole language made up of numerous varieties spoken in the Leeward Islands, Antigua and Barbuda, Saint Kitts and Nevis and the British territories of Anguilla and Montserrat. It emerged during the 18th century as an English-Lexifier Creole. While it thus accepted many structures of the English language everything from the creole’s dictionary to its phonology imitates Antigua’s more colourful history. - Dominica. The country of Dominica, a small island in the eastern Caribbean, is trying to preserve their unique version of the Creole language. These languages were moulded when Africans assorted their mother languages with those of their European enslavers and indigenous peoples. The languages then evolved over the years. - Saint Kitts and Nevis. Saint Kitts Creole is a dialect of Leeward Caribbean Creole English spoken in Saint Kitts and Nevis by around 40,000 people. Saint Kitts Creole has somewhat the same history as other English Caribbean creoles. Its origin goes back to 17th-century enslaved West Africans, who, when brought to the islands to work on sugar plantations, were enforced to learn British English quickly because their labour demanded it. - Trinidad and Tobago. Just as other Caribbean English-based creoles, Trinidadian English Creole has a vocabulary derived from English. Spanish, Portuguese, a number of African languages (especially Yoruba), Chinese (mainly Cantonese, with some Hakka, and now Mandarin), Trinidadian Hindustani, Tamil, and other South Asian languages have also influenced the language. Our professional language translators and interpreters are waiting for you. Whenever you need precise and accurate document translations or language interpreters, we are ready for you. At eTranslation Services, you will get professional and high-quality translations and interpretations from our native-speaking translators anywhere you are in the world. Contact us for your translation or interpretation projects via email at [email protected] or call us at (800) 882-6058.

<urn:uuid:d5098499-f045-41ef-812e-33f91027eee2>

What is the X in X-mas? "sum total of genes in a set," 1930, modeled on German genom, coined 1920 by German botanist Hans Winkler, from gen "gene" + (chromos)om "chromosome." genome ge·nome (jē'nōm') or ge·nom (-nŏm) A complete haploid set of chromosomes with its associated genes. The total amount of genetic information in the chromosomes of an organism, including its genes and DNA sequences. The genome of eukaryotes is made up of a single, haploid set of chromosomes that is contained in the nucleus of every cell and exists in two copies in the chromosomes of all cells except reproductive and red blood cells. The human genome is made up of about 35,000 genes. Compare proteome.

<urn:uuid:ab5fc767-8a2b-4a2d-a32a-bdce132db343>

The research program, code-named Apotherapy, will develop methods to activate a protein at the surface of ovarian, lung and bladder tumor cells which will stop their growth. This protein, called CD40, can also induce the destruction of malignant cells by the body’s own defences. The scientists who participate in the program aim to combine CD40 triggering with chemotherapy or with innovative drugs that will cut-off signals necessary for the survival of cancer cells. This strategy is expected to achieve maximal therapy with minimal side effects. Dr Aristides Eliopoulos of the University of Crete Medical School who co-ordinates the Apotherapy research program, commented: “We are delighted to have received funding under this program grant. It gives us the opportunity to collaborate with some of the top European scientists and oncologists to fight this deadly disease. We are confident that in the near future, we will be able to progress the best of our developed strategies into clinical practice for the benefit of cancer sufferers.” The project integrates the core skills and expertise of academic scientists, oncologists and biotechnology researchers from a total of seven Institutions:University of Crete Medical School, Greece; Apotherapy: CD40 ligand-based modalities for the treatment of solid tumors Paivi Lehtinen | alfa Spanish scientists create a 3-D bioprinter to print human skin 24.01.2017 | Carlos III University of Madrid Tracking movement of immune cells identifies key first steps in inflammatory arthritis 23.01.2017 | Massachusetts General Hospital A Swedish-German team of researchers has cleared up a key process for the artificial production of silk. With the help of the intense X-rays from DESY's... For the first time ever, a cloud of ultra-cold atoms has been successfully created in space on board of a sounding rocket. The MAIUS mission demonstrates that quantum optical sensors can be operated even in harsh environments like space – a prerequi-site for finding answers to the most challenging questions of fundamental physics and an important innovation driver for everyday applications. According to Albert Einstein's Equivalence Principle, all bodies are accelerated at the same rate by the Earth's gravity, regardless of their properties. This... An important step towards a completely new experimental access to quantum physics has been made at University of Konstanz. The team of scientists headed by... Yersiniae cause severe intestinal infections. Studies using Yersinia pseudotuberculosis as a model organism aim to elucidate the infection mechanisms of these... Researchers from the University of Hamburg in Germany, in collaboration with colleagues from the University of Aarhus in Denmark, have synthesized a new superconducting material by growing a few layers of an antiferromagnetic transition-metal chalcogenide on a bismuth-based topological insulator, both being non-superconducting materials. While superconductivity and magnetism are generally believed to be mutually exclusive, surprisingly, in this new material, superconducting correlations... 19.01.2017 | Event News 10.01.2017 | Event News 09.01.2017 | Event News 24.01.2017 | Physics and Astronomy 24.01.2017 | Life Sciences 24.01.2017 | Health and Medicine

<urn:uuid:9be33758-c610-401a-9651-fd71cdcfd670>

Data mining can be defined as the process which helps in discovering several patterns in large sets of data involving techniques of intersecting statistics, machine learning, and a database system. It is an in a disciplinary sub-category of statistics and computer science. It aims at extracting information along with intelligent methods from a set of data and transforming the same into a comprehensive structure which could be used for other purposes. In discovering knowledge on the database, the role of data mining is quite analytical. It is basically the analytical step which involves data management and database management. It also involves model, data pre-processing, and inference considerations along with complexity consideration, intersecting risk metrics, visualization, post-processing of investigated structures and online updating. Data mining has a wide scope in analyzing different sets after gathering and transforming them. Sometimes we get confused by data mining and data analysis. These two concepts are quite different from each other. Data analysis is applied to hypothesis and test models on the data set. For example, data analysis is mainly used in analyzing marketing campaign effectiveness irrespective of the quantity of data. On the other hand, we can see data mining makes the use of statistical models and machine learning to investigate and reveal hidden patterns in a large quantity of data. In this article, our experts from Assignment Help UK will tell you about the aim and techniques of data mining. The main aim of data mining is to extract knowledge and patterns from a huge volume of data. It is not only limited to the extraction of data. It is frequently used in referring to large volume data or the process of collecting, extracting, warehousing, analyzing, and producing statistical information. It is also equally applicable to the domain of decision support system of computer and machine learning along with business intelligence. In the domain of artificial intelligence, the use of data mining can be observed. It can be said that data mining is a semi-automatic task or an automatic analysis of the huge volume of data with the aim of extracting interesting patterns and unknown patterns of data records, dependencies, and unusual records. Here, the dependencies mean sequential pattern, mining, and rule mining. On the other hand, unusual records indicate anomaly detection of several groups of data records. Several database techniques are involved in spatial indices. Database techniques are found as a summary of the entire input data which could be used in predictive analysis and machine learning. Data mining process or step identifies several groups within the data which could be applied to gather more comprehensive and accurate predictions on the basis of the decision support system. Data Mining Techniques There can be several data mining techniques which are used to cater to specific business problems and to come up with a different insight. It is very important to identify the particular type of business issue or problem which is to be solved with the application of data mining techniques. If the business problem is identified accurately, it should be quite easier to select the particular data mining technique which could be useful in yielding best results. Today’s world has become quite digital in nature. People are surrounded by huge quantities of data. It could be forecasted that there would be a rapid growth of 40% per year in the coming decade. But there is a challenge in this rapid growth. The population is slowly drowning in data but people are starving for accurate knowledge. The basic reason behind this is the fact that all the data which are created are difficult to get processed. The failing initiatives to big data have generated huge amorphous data. The basic knowledge is buried inside. If people do not have the strength of powerful techniques and tools of mining such data, it would be highly challenging for them to gather benefits from the data. There are some of the data mining techniques which can help the business organizations and the entire population to develop optimal results to some particular problems. The data mining techniques help in the analysis of different data from different angles and perspective. Now, we can have the knowledge to develop our decisions on the selection of the best-suited data mining technique so as to summarise data and come up with useful information. It is very important that the information which we develop with the application of any one of the data mining techniques can be applied in solving different business problems. These techniques are highly important because actually help in analyzing the problems and identifying the workable solutions which could not only increase the revenues of the business but also could increase customer satisfaction and decrease unwanted operating and business costs. Furthermore, these techniques have been introduced after several experiments and trials. Therefore, people can depend on these techniques to understand the business problems and to figure out the best-suited solutions to each of the problem. The main aim of the business owners and analysts is to come up with prudent strategies and decisions which could eliminate the issues and put in place effective policies and actions increase the overall performance and revenues of the business. Now our Instant Assignment Help experts will tell you about various analysis. Classification analysis is a data mining technique which is applied to retrieve relevant and important information about metadata and data. It is mainly used in classifying several data and categorizing them in different classes. The classification process is quite similar to that of clustering because in the case of classification, data segments are created from data records and the segments are known as classes. But in the case of clustering, the data analysts initially gather knowledge of different cluster and classes. So in the case of data classification and analysis, we can apply algorithms with the aim of deciding the ways new data could be classified. For example, in the case of Outlook Email, algorithms are used to characterize a particular email as spam or legitimate. Association rule learning- Association rule learning is another data mining technique which helps in identifying interesting relations like dependency modelling. The relations which are revealed by this technique highlights the relationships among different variables present in large databases. This technique helps us in unpacking some latent patterns in the data which could be used to recognize variables present within the data and also could highlight the concurrence of several variables appearing quite frequently in the data set. This technique is quite essential and useful for forecasting and examining customer behaviours. It is highly important that this method could bring in positive results in the retail industry sector. This technique is also used in determining catalogue design, product clustering, and shopping basket data analysis and store layout. In the domain of Information Technology, the professionals are found to use this technique to develop programs which are capable of machine learning. Outlier detection or Anomaly- Outlier detection or Anomaly is another method of data mining in which observation for different items of data present in a data set which actually do not match with unexpected behaviour or pattern takes place. Anomalies are the novelties, outliers, deviations, noise, and exceptions. They are actionable and critical information providers. Anomaly is basically an item which deviates from common average present between a data sets or in a combination of various data. These items are generally statistically isolated from the rest of the data. They basically indicate something special or when something out of an ordinary takes place which needs additional attention. This data mining technique can be applied in system health monitoring, intrusion detection, fault detection, fraud detection, sensor networks, event detection, and ecosystem disturbance detection. The analysts discover outcomes with efficiency and accuracy by removing from the database stop the anomalous data. Clustering analysis is another data mining technique which actually considers the collection of data objects which are similar within a particular cluster. The objects within a particular cluster are found to be having similar properties when they are in the same group but they are dissimilar or different from the objects present in other clusters or groups. It is a process of revealing clusters and groups in the data with the help of a process where the association degree between any two objects is found to be highest. But they should belong to a similar group. The result of clustering analysis can be applied in developing customer profiling. It is another important method which is quite similar to that of the classification method of data mining. But in the case of clustering, a grouping of data takes place between the data which are of similar nature. Clustering can be done on the basis of demographics of the audience of any particular organization. The disposable income of that particular target segment can be recognized and identified by the method of clustering. This method also helps the business organizations and brands to develop an idea of the frequency of purchasing of the shoppers. Regression analysis is another important and commonly found data-mining technique which is expressed in statistical terms. Regression analysis is the method of identifying and analyzing the fundamental relationship between several variables. This method can help us in understanding the fundamental and characteristic value of several dependent variables and their changes. The changes independent variables take place when a single independent variable gets varied. This method is also an important method because it identifies the basic value of various dependent variables and analyses their changes with the change in independent variables. In the domain of forecasting and predicting, regression analysis technique is very commonly used to come up with an accurate outcome. Tracking patterns is one of the fundamental techniques of data mining which is used in learning the patterns in the data sets. This technique is basically a recognition of some of the aberration in our data which are taking place at regular intervals and it also helps in recognizing the flow of variables with time. For example, the sales of any product or service can seem to be getting higher before some particular holidays. Some organizations can also observe that a particular website gets the majority of the views because of a particular season. These data patterns are recognized by tracking patterns method. Prediction is another important and valuable technique of data mining. It is very important because it is implemented to project particular types of data which the business organizations assume or predict for the future. In most of the cases, understanding and recognizing historical trends is sufficient to result in accurate prediction about future outcomes. For example, the prediction technique helps in reviewing credit histories of the consumers and their past purchases and provide information about whether the customers will be credit risk for the future or not. Importance of Data Mining Techniques Data mining techniques are highly important and valuable because they help business organizations to acquire knowledge-based information. They also support organizations to make profitable adjustments in their production and operation. Data mining is one of the efficient and cost-effective solutions compared to any other statistical data application. It can be said that data mining basically helps the decision-making process to become more efficient. It also facilitates automated forecasting of behaviour and trends and also an automated discovery of latent patterns. Data mining techniques can be implemented in both existing platforms and new systems. These techniques can help the users to analyze the huge quantity of data in a cost-effective and efficient manner. Data mining techniques have different applications in different segments such as communications, insurance, education, manufacturing, banking, retail, service providers, E-Commerce, supermarkets, Crime Investigation, and bioinformatics. In the domain of communication, data mining techniques are implemented in predicting consumer behaviour and helping business organizations to offer relevant campaigns and highly targeted promotional strategies. In the field of insurance, data mining techniques can help the insurance organizations to fix the prices of their deliverables in an efficient way where the insurance providers can earn profits and promote various new offers to both their existing and new customers. For more information, you can also check with Online Assignment Help.

<urn:uuid:5eda223f-ebcb-4f64-9f23-a9c97d7de0b7>

About North America Map :-North America is the third-largest continent and is spread over 9,540,000 sq miles. The continent encompasses 23 independent states including the US, Canada, and Mexico. The Map of North America points out all the capital cities such as Ottawa, Washington D.C., Mexico City, Guatemala, San Salvador, Managua, San Jose, Panama City, Tegucigalpa, Belmopan, Kingston, Havana, Nassau, Santo Domingo, Port of Spain, Port-su-Prince, and Nassau. The North America map also points to the major rivers in the continent including River Mississippi, River Mackenzie, River Colorado, and River Missouri, the highest peaks such as Mt. Washington, Mt. Mitchell, Mt. Katahdin, Mt. Whitney, Mt. Hood, Mt. Baker, and Mt. Elbert, and the major landforms such as the Appalachian Mountains, the Rocky Mountains the Great Basin, the Sierra Madre, the Edwards plateau, the Colorado Plateau, the Caribbean island nations, and the Atlantic and Pacific coastal regions. Anthropologists are of the opinion that early initial inhabitants arrived in North America around 40,000 years ago, possibly through the Bering Land Bridge by using primitive boats. Paleo-Indians are thought to be amongst the first to arrive in North America from Asia or migrated down the Pacific coast. These people proliferated and created diverse communities across the continent. Europeans began “exploring and staking claims” in several parts of North America with the advent of the Age of Discovery (from early 15th century). The native population dwindled owing tothe violent conflicts and introduction of European diseases. After Britain, Spain, and France had fought against each other and established their presence in North America, several independence movements started across the continent in the late 18th century leading to creation of the modern countries. After the 13 British colonies on the North Atlantic coast were declared independent in 1776, they became the United States of America. The northern territories controlled by Britain and France were unified to form Canada. New Spain (from modern-day southern US to Central America) became the first Mexican empire after it was declared independent in 1810. More North America Maps Major Countries in North America North America is the third largest continent with an area of 24,346,000 square km (9,400,000 square miles). This northernmost continent is surrounded by the Atlantic Ocean on the east, Pacific Ocean on the west, Arctic Ocean on the north and the Caribbean Sea and Atlantic ocean on the south. North America is broadly divided into four great regions: the Great Plains stretching from the Gulf of Mexico to the Canadian Arctic, the Rocky Mountains, the Great Basin and Alaska in the west, and the plateau of the Canadian Shield in the northeast. The eastern region of the continent is the fourth great region that comprises the Appalachian Mountains, the Florida peninsula, and the coastal plain. The Great Plains and the Mississippi River System are among the most interesting geographical features of North America. Except a few hills, the Great Plains is generally a large swathe of treeless areas and shallow river valleys. Mississippi (3,765 km) is the most important river of North America. It combines with its tributaries – Missouri and Ohio rivers – to become the third largest river system (6,236 km) in the world. North America is a home to numerous islands located off the continent's coasts. Greenland, the world's largest island, is also a part of the continent geographically. According to the United States Geographical Survey (USGS), the geographic center of North America is about 24 km (15 mi) from Rugby, North Dakota. Mt McKinley (20,322 ft) in Alaska and the Death Valley (282 ft below sea level) in California are the highest and lowest points in the continent. Canada is one of the oldest regions in the continent with large reserves of iron, nickel, zinc, copper, gold, lead, molybdenum, and uranium. The Canadian Shield in the north is also known for its boreal forests, which are the lifeline of the logging industry. Central America is considered the geologically most active zone in the continent with volcanic eruptions and earthquakes frequenting the region. This region also has several mountain ranges with Sierra Madre de Chiapas and the Cordillera Isabelia being the longest ones. The richness in biodiversity in Canada and the USA is directly linked to their diverse landscape and large areas. While continental US and Canada are known for their vascular plants and temperate forests, Hawaii is home to more than 1,800 species of flowering plants. Laurel forests, which are temperate evergreen cloud forests, could be seen in large swathes in the southernmost point of North America. More than 430 species of mammals are endemic to the continental U.S. White-tailed deer, American mink, American beaver, striped skunk, and red fox add diversity to the fauna of North America. Gray wolf, brown bear, caribou, wolverine, and the musk ox are synonymous with Canada. The red-tailed hawk is not only quite commonly seen in the U.S., but also in the entire continent. Apart from cougars, Jaguars, and spider monkeys, it is the red brocket (deer) found in tropical forests that make the continent's fauna exclusive. Greenland is the coldest region in the entire continent by virtue of having an Arctic climate. The average temperatures hardly exceed 10°C (50° F) even during the peak of summer. However, the southern part of the country can witness temperatures rising more than 20° C (68° F) in June, July or August. Canada is known for harsh winters owing to its continental climate. Coastal regions, including British Columbia, have a temperate climate with mild winter and warm summers with average temperature ranging from 25 to 30 °C (77 to 86° F). Different climatic zones exist in the USA, thanks to its geographic variety. While south Florida and Hawaii have tropical climate, the Great Plains witness semi-arid climate. The Mediterranean climate in coastal California is in sharp contrast to the sub-Arctic climate of Alaska. North Mexico has a dry climate unlike in the tropical lowlands of southern part of the country that witnesses an average rainfall of more than 2,000 mm. The capital city of Mexico remains pleasant throughout the year with the difference between summer and winter mean temperatures being approximately 6 to 8 °C (11 to 14 °F). United States is the most populous country in North America with a total population of 320, 806, 576 (as of May 4, 2015). Mexico comes a distant second with a population of 120,286,655 (July 2014). Canada is the third largest country with a population of 34,834,841(July 2014). North America is also home to the biggest island, Greenland, which also has the world's lowest population density. Some of the Caribbean island-nations such as Cuba, Dominican Republic, Jamaica, and Trinidad and Tobago have large cities with populations greater than one million. English, Spanish, and French are the dominant languages in the continent. In Canada, English and French are considered co-official languages. In fact, places such as Ontario, Manitoba, and the US state of Louisiana have significant French-speaking population. Mexican is widely spoken in southern part of the USA. Greenland has a significant Danish-speaking population and Dutch is spoken in some of the Caribbean nations. A large chunk of North America’s population is found in the U.S.A., Mexico and Canada, and Christianity is the dominant religion in these countries. Followers of Hinduism, Buddhism and Sikhism have also made inroads into this continent. Democracy dominates the political system in the Caribbean with the presence of one-party system, multi-party systems and two-party systems. While Cuba is a revolutionary socialist democracy with one-party system, Jamaica and Barbados are among the anglophone nations that have two-party systems. The multi-party system is evident in countries such as Haiti and Suriname. US is a two-party system dominated by the Democratic Party and the Republican Party. While the democrats support a modern American liberal platform, the Republicans favor a conservative platform. Like, the US, Mexico has a congressional system of government wherein the President is the head of state and head of government. Politics of Canada stands out as it is considered a constitutional monarchy, which means the Monarch is the head of the state. The country has a multi-party system and follows the principles of parliamentary democracy. Of all the nations in North America, the U.S.A. has the largest economy. The country's estimated per capita gross domestic product (as on 2014) is $54,980. Canada is close second with its per capita GDP estimated at $44,656 and considerable growth in service, manufacturing, and mining sectors. Mexico is comparatively new to the idea of an industrialized country as it is on the cusp of change from traditional operations to modern operations. Electronic goods, industrial exports, oil and automobiles are revenue-generating sectors of Mexican economy. Cuban economy has largely been state-controlled. It is now in a revival mode after it received a setback owing to its adherence to socialist principles. The North America Free Trade Agreement (NAFTA) is one of the largest trade blocs in the world with its member nations – USA, Canada, and Mexico – establishing strong economic cooperation to eliminate trade barriers. The Caribbean trade bloc, CARICOM (Caribbean Community), is one of the earliest entities formed in 1973 with an objective of promoting economic integration among the 15 Caribbean nations. Central American Free Trade Agreement (CAFTA) was implemented in 2004 by Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua along with Dominican Republic and the U.S.A. to promote financial cooperation among its members and create a free trade area similar to NAFTA. Guatemala has the largest economy in Central America, with bananas, coffee, sugar, and petroleum being its main exports. Cuisine in North America is as varied as its topography. While Caribou stew, smoked salmon, roast beef with Yorkshire pudding, and Montreal-style smoked meat are a craze in Canada, the US swears by its hamburgers, pies, and hot dogs. Rice and fish is the staple food of the Caribbean. Flying fish, lobster, crab soup, turtle stew, and meat pies are common in almost every island in the region. Coconut is a dominant ingredient in the curries. In fact, the cuisine of Southeastern Mexico also has a Caribbean influence. Seafood is more popular in regions close to the Pacific Ocean or the Gulf of Mexico. Cuban dishes are mostly sautéed or slow-cooked. Sofrito, which is widely used for seasoning, adds a distinctive flavor to the native cuisine. Stews, meat dishes, and tomato-based sauces are quite a hit among the locals. From Mexican Mariachi to American Rock & Roll, the North America is known for introducing several genres of music to the world. American pop stars such as Elvis Presley and Michael Jackson are still considered the stalwarts. Cuban music is inspired by various musical styles like salsa, mambo and the cha-cha-cha. Popular Cuban music has strong African and European influences. The evolution of Caribbean music is largely attributed to the descendants of African slaves. Calypso and reggae are some of the genres that got worldwide popularity. Celine Dion and Shania Twain are the names that continue to bring the focus back on Canadian music. Art & Sculpture The Afro-American and European sculptors who migrated to the US revived the classical tradition and gave prominence to the idea of American Expressionism. After artists such as Jackson Pollock showed interest in Native American art, several American artists followed suit and began to recreate their traditional art. They also gave birth to a new art blending European and Native American ideas. Cuba has a long tradition when it comes to visual arts. The country has witnessed a steady transition from pre-revolution modernist masterpieces to contemporary paintings and sculptures. The mural paintings of Mexico is revered by art lovers all over the world. The immediate impact of Mexican Revolution (1910 to 1920) on Mexican art was 'dramatic', to say the least. Apart from murals, paintings with nationalistic and political messages were created on public buildings, and they had established a tradition in other parts of the Americas. Design & Architecture The US is distinctly known for its ability to create the tallest and the swankiest buildings of the world. Names such as Frank Lloyd Wright and Philip Johnson are associated with the US architecture. In Mexico, it is common to find colonial architecture with traces of Baroque style. The Meso-American architecture is noted for its pyramidal structures. The colorful colonial buildings on the streets of Cuba are among the most photographed architecture. Besides, the country includes an assortment of styles and influences for creating a uniquely Cuban-style of architecture. American literature has wowed the world with its dedicated practitioners dishing out thought-provoking ideas through novels, verses, essays and plays. The world vividly remembers such names as T. S. Eliot, Robert Frost, and Ezra Pound. Modern playwrights such as Tennessee Williams and Arthur Miller and novelists such as Toni Morrison, Virginia Woolf, William Faulkner and Ernest Hemingway are amongst the doyens of American literature. Mexican literature is also known for its prolific patrons and globally recognized authors. Cuban literature has received a belated recognition. Its themes of freedom and independence got prominence not before the advent of the 19th century. Hollywood, or the American movie industry, is perhaps the most popular across the world. It is closely intertwined with the Canadian cinema which finds a respectable position in the world cinema. Notable filmmakers such as James Cameron, David Cronenberg, and Deepa Mehta have added to the list of glorious movies made in North America. The Golden Age of Mexican cinema (1936 and 1969) has left the movie buffs with much to relish. Salma Hayek is another name that is inherently linked to Mexican and world cinema. Movies such as 'I Am Cuba' (1964) and 'The Last Supper' (1976) brought limelight on Cuban cinema. In fact, the 'Imperfect Cinema' of Cuba has been widely acknowledged as very thought-provoking and ingenious works of art. North America has an extensive railway network. The United States, Canada, and Mexico have an interconnected rail system. Plans are afoot to connect Alaska to the North American rail network. Freight-oriented railways in Mexico has a railroad network that connects the US. Panama Canal Railway connects Atlantic Ocean with Pacific Ocean. The railway line runs parallel to the Panama Canal. Guatemala runs occasional chartered tourist trains across the country. Cuba's railway system is the only one in the Caribbean islands. It provides both passenger and freight services within the country. Pan-American Highway is a network of roads totaling a length of about 48,000 km (30,000 mi). It links almost all the mainland nations. This is considered as the world's longest "motorable road." The U.S.A. has the world's largest road network with 6.4 million km (4 million mi) of roadways including interstate highways and U.S. Highways. The Trans-Canada Highway is the lifeline of Canada. In fact, Canada and the U.S.A. have built the Alaska Highway that connects Anchorage (Alaska) to Canada and the rest of the United States. Mexico also has a large road network of 323,977 km. The Inter-American Highway, which is a section of Pan-American Highway in Central America, runs for 5,470 km (3,400 mi) between Nuevo Laredo, (Mexico), and Panama City, (Panama). Like Alaska, several North American islands are not linked to continental road network and are served by ferries or private boat. West Indies, Vancouver Island, and Newfoundland (island) are some of the examples. Alaska's state-owned ferry system (Alaska Marine Highway) serves local transportation purpose. The same system operates a ferry service from Bellingham (Washington) to British Columbia in Canada. The rail ferry service between Alaska and British Columbia is one of the few such services in the entire world. Panama operates one of the busiest waterways in the world – the Panama Canal. It connects the Atlantic and Pacific Oceans. The popularity of air travel as a feasible mode of transport was felt following the World War II. The busiest airports in North America are located in the United States. Except the Toronto Pearson International Airport in Canada, nine out of 10 busiest airports are in the U.S.A. Atlanta International Airport (Atlanta) and O'Hare International Airport (Chicago) are among the major gateways to North America. While Panama has around 53 airports with paved runways, Cuba's state-owned airline 'Cubana' serves several destinations in North, Central and South America along with Europe and the Caribbean. |North America Timeline| |900AD||Toltec civilization develops in present day Mexico| |1000||Vikings visit coast of Newfoundland| |1325||Aztecs establish Mexico City| |1492||Christopher Columbus discovers the New World (the Americas)| |1499-1502||Amerigo Vespucci recognizes the new world as a separate continent| |1521||Spain defeats Aztecs and captures Mexico city| |1605||First French settlement in Port Royal (present day Nova Scotia)| |1607||First English settlement in Virginia Colony (Present day Virginia)| |1775||Start of American Revolution| |1776||USA gains independence from British Monarchy| |1821||Mexico declares independence from Spain| |1867||Four Canadian Colonies federate and create Dominion of Canada| |1991||Cold War ends and era of economic expansion begins| |1994||NAFTA (North American Free Trade Agreement) is signed between USA, Canada, and Mexico creating world largest Free Trade Area| |2004||CAFTA (Central American Free Trade Agreement) is signed between Central American Countries| Last Updated on: July 09 ,2015

<urn:uuid:ff5f1812-a257-4142-9317-2111af25ef83>

Globalization of economic life, increase of bilateral links between countries and dependence from each other, rapidity on global economic problems have turned the advisible regulation of foreign economic activity to the objective maintance. First of all mutual trading and economic link among countries are the main aspects. Foreign trade activity is the main factor for increasing social-economic prosperity in every society, but it can be caused to crisis too. Positive reflection of foreign trade activity on national economy is depended on perfectly regulation these links and stimulation them. In the first step there must be risen the level of export, that is much more attention to develop production fields contacted with export. To pay more attention for entreprices producing different kinded products ecologically safety for human health not damageus is main argument on this way. [ 2, pg 55-62] In generally, state is carring much more responsibility in the direction of economical security of country and in charge to protect nation-wide interests during market economy. Practically state experience on foreign trade regulations is exhisted in all of world countries. But its scale and methods are differed with each other due to purposes and tasks put in front of state, also state regulation on foreign trade is determined by the rules of country room in modern world-economy and internal-foreign policy of the state. The importance of state regulation for foreign trade activity is understood as the main part of economic relations developing on institutional structures. Why it is too important, foreign relations are not organized only with the sake of economical efficiency. The main issue staying by the foreign economic relations is to obtain prosperity on scientific technologies. So scientific technologies not only settled in one country, but it is integrated to global economic system after certain time. It gives much more opportunity for country economies get in co-operation with one another for the establishment new foreign economic relations. Foreign trade activity is based on full norm acts. Its known that, foreign trade activity is realized on the base of international juridical norms. Another factors are also reflected in foreign trade activity such as country participation on global system, government structure, labour forces, financial and natural recources are reasonable factors in foreign economic relations. [ 4, 6, 7] Here is given main objectives of the regulation for foreign economic activities: Preparation of norms determining juridical principles of foreign trade activity and regulation of them. Determination of organ statuses for regulating foreign trade activities. To define state regulation of foreign trade activity, declaration of norm acts over building new joint companies in country. Determination of export regime, export license, definition of rules for bringing and taking out goods Realization for currency and custom regulations To take measure for the protection of interests of the state for participation in foreign trade activity It is well known that foreign trade activity as the part of national production. All of economic reforms passed in the country shows that, these economic reforms are main parts of foreign policy realized by country on trade activities. The state looks up for forming foreign trade relations in macro-economical scale and solves global economic links. [ 3, 5 pg 21-67 ] When all methods and principles are accorded to economic reforms passed in the country, high efficiency will be made over foreign trade activity. Then economic reforms must be accorded to global economic integration too. This, is helping to expand main potensials of the country for integration to global economic system. Also we have to note that, economic reforms passed in the brand of forming foreign trade activities are reflecting advantages and disadvantages of transition term on it. State sovereignty and policy in direction of foreign economic activity are considered with the advantages of following cases; Country economy must be in charge of open policy. First stage in foreign trade could be aiming on economic relations Foreign trade activity should be organized with the principles of local resources economy, that’s there must be big amount of ready products among product exports. In foreign economic activity regulations some of main parameters will be improved: Juridically norm bases for trade policy and limitation for purpose leveling (import new technologies) Participation rules while co-operation with foreign countries, financial problems, custom tarriffs and tax system gradually are improved Import-export and personals participating with citizenship must be improved Transfer foreign trade laws to local system in the condition of international juridical system State regulation of foreign trade activities is differed mainly with the multiformed sources. In modern condition of free marketing, foreign trade regulations are analised on folllowings; International production unions Scientific-technological co-operations and joint entrepreneurship Labour forces international migrations International flow of capital International integration unions Co-operation under the frame of international organizations. The forms of foreign trade is depended on global economic development and situations. So exchangement one of these forms would reflect on anothers prioroty. Naturally by these causes, state regulation system and rules by this way will be exchanged too. In the economic theory and practise foreign trade activity regulations are determined integrally below; [1, pg 121-140] Protection of economic independence Economic security quarantee Stimulation of the national economic dveleopment 4. Rational integration supports in global economy Foreign trade activity regulations are passed by the ways named economically processes regulatutions. This processes are containing main elements of foreign economy during free marketing. These elements should be described as followings; Foreign trade policy Policy for payment balance Direction of currency reserves Foreign credits and state debts Institutional regulations of foreign trade. Described last element for foreign trade activity is mainly acted while suitable governing mechanism from the state side. C. Kharimoff, A. Oruchoff “World Economy”, Baku-2009 - C. Kharimoff, A. Oruchoff “International Economic Relations”, Baku- 2010 - H. Allahverdiyeff, K. Gapharoff “State regulation for National economy”, Baku 2009 - Aliyeff A. “Custom works and world economic development” Baku, 2003 - Авдокушин Е.Ф. Международные экономические отношения: Учебник. - М.: Юрист, 2001. – 304 с. - Международные экономические отношения: Учебник для вузов / под ред. В.Е. Рыбалкина. – М.: ЮНИТИ-ДАНА, 2007. – 605 с. - Смирнова Е.В. Рейтинг конкурентоспособности стран мира в 2007 году. // Внешнеэкономический бюллетень, 2008. – №5. – С. 3-9.

<urn:uuid:6fc74513-f438-4059-9f8b-365e5cb8b631>

According to the Centers for Disease Control and Prevention (CDC), asthma is responsible for around 10 deaths per day in the United States. Although asthma affects both children and adults, adults are four times as likely to die from asthma-related complications than young people. So, preventing asthma symptoms whenever possible is vital. The following are some avoidable asthma risk factors. Exposure to firsthand cigarette smoke can irritate the airways and make it more likely that a person with asthma will have more frequent and severe symptoms. This is also true for secondhand smoke. Even when people smoke outside the home or in a car, the lingering smoke and chemicals can expose others to secondhand smoke. Children whose mothers smoke cigarettes during pregnancy are also at greater risk of asthma than children whose mothers do not, according to the American Lung Association. Doctors are not yet sure of the underlying cause, but obesity seems to be linked with asthma. Scientists have a theory that obesity can cause inflammation in the body, including in the airways, leading to asthma. Obesity increases the amount of specific inflammatory factors that can increase the number of white blood cells in the body. This may cause inflammation and airway irritation. Allergens such as pet dander and pollen can trigger asthma attacks. People who have allergy-related conditions such as eczema and allergic rhinitis are more likely to have asthma. As a result, avoiding allergic triggers can help prevent asthma reactions. Examples of allergens that may trigger asthma include: - pet dander - dust mites If certain allergens trigger asthma symptoms, avoiding these triggers whenever possible is vital. Some strategies to help prevent asthma symptoms include: - stopping smoking and refraining from smoking around others, especially children - avoiding public places where cigarette smoking occurs - limiting outdoor exposure on days with heavy smog or smoke - encouraging a diet high in fruit, vegetables, whole grains, and lean protein - encouraging childhood vaccinations that can prevent common respiratory infections that could lead to worsening asthma symptoms - avoiding allergens that trigger asthma attacks, such as pet dander, dust mites, mold, and pollen A person should consider talking with their doctor if they think that allergens are triggering their asthma. Recognizing asthma symptoms, such as wheezing, coughing that is worse at night, and shortness of breath, is vital because it can help people seek suitable treatments for the condition. An estimated 75 percent of severe asthma attacks are preventable, according to the American Academy of Allergy, Asthma, & Immunology. Doctors can prescribe many different treatment types and combinations to help a person treat their asthma. This includes inhalers to open up the airways, steroid medications to reduce inflammation, and other oral medications that help reduce airway reactivity. If a person takes them consistently, medications alongside preventive efforts can help prevent asthma attacks from occurring. Asthma can affect a person’s quality of life and cause serious respiratory distress that can sometimes be life-threatening. Knowing risk factors and triggers for the condition can help a person engage in preventive efforts. If a person has asthma or concerns about risk factors, it is important that they talk with their doctor about how to consistently and effectively manage their symptoms. Source: Read Full Article

<urn:uuid:a28d31eb-de7e-4bc4-9be9-b4d057cee42a>

Vitamin D actually helps ensure that the body absorbs and retains calcium and phosphorus, both critical for building bone. Thanks! Vitamin D is a group of fat-soluble secosteroids responsible for enhancing intestinal absorption of calcium and phosphate. In humans, the most important compounds in this group are vitamin D3 (also known as cholecalciferol) and vitamin D2 (ergocalciferol). Cholecalciferol and ergocalciferol can be ingested from the diet and from supplements. The body can also synthesize vitamin D (specifically cholecalciferol) in the skin, from cholesterol, when sun exposure is adequate (hence its nickname, the "sunshine vitamin"). Although vitamin D is commonly called a vitamin, it is not actually an essential dietary vitamin in the strict sense, as it can be synthesized in adequate amounts by most mammals exposed to sunlight. A substance is only classified as an essential vitamin when it cannot be synthesized in sufficient quantities by an organism, and must be obtained from its diet. In common with other compounds commonly called vitamins, vitamin D was nevertheless discovered in an effort to find the dietary substance lacking in a disease, namely rickets, the childhood form of osteomalacia. Additionally, like other compounds called vitamins, in the developed world, vitamin D is added to staple foods, such as milk, to avoid disease due to deficiency. Nutrition Calcium (Ca2+) plays a pivotal role in the physiology and biochemistry of organisms and the cell. It plays an important role in signal transduction pathways, where it acts as a second messenger, in neurotransmitter release from neurons, contraction of all muscle cell types, and fertilization. Many enzymes require calcium ions as a cofactor, those of the blood-clotting cascade being notable examples. Extracellular calcium is also important for maintaining the potential difference across excitable cell membranes, as well as proper bone formation. Calcium levels in mammals are tightly regulated, with bone acting as the major mineral storage site. Calcium ions, Ca2+, are released from bone into the bloodstream under controlled conditions. Calcium is transported through the bloodstream as dissolved ions or bound to proteins such as serum albumin. Parathyroid hormone secreted by the parathyroid gland regulates the resorption of Ca2+ from bone, reabsorption in the kidney back into circulation, and increases in the activation of 3vitamin D to Calcitriol. Calcitriol, the active form of vitamin D3, promotes absorption of calcium from the intestines and the mobilization of calcium ions from bone matrix. Calcitonin secreted from the parafollicular cells of the thyroid gland also affects calcium levels by opposing parathyroid hormone; however, its physiological significance in humans is dubious. Vitamin Calcium metabolism or calcium homeostasis is the mechanism by which the body maintains adequate calcium levels. Derangements of this mechanism lead to hypercalcemia or hypocalcemia, both of which can have important consequences for health. Hypervitaminosis D is a state of vitamin D toxicity. The normal range for blood concentration is 30.0 to 74.0 nanograms per milliliter (ng/mL). Science of drugs including their origin, composition, pharmacokinetics, pharmacodynamics, therapeutic use, and toxicology. Pharmacology (from Greek φάρμακον, pharmakon, "poison" in classic Greek; "drug" in modern Greek; and -λογία, -logia "study of", "knowledge of") is the branch of medicine and biology concerned with the study of drug action, where a drug can be broadly defined as any man-made, natural, or endogenous (within the body) molecule which exerts a biochemical and/or physiological effect on the cell, tissue, organ, or organism. More specifically, it is the study of the interactions that occur between a living organism and chemicals that affect normal or abnormal biochemical function. If substances have medicinal properties, they are considered pharmaceuticals.

<urn:uuid:b3aaa0be-9cfd-4b14-ab5f-838fe532f41e>