Upload 1006 files to data/part_1

data/part_1/0036a282458736b925b571e7cb4dedc0.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0036a282458736b925b571e7cb4dedc0","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7ccdfeca-a2d6-4ad9-b0ae-073a5a3171e4/retrieve"},"pageCount":17,"title":"Profiling of bean seed and variety information dissemination channels used by seed producers in Eastern and Southern Africa","keywords":[],"chapters":[{"head":"| INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":128,"text":"Information dissemination on variety and seed can take several forms and is an avenue for introducing new technology to potential users. It is also a means for sustaining the use of a given technology. Bean seed and variety information can be share shared between research/breeder/seed system experts and farmers, between seed producers and farmers or between farmers and farmers. These promotional/information events may take a form of: demonstrations, participatory variety selection, exhibitions, Barraza's, sensitizations, trainings, and field days. To build synergies and utilize existing networks, the new paradigm is to have events organized as a collaboration between public and private sector (private seed companies, Non-Governmental Organizations, Community Based Organizations, Schools, agro-dealers, Extension agents, traders etc.) actors. The promotional event types vary by country and location within the country."},{"index":2,"size":59,"text":"Disseminating variety and technology information is important because it helps influence adoption of improved technologies thus allowing farmers exploit better genetics leading to genetic gains in farmers' fields. Also, several farmers when they adopt new varieties may be conservative to change which makes old bean varieties dominate production systems. This is true for different crops in the developing world."},{"index":3,"size":129,"text":"For example, despite having new maize varieties, the average age of maize varieties in farmers' fields is 15-20 years (Marcho et al., 2020), the age of rice varieties grown by farmers in India is 25 years (Marcho et al., 2020), and varietal turnover for common bean is 19 years in Ethiopia (Habte, et al., 2021). Having low variety turn over makes several dollars invested in developing new varieties go to waste since the superior varieties are not in use and not in farmer hands. Quickening variety turnover is critical for crops like common bean because it not only lift the crop's yield potential, but has also become urgent because common bean is highly vulnerable to environmental stresses that is on increase due to climate change (Atlin et al., 2017)."},{"index":4,"size":85,"text":"Given the importance of having varieties and other complimentary technologies in farmers hands and that seed producers play a pivotal role in ensuring access to quality seed, it is important to document the promotional methods that they use. It is also important to understand their assessment of the different methods in reaching men, women and youth. This study was thus set out to undertake an evaluation on methods use to promote bean varieties, use of improved bean seed and other integrated crop management (ICM) options."}]},{"head":"| METHODS","index":2,"paragraphs":[]},{"head":"Study area.","index":3,"paragraphs":[{"index":1,"size":55,"text":"The study was carried out in four countries. Two countries in east Africa (Burundi and the Democratic republic of Congo) and two countries in southern Africa (Zambia and Zimbabwe). The study did not limit itself to any geographical location within each country but tracked different seed producers that existed and or operated within the country."}]},{"head":"Sampling and data collection","index":4,"paragraphs":[{"index":1,"size":94,"text":"To obtain the sample of seed producers' information on existing bean seed producers was obtained from nation seed certifying authorities. Additional information was obtained from National Agricultural Research systems (NARS) partners on the seed producers that source EGS seed from them or those that are within their networks. These were then categorized as individual seed producers, contracted out growers, community based seed producers/local seed businesses, farmer cooperatives, seed companies, and NARS and data elicited from them. However that most supplied certified or quality declared seed to farmers, we clustered them together in the analysis."},{"index":2,"size":73,"text":"Data was collected on the seed producer's sources of bean variety, seed, and ICM information and the information dissemination channels they use to deliver this information. Data was also was collected on the seed producer's subjective assessment of the best information channels to use to effectively create comprehension among men, women and youth and also the most cost effective channels. Whether seed producers conduct capacity building and offer extension services was also assesses."}]},{"head":"| DATA","index":5,"paragraphs":[{"index":1,"size":104,"text":"A study to profile bean seed producers was conducted in four countries: Burundi, The democratic republic of Congo, Zambia, and Zimbabwe. In total 15 seed producers were interviewed in Burundi, 37 in DRC, 14 in Zambia, and 49 in Zimbabwe. The seed producers were of different categories including community based seed producers/farmer groups, formally registered farmer cooperatives, individual seed producers contracted as out growers, Non-governmental organizations, and seed companies. There were variations of the types of seed producers depending on the countries context. The sampling of seed producers was purposive and depended on the availability of a given type of seed in the country."}]},{"head":"| RESULTS","index":6,"paragraphs":[]},{"head":"| Source of variety and seed information among bean seed producers","index":7,"paragraphs":[{"index":1,"size":66,"text":"The major source of information on bean varieties for seed producers is research/NARS. Other sources of information are summarized in figure 1. Zambian seed producers had the least diverse ways of accessing variety information while Zimbabwe and Burundi producers had the most diverse sources for accessing variety information. Since Research/NARs is the most important source of information, it is important to support their information delivery avenues. "}]},{"head":"| Information dissemination channels used by seed producers","index":8,"paragraphs":[{"index":1,"size":121,"text":"Once seed producers receive this information, they disseminate it seed buyers. Offering variety information to seed buyers is important in creating and sustaining bean seed demand. From the survey, 57.4% of the sampled seed producers reported offering information on varieties to their clients. The largest share of seed producers that offered information was in Zambia and the lowest was in Zimbabwe (Figure 2) For the seed producers that disseminated information, the information on bean varieties, seed and integrated crop management options was mostly disseminated through demonstration plots and radio in Burundi, through agricultural shows in DRC, and mostly through agricultural shows, field days, and demonstration plots in Zambia. In Zimbabwe, the commonest means of disseminating information was demonstration plots (Table 1).  "}]},{"head":"| Perception on channels for effectively reaching different gender groups","index":9,"paragraphs":[{"index":1,"size":91,"text":"We asked seed producers to offer their perception in terms of effectiveness of different dissemination channels in reaching men, women and youth farmers. These varied by country but less between men and women. For example in Burundi, the most effective channel deemed effective in creating faster comprehension among adult mean was field demonstrations , while in DRC was agricultural shows, Zambia was field days, and in Zimbabwe was demonstrations and Radio (Figure 3). This was perceived the same for adult women though fields days also faired highly in Zimbabwe (Figure 4)."},{"index":2,"size":51,"text":"For male youth, the most important channels effective in creating faster comprehension were social media platforms and fields days in Burundi, Agricultural shows in DRC, field days and Radio is Zambia, and demonstrations, agricultural shows, and fields days in Zimbabwe (Figure 5). The methods were similar for female youth (Figure 6)."},{"index":3,"size":16,"text":"In terms of cost effectiveness in creating awareness about bean varieties and ICM options, three methods "}]},{"head":"ZIMBABWE (n=16)","index":10,"paragraphs":[{"index":1,"size":14,"text":"Figure 7: The most cost-effective information dissemination approach for raising variety awareness among farmers"}]},{"head":"| Bean seed production capacity building activities among bean seed producers","index":11,"paragraphs":[{"index":1,"size":113,"text":"Another way of delivering information is through offering training to bean seed producers who in turn pass the information to the community. About 42.9%, 61.1%, 23.1%, and 32.7% of seed producers in Burundi, DRC, Zambia, and Zimbabwe, respectively, reported that they offered training to their bean seed growers. A majority of seed producers trained in Burundi were individual seed producers, in DRC and Zambia were mostly community based seed producer/Farmer group/CBO/Local seed Business and in Zimbabwe were out growers/Individual contracted seed producer (Table 2). Figure 8 gives the most dominant methods used by seed producers to build the capacity of farmers. The commonest methods throughout countries were field demonstrations and farmer field schools."},{"index":2,"size":31,"text":"Workshops with demonstrations were also a common method. The number of men, women, and youth farmers that have benefited from capacity building offered by seed producers are summarized in Table 3.  "}]},{"head":"| Provision of extension services by seed producers","index":12,"paragraphs":[{"index":1,"size":58,"text":"To ensure that quality seed is produced, seed producers often employ extension agent and offer extension services. About 46.7%, 8.1%, 21.4%, and 32.7% of seed producers in Burundi, DRC, Zambia, and Zimbabwe reported that they offered extension related services to their seed producers. The gendered disaggregation of extension agents sued by seed companies is shown in Table 5. "}]},{"head":"| SUMMARY AND CONCLUSIONS","index":13,"paragraphs":[{"index":1,"size":134,"text":"Up to nine methods were reported by seed producers for accessing information on bean varieties and ICM options. The commonest information source was from research/NARS systems and these are the developers and maintainers of these varieties. Once seed producers access information, they disseminate to grain farmers and also contracted seed growers. The main and traditional strategies used to deliver this information includes agricultural shows, field days, and demonstrations. However there are emerging new digital tools for delivering information including social media, animations, and Radio. It was perceived that for adult men and women, use of similar kind of information channels could achieve the same levels of effectiveness. For male and female youth bean seed farmers, the use of traditional information and technology dissemination strategies combined with digital tools (social media and aminations) is critical."},{"index":2,"size":76,"text":"Seed producers also build the capacity of the seed producers they contract to produce seed. This improves their competence and thus the productivity of seed production. The commonest methods used to build the capacity of seed producers include field demonstrations, farmer field schools, and workshops with demonstrations. Seed producers are mostly trained on good seed production agronomic practices, variety identification and maintenance of genetic purity, and business management. This knowledge is further extended through extension support."}]}],"figures":[{"text":"Figure 1 : Figure 1: Major information sources for seed producers, by country "},{"text":"Figure 2 : Figure 2: Proportion of seed producers that offer variety and production information to buyers "},{"text":"Figure 3 :Figure 4 : figures 3, 4, 5, 6 and 7. "},{"text":"  "},{"text":"Table 1 : Information dissemination channels used by seed producers to create awareness   Burundi DRC Zambia Zimbabwe BurundiDRCZambiaZimbabwe Variable (n=8) (N=29) (n=13) (n=16) Variable(n=8)(N=29)(n=13)(n=16)   Percentage  Percentage Print material (leaflets, brochures,     Print material (leaflets, brochures, posters) 37.5 6.9 30.8 6.3 posters)37.56.930.86.3 Agricultural shows 0.0 82.8 100.0 25.0 Agricultural shows0.082.8100.025.0 Field days 37.5 27.6 100.0 37.5 Field days37.527.6100.037.5 Demonstration plots 62.5 13.8 100.0 56.3 Demonstration plots62.513.8100.056.3 Participatory variety selection 0.0 20.7 7.7 12.5 Participatory variety selection0.020.77.712.5 Seed fairs 12.5 13.8 15.4 12.5 Seed fairs12.513.815.412.5 Radio 50.0 13.8 15.4 6.3 Radio50.013.815.46.3  "},{"text":"Table 2 : Type of bean seed producers trained after outsourcing services  Burundi DRC Zambia Zimbabwe BurundiDRCZambiaZimbabwe (n=6) (n=22) (n=3) (n=16) (n=6)(n=22)(n=3)(n=16)  Percentage  Percentage  "},{"text":"Table 3 : Numbers of men and women seed producers trained  Burundi  Zambia Zimbabwe BurundiZambiaZimbabwe (n=9) DRC (n=36) (n=4) (n=16) (n=9)DRC (n=36)(n=4)(n=16)  "},{"text":"Table 4 : Type of training received by bean seed producers.  Burundi  Zambia Zimbabwe BurundiZambiaZimbabwe (n=6)  DRC (n=22) (n=3) (n=16) (n=6)DRC (n=22)(n=3)(n=16)   Percentage  Percentage Maintaining genetic purity in seed     Maintaining genetic purity in seed production 66.7 31.8 100.0 75.0 production66.731.8100.075.0 Field disease identification 66.7 54.5 100.0 18.8 Field disease identification66.754.5100.018.8 Store level disease identification 33.3 9.1 66.7 18.8 Store level disease identification33.39.166.718.8 Pest management 50.0 81.8 100.0 25.0 Pest management50.081.8100.025.0 Field variety Identification 16.7 27.3 66.7 18.8 Field variety Identification16.727.366.718.8 In store variety Identification 16.7 4. 66. 12.5 In store variety Identification16.74.66.12.5 Proper spacing 83.3 59.1 100.0 6. Proper spacing83.359.1100.06. Appropriate planting window 83.3 4.5 100.0 6.3 Appropriate planting window83.34.5100.06.3 plant population 83.3 40.9 66.7 12.5 plant population83.340.966.712.5 fertility management including     fertility management including inoculation 50.0 18.2 100.0 6.3 inoculation50.018.2100.06.3 Proper weed control 50.0 9.1 100.0 12.5 Proper weed control50.09.1100.012.5 Seed marketing 33.3 72.7 0.0 25.0 Seed marketing33.372.70.025.0 Record Keeping 16.7 13.6 66.7 6.3 Record Keeping16.713.666.76.3  "},{"text":"Table 5 : Number of extension agents employed by seed producers, by country Variable Variable  "}],"sieverID":"55b1c9b9-3e0c-447a-a51d-e2671a0f9ebf","abstract":""}

data/part_1/007764a9e23732365de87ed6a6747e41.json

@@ -0,0 +1 @@
+{"metadata":{"id":"007764a9e23732365de87ed6a6747e41","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6c8efc84-df49-4f14-bd10-fe1e3e641b3c/retrieve"},"pageCount":21,"title":"","keywords":[],"chapters":[{"head":"Figures and Tables","index":1,"paragraphs":[]},{"head":"Project's capacity to produce verifiable credits SLM interventions implemented","index":2,"paragraphs":[{"index":1,"size":139,"text":"The sustainable agricultural land management (SALM) practices that are being implemented in this project must be measurable within the \"Adoption of sustainable agricultural land management (SALM) by landholders and farmers \" methodology under the Voluntary Carbon Standard (VCS). These interventions, primarily in maize-based systems, will include practices that sequester carbon in above and below-ground biomass by increasing soil organic matter (minimum tillage, leaving crop residues on fields, livestock enclosures, composting of manure, compost application on fields), woody perennials (tree intercropping and planting of woodlots), and nitrogen fixing plants. The project also provides opportunities for credits from reducing GHG emissions by limiting biomass burning and NO2 emissions from inorganic fertilizers. In addition to climate-friendly practices, Vi also works with farmers on SLM interventions including water harvesting structures, crop rotations, integrated pest and disease management, and the provision of certified seeds."}]},{"head":"Project targets","index":3,"paragraphs":[{"index":1,"size":243,"text":"The carbon project is being built on the experience of Vi Agroforestry's 25-year presence in western Kenya and, in particular, on relationships in the Kisumu and Kitale areas (see Figure 1). The targeted districts for the project are Bungoma, Kisumu and Siaya. The project divisions are Bumula, Malakisi, Sirisia, Wangai, Kombewa and Madiany. For this project to be additional, however, the areas where SALM interventions are being implemented will have to be locations within these regions where Vi Agroforestry has not yet operated SALM programs. The total project area is 116,000 ha and covers mainly agricultural land (86,000 ha), dense vegetation/forest (20,000 ha), houses and compounds (7,500 ha), rivers (2000 ha) and infrastructure/roads (1,300 ha). The project plans to introduce climate-friendly SALM practices on approximately 45,000 ha, 22,500 ha in each of these two project regions, Kisumu and Kitale. Practices are not anticipated to be adopted on all agricultural land in the project area. The goal will be for 64,800 households to participate. The enrolment period is planned to last 6 years, with a goal of recruiting approximately 10,800 farmers per year. To reach these numbers, each of Vi Agroforestry's 27 field officer will have a goal of signing up 400 farmers per year into the program. Farmers are eligible to participate if they have the ability to sequester 0.5 metric tons/year of CO2e over the life project, although it is expected that the average will be 0.75 ha/year/farmer (little confusing -different units)."},{"index":2,"size":75,"text":"Over the 20 year life of the project, the emissions reduction goal will be 1,236,373 tons of CO2e at 61,818/year and with an average of 1.37 per ha/year. The credits per ha numbers differ between Kisumu (2.0 per ha/year) and Kitale (0.8 per ha/year). (See Table 1). The total voluntary carbon units (VCUs), as credits as called within the VCS, are projected total about 494,549 because of the 60% non-permanence buffer required for the project. "}]},{"head":"Progress towards targets","index":4,"paragraphs":[{"index":1,"size":43,"text":"The project signed the Emissions Reductions Purchase Agreement (ERPA) with the World Bank Biocarbon Fund in November, 2010, much later than originally anticipated, the project was operational from January 2009 after a piloting and testing phase. Progress towards targets is just now beginning."}]},{"head":"Actors for the implementation of carbon-friendly SLM practices","index":5,"paragraphs":[]},{"head":"Vi Agroforestry field officers","index":6,"paragraphs":[{"index":1,"size":181,"text":"One Vi Agroforestry field officer is assigned to each of the project's 27 focal areas. Each focal area includes roughly 12 villages, 20 to 30 groups (more on the group structure in section 0), and each year each field officer is expected to enrol about 400 farmers. When farmer groups express interest, the extension officers provide trainings on carbon sequestering SALM practices. Officers conduct trainer of trainers (TOT) activities, and hold field days to introduce farmers to the project and to demonstrate practices. They also convey information through leaflets, newspapers and radio programs. The Provincial government, particularly village chiefs, also organize public meetings for farmers and Vi Agroforestry staff to interact (see section 2.1 for more on the role of Provincial government). In addition to SALM extension and carbon project management, Vi Agroforestry runs programs in farmer organizational development, marketing and agribusiness management and village savings and loans. Gender is mainstreamed in all community activities related to access and control. The officers also offer capacity building activities that will allow community groups to take over once field officers leave the area."}]},{"head":"Community facilitators","index":7,"paragraphs":[{"index":1,"size":156,"text":"Community facilitators act as the primary liaison between the Vi Agroforestry field officers and the farmers groups. They act as a second field officer in a location. They are trained by Vi Agroforestry so that they can provide extension activities in the area, collect farm data necessary for monitoring, and help to transmit project information down to the individual community groups. They are also the cornerstone of Vi Agroforestry's plans to devolve project responsibility to communities over time, and they are being groomed for this purpose. Community facilitators are paid a small fee for their work, and are reimbursed for their travel expenses. Vi Agroforestry aims for gender balance in the selection of community facilitators. Youth tend not to be selected because of their perceived tendency of leaving home to seek employment in the urban areas. Compared to men, women are usually a better option in this case since they usually are available for community programmes."}]},{"head":"Government extensionists","index":8,"paragraphs":[{"index":1,"size":131,"text":"The presence of an organization like Vi Agroforestry is necessary in the project area, because extension activities have essentially collapsed in Kenya. A survey of farmers in the Lake Victoria area found that 89% of them received no extension services from the government. However, the Ministries of Agriculture and of Livestock do have some presence in the area. These government extensionists do have the mandates to disseminate knowledge on SALM practices, but they are grossly under-resourced. For example, the Ministry of Agriculture in Bumula district has 14 extension agents, and few resources for the agents to implement activities. This is roughly the same number as Vi Agroforestry, but their mandate is larger. There are approximately 26,000 households in the district, so for each extensionist there are roughly 1850 households to cover."}]},{"head":"Farmers and farmer groups","index":9,"paragraphs":[{"index":1,"size":61,"text":"Farmers will decide from a menu of climate-friendly SALM interventions which practices will be appropriate for their farm. They will develop and implement a farm plan. Groups will work together to share their knowledge and experiences with various interventions. Through capacity building activities of these groups the importance of balanced participation of women, men and youth in leadership positions is highlighted."}]},{"head":"Carbon measurement methodology","index":10,"paragraphs":[{"index":1,"size":82,"text":"The project is developing and piloting the \"Adoption of sustainable agricultural land management (SALM) by landholders and farmers \" Methodology under the Voluntary Carbon Standard (VCS). This methodology allows for the measurement of above and below ground carbon, as well as emissions reductions within agricultural landscapes. Soil carbon will not be physically measured on all farms, although a sample of farms will be periodically tested. Soil carbon measurements will be modelled using RothC. Trees will be measured using a CDM afforestation/reforestation methodology."}]},{"head":"Roles in monitoring","index":11,"paragraphs":[{"index":1,"size":99,"text":"The primary mechanism for project monitoring is the Activity Baseline and Monitoring Survey (ABMS), which is filled out by a sample of participating farmers annually. It collects both GHG related information as well as data on land tenure, land size, crop type, livestock, household cooking and heating, type of shelter, type of roof, water sources, distance to water, water availability, savings, goals of savings, food security, levels of education, on-farm decision making, family size and age structure, and household budgets. The survey is currently in its second edition, as revisions were made based on experiences from the pilot phase."}]},{"head":"Vi Agroforestry","index":12,"paragraphs":[{"index":1,"size":28,"text":"Vi Agroforestry field officers distribute the ABMS surveys to farmers. They have a one staff person in the Kisumu office that works on mapping and another on GIS."}]},{"head":"Community Facilitators","index":13,"paragraphs":[{"index":1,"size":21,"text":"Along with the field officers, they help community members fill out the ABMS. There is at least one in each location."}]},{"head":"Farmers and farmer groups","index":14,"paragraphs":[{"index":1,"size":116,"text":"Farmers self-monitor their carbon-friendly practices by filling out the ABMS and reporting every month. First, they must fill out a form stating their willingness to participate in the project. This form is also signed by the farmer group leader who will ultimately be responsible for collecting the ABMS forms from farmers in the group. The Vi Agroforestry field officer will collect all of the records from the group leaders. Payments will be made to the group based on the ABMS survey submitted by the farmers within it, and the groups will be responsible for distributing payments to farmers. After the project is established, each year 5% of participating farmers will be asked to complete the ABMS."}]},{"head":"World Bank Biocarbon Fund","index":15,"paragraphs":[{"index":1,"size":28,"text":"They are supporting the development and testing of the SALM. They have enlisted Unique Forestry Consultants and Joanneum Research, international carbon consultants, as technical advisors on the project."}]},{"head":"Project management capacity","index":16,"paragraphs":[]},{"head":"Organization of project participants Project Manager: Vi Agroforestry Programme","index":17,"paragraphs":[{"index":1,"size":82,"text":"Vi Agroforestry has 25 years of experience providing agroforestry advisory services in East Africa. In addition to activities in Kenya, Vi Agroforestry is also active in Tanzania, Uganda and Rwanda. The core business historically for Vi Agroforestry has been provision of extension services focused on sustainable land management's to improve farm productivity. Vi Agroforestry also has substantial experience in convening development stakeholders and conducting joint activities and sharing information with government agencies. (See section 0 for details on Vi Agroforestry's organizational structure.)"}]},{"head":"Project funders","index":18,"paragraphs":[{"index":1,"size":18,"text":"Project funders include the foundation Vi Planterar trad, the Swedish international development agency (Sida), World Bank Biocarbon Fund"}]},{"head":"Credit buyer","index":19,"paragraphs":[{"index":1,"size":4,"text":"World Bank BioCarbon Fund"}]},{"head":"Government stakeholders","index":20,"paragraphs":[{"index":1,"size":114,"text":"Government extension: Ministry of Agriculture, Ministry of Livestock and the Kenya Forest Service The Ministries of Agriculture and Livestock and the Kenya Forest Service have all worked with Vi Agroforestry in some capacity on this project and will play a key role as Vi Agroforestry transitions to a less intensive management role. These government agencies are also the primary conveners of communities to develop Community Action Plans within focal areas. Theoretically, these inform, and are informed by, divisional, district and national action plans. Communities then identified partners that they would like to work with to address key issues identified in the plans. Recent plans have included action on tree planting and climate change adaptation."},{"index":2,"size":36,"text":"Government regulation: The National Environmental Management Authority (NEMA) NEMA has national responsibility for environmental protection in Kenya and has been the primary regulatory authority for the project. (For more information on NEMA's role see section 2.4.)"}]},{"head":"Provincial administration as convener","index":21,"paragraphs":[{"index":1,"size":68,"text":"The Provincial government, particularly the village chiefs, has organized public meetings for Vi Agroforestry staff, farmers and other stakeholders to discuss climate change issues and the implementation of this carbon project. Clan leaders and village elders have played important roles as interpreters of maps for the carbon baselines. They also play important roles in land disputes, which could be relevant to the implementation of projects (see section 2.5)."}]},{"head":"Research stakeholders","index":22,"paragraphs":[{"index":1,"size":19,"text":"The Kenya Forestry Research Institutes (KEFRI) KEFRI's research helps to guide the selection of trees planted in the project."},{"index":2,"size":35,"text":"Kenya Agricultural Research Institute (KARI) KARI has collected data on soil carbon which can be used in the baseline and monitoring models for carbon projects. They also partnered a Millennium Ecosystem Assessment survey on soils."},{"index":3,"size":34,"text":"World Agroforestry Centre (ICRAF) Although ICRAF no longer works in the area, their previous research on trees has been used as a guide by Vi Agroforestry and government extensionists for which trees to plant."},{"index":4,"size":27,"text":"Lund University A PhD Student from Lund University has produced relevant research paper on Vi Agroforestry's work and provided funds for workshop with stakeholders on climate change."}]},{"head":"Private sector: Syngenta","index":23,"paragraphs":[{"index":1,"size":55,"text":"Syngenta is a local sellers of hybrid seed and herbicides. The have worked with Vi Agroforestry on trainings and see Vi Agroforestry as an intermediary allowing them to reach more farmers. They sometimes extend credit to farmers for their products. They are likely other sellers in the area, but they seem to be most active."}]},{"head":"Community Institutions: Umbrella groups, small groups and community facilitators","index":24,"paragraphs":[{"index":1,"size":5,"text":"Small groups/Community Interest Groups (CIGs)"},{"index":2,"size":81,"text":"These groups are the smallest unit of organization within the carbon project. This is the level at which the carbon contract is signed. Most of these started as groups serving community support (providing for orphans), production (joint production or marketing) or financial (village savings and loans) functions, and the structures are being leveraged so that their members can participate in the carbon project. Most have membership fees and elected positions. The existing groups help to identify new ones for the project."},{"index":3,"size":54,"text":"Umbrella groups/Community Based Organizations (CBOs) Umbrella groups are coalitions of smaller groups that interact together with field officers and pay the community facilitators. These groups may be already established livelihood or religious organizations that have sub-groups throughout the area. The groups are usually governed by elected officers. (See section 2.4 for elaboration and examples.) "}]},{"head":"Community facilitators See previous sections for information on Community facilitators","index":25,"paragraphs":[]},{"head":"The project process and timeline","index":26,"paragraphs":[{"index":1,"size":245,"text":"2007: The initiation of the project from the World Bank Biocarbon Fund which approaded Vi Agroforestry. Vi Agroforestry developed an organizational strategy to work on climate issues, and decided that they wanted to develop a carbon project. While Vi Agroforestry was developing a strategy, the World Bank Biocarbon Fund was looking for an agricultural carbon project in which to invest. The Biocarbon Fund approached Vi Agroforestry and the groups began to work together to develop the project. The project region was chosen because it met a set of poverty, food security and environmental degradation criteria developed by the groups. Also, the area had very little access to government services, and there were no major NGOs operating in the area. Vi Agroforestry and the World Bank were interested in developing a project that would test the notion that carbon finance projects could be developed with farmers in very poor and very degraded rural areas and that they could successfully and profitably create carbon credits from soil carbon. Once the site was chosen, project managers and staff were hired and Vi Agroforestry began preparing the initial project documents. Vi Agroforestry receives pre-financing from Sida for local mobilization for the project and to engage communities. March 2009: The implementation of carbon monitoring and farmer self-assessments begins. The initial iteration of the assessment turned out to be very tedious, so it was modified to take the form of the Activity Baseline Monitoring Survey (ABMS) that is currently being used."},{"index":2,"size":12,"text":"January 2010: The crediting period begins; Environmental and Social Assessments are completed."},{"index":3,"size":22,"text":"November 2010: World Bank Biocarbon Fund signs Emissions Reductions Purchase Agreement (ERPA) with Vi Agroforestry to buy credits generated from the project."}]},{"head":"2012:","index":27,"paragraphs":[{"index":1,"size":18,"text":"The first Verified Emission Reductions (VERs) are expected to be delivered, along with the first payments to farmers."}]},{"head":"2017:","index":28,"paragraphs":[{"index":1,"size":100,"text":"The project plans will enroll its final households. Vi Agroforestry plans to do a direct extension in a given area for 3 to 6 years. The carbon contracts will run for nine years, but money for the credits will flow for 20 years. A primary goal during the intensive 3 to 6 year phase is to develop the capacities for community-led project management systems based on strong community organizations with democratic principles that would allow communities to run the carbon project on their own. Eventually ViAgroforestry's responsibilities would include backstopping on monitoring and financial intermediation. 2029: The crediting period ends."}]},{"head":"Project management capacity","index":29,"paragraphs":[{"index":1,"size":4,"text":"Vi Agroforestry staffing structure"}]},{"head":"Organizational Units","index":30,"paragraphs":[{"index":1,"size":90,"text":"Vi Agroforestry implements a variety of programs outside of the carbon project, and its organizational structure allows for this range of activity. The operation in western Kenya, headquartered in Kisumu is split into four units: 1) An administrative unit which deals with organizational management and finances; a field operations unit which oversees the zone coordinators and supervision of staff; a farmer enterprise development unit which works with groups of farmers on a demand basis; and the environment and climate change unit which oversees the carbon project development and carbon monitoring."}]},{"head":"Program Director","index":31,"paragraphs":[{"index":1,"size":25,"text":"The program director has primary responsibility for the carbon project, negotiates and coordinators with buyers and manages the relationships with the World Bank BioCarbon Fund."},{"index":2,"size":21,"text":"Project managers and deputy project managers They are responsible for field staff and coordinating the collection of information for carbon monitoring."}]},{"head":"Zone coordinators","index":32,"paragraphs":[{"index":1,"size":10,"text":"The zone coordinators oversee the field staff within each zone."}]},{"head":"Field officers","index":33,"paragraphs":[{"index":1,"size":17,"text":"Vi Agroforestry has 27 field officers that cover each of the 27 locations within the project area."}]},{"head":"Organization of project participants","index":34,"paragraphs":[]},{"head":"Organizational capacity","index":35,"paragraphs":[{"index":1,"size":53,"text":"Vi Agroforestry's long-standing presence in the project area has provided them with the necessary organizational stability to lead this project. Carbon is a relatively small component of their total development activities in the area, and they have therefore been able to withstand the logistical, technical and financial challenges that this project has presented."},{"index":2,"size":85,"text":"Vi Agroforestry's credibility in the region has also positioned them to play the convening role required to lead this work. The nature of the project requires that they engage a wide variety public, private, and community based stakeholders. In this process, they have been able to overcome skepticism on behalf of some farmers because of previous negative experiences they had with other NGOs in the area. They have successful engaged the provincial administration, have explained the carbon project concept to local political and community leaders."},{"index":3,"size":64,"text":"Vi Agroforestry has also put significant resources into the development of Kenyan staff. Some of them have the opportunity to receive training in Sweden. There is also a cohort of project staff that have significant experience attending international climate policy meetings and working with international research projects. These experiences allow these staff to explain the full project context to participating community groups and farmers."}]},{"head":"Community structure and governance","index":36,"paragraphs":[{"index":1,"size":65,"text":"As described in section 2.1, there are two major levels of community-based organizations for carbon projects, the umbrella groups and the small groups, or community interest groups (CIGs). These groups are linked to the Vi Agroforestry management structure through the Vi Agroforestry field officer and the community facilitator which works with Vi on extension and monitoring, but also represents the community's interests within the project."},{"index":2,"size":51,"text":"There are a variety of histories and shapes of these groups. Most of those that Vi Agroforestry works with existed before the project and are overlaying the carbon project on their pre-existing organization structure. A generic organogram of these community groups is presented in Figure 3. Here are some specific examples:"},{"index":3,"size":75,"text":"The Wagai Integrated Farming Programme (WIFAP) WIFAP formed in 2005 with the goal of mobilizing farmers to promote agricultural production and food security. It is comprised of 125 groups with membership ranging from 10-30 people. It implements projects on beekeeping and fish farming. WIFAP has bank accounts, although some of the smaller groups do not. For the carbon project, it has collected data for the baseline survey of the level of uptake of SALM practices."}]},{"head":"Kimeiti Farmers CBO","index":37,"paragraphs":[{"index":1,"size":175,"text":"The vision of this group is \"a strong organization offering services to farmers in the whole location.\" Their activities include agricultural production (group farming), marketing (group marketing), capacity building (forming partnership with extensionists and other outside groups) and financial services (village savings and loan groups and rural/village banks). Forming the larger group are approximately 25 farmer CIGs that have existed for 5 to 10 years. These CIGs are formed when five farmers come together and decide that they want to initiate a set of joint activities. They can grow in size afterwards, but this is the minimum. The purpose of the CBO is to plan together, but the CIGs implement the activities. Smaller groups of the CIGs come together in an area and form a block. These blocks collaborate on joint trainings and marketing activities. There are 6 blocks within the Kimeiti location. Group members are aware of Vi Agroforestry climate activities and have been trained in SALM practices including minimum tillage, composting manure, mulching with crop residue, and careful use of agrochemicals and fertilizers."},{"index":2,"size":5,"text":"Inter-Christian Fellowship Evangelical Ministries (ICFEM)"},{"index":3,"size":106,"text":"ICFEM is a Kenyan missionary organization that has been operating in western Kenya since 1989. The Kimieti local unit arrived about the same time as Vi in the area, and they have worked well together on development activities. Fellowship groups are in the range of 25 to 40 members. There are now 80 of these in the area. Each fellowship has five executives. The fellowship leaders are trained directly, and they are responsible for training their members. Each fellowship has an agricultural coordinator, but also provides services on education, health, credit and sports. A Vi Agroforestry agent first approached them about the carbon project in 2009."},{"index":4,"size":41,"text":"Rural Energy and Food Security Organisation (REFSO) REFSO started work in 1999 and works on traditional orphan crops including cassava leguminous crops, cashew nuts, bananas, millet and sorghum. The organization is comprised of five groups with about 30 members in each."},{"index":5,"size":57,"text":"They developed cuttings of these crops that are distributed to members of the group. They work as a collective marketing group, and a portion of the proceeds from each farmer's harvest is returned to the members. Each of the five groups has received climate change trainings from Vi Agroforestry and has begun to implement climatefriendly SALM practices."},{"index":6,"size":104,"text":"Ngoli Adult Learning Group Group started in 2003 and has currently has 53 members. This is a CBO made up of six small groups and meets every Monday. The vision is \"A healthy, wealthy community\". Group activities include agroforestry tree planting and manure composting. The group has planted 1700 trees in the past nine months and has 30,000 seedlings in the nursery. The group reports that their interventions have increased maize production from 5 bags per acre to 11 bags per acre since group activities began. In 2009, a Vi Agroforestry project officer visited them for the first time to discuss the carbon project."}]},{"head":"Community roles in project management","index":38,"paragraphs":[{"index":1,"size":49,"text":"Individual farmers do not have direct influence on project decisions and they cannot negotiate carbon prices. Their primary choices are whether or not to participate and which farm interventions to implement. The community facilitators are the direct lines of communication between the communities and the carbon project management staff."},{"index":2,"size":39,"text":"Vi Agroforestry anticipates devolving project management power to community groups after a period of intensive extension work. For most of their interventions, this period is 3 to 5 years, but it may end up being longer in this case. "}]},{"head":"Gender","index":39,"paragraphs":[{"index":1,"size":11,"text":"Women are included in project climate change sensitization and implementation activities."},{"index":2,"size":152,"text":"Women provide most of the agricultural labor, and their knowledge on composting, tree planting, residue management, manure management and fertilizer application is critical in the project. However, it is likely that they will end up with extra work that is required for agricultural interventions. Some work may be harder as a result of the project, but some may also be easier. On the one hand, cover cropping and residue management may require increased work for women. On the other hand, tree planting for firewood will reduce the time that women spend gathering firewood, and improved water harvesting reduces time spent by women collecting water. The project promotes water management for household and agricultural uses. Improving the efficiency of livestock production will also reduce labor intensity for women. Upgrading of livestock in KACP for emission reduction would support women to increase animal products, yields, income, food and nutrition security, reduce labour intensity, time"},{"index":3,"size":62,"text":"Men are regarded as the owners of land in the area, and title is normally issued in the name of the man. Women can own land, but only after their husband dies. Under the new constitution, equal ownership right are allowed for women. Women generally own the small animals, but they are able to buy larger ones if they have the money."},{"index":4,"size":49,"text":"Recently the number of community-based women's groups in the area have increased, along with their rights. A relatively recent development for women in this area is that they can now plant trees for lumber/firewood and also for food, such as bananas. Women own annual food crops and kitchen gardens."},{"index":5,"size":56,"text":"At the household level, most agricultural decisions are made together by men and women. This includes what is to be produced, how it is produced, and how the returns will be spent. Women and children provide most of the family labour. For this project, members of the community are advised on how to value this work."},{"index":6,"size":115,"text":"At the group level, women hold leadership roles, and there is affirmative action to reach leadership balance. Some contracted groups are self-help groups for women. The project supports the empowerment of women. It buys carbon from women as long as they own the land. Trainings are focused on valuing all work done by both men and supporting Farmer Enterprise Development for women to participate more in business. Women are hired as field agents for the purpose of reaching out to women. Vi Agroforestry also makes an effort to work with women community facilitators and women social worker collaborators. Many trainings are targeted specifically for women and take place in the afternoon when they are available."}]},{"head":"Key policy issues","index":40,"paragraphs":[]},{"head":"Land tenure","index":41,"paragraphs":[{"index":1,"size":146,"text":"Ownership delineation problems are not anticipated in the project area. The ownership of land was adjudicated and legally assigned to individual land owners after consolidation and demarcation in the mid 1950's. Land in the project area, as in the rest of the region, is under freehold titles, which is only transferable through sale or inheritance. This ownership arrangement gives landowners the control over resources necessary to participate in an agricultural carbon project. While land boundaries are generally respected, the charge for obtaining title deeds is high, and not all farmers have them. This occasional lack of documentation notwithstanding, land policy in the project area is more conducive to carbon project development activitiy than other Lake Victoria countries where Vi Agroforestry has a presence (Rwanda and Uganda). In fact, land tenure was one of the key reasons this area was chosen to pilot an agricultural carbon project."}]},{"head":"Carbon Rights","index":42,"paragraphs":[{"index":1,"size":17,"text":"International rules do not stipulate who has the right to benefit from sequestered carbon or emissions reductions."},{"index":2,"size":85,"text":"Policies on this topic are left to the host country. Although many countries have yet to address the legal status of carbon Kenya already has some experience with this issue with a number of land use carbon projects already in operation. As part of the project development process the have received a letter of no objection from NEMA, so it does not seem as though there is significant risk that land users in this project will loose their right to carbon during the contract period."}]},{"head":"Regulations","index":43,"paragraphs":[{"index":1,"size":108,"text":"NEMA is the national developer and enforcer of environmental regulations. However, they are very thinly staffed with only a single staff member per division in the project area. At the location level, NEMA has virtually no presence. One local chief did not realize that they operated in the area at all. For this project, Vi Agroforestry completed an Environmental Impact Assessment (EIA) which NEMA was responsible for reviewing along with experts in the other line ministries include agriculture, water, public health and the Kenya Forest Service. NEMA may also be responsible for helping to resolve the additionality implications of Kenya's new mandate for 10% tree cover on farms."}]},{"head":"Kenya climate change response strategy","index":44,"paragraphs":[{"index":1,"size":70,"text":"Climate change policy has been developed at the national level, but has yet to be implemented at the local level. One major focus of this project has been tree planting, but so far it has not addressed soil carbon directly. NEMA is Kenya's lead agency on forest carbon, but it is not clear whether they will also be regulating agricultural carbon, or if it will be the Ministry of Agriculture."}]},{"head":"Environmental planning processes","index":45,"paragraphs":[{"index":1,"size":132,"text":"A District Environment Action plan was created in 2008 with major issues being identified as waste management, riparian system protection and reduction of fuelwood use. This process was shepherded by a District Environment Committee that has membership from government ministries, CBOs and NGOs. The district plan feeds into the National Environmental Action Plan. Regulations have been created based on these planning processes, but there is virtually no enforcement, and climate change is not directly addressed in these regulations. The new constitution will shift administrative boundaries, and these action plans will need to be revisited. To further complicate matters, the new Constitution has split the country into counties, a new administrative distinction for Kenya. The structure of the management of these counties is not solidified and they do not yet have any resources."}]},{"head":"Land conflict resolution","index":46,"paragraphs":[{"index":1,"size":100,"text":"Most land conflict resolution is handled by the local provincial governments. Clan elders work under the chiefs, and each clan has a chairman who deals with land disputes. This system resolves roughly 70% of the conflicts. In cases where this system is insufficient, tribunals of elders are established. That being said, the clan structure has slowly been breaking down in the area as youth move to the cities in search of jobs. The village leaders now fulfil most of the administrative roles in the village while the clan leaders, under the provincial administration, play important family and dispute resolution functions."}]},{"head":"Interaction with landscape scale processes","index":47,"paragraphs":[{"index":1,"size":80,"text":"The project is located within the Lake Victoria Basin, which contains an abundance of water resources including large rivers, wetlands and springs as well as Lake Victoria itself, the second largest fresh water lake in the world. The basin is under substantial environmental threat from agricultural land degradation, deforested and degraded water catchments, agricultural chemicals and urban waste. A majority of the people in the Basin live in poverty. Vi Agroforestry is in communication with the basin's watershed-wide management initiatives."},{"index":2,"size":111,"text":"The Lake Victoria Environmental Management Program (LVEMP), a project of the Lake Victoria Basin Commission (LVBC) is designed to improve collaborative management of the transboundary natural resources of Lake Victoria basin and to reduce environmental stress in degraded and polluted target areas to improve the livelihoods of communities that rely on the basin's resources. Components of LVEMP's work include the support of sustainable soil and water management practices for watershed restoration and the coordination of institutional and policy development in the basin. There are many potential linkages to the Vi Agroforestry carbon project. It has developed a memorandum of understanding with KARI to develop institutional capacity to implement and carbon projects."}]},{"head":"Institutional challenges and solutions","index":48,"paragraphs":[{"index":1,"size":101,"text":"This project was designed to be a trailblazer. As the first carbon project to develop credits for soil carbon and one of the first to work with poor farmers, this project presents a number of unique challenges to both the project manager as well as to communities and farmers. The background economic, demographic and environmental challenges of widespread poverty, increasing population density, increasing land fragmentation, land degradation, unreliable weather patterns, a general drying trend, and volatile agricultural markets intensify risks for all project stakeholders. This section describes some the most significant challenges and identifies potential mechanisms for them to be met."}]},{"head":"Project challenges and solutions","index":49,"paragraphs":[]},{"head":"Farmer Expectations","index":50,"paragraphs":[{"index":1,"size":70,"text":"Challenge: When the idea of carbon payments is first explained to farmers, expectations are often raised for levels of payment that will not be met. This could lead to disappointment, resentment and an erosion of trust between communities and Vi Agroforestry. Solution: Vi Agroforestry staff must emphasize the benefits from improved yields and other co-benefits from the beginning, and be very clear about the expected level and timing of payments."}]},{"head":"Devolving responsibility","index":51,"paragraphs":[{"index":1,"size":45,"text":"Challenge: The long-term financial success of the project will be based on the transitioning of management responsibilities away from Vi Agroforestry staff to community organizations. Most of these groups will have management structures when the project begins that are insufficient to take on this responsibility."}]},{"head":"Solution:","index":52,"paragraphs":[{"index":1,"size":34,"text":"The importance of participatory planning throughout the project should be emphasized, and concentrated efforts should begin early to build management capacity for community groups and to train community facilitators to be future project managers."}]},{"head":"Constitutional changes","index":53,"paragraphs":[{"index":1,"size":34,"text":"Challenge: The new constitution in Kenya will alter national and local government structures, and this period of transition may create insecurity within the projects about the stability of government institutions necessary for it success."},{"index":2,"size":54,"text":"Solution: Vi Agroforestry should continue to focus on communicating with national level regulatory agencies that will likely remain in charge of approving carbon projects in the country. If there are signs that the current structure will significantly change, Vi Agroforestry can try to inform these changes and remain responsive to any requests from regulators."},{"index":3,"size":103,"text":"Farmer skepticism of NGOs and introduced SALM practices Challenge: Some farmers have had negative experiences with NGOs in the past and consequently are initially distrustful of the project. There may also be cultural barriers that hinder the transition to new practices, or other reasons farmers don't want to participate. For example, certain SALM practices require increased labor. Solution: Vi Agroforestry has a 25 year track record in western Kenya and a strong reputation. Demonstration plots and other knowledge sharing activities can be helpful in overcoming skepticism regarding practices. If there other reasons farmers do not wish to participate, those reasons should be respected."},{"index":4,"size":66,"text":"Delays with World Bank Biocarbon Fund Challenge: Working with the World Bank Biocarbon Fund on its first soil carbon project has been a very slow and often frustrating process. Project timelines have been delayed on multiple occasions. Solution: This project is the first of its kind, and some delays should be expected. The ERPA was finally signed in November 2010, so the project can now commence."}]},{"head":"Trees on farm mandate","index":54,"paragraphs":[{"index":1,"size":18,"text":"Challenge: Kenya has developed a national mandate that 10% of all agricultural land should be covered by trees."},{"index":2,"size":50,"text":"There is an open question as to whether this mandate will affect the claims on additionality of trees planted on farms for the purpose of the project when a farm has less than 10% tree cover. Solution: This is an issue the needs to be clarified at the national level."},{"index":3,"size":92,"text":"The challenge for Vi Agroforestry has been greater because of the relative difficulty of introducing and tracking a suite of SALM practices that includes conservation tillage. For tree-based projects, this process is relatively easier. Systems for tracking the carbon in trees on farms are fairly well developed, and farmers are already familiar with tree-planting practices. Conservation tillage systems, for many farmers, are entirely new and represent a much more significant transition for farmers than tree-planting alone. If this project is successful, it will open up opportunities for similar initiatives throughout the world."}]},{"head":"Project finances and equity for farmers","index":55,"paragraphs":[{"index":1,"size":5,"text":"The project costs and benefits"}]},{"head":"Project costs","index":56,"paragraphs":[{"index":1,"size":166,"text":"Table 2 summarizes Vi Agroforestry's projected costs from the beginning to the end of the project. The vast majority of this amount will go towards operations after the first SALM practices have been implemented. These operating costs will not be uniform throughout the project's lifespan. There will be two distinct phases of intensity for Vi Agroforestry's engagement, represented in the table as Phase 1 and Phase 2. Costs for implementing Phase 1 ($US1,026,000) will dwarf Phase 2 ($US162,000). The key difference between these phases is the level of staffing that will be necessary for Vi Agroforestry to run the program. In Phase 1, the project will support one extension agent for each of the 27 project locations and will require one supervisor for every 14 advisors. In Phase 2, it is projected that there will be only one Vi Agroforestry extension advisor needed for each of the 6 divisions in the project area. During this period, Vi Agroforestry expects to devolve project responsibility to community organizations."},{"index":2,"size":233,"text":"It is likely that the intensive Phase 1 period, assumed in this calculation to last 3 years, will last longer. Vi Agroforestry managers have indicated that the project may need a Phase 1 level presence for 5 to 10 years. But the message that can be drawn from the enormous difference in projected costs between the two phases is that the financial success of this project from the developer's perspective lies mainly in the project's ability to quickly and efficiently devolve responsibility to community organizations. The importance of staffing costs in the project budget is further clarified in Table 3, summarizing the relative budget percentages of Vi's project costs. It is difficult to conduct a full cost accounting of this project, because organizations other than Vi Agroforestry have made substantial contributions and significant investment in building institutions before the start of the project. Vi Agroforestry has been operating in western Kenya for 25 years and has developed significant experience and credibility among communities in the region on SALM practices as well as other development activities. The SALM methodology development and testing has been covered by the World Bank BioCarbon Fund. Sida provided prefinancing for the project which could not have been secured in private carbon markets. Vi Agroforestry anticipates that the project will eventually break even and make money over the long run, but this would not be possible without these key investments."}]},{"head":"Project benefits","index":57,"paragraphs":[{"index":1,"size":92,"text":"At US$ 4 of carbon, the carbon credit value per ha is very small. However, taken as a whole the project has potential to generate significant revenue. The yearly revenue, using carbon credit production figures from Table 1, for the project would be US$247,272, and over the life of the project, this would be US$4,945,492. (US$1,978,197 with 60% beuffer set aside.) This revenue could increase if the price of carbon increases or if the accuracy of measurement improves over the life of the project from tier 1 to tier 2 or 3."},{"index":2,"size":118,"text":"The cash revenue from carbon credits is projected to be distributed between farmers groups (60%), Vi Agroforestry extension operations in the project area (30%) and Vi Agroforestry headquarters in Stockholm to cover administrative costs (10%). Farmers groups receive payment according the carbon they deliver based on the ABMS survey. Groups make their own arrangement for distributing cash to member farmers. These payments have not yet been made and the structure of the specific payment mechanism from Vi to the groups and from the groups to the farmers has not yet been determined. Vi Agroforestry is planning to develop the payment mechanisms to groups in January 2011, and each small group is responsible for designing its own distribution systems."},{"index":3,"size":34,"text":"Even under the conditions of the model described in this section, Vi Agroforestry would still come out ahead over the life of the project. The 3 sources of financing for the project, summarized in "}]},{"head":"The farmers' costs and benefits","index":58,"paragraphs":[{"index":1,"size":63,"text":"A key principle for this project is that farmers will be better off participating even if they receive no cash payment from carbon credits. The most significant cost for them will be the time it takes to learn about new practices and the labor requirements to implement a conservation tillage system. They may also choose to invest in tree seedlings or other seeds."},{"index":2,"size":91,"text":"The cash benefits that will come to them will be relatively small. It is estimated that each farmer will have roughly 0.75 ha in the project. Using Vi Agroforestry's projected average figure of 1.37 tons of CO2e/ha for Kisumu and Kitale, and $4 per ton of CO2e, the project could create US$4.11. Farmers only receive 60%, so an average farmer would receive US$2.47 per year. The remaining US$1.64 goes to Vi Agroforestry and is essentially a payment to Vi Agroforestry for the extension and carbon project management services that they provide."},{"index":3,"size":151,"text":"The most significant benefits will come from increasing yields and agricultural profitability. In the absence of the project, the productivity of the agricultural systems will likely continue to decline. As the rates of per capita arable land decrease, additional pressure will be placed on degrading soils. In general, SALM measures will improve general soil health, water holding capacity and make soils more resistant to drought. Although there is no data yet on the effects of practice changes for this project, one study documents 41 sustainable land management interventions and nearly all of them demonstrate significant yield increase, with 24 interventions showing a yield increase greater than 100% (Pender, 2008). Another study reviewed 45 sustainable land management interventions in Sub-Saharan Africa and found that cereal yields increased between 50% and 100% in almost all of the cases (Pretty, 2006). Almost all of these land use practices also showed significant profitability for farmers."},{"index":4,"size":33,"text":"In addition to crop yield improvements, the project can bring other benefits to farmers. More trees on farmers could improve the sale of tree products and reduce the cost of buying firewood off-farm."},{"index":5,"size":103,"text":"Composting and conservation tillage systems may reduce farmer dependence on fertilizers and pesticides. Project participation may also improve farmers' agricultural knowledge and skills. Finally, there are the social benefits of participating in the project including the potential for improved community cohesion, community organization strength, and potentially new opportunities for women and youth, particularly in the development of tree nurseries. It is difficult to know all the impacts that the project has on farmers because systems and are not in place for farmers to report them all. But, ultimately farmers' continued participation in the project will be an indication that they find it beneficial. "}]},{"head":"Ngoli CBO","index":59,"paragraphs":[]}],"figures":[{"text":"Figure Figures and TablesFigure1: Map of Project Area .......................................................................................................Figure 2: Project Structure ..............................................................................................................Figure 3: Structure of a generic umbrella group ........................................................................... Table 1: Carbon credit production targets (CO2e) without buffer ................................................. Table 2: Summarized project costs ............................................................................................... Table 3: Breakdown of project costs by percentage ..................................................................... Table 4: Sources of project finance .............................................................................................. "},{"text":" Figures and TablesFigure1: Map of Project Area .......................................................................................................Figure 2: Project Structure ..............................................................................................................Figure 3: Structure of a generic umbrella group ........................................................................... Table 1: Carbon credit production targets (CO2e) without buffer ................................................. Table 2: Summarized project costs ............................................................................................... Table 3: Breakdown of project costs by percentage ..................................................................... Table 4: Sources of project finance .............................................................................................. "},{"text":"Figure 2 : Figures and TablesFigure1: Map of Project Area .......................................................................................................Figure 2: Project Structure ..............................................................................................................Figure 3: Structure of a generic umbrella group ........................................................................... Table 1: Carbon credit production targets (CO2e) without buffer ................................................. Table 2: Summarized project costs ............................................................................................... Table 3: Breakdown of project costs by percentage ..................................................................... Table 4: Sources of project finance .............................................................................................. "},{"text":"Figure 3 : Figures and TablesFigure1: Map of Project Area .......................................................................................................Figure 2: Project Structure ..............................................................................................................Figure 3: Structure of a generic umbrella group ........................................................................... Table 1: Carbon credit production targets (CO2e) without buffer ................................................. Table 2: Summarized project costs ............................................................................................... Table 3: Breakdown of project costs by percentage ..................................................................... Table 4: Sources of project finance .............................................................................................. "},{"text":"Figure 1 : Figure 1: Map of Project Area. "},{"text":"Figure 2 : Figure 2: Project Structure. "},{"text":" 2008: Vi Agroforestry continues to develop project documentation and baselines. Vi Agroforestry also approaches stakeholders of the region and introduces them to ideas for a carbon project and work on climate change adaptation and mitigation generally. This information is passed along to communities. Vi Agroforestry reaches out to political leaders through letters including Members of Parliament (MPs) and counselors.2008:The carbon baseline is established and Vi Agroforestry field staff start to recruit farmers and train them on various aspects of SALM and climate change. "},{"text":"Figure 3 : Figure 3: Structure of a generic umbrella group. "},{"text":"Table 1 : Carbon credit production targets (CO2e) without buffer  Kisumu Project Region Kitale Project Kisumu Project RegionKitale Project   Region Region Cumulative (over 20 years 898,284 338,089 Cumulative (over 20 years898,284338,089 Average per year 44,914 16,904 Average per year44,91416,904 Average per hectare per year 2.0 0.8 Average per hectare per year2.00.8 Total Project cumulative 1,236,373  Total Project cumulative1,236,373 Per year 61,818  Per year61,818 Total Project average per 1.37  Total Project average per1.37 hectare and year   hectare and year Adapted from VCS 2010   Adapted from VCS 2010  "},{"text":"Table 2 : Summarized project costs Projected Costs Amount (US$) Projected CostsAmount (US$) Preparation costs (feasibility studies, monitoring 50,000 Preparation costs (feasibility studies, monitoring50,000 plan, PDD, etc.)  plan, PDD, etc.) Establishment costs (site and soil preparation, 50,000 Establishment costs (site and soil preparation,50,000 seedlings, planting, weeding until planting is  seedlings, planting, weeding until planting is completed)  completed) Operating costs for Phase 1 (year 1-3 after practices 1, 026, 000 Operating costs for Phase 1 (year 1-3 after practices1, 026, 000 have been implemented)  have been implemented) Operating costs for Phase 2 (year 4-6) 162,000 Operating costs for Phase 2 (year 4-6)162,000 Others (carbon validation, 3 times -2011, 2014, 172, 000 Others (carbon validation, 3 times -2011, 2014,172, 000 2017)  2017) Total 1,460,000 Total1,460,000 Adapted from World Bank Carbon Finance Unit (2008)  Adapted from World Bank Carbon Finance Unit (2008)  "},{"text":"Table 3 : Breakdown of project costs by percentage Planned Costs % of costs Planned Costs% of costs Salaries for Vi Agroforestry staff, 60 Salaries for Vi Agroforestry staff,60 Logistics/transport 15 Logistics/transport15 Training/capacity building of staff 10 Training/capacity building of staff10 Seeds and seedlings 5 Seeds and seedlings5 Other (insurance, office rent, electricity) 10 Other (insurance, office rent, electricity)10 Adapted from World Bank Carbon Finance Unit (2008)  Adapted from World Bank Carbon Finance Unit (2008)  "},{"text":"Table 4 : Table X are Vi Agroforestry, Sida and farmers. Vi Agroforestry's 32% share comes to US$ 466,550. At 40% share of total revenues for field operations and Stockholm headquarters, their total would be US$ 1,978,197 over the life of the project. (US$791, 299 with the 60% buffer.) Sources of project finance Sources of Finance Amount (US$) Sources of FinanceAmount (US$) Vi Agroforestry 466,550 (32% of costs) Vi Agroforestry466,550 (32% of costs) Sida 552,000 (38% of costs) Sida552,000 (38% of costs) Farmers 441,450 from their portion of the carbon revenue Farmers441,450 from their portion of the carbon revenue  (30% of costs ) (30% of costs ) Total 1,460,000 Total1,460,000 Adapted from World Bank Carbon Finance Unit (2008)  Adapted from World Bank Carbon Finance Unit (2008)  "}],"sieverID":"8850348f-c404-40a9-9630-b96e5e891f36","abstract":""}

data/part_1/014417fb16e3392ce260f185298a7f8a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"014417fb16e3392ce260f185298a7f8a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/cee0e3b1-a5e4-43cb-9941-bc3d0b3d4a6b/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"621985f6-1608-4227-95e4-729cb68844f2","abstract":""}

data/part_1/015af4981075abc4dd458d5e234e5d4d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"015af4981075abc4dd458d5e234e5d4d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7d00fc90-8d7e-4d34-8961-ea8bac92ab3c/retrieve"},"pageCount":13,"title":"Summary Minutes 1 44 th ILRI Board of Trustees Meeting","keywords":[],"chapters":[{"head":"The Chair will open the 44 th Board Meeting","index":1,"paragraphs":[{"index":1,"size":52,"text":"The chair welcomed members, observers and management, noting appreciation to everyone as well as IFPRI for facilitating the move of location to Washington DC to enable participation of the DG and chair designate in crucial CGIAR meetings. Apologies to the ILRI staff in Addis for not holding the meeting there were registered."},{"index":2,"size":99,"text":"The chair noted appreciation to HE Dr Wondirad Mandefro who had left the board and welcomed HE Dr Gebregziabher Gebreyohannes, Ethiopian state minister for livestock, who had been nominated by the Ethiopian government as the new host country representative following the establishment of a new ministry for livestock and fisheries. Two observers, Dr Judith Lungu and Dr Chanda Nimbkar were also welcomed and it was noted that Carles Soriano from CGIAR IAU would be joining audit and risk committee. HE Dr Gebregziabher, Drs Lungu and Nimbkar gave brief introductions and expressed their appreciation to be welcomed to the meeting."},{"index":3,"size":20,"text":"The chair invited members to share highlights since the last board meeting, and a range of issues were mentioned including:"},{"index":4,"size":91,"text":"-Opportunity for nominations for the World Prize in International Integrated Development -In Kenya the ministry of agriculture, and beyond are pleased with ILRI's work on livestock insurance with the government rolling out the product effective from 1 Oct for one year to mitigate the risks arising from drought. It was noted that the DG and principal secretary for livestock (Fred Segor) had the privilege of meeting the deputy president with the ILRI team as part of setting this up. A visit form the deputy president was welcomed and will be organised."},{"index":5,"size":37,"text":"The chair expressed ILRI's appreciation for the range of support provided by Prof Segor as the Kenya representative on the board. -A new opportunity for Canadian funding for vaccine work that may arise in the near future."},{"index":6,"size":19,"text":"-Opportunities for ILRI to become a partner in the STAR IDAZ alliance which should open up new research opportunities."},{"index":7,"size":26,"text":"Given this was her last meeting, the board chair shared a number of reflections of her time on the board and opportunities for ILRI going forward."}]},{"head":"The meeting will be invited to consider and adopt the agenda of the 44 th Board meeting","index":2,"paragraphs":[{"index":1,"size":24,"text":"The agenda had been circulated to members in advance of the meeting. The board secretary reviewed the agenda and asked for comments or modifications."},{"index":2,"size":7,"text":"The agenda was approved by the board."}]},{"head":"Review and Approval of Minutes of the 43 rd Board meeting","index":3,"paragraphs":[{"index":1,"size":19,"text":"The minutes of the 43 rd meeting of the ILRI Board of Trustees had been circulated and approved electronically."},{"index":2,"size":15,"text":"The minutes of the 43 rd meeting of the ILRI Board of Trustees were approved."}]},{"head":"Summary of Disposition of Matters Arising from the Minutes of the 43 rd Board Meeting","index":4,"paragraphs":[{"index":1,"size":32,"text":"The board secretary reviewed actions from the 43 rd meeting, the need for conclusion on the science strategy was highlighted, noting that most issues would be dealt with in the committee agendas."},{"index":2,"size":17,"text":"Action: Management to provide board members with final version of the science strategy by mid January 2016."}]},{"head":"Director General's report","index":5,"paragraphs":[{"index":1,"size":30,"text":"The DG welcomed members to Washington and thanked everyone for making adjustments to their schedules. Special words of welcome were extended to HE Dr Gebregziabher Gebreyohannes, Drs Lungu and Nimbkar."},{"index":2,"size":14,"text":"The DG gave a comprehensive presentation, spanning developments in the CGIAR and ILRI internal."},{"index":3,"size":75,"text":"The former covered important CGIAR developments since the last Board meeting in April, 2015. The latter included some programme highlights, an over view of budget performance in 2015 and proposals for 2016, resource mobilization, a brief on developments in the People and Organizational Development Directorate, ILRI and the on-going CGIAR reform process and legal issues the institute is dealing with. Members thanked the DG for the excellent report and a number of issues were discussed."},{"index":4,"size":74,"text":"The current uncertainty regarding the CGIAR, its financing and the next phase of CRPs was highlighted, recognising that efforts are underway both across the CGIAR and within ILRI to ensure any risks are mitigated. A key strategy for ILRI is resource mobilization for which the roles of both scientists and the to-be-recruited head of business development were clarified in terms of ensuring the institute has strong mechanism to turn science ideas into bankable proposals."},{"index":5,"size":23,"text":"Regarding legal issues, members agreed that ILRI's approach was appropriate and encouraged management to learn lessons especially with regard to engagement with partners."},{"index":6,"size":14,"text":"Members considered research an animal health and zoonoses, noting the opportunities in these areas."},{"index":7,"size":28,"text":"IT was noted also that a new strategy for animal health research will soon be available which will have a strong emphasis on vaccines, diagnostics (including penside) etc."},{"index":8,"size":61,"text":"ILRI's modus operandi with national institutes was considered, noting that this may look very different for example in India with ICAR compared to instances such as the recent engagement with the government of Ethiopia on the livestock master plan. The importance in all cases of ILRI being proactive and identifying its appropriate comparative advantage, where it can add value, was stressed."},{"index":9,"size":79,"text":"In reviewing ILRI's communication and knowledge management outputs it was noted that there seemed to be a drop in 2014, and that training resources seemed generally very low. The cyclical nature of research and products was noted in relation to the former, stressing that there does need to be awareness to ensure scientists do publish and retain a balance, including with CRP preparations. It was agreed that many training resources are probably not captured in the metrics at present."}]},{"head":"Programme Committee","index":6,"paragraphs":[{"index":1,"size":21,"text":"Present: Lorne Babiuk (Chair), Khatijah Yusoff (Vice Chair), all board members and observers. Others: Iain Wright (Secretary), members of ILRI management."},{"index":2,"size":152,"text":"1. Update on the CG Research Programme on Livestock and Fish Tom Randolph, Director of the CGIAR Research Programme (CRP) on Livestock and Fish, presented a short update on the CRP. He informed the Committee that the 2106 budget is likely to be in line with expectations. The new modus operandi of the Scientific and Partnership Advisory Committee (SPAC) with direct interaction between members and flagship leaders appeared to be working well. There was no written report from the SPAC as they had not met since the previous board meeting. He informed the Committee that the report from the Independent External Evaluation should be received in November and this will be available to the Board so that their comments can be incorporated in the response. The Committee reminded management of the need to demonstrate transparency and robustness in the process in identifying partners and that Board members can help in building partnerships."}]},{"head":"Recommendation: The committee recommended for confirmation the previous approval by email of the renewal for a second term on the Livestock and Fish Scientific and Partnership Advisory Committee for Max Rothschild and Andy Peters, and confirmed the existing appointments of Rohanna Subasinghe, Martin Webber and Maureen Miruka.","index":7,"paragraphs":[]},{"head":"Recommendation: The Committee recommended that the vacant position on the Livestock and Fish Scientific and Partnership Advisory Committee should not be filled for the remaining one year of the CRP. Action: The Committee reminded Management that the Livestock and Fish CRP Annual Report should be submitted to the Board for comment and approval prior to timely submission to the Consortium Office.","index":8,"paragraphs":[{"index":1,"size":22,"text":"Action: Management will ensure that the Board receives the report of the Independent External Evaluation panel on the Livestock and Fish CRP."}]},{"head":"Update on the BecA-ILRI Hub including Advisory Panel recommendations","index":9,"paragraphs":[{"index":1,"size":38,"text":"The Director of the BecA-ILRI Hub presented a short report to the Committee on capacity building, research, facilities and management, partnerships and resource mobilization. The report and recommendations from the second meeting of the Advisory Panel was tabled."},{"index":2,"size":47,"text":"Recommendation: The Committee noted that significant progress that has been made in the BecA-ILRI Hub, including the increase in livestock related projects and an expansion of partners. The committee recommended that Management continue to implement the recommendations of the second meeting of the BecA-ILRI Hub Advisory Panel."}]},{"head":"Update on CRPs Phase 2","index":10,"paragraphs":[{"index":1,"size":123,"text":"Iain Wright, DDG-Integrated Sciences, gave an update on the process and progress towards developing the second phase portfolio of CRPs and ILRI's engagement. There was still considerable uncertainty as to the content of the portfolio with the Consortium Board having suggested a different configuration. The expectation at the time of the meeting was that this would be resolved at the Fund Council meeting on 3-5 November. The response from the ISPC, based on the written response and a subsequent meeting with the Chair of the ISPC, was summarized and the plans to respond to their comments outlined. However until the Fund Council meets, the exact process will not be finalized. Action: Management will have regional strategies in place before the next board meeting."}]},{"head":"Update on ILRI Animal Science for Sustainable Productivity Programme","index":11,"paragraphs":[{"index":1,"size":44,"text":"The Committee received a presentation on the Animal Science for Sustainable Productivity Programme from Siboniso Moyo, the Programme Leader. She explained the structure of the programme, with three complementary themes, Feeds, Heath and Sustainable Intensification, and the objectives of each, highlighting some recent achievements."},{"index":2,"size":55,"text":"Recommendation: The committee noted and appreciated the complexity of the Animal Science for Sustainable Productivity Program and reminded management to continue to be clear about the need to focus and the value proposition of the programme. It recommended that the links to other CRPs be optimized especially within the context of the site integration initiatives."}]},{"head":"Update on ILRI Animal Biosciences Programme","index":12,"paragraphs":[{"index":1,"size":54,"text":"Steve Kemp, Programme Leader of the Animal Biosciences Programme provided an overview of the programme with its emphasis on up steam research on genomics and health. He highlighted the challenge of dependence on a small number of donors and the lack of full cost recovery, especially from the Bill and Melinda Gates Foundation grants. "}]},{"head":"Recommendation","index":13,"paragraphs":[]},{"head":"Update on Dashboard indicators","index":14,"paragraphs":[{"index":1,"size":113,"text":"Shirley Tarawali provided an update on the progress towards developing a series of nested dashboard indicators that can be used by the Board and Management to monitor progress in implementing the five critical success factors underpinning the ILRI strategy. The plan is that for each critical success factor a small number of aggregate indicators can be used by the Board while under these there are a series of increasingly dis-aggregated indicators that can be used by the Institute Management Committee and Programme Leaders/Unit Managers. An initial set of indicators will be presented to the Board in April 2016. It was recognized that not all indicators need to be developed at the same time."},{"index":2,"size":32,"text":"Recommendation: The Committee appreciated the work done on the progress towards developing a set of nested indicators for Board oversight and management purposes and recommended that management continue to refine the indicators."}]},{"head":"Finance Committee","index":15,"paragraphs":[{"index":1,"size":22,"text":"Present: Lindsay Falvey (Chair), Cheikh Ly (Vice Chair), all other board members and observers Others: Misja Brandenburg (Secretary), members of ILRI management."}]},{"head":"Matters arising from the Minutes","index":16,"paragraphs":[{"index":1,"size":88,"text":"A simplified 'stress test' of the adequacy of the reserves, as requested by the Board, will be presented as part of agenda item 3. For a more comprehensive 'stress test' ILRI management will await the outcome of consultancy assignments on this matter from other centres (CIMMYT) and will align itself accordingly (second half of 2016). Management has made a multi annual rolling capital investment plan, but due to staffing issues, it has not been finalized and will now be presented during the next Board meeting in April 2016."}]},{"head":"2014 Financial Statements compared to other CGIAR centres","index":17,"paragraphs":[{"index":1,"size":11,"text":"The Board reviewed the comparative data presented and noted the following:"},{"index":2,"size":93,"text":"-The institute's indirect cost rates are just within CGIAR targets, but still on the high side compared to other (non CGIAR) organisations in the market. This has partly to do with the 'research' characteristics of ILRI, but is a point of attention to avoid falling outside of donor acceptable limits. -The Board appreciated the simplified stress test presentation, but would still be interested in a more comprehensive and sophisticated reserve analysis exercise. -The Board valued the data presented which enabled benchmarking for ILRI and a better understanding of the position of the centre."},{"index":3,"size":86,"text":"Action: Management to ensure the use of consistent terminology in future reports and presentations Action: Management to present the results of a comprehensive and sophisticated reserve analysis exercise in 2016 3. Update on financial position September 2015 Management presented the 2015 burn rates up to September and a forecast for December 2015 to reach a $1.9M deficit and an increase of reserves of $2.5M. The full set of ILRI's internal KFI's will be presented during April meetings when the financial year has been closed and audited."},{"index":4,"size":14,"text":"The Board expressed satisfaction with the progress and results of the 2015 budget implementation."}]},{"head":"2015 Investment Report","index":18,"paragraphs":[{"index":1,"size":19,"text":"Management presented an investment report that detailed the state of ILRI's investments for the year 2015 (up till September)."},{"index":2,"size":12,"text":"The Board indicated its comfort with the current investment portfolio as presented"}]},{"head":"Proposed 2016 Budget","index":19,"paragraphs":[{"index":1,"size":86,"text":"The Board received a draft 2016 budget proposal wherein it was noted that income was projected to amount to $74.2M with expenditure of $77.5M, leading to a projected deficit of $3.3M for 2016. Management's advised that its aim is to reduce the deficit for 2017 to under $1M. Management also presented a proposal for an initial $1M CAPEX budget for essential equipment and will come up with an additional CAPEX request by the April 2016 board meeting for other investment categories, based on multi annual plans."},{"index":2,"size":94,"text":"Management will continue to address the deficit through a combination of resource mobilization and cost containment/reduction and provide an update and final 2016 budget proposal at the April Board meeting. The Board emphasised that there is a need to have Regional strategy papers in place, describing targets and timelines. The Board noted that Kapiti farm is a wholly owned asset of ILRI through a different legal entity and consequently requested a regular, short report on the progress, risks, proposals, and options available, possibly in the form of minutes and financial statements of this subsidiary."},{"index":3,"size":39,"text":"The Board approved the draft 2016 budget and its $3.3M deficit as presented, to be taken from the undesignated reserves of the institute on the understanding that the deficit in 2017 would not exceed $1M based on current projections."},{"index":4,"size":24,"text":"The Board approved the initial $1M CAPEX request, the specified $2.6M carry forward of 2015 CAPEX and $250K investment in the Kapiti farm (house)."},{"index":5,"size":25,"text":"Action: Management will provide more information on Kapiti budgets, results and risks in future Board meetings. Management will ensure this becomes a recurrent agenda issue."},{"index":6,"size":18,"text":"Action: Management will present an additional 2016 CAPEX proposal at April Board meeting, based upon multi annual plans."}]},{"head":"One Corporate System (OCS) Update","index":20,"paragraphs":[{"index":1,"size":24,"text":"Management presented an update of the rollout of OCS, describing the recent 'go live', current challenges and planned action for phase 2 in 2016."},{"index":2,"size":27,"text":"The Board noted with satisfaction that the system is in operation and congratulated management on the progress made. The board is comfortable with the planned way forward."}]},{"head":"Corporate Service Directorate Update","index":21,"paragraphs":[{"index":1,"size":30,"text":"Management presented the vision for the corporate services directorate, with the related recent and future planned activities. This included the reorganisation of the finance department and other future efficiency gains."}]},{"head":"Human Resources Committee","index":22,"paragraphs":[{"index":1,"size":22,"text":"Present: Suzanne Petersen (Chair), Rodney Cooke, (Vice Chair), all other board members and observers. Others: Stella Kiwango (secretary), members of ILRI management."}]},{"head":"Progress Reports (i) Online Performance Management System","index":23,"paragraphs":[{"index":1,"size":34,"text":"The Human Resources Committee was informed that the new online performance management system was introduced in 2015 after it became clear that the previous system did not meet the expectations of management and staff."},{"index":2,"size":35,"text":"Management emphasized that the performance management process is being implemented in stages and will eventually be linked to reward. However, it was clarified that this is a gradual process and is being introduced in stages."},{"index":3,"size":18,"text":"Recommendation: Management follow up with all staff members to ensure 100% completion rate for 2016 individual performance plans."},{"index":4,"size":20,"text":"Recommendation: Management provide the outputs of the project in monitoring performance and outcomes at institute level at the next meeting."}]},{"head":"(ii) Compensation and Benefits Project","index":24,"paragraphs":[{"index":1,"size":15,"text":"The Hay Group will undertake the Compensation and Benefits (C&B) project commencing in June, 2016."},{"index":2,"size":39,"text":"Management emphasized the importance of the project to ensure that the institute remains competitive in the labour market by defining its Employee Value Proposition and addressing issues regarding the remuneration of staff in locations with different costs of living."},{"index":3,"size":20,"text":"Recommendation: Management to provide an update at the next meeting in April, 2016, with a clear set of progress indicators."}]},{"head":"(iii) Program Management Framework","index":25,"paragraphs":[{"index":1,"size":65,"text":"Management informed the Committee of the commencement of the Program Management Framework being facilitated by the Accenture group and that the project was introduced to address a number of challenges in the execution of projects. Whereas in the past, ILRI managed many small projects, the institution is moving towards the management of much bigger and complex projects that needed more effective management to ensure delivery."},{"index":2,"size":49,"text":"The Committee was further informed that the first six months of the project is the design phase that is being spent in developing the new program management framework and related processes through the engagement of the relevant staff. The next six months commencing January 2016 is the implementation phase."}]},{"head":"Recommendation: Management is requested to provide an update of progress at its next meeting in","index":26,"paragraphs":[{"index":1,"size":12,"text":"April, 2016 on the project with a clear set of progress indicators."}]},{"head":"Follow up Action on Organizational Climate Survey","index":27,"paragraphs":[{"index":1,"size":50,"text":"Management presented an action plan on the results of the staff climate survey undertaken in 2014 taking into account a report on underlying issues in the institution related to openness and trust. The action plan and report had been requested by the Committee in its previous meeting of April, 2015."},{"index":2,"size":26,"text":"In discussion regarding the proposed action plan on the staff survey, management was cautioned to be careful on its communication to staff to ensure appropriate messaging."},{"index":3,"size":22,"text":"Management confirmed that another climate survey shall be held in 2016 and that this survey will include perceptions and feedback on OCS."},{"index":4,"size":17,"text":"Recommendation: Management is requested to provide an update on the action plan at the April 2016 meeting."}]},{"head":"Workforce Data","index":28,"paragraphs":[{"index":1,"size":96,"text":"The Committee noted the comparative workforce data for the period September 2014 and September 2015. Management informed the Committee that it is still working on the aspect of the ILRI retirement age, as requested by the Committee in its previous meeting and that a proposal on the retirement age will be provided to the Board at the April 2016 Board meeting. In this respect, the Committee was also informed that the Director General has discretion for appointment of candidates over the age of 60, so that the institute can remain flexible where it needs particular expertise."},{"index":2,"size":32,"text":"The Committee noted that the number of consultants has now been reduced and that the data that has started being collected that will provide a 3 year period for comparison in 2016."},{"index":3,"size":21,"text":"Recommendation: The terms 'developed' and 'developing' instead of \"northern hemisphere\" and \"southern hemisphere\" should be used in presenting the workforce data."},{"index":4,"size":16,"text":"Recommendation: Management to present a proposal on the ILRI retirement age at the April 2016 meeting."}]},{"head":"Guidelines and Policies","index":29,"paragraphs":[{"index":1,"size":21,"text":"Management presented seven guidelines for information purposes only and one policy change for approval: Overtime work, Overtime payments and Compensatory leave."},{"index":2,"size":17,"text":"The revised policy includes clarification regarding eligibility for overtime and carry over days of compensatory leave days."},{"index":3,"size":21,"text":"Recommendation: The Human Resources Committee recommends that the appropriate changes be made to this policy and circulated by email for approval."}]},{"head":"Board Interaction with Staff Councils","index":30,"paragraphs":[{"index":1,"size":87,"text":"Management presented a proposal for board interaction with the staff councils for the future. The Human Resources Committee recognized that the two staff councils have the option of requesting to meet with the Board as provided for by the councils' charters 9. Audit and Risk Committee (Carles Soriano from CGIAR IAU joined the meeting) Present: Siew Fing Wong (Chair), Dieter Schillinger (Vice Chair), all board members and observers. Others: Peter Getugi (Head Internal Audit Unit -HIAU, Secretary), members of ILRI management, Carles Soriano (CGIAR Internal audit unit)."}]},{"head":"1.","index":31,"paragraphs":[{"index":1,"size":25,"text":"Follow up actions of the 14th meeting of the audit & risk committee A list of the follow up actions was presented to the committee."},{"index":2,"size":54,"text":"Guidelines developed on the management of ICT assets to safeguard ICT assets, following the increase of ILRI asset capitalization threshold from $1000 to $3000 was tabled by the Corporate Services Director (CSD) and endorsed by A&RC, and it was agreed that these guidelines will form part of the updated policy on the Asset Management."},{"index":3,"size":64,"text":"It was noted the due diligence guidelines and procedures for assessing partner capabilities presented by the CSD concentrate more on financial capability than technical capability. CSD explained that, however, that the partnership recruitment process also includes technical evaluation by the project team. These form the basis of the Collaborative Research Agreement (CRA) which the DDG approves after the Principal Investigator (PI) has signed off."},{"index":4,"size":22,"text":"The CSD confirmed that the levels of approval are included in the OCS work flow, so that procedural approvals cannot be circumvented."}]},{"head":"2.","index":32,"paragraphs":[{"index":1,"size":15,"text":"Internal Audit activities reports -Summary and Status of 2015 audit plan (April 2015 to Oct."}]},{"head":"2015)","index":33,"paragraphs":[{"index":1,"size":21,"text":"The HIAU presented a summary of 8 audit assignments conducted between April 2015 and October 2015. Some key findings were highlighted"}]},{"head":"Update on Institutional risk matrix","index":34,"paragraphs":[{"index":1,"size":32,"text":"The committee received a report on institutional risks by the HIAU. The 12 key risks presented in the report were last reviewed by Risk Owners and Risk Action Managers in October 2015."},{"index":2,"size":32,"text":"Recommendation: To improve on the presentation of risks, ILRI should consider quantifying the risks impact and likelihood and also consider incorporating other good practices on presentation of risks from other CGIAR centres."},{"index":3,"size":23,"text":"Recommendation: ICT management to identify risks associated with data management to ensure risks related to emerging data security and management, are adequately mitigated."},{"index":4,"size":36,"text":"Recommendation: Follow up with risk owners and risk action managers to ensure that the action plans to address various risks are up to date. Highest risks should be articulated to the board, with its reactions noted."}]},{"head":"Report from the CGIAR IAU","index":35,"paragraphs":[{"index":1,"size":17,"text":"Carles Soriano of the CGIAR IAU briefed the Committee on two audits which it conducted in 2014/15."},{"index":2,"size":8,"text":"IT controls audit and CRP Livestock and Fish."}]},{"head":"Closed session with Head, Internal Audit","index":36,"paragraphs":[{"index":1,"size":56,"text":"The committee held a closed door session with the HIAU 6. AOB Ernst and Young (EY) have been hired as ILRI external auditors commencing financial year 2015 after the expiry of the KPMG term. The board approved the appointment of EY as the external auditors electronically in July 2015 and the approval is formally noted here."}]},{"head":"Full Board meeting: adoption of committee recommendations","index":37,"paragraphs":[{"index":1,"size":18,"text":"Committee recommendations from the program, finance, HR and audit and risk committees were presented and approved as above."},{"index":2,"size":19,"text":"It was noted that the audit and risk committee should include presentation of audit findings along with management responses."}]},{"head":"Closed Board meeting 11a. Review and recommendations: new board members","index":38,"paragraphs":[{"index":1,"size":45,"text":"Chanda Nimbkar and Judith Lungu had been interviewed by members of the nominations committee, Lindsay Falvey and Khatijah Yusoff earlier in the year, and their recommendations had been presented to the full board who agreed to invite both candidates as observers to the present meeting."},{"index":2,"size":26,"text":"The board considered the candidature of Chanda Nimbkar, who presented a summary of her credentials. Chanda indicated her willingness to become a member of the board."},{"index":3,"size":26,"text":"The board considered the candidature of Judith Lungu, who presented an overview of her credentials to the board and indicated she would be willing to join."},{"index":4,"size":14,"text":"The board met in closed session to consider the candidature of the two observers."},{"index":5,"size":24,"text":"The board considered Chanda Nimbkar and Judith Lungu would be suitable candidates for the board and thus both were invited and accepted to join."}]},{"head":"11b. Report of the Nominations Committee","index":39,"paragraphs":[]},{"head":"A. Review of committee chairs","index":40,"paragraphs":[{"index":1,"size":53,"text":"The committee undertakes a regular review and, where appropriate, refresh of chairs and vice chairs to ensure appropriate succession planning is in place as members complete their board terms. In this regard, the committee reviewed the current composition and based recommends the following to begin from the end of the current board meeting."}]},{"head":"Executive and full board","index":41,"paragraphs":[{"index":1,"size":8,"text":"Board chair: Lindsay Falvey Vice chair: Lorne Babiuk"},{"index":2,"size":66,"text":"The board noted that given the likely occurrence of CGIAR meetings at this time, members should be prepared for the meeting to move one week earlier or later, once the CGIAR meeting dates are known. Action: board secretary to confirm CGIAR meetings and advise on board meeting dates accordingly 47th ILRI Board meeting 14-17 April 2017 -TBC 48th ILRI Board meeting 4 -8 November 2017 -TBC"}]}],"figures":[{"text":" Recommendation: Recognizing the uncertainty regarding the second phase CRPs the Committee recommended that Management consider the risk of a delay in the approval of the Livestock CRP and put in place a risk mitigation strategy. Action: The Committee appreciated the urgent need at this time to mobilize more resources through Window 3 and bilateral funding and endorsed the actions being made by management. "},{"text":" : The Committee recommended that Management provide a clear definition of the different types of collaborative arrangements (partners, collaborators, service suppliers etc.) and clarify the strategy for selection of collaborators. Action: Management will provide a definition of the different types of partnership arrangements and the strategy for selection of partners and other collaborative arrangements. "}],"sieverID":"43e0be09-c65c-4292-a874-1dd5f05ac1ed","abstract":"Members of ILRI's senior management team, Carles Soriano (CGIAR internal audit) joined the audit and risk committee meeting. 1 Official full minutes are those retained by the ILRI Board Secretary on behalf of the Board"}

data/part_1/03523ee8e5ac1184f5b7a443e4232c50.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03523ee8e5ac1184f5b7a443e4232c50","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3e61c20d-91ef-49c2-8b87-caa3804bfb42/retrieve"},"pageCount":2,"title":"","keywords":["Jemima Mandapati","Strategic Marketing and Communication","ICRISAT Photos: ICRISAT Design: Pavan Arts"],"chapters":[{"head":"INSPIRATION FROM YEWOL","index":1,"paragraphs":[]},{"head":">> WHAT HAPPENED","index":2,"paragraphs":[{"index":1,"size":75,"text":"Five years ago, communities in the dry highlands of the Yewol mountains found it difficult to grow even their staple crops. In the rainy season, rainwater gushed down the slopes eroding the soil. Free grazing of cattle and unreliable rain affected the productivity so much that crops began to dwindle along with their livestock. Migration was the only way out for some. Food shortage stalked the residents and it still is a reality for some. "}]},{"head":"Saving the soil","index":3,"paragraphs":[]},{"head":"Upscaling avenues Influence on policy makers","index":4,"paragraphs":[{"index":1,"size":27,"text":"Project success caught the attention of higher officials, decision makers and regional administrators including the president of Amhara regional state. Concrete actions taken by concerned institutions include: "}]},{"head":"THE WAY THE PROJECT EMPOWERED FEMALE AND MALE FARMERS","index":5,"paragraphs":[]}],"figures":[{"text":"FOR ALL OF US WE WORKED TOGETHER Our land is scattered. If we work individually, we cannot get there. Even the office of agriculture can't get there. Each of us contributed 60 days to build these structures on our farms and on those of our neighbors. ALI AHMED | a farmer from woreillu DISTRICT I am from Ethiopia and want to see my country prosper. Watershed management is a very complex agenda. It requires multiple players and multiple skills. So I talked to as many people as possible, finding others who also had a vision and cared about the people and the environment.\" DR TILAHUN AMEDE | ICRISAT YOU CANNOT DO IT ALONE Almost every initiative that has come to the watershed has been beneficial. But not everyone has benefitted. There are also possibilities to scale this approach out to other sites. DERIB HASSAN | DISTRICT ADMINISTRATOR FOR WOREILLOOTHERS ARE STILL WAITINGHow communities joined hands to replenish the ecosystem that belongs to themHOW IT WAS DONE >> WHAT WAS DONEAt a time when the people were struggling with the situation, a watershed initiative was started by concerned local researchers with the support of the government. The project brought in the needed change among communities to join hands and work together to replenish the dwindling resources of their homeland, Yewol, which in Amharic means 'for all of us'! "},{"text":" Terracing and contour ditches prevented soil erosion and increased recharge of groundwater 7,500 hectares i.e. the entire watershed area was terraced by the community as part of the government's Safety Net Program with technical support from ICRISAT Scientifically tested solutions ensured effectiveness and sustainability. Local byelaws were framed to support solutions 60 days of work was contributed by each farmer for building terraces and other structures Birr* was the average income of young farmers in the potato cooperative. The project distributed crossbreed bulls and rams, and recruited artificial insemination for further scaling up/out Started interventions of the same kind and showed interest to scale-up/out Incorporated it into the Productivity Safety Net program (PSNP) "},{"text":" livestock from the effect of drought (% of households) *1 birr = 0.035 US$ "}],"sieverID":"83ff9c43-36ea-4b04-a8ff-1ebffc17b78b","abstract":""}

data/part_1/03beb24fa0787309c627a63f5bdfcc1c.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03beb24fa0787309c627a63f5bdfcc1c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/89b3d904-df5b-4691-a9da-63e9d6bd3d1f/retrieve"},"pageCount":18,"title":"","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":105,"text":"This report documents Africa RISING's efforts to assess the gender knowledge, skills, and needs of its research partners; and to use the results for tailored capacity building. It shows how an assessment in 2015 (East and Southern Africa project, West Africa project) led to the development of a training concept that matches the project's farming systems and action research approach. After four gender analysis training sessions in 2017, a manual was completed and published on CGSpace to make the training contents accessible to a wider audience. At the same time, a follow-up investigation with the training participants revealed where gender support could be further strengthened."},{"index":2,"size":55,"text":"This report focuses on project-wide gender capacity building measures. It does not document individual learning (for instance through interdisciplinary research the gender person took part in or through feedback the gender person gave on a variety of tools). Also, it does not mention shorter training sessions offered to individual teams or at larger project meetings."},{"index":3,"size":117,"text":"Assessing the gender capacity and training needs of Africa RISING partners (2015/2016) Africa RISING's overall objective of improving the livelihoods of especially female smallholders and their children emerges from a clear vision of gender equity. It can only be achieved if project partners are invested with well-developed gender capacities. For this reason, Africa RISING (IITA-led West Africa and East and Southern Africa regions) conducted a gender capacity assessment in 2015. The evaluation aimed to direct attention to the importance of gender capacities for the success of the project, provide an outline for a capacity development plan, enable the management to prioritize areas for increased efforts, and set a baseline against which continuous capacity building can be measured."},{"index":4,"size":94,"text":"A framework for the assessment was designed by combining elements from the \"Gender Capacity Assessment and Development Guide\" of the CGIAR Research Program on Livestock and Fish (2015) and the UN Women \"Gender Equality Capacity Assessment Tool\" (2014). It resulted in an investigation on three levels: an evaluation of agricultural policies in Africa RISING countries in terms of their conduciveness for gender-sensitive research for development (environmental level); a focus group discussion with management members about delineated gender core capacities (organizational level); and a survey about the same core capacities among individual staff (individual level)."},{"index":5,"size":255,"text":"At the environmental level, all Africa RISING countries follow the Comprehensive Africa Agriculture Development Program's (CAADP) principle of gender mainstreaming but at varying degrees of national elaboration and implementation. The Governments of Ghana, Malawi, and Zambia emerged as more committed to gender-sensitive agricultural research and extension work and the development of relevant capacities in their staff than their counterparts in Mali and Tanzania. At the organizational level, management members recognized \"gender analysis\" (including the use of its results for research programming) and the application of \"gender transformative approaches\" as areas in which efforts should be increased. \"Effective partnerships\", \"gender and leadership,\" and \"knowledge management and gender-responsive M&E\" were perceived as well-developed capacities. Some findings at the individual level support the management's self-assessment, especially the proposition that skills, experience, and knowledge of \"gender analysis\" and \"gender transformative approaches\" are low among research staff. Other data show that areas the management considered as well-developed were considered to be as less-developed by individual respondents. \"Gender and leadership\" emerged as a capacity where management viewed itself as very committed; however, a larger number of respondents indicated a lack of mandate for gender mainstreaming. Similar assessment gaps appeared for \"knowledge management and gender-responsive M&E\" and \"effective partnerships\". Overall, majority of individual respondents regarded gender as significant to their everyday work, but at the same time indicated a need for higher capacities to effectively include gender aspects into the research process. The capacity assessment report identified starting points for leveraging gender mainstreaming within Africa RISING. For the full report, see: https://cgspace.cgiar.org/handle/10568/72524"},{"index":6,"size":157,"text":"The report especially recommended the offering of gender analysis training to research partners. Therefore, the Africa RISING gender person teamed up with an experienced international trainer (responsible for the didactic approach and methodology of the training) and a junior gender expert to draft the concept and contents of a \"gender analysis in agriculture\" training. While waiting for the completion of the capacity assessment and the Training Africa RISING partners in gender analysis in agriculture (2017) In 2016 and early 2017, the gender team developed a draft training manual for gender analysis in agriculture. In June and September 2017, four training sessions were conducted in Mali, Ghana, Tanzania, and Malawi. The manual is based on a training concept that resonates with Africa RISING's farming systems and action research approach and puts a focus on gender transformation. The following table (Table 1) provides an overview over the four two-day training that reached a total of 60 Africa RISING researchers. "}]},{"head":"ICRISAT, WorldVeg and other Africa RISING partners","index":2,"paragraphs":[{"index":1,"size":111,"text":"Participants self-assessed their knowledge and skills at the beginning and after completing the training. The following figure and table provide an overview of their perceived learning outcomes. Figure 1 aggregates results for all four countries as well as sub-questions, while Table 2 presents more detailed and disaggregated information. Table 2 also includes results to the question of whether participants have identified entry points for an inclusion of gender analysis in their research together with social scientists.    • To maintain participants' competence and confidence in integrating gender analysis into research activities; and • To identify and (where possible) solve challenges that limit the application of knowledge and skills acquired during the training."},{"index":2,"size":71,"text":"A list of questions was discussed with participants in individual face-to-face interviews at regional review and planning meetings or sent to them via email. Twenty participants (out of 60 in total) responded (13 male, 7 female). Responses covered all countries (Mali 6, Ghana 5, Tanzania 5, and Malawi 4). Questions sought qualitative feedback and suggestions for further support. The sections below summarize the responses received, including direct quotes from some participants."}]},{"head":"Skills that participants found useful in their work after the training","index":3,"paragraphs":[{"index":1,"size":96,"text":"Responses to this question varied depending on the focus of respondents' daily responsibilities. Several researchers reported to have conducted surveys (design, sexdisaggregation, sampling) in a more gender-sensitive manner since attending the training. One scientist had found participatory tools (daily activity clocks and seasonal calendars) useful. Those more engaged in community mobilization and extension cooperation emphasized that their skills had improved in gender-aware targeting of farmers for R4D activities and in understanding men's and women's differential needs, priorities, and roles. Generally, responses indicated an increased understanding of gender concepts and terminology, as the following two quotes illustrate:"},{"index":2,"size":46,"text":"The training made me more aware of the gender-terminology and I was able to better evaluate 'gender-statements' in publications. Furthermore, the training was useful in that it made me aware of the fact that I was already having 'gender'-elements in my ongoing research (participant from Ghana)."}]},{"head":"Prior to the training, my understanding about integration of gender into my work was limited to just counting the number of men and women doing interventions. After my training, I got to appreciate that gender research goes beyond having sex-disaggregated data to","index":4,"paragraphs":[{"index":1,"size":14,"text":"understanding roles and responsibilities of people in a household or community (participant from Tanzania)."}]},{"head":"Areas of training participants shared with colleagues","index":5,"paragraphs":[{"index":1,"size":11,"text":"Participants shared various aspects of the Africa RISING training with colleagues:"},{"index":2,"size":218,"text":"• Four participants trained other researchers in the application of participatory gender tools such as activity profiles, daily activity clocks, seasonal calendars, linkage diagrams, or matrix scoring. The last tool, matrix scoring, is based on the Sustainable Intensification Assessment Framework (SIAF) Africa RISING uses for technology assessments. One participant mentioned that learning and using the matrix scoring tool had improved his understanding of the human and social domains of SIAF, which again had helped his co-researchers to become more aware. • Six participants indicated to have shared their knowledge of gender concepts (intersectionality, gender roles and relations). One researcher noted that gender concepts are now included in brainstorming with colleagues when planning activities. Another person reported that concepts were useful in developing work proposals with co-researchers. • Three participants shared their knowledge on principles for gender-sensitive surveys (including standards for sex-disaggregation) with co-workers. • One participant had intended to organize a \"small workshop\" to train research partners on the most important aspects of the Africa RISING gender training. However, some of her colleagues were not immediately interested and doubted the workshop's usefulness. Therefore, the workshop did not take place. • Two respondents communicated with partners about strengthening a gender transformative approach in R4D activities, especially a closer collaboration with local stakeholders to support sustainable changes in gender relations."}]},{"head":"Feedback conversations with supervisors about the training","index":6,"paragraphs":[{"index":1,"size":26,"text":"The majority of respondents had feedback conversations with supervisors ranging from a short exchange to detailed discussions on how to further include gender aspects in activities."},{"index":2,"size":25,"text":"Several researchers attended the training with their supervisors, which, they indicated, catalyzed the integration of the newly acquired gender knowledge and skills in their work."},{"index":3,"size":18,"text":"One woman used the discussion with her superior to improve a participatory tool they had planned to employ.  "}]},{"head":"Changes in the interaction/collaboration with the gender focal point in participants' organizations since the training","index":7,"paragraphs":[]},{"head":"Gender concepts participants considered in their research","index":8,"paragraphs":[{"index":1,"size":51,"text":"Looking at the gender concepts introduced during the training, many of the participants felt confident to consider gender roles and gender relations in their research (Table 3). However, only few applied the concept of intersectionality. Three responses revealed that the concept itself and its operationalization in research were not yet clear. "}]},{"head":"Gender tools participants applied in their research","index":9,"paragraphs":[{"index":1,"size":68,"text":"Among the gender tools the training focused on, participants most frequently applied activity profiles and seasonal calendars, while a smaller number also employed linkage diagrams and matrix scoring (Table 4). Some respondents had not applied the tools for lack of opportunity or because they could not fit them into ongoing activities. Some responses also conveyed a sense of insecurity in terms of how to exactly use the tools. "}]},{"head":"Standards for gender-sensitive surveys participants employed in their research","index":10,"paragraphs":[{"index":1,"size":90,"text":"Many of the training participants had used the standards for gender-sensitive surveys (Table 5). This may be due to the fact that surveys constitute the most common method to elicit socioeconomic information in agricultural research (as compared to qualitative or participatory methods). In terms of sex-disaggregation, reporting requirements to donors have further promoted its widespread use. One participant commented that a gendersensitive research set-up could not be established since his superior decided otherwise. This underlined the importance of providing training not only to junior researchers but also to lead scientists. "}]},{"head":"Difficulties in applying the content of the gender training","index":11,"paragraphs":[{"index":1,"size":79,"text":"Most respondents simply indicated \"no\" to this question. Three wrote that they were still in the process of experimenting with the new tools and concepts and would need time to fully include them into their work. One participant requested more training on the Sustainable Intensification Assessment Framework (SIAF) and the related matrix scoring tool. Another said that results of gender analysis must be integrated into subsequent interventions -a process he saw as not manageable without further support. He wrote:"},{"index":2,"size":44,"text":"Once gender analysis is complete, we need to iron out identified problems before moving forward. The needed support for interventions to address differences (e.g., access to productive resources and decision-making) identified in gender analysis does not appear to be readily available (participant from Ghana)."},{"index":3,"size":32,"text":"A person from Tanzania further supported the observation that when less gender-aware superiors design research activities alone, it becomes at times difficult for young scientists to apply their gender knowledge. His comment:"},{"index":4,"size":32,"text":"Nothing was hard to consider. The only challenge is when someone else has already done the overall study and you are just needed to collect data in the field (participant from Tanzania)."}]},{"head":"Suggestions for improving the training and the follow-up support after the training","index":12,"paragraphs":[{"index":1,"size":11,"text":"Participants suggested the following to improve the training and subsequent support:"},{"index":2,"size":20,"text":"1. Offer annual or biannual follow-up sessions for participants to promote networking and sharing of field experiences with gender analysis. "}]}],"figures":[{"text":"Figure 1 : Figure 1: Aggregated results of participants' self-assessment before and after the Africa RISING \"Gender analysis in agriculture\" training in 2017. "},{"text":" Developing a training manual for gender analysis in agriculture(2018)    After completion of the training in September 2017, the gender team revised the draft manual based on feedback from participants and facilitators. Three gender experts then peer-reviewed the manual and provided comments to improve its contents and structure. The final version of the manual is available on CGSpace: https://cgspace.cgiar.org/handle/10568/100149The figure below gives an overview of the gender training. The training is organized in four learning units: introduction, basic gender concepts, principles and tools for gender analysis, and wrap-up and evaluation. Each unit consists of several modules. "},{"text":"Figure 2 : Figure 2: Overview of contents of gender training "},{"text":" Three participants indicated not to have a gender focal point in their organization or only having a distant working relation to that person (without any changes after the training). When contacting the gender focal point of one of the participating organizations for feedback, she reported that she had not received requests for support or collaboration from training participants. Two partners involved in the training were gender focal points themselves. Only two respondents described an exchange or follow-up with the gender person of their organization. "},{"text":"  "},{"text":"  "},{"text":"Table 1 : Africa RISING \"Gender analysis in agriculture\" training  Where, when Participants Organizations Where, whenParticipantsOrganizations Gender Arusha, Tanzania 14 participants (13 WorldVeg, IITA, CIMMYT, GenderArusha, Tanzania14 participants (13WorldVeg, IITA, CIMMYT, analysis in 08 to 09/06/2017, male, 1 female) CIAT and other Africa RISING analysis in08 to 09/06/2017,male, 1 female)CIAT and other Africa RISING agriculture SG Resort  partners agricultureSG Resortpartners  Lilongwe, Malawi 16 participants (8 male, Michigan State University, Lilongwe, Malawi16 participants (8 male,Michigan State University,  12 to 13/06/2017, 8 female) IITA, LUANAR, CIAT and other 12 to 13/06/2017,8 female)IITA, LUANAR, CIAT and other  Crossroads Hotel  Africa RISING partners (also Crossroads HotelAfrica RISING partners (also    from Zambia) from Zambia)  Tamale, Ghana 15 participants (12 IWMI, STEPRI, FOSTERING, Tamale, Ghana15 participants (12IWMI, STEPRI, FOSTERING,  07 to 08/09/2017, male, 3 female) UDS and other Africa RISING 07 to 08/09/2017,male, 3 female)UDS and other Africa RISING  Modern City Hotel  partners Modern City Hotelpartners  Bamako, Mali 15 participants (13  Bamako, Mali15 participants (13  11 to 12/09/2017, male, 2 female)  11 to 12/09/2017,male, 2 female)  ICRISAT   ICRISAT  "},{"text":"Table 2 : Detailed Describe Africa RISING research 2.91 4.23 2.20 4.36 2.62 4.00 3.27 4.13 Describe Africa RISING research2.914.23 2.204.36 2.624.003.274.13 approaches and their gender         approaches and their gender link         link Distinguish main features of 2.82 4.54 3.19 4.71 3.00 4.33 2.85 4.20 Distinguish main features of2.824.54 3.194.71 3.004.332.854.20 gender roles and relations         gender roles and relations Define the concept of 2.27 4.54 2.25 4.43 2.31 4.08 2.69 4.33 Define the concept of2.274.54 2.254.43 2.314.082.694.33 intersectionality for their work         intersectionality for their work Apply basic gender concepts:         Apply basic gender concepts: a. Gender roles 2.64 4.69 3.31 4.57 3.14 4.25 3.67 4.08 a. Gender roles2.644.693.314.573.144.253.674.08 b. Gender relations 2.55 4.55 3.14 4.43 2.50 4.00 3.46 4.07 b. Gender relations2.554.553.144.432.504.003.464.07 c. Intersectionality 2.50 4.36 3.07 4.43 2.10 3.75 2.22 4.14 c. Intersectionality2.504.363.074.432.103.752.224.14 Explain basic principles of 2.17 4.23 2.88 4.36 2.50 3.92 2.75 4.27 Explain basic principles of2.174.23 2.884.36 2.503.922.754.27 gender analysis in agriculture         gender analysis in agriculture Apply participatory gender 2.00 4.31 2.86 4.21 2.38 4.00 2.33 3.93 Apply participatory gender2.004.31 2.864.21 2.384.002.333.93 analysis tools together with         analysis tools together with social scientists         social scientists  "},{"text":"Table 3 : Consideration of gender concepts in research Gender concept Yes, considered If yes, how? If no, why not? Gender concept Yes, consideredIf yes, how?If no, why not? Gender roles 9 Labor allocation Gender roles9Labor allocation   Decision-making Decision-making   Differential interests Differential interests   Crop allocation Crop allocation Gender relations 8 Analysis of social relations Gender relations 8Analysis of social relations   and power balances and power balances Intersectionality 3  No opportunity Intersectionality 3No opportunity    Concept and Concept and    operationalization operationalization    not clear not clear  "},{"text":"Table 4 : Application of gender tools in research Gender tool Yes, applied If yes, how? If no, why not? Gender toolYes, appliedIf yes, how?If no, why not? Activity profiles, 7 Identification of daily or  Activity profiles,7Identification of daily or daily activity  seasonal work patterns  daily activityseasonal work patterns clocks, seasonal  Seasonal application of  clocks, seasonalSeasonal application of calendars  Aflasafe No opportunity calendarsAflasafeNo opportunity Linkage diagrams 3 Identification of topics and Failure to integrate Linkage diagrams 3Identification of topics andFailure to integrate   partners the tools into partnersthe tools into   Teasing out ongoing activities Teasing outongoing activities   interrelationships between Insecurity in terms of interrelationships betweenInsecurity in terms of   topics application topicsapplication Matrix ranking 4 Participatory technology or  Matrix ranking4Participatory technology or and scoring  variety selection during  and scoringvariety selection during   field days  field days  "},{"text":"Table 5 : Use of standards for gender-sensitive surveys  Yes, employed If yes, how? If no, why not? Yes, employedIf yes, how?If no, why not? Sex-disaggregation 15 In reports, since  Sex-disaggregation15In reports, since of data  mandatory (sex-  of datamandatory (sex- Inclusion of gender 11 disaggregation) Survey had no Inclusion of gender11disaggregation)Survey had no analysis questions  In combination with gender focus analysis questionsIn combination withgender focus Gender-sensitive 9 WEAI (Women Need to continue Gender-sensitive9WEAI (WomenNeed to continue sampling  Empowerment in with the same samplingEmpowerment inwith the same   Agriculture Index) sample Agriculture Index)sample Gender-sensitive 10 Considered in new More training Gender-sensitive10Considered in newMore training research set-up  research needed research set-upresearchneeded   Already considered Decision on set-up Already consideredDecision on set-up   before training was taken by before trainingwas taken by    superior superior  "},{"text":" Set up a web site where gender analysis tools can be easily accessed.\" (participant from Mali).3. Offer more support for gender inclusion in daily activities of participants.\"Consider providing support for implementation visits, and supervisions should also be provided.\" (participant from Malawi).\"The facilitators need to understand what we are implementing in different activities and oversee how far gender issues have been understood and considered in every progress made in the project.\" (participant from Tanzania). 4. Work on \"real\" tools and activities to be implemented after the training. \"Training should be geared towards addressing identified needs and problems of society/staff. Such training should necessarily end with assigned tasks that can be accomplished within a short period of time.\" (participant from Ghana). \"... during the training ask scientists to draft a questionnaire for data collection. Then highlight the concepts and gender tools.\" (participant from Mali). 5. Increase the number of training days. \"I generally appreciated the training on gender analysis because the training was very rich and interactive with the participation of several people with different specialty. However, to improve the training given the importance of the gender aspect in agriculture, I suggest increasing the number of days for the training so that the facilitators can explain more on the different topics of the training.\" (participant from Mali). 6. Offer a module on how to include gender in work proposal development. \"I think much is at proposal development stage where we miss to set goals and activities that are more inclusive because of lack of understanding of gender issues. Perhaps in future training could include a simple proposal development practice that would see how gender issues are integrated in various proposal components. Because all follow up gender issues arise too late during implementation and that gives a problem even to collect some critical information.\" (participant from Tanzania). \"The training was good and has enhanced my understanding on gender analysis. \"The training was good and has enhanced my understanding on gender analysis. Such training, once a year, involving a cross-section of participants from previous Such training, once a year, involving a cross-section of participants from previous training sessions to share their real field experiences will help improve the training.\" training sessions to share their real field experiences will help improve the training.\" (participant from Ghana). (participant from Ghana). \"Have a training or refresher training on different gender topics every 6 months or 12 \"Have a training or refresher training on different gender topics every 6 months or 12 months.\" (participant from Mali). months.\" (participant from Mali). \"More networking for sharing of tools, resources and experiences between trainers \"More networking for sharing of tools, resources and experiences between trainers and trainees, and also among trainees to ensure effective co-learning.\" (participant and trainees, and also among trainees to ensure effective co-learning.\" (participant from Ghana). from Ghana).  "}],"sieverID":"2b23afa5-931c-43e0-94ee-8cbf6e22124b","abstract":""}

data/part_1/03d66e43a67816e92067a4915cdc938f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03d66e43a67816e92067a4915cdc938f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/01eca8c9-22ae-48db-8c28-4420e8bd59c5/retrieve"},"pageCount":31,"title":"Note: Sign at the 16 October women's empowerment rally in Nigeria. Credit: Projekthope (Creative Commons License)","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":18,"text":"Collective level • Often externally defined, depending on the type of group (and who set it up), e.g."},{"index":2,"size":6,"text":"• Amount collectively marketed (producer organizations)"},{"index":3,"size":4,"text":"• Income increases (SHGs)"},{"index":4,"size":7,"text":"• Improvements in natural resources (NRM groups)"},{"index":5,"size":10,"text":"• How do groups themselves define their objectives and achievements?"},{"index":6,"size":16,"text":"• How do different members (women and men of different backgrounds) define and value collective achievements?"},{"index":7,"size":4,"text":"Findings from expert workshop  "}]}],"figures":[{"text":"•• Collaboration between IFPRI, the World Bank's LSMS team and Africa Gender Innovation Lab, the International Rescue Committee, and Oxford University • Aims to broaden and deepen the measurement of women's agency, based on the development of new tools and rigorous testing and comparison of both new and existing methods for measuring agency, and promoting the adoption of these measures at scale. • Focused on three dimensions of women's agency that have high potential for catalyzing progress on women's economic empowerment, but for which the body of existing measurement methods is weak or under-tested: • Ownership and Control Over Assets • Sense of Control and Efficacy • Goal Setting and Decision-Making Research partnership with Professional Assistance for Development Action (PRADAN) • Co-develop and pilot a survey module for measuring collective agency among members of PRADAN-sponsored self-help groups (SHGs) in India in 3 states • Pilot survey ongoing • Individual interviews with 900 women members of 150 SHGs (randomly selected from 30 village organizations) + group interviews with 3-5 leaders (or longstanding members) for every VO and SHG "},{"text":"  "},{"text":"• A need for better and more appropriate tools to capture nuances, disarm the notion that forming groups is the same as collective agency.• Integrate view of researchers, practitioners mobilizing women's groups, and grassroots organizations. • Understand what is happening in the group's environment and examine questions of social capital and structural transformation. • Agency seems to be missing from a lot of the instruments and indicators. Looks like they are more about group performance and functioning. • Expand measurement of group outcomes beyond economic outcomes. • Almost all current indicators are externally defined performance indicators of the group, rather than things that the group itself necessarily defines. Many latent constructs, but need clarity on what we are considering • Need more on collective level, but be aware of heterogeneity of individual values and experiences within the collective • Balance between measures specific to the project and context vs ones that have broader comparability Implications for Measurement • Portfolio of partner projects • Measures for Advancing Gender Equality (MAGNET) Implications for Measurement • Portfolio of partner projects • Measures for Advancing Gender Equality (MAGNET) • Applying New Evidence for Women's Empowerment (ANEW) • Applying New Evidence for Women's Empowerment (ANEW) • Overcoming Roadblocks to Women's Participation through Advocacy • Overcoming Roadblocks to Women's Participation through Advocacy Training Training • Pan Africa Bean Research Alliance (PABRA) • Pan Africa Bean Research Alliance (PABRA) • Promise of Commons initiative • Promise of Commons initiative  "}],"sieverID":"58aac902-789e-4f8a-81ba-af7442e5a6dd","abstract":""}

data/part_1/03e64fe899b45b566700afebacda9c59.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03e64fe899b45b566700afebacda9c59","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/031a881c-65ea-4e72-b648-4e2591c40131/retrieve"},"pageCount":31,"title":"Elaboración de planes de negocio para la gestión de empresas asociativas rurales","keywords":[],"chapters":[{"head":"Introducción","index":1,"paragraphs":[{"index":1,"size":52,"text":"El plan de negocios posibilita a través de un documento reunir toda la información necesaria para valorar un negocio y establecer los parámetros generales para ponerlo en marcha. En el documento se establece la naturaleza del negocio, los objetivos de la organización y las acciones que se requieren para alcanzar dichos objetivos."},{"index":2,"size":104,"text":"La experiencia de redactar un plan de negocios es similar a la construcción de un edificio bloque por bloque. En cada parte de la construcción se deben tomar buenas decisiones que permitan levantar un negocio sólido y duradero. Un proyecto se inicia con una buena idea, pero para convertir esta idea en negocio, se debe comprobar si se cuenta con los recursos para llevarla a cabo. En el plan de negocios se detalla y estudia toda la información relacionada con los recursos humanos, las propuestas estratégicas, los planes comerciales, la forma de operar y los aspectos financieros necesarios para convertir las ideas en negocios."},{"index":3,"size":80,"text":"El plan se utiliza tanto para una gran empresa como para un pequeño emprendimiento. En distintas etapas de la vida de una empresa es necesario establecer a través de un documento los aspectos esenciales de los proyectos que pueden estar relacionados con: el lanzamiento de nuevos productos, las mejoras de los productos existentes, los cambios o ampliaciones de locales para aumentar la capacidad de producción, los respaldos de un pedido de crédito o el despertar interés a un socio potencial."}]},{"head":"Objetivo de esta guía","index":2,"paragraphs":[{"index":1,"size":51,"text":"La Guía para la elaboración de un plan de negocios tiene por objetivo recalcar la importancia de construir un documento que permita a una organización visualizar su futuro. Esta guía provee la información necesaria para apoyar la preparación de un plan de negocios sencillo, pero completo, que pueda implementarse con éxito."}]},{"head":"Capacidades a fortalecer","index":3,"paragraphs":[{"index":1,"size":60,"text":"¿Cuáles son las características de los productos? ¿Cuál es la estructura funcional del negocio? ¿Quiénes son los principales ejecutivos que pueden asegurar el éxito del proyecto? ¿Cuáles son los costos de producción y administración asociados al proyecto? ¿Cuál es la rentabilidad esperada del proyecto? ¿Cuáles son las necesidades de financiamiento del mismo? ¿Cuándo se debe elaborar un plan de negocios?"},{"index":2,"size":15,"text":"Las razones más comunes por las cuales se decide elaborar un plan de negocios incluyen:"},{"index":3,"size":86,"text":"• Cuando se requiere verificar, antes de iniciarlo, si un negocio es viable desde el punto de vista económico y financiero.. • Cuando se quiere ganar eficiencia para poner en marcha un negocio nuevo. • Cuando se necesita estimar cuanto dinero se requiere para el emprendimiento del negocio y localizar posibles fuentes de financiamiento. • Cuando se busca detectar y prevenir problemas antes de que ocurran, y de esta manera ahorrar tiempo y dinero. • Cuando se necesita revisar el desempeño de un negocio en marcha."},{"index":4,"size":12,"text":"• Cuando se quiere tasar una empresa o negocio para la venta."},{"index":5,"size":20,"text":"• Cuando un banco o un ente donante solicita el plan de negocios como respaldo para la entrega de recursos."},{"index":6,"size":73,"text":"2. La capacidad de saber en que momento se debe elaborar un plan de negocios 3. La capacidad de encontrar en forma eficiente la información para la elaboración de un plan de negocios 4. La capacidad de redactar un plan de negocios en forma sencilla, pero completa 5. La capacidad de utilizar el plan de negocios, una vez que ha sido escrito ¿Por qué es útil la elaboración de un plan de negocios?"},{"index":7,"size":33,"text":"El plan de negocios es un valioso instrumento que sirve para reflexionar sobre los asuntos críticos de un emprendimiento. También es útil para explicar el negocio a inversionistas, a socios y a empleados."},{"index":8,"size":97,"text":"Además, el plan de negocios puede utilizarse como un documento de consulta permanente para medir los avances del negocio. La mejor forma de utilizar el documento es revisándolo periódicamente para hacer los ajustes necesarios de acuerdo a la realidad cambiante que enfrenta la organización. El plan de negocios nunca se debe convertir en una camisa de fuerza; no se elabora para siempre seguirlo al pie de la letra, sino como una buena guía que hay que seguir, siempre tomando en cuenta las circunstancias que se van presentando en el desarrollo de la organización en la vida real."},{"index":9,"size":11,"text":"Un plan de negocios debe contestar, al menos, las siguientes preguntas:"},{"index":10,"size":15,"text":"¿Cuáles son las necesidades u oportunidades que se pretenden atender con el plan de negocios?"},{"index":11,"size":31,"text":"¿Cuáles son los objetivos de la empresa y de qué manera se van a lograrlos? ¿Cuál es el mercado objetivo? ¿Cómo es la estructura del mercado (¿hay muchos participantes?, ¿hay sustitutos?)?"},{"index":12,"size":12,"text":"¿Cuáles son los canales de distribución definidos para llegar a los clientes?"},{"index":13,"size":15,"text":"¿Cuál es la política de precios de los productos? ¿Cuáles son las estimaciones de ingresos?"},{"index":14,"size":45,"text":"En el momento de organizar la información en el plan de negocios es importante tomar en cuenta a quien va dirigido el documento y quienes son las personas que van a revisarlo, con el objetivo de brindarles toda la información que necesiten para tomar decisiones."}]},{"head":"Recordemos","index":4,"paragraphs":[]},{"head":"Estructura de la guía","index":5,"paragraphs":[{"index":1,"size":48,"text":"La guía está escrita para acompañar al lector en la construcción de cada uno de los bloques del plan de negocios. Llamaremos \"bloques\" del plan de negocios a los capítulos que se deben redactar uno a uno, para contar finalmente con un documento sólido, completo y bien concatenado."},{"index":2,"size":7,"text":"Los bloques a construir son los siguientes:"},{"index":3,"size":1,"text":"1."},{"index":4,"size":27,"text":"Introducción o resumen ejecutivo: presenta los datos más relevantes de todo el plan de negocios en forma concisa para explicar el negocio, sus características y sus proyecciones."},{"index":5,"size":34,"text":"2. Descripción de la organización o proyecto: presenta los antecedentes más importantes de la organización si se trata de un negocio ya establecido o los datos de constitución si se trata de uno nuevo.."}]},{"head":"3.","index":6,"paragraphs":[{"index":1,"size":21,"text":"Productos y servicios: se describe los servicios y/o productos que la organización ofrece a sus clientes (sean estos internos o externos)."}]},{"head":"4.","index":7,"paragraphs":[{"index":1,"size":24,"text":"Análisis de mercado: se dedica especial atención a identificar y entender los grupos de clientes potenciales de los servicios y productos que se ofrecerán."}]},{"head":"5.","index":8,"paragraphs":[{"index":1,"size":25,"text":"Estrategia e implementación: se define la propuesta de valor de la organización, y la estrategia de mercadeo y ventas que surge del análisis del mercado."}]},{"head":"6.","index":9,"paragraphs":[{"index":1,"size":24,"text":"Administración de la empresa o proyecto: se describe la forma en que los esfuerzos de producción, comercialización y control administrativo se llevarán a cabo."}]},{"head":"7.","index":10,"paragraphs":[{"index":1,"size":30,"text":"Planificación financiera: este bloque recoge la información ya establecida en todos los bloques anteriores y se les asigna valores que permiten determinar la viabilidad financiera de la organización o proyecto."}]},{"head":"Resumen ejecutivo o introducción","index":11,"paragraphs":[{"index":1,"size":32,"text":"El resumen ejecutivo tiene por objetivo presentar los datos más relevantes de todo el plan de negocios y es útil para entender en forma concisa el negocio, sus características y sus proyecciones."},{"index":2,"size":80,"text":"Este bloque llegará a convertirse en un resumen del plan de negocios completo y será determinante para el lector una vez que el plan esté listo. El resumen ejecutivo se presenta al principio del documento, inmediatamente después de la carátula. Sin embargo, será el bloque que se preparará al final del ejercicio, una vez que se cuente con la información de los otros bloques, pues la introducción no es más que una recopilación de la esencia de las demás piezas."},{"index":3,"size":35,"text":"El resumen debe tener una extensión máxima de dos páginas, escritas con el fin de facilitar su revisión mediante una síntesis descriptiva que entusiasme al lector y le anime a participar en el proyecto planteado."},{"index":4,"size":34,"text":"Además de los datos más importantes de todos los demás bloques, el resumen ejecutivo debe incluir también la idea del negocio, los objetivos, la misión y los factores críticos de la empresa o proyecto."},{"index":5,"size":23,"text":"• Objetivos: son las metas del negocio, objetivos de mercado, objetivos en ventas y objetivos de rentabilidad. Todos estos objetivos deben ser medibles."}]},{"head":"•","index":12,"paragraphs":[{"index":1,"size":16,"text":"Declaración de la misión: define el negocio-explica la razón de ser de la empresa o proyecto."}]},{"head":"•","index":13,"paragraphs":[{"index":1,"size":24,"text":"Factores críticos de éxito: son las dos o tres acciones que se deben llevar a cabo particularmente bien para que el negocio realmente funcione."}]},{"head":"Definiendo la idea del negocio","index":14,"paragraphs":[{"index":1,"size":31,"text":"Cuando se ha seleccionado una idea como iniciativa para desarrollar un negocio, la misma debe responder a una necesidad o deseo actual o potencial de los consumidores-éste es el objetivo fundamental."},{"index":2,"size":71,"text":"Las personas compran bienes o servicios para satisfacer una necesidad o un deseo: por ejemplo, satisfacer su necesidad de alimentos (pan, carne, frutas, etc.); tener más comodidad en el hogar (electrodomésticos, muebles, etc.); tener esparcimiento (cine, teatro, viajes); satisfacer la necesidad de transporte (automóviles, autobus, aviones). Detectar esas necesidades y deseos permite Objetivo identificar oportunidades de negocios y de esta manera el empresario debe buscar la forma más conveniente de satisfacerlos."},{"index":3,"size":55,"text":"En primer lugar, el empresario debe definir en qué negocio (sector industrial) se encuentra el producto o servicio que va a desarrollar. Al detectar la necesidad o el deseo real del consumidor que uno satisface, se logra entender mejor la industria en la cual uno \"está\" y no solo en la que uno \"cree estar.\""},{"index":4,"size":71,"text":"El siguiente ejemplo puede ayudar a entender como identificar mejor la industria en que se opera. Cuando un comerciante vende agujereadoras, ¿qué es lo que vende realmente? ¿Qué le compra el cliente? ¿Agujereadoras? En realidad no. Lo que el cliente realmente busca y por lo que paga es \"la capacidad de hacer agujeros.\" La misma que logrará con el uso del aparato que llamamos \"agujereadora\" o posiblemente con otro dispositivo similar."},{"index":5,"size":26,"text":"De este ejemplo se entiende que este comerciante no está en el negocio de \"agujereadoras\", sino más bien en el negocio de \"aparatos para hacer agujeros.\""},{"index":6,"size":44,"text":"La idea de negocio debe sonar atractiva para un inversor. No consiste en un folleto publicitario de un producto supuestamente asombroso, ni en una descripción técnica, sino, más bien, en un documento de toma de decisión, que da respuesta a las siguientes tres preguntas:"},{"index":7,"size":105,"text":"¿Cuál es el beneficio para el cliente?, o sea, ¿qué problema se va a resolver? El éxito en el mercado se logra gracias a clientes satisfechos, no a productos asombrosos. Los clientes compran un producto porque quieren satisfacer una necesidad o resolver un problema; da igual que se trate de comida o bebida, de reducir un esfuerzo, de aumentar el placer o de mejorar su imagen. Por esta razón, la primera característica que debe tener una idea de negocio es que ésta establezca con claridad qué necesidad va a satisfacer y de qué forma lo va a conseguir (a través de qué producto o servicio)."},{"index":8,"size":58,"text":"¿Cuál es el mercado? Una idea de negocio sólo adquiere valor económico real si la gente quiere comprar el producto o servicio. Así, la segunda característica de una idea de negocio existosa es que sea capaz de demostrar la existencia de un mercado para el producto o servicio y que identifique al grupo o grupos de clientes objetivo."},{"index":9,"size":78,"text":"¿Cómo ganará dinero? La mayoría de los productos generan ingresos directamente, a partir de las ventas a los clientes. En algunos casos, sin embargo, el mecanismo de generación de ingresos puede ser más complicado: por ejemplo, el producto se entrega gratuitamente al cliente y son los anunciantes quienes lo pagan. Por esta razón, la tercera característica para que una idea de negocio tenga éxito es que se deje muy claro cómo se generarán ingresos y en qué cantidad."}]},{"head":"Ejemplo","index":15,"paragraphs":[{"index":1,"size":21,"text":"A continuación se presenta un ejemplo de un resumen ejecutivo elaborado para un negocio de producción de hortalizas y granos básicos."}]},{"head":"Resumen ejecutivo","index":16,"paragraphs":[{"index":1,"size":101,"text":"COSEMPROS es una cooperativa de servicios múltiples integrada por productores de hortalizas Las Segovias. Su sede se localiza en el municipio de Pueblo Nuevo, a una distancia de 65 km de Estelí, cabecera departamental. Cuenta con con buenas vías de acceso a los diferentes mercados. Fue constituida en diciembre de 2009 y está debidamente inscrita con una personería jurídica conformada por 38 socios/as de diferentes comunidades de los municipios de Pueblo Nuevo y Condega en el departamento de Estelí. La cooperativa se dedica a la producción de hortalizas y granos básicos, generalmente vendidos a comerciantes de los diferentes mercados del país."},{"index":2,"size":48,"text":"La cooperativa nació como una propuesta social para beneficiar directamente a sus socios fundadores y sus familias e indirectamente a las familias campesinas que viven en el poblado a través de la generación de empleo. Además buscó fortalecer la capacidad de organización y cooperación de los productores socios."},{"index":3,"size":104,"text":"Con el incremento de la producción de hortalizas y granos básicos se debe pensar en la exportación a otros mercados como los de El Salvador y Honduras y la apertura de nuevos lugares de venta para sus productos como los supermercados existentes en el país. Sin embargo, para que los socios aprovechen estas oportunidades es necesario poner en marcha un plan de negocios que permita establecer las pautas a seguir de acuerdo a los análisis de mercado y rentabilidad, así como lograr que en la organización se consolide y fortalezca la capacidad organizativa, productiva y de comercialización de sus productos, con enfoque de calidad."},{"index":4,"size":101,"text":"En este sentido el grupo de productores organizados se ha propuesto desarrollar y ejecutar un plan de producción que les permite obtener un producto de calidad utilizando tecnologías apropiadas para lograr la sostenibilidad. Esto incluye hacer uso de productos amigables con el medio ambiente, sistema de riego por goteo, fertiriego y una producción escalonada. Para la puesta en marcha del plan de negocio, se ha tomado en cuenta la compra y venta de insumos para la producción y comercialización de maíz en elote, estimando que se requiere un capital de US$90.393,72 los cuales se gestionarán a través de la banca privada."}]},{"head":"Consejos prácticos","index":17,"paragraphs":[{"index":1,"size":5,"text":"Al redactar el resumen ejecutivo:"},{"index":2,"size":16,"text":"• Asegúrese de incluir los datos más importantes de las demás secciones del plan de negocios."}]},{"head":"•","index":18,"paragraphs":[{"index":1,"size":14,"text":"Tenga en mente las características de las personas que van a leer el documento."}]},{"head":"•","index":19,"paragraphs":[{"index":1,"size":21,"text":"Permita que una persona ajena a la elaboración del plan de negocios lo lea antes de dar el documento por revisado."},{"index":2,"size":43,"text":"Es el momento de iniciar su plan de negocios. Para redactar el resumen ejecutivo se necesitará esperar los datos de los demás bloques del plan que está por preparar. Por el momento puede avanzar escribiendo los siguientes datos preliminares de su resumen ejecutivo."}]},{"head":"Descripción de la organización o proyecto","index":20,"paragraphs":[{"index":1,"size":33,"text":"Si se trata de un negocio ya establecido, el objetivo es presentar a la organización y sus antecedentes más importantes; si se trata de un negocio nuevo, es presentar los datos de constitución."},{"index":2,"size":53,"text":"En este bloque del plan de negocios se presenta la identidad de la organización o del proyecto que se realizará. Se describe el nivel de organización y legalización del emprendimiento y se da a conocer quienes son las organizaciones (personas jurídicas) o individuos (personas naturales) que están detrás de la idea de negocio."},{"index":3,"size":14,"text":"Mediante la redacción de este bloque se debe dar respuesta a las siguientes preguntas:"},{"index":4,"size":10,"text":"• ¿Cuál es el nombre de la empresa o proyecto?"},{"index":5,"size":5,"text":"• ¿Cuánto tiempo ha existido?"},{"index":6,"size":8,"text":"• ¿Qué vende y cuál es su mercado?"},{"index":7,"size":5,"text":"• ¿Quiénes son los dueños?"},{"index":8,"size":21,"text":"• ¿Cuál es la figura jurídica o legal bajo la cual opera? ¿Existen planes para cambiar la figura jurídica o legal?"},{"index":9,"size":20,"text":"• ¿En donde está ubicada la organización o el proyecto? ¿Cuenta con una sola instalación o cuenta con varias ?"},{"index":10,"size":9,"text":"• ¿Con qué activos cuenta la organización o proyecto?"},{"index":11,"size":26,"text":"• ¿Qué hace que la organización o proyecto sean competitivos? ¿Qué ofrece la empresa a los clientes que es diferente a lo que ofrece la competencia?"},{"index":12,"size":35,"text":"• Además se debe presentar un resumen de los resultados financieros históricos si se trata de una organización ya existente o un detalle de los gastos de constitución si se trata de un nuevo emprendimiento."},{"index":13,"size":26,"text":"¿De que se trata el plan de negocios? ______________________________________________________________ ¿A qué segmento de mercado atenderá el negocio? ¿A qué tipo de clientes se quiere atender? ______________________________________________________________"}]},{"head":"Compra y venta de insumos","index":21,"paragraphs":[{"index":1,"size":59,"text":"Se ofertarán insumos agrícolas a sus socios/as y clientes utilizando la modalidad de compras en conjunto para obtener precios más favorables que les permita tener un margen de utilidad, considerando que las cooperativas están exceptuadas del pago de impuestos y tiene la facultad de importar productos agrícolas y maquinarias según la Ley 199 de Cooperativas si así lo desean."},{"index":2,"size":83,"text":"Para la ejecución del plan de negocios se iniciará operaciones con un capital inicial de US$90.393,72. Según las proyecciones estimadas, los ingresos netos anuales ascienden a US$41.518,91. Si se toman en cuenta las experiencias del personal y las demandas de estos rubros en cuanto a consumo de los productos a ofertar, se considera que el plan de negocios presenta viabilidad económica, financiera y social para aplicarse en el corto, mediano y largo plazo; por lo tanto, se hace necesaria la ejecución del mismo."}]},{"head":"Consejos prácticos","index":22,"paragraphs":[]},{"head":"Objetivo Consejos prácticos","index":23,"paragraphs":[{"index":1,"size":35,"text":"Al redactar la descripción de la organización o proyecto es importante demostrar que se cuenta con el respaldo de personas responsables y que las gestiones del plan se realizarán en orden y con plena legalidad."}]},{"head":"Consejos prácticos","index":24,"paragraphs":[]},{"head":"Manos a la obra","index":25,"paragraphs":[{"index":1,"size":35,"text":"En la preparación de planes de negocios ya existentes se suele incluir como parte de esta sección una descripción de las fortalezas, oportunidades, debilidades y amenazas que se enfrentan al momento de preparar el documento."},{"index":2,"size":19,"text":"Si los lectores del plan de negocios se pueden beneficiar de este análisis, no se debe dudar en incluirlo."},{"index":3,"size":29,"text":"También se puede incluir en este bloque una reseña histórica de la organización para dar a conocer sobre todo los éxitos obtenidos hasta la fecha y cualquier reconocimiento recibido."},{"index":4,"size":57,"text":"Nota importante: El ejemplo presentado puede ser útil como una pauta para la redacción de esta sección, pero hay que recordar que la descripción de la organización o proyecto debe ser muy propia y única. Debe incluir elementos que aunque no aparezcan en el ejemplo de esta guía, son necesarios para entender mejor el plan de negocios."},{"index":5,"size":26,"text":"Se debe redactar la sección de descripción de su organización o proyecto asegurándose en dar respuesta a las interrogantes que se presentan en la siguiente tabla."}]},{"head":"Ejemplo","index":26,"paragraphs":[]},{"head":"Descripción de la organización o proyecto","index":27,"paragraphs":[{"index":1,"size":63,"text":"La Cooperativa Multisectorial Café de Altura R.L.(COOMCAFE) tiene como objetivo cubrir toda la cadena de producción del café llegando a la industrialización y comercialización de café molido. Los productores formaron la cooperativa desde hace tres años (2007-2009) con el objetivo de superar las limitaciones que los productores han tenido en la zona para accesar a conocimiento, financiamiento, organización, y comercialización de sus productos."},{"index":2,"size":93,"text":"Actualmente la cooperativa está formada por 327 pequeños productores de café con un promedio de 2,54 manzanas de café en producción y con una producción de 12,25 quintales oro por manzana, para una producción total de 10.352,25 quintales oro exportable. Según estudios realizados al café de la cooperativa, de éste resulta un puntaje de muestra general de la cooperativa de 83,20 puntos en catación, con productores que llegan a los 94 puntos-lo que demuestra que es un café de alta calidad y clasifica en los mejores puestos de la tasa de la excelencia."},{"index":3,"size":26,"text":"La cooperativa está liderada por una directiva integrada por un Comité de Vigilancia y un Comité de Educación. Estos comités dan seguimiento a las diferentes actividades."},{"index":4,"size":22,"text":"También se cuenta con el apoyo de Project Concern International (PCI) en Nicaragua y La CUCULMECA para el fortalecimiento de la cooperativa."},{"index":5,"size":83,"text":"COOMCAFE ha llegado a comercializar con la empresa Green Coffee (como café gourmet) 14 contenedores a nivel internacional y 1,5 contenedores a nivel nacional, equivalente a 15.000 quintales pergamino de diferentes variedades. Entre las variedades más comunes se encuentran Catuai, Catimore, Maragojipe, Pacamara y, la más relevante, Caturra. Los principales beneficiados los pequeños y medianos productores asociados a COOMCAFE, ya que la comercialización es directamente entre el comprador y los productores, logrando eliminar a intermediarios que eran los que obtenían las mayores ganancias.."},{"index":6,"size":29,"text":"Se ha podido brindar diferentes servicios para beneficio de los asociados como, por ejemplo, financiamiento con tasas de interés bajo, capacitaciones, asistencia técnicay transferencia de tecnología, entre otros servicios."},{"index":7,"size":106,"text":"La cooperativa está legalmente constituida desde el 18 de octubre de 2006 y su personería jurídica fue aprobada el 8 de noviembre de 2007 con el nombre de Cooperativa Multisectorial Café de Altura R.L. bajo las siglas COOMCAFE R.L. La cooperativa se identifica con el Número de Registro de Contribuyentes (RUC) 081106-9274. Actualmente la integran 77 socios y tiene un registro de 340 socios(as): 259 varones y 81 mujeres. El radio de acción es en las comunidades de San Rafael del Norte, municipio del departamento de Jinotega. Las oficinas están ubicadas (en el casco urbano) de la esquina noroeste del parque municipal, 100 metros al norte."}]},{"head":"Ejemplo Manos a la obra","index":28,"paragraphs":[{"index":1,"size":19,"text":"A continuación se presenta un ejemplo de la descripción de una cooperativa para la industrialización y comercialización de café. "}]},{"head":"Productos y servicios","index":29,"paragraphs":[{"index":1,"size":28,"text":"Definir y describir los productos y/o servicios que la organización ofrecerá a sus clientes, sus formas de producir y los recursos necesarios para satisfacer los requerimientos del mercado."}]},{"head":"Descripción de los productos y/o servicios","index":30,"paragraphs":[{"index":1,"size":24,"text":"En este bloque del plan de negocios se definen los atributos del producto y/o servicio que se diseñan en base a los siguientes datos:"},{"index":2,"size":15,"text":"• Los requerimientos de presentación de los servicios y/o productos (envase, etiqueta, tamaño, entre otros)"},{"index":3,"size":46,"text":"Los requerimientos de producción en el mercado (las necesidades y los deseos de los clientes potenciales) • Los objetivos del negocio de la organización (costos de producción y volúmenes de venta esperados) • Los requerimientos de logística (necesidades de proveedores de servicios directos o de apoyo)"},{"index":4,"size":43,"text":"Se deberá especificar en que consiste cada producto o servicio que se incluye en el plan de negocios, describiendo sus características físicas, sus usos, sus beneficios, sus dimensiones, sus materiales, sus colores y cualquier otra característica distintiva que ilustre al lector del plan."}]},{"head":"Descripción del proceso productivo","index":31,"paragraphs":[{"index":1,"size":23,"text":"En esta parte del plan de negocios también se define y describe la forma en la cual se elaborarán los productos y servicios."},{"index":2,"size":66,"text":"Proceso de elaboración del producto o servicio: se debe describir las actividades requeridas para producir el bien o prestar el servicio, organizar las actividades de manera secuencial y en algunos casos establecer los tiempos requeridos para llevar a cabo cada actividad. Es muy útil la utilización de diagramas de flujo del proceso de producción-que no es más que la secuencia de operaciones expresada en forma gráfica."},{"index":3,"size":39,"text":"Tecnología de producción: se debe describir la tecnología que se utiliza o se planifica utilizar para la elaboración de los productos o servicios. Al seleccionar el nivel tecnológico adecuado al proyecto se deben tomar en cuenta los siguientes aspectos:"},{"index":4,"size":29,"text":"• Facilidad de adquisición de la tecnología requerida • Condiciones especiales para hacer uso de la tecnología (patentes, acuerdos) • Aspectos técnicos especiales (capacitación del personal, equipo, instalaciones, etc.)"},{"index":5,"size":12,"text":"Posibilidades de que la tecnología sea copiada y como protegerse de imitadores."}]},{"head":"•","index":32,"paragraphs":[{"index":1,"size":8,"text":"Velocidad en que se dan las innovaciones tecnológicas."},{"index":2,"size":44,"text":"Materiales: Se deben determinar y describir los materiales que se requieren para la elaboración de los productos y/o servicios. Se deben seleccionar en base a la forma en que sus especificaciones son adecuadas para las expectativas de calidad de la empresa y del consumidor."},{"index":3,"size":32,"text":"Capacidad de producción: Se espera que la empresa tenga suficiente producción para satisfacer la demanda proyectada de su mercado. Para determinar la capacidad óptima, se pueden tomar en cuenta los siguientes aspectos:"},{"index":4,"size":100,"text":"• La capacidad en unidades de cada una de las máquinas (aun tomando en cuenta algunas contingencias) • Identificar los cuellos de botella del proceso, es decir, aquellas actividades que producen menos unidades del producto en una misma medida de tiempo • Determinar la capacidad real de producción (por ejemplo, 1.000 unidades por hora) • Comparar con la demanda y revisar si la satisface Instalaciones: Al entender el proceso productivo, la maquinaria necesaria y los materiales a almacenar, se debe estimar el tamaño y el diseño de las instalaciones. Se debe decidir si las instalaciones se rentarán o se construirán."}]},{"head":"Inversiones en instalaciones y equipo","index":33,"paragraphs":[{"index":1,"size":69,"text":"Una vez determinado el equipo y las instalaciones requeridas, es necesario cotizar los precios que se pueden obtener en el mercado, sin olvidar los costos adicionales de transporte e importación en el caso de que deban ser traídos del exterior. Para efectos de los cálculos financieros posteriores, es importante también proyectar la depreciación anual por el período del plan de negocios y el valor de rescate a esa fecha."}]},{"head":"Objetivo Costos de producción","index":34,"paragraphs":[{"index":1,"size":46,"text":"También es importante en esta sección calcular los costos de producción que deben incluir tanto los gastos directos, como materia prima y mano de obra, como los gastos indirectos, como materiales, insumos, electricidad y otros costos que se pueden distribuir y calcular entre la producción total."}]},{"head":"Ejemplo","index":35,"paragraphs":[{"index":1,"size":20,"text":"Descripción de productos y servicios de la Cooperativa de Servicios Múltiples Ocho de Julio de la comunidad de Payacuca, Nicaragua."}]},{"head":"Ejemplo","index":36,"paragraphs":[]},{"head":"Productos y servicios","index":37,"paragraphs":[{"index":1,"size":124,"text":"A. Servicio de financiamiento: mantenimiento de café Es un servicio categorizado como disponible porque actualmente la cooperativa compra servicio de financiamiento a la central de cooperativas con intereses blandos. Tiene capacidad administrativa ya que los encargados (Consejo de Administración y Comité de Crédito) tienen experiencia y cuentan con apoyo de la Central de Cooperativas de Servicios Múltiples \"Aroma del \"Cafe\" (CECOSEMAC) a través de un gerente técnico para la asesoría. Es un servicio necesario porque es un crédito que demandan año con año los socios y. los requisitos son accesibles para todos ellos. La cooperativa se ha caracterizado por tener socios con un buen record crediticio según registros de CECOSEMAC, que era la que anteriormente se encargaba de entregar el crédito a cada socio."},{"index":2,"size":69,"text":"Según un análisis de costos e ingresos la cooperativa tiene una alta expectativa ya que los socios están pagando los costos de este servicio, solo el subsidio que reciben de CECOSEMAC es el pago de salario del técnico y el mantenimiento de la moto.Sin embargo un análisis de costos refleja que con el costo que pagan los socios este servicio será sostenible cuando CECOSEMAC deje de pagar al gerente."},{"index":3,"size":61,"text":"Se priorizó este servicio porque, según la evaluación de la oferta actual, es un servicio estrella, altamente demandado por los socios, menos riesgoso en cobros y por lo tanto a la cooperativa se le facilita la recuperación del crédito; la mayoría lo recuperará en especie al momento de la cosecha y esta será vendida al mercado que CECOSEMAC ya tiene establecido."},{"index":4,"size":40,"text":"Este crédito será entregado a los socios productores de café, que prenden su cosecha.Se entregará en el mes de abril un 50% del valor solicitado, el restante 50% se entregará al momento de la cosecha en el mes de octubre."}]},{"head":"B. Servicio de financiamiento: Renovación de café","index":38,"paragraphs":[{"index":1,"size":93,"text":"Es un servicio especializado porque se demanda específicamente para renovar plantaciones de café. Es un servicio de apoyo porque es de interés común y es esencial para mejorar la productividad y calidad; es una forma de incentivar a los socios productores de café. Es un crédito a largo plazo por lo que anualmente estará generando ingresos a través de los intereses que abonen los socios. Además, es un rubro de baja demanda-no todos los años los socios renuevan sus cafetales. El movimiento de este servicio es más lento que otros tipos de financiamientos."},{"index":2,"size":45,"text":"C. Servicio de financiamiento a la producción de frijol y hortalizas El crédito para la producción de frijol y hortalizas es un servicio demandado por los socios debido a que en la zona se producen frijoles y hortalizas en cantidades considerables por las condiciones climatológicas."},{"index":3,"size":148,"text":"El servicio de financiamiento a la producción de frijol y hortalizas se hará en las dos épocas de cosechas, primera y postrera, por lo que este servicio proporcionará ingresos dos veces al año. Es considerado como un servicio de prioridad por la generación de ingresos y la alta demanda de los socios; por eso es tipificado como un servicio genérico. Se ofrece a un gran número de productores de diversos rubros y es un servicio con disponibilidad en baja escala, ya que la capacidad económica de la empresa es muy baja. Actualmente solo se cuenta con un monto menor a los 100.000 córdobas, con los cuales se ha beneficiado a un grupo pequeño de productores socios con montos menores a 20.000 córdobas, lo cual es pertinente por la demanda real de los socios aunque no todos tienen acceso al crédito por destinar un monto pequeño para este servicio."},{"index":4,"size":46,"text":"D. Servicio de abastecimiento de insumos, herramientas y equipo agrícola Este servicio es de gran necesidad para los socios ya que para abastecerse tienen que comprar en Matagalpa y pagar transporte de los insumos y de la persona que se encarga de la adquisición del producto."},{"index":5,"size":83,"text":"El servicio tendrá precios accesibles para los socios y el puesto será ubicado estratégicamente donde todos puedan comprar y trasladar las compras a sus fincas-les va a permitir a los socios disminuir los costos de producción. Se pretende que sea un servicio oportuno porque se ofertará realmente en el momento en que el cliente lo necesita. Para la cooperativa representa una oportunidad para diversificar sus servicios y le permitirá ingresos para la sostenibilidad ya que este servicio será pagado totalmente por los socios."},{"index":6,"size":22,"text":"E. Servicio de acopio de café orgánico y convencional La cooperativa se encargará del acopio de café orgánico y convencional, principalmente el"},{"index":7,"size":24,"text":"A continuación se presenta una tabla de inversión en instalaciones y equipo con su proyección de depreciación y valor de rescate a 10 años. "}]},{"head":"Consejos prácticos","index":39,"paragraphs":[{"index":1,"size":42,"text":"El bloque de productos y servicios es uno de los más técnicos de un plan de negocios. Al planificar es necesario el acompañamiento de una o varias personas que conozcan la industria del proyecto y puedan compartir la experiencia con la organización."}]},{"head":"Manos a la obra","index":40,"paragraphs":[{"index":1,"size":27,"text":"En esta sección del plan de negocios se debe definir y especificar las operaciones así como el equipamiento necesario para generar y entregar el producto o servicio."},{"index":2,"size":29,"text":"Algunos de los recursos que se deben considerar para la implementación del proyecto son las instalaciones, la maquinaria y el equipo, la instrumentación, los insumos, el capital humano, etc."},{"index":3,"size":33,"text":"Para un proyecto de empresa o de producto que requiera instalaciones productivas, el plan de negocios deberá describir el modo en que éstas se obtendrán y cómo será reclutado el personal de producción."},{"index":4,"size":20,"text":"Un flujo o diagrama de proceso puede ayudar al lector del plan a comprender la forma en que se operará."},{"index":5,"size":27,"text":"Esta sección debe armarse dando respuesta a cuatro principales temas. Las respuestas a las siguientes preguntas podrán apoyar la construcción de este bloque de productos y servicios."}]},{"head":"Para redactar Ubicaciónponer arriba","index":41,"paragraphs":[{"index":1,"size":6,"text":"• ¿Dónde estará ubicado su negocio?"},{"index":2,"size":9,"text":"• ¿Cuáles son los requerimientos de espacio y equipo?"},{"index":3,"size":49,"text":"• ¿Qué tipo de espacio es (oficina, industria o una combinación de ambas)? • ¿Existe alguna ventaja en su localización (acceso fácil, bajo costo, cerca de) • ¿Hay tiendas que atraigan a los mismos clientes, mano de obra accesible, etc.? • ¿Cuenta con un bosquejo (layout) de las instalaciones?"},{"index":4,"size":10,"text":"• ¿Tiene considerado el espacio para futuras ampliaciones y mejoras?"}]},{"head":"Equipamiento","index":42,"paragraphs":[{"index":1,"size":5,"text":"• ¿Qué equipamiento se necesitará?"},{"index":2,"size":3,"text":"• ¿Cuánto cuesta?"},{"index":3,"size":26,"text":"• ¿Se requerirá alguna inversión en un local/planta o maquinaria especial? • ¿Se comprará el equipo o se alquilará? • ¿Quiénes serán los proveedores del equipo?"}]},{"head":"Personal","index":43,"paragraphs":[{"index":1,"size":18,"text":"• ¿Cuántos empleados se necesitará y cuántos turnos manejarán? • ¿Qué perfiles y habilidades necesitará de los trabajadores?"},{"index":2,"size":41,"text":"• ¿Qué salarios se pagarán en los distintos niveles (agregar un porcentaje para pagar los impuestos de nómina, de desempleo, seguro de compensación a los trabajadores, y demás deducciones)? • ¿Qué criterios y políticas se usarán para la contratación de personal?"},{"index":3,"size":98,"text":"café prendado en los créditos. Además, ayudará a recuperar los créditos de mantenimiento y renovación de café. Es un servicio operativo subcontratado por CECOSEMAC para mejorar los servicios de comercialización del café, abastecer de forma ordenada el mercado ya existente a través de las certificaciones FLO-Cert y Bio Latina. Por este servicio la cooperativa percibirá un incentivo por cada quintal acopiado. Para brindar un buen servicio se contratará a una persona responsable del acopio y de realizar la entrega de manera fluida del producto a CECOSEMAC-esto será pagado con el incentivo que CECOSEMAC le pague a la cooperativa."},{"index":4,"size":18,"text":"Los principales proveedores son los 36, que le provee fondos a la cooperativa para financiar a los socios."},{"index":5,"size":41,"text":"Otro servicio que se pretende ofertar en el futuro es el acopio y la comercialización de café con clientes que no son socios con costos diferenciados, ya que estos no podrán tener oportunidad de la distribución de excedente de la cooperativa."}]},{"head":"Consejos prácticos","index":44,"paragraphs":[]},{"head":"Manos a la obra","index":45,"paragraphs":[]},{"head":"Procesos de manufactura y servicios","index":46,"paragraphs":[{"index":1,"size":57,"text":"• ¿Se cuenta con el flujo del proceso en donde se explique el proceso de fabricación o atención? • ¿Cuáles son los tiempos de producción? • ¿Cómo se medirá, controlará y mejorará la calidad? • ¿Cuál es el horario de operación? • ¿Dónde se obtendrá y almacenará las materias primas? • ¿Cómo serán los procesos de compra?"},{"index":2,"size":7,"text":"• ¿Dónde se almacenarán los productos terminados?"},{"index":3,"size":8,"text":"• ¿Cómo se manejará el control de inventarios?"},{"index":4,"size":23,"text":"• ¿Cómo se distribuirán los productos terminados o los servicios? • ¿Se necesitará contratar alguna póliza de seguro para su negocio o planta?"},{"index":5,"size":16,"text":"Dibujar la distribución en la planta de proceso o como estará distribuida el área de servicios"},{"index":6,"size":18,"text":"En este espacio se puede dibujar el flujo de proceso de producción o el diseño de su planta"}]},{"head":"Análisis del mercado","index":47,"paragraphs":[{"index":1,"size":30,"text":"Entender quienes son las personas/empresas que potencialmente harán uso de los productos y servicios de la organización, cuáles son sus preferencias, cómo compran y qué medios de comunicación les alcanzan?."},{"index":2,"size":24,"text":"El elemento esencial de todo negocio son sus clientes y por lo tanto el plan de negocios debe prestar especial atención a los mismos."},{"index":3,"size":56,"text":"El realizar un análisis riguroso del mercado y la competencia ayuda en buena medida a predecir importantes variables como la cantidad probable de clientes que comprarán y que ventajas se le ofrecerán al cliente en relación a la competencia, entre otras. Se propone en esta guía una investigación de mercado simple, práctica y de sentido común."}]},{"head":"Investigación de mercado","index":48,"paragraphs":[{"index":1,"size":35,"text":"La investigación de mercado es el instrumento que posibilita a la empresa conocer el mercado donde va a ofrecer sus productos y servicios, acercarse al mismo para comprenderlo y luego desarrollar su estrategia para satisfacerlo."},{"index":2,"size":37,"text":"Es necesario definir quienes van a ser los posibles clientes, tratando de averiguar con el mayor detalle posible sobre sus ingresos, sexo, edad, educación y hábitos de consumo. Se debe encontrar respuesta a las preguntas que siguen."},{"index":3,"size":44,"text":"¿Qué medios de comunicación escuchan? ¿Qué niveles de gasto tienen? ¿En que zona realizan sus compras? ¿Cómo perciben los atributos de los productos o servicios que se les ofrecen? ¿Cuáles son los puntos fuertes y débiles de los productos o servicios que actualmente compran?"},{"index":4,"size":13,"text":"Las respuestas a estas preguntas apoyarán a la empresa para definir lo siguiente:"},{"index":5,"size":78,"text":"• Los medios y el tipo de publicidad que se debe realizar • La política de precios que se debe tener • La ubicación más conveniente de los centros de producción y venta • Los atributos de los productos o servicios que se deben destacar Una de las grandes incógnitas que se busca dilucidar por medio de la investigación de mercado es si hay datos que indican que habrá suficientes clientes como para que el negocio genere ganancias."},{"index":6,"size":26,"text":"Los costos de producción están generalmente formados por el costo de la materia prima, la aplicación de mano de obra y los gastos indirectos de fabricación."}]},{"head":"Recordemos","index":49,"paragraphs":[]},{"head":"Objetivo","index":50,"paragraphs":[{"index":1,"size":51,"text":"La investigación de mercado por si sola no podrá dar respuesta segura a ésta interrogante porque los factores que hacen viable a un negocio son múltiples, pero los resultados de la investigación pueden orientar las líneas generales del emprendimiento y ver si vale la pena seguir o no con el mismo."},{"index":2,"size":58,"text":"La investigación permite saber en qué mercado va a actuar la empresa, qué parte de ese mercado tiene posibilidades de atender, quiénes son los competidores, quiénes y en qué cantidades van a comprar el producto, a qué precio y si existe probabilidad de crecimiento de la demanda, o por el contrario es un sector que tiende a decrecer."}]},{"head":"Lineamientos prácticos para una investigación de mercado","index":51,"paragraphs":[{"index":1,"size":4,"text":"Análisis de los clientes "}]},{"head":"Consejos prácticos","index":52,"paragraphs":[{"index":1,"size":40,"text":"El contar con empresas especializadas en investigaciones de mercado es útil, pero nunca sustituye el \"olfato\" del mercado de la o las personas que están comprometidas con el emprendimiento. Los clientes son la clave de su negocio: no los descuide."}]},{"head":"Ejemplo","index":53,"paragraphs":[{"index":1,"size":34,"text":"A continuación se presenta un ejemplo del análisis de mercado del plan de negocios de la Unión Nacional de Agricultores y Ganaderos (UNAG) en la región de Madriz, Nicaragua, para la comercialización del frijol."}]},{"head":"Manos a la obra","index":54,"paragraphs":[{"index":1,"size":56,"text":"Llegó el momento de que se ponga por escrito alguna información sobre el mercado y datos importantes sobre la competencia. Es posible que mucha de esta información sea el resultado de una investigación de mercado, pero se recomienda avanzar exponiendo lo que ya se conoce. A continuación se comparten preguntas guías que le servirán de apoyo. "}]},{"head":"Análisis de mercado","index":55,"paragraphs":[{"index":1,"size":68,"text":"A. Industria y competencia Los más cercanos competidores son los comerciantes intermediarios que no representan mercado formal. Estos competidores tienen un alto nivel de experiencia en acopio y comercialización; además, son agentes que dependen de recursos económicos de comerciantes extranjeros (salvadoreños, costarricenses). También cuentan con medios de transportes para llegar hasta la parcela de los productores y los proveen de abarrotes de primera necesidad en momentos de crisis."},{"index":2,"size":28,"text":"Lo que se puede observar en cuanto a las debilidades de los competidores es la parte organizativa-solo actúan conforme a la coyuntura del momento que se les presenta."},{"index":3,"size":28,"text":"La UNAG está establecida de manera permanente, no surge de una coyuntura ni de manera temporal y está en permanente comunicación con sus socios y con el mercado. "}]},{"head":"B.Segmentación del mercado","index":56,"paragraphs":[]},{"head":"Estrategia e implementación","index":57,"paragraphs":[{"index":1,"size":21,"text":"Definir la propuesta de valor de la organización y la estrategia de mercadeo y ventas que surge del análisis del mercado."}]},{"head":"Estrategias, tácticas y programas","index":58,"paragraphs":[{"index":1,"size":71,"text":"Es importante definir dos a tres estrategias, sus tácticas de implementación y los programas que se requerirán para llevarlas a cabo. Por ejemplo: la estrategia puede ser desarrollar relaciones de largo plazo con los clientes, la táctica puede ser capacitar al personal para establecer una sólida conexión con quienes se acerquen a la empresa y el programa puede ser ofrecer una hoja de evaluación a cada cliente que visite la empresa."}]},{"head":"Propuesta de valor","index":59,"paragraphs":[{"index":1,"size":65,"text":"Es la promesa que se puede hacer a los clientes en relación al producto o servicio ofrecido. Por ejemplo: \"Ofrecemos el café más aromático y achocolatado del país.\" Una vez que se ha presentado una promesa, toda la organización debe trabajar para cumplirla. La publicidad puede girar alrededor de esa promesa y la empresa se puede distinguir de la competencia en base a esa promesa."}]},{"head":"Estrategia y plan de mercado","index":60,"paragraphs":[{"index":1,"size":41,"text":"El plan de mercado se define a la luz de los resultados de la investigación del mismo. Este puede ser redactado siguiendo el marco teórico conocido como las cuatro \"P\" (producto, precio, plaza y promoción) las cuales se detallan a continuación"}]},{"head":"Producto","index":61,"paragraphs":[{"index":1,"size":19,"text":"El producto tiene tres aspectos básicos que es necesario tener en cuenta desde el punto de vista del mercado:"},{"index":2,"size":6,"text":"• Características del producto: ¿Qué es?"},{"index":3,"size":13,"text":"• Funciones del producto: ¿Qué hace? • Beneficios del producto: ¿Qué necesidades satisface?"},{"index":4,"size":19,"text":"La pregunta clave es ¿por qué el cliente elegirá nuestro producto entre tantos otros productos similares en el mercado?"}]},{"head":"Precio","index":62,"paragraphs":[{"index":1,"size":46,"text":"Los precios son una variable estratégica del mercadeo. Es necesario considerar varios factores antes de establecerlos Costos: Los precios deben cubrir los costos y permitir un margen de utilidad aceptable. Esto es aplicable tanto a empresas industriales, de servicios o que comercializan productos fabricados por terceros."},{"index":2,"size":31,"text":"Precios de los competidores: El precio en relación a la competencia puede ser más alto o más bajo aún cuando se venda el mismo producto debido a una serie de factores."},{"index":3,"size":46,"text":"Percepción de los clientes: Existen productos que a mayor precio generan mayores ventas debido a que los clientes piensan que la calidad y los precios van de la mano. Por ello es fundamental estudiar el nicho de mercado al que se dirige el producto o servicio."},{"index":4,"size":18,"text":"Es importante determinar lo que se desea alcanzar con la estructura de precios. Algunos objetivos de precios incluyen:"},{"index":5,"size":7,"text":"• Alcanzar un monto determinado de ventas "}]},{"head":"Plaza (distribución)","index":63,"paragraphs":[{"index":1,"size":51,"text":"El propósito fundamental de ésta variable del mercadeo es poner el producto o servicio lo más cerca posible del cliente para que éste pueda comprarlo con rapidez y simplicidad. Tiene que ver con el lugar donde se va a ofrecer el producto (ubicación) y la forma de llegar al cliente (distribución)."},{"index":2,"size":29,"text":"Ubicación: la ubicación para muchos emprendimientos representa un factor crítico para realizar la comercialización de los productos. Los criterios fundamentales para analizar las alternativas de ubicación son los siguientes:"}]},{"head":"Objetivo","index":64,"paragraphs":[{"index":1,"size":21,"text":"• Hay que evaluar cuales son los costos de cada ubicación posible y los beneficios que ofrece cada una de ellas."}]},{"head":"•","index":65,"paragraphs":[{"index":1,"size":33,"text":"No se debe forzar el armado de un negocio por el sólo hecho de contar con un local propio o de bajo alquiler, si no es el lugar adecuado para realizar el emprendimiento."}]},{"head":"•","index":66,"paragraphs":[{"index":1,"size":19,"text":"Se debe analizar si se va a visitar a los clientes o los clientes van a venir a comprar."}]},{"head":"•","index":67,"paragraphs":[{"index":1,"size":78,"text":"¿Cuál es la imagen que debe tener el lugar y el establecimiento? ¿Es importante estar cerca de los proveedores? ¿Hay espacio suficiente para depositar la mercadería? ¿En una etapa futura es posible realizar ampliaciones? ¿Es una zona segura y con potencialidad de crecimiento? ¿El lugar de acceso y el estacionamiento son los apropiados para el negocio? ¿Hay lugar para cargar y descarga mercadería o insumos? ¿El lugar cuenta con los servicios públicos de electricidad, agua, luz, gas, teléfono?"},{"index":2,"size":26,"text":"Los canales de distribución: Los objetivos que deben cumplir los canales de distribución se relacionan con la cobertura del mercado. Se pueden utilizar los siguientes tipos:"},{"index":3,"size":62,"text":"• Directos: son aquellos que vinculan a la empresa con el mercado sin intermediarios y poseen un solo nivel. Pueden desarrollar su actividad a través de locales propios de venta al público, por medio de corredores, agentes de ventas o el servicio de correo. Un ejemplo del uso de canal directo es el esquema de distribución de los productos de cosméticos AVON."},{"index":4,"size":41,"text":"• Indirectos: pueden ser cortos o largos, según cuenten con uno o más niveles entre la empresa y el consumidor. Cortos a través de venta minorista o canales largos cuando la venta se realiza a través de mayoristas, distribuidores y representantes."}]},{"head":"Promoción (comunicación)","index":68,"paragraphs":[{"index":1,"size":58,"text":"La promoción comprende el conjunto de actividades que se desarrollan con el propósito de informar y persuadir a las personas que conforman los mercados meta para adquirir los productos y/o servicios. Es necesario establecer un vínculo con el consumidor para hacer conocer lo que se ofrece, motivar la adquisición del producto e incentivar la reiteración de la compra."},{"index":2,"size":9,"text":"Para ello es necesario dar respuesta a lo siguiente:"},{"index":3,"size":72,"text":"• ¿Cómo se informa a la gente sobre la existencia del negocio? • ¿Dónde se enteran los potenciales clientes sobre los productos o servicios que desean comprar? • ¿Leen los diarios, miran la televisión, escuchan la radio, se enteran por comentarios de amigos o familiares, o se fijan por las ventajas de los locales de venta? ¿Cuánto se puede invertir en promoción y publicidad? ¿Las ventas que puede conseguir, justifican la inversión?"},{"index":4,"size":8,"text":"La comunicación está integrada por las siguientes estrategias:"},{"index":5,"size":45,"text":"• Publicidad: El objetivo de la publicidad es brindar una información a los consumidores con el fin de estimular o crear demanda para un producto o servicio. Entre los medios publicitarios más utilizados se encuentran diarios, revistas, radio, televisión, cine y rotulación en vías públicas."}]},{"head":"•","index":69,"paragraphs":[{"index":1,"size":29,"text":"Promoción de ventas: La promoción de ventas tiene como finalidad tomar contacto en forma personal con el mercado objetivo para comunicar sobre el producto o servicio de la empresa."}]},{"head":"•","index":70,"paragraphs":[{"index":1,"size":45,"text":"Relaciones públicas: Las relaciones públicas se desarrollan prácticamente en todas las organizaciones, con mayor o menor intensidad. Son parte del sistema de comunicación y se realizan en forma consciente o inconsciente en todos los contactos que la organización tiene con las personas, clientes o proveedores."},{"index":2,"size":32,"text":"El gran desafío es obtener los mejores resultados de comunicación con los menores costos posibles y para ello es necesario detectar qué estrategias son las más adecuadas para llegar a los consumidores."}]},{"head":"Proyección de ventas","index":71,"paragraphs":[{"index":1,"size":60,"text":"Acérquese a la proyección de las ventas con la convicción de que se trata de un \"cálculo educado\"-es decir, una buena adivinanza. Lo que se necesita es un buen sentido y conocimiento del negocio mismo. La mejor forma de proyectar las ventas es recorrer mentalmente el ciclo de ventas, ya sea mensualmente o por temporada (en relación a la producción)."},{"index":2,"size":23,"text":"Las ventas se proyectan por producto o por línea de productos, de la forma en que los datos se logren estimar más cómodamente."},{"index":3,"size":69,"text":"Típicamente al proyectar las ventas, se pueden también proyectar los costos directos relacionados con esas ventas (esto depende de la naturaleza del negocio y sus productos). Muchas veces ayuda el proyectar primero las unidades a vender y el monto en el cual se venderían esas unidades. Muchos detallan las ventas para cada mes del primer año proyectado y solo las ventas totales por año para los subsiguientes periodos proyectados."},{"index":4,"size":31,"text":"La proyección de las ventas puede ser graficada para facilitar al lector final del plan de negocios una imagen de los ciclos de ventas o de crecimiento con un solo vistazo."}]},{"head":"Estrategia de ventas","index":72,"paragraphs":[{"index":1,"size":60,"text":"¿Cómo venderá sus productos o servicios? ¿A través de vendedores al detalle? ¿Directamente? ¿Contará con fuerza de ventas? ¿Cómo va a capacitar a la fuerza de ventas? ¿Como va a compensar a la fuerza de ventas? ¿Qué costos están relacionados con la obtención de prospectos, el cierre de las ventas y el mantenimiento de una base de datos o archivo?"}]},{"head":"Planes de acción","index":73,"paragraphs":[{"index":1,"size":23,"text":"En algunos casos el detallar con especificidad algunas tareas que tienen que ser hechas en materia de ventas y mercadeo puede ser útil."}]},{"head":"Consejos prácticos","index":74,"paragraphs":[{"index":1,"size":42,"text":"Al redactar las estrategias en el plan de negocios se puede ilusionarse. Véase ya vendiendo el producto/servicio, asignando precios rentables, atendiendo a sus clientes y convenciéndolos de comprarle. Debe calcular cuánto va a vender y describir la forma en que lo logrará."},{"index":2,"size":43,"text":"A continuación se presentan los cuadros de ventas proyectadas a cinco años para una empresa de producción de dulces de leche Debe dar respuesta a las siguientes preguntas para construir su estrategia de mercado, servirles a los clientes y enfrentar a la competencia."},{"index":3,"size":57,"text":"Redactar detalladamente las actividades iniciales que piensa realizar previas al inicio del negocio, así como los costos en los que incurrirá en gastos de instalación, asesoría legal, etc. En este acápite debe ser preciso en detallar las actividades de preinversión necesarias para el inicio del negocio (puede hacer referencia a un plan de trabajo en un anexo):"}]},{"head":"_________________________________________________________ _________________________________________________________ _________________________________________________________","index":75,"paragraphs":[{"index":1,"size":39,"text":"Redactar la estrategia de precios: ¿Cómo establecerá los precios de los productos o servicios? ¿Cómo son en relación con los de los competidores? Por ejemplo, ¿seguirá una política de precios bajos, descuentos por cantidad, financiamiento o alguna otra estrategia?"}]},{"head":"_________________________________________________________ _________________________________________________________ _________________________________________________________","index":76,"paragraphs":[{"index":1,"size":32,"text":"Redactar la estrategia de distribución: ¿Cómo distribuirá sus productos y/o servicios a sus mercados? ¿Dónde están ubicados sus clientes y cómo llegará a ellos, tanto para la venta como en la posventa?"}]},{"head":"_________________________________________________________ _________________________________________________________ _________________________________________________________ Consejos prácticos","index":77,"paragraphs":[{"index":1,"size":80,"text":"Redactar la estrategia de promoción: Tener un buen producto o servicio no es una garantía de éxito. Usted tiene que hacer conocer sus productos o servicios e informar cómo y dónde pueden adquirirlos. Debe describir cómo hará para que se conozcan. Debe destacar las actividades que emprenderá con ese objetivo, por ejemplo, inversión en publicidad, demostraciones comerciales, envío por correo , telemercadeo y cualquier otro medio de promoción que utiliza o se utilizará para llegar a los clientes potenciales ."}]},{"head":"_________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________","index":78,"paragraphs":[{"index":1,"size":46,"text":"Una vez redactada la estrategia de promoción es importante valorar que otras actividades complementarias se deberán de realizar durante la ejecución del negocio y se puede agregar otras actividades para realizar a futuro: _________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________ Elaborar y describir el plan de ventas del negocio:"},{"index":2,"size":15,"text":"-Proyectar cuantas unidades de los productos o servicios se esperan vender en los próximos años."},{"index":3,"size":17,"text":"-Proyectar los niveles de venta en moneda al multiplicar la cantidad de sus productos por sus precios."},{"index":4,"size":5,"text":"_________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________ _________________________________________________________"}]},{"head":"Administración de la organización o proyecto","index":79,"paragraphs":[{"index":1,"size":28,"text":"Describir la forma en que los esfuerzos de producción, comercialización y control administrativo se llevarán a cabo y el personal necesario requerido para darle vida a la organización."},{"index":2,"size":42,"text":"Todas las empresas, grandes o pequeñas, necesitan definir alguna forma de ordenamiento interno. Es necesario distribuir las tareas y responsabilidades entre los propietarios y empleados de la empresa. En general las áreas principales de una empresa son producción, ventas, administración y finanzas."},{"index":3,"size":59,"text":"En el micro o el pequeño emprendimiento es común que el propietario esté a cargo de todas las áreas desempeñando todas las funciones. Se encarga de producir, vender, cobrar, realizar la administración y manejar las finanzas. Uno de los mayores retos de los microemprendedores es la implementación de un sistema de administración que le permita crecer, delegar y controlar."},{"index":4,"size":36,"text":"Cuando se va a incorporar personal es necesario realizar una selección adecuada para permitir el cumplimiento de los objetivos de la empresa. Es necesario contar con personal idóneo-de lo contrario se traduce en un perjuicio económico."},{"index":5,"size":44,"text":"Cuando se redacta el plan de negocios es necesario prestar mucha atención al área de personal, porque el éxito de un emprendimiento depende en gran medida de la gente que participa en la organización. Para ello se debe tomar en cuenta los siguientes aspectos:"},{"index":6,"size":34,"text":"• La descripción de los puestos de trabajo Los aspectos de organización incluyen la distribución y definición de tareas y responsabilidades, planificación del personal, dirección y cultura (valores, visión y misión) de la empresa."},{"index":7,"size":31,"text":"Una vez establecido esto se deberán definir los procesos operativos de la empresa: ¿Qué se hace? ¿Con qué se hace? ¿En cuánto tiempo se hace? ¿Cómo se hace? ¿Dónde se hace?"},{"index":8,"size":26,"text":"Cualquier actividad empresarial necesitará considerar aspectos de tipo organizativo. La organización debe ser flexible y adaptarse a las nuevas circunstancias. Se deberán establecer las siguientes fases."}]},{"head":"Análisis estratégico y definición de objetivos","index":80,"paragraphs":[{"index":1,"size":46,"text":"Se observarán los aspectos externos e internos que son favorables y desfavorables para el desarrollo del proyecto con el objetivo de hacer un diagnóstico de la situación del mismo. A partir de este diagnóstico, se deben establecer los objetivos a corto y medio plazo como empresa."}]},{"head":"Organización funcional de la empresa","index":81,"paragraphs":[{"index":1,"size":15,"text":"En esta fase, a partir de los objetivos fijados, se deberán complementar los siguientes pasos:"},{"index":2,"size":71,"text":"• Organigrama de la empresa • Definición de funciones • Asignación de funciones y responsabilidades sobre la base de los antecedentes y experiencia profesional • Gestión y dirección (proceso de toma de decisiones) • Perspectivas de la evolución de la plantilla de empleados • Forma prevista de retribución (sueldos, reparto de beneficios, facturación por servicios) • Confección de presupuestos operacionales Se presenta a la derecha el organigrama básico de una empresa."}]},{"head":"Elaboración de descripciones y perfiles de puesto","index":82,"paragraphs":[{"index":1,"size":63,"text":"Una vez que hemos definido nuestra estructura organizacional, se deberá proceder a la elaboración de la descripción del puesto. En este sentido se deberá desarrollar el puesto o plaza propuesta a través de una descripción escrita de las actividades que realizará la persona que ocupe dicho puesto, incluyendo las especificaciones que tiene que ver con la escolaridad deseada, las habilidades y las aptitudes."}]},{"head":"Ejemplo","index":83,"paragraphs":[{"index":1,"size":18,"text":"Departamento de Administración y Finanzas Cargo: administrador-contador Jefe inmediato: Gerente general Fecha de contratación: XXXX Descripción de responsabilidades:"},{"index":2,"size":23,"text":"• Dirigir la contabilidad de costos por procesos: control de calidad, maduración, empaque y comercialización-basado en costos estándares (en unidades, rendimientos y valores)"},{"index":3,"size":22,"text":"• Dirigir el área financiera y contable • Analizar el desempeño financiero de la empresa y establecer acciones para aumentar dicho desempeño"},{"index":4,"size":34,"text":"• Elaborar un sistema de reporte financiero y económico para ejercer el control contable • Asegurar del cumplimiento de las normas de control interno • Asegurar el pago oportuno y exacto a los proveedores."},{"index":5,"size":30,"text":"• Mantener un adecuado manejo de los recursos de la empresa en instrumentos financieros con el fin de asegurar la liquidez de la misma Perfil requerido para ocupar la posición:"},{"index":6,"size":4,"text":"• Licenciado en contaduría "}]},{"head":"Planificación financiera","index":84,"paragraphs":[{"index":1,"size":23,"text":"Resumir la información ya establecida en los bloques anteriores y asignarle valores que permitan determinar la viabilidad financiera de la organización o proyecto."},{"index":2,"size":37,"text":"Por medio del análisis financiero se conoce la inversión o financiamiento necesario para el negocio, se determinan los ingresos esperados, las expectativas de retorno de la inversión y el tiempo requerido para alcanzar el punto de equilibrio."},{"index":3,"size":53,"text":"Esta es la sección del plan que obtendrá la máxima atención de los inversionistas, donantes o acreedores. Todas las ideas, conceptos y estrategias expuestos confluyen en un estado financiero y sus proyecciones. Nada interesa más a un inversionista como el saber qué se hará con el dinero y cuando verá ganancias del negocio."},{"index":4,"size":67,"text":"El análisis financiero y las proyecciones deben seguir las normas de contabilidad generalmente aceptadas, ya que los inversionistas están familiarizados con dichas normas y esperan verlas reflejadas en el análisis financiero de su plan de negocios. Esta es la sección en la cual se presenta el caso tanto en palabras como en números, también se debe demostrar que se han evaluado los riesgos relacionados con el negocio."},{"index":5,"size":20,"text":"El bloque financiero de un plan de negocios que va a ser revisado por inversionistas debe incluir la siguiente información:"},{"index":6,"size":12,"text":"• Detalle y descripción de los riesgos y los planes para enfrentarlos."},{"index":7,"size":6,"text":"• Estados de flujo de efectivo"},{"index":8,"size":4,"text":"• Hojas de balance"},{"index":9,"size":6,"text":"• Estado de pérdidas y ganancias"},{"index":10,"size":49,"text":"• Solicitud y retorno de la inversión Aun si su plan será utilizado únicamente como un mapa para el desarrollo de el negocio, deberá crear un estado de flujo de efectivo y un estado de pérdidas y ganancias para obtener números que puedan medir el desarrollo de la organización."}]},{"head":"Riesgos","index":85,"paragraphs":[{"index":1,"size":80,"text":"La habilidad que se tenga para identificar los riesgos y exponerlos demuestra la destreza como administrador e incrementa la credibilidad con inversionistas potenciales. Se les demostrará que ha tomado la iniciativa de confrontar estos puntos y que es capaz de manejarlos. Lo opuesto es también verdadero. Si un inversionista potencial descubre que no se mencionó algún factor negativo, se debilitará paulatinamente la credibilidad de su plan y pondrá en peligro las oportunidades de obtener el financiamiento o cualquier otro apoyo."},{"index":2,"size":18,"text":"La siguiente lista de algunos problemas potenciales; le dará una idea de los riesgos que se pueden presentar."},{"index":3,"size":6,"text":"• La competencia baja los precios."}]},{"head":"•","index":86,"paragraphs":[{"index":1,"size":6,"text":"Un cliente clave cancela el contrato."}]},{"head":"•","index":87,"paragraphs":[{"index":1,"size":8,"text":"Cae el porcentaje de crecimiento de la industria."}]},{"head":"•","index":88,"paragraphs":[{"index":1,"size":9,"text":"Los costos de diseño o fabricación exceden las proyecciones."}]},{"head":"•","index":89,"paragraphs":[{"index":1,"size":7,"text":"Las proyecciones de ventas no son alcanzadas."}]},{"head":"•","index":90,"paragraphs":[{"index":1,"size":8,"text":"Una importante campaña publicitaria pasa por muchos tropiezos."}]},{"head":"•","index":91,"paragraphs":[{"index":1,"size":6,"text":"Importantes subcontratistas fallan en las entregas."}]},{"head":"•","index":92,"paragraphs":[{"index":1,"size":16,"text":"La competencia se adelanta al sacar a la venta un nuevo y mejor producto o servicio."}]},{"head":"•","index":93,"paragraphs":[{"index":1,"size":8,"text":"Cambia la opinión pública del producto o servicio."}]},{"head":"•","index":94,"paragraphs":[{"index":1,"size":8,"text":"No se logra encontrar mano de obra capacitada."},{"index":2,"size":44,"text":"Se debe evaluar honestamente los riesgos y colocarse en una situación de \"¿Qué pasaría si…?\" ¿Qué pasa si la competencia encuentra la propuesta única de ventas y pone al producto a un lado? ¿Qué pasa si no se logra encontrar a los empleados correctos?"},{"index":3,"size":32,"text":"Para generar un listado completo de riesgos, se debe examinar todos los supuestos que ha tomado en cuenta para elaborar el plan de negocios y evalúe que tan seguro es el cumplimiento."}]},{"head":"Estado de flujo de efectivo","index":95,"paragraphs":[{"index":1,"size":69,"text":"El estado de flujo de efectivo es el estado financiero básico que muestra el efectivo generado y utilizado en las actividades de operación, inversión y financiamiento. Un estado de flujo de efectivo es de tipo financiero y muestra entradas, salidas y cambio neto en el efectivo de las diferentes actividades de una empresa durante un periodo contable, en una forma que concilie los saldos de efectivo inicial y final."}]},{"head":"Objetivo","index":96,"paragraphs":[{"index":1,"size":28,"text":"El estado de flujo de efectivo demuestra a los lectores del plan de negocios qué cantidad de dinero necesitará, cuándo lo necesitará y de dónde saldrá el dinero."},{"index":2,"size":35,"text":"En términos generales, el estado de flujo de efectivo analiza el efectivo y las fuentes de ingresos, menos los gastos y requerimientos de capital para dar como resultado una figura neta de flujo de efectivo."}]},{"head":"Consejos prácticos","index":97,"paragraphs":[{"index":1,"size":19,"text":"• Tener preparado el estado de flujo de efectivo o al menos revisado por un contador con buena reputación"},{"index":2,"size":46,"text":"• Evitar un salto no real de las ventas. Muchas de las compañías experimentan un incremento gradual en las ventas, inclusive en base mensual. Un incremento inesperado e inexplicable de las mismas se hará notar y puede ser interpretado como una valoración no honesta del negocio."},{"index":3,"size":39,"text":"• Incluir los efectos de las temporadas o ciclos del negocio en todas las proyecciones. Por ejemplo, si se encuentra en el negocio de los regalos, se necesita mostrar la época navideña de compras o la época de bodas."}]},{"head":"•","index":98,"paragraphs":[{"index":1,"size":30,"text":"No caer en la trampa más común de subestimar las necesidades del flujo de efectivo. Esta situación puede llevar a la subcapitalización-los fondos se probarán inadecuados para cubrir las obligaciones."},{"index":2,"size":15,"text":"• Evitar presentar categorías con valores abultados y sin información de respaldo sobre los componentes."}]},{"head":"Ejemplo","index":99,"paragraphs":[{"index":1,"size":12,"text":"A continuación se muestra un ejemplo del estado de flujo de efectivo "}]},{"head":"Hoja de balance","index":100,"paragraphs":[{"index":1,"size":39,"text":"La hoja de balance es el estado financiero que refleja la situación del patrimonio de una entidad en un momento determinado. El balance se estructura a través de tres conceptos patrimoniales: el activo, el pasivo y el patrimonio neto."},{"index":2,"size":31,"text":"El activo incluye todas aquellas cuentas que reflejan los valores de los cuales dispone la entidad. El pasivo muestra todas las obligaciones ciertas del ente y las contingencias que deben registrarse."}]},{"head":"Consejos prácticos","index":101,"paragraphs":[{"index":1,"size":3,"text":"Ejemplo 50 51"},{"index":2,"size":24,"text":"El patrimonio neto es la diferencia del activo menos el pasivo. Representa los aportes de los propietarios o accionistas más los resultados no distribuidos."},{"index":3,"size":18,"text":"Generalmente, la hoja de balance es creada una vez al año para calcular el valor neto del negocio."},{"index":4,"size":67,"text":"Si el plan de negocios es para empezar un negocio, es necesario incluir una hoja de balance resumiendo los activos y pasivos. Si el negocio ya existe, se debe incluir la hoja de balance del año anterior hasta la hoja de balance del último periodo reportado. Luego se debe analizar los resultados de la hoja de balance brevemente e incluir este análisis en el plan de negocios. "}]},{"head":"Estado de pérdidas y ganancias","index":102,"paragraphs":[{"index":1,"size":78,"text":"Este estado financiero suministra información de las causas que generaron el resultado atribuible al periodo, sea bien éste un resultado de utilidad o pérdida. El estado de pérdidas y ganancias es donde se refleja el potencial del negocio para generar efectivo. En este documento se registran los ingresos, gastos y el costo de mercadería. El resultado de la combinación de estos elementos demuestra que tanto dinero hizo o hará el negocio, o perdió o perderá durante el año."},{"index":2,"size":88,"text":"Un estado de pérdidas y ganancias y un estado de flujo de efectivo se diferencian en que el estado de pérdidas y ganancias no incluye detalles de cuando fueron acumulados los ingresos o cuando fueron pagados los gastos. Un estado de pérdidas y ganancias para un plan de negocios deberá ser calculado por mes durante el primer año, trimestralmente el segundo año y anualmente por cada año siguiente. Se deben analizar los resultados del estado de pérdidas y ganancias e incluir este análisis en el plan de negocios."}]},{"head":"Ejemplo","index":103,"paragraphs":[{"index":1,"size":24,"text":"Nombre de la empresa Estado de pérdidas y ganancias proyectadas Miles de US$ (Año 1 al año 5) Requerimientos de efectivo (solicitud de fondos)"},{"index":2,"size":37,"text":"Se debe mencionar el monto requerido de efectivo y el tipo de inversión que se busca para el negocio (deuda o patrimonio). Es importante proporcionar un detalle de cómo el dinero será aplicado. Debe exponer lo siguiente:"},{"index":3,"size":32,"text":"• ¿Qué efecto tendrá el capital en el potencial del negocio para crecer y obtener utilidades? • ¿Cuándo se necesitará el dinero? • ¿Qué inversión ha sido ya realizada en la empresa?"},{"index":4,"size":12,"text":"Los inversionistas también quieren saber qué recibirán a cambio de su capital."},{"index":5,"size":53,"text":"Por esta razón se debe ser tan claro como sea posible en esta sección acerca de los pros y contras de invertir en el negocio. Un error común en un plan de negocios es no ser claro con las expectativas que los inversionistas o donantes pueden tener al aportar fondos para el emprendimiento."},{"index":6,"size":58,"text":"Si los fundadores de la empresa han realizado inversiones, se debe incluir este detalle de inversiones en el plan de negocios. En este punto se puede incluir un análisis de razones financieras que indique los beneficios del proyecto-se puede mostrar la tasa interna de retorno (TIR), el valor actual neto (VAN) o el punto de equilibrio del proyecto."}]},{"head":"Razones financieras","index":104,"paragraphs":[{"index":1,"size":30,"text":"Son aquellos números que indican la factibilidad financiera del proyecto tomados del flujo de caja y en los cuales se basa gran parte de la decisión de realizar el emprendimiento."},{"index":2,"size":71,"text":"Las razones financieras más importantes son Para analizar la viabilidad o no de un proyecto o negocio, los resultados obtenidos del calculo de las razones financieras se deben comparar con los valores mínimos de retorno que los inversionistas consideren aceptables bajo las condiciones económicas en ese momento y en el país en que la inversión se realizará. A estos valores aceptables se les denomina tasa de descuento o punto de corte."},{"index":3,"size":10,"text":"Tasa de descuento, punto de corte o rentabilidad mínima aceptablen"},{"index":4,"size":25,"text":"La tasa de descuento puede variar según el país, el tipo de negocio y la estructura de capital que tiene la empresa (proporción deuda/capital propio)."},{"index":5,"size":54,"text":"Generalmente la tasa de descuento para la evaluación de un proyecto es un poco mayor al costo de capital en un lugar y en un momento determinado. Es decir que el porcentaje de retorno del capital en el año debe ser mayor al porcentaje que produciría invertir ese mismo monto en el mercado financiero."},{"index":6,"size":82,"text":"Ejemplo: Si por un depósito a plazo fijo el sistema bancario ofrece un 9% anual, el retorno a obtener en una inversión alterna debe ser suficientemente mayor para que sea atractivo, aun tomando en cuenta que el riesgo en un emprendimiento es mucho mayor al de un depósito a plazo fijo. En este caso el inversionista probablemente no estaría dispuesto a invertir por un retorno menor al 15% anual. A mayor riesgo, mayor será la tasa de descuento que solicitará el inversionista."},{"index":7,"size":26,"text":"Otra forma de determinar la tasa de descuento para la evaluación de un proyecto es utilizando como mínimo la tasa de descuento de otro proyecto alternativo."},{"index":8,"size":34,"text":"Ejemplo: Si el inversionista puede escoger entre varios proyectos y el proyecto \"x\" proyecta una tasa de descuento del 18%, cualquier otro proyecto debe ofrecer una tasa mayor a ésta para que sea atractivo."}]},{"head":"Razón costo beneficio (C/B)","index":105,"paragraphs":[{"index":1,"size":26,"text":"Es la sumatoria de los beneficios netos descontados de cada período del proyecto, sobre la sumatoria de los costos de cada período del proyecto también descontados."},{"index":2,"size":18,"text":"El valor de la razón costo beneficio cambiará dependiendo de cuando ocurran las salidas y entradas de dinero."},{"index":3,"size":37,"text":"La formulación convencional de la razón C/B es Donde: VP (B): valor presente de (B) B: beneficios del proyecto propuesto I: inversión inicial en el proyecto propuesto O y M: costos de operación y mantenimiento del proyecto"},{"index":4,"size":34,"text":"El numerador de la razón beneficio/costo (C/B) expresa el valor equivalente de los beneficios menos el valor equivalente de los costos de O y M, el denominador incluye sólo los costos de inversión iniciales."},{"index":5,"size":11,"text":"Para tomar una decisión sobre el resultado de criterio se tiene:"},{"index":6,"size":27,"text":"Si: C/B >0, el proyecto es recomendable Si: C/B <0, el proyecto no se recomienda SI: C/B =0, el proyecto con los ingresos apenas cubre los costos"},{"index":7,"size":45,"text":"Si la relación C/B es menor a uno, el valor presente de los beneficios es menor al valor presente de la inversión y ésta no se recupera. Para que un proyecto sea aceptado el resultado de la razón deberá ser uno o mayor a uno."},{"index":8,"size":51,"text":"Es importante notar que el valor de la razón C/B varía dependiendo del valor de la tasa de descuento escogida. Entre mayor es la tasa, más pequeña será la razón costo beneficio, y si una tasa suficientemente alta es escogida, la razón C/B puede ser llevada a valores menores que uno."}]},{"head":"Valor actual neto (VAN)","index":106,"paragraphs":[{"index":1,"size":22,"text":"Este valor refleja lo que vale todo el proyecto a la fecha. Es el valor presente de los ingresos menos los egresos."},{"index":2,"size":17,"text":"• El VAN toma en cuenta la importancia de los flujos de efectivo en función del tiempo."},{"index":3,"size":24,"text":"• Consiste en encontrar la diferencia entre el valor actualizado de los ingresos y el valor actualizado de las inversiones iniciales y otros egresos."}]},{"head":"•","index":107,"paragraphs":[{"index":1,"size":48,"text":"La tasa que se utiliza para descontar los flujos es el rendimiento mínimo aceptable de la empresa, por debajo del cual los proyectos de inversión no deben efectuarse. Se puede afirmar que si la TIR es mayor que el rendimiento mínimo aceptable, el VAN es mayor que cero."}]},{"head":"Tasa interna de retorno (TIR)","index":108,"paragraphs":[{"index":1,"size":47,"text":"Ésta representa la tasa de rendimiento que el proyecto le genera al inversionista. La TIR se compara con la tasa de descuento de la empresa. Si la TIR es igual o mayor a la tasa de descuento, el proyecto debe aceptarse y si es menor debe rechazarse."},{"index":2,"size":11,"text":"• Utiliza actualización o descuento de los flujos futuros de efectivo"},{"index":3,"size":19,"text":"• Toma en cuenta tanto el monto de los flujos, como el momento en que se producen los flujos."},{"index":4,"size":34,"text":"• La TIR de un proyecto es la tasa de descuento que hace que el valor actual de los flujos de beneficio (positivos) sea igual al valor actual de los flujos de inversión (negativos)"},{"index":5,"size":28,"text":"I= Inversión inicial R1 a Rn = Flujos de efectivo futuros por período r= Tasa interna de rendimiento que verifique la ecuación. Se calcula mediante un procedimiento iterativo."}]}],"figures":[{"text":" = Flujos de efectivo futuros por período k = Rendimiento mínimo aceptable Si el VAN de un proyecto es positivo, la inversión debe realizarse y si es negativo deberá rechazarse. "},{"text":"  "},{"text":"  "},{"text":" Nuestros clientes se pueden dividir en clientes seguros, los afiliados a la UNAG y a la Unión de Cooperativas de Servicios Múltiples del Norte R.L.(UCOSEMUN R.L.) y los clientes no seguros, el mercado nacional en general. Se espera un ritmo de crecimiento del 20% anual en relación al número de clientes seguros y en un 5% anual en clientes no seguros. ¿Cuáles son los precios de los  ¿Cuáles son los precios de los productos o servicios de la ¿Cuál es la clasificación de la zona? competencia? ¿Qué usos tendrá este producto? ¿Cuáles son los hábitos de los clientes? productos o servicios de la ¿Cuál es la clasificación de la zona? competencia?¿Qué usos tendrá este producto? ¿Cuáles son los hábitos de los clientes?  ¿Cómo compran? ¿Qué compran? ¿Cómo compran? ¿Qué compran? ¿Es el mercado estable, cambiante ¿Cómo distribuyen los productos y/o servicios a los mercados la competencia? (mejorando, deteriorando)? ¿Cómo? ¿En qué se diferencia ese producto de la competencia? ¿Qué parte o porcentaje de ese mercado ¿Es el mercado estable, cambiante ¿Cómo distribuyen los productos y/o servicios a los mercados la competencia? (mejorando, deteriorando)? ¿Cómo?¿En qué se diferencia ese producto de la competencia? ¿Qué parte o porcentaje de ese mercado  puede captar el negocio? puede captar el negocio? ¿Cómo es el acceso de los clientes? (Autobuses, etc.) ¿Cuál es la estrategia de promoción de los productos y servicios de la competencia? ¿Por qué los clientes comprarán esos productos o servicios en lugar de hacerlo a otra empresa? Si se ha realizado una adecuada encuesta de mercado, se conocerá la siguiente información sobre los competidores: ¿Cómo es el acceso de los clientes? (Autobuses, etc.) ¿Cuál es la estrategia de promoción de los productos y servicios de la competencia?¿Por qué los clientes comprarán esos productos o servicios en lugar de hacerlo a otra empresa? Si se ha realizado una adecuada encuesta de mercado, se conocerá la siguiente información sobre los competidores: Descripción del product/servicio a. si hay pocos o muchos Descripción del product/servicioa. si hay pocos o muchos ¿Cuál es la característica de su competidores; ¿Cuál es la característica de sucompetidores; producto y/o servicio que lo hace b. si son grandes o pequeños en producto y/o servicio que lo haceb. si son grandes o pequeños en diferente de los competidores? ¿Cómo es el tamaño del producto? ¿Por qué los clientes van a dejar tamaño; c. si las características de los diferente de los competidores? ¿Cómo es el tamaño del producto? ¿Por qué los clientes van a dejartamaño; c. si las características de los de comprar el producto de la productos son o no, similares o no de comprar el producto de laproductos son o no, similares o no competencia para comprar el suyo? entre sí; competencia para comprar el suyo?entre sí;  d. si las características de los d. si las características de los ¿Cuál será el diseño del producto? Análisis de la demanda del mercado ¿Quiénes son los competidores principales, directos e indirectos? productos son o no similares al suyo. ¿Cuál será el diseño del producto? Análisis de la demanda del mercado¿Quiénes son los competidores principales, directos e indirectos? productos son o no similares al suyo. ¿A qué clientes o segmentos de mercado la  ¿A qué clientes o segmentos de mercado la empresa apuntará específicamente? ¿Qué tan sensibles a los precios son los empresa apuntará específicamente?¿Qué tan sensibles a los precios son los producto? ¿Cuáales son las características del potenciales? ¿Cuáles son los competidores consumidores? producto? ¿Cuáales son las características delpotenciales? ¿Cuáles son los competidores consumidores? ¿Cuál es el tamaño del mercado?  ¿Cuál es el tamaño del mercado?  ¿Con qué frecuencia compran los ¿Con qué frecuencia compran los ¿Qué beneficios trae ese producto a los consumidores? ¿Cuáles son los productos sustitutos? consumidores productos similares ? ¿Qué beneficios trae ese producto a los consumidores?¿Cuáles son los productos sustitutos? consumidores productos similares ? ¿Cuál es la participación de la organización  ¿Cuál es la participación de la organización en el mercado actual?  en el mercado actual? C. Estrategias de comercialización ¿Es este un producto nuevo o un producto ya existente? Describirlos de manera breve C. Estrategias de comercialización ¿Es este un producto nuevo o un producto ya existente?Describirlos de manera breve • Segmentar y clasificar a los clientes  • Segmentar y clasificar a los clientes • Identificar los mejores clientes  • Identificar los mejores clientes • Sondear e identificar clientes potenciales y grandes consumidores (universidades,  • Sondear e identificar clientes potenciales y grandes consumidores (universidades, supermercados, hospitales, etc.)  supermercados, hospitales, etc.)  "},{"text":"Proyección de unidades vendidas       Proyección de ventas totales en córdobas nicaragüenses Proyección de ventas totales en córdobas nicaragüenses      Producto 2011 2012 2013 2014 2015 Producto20112012201320142015      Canillitas 144.000 195.000 217.500 270.000 288.000 Canillitas144.000195.000217.500270.000288.000      Bolitas 48.000 61.200 81.000 96.000 96.000 Bolitas48.00061.20081.00096.00096.000      Cajuela 144.000 189.000 240.000 264.000 360.000 Cajuela144.000189.000240.000264.000360.000      TOTALES 336.000 445.200 538.500 630.000 744.000 TOTALES336.000445.200538.500630.000744.000 Producto 2011 2012 2013 2014 2015 Producto20112012201320142015 Canillitas 144.000 156.000 174.000 180.000 192.000 Canillitas144.000156.000174.000180.000192.000 Bolitas 96.000 102.000 108.000 120.000 120.000 Bolitas96.000102.000108.000120.000120.000 Cajuela 48.000 54.000 60.000 66.000 72.000 Cajuela48.00054.00060.00066.00072.000 Proyección de precios unitarios en córdobas nicaragüenses  Proyección de precios unitarios en córdobas nicaragüenses Producto 2011 2012 2013 2014 2015 Producto20112012201320142015 Canillitas 1 1,25 1,25 1,50 1,50 Canillitas11,251,251,501,50 Bolitas 0,50 0,60 0,75 0,80 0,80 Bolitas0,500,600,750,800,80 Cajuela 3 3,50 4 4 5 Cajuela33,50445  "},{"text":"• Experiencia minima de cinco años en puestos similares • Dispuesto a trabajar en horarios extraordinarios • Dispuesto a cumplir con tareas adicionales si se requiere  Junta General Junta General Nivel Estratégico  Nivel Estratégico  Directorio Directorio  Gerente General Gerente General Nivel Táctico  Nivel Táctico Apoyo y soporte Asesoría Técnica Apoyo y soporteAsesoría Técnica Nivel Operativo Unidades de Nivel OperativoUnidades de  Ejecución Ejecución  Ejemplo Ejemplo  "},{"text":"Nombre de la empresa Flujo de efectivo proyectado Miles de US$ (Del año X al año Y)   Año 1 Año 2 Año 3 Año 4 Año 5 Año 1Año 2Año 3Año 4Año 5 Utilidad neta 182.775 177.829 313.911 326.511 (17.228) Utilidad neta182.775177.829313.911326.511(17.228) Depreciaciones 458 458 458 458 458 Depreciaciones458458458458458 Amortizaciones 18.000 18.000 18.000 18.000 18.000 Amortizaciones18.00018.00018.00018.00018.000 Capital de trabajo (275.412) (3.179) (24.727) 22.435  Capital de trabajo(275.412)(3.179)(24.727)22.435 Flujo de operaciones (74.179) 193.108 307.642 367.404 1.230 Flujo de operaciones(74.179)193.108307.642367.4041.230 Emisión de acciones      Emisión de acciones Financiamiento bancos      Financiamiento bancos Pago de dividendos      Pago de dividendos Flujo financiero      Flujo financiero Compra activos fijos      Compra activos fijos Flujo de inversiones (22.000)     Flujo de inversiones(22.000) Aumento de efectivo (96.179) 193.108 307.642 367.404 1.230 Aumento de efectivo(96.179)193.108307.642367.4041.230 Efectivo inicial 240.000 143.821 336.821 644.463 1.011.867 Efectivo inicial240.000143.821336.821644.463 1.011.867 Efectivo final 143.821 336.929 644.463 1.011.867 1.013.097 Efectivo final143.821336.929644.463 1.011.867 1.013.097  "}],"sieverID":"e7417b7b-540d-4a2b-bd3c-baa6dbcd16ce","abstract":""}

data/part_1/03e7b9cd60b02b9764b6be36852f03e1.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03e7b9cd60b02b9764b6be36852f03e1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b5e12561-5ad3-4290-a57d-49734730740c/retrieve"},"pageCount":22,"title":"Redesigning crop varieties to win the race between climate change and food security","keywords":["climate change","food security","crop breeding","cropping systems","expert survey","sub-Saharan Africa"],"chapters":[{"head":"INTRODUCTION","index":1,"paragraphs":[{"index":1,"size":213,"text":"The world's climate is changing, and while some expected effects can be predicted (USGCRP, 2018;IPCC, 2022), future crops will grow in unprecedented environments, facing new challenges and offering new opportunities. Most recent estimates of the effects of climate change on crop yields are negative, e.g., -17% overall by 2050 (Nelson et al., 2014), median of -6% for major staple crops in West Africa (Carr et al., 2022), and median of -10% to -15% for maize in Africa (Zhai et al., 2021). Entomologists and pathologists warn that, although the effects of rising temperatures will vary, pest and pathogen generation times (life cycles) will likely shorten, their ranges will expand, and species with suitable hosts will prevail in less-favorable environments, all of which would have negative or unpredictable effects on crops (Bebber, 2015;Fones et al., 2020;Chaloner et al., 2021;Skend zi c et al., 2021;Harvey et al., 2023). Molds and mycotoxins may also expand their ranges and become more problematic; for example, Aspergillus flavus thrives in high temperatures and aflatoxin (AFB1) production is stimulated by increased temperatures, drought stress, and CO 2 levels (Zingales et al., 2022). Finally, nutritional quality, particularly micronutrient and protein contents are expected to decline under increased CO 2 conditions (Soares et al., 2019), especially for C3 crops (Myers et al., 2014)."},{"index":2,"size":55,"text":"Sustainably achieving food and nutrition security for the growing global population under likely climate change scenarios is one of humanity's greatest challenges. There will be no single solution to this problem. A strategic approach begins with an assessment of the current scenario: our strengths, weaknesses, opportunities, and threats to achieve sustainable nutrition security for all."}]},{"head":"Strengths","index":2,"paragraphs":[{"index":1,"size":146,"text":"Vast collections of largely unexploited crop genetic diversity are easily accessible through national and international germplasm banks (Ramirez-Villegas et al., 2022), often with precise information about their site of origin, which allows accessing environmental and climate data defining their range of adaptation. Genetic resources are the fundamental building blocks or raw materials for all the food we eat, and dozens of examples have demonstrated the value of exotic genetic resources (crop wild relatives or landraces) in conferring pest or disease resistance, abiotic stress tolerance, quality, and other traits in crop improvement (Pimentel et al., 1997;Dempewolf et al., 2014;Kilian et al., 2021;Bohra et al., 2022). Genomic and pangenome data are available for major and minor crops (Sansaloni et al., 2020;Chapman et al., 2022), and molecular and biotechnology tools are widely available for discovery and breeding applications National Academies of Sciences, Engineering, and Medicine, 2016;Pixley et al. (2019)."}]},{"head":"Weaknesses","index":3,"paragraphs":[{"index":1,"size":121,"text":"We cannot predict the effects of climate-changed environments on crop physiology or the complex genotypic and epigenomic characteristics (Kakoulidou et al., 2021) that will succeed in them. The complexity that characterizes crop and disciplinary science encourages specialization at the expense of transdisciplinary approaches that could elucidate innovative solutions to cope with changing climate. While germplasm banks contain large, untapped sources of alleles that can help in mitigating the effects of future climate, many wild crop species, especially in conflict areas, remain under-conserved and unavailable Vincent et al. (2019); Ramirez-Villegas et al. (2022). Finally, declining trends in public sector agricultural research investment (Beintema and Stads, 2017;Heisey and Fuglie, 2018) adversely affect the scientific community and its rate of progress on crop improvement."}]},{"head":"Opportunities","index":4,"paragraphs":[{"index":1,"size":185,"text":"Data science has and continues to advance, enabling the use and integration, including via machine learning and artificial intelligence, of big data from genomics, transcriptomics, phenomics, climate, soils, and other fields (Parmley et al., 2019;Siddiqui et al., 2021). Modern breeding methods, including genomic selection, speed breeding, doubled haploids, and genome editing promise faster development of new varieties that can quickly respond to emerging challenges (Atlin et al., 2017). Perhaps the most promising opportunity, however, is to design crop varieties for innovative cropping systems that maximize climate resilience, minimize climate risk, and benefit from climate-changed environments, e.g., by shifting cropping calendars, rotations, and relays (Swastika et al., 2004;Thanh Ha et al., 2004;Gathala et al., 2020), or exploiting genotype by environment and crop management interactions (Haug et al., 2020;Cooper and Messina, 2021;Zhai et al., 2021;Farooq et al., 2023). There may also be important opportunities to reap large returns on investments in research in low-income countries, where current yield gaps and predicted negative impacts of climate change are largest (especially in the tropics), and investment in agricultural research are currently smallest (Pixley et al., 2019;Yoshida and Iizumi, 2023)."}]},{"head":"Threats","index":5,"paragraphs":[{"index":1,"size":97,"text":"The biggest threat is complacency and ''business as usual.'' We are not on-track toward healthy nutrition security for all (World Resources Institute, 2019), nor for producing our food within safe planetary boundaries (Steffen et al., 2015). Recent crises have highlighted the vulnerability of food systems to external factors and have the potential to re-direct funding away from food and nutritional food security objectives (Mottaleb et al., 2022;Jr. Tabe-Ojong et al., 2023). Given the limited resources for agricultural research, the risk of unwisely prioritizing investments is huge, as is the risk of failing to seize the available opportunities."},{"index":2,"size":103,"text":"The objectives of this paper are to: (1) survey experts from diverse disciplines for six major staple crops of Africa to elucidate (1a) likely agronomic changes in future cropping systems seeking sustainability, intensification, resilience and productivity under climate change, and (1b) associated desirable or essential crop traits, particularly those that are not currently prioritized in crop improvement programs, (2) review the current status and opportunities for improving (2a) future, prioritized traits and (2b) future traits that the authors consider potential ''blind spots'' among the surveyed experts, and (3) discuss novel approaches to harness genetic diversity to develop climate-resilient crops for combating climate change."}]},{"head":"DRIVERS OF CHANGE FOR CROP AGRONOMY AND CROPPING SYSTEMS MANAGEMENT AND LIKELIHOOD OF ADOPTION OF CROP MANAGEMENT INNOVATIONS UNDER FUTURE CLIMATES","index":6,"paragraphs":[{"index":1,"size":165,"text":"The majority of survey respondents across all crops considered 13 drivers of crop and cropping systems change to be of high or very high importance. Climate change-related factors, such as increased likelihood of lesser rainfall, higher temperatures, and increased frequency of erratic or extreme climatic events, were perceived as the strongest drivers for changes in agronomy or cropping systems, followed by increased demand from a growing population, and the (re)emergence of pests and diseases (Table 1, supplemental Tables 2-7, and supplemental Figures 1-4). For the three cereal crops (pearl millet, sorghum, and maize), soil degradation through erosion or loss of fertility was considered an important driver by more than half of the respondents. In addition, for sorghum and maize, increased demand for stover for animal feed and grain for feed and industrial uses were identified as important drivers. For cowpea and beans, the increased demand for nutrient-dense crops was considered of high importance (supplemental Tables 8-43 and supplemental Figures 5-28 include crop specific survey results)."},{"index":2,"size":175,"text":"Regarding the likelihood of adoption of crop management innovations, the majority of respondents across crops considered likely or very likely that farmers will need to innovate around cropping systems diversification and intensification through, for example, optimized crop rotations, intercropping, relay, or double cropping, increased use of mechanization, and early sowing to extend the Numbers may not equal 100 due to the exclusion of \"I don't know\" responses. cropping season and optimize crop rotations (Table 2). For the legume crops (groundnut, cowpea, and bean), increasing planting density was considered highly likely, while the use of hybrids was considered unlikely. An inverse pattern was found for cereals, whereby increased planting density was considered less likely than the increased use of hybrids. Notably for maize, greater use of hybrids was considered the most likely technological change. The adoption of sustainable agriculture techniques that maintain soil cover with crop residues and reduce tillage, adoption of precision agriculture machinery, and increased prioritization of fodder versus grain production were perceived to have a low likelihood of adoption by farmers across crops."}]},{"head":"BREEDING FOR FUTURE CLIMATES","index":7,"paragraphs":[{"index":1,"size":181,"text":"Current product profiles in pearl millet, sorghum, maize, groundnut, cowpea, and bean breeding programs in sub-Saharan Africa (SSA) primarily focus on increasing grain yield under abiotic and biotic stresses (see Table 3 and Concluding remarks). To sustainably reach food and nutritional security under changing climate may require realignments in breeding targets. We surveyed nearly 100 crop scientists for each of these six crops (see supplemental material: methods, figures, and tables) to elicit expert opinions about essential and desirable traits to enhance resilience and productivity of future crop varieties. About 90% of the survey respondents are based and work in Africa, half are plant breeders, 20% are women, and 16% work in CGIAR institutions. The small percent of female respondents, which was less marked for bean than all other crops, is slightly lower than previous estimates of women enrolled in higher education in science and technology fields in SSA (Tiedeu et al., 2019;Fisher et al., 2020). While this study focused on researchers working within a specific area of science and technology, it suggests a gender disparity in crop improvement teams in SSA."},{"index":2,"size":100,"text":"Figure 1 summarizes the results of the survey, while extensive details across and per individual crop are available in supplemental materials. Highly impactful traits for future varieties can be grouped as very or not innovative, and as readily (feasible) or difficult to breed for. Below, we discuss two characteristics or traits for each crop, chosen to maximize both impact potential and innovativeness, because non-innovative traits are by our definition adequately addressed by current breeding programs. We also discuss for each crop one trait whose impact potential and innovativeness we believe may have been overlooked by the survey respondents (Table 4)."}]},{"head":"Pearl millet (Pennisetum glaucum)","index":8,"paragraphs":[{"index":1,"size":176,"text":"Pearl millet is the sixth most extensively grown cereal crop in the world and has large area-expansion potential because of its excellent adaptation to drought and heat and exceptionally good nutritional value (Ghatak et al., 2021). Its production and use are largely limited to arid and semi-arid regions in SSA and India. With increasing temperatures and expected consequences of climate change, continued or increased breeding for climateadaptive traits will be necessary (Serba et al., 2020). Pearl millet is known for its exceptional heat tolerance, and further improvement for this character is possible (Satyavathi et al., 2021), aided by recent elucidation of underlying regulatory and genomic factors (Yan et al., 2023). Our expert survey identified stay-green and nutrient biofortification as innovative and potentially impactful traits for future varieties, and we also discuss breeding for bird resistance because it is currently not within product profiles and was highlighted as a potentially highly impactful trait to breed for (Figure 1A and Table 4). Detailed survey results for pearl millet are summarized in supplemental Figures 5-8 and supplemental Tables 8-13."},{"index":2,"size":178,"text":"Stay-green enables pearl millet genotypes to sustain photosynthetic activity during terminal drought, contributing to grain filling and yield (Ghatak et al., 2021). The effect of stay-green on water extraction by pearl millet after anthesis under drought stress is (A-F) (A) Millet, (B) sorghum, (C) maize, (D) groundnut, (E) cowpea, and (F) bean. The size and color of bubbles represents the likely feasibility of incorporating individual traits into breeding pipelines. BioFort, biofortification/nutritional enhancement; BirdResist, bird resistance; CarbhSTRG, carbohydrate storage and remobilization; CookTime, reduced cooking time; CropSyst, changed cropping systems; DT, drought tolerance; EarlyMat, early maturity; EarlyVig, early vigor; FunctSG, functional stay-green; GrainYLD, grain yield; HT, heat tolerance; LateMat, later maturity (longer season); LightIntercep, light interception; LowNgtResp, lower respiration under high nighttime temperatures; Mech, mechanization; Microbiome, root microbiome; NUE, nitrogen use efficiency; NUpE, nitrogen uptake efficiency; P&D, emerging or re-emerging pests and diseases; PhotoSens, reduced photoperiod sensitivity; PoorSoils, poor soil quality including acidity; PUE, phosphorus use efficiency; Roots, root architecture; SoilD, resistance to soilborne diseases; StoverQLTY, stover quality for feed; StoverYLD, stover yield; Till, tillering ability; WUE, water use efficiency."},{"index":3,"size":109,"text":"crucial for grain filling (Vadez et al., 2013). Molecular markers have been identified for stay-green in pearl millet (Debieu et al., 2018); for example, an InDel in a putative chlorophyll a/b binding protein gene was associated with stay-green and grain yield under drought conditions (Sehgal et al., 2015). Molecular markers associated with stay-green were mapped on chromosome 6, two of which were also associated with biomass yield under early drought (Debieu et al., 2018). Stay-green also contributes to fodder quality for animal feed (Kamal et al., 2019), making it a valuable trait for dual-purpose (food and feed) breeding, which was assessed as moderately impactful and innovative by survey respondents."},{"index":4,"size":64,"text":"Compared with other cereals, pearl millet has high concentrations of antioxidants, amino acids, leucine, isoleucine, and lysine, and micronutrients, Fe and Zn, and provitamins A (Dube et al., 2021). Diet diversification, food fortification, and nutrition supplementation are used to address micronutrient deficiencies; however, these solutions are not affordable and accessible to all who need them. Biofortification of pearl millet can be a sustainable and "}]},{"head":"Molecular Plant","index":9,"paragraphs":[{"index":1,"size":42,"text":"cost-effective approach to alleviating micronutrient deficiencies and may have income-generating value for farmers. Genetic variability and molecular breeding strategies are available to enable breeding of Fe-and Zn-rich varieties (Govindaraj et al., 2016(Govindaraj et al., , 2022;;Kumar et al., 2016;Singhal et al., 2021)."},{"index":2,"size":287,"text":"Although few studies have examined bird resistance in pearl millet, several for sorghum have reported high tannin grain, drooping and open panicles to have least bird damage (Mofokeng and Shargie, 2016). Sorghum cultivars expressing tannin binding proteins at immature grain stage, but not in ripened grain, would not significantly impact nutritional quality while reducing bird damage. A recent study revealed that Tannin1, which encodes a D40W protein that functions in the WD40/MYB/bHLH protein complex, controls bird feeding behavior in sorghum by affecting the accumulation of anthocyanins and tannin compounds in grain (Xie et al., 2019). Identifying and breeding for favorable alleles of an analog in pearl millet could make significant progress for bird tolerance. The extent to which bird damage can be controlled in pearl millet through genetic traits of the host plant is unclear; however, dense panicles with long bristles have been reported to suffer least bird damage (Akromah et al., 2008;Drabo et al., 2019). Unfortunately, varieties with these traits may be rejected by farmers who harvest and thresh the crop manually (Drabo et al., 2019), although the recent release of a bristled panicle millet in Nigeria suggests that some farmers are interested in growing them. Currently, non-genetic approaches, e.g., bird scaring or bird destruction, are the most effective, but with increased use of mechanization, as predicted by survey respondents (Table 2), and availability of novel breeding technologies such as genome editing, new opportunities to breed for traits that deter bird feeding may become feasible. The very likely increased use of hybrids will also facilitate mechanization of harvest. Finally, research on biochemical compounds and pathways may elucidate opportunities to breed or apply genome editing (e.g., to edit tannin genes) to confer resistance or non-preference by birds."}]},{"head":"Sorghum (Sorghum bicolor)","index":10,"paragraphs":[{"index":1,"size":273,"text":"Sorghum is the second most widely grown crop in Africa with 28.1 M ha (69% of the global area) grown mainly across arid and semi-arid zones by smallholder farmers in a diversity of cropping systems. Most of the grain production is consumed at the household level, and the stover is increasingly used as livestock feed, especially during dry seasons where natural pasture is limited. Sorghum is a ''climate smart'' crop due to its water use efficiency and tolerance to high temperatures and rainfall variability. However, changing climate is predicted to increase temperatures, the numbers of dry days and heavy rainfall events, and cause yields to change by +10% to -40% by the end of the century (Akinseye et al., 2020;Mohammed and Misganaw, 2022;Alvar-Beltra ´n et al., 2023). The survey identified early maturity and stay-green among the most impactful traits for future sorghum production, and we selected low soil phosphorus as a potentially overlooked, high-value future trait (Figure 1B and Table 4). Detailed survey results for sorghum are summarized in supplemental Figures 9-12 and supplemental Tables 14-19 Previous reports indicating farmers' preference for early maturity and stay-green varieties in Ethiopia, Zimbabwe, Mali, and Nigeria (Belay and Wale, 2021;Melesse et al., 2021;Ahmad Yahaya et al., 2022;Traore et al., 2022) support the importance of these traits for adaptation to the changing environments. Early maturity may allow escape from terminal drought, reducing production risks. prioritized by survey respondents and selected by authors for discussion; prioritized by survey respondents but not discussed due to space constraint; and characteristic or trait chosen and discussed by the authors but not prioritized by survey respondents, i.e., potential ''blind spots'' among respondents."},{"index":2,"size":34,"text":"Note: grain yield was always prioritized by survey respondents as impactful, albeit not innovative for future varieties; it was not included for discussion to avoid repetitiveness and to focus on more innovative breeding opportunities."},{"index":3,"size":127,"text":"Flowering time genes activate the transition from vegetative to reproductive growth (Faye et al., 2022); while stay-green genes delay leaf senescence and increase water and nitrogen use efficiency under post-flowering water stress (Abebe et al., 2021;Hou et al., 2021). Stay-green QTLs are co-located with genes associated with narrow root angle, which contributes to deep rooting and greater water extraction (Tebeje et al., 2020). In addition to its importance to drought stress adaptation, staygreen contributes to maintaining stover quality of dual-purpose (grain for food and stover for feed) varieties. Stover digestibility, which is severely reduced under drought (Somegowda et al., 2021) may be less affected for lines expressing stay-green. Molecular marker-assisted selection (MAS) has been reported for stay-green in elite lines (Nofou et al., 2017;Kamal et al., 2021)."},{"index":4,"size":145,"text":"Sorghum's yield gap in Africa can be reduced using improved varieties and appropriate fertilization, especially phosphorus and nitrogen. The survey did not identify P uptake and use as future impactful traits for sorghum improvement; however, low soil P availability is a major constraint for crop production in tropical regions (Hufnagel et al., 2014). P uptake in low-P soils is correlated with root architecture (length and surface area) and with grain yield. Breeding for increased P uptake will enhance crop resilience to climate change and increase yield in low-P soils. Significant genetic diversity and high heritabilities have been reported for P uptake and use efficiency among west and central African sorghums under low-and high-P conditions (Leiser et al., 2014). These traits are positively correlated and are controlled by few genes, including Al tolerance gene sbMATE (Bernardino et al., 2019) for which markers are available for MAS."}]},{"head":"Maize (Zea mays)","index":11,"paragraphs":[{"index":1,"size":139,"text":"Survey respondents, especially non-breeders, identified breeding for increased cropping system diversity as innovative with high potential for impact (Figure 1C). Breeders, however, identified heat tolerance as the most innovative trait, which all respondents believe has moderate impact potential although we believe it may be highly impactful in key maize-producing regions of SSA under climate change. Increasing cropping system diversity can increase productivity per unit area, reduce risk, suppress pests and diseases, and optimize resource capture while reducing erosion, soil carbon loss, and nutrient runoff from increased crop cover (Li et al., 2020;Burgess et al., 2022). We now discuss breeding for: (1) increased cropping system diversity, (2) cooccurrence of heat and drought, and as a potentially overlooked trait, (3) breeding to optimize the rhizosphere microbiome. Detailed survey results for maize are summarized in supplemental Figures 13-16 and supplemental Tables 20-25."},{"index":2,"size":136,"text":"Despite the advantages of intercropping, maize breeding in SSA is primarily conducted under a mono-cropping system (Prasanna et al., 2022). While many farmers use intercropping when testing elite candidate hybrids from breeding programs (on-farm testing), this typically happens late in the product development process, when genetic variation and opportunity to select hybrids that perform optimally under intercrop systems is limited (Voss et al., 2021). Breeding varieties specifically for an intercropbased system is complex because it requires the optimization of two or more crops simultaneously for complementarity in the same ecosystem (Moore et al., 2023). Genomic selection was recently shown to significantly increase the rate of genetic gain relative to phenotypic selection for grain yield alone when breeding for intercrop systems, regardless of the genetic correlation of intercrop with monocrop yield (Ban ci c et al., 2021)."},{"index":3,"size":53,"text":"Over the past 30 years, there has been a two-fold increase in the probability of the co-occurrence of heat and drought stress during maize-growing seasons (Heino et al., 2023). The co-occurrence of heat and drought stress reduces maize yields by 1.7% for every accumulated degree day above 30 C (Lobell et al., 2011)."},{"index":4,"size":43,"text":"Research in southern Africa showed that screening for drought tolerance under moderate temperatures indirectly selected against heat tolerance, resulting in elite drought tolerant lines, widely used in commercial hybrids that are highly susceptible to combined drought and heat stress (Cairns et al., 2013)."},{"index":5,"size":50,"text":"Therefore, the study highlighted the importance of selection for both heat and drought tolerance. Increased temperatures under climate change will result in many African countries experiencing temperatures unrepresented under current climates and increased germplasm exchange from countries identified as analogs of future climates will be essential (Burke et al., 2009)."},{"index":6,"size":275,"text":"Low and variable profitability of fertilizers in maize production is a key driver of sub-optimal fertilizer use and subsequently the maize yield gap in SSA (Bonilla-Cedrez et al., 2021). Although exploiting the root microbiome was identified as low in terms of feasibility and potential impact, and moderately high for innovativeness as a breeding target, it could play an important role in increasing fertilizer use efficiency (York et al., 2022;Michl et al., 2023). Maize genotypes vary in their ability to mediate soil organic matter mineralization, which can result in the mobilization of ammonium and subsequent nitrification providing nitrogen for plant uptake (Mwafulirwa et al., 2021). Biological nitrification inhibition (BNI) could play a significant role in nitrogen use efficiency in maize production (Petroli et al., 2023). Soil P content is a major driver of bacterial and fungal communities, with low soil P, which is pervasive in SSA, favoring microbial communities that suppress maize growth (Gomes et al., 2018). Measuring the rhizosphere microbial diversity is possible under field conditions (Peiffer et al., 2013), but quantifying rates of soil organic matter mineralization and nitrification is complex and generally conducted under controlled conditions (Mwafulirwa et al., 2021). Decades of selection in breeding programs for yield primarily under highinput conditions may have indirectly modified interactions between maize and its microbiome and altered the recruitment of specific N-cycling or low-P-tolerance functional groups within the rhizosphere. Landraces, including those held in germplasm banks, may provide an important source of novel alleles for improving the microbiome in the maize rhizosphere (Favela et al., 2021), while genomic selection may offer the needed tactic to incorporate such complex traits into breeding pipelines (Baggs et al., 2023)."}]},{"head":"Groundnut (peanut, Arachis hypogaea)","index":12,"paragraphs":[{"index":1,"size":185,"text":"The future traits survey revealed grain yield, early maturity, emerging pest and disease resistance, drought tolerance, water use efficiency, and nutritional fortification, followed by mechanization, early vigor, stay-green, N use efficiency, soil borne diseases, and cropping systems as impactful traits for future groundnut varieties (Figure 1D). Several previous studies have also ranked grain yield, drought tolerance, early maturity, and disease resistance as essential for future groundnut varieties (Banla et al., 2018;Daudi et al., 2018;Sinare et al., 2021). While breeders and non-breeders generally agreed on the most impactful future traits, they often disagreed on which traits are innovative breeding targets. All agreed that mechanization, nutritional enhancement, and cropping systems are innovative targets, while only breeders felt that early vigor, microbiome, and N use efficiency are innovative, and only nonbreeders believe that water use efficiency, early maturity, and stay-green are innovative targets. We focus on three traits judged to have high potential impact and to be innovative targets for breeding: (1) nutritional enhancement, (2) mechanization, and (3) dual-purpose (grain and haulm production). Detailed survey results for groundnut are summarized in supplemental Figures 17-20 and supplemental Tables 26-31."},{"index":2,"size":241,"text":"Groundnut is known for its high nutritional value and is a preferred ingredient for nutrient-dense foods to prevent malnutrition in children and pregnant and nursing women (Parmar et al., 2022). Nonetheless, substantial genetic variability exists to further improve the nutrient composition of groundnut, particularly oil content (Janila et al., 2016) and oleic-linoleic oil ratio (Deshmukh et al., 2020;Kamdar et al., 2021). Recent advances in analytical tools have enabled cost-effective and nondestructive phenotyping for oil and high oleic (HO) content using near-infrared reflectance spectroscopy (Misra et al., 2000;Pasupuleti and Nigam, 2013). In SSA, breeding HO groundnut is in its infancy despite documented health benefits (Bimro et al., 2020) and longer shelf-life through reduced oxidative rancidity (Deshmukh et al., 2020). Several QTL and marker-trait associations have been reported for oil and HO content (Sarvamangala et al., 2011;Pandey et al., 2014;Shasidhar et al., 2017;Liu et al., 2020;Guo et al., 2021), and MAS and marker-assisted backcrossing have been used to enhance oil quality for groundnut (Janila et al., 2016;Bera et al., 2018;Huang et al., 2019). Mutant ahFAD2 alleles, conferring HO, have been successfully used for trait introgession (Huang et al., 2019). Nonetheless, HO groundnut varieties remain rare in SSA in contrast to other groundnut producing regions. Efforts to develop high Fe, Zn, pro-vitamin A, or protein groundnut varieties in SSA have been limited, but genetic variability exists for these traits within the primary gene pool (Janila et al., 2015;Chandrashekar et al., 2016;Kadirimangalam et al., 2022)."},{"index":3,"size":257,"text":"Groundnut harvesting and pod stripping are labor intensive and expensive and are often complicated by dry soil at harvest. For smallholder farmers, especially the women who are the main producers, labor is becoming more expensive and scarcer. Mechanization of the groundnut production process is one of the key factors that can improve efficiency and profit margins. Staygreen is a trait that would facilitate mechanized harvesting through the maintenance of peg and stem strength, thus minimizing pod losses during harvest. Stay-green may also protect the crop from yield loss (e.g., peg detachment, and termite and insect damage) when the harvest is delayed due to labor shortages or competing priorities. Stay-green also contributes to drought tolerance (Williams et al., 2022) and improved fodder quality. The underlying physiological mechanisms leading to stay-green expression, QTL identification, and gene discovery have been important research areas for various crops including sorghum (Borrell et al., 2014), wheat and barley (Williams et al., 2022), and groundnut (Vadez and Ratnakumar, 2016). Introgression of QTL for stay-green has resulted in sorghum varieties with improved drought tolerance and yield (Vadez et al., 2011;Sintayehu et al., 2018). Simultaneous selection for staygreen and grain yield has been recommended to ensure that delayed senescence is not caused by low sink demand (Borrell et al., 2014). In addition to contributing tolerance to terminal drought stress, stay-green contributes to groundnut haulm quantity and quality, disease tolerance (Danful et al., 2019), and grain quality. Drone-based sensors can measure physiologic and agronomic characteristics useful for breeding stay-green varieties with high yield (Sarkar et al., 2022)."},{"index":4,"size":170,"text":"Because the price of groundnut's haulm can equal or exceed that of its grain, breeding for dual-purpose (grain and fodder) varieties with stay-green, nutritious haulm would be valuable. Dual use groundnut was not highlighted as a critical future trait, particularly by non-breeders, but evidence suggests that fodder quality should be included in selection criteria for future groundnut varieties (Samireddypalle et al., 2017). Already groundnut haulms are exported as livestock feed from Sudan to the Middle East, and changing climate is likely to increase pressure on cropping systems to produce feed for livestock as rangeland areas are reduced (Godde et al., 2021). Substantial genetic variation exists, and fodder quality is already being mainstreamed as a release criterion for groundnut varieties for some market segments. With the existing genetic diversity for nutritional quality traits, stay-green traits, and haulm quality traits, and the advances in phenotyping and genomic tools, it is feasible for breeding programs to develop nutrient-rich, stay-green, and dual-purpose groundnut varieties that are climate resilient and meet farmer and market demands."}]},{"head":"Cowpea (Vigna unguiculata)","index":13,"paragraphs":[{"index":1,"size":55,"text":"The survey of experts identified early maturity and resistance to emerging pests and diseases as the most impactful traits for adaptation and to diminish the risks of cowpea crop failure under changing climate (Figure 1E). Breeding for optimal root architecture would address two of the characteristics prioritized as future-impactful, drought tolerance and water use efficiency."},{"index":2,"size":65,"text":"Breeding for root architecture would also be highly innovative, likely because of the challenges for phenotyping and hence currently low feasibility for breeding. For these reasons, we discuss root architecture as a potentially overlooked trait, after discussing breeding for early maturity and resistance to emerging or re-emerging pests and diseases. Detailed survey results for cowpea are summarized in supplemental Figures 21-24 and supplemental Tables 32-37."},{"index":3,"size":129,"text":"In the Sahel and Sudan Savanna, early maturing cowpea varieties provide food during critical hunger periods when food supplies from the previous cropping season run out. Early maturity allows cowpea to escape terminal drought and thrive in arid and semiarid environments. Adaptation to short growing seasons sacrifices yield potential in favor of stable and reliable yield during most cropping seasons (Thierfelder et al., 2016;Acevedo et al., 2020). Genetic variation for earliness exists (Ribeiro et al., 2014;Owusu et al., 2018b) and earliness is an important objective in most cowpea breeding programs in SSA (Padi, 2007;Santos et al., 2020). In addition to escaping unfavorably high temperatures during flowering and podding stages, early maturity is valuable for avoidance of pests and diseases (Halder and Srinivasan, 2011;Owusu et al., 2018a;Mulwa et al., 2023)."},{"index":4,"size":131,"text":"Emerging pests and diseases pose threats to crop production, and currently minor pests may become major pests under changed climate (Sadda et al., 2021). As examples, evolving aphid biotypes have overcome resistance in improved cowpea varieties (Abdou et al., 2013) and leaf thrips (Hydatothrips adolfifriderici Karny), formerly occurring sporadically, now pose a serious threat and cause devastating effects through regular outbreaks in some areas in Nigeria (Moritz et al., 2013). Multiple races of Striga gesnerioides have recently been reported in West African countries where previously only one race was present (Ohlson and Timko, 2020;Sawadogo et al., 2021). After resurgence of scab disease in Uganda in 2010, widespread presence with moderate to severe disease symptom levels was found in all the 17 cowpea growing districts surveyed in 2015 (Afutu et al., 2017)."},{"index":5,"size":179,"text":"Few respondents to the survey opined that root architecture is likely to provide high impact in future; however, we believe that this trait deserves greater attention in breeding cowpea for adaptation to climate change. Root architecture is important for plant acquisition of nitrogen and water (Lynch and Brown, 2001;Lynch, 2013), and of phosphorus, which is highly immobile and commonly limiting. Considerable genetic diversity exists for root traits that enhance growth in nutrient-poor and dry environments (Krasilnikoff et al., 2023). Root traits contributing to efficient root architecture and improved productivity under stressful (low soil fertility and drought) and optimal environments have been identified in cowpea (Adu et al., 2019). Significant genotypic variation and high heritability were observed for phenotypes including primary root length (he ritability = 0.77), basal root number (0.72), and taproot branching density (0.67) (Mohammed et al., 2022). With the development of high-throughput methods for phenotyping root architecture, e.g., robotic imaging tools and analysis pipelines to visualize, quantify, and analyze diverse root traits (Galkovskyi et al., 2012), genetic diversity for root architecture could be exploited in cowpea breeding."}]},{"head":"Common bean (Phaseolus vulgaris)","index":14,"paragraphs":[{"index":1,"size":92,"text":"The common bean expert survey identified resistance to emerging pests and diseases, short cooking time (CKT), drought tolerance, early maturity, and nutritional biofortification as impactful future traits, while CKT, nutritional biofortification, early vigor, and water use efficiency were considered the most innovative traits for breeding (Figure 1F). We discuss CKT and nutritional enhancement, and include tolerance to poor soil fertility as a potentially overlooked characteristic for bean (and likely for all six crops in this review). Detailed survey results for common bean are summarized in supplemental Figures 25-28 and supplemental Tables 38-43."},{"index":2,"size":266,"text":"Beans are a major staple food in many parts of Africa; however, long CKT is a disincentive to consumption since it demands large amounts of water, fuel, and time (Shellie-Dessert and Hosfield, 1990). Women constitute more than 60% of bean producers across Africa (Nchanji, 2021) and benefit from improved common bean varieties with shorter CKT (Nakazi et al., 2017). Over 85% of the rural and urban poor use wood or charcoal as fuel to cook beans, which has environmental impact due to deforestation. Research on ''cookability'' in common bean began in the 1960s, and CKT and rate of water absorption were later shown to be unique traits, with a low phenotypic correlation between them and relatively small genotype by environment interaction for both traits (Jackson and Varriano-Marston, 1981;Shellie and Hosfield, 1991). Wide genotypic variability associated with CKT exists in both Andean and Mesoamerican bean accessions (Ribeiro et al., 2014(Ribeiro et al., , 2021;;Cichy et al., 2015). Variation in CKT has been associated with seed qualities including color, size, and seed coat thickness (Reyes-Moreno and Paredes-Lo ´pez, 1993;Klasener et al., 2019;Bassett et al., 2021). In breeding for reduced CKT, care must be taken to maintain protein content and quality. Studies indicate that few QTLs contribute to CKT in beans, and high narrow-sense heritability of CKT in beans (h 2 = 0.74) has been reported (Jacinto-Hernandez et al., 2003;Cichy et al., 2015). Using an African bean panel of 358 genotypes, it was recently reported that genomic selection with optimal contribution selection can accelerate breeding of high yielding, biofortified, and rapid cooking common bean cultivars (Saradadevi et al., 2021)."},{"index":3,"size":35,"text":"In many African homes, beans are an accessible source of Fe and Zn, which are essential to the health and well-being of women and children, and of protein which is essential for the entire household."},{"index":4,"size":183,"text":"In a bio-efficacy trial among college-age women in Rwanda, high Fe beans improved Fe status and enhanced cognitive ability, brain function, and work efficiency (Murray-Kolb et al., 2017). The opportunity exists to improve the health of women and children through increased consumption of rapid-cooking beans with high and bioavailable Fe and Zn content. Genetic variation exists for nutritional composition of cooked bean, including Zn, P, K, Ca, and Fe in the Andean Diversity Panel (Katuuramu et al., 2018) and in varieties released by Pan Africa Bean Research Alliance (PABRA) programs (Amongi et al., 2018;Mukankusi et al., 2019). Future breeding efforts may focus on improving the bioavailability of Fe and Zn by incorporating mechanisms such as non-or slowdarkening grain, or low phytate mutants (Beebe, 2020). However, a homeostatic mechanism that regulates Fe and Zn uptake has been found to impede biofortification progress and breeders may need to cross between gene pools to achieve higher levels of Fe and Zn uptake; using sister species that have evolved in Fe-poor environments and are more receptive to Fe uptake could also be a viable strategy (Beebe, 2020)."},{"index":5,"size":214,"text":"Common beans exhibit considerable genetic variability for specific single or multiple edaphic stress tolerances including low N, low P, and soil acidity with associated Al and/or Mn toxicities (Lunze et al., 2012). Research on root phenotypes and their role in enhanced soil exploration and P acquisition has been ongoing for a long time, leading to better understanding of these traits (Lynch, 2011). Several traits such as greater root branching and longer root hairs (Lynch, 2011), percentage of N derived from atmosphere (Rao et al., 2016), BNI (Subbarao et al., 2015), receptor kinases, transmembrane transporters, and transcription factors (Kamfwa et al., 2017) have been employed to select for tolerance to specific mineral deficiencies. However, developing varieties that are adapted to multiple soil mineral deficiencies occurring in combination with abiotic stresses such as drought, heat, and waterlogging common under farmers' conditions has made little progress. Definition of target population of environments has mainly focused on climatic factors with less emphasis on soil characteristics and deficiencies, which could guide variety testing for low soil fertility tolerance. Gaps in breeding for multiple edaphic stress tolerance include inadequate mapping of soil deficiencies, poor understanding of the genetic basis of tolerance to multiple soil mineral deficiencies, difficulties in developing suitable screening protocols, and limited cooperation between breeders and soil scientists."}]},{"head":"Innovative methods for mining genetic diversity","index":15,"paragraphs":[{"index":1,"size":294,"text":"The extensive expert surveys reported herein propose traits with high potential value for future crop varieties, some of which are innovative in the sense that they are not currently prioritized by breeding programs. Initiating breeding work for such desirable or essential future traits relies on the availability of genetic diversity and the ability to accurately phenotype the trait or linked secondary trait(s). When useful diversity is not available within the elite, adapted breeding germplasm pool, trait discovery in exotic germplasm is necessary, and breeding teams must balance the benefits from incorporating the desired genetic variation with the linkage drag effects from less-desired variation from the same donor. Therefore, breeding programs seeking trait variation not found in the immediate elite breeding pool (Figure 2A, quadrant Qa), generally initially explore elite germplasm from outside the adaptation target zone (Figure 2A, quadrant Qb). This approach avoids the most deleterious impacts of linkage drag and minimizes the difficulty, cost, and time of developing new, competitive, and adapted germplasm (Figure 2B). Despite these advantages, the challenge faced when exploring elite unadapted (Qb) germplasm as potential sources of ''new'' traits is their relatively limited variation (Figure 2B). This limitation drives many teams to consider adapted landraces (Qc) and non-adapted landraces and wild relatives (Qd) as sources of genetic variation novel to the elite pools. Despite challenges of using landrace and wild relatives as trait donors, there are numerous examples of successful trait identification and deployment in modern breeding from these sources (Kilian et al., 2021). Common challenges of using exotic germplasm include sorting through many thousands of potential sources, little relevant information to aid germplasm selections, difficulties applying elite-breeding-based phenotyping assays to often heterogeneous and very diverse materials, and the inevitable linkage drag observed when breeding from these germplasm sources."},{"index":2,"size":145,"text":"Over the last 15 years, genomics has begun to open the black box of genetic diversity through the evolution and application of cheap, fast, and precise DNA sequencing technology. Unprecedented scales of crop genetic resource genomic characterization, such as those conducted in the 3000 genomes work in rice (Wang et al., 2018) and for maize and wheat at CIMMYT (Sansaloni et al., 2020), leveraged sequencing technology advances to understand genetic resources. This genomic framework, while powerful, required relevant phenotypic data to conduct primary discovery activities through genome-wide association study (GWAS) and genomic prediction approaches (Crossa et al., 2016;Romero Navarro et al., 2017;Singh et al., 2018). Exploration of the use of other variables, specifically germplasm collection site enviro-climatic variables such as precipitation, temperature, soil pH, etc., has facilitated a step-change in our ability to quickly identify (1) novel genetic variants of potential value for pre-breeding and"},{"index":3,"size":37,"text":"(2) the germplasm bank accessions most enriched in the desired genetic variants (Forester et al., 2016;Mosca et al., 2016;Yu et al., 2016;Romero Navarro et al., 2017;De La Torre et al., 2019;Gates et al., 2019;Lasky et al., 2023)."},{"index":4,"size":170,"text":"Environmental GWAS (EnvGWAS) and environment-based prediction use climate variables alone or in combinations as response variables replacing phenotype(s) used in classical GWAS. This ''allele mining'' paradigm offers a new scale of experimentation because isolation of environmental variables from georeferenced germplasm collections is many orders of magnitude cheaper than phenotyping the same material. EnvGWAS therefore avails all germplasm bank accessions with genomic data and georeference data for their collection site. These large and diverse germplasm panels offer powerful resources to explore adaptation to features strongly represented in the environmental data, such as tolerance to drought, high temperature, flooding, and low soil pH. Where historic and endemic disease and pest distributions are well documented, these can also be used for EnvGWAS analyses (Bellis et al., 2020). This paradigm does not extend well when the features of interest are poorly represented in environmental data, for example poor data on disease distribution, poor spatial resolution of variables such as salinity, or limited ranges for a feature of interest, e.g., freezing temperatures among maize collections."},{"index":5,"size":75,"text":"Furthermore, using genomic data per se, comparison of landrace with modern cultivars can help identify genomic regions where diversity in elite materials is narrow or fixed compared with landraces. While this assessment and comparison of diversity does not provide an understanding of direct benefit or cost of using exotic diversity, it provides a structured approach to sample and test exotic diversity in regions of the genome where breeding bottlenecks have arisen (Sansaloni et al., 2020)."}]},{"head":"Gene editing to develop climate-resilient crops","index":16,"paragraphs":[{"index":1,"size":149,"text":"Forward breeding, which has been and will continue to be a mainstay of crop improvement, requires crossing of genotypes with complementary traits followed by selection of desirable recombinants in the target environments, often taking more than a decade to develop an improved cultivar. In contrast, introduction of highvalue traits such as herbicide tolerance and insect resistance using biotechnology has contributed substantially to food production over the last two and a half decades (Kl€ umper and Qaim, 2014). The impact of these products has been limited by onerous regulatory approval processes, and opposition to transgenic plants in many countries. CRISPR-Cas, which was introduced as a tool for genome editing a decade ago, enables altering of genes directly in crop plants without permanently introducing foreign genetic material (Wang and Doudna, 2023). Myriad examples of modifying genes using this technology to improve crop plants have already been reported (Nascimento et al., 2023)."},{"index":2,"size":213,"text":"Success of gene editing in any crop plant is contingent on the transformation and editing efficiencies. In rice and maize, for example, almost any gene can be edited, whereas in difficultto-transform crop plants, including pearl millet, none or very few examples are known (Nascimento et al., 2023). Two common scenarios in gene editing with CRISPR-Cas are: (1) repair of the Cas-catalyzed double-stranded DNA break by non-homologous end joining (NHEJ), which deletes or introduces nucleotides, often leading to frameshift mutations, and (2) template-directed repair, referred to as homology-directed repair (HDR), which allows introduction of targeted changes. HDR is used for precise replacement or deletion of specific nucleotides and insertion or replacement of large DNA segments (Anzalone et al., 2020;Wang and Doudna, 2023). Other methods that can produce results like HDR include base editing and prime editing, which provide value where HDR is difficult to perform, for example, in non-dividing cells. In plants, although all the various CRISPR-Cas-mediated methods of gene editing have been reported, NHEJ and HDR suffice to introduce any type of the aforementioned changes (Anzalone et al., 2020). The CRISPR-Cas system has been demonstrated to introduce random mutations (NHEJ), change or replace specific nucleotides (HDR), and replace or insert DNA segments (HDR) in commercial crops (Svitashev et al., 2015;Shi et al., 2017)."},{"index":3,"size":114,"text":"Mutant libraries could be useful for the discovery and validation of genetic diversity for use in breeding. The CRISPR-Cas system was used to generate a library of mutations of the coding genes in rice, which is a useful resource for gene discovery, similar to TILLING and transposon-tagged populations (Slade et al., 2005;McCarty and Meeley, 2009;Liu et al., 2023). For example, mutations in genes for plant architecture and stalk strength were isolated from a mu-tagged maize population (Gallavotti et al., 2004;Ching et al., 2006;McCarty and Meeley, 2009). Similarly, a TILLING population of wheat was screened to isolate mutants of all three homeoalleles of the powdery mildew resistance locus (Slade et al., 2005;Acevedo-Garcia et al., 2017)."},{"index":4,"size":228,"text":"CRISPR-Cas can be a useful tool in validating the effect of selected gene candidates from field or laboratory screening, or which may be predicted by other methods, for example, EnvGWAS and bioinformatic analyses, as long as a knockout provides the requisite information. However, HDR would be required if the objective is to measure the effect of a functional candidate gene or genetic region on plant performance in the target environment. CRISPR-Cas technology allows the insertion of large pieces of DNA spanning several to many kilobases into the genome (Anzalone et al., 2020). The resources required to accomplish this would be extensive, though, first to perform HDR, the frequency of which is an order to two orders of magnitude lower than that of NHEJ, and to subsequently test the individual coding sequences in the candidate interval. Gene editing where HDR is required would preferably be reserved, in practice, for the narrowed genetic intervals that have been proven with high confidence to confer yield or performance advantage in a target environment. Furthermore, the selected genetic interval would ideally contain only a few genes to allow rapid identification of the causal gene. Yet, there is no dearth of desirable traits where an inactive gene results in a favorable phenotype, or where the specific polymorphisms are known to improve the performance of a plant. Gene editing, thus, can contribute to crop improvement."},{"index":5,"size":122,"text":"To study the effect of multiple genes on a trait, instead of combining individual, edited genes by crossing and selection, a multiplex approach to edit the multiple target genes simultaneously in the same line would be more efficient. Mutant maize populations for various combinations of 48 growth-related genes were generated via multiplexing (Lorenzo et al., 2023). Several loci in wild tomato were altered to increase fruit size and quality characteristics (Zhang et al., 2020). These types of studies are useful in advancing knowledge but, for expedited product development, if a combination of three or more genes results in a measurable effect on the desired trait, it would be preferable to create it afresh in each target cultivar instead of crossing and selection."},{"index":6,"size":114,"text":"A major advantage of editing a gene to improve a trait is that it can be performed directly in a commercial cultivar or elite line, eliminating traditional pre-breeding steps of backcrossing and selection for the parental genetic background and genetic drag that inevitably accompanies these steps (Dhugga, 2022;Li et al., 2022;Pixley et al., 2022;Biswal et al., 2023). Furthermore, it reduces the time to develop an improved cultivar by nearly two-thirds relative to forward breeding (Dhugga, 2022). In the many countries that have approved guidelines to consider gene-edited crops as nontransgenic, improved crop varieties incur no costs for deregulation, and the costs and procedures for registration are similar to the candidates developed by traditional methods."}]},{"head":"Pre-breeding approaches","index":17,"paragraphs":[{"index":1,"size":68,"text":"Our expert survey identified several traits for pearl millet, sorghum, maize, groundnut, bean, and cowpea that will be impactful in mitigating and adapting to climate change. There has been limited work for several of these traits, particularly in some of these six crop species. Therefore, there is an immediate need to intensify research to better understand the inheritance and genetics toward developing population improvement strategies and breeding tools."},{"index":2,"size":135,"text":"New machine learning algorithms facilitate the identification of candidate genes (Sun et al., 2020). Growing understanding of structural variations in genomic regions, and comparative genomics in related species, enabled by the availability of pangenomes, have further enhanced our ability to discover, validate, and implement such knowledge in breeding programs (Ruperao et al., 2021;Petereit et al., 2022;Yan et al., 2023). Gene editing also provides tremendous opportunities for simple or oligogenic traits with known causative gene information to rapidly deliver improved germplasm where regulatory frameworks permit (Pixley et al., 2022;Rock et al., 2023). For traits with simple or oligogenic inheritance, these technological advances allow fast and cost-effective genetic mapping of traits, and rapid forward and backcross breeding using speed breeding techniques (Ghosh et al., 2018;Wanga et al., 2021) and MAS (Bankole et al., 2017;Baloch et al., 2023)."},{"index":3,"size":62,"text":"For complex traits, the impact of genomic selection in accelerating genetic gain in crop breeding has been facilitated by cheaper costs of mid-density genotyping, the availability of computing power, new and novel algorithms, and rapid recycling of elite material through doubled-haploid and speed-breeding methods (Jeon et al., 2023). Genomic selection will be appropriate for improving many of the traits identified in surveys."},{"index":4,"size":107,"text":"Over the last decade, there have been several successful uses of high-throughput phenotyping tools, such as drone-and satellitebased images to rapidly screen thousands of breeding plots with higher accuracy. There are several options already available to deploy in breeding programs and active areas of research. These technologies combined with machine learning algorithms have significantly improved our ability to measure traits reliably and consistently and allowed us to measure component traits, which were previously unthinkable due to labor costs or other constraints (Gill et al., 2022). Such technologies can be used to dissect genetics and reliably measure component traits at higher scale, accuracy, and precision in breeding programs."},{"index":5,"size":94,"text":"Despite tremendous technological advancements for breeding crop varieties, their use is often limited by genotype-byenvironment or genetic background effects, and availability of digital platforms to integrate genetic information in decision making. Most of the investments are in model species, in developed countries (Marks et al., 2023), and targeting commercial traits, crops, and cropping systems (Pixley et al., 2019(Pixley et al., , 2022)). This disproportional investment in crops and geographies is concerning and challenges efforts to upscale the use of technologies equitably to benefit farmers and societies where agriculture is most vulnerable to changing climate."}]},{"head":"BREEDING FOR FUTURE CROPPING SYSTEMS","index":18,"paragraphs":[{"index":1,"size":20,"text":"The demand exerted by a rising middle class and growing population will continue to put pressure on agriculture to intensify. "}]},{"head":"Molecular Plant","index":19,"paragraphs":[{"index":1,"size":86,"text":"Redesigning crop varieties for changed climate Nutritionally dense food and feed are expected to be in demand, which will require breeding attention to novel traits as predicted by survey respondents (Figure 1). On the other hand, our survey did not explore additional, post-farm societal demands such as innovative plant protein products to reduce meat consumption, or environmental services, e.g., net carbon sequestration, biodiversity conservation, and others (Kuyah et al., 2023). All of these growing demands require transdisciplinary efforts, where plant breeders work closely with diverse experts."},{"index":2,"size":144,"text":"Intensified cropping systems will take a range of forms, from monocultures to double and triple cropping systems, to relay and intercrop arrangements. Cropping calendars will shift with changing climate, and cropping options will adapt based on management innovations, access to appropriate inputs (including varieties with novel traits), and market forces. Mechanization, for example, is expected to increase over time and space, supporting and demanding the use of different varieties to tolerate new stresses, e.g., sowing in wetter soils or higher plant population density, and opportunities such as dual-purpose, or bird-resistant, or avoiding varieties. Increased use of hybrids is predicted by our survey to be of primary importance in cereal crops, which will require plant architecture that is compatible with close spacing (Richards et al., 2019), and increased levels of drought, disease, and pest tolerance expected in such intensive planting systems (Ando et al., 2007)."},{"index":3,"size":157,"text":"Novel cropping systems will offer new stress-coping and productivity-or profit-maximizing options requiring system-optimizing management practices and crop varieties. Complementary architectural and growth traits are already utilized in intercrop systems such as cereal-legume associations and legume-legume systems (Kuyah et al., 2021). For example, farmer participatory research has shown that farmers in Rwanda select for ideotypes of beans that perform well when intercropped with maize (Isaacs et al., 2016). Architectural traits can be selected to facilitate complementarity, such as slow growth aboveground, with a retarded rate of branching in one crop, combined with selecting for rapid growth in a complementary crop that is also selected for shade tolerance. Maize and pigeonpea are a widely grown example of such complementarity of plant phenotypes, which could be enhanced through deliberate selection (Snapp et al., 2019). Belowground competition could be minimized by developing crops with steep root angles to reduce root overlap at the surface (Bonser et al., 1996;Lynch et al., 2022)."},{"index":4,"size":163,"text":"As highlighted by respondents in this study, heat-and droughttolerant varieties will be very important to the success of future cropping systems. Drought avoidance has been widely relied upon historically and, as confirmed by our survey, will continue to be important through selection for early maturing and rapid growth types (Snowdon et al., 2021). In addition, a wide range of plant physiological characteristics can enhance adaptation to water deficiency and heat stress; these will need to be selected as stand-alone traits and in combination (see maize section, above). Crops with exceptional heat and drought tolerance attributes, notably pearl millet, are expected to achieve further progress in climate change adaptation traits, and some of these traits will be extendable to related cereal crops through studies of genomic synteny and application of modern breeding technologies. Breeding for these traits will provide varieties for novel cropping systems and to allow continued cultivation of crops in their traditional agro-ecologies as climate change alters the weather associated with them."},{"index":5,"size":115,"text":"The ability of crops to tolerate nutrient-deficient soils is expected to be of future importance and is highly complementary to drought tolerance. This includes both belowground and aboveground traits, as nutrient acquisition, allocation, and efficiency of use are all involved (Liu et al., 2022). The plasticity of roots and related factors that lead to large genotype by environment interaction effects have historically complicated and slowed progress in breeding for tolerance to low nutrient status, but the advent of molecular and statistical tools could lead to breakthroughs in this field. Progress in improving nutrient acquisition and use efficiency will provide crop types that are expected to improve the performance of conservation, sustainable, and restorative agricultural systems."},{"index":6,"size":196,"text":"Future scenarios that may vary widely are those driven by globalization, altering land use, farming systems, and market demand. These could include greater integration of crop and livestock systems, which will increase the demand for crop types that are dual use for fodder and food (Thornton and Herrero, 2014). Forage quality and quantity of stover are very important in such systems (Melesse et al., 2021). This is an area where respondents predict rapid progress can be made. A much longer-term project would be to breed for perennial and semiperennial grain crops, the prototypes of which have shown to provide a wide range of environmental services such as reduced loss of nitrogen to the environment (Culman et al., 2013), although others caution that perennial crops may be highly vulnerable to pests and diseases. More specifically, enhanced soil carbon gain has been proposed in a dual-use crop type through selection for enhanced suberin and related biochemical properties in roots of cereal and pulse crops (Eckardt et al., 2023). BNI is another example of an environmentally friendly service that can enhance crop performance in an intensive cropping system, well suited to cereal crop genetic improvement (Subbarao et al., 2021)."}]},{"head":"CONCLUDING REMARKS","index":20,"paragraphs":[{"index":1,"size":11,"text":"Climate change will affect agriculture in every corner of the world."},{"index":2,"size":114,"text":"Our survey respondents echoed predictions that temperatures will increase, rainfall distribution will be less predictable, and pest and disease ranges will change (Table 1). Not all changes will be negative. Warmer temperatures will accelerate crop development, enabling use of longer-duration and higheryielding varieties, or novel or intensified cropping systems (Table 2). Optimal options for relay cropping may change in regions where this practice is already common, such as Indonesia, Vietnam, and India (Swastika et al., 2004;Thanh Ha et al., 2004;Jat et al., 2020), and new opportunities may arise in areas where only one crop was previously possible, for example, in parts of West Africa predicted to become hotter and wetter (Zhai et al., 2021)."},{"index":3,"size":181,"text":"Changing cropping systems will expose crops to new environments that may require or benefit from characteristics that are not valuable in today's varieties. Relay cropping may force crops out from their optimal monocrop or current relay crop season, exposing them to wetter or drier than optimal soils at planting, sunnier or cloudier conditions during vegetative growth, hotter or cooler temperatures during grain fill, fewer or different insect pests, etc. Short turn-around time between crops may incentivize redesigning of crop varieties, for example to facilitate mechanization of harvest or planting, and to prioritize rapid emergence, early vigor, quick dry-down, and early and enhanced accumulation of nutritional components in grain (e.g., protein, Fe, Zn, and provitamins A) (Figure 1 and Table 4). Dual-purpose varieties, suitable for grain and fodder production, may be increasingly valued for averting the risk of crop failure during seasons when grain production is poor or fails. For crops that will be intercropped, traits related to growth architecture (e.g., erect leaves, branch angle, plant height) and growth habit (e.g., early vigor, spreading habit, determinate vs. indeterminate) will play important roles."},{"index":4,"size":46,"text":"Breeding crop varieties for intercropping or relay crop systems may require selection at early stages in breeding programs to consider general and specific mixing ability (GMA and SMA), assessing the suitability for use in multiple or specific systems (Moore et al., 2022(Moore et al., , 2023))."},{"index":5,"size":189,"text":"The expert survey prioritized very few future-essential traits that are not already targeted in current breeding programs (Table 3 and supplemental information). These were mainly water use efficiency in pearl millet, groundnut, and cowpea, adaptation to cropping systems for pearl millet and maize, and suitability for mechanization in groundnut. This finding is consistent with recent surveys in 19 low-and middle-income countries that concluded that changing climate has resulted in greater urgency and intensified breeding work on traits that already had high priority (Galluzzi et al., 2020). While smarter and faster breeding for currently important traits is essential, we suggest blind spots and potentially large, missed opportunities from relying entirely on this approach. We describe recent advances in diverse fields of science that make or could soon make it feasible to breed for: (1) optimized rhizosphere microbiome, with impacts on P, N, and water use efficiency, (2) optimized performance across or in specific cropping systems, (3) decreased nighttime respiration, (4) improved stover quality, (5) increased early vigor, and (6) improved heat tolerance. Each of these traits would be valuable in most or all crops' adaptation and resilience to climate change."},{"index":6,"size":129,"text":"Survey respondents perceived a low likelihood of adoption of sustainable agriculture approaches including reduced tillage, increased soil cover, increased vegetative yield, and increased use of precision machinery in agriculture to maximize efficiency of fertilizer and other inputs (Table 2). This is a surprising result given worldwide soil health concerns, conservation agriculture being on the rise, and marked competition in uses for crop residues. A strong case can be made for designing crops with traits that are key to successful conservation farming, such as vigorous early growth for improved performance under mulch. The views documented here highlight a perception challenge, suggesting that many experts view conservation farming practices and precision agriculture narrowly, limited to approaches that require a high degree of mechanization, which may contribute to skepticism about adoption potential."},{"index":7,"size":121,"text":"Breeding varieties that are redesigned for agriculture under changed climate will require innovative phenotyping approaches and transdisciplinary teams with expertise in agronomy, soil science, microbiology, biochemistry, physiology, genomics, data sci-ence, and more. These teams must be bold enough to tackle traits found only in exotic germplasm (see Figure 2) and for which selection methods must be developed, validated, and optimized. As described herein, recent and emerging methods for gene discovery, allele mining, and plant breeding offer unprecedented opportunities for precision, accuracy, and speed in developing new varieties. By consequence, the greatest challenge to developing crop varieties that win the race between climate change and food security might be our innovativeness and boldness in defining the future traits we breed for today."}]}],"figures":[{"text":"Figure 1 . Figure 1. Perceived degree of innovation (X axis) and potential impact (Y axis) of characteristics or traits for breeding for future climates. "},{"text":"Figure 2 . Figure 2. Source germplasm types for trait discovery to serve a core breeding pipeline. (A) Four trait discovery and deployment quadrants, Qa, Qb, Qc, and Qd, separate potential trait donor germplasm sources along two axes, one focused on the adaptation of the potential source germplasm to the target population of environments that the core breeding pipeline is serving, and the other axis indicating the competitiveness of the germplasm compared with elite performance. (B) The relative technical difficulty, cost, and probability of finding and deploying novel variation from each of the quadrants. "},{"text":"Table 1 . Factors likely to drive changes in crop agronomy or cropping systems for future climates across six crops, expressed as percentage of 588 survey respondents.  "},{"text":"Table 3 . Current target traits of CGIAR-NARS breeding pipelines in pearl millet, sorghum, maize, groundnut, cowpea, and common bean in sub-Saharan Africa. Each crop has several breeding pipelines targeting different market segments. Blue cells with ''+'' indicate a trait is included in all breeding pipelines, Each crop has several breeding pipelines targeting different market segments. Blue cells with ''+'' indicate a trait is included in all breeding pipelines, green cells with ''+/À'' indicate the trait is included in certain breeding pipelines, and yellow cells with ''À'' indicate the trait is not used in selection within green cells with ''+/À'' indicate the trait is included in certain breeding pipelines, and yellow cells with ''À'' indicate the trait is not used in selection within any breeding pipelines in sub-Saharan Africa, as known or assumed by the authors. any breeding pipelines in sub-Saharan Africa, as known or assumed by the authors. Molecular Plant 16, 1590-1611, October 2 2023 ª 2023 The Author. 1595 Molecular Plant 16, 1590-1611, October 2 2023 ª 2023 The Author. 1595  "},{"text":"Table 4 . Characteristics or traits prioritized as impactful and innovative to breed for future climate-resilient varieties of six crops:  Characteristics prioritized by Characteristics prioritized by Blind spot prioritized by authors and Characteristics prioritized byCharacteristics prioritized byBlind spot prioritized by authors and Crop surveys and discussed surveys but not discussed discussed Cropsurveys and discussedsurveys but not discusseddiscussed Pearl millet stay green water use efficiency bird resistance Pearl millet stay greenwater use efficiencybird resistance  nutritional enhancement emerging pests and diseases  nutritional enhancementemerging pests and diseases   cropping systems  cropping systems Sorghum early maturity drought tolerance low soil phosphorus Sorghumearly maturitydrought tolerancelow soil phosphorus  stay green stover quality  stay greenstover quality   emerging pests and diseases  emerging pests and diseases Maize cropping systems drought tolerance microbiome Maizecropping systemsdrought tolerancemicrobiome  heat tolerance early maturity  heat toleranceearly maturity   emerging pests and diseases  emerging pests and diseases Groundnut nutritional enhancement early maturity dual purpose Groundnut nutritional enhancementearly maturitydual purpose  mechanization emerging pests and diseases  mechanizationemerging pests and diseases   water use efficiency  water use efficiency Cowpea early maturity drought tolerance root architecture Cowpeaearly maturitydrought toleranceroot architecture  emerging pests and diseases cropping systems  emerging pests and diseasescropping systems   water use efficiency  water use efficiency Bean short cooking time emerging pests and diseases low soil fertility tolerance Beanshort cooking timeemerging pests and diseaseslow soil fertility tolerance  nutritional enhancement drought tolerance  nutritional enhancementdrought tolerance   early maturity  early maturity  "}],"sieverID":"d6bc4cfc-734a-472b-8f99-19245decbd5c","abstract":"Climate change poses daunting challenges to agricultural production and food security. Rising temperatures, shifting weather patterns, and more frequent extreme events have already demonstrated their effects on local, regional, and global agricultural systems. Crop varieties that withstand climate-related stresses and are suitable for cultivation in innovative cropping systems will be crucial to maximize risk avoidance, productivity, and profitability under climate-changed environments. We surveyed 588 expert stakeholders to predict current and novel traits that may be essential for future pearl millet, sorghum, maize, groundnut, cowpea, and common bean varieties, particularly in sub-Saharan Africa. We then review the current progress and prospects for breeding three prioritized future-essential traits for each of these crops. Experts predict that most current breeding priorities will remain important, but that rates of genetic gain must increase to keep pace with climate challenges and consumer demands. Importantly, the predicted future-essential traits include innovative breeding targets that must also be prioritized; for example, (1) optimized rhizosphere microbiome, with benefits for P, N, and water use efficiency, (2) optimized performance across or in specific cropping systems, (3) lower nighttime respiration, (4) improved stover quality, and (5) increased early vigor. We further discuss cutting-edge tools and approaches to discover, validate, and incorporate novel genetic diversity from exotic germplasm into breeding populations with unprecedented precision, accuracy, and speed. We conclude that the greatest challenge to developing crop varieties to win the race between climate change and food security might be our innovativeness in defining and boldness to breed for the traits of tomorrow."}

data/part_1/03fc49cd02235f3aedcd3e35e513a8fd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"03fc49cd02235f3aedcd3e35e513a8fd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0395c5d6-fbbd-46c5-997c-4c1074049341/retrieve"},"pageCount":5,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":116,"text":"As a minimum, researchers should, in the future, arrange for post-print versions to be stored in institutional repositories. This allows researchers to publish where they want to (e.g. subscription-only / hybrid journals) but for the content to be discoverable in our institutional repositories. It also allows for open access to be purchased via article processing fees (and for such fees to be built into the funding application stage). This is a rapidly evolving area and our scientists that they should never feel pressured into choosing a journal purely because it offers immediate open access. That is not what this policy is about; it is not in the interests of researchers, science or our overall research project."}]},{"head":"How does this differ from current practices?","index":2,"paragraphs":[{"index":1,"size":48,"text":"Open access is compatible with copyright, peer review, revenue (even profit), print, preservation, prestige, quality, career-advancement, indexing, and other features and supportive services associated with conventional scholarly literature. The primary difference is that the bills are not paid by readers and hence do not function as access barriers."}]},{"head":"What are the benefits of open access?","index":3,"paragraphs":[{"index":1,"size":37,"text":"Open access enhances the visibility of research findings as CGIAR content will be made freely available and can be accessed by all researchers, and not just those based at an institution that subscribes to a particular journal."},{"index":2,"size":59,"text":"The overall project aims to provides innovative tools and services for the ag4dev research community: a single open.cgiar.org portal search to CGIAR information products, journals, books, data, and spatial information and other relevant content, together with the integration of text-mining tools, which highlight and link biological entity types found within the text of an article to external data sources."}]},{"head":"What is the purpose of the Policy?","index":4,"paragraphs":[{"index":1,"size":44,"text":"The OA Policy builds on the CGIAR Principles on the Management of Intellectual Assets, which mandates the prompt and broad dissemination of research outputs. The OA Policy gives further detailed guidance on what this means in the content of traditional research outputs and data."},{"index":2,"size":43,"text":"This policy was adopted by the CB on 2 October 2013 and applies to all information products produced by the CGIAR Consortium, its members and their partners within the scope of the Strategy and Results Framework (\"SRF\") and the CGIAR Research Programs (\"CRPs\")."}]},{"head":"What type of information products are covered by this Policy?","index":5,"paragraphs":[{"index":1,"size":66,"text":"This Policy sets common expectations with respect to open access to the following indicative types of information products (\"information products\"): peer-reviewed journal articles; reports and other papers; books and book chapters; data and databases; data collection and analysis tools (e.g. models and survey tools); video, audio and images; computer software; web services (e.g. data portals, modelling on-line platforms); and metadata associated with the information products above."}]},{"head":"How will CGIAR monitor compliance with the Policy?","index":6,"paragraphs":[{"index":1,"size":49,"text":"CGIAR will conduct evidence-based annual reviews of implementation and compliance with the Policy throughout the implementation phase of the Policy. This will include actively monitoring the papers authored by our researchers to ensure that they comply with our policy, including through the review of publications listed in CRP reporting."}]},{"head":"What is the implementation phase of the Policy?","index":7,"paragraphs":[{"index":1,"size":26,"text":"The transition period runs from the effective date of the Policy for an initial period of 5 years, with comprehensive implementation by the end of 2018."}]},{"head":"How will Open Access costs be met?","index":8,"paragraphs":[{"index":1,"size":28,"text":"The attached Concept Note sets out specific plans regarding initial funding for the project. Open Access costs should also be incorporated into the 2 nd call for CRPs."}]},{"head":"Who can I contact for more information and/or help?","index":9,"paragraphs":[{"index":1,"size":14,"text":"If you have any queries about this policy and its implementation please email [email protected]."}]},{"head":"CGIAR Open Access and Data Management Policy -Data Management Implementation FAQs 1. What constitutes \"data\" covered by a Data Management Plan?","index":10,"paragraphs":[{"index":1,"size":73,"text":"The Open Access Policy defines data as the digital recorded factual material commonly accepted in the scientific community as necessary to validate research findings, including data sets used to support publications and/or that have been prepared and validated but that do not support publications. This does not include laboratory notebooks, preliminary analyses, drafts of scientific papers, plans for future research, peer review reports, communications with colleagues, or physical objects, such as laboratory specimens."}]},{"head":"Is a plan for Data Management required if my project is not expected to generate data or samples?","index":11,"paragraphs":[{"index":1,"size":27,"text":"Yes. It is acceptable to state in the Data Management Plan that the project is not anticipated to generate data or samples that require management and/or sharing."}]},{"head":"Am I always required to deposit my data in a suitable repository?","index":12,"paragraphs":[{"index":1,"size":77,"text":"You are required to ensure that all data is stored safely so that it may be accessed by your colleagues should you leave your research group. However, not all data that is stored should always be loaded into repositories that are accessible by the public. For example, it is understood that certain types of information are not appropriate for sharing (e.g. household data where individuals can be identified or where consent to data sharing has been withheld)."},{"index":2,"size":41,"text":"What constitutes reasonable data management and access will be determined by the CRP through the process of peer review and program management. In many cases, these standards already exist, but are likely to evolve as new technologies and resources become available."}]},{"head":"There is no suitable repository for my type of data. What can I do to provide data access?","index":13,"paragraphs":[{"index":1,"size":32,"text":"Contact the relevant CRP data management officer for assistance in this situation. Ensure that your data is stored and backed up and is accessible by your research group in the first instance."}]},{"head":"Does this policy mean that I must make my data available immediately, even before publication?","index":14,"paragraphs":[{"index":1,"size":20,"text":"Not necessarily. The expectation is that all data will be made available within 12 months of completion of data collection."}]},{"head":"What are CGIAR expectations regarding the release of data that include sensitive information (e.g., personal information about individuals or price-sensitive data)?","index":15,"paragraphs":[{"index":1,"size":74,"text":"Any data sharing is subject to the legal rights and legitimate interests of stakeholders and third parties, including intellectual property rights, confidentiality, sensitivity (including price and politically sensitive information) and privacy. Therefore, such data should be stored and protected in accordance with appropriate standards for protecting privacy rights and maintaining the confidentiality of respondents. Within legal constraints, what constitutes reasonable data access will be determined by the research group through the process program management."}]},{"head":"My data include information of potential commercial value. Am I required to make that information available?","index":16,"paragraphs":[{"index":1,"size":90,"text":"Not necessarily. Please refer to the CGIAR Principles on the Management of Intellectual Assets, which sets out details of where certain restrictions may be sought. It is CGIAR's strong expectation that researchers will share with other researchers, at no more than incremental cost and within a reasonable time, the primary data, samples, physical collections and other supporting materials created or gathered in the course of CRP work. However, it may also be necessary to protect intellectual property rights by reference to the CGIAR Principles on the Management of Intellectual Assets."},{"index":2,"size":43,"text":"8. If data or samples are requested before I have completed all analyses on them, must I share them? Not necessarily. The expectation is that all data will be made available after 12 months, which is the default period of exclusivity for researchers."}]},{"head":"What is a digital repository?","index":17,"paragraphs":[{"index":1,"size":30,"text":"A 'digital repository' stores, maintains, and disseminates digital materials for a given community. Some communities are organised by subject (e.g. Cassavabase) while others are organised by institution (e.g. ICRISAT's repository)."},{"index":2,"size":25,"text":"The repository provides online archival storage -usually open access-and cares for digital materials, ensuring that they remain readable for as long as the repository survives."}]},{"head":"Why would I put my data in a digital repository?","index":18,"paragraphs":[{"index":1,"size":60,"text":"1. Raise the impact of your research. Digital repositories allow you to make data easily accessible to more people than ever before. The more people who can use your data, the more public good it can do and the more it can do to enrich your field of research. Open online access makes new collaborations and uses of data possible."},{"index":2,"size":47,"text":"2. Raise your research profile. The more other researchers cite your data, the more they will understand your work. As the trend toward online open access rises, the prestige associated with data citations is growing. In addition, making data available can increase the credibility of your analyses."},{"index":3,"size":56,"text":"3. Keep your data safe and readable in the long term. Many repositories store and back up your research products and will, if appropriate file formats are used, attempt to move the data into new file formats as the original formats become obsolete. So long as the repository exists, your materials will remain readable and usable."},{"index":4,"size":47,"text":"4. Your funder may require it. This is more and more common. You can find summary of funders' open access requirements using the SHERPA/JULIET database. Even if your funder does not require that you deposit your data, a plan to deposit your data may strengthen your grant."},{"index":5,"size":21,"text":"11. I worked hard to collect this data! Doesn't this give someone else the chance to use my data before me?"},{"index":6,"size":78,"text":"There is definitely a trade-off. Depositing in a repository is a way of publishing your digital materials as well as maintaining them. You can submit your data at the end of a project (when it is easiest to pull the data together) but embargo (restrict access) its release for 12 months. It may be possible to store part of a set of materials publically and will maintain the other, more proprietary parts while keeping them hidden and inaccessible."}]}],"figures":[],"sieverID":"f37678ed-0257-4378-bda2-2810497ffa44","abstract":"and Data Management Policy (the Policy) FAQs 1. What is open access?Open access means the immediate, irrevocable, unrestricted and free online access by any user worldwide to the information products produced by CGIAR, and unrestricted re-use of content (which may need to be restricted to non-commercial use and/or granted subject to appropriate licences in line with the CGIAR IA Principles), subject to proper attribution.For example, an open access publication is one that is free-to-view for all users to, subject to attribution of authorship. Specifically, a complete version of the work and associated permissions should be deposited in a standard electronic format in a suitable online, open access repository immediately on publication."}

data/part_1/04880b087ff0efcc045d1688de37d205.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04880b087ff0efcc045d1688de37d205","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/06a56a21-b667-48de-b790-15c86aaee24a/retrieve"},"pageCount":32,"title":"","keywords":["Baseline","Ethiopia","village study","participatory mapping","organisations","access to information CCAFS consultant, Theme 4.2 and East Africa region","International Livestock"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":110,"text":"The CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS) is a strategic ten-year partnership between the Consultative Group on International Agricultural Research (CGIAR) and the Earth System Science Partnership (ESSP) to help the developing world overcome the threats posed by a changing climate, to achieving food security, enhancing livelihoods and improving environmental management. In 2010, CCAFS embarked on a major baseline effort at household, village and organisation levels across its three target regions, namely East Africa, West Africa and South Asia (more information about CCAFS sites is available on our website http://ccafs.cgiar.org/where-we-work). CCAFS trained survey teams from partner organizations in the three regions to conduct the baseline."},{"index":2,"size":159,"text":"The baseline effort consists of three componentsa household survey, village study and organisational survey. The household baseline survey, a quantitative questionnaire on basic indicators of welfare, information sources, livelihood/agriculture/natural resource management strategies, needs and uses of climate and agricultural-related information and current risk management, mitigation and adaptation practices, was implemented by CCAFS partners in 35 sites (245 villages) with nearly 5,000 households in 12 countries to date. CCAFS partners are implementing village baseline studies (VBS) and organisational surveys in one out of the seven villages within each CCAFS site where the household survey was implemented. The plan is to revisit these villages in roughly 5 years, and again in 10 years, to monitor what changes have occurred since the baseline was carried out. The goal is not to attribute these changes to the program, but to be able to assess what kinds of changes have occurred and whether these changes are helping villages adapt to, and mitigate, climate change."},{"index":3,"size":68,"text":"The focus of this site analysis report is the village baseline study (VBS). To date, fifteen VBS were conducted in the three CCAFS regions. The VBS aims to provide baseline information at the village level about some basic indicators of natural resource utilisation, organisational landscapes, information networks for weather and agricultural information, as well as mitigation baseline information, which can be compared across sites and monitored over time."},{"index":4,"size":9,"text":"The objectives of the village baseline study are to:"},{"index":5,"size":103,"text":" Provide indicators to allow us to monitor changes in these villages over time. In particular, changes that allow people to o Manage current climate risks, o Adapt to long-run climate change, and o Reduce/mitigate greenhouse gas emissions  Understand the enabling environment that mediates certain practices and behaviours and creates constraints and opportunities (policies, institutions, infrastructure, information and services) for communities to respond to change  Explore social differentiation: o Perceptions of women and men will be gathered separately to be able to present different gender perspectives. o Focus group participants will be selected to present perceptions of groups differentiated by age."},{"index":6,"size":34,"text":"The detailed tools and guidelines used for the implementation of the village baseline study across all CCAFS sites, as well as the manuals, data and analysis reports can be accessed on our website (http://ccafs.cgiar.org/resources/baseline-surveys)."},{"index":7,"size":160,"text":"This report presents the results of the VBS conducted on August 10 to 12, 2011 in the village of Denbela Saden, in the CCAFS benchmark Yabello site, Ethiopia (Map 1). The village geocoordinates are 4.797; 38.341. Denbela Saden village was chosen for the baseline survey because of its relative central location in the block. The survey team was composed of two facilitators, two note takers and two translators. Each pair was male and female. Two groups, composed respectively of 15 men and 15 women, were chosen to allow for collection of gender-differentiated information. The groups met during three consecutive days, with different participants joining each day. On the first day of the survey, the team explained the rationale and approach of the survey to the whole community, and provided a summary of the results of an earlier household survey organized by CCAFS. On the third day the team provided a summary for whole community on the findings of the survey."},{"index":8,"size":219,"text":"On day one the team introduced the participants to a satellite image of the block and worked with each group to identify and map/sketch resources that are important to the community, their current state, their past state and what caused the changes. The groups dialogued about the resources among each other until they arrived to a consensus, and then drew diagrams on the floor using chalk, which were then transferred to paper. On day two the team worked with each group to understand the organisational landscape and the links that exist between the organisations in terms of food security in a normal year and in a year of crisis, and in relation to natural resource management. The outputs were diagrams showing the organisational landscape, again drawn on the floor and then transferred to paper as diagrams. Information on each organisation was captured in cards. The links between the organisations were shown using lines and arrows on the diagrams. On day three, the team worked with each group to understand information networks in relation to weather and farming activities, and summarized the information in tables. The team joined the two groups and facilitated their verbalization of what the community would envision their village to be like in the future. The output was a map/sketch showing \"the vision of the community.\""},{"index":9,"size":51,"text":"The following paragraphs provide a summary of some of the results of the CCAFS household baseline survey carried out in the Borana site in Arero and Yabello Weredas in four Pastoral Associations and 7 villages, with 140 households. This summary was shared with the Denbela Saden village on the first day."},{"index":10,"size":172,"text":"All the respondents were from one single ethnic group called Borana Oromo. Roughly half of the household survey respondents were male. The mean household size was 7 persons. Over 70% of the households have more than 60% of their members within working age. Ninety six percent of the households produced and sold livestock and livestock products. More than half kept 3 types of animals, including cattle, sheep, goats and/or camel. Eighty percent of the households had less than 20 heads of cattle, 13% had 21-50 heads, and the remaining had 51-100 cattle. More than a third of the respondents had camels. More than half of the surveyed 140 households own one or more chicken which have become a source of cash in particular for women. About 93% of households have farmlands and half of them cultivated two main crops, maize and beans. Women and men equally share the responsibility for livestock and agricultural production. On average each household cultivated less than 2 ha. Off-farm sources of livelihood, including cash, are very limited."},{"index":11,"size":107,"text":"For 5 months, from June to October, the households obtained food from their own farm and herd. For the 7 remaining months (November to May) the households obtained 60-90% of their food from outside sources. November to April is a period of serious food shortage when households struggle to feed their family members. According to the food security index only 6 households out of the 140 interviewed (4%) have food for 10 months and 2 households (1.4%) are food-secure all year round. The rest (132 households or about 95%) are food secure for less than 6 months. This indicates how food insecure pastoralists in this area are."},{"index":12,"size":95,"text":"Soil and water management is not a common practice, and very few households planted trees deliberately. Use of inputs such as improved seeds is uncommon. The system is livestock dependent and 84% of the respondents have purchased veterinary medicines over the 12-month period. The pastoralists are asset poor except for livestock, but allocate their resources differently. Three households owned bicycles, and 1 owned a mechanical plough, but at the same time 26 households owned radios, and 42 households owned cell phones. Two households had bank accounts. The households that owned resources were predominantly male-headed households."},{"index":13,"size":37,"text":"Availability and access to modern climate and weather information was limited. Over 63% of the respondents received some kind of weather/climate related information over the year, but 75% of them received the information from an indigenous system."}]},{"head":"Data analysis","index":2,"paragraphs":[{"index":1,"size":7,"text":"Topic 1: Community resourcesparticipatory satellite imagery interpretation"},{"index":2,"size":95,"text":"Community infrastructure and resources and gender-differentiated access and utilisation of those resources have been analysed, based on a process of participatory visual interpretation of high resolution satellite imagery (RapidEye). The aim was to create a basic understanding of existing community resources, as well as of community dynamics in relation to its environment. The participants discussed the current state of those resources, in terms of quality, access, management, history and potential drivers of change. Another group developed an image of village resources and human well-being into 2030 to understand opportunities, constraints and aspirations for the future."},{"index":3,"size":27,"text":"The detailed approach to this exercise is outlined in the CCAFS Village Baseline Study Implementation Manual (follow the link to the baseline study from our website http://ccafs.cgiar.org/resources/baseline-surveys)."}]},{"head":"A. Current resources","index":3,"paragraphs":[{"index":1,"size":128,"text":"Separate groups of men and women drew maps on the ground outlining the main landmarks in the village, including the natural resources and infrastructure (road, school, etc). The resulting sketches were transferred onto flipcharts. The CCAFS team then placed the satellite image on a wall facing the participants, and asked them to point out their village and current location on the image. Once the participants established their bearings on the satellite image, the team positioned a piece of tracing paper on top of the satellite image, asked the participants to identify on the satellite image the landmarks they had previously drawn on the ground, and recorded those landmarks on the tracing paper (Photo 1). The resulting maps of current community resources are shown below (Maps 2 and 3)."},{"index":2,"size":205,"text":"The team invited the participants to discuss the main resources in the area. These included roads, schools, markets, health centres, forests, agricultural land, grazing land, natural resources, and water sources for drinking or livestock. Questions were made on the state of management of the land in the community, i.e. whether they were community-managed areas, degraded areas or protected areas. A summary of the discussion on the resources available in the community is presented in Denbela Saden is located in a grass and scrub habitat, lying on semi-arid area. The area is known as rangeland. Only a small portion of the rangeland is devoted to crop production and the crop lands are fragile and opportunistic. Its population is predominantly Borana engaged in pastoralism herding cattle, shoats and camel. The rainfall in the area is low and scanty and more prone to frequent drought. The land is generally subjected to soil erosion. What is termed 'forest' in the area is dense scrubland or riverine clusters of trees. Trees provide wood fuel and construction material. Trees contribute to soil moisture retention and improve the microclimate of the locality where they are found. The trees also act as a windbreak. All community members have free access to the trees."},{"index":3,"size":42,"text":"During the dry seasons, the community harvests acacia tree leaves and pods and feed them to the animals. The community realizes that some trees grow where there is water, and also uses this as a guide to locate their traditional water points."},{"index":4,"size":108,"text":"Grasslands form the dominant vegetation type and are communally owned and managed for grazing livestock, which is the mainstay of the community. The quality of the pasture/grass is managed through enclosures that are located at selected points including Burbus, Hange, and Qaa Rikatota. Large enclosures are managed by 5 or 6 villages that form a cluster, but there are also small enclosures owned individually, especially along the cultivated fields near the encampments that are locally referred to as 'Olla.' In the past, the enclosures were used to provide pasture for the young and weak/sick livestock but today they are mainly viewed as a form of range management practises."},{"index":5,"size":129,"text":"The quality of pastures has deteriorated over time as a result of encroachment by bushes. Hence, organisations working with livestock contribute resources towards bush clearing within the enclosures. A portion of the livestock from the village move out with a few members of the household, although movements are more restricted these days due to population pressure and proliferation of settlements. In the past the whole community moved but over time this practice is becoming less and less frequent due to increase in population, settlements and conflicts. The women of Denbela Saden indicated that they had not moved in the last 30 years. Only a few members of the household (mainly men) and the livestock moved in search of water and pasture and then came back when the conditions improved."},{"index":6,"size":90,"text":"There are ponds (locally called \"dams\") near the community from which the community in Denbela Saden draws water. The ponds are Hayaguracha and Harbule. The ponds are good for livestock and human use but have low quality and are accessible at a fair distance. The water from these sources is not sufficient enough for human and livestock throughout the year. There are also water tanks that are owned and managed by wealthy individuals. There are few owned by the community. The area around the water points is covered with trees."},{"index":7,"size":132,"text":"Crop farming is done along valley beds-locally termed \"labu\"-that have fertile alluvial soils that also retain moisture longer than the other parts of the landscape. Pastoralists grow maize and beans, and are currently doing trials on teff. Trees/bush are cut down for cultivation and bush control. This creates more land conducive for pasture growth. Cultivation is dependent on rainfall, and the rainfall is neither adequate nor reliable, and so the crop fields generally yield very little and are often subject to crop failure. Food production is intended primarily for home consumption, but some of it is also sold to supplement pastoral production. Crop residue is used to feed animals. The land is owned and managed communally through a traditional system but is cultivated individually. The heads of cluster (Arda) allocates individual farms."},{"index":8,"size":33,"text":"The Borana are pastoralists who move from time to time in search of pasture. Their lifestyle is governed by a strong traditional system named \"Gada\". All clans are represented in the Gada system."},{"index":9,"size":73,"text":"In this system, age-based classes (partilines) succeed each other every 8 years in assuming political and ritual responsibilities. The system applies to all Borana irrespective of the nation in which they fall, and thus is found in Kenya and Ethiopia. The Abba Gada, the traditional head of the Borana, works with a council of elders who make rules on grazing and water issues, as well any other issues that pertains to the community."},{"index":10,"size":209,"text":"The Borana live in encampments made up of homesteads. Several encampments or \"Olla\" make up a village, common grazing and watering which is locally called an \"Arda\" or \"Rera\". Several villages, in turn, form a \"Mada\"; one or more Mada forms a PA which the government recognizes as a Pastoral Association (PA) and the lowest level of government representation. Denbela Saden, where the survey was implemented, is one \"Mada.\" Several Mada or PAs make up a \"Woreda\" such as Yabello/Arero, and several Woreda make up a 'Zone' such as Borana. Finally, several zones make up a 'Region' such as Oromia. The terms Woreda, Zone and Region are used by both the traditional system and the government system to mean the same area. The \"Olla\" has thatched houses, which are better than the structures they used to live in earlier. It has a perimeter protection. All the livestock sleep within the confines of the \"Olla.\" The calves are kept inside thatched houses to keep them warm at night. The houses belong to individuals but the village head (Abba Olla) manages the encampment. The structure of their human settlements provides them with several opportunities such as protection for their animals from wildlife and enhanced collective action for welfare and community development."},{"index":11,"size":39,"text":"There is a hill in the area from where the community obtains stones and gravel for construction, as well as pasture for livestock. It is located at Bulehersogido and publicly owned. It takes 2.5 hours to walk to it."},{"index":12,"size":58,"text":"There are only two significant roads to the villageone to Gada (adjacent village) and another to Arero Woreda/Districtwhich the government manages and are in relatively good condition. The roads allow access to services and goods including veterinary and health services. The roads are not paved and thus deteriorate in the rainy season. They do not have good bridges."},{"index":13,"size":86,"text":"There are few schools in the area including one at Hawatu and another at Denbela Abbachana. The school at Harwatu was with mud walls and thatched roof, and is 1 hour 30 minutes on foot away from the village. The community owns it, but the government and a committee from the community manage it jointly. The school has an enclosure with grass that is cut to be sold to buy furniture. The children and the elderly use the school to learn how to read and write."},{"index":14,"size":75,"text":"There are 2 markets, respectively at Denbela Abachana and Kelkelchwaro, which have a limited choice of basic goods and services. People must move to larger market centres such as Yabello to obtain higher-level goods and services. Markets supply food, household items, livestock, health services, veterinary services and employment, as well as access to transport. They are places where people go to obtain and exchange important information regarding peace conditions, market prices, weather, pasture availability, etc."}]},{"head":"B. Gender-differentiated comparison of current conditions","index":4,"paragraphs":[{"index":1,"size":50,"text":"Cultivation of crops in the \"labu\" was discussed by both groups who agreed that soils in the \"labu\" were very fertile. The men raised the issues of income generation and food security as reasons for continued cultivation. The women on the other hand were concerned about frequency of crop failure."},{"index":2,"size":30,"text":"Trees grow in clusters along valley bottoms and other favourable locations. Both men and women groups identified them as a source of fodder for livestock and as providing environmental benefits."},{"index":3,"size":84,"text":"The men identified water conservation as the environmental benefit while the women identified shielding them from the wind as an environmental benefit of trees. The men raised many issue linking trees to water while women discussed trees as a source of building material and wood fuel. Both groups discussed grasslands as the pastureland and the significance of the enclosures especially for the young and the ailing livestock during periods of drought. Map 4 below compares the current resources identified by male and female participants."}]},{"head":"C. Major changes of resource conditions","index":5,"paragraphs":[{"index":1,"size":114,"text":"Participants were asked to consider the resources they had in their community, to discuss the history of land use, and to identify major changes that had occurred in the landscape in the past 10 years. In addition, they were invited to examine how the resources got to the current condition and the major drivers of those changes; as well as the opportunities and constraints into the future. In the following pages the results of those discussions are summarized both on maps traced on top of the satellite images for the village (Maps 5 and 6), and Table 2 that includes the major changes and drivers of change, as perceived by male and female participants."},{"index":2,"size":236,"text":"Map 5. Major changes in resources (comparing past and present) for men Map 6. Major changes in resources (comparing past and present) for women Government policy to permanently settle pastoralists and lack of agricultural extension services related to cultivation combined with population growth and drought have been the most important drivers of change in the area. Until 20 years ago, most people were mobile pastoralists who depended almost exclusively on livestock products for their livelihood security. There were very few crop farmers in the area. Then, drought made pastures scarce and people were unable to feed their livestock. Pasture was traditionally considered a critical resource because it provided feed for livestock and almost all food and income for people. To address food insecurity, the government discouraged itinerant migration, and encouraged people to settle in selected areas. At the same time, the government adopted a policy that supported the opening up of the area, and engaged in construction of new roads. All of this resulted in the creation of villages that increased the stress on pasture in the surrounding area. People started supplementing livestock products with crops as sources of food and income, and soon all households were engaged in crop production. Over time increases in population consolidated sedentary living because most areas became claimed and there was less free space to move about. More education and urbanization have led to more exposure and acceptance of change."},{"index":3,"size":111,"text":"Today the household economy is dependent on pastoral resources and crops. The change, however, tends to be at the expense of pastures and pastoralism. Crop fields and human settlements are constantly encroaching on grazing fields. Likewise, forests in the valleys have been cleared to make way for cultivation. Bushes and thickets were restricted to some area in the past. Traditionally people used fire to control bushes. The government banned bush burning, which allowed the bush to invade the grazing fields. The government has now accepted that burning should be reintroduced but there are ecological challenges that hinder implementation. So today there are more bushes and less pasture than in the past."},{"index":4,"size":67,"text":"The pasture area is shrinking, which is resulting in livestock overstocking and overgrazing relative to the area available, and significant soil erosion, which in turn have resulted in deterioration of the quality of pastures. Livestock production and grazing fields are still critical for livelihood security in the area. Pasture management has become more necessary than in years past, and as a result there are more enclosures today."},{"index":5,"size":30,"text":"Tragically, bushes are sometimes not considered a critical resource. Bushes, which are of little grazing value, are perceived as a nuisance, particularly if they are located in the grazing fields."},{"index":6,"size":18,"text":"Community resources are spent to reduce these nuisance bush and shrub populations and improve the quality of pasture. "}]},{"head":"D. Vision of the future","index":6,"paragraphs":[{"index":1,"size":91,"text":"With a mixed group of men and women, the goal was to develop an image of village resources and human wellbeing into 2030 to understand the opportunities and constraints, as well as aspirations for the future. This exercise built upon all the work completed in the previous sessions. In addition, the exercise took into account the photographs of the landscape, including things they are proud of and things that need to be improved upon in the future, that a group of young people had produced following instructions given on day 1."},{"index":2,"size":40,"text":"In the section below we include the map that encapsulates Denbela Saden village's vision of the future (Map 7). We also include a few of the photographs taken by the youth. These images operationalize the collective vision of the future."},{"index":3,"size":87,"text":"Map 7. Future map of the community Both men and women established that the valley beds (\"labu\") presented an opportunity because it allowed cultivation of crops to supplement pastoralism. The \"labu\" is an area where the water table is high and shallow wells are often dug within it. It also has more vegetation, which the livestock browse on. The men identified opportunities for irrigation using the water pans. The women established that during dry seasons the forests /bushes are an opportunity because animals feed on acacia trees."},{"index":4,"size":62,"text":"Both men and women identified the opportunities presented by the expanded infrastructure, which improved access to goods and services especially human and animal health services. Markets and trading centres facilitate exchange of goods and services close to the community. The men identified an opportunity in the settlements/encampments design, which provides protection for their animals and promotes collective action by the community members."},{"index":5,"size":47,"text":"Both men and women identified as a limitation the fact that the grasslands were under stress by the lack of control of grazing. All community members had open access to the grazing fields. They also identified the invasion of the rangeland by woody species as a limitation."},{"index":6,"size":56,"text":"Both the men and women identified the rudimentary state of infrastructural development as a major limitation. The men identified the low productivity of the land and the low numbers of water pans/dams as limitations. The women identified as a limitation the fact that cultivation is dependent on rainfall and the rainfall is neither adequate nor reliable."}]},{"head":"Topic 2: Organisational landscapes","index":7,"paragraphs":[{"index":1,"size":114,"text":"This topic aims to show evidence of organisational capacities that help address food security and manage resources. This will inform CCAFS about how prepared the village is to respond to the challenges envisaged as a consequence of climate change or other future challenges and to engage with CCAFS partners at a collective level. Specifically, this section presents the different formal and informal organisations involved in the community in general terms, as well as with respect to food security in different situations (i.e. average and crisis conditions), and natural resources management (NRM). It also elaborates on what types of activities the organisations are engaged in, who their members are, whether the organisations are useful, etc."}]},{"head":"A. Basic spheres of operation","index":8,"paragraphs":[{"index":1,"size":113,"text":"Participants were asked to draw three large concentric circles on the ground. The inner circle would represent the community, the middle circle the locality and the outer circle beyond the locality. Participants were then asked to name organizations working in the area, whose names were written on cards, and place the cards in the appropriate circle. Thus, the group placed in the inner circle the cards of organizations that worked in the community, in the middle circle the cards of organisations operating in the locality, and in the outer circle those that operated beyond the locality (see Photo 2). The results are shown in the images that are displayed in the following pages."},{"index":2,"size":37,"text":"Results from the survey indicate that there are a total of 16 organizations working in the Photo 2. Organisational landscape as created by the men's group Organize the people and works with safety net. Facilitates bush clearing."}]},{"head":"Open to both men and women","index":9,"paragraphs":[]},{"head":"State Locality","index":10,"paragraphs":[]},{"head":"B. Organisational landscape of food security","index":11,"paragraphs":[{"index":1,"size":33,"text":"The goal of this exercise was to get an improved understanding of how the organisational landscape contributes to the food security of the group. Food security is mostly measured at the household level."},{"index":2,"size":53,"text":"Nonetheless, community-level organisations and interactions influence the food security of different groups within the community differently. Male and female participants were asked to discuss the concepts of food availability, access and utilization, and then review each organisation they had previously identified by asking which of them had activities that fell under these categories."},{"index":3,"size":203,"text":"The women's group identified 8 groups/organisations that addressed food security in one way or another while the men identified 6. In total 69% of the groups (11) were involved in food security. Of the groups identified by women, 4 operated within the community, 2 within the locality and 2 beyond the locality. Among the groups identified by the men only one operated within the community, none within the locality and 5 beyond the locality. The pattern created by women is the ideal one with more actors at the community level and fewer beyond the locality. The pattern created by men is the inverse and is not appropriate. However what emerges after the combination of the two groups is the reality on the landscape: 4 groups within the community, 2 in the locality and 5 beyond the locality. Different aspects of food security were addressed at different levels. Out of the 16 groups identified, 8 addressed food availability, 6 focused on food access and only one dealt with food utilisation. The area has been described by its government as a chronically food insecure area therefore it is logical that more than half the groups /organisations in the area be engaged in addressing food security.  "}]},{"head":"C. Organisational landscape of food crisis situations","index":12,"paragraphs":[{"index":1,"size":50,"text":"The purpose of this exercise was to understand how organisations help people to cope in times of food crisis. Participants identified a food crisis situation that they all remembered (e.g. a bad year or the lean season), and discussed how the organisational landscape of food security operated in that situation."},{"index":2,"size":153,"text":"The men identified a change in the organisational landscape during food crisis while the women did not. The men identified 3 groups/organisations that engaged with the community during food crisis. One operated in the community while 2 operated beyond the locality. They addressed food availability by bringing in food, food access by providing the community with money and food utilisation by providing the community with nutritional supplements especially for the young. No links were identified among those organisations (Figure 5). In total 10 out of the 16 groups were involved in natural resource management. The men identified 4 organisations engaged in natural resource management. Three of them operated beyond the locality and one within the community. The groups that men identified engaged respectively in protection of endangered tree species, protection of wild animals from hunting for bush meat, water conservation and management, soil and water conservation, and rehabilitation of degraded lands for grazing."},{"index":3,"size":118,"text":"The women identified 7 groups involved in natural resource management. Four of those groups operated within the community, 2 beyond the locality and 1 within the locality. Groups identified by women engaged in two broad types of foci: provision of pasture for animals and water access for humans and livestock. Activities pertaining to livestock feed included management and grass growth promotion (2 groups), provision of machines to cut and store grass to give animals during draught seasons; provision of relief grass (hay) to feed animals; facilitate clearing of unwanted bushes that inhibit growth of grass (2 groups), and fence enclosures. Activities related to water access included management of dams/ponds and digging ponds to provide the community with water."},{"index":4,"size":188,"text":"There is a high level of community participation in natural resource management as evidenced by the many groups active on the subject within the community. This improves the chance of adoption and sustainability of interventions. Groups beyond the locality are often organisations with significant financial and technical capacity that can therefore contribute to building the capacity of local groups/organisations and contributing to resources mobilisation. Overall, the study identified 4 organisations that operated within Denbela Saden village, 2 within the locality and 10 beyond the locality constituting 25%, 12.5% and 62.5%, respectively. The emerging pattern is not appropriate for driving rural development. In the ideal situation there should be more actors in the community and fewer actors beyond the locality, forming a bottom heavy structure. This pattern points to the fact that organisations operating beyond the locality have not succeeded in building local capacity in relation to collective action/group formation. It can also be an indication that this community is vulnerable and relies heavily on external aid. Table 6 summarises information on 4 organisations that CCAFS should consider as potential partners, considering their capacities to contribute to food security."},{"index":5,"size":285,"text":"It is important to keep in mind that two parallel governance systems co-exist in Denbela Saden village, namely the traditional Gada system and the Federal Government system. The links between the government and the traditional system are still fuzzy. The Gada system has enormous capacity to mobilise the community while the Pastoral Association-the lowest unit/institution of Regional government-has capacity to tap into Government resources. At the local level, the challenge is therefore to create a win-win situation where the operations of the Pastoral Association and the Olla are synchronized. Olla is the lowest unit/institution of the traditional Gada system. It coordinates community-level activities and plays a critical role in the management of natural resources. Coordination between the two systems is important, especially if there are instances where the Pastoral Association is more powerful than the Olla. The Oromia Regional Government established the Pastoral Development Department to coordinate development in the pastoral areas of Oromia. It was represented by the Oromia Pastoral Area Development Commission. It works with the cooperative Promotion Commission which is also a regional body charged with matters related to the marketing of livestock. The creation of relevant memoranda of understanding (MOUs) is one way to go in terms of creating a working synergy. Also, the federal government has established a 15-year Pastoral Community Development Programme (PCDP) that supports livelihoods, cooperatives and diversification. This can be a good partner for CCAFS at the Federal level. Table 7 below recapitulates information on all the organizations identified by male and female participants. The organizations are classified according to their role in supporting food availability, access and/or utilization, as well as the provision of relief in times of food crisis, and the management of natural resources."},{"index":6,"size":5,"text":"Topic 3: Networks of information"},{"index":7,"size":54,"text":"The aim of this exercise was to understand the diversity of options people use for accessing information on agriculture and weather, how people take advantage of sources of information available, and if some sources are not used, and why. We wanted to describe networks of how people access and share information within the community."},{"index":8,"size":47,"text":"The men's discussion group identified the following topics about which people seek information to help them make production decisions: the start/end of rainfall; prospect of pasture areas; market prices for livestock and other farm produce; where to access drugs for livestock; drought information; and status of peace."},{"index":9,"size":54,"text":"The women participants highlighted some specific times when men seek information to make production decisions. These times pertained to livestock and crop production, as it could be expected from a community that depends on both approaches. It is significant that the group provided more examples of information on livestock management than on crop management."},{"index":10,"size":16,"text":"Critical times for livestock management decisions as mentioned by the women's discussion group included the following:"},{"index":11,"size":180,"text":" Grazing. They seek information from their fellow herdsmen on the best area to graze the animal.  Tick control. They consult from those who have the spraying machine on the best acaricide available before buying it. They need to decide whether to use acaricide or the traditional method of tick control.  Watering. They get information from fellow herdsmen regarding availability of water from different water points.  Deworming. They seek information on the amount of drugs to give to the animal from those who have used the medicine in the past, and from veterinary agents and pharmacists.  Making enclosures. They consult among themselves in the village before making the enclosures.  Livestock migration. They inquire from their fellow herdsmen on the condition of pasture on other areas before moving out. If they are not sure of the status of pasture, they can even send one of them to scout the areas.  Purchasing fodder. They seek information on sources and price of fodder. If satisfied, they normally sell an animal to get money to purchase the fodder."},{"index":12,"size":16,"text":"Critical times for crop management decisions as mentioned by the women's discussion group included the following:"},{"index":13,"size":74,"text":" Cutting trees for land preparation. They generally use their own judgment before clearing the land but sometimes they seek other persons' opinions.  Planting. They seek information on the best seed available. They also need to know on short season varieties.  Looking after the animals. Inquire from neighbours if there are traces of animals that can destroy their crops or farm.  Harvesting. Before harvesting the crops, they prepare the traditional stores."},{"index":14,"size":43,"text":"Critical times for both livestock and crop management decisions as mentioned by the women's discussion group included the following:  Marketing-They ask people from the market on the prevailing market prices for the commodities. They also get the same information from the radio."},{"index":15,"size":46,"text":"Table 8 shows the most important sources of information in Denbela Saden village. Results of this study indicate that individuals are the most significant source of information on agriculture in the village. The individuals include friends, family and the elderly. Other sources of information in order"}]}],"figures":[{"text":"Figure 3 . Figure 3. Organizational landscape of food securitymen Legend 1 Productivity Safety Net Program (PSNP) 2 Care International 3 Ministry of Education 4 Abba Gada institutions 5 Ministry of Health 6 Gare groups 7 Pastoralist Commission 8 Ministry of Water Development 9 CISP 10 SORDU 11 Wildlife Conservation Agency 12 Ministry of Lands "},{"text":"Figure 4 . Figure 4. Organizational landscape of food securitywomen "},{"text":"Figure 5 . Figure 5. Organizational landscape for food crisismen "},{"text":"Figure 6 . Figure 6. Organisational landscape of NRMmen "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"Table 1 , below. Photo 1. The men's map of current resources as traced over the satellite image  Map 2. Men's  map  of  current  community  resources Map 2. Men's  map  of  current  community  resources  "},{"text":"Table 1 . Summary of current situation, as perceived by men (M) and women (F) Land Land  "},{"text":"cover class Community determined land use Location Names Current state (quality) Time to resource Management and ownership issues Environmental Benefits Opportunities Limitations  Wooded Crop farming,  Affected by soil 1 hour at  Retains soil Supplements WoodedCrop farming,Affected by soil1 hour atRetains soilSupplements valley (M) underground water  erosion most  moisture for the livelihood valley (M)underground watererosionmostmoisture for thelivelihood  harvesting, and     vegetation and besides harvesting, andvegetation andbesides  animal browsing     creates pastoralism animal browsingcreatespastoralism       microclimate  microclimate Bush land (F) Fetch firewood, Along the Unlimited /plenty  It is free and they Act as During dry Bush land (F)Fetch firewood,Along theUnlimited /plentyIt is free and theyAct asDuring dry  building materials valley trees  fetch without any windbreak seasons, women building materialsvalleytreesfetch without anywindbreakseasons, women      restrictions even  feed acacia pods restrictions evenfeed acacia pods      on individual  and leaves to on individualand leaves to      land.  their animals land.their animals Grassland (M) Community grazing Burbus, Hnge Pasture area has 2 hours to Owned by Pasture for Grass for They only open Grassland (M) Community grazingBurbus, HngePasture area has2 hours toOwned byPasture forGrass forThey only open  area  reduced. There is a Burbus and 3 Borana livestock grazing. Stones, specific areas for areareduced. There is aBurbus and 3Boranalivestockgrazing. Stones,specific areas for    lot of encroachment hours to Hnge community  sand and tress use, but there is lot of encroachmenthours to Hngecommunitysand and tressuse, but there is    and erosion on foot though there are  for building. equal chance for and erosionon footthough there arefor building.equal chance for      government  Gum from acacia all to use. Only governmentGum from acaciaall to use. Only      regulations in  and commiphora the weaker regulations inand commiphorathe weaker      case one flouts  for sale to animals are given case one floutsfor sale toanimals are given      the rules  tanning factories priority the rulestanning factoriespriority Grassland (M) Graze land/  They have increased Between 0.5 Enclosures are Emergency Pasture for Grassland (M) Graze land/They have increasedBetween 0.5Enclosures areEmergencyPasture for  enclosures  pastures of better to 1 hours owned and feeds to animals livestock enclosurespastures of betterto 1 hoursowned andfeeds to animalslivestock    quality  managed by during drought  qualitymanaged byduring drought      members of the conditions  members of theconditions      village   village Grassland (F) Grazing field Qaa Rikatota They are currently  Managed by the   Bushes have Grassland (F)Grazing fieldQaa RikatotaThey are currentlyManaged by theBushes have   (the main facing drought and  community   invaded the (the mainfacing drought andcommunityinvaded the   valley) the animals do not     pastures valley)the animals do notpastures    have pasture. Only     have pasture. Only    the young ones have     the young ones have    some feed from the     some feed from the    enclosures     enclosures  "},{"text":"Land cover class Community determined land use Location Names Current state (quality) Time to resource Management and ownership issues Environmental Benefits Opportunities Limitations  Land cover Community Location Current state Time to Management Environmental Opportunities Limitations Land coverCommunityLocationCurrent stateTime toManagementEnvironmentalOpportunitiesLimitations class determined land Names (quality) resource and ownership Benefits   classdetermined landNames(quality)resourceand ownershipBenefits  use    issues    useissues Water pan/ Hill (M) Graze land Haiurachapon, Buleharsogido Diminishing Depends on 2.5 hours Owned and Owned by Source of water Source of stones Restricted to Water pan/ Hill (M)Graze landHaiurachapon, BuleharsogidoDiminishingDepends on 2.5 hoursOwned and Owned bySource of waterSource of stonesRestricted to pond (M)  Har Bule quantity season: 20 managed by community but to the water and gravel for only one pond (M)Har Bulequantityseason: 20managed by community butto the waterand gravel foronly one     minutes to community managed by pan. It  \"traps\" wells, roads and \"kabala\" minutes tocommunity managed bypan. It  \"traps\"wells, roads and\"kabala\"     Haiguracha local rain. house  Haigurachalocalrain.house     pond and 4 administration  construction.  pond and 4administrationconstruction.     hours to Har   Provides pasture  hours to HarProvides pasture     Bule   for the animals  Bulefor the animals Water pan/ pond (F) Roads (M)   Water from the source is enough and good for use market Denbela Abachana In bad condition village to the especially from the 3hrs, 30 min on foot Community manages it Owned and community managed by The area around the water pan is trees covered with services and health Access to services e.g. vet government The bad Dries up during dry season conditions Water pan/ pond (F) Roads (M)Water from the source is enough and good for use market Denbela Abachana In bad condition village to the especially from the3hrs, 30 min on footCommunity manages it Owned and community managed byThe area around the water pan is trees covered withservices and health Access to services e.g. vet governmentThe bad Dries up during dry season conditions Farmland (M) Crop farming Roads (F) To Gada and Arero Soil condition/ fertility still intact since no much Not tarmac but generally in good condition farming is done Less than 30 minutes Owned and managed by individuals Managed by government Crop residue used to feed Improved access to the animals area Quicker access to services and goods Individual It is adversely ownership affected by rain. Does not have good bridges Farmland (M) Crop farming Roads (F)To Gada and AreroSoil condition/ fertility still intact since no much Not tarmac but generally in good condition farming is doneLess than 30 minutesOwned and managed by individuals Managed by governmentCrop residue used to feed Improved access to the animals areaQuicker access to services and goodsIndividual It is adversely ownership affected by rain. Does not have good bridges Farmland (F) Schools (M) Cultivated fields The main valley Qaa Rikatoota, along the labu Abachana Denbela Hawatu and Farms yield very little and are often subject to crop failure due to inadequate rainfall sheet roofing Improved with iron foot minutes on 1 hour 30 The land is administered communally but cultivated committee from individually government and managed by community but Owned by No restrictions read and write elderly learn to Children and Cultivation is rainfall unreliable dependent on Long distance Farmland (F) Schools (M)Cultivated fieldsThe main valley Qaa Rikatoota, along the labu Abachana Denbela Hawatu andFarms yield very little and are often subject to crop failure due to inadequate rainfall sheet roofing Improved with ironfoot minutes on 1 hour 30The land is administered communally but cultivated committee from individually government and managed by community but Owned byNo restrictionsread and write elderly learn to Children andCultivation is rainfall unreliable dependent on Long distance Enclosures (F)  Next to the Protected grass for  5-6 villages form the community Grass covers  Management not Enclosures (F)Next to theProtected grass for5-6 villages form the communityGrass coversManagement not Markets (M)  village Denbela, Abachana, and kelkelch waro the young animals and the weak animals. Enclosures drought. are now open due to Limited good and service choices to and 4 hours 3 hours to Denbela Abachana and community local government a cluster, and they own one enclosure. Owned by community and managed by the soils and protects from No restrictions erosion  very strict on Long distance to access and from the village Markets (M)village Denbela, Abachana, and kelkelch warothe young animals and the weak animals. Enclosures drought. are now open due to Limited good and service choicesto and 4 hours 3 hours to Denbela Abachanaand community local government a cluster, and they own one enclosure. Owned by community and managed bythe soils and protects from No restrictions erosionvery strict on Long distance to access and from the village Settlements/   Current thatched Kalkelchwaro Houses belong to    Settlements/Current thatchedKalkelchwaroHouses belong to encampments   houses are better on foot individuals while    encampmentshouses are betteron footindividuals while (M)   than the structures  the encampment    (M)than the structuresthe encampment    they used to live in  belongs to the    they used to live inbelongs to the    earlier on  village elder    earlier onvillage elder  "},{"text":"Table 2 . Major changes and drivers of change in the last 10 years, as perceived by men and women Land cover Past state Current state Drivers of change Land coverPast stateCurrent stateDrivers of change class    class Grazing Same size but of better Less pasture and now of Overgrazing due to GrazingSame size but of betterLess pasture and now ofOvergrazing due to lands quality with a lot of grass. poor quality. Community overstocking, drought and landsquality with a lot of grass.poor quality. Communityoverstocking, drought and  There were enough pastures created enclosures because population increase. The There were enough pasturescreated enclosures becausepopulation increase. The  for livestock. There was no there is not enough pasture government banned the use for livestock. There was nothere is not enough pasturegovernment banned the use  drought, and animals were available. of fire to control bush. drought, and animals wereavailable.of fire to control bush.  more productive and healthy   more productive and healthy Settlements Simple shelters, whole Permanent settlements. Government policy is Settlements Simple shelters, wholePermanent settlements.Government policy is  community moved Only men move with discouraging migration of the community movedOnly men move withdiscouraging migration of the   animals community. Better education animalscommunity. Better education    and urbanization and urbanization Roads Main road-to Gada-existed There are two roads now, Road to Arero was RoadsMain road-to Gada-existedThere are two roads now,Road to Arero was  on the southern part of the but there are fewer paths constructed by the on the southern part of thebut there are fewer pathsconstructed by the  block. However, it was than in the past government block. However, it wasthan in the pastgovernment  winding   winding Forest The area was covered with Bushes have now grown to Population increase and lack ForestThe area was covered withBushes have now grown toPopulation increase and lack  bushes. There were trees in be trees or thick bushes, and of community control bushes. There were trees inbe trees or thick bushes, andof community control  the valleys area can no longer be used  the valleysarea can no longer be used   for grazing. Forests in the  for grazing. Forests in the   valleys have been cleared to  valleys have been cleared to   make way for cultivation.  make way for cultivation. Watering They used to get water from Less water available than in The government has WateringThey used to get water fromLess water available than inThe government has points same place as today the past intervened to provide water pointssame place as todaythe pastintervened to provide water    for the livestock keepers for the livestock keepers School No school existed in the There are 2 schools Population increase and SchoolNo school existed in theThere are 2 schoolsPopulation increase and  community in the past  government intervention community in the pastgovernment intervention Farmland Most people were All households cultivate. Food insecurity. The crops FarmlandMost people wereAll households cultivate.Food insecurity. The crops  pastoralists, and only a few  provide food to supplement pastoralists, and only a fewprovide food to supplement  were farmers. Cultivation  livestock products. were farmers. Cultivationlivestock products.  started 15-20 years ago due   started 15-20 years ago due  to increased food insecurity.   to increased food insecurity.  "},{"text":"Table 3 . Vision of the future Resources Preferred condition Opportunities Constraints Organisations ResourcesPreferred conditionOpportunitiesConstraintsOrganisations  for 2030   to be involved for 2030to be involved Rangelands Grasslands are strong, Livestock production Control of grazing Community Rangelands Grasslands are strong,Livestock productionControl of grazingCommunity  protected and available  is lacking. Pasture and protected and availableis lacking. Pastureand  to all  is encroached by government to allis encroached bygovernment    bushes.  bushes. Roads There is a tarmac main \"Labu\"  represents  an  Central RoadsThere is a tarmac main\"Labu\"  represents  anCentral  road. There is a bridge opportunity for cultivation  government road. There is a bridgeopportunity for cultivationgovernment  at the valley beds and grazing. It has plenty of   at the valley bedsand grazing. It has plenty of  (\"labu\") water and vegetation   (\"labu\")water and vegetation Water pan There is another water Opportunities for irrigated Inadequate and Community Water panThere is another waterOpportunities for irrigatedInadequate andCommunity  pan in the village, and crop production unreliable rainfall  pan in the village, andcrop productionunreliable rainfall  the existing ones are  result in low crop  the existing ones areresult in low crop  enlarged  yields  enlargedyields Woody Harbour vegetation is During dry seasons livestock  Community WoodyHarbour vegetation isDuring dry seasons livestockCommunity valleys protected and dense is feed on acacia tree leaves.   valleysprotected and denseis feed on acacia tree leaves.   Water would be sufficient for   Water would be sufficient for   crop production   crop production Settlements Stronger settlements Settlements afford better  Community Settlements Stronger settlementsSettlements afford betterCommunity  that include trading access to goods and services,  and that include tradingaccess to goods and services,and  centres protection for livestock and  government centresprotection for livestock andgovernment   community collective action   community collective action Hospital There is one hospital in Improved human health  Central HospitalThere is one hospital inImproved human healthCentral  the village   government the villagegovernment Vet post There is one vet post in Improved animal health  Central Vet postThere is one vet post inImproved animal healthCentral  the village   government the villagegovernment School School has been   Central SchoolSchool has beenCentral  expanded to standard 8   government expanded to standard 8government Water Water supply has been   Central WaterWater supply has beenCentral supply fixed in the village   government supplyfixed in the villagegovernment  "},{"text":"Table 4 . Information on the first five organisations ranked by the men For community groups For community groups  "},{"text":"Table 5 . Information on the first five organisations ranked by the women For community groups For community groups  "},{"text":"Table 6 . Potential CCAFS partners     Organisation Sphere of Activities Strength OrganisationSphere ofActivitiesStrength  operation   operation Abba Gada (Gada Beyond locality Establishing rules Community and resource Abba Gada (GadaBeyond localityEstablishing rulesCommunity and resource system)  and regulations mobilisation system)and regulationsmobilisation Pastoral Community Beyond locality- NRM and food Resource Mobilisation Pastoral CommunityBeyond locality-NRM and foodResource Mobilisation Development National security  DevelopmentNationalsecurity Programme    Programme Pastoral Association Locality Food security Resource mobilisation Pastoral AssociationLocalityFood securityResource mobilisation Abba Olla (Head of Community Food security and Community mobilisation Abba Olla (Head ofCommunityFood security andCommunity mobilisation the village)  NRM  the village)NRM Oromia Pastoral Area Beyond locality Food security and Resource Mobilization Oromia Pastoral AreaBeyond localityFood security andResource Mobilization Development  NRM  DevelopmentNRM Commission    Commission  "}],"sieverID":"a429ffe4-b238-4be7-b14d-e358cc90a21c","abstract":"The detailed tools and guidelines used for the implementation of the village baseline study across all CCAFS sites, as well as the mapping outputs of topic 1 at a higher resolution can be accessed on our website (http://ccafs.cgiar.org/resources/baseline-surveys)."}

data/part_1/04a5a1215bedadcffe86bd96f64c1302.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04a5a1215bedadcffe86bd96f64c1302","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5bb0336a-fd34-4bd8-aa69-daaa0b54f0a6/retrieve"},"pageCount":2,"title":"Community outreach nutrition education materials based on local nutrient-dense underutilized foods for low literate population using linear programming","keywords":[],"chapters":[],"figures":[],"sieverID":"522264b6-f135-477e-a043-c8d51d91495a","abstract":"See document National Committee on food and nutrition security in Bénin where videos and Bioversity International are mentioned several times throughout the document. available at teamspace. 2018: Posters and dissemination workshops held at both community and district-level to build capacity on use of the tools were developed."}

data/part_1/04d94acfdd6fb6a12e780fa84bb4d81e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"04d94acfdd6fb6a12e780fa84bb4d81e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8385edb5-27fd-4e86-acab-1756e7cfebc3/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":75,"text":"The East African highland cooking banana (matooke) is a key source of livelihood for over 13 million farmers in Uganda. The banana fruits all year round -a characteristic that makes it an important income and food security crop. Although farmers grow many banana varieties, only a few are preferred by traders and consumers outside the production areas. The most commonly preferred varieties are Kibuzi, Nakitembe, Musakala and Mbwazirume. The attributes responsible for their popularity are:  "}]},{"head":"MARKET-PREFERRED BANANA VARIETIES","index":2,"paragraphs":[]}],"figures":[{"text":" an output of Expanding Utilization of Roots, Tubers and Bananas and Reducing their Postharvest Losses (RTB-ENDURE) project implemented by CGIAR Research Program on Roots, Tubers and Bananas (RTB) with funding from the European Union and technical Support from IFAD. "},{"text":"sized fingers n Fast maturing, but can also be eaten when not fully mature n Golden yellow, soft and tasty food (Nakitembe has the best flavour according to consumers) MBWAZIRUME, NAKITEMBE KIBUZI n Stout pseudo-stem n Big, compact bunches n Long shelf-life n Hard skin (does not bruise easily) n Makes tasty food with a nice aroma   "},{"text":"soft, tasty food n A few fingers give a lot of food MUSAKALA  1. Mugabi Vicent 1. Mugabi Vicent (Rugaaga-Isingiro) (Rugaaga-Isingiro) [email protected] [email protected] -0702 562669 -0702 562669 2. Enock Lwabulanga 2. Enock Lwabulanga (Dwaniro-Rakai) (Dwaniro-Rakai) [email protected] [email protected] -0701-570877 -0701-570877 3. Sebowa Joseph 3. Sebowa Joseph -0783 205282 -0783 205282 4. Gyavira Musoke 4. Gyavira Musoke -0782 468094 -0782 468094 5. Nsubuga Fred 5. Nsubuga Fred -0772 875783 -0772 875783 6. Kizito Esperito 6. Kizito Esperito -0774 011668 -0774 011668 Contact us Contact us National Agricultural National Agricultural Research Laboratories Research Laboratories [email protected] / [email protected] / [email protected], [email protected], www.banana.go.ug www.banana.go.ug  "}],"sieverID":"54512764-45e4-4ed3-9e5d-a7a4003c5808","abstract":""}

data/part_1/05326d032fc8ec8f498b5d9bdae65992.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05326d032fc8ec8f498b5d9bdae65992","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/9ab51d01-d9d5-449e-ab9b-7922c86a6aae/retrieve"},"pageCount":1,"title":"Avances en el Manejo Integrado de Avances en el Manejo Integrado de Cyrtomenus bergi Cyrtomenus bergi Froeschner(Hemiptera: Cydnidae), Chinche de la Viruela, Froeschner(Hemiptera: Cydnidae), Chinche de la Viruela, en el Cultivo de Yuca ( en el Cultivo de Yuca (Manihot esculenta Manihot esculenta Crantz.) Crantz.)","keywords":[],"chapters":[{"head":"INTRODUCCION INTRODUCCION CICLO BIOLÓGICO CICLO BIOLÓGICO AVANCES EN LA IMPLEMENTACION DEL MANEJO INTEGRADO DE AVANCES EN LA IMPLEMENTACION DEL MANEJO INTEGRADO DE C. C. bergi bergi","index":1,"paragraphs":[{"index":1,"size":56,"text":"Pruebas de campo y estudio de laboratorio sugieren que la preferencia alimenticia de C. bergi puede estar relacionada con los niveles de glucósidos cianogénicos en las raíces de yuca. Adultos y ninfas alimentados con variedades con alto contenido HCN (mayor a 100 ppm) retrazan su desarrollo, reducen su producción de huevos y se incrementa la mortalidad."},{"index":2,"size":93,"text":"Riis (1997) mostró que la oviposición sobre clones con un CNP (potencial cianogénico) menor de 45 ppm (peso fresco) fue mayor que en clones con un CNP mayor a 150 ppm. Estudios adicionales indican que los instares tempranos son más susceptibles al potencial cianogénico de las raíces debido a la longitud de su estilete, con el cual alcanza a alimentarse solo de la corteza, el cual se demuestra el mayor contenido de cianógenos, como ocurre en la variedad CMC-40. Del tercer a quinto instar se alimentan directamente del parénquima (Bellotti & Riis, 1994)."}]},{"head":"Evaluación de Evaluación de Entomopatógenos Entomopatógenos","index":2,"paragraphs":[{"index":1,"size":117,"text":"El potencial para el control biológico de C. bergi está siendo investigado y estudios recientes con nemátodos y hongos entomopatógenos indican una posible solución. Sin embargo, estas investigaciones se han realizado bajo condiciones de laboratorio/invernadero, siendo necesaria la fase de campo antes de recomendarlas como tecnologías aplicables. Evaluaciones realizadas en laboratorio con dos de las tres cepas nativas, LFR92 y SQC92 por Barberena & Bellotti (1996), mostraron que las dos razas parasitaron todos los estados del chinche. El parasitismo más bajo se presentó en ninfas de primer instar con un 65% con ambas razas y el estado más susceptible, el quinto instar con un 90 y 100% para SQC92 y LFR92 respectivamente, 10 días después de inoculado."}]},{"head":"Nemátodo","index":3,"paragraphs":[]},{"head":"Hongos Hongos E Entomopatógenos ntomopatógenos","index":4,"paragraphs":[{"index":1,"size":43,"text":"Sánchez & Bellotti (1997), evaluaron el potencial de 15 aislamientos de hongos de tres especies, 13 cepas de Metarrhizium anisopliae, Beauvería bassiana y Paecilomyces lilacinus sobre adultos de C. Bergi, siendo las cepas de M. anisopliae las más virulentas sobre los estados ninfales."},{"index":2,"size":52,"text":"Las tres especies de M. anisopliae más promisorias para el control de C. bergi fueron 9236 (origen desconocido) con 84% de mortalidad sobre ninfas de quinto instar después de 8-12 días de inoculado, seguido por las cepas 9501 (C. bergi) y 9206 (Aenolamia reducta) con un 70 y 62% de mortalidad respectivamente."},{"index":3,"size":60,"text":"Resultados preliminares muestran tres cepas de M. anisopliae como las más patogénicas sobre ninfas de quinto instar con un 65, 58 y 57%, seguido por Paecilomyces sp. con un 56% y B. bassiana con un 55%. Comparado con el 55% de mortalidad en adultos con las tres especies de hongos en un período de 15 días (Bellotti et al., 2001)."},{"index":4,"size":51,"text":"El objetivo final de estas evaluaciones es la obtención de las mejores cepas para el control del chinche de la viruela y el desarrollo de un producto comercial disponible a los productores en las diversas regiones geográficas donde C. bergi está causando pérdidas económicas en cultivos comerciales (Bellotti et al., 2001)."}]},{"head":"ADULTO NINFAS Ministerio de Agricultura y Desarrollo Rural MADR CONCLUSION CONCLUSION","index":5,"paragraphs":[{"index":1,"size":83,"text":"Los proyectos MIP en yuca son pocos y la decisión de realizar guías y estrategias requeridas para una apropiada implementación de opciones de control aún no están disponibles para los pequeños agricultores (Bellotti et al., 1999). Esto es fuertemente sentido en sistemas intensivos donde la implementación de un MIP, basado en el control biológico y resistencia varietal, es decisivo para el mantenimiento de un agrecosistema sostenible tanto económico como ambiental (especialmente en el Neotropico donde existe un gran complejo de artrópodosplagas y enfremedades)."}]},{"head":"REFERENCIAS REFERENCIAS Control Botánico Control Botánico","index":6,"paragraphs":[{"index":1,"size":61,"text":"La evaluación del cultivo intercalados de yuca con la leguminosa Crotalaria juncea, redujo el daño en las raíces a menos de 4% comparado con el 61% de daño en monocultivo. Sin embargo, el rendimiento de la yuca se redujo en un 22% por lo que la adopción de esta tecnología fue rechazada por los agricultores (Riis, 1990, Vargas et al., 1986)."},{"index":2,"size":162,"text":"Las poblaciones de C. bergi están presentes en el suelo a través de todo el ciclo de cultivo causando daño en un 70-80% del total de las raíces y una redución del 50% en el contenido total del almidón. Riis (1990) mostró que con poblaciones cercanas a cero el 22% de las raíces presentaban daño. Estimándose que con el 20 -30% de las raíces afectadas se presenta el 100% de pérdida comercial (Arias & Bellotti, 1985) Riis et al (1997) evaluaron el potencial de resistencia/tolerancia a C. bergi en 33 clones y 14 progenies de yuca con niveles de bajo, intermedio y alto potencial cianogénico, bajo condiciones de campo. Además de 161 variedades de bajo CNP (menor de 50 ppm de HCN peso fresco). Seleccionando 15 variedades con bajo contenido de CNP que mostraron resistencia/tolerancia. El empleo potencial de esta resistencia varietal requiere investigaciones adicionales de comportamiento de la plaga e identificación de los mecanismos bioquímicos y genéticos involucrados en la resistencia/tolerancia."},{"index":3,"size":36,"text":"Actualmente se está evaluando la patogenicidad y virulencia de 35 cepas de hongos nativos de Metarrhizium anisopliae, Beauvería bassiana y Paecilomyces sp. en condiciones de laboratorio sobre adultos y ninfas de C. bergi en suelo estéril."},{"index":4,"size":10,"text":"Centro Internacional de Agricultura Tropical International Center for Tropical Agriculture"}]}],"figures":[{"text":" & Bellotti, 1995) realizaron un reconocimiento de nemátodos nativos asociados a C. bergi en ocho localidades de Colombia. Se recuperaron tres cepas de la especie nativa, identificada por G. Poimar como Heterorahbditis bacteriophora (SQC92, LFR92 Y SC93). Actualmente esta especie está siendo redescrita por la taxónoma Patricia Stock, de la Universidad de Davis, California, como una nueva especie del género Rhabditis (comn. Pers. Stock P., 2001). "}],"sieverID":"c84427f2-72c1-4c96-92a4-38529e79725d","abstract":"Steinerma carpocapsae, la cual parasitó exitosamente todos los estados del chinche en laboratorio. El adulto fue el estado más susceptible, con 58.6% después de 10 días de inoculado. Los menos susceptibles fueron el primer y segundo instar con 17 y 31% respectivamente (Caicedo & Bellotti, 1994)."}

data/part_1/05693b44b261380fda32ce184e4ac106.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05693b44b261380fda32ce184e4ac106","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c0e01229-d939-4c92-aa5d-44d64b93d769/retrieve"},"pageCount":24,"title":"Notes from a Tanzania virtual stakeholder consultation on two proposed One CGIAR initiatives on Sustainable Animal Productivity for Livelihoods, Nutrition and Gender inclusion and on Livestock, Climate Change and Resilience, 28 July 2021","keywords":[],"chapters":[{"head":"Background and objectives","index":1,"paragraphs":[{"index":1,"size":108,"text":"To implement its 2030 research and innovation strategy, the CGIAR is developing a series of initiatives designed to achieve a world with sustainable and resilient food, land, and water systems that deliver more diverse, healthy, safe, sufficient, and affordable diets, and ensure improved livelihoods and greater social equality, within planetary and regional environmental boundaries. CGIAR Initiatives are major, prioritized areas of investment that bring capacity from within and beyond CGIAR to bear on well-defined, major challenges. Sustainable Animal Productivity for Livelihoods, Nutrition and Gender inclusion (SAPLING) and Livestock, Resilience and Climate Change (LRCC) 1 , are two initiatives currently being developed by ILRI, ICARDA, ABC and other partners."},{"index":2,"size":42,"text":"Given the importance of livestock in the lives and livelihoods of its people and the commitment of public and private actors to transform food systems through livestock, Tanzania is one of six countries identified as a potential partner country for these initiatives."},{"index":3,"size":98,"text":"To 'ground' and improve the proposed initiative given the Tanzania National Livestock Research Agenda and any other important considerations, this meeting was convened to guide the initiative design teams as they formulate the key interventions and work packages to be delivered. Specifically, to improve the current proposal outlines by: 1. specifying which elements and work packages are highest priority for Tanzania; 2. identifying missing elements that must be included for it to best serve Tanzania's situation; 3. providing feedback to strengthen the proposed approach and framework; 4. identifying the interests of key national actors in different work packages."}]},{"head":"Limitations of the proposal","index":2,"paragraphs":[{"index":1,"size":5,"text":"-Processing/value addition is not clear."},{"index":2,"size":9,"text":"-The strengthening of extension services is not well addressed."},{"index":3,"size":6,"text":"-Does not adequately address post-harvest losses."},{"index":4,"size":5,"text":"-Digital tools for extension strengthening."},{"index":5,"size":5,"text":"-More consultation is still needed."},{"index":6,"size":15,"text":"-Develop Africa Swine fever vaccine -No details on animal genetics conservation highlighted in the proposals."},{"index":7,"size":63,"text":"-Where do we capture community capital (how will the community participate and contribute to the initiatives? Building on communities' resources and capabilities) -Address malnutrition issues -48% of children under 5 are malnourished in some areas in TZ e.g., Rungwe -How people will take ownership of solutions -Iringa case where malnutrition levels are very low -how to help struggling farmers to solve those issues."},{"index":8,"size":100,"text":"-Problem statements may be different from what the people in TZ may see/find. Add a workstream to address the challenges. -Done with good intentions. Statement of problems made may be different from problems seen with real players within TZ -Workstream -re-ask questions, asked with CG and ask people on the ground e.g. Tanga, Rungwe etc. May find a whole different set of challenges. -will contextualize problem statements from demand coming from all system actors in each VC -Sustainability -how farmers will continue doing what the project has done. Needs to be addressed -Sustainability and ownership -Farmers struggling with significant survival."},{"index":9,"size":21,"text":"-Understanding language used in the mainstream -how it will translate to people in Rungwe for example. -consider additional technologies and innovation."},{"index":10,"size":3,"text":"-consider socio-cultural change."},{"index":11,"size":12,"text":"-consider national disease surveillance (understanding the testing capability at the local level)."},{"index":12,"size":8,"text":"-consider the coordination amongst pastoralists who are uncoordinated."},{"index":13,"size":23,"text":"-consider the whole value chains of productivity (to observe bottlenecks from production to market). -Need for clear protocol on engaging the private sector."},{"index":14,"size":16,"text":"-Need to build on the local community food systems to ensure the issue of food sovereignty."},{"index":15,"size":33,"text":"-Consideration of concurrently existing projects/ stakeholders in terms of interaction with farmers and targeted actors; aside from continuity of existing projects. -Private sector engagement needs to be clear in-service delivery and input supply."},{"index":16,"size":76,"text":"-More of focus on gender rather than women/ youth only without seeing where we leave/ include the men. -Need for participatory approaches with bottom-up approaches (consideration of farmer needs and voices), need for demand-driven approach. -Need for catalytic particularly financial/ capital support for women with interest to invest. -Southern Highland -Iringa, Mbeya, Jombe -big potential for dairy. Tanga, Morogoro regions. Northern part -Kilimanjaro region -Poultry -Southern regions e.g., Mtwara, Luvuma region (ADGG and Women in Business)."}]},{"head":"Priority locations for the proposal","index":3,"paragraphs":[{"index":1,"size":18,"text":"-Peri-urban areas for both dairy and chicken -Start in areas where there is production and processing in place."},{"index":2,"size":12,"text":"-Dairy industry has more structure with established farmer cooperatives -through their organizations."}]},{"head":"Priority value chains","index":4,"paragraphs":[{"index":1,"size":26,"text":"-Minister is emphasizing sheep and goats to create impact along the lines of heifer-in-trust schemes (Kopa mbuzi lipa mbuzi). -Yes, dairy continues to be a priority."},{"index":2,"size":9,"text":"-Chicken/poultry is a priority especially for women (gender inclusion)."},{"index":3,"size":13,"text":"-The priority value chains in the initiatives are consistent with national priority VCs."},{"index":4,"size":69,"text":"-We need to consider an existing community-based breeding program for Goats between ICARDA and TALIRI -Small ruminants -sheep and goats are important. Central -Dodoma and Singida, Southern -Lindi and Mtwara, Nothern -Arusha and Manyara, Kilimanjaro -Meat Goat. Efforts to increase goat milk in the industry. Crossbreeding -through NGOs -More focus on goats -goat meat market is high and more preferable. -The infrastructure to help smallholder producers market their produce."},{"index":5,"size":64,"text":"-Dairy VC: The issue of marketing (e.g., processing) is very important. If there is no market for products, then not much improvement can be done. -Equity and inclusion are well emphasised in the initiatives. In the Kilimanjaro dairy system, women play a key role. So, including them in the initiative is very important, especially capturing the benefit of getting involved in the value chains."},{"index":6,"size":169,"text":"-The involvement of the private sector in milk processing. That is, building the link between farmers and the private sector in all the initiatives. -Targeting regions with high malnutrition problems as part of initiative intervention work packages. -How do you capture consumers preferences (e.g., consumer awareness of dairy products is very low)? How to view the role of the private sector in linking smallholder producers to markets. -Issues of food safety (e.g., milk hygiene). The issues of milk adulteration need to be considered when we talk about marketing. That is, identifying food safety hot spots along the value chain. -Milk marketers need to be captured in our interventions as they play a key role. Sometimes when farmers milk gets rejected marketers can help to market it. -How to ensure that children have access to milk and milk products at home and school? How to ensure it is safe milk as a large portion of the milk is not safe for consumption (food safety issues)? -Engagement of the private sector."},{"index":7,"size":13,"text":"-Buy-in into the statement of the problem to make them ambassadors of solutions."},{"index":8,"size":13,"text":"-Dissemination of knowledge about CC smartly packaged and delivered at the country level."},{"index":9,"size":11,"text":"-Marketing of milk -factories offer lower prices from other existing markets."},{"index":10,"size":12,"text":"-Market regulations for more formal market processing of animal products (effective policies)."},{"index":11,"size":11,"text":"-Implementation of effective policies to enable market conditions to be easier."},{"index":12,"size":9,"text":"-Feeding intervention -Improve the way of making homemade feeds."},{"index":13,"size":5,"text":"-Breeding Improvement particularly for chicken."},{"index":14,"size":28,"text":"-Feeds and forages-across the 3 species -Digital database for all value chains -Genetics-improving the conservation for chicken and dairy-gene banks -Improve efficiency in aggregation and delivery to markets."},{"index":15,"size":88,"text":"-The supply chain for service and inputs for all the VCs. -Improved product packaging for marketing. -Investments in the environment -does it not need public investment? Is collaboration with governments strong enough in the proposal? -Ongoing project with Care Int and Land Coalition -there are innovations on climate change and indigenous knowledge, targeting pastoralists. Can this be strengthened? -Locally available forage seeds need to be multiplied for scaling -is this strongly addressed? -Resilience should be more prominent in the initiative. Adaptation to climate and environmental change is key."}]},{"head":"PRIORITY WORK PACKAGES","index":5,"paragraphs":[]},{"head":"Priority locations for the proposal","index":6,"paragraphs":[{"index":1,"size":5,"text":"-Coast region: hotspot for conflict."},{"index":2,"size":4,"text":"-Kilosa, Mvomero -Morogoro region."},{"index":3,"size":25,"text":"-Lake region: expressed interest in scaling PRM -Kagera region -Arusha and Manyara regions -> prolonged dry season and vulnerability to climate change, local network support."}]},{"head":"Priority value chains","index":7,"paragraphs":[{"index":1,"size":8,"text":"-Dairy: key in terms of climate and environment."},{"index":2,"size":15,"text":"-The feed value chain for a working dairy value chain (2nd beef and 3rd goat)."}]},{"head":"TOP priority interventions","index":8,"paragraphs":[{"index":1,"size":5,"text":"-Building on local communities' needs."},{"index":2,"size":5,"text":"-Building local capacities is key."},{"index":3,"size":7,"text":"-Strengthening risk surveillance along feed value chains."},{"index":4,"size":57,"text":"-Sustainable and participatory rangeland management -> can have a significant impact to reduce land conflict! There is demand. -Indigenous knowledge on local forage varieties -> involves people themselves, builds on locally available resources, multiplication is important. -Indigenous knowledge on local forage varieties -> involves people themselves, builds on locally available resources, multiplication is important. -Indigenous/local pastures established."},{"index":5,"size":63,"text":"-Digital services delivered through ICT is key to improve communication -> how to improve productivity, feed availability -The finance mechanism needs to be locally embedded; we can also mobilize local resources not only outside funders. -Providing access to feed -> it is a low-hanging fruit! -Link policy engagement with ongoing national initiatives, e.g., National Climate Change Plan which was finalized in May 2020."}]},{"head":"PRIORITY WORK PACKAGES","index":9,"paragraphs":[{"index":1,"size":57,"text":"-WP1: Building on local communities' needs -WP3: Building local capacities is key -WP3: Strengthening risk surveillance along feed value chains -WP4: Finance mechanism needs to be locally embedded, we can also mobilize local resources not only outside funders -WP5: Link policy engagement with ongoing national initiatives, e.g., National Climate Change Plan which was finalized in May 2020."}]},{"head":"Chat feedback: What livestock challenges matter","index":10,"paragraphs":[{"index":1,"size":181,"text":"-Limited private sector engagement in driving the livestock agenda -Land conflicts -Feeds and feeding -Low productivity -Ensuring livestock development does not leave anyone behind -Livestock breeds -Grazing pasture for pastoralists fuelling land conflicts -Low dairy productivity despite the huge potential and need to improve nutrition security -Infectious and nutritional diseases -Profitable farm systems -Markets -Feed: no commercial feed system for sustainability -Feeds (forages) and Genetics -Inadequate nutrition and diseases -Low quality feeds all year round -uncoordinated marketing system -Marketing systems and socio-cultural and economic aspects -Low genetic potential, -Lack of appropriate data recording system -Feed shortage in the dry season, diseases and parasites, low production of the local breeds -Sales of unprocessed meat and dairy, illegal in most countries, but permitted in Tanzania. In the dairy industry, only 3% of milk consumed has been properly processed. -Low productivity and limited services for smaller-scale producers -Poor services to small and medium-scale producers Chat feedback: Advice for the team -SAPLING needs to build on the proven existing local food systems and techniques to ensure the local food sovereignty -Get the market conditions right."},{"index":2,"size":138,"text":"-Address human and climate-related conflicts -Prioritize on feeds and forage production and supply system--Digital Database -Strengthen private sector engagement protocol -Increase availability and affordability of animal source foods to improve food security -Leverage the private sector -Consider the market needs -Think of sustainability for any initiatives during implementation the coordination of pastoral communities -Forages and better breeds -Build capacity in agri-ecology research -Continued concerted and coherent partnerships -Increase forage availability and strengthen market -Information communication is critical -strengthening farmer groups -Forage feed systems should be encouraged -Disease control -Gender focus for inclusivity rather than exclusively women/ youth focus -The market should be well considered and aligned to increased productivity -More efforts on promoting milk products and consumer awareness -Improve the laboratory facilities for breeding technologies -Value addition of livestock products -Security of grazing land and improve forage production"}]}],"figures":[{"text":"- Lake zone and Kagera: encouraging investors in dairy too. -SHOATS -Southern Zone, Central, Northern Zone. -Look at ASDP and TLMP for priority locations. -Dairy Northern, Southern highlands. -Zanzibar -poultry and dairy. -Diary: Arusha, Kilimanjaro, Tanga -Southern Zone (Njombe, Mbeya). -Small ruminants: Mwanza, Singida. -Morogoro, Coastal region, Dar es salaam. -Dodoma, Tabora, Singida (chicken) -Mtwara and Kigoma. -Chicken: Manyara, Dodoma and Singida, Lindi, Pwani, Dar es Salaam. -Potential for Dairy-Southern Highlands. -Dairy-Arusha, Kilimanjaro, Manyara, Tanga. -Pigs; Arusha, Manyara, Kilimanjaro, Morogoro (some places) -Poultry (central points) -Dodoma, Singida regions -Locations of dairy VC -Tanga region, Moshi, Kigamboni (smallholder farmers), Mwanza/Musoma (low uptake of factory facility), Iringa (effective engagement with farmers). "},{"text":" -Agree on dairy, chicken, sheep and goats. -Dairy -Chicken -Pig -Priority for selection of VC based on productivity TOP priority interventions -Vaccines and their delivery (Animal and herd health). -Assisted reproductive technologies -Engaging youth. -Feed technologies e.g., the introduction of improved forage species /GHG reduction. -Extension and market information (use of digital tools). -Ensuring safe food. -Evidenced-based advocacy to attract more investors for processing and value addition. -Collective action for marketing/ strengthening cooperative unions -Capacity building and continuing professional development. -Animal identification and record keeping. -Breeding programs. -Addressing drudgery especially in processing and feeds. -Engaging the private sector in new technology dissemination. -Strengthening partnerships. "},{"text":" Work package 1: We need to include technologies such as Artificial insemination (AI). How to use technology to make AI more efficient? Making the supply chain of AI more efficient. -Providing incentives for farmers to produce quality milk (e.g., creating awareness through ICT technology to reward farmers who work on reducing milk adulteration. -Work package 2: Identifying technologies to detect if there is any kind of adulteration in the milk (e.g., using mobile phones to detect such issues). Technologies and tools to help address issues of adulteration. -Target youth of the country to be ambassadors of climate change message -equipped with the right knowledge. -Climate change -dissemination of knowledge in general. Help people take ownership and develop solutions within the country. -Engage the private sector -take to scale some of the innovations. -Work package 1 -Boost digital technologies in livestock. -Work package 2 -Sensitization and promotion of consumption of ASF from childhood Feedback on the LCCR proposal Strengths of the proposal -Good proposal. Very timely. Builds on past work e.g. sustainable rangeland projects and PRM. Not starting from scratch which is good. -Scaling the existing innovations. -Building on indigenous knowledge, e.g. Ololili, which is what TALIRI and ILRI worked on in past projects. -Gender inclusion is part of it. Important to take equity into account with mitigation and adaptation. -Upscaling is part of the initiative which is important. Limitations of the proposal -Strengthen indigenous knowledge components. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"b15bfc59-0913-45d3-9787-2b040c550e2d","abstract":"Strengths of the proposal -Inclusion of nutrition, genetic and diseases. -Moving to business-driven market models. -Having the technologies in combination and not addressed in silos integrating the work across the cross-cutting themes. -Inclusion of women and youth in the proposal. -Value chain linkages have a big part of the consideration in the proposal -linking various actors. -Synergies and complementarity between the two initiatives. -SAPLING is building on other research projects e.g., CRP, large bilateral projects like Maziwa Zaidi, ADGG, EADD etc. -Alignment of the proposal to existing Government interventions e.g., TZ vision 2025 as well at TZ LMP. Will get support from Government. -Scaling part of the proposal addresses sustainability. -Aligns with Tanzania Research initiative agenda. -Addresses livestock productivity+ greenhouse emission as global agenda. -Appropriateness of technologies and innovations that align with other stakeholders. -Building on the existing initiatives, helping to draw lessons and improve. -Inclusion of women and youths. -Opportunities presented on the demand-supply gap. -Very key value chains have been taken into consideration, dairy, chicken. -Innovation digital technology such as devices for remote communication with farmers -Picks up on packages such as building on what was previous CRP work.-Intention to have evidence-based scaling up tool; evidence can be generated, and scaling can be done. -Alignment with the livestock masterplan in terms of timing -Emphasis on gender equity and inclusiveness at the core which is compatible with the partners thinking in Tanzania."}

data/part_1/05876e0e5bddf5fe34418f4473765471.json

@@ -0,0 +1 @@
+{"metadata":{"id":"05876e0e5bddf5fe34418f4473765471","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4c22d4c9-e6ec-4769-9644-39be04c069ca/retrieve"},"pageCount":26,"title":"FR1.3: Gendered differences in accessing and using climate-smart agricultural technologies in Tanzania","keywords":[],"chapters":[{"head":"Results","index":1,"paragraphs":[{"index":1,"size":1,"text":". "}]},{"head":"Sociodemographic characteristics of respondents by gender","index":2,"paragraphs":[{"index":1,"size":29,"text":"❖ Most households were men headed. ❖ Women had lower education qualification compared to men and the youth. ❖ 31% of the women were either widowed, separated are divorced.  "}]},{"head":"Farm and bean farming characteristics","index":3,"paragraphs":[]},{"head":"Decision maker about changes to protect bean production against production constraints by gender","index":4,"paragraphs":[{"index":1,"size":31,"text":"More men farmers (79%) than women (74%) and youths (73%) said that both man and woman in the household made the decision to make changes in response to the production constraints."}]},{"head":"Use of climate-smart agricultural technologies/practices by gender","index":5,"paragraphs":[{"index":1,"size":68,"text":"Conservation agriculture (62%) and pesticide use (40%) were the most frequently used climate-smart agricultural practices, followed by the use of fertilizer (30%) and improved seed (24%). Determinants of use of climate-smart technologies and practices ❖ Younger farmers were more likely to use improved bean seed and fertilizer than women farmers ❖ Education had a significant positive influence on the use of improved seeds, fertilizer-, pesticides, and conservation agriculture."},{"index":2,"size":14,"text":"❖ Married farmers were less likely to use improves seed, fertilizer, and conservation agriculture."}]},{"head":"Conclusion","index":6,"paragraphs":[{"index":1,"size":42,"text":"❖ Gender and intersectional categories influence adaptation to changing climate conditions ❖ There were gender differences in ownership and access to land, with men owning and having higher access to land than women and youths ❖ Joint decision-making dominated bean farming decisions."},{"index":2,"size":87,"text":"❖ There were also gender disparities in bean production constraints with women and young farmers being more vulnerable than men ❖ There was also low institutional, technical, and social support to enable farmers to adopt climate-smart technologies and practices ❖ There were systematic differences in terms of factors that conditioned the use of agricultural technologies and practices ❖ Addressing gender disparities in land access, access to digital technology, encouraging women's literacy through higher education, and collective action are likely to enhance the resilience dimension in farming Conclusion"}]}],"figures":[{"text":"Background❏❏❏ Agriculture is critical to the economic growth of sub-Saharan African countries but is negatively affected by climate change. ❏ Some of the rampant effects of climate change in SSA include ➔ Prolonged drought ➔ Flooding ➔ Erratic rainfall ➔ Increased pest and diseases, and ➔ Rising temperatures ❏ Smallholder farmers are the most affected because of their reliance on rain-fed agriculture. ❏ As a result, climate change results in increased cases of food insecurity and poverty, affecting local markets, and slowing down economic growth. ❏ The vulnerability of smallholder farmers to climate change is worsened by preexisting conditions, including: ➢ Low access to markets, ➢ Weak institutional support and policy, ➢ Low technology adoption, and poverty Background ❏ The impacts of climatic shocks are skewed with women being the most vulnerable group in Tanzania. ❏ Smallholder farmers, especially women cultivate relatively small pieces of land which often lack access to reliable irrigation. ❏ Their participation in output markets is low largely because of poor harvests. ❏ As a result, climate change has undermined the ability of Tanzania to achieve the Sustainable Development Goals. Background ❏ Few studies have focused on how access and use of these technologies vary by gender in Tanzania ❏ The potential role of individuals and households in gendered differences in the use of climate-smart agriculture has not been explored comprehensively in Mbeya and Mbozi districts. This study investigated the role of gender in the uptake of climate-smart agricultural practices in Tanzania. headship, gender, primary occupation, marital status, household type) Six villages were randomly selected from the two districts ❏ Participants were then selected randomly from lists of farmers that were provided by local extension offices in the different wards. ❏ Farmers randomly selected using the RAND function resulting in 357 respondents Sampling Design ❏ The two districts were selected for the study because they are among the main bean production hubs in the Southern Highlands of Tanzania. ❏ They also receive diverse bean value chain interventions. Data Collection ❏ Data was collected using semi-structured questionnaire. ❏ The tool was co-developed by all stakeholders ❏ The information collected comprised ➢ Demographic characteristics ➢ Land ownership, access, and allocation to bean production ➢ Types of seed and bean varieties planted by farmers ➢ Bean production practices ➢ Production constraints ➢ Farmers access to information on bean production, technologies, and marketing Data Analysis ❖ Measures of Central Tendency (Mean and standard deviation) ❖ Analysis of proportions (Frequencies and percentaged) ❖ Inferential statistics ❖ Analysis of test of significance (ANOVA and chi-square). "},{"text":" on the purpose of growing beans was made jointly between man and woman in a household but secondly, by women, even though men said otherwise Farm and bean farming characteristics ❖Men owned more land (5 acres) than women (3 acres) and youth (0 acres). ❖Men also accessed more land (6acres) than women (4acres) and youth (4 acres) land owned Average acres of land accessedFarm and bean farming characteristics ❖Beans were mainly grown for income (76%), while only 24% grew for food. It is important to note that beans are now more commercialized and this might have implications for women in relation to income from sale of beans "},{"text":"  "},{"text":"Farmers access to institutional, technical, and social support services ❖ Access to production information and agricultural training was low with only 28% and 26% of the respondents reporting that they received the support, respectively. ❖ Women had marginally lower access to information via social media and mobile phones than men and youths. ❖ Low access to information via mobile phones was reported despite 91% of the respondents indicating that they owned mobile phones. 70 80 Variable Variable Youths Seed Coeff. 0.557**  67.27 Pesticides Total Coeff. -0.096 Fertilizer Youths Women Coeff. 0.592** CA Men Coeff. -0.114 p-value 70 80 Variable Variable YouthsSeed Coeff. 0.557**67.27 Pesticides Total Coeff. -0.096Fertilizer Youths Women Coeff. 0.592**CA Men Coeff. -0.114p-value 62.46 Average distance to agro-dealer (km) 61.36 60 Age Marital status (married) 0.026*** -0.546* -0.007 -0.152 17.52  59.13 18.33 0.016 -0.623** 17.65 16.47 -0.001 -0.580*** 0.541 62.46 Average distance to agro-dealer (km) 61.36 60 Age Marital status (married)0.026*** -0.546*-0.007 -0.15217.5259.13 18.33 0.016 -0.623**17.6516.47 -0.001 -0.580***0.541 Percent owning mobile phone Relation to HH head (=head) -0.125  -0.133 90.76  91.67 -0.536** 84.55 95.65 -0.205 0.014 Percent owning mobile phone Relation to HH head (=head)-0.125-0.13390.7691.67 -0.536**84.5595.65 -0.2050.014 39.78 Percent receiving information on mobile phone 39.39 50 Education level 0.393** 29.97 31.06 23.53 Presence on agriculture social media platform (%) 20.45 Occupation of HH head (=Farming) 1.013*** 40 land size accessed 0.031 20 30 Percent received bean production information Manager of bean plot 0.216 Percent received agricultural training Distance to agro-dealer -0.017*** Membership to local groups/associations (%) Cell phone ownership 1.222*** Group membership 0.766*** 10 Region (Songwe) 0.008 38.18 0.417*** 39.78 29.09 3.36 0.666*** 0.031* 28.01 -0.024 26.61 -0.019*** 42.86 0.443* 0.345** 0.002 20 34.85 0.459*** 41.74 37.27 29.57 6.06 0.91 0.727*** 0.048*** 23.48 27.27 0.067 21.21 26.36 -0.022*** 40.15 40.00 0.569** 0.488*** 0.022 47.83 0.111 2.61 1.709*** 0.024 30.43 33.91 0.605*** 33.04 -0.024*** 48.70 -0.244 0.261 -0.488*** 0.094 0.074 0.187 0.110 0.307 39.78 Percent receiving information on mobile phone 39.39 50 Education level 0.393** 29.97 31.06 23.53 Presence on agriculture social media platform (%) 20.45 Occupation of HH head (=Farming) 1.013*** 40 land size accessed 0.031 20 30 Percent received bean production information Manager of bean plot 0.216 Percent received agricultural training Distance to agro-dealer -0.017*** Membership to local groups/associations (%) Cell phone ownership 1.222*** Group membership 0.766*** 10 Region (Songwe) 0.00838.18 0.417*** 39.78 29.09 3.36 0.666*** 0.031* 28.01 -0.024 26.61 -0.019*** 42.86 0.443* 0.345** 0.0022034.85 0.459*** 41.74 37.27 29.57 6.06 0.91 0.727*** 0.048*** 23.48 27.27 0.067 21.21 26.36 -0.022*** 40.15 40.00 0.569** 0.488*** 0.02247.83 0.111 2.61 1.709*** 0.024 30.43 33.91 0.605*** 33.04 -0.024*** 48.70 -0.244 0.261 -0.488***0.094 0.074 0.187 0.110 0.307 0 Constant -4.402  -1.069   -2.304***  0.413 0 Constant-4.402-1.069-2.304***0.413 Total Youths  Women   Men TotalYouthsWomenMen Conservation agriculture Pesticide use Fertilizer use Use of improved seed  Conservation agriculturePesticide useFertilizer useUse of improved seed  "}],"sieverID":"8a2178c0-16c6-4524-acc9-2c9aea74889b","abstract":""}

data/part_1/062e9ef3acfe8db4c6164a5c63d7c527.json

@@ -0,0 +1 @@
+{"metadata":{"id":"062e9ef3acfe8db4c6164a5c63d7c527","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/918e6ad0-c0a3-4bc7-b452-30aeb5b9790f/retrieve"},"pageCount":31,"title":"","keywords":["72 .. 2:3l•J 7'2 .. ::::'ltJ) 72. :,,: 1t>J 72. :Hv) 72.:,loJ 72. 04-~'J 72 .. ()¿~L\\J 1 bí') 72 .. 2:SL1J 72.3'7l<j 13 .. 2t'3S 12",".. :::","•OS 1 :3. 2E:m 13.315 7é.')ü 2760 :","-¡,,70 ~,:,ví~:,íü '2f-J2ü 2800 ., _,'l() :':\"''","'6.0 :~:960 ~","EV)() 2C'","11,'10"],"chapters":[],"figures":[],"sieverID":"ce844fd6-3333-4e99-82df-39bf5eb58743","abstract":"Nr 5~)ecies/subspecies/•FDrm 2p71 P .. au9usti 2572 P .. vLllgdris ~~f;7:3 P .. VLtl gar<l s 2\"'74 P .. augusti ?k 7 \", P .. au9usti .... ¡;:,;; d 2576 P.vulgaris 25?7 F'~VL(l g¿\\ris 2578 F:' .. vul gari s 2579 P .. vulqC\\ris 2eiBO P.vulgar-is 2f.\",81 P .. vul gt;'\\r~i s 25B2 P.vulgaris 2t 83 P .. vulgaris 2 84 P.augus.ti 2tB:5 p\" vul ~}¿tri s 2f,86 p~ vul gal'-i El 2~E:17 P. éiU 9usti 2 8~1 P .. vt.tl ~Jar~ i s 2tB9 P .. eiLI9Li ~ t. i 2r. 9O P~vulqar-is 2,.,91 F' _ i::\\U9ust i 2~92"}

data/part_1/0631a51c00d3c4b6728305e13284f2dd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0631a51c00d3c4b6728305e13284f2dd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/774fcfa7-8f6a-4d95-a421-4551a9c0334b/retrieve"},"pageCount":1,"title":"Supporting agricultural transformation through Big Data solutions: experiences and lessons","keywords":[],"chapters":[{"head":"Introduction:","index":1,"paragraphs":[{"index":1,"size":70,"text":"Lack of site-specific fertilizer application is responsible for low agricultural yield in SSA. Low productivity is even worse in Ethiopia due to complex social-ecological system. Lack of site-specific fertilizer input and good agronomy practices also undermine overall system productivity in the country. Embracing agriculture with digital solutions can facilitate agricultural transformation through data-based informed decision making. We employ Big Data analytics to develop site-and context targeting of technologies across space."},{"index":2,"size":45,"text":"Objective: Develop methodological approach to assess the spatio-temporal dynamics of crop yield response to fertilizer application and develop agricultural technology recommendation domain considering relevant environmental conditions and variables. The aim is to develop optimal site-specific fertilizer application and ag technologies within corresponding recommendation units.  ([email protected])"}]},{"head":"Integration and","index":2,"paragraphs":[]}],"figures":[{"text":" Links with National R&D  MOA (ATA/GTP/EARCS/)  NGO (CGs, CASCAPE, OFRA, IFDC, GIZ) Wheat yield prediction and response to fertilizer (N rate) curve at validation points  Basic data mining and pattern recognition 2. Core activities: Collate available soil/agronomic dataenvironmental covariates-Big Data analysis -Web-GIS (DSS). Recommendation domain/SoilScape to facilitate targeting and scaling (investment prioritization) Use case of recommendation domain for fertilizer application optimization: Fertilizer response curve aggregated at recommendation domain level More data, more testing, fine tuning and improve  Conduct validation workshop  Coupling  Deploy the DSS (Web-GIS)  Develop dissemination platform (web-GIS/apps etc)  Capacity building and training  Investment planning and targeting tools "}],"sieverID":"0d1558e9-24a3-459c-a116-3966253e309b","abstract":""}

data/part_1/064aca10e2aeb94a9b0d05eee4e51c5d.json

@@ -0,0 +1 @@
+{"metadata":{"id":"064aca10e2aeb94a9b0d05eee4e51c5d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/376fc882-3986-4c08-a101-88903d998f4a/retrieve"},"pageCount":21,"title":"Informe Técnico 2020","keywords":[],"chapters":[{"head":"Introducción","index":1,"paragraphs":[{"index":1,"size":223,"text":"El documento reúne información de las actividades \"ganadería\" realizadas durante el año 2020 en el municipio El Rama. Las acciones desarrolladas estuvieron enfocadas en el fortalecimiento de capacidades de familias ganaderas en temas de buenas prácticas para el manejo de los sistemas ganaderos del municipio, contribuyendo así en la mejora de la productividad y la protección de los recursos naturales de la zona. Se trabajó con 440 productores (110 mujeres, 147 hombres y 183 jóvenes) representando familias ganaderas de 11 comunidades: Julio Buitrago, María Cristina, El Castillo, Chalmeca, San Ramón, Salto de la Cruz, La Ceiba, Walpapine, El Pavón, Minas de Kisilala y la Concha. De los 11 ECAs que se atienden dentro del Proyecto PASOS se desarrollaron 10 durante el mes de febrero, 7 durante el mes de marzo, 3 durante el mes de abril (debido a la suspensión parcial de actividades por COVID-19), 9 durante los meses de mayo y junio, 8 durante el mes de julio y 11 durante los meses de septiembre a diciembre. Con la coordinación del equipo técnico del proyecto y el equipo de M&E de SOLIDARIDAD se logró desarrollar el envío de mensajes de texto a productores sobre prácticas que no deben dejar de realizarse durante la época de verano. Con apoyo de SOLIDARIDAD se buscaron 5 promotores para desarrollar ECAS y visitas a los productores."}]},{"head":"Actividades realizadas","index":2,"paragraphs":[{"index":1,"size":19,"text":"Las actividades consistieron por la mayor parte en capacitaciones a familias ganaderas que conforman las Escuelas de Campo (ECA)."}]},{"head":"Los temas fueron los siguientes:","index":3,"paragraphs":[{"index":1,"size":144,"text":"1. Plan de Uso de Finca (PUF) 2. Alternativas de alimentación en épocas de verano 3. Aplicación de productos fármacos 4. Análisis de Fertilidad en Sementales (ver también el Anexo: Resultados de evaluaciones de fertilidad de sementales en fincas ganaderas de Proyecto PASOS CIAT en municipio El Rama) 5. Uso y Establecimiento de cercas vivas 6. Manejo Responsable de productos fitosanitarios 7. Uso Eficiente de Fertilización en Pasturas Mejoradas 8. Uso Correcto de Sales Minerales 9. Uso del botón de oro como fuente de proteína 10. Proceso de Evaluación de Aprendizaje 1. Plan de Uso de Finca (PUF) Objetivo General: Brindar a los grupos y sus miembros un instrumento de mediano a largo plazo que les permita planificar e implementar el uso racional y sostenible del terreno en las fincas, contribuyendo a la conservación del ambiente, al mejoramiento de la productividad y la rentabilidad."}]},{"head":"Objetivos Específicos:","index":4,"paragraphs":[{"index":1,"size":37,"text":" Mostrar la importancia de realizar un.  Elaborar un plan de actividades en la finca que facilite la toma de decisiones de las familias y mejore la calidad de vida.  Practica del llenado de registros."},{"index":2,"size":295,"text":"Se dio a conocer la importancia sobre la realización de un plan de uso de finca. Una \"finca\" normalmente corresponde a una \"unidad de producción\" pero no son siempre iguales, ya que en algunos casos un beneficiario está trabajando varias fincas separadas que para él conforman una misma unidad de producción. El uso de suelo de la finca puede variar entre agrícola, ganadero, forestal o mixto (agropecuario, agroforestal o silvopastoril). El significado central del PUF radica en la conservación del ambiente a nivel de finca, y no es un plan solo de desarrollo productivo. Sin embargo, el PUF ayuda a entender cuáles inversiones podrán ser aporte propio del beneficiario y cuáles deberán ser aporte externo. No se requiere especificar todos los detalles de las inversiones ya que el PUF es un plan maestro de la finca a mediano y largo plazo. Para esta ocasión se les enseño la elaboración de un PUF apegado a las actividades ganaderas que tendrá la durabilidad de un año. A través del desarrollo de la ECA los productores adquirieron mayor fortaleza para la elaboración de un plan de actividades en finca, el cual les permita distribuir en todo un año las actividades conforme al tiempo conveniente y el desarrollo de la misma, se creó debate para medir los conocimientos de los productores sobre el tema haciendo que estas experiencias contribuyan al fortalecimiento de ideas que ayudan a mejorar la toma de decisiones dentro de las familias productoras. Durante el desarrollo de las ECAS se colaboró a que las instituciones de gobierno como el MEFFCA, INTA e INAFOR desarrollen experiencias en temas que ayuden a mejorar las condiciones de vida de las familias productoras, que se les provea de especies forestales para su establecimiento y les capaciten en su debido manejo."}]},{"head":"Alternativas de alimentación en épocas de verano","index":5,"paragraphs":[{"index":1,"size":19,"text":"Objetivo General: Brindar a los grupos y sus miembros diferentes alternativas de alimentación para su ganado en época seca."}]},{"head":"Objetivos Específicos:","index":6,"paragraphs":[{"index":1,"size":45,"text":" Mostrar la importancia de preparar y conservar alimentos para época de sequía como los beneficios que estos traen en la dieta del bovino y a los ingresos de las familias.  Practica de elaboración de alternativa de alimentación (ensilaje, bloques multinutricionales, concentrado entre otros)."},{"index":2,"size":306,"text":"Se dio a conocer la importancia que existe en las familias productoras sobre diversas alternativas de alimentación de verano. En algunos casos los productores se ven en la necesidad de incurrir a la compra de alimentos como concentrados, heno u otros tipos de alimentos que les permita nutrir sus animales y que estos no bajen su condición corporal o producción de leche. Por tal razón durante las ECAs se estuvo realizando una de diferentes alternativas de alimentación para épocas donde hay escases de comida para los bovinos. Un animal a diario necesita de buena alimentación en cantidad y calidad para la sobrevivencia de el mismo como para la producción ya sea de leche o carne; siendo esta obtenida de los pastos que consumen en los potreros. En la estación de invierno los pastos producen la suficiente cantidad de follaje y nutrientes como para poder cubrir los requerimientos del bovino, por tal razón los productores no se ven a la necesidad de elaborar otro tipo de alimento más que el pastoreo tradicional. El caso es que en época de verano los pastos tienden a disminuir la calidad nutricional debido a los escases de agua, es ahí donde los bovinos empiezan a bajar de peso y disminuir la producción de leche/carne ocasionando pérdidas económicas a las familias productoras. En este caso es importante suministrar otros alimentos que conlleven alto valor nutritivo el cual permita que el animal no consuma de sus reservas del cuerpo para la producción del mismo ya sea en leche o carne. Durante el desarrollo de las ECAS se colaboró a que las instituciones de gobierno como el MEFFCA, INTA e INAFOR desarrollen experiencias en temas que ayuden a mejorar las condiciones de vida de las familias productoras, que se les provea de especies forestales para su establecimiento y les capaciten en su debido manejo. "}]},{"head":"Aplicación de productos fármacos","index":7,"paragraphs":[{"index":1,"size":20,"text":"Objetivo General: Brindar a los grupos y sus miembros el conocer de las diferentes vías de administración de productos fármacos."}]},{"head":"Objetivos específicos:","index":8,"paragraphs":[{"index":1,"size":33,"text":" Mostrar la importancia de aplicar productos fármacos de cualquier índole como vitaminas, desparasitante, antibióticos, sueros entre otros a través de los diferentes puntos de administración.  Practica de aplicación de productos fármacos."},{"index":2,"size":116,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras sobre diversas vías de administración de productos fármacos. Es importante recalcar que los productores día a día conviven con la actividad ganadera y que en circunstancias se afrontan con cosas complejas como la necesidad de aplicar un tratamiento mediante alguna vía que ellos desconocen o sienten temor en hacerlo. Se vio la necesidad de compartir los conocimientos con las diferentes ECAS que se atienden en la zona de El Rama para crear estas herramientas que aportan con el fortalecimientos de capacidades dentro de las familias productoras, como es el caso de administrar productos fármacos por diferentes vías."},{"index":3,"size":94,"text":"Durante el desarrollo de las ECAS se colaboró a que las instituciones de gobierno como el MEFFCA desarrollen experiencias en temas que ayuden a mejorar las condiciones de vida de las familias productoras. También se logró crear una base de datos actualizadas con la mayor cantidad posible de contactos para el envío de SMS dese el equipo de M&E por parte de SOLIDARIDAD para mantener a las familias productoras al tanto de las actividades que se deben estar realizando en el rubro, más en tiempos de verano donde se requiere mayor vigilancia del hato. "}]},{"head":"Análisis de Fertilidad en Sementales","index":9,"paragraphs":[{"index":1,"size":25,"text":"Objetivo General: Brindar a los grupos y sus miembros el conocer de la importancia que existe en la elaboración de Exámenes de Fertilidad en Sementales."}]},{"head":"Objetivos Específicos.","index":10,"paragraphs":[{"index":1,"size":22,"text":" Sabrán la importancia de elaborar exámenes de fertilidad a los sementales.  Elaboración de los exámenes para determinar % de fertilidad."},{"index":2,"size":29,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras sobre realizar las pruebas de \"Análisis de fertilidad en sementales\"."},{"index":3,"size":139,"text":"En las unidades de producción se dan a la tarea del cuido y manejo del hato bovino que indispensablemente no debe faltar un semental. Por tal razón es importante recalcar que los productores se afrontan con problemas de reproducción bovina y se vio la necesidad de realizar y compartir los conocimientos con las diferentes ECAS que se atienden en la zona del Rama y CONAGAN; para realizar una prueba de fertilidad que les permitiese conocer como esta su toro en la actualidad como principal medio de reproducción. Esto ayudara a que los productores mejoren el IPP, vitaminar muy bien sus toros para que estos den el mayor % de preñez dentro del hato ganadero, lo cual ayudara a que las vacas se preñen con seguridad y traer el aumento de producción de leche y terneros dentro de la finca. "}]},{"head":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE MAYO (PASOS)","index":11,"paragraphs":[]},{"head":"Conclusiones:","index":12,"paragraphs":[{"index":1,"size":34,"text":"En esta zona se identifica un porcentaje de toros infértiles, relativamente bajo, que indica un buen manejo de los toros, seguramente está incidiendo los servicios de asistencia técnica del CIAT, en alimentación y manejo."}]},{"head":"Recomendaciones del personal de CONAGAN:","index":13,"paragraphs":[{"index":1,"size":59,"text":" Uso de minerales y vitaminas y en especial micro minerales para los sementales evaluados como regulares (Selenio, Zinc, Cobre, Iodo, Manganeso).  Orientar sacrificio de los sementales de descarte y su reposición con sementales de buena fertilidad  Compra de sementales certificados, con fertilidad comprobada.  Evitar desparasitaciones en periodos de monta, procurando reducir el uso de ivermectina."}]},{"head":"Uso y Establecimiento de cercas vivas","index":14,"paragraphs":[{"index":1,"size":27,"text":"Objetivo General: Brindar a los grupos y sus miembros el valor del buen uso y la importancia de establecer las cercas vivas dentro de la unidad productiva."}]},{"head":"Objetivos Específicos.","index":15,"paragraphs":[{"index":1,"size":36,"text":" Compartir experiencias del uso y establecimiento de las cercas vivas.  Saber la importancia del uso y establecimiento de las cercas vivas para su debido manejo.  Practicar en la selección correcta de cercas vivas."},{"index":2,"size":106,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras el \"Uso y Establecimiento de cercas vivas\". El uso de cercas vivas en reemplazo de los sistemas tradicionales para delimitar áreas, ofrece ventajas que van desde las ecológicas (ya que con ellas se disminuye la deforestación y la liberación de gases efecto invernadero a la atmósfera) hasta las económicas (si se plantan árboles de alto valor). Establecer árboles de manera productiva no solo significa establecer una plantación compacta en un arreglo silvopastoril1 agroforestal, también es posible obtener madera comercial a partir de la plantación de cercas vivas."},{"index":3,"size":178,"text":"Las cercas vivas son plantaciones de especies forestales que se establecen para dividir potreros o linderos, establecer barreras rompe vientos, proteger fuentes de agua, suelos, cultivos o pastizales, proteger contra las heladas o contribuir al mejoramiento de la ecología local. En algunos casos, en predios de grandes extensiones, además de servir en los linderos, proveen madera con un enfoque productivo si se usan especies valiosas (como teca, cedro o caoba). El cerco vivo se define como una línea de árboles principalmente nativos, multipropósito o de usos múltiples, que se encuentran delimitando una propiedad. El uso de este tipo de cercos en la agricultura y la ganadería de la región es una práctica poco utilizada, lo cual nos llevó a desarrollar este importante tema. Además de su función principal (servir como barrera), las cercas vivas pueden proveer leña, forraje, alimentos, actuar como cortinas rompe vientos y enriquecer el suelo, dependiendo de las especies que se utilicen. Además, es una actividad fácil, productiva, mejora el rancho, valoriza la tierra, diferencia linderos, da sombra y disminuye el mantenimiento de las cercas."}]},{"head":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE JUNIO (PASOS) \"USO Y ESTABLECIMIENTO DE CERCAS VIVAS\"","index":16,"paragraphs":[]},{"head":"Manejo Responsable de productos fitosanitarios","index":17,"paragraphs":[{"index":1,"size":25,"text":"Objetivo General: Brindar a las familias productoras el conocimiento de una nueva tecnología que les permita reducir al máximo los daños ocasionados por productos agroquímicos."}]},{"head":"Objetivos Específicos.","index":18,"paragraphs":[{"index":1,"size":19,"text":" Saber el uso y la importancia de la cama biológica.  Hacer la construcción de la cama biológica."},{"index":2,"size":135,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras el \"Manejo responsable de productos fitosanitarios\". Las camas biológicas se diseñan en base a una biomezcla, es decir, un conjunto de diferentes materiales que pueden ir variando de acuerdo a la zona. Una cama biológica es un lugar que se construye para destinar los depósitos de los residuos de los enjuagues de la bomba, cuando se aplica un producto químico o plaguicida. Uno de los componentes fundamentales es el suelo, que se aconseja que sea de la misma región en donde se va a construir el biolechos. El mismo, \"es el que aporta los microorganismos que están adaptados a la degradación de agroquímicos que se aplican en ese campo y a las condiciones de ese lugar\"."},{"index":3,"size":119,"text":"Asimismo, al suelo se le suma alguna materia rica en fibra celulósica ya sea pasto seco, trigo o paja de alfalfa. Otra alternativa que se puede incorporar es material orgánico que provea aireación a la biomezcla como resaca de río o compost. Una vez que los líquidos contaminados llegan a la cama biológica, el trabajo lo realizan los microorganismos. \"Las bacterias y los hongos degradan los agroquímicos, por lo que no se trata de pasar el contaminante de una matriz a otra, sino de degradarlo\". Se ha comprobado que esta tecnología resulta ser eficiente en la remoción de glifosato y se realizan ensayos con combinaciones de los agroquímicos más empleados en la región, incluyendo PYCLORAN, 2-4D, CARBENDAZIM entre otros."}]},{"head":"Función de las capas que componen la cama biológica:","index":19,"paragraphs":[{"index":1,"size":37,"text":"Capa de tierra y zacate: Ayudan en la infiltración de los agroquímicos hacia las capas de abajo. Ayudan a mantener el porcentaje de humedad de la cama biológica, el cual debe mantener un porcentaje mínimo de 70%."}]},{"head":"Los rastrojos de cosecha y abono orgánico:","index":20,"paragraphs":[{"index":1,"size":5,"text":"Desarrollan hongos descomponedores de agroquímicos.  "}]},{"head":"Uso Eficiente de Fertilización en Pasturas Mejoradas","index":21,"paragraphs":[{"index":1,"size":41,"text":"Objetivo General: Brindar a las familias productoras la importancia del uso eficiente de fertilización en pasturas de tal modo que permita incrementar la productividad forrajera y representa la práctica clave en el manejo de los rejuvenecimientos y promociones de diferentes especies."}]},{"head":"Objetivos Específicos.","index":22,"paragraphs":[{"index":1,"size":12,"text":" Sabrán la importancia de fertilizar las pasturas.  Harán fertilizante orgánico."},{"index":2,"size":148,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras el \"Uso Eficiente de Fertilización en Pasturas Mejoradas\". De igual manera se le dio a conocer la importancia que se le debe dar al cuido del hato ganadero en mineralización, alimentación y manejo sanitario. La ganadería bovina que se desarrolla en las regiones tropicales basan su alimentación con pastos y forrajes por ser la fuente más económica y disponible estos presentan las limitantes que son de producción estacional, dependiente de la época climática (seca y lluvias) y que presentan bajo valor nutritivo, sobre todo en el contenido de proteína cruda, lo que afecta la producción de carne y leche. Los efectos de estas limitantes pueden disminuirse a través de la fertilización mineral, la cual reestablece los nutrimentos esenciales que fueron removidos por el animal durante el pastoreo o corte."},{"index":3,"size":80,"text":"Los productores deben ver el pasto como un cultivo, tal como es; ya que su establecimiento indica costos elevados de inversión y valor agregado a su unidad de producción. Por tal razón deben convivir más con los potreros, así garantizaran cuando y que es lo que está pidiendo el pasto, existen diferentes casos de requerimientos nutricionales en las pasturas, los tales podemos diferenciar con solo ver sus hojas:  Deficiencia de Nitrógeno.  Deficiencia de Fosforo.  Deficiencia de Potasio."},{"index":4,"size":7,"text":" Deficiencia Calcio.  Deficiencia de Zinc."},{"index":5,"size":124,"text":"De no brindarles su debida atención tendríamos pérdidas económicas cuantiosas por degradación de pasturas, perdidas de coberturas en el área donde se estableció el pasto y esto nos llevaría a menos forraje disponible lo cual indica que habrá menos volumen de ganado e incluso muertes de animales. Es necesario hacer un buen uso eficiente de fertilizantes de manera constante a los potreros donde hemos establecido diferentes variedades de cultivos de gramíneas mejoradas. Esto permitirá que haya pasturas frescas, jóvenes, vigorosas y con muchos nutrientes que dispondría mayor Calidad nutricional para los animales. La fertilización balanceada aumenta la cantidad y la capacidad del forraje y, por consiguiente, incrementa la capacidad de mantenimiento y producción por unidad de área. Total de visitas en el mes 43"}]},{"head":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE SEPTIEMBRE (PASOS) \"USO EFICIENTE DE FERTILIZACION EN PASTURAS MEJORADAS\"","index":23,"paragraphs":[]},{"head":"Uso Correcto de Sales Minerales","index":24,"paragraphs":[{"index":1,"size":29,"text":"Objetivo General: Brindar a las familias productoras la importancia del uso correcto de sales minerales en la dieta de los bovinos como suplemento para mejorar los índices de producción."}]},{"head":"Objetivos Específicos:","index":25,"paragraphs":[{"index":1,"size":14,"text":" Sabrán la importancia del uso correcto de sales minerales.  Elaboraran Sal Proteinizada."},{"index":2,"size":95,"text":"Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras el \"Uso Correcto de Sales Minerales\". Además de contar con una buena calidad de forrajes y fuentes hídricas, cierto es que los pastos aportan en más proporción proteína, energía y fibra. Sin embargo, debemos tener presente que las sales contienen minerales, las sales minerales son un suplemento en la dieta de los bovinos que generan grandes beneficios. Los ganaderos deben tener en cuenta la importancia de las sales mineralizadas en la alimentación balanceada de sus semovientes."},{"index":3,"size":68,"text":"Con una proporción adecuada y balanceada, esta sustancia será el complemento perfecto en la alimentación del animal para generar una mejor y mayor productividad en el predio. Los minerales no representan una opción nutricional en el hato de carne o leche, son obligatorios. Y la cantidad que se debe dar, por medio de los alimentos, está relacionada con la zona, tipo de ganado y calidad de las pasturas."},{"index":4,"size":47,"text":"La sal blanca solo le aporta cloruro de sodio a los semovientes. Mientras que el fósforo y el calcio, que son importantes y básicos para el desarrollo cárnico y lácteo, están en el producto mineralizado. Varios estudios científicos revelan que la suplementación animal con sales minerales beneficia:"},{"index":5,"size":41,"text":" La producción y reproducción de las terneras que en un futuro próximo serán el reemplazo de las vacas productoras.  Baja los índices de mortalidad ya que fortalece su sistema inmunológico.  Aumenta el desempeño del animal en el predio."},{"index":6,"size":67,"text":"Las sales se deben suministrar en cantidades específicas, sin cometer el error de dejarlas en los potreros en abundancia. Por ejemplo, si se tiene en el predio una vaca de mediana producción se dan 100 gramos al día de sal mineral y de alta producción, 150 gramos. \"No es llenar los saleros como lo hacen a veces los ganaderos, es proveerle el suplemento mineral necesario del semoviente\"."},{"index":7,"size":130,"text":"\"Los problemas de reproducción son por falta de algunos minerales que ayudan al buen funcionamiento de la parte reproductiva\", es elemental que la sal otorgada cuente con micro elementos. Es importante que les den a las semovientes sales mineralizadas y no blancas. \"Gracias al consumo de estas sales el ganadero obtendrá una carne de mejor sabor y un mejor peso del animal. En cuanto a la cría, el productor tendrá mayores partos, pues se disminuirán los intervalos entre parto-parto\". Total de visitas en el mes 33 9. Uso del botón de oro como fuente de proteína Objetivo General: Brindar a las familias productoras una guía técnica para el montaje de un sistema silvopastoril basado en el uso de botón de oro (Tithonia diversifolia) en potreros con pasturas mejoradas previamente establecidas."}]},{"head":"Objetivos Específicos:","index":26,"paragraphs":[{"index":1,"size":54,"text":" Conocer el valor nutritivo e importancia del uso del botón de oro.  Realizar siembra de botón de oro en pasturas establecidas como SSP Mediante el desarrollo de las diferentes ECAS, se dio a conocer la importancia que existe en las familias productoras el \"Uso del botón de oro como fuente de proteína\"."},{"index":2,"size":58,"text":"En ganado lechero son indispensables para su producción y entre más leche produce una vaca, más proteínas requiere diariamente\". También los nutricionistas explican que la principal fuente de proteínas para el ganado bovino son los pastos y otros forrajes (madero negro, botón de oro) que deben estar disponibles en suficiente cantidad para llenar los requerimientos de estos animales."},{"index":3,"size":46,"text":"El botón de oro (Tithonia diversifolia) es una planta herbácea, de grandes flores amarillas con olor a miel, hojas simples y alternas de tres a cinco lóbulos; de alto valor nutricional y rápida recuperación; luego del ramoneo, produce gran cantidad de forraje y resiste la sequía."},{"index":4,"size":67,"text":"Tiene un alto nivel de proteína, con concentraciones que van desde 19% a 29 %. Dado su elevado contenido de proteína, el ganadero puede reemplazar concentrados con esta planta. El beneficio es nutricional y también económico, pues mientras el productor se ve obligado a gastar mucho dinero en alimentos balanceados, el botón de oro no tiene mayor costo y se da de forma natural en el predio."},{"index":5,"size":51,"text":"Además, es una planta que funciona y se complementa en sistemas silvopastoriles, las varetas deben de medir de 20 a 30 cm al establecerlo por material vegetativo. Cuando se usa como arbusto forrajero, el animal lo puede ramonear directamente y consumir su flor en áreas con asocio de pasturas mejoradas establecidas."},{"index":6,"size":51,"text":"Aunque no contribuye a aumentar la producción de leche, sí permite una mejoría en la calidad. Cuando una vaca consume botón de oro, los niveles de proteína y de grasa aumentan, hecho que redunda en beneficio para el productor que obtiene un mayor precio si la calidad del lácteo es mejor."},{"index":7,"size":52,"text":"De otro lado, el botón de oro puede emplearse para restaurar los suelos y las áreas degradadas. La facilidad que tiene para cubrir suelos erosionados y formar mantos densos en terrenos inestables lo hacen ideal para recuperar terrenos que se creían perdidos, las hojas tienen un alto contenido de fósforo y potasio."},{"index":8,"size":74,"text":"Finalmente, varios trabajos llevados a cabo por investigadores concluyeron que el botón de oro actúa como repelente contra las hormigas arrieras o cortadoras de hojas. En este caso, aunque no las mata en condiciones naturales, la planta ejerce un efecto disuasivo, obligándolas a hacer largos recorridos para evitar las hojas que se encuentra cerca del botón de oro. En otras regiones, los productores lo utilizan para espantar garrapatas y moscas que afectan al ganado."}]},{"head":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE NOVIEMBRE (PASOS)","index":27,"paragraphs":[{"index":1,"size":1,"text":"\" "}]}],"figures":[{"text":" La arcilla, barrial o barro: Tienen la capacidad de absorber los residuos de los plaguicidas y los degradan. Evita que se infiltren el agua de abajo hacia las capas de encima. "},{"text":"  "},{"text":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS SOBRE PLAN DEL USO DE FINCA  No Fecha Comunidad Varones Mujeres Jóvenes Institu-ciones Guberna-mentales Total Partici-pantes NoFechaComunidadVaronesMujeres JóvenesInstitu-ciones Guberna-mentalesTotal Partici-pantes 1 6/2/2020 María Cristina 13 5 11 - 29 16/2/2020María Cristina13511-29 2 18/2/2020 Julio Buitrago 10 6 13 - 29 218/2/2020 Julio Buitrago10613-29 3 19/2/2020 El Castillo 14 17 15 4 50 319/2/2020 El Castillo141715450 4 20/2/2020 El Pavón 11 7 13 2 33 420/2/2020 El Pavón11713233 5 21/2/2020 Salto de la Cruz 15 2 12 1 30 521/2/2020 Salto de la Cruz15212130 6 24/2/2020 La Ceiba 12 7 10 1 30 624/2/2020 La Ceiba12710130 7 25/2/2020 Chalmeca 8 5 15 1 29 725/2/2020 Chalmeca8515129 8 26/2/2020 Minas Kisilala 16 12 20 3 51 826/2/2020 Minas Kisilala161220351 9 27/2/2020 San Ramón 13 10 6 1 30 927/2/2020 San Ramón13106130 10 28/2/2020 Walpapine 11 3 15 - 29 1028/2/2020 Walpapine11315-29  Total General 123 74 130 13 340 Total General1237413013340  "},{"text":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS SOBRE ALTERNATIVAS DE ALIMENTACIÓN EN ÉPOCAS DE VERANO Nª Fecha Comunidad Varones Mujeres Jóvenes Institu- ciones Guberna- mentales Total Participa ntes  1 10/03/2020 María Cristina 14 4 10 5 33 110/03/2020 María Cristina14410533 2 11/03/2020 El Castillo 8 11 18 2 39 211/03/2020 El Castillo81118239 3 16/03/2020 La Ceiba 15 4 12 1 32 316/03/2020 La Ceiba15412132 4 17/03/2020 La Concha 6 9 20 3 38 417/03/2020 La Concha6920338 5 18/03/2020 Julio Buitrago 8 6 12 1 27 518/03/2020 Julio Buitrago8612127 6 19/03/2020 El Pavón 14 3 12 1 30 619/03/2020 El Pavón14312130 7 20/03/20 Salto de la Cruz 13 2 15 - 30 720/03/20Salto de la Cruz13215-30  Total General 78 39 99 13 229 Total General78399913229  "},{"text":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS SOBRE ADMINISTRACIÓN DE PRODUCTOS FÁRMACOS Nª Fecha Comunidad Varones Mujeres Jóvenes Instituciones Guberna- mentales Total Partici- pantes  1 27/04/2020 Chalmeca 5 2 4 - 11 127/04/2020 Chalmeca524-11 2 29/04/2020 La Concha 8 12 14 1 35 229/04/2020 La Concha81214135 3 30/04/2020 San Ramón 8 2 1 - 11 330/04/2020 San Ramón821-11  Total General 21 16 19 1 57 Total General211619157  "},{"text":"Resultados de evaluaciones de fertilidad de sementales en fincas ganaderas de Proyecto PASOS CIAT en municipio El Rama Introducción: En el período comprendido entre el 11 al 18 de mayo 2020, CONAGAN con el apoyo del personal de campo del proyecto PASOS-CIAT y los productores usuarios del proyecto, realizaron evaluaciones andrológicas a 58 sementales en 38 fincas, de 11 comunidades del municipio de El Rama. realizar reposición de los mismos, unos por resultar descartados, otros que aún tienen buena fertilidad, para evitar se crucen con sus hijas, con ello bajar riesgos de consanguinidad.Un 81 % de los sementales son Pardo suizo, Holstein o cruces con alto encaste de razas Bos taurus, indican que la mayor parte de las fincas atendidas están orientadas a ganadería doble propósito, buscando leche y terneros de mejor condición corporal, por efecto de heterosis, dado que predomina hembras con alto encaste brahmán. Edad de toros Anexo: Ubicación 2 3 4 Cantidad de Cuenta de Edad años 16 16 12 ganaderos Total sementales % toros por edad 27.6 27.6 20.7 Período 5 3 5.1 examinados Rama 38 58 6 y mas 11 19 11 al 18 de mayo Total 38 58 Total general 58 100%   Edad de toros Anexo: Ubicación 2 3 4 Cantidad de Cuenta de Edad años 16 16 12 ganaderos Total sementales % toros por edad 27.6 27.6 20.7 Período 5 3 5.1 examinados Rama 38 58 6 y mas 11 19 11 al 18 de mayo Total 38 58 Total general 58 100% Resultados:           Resultados:  Tipo racial Cantidad reses  %     Tipo racialCantidad reses%  Bos indicus   11  19%     Bos indicus1119%  Bos taurus    47  81%     Bos taurus4781%  Total general   58 100%     Total general58100% Fecha Parece que en general los Bos Taurus muestran menos fertilidad que los demás. Comparando buena Comunidad Varones Mujeres Jóvenes Total Participantes Sementales Muestreados Ubicación Toros analizados Toros descartados % Descarte Rama 58 7 fertilidad (muy bueno + bueno) con no-buena fertilidad (regular+pobre), 70% de los cruces y b. indicus 14 Total 58 58 14 tienen buena fertilidad, en comparación con 60% de los b. taurus. Fecha Parece que en general los Bos Taurus muestran menos fertilidad que los demás. Comparando buena Comunidad Varones Mujeres Jóvenes Total Participantes Sementales Muestreados Ubicación Toros analizados Toros descartados % Descarte Rama 58 7 fertilidad (muy bueno + bueno) con no-buena fertilidad (regular+pobre), 70% de los cruces y b. indicus 14 Total 58 58 14 tienen buena fertilidad, en comparación con 60% de los b. taurus. 1 2 3 4 5 buenos. y seguir las recomendaciones para mejorar la fertilidad de los toros evaluados como regulares o y 12/05/2020 La Ceiba 8 2 3 13 5 13/05/2020 El Castillo 6 5 4 15 3 14/05/2020 María Cristina 8 3 6 17 7 15/05/2020 Salto de la Cruz 9 1 13 23 16/05/2020 El Pavón 8 -12 20 12 16 bueno no-bueno Los resultados indican que 31 toros fueron caracterizados como muy buenos (53.5% del total de toros), cruces 71% 29% 7 toros como buenos (14 %) 13 como regulares (11%) y 7 toros fueron caracterizados como pobres en Bos indicus 69% 31% fertilidad (14%). Estas proporciones indican que en las fincas de estos productores se maneja adecuadamente a la mayoría de los sementales. Solamente es necesario descarte y reposición de 7 toros, Bos taurus 59% 41% 1 2 3 4 5 buenos. y seguir las recomendaciones para mejorar la fertilidad de los toros evaluados como regulares o y 12/05/2020 La Ceiba 8 2 3 13 5 13/05/2020 El Castillo 6 5 4 15 3 14/05/2020 María Cristina 8 3 6 17 7 15/05/2020 Salto de la Cruz 9 1 13 23 16/05/2020 El Pavón 8 -12 20 12 16 bueno no-bueno Los resultados indican que 31 toros fueron caracterizados como muy buenos (53.5% del total de toros), cruces 71% 29% 7 toros como buenos (14 %) 13 como regulares (11%) y 7 toros fueron caracterizados como pobres en Bos indicus 69% 31% fertilidad (14%). Estas proporciones indican que en las fincas de estos productores se maneja adecuadamente a la mayoría de los sementales. Solamente es necesario descarte y reposición de 7 toros, Bos taurus 59% 41% 6 18/05/2020 Minas de Kisilala 8  7  5  20  11 618/05/2020 Minas de Kisilala8752011 7 19/05/2020 San Ramón Muy Ubicación Bueno 13 Bueno 3 1 Regular Pobre Total general 17 4 719/05/2020 San Ramón Muy Ubicación Bueno13Bueno31 Regular Pobre Total general 174 8 20/05/2020 Chalmeca Rama 31 7 7 2 13 6 7 15 58 - 820/05/2020 Chalmeca Rama3177213671558- 9 21/05/2020 La Concha Total 31 5 7 4 13 8 7 17 58 - 921/05/2020 La Concha Total3157413871758-  Total General  72  27 58  157  58 Total General72275815758  "},{"text":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE JUNIO (PASOS) \"USO Y ESTABLECIMIENTO DE CERCAS VIVAS\"  Nº Fecha Comunidad Varones Mujeres Jóvenes Institución de gobierno/otros Total Participantes NºFechaComunidad Varones Mujeres JóvenesInstitución de gobierno/otrosTotal Participantes 1 08/07/2020 María Cristina 5 2 12 - 19 108/07/2020 María Cristina5212-19 2 08/07/2020 El Concha 4 - 13 1 18 208/07/2020 El Concha4-13118 3 13/07/2020 La Ceiba 7 7 10 - 24 313/07/2020 La Ceiba7710-24 4 15/07/2020 San Ramón 10 4 4 - 18 415/07/2020 San Ramón1044-18 5 17/07/2020 El Castillo 8 9 4 - 21 517/07/2020 El Castillo894-21 6 20/07/2020 Julio Buitrago 7 3 8 - 18 620/07/2020 Julio Buitrago738-18 7 22/07/2020 Minas de Kisilala 10 5 3 - 18 722/07/2020Minas de Kisilala1053-18 8 23/07/2020 Chalmeca 9 4 10 - 23 823/07/2020 Chalmeca9410-23  Total General 60 34 64 1 159 Total General6034641159  "},{"text":"TABLA DE PARTICIPACION A LAS ECAS DESARROLLADAS EN EL MES DE OCTUBRE (PASOS) \"USO CORRECTO DE SALES MINERALES\"    TABLA DE VISITAS TECNICAS REALIZADAS POR PROMOTORES TABLA DE VISITAS TECNICAS REALIZADAS POR PROMOTORES Nº  Promotor  Objetivos de las visitas Nº de Visitas Realizadas NºPromotorObjetivos de las visitasNº de Visitas Realizadas 1 Silvio Fernández Espinoza  Uso de cercas vivas. 4 1 Silvio Fernández Espinoza Uso de cercas vivas.4 2 Jairo López Rosales 3 Skarleth Sandoval Ortega  Uso de pastos mejorados.  Uso de camas biológicas.  Uso de sales minerales. 8 5 2 Jairo López Rosales 3 Skarleth Sandoval Ortega Uso de pastos mejorados.  Uso de camas biológicas.  Uso de sales minerales.8 5 4 Eduardo Silva Gazo  Manejo sanitario. 8 4 Eduardo Silva Gazo Manejo sanitario.8 5 Jonny Gómez Amador  Cumplimiento de plan de finca. 8 5 Jonny Gómez Amador Cumplimiento de plan de finca.8 Nº Fecha Comunidad Varones Mujeres Jóvenes Institución de gobierno/otros Total Participantes NºFechaComunidadVarones Mujeres JóvenesInstitución de gobierno/otrosTotal Participantes 1 06/10/2020 La Ceiba 15 8 5 - 28 1 06/10/2020 La Ceiba1585-28 2 07/10/2020 La Concha 2 4 22 1 29 2 07/10/2020 La Concha2422129 3 08/10/2020 Walpapigne 13 5 8 - 26 3 08/10/2020 Walpapigne1358-26 4 09/10/2020 San Ramón 14 8 4 1 27 4 09/10/2020 San Ramón1484127 5 19/10/2020 María Cristina 10 5 12 - 27 5 19/10/2020 María Cristina10512-27 6 20/10/2020 Minas de Kisilala 12 12 5 - 29 6 20/10/2020 Minas de Kisilala12125-29 7 21/10/2020 El Castillo 15 8 13 - 36 7 21/10/2020 El Castillo15813-36 8 21/10/2020 Chalmeca 11 7 8 - 26 8 21/10/2020 Chalmeca1178-26 9 21/10/2020 Julio Buitrago 11 3 13 - 27 9 21/10/2020 Julio Buitrago11313-27 10 22/10/2020 El Pavón 5 5 18 - 28 10 22/10/2020 El Pavón5518-28 11 23/10/2020 Salto de la Cruz 14 2 12 - 28 11 23/10/2020 Salto de la Cruz14212-28  Total General 122 67 120 2 311 Total General122671202311  "},{"text":"USO DEL BOTON DE ORO COMO FUENTE DE PROTEINA\"  TABLA DE PARTICIPACION A    TABLA DE PARTICIPACION A Nº Fecha Comunidad Varones Mujeres Jóvenes Institución de gobierno/otros Total Participantes NºFechaComunidadVarones Mujeres JóvenesInstitución de gobierno/otrosTotal Participantes 1 10/11/2020 La Ceiba 7 7 14 1 29 1 10/11/2020 La Ceiba7714129 2 11/11/2020 La Concha 5 6 15 1 27 2 11/11/2020 La Concha5615127 3 12/11/2020 Salto de la Cruz 15 8 4 1 28 3 12/11/2020 Salto de la Cruz1584128 4 13/11/2020 Walpapigne 9 9 10 1 29 4 13/11/2020 Walpapigne9910129 5 16/11/2020 María Cristina 13 4 9 1 27 5 16/11/2020 María Cristina1349127 6 18/11/2020 El Castillo 11 9 17 4 41 6 18/11/2020 El Castillo11917441 7 20/11/2020 Minas de Kisilala 10 11 5 - 26 7 20/11/2020 Minas de Kisilala10115-26 8 20/11/2020 San Ramón 10 6 6 - 22 8 20/11/2020 San Ramón1066-22 9 23/11/2020 Julio Buitrago 7 2 8 - 17 9 23/11/2020 Julio Buitrago728-17 10 23/11/2020 El Pavón 9 4 3 1 17 10 23/11/2020 El Pavón943117 11 23/11/2020 Chalmeca 5 5 14 - 24 11 23/11/2020 Chalmeca5514-24  Total General 101 71 105 10 287 Total General1017110510287  "},{"text":"LAS ECAS DESARROLLADAS EN EL MES DE DICIEMBRE (PASOS) \"PROCESO DE EVALUACION DE APRENDIZAJE DE ESCUELA DE CAMPO\"  Nº Fecha Comunidad Varones Mujeres Jóvenes Institución de gobierno/otros Total Participantes NºFechaComunidad Varones Mujeres JóvenesInstitución de gobierno/otrosTotal Participantes 1 30/11/2020 El Castillo 8 12 18 1 39 1 30/11/2020 El Castillo81218139 2 01/12/2020 María Cristina 14 4 10 1 29 2 01/12/2020María Cristina14410129 3 01/12/2020 La Ceiba 4 9 13 - 26 3 01/12/2020 La Ceiba4913-26 4 02/12/2020 Minas de Kisilala 15 12 2 - 29 4 02/12/2020Minas de Kisilala15122-29 5 03/12/2020 Chalmeca 5 6 16 - 27 5 03/12/2020 Chalmeca5616-27 6 04/12/2020 San Ramón 8 5 16 - 29 6 04/12/2020 San Ramón8516-29 7 04/12/2020 Salto de la Cruz 16 1 12 - 29 7 04/12/2020Salto de la Cruz16112-29 8 04/12/2020 La Concha 7 8 17 - 32 8 04/12/2020 La Concha7817-32 9 05/12/2020 El Pavón 10 14 6 - 30 9 05/12/2020 El Pavón10146-30 10 07/12/2020 Julio Buitrago 6 6 15 - 27 10 07/12/2020Julio Buitrago6615-27 11 09/12/2020 Walpapigne 6 6 17 - 29 11 09/12/2020 Walpapigne6617-29  Total General 99 83 142 2 326 Total General99831422326  "},{"text":"TABLA DE VISITAS TECNICAS REALIZADAS POR PROMOTORES Nº Promotor Objetivos de las visitas Nº de Visitas Realizadas   Escuelas de Campo -Ganadería -Participantes 2020 Escuelas de Campo -Ganadería -Participantes 2020 Nº Comunidad Varones Mujeres Jóvenes Total Participantes NºComunidadVaronesMujeresJóvenesTotal Participantes 1 María Cristina 14 6 12 32 1María Cristina1461232 2 San Ramón 14 10 16 40 2San Ramón14101640 3 Chalmeca 11 7 16 34 3Chalmeca1171634 4 La Ceiba 15 9 14 38 4La Ceiba1591438 5 La Concha 8 12 22 42 5La Concha8122242 6 Walpapine 13 9 17 39 6Walpapine1391739 7 Julio Buitrago 11 6 15 32 7Julio Buitrago1161532 8 El Castillo 15 17 18 50 8El Castillo15171850 9 Minas de Kisilala 16 12 20 48 9Minas de Kisilala16122048 10 Salto de la Cruz 16 8 15 39 10 Salto de la Cruz1681539 11 El Pavón 14 14 18 46 11 El Pavón14141846  Total General 147 110 183  Total General147110183  1 Silvio Fernández Espinoza  Uso de cercas vivas.  7 1 Silvio Fernández Espinoza Uso de cercas vivas.7  2 Jairo López Rosales 3 Skarleth Sandoval Ortega  Uso de pastos mejorados.  Uso de camas biológicas.  Uso de sales minerales. 10 8 2 Jairo López Rosales 3 Skarleth Sandoval Ortega Uso de pastos mejorados.  Uso de camas biológicas.  Uso de sales minerales.10 8  4 Eduardo Silva Gazo   Manejo sanitario.  8 4 Eduardo Silva Gazo Manejo sanitario.8  5 Jonny Gómez Amador  Cumplimiento de plan de finca. 7 5 Jonny Gómez Amador Cumplimiento de plan de finca.7  Total de visitas en el mes   40 Total de visitas en el mes40  "}],"sieverID":"eb049161-4d73-4583-bcf5-d5048a6c82d0","abstract":""}

data/part_1/0679e605696fb9ba28774a49eec8813e.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0679e605696fb9ba28774a49eec8813e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/430c74a7-d98a-47e2-9fd4-4a68a77cb7a1/retrieve"},"pageCount":21,"title":"\\-Llil/-/~u","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":10,"text":"' FRWa fresh root yi.,ld; DM .. dry root yield."},{"index":2,"size":46,"text":"Table 4 summarizes six years of yield data in regional trials and seven years of data for replicated yield trials in the Varietal lmprovement section. In the regional trials, only varieties and lines that had outstanding perforrnances against local varieties in each site have been included."}]},{"head":"V arietal Adaptation and Yield Stability","index":2,"paragraphs":[{"index":1,"size":69,"text":"Accumulated yield data in Table 4 enable sorne detailed analyses of cassava adaptation and yield stability. Varieties M Col 1468, M Col 1684 and M Col 22, tested for 45, 40 and 40 cycles respectively, have produced weighted average yields of 29. 1, 30.8 and 22.0 t/ ha, respectively. Yields ofthe first two are both high and relatively stable, while yields of M Col 22 are lower and unstable."},{"index":2,"size":220,"text":"M Col 1468, a variety from Campinas, Brazil (located about 20°S latitude) has peJjormed well as far as 22° N latitude. Based on good performance in Cuba, it was released for commercial production there; it was also outstanding in international yield trials this year in the Dominican Republic and Ecuador. These results confirm its wide range of adaptation. Variety M Coll684 has also produced high yields and showed good adaptation in both Ecuador and the Dominican Republic. Its high yield at the Napo Station in Ecuador (Table 5) was produced on an acid infertile Oxisol soil.  15.3 28.9 9.9 10.9 18.9 5.8 34.6 10.9 20. 1 6.3 yields were similar across locations, they were slightly lower at Media Luna and Río Negro where no irrigation was osed . Yield variation within locations was very large, especially at Carimagua due to the very high soil, water, disease and insect stresses common there. These yield variations and high maximum yields suggest three conclusions relating to selected genotypes: a) genotype x location interaction is not so great if genotypes are planted under favorable conditions at each location; b) yield variation within a location is as great as or greater than yield variation across locations; e) an apparently large genotype x environment interaction is, in many cases, actually a genotype x within-location variation interaction."},{"index":3,"size":66,"text":"Several factors influence within-location variation. Sorne such as land preparation, irrigation, soil fertility, weed control, and pesticide applications are controllable; others like temperature, rainfall, and disease and insect pest outbreaks are largely uncontrollable. Because cassava will continue to be produced primarily on marginal soils with animal or only modest input levels, understanding of within-location variation from uncontrollable factors is receiving major attention in the Cassava Program."},{"index":4,"size":190,"text":"Severa! hybrid promising lines ha ve been tested for more than lO cropping cycles and have yielded well in severa! locations including the high stress sites at Carima~ua and CIAT-Quilichao (Table 4). Performance of these crosses over time and locations indicates progress in finding superior germplasm through breeding manipulation. Yield performance and main characteristics of promising cassava lines and accessions during six years of regional trials.   Yicld variations at CIAT-Palmira, Caribia and Carimagua were analyzed for three germplasm accessions-Llanera, M Col22 and M Col 1684 (Fig. 2). While M Col 1684 had the highest average yield at all locations, its yields were also the most unstable. Yields of Llanera and M Col 22 were similar at CIAT-Palmira although Llanera yields were stable. At Caribia, Llanera yielded poorly and unstably, and M Col 22 produced relatively high, stable yields. At Carimagua, yields of all three cultiva rs were unstable. These data suggest that wide adaptation and yielding ability are both independent of 44 60 -;;- yield stability within a location. Since stable yield in one si te does not guarantee stability in other locations, stableyield musl be sought in each location."},{"index":5,"size":22,"text":"Severa! factors affecl yield stability. The following examples from regional trials testing show how sorne of the factors can influence cassava yields."},{"index":6,"size":70,"text":"Cullivars M Ven 218 and CM 308-197 are high yielding selections although bolh are susceptible lo CBB. At Carimagua they yielded well when CBB was controlled ( 197 6 plantings) and when plantings escaped heavy infection from CBB ( 1977 plantings). However, yields were almosl nil when CBB was present (Fig. 3). lt is obvious thal despite their high yield potentials, susceptible genotypes cannot provide stable yields in disease-endemic environments."},{"index":7,"size":77,"text":"CM 507-34, CM 516-7 and CM 517-1 were selected at CIAT-Palmira between 1976 and 1978; all yielded more than 50 t/ ha in 1978. CM 507-34 has produced stable yields up to now but yields of the other two have dropped markedly (Fig. 4). Over lhe years populations of thrips have been increasing al CIAT-Palmira and it was recently found lhal CM 507-34 and CM 517-1 were highly susceptible lo lhis pesl while CM 516-7 is tolerant."},{"index":8,"size":174,"text":"Similarly, yields of CM 489-1, one ofthe highest yielding lines at C1AT-Palmira, have declined steadily. In thiscase, this line was tolerant to thrips but susceptible to mites and the lace bug, two other pests w hose populations ha ve increased over the years. CM 430-9 and CM 440-5 had been high-yielding lines at Caribia. They were then found to be poor germinators (average 28%) when planted with stakes produced locally but not treated chemically (plantings of 1979 and 1980, Fig. 5). CM 342-170 on the other hand showed germination, regardless of the source• of planting stakes. Thus, germination ability also affects yield stability and genetic variation for this factor can be hidden, especially when good-quality stakes are used.    Finally, at CIAT-Palmira, Llanera and M Col 113 yielded similarly but M Col 113 was more unstable (Fig. 6). Severe lodging was observed in M Col 113 when its yields were measured below 15 t/ ha. As in many other crops, lodging ha bit was a major cause of yield instability for this cultivar at CIAT-Palmira."}]},{"head":"\\","index":3,"paragraphs":[{"index":1,"size":82,"text":"All of the factors mentioned above are genetically controlled so that each can be improved upon through breed. ing and selection. Repeated evaluation of cassava genetic materials in specific si tesis rnandatory to obtaining stable yielding cultivars. lt is for this reason that the Varietal lmprovement section does evaluations for three years in one site before releasing ma}erials for regional trials another three years in various sites within similar ecosystems. Only then can selected materials be considered ready for possible• varietal release."}]},{"head":"International Yield Trials","index":4,"paragraphs":[{"index":1,"size":67,"text":"Due to plant quarantine regulations in many countries the distribution of selected cassava germplasm as planting stakes is diminishing. This has caused a sharp decrease in the number of cooperative international regional trials planted. This trend will reverse as national workers are trained in the techniques of cassava tissue culture as a means of transferring germplasm without danger of pest and disease movement (see Tissue Culture section)."},{"index":2,"size":24,"text":"Three yield trials in two countries are reported this year (Table 5). In all locations the selected genotypes as groups outyielded local check materials."}]},{"head":"Cassava Propagation from Leaf-Bud Cuttings","index":5,"paragraphs":[{"index":1,"size":45,"text":"The international transfer of cassava varieties as diseasefree meristem cultures requires a rapid multiplication technique for use in countries receiving the new introductions. The single leaf-bud cutting technique offers a means for producing a large amount of plantin_g material from small numbers of imported clones."},{"index":2,"size":125,"text":"The single leaf-bud cutting technique was created in 1972 by Kloppenburg and workers at the Department of Tropical Crops, Wageningen University, the Netherlands, and by Sykes and Harney at the University of Guelph, Canada. lt was further improved and developed by Pateña , and others at the lnstitute of Plant Breeding, University of the Philippines, Los Baños. The method has been tested and simplified at CIA T in a joint project with the Philippine workers to make it cheaper and more efficient for cassava. Operational details of the technique are available from the ClAT Cassava Program. On a conservative basis, the method has tbe potential for enabling production of 200,000 to 300,000 plants for commercial planting from a single mother plant after only one year."}]},{"head":"Cultural Practices Weed Control","index":6,"paragraphs":[{"index":1,"size":88,"text":"Many cassava farmers agree that efficient, timely and economic weed control is possible with selective preemergent herbicides. Compared to hired labor for hand weeding, chemical control often gives more timely control because large areas can be treated in a short time before weeds begin to compete . Depending on labor cost, it may also be a cheaper option which even small farmers can afford. Furthermore, labor peaks at weeding time may limit the total cassava area; thus, herbicide use may allow the farmer to increase the area planted."}]},{"head":"Preemergent herbicide mixtures","index":7,"paragraphs":[{"index":1,"size":63,"text":"In Caribia where conditions favor a great variety of 'M!ed species and weed pressure on cassava is extremely heavy, severa! t rials were conducted to study preemergent herbicides alone and in mixtures. Mixtures were tested to: a) increase the spectrum of weed species controlled; b) check on synergistic effects among chemicals; and e) identify cheapcr mixtures having the same effectiveness as single products."},{"index":2,"size":46,"text":"Preliminary results had shown that mixtures of oxyfluorfen and alachlor promised to fulfUI these purposes. Therefore, severa! combinations of these two chemicals were tested along with other mixtures. Weed control efficiency and chemical injury ratings 29 and 57 days after application are given in Table 6."},{"index":3,"size":128,"text":"Treatment No. 5 (0.5 kga.i.j ha of oxyfluorfen and 0.7 kg a.i. / ha of alachlor) provided very effective and economical weed control; however, when purple nutsedge was a major problem, the rate . was too low to give effective control. In this case, oxyfluorfen alone (No. 1) or combination treatments No. 7 or 8 suppressed growth of purple nutsedge better without being too expensive. Higher rates of oxylluorfen alone or in mixtures with alachlor were not more elfective than these treatments and were costtier. In addition , higher rates of oxyfluorfen may be detrimental to cassava particular! y on sandy soils. Further testing on light soils is required. An interesting result was obtained with fluridone and diuron, particularly because of its above-average, early control of purple nutsedge."},{"index":4,"size":84,"text":"Strict observations of chemical injury in this tria!, which was planted on a loam soil and received 541 mm of rain during the first 60 days after application, resulted in the readings in Table 6. In no case were symptoms stronger than a light yellowing of lower lea ves without necrosis; this practically disappeared after 45 days. Earlier trials have shown that a low injury leve! does not affect cassava root yield, possíbly due to the crop's long growth cycle and vigorous recovering ability."},{"index":5,"size":93,"text":"Weed control in mixed cropplng systems For centuries traditional farming has followed the systems of growing two or more crop species simultaneously in the same field to gain food diversification, better distributio' n of work and risk aversion. Weed control was done manually by the farmer and bis family. An increasing number of small producers are now interested in using herbicides to help with tedious hand-weeding. Since they would not like to abandon intercropping as their preferred production system, the need arises for chemicals with selectivity to a greater range of crop species."},{"index":6,"size":67,"text":"Six preemergent herbicide treatments were tested on crop combinations including cassava, maize, tbe common bean, cowpea, mungbean, groundnut and the forage legume species Desmodium heterophyllum. Rates of 0.5, 1.0 and 2.0 times the commercial recommended rate of herbicides were applied with check plots left untreated. Overall efficiency of the heFbicides and their selectivity levels in individual crops were assessed weekly during the first two months after application."},{"index":7,"size":19,"text":"All treatments were chosen for their selectivity to cassava, however, only three combinations showed selectivity to other crop species."},{"index":8,"size":69,"text":"The three promising treatments from the first tria! together with two new combinations were tested in a follow-up tria! with the same crop species as previously except that Desmodium hererophyllum was replaced by Croralaria sp. Half of the tria! was planted befo re herbicide application (i.e., in the traditional way for preemergence herbicides); the other half was planted the day following application, to hopefully obtain an additional selectivity advantage."},{"index":9,"size":141,"text":"Combined results from the two experiments showed three mixtures to ha ve good weed control effectiveness and selectivity to a wide range of crop species (Table 7). The liriuron-metolachlor mixture showed a particularly high degree of selectivity, and there was no difference with respect to whether the crops had been planted before or after application. In contrast, the selectivity of the other two mixtures was markedly improved when they were applied prior to planting. Five conclusions are evident from results in the two experiments: a) Chemical .weed control in mixed cropping systems is feasible using an appropriate herbicide or herbicide combination at the correct rate of application. b) Selectivity of herbicides to the different components of a cropping system should be tested in simultaneous plantings at one location since different planting seasons or soils may alter selectivities for the individual crops."},{"index":10,"size":111,"text":"e) The selectivity of a herbicide toa number of crops can be increased by either lowering the application rate or by post-application planting. However, both practices may decrease weed control efficiency. d) A herbicide with selectivity to a variety of crops may give less effective or less persistent weed control than one selective to a single crop. However, in mixed cropping systems, an earlier and denser cover by the crops shortens the period during which effective chemical control is required. e) A mixture of 0.25 to 0.5 kg a.i. 1 ha of linuron with 1.0 kg a.i./ ha of metolachlor appears particularly suitable for weed control in cassava rnixed croppings systems."}]},{"head":"Purple nutsedge control","index":8,"paragraphs":[{"index":1,"size":97,"text":"One of the more diJficult weeds to control in cassava is purple nutsedge ( Cyperus rotundus L.). The slow initial development and ground covering of cassava and the usual wide spacing provide ideal light, moisture and nutrient conditions for purple nutsedge at early growth stages. Preliminary studies on the Colombian North Coast showed that purple nutsedge can reduce cassava root yield up to 29%. Thcrefore, experiments were designed to evaluate the potcntial of an integrated control system based on thosc principies which take advantage of purple nutsedge's proveo weaknesses, i.e., susceptibility to dehydration. shade and post-emergence herbicides."},{"index":2,"size":193,"text":"Heavily infested plots at Caribia (2300 nutsedge tubers / m 1 toa depth of 25 cm) were treated with harrowing frequencies ranging from no harrowing to harrowing e\\tery ten days during the dry season. Treatments were stopped befare rains started; after nutsedge sprouted, 50% of the plot area received an application of 4.5 literj ha of glyphosate (commercial product). Four days later, plots were subdivided in quarters and planted either to cassava alone (M Col 22 in a l x 1 m arrangement), to a cassavamungbean association (1.8 x 0.6 m arrangement) or to mungbean monoculture (cv. 1380 Mg 50-lOA, 22 x 1(}4 plants/ ha at 0.6 m row spacing). The fourth qua ter was left uncultivated. A preemergent herbicide mixture (linuron + fluorodifen, 1 kg + 7 liter 1 ha commercial product) was applied to all cultivated and uncultivated plots to control all other weeds. Percentage ground cover achieved in the different systems, from planting to 6.5 months after planting, was recorded . Changes in tuber number of cyperus rotundus from before treatments to nine months after planting (cassava harvest) are shown in Table 8 along with yields for cassava and mungbeans."},{"index":3,"size":91,"text":"In cassava monoculture, a ground cover of80% or more was attained 60-90 days after planting and an 80-100% cover was then maintained until harvest. The canopy buildup was faster with than without glyphosate; the harrowing plus glyphosate treatment provided the earliest cover. The aim of intercropping cassava with mungbeans was to provide an earlier ground cover than is possible with cassava monoculture, to obtain shade befare pre-planting treatments lost their effectiveness. A ground cover of 80-90% was obtained only 30 days after planting, irrespective of harrowin,g or herbicide treatments (Fig. 7)."},{"index":4,"size":23,"text":". Fast-growing mungbeans in monoculture quickly covered the ground but this cover was not maintained very long because of their short growth cycle."},{"index":5,"size":46,"text":"The best and most stable control in cassava monoculture was obtained from the combined harrowing and glyphosate treatment, with control from the shade becoming effective befare the preplanting treatments had lost their influence. The cassava-mungbean intercrop provided earlier and more effective control than the other systems."},{"index":6,"size":31,"text":"Besides the visible effect of pre-planting treatments and crop cover on nutsedge growth, there was also a clear influence on the weed's subterranean propagation system and on crop yields (Table 8)."},{"index":7,"size":72,"text":"Although single effects of treatments were small, there was a strong aggregate effect when the different control principies were combined. Reducing viable nutsedge tuber number to 9% of the original infestation with the second system (no harrowing, glyphosate and intercropping) while producing good crop yields, was a promising result after only one crop cycle. This experiment will be continued to follow purple nutsedge infestation under the continued influence of the different treatments. "}]},{"head":"Multiple Cropping","index":9,"paragraphs":[{"index":1,"size":36,"text":"Trials to determ ine the agronomic management of grain legumes in association with cassava were conducted at CIA T -Quilichao. Studies on mineral nutrition aspects of cassava-legume intercrops both at CIA T-Quilichao and Caribia were begun."}]},{"head":"Legume agronomy in cassava-legume intercrops","index":10,"paragraphs":[{"index":1,"size":165,"text":"Groundnuts (Arachis hypogaea L., cv. ICA-Tatui 76) were planted as an intercrop with •CMC-84 cassava a t densities betwccn 50,000 and 600,000 plants/ ha. Three row spacings were used , 45/ 2, 70/ 2 and 60/ 3 (see CJA T Cassava Prog. 1979 Ann. Rept.). Cassava planting density was constant at 9259 plants/ ha in a 1.8 x 0.6 m arrangement. Thc tria! recei vcd a basal dressing of0.5 t / ha of dolomitic lime preplanting incorporated and was bandfertilizcd at planting with 90-60-55-10-2 kg/ ha of N, P, K. Zn and B. respectively. Groundnut yields responded positively to planting densities of up to 250,000 plants/ ha (Fig. 8). Cassava root yield was rather independent of groundnut planting density (Fig. 9), but showed a significant negative relationship to groundnut grain yield (Fig. 10). Although this yield relationship was expected a nd normal dueto competition, cassava yield depression was not as severe as was observed last year with cowpeas intercropped at high pla nting densities.  •"},{"index":2,"size":2,"text":"400 500"},{"index":3,"size":11,"text":"Groundnut dcnsity (plant; ha 10' ) r = 0. 147 n.s."}]},{"head":"•","index":11,"paragraphs":[{"index":1,"size":2,"text":". ."},{"index":2,"size":35,"text":"• 600 lnjluence of groundnut planting density on cassava root yield m a groundnut-cassava intercropping system, at CIA T• Qwlichao.     Relationship between yields oj groundnuts and cassava grown in an mtercrupping system, at CIA T-Quilichao."},{"index":3,"size":60,"text":"A similar experiment was conducted with cowpeas (Vigna unguiculata, cv. TVU 354-IB) and cassava (M Ven 218), using cowpea planting densities between 50,000 and 200,000 plants/ ha in the three spatial arrangements mentioned above. The tria! received 0.5 t/ ha of dolomitic lime preplanting incorporated and band fertilization of 100-66-62-10-1 kg/ ha of N, P, K, Zn and B, respectively."},{"index":4,"size":60,"text":"Cowpea grain yield reached a flat peak at densities about 120,000 plants/ ha and declined at higher densities. While cassava root yield was strongly depressed by cowpea densities above 200,000 plantsf ha last year, the actual range of observed cowpea plant populations in this tria! (55,000 to 190,000 plants/ ha) had almost no influence on cassava yie ld (Fig. 11)."},{"index":5,"size":71,"text":"Data in Figures 8-11 are combined resulls from three different row arrangements of legumes. Although legume and cassava yield differences due to different competition situations induced by these three arrangements were observed, the agronomic behavior of groundnuts and cowpeas was not substantially altered, i.e., basic agronomic reactions such as yield response to planting density or the planting density 1 pods per plant compensation were the same for all three spatial arrangements."},{"index":6,"size":35,"text":"Three conclusions are evident for the agronomic management of grain legumes as intercrops with cassava in simultaneous planting on acid, infertile soils: a) lntercropped grain Jegumes react agronomically in the same manner as. in monoculture.    "}]},{"head":"52","index":12,"paragraphs":[{"index":1,"size":102,"text":"b) Optimun planting densities for grain legumes intercropped with cassava are similar to those for monoculture, however, plan~ing patterns must differ from monoculture to accommodate component crops in a way that minimizes competition and maximizes productivity. e) A safe margin exists between compatible plant types within which optimum agronomic management can be sought for each crop individually, to maximize its yield without seriously affecting the yield of the companion crop. This is true both for excellent growing conditions on fertile soil (CIAT -Palmira) and also for suboptimal conditions on acid, infertile soil at CIAT-Quilichao where competition for nutrients and water are important."}]},{"head":"Nutrient responses of cowpea-cassava intercrops","index":13,"paragraphs":[{"index":1,"size":290,"text":"Three experiments were conducted to determine responses of a cassava cowpea intercrop and the respective monocultures to N, P and K. At CIA T-Quilichao where soil P levels are extremely low, cassava (M Ven 218) and cowpeas (cv. TVU 354-1 B) were grown on previously uncultivated land , alone and in association at P levels ofO, 22, 44, 66 and 132 kg/ ha, banded at planting as triple superphosphate. N itrogen (as urea), K (as KC 1 ), Zn (as Zn-SO ) and B (as Borax) were also applied in bands at 100, 62, 1 O and 1 k g/ ha, respective! y; these rates were constant for all P levels. Fertilizer was divided equally between cowpeas and cassava. In the intercrop planting an allfertilizer-broadcast treatment was added. A basal application of 0.5 t/ ha dolomitic lime was incorporated before planting. Cassava was planted at 9259 plants / ha in a 1.8 x 0.6 m spacing with cowpeas intercropped at 110,000 plants/ ha in a 60 { 3 arrangement. The cowpea monoculture spacing was 0.6 x 0. 15 m. Phospborus. Leaves were sampled from the central portion of cowpea plants in the pre-flowering stage and the youngest fully expanded leaves of cassava were sampled after cowpea harvest. Leaf P concentration of cassava and cowpea are shown in Table 9. In cassava, leaf P levels were not affected by applied P levels, and in cowpea, an increase was noted only at the higbest P rate in botb monoculture and intercropping. P levels in lea ves ofboth crops tended to be lower for the intercrops than in monoculture. While leaf P levels in cassava monoculture were already well below the normal of 0.3-0.5%, they were a lmost deficient (0.2%) in intercropped cassava."},{"index":2,"size":68,"text":"Cowpeas, both monoculture and intercro pped, had considerably lower Ieaf P levels (0.5-0.9%) than those reported under normal growing conditions at the lnternational Institute for Tropical Agriculture (liT A). Besides extremely low soil P and high P fixing capacity, tbe low P concentrations in the tissue of both crops may also be seen in relation to the dry spells acompanying the sampling period which possibly reduced P uptake."},{"index":3,"size":53,"text":"Cowpea grain yield response to applied P levels showed two peaks, one at 22, the other at 132 kg/ ha(Fig. 12) with intercropped cowpeas yielding more when fertilizer (including P) was broadcast. The relatively weak, nonlinear yield response was unexpected on this highly Pdeficient soil where a more linear response would seem likely."},{"index":4,"size":145,"text":"Cassava in monoculture attained maximum root yield with only 22 kg/ ha P whereas, in the cassava-cowpea association with banded fertilizer, maximum root yield was reached with 44 kg/ ha P; with the broadcast application, 66 kg/ ha P were needed to produce maximum root yield (Fig. J 2). lt appears logical that with greater demand for nutrients, in particular P, in association, peak yield should ha ve been produced at a higher leve! of applied P than in monoculture. With competition for P in the association, 700 kgf ha more roots were obtained with 22 kg/ ha P less, when fertilizer was banded instead of broadcast. Greatest root yield was never obtained with the highest P leve!, confirming that although cassava has a high externa! requirement of P for maximum growth, maximum root production is achieved at much lower P levels in the field."},{"index":5,"size":238,"text":"These results show that competition for P in a Pdeficient soil is more in tense when cassava and cowpeas are intercropped than in monoculture. This is confirmed by foliar analyses and by crop productivity. In order to compensate for higher P demand in intercropping and avoid P deficiency, each crop in the intercropping should    Nitrogen and Potasium. The N and K response trials grown in Caribia on a soil with low organic matter and K but high extractable P levels (Table 10) were identical in design and agronomic practices to the P response trial. The cassava and cowpea cultivars were M Col 22 and TVX 1 193-059 D, respectively. In the N response trial, nitrogen was applied as urea at rates ofO, SO, 100, I50 and 300 kgf ha N anda constant fertilization of 63 kgf ha K (as KCI), 10 k g / ha Zn (as Zn$0 4 ) and 1 kg/ ha B (as Borax) were band applied at planting. The K response trial received rates ofO, 42, 84, 126 and 252 kg/ ha of K anda constant fertilization of 1 00 k g/ ha N, 1 O k g/ ha Zn and 1 kg/ ha B, using the same sources as above. In both trials, all fertilizer was banded at planting, except in the intercropped all-fertilizer-broadcast treatments. Sampling of plant tissue and soil for analyses was done in the manner and at intervals described before."},{"index":6,"size":164,"text":"Leaf N concentrations were not affected by applied N rates in either cassava or cowpea, however, intercropping reduced cassava leaf N from normal concentrations (4.7-5.4) to near deficient levels (4.5-4.8), whereas N in cowpea leaves was not influenced by intercropping (Table 11). Cassava root yield in monoculture responded positively to SO kg/ ha N ( Fig. 13 ). When intercropped with cowpeas, cassava yields were lower than in monoculture up to an N leve! of 100 kgf ha. At higher N rates, cassava intercrop yields were greater than monoculture yields, with the increase being stronger with broadcast than with banded N. Although cowpeas did not respond with grain yield to N fertilization, they appeared to strongly compete for this element. Both the facts that leaf N concentration in cassava was reduced through intercropping, and that high N rates compensated for initially depressed cassava root yields in intercropping, point to a N competition situation in the mixed stand which was corrected by increased N fertilization."},{"index":7,"size":100,"text":"Cassava's yield performance is understandabie from the influence of N rates on top growth and harvest index. M Col 22, which is rather vigorous in the hot, humid environment of Caribia, showed exccesive top growth at the higher N rates in monoculture; thus, harvest index and yield decreased. With intercropped cowpeas, cassava top 54 growth without applied N was 19% less than in monoculture. However; higher N rates increased top growth of intercropped cassava, bringing about a better balance between top and root growth and resulting in root yields comparable to those obtained at low N rates in cassava monoculture."},{"index":8,"size":91,"text":"In contrast to cassava, cowpea, with its aggressively growing and expanding root system,should ha ve made use of most of the available N at zero and low rates of applied N. As a legume, it also should not have suffered from N deficiency due to rhizobial symbiosis. While the N-fiXing activity may ha ve been reduced at higher N rates, this was apparently nearly compensated for by a greater N uptake from fertilizer in these treatments. As a result, both leaf N and grain yield were stable over all N rates."},{"index":9,"size":283,"text":"In the K response trial, cassava petiole K concentrations clearly increased according to applied K rates, both in monoculture and intercropped cassava (Table 12). Petiole K was slightly lower in intercropped than in monoculture cassava, but in both systems, K concentration was well above the normal range of 1.5-3.0%. In contrast, cowpea Jeaf K concentration was not affected by either K rates or cultivation system. Similar to the N trial, monoculture cassava root yield responded positively up to 42 kg/ ha, and yields declined at the higher K rates (Fig. 14). Yield of intercropped cassava was lower than the monoculture yield at the low K rates but increased to the maximum monoculture yield at the highest K rate, with no significant difference between banded and broadcast applications. Cowpea yields werenot influenced by either the cultivation system or method of application and yield was stable over all K rates. Competition for K was probably the least of the three major elements examined at ClA T-Quilichao and in Caribia,although sorne roa y ha ve occurred in intercropped cassava as the positive yield response to the highest K rate roa y suggest. H owever, petiole K concentrations were high enough to indicate that cassava, even when intercropped, was far from a deficiency situation. Cowpea nutrition with K was apparently also adequate as both the lack of differences in leaf K concentrations of monoculture vs i ntercropped cowpea and the absence of yield response to hígher K rates would indicate. K fertiJization in cassavacowpea intercropping systems should, therefore, be directed mostly to the needs of cassava which extracts greater amounts of this element whereas the removal by cowpea when only seed is harvested, is rather low . "}]},{"head":"Stonge of Planting Material","index":14,"paragraphs":[{"index":1,"size":98,"text":"Cassava planting material undergoes a variety of transfonnations d uring storage which may seriously affect its value for future plantings. lt has been shown previously that fungal infestation is probably the most detrimental factor for stake preservation. Besides being attacked by pathogens, stored cassava stems lose moisture, and the dehydration of living stake tissue leads to irreversible loss of bud viability. The loss of moisture is related to both storage duration and conditions and may be considerable. When 1 m cassava stems were stored for 201 days in an open-air, bamboo shade environment, weigbt loss was almost 40o/o."},{"index":2,"size":81,"text":"Another change during storage occurs in the so1ublenonsoluble carbohydrate concentration of tbe stakes. The former increases and the latter decreases during storage, with the new carbohydrate loss possib1y dueto respiration and rooting and sprouting. During 201 days of storage, the soluble fraction increased from 3.5 to 5.0% wbile nonso1ub1e carbohydrates decreased from 26.6 to 8.4%. Roots and sprouts were removed from tbe stored material before ana1yses. As a consequence of these processes, the amount of useful planting material diminishes with storage."},{"index":3,"size":69,"text":"When the same stake selection criteria were applied to stakes from 1-m stems which were cbemically treated and stored for different intervaJs, tbe usefuJ amountofp1anting material obtained from these stems was reduced over 180 days from 98 to 59o/o. While a pre-storage treatment witb fungicides (BCM and captan at 3000 ppmeach)can reduce pathogenic deterioration of the stakes, storage conditions influence the degree of debydration and 1oss of carbohydrate reserves."},{"index":4,"size":89,"text":"• Stems 1 m long of variety CMC-40 were stored for 60, 120 and 180 days under either dry room or bamboo-shade field conditions with and without adding sodium a1ginate for protection against dehydration to the standard fungicide treatment. After storage all materials were planted together with fresh stakes at 1 x 1 m in a preirrigated field. Sprouting, ear1y growth and canopy formation were monitored to determine whetherearlycrop development was affected by storage intervals or treatments, and bow an influence on ear1y crop development would affect final productivity."},{"index":5,"size":35,"text":"Neither storage sites nor chemical treatment with sodium alginate influenced sprouting and ear1y deve1opment. Storage intervals did not affect final sprouting percentage(Figs. 15 and 16) but clearly influenced early growth and canopy formation (Table 13)."},{"index":6,"size":52,"text":"Correlations between these early growth parameters and final root yield were not aH significant and ratber low ( Tab1e 14 ). Nevertheless, more vigorous ear1y growth and canopy expansion appeared positive1y related to high final yield. This was particuJarly true for plant height at 45 days, mean leaf size and light interception."},{"index":7,"size":112,"text":"The in verse was true when top growth during la ter stages was related to root yield. Weight of tops at harvest was reduced by storage, with reduction proportional to tbe length of the storage interval. The reduction in top weight appeared to be directly related to an increase in harvest index which was highest at the 60 and 180-day storage intervals and lowest with fresh stakes. Total and commercial root yie1ds in turn showed the same ranking as did harvest index (Table 15).  e) The use of sodiwn alginate in dip treatments, together with fungicides, to reduce moisture loss from stored planting material, does not appear to provide any additional advantage."},{"index":8,"size":125,"text":"d) The transformation of part of the nonsoluble carbohydrate fraction (starch) into soluble carbohydrates {sugar) during storage of cassava stems appears to enhance early growth and canopy forrnation in the young crop when storage has been for two months or less. Vigorous early growth and establishment seems to be positively related to fmal root yield. With longer storage intervals, loss of carbohydrates from stored stems-principally due to respiration, rooting and sprouting-may be considerable and cause depressed growth of tbe crop during early and later stages. e) Reduced top growtb of cassava raised from longstored planting material may cause an increase in harvest index and, thus, in total and commercial root yields. This should apply in particular to vigorous, leafy types of cassava. Printcd: Should be: "}]}],"figures":[{"text":"Figure 1 Figure 1 shows yield data for M Col 1684 in seven Colombian locations below 1300 mas!. While maximum "},{"text":"Figure 3 . Figure 2. "},{"text":"Figure 4 . Figure 4. Yield fluctuatións of cassava lines having diflerent resistances to insects, at CIA T-Palmira.4S "},{"text":" Figure "},{"text":"Figure 6 . Figure 6. Yiefd fluctuations of cassava fines having di.fferent fodging habits, at CIAT-Pafmira. "},{"text":" Figure 8. "},{"text":"•Figure 12 . Figure 12. Effects of rotes and application methods of P on yields of cassava and cowpeas in association and monoculture, at CIA T-Quilichao, 1980. "},{"text":"Tab1e 10 . Soil characteristics of the Caribia experimental site, 1979. "},{"text":"35K Figure 14. E.ffects of rores and oppficorion methods of K on yields of cassovo ond cowpeas in associotion ond monoculture, oJ Caribio, IY80. "},{"text":"Figure 15 .Figure 16 . Figure 15. Sprow ing and crop establishment when fresh cassava :uakes are planted after chemicaltreatment. "},{"text":" Figure2 "},{"text":"Table J . Main climatological and edaphic characteristics at sites of the 1979-80 regional yield trials for cassava, in1Colombia.        . -      9.5 . -9.5 CM 309-211   3.4          3.4 CM 309-2113.43.4 M Col 22 19.6            19.6 M Col 2219.619.6 CMC 9              CMC 9 (M Col 1438)      11.0       11.0 (M Col 1438)11.011.0 M Mex 59      30. 1   1 -    30. 1 M Mex 5930. 11 -30. 1 Si te CMC 76 Altitude Mean Rainfal1 1 Days to Soil texture Soil Soi.l Soü P , SoiJ K Si te CMC 76AltitudeMeanRainfal1 1 Days toSoil textureSoilSoi.lSoü P ,SoiJ K (M Col 1506)  Temperature 34.5  harvest   pH orgaoic Bray ll  34.5 (M Col 1506)Temperature 34.5harvestpHorgaoicBray ll34.5 ICA-HMC-3 Media Luna ICA-HMC-53 (mas1) 10 (oq 31.7 27.2 64.2 (mm) 1190 328  Sandy 1oam  6.6 (%) 0.7 (ppm) (meq/ 100 g) 31.7 7.2 0.08 64.2 ICA-HMC-3 Media Luna ICA-HMC-53(mas1) 10(oq 31.7 27.2 64.2(mm) 1190328Sandy 1oam6.6(%) 0.7(ppm) (meq/ 100 g) 31.7 7.2 0.08 64.2 Chigorodó Average, including 28 28.0 1059 305  Silty clay 1oam  6.8 4.2 27.8  0.51  Chigorodó Average, including2828.01059305Silty clay 1oam6.84.227.80.51 Carimagua local varieties 200 15.3 26.2 45 .7 2867 6.9 398 17.4 Si1ty clay 20. 1 35.3 4.7 3.2 20.4 1.9 37.9 0. 14  Carimagua local varieties200 15.326.2 45 .72867 6.939817.4Si1ty clay 20. 135.34.73.2 20.41.937.90. 14 Rlo Negro San Ma rtln Best promising OAT-Pa1mira hybrid or variety 250 300 1000 25 .9 27 .0 25.0 23.8 64.2 2009 2373 704 18.2 329 332 336 24.6 Sandy clay 1oam C1ay C1ay 24.5 55.7 4 .4 4.2 7.0 2. 1 3.2 3.9 32.0 4.0 7.4 73.3 55.2 0. 11 0. 16 0.70 37.5 Rlo Negro San Ma rtln Best promising OAT-Pa1mira hybrid or variety250 300 1000 25 .927 .0 25.0 23.8 64.22009 2373 704 18.2329 332 33624.6Sandy clay 1oam C1ay C1ay 24.555.74 .4 4.2 7.02. 1 3.2 3.9 32.04.0 7.4 73.355.20. 11 0. 16 0.7037.5 C IA T-Qui1ichao 1070 23.0 1233 310  Clay 1oam  3.6 6.7 40.5  0.35  C IA T-Qui1ichao107023.01233310Clay 1oam3.66.740.50.35 Caicedonia 1200 22.2 1344 256  Sandy clay 1oam  5.5 3.2 40.5  0.35  Caicedonia120022.21344256Sandy clay 1oam5.53.240.50.35  "},{"text":"Table 3 . Cumulative average fresh and dry root yields of the three best promising varieties compared with the best •local variety. a t nine sites of cassa va regional trials. Si te Si te  "},{"text":"Table 4 .   "},{"text":"Table 4 . (continued). Averaae Dry Dileax ractáons 1 AveraaeDryDileax ractáons 1  "},{"text":": s .Sua«pleblt: MRa Modentely reti.ltant; R. ResiJtanl h auru '\" JH~tenthesn 11\\dlc.atc num.ber o( croppu\\1 cycl«. .1:1.  Fresh root yields of promising ICA-CIA T cassava lines and Fresh root yields of promising ICA-CIA T cassava lines and varieties harvestcd in international regional tria ls during the varieties harvestcd in international regional tria ls during the 1979-80 testmg cycle.   1979-80 testmg cycle. Line or  Yield (t/ ha)  Line orYield (t/ ha) varicty Ecuador Napo Station Dominican Rcp. varictyEcuadorNapo StationDominican Rcp.  Pichilingue  San Cristóbal PichilingueSan Cristóbal Best local l 32.2 17.9 23 .0 Best local l32.217.923 .0 M Col 1468    M Col 1468 (CMC 40) 30.4 14.0 42.5 (CMC 40)30.414.042.5 M Col 1684 37.2 30.7 35.4 M Col 168437.230.735.4 CM 305-4 1 42.0 9.0 37. 1 CM 305-4 142.09.037. 1 ICA-HMC-1 26.5 21.5 31.6 ICA-HMC-126.521.531.6 CM 305-145A 33.2 15.6 18.9 CM 305-145A33.215.618.9 M Ptr 26 32.1 17.3  M Ptr 2632.117.3 M Mex 17 23.7 19.4  M Mex 1723.719.4 CM 321-188 46.6   CM 321-18846.6 ICA-HM C-7 46.3  36.2 ICA-HM C-746.336.2 CM 323-142 38.5   CM 323-14238.5 CM 305-120 35.4   CM 305-12035.4 CM 309-163    CM 309-163 CM 344-27    CM 344-27 CM 192-1 29. 1   CM 192-129. 1 CM 305-122    CM 305-122 CM 340-30    CM 340-30 CM 344-71    CM 344-71 ICA-H MC-2  38.5 40.8 ICA-H MC-238.540.8 CM 308-197  15.2 35.4 CM 308-19715.235.4 CM 323-375  12.7 37.0 CM 323-37512.737.0 M Col 1513    M Col 1513 (CMC 84)   33.8 (CMC 84)33.8 CM 305-38   29.8 CM 305-3829.8 lCA-HMC-4   28.5 lCA-HMC-428.5 M Ven 218   27.9 M Ven 21827.9 CM 309-21 1   23.5 CM 309-21 123.5 M Mex 59   23.1 M Mex 5923.1 M Col 22   21.7 M Col 2221.7 Average yield,    Average yield, without local check 32.8 19.4 31.5 without local check32.819.431.5 Bc•t local at Pichilingue: Yema de Huevo; at San Cristóbal: Zenon. Bc•t local at Pichilingue: Yema de Huevo; at San Cristóbal: Zenon.  "},{"text":"Table 6 . Wced Chemical Cost ChemicalCost  "},{"text":"Table 7 . Promising preemergent herbicide mixtures for use in cassava-based intercropping systems based on rates and time of application, effectiveness and selectivity in eight crops, at CJAT-Palmira, 1980. 48 48  "},{"text":"Table ! ! . Number of viable tubers of purple nutsedge and yíelds of cassava and mungbeans in dífferent nutsedge control system~. at Caribia, 1979-80. 1 Control system Viable• Cassava Mungbean Control systemViable•Cassava Mungbean  tubers  yíeld yield tubersyíeldyield (per m 1 ) (%)2 (t / ha) (kg/ ha) (per m 1 ) (%)2(t / ha)(kg/ ha) No harrowíng. no glyphosate;     No harrowíng. no glyphosate; cassa va-mungbean intercrop 1847 80 15. 1 1115 cassa va-mungbean intercrop18478015. 11115 No harrowing, with glyphosate;     No harrowing, with glyphosate; cassava-mungbean mtercrop 208 9 18.5 1499 cassava-mungbean mtercrop208918.51499 Ha rrowing every 10 days. with     Ha rrowing every 10 days. with glyphosate; cassava-mungbean     glyphosate; cassava-mungbean intercrop 557 24 7.8 1632 intercrop557247.81632 ' Evalualed nme months afler planung.     ' Evalualed nme months afler planung.  "},{"text":"Table 9 . Effects of ba nd-applied P rates on leaf Pconcentratio n of cassava and cowpeas grown in monoculture and intercropped, at CIA T-Quilichao, 1979. p p  "},{"text":"Table 13 . Effects of sto rage duration of cassava planting material on growth parameters during lhe flrts JO weelc.s after planting, at C IAT-Palmira, 1979. 1 Variety C MC 40; treated w1th BCM a nd captan (3000 ppm each) bcfore storage; means of two stora&e sites and two chemical treatmenu (w1th and wnhout sod1um algmate). ' DAP•days after p lanting ' Values WJthin the same column and foUowed by the same leu er are not significanlly different at the S% level. Storage Sprouting Final Plant Mean number Mean leaf Light StorageSproutingFinalPlantMean numberMean leafLight duration ratc sprouting, hcight, stems/ plant, siz.e, interception, durationratcsprouting,hcight,stems/ plant,siz.e,interception,   31 DAP 2 45 DAP 60DAP 60 DAP 76 DAP 31 DAP 245 DAP60DAP60 DAP76 DAP  (plants      (plants (days) dayf plot) (%) (cm)  (cm 2 ) (%) (days)dayf plot)(%)(cm)(cm 2 )(%) o !'f13 a 1 100 a 26 a 2.66 a 278 ab 77 a o!'f13 a 1100 a26 a2.66 a278 ab77 a 60 1.83 a lOO a 27 a 2.73 a 282 ab 78 a 601.83 alOO a27 a2.73 a282 ab78 a 120 1.59 ab 100 a 23 b 2.36 b 253 b 72a 1201.59 ab100 a23 b2.36 b253 b72a 180 1.40 b 98 b 25 ab 2.23 b 296 a 75 a 1801.40 b98 b25 ab2.23 b296 a75 a  "}],"sieverID":"1f058bf8-a413-43bf-b24e-3a66f7dc4a3b","abstract":"Results of sixtb c:yde. The sixth testing cycle for promising cassava varieties under uniform improved technology (CIA T Ann. Rept. 1974)  was completed in 1980 with harvesting at eight locations in Colombia. Table 1 shows the edaphic and climatic conditions of the different sites.Lime and fertilizer were used only at Carimagua and CIAT-Quilichao. At Carimagua, rates applied were 0.5 t/ ha of lime, 1 t/ ha of 10-20-20, 20 kg/ ha of S and 5 kg/ ha of Zn. At CIAT-Quilichao, where planting has been done in the same field for three years, 375 kg/ ha of lime, 100 kgj ha of N and 50 kg/ ha of P2 05 were applied; zinc was included in the stake treatments.Principal problems in 1980 were heavy attacks of CBB and superelongation at Carimagua and superelongation, frog skin, Cercospora diseases, mites, white flies, white scale and thrips at ClA T-Quilichao. At Rfo Negro, 8 month-old plantings were completely defoliated by the cassava hornworm.As in previous years, the best selected fines outyielded local materials an average of37.5 t/ ha to 18.5 t/ ha. M Col 1684, CM 342-55 and CM 489-I outyielded tbe best local clones in seven of eight sites; CM 308-197 and CM 462-6 surpassed local materials in six of eight sites; and CM 430-37, CM 321-188, CM 311-69, CM 451 -4, C71-4 and ICA-HMC-2 were outstanding in five of eight sites (Table 2). This again reflects the higher yie1d potential of selected improved material, compared to regional or local varieties.Two new hybrids (CM 342-55 and CM 430-37) seem promising after their relatively high yields across severa! locations including Carimagua and CIAT-Quilichao. CM 342-55 is the result of crossing M Col 22 and M Col 1468 (CMC-40); the latter parent is widely adapted with good yield stability over time.Overall six-year results. After six years of regional trials the three most promising cultivars at each site produced an average fresh root yield across all si tes of 34.6 t/ ha, compared to 20. 1 t/ ha for local varieties (Table 3). tyioreover, at each site, promising materials substantially outyield local cultivars. This represents a tremendous increase in both types of materials compared with the Colombian average estimated yield of 9.7 t / ha. :•Jable 2.Yields of pro mising ICA-CIA T cassava varieties and hybrids at eigbt locations in Colombia during 1979-80 regional trials."}

data/part_1/06abfe2fc605655640c21a629a0dd613.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06abfe2fc605655640c21a629a0dd613","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c1f40a0e-6e60-4515-a598-6725d150224e/retrieve"},"pageCount":4,"title":"","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":69,"text":"Africa is the best-placed continent to take advantage of the 'sustainable intensification' of agricultural, particularly livestock, systems, producing significant benefits in terms of increased food security, incomes, trade, and smallholder competitiveness, as well as improved ecosystem services (Herrero et al. 2014). Low crop and livestock yields suggest substantial scope for increasing productivity through increased provision of services and inputs, and enhanced institutional support and market efficiency, i.e. sustainable intensification."},{"index":2,"size":88,"text":"Rapid growth in demand for animal-source food in Africastimulated by rapid increases in population, urbanization and per capita incomes-offers a major opportunity to achieve these objectives and the United National Sustainable Development Goals (SDGs). Livestock are critical to smallholder mixed crop/livestock and pastoral systems in much of Africa. In most African countries 60-80 % of rural households keep livestock as mobile and liquid assets, income generators, and for household food security and nutrition. Organic fertilizer (manure) and animal traction also make indirect and critical contributions to crop production."},{"index":3,"size":55,"text":"In 2005/07, the average African consumed about 11kg of meat and 35 litres of milk per year, expected to rise to 26kg and 64 litres respectively by 2050 (Alexandratos and Bruinsma 2012). Notable per capita consumption increases are more striking when population increases between 2007 and 2050 of more than 100% are taken into account."}]},{"head":"ILRI POLICY BRIEF 18 October 2015","index":2,"paragraphs":[{"index":1,"size":33,"text":"Although encouraging, expected consumption levels are still far lower than FAO recommended levels of 50kg of meat, 200 litres of milk, and 300 eggs per capita needed for sustainable human development (FAO 2009)."},{"index":2,"size":83,"text":"Projections following a 'business as usual' scenario by Herero et al. 2014 indicate that, despite increases in investment and technological change, African producers would not be able to satisfy the growing demand for livestock products, including: expected consumption increases of 300% for milk and more than 600% for pork and poultry. Rising demand could only be met by increases in imports, causing the trade deficit to double to 20%. Untenable for producers, consumers and continental food security, this is not a 'sustainable' scenario."},{"index":3,"size":70,"text":"As part of its strategy to realize the livestock sector's potential, the African Union's Inter-African Bureau for Animal Resources (AU-IBAR) has coordinated the formulation of the 20-year Livestock Development Strategy for Africa (LiDeSA) designed to fast track policy reform in the sector, transformative technological change and productivity improvement. The LiDeSA also highlights the contribution of livestock to the Africa Accelerated Agricultural Growth and Transformation Agenda (Malabo Declaration (Assembly/AU/ / Decl.1(XXIII))."}]},{"head":"Sustainable intensification scenario","index":3,"paragraphs":[{"index":1,"size":62,"text":"Only annual livestock productivity growth of 6% will be able to meet rising demand domestically (Herrero et al. 2014). This can only be achieved under a 'sustainable intensification' scenario, meeting priority development goals and maintaining the current trade deficit until 2050. Such projected increases in demand under this scenario offers major opportunities for market-driven growth for smallholder farmers and large-scale commercial producers."},{"index":2,"size":106,"text":"Both improved smallholder family and large-scale commercial specialized systems can play complementary roles in bringing about African livestock transformation. Large-scale commercial specialized farms and processors can act as innovation leaders providing examples which act as 'pull' factors for productivity improvement in smallholder systems. The strategy for African livestock sector thus needs to have a dual-track approach: Support potential market-oriented producers to enhance livestock production and productivity, generating spill-over benefits in terms of employment and lower animal-source food prices for consumers; and build the capacity of poor smallholder livestock keepers capacity to fully utilize their livestock assets, helping improve their livelihoods in the short to medium term."},{"index":3,"size":110,"text":"The 'sustainability scenario' would involve rapid global progress in reducing fossil fuel dependency. Low-income countries would grow more rapidly, inequality between and within economies fall, technology spread, and more action to reduce the environmental costs of growth would be taken. Investments in education would help cut population growth. The SDGs would be achieved by 2030, resulting in educated populations being given access to safe water, improved sanitation and medical care. Other factors reducing vulnerability to climate and other global changes would include the implementation of stringent policies to control air pollutants and rapid shifts towards universal access to clean and modern energy in the developing world (Herrero et al. 2014)."},{"index":4,"size":71,"text":"Meeting SDGs through the sustainable intensification strategy would require substantial increases in livestock productivity, as well as increases in total cattle numbers. Reducing greenhouse gas emissions could be meet by increasing the share of chicken meat in total meat consumption, reducing the share of larger high emitting ruminants. This would require substantial investments in promotional activities to change tastes and preferences from red to high yielding crossbred chicken meat and eggs."},{"index":5,"size":125,"text":"Even under the sustainable intensification strategy smallholder African livestock keepers will only realize the potential benefits if their competiveness is enhanced and policy makers maximise economic and social benefits of growth, thereby contributing to their food security, improved nutrition and poverty reduction and minimizing the negative effects to the environment and public health. Realistic goals for African livestock transformation over the next 15 years include a doubling of livestock production, of the contribution of livestock inputs into domestic industrial sectors and of exports and export earnings, a halving of domestic livestock product prices and the achievement of livestock relevant SDGs. Indirectly the livestock sector could contribute to higher incomes, job creation, downward pressure on animal-product prices and increased supply of agricultural inputs for industrial production."},{"index":6,"size":13,"text":"In line with the findings of Africa Livestock Futures (Herrero, et al. 2014)  "}]},{"head":"Priority technology interventions","index":4,"paragraphs":[{"index":1,"size":217,"text":"Based on these, and some country-specific, development objectives, African Livestock Futures identifies four key commodity livestock value chains with the most long-term potential to transform the continent's livestock production by 2050. They involve investing in both ruminant and monogastric livestock systems: red meat and milk (from cattle, sheep, goats, and camels); poultry meat and eggs; pork; and specialized dairy (from cattle, goats and camels) (Herrero et al. 2014). Depending on biophysical, agro-ecological, and market conditions facing livestock, it was found that various combinations of three standard types of livestock technology interventions-improved genetics, health and feedwere best placed to increase productivity and incomes, and thus help achieve most national development objectives and SDGs. They include: • Improvements in cattle and goat dairy breeding by combining artificial insemination using exotic semen with oestrus synchronization in dairy shed and periurban areas. • Investment in the animal health of local meat and dairy ruminants, undertaking critical vaccinations and parasite control measures, designed to reduce young and adult stock mortality and increase productivity. • Public investment in rehabilitating range and pasture lands to improve feeding and animal management. • Private and/or public-private investment in the importation and dissemination of improved semiscavenging poultry breeds and exotic pig breeds, together with improved animal health and extension services. • More specialized commercial production units, i.e."},{"index":2,"size":21,"text":"animal numbers in all value chains, wherever conducive agro-ecological and market conditions prevail, and employ appropriate genetic, health and feed technologies."}]},{"head":"Priority policy interventions","index":5,"paragraphs":[{"index":1,"size":94,"text":"The public sector will need to create an 'enabling business environment' for the livestock sector. It will need to not only supply key public goods-such as infrastructure and an animal health disease and control system-but also facilitate social desirable private sector innovation by providing tax and other incentives to entrepreneurs willing to enter the livestock value chains or expand their livestock. Public policy should also ensure that medium-scale livestock farmers and commercial farms tap into the growing animal food market and that small livestock producers sustainably maximize the contribution of animals to their livelihoods."},{"index":2,"size":57,"text":"Attracting substantial levels of private investment in postproduction and processing will be required to achieve revolutionize African livestock sectors. In line with the African Livestock Future study findings, incentives should be focused on smallholder farms and small-scale postharvest agro-industries (Herrero et al. 2014). Realizing the potential of the technological interventions will require complementary policy changes, governments should:"},{"index":3,"size":194,"text":"• Promote substantial private investment in livestock product transformation, by incentivizing 'value-added' processing. • Promote private-sector investment in flour and oil mills to encourage the production of additional feeds from agro-industrial by-products by introducing tax and/ or land-lease incentives, and protective policies against flour and cooking oil imports; • Boost the availability of credit and simplify the investment licensing process to facilitate investment in value-adding processing plants and feed production and mills. • Introduce policy and legislation to promote the establishment of forage seed industries, the production of improved forage and fodder, and trade in feed. • Promote and enforce outsourcing contracts for forage and forage seed production. • Introduce policy measures to rationalize public and private sector roles in the provision of veterinary services, leading to transition to private provision of clinical services wherever feasible. • Promote feed-use efficiency by removing VAT and duty on feed mill ingredients, and introducing quality control enforcement measures. • Promote exports to more remunerative markets through the introduction of a practical and affordable system of animal ID and traceability, as well as programs to ensure food safety and animal health through monitoring of abattoirs and disease surveillance."}]},{"head":"Proposed interventions to strengthen institutional capacity","index":6,"paragraphs":[{"index":1,"size":28,"text":"The transformation of the sector has been hindered by a lack of institutional capacity at national, regional and continental level to develop and implement strategies driving sustained growth.  "}]}],"figures":[{"text":" Unlocking Africa's agricultural potential for transformation to scale African livestock developmentSimplice Nouala and Barry I Shapiro "},{"text":" Photo credits: Page 1: ILRI/Niels Teufel Page 1: ILRI/Dave Elsworth Page 3: ILRI/Stevie Mann Page 4: ILRI/Stevie Mann "},{"text":"  "},{"text":" and the Livestock development Strategy for Africa (AU-IBAR 2014), investment in the priority technology and policy interventions proposed in this brief are crucial to successful transformation of African livestock sectors. They would help reorganize African livestock sectors. They would help reorganize traditional smallholder family farms into improved market- traditional smallholder family farms into improved market- oriented, profitable and sustainable systems, as well as oriented, profitable and sustainable systems, as well as substantially enhance profitability and sustainability of large substantially enhance profitability and sustainability of large commercial specialized systems. This would help meet the commercial specialized systems. This would help meet the livestock-related SDGs and national livestock development livestock-related SDGs and national livestock development objectives driving investment interventions and policy objectives driving investment interventions and policy change initiatives (Shapiro 2015), such as: change initiatives (Shapiro 2015), such as: • Reducing poverty • Reducing poverty • Achieving food and nutritional security • Achieving food and nutritional security • Contributing to economic growth (GDP) • Contributing to economic growth (GDP) • Contributing to exports and foreign exchange earnings • Contributing to exports and foreign exchange earnings • Contributing to environmental sustainability • Contributing to environmental sustainability • Contributing to climatic resilience • Contributing to climatic resilience • Protecting human health from zoonotic diseases • Protecting human health from zoonotic diseases  "},{"text":" Improved coordination, partnership, and alliance within and across sectors and countries. • Increased public investment in agriculture achieving better value for money. • Enhanced knowledge support and skills development through improved science and technology, education and training, analytical capacity peer learning. • Improved and inclusive evidence-based policy design, • Improved and inclusive evidence-based policy design, development planning and implementation capacity development planning and implementation capacity focusing on poverty, food security and health. focusing on poverty, food security and health. • More effective and accountable planning to drive • More effective and accountable planning to drive implementation of public policies and investment implementation of public policies and investment programs. programs. • • Building the capacity of farmers Building the capacity of farmers and institutions, in line with the Comprehensive African and institutions, in line with the Comprehensive African Agricultural Development Program (CAADP) results Agricultural Development Program (CAADP) results framework would enhance the ability of the livestock framework would enhance the ability of the livestock sector to significantly contribute through balanced and sector to significantly contribute through balanced and inclusive socio-economic growth, helping achieve multiple inclusive socio-economic growth, helping achieve multiple development objectives of African governments. Policy development objectives of African governments. Policy makers need to ensure: makers need to ensure:  "}],"sieverID":"42bc1631-1650-406a-939b-0381a17013ad","abstract":""}

data/part_1/06b643bcc6decbf6ce6e69a69507a352.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06b643bcc6decbf6ce6e69a69507a352","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c974c7cf-0ec5-4760-afb5-73943495343f/retrieve"},"pageCount":6,"title":"Minutes ILRI 62 nd Board meeting","keywords":["EMD (Claudia Sadoff)","CGIAR board secretariat representative (Christine Larson-Luhila)","BAC members (Judith Lungu","Chanda Nimbkar)","members of ILRI senior management"],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":6,"text":"The consent agenda items were approved."}]},{"head":"Opening and Agenda","index":2,"paragraphs":[{"index":1,"size":133,"text":"The Board chair welcomed all board members, those in Ethiopia and joining virtually. Anne Eriksson, incoming AFRC focal point for ILRI joined the meeting in person and was welcomed. The Board chair noted that all members had completed the required declarations of interests which had been reviewed by the chair and DG who noted that there were no conflicts of concern. The chair invited members to raise any potential conflict of interest in relation to the present meeting. Martyn Jeggo noted a relative had joined PwC in Australia (no relationship to Kenya) and was asked to add this to the register. Patrick Caron noted he is no longer vice chair of university. Hilary Wild noted interest in two items, namely ILRI Board (agenda 5) and AFRC membership (agenda 4). Page 2 of 6"},{"index":2,"size":34,"text":"One addition to the agenda under agenda 5 was indicated -the chair of the search committee for the new EMD, Patrick Caron would provide a brief update. With this, the meeting agenda was approved."},{"index":3,"size":19,"text":"The chair welcomed the incoming ILRI director general, noting he had been in the post for just six weeks."},{"index":4,"size":76,"text":"2. Strategic issues for discussion a. Director General's report The Director General (DG) presented his report to the Board, noting that he had begun his term on 1 April 2023, succeeding the former DG Jimmy Smith, with Shirley Tarawali having been interim DG and senior director livestock-based systems for the first three months of the year. He expressed appreciation for the smooth transition facilitated by the former and interim DGs as well as the management team."},{"index":5,"size":35,"text":"Noting that the Board meeting format is now considerably shorter than previously, the DG appreciated the opportunity afforded to him for a virtual interaction with Board members several weeks earlier. His report covered several elements."}]},{"head":"Context","index":3,"paragraphs":[{"index":1,"size":73,"text":"Noting that the IFA was signed by 12 centres in February 2023, the DG noted the opportunities for continued and ongoing strategic and operational engagements to support IFA implementation. He further highlighted that country and regional operations will be of paramount importance, given this is where impact really happens. In this regard, the commencement of the Initiatives has now fully taken off, providing an important avenue for partner engagement, research delivery and implementation."}]},{"head":"Highlights of programs","index":4,"paragraphs":[{"index":1,"size":75,"text":"The DG touched on several program highlights, noting that the written report along with program committee material provided more details. He stressed the importance of protecting the 'discovery' part of the CGIAR science agenda, opportunities for livestock through recognizing the diversity of systems (pastoral, mixed crop livestock, semi-intensive) and the importance of ILRI's unique facilities to support the requirements of livestock research, engagements with national partners and opportunities to broker arrangements with private sector enterprises."}]},{"head":"ILRI and One CGIAR Initiatives","index":5,"paragraphs":[{"index":1,"size":62,"text":"The DG noted that at the request of the ILRI program committee, several Board members had joined a virtual call prior to the Board meeting where overviews of the three livestock-focused, ILRI-led Initiatives were shared. The comments from the program committee and today's discussions were appreciated. The presentations had been recorded and shared for those members unable to join at the time."},{"index":2,"size":31,"text":"ILRI's commitment to CGIAR was reaffirmed, while noting that the current financing of livestock across the portfolio remains relatively small and not commensurate with the potential and importance of the sector."},{"index":3,"size":116,"text":"4. Finance ILRI's 2022 burn rate was lower than usual, attributed to the slow start for the Initiatives -multiple iterations of planning and late information on budget allocations in particular. For 2023, the highestever ILRI budget of $106 million would require a diligent focus on execution. Both of these matters had been submitted to the AFRC for review and recommendation to the ILRI Board and would be addressed under agenda 4 in the present meeting. ILRI, as with many other centres, continues to face challenges with leveraging resources to engage in bilateral projects (particularly those at the Page 3 of 6 development interface, which often do not have full-costing) and to resource its infrastructure and facilities."}]},{"head":"Legal","index":6,"paragraphs":[{"index":1,"size":70,"text":"Noting that information on pending legal matters had been summarized in the written report, the DG highlighted in particular the pending matter regarding the resolution of the Board at its 52 nd meeting concerning Kapiti. He assured the Board that management is working to complete this arrangement as soon as possible, and noted that at the same time, the ILRI program committee had discussed the emerging business plans for Kapiti."}]},{"head":"Some reflections","index":7,"paragraphs":[{"index":1,"size":54,"text":"During his first six weeks, the DG noted many external engagements, including with investors private sector, universities and research institutions, the CGIAR Senior Leadership Team and importantly with ministries and other senior officials in ILRI's host countries Ethiopia and Kenya. The latter engagements having been supported in person by the former DG, Jimmy Smith."},{"index":2,"size":49,"text":"Moving forward, the challenges of growing pooled funding, resource mobilization and the transition to the next phase of Initiatives were highlighted. Alongside these, opportunities to build on the strong ILRI and CGIAR offering in countries and regions and developing new ILRI, livestock-based systems and animal-source foods strategies were highlighted."},{"index":3,"size":59,"text":"b. Planning for a new ILRI strategy ILRI's corporate strategy ended in 2022, and the incoming director general will lead a process to develop a new corporate strategy, in tandem with a science strategy along with strategies for CGIAR livestock-based systems and animal-source foods. The Board was appraised of the anticipated process for developing these strategies and their inter-relationships."},{"index":4,"size":43,"text":"It was noted that at the ILRI Board program committee meeting, an overview of the lessons learned, internal and external factors that will need to be considered as a new science strategy is developed were considered, and many helpful inputs were received ."},{"index":5,"size":15,"text":"Board members provided comments and inputs on the DG's report and the proposed strategy processes."}]},{"head":"BOT62 FB2.2","index":8,"paragraphs":[{"index":1,"size":32,"text":"Noting the importance of Board engagement at key moments, and the inputs into process from the Board and program committee discussions, the Board approved the process for strategy development Decision: BOT62 FB2.2"}]},{"head":"Program committee report and recommendations","index":9,"paragraphs":[{"index":1,"size":57,"text":"The Chair of the Program Committee presented the report and recommendations. The program committee had reviewed the Initiative and program dashboard reports, considered ILRI's 2022 financial report and 2023 budget from a programmatic perspective, reviewed plans for Kapiti and considered elements to inform the development of ILRI's science strategy. Programmatic and fiduciary risks had also been reviewed."},{"index":2,"size":55,"text":"The committee recommended that additional resources for One Health should be highlighted as a System Council matter. It was noted that there were some misperceptions about One Health, in particular regarding the breadth -that it covers more than just 'zoonoses', but does not cover all aspects of agriculture, plants, soils etc. Page 4 of 6"},{"index":3,"size":43,"text":"The Board appreciated the suggestion that members who are also SB members were encouraged to ensure that a framework is institutionalized for gathering lessons from all Centres and Initiatives and that this will be important to inform the next phase of Initiative development."},{"index":4,"size":127,"text":"Noting the program committee's consideration of funding in relation to ILRI's infrastructure and the need for leveraging resources, the Board requested further information on infrastructure requirements and opportunities. Management highlighted significant infrastructure needs including bioscience laboratories for high-end genomics work, climate change facilities, vaccine research (including mRNA) among others. It was noted too that positive discussions with the Genetic Innovation team had highlighted the opportunity for ILRI's facilities in Nairobi to become a 'hub' for both plant and animal research across CGIAR and its partners. If more CGIAR centres decide to (re)locate to ILRI's Nairobi or Addis campuses, office space will need to be addressed. The Board noted management plans to further evaluate and prioritize options to develop Kapiti, including in relation to the contract research facility."},{"index":5,"size":43,"text":"Board members noted that many centres have highlighted similar challenges of resourcing facilities and of leveraging funds for bilateral projects that don't cover full costs. These matters will require innovative approaches and a finance working group has been established to advance these matters."},{"index":6,"size":20,"text":"The program committee had reviewed risk matrices for programmatic and related fiduciary matters, which would be considered under agenda 4."}]},{"head":"Audit, Finance and Risk Committee reports and recommendations","index":10,"paragraphs":[{"index":1,"size":73,"text":"The ILRI focal point for AFRC, Richard Golding presented the committee's report and recommendations. The AFRC had reviewed ILRI's financial and investment reports for 2022 and the revised 2023 budget. AFRC met with external auditors, including an in-camera session, and reviewed the Audited Financial Statements for 2022. The external auditors highlighted several current and prior year unresolved audit recommendations, particularly on IT, and the AFRC urged management to take immediate action to resolve."},{"index":2,"size":51,"text":"The AFRC monitored ILRI's top risks, received a briefing on evolving mitigation measures and took note that there was a consistency of top risks across most centers. ILRI top five risks: 1. One CGIAR transition risk 2. Funding risk 3. Impact delivery risk 4. People and talent risk 5. Data risk"},{"index":3,"size":3,"text":"The AFRC also:"},{"index":4,"size":104,"text":"• Considered results of the follow up on internal audit recommendations and noted that ILRI currently shows a significant number of outstanding IA recommendations requiring closure. The AFRC understands that management and IA have agreed appropriate actions to achieve this • Reviewed Internal Audit Charters and agreed with management the plan for future standardization • Requested the IA community to present a standardized performance evaluation process for Center/Alliance head of internal audit to be used for 2023 The AFRC received updates from CGIAR Ethics & Business Conduct Unit and monitored key ethics cases. There were no significant areas to highlight for the ILRI Board."},{"index":5,"size":34,"text":"AFRC noted that all centres had highlighted matters such as uncertain processes, inadequate communication and late budget information, along with funding for infrastructure and assets. AFRC will raise these matters for SB to address."},{"index":6,"size":43,"text":"The Board noted that ILRI's reserves had reduced, as was the case for many centres which raises concerns on the liquidity of centres and should continue to be monitored, by the AFRC and Board. Considerations are underway to adopt a more risk-based approach."},{"index":7,"size":66,"text":"The Board requested further clarification regarding FOREX and currency holdings. Management confirmed that it had operated within the institute's investment policy and that measures are in place to minimize FOREX losses. ILRI has multiple bank accounts which reflect the necessity to operate in multiple countries and currencies, as well as the requirements of some donors. Fund disbursements to country offices are adjusted according to cashflow requirements."},{"index":8,"size":85,"text":"The Board noted a number of outstanding audit matters and highlighted that it would like more information on audit reports and further opportunities to interrogate in particular the internal audit report, with perhaps an in-camera session with the internal auditor. This could take place as a side session prior to the Board meeting, focusing only on ILRI matters, with the invitees being only the ILRI Board members, the ILRI internal auditor, and the AFRC Point of Contact for ILRI. AFRC will also review this matter."}]},{"head":"BOT62 FB4","index":11,"paragraphs":[{"index":1,"size":97,"text":"The The committee held its first meeting on 1 March 2023 and appointed Alice Ruhweza as its chair. The committee has since held two meetings on 15 March and 3 May 2023. Board members were encouraged to provide recommendations for suitable candidates. The Board also noted that given the governance review will not be completed until late 2023 at the earliest, it would be important to continue to advance this process of identification and appointment of new members for the ILRI Board to ensure at least one member is appointed before the Q4 board meeting of 2023."}]},{"head":"Governance review","index":12,"paragraphs":[{"index":1,"size":58,"text":"The co-chair of CGIAR ad-hoc committee on governance, Neal Gutterson updated the Board on the ongoing process for CGIAR governance review as stipulated in the IFA signed earlier in 2023. The Board noted that clarity on the process following the review is required, including the roles of the SC, SB and centre boards, especially if constitutional changes result."},{"index":2,"size":26,"text":"Update on search for EMD The process to identify the next CGIAR EMD began in early Feb and Board members were appraised of the process underway."},{"index":3,"size":50,"text":"The Board noted that although these two matters (governance review and EMD recruitment) had been considered in the Board's closed session, there is considerable concern and interest across CGIAR staff in these matters. In that regard it was agreed that a common and consistent communication to staff would be appropriate."}]}],"figures":[{"text":"Any Other Business in camera (Board members and secretary only) ILRI Board approved the revised 2023 budget with income of US$106.277 million; expenses of US$106.470 million and a deficit of US$192k.  • Neal Gutterson; •Neal Gutterson;  • Shenggen Fan; •Shenggen Fan;  • Patrick Caron •Patrick Caron  Extension of term on ILRI Board through 31 December 2024: Extension of term on ILRI Board through 31 December 2024:  • Lindiwe Majele Sibanda •Lindiwe Majele Sibanda Ad-hoc nominations committee Ad-hoc nominations committee At the 61st Board meeting, the Board agreed: At the 61st Board meeting, the Board agreed:  '…to establish an ad hoc nominations committee: Jing Zhu, Li Lin Foo, Alice Ruhweza, Alyssa Jade '…to establish an ad hoc nominations committee: Jing Zhu, Li Lin Foo, Alice Ruhweza, Alyssa Jade  McDonald-Baertl, Regassa Fikru'. A key task of the committee is the identification of new ILRI Board McDonald-Baertl, Regassa Fikru'. A key task of the committee is the identification of new ILRI Board  members -The ad hoc nominations committee to review the skills mix and criteria for Board members members -The ad hoc nominations committee to review the skills mix and criteria for Board members  taking cognizance of succession planning.' taking cognizance of succession planning.'    Decision: Decision:    BOT62 FB4.1 BOT62 FB4.1  The ILRI Board approved ILRI Audited Financial Statements for the year The ILRI Board approved ILRI Audited Financial Statements for the year  ended 31 December 2022 when ILRI recorded a revenue of $84 million ended 31 December 2022 when ILRI recorded a revenue of $84 million  and an expenditure of $83.3 million realizing a surplus of $0.8 million. and an expenditure of $83.3 million realizing a surplus of $0.8 million.  For Fiscal Year 2023, the ILRI Board reappointed For Fiscal Year 2023, the ILRI Board reappointed  PricewaterhouseCoopers Kenya (PwC Kenya). PricewaterhouseCoopers Kenya (PwC Kenya).  AFRC Membership: For Hilary Wild, Esteban Chong and Nancy AFRC Membership: For Hilary Wild, Esteban Chong and Nancy  Andrews whose committee membership terms are ending 31 August Andrews whose committee membership terms are ending 31 August  2023, the ILRI Board extended the terms until 31 December 2023. 2023, the ILRI Board extended the terms until 31 December 2023.  The ILRI Board reviewed and approved the risk matrices for The ILRI Board reviewed and approved the risk matrices for  programmatic and fiduciary risks along with those consolidated for programmatic and fiduciary risks along with those consolidated for  AFRC. It was agreed that risk no. 8 in the fiduciary matrix, regarding AFRC. It was agreed that risk no. 8 in the fiduciary matrix, regarding  macroeconomic downturn is highly significant, given the global macroeconomic downturn is highly significant, given the global  situation and as such should be increased to 4*4=16. situation and as such should be increased to 4*4=16. 5. ILRI Board members  5. ILRI Board members BOT62 The ILRI Board approved: Decision/BOT62 BOT62The ILRI Board approved:Decision/BOT62 FB5.1 Extension of term on ILRI Board through 31 December 2023: FB5.1 FB5.1Extension of term on ILRI Board through 31 December 2023:FB5.1  • Alice Ruhweza; •Alice Ruhweza;  • Alyssa Jade McDonald-Bäertl; •Alyssa Jade McDonald-Bäertl;  • Hilary Wild; •Hilary Wild;  "}],"sieverID":"53039811-1887-4db3-b898-25042bf63efc","abstract":"Tarawali (Board secretary); Robert Nzioka (chief financial officer), Eva Kathambana (legal counsel) and Peter Getugi (head of internal audit))."}

data/part_1/06c6c8d86670fed189b573041b2f3f09.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06c6c8d86670fed189b573041b2f3f09","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/93f9e280-5507-41b1-8a85-971783dad094/retrieve"},"pageCount":13,"title":"Gene expression analysis during cassava defense response to bacterial blight disease","keywords":["yuca","añublo bacteriano","identificación de genes","librerías sustractivas","microarreglos cassava","bacterial blight","gene expression","subtractive library","microarrays"],"chapters":[{"head":"INTRODUCCIÓN","index":1,"paragraphs":[{"index":1,"size":158,"text":"La yuca (Manihot esculenta Crantz) es la especie productora de carbohidratos más eficiente por unidad de área en el trópico. Es el cuarto producto básico más importante en el mundo y hace parte de la dieta de más de 1000 millones de personas. La bacteriosis vascular de la yuca es considerada una de las enfermedades más limitantes para la producción de yuca en el trópico, las pérdidas del cultivo oscilan entre 12% y 100% (Lozano, 1986). Algunos trabajos han sido desarrollados con el ánimo de caracterizar citoquímica y bioquímicamente la interacción con el agente etiológico Xanthomonas axonopodis pv. manihotis (Xam) (Boher et ál., 1997;Kpémoua et ál., 1996), identificar las variedades resistentes y susceptibles a las diferentes cepas del patógeno (Restrepo et ál., 2000) y medir su diversidad genética y diferenciación geográfica (Restrepo and Verdier, 1997), entre otros. Sin embargo, los genes que gobiernan las respuestas de defensa en contra del ataque del patógeno no han sido aún identificados."},{"index":2,"size":171,"text":"Muchos detalles de los procesos de interacción planta-patógeno son conocidos (Baker et ál., 1997). Una vez la planta y el patógeno entran en contacto, el organismo hospedero activa una serie de respuestas de defensa. Son inducidas diferentes vías de señalización, entre ellas las mediadas por Intermediarios con Oxígeno Reactivo (ROS), ácido salicílico, óxido nítrico, etileno y ácido jasmónico. También es activada la expresión de genes Relacionados con Patogenicidad (PR) y la síntesis de compuestos antimicrobianos que son generalmente fitoalexinas, defensinas, compuestos fenólicos y flavonoides producidos para atacar directamente al patógeno (Baker et ál., 1997). La activación de todas estas vías de señalización termina en la inducción de la Respuesta Hipersensible (HR), una muerte celular programada localizada en el sitio del ataque, con el fin de impedir la dispersión del patógeno, y la Respuesta Sistémica Adquirida (SAR) mediada por el ácido salicílico, que distribuye la resistencia a todos los órganos de la planta (Hammond-Kosack and Jones, 1996). En yuca no han sido aún caracterizadas las vías de respuesta a sus diferentes patógenos."},{"index":3,"size":128,"text":"Utilizando innovadoras herramientas de genómica funcional se ha avanzado en el entendimiento de la biología molecular en los pro-cesos de resistencia a enfermedades y condiciones de estrés en general. Con la aplicación de estas herramientas, tales como la construcción de librerías sustractivas y la tecnología de microarreglos, se pueden realizar análisis globales de expresión de cientos o miles de genes bajo condiciones ambientales y fisiológicas específicas; por ejemplo identificar genes involucrados en las respuestas de defensa en contra del ataque de patógenos. En el caso particular de la yuca, la aplicación de genómica funcional en el estudio de su interacción con Xam podrá contribuir en la solución de un problema que le resta interés al cultivo y lo hace menos rentable en comparación con otros productores de carbohidratos."},{"index":4,"size":37,"text":"En este trabajo se han utilizado herramientas de la genómica funcional: construcción de librerías sustractivas y microarreglos de ADN, a fin de identificar genes expresados en las respuestas de la yuca para defenderse del ataque de Xam."}]},{"head":"MATERIALES Y MÉTODOS","index":2,"paragraphs":[{"index":1,"size":98,"text":"Inoculación de dos variedades resistentes de yuca con Xanthomonas axonopodis pv. manihotis Las estacas de plantas de las dos variedades resistentes a la cepa de Xam (CIO-151) SG 107-35 y MBRA 685 (Restrepo et ál., 2002) mantenidas en campo fueron sembradas en bolsas de plástico perforadas de 6 cm x 7 cm. con una proporción de tierra:arena (1:3) estéril, cuatro semanas después fueron transferidas a condiciones de invernadero (temperatura de 28 °C / 19 °C (temperaturas día/ noche), 12 horas de fotoperíodo (luz de día) y 80% de humedad relativa, en el Centro Internacional de Agricultura Tropical (CIAT)."},{"index":2,"size":176,"text":"Se inocularon las dos variedades con la cepa CIO-151 de Xanthomonas axonopodis pv. manihotis por punción de tallos en la variedad SG 107-35 y de hojas en la variedad MBRA 685. Se colectaron los tallos y hojas respectivamente pasadas 6, 12, 24, 48, 72 horas y 7 días de la inoculación. Fueron utilizadas 4 plantas para inocular con Xam por cada tiempo. Adicionalmente, para cada conjunto de 4 plantas tratamiento (tiempos de inoculación con Xam) se colectaron el mismo número de plantas sanas y estresadas por punción, para un total de 24 plantas inoculadas (6 tiempos, 4 réplicas por tiempo), 24 plantas sanas (4 réplicas control por cada tiempo) y 24 plantas estresadas por punción (6 tiempos, 4 réplicas por tiempo). Para la inoculación en hojas se abrieron orificios de 2 mm de diámetro y se colocaron sobre ellos 10 mL de una suspensión bacteriana (10 8 unidades formadoras de colonias/mL) (Restrepo et ál., 2000a). Inmediatamente después de colectar el tejido se introdujo en nitrógeno líquido para su preservación y luego fue almacenado a -80 °C."},{"index":3,"size":202,"text":"Extracción de ARN total, aislamiento de ARNm y síntesis de ADNc Para cada variedad dos extracciones de ARN total fueron hechas paralelamente. En la primera se pesaron 600 mg de cada tejido perteneciente a los tiempos 6, 12, 24, 48, 72 horas y 7 días después de la inoculación, para un total de 3 gr. de tejido, cuyo ARN representa todos los tiempos del proceso de infección por Xam. En la segunda se pesaron 420 mg del tejido estresado por punción perteneciente a los tiempos 0, 6, 12, 24, 48, 72 horas y 7 días, para un total de 3 g de tejido, cuyo ARN representa los genes expresados por una planta sana y los expresados en respuesta al estrés por punción. De esta manera se extrajo manualmente ARN total de tallos y hojas de SG 107-35 y MBRA 685 respectivamente, siguiendo las modificaciones hechas por Rocha, P.J. (1995) al protocolo descrito por Hall et ál., (1978). Se aisló el ARNm utilizando el kit Oligotex mRNA Midi (QIAGEN, CA), siguiendo fielmente las indicaciones del productor, luego se sintetizó el ADNc usando el kit SMART TM PCR cDNA synthesis (CLONTECH, CA), siguiendo las instrucciones del productor, a partir de 400-500 ng de ARNm."},{"index":4,"size":46,"text":"Al final de este proceso se contaba con una Población 1 de ADNc que representa la expresión génica en todos los tiempos de la infección después de la inoculación y una Población 2 de ADNc perteneciente a plantas sanas y estresadas. Todo esto para cada variedad."},{"index":5,"size":122,"text":"Librería sustractiva de ADNc por el método de DSC Con el fin de aislar únicamente los genes que se expresan en respuesta al ataque del patógeno, fue implementada una metodología de sustracción que puede hallar rápidamente diferencias entre dos poblaciones de ADN Luo et ál. (1999). Brevemente, El ADNc de la Población 1 proveniente de plantas inoculadas fue usado como tratamiento y el ADNc de la Población 2 proveniente de plantas sanas y estresadas fue usado como control. Ambos (control y tratamiento) fueron digeridos con la enzima de restricción DpnII. Seguidamente, el producto de la digestión fue ligado con un adaptador/primer diferente para cada población de ADNc (Población 1: BamIa, ATGAAGTGCACCCTACGATTCGAG; BamIb, pGATCCTCGAAATCGTA GGGGTGCACT. Población 2: BamIIa, ATGAGAC ATGTTTCGTAGCCTAGG, BamIIb, pGATCCC TAGGCTACGAAACATGTC)."},{"index":6,"size":252,"text":"El producto de la ligación fue sujeto a amplificación por PCR bajo las siguientes condiciones: 94 °C por 2 min., 94 °C por 30 seg., 68 °C por 2 min. por 30 ciclos de amplificación. Para la primera ronda de hibridación del DSC, 10 mg de control previamente digerido con DpnII (para remover de nuevo los adaptadores) fue mezclado con 100 ng de tratamiento, la mezcla fue precipitada y resuspendida en un volumen final de 32 mL de buffer de hibridación (50 mM Hepes, 1M CTAB). La mezcla fue calentada a 98-100 °C por 5 min y se adicionaron 8 mL de 5 M NaCl para un volumen de 40 mL. Luego se incubó a 67 °C por 14-16 h. El ADN renaturado fue purificado con el kit QIAquick PCR purification (QIAGEN, CA) y resuspendido en 50 mL de buffer 1X para la enzima exonucleasa mung bean (New England Biolabs, MA) con 10U de enzima mung bean e incubado a 30 °C por 25-30 min. Para inactivar la exonucleasa, la muestra fue purificada con el kit QIAquick PCR purification (QIAGEN, CA). Una alícuota de 2.5 mL del ADN purificado fue tomada para examinar la eficiencia de la sustracción por PCR bajo las siguientes condiciones: 94 °C por 2 min., 94 °C por 30 seg., 68 °C por 2 min. por 35 ciclos de amplificación. El producto restante (+/-55 mL) fue concentrado al vacío, resuspendido en 32 mL de buffer de hibridación y recalentado a 98 °C para una segunda ronda de hibridación."},{"index":7,"size":60,"text":"Con el producto de PCR de la segunda y tercera ronda de hibridación para SG 107-35, y la tercera y cuarta ronda de hibridación para MBRA 685, se construyó una librería de 384 clones para cada va-riedad. Para ello se transformaron por electroporación células competentes de la cepa DH-5a de E. coli. El vector utilizado fue el pGEM Ò -Teasy."}]},{"head":"Secuenciación y análisis de secuencias","index":3,"paragraphs":[{"index":1,"size":113,"text":"Cuarenta y ocho clones para las dos últimas rondas de hibridación en ambas variedades fueron secuenciados utilizando el secuenciador automático ABI Prism 377, disponible en el CIAT. Estas secuencias fueron editadas usando el programa Sequencher 4.1 (Gene Codes Corporation). De los 192 clones secuenciados en total (48 de cada ronda de sustracción para las dos variedades) se obtuvieron en total 110 secuencias únicas, 63 para MBRA 685 y 47 para SG 107-35. Con el fin de encontrar posibles funciones para el grupo de secuencias, se realizaron búsquedas de similitud con BLASTn y BLASTx contra la base de datos del NCBI, teniendo como valor de probabilidad límite E = 1,0 x 10 -4 ."}]},{"head":"Construcción del microarreglo, hibridación y análisis de datos","index":4,"paragraphs":[{"index":1,"size":69,"text":"Los 110 clones seleccionados de la librería sustractiva fueron utilizados para construir un microarreglo. Cada clon fue replicado 8 veces en el microarreglo. Con el propósito de ejercer un control de calidad sobre el microarreglo, fueron organizados genes control de tomate, papa, humano y genes constitutivos de yuca. Los clones fueron organizados en láminas de poli-lisina (Telechem International, Sunnyvale, CA) usando el robot SPBIO Microarray Spotting Station (MiraiBio Inc.)."},{"index":2,"size":110,"text":"Plantas de MBRA 685 y SG 107-35 fueron inoculadas como se describió anteriormente y colectadas después de 24, 48 horas (h) de infección, el tejido fue agrupado por genotipo. La hibridación al microarreglo fue realizada con el conjunto de ADNc de plantas infectadas vs. plantas sanas. Para confirmar la reproducción del experimento cada hibridación se hizo por duplicado. El ARN fue extraído usando el kit SV total RNA isolation system (Promega Corp.). El ADNc fue sintetizado usando el kit SMART TM PCR cDNA synthesis (CLONTECH, CA). En el marcaje con fluorescencia se incorporó Cye3-dUTP (fluorescencia verde) al ADNc de plantas sanas y Cye5-dUTP (fluorescencia roja) al ADNc de plantas infectadas."},{"index":3,"size":57,"text":"El arreglo fue escaneado usando el escáner Virtek Chip-Reader scanner (BIO-RAD). La obtención de valores para cada señal, eliminación de hibridación inespecífica y normalización de los datos por LOESS, fue realizada usando el programa ArrayPro 4.0. (BIO-RAD). Los genes diferencialmente expresados fueron detectados usando el programa de análisis SAM (Significance Analysis of Microarrays) (Tusher et ál., 2001)."}]},{"head":"RESULTADOS Y DISCUSIÓN","index":5,"paragraphs":[{"index":1,"size":82,"text":"Análisis funcional de las secuencias aisladas por la sustracción Provenientes de la librería sustractiva fueron obtenidas 110 secuencias únicas, 63 para MBRA 685 y 47 para SG 107-35. En ambas variedades fueron encontrados 14 genes que hacen parte de las respuestas de defensa de la planta al ataque del patógeno, entre ellos genes que participan en vías completas de señalización, desarrollo de estrés oxidativo, que muy probablemente activa la HR y SAR, modificación de la pared celular y degradación proteica (tabla 1)."}]},{"head":"Flujo de calcio","index":6,"paragraphs":[{"index":1,"size":167,"text":"Numerosas vías de señalización en las respuestas de defensa son activadas por el flujo de calcio (Ca 2+ ) (Kim et ál., 2002). Se ha demostrado que el calcio es esencial para la activación de la síntesis de fitoalexinas, inducción de genes PR y HR (Zimmermann et ál., 1997). Puesto que gran parte de las señales de Ca 2+ son mediadas por proteínas de unión a calcio como calmodulinas (CaM), se ha propuesto la importancia de estas proteínas como moduladores de las señales de transducción mediadas por calcio en las respuestas de defensa (Kim et ál., 2002). La producción de ROS, compuestos que generan el estrés oxidativo, depende en gran medida de la activación del flujo de calcio y su modulación por calmodulinas (Grant and Loake, 2000). Estas proteínas de unión a calcio generalmente presentan el dominio EF hand, al cual se une el Ca 2+ para luego ser cargado a una vía NADPH quinasa dependiente y terminar en la producción de ROS (Grant and Loake, 2000)."},{"index":2,"size":86,"text":"En ambas variedades de yuca fue aislada una secuencia que codifica para la enzima calmodulina (SUS01) y presenta un dominio EF hand. Para confirmar su posible papel en las respuestas de defensa fue alineada con siete secuencias CaM encontradas por Kim et ál. (2002) y que están asociadas con respuestas de defensa a hongos en arroz. Se encontró una similitud del 98% con estas secuencias. El resultado sugiere que la calmodulina aislada en la sustracción podría pertenecer a este grupo de genes con secuencias altamente conservadas."}]},{"head":"Estrés oxidativo.","index":7,"paragraphs":[{"index":1,"size":126,"text":"Todos los organismos usan el O 2 como aceptor final en la cadena de transporte de electrones de la respiración; en este proceso el O 2 puede ser reducido para formar ROS, tales como el radical superóxido (O 2 -). Los principales componentes celulares son susceptibles al daño por radicales libres, ya que estos tienen gran efecto sobre proteínas, lípidos, carbohidratos y ácidos nucleicos (Blokhina et ál., 2003). Con el fin de prevenir daños ocasionados por ROS, los organismos aeróbicos poseen enzimas que rápidamente los degradan, una de ellas es la catalasa, esta enzima protege la célula del H 2 O 2 y de otros ROS por conversión del H 2 O 2 en agua y oxígeno molecular durante una reacción catalítica (Blokhina et ál., 2003)."},{"index":2,"size":194,"text":"Está bien documentado que la catalasa cumple un importante papel en las respuestas de defensa en plantas en contra de un amplio rango de patógenos (Yi et ál., 1999). Una de las más rápidas respuestas de defensa seguidas al reconocimiento del patógeno la constituye la producción de ROS, se ha sugerido que el aumento de ROS representa una vía de señalización para el inicio de la HR y SAR (Grant et ál., 2000). Para que los compuestos con oxígeno reactivo se acumulen en la célula es necesaria la inhibición de la enzima calatasa. El ácido salicílico es el encargado de inhibir tanto la transcripción como la actividad enzimática de la catalasa (Yi et ál., 1999). Algunos experimentos han sido ejecutados con el fin de dilucidar el papel de la catalasa y ROS en la activación Tabla 1. Secuencias aisladas en la librería sustractiva para ambas variedades que están asociadas en procesos de defensa a patógenos en plantas. Se muestran los valores de probabilidad E que resultan de las búsquedas de similitud en la base de datos del NCBI usando el algoritmo BLASTx, como puede verse todas las secuencias tienen un nivel de similitud alto."},{"index":3,"size":56,"text":"de respuestas de defensa. Plantas transgénicas de tabaco expresando genes con orientación antisentido de dos familias de catalasa que se unen a ácido salicílico (CAT1 y CAT2) mostraron el desarrollo de HR, inducción de genes PR de la familia PR-1 y el aumento de la resistencia al virus del mosaico del tabaco (Chamnongpol et ál., 1998)."},{"index":4,"size":88,"text":"Durante la sustracción realizada en las dos variedades resistentes MBRA 685 y SG 107-35 fueron encontrados genes que codifican enzimas catalasas (SUS02) pertenecientes a la familia CAT1 que es inhibida por ácido salicílico, este resultado sugiere un papel importante de CAT1 en la interacción yuca-Xam. Las secuencias que codifican para catalasa CAT1 tienen una similitud del 89% (valor E = 4e-18) con el gen Ngcat1 aislado por Yi et ál. (1999) durante un estudio realizado para evaluar el papel de la catalasa en respuestas de defensa en tabaco."},{"index":5,"size":85,"text":"En la sustracción fueron aisladas otras dos secuencias que cumplen importantes papeles en el estrés oxidativo de la planta durante las respuestas de defensa. La primera de ellas es la Nucleósido Difosfato Quinasa (SUS03), capaz de inhibir la generación de ROS (Moon et ál., 2003). La segunda es la Glutarredoxina (SUS04), una pequeña óxido-reductasa que participa, entre otros, en el plegamiento y regulación de proteínas y en la reparación de proteínas que han sido afectadas por el estrés oxidativo (para una revisión, ver Grant, 2001)."}]},{"head":"Expresión de genes PR","index":8,"paragraphs":[{"index":1,"size":88,"text":"En la librería sustractiva fue aislada, para la variedad SG 107-35, una secuencia perteneciente a la familia PR-10 que se caracteriza por presentar el dominio Betv1 (SUS05) (81% de similitud) (Van Loon et ál., 1994). Se ha demostrado que el dominio Betv1 tiene actividad ribonucleasa (ARNasa) (Bufe et ál., 1996). Recientemente fue aislado el gen PPRG2 durante la infección por la planta parasítica Cuscuta trifolii en alfafa; este gen contiene el dominio Betv1 y se expresa en grandes cantidades durante la infección por Xanthomonas (Borsics and Lados, 2002)."},{"index":2,"size":166,"text":"Otra secuencia relacionada con patogenicidad fue aislada durante la sustracción en la variedad MBRA 685, pertenece a la familia PR-14 y codifica una proteína de transferencia de lípidos (LPT)(SUS06) que contribuye en la transferencia de lípidos, particularmente fosfolípidos, a través de membranas (Borsics and Lados, 2002); su relación con la respuesta al ataque de patógenos ya ha sido estudiada. Molina et ál. (1993) mostraron que cuatro LPTs de cebada y maíz eran potentes inhibidores de los patógenos Clavibacter michiganensis subsp. sepedonicus, Pseudomonas solanacearum y Fusarium solani. Ese mismo año, Molina et ál. (1993) estudiaron el comportamiento de tres de estas LPTs durante la infección por una cepa avirulenta y otra virulenta de Erysiphe graminis en cebada; en ambos casos se observó comportamiento bifásico en la acumulación de LPTs con un alto incremento en las primeras horas de infección y una fuerte reducción en las siguientes. La secuencia aislada en la sustracción presenta una similitud del 58% con Cw20, una de las tres LPT aisladas en cebada."},{"index":3,"size":156,"text":"Al parecer la expresión de genes PR está altamente controlada y es dependiente de SAR. Uno de los genes candidatos para controlar la expresión de algunos genes PR es el NPR1 en Arabidopsis. Mutantes con NPR1 defectuosos no activan SAR, disminuyen la expresión de genes PR y se hacen susceptibles (Cao et ál., 1997). El gen NPR1 codifica una proteína que contiene repeticiones de ankirina, los mutantes NPR1 presentan una interrupción en estas repeticiones, lo que sugiere que son importantes en la función de NPR1. Cuando se introduce el NPR1 silvestre dentro de mutantes NPR1 se restablece la inducción de SAR, la expresión de genes PR y la resistencia a Pseudomonas syringae (Cao et ál., 1997). Una proteína con repeticiones de ankirina fue encontrada en la respuesta de defensa del arroz contra el ataque del hongo patógeno Pyricularia grisea y en respuesta al tratamiento con Benzotiadiazol un homólogo funcional del ácido salicílico (Xiong et ál., 2001)."},{"index":4,"size":82,"text":"En la sustracción fue aislada en la variedad SG 107-35 una secuencia (SUS07) que muestra una similitud del 98% con una ankirina de Oryza sativa (número de accesión AAN64471) y del 90% con una de Arabidopsis (número de accesión NP_187842); probablemente la ankirina esté involucrada en procesos de interacción proteína-proteína durante la inducción de SAR en las respuesta de defensa de yuca contra Xam, de la misma manera como ha sido demostrado para otros patosistemas (Cao et ál., 1997;Kuhlmann et ál., 2003)."}]},{"head":"Modificaciones de la pared celular","index":9,"paragraphs":[{"index":1,"size":177,"text":"Una de las estrategias para combatir el ataque de patógenos radica en la modificación de la pared celular y sus componentes (Baker et ál., 1997). En la sustracción fue aislada para la variedad SG 107-35 una secuencia que codifica la proteína Xiloglucan endotransglicosilasa (XET) (SUS08). En la década pasada se realizaron muchos estudios sobre esta enzima por su papel determinante en los procesos de expansión de la pared celular durante el crecimiento y desarrollo de la planta Cosgrove (2000). Hacia 1994 fue reportado el BRU1, un gen regulado por Brasinosteroides (BRs) y que codifica la proteína XET (Zurek and Clouse, 1994). Los Brasinosteroides son compuestos poli-hidroxilados derivados del esterol que están presentes en todas las plantas y se encuentran ampliamente involucrados en la regulación de numerosos genes que controlan los procesos de crecimiento y desarrollo (Clouse and Sasse, 1998) y en procesos más específicos de morfogénesis y expansión de la pared celular. También están involucrados en la respuesta a estrés biótico y abiótico, incluyendo estrés por salinidad, temperaturas extremas y ataque de patógenos (Clouse and Sasse, 1998)."},{"index":2,"size":102,"text":"Recientemente se ha demostrado con evidencia experimental el importante papel de los BRs en el desarrollo de resistencia a enfermedades en plantas (Nakashita et ál., 2003). Plantas silvestres de tabaco fueron tratadas con un Brasinólido (un tipo de BRs) y mostraron alta resistencia a TMV, al patógeno bacteriano Pseudomonas syringae pv. tabaci y al hongo Oidium sp., también demostraron que el desarrollo de la resistencia por BRs no requiere biosíntesis de ácido salicílico y es independiente del SAR y de la resistencia inducida por heridas. También comprobaron la resistencia inducida por BRs contra Magnaporthe grisea y Xanthomonas Oryzae pv. oryzae en arroz."},{"index":3,"size":75,"text":"La secuencia que codifica para XET aislada en la variedad SG 107-35 presenta una similitud del 82% con el gen regulado por BRs (BRU1) re-portado por Zurek et ál. (1994) (número de accesión P35694). Ha sido reportada la expresión de BRU1 en tejidos vasculares y su posible papel en la formación de pared celular. También se ha confirmado su expresión en células parenquimáticas alrededor del tejido vascular en tallos de soya (Oh et ál., 1998)."},{"index":4,"size":65,"text":"Los anteriores resultados sugieren que los BRs pueden regular la expresión de XET e inducir lignificación del tejido vascular durante la interacción yuca-Xam. Resultados que concuerdan con previos estudios bioquímicos e histológicos que confirman el refuerzo de las paredes celulares en los tejidos vasculares de la yuca con el fin de impedir la dispersión del patógeno durante la infección por Xam (Kpémoua et ál., 1996)."}]},{"head":"Factores de transcripción","index":10,"paragraphs":[{"index":1,"size":119,"text":"El papel de los factores de transcripción en las respuestas a estrés biótico y abiótico ha sido estudiado desde hace pocos años pero con resultados productivos respecto a su identificación en las respuestas de defensa (para una revisión ver Singh et ál. 2002). La inducción de la expresión génica en respuesta a un estrés ocurre inicialmente a nivel de la transcripción, regular los patrones de expresión temporal y espacial de aquellos genes es una de las principales tareas de la planta en la respuesta a un tipo determinado de estrés. El genoma de Arabidopsis codifica por lo menos 1500 factores de transcripción (Riechmann et ál., 2000); sin embargo, para la gran mayoría no se conocen detalles de su función."},{"index":2,"size":277,"text":"Una de las familias de factores de transcripción identificadas en las respuestas de defensa a estrés son los genes MYB (Jin et ál., 1999). Estas proteínas participan en las vías de producción de metabolitos secundarios, proliferación y forma celular, entre otros. Algunos de ellos son expresados en respuesta al tratamiento con hormonas y al ataque de patógenos (Kranz et ál., 1998). En la sustracción fue aislado un factor de transcripción MYB (SUS09) en la variedad MBRA 685, aunque no hubo ninguna similitud con MYB1, ATR1 y otros genes MYB reportados en la literatura como expresados en las respuestas de defensa, su presencia en la librería sustractiva sugiere una posible participación en la interacción yuca-Xam.. Otro factor de transcripción cuya expresión es inducida en respuesta a estrés biótico y abiótico es la proteína Dedo de Cinc (ZFP, del inglés Zinc Finger Protein) (Xiong 2001); ha sido demostrada su participación en la respuesta de defensa de Oriza sativa al ataque por Pyricularia grisea (Xiong, et ál., 2001). Recientemente se ha realizado un estudio de la expresión diferencial de factores de transcripción a gran escala, 402 factores de transcripción ubicados en un microarreglo fueron evaluados utilizando como sonda ARNm de diferentes tipos de estrés y estados de desarrollo en Arabidopsis (Chen et ál., 2002). La expresión diferencial tanto de genes MYB como ZFP es evidente, ambos tipos de factores de transcripción se expresan en respuesta tanto a estrés biótico (ataque de bacterias, hongos y virus) como abiótico (frío, salinidad, tratamiento con ácido jasmónico), algunos de estos genes se expresan simultáneamente durante estrés biótico o abiótico sugiriendo un cruzamiento en las vías de señalización que responden a ambos tipos de estrés."},{"index":3,"size":129,"text":"En la librería sustractiva fue aislada una secuencia en la variedad SG 107-35 que codifica un ZFP (SUS10), el resultado sugiere una regulación transcripcional en las respuestas de defensa a Xam en esta variedad resistente. Degradación de proteínas. La degradación selectiva de proteínas es un mecanismo empleado para activar una variedad de señales de transducción en plantas superiores (Callis et ál., 2000). Esta degradación de proteínas intracelulares se realiza a través del complejo de ubiquitinas presentes en los eucariotas. Las ubiquitinas se unen covalente y específicamente a las proteínas que van a ser destinadas a la degradación a través de una vía dependiente de ATP. Fuertes evidencias sugieren que muchas respuestas a estrés abiótico y resistencia a patógenos son activadas y mediadas por degradación proteica (Ellis et ál., 2002)."},{"index":4,"size":55,"text":"En la sustracción fueron aisladas dos secuencias que codifican para la poliubiquitina 10 (UBQ10) (SUS11) en ambas variedades y la poliubiquitina 12 (UBQ12)(SUS12) en la variedad SG 107-35. El resultado sugiere que el sistema ubiquitina podría estar involucrado en la activación de vías de señalización mediadas por lisis proteica para responder al ataque por Xam."},{"index":5,"size":189,"text":"Literatura reciente ha mostrado el papel de las proteinasas como un activo mecanismo de defensa en contra del ataque por hongos, virus y bacterias, y la inducción de su expresión en respuesta a estrés abiótico (Liu et ál., 2001). Los mecanismos utilizados por las proteinasas para impedir el ataque del patógeno son muy diversos; por ejemplo, la activación de algunas señales de transducción para responder a la infección es trabajo de las ubiquitinas. Sin embargo, la planta puede expresar proteinasas como compuestos antimicrobianos que atacan de manera directa al patógeno, a este grupo pertenecen las proteinasas defensinas como tioninas e inhibidores de proteinasas que causan lisis a la membrana plasmática de hongos invasores impidiendo su crecimiento (Toma et ál., 2002). Además de las defensinas otras proteínas proteolíticas participan en las respuestas de defensa, entre ellas están las metaloproteinasas (Liu et ál., 2001). Se ha clonado la secuencia completa de ADNc de una metaloproteinasa (Cs1-MMP) en pepino (Cucumis sativus), los resultados sugirieron que Cs1-MMP estaba involucrada en el desarrollo de senescencia y muerte celular programada y que podría participar en la degradación de la matriz extracelular (Delorme et ál., 2000)."},{"index":6,"size":203,"text":"En el estudio realizado por Liu et ál. (2001) proponen que la metaloproteinasa GmMMP2 aislada en soya está involucrada en un nuevo mecanismo de defensa de la planta en contra de la infección por patógenos. Los niveles de transcripción de GmMMP2 incrementan rápidamente durante la interacción compatible (desarrollo de la enfermedad) o incompatible (producción de resistencia) con el hongo Phytophhtora sojae y la bacteria Pseudomonas syringae; sin embargo, GmMMP2 también se acumula durante el estrés por deshidratación y herida, además su expresión es independiente de la presencia de los ácidos salicílico y jasmónico y no está correlacionada con la inducción de HR. Varias funciones fueron sugeridas para GmMMP2: (1) regular indirectamente la biosíntesis de fitoalexinas; (2) liberar una serie de sustancias antimicrobianas que retardan el crecimiento del patógeno y (3) regular vías de señalización diferentes a las reguladas por ácido salicílico y jasmónico. Recientemente han sido encontradas las metaloproteinasas en la respuesta del tomate a una toxina del hongo patógeno Fussicocum amygdali (Frick et ál., 2002), en este estudio fue construido un microarreglo con 235 secuencias de ADNc e interrogado con ARN proveniente de plantas tratadas con la toxina, una rápida y transitoria inducción de la expresión fue vista en la metaloproteinasa MMP1."},{"index":7,"size":58,"text":"En la librería sustractiva fue encontrada para la variedad SG 107-35 la secuencia que codifica para la enzima metaloproteinasa (SUS13). Esta secuencia presenta una similitud del 48% (Valor E = 1x 10 -9 ) con Cs1-MM P, la secuencia relacionada con muerte celular aislada en pepino, y una similitud del 46% con MMP1, la metaloproteinasa aislada en tomate."}]},{"head":"Eficiencia en el tráfico de proteínas","index":11,"paragraphs":[{"index":1,"size":128,"text":"Durante las respuestas de defensa a patógenos en plantas, grandes cantidades de proteínas son sintetizadas en el Retículo Endoplasmático Rugoso (RER) y dirigidas vía tráfico vesicular a compartimentos específicos intra celulares o a la matriz extracelular (Jelitto-Van Dooren et ál., 1999). Está demostrado que cuando la planta es sometida a estrés o atacada por un patógeno se acumulan una serie de proteínas residentes en RER con el fin de asistir el plegamiento, ensamblaje y formación de puentes disulfuro en las proteínas recién sintetizadas (Cunnea et ál., 2003;Jelitto-Van Dooren et ál., 1999). Entre estas proteínas se encuentran las chaperonas y las proteínas residentes en RER de la familia DnaJ (Cunnea et ál., 2003), estas proteínas están relacionadas con el apropiado plegamiento proteico y su transporte a través de RER."},{"index":2,"size":52,"text":"En la sustracción fue aislada, para la variedad SG 107-35, una proteína de la familia DnaJ (SUS14), su presencia sugiere una posible participación durante la síntesis de proteínas que responden al ataque de Xam con el fin de hacer más eficiente la respuesta de defensa de la yuca en contra del patógeno."},{"index":3,"size":81,"text":"Es importante notar que las secuencias con las que se hizo el análisis funcional pertenecen a un porcentaje inferior al 30% de las secuencias aisladas para ambas variedades, el 64% de las secuencias aisladas tanto en MBRA 685 como SG 107-35 no presentan función conocida o no tienen secuencias similares en la base de datos del Gen-Bank. Este resultado sugiere que existe un gran potencial de nuevas secuencias, probablemente específicas de yuca que se expresan en respuesta al ataque de Xam."},{"index":4,"size":269,"text":"El análisis funcional permite elaborar un flujo hipotético (figura 1) de la respuesta de defensa de la yuca a la infección por Xam. Una vez el patógeno ha sido reconocido se desencadenan una serie de respuestas locales para impedir su dispersión, la primera de ellas es la síntesis de ROS que está altamente controlada durante el proceso de infección por proteínas como CAT1 y NDPKs. En algún momento de la infección, tal vez en sus etapas tempranas, la célula aumenta su metabolismo, por ejemplo el tráfico vesicular, y protege sus enzimas del estrés oxidativo induciendo la expresión de glutarredoxinas. Cuando el ataque del patógeno es más fuerte, la célula activa el proceso contrario y entonces muchas vías de señalización son activadas, entre ellas las mediadas por calcio, que resultan en la expresión de genes PR como el Betv1 y los LPTs y la inducción (conjuntamente con ROS) de la HR. Todos estos procesos de activación de genes y control son muy probablemente regulados en gran parte por la expresión de factores de trascripción como los genes MYB y ZFP. Con el fin de inducir rápidamente la HR, complejos de ubiquitina activan vías de señalización mediadas por degradación proteica y las metaloproteinasas podrían atacar directamente al patógeno. Es importante aclarar que el flujo hipotético no pretende mostrar cómo se suceden los eventos de respuesta al patógeno en el tiempo, además, por ser hipotético, cada una de las vías que se muestran deben ser confirmadas con otros experimentos. Sin embargo, es el primer modelo hipotético de respuesta de defensa de la yuca al ataque por Xam, y ahí radica su valor."}]},{"head":"Identificación de genes expresados diferencialmente usando microarreglos","index":12,"paragraphs":[{"index":1,"size":212,"text":"Con el fin de confirmar la expresión diferencial de los genes aislados en la librería sustractiva, fue construido un microarreglo de ADNc y evaluado con plantas sanas vs. plantas infectadas y colectadas después de 24 y 48 h. El análisis de datos reveló que 9 genes (5 genes después de 24h y 4 genes después de 48h) se encuentran diferencialmente expresados durante la respuesta de defensa de la yuca contra la infección por Xam, entre ellos la glutarredoxina (SUS04), el gen PR (SUS06), el factor de transcripción Dedo de Cinc (SUS10), la ubiquitina (SUS11), genes de Arabidopsis con función no conocida (A.th) y algunos genes que no presentan similitud en las bases de datos (NH) (tabla 2). En el futuro podría ser interesente evaluar otros tiempos de infección usando microarreglos, de forma que pueda ser caracterizada en detalle la expresión de genes en las respuestas de defensa para este importante cultivo. En orden a seleccionar fuertes genes candidatos que puedan ser utilizados en posteriores estudios de transformación genética o silenciamiento de genes, recientemente se han validado estos y otros genes diferencialmente expresados encontrados en otros experimentos, usando la tecnología de PCR en Tiempo Real (RT-PCR). La correspondencia encontrada entre los resultados de microarreglos y RT-PCR fue del 100% (López et ál., 2005)."},{"index":2,"size":192,"text":"Figura 1. El modelo hipotético basado en secuencias aisladas en la sustracción muestra la posible ubicación de las secuencias aisladas en la librería sustractiva (en verde) en las vías de respuesta de defensa al ataque por Xam. Una vez se ha hecho el reconocimiento entre los genes avr del patógeno y R de la planta se inicia una serie de respuestas de defensa. Posiblemente en los estados iniciales de infección la célula aumenta su metabolismo y tráfico vesicular (expresión de SUS14) al tiempo que protege sus proteínas del estrés oxidativo (expresión de SUS04). A medida que la infección avanza se activan señales de transducción (como las mediadas por calcio, SUS01) que refuerzan la síntesis de ROS y la inducción de HR. Los factores de transcripción como MYB (SUS09) y ZFP (SUS10) inducen la expresión de genes PR (SUS05, SUS06), se activan las vías de ubiquitinación (SUS11, SUS12) y degradación proteica (SUS13), así como la modificación de la pared celular (SUS08). En tiempos específicos durante la enfermedad, la síntesis de ROS es controlada por catalasas (SUS02) y NDPKs (SUS03). Las flechas punteadas indican relación entre dos procesos que podría no ser necesariamente directa."},{"index":3,"size":122,"text":"Tabla 2. Resumen de estadísticos para el programa SAM y número de genes diferencialmente expresados a 24 y 48h durante la infección por Xam Genes reprimidos 0 0 CONCLUSIONES Con este estudio se ha logrado el primer acercamiento al conocimiento de los patrones de expresión génica que están asociados con las respuestas de defensa de la yuca a la bacteriosis vascular. Muchas vías de señalización dirigen respuestas como estrés oxidativo, inducción de genes PR y factores de transcripción, modificaciones de la pared celular y regulación del tráfico de proteínas. Se ha demostrado que la genómica funcional y sus tecnologías de alto alcance pueden ser de gran utilidad para avanzar hacia la solución de problemas en cultivos de alto interés económico en Colombia."}]}],"figures":[],"sieverID":"686a9f97-4870-4d52-97b8-a432fddd8a58","abstract":"por la bacteria Xanthomonas axonopodis pv. manihotis (Xam). Produce pérdidas entre el 12% y 100% de los cultivos. Algunos estudios se han realizado a nivel bioquímico y citoquímico para conocer las respuestas de defensa de la yuca a Xam; sin embargo, las bases moleculares de los mecanismos de defensa no han sido aún caracterizadas. Con el propósito de identificar genes diferencialmente expresados durante la respuesta de la planta al patógeno, se ha construido una librería sustractiva, usando el método de Sustracción Diferencial en Cadena (DSC), con 1536 clones de dos variedades resistentes (MBRA 685 y SG 107-35). De esta librería fueron seleccionados al azar 110 clones para ser secuenciados y realizar búsquedas de similitud en bases de datos públicas. El análisis de secuencia mostró 14 clones con similitud a genes previamente reportados como involucrados en procesos de defensa en plantas, 70 clones con similitud a genes de plantas sin función conocida o que no presentaron similitud, representando nuevos genes potencialmente involucrados en las respuestas de defensa de la yuca. Finalmente fueron construidos microarreglos de ADNc, usando los clones seleccionados de las librerías sustractivas para confirmar su expresión diferencial durante el desarrollo de la infección."}

data/part_1/06e2a70363b0d20be32a997141359da7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"06e2a70363b0d20be32a997141359da7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e00274bd-f993-4f04-b85c-85da8f529e62/retrieve"},"pageCount":18,"title":"EstudIa~te de posgrado Unlvers1dad NaCIonal de","keywords":[],"chapters":[{"head":"INTRODUCCION","index":1,"paragraphs":[{"index":1,"size":377,"text":"En los troplcos el 42% de area, aproximadamente 2050 millones de hectareas, esta ocupada por suelos oXlsoles, ultlsoles o Inceptlsoles, con 48% en Amenca, 35% en Afnca y 17% en ASia En Colombia se estima que el 57% del area, es decir aproximadamente 67 millones de hectareas, astan ocupados por oXlso/es y ultlsoles (Sanchez y Salinas, 1981) Estos suelos aCldos son caracterizados por una fertilidad defiCiente, baJo pH, pobre capaCidad de Intercambio catlOnlCO, altos niveles de aluminiO soluble y algunas veces de manganeso, y alta flJaclon de fosforo En la mayona de los cereales, los daños por exceso de aluminiO ocurren aparentemente primero en las ralces Las ralces afectadas crecen menos, son menos abundantes y no se ramifican normalmente, las puntas se deSintegran y se tornan color cafe (Reld, 1976) Se han desarrollado diferentes tecmcas de evaluaclon para determinar la toleranCia relativa al aluminiO de diferentes especies y genotipos Estos Incluyen, ademas de evaluaCiones en campo, pruebas en potes con suelos aCldos en Invernadero (Borgonovl el al, 1987, Foy et al, 1987, Ahlnchs et al, 1990) yen solUCiones nutntlvas (Konzak et al, 1976, Rhue and Grogan, 1977, Magnavaca et al, 1987ay 1987b, LIma el al, 1992) Las evaluaCiones en campo consumen tiempo y la respuesta de la planta a Al y otros factores adversos son frecuentemente afectadas por la heterogeneIdad del suelo Los coefiCientes de vanaclon resultan ser consecuentemente, demaSiados altos El desarrollo de tecnlcas que permitan obViar o redUCir las evaluaCiones de 2 campo es, por lo tanto, muy deseable Se han realizado numerosos trabajos en soluciones nutritivas El problema de las mismas es que solo controlan uno de los factores que limitan el crecimiento de las plantas en suelos aCldos EXisten muchos otros factores (pH, P, Mn, Ca, fertilidad, textura del suelo, disponibilidad de agua, etc) que tamblen actuan y que determinan Interacciones muy complejas EXisten muy pocos estudios en malz que permitan comparar las diferentes metodologlas con los resultados obtenidos en campo El objetiVO del presente estudio fue desarrollar una tecnlca en potes que permita dlscnmlnar la toleranCia a suelos aCldos en malz e Identificar cuales caractenstlcas se correlacionan mejor con rendimiento a campo para seleCCionar los genotipos mas tolerantes a aCidez Se busca ademas determinar efectos genetlcos en la expreslon de la toleranCia      "}]}],"figures":[{"text":"los para varl.ables seleccl.onadas, del ensayo d~alél~co, evaluado en soluc~6n Cuadrados rned~os del anál~s~s de var~anza cornb~nado del d~alél~co TABLA 1 cuadrados med-nutr~t~va ( L R R S) Y potes 3 5 '9 TABLA 1 cuadrados med-nutr~t~va ( L R R S) Y potes3 5 '9 PROCEDIMIENTO EXPERIMENTAL RESULTADOS y DlSCUSION vanables evaluadas Indica, que el comportamiento de los ocho genotipos CONCLUSIONES aCldos\" al tener en cuenta la mayona o totalidad de factores En Genetlc aspects of plan! mineral nutntlon (eds) W H Fuente de var~ac~6n gl L R R S Potes (++) PROCEDIMIENTO EXPERIMENTAL RESULTADOS y DlSCUSION vanables evaluadas Indica, que el comportamiento de los ocho genotipos CONCLUSIONES aCldos\" al tener en cuenta la mayona o totalidad de factores En Genetlc aspects of plan! mineral nutntlon (eds) W H Fuente de var~ac~6n gl L R R S Potes (++)  tolerantes fue similar en los suelos de Canmagua y Santander de QUJllchao, edaflcos Ilmltantes. aSI como sus Interrelaciones Gabelman and B C Loughman Martlnus NIJhoff, the Hague, the AI?I? APQ L R S P-Q L R S S-Q tolerantes fue similar en los suelos de Canmagua y Santander de QUJllchao, edaflcos Ilmltantes. aSI como sus Interrelaciones Gabelman and B C Loughman Martlnus NIJhoff, the Hague, the AI?I? APQL R S P-QL R S S-Q  2 1 Expenmento 1 3 1 EXPERIMENTO 1 sugiriendo que la misma tecnlca podna ser efectiva usando otros suelos aCldos Suficiente vanabllldad genetlca eXiste en malz para la tolerancia Nelherlands 189-199pp 2 1 Expenmento 1 3 1 EXPERIMENTO 1 sugiriendo que la misma tecnlca podna ser efectiva usando otros suelos aCldos Suficiente vanabllldad genetlca eXiste en malz para la tolerancia Nelherlands 189-199pp En este estudio se utilizaron cinco vanedades experimentales de malz a los suelos aCldos Efectos genetlcos aditivoS y no aditivoS estan Repet~c16n 1 (2) + O 039 1628 192** 479 732** 169 284** 23 136** En este estudio se utilizaron cinco vanedades experimentales de malz a los suelos aCldos Efectos genetlcos aditivoS y no aditivoS estan Repet~c16n 1 (2) + O 039 1628 192** 479 732**169 284**23 136** tolerantes a suelos aCldos del programa de mejoramiento de CIMMYT (SA3, Los resultados que se presentan en la Tabla 1, muestran que la A e G para Involucrados en la expreslon de LRSS en soluclon nutntlva (74 Y 7 MAGNAVACA, R ,C O GARONER, ANO R B CLARK 1987b Inhentance Genot1.po 35 O 038** 9 515** 19 148** 28 479** 9 272** tolerantes a suelos aCldos del programa de mejoramiento de CIMMYT (SA3, Los resultados que se presentan en la Tabla 1, muestran que la A e G para Involucrados en la expreslon de LRSS en soluclon nutntlva (74 Y 7 MAGNAVACA, R ,C O GARONER, ANO R B CLARK 1987b Inhentance Genot1.po 35 O 038** 9 515** 19 148**28 479**9 272** SA4, SA5, SA6, SA7) y dos susceptibles (Tuxpeño Selecclon SeqUla C6, Pool Los genotipos tolerantes en subsuelo de Quillchao y Canmagua (BASA) Tabla 26% respeclivamente), en potes para AP en Palmlra (73 y 27%), to alumlnum tolerance In malze Eds W H Gabelman and B C Loughman Padres ( P) 7 O 050** 9 100 33 172** longitud relativa de ralz seminal (LRRS), en Solucion nutntiva contnbuyo con un 74% del total de la suma de cuadrados, indicando mayor Importancia de los 5, presentaron los mayores valores promedios comparado con los susceptibles AP (72 Y 28%), LRSP (58 y 42%), Y LRSS (52 y 48%) en suelo de To1erantes(T) 5 O 043** 7 518 39 1211t'1t Martlnus NIJhoff, The Hague, The Netherlands 201-212pp Suscept~bles(S) 1 O 000 18 375* 16 335 71 519** 81 158** 6 615 12 345** 13 097** 1 500 SA4, SA5, SA6, SA7) y dos susceptibles (Tuxpeño Selecclon SeqUla C6, Pool Los genotipos tolerantes en subsuelo de Quillchao y Canmagua (BASA) Tabla 26% respeclivamente), en potes para AP en Palmlra (73 y 27%), to alumlnum tolerance In malze Eds W H Gabelman and B C Loughman Padres ( P) 7 O 050** 9 100 33 172** longitud relativa de ralz seminal (LRRS), en Solucion nutntiva contnbuyo con un 74% del total de la suma de cuadrados, indicando mayor Importancia de los 5, presentaron los mayores valores promedios comparado con los susceptibles AP (72 Y 28%), LRSP (58 y 42%), Y LRSS (52 y 48%) en suelo de To1erantes(T) 5 O 043** 7 518 39 1211t'1t Martlnus NIJhoff, The Hague, The Netherlands 201-212pp Suscept~bles(S) 1 O 000 18 375* 16 33571 519** 81 158** 6 61512 345** 13 097** 1 500  efectos genetlcos aditivos para esta caracterlsllca La longitud relativa de ralz para PFR (374 vs 337 g), AP (41 1 vs 378 cm), LRSS (242 vs 235 cm), QUllichao, aSI como para rendimiento en campo (89 y 11 %, T vs S 1 O 135* 7 736 20 267 88 224** 19 428** efectos genetlcos aditivos para esta caracterlsllca La longitud relativa de ralz para PFR (374 vs 337 g), AP (41 1 vs 378 cm), LRSS (242 vs 235 cm), QUllichao, aSI como para rendimiento en campo (89 y 11 %, T vs S 1 O 135* 7 736 20 26788 224**19 428** seminal promedio fue superior en un 18% para los genotipos tolerantes con NRSS (806 vs 7 83), PST (O 65 vs O 57 g), PSR (O 35 vs O 33 g), L!o! (65 3 vs respectivamente) 8 REIO, O A 1976 Genetlc potentlals for solvlng problems of s011 mineral P vs e 1 o 091** 4 557 3 800 5 369 o 420 seminal promedio fue superior en un 18% para los genotipos tolerantes con NRSS (806 vs 7 83), PST (O 65 vs O 57 g), PSR (O 35 vs O 33 g), L!o! (65 3 vs respectivamente) 8 REIO, O A 1976 Genetlc potentlals for solvlng problems of s011 mineral P vs e 1 o 091** 4 557 3 8005 369o 420 relaclon a los susceptibles (1 37 vs 1 16 cm), Siendo esta diferencia 61 3 cm), PSTot (1 00 vs O 90 g) De la misma manera los genotipos tolerantes stress alumlnum and manganese loxlcltes In the cereal gralns In Cruzamlentos(C) 27 O 033** 9 807** 16 080** 18 176* 8 803** relaclon a los susceptibles (1 37 vs 1 16 cm), Siendo esta diferencia 61 3 cm), PSTot (1 00 vs O 90 g) De la misma manera los genotipos tolerantes stress alumlnum and manganese loxlcltes In the cereal gralns In Cruzamlentos(C) 27 O 033** 9 807** 16 080**18 176*8 803** Las vanedades 90SA3, 90SA4, y CMS36 presentaron, en Plan! adaptatlon lo mineral stress In problem sOlls (eds) J 7 o 094** 27 522*' 44 861** significativa A e G general, efectos de A C G pOSitivoS y significativos para AP, A e E 20 o 012** 3 608 6 007 Wnght Departamento de Agronomla Come!! Unlverslty Ithaca. Error 35(70)+ O 004 4. 452 7 019 40 787** 10 261 9 990 17 589** 5 727** 2 406 Las vanedades 90SA3, 90SA4, y CMS36 presentaron, en Plan! adaptatlon lo mineral stress In problem sOlls (eds) J 7 o 094** 27 522*' 44 861** significativa A e G general, efectos de A C G pOSitivoS y significativos para AP, A e E 20 o 012** 3 608 6 007 Wnght Departamento de Agronomla Come!! Unlverslty Ithaca. Error 35(70)+ O 004 4. 452 7 01940 787** 10 261 9 99017 589** 5 727** 2 406 La A C G mostro diferencias altamente significativas en potes, mientras que la LRSP, y LRSS evaluados en potes Estos valores estuvieron New York 55-64pp e v ( % ) 4 42 6 34 10 79 19 61 21 72 La A C G mostro diferencias altamente significativas en potes, mientras que la LRSP, y LRSS evaluados en potes Estos valores estuvieron New York 55-64pp e v ( % ) 4 42 6 34 10 7919 6121 72 A e E presento diferencia altamente Significativa para LRRS en QUlllchao aSOCiados con altos rendimientos en las evaluaCiones a campo * ** Sl.gnl.flCanCla I? < o 05 y P < O 01, respectl.vamente , A e E presento diferencia altamente Significativa para LRRS en QUlllchao aSOCiados con altos rendimientos en las evaluaCiones a campo * ** Sl.gnl.flCanCla I? < o 05 y P < O 01, respectl.vamente , (+) (Tabla 1) Del total de la suma de cuadrados para cruzamientos la A e G En forma similar, los padres susceplibles Tuxpeño y Pool 26, 9 RHUE, R D and C O GROGAN 1977 Screemng corn for Al tolerance Grados de l~bertad ensayo en potes (+)(Tabla 1) Del total de la suma de cuadrados para cruzamientos la A e G En forma similar, los padres susceplibles Tuxpeño y Pool 26, 9 RHUE, R D and C O GROGAN 1977 Screemng corn for Al tolerance Grados de l~bertad ensayo en potes (++) explico el 72% de la vanaclon para AP tanto en QUlhchao como en Palmlra En el Expenmento 1 mostraron valores de A C G negalivos, que frecuentemente uSlng dlfferent Ca and Mg concentratlons Agron J 69 755-760 (++)explico el 72% de la vanaclon para AP tanto en QUlhchao como en Palmlra En el Expenmento 1 mostraron valores de A C G negalivos, que frecuentemente uSlng dlfferent Ca and Mg concentratlons Agron J 69 755-760  el caso de LRSP y LRSS en QUlhchao la A e G contnbuyo con el 58 y 52%, alcanzaron slgnlficancla estadlstlca y estuvieron correlaCionados el caso de LRSP y LRSS en QUlhchao la A e G contnbuyo con el 58 y 52%, alcanzaron slgnlficancla estadlstlca y estuvieron correlaCionados  respectivamente, por lo que tuvieron Similar Importancia En general los con baJOS rendimientos 10 SANCHEZ, P A, and J G SALINAS 1981 Low Input technology for respectivamente, por lo que tuvieron Similar Importancia En general los con baJOS rendimientos 10 SANCHEZ, P A, and J G SALINAS 1981 Low Input technology for  mayores valores promedios se presentaron en los padres tolerantes a suelos managlng OXlsols and ultlsols In Tropical Amence Adv Agron 34 mayores valores promedios se presentaron en los padres tolerantes a suelos managlng OXlsols and ultlsols In Tropical Amence Adv Agron 34  aCldas 90 SA3 y CMS 36 comparado con los susceptibles Tuxpeño y Pool 26 3 2 EXPERIMENTO 2 La tecmca de evaluaclon en potes se muestra promlsofla, ya que, 279-406 aCldas 90 SA3 y CMS 36 comparado con los susceptibles Tuxpeño y Pool 26 3 2 EXPERIMENTO 2 La tecmca de evaluaclon en potes se muestra promlsofla, ya que, 279-406  las correlaCiones con rendimiento a campo fueron adecuadas las correlaCiones con rendimiento a campo fueron adecuadas  En el anahsls combinado del rendimiento en campo (Tabla 2), las interacciones En el anallsls de varianza combinado a traves de suelos (Tabla 4 ), todas las (alrededor del O 50), Y vanas caracteflslicas pudieron distingUir En el anahsls combinado del rendimiento en campo (Tabla 2), las interacciones En el anallsls de varianza combinado a traves de suelos (Tabla 4 ), todas las (alrededor del O 50), Y vanas caracteflslicas pudieron distingUir  padres por ambiente y padres vs cruzamiento por ambiente indicaron vanables mostraron diferencias altamente significativas entre suelos (P ;; O 01), efiCientemente los genolipos tolerantes y susceptIbles Los padres por ambiente y padres vs cruzamiento por ambiente indicaron vanables mostraron diferencias altamente significativas entre suelos (P ;; O 01), efiCientemente los genolipos tolerantes y susceptIbles Los  consistencia en el comportamiento de los padres y en los efectos promedios a excepto AR que alcanzo slgnlflcancla de solo (P ,; O 05), Y PFR que no caracteres AP. PFR, lRSS y AR. se muestran como los mas consistencia en el comportamiento de los padres y en los efectos promedios a excepto AR que alcanzo slgnlflcancla de solo (P ,; O 05), Y PFR que no caracteres AP. PFR, lRSS y AR. se muestran como los mas  traves de ambientes La InteraCClon A e G por ambiente fue altamente presento diferencias Todas las vanables, sin excepclon, mostraron diferencias promlsonos debido a su relativa facilidad para evaluar Esta traves de ambientes La InteraCClon A e G por ambiente fue altamente presento diferencias Todas las vanables, sin excepclon, mostraron diferencias promlsonos debido a su relativa facilidad para evaluar Esta  Significativa para rendimiento, indicando que el comportamiento promedio altamente significativas entre genotipos Finalmente solo se observo tecnlca tendrla su mayor utilidad para eliminar matenales Significativa para rendimiento, indicando que el comportamiento promedio altamente significativas entre genotipos Finalmente solo se observo tecnlca tendrla su mayor utilidad para eliminar matenales  susceptibles y evaluarla de una forma mas real que la soluclon susceptibles y evaluarla de una forma mas real que la soluclon  nutnliva la toleranCia de los genotipos al .. complejO de los suelos nutnliva la toleranCia de los genotipos al .. complejO de los suelos  "},{"text":"en campo en s~ete amb~entes en suelos ác~dos durante 1992 Fuente gl    Rend~Im.ento  Rend~Im.ento Ambl.ente lA) 6 217 57 ** Ambl.ente lA)6217 57** Repetl.cl.6n / A 32 3 27  Repetl.cl.6n / A323 27 Genotl..po (G) 35 5 74  Genotl..po (G)355 74  "},{"text":" Efectos de aptltud comln.nator.l8 general de ocho padres evaluados en soluclón nutr.ltlva, potes y rend.lIDlento en campo TAllL!\\ 3    TAllL!\\ 3 Padres Rdto(+J Sol nutrlt:.va  Potes (++) PadresRdto(+JSol nutrlt:.vaPotes (++)     •• •• Cruzam~ento le) 27 3 47 ** Cruzam~ento le)273 47**  AeG  7 11 93 ** AeG711 93**  ACE  20 o 51 ACE20o 51 G x A   210 o 72 •• G x A210o 72•• P ¡¡ A T x A  42 30 o 69 o 84 .. P ¡¡ A T x A42 30o 69 o 84..  S \" A  6 o 19 S \" A6o 19  T vs S x A  6 o 45 T vs S x A6o 45 p vs C x A  6 1 03 p vs C x A61 03 e ¡¡ A  162 071 • e ¡¡ A162071•  ACG ¡¡ A  42 1 10 ** ACG ¡¡ A421 10**  AeE ¡¡ A  120 o 58 AeE ¡¡ A120o 58 Error   1120 O 55 Error1120O 55 • , ** S1gnlflcanCla P $ O 05 Y P < O 01, respectJ.vamente • , ** S1gnlflcanCla P $ O 05 Y P < O 01, respectJ.vamente  "},{"text":"en canpo SolucI6n nutrlt1.Va y en potes usando sUelos ác~dos y no ác~dos Anáhsls de vananza combmado 2M. evaluacIón en ~otes en suelos con bala ~ alto estrés Eor .lumlOlo CIA T PaIrrur. I 993B Genot~po TABLA 4 Fuente de vanac16n    Rdto'\"    AP LRSP Cuadrados medIOs LRSS NRSS PST PSR AR ~STo Genot~po TABLA 4 Fuente de vanac16nRdto'\"APLRSP Cuadrados medIOs LRSS NRSSPSTPSRAR~STo SUELOS  3 ~l t/ha PFR 1886 (L R R SI cm AP 5683** gr LRSP 59981\" LRSS 60775\" cm NRS Cll', 1822\" PST 045\" n 9 PSR 9 009** AR ~-5 10 64\" Ltot 197920\" cm 9 PSTot 082\" SUELOS3~lt/ha PFR 1886(L R R SI cm AP 5683**gr LRSP 59981\"LRSS 60775\" cmNRS Cll', 1822\"PST 045\" n9PSR 9 009**AR ~-5 10 64\"Ltot 197920\" cm 9PSTot 082\" Suelos no áCldos ASAvsBASA    2677 575 14758 592   2220\" 007 008\" 1 03 104250\" 029 Suelos no áCldos ASAvsBASA2677575147585922220\"007008\"1 03104250\"029 88SA3 Q/chao vs Clmagua (BASA)   2674 \\6210\" 3 58 396 03' 42 4 83899\" 14 5 041 23 5 1 52 109\" O 63 017\" O 33 2 54 2253\" o 96 163467'-209\" 88SA3 Q/chao vs Clmagua (BASA)2674\\6210\"3 58 396 03'42 4 83899\"14 5 041 23 51 52 109\"O 63 017\"O 332 54 2253\"o 96 163467'-209\" 91SAJ Q/chao vs C/magua(ASA)   306 266 3 85 125583-' 96333\" 43 6 16 3 3203'-21 9 8 04 018 O 70 002 O Jo 2 35 837 55 326042--009 1 04 91SAJ Q/chao vs C/magua(ASA)3062663 85 125583-' 96333\" 43 616 3 3203'-21 98 04 018O 70 002O Jo2 35 83755 326042--009 1 04 90SA3 Rcp(suelo) 91S;'.5 O 32 ...... -O 01 20 1095 2 28** 666 2 33*'\" 3 73 8035 2 23** 38 2 18 4 4210 221 23 4 1 54** 7 11 006 O 52 001 O 34 3 17 271 8109 O 86 010 90SA3 Rcp(suelo) 91S;'.5O 32 ......-O 01 2010952 28** 6662 33*'\" 3 73 80352 23** 38 2 18 4 4210 221 23 41 54** 7 11 006O 52 001O 343 17 2718109O 86010  90SM O 1~* -O 05''¡'d,  O 82 1 33- O 26   O 54 90SMO 1~*-O 05''¡'d,O 821 33-O 26O 54 91SA6 90SAS -O OS -O 08**  -1 25** -1 61+'\" 4 56 O 35 31 1 16 8  23 3 O 28 8 SO O 66 O 42 2 83 1 07 91SA690SAS-O OS-O 08**-1 25**-1 61+'\" 4 56O 35 31 1 16 823 3O 28 8 SOO 66O 422 831 07 90SA6 GenotIpo 91SA7 -O 03 -O 03 9 686\" -1 56** 1640** -1 22+ 4 02 84 12\" -1 48' 41 O 15 3 11535\" 8 23\" 26 9 -O 85-8 44 014\" O 73 004** O 39 3 15 562-- 1 12 43690'- 029\" 90SA6 GenotIpo 91SA7-O 03-O 03 9686\"-1 56** 1640**-1 22+ 4 02 84 12\"-1 48' 41 O 15 3 11535\" 8 23\" 26 9-O 85-8 44 014\"O 73 004** O 393 15 562--1 12 43690'-029\" 90SA7 Tol vs Sus (T vs S) 91SA8 -O 03 -O 02 2\\ O\" -O 10 5543*' -O 32 3 65 121 13\" -o 97 43 8 19 9 74977\" 11 27' 24 5 -O 26 7 77 040\" O 77 009\" O 37 2 65 3050\" 1 13 27587S\" 088 90SA7 Tol vs Sus (T vs S) 91SA8-O 03-O 022\\ O\"-O 10 5543*'-O 32 3 65 121 13\"-o 97 43 8 19 9 74977\" 11 27' 24 5-O 26 7 77 040\"O 77 009\"O 372 65 3050\"1 13 27587S\"088 Q1S 36 Tuxpei'lo Susceptibles (S) C}1S36 Tolerantes (T) O 13* -o 21-\"\"- a 21*\"* -o 03-1 7 049 575-' o 27 -o 77 133 3' 1127\" 1 60** -1 85** 3 01 6912 8098' 2 06** -1 61' 41 8 19 3 4740' 252 25 6 3443\" 861** o 92\"'* -o 89' 7 46 008\" 012\" O 59 001 004\" O 31 3 13 080 27S\" 001 16770\" o 89 004 024** Q1S 36 Tuxpei'lo Susceptibles (S) C}1S36 Tolerantes (T)O 13* -o 21-\"\"-a 21*\"* -o 03-1 7049 575-'o 27 -o 77 133 3' 1127\"1 60** -1 85** 3 01 6912 8098'2 06** -1 61' 41 8 19 3 4740' 252 25 6 3443\" 861**o 92\"'* -o 89' 7 46 008\" 012\"O 59 001 004\"O 313 13 080 27S\"001 16770\" o 89004 024** CMS30 Peal 26 -O 30** O 01  O 32 -O 26 3 32 -O 84 40 6 19 1  24 6 -1 29** 9 00 O 60 O 34 2 98 o 94 CMS30Peal 26-O 30**O 01O 32-O 26 3 32-O 84 40 6 19 124 6-1 29** 9 00O 60O 342 98o 94 Pool 26 Genot¡po X Suelo  27 061 246 3 27 53342' 38 7 62623\" 17 8 244 22 3 7 50 001 O 60 000 O 31 3 25 058 o 91 80720\" 002 Pool 26 Genot¡po X Suelo270612463 27 53342'38 7 62623\"17 8 244 22 37 50 001O 60 000O 313 25 058o 91 80720\"002 TuxpeflO (ASA vo BASA) X (T vo S) 1 528 63 l' 3 47 25751\" 36 8 32877\"  19 3 015 24 7 8 15 002\" O 54 003\" O 35 3 79 052 Ü 8S 447 17\" 009\" TuxpeflO (ASA vo BASA) X (T vo S)152863 l'3 47 25751\"36 8 32877\"19 3 015 24 78 15 002\"O 54 003\"O 353 79 052Ü 8S 447 17\"009\" Med general x (8)  1 000 879 091 3 67 40 S 3088  17 9 1750\" 24 1 8 01 006\" o 63 o 35 2 90 001 021 7651 o 98 008' Med general x (8)10008790913 6740 S 308817 9 1750\" 24 18 01 006\"o 63 o 35 2 90 001 0217651o 98008' Med tolerantes x(T)  7 052 100 359 3 74 41 1 4053\" 17 7 067 24 2 8 06 000 O 65 000 o 35 2 85 039 65 J 3899 1 00 000 Med tolerantes x(T)70521003593 7441 1 4053\"17 7 067 24 28 06 000O 65 000o 35 2 85 03965 J 38991 00000 Méd susceptlbles Q vs C (BASA) X (T vs S)   012 54 3 37 26181\" 37 8 65030\" 18 6 563 23 5 7 83 000 o 57 O 33 J 52 000 079 85094\" o 90 000 Méd susceptlbles Q vs C (BASA) X (T vs S)012543 37 26181\"37 8 65030\"18 6 563 23 57 83 000o 57 O 33 J 52 000 07985094\"o 90000 D M 5% (O 051 x(S)  1 019 427 630 O 49 2 43 368   4 4 O 2 68 038 O 82 003' o 07 O 05 O 66 000 063 4214 o 11 005 D M 5% (O 051 x(S)1019427630O 492 43 3684 4 O 2 68 038O 82 003'o 07 O 05 O 66 000 0634214o 11005  x (T)  7 057 490 6981' 4379\"  045 001 000 087 3148 002 x (T)70574906981'4379\"0450010000873148002 Suelos ác:tdos Q vs C (ASA) x (T vs S)   029 79 398  4909'  963 000 000 108 9144 001 Suelos ác:tdos Q vs C (ASA) x (T vs S)029793984909'9630000001089144001 saSA3 x(S)    3 28 023 1 80 20 4 08 41 34 44 1 1855   19 8 017 25 5 8 29 000 O 67 000 o 37 3 40 035 8894 1 04 000 saSA3x(S)3 28 0231 80 204 08 41 3444 1 185519 8 017 25 58 29 000O 67 000o 37 3 40 03588941 04000 91SA3 x(T)  7 3 08 039 1 7: 58 . ::. 62 1847 45 3 276  19 7 350 25 6 8 29 001 O 75 000 O 39 2 50 047 1271 1 14 001 91SA3x(T)73 08 0391 7: 58. ::. 62 184745 3 27619 7 350 25 68 29 001O 75 000O 392 50 04712711 14001 9151\\5 Error   180 2 52 049 1 60 272 31 61 39 9 11 71 19 9 264 2S 3 8 33 001 O 64 000 O 38 3 56 063 2464 1 02 002 9151\\5 Error1802 52 0491 60 27231 6139 9 11 7119 9 264 2S 38 33 001O 64 000O 383 56 06324641 02002 91SA6 • ..     2 42 1 30  5 28 39 7   : 7 4 22 4 9 79 O 70 o 47 3 77 91SA6 • ..2 421 305 2839 7: 7 422 49 79O 70o 47 3 77  "},{"text":"promedlo a traves de Clnco arnblentes en suelos ACldos  • •            ••    17          17 91SA7 2 58 1 38 4 98 43 1 16 9 24 8 9 88 O 74 O 44 3 71 §7 1 18 91SA72 581 384 9843 116 924 89 88O 74O 443 71§71 18 91SA8 3 18 1 69 4 85 43 9 23 7 26 6 8 48 O 77 O 43 3 48 SO 1 20 91SA83 181 694 8543 923 726 68 48O 77O 433 48SO1 20 CM36  1 86 3 52 43 1 23 7 27 4 8 02 O 59 O 32 3 79 SO O 90 CM361 863 5243 123 727 48 02O 59O 323 79SOO 90 CMS30  1 78 4 71 42 5 19 O 27 6 8 90 O 66 O 39 3 42 1 0 1 06 CMS301 784 7142 519 O 27 68 90O 66O 393 421 01 06 Pool 26   3 35 39 O 14 5 17 O 8 29 O 62 O 31 4 58 0 6 O 93 Pool 263 3539 O14 517 O 8 29O 62O 314 580 6 O 93 Tuxpef'¡o   3 55 36 9 17 6 18 6 8 29 O 52 O 33 4 56 g5 O 85 Tuxpef'¡o3 5536 917 618 68 29O 52O 334 56g5O 85 Med general 2 84 1 64 4 34 41 8 19 2 24 1 8 66 O 67 O 38 3 68 liS 1 05 Med general2 841 644 3441 819 224 18 66O 67O 383 68liS 1 05 Med tolerantes   4 56 42 7 20 O 25 7 8 75 O 69 O 40 3 45 ~8 1 09 Med tolerantes4 5642 720 O 25 78 75O 69O 403 45~81 09 Med suscept~bles   3 45 37 9 16 1 17 8 8 29 O 57 O 32 4 57 ¡¡S O 89 Med suscept~bles3 4537 916 117 88 29O 57O 324 57¡¡S O 89 O M S% (O 051  O 10 O 56 2 30 8 72 9 43 O 78 O 07 O 05 O 62 5 6 O 11 O M S% (O 051O 10O 562 308 729 43O 78O 07O 05O 625 6 O 11  "}],"sieverID":"4b9d4b53-01de-45a1-93e0-ac1d25f4467b","abstract":"El obJetiVO dol presente estudio fue desarrollar una técnica que permitiera dlscrimmar genotipos toléranlns a suelos áCidos IdentifICar las earaelerlshcas que mejor se correlacionen con rendlmlenlo en campo y determinar los efectos genéheo$ en malz de la expfestón de dicha to!eranc;a CmcO' v:medades de malz tolerantes a sue!os éCldos dos $u$optlbl8$ y sus mSpeGtlvos cruzamientos d¡alallC08 fueron evaluados en campo potes y solucIón nu:ntNa La mformaclón se analIZÓ con basa en el anáhSI$!U de Eberhart y Gardner en donde los ambientes fueron aleatonos y JO$ genotipos fijOS En solUl::¡ón nulnltva tos genollpos fuafOn CfGC,dos on 185 mlcromolas-de Al '1 45 P P m do P en polas los tratamlenlos fueron suelo fértil de Palmlfa subsuelo de Santander de QUlllchao con 85% Sat Al y subsuelo 00 Canmagua con 90% SatAl en ensayo de campo con 45 55 V 70% de Sal de f..J En solucIón nulrrtwa 'f en campo el diseño u'JllZado fue bloques completos al azar con dos y SeiS re¡rotlclones respectNaman1e En potes el disenO fue el da parcelas drvtdldas con tras repe11Clones la~1faracterlShcas medidas en planlulas mdllfldualas lueron longllud relativa de miz $omloal en solución nutritiva longitud de mil: semmal pnnClpal longitud de r312 $emmal secundana numero de r.tlces semmales secundarlas tongltud de tallo longItud lotal de la planta peso seco de lallo peso. seco de faiZ peso seco total abundancia de raiCillas en potes y rendlmtento. en campo Los resultados de este estudiO mdlcan qua efectos genétiCOS adlll\\los V no ad¡hvos están Involucrados en la exprGSlón de la tolernnc¡a ;lando 10$ efectoo genétH:os adItIVos relatl\\famcníe má$ Importante; En potes las variedades 9OSA3 9OSA4 V CMSJ6 pre:sentamn los mayores-efectos do A e G para largo da tallo (AP) longitud de raíz seminal pnnclpal (LRSP) y longItud de rslZ semmal secundana (l.RSS) Un segundo expenmento fua nevado a cabo duranto 19936 utilizando dlOZ vanedadas en aoJUCI6n nututIV3 en potea (subsl..ielo do S QUlhchao 11 V 66% Sal Al) y Subsuelo de Canmagua (11 'f 46% do Sat AO yen campo a través de CltlCO ambientes en &uelos áCldO$ baJO diferentes condiCiones de eslrás por Al laG modificaCiones mtroducldas en la evatuaclón en potas aumentaron la eflClQttCla do la tócmca penmbcndo dlscnmlnar mas efic¡enlemanla entre tolorantes V &Usceptlbles las vanablea longitud do tallo (AP) peso fresco de r.uz (PFR) longitud de ralces semlr'lalé$ wcundanas (lRSS) y abun¡;lancla de pelos mdlCá[es: (AH) en potes so muestran como las más pfomu.onas SUMMARY TINO expenmants were camed out to tesl 2nd ImprO'le a pot techmque for avaluabng lolerance In ma12:e lo soll aCldl1y In greenhouso condtMos ¡he iechn¡que Usos pots (2 Kg sod C<lpaclly) were s.ccdlmgs are grown lor a penod oC about two weeks Acld 6011$ ffOm Santander of Cu¡lIchao and Canmagua were usad Several vanables tt;era measurad and tna best Orles s.elected lor a rapld easyand unel<pensW6 malhoo to separata tolerant amI susceptible senotypes The first expenment conSlsted of an evalualJon of a sel of dlaUel crosses amoog S paranls (two of Ihnm know to be suscepllble lo actd sotls) The s:econd expenment Illcluded tan expenmental vanehes IIlCIOOUlg two suscepllble checks In bolh expenments al! the gtm{Jlypes were ev-alualed under field condlhons In nutnanl soluhons and Iíl pots Results 8u9906t iha{ the pol techmque effic¡en!ly d!slmgUlsh loleranl from susceptible genotypes Correlattons belwecn the bes! vanab!es In th~ poI evaluabon anj riela YI¡;;l[.:;! ranged from o 45 to O 55 No slgruficanl genotype )( sOllmteractlOn was observed In the seoóndmpenrnon1 suggesllng tha1 techmque vlOuld be appropnate usmg dlfferent typO$ of 8c:td $Olls The sm!s used should prolllde an edaphsc stress stmng e:rtOvgh lo alky. .... !ha expresslOn of tolerance but no! lo the extreme were toterance 15 supprassed AA $ltOSS rangl09"}

data/part_1/082bd9cce3654e20848638fa29df1f02.json

@@ -0,0 +1 @@
+{"metadata":{"id":"082bd9cce3654e20848638fa29df1f02","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/20c892d4-203d-435a-b5e3-1646a71a7af8/retrieve"},"pageCount":34,"title":"Screening of West African plants for anthelmintic activity*","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":100,"text":"Helminthiasis has long been recognized as a major constraint to the productivity of ruminants in Nigeria and elsewhere, and has been the cause of serious economic losses (Akerejola et al, 1979;Okun et al, 1980). For example in Nigeria the economic loss due to helminthiasis in small ruminants alone has been estimated to be at least 144 million naira annually, through death, weight loss and liver condemnation (Akerejola et al, 1979). In addition more than 800 million people in the world are affected by helminthiasis (Stoll, 1947). Helminths are more widespread in tropical regions due to climatic and sociological factors (Cavier,1973)."},{"index":2,"size":19,"text":"The major control measure against helminthiases in Nigeria is chemotherapy. However, the availability of drugs varies (Okun et al,1980)."},{"index":3,"size":65,"text":"The significance of helminthiases has been recognized by local people and herdsmen from the earliest times who have made various attempts at control through the use of medicinal plants. Fulani herdsmen in Nigeria recognize animal helminthiasis to be a problem of greatest significance in calves of less than a year old and routine herbal treatment is started within 1 week of birth (Ibrahim et al,1983a)."},{"index":4,"size":89,"text":"Only a few of the plants used traditionally as anthelmintics in Africa have previously been studied. Hunteria umbellata (Polyadoa umbellata), which has been used as an anthelmintic for humans in Nigeria, was shown to have the same anti-ascarid potency as pure piperazine base by Onuaguluchi (1964). The plants Combretum mucronatum and Mitragyna stipulosa, used for the treatment of guinea-worm in African traditional medicine, were found to be effective against helminthiasis and their use has been recommended, as has that of a combination of Elaeophorbia drupifera and Hillarialatifolia (Ampofo, 1978)."},{"index":5,"size":126,"text":"A number of plants, either those used in African traditional medicine as anthelmintics or species closely related to them, have been tested elsewhere and some have been found to be useful. Raw garlic (Allium sativum), used in Nigeria as a vermifuge (Dalziel, 1937), was shown to have some activity against Ascaridia galli in chicken (Das and Thakuria, 1977) and to inhibit the embryonation of the eggs of Necator americanus and Ancylostoma caninum (Bastidas,1970). The juice of Citrus aurantifolia is used as a vermifuge in Senegal and Sierra Leone and as a treatment for dysentery in West Africa (Dalziel, 1937). A number of Citrus species such as C. decumara, C. acida, C. aromaticum and C. medica have been found to be active against Ascaris lumbricoides (Kaleysa, 1975)."},{"index":6,"size":166,"text":"Diospyros mespiliformis is used in Nigeria as a veterinary vermifuge and as a remedy for dysentery in humans (Dalziel,X937).Diospyrol, from the related plant D. mollis, was shown to be superior to bephinium against Necator americanus in hamsters and against Hymenolepis nana in mice (Sen et al,1975). Decoctions of the berries of D. mollis have been used in antihookworm campaigns in Thailand (Sadavongvivad, 1980). Similarly several Cucurbita species, such as C. maxima, C. moschata and C. aromatica, have been shown to be taeniacidal in mice (Albert et al, 1972), in rats (Srivastava and Singh, 1967) and in man (Lozoya,1978;Plotnikov et a1,1973). Some of the plants used as traditional anthelmintics in Africa have been studied and the chemical basis of their action outlined. The alkaloids pelletierine and isopelletierine are responsible for the taeniacidal action of Punica granatum (Oliver, 1960). The main taeniacidal components of the female flowers of Hagenia abyssinica, used in Ethiopian traditional medicine, are Phloroglucinol derivatives (α-kosin, β-kosin, protokosin and kosotoxin) (de Carneri and Vita, 1973)."},{"index":7,"size":64,"text":"There are also some plants common in Nigeria whose use as anthelmintics elsewhere has been confirmed experimentally. Such plants include Tribulus terrestris whose anti-ascarid use in India was confirmed against Ascaridia galli (Chakraborty et al, 1979), as well as Anacardium occidentale, the oil of which is active against Ascaridia galli in chicken (Varghese et al, 1971) and against hookworms in dogs and man (Cavier,1973)."},{"index":8,"size":89,"text":"However, most of the plants used to treat helminthiasis in Africa have not been studied. It is important to screen local herbs in order to supplement modern drugs and to provide new chemical leads. Effective herbs may be used where modern drugs are not available, or when the herbs prove to be more effective, safer or less costly. There is also a need to establish standard dosages for herbal preparations, and to investigate their toxicity (Nwude and Ibrahim, 1980;Oliver, 1960) as traditional medicine is still very much in use."},{"index":9,"size":32,"text":"This study was designed to detect and salvage traditional anthelmintic herbs which may be used for the control of parasitic gastroenteritis in animals using Nippostrongylus braziliensis as the indicator organism in rats."}]},{"head":"Methods","index":2,"paragraphs":[{"index":1,"size":63,"text":"Information was collected from Fulani herdsmen in Zonkwa, Kurmin Biri and Abet in Kaduna State on the plants used in the control of parasitic gastroenteritis in cattle. The plants' vernacular names, parts used, method of preparation, route and frequency of administration, and any side effects resulting from their use in animals or man were also recorded. The plants used were collected and identified."},{"index":2,"size":20,"text":"Similar information was then reviewed from the literature on plants used in man and animals for the control of helminthiasis."},{"index":3,"size":27,"text":"Plants to be screened for activity against helminths were selected from the information collected on the basis of accessibility. Selected plants were collected and their identity confirmed."}]},{"head":"Plant material","index":3,"paragraphs":[{"index":1,"size":69,"text":"Selected plants were collected for extraction in the dry season (April 1982and November 1982to April 1983). As much as possible the parts used in traditional medicine were collected. Root, leaf, bark, seed and stem material were dried in locally designed and constructed wire trays. The dried material was then pounded to powder in a wooden mortar. Where the juice was used, this was done within one hour of collection."},{"index":2,"size":67,"text":"The dried, powdered material was mixed with methanol in a ratio of 1:5 w/v in large containers and allowed to stand for 48 hours at room temperature. The liquid was then decanted and filtered. The filtrate was evaporated to dryness at 40°C under low pressure using a rotary evaporator coupled to a thermoregulator. The solid extract obtained was removed and stored in bottles at 4°C until required."},{"index":3,"size":33,"text":"Leaf juices were obtained by pounding fresh samples in a mortar and then extracting the juice by straining through several layers of gauze. The juice was filtered and stored at 4°C until required."},{"index":4,"size":62,"text":"The maximum convenient concentration (MCC) of each solid extract was estimated by determining the minimum amount of water that dissolved or suspended 1.0 g of the extract such that the solution or suspension could be easily delivered through an 18 gauge needle at room temperature. A solution of the extract at the MCC was then made and stored at 4°C until required."},{"index":5,"size":98,"text":"It was assumed that the maximum concentration that could conveniently be administered orally to rats was 5 ml/kg. The highest dose that could be administered to rats (HDR) was then calculated by multiplying the maximum concentration by 5 for each extract. In the case of proprietary drugs, it was assumed that the maximum concentration was that used in the commercial preparation, and the highest dose was calculated as above. This dose was used to test the toxicity and activity of the extract. Leaf juices were used at 5 ml/kg as was water in the case of control animals."}]},{"head":"Experimental animals","index":4,"paragraphs":[{"index":1,"size":132,"text":"White rats bred in the Department of Veterinary Physiology and Pharmacology at Ahmadu Bello University and weighing 50 to 100 g were used. The animals were maintained on commercial mice cubes (Pfizer Livestock Feed Co. Ltd. Kaduna) and water. Sawdust was used as bedding and was changed every 2 days. Individuals were identified by marks on their tails and cages. Random faecal samples were collected from rats in the animal room and examined regularly for helminth ova, and the entire rat population in the animal room was dewormed by adding piperazine at 7 mg/ml/day to their drinking water for 7 days once every 2 months. Young animals were separated from adults at an early age, and all rats artificially infected were kept in a separate room to prevent contamination of the controls."}]},{"head":"Pilot toxicity studies","index":5,"paragraphs":[{"index":1,"size":126,"text":"Prior to screening, the effect of each extract following oral administration with the maximum dose (HDR) once a day for 3 consecutive days was tested. Three to five rats were used to test each extract. For each batch of rats one group of five rats was used as control and the rats were dosed orally with water at the rate of 5 ml/kg for the same duration. Animals were observed for 2 weeks after administering the test substance. Extracts producing a lethal effect at this dose were subjected to further investigation to determine the maximum tolerated dose by dose titration using 5 rats for each dose level and a log interval of 1.6. For toxic extracts, the maximum tolerated dose was used for the chemotherapeutic trials."}]},{"head":"Helminth material","index":6,"paragraphs":[{"index":1,"size":63,"text":"A rat adapted strain of Nippostrongylus braziliensis Travassos, 1914, (Nematoda: Trichostrongylidae) was used in the laboratory as the primary screen. It was maintained in the laboratory rat by bimonthly passage. Young rats were injected subcutaneously in the cervical region with 2000 infective larvae in a volume of 0.2 ml for maintenance, using an 18 gauge needle attached to an insulin syringe (Standen, 1963)."}]},{"head":"Coprocultures","index":7,"paragraphs":[{"index":1,"size":93,"text":"The droppings of rats artificially infected with N. braziliensis were collected and soaked in water for 4 hours. Excess water was then decanted, the faeces crushed in a glass mortar, transferred to plastic containers in lots of about 5.0 g and shaken with glass beads. The material was then mixed with about 1 litre of water and strained through several layers of gauze. The filtrate was transferred to jars. The supernatent solution was then discarded and the sediment mixed with vermiculite in labelled plastic petri dishes and incubated at 27°C for 7 days."},{"index":2,"size":64,"text":"The infective 3rd stage larvae (L 3 ) were recovered from 7 to 14 day old vermiculite-faecal cultures using modified Baermann apparatus. The L 3 obtained were washed several times with distilled water and their number determined by dilution counting. The volume was then adjusted to give 200 L 3 in 0.2 ml for screening, and 2000 L 3 in 0.2 ml for maintenance."}]},{"head":"Artificial infection of rats","index":8,"paragraphs":[{"index":1,"size":88,"text":"Rats were infected subcutaneously in the cervical region with 200 L 3 per 0.2 ml per rat using an 18 gauge needle attached to an insulin syringe on day 0. Fresh faecal pellets were collected from each rat by squeezing them out of the rectum into labelled plastic tubes 7 days after infection. Helminth eggs were recovered and examined qualitatively by flotation using 33% zinc sulphate at a specific gravity of 1.180. Rats not shedding Nippostrongylus ova and those shedding other helminth ova were discarded from the experiment."}]},{"head":"Chemotherapeutic trials","index":9,"paragraphs":[{"index":1,"size":73,"text":"This was done essentially as described by Cavier (1973). Trials commenced on the 10th day after experimental infestation. Five rats were used to test each extract. Animals were dosed orally on the 10th, 11th and 12th days of infection with the estimated maximum dose using an 18 gauge needle fitted with a plastic canula. For each batch of trials, five animals were dosed with water at 5 ml/kg and were used as controls."},{"index":2,"size":56,"text":"On the 14th day the animals were starved and were killed on the 15th day in a chloroform chamber. The rats were autopsied and the first 15 cm of the small intestine removed, sectioned longitudinally, enclosed between two plates of thick glass, and examined under a dissection microscope. The number of worms easily visible were counted."},{"index":3,"size":22,"text":"The screen was tested with oxfendaxole (Systamex (R), supplied by the Welcome Foundation Ltd, London, England) at the beginning of the trials."}]},{"head":"Interpretation of results","index":10,"paragraphs":[{"index":1,"size":51,"text":"Results were analysed according to .the method recommended by Cavier (1973). The percentage of deparasitization was calculated using the formula where N = average number of worms found in control animals, and n = average number of worms found in groups of treated animals. A deparasitization of 50% was considered significant."}]},{"head":"Results","index":11,"paragraphs":[{"index":1,"size":55,"text":"Information on about 300 plant species used as anthelmintics in man and his animals throughout Africa was collected. Most of the plants reported in the literature have been used against helminthiasis in man. About 30 plant species were found to be used by Fulani herders in Kaduna State for the control of helminthiasis in cattle."},{"index":2,"size":20,"text":"In the pilot toxicity studies, none of the 18,plants tested had a lethal action in rats at the doses tested."}]},{"head":"Chemotherapeutic trials","index":12,"paragraphs":[{"index":1,"size":37,"text":"The results are summarized in Table 1. Table 2 presents a summary of background information on the plants found to be effective. The leaf juice is used in Nigeria topically for the treatment of guinea-worm. (Dalziel, 1937)."}]},{"head":"Anogeissus leiocarpus","index":13,"paragraphs":[{"index":1,"size":6,"text":"Hausa: marke Igbo: atara Yoruba: ayin"},{"index":2,"size":23,"text":"The bark and seed are used in Nigeria for treatment or prevention of worm infestation in equine species. (Dalziel, 1937;Lely, 1925;Oliver, 1959;Oliver, 1960)."}]},{"head":"Annona senegalensis","index":14,"paragraphs":[{"index":1,"size":5,"text":"Hausa: gwandar dajiIgbo: uburu-ochaYoruba: abo"},{"index":2,"size":27,"text":"Leaves, bark and roots are used as vermifuge for horses in Nigeria and large quantities of the fruit are eaten in the treatment of guinea-worm. (Dalziel,1937;Oliver, 1960)."}]},{"head":"Cassia occidentalis","index":15,"paragraphs":[{"index":1,"size":7,"text":"Hausa: rai'dore Igbo: okamo Ashanti: ananse dua"},{"index":2,"size":20,"text":"The leaves are used in West Africa for the treatment of guinea-worm and as a vermifuge for children. (Dalziel, 1937)."}]},{"head":"Diospyros mespiliformis","index":16,"paragraphs":[{"index":1,"size":5,"text":"Hausa: kanya Igbo: onye-kojiYoruba: kanran"},{"index":2,"size":13,"text":"The bark is used in Nigeria as a vermifuge for horses. (Dalziel, 1937)."}]},{"head":"Terminalia avicennioides Hausa: bausheFulfulde: bo'di","index":17,"paragraphs":[{"index":1,"size":18,"text":"The leaves and roots are used to treat gastro-intestinal helminthiasis in calves in Nigeria. (Ibrahim et al, 1983b)."},{"index":2,"size":53,"text":"Six of the 18 plants tested showed significant activity against N. braziliensis in rats. Aloë barteri (leaf juice) and extracts of Terminalia avicennioides (root), Annona senegalensis (bark), Cassia occidentalis (leaf), Anogeissus leiocarpus (bark) and Diospyros mespiliformis (bark) were found to be effective, with deparasitizations of 92, 89, 75, 69, 60 and 58% respectively."},{"index":3,"size":48,"text":"The alcoholic extracts of the plants Aframomum melegueta (root), Afrormosia laxiflora (leaf), Boswellia dalzelli (bark), Calotropis procera (root), Cassia tora (leaf), Guiera senegalensis (leaf), Khaya senegalensis (bark), Lawsonia inermis (root), Tamarindus indica (root), Vitex doniana (root) and the leaf juice of Blumea aurita were found to be ineffective."},{"index":4,"size":9,"text":"Oxfendazole (Systamex (R) ) gave a deparasitization of 100%."}]},{"head":"Disscusion","index":18,"paragraphs":[{"index":1,"size":53,"text":"The results indicate that Aloë barteri, Terminalia avicennioides, Annona senegalensis, Cassia occidentalis, Anogeissus leiocarpus and Diospyros mespiliformis are effective against adultNippostrongylus braziliensis in rats at non-toxic doses. The chemotherapeutic links between N. braziliensis and trichostrongyles in sheep and between N. braziliensis and hookworms in dogs and man have been established (Whitlock, 1945;Standen, 1963)."},{"index":2,"size":13,"text":"The results therefore justify secondary screening of these plants in sheep and dogs."},{"index":3,"size":79,"text":"The results of this study do not rule out the possibility that some of the apparently inactive plants do possess activity, even against other trichostrongyles, since N. braziliensis is more resistant to anthelmintics than most other strongyloids (Standen, 1963;Cavier, 1973). For example had N. braziliensis alone been used to screen phenothiazine, the drug might not have been discovered (Gordon, 1957). It is desirable to include several representative groups or families in screening tests before discarding a compound (Standen, 1963)."},{"index":4,"size":74,"text":"These plants have not previously been tested for activity against helminths, but species of Aloë and Cassia have been used extensively as indirect irritant purgatives. In fact these were once considered as the most important drug plants of the African continent (Githens, 1948). Following oral administration, they are absorbed and metabolized, possibly in the liver, to give active anthraquinones., which are then secreted into intestine giving their observed purgative action (Brander and Pugh, 1977)."},{"index":5,"size":38,"text":"The synthetic 1:8 dihydroxyanthraquinone is highly effective against all the large bowel parasites of sheep i.e. Oesophagostomum columbianum, O. venulosum, Chabertia ovina and Trichuris spp., and to possess moderate activity against Haemonchus contortus at non-toxic doses (Gordon, 1955)."},{"index":6,"size":38,"text":"It seems possible that the anthelmintic factors in Cassia occidentalis and Aloë barteri are precursors of anthraquinones. A species related to A. barteri, A. barbadensis, has been shown to be active against plant nematodes (Mahmood et al, 1982)."},{"index":7,"size":51,"text":"Although the seeds of C. occidentalis are known to contain the heat labile toxic material chrysarobin, the roots, leaves and stems are toxic to cattle only when large amounts are consumed (Nwude, 1977), and no toxic signs were observed with the leaves at the dose tested in rats in this study."},{"index":8,"size":89,"text":"The anthelmintic factors contained in Anogeissus leiocarpus, Annona senegalensis and Terminalia avicennioides, all of which were found to be effective in this study, are unknown, but related species have been studied for action against other organisms. Annona squamosa has been shown to be active against the plant nematodes Meloidogyne incognita and Rotylenchulus reniformis by Mahmood et al (1982), while Annona senegalensis and Terminalia mollis are molluscicidal against Bulinus globosus (Adewumi and Sofowora, 1980). However, Terminalia chebula was reported to be inactive against Ascaridia galli in chickens (Sharma et al,1967)."},{"index":9,"size":104,"text":"Diospyros Mollis has been reported to be used as a traditional anthelmintic in Thailand and the berries were used in antihookworm mass chemotherapy for more than a decade until implicated as the cause of blindness in humans (Sadavongvivad, 1980). The anthelmintic principle in D. mollis is Diospyrol (1,1', 8,8'-tetrahydroxy 6-6'-dimethyl-2, 2'-binapthalene) (Sen et al, 1975). It is possible that the plant Diospyros mespiliformis, which we found to be effective, contains components similar to D. mollis. The plant is therefore recommended for detailed toxicological investigation in order to determine its effect on the eye in animals as a prerequisite to its use as an anthelmintic."},{"index":10,"size":66,"text":"Further studies are recommended with other laboratory models both for the plants found to be effective and those found to be inactive against N. braziliensis in order to determine the spectrum of activity of the former and possible action against other helminths with the latter. Different parts of the plants found to be effective should be screened and their toxicity and activity tested using secondary screens."}]},{"head":"The environment of the Ethiopian Rift Valley compared to other areas of Africa*","index":19,"paragraphs":[{"index":1,"size":2,"text":"A. Russel "}]},{"head":"Introduction","index":20,"paragraphs":[{"index":1,"size":62,"text":"ILCA's Forage Legume Agronomy Group aims to evaluate tropical forage and pasture species for potential use throughout Africa. Although the Ethiopian Rift Valley seems attractive as a location for such evaluation, because of its ease of access and range of climates and soils, it was first necessary to establish of which areas of Africa it is representative in terms of plant environments."},{"index":2,"size":118,"text":"The aim of this study was to briefly review the climates, soils and vegetation of the Rift Valley and to relate these to other areas of Africa. Clearly the conclusions reached depend in part on the level of detail at which comparisons were made. For this initial assessment broad-scale comparisons were made; more detailed studies of individual regions within the Rift Valley will have to await the availability of more data.  Since the end of the Tertiary period the Ethiopian Rift Valley has been the scene of intense volcanic activity and further minor faulting. Consequently the geological formations are almost entirely volcanic in origin and include both alkaline (basalts) and acidic (rhyolites, ignimbrites, pumices and ash) rock types."},{"index":3,"size":69,"text":"One consequence of the volcanic origin of the bedrock of the Rift Valley is the extensive and serious erosion in certain areas. This is particularly noticeable where the soils overlie ignimbrite-rock types deposited from incandescent volcanic clouds escaping from cracks in the crust, which opened after the formation of the rift. These young volcanic rocks are generally rich in base elements but in many cases are deficient in phosphorus."}]},{"head":"Climate","index":21,"paragraphs":[{"index":1,"size":7,"text":"The climate of the Ethiopian Rift Valley"}]},{"head":"Rainfall","index":22,"paragraphs":[{"index":1,"size":105,"text":"From November to February northeast winds prevail, giving settled dry weather throughout most of the valley. During this period there is little cloud, diurnal temperatures are high and relative humidities low. Between March and May more unsettled weather is experienced due to the convergence of moist southeast winds from the Indian Ocean with the northeast airstream. This brings heavy rains south of latitude 6°30' (Lake Abaya), but north of this latitude rainfall is normally light and very unreliable. From July to October the main rains come to the northern Rift Valley with the wet winds from the Indian and Atlantic oceans converging over the highlands."},{"index":2,"size":48,"text":"Intense rainfalls associated with convective thunderstorms are frequently experienced at the beginning of this period. In the southern part of the valley, however, there is little rainfall between June and August and a secondary peak in September and October. There are thus two rainfall regions within the valley."},{"index":3,"size":129,"text":"The average annual rainfall for all stations in the Rift Valley below the 1700 m altitude is 754 mm (n = 29). All such locations can be considered to be on the floor of the valley. This estimate is probably high due to the location of most stations in the highest rainfall areas. Figure 2 shows isohyets of mean annual rainfall for the Rift Valley. These suggest that a value between 600 and 700 mm annually is a reasonable average value for most of the floor of the valley. Rainfall increases with altitude along the Rift Valley escarpment to an approximate annual average of 1600 mm at the 3000 m contour. However above about 1800 m the correlation of rainfall with altitude is particularly poor due to oreographic effects."},{"index":4,"size":15,"text":"From the viewpoint of climatic classification the area of the Rift Valley includes four zones:"},{"index":5,"size":10,"text":"1. Arid zone: median annual rainfall less than 400 mm."},{"index":6,"size":11,"text":"2. Semi-arid zone: median annual rainfall between 400 and 700 mm."},{"index":7,"size":11,"text":"3. Subhumid zone: median annual rainfall between 700 and 1000 mm."},{"index":8,"size":9,"text":"4. Humid zone: median annual rainfall above 1000 mm."},{"index":9,"size":21,"text":"Approximate estimates for the overall areas of the semi-arid and subhumid zones within the Rift Valley are 35% and 55% respectively."}]},{"head":"Temperature","index":23,"paragraphs":[{"index":1,"size":109,"text":"Records for temperatures from stations in the Rift Valley are even fewer and more fragmentary than those for rainfall, and to date data have been obtained for only 13 stations. These data are summarised in Table 1. There is a reasonable correlation between temperature and altitude: on average mean annual temperatures decrease by approximately 1.55°C for every 100 m increase in altitude. The incidence of low temperatures may influence the growth of plants at altitudes above 1400 m. It is known that many tropical legumes cease to grow at temperatures between 10 and 12°C (Fitzpatrick and Nix, 1970) and that some show considerable limitation in growth at around 15°C."}]},{"head":"Length of growing season","index":24,"paragraphs":[{"index":1,"size":69,"text":"The Ethiopian Mapping Agency has recently published a length-of-growing-season map for the whole of Ethiopia on a 1:2 000 000 scale (EMA,1983). The length of growing season is calculated in days for which rainfall exceeds 50% of the potential evapotranspiration calculated from Penman's formula. Very approximate estimates can be made for the proportion of the total area of the Rift Valley with different lengths of growing season as follows:"},{"index":2,"size":4,"text":"< 60 days 10% "}]},{"head":"The climates of the Rift Valley and other areas of Africa","index":25,"paragraphs":[{"index":1,"size":22,"text":"The important climatic zones in the Rift Valley are the semi-arid zone (400-700 mm rainfall) and the subhumid zone (700-1000 mm rainfall)."},{"index":2,"size":53,"text":"Since rainfall is of overriding importance in determining plant growth, the main basis of comparison has been the annual quantity and duration of rainfall. Seasonal distribution has also been taken into account. Temperatures have been considered, but only where extreme temperatures are likely to influence the distribution of tropical or subtropical plant species."}]},{"head":"The Sahel","index":26,"paragraphs":[{"index":1,"size":101,"text":"The Sabel comprises a vast area of semiarid and arid land. The climatic limits of the region are normally taken to lie between the 600 mm rainfall isohyet in the south and the 100 mm isohyet in the north. The most obvious feature of rainfall in the Sahel is its restriction to a period in summer of 2 to 4 months, with little or no rainfall during the rest of the year. The actual duration of the growing season varies from an average of 120 days at the southern edge of the region to about 45 days in the north (FAO,1978)."},{"index":2,"size":116,"text":"The areas of the Rift Valley which are likely to be most similar to the Sahel would therefore have a mean annual rainfall between 100 and 600 mm, with a unimodal distribution centred sharply on July and August and mean annual temperatures between 27.5 and 29.0°C. The most similar area is the extreme northern part of the Rift Valley in the Middle Awash valley. It is not argued that this area represents an exact climatic homologue to anywhere in the Sahel region-indeed the seasonal distribution of rainfall is broader than for most areas of the Sahel. However it does appear more similar than other areas of the valley, a conclusion supported by the data on vegetation."}]},{"head":"The northern Sudanian savanna","index":27,"paragraphs":[{"index":1,"size":62,"text":"The Sudanian savanna is a band of tree or shrub savannas stretching across West Africa between the Sahel to the north and the zone of dense tropical forest in the south. We are concerned here only with the northern portion of the region having an annual rainfall between 650 and 1000 mm and corresponding approximately with the subhumid zone as defined above."},{"index":2,"size":18,"text":"The dry season lasts for 6 to 8 months and mean annual temperatures vary between 26.0 and 29.5°C."},{"index":3,"size":34,"text":"Although a large part of the Ethiopian Rift Valley has rainfall between 650 and 1000 mm annually, much of this area lies in the southern portion of the valley with a bimodal distribution pattern."},{"index":4,"size":87,"text":"Furthermore most of the areas with a subhumid climate lie at altitudes above 1300 m with average annual temperatures below 25°C and average minimum temperatures below 17.5°C. These areas are relatively cool compared to the northern Sudanian region of West Africa. However, much of the northern Rift Valley has mean temperatures for this period between 17.5 and 22.5°C. While these figures are 5 to 7°C lower than the corresponding values for the northern Sudanian zone, they are probably not limiting to the growth of many tropical legumes."}]},{"head":"East Africa","index":28,"paragraphs":[{"index":1,"size":45,"text":"The climate of East Africa is extremely complex. Griffiths (1972) describes 52 climatic regions for the area covering 30 different rainfall seasons. This complex pattern can be somewhat simplified by dividing the area into a part with unimodal rainfall and a part with bimodal rainfall."},{"index":2,"size":18,"text":"The region as a whole, and particularly Kenya, is also well known for the unreliability of its rainfall."},{"index":3,"size":21,"text":"Stations in the Rift Valley of Kenya, like those in the southern Rift Valley of Ethiopia, have a bimodal rainfall distribution."},{"index":4,"size":86,"text":"Although no temperature data are available for stations in Kenya, the relationship between temperature and altitude for the Kenyan Rift Valley should be similar to that for the Ethiopian Rift Valley. If this is the case there should be a reasonable similarity between areas at the same altitude in the Ethiopian and Kenyan portions of the Rift Valley. There are also other parts of the semi-arid and subhumid zones of East Africa, particularly in Tanzania, that may be climatically similar to the Rift Valley of Ethiopia."}]},{"head":"Other areas","index":29,"paragraphs":[{"index":1,"size":27,"text":"Although there are large areas of central and southern Africa that have semi-arid or subhumid climates, they differ from the Ethiopian Rift Valley in two important aspects:"},{"index":2,"size":20,"text":"1. South of approximately 7°S the rains fall between November and April, precisely the reverse of the case in Ethiopia."},{"index":3,"size":47,"text":"2. Over much of this area low temperatures are experienced, at least for short periods, during the dry months when cold air penetrates the region from the south. Consequently night frosts can be experienced at this time of the year at altitudes as low as 1000 m."}]},{"head":"Conclusions","index":30,"paragraphs":[{"index":1,"size":110,"text":"The climate of much of the Ethiopian Rift Valley can be described as cool, semi-arid or subhumid with either bimodal or unimodal rainfall distribution. Only below an altitude of about 1100 m are hot conditions found. Much of the southern Ethiopian Rift Valley is climatically similar to the Rift Valley in Kenya and, possibly to that of Tanzania. There may be more general similarities between this part of the valley and other semi-arid and subhumid parts of East Africa as a whole. In the extreme north, below 1100 m, there is an area in the Middle Awash valley which shows some climatic similarities to the Sahel region of West Africa."}]},{"head":"Soils Soils of the Ethiopian Rift Valley","index":31,"paragraphs":[{"index":1,"size":108,"text":"The information on soils was drawn from the maps in Makin et al (1975) and FAO (1965). Areas for major soil units within the southern Rift Valley were computed from King and Birchall (1975) and for the northern portion they were derived from planimetric measurements on the soils map of the Awash River basin in FAO (1965). The legend of the latter map was interpreted in terms of the approximate equivalent units in the FAO classification system. The FAO system of classification was used (and adapted) because it permits comparisons between the Rift Valley and other parts of Africa, based on the FAO/UNESCO Soil Map of Africa (1977)."}]},{"head":"Major soil types","index":32,"paragraphs":[{"index":1,"size":20,"text":"Thirteen major units and a further six subunits in the FAO/UNESCO soil classification are of importance in the Rift Valley."},{"index":2,"size":111,"text":"Table 2 shows the estimated extent of each of the major soil units within the Rift Valley and the proportion of the total area occupied by these units. For our purposes, histosols and gleysols can be ignored as being permanently flooded or waterlogged. Saline soils (solonchaks and solonetz), while used for grazing to some extent, are of sufficiently small area to be of little importance overall. The most important groupings in terms of total area covered are thus: vertisols (19.2%), cambisols (17.9%), fluvisols (16.2%), regosols (15.8%), lithosols (9.5%), andosols (7.1%) and acrisols (6.1%). All remaining soil units taken together account for less than 10% of the total area. Source: FAO (1977)."}]},{"head":"The soils of the Rift Valley and other areas of Africa","index":33,"paragraphs":[{"index":1,"size":174,"text":"The soils of the Rift Valley of Ethiopia are quite diverse. Seventeen out of 106 FAO suborders are important in the region, a reasonable proportion for a small area in African terms. However, there are certain peculiar features of the Rift Valley soils that distinguish the valley from many other areas of the continent. Firstly, the soils are for the most part derived from young rocks of volcanic origin. The result is that many of the soils are of good nutrient status since leaching has not proceeded to a very marked degree. Approximate estimates based on the figures in Table 2 would suggest that 46% of the area has soils of excellent base status, 31 % of the area has a moderate base status while only 23% of the area has soils of poor base status. Such a high proportion of `good' soils must be relatively unusual for other African regions. Overall the most frequent limitation to plant growth in the Rift Valley is likely to be availability of water rather than soil fertility."},{"index":2,"size":33,"text":"The other important feature of the soils of the area is the absence of certain major soil units (e.g. arenosols, luvisols and ferrasols) which are of widespread occurrence in other areas of Africa."},{"index":3,"size":135,"text":"The total area and proportion of sub-Saharan Africa occupied by various soil units is shown in Table 3. This reveals some interesting features of these units as regards their importance in tropical Africa as a whole. Firstly, the 17 units listed together only account for 27% of the total area of tropical Africa. Secondly, if one divides the soil units into those of `high', `medium' and `low' base status one finds that `high' base status units account for 6.6% of the total area of tropical Africa, `medium' for 7.3% and `low' for 12.9% of the total area. This is exactly the reverse order to that for the Ethiopian Rift Valley. Thirdly, 11 of the 17 soil units are proportionally better represented in the Rift Valley than in sub-Saharan Africa as a whole. Source: FAO (1977)."}]},{"head":"Vegetation Vegetation of the Ethiopian Rift Valley","index":34,"paragraphs":[{"index":1,"size":51,"text":"No complete vegetation survey exists for the Rift Valley as a whole and general descriptions are vague and concentrate almost entirely on woody vegetation. The following general description of the vegetation of the region must thus be regarded as provisional. The diversity of vegetation types in the area is however apparent."}]},{"head":"General description","index":35,"paragraphs":[{"index":1,"size":15,"text":"Makin et al (1975) divide the southern Rift Valley into the following four ecoclimatic zones:"},{"index":2,"size":20,"text":"Zone 1: Humid to dry-humid lands, now mostly under coffee or other intensive agricultural use; formerly forest or montane grassland."},{"index":3,"size":15,"text":"Zone 2: Dry subhumid or semi-arid lands characterised by evergreen shrubs, Combretum or allied vegetation."},{"index":4,"size":20,"text":"Zone 3: Semi-arid lands with relatively low or erratic rainfall, characterised by dryland acacias with some broad-leaved trees and shrubs."},{"index":5,"size":12,"text":"Zone 4: Arid lands, mostly dry thorn bushland unsuitable for rainfed agriculture."},{"index":6,"size":52,"text":"Zone 1 lies almost entirely above 1800 m altitude and therefore is not considered in this study. Zones 2 to 4 correspond in a very general way to the subhumid, semiarid and arid climatic zones defined above, but the exact limits of each zone in tenors of rainfall are not clearly defined."},{"index":7,"size":81,"text":"Table 4 shows the approximate area and proportion of the southern Rift Valley occupied by each ecoclimatic zone and also the relationship of these zones to those defined by Pratt et al (1966) for East Africa. The grass cover is discontinuous, with up to 60% bare ground in very dry or heavily grazed areas. In all areas other than those that are seasonally waterlogged or saline, Chrysopogon plumulosus is the dominant grass accounting for up to 65% of the herbaceous cover."},{"index":8,"size":13,"text":"Ephemeral annual grasses are abundant, particularly species of the genera Aristida and Eragrostis."}]},{"head":"Vegetation of the Rift Valley and other areas of Africa","index":36,"paragraphs":[]},{"head":"Phytogeographic relationships","index":37,"paragraphs":[{"index":1,"size":144,"text":"According to Ibrahim (1978), Ethiopia lies within the Sudano-Zambezian phytogeographic region of Africa which comprises the largest formation of the continent and can be characterised as tropical, with an annual dry season of 4 to 9 months, annual rainfall between 300 and 1500 mm and vegetation which includes steppe, savanna and dry to subhumid woodland and forest. More specifically it comes within the Sudanian subregion with a dry tropical climate and rainfall up to 1000 mm. The highlands of Ethiopia are, of course, excluded, forming part of the Afro-montane region. At a third level of organisation Ibrahim includes Ethiopia in the Afro-Oriental domain which covers the lowlands of Tanzania, Kenya, Somalia and Ethiopia. Vegetation ranges from steppe to thorn woodland. Ibrahim sets an attitudinal limit of 1100 m for this domain but it probably extends considerably higher than this in the Ethiopian Rift Valley."},{"index":2,"size":62,"text":"In plant geographic terms the lowlands of Ethiopia belong with the rest of East Africa, with most of Uganda excluded. However, they have more general connections throughout the Sudano-Zambezian region. In particular White (1965) suggests that the Sahel region, which can be characterised as wooded steppe with Acacia and Commiphora spp., represents a floristically impoverished western extension of the rich Afro-Oriental domain."},{"index":3,"size":72,"text":"Of the tree species found in the Ethiopian Rift Valley, Acacia nilotica, A. seyal, A. senegal, and A. sieberiana occur throughout much of the Sudanian subregion, including the Sahel, while A. nubicaand A. mellifera have an Afro-Oriental and eastern Sudanian distribution. The grass Schoenfeldia gracilis is a more strictly Sahelian species but is also known from the lowlands of Ethiopia (Froman and Persson, 1974). Other important grass species from the  (Wickens, 1976)."},{"index":4,"size":78,"text":"Application of Hartley's agrostological index Hartley (1963) has devised a technique for comparing grass floras on the basis of the proportion of different tribes of grasses in the flora of a given area. Using a previous analysis of the climatic relationships of some of the more important tribes of tropical grasses, he was able to show that the proportions of these tribes within the flora of a given area provided a reasonable indication of the prevailing environmental conditions."},{"index":5,"size":73,"text":"The first step in using this analysis to compare Ethiopian and other grass floras was to try to quantify the relationship between the proportion of different grass tribes in the floras considered with climatic factors. This was possible for annual rainfall even though in some cases the figures used were taken from rather vague references or, in the cases of some of the larger areas, were the mean figure from a wide range."},{"index":6,"size":303,"text":"Figures 3 and 4 show the relationship between mean annual rainfall and the proportion of different grass tribes in the floras of 15 localities in West Africa, Sudan and Ethiopia. It can be seen that there is a good positive correlation (r = 0.88) between annual rainfall and percent Andropogoneae in a grass flora, while Aristideae show a good negative correlation (r = -0.81) with rainfall. The proportion of Eragrostideae is negatively correlated with rainfall but the correlation is poor (r = -0.64), while the proportion of Paniceae does not appear to be correlated with rainfall at all. It should be noted that the majority of observations were from the semi-arid and arid zones and that the relationships determined here do not necessarily extend to wetter climatic zones.   The data on tribal composition of the 20 grass floras considered in this study are shown in Table 5. Only the proportion of the larger tribes is included, together with annual rainfall (where known) and the approximate latitude for each site. The method used in classifying these grass floras was cluster analysis. In this method clusters of observations are formed based on the Euclidean distance (i.e. the square root of the sum of squares of differences between values of observations for two sites). The Euclidean distance between 2 sets of clusters (j and 1) is:  Initially each site is considered to be in a cluster of its own. At each step the two clusters with the shortest Euclidean distance between them are amalgamated and treated as one cluster. This process of combining clusters continues until all sites are combined into one cluster. This algorithm is known as the average distance or average linkage. A tree diagram of the clusters is then constructed to describe the sequence of clusters formed. This is shown in Figure 5. "}]},{"head":"Comparison by shared species","index":38,"paragraphs":[{"index":1,"size":31,"text":"A second method of comparing vegetation of different areas is to use shared species to group related, areas. For this purpose a very simple index, Soroensen's quotient of similarity, was adopted:"},{"index":2,"size":27,"text":"where j = species shared between two areas; a = total number of species in area a; and b = total number of species in area b."},{"index":3,"size":71,"text":"In this index, shared species are weighted by a factor of 2 to stress their importance. When the quotient is calculated for all combinations of the areas considered, they can be arranged in the form of a Trellis diagram where individual sites are ranked in an order that brings together those with close quotients of similarity. The areas can then be divided on a subjective basis into `communities' with similar indices."},{"index":4,"size":58,"text":"Because computation of shared species by hand is highly time-consuming, only 12 of the 20 sites listed in Table 5 have been included in the analysis. These have been selected to include the full range of geographic locations and of annual rainfall covered by all the sites. They also include all three locations from the Ethiopian Rift Valley."},{"index":5,"size":151,"text":"The Trellis diagram for the sites analysed is shown in Figure 6. The shading in the upper quadrant has been added to assist interpretation and shows values for the index between 0.00 and 0.20, 0.21 and 0.40, 0.41 and 0.60 respectively. Firstly, the values are generally low with only 4 out of 66 exceeding 0.40. Secondly, it is clear that there is a group of West African sites (Gallayel, Niono; Sud-Tamesna and Leo) with a high proportion of shared species. The two types of analysis of the grass floras carried out here clearly provide different types of information concerning the similarity ,of the areas studied. Hartley's agrostological index tells us about the general environmental conditions, and more particularly about the degree of aridity or otherwise of an area. Analyses based on shared species provide information on present-day pathways of dispersal of species and on the phytogeographic history of the areas concerned."}]},{"head":"Conclusions","index":39,"paragraphs":[{"index":1,"size":150,"text":"Climatically much of the Ethiopian Rift Valley is very similar to the Rift Valley of Kenya, and possibly to parts of Tanzania. However the region is clearly diverse, with climates ranging from hot and arid to cool (subtropical) and humid. Both temperatures and rainfall vary with altitudes, although in the latter case the relationship is only approximate due to oreographic effects. While frosts are probably of little importance within the Rift Valley as defined above, it is concluded that low temperatures may well affect the growth and distribution of tropical legumes at altitudes above 1400 m. In the extreme north of the Rift Valley there is an area of hot, lowlying country with unimodal rainfall centred on July and August, which has some similarities to the climate of the Sahel region of West Africa. The climatic comparisons have been limited by lack of suitable data for other areas of Africa."},{"index":2,"size":157,"text":"The soils of the Rift Valley, mainly derived from young volcanic rocks, are generally of good base status. In this they differ markedly from soils of many other areas of Africa, where a combination of poor parent materials and intensive weathering has produced soils impoverished in mineral nutrients. Constraints to forage or crop production in the Rift Valley relate to the low phosphorus status of many soils, micronutrient imbalances and, in the case of vertisols and saline soils, difficult physical conditions. It is possible that for the purposes of screening forage species in the Rift Valley, soil types (e.g. acrisols and nitosols) of low fertility can be located that have a range of constraints for plant growth similar to the highly weathered arenosols and luvisols characteristic of many other parts of Africa. The importance attached to locating such impoverished soils will depend on the relative weight given to screening for climatic or edaphic adaptation of forage species."},{"index":3,"size":99,"text":"In phytogeographic terms the Rift Valley belongs to the Sudano-Zambezian region of Africa, with rainfall between 300 and 1500 mm annually and 4 to 9 months of annual dry season. In areas with annual rainfall between 300 and 700 mm the dominant woody species are acacias, but above 700 mm broad-leaned trees and shrubs are dominant. Many of the common acacia species are very widely distributed and are also dominant in the Sahelian domain of West Africa which is extremely similar, in physiognomic terms, to many areas of the Rift Valley of East Africa and Ethiopia, although floristically impoverished."},{"index":4,"size":47,"text":"The use of Hartley's agrostological index also suggests that there is a clear relationship between some of the lower-lying areas of the Ethiopian Rift Valley and the Sahel region of West Africa, while the areas at higher altitudes appear more similar to other areas in East Africa."},{"index":5,"size":82,"text":"The other method of floristic comparison used here, based on the proportion of shared species in different grass floras, is probably of less value for establishing agronomically similar areas. It is probably influenced by historical factors in the evolution of the floras concerned, and certainly by the ease of dispersal of species between different areas. Many of the shared species between two or more sites will have either pantropical or palaeotropical distribution patterns which contribute little relative information about the areas concerned."},{"index":6,"size":79,"text":"Attempting to use soils as a means of comparing areas has many drawbacks. Soils are normally of secondary importance to climate (in particular rainfall) in determining where plant species will grow. Also the soil units used for mapping purposes often do not reflect the problems faced by the plant in growing in those soil types. Many of the major soil, units are of such widespread distribution that they are of little use for the purposes of classifying different areas."},{"index":7,"size":72,"text":"The use of climatic information for comparing different areas avoids many of these drawbacks and has been tried with some success in the past (e.g. Russell and Moore, 1970). However Williams and Burt (1982) highlight two difficulties with this approach. The first is the theoretical one that plants respond to more than just climate. The second is the difficulty in obtaining reliable and comparable climatic data for many areas in the tropics."},{"index":8,"size":59,"text":"On theoretical grounds plants themselves should act as the best indicators of all the factors that influence their ability to survive in a particular area. For the grass floras examined in this study there does seem to be a reasonable correlation between the proportion of certain families and rainfall at least in the semi-arid and subhumid areas of Africa."},{"index":9,"size":103,"text":"In screening forage species, the range of adaptability of species already in use, especially those in commercial production, is of particular importance. In Table 6 the adaptability of some of the important tropical genera is shown with respect to water stress, temperature stress and poor soils. The widest range of adaptability is shown by Acacia spp. This genus of some 800 species of trees and shrubs has worldwide distribution and in Africa alone is found at altitudes from sea level to almost 3000 m and on a wide variety of soils. The much smaller genus Macroptilium also has reasonable adaptability to these conditions."},{"index":10,"size":18,"text":"Adaptation to temperature stress, particularly low temperatures, appears more widespread than adaptation to water stress amongst these genera."}]}],"figures":[{"text":" The limits of the Rift Valley for the purposes of this study are shown in Figure1. The limits of the study area along the escarpments of the valley correspond to the 1800 m contour. Above this altitude the vegetation is quite different from the semiarid steppe and savanna woodland communities of the Rift Valley floor, and below 1800 m frosts are of infrequent occurrence and of negligible importance in determining the nature of the vegetation. "},{"text":"Figure 1 . Figure 1. Map of the Ethiopian Rift Valley showing units of the study area and 1000 m and 1800 m contours. "},{"text":"Figure 2 . Figure 2. Isohyets of mean annual rainfall in the Ethiopian Rift Valley. "},{"text":"Figure 3 . Figure 3. Relationship between rainfall and proportion of (A) Andropogoneae and (B) Aristideae in different grass floras. "},{"text":"Figure 4 . Figure 4. Relationship between rainfall and proportion of (A) Eragrostideae and (B) Paniceae in different grass floras "},{"text":"Figure 5 . Figure 5. Dendrogram derived from cluster analysis of sites listed in Table5. "},{"text":"Figure 6 . Figure 6. Trellis diagram showing relationships between 12 grass floras from Africa using Soroensen's index of similarity to group floras according to shared species. "},{"text":"Table 1 . Summary of screening of plants against N. braziliensis in rats. Plant or reagent Part used Dose (g/kg) % deparasitization Activity Plant or reagentPart usedDose (g/kg) % deparasitization Activity 1. Acacia albida bark 20.0 34 inactive 1. Acacia albidabark20.034inactive 2. Aframomum melegueta root 10.0 22 inactive 2. Aframomum meleguetaroot10.022inactive 3. Afromosia laxiflora leaf 20.0 23 inactive 3. Afromosia laxifloraleaf20.023inactive 4. Aloë barteri leaf juice 5.0 (ml/kg) 92 very active 4. Aloë barterileaf juice5.0 (ml/kg)92very active 5. Anogeissus leiocarpus bark 20.0 60 active 5. Anogeissus leiocarpusbark20.060active 6. Annona senegalensis bark 20.0 75 active 6. Annona senegalensisbark20.075active 7. Blumea aurita leaf juice 5.0 (ml/kg) 1 inactive 7. Blumea auritaleaf juice5.0 (ml/kg)1inactive 8. Boswellia dalzelii bark 25.0 38 inactive 8. Boswellia dalzeliibark25.038inactive 9. Calotropis frocera root 5.0 7 inactive 9. Calotropis froceraroot5.07inactive 10. Cassia occidentalis leaf 12.5 69 active 10. Cassia occidentalisleaf12.569active 11. C. tora leaf 20.0 -8 inactive 11. C. toraleaf20.0-8inactive 12. Diospyros mespiliformis bark 20.0 58 active 12. Diospyros mespiliformisbark20.058active 13. Guiera senegalensis leaf 5.0 -4 inactive 13. Guiera senegalensisleaf5.0-4inactive 14. Khaya senegalensis bark 5.0 -21 inactive 14. Khaya senegalensisbark5.0-21inactive 15. Lawsonia inermis root 5.0 -16 inactive 15. Lawsonia inermisroot5.0-16inactive 16. Tamarindus indica root 5.0 -23 inactive 16. Tamarindus indicaroot5.0-23inactive 17. Terminalia avicennioides root 2.5 89 very active 17. Terminalia avicennioidesroot2.589very active 18. Vitex doniana root 10.0 14 inactive 18. Vitex donianaroot10.014inactive 19. Oxfendazole (Systamex (R) )  0.11 100 very active 19. Oxfendazole (Systamex (R) )0.11100very active  "},{"text":"Table 2 . Traditional uses of plants with anthelmintic activity. Plant Vernacular names Comments PlantVernacular namesComments 1. Aloë barteri Hausa: zabuwa  1. Aloë barteriHausa: zabuwa  "},{"text":"Table 1 . Mean annual temperatures for some stations in the Rift Valley.Highest monthly temperatures are normally recorded in the dry season between November and March. Lowest monthly minimum temperatures are also recorded during the dry season when night skies are clear. Station Altitude (m) No. of years Ann. mean (Min.°C) Ann. mean (Max.°C) Ann. mean (°C) StationAltitude (m)No. of yearsAnn. mean (Min.°C)Ann. mean (Max.°C)Ann. mean (°C) Asela 1700 10 12.7 28.4 20.6 Asela17001012.728.420.6 Alaba Colito 1800 10 11.5 26.4 18.9 Alaba Colito18001011.526.418.9 Awassa 1680 12 11.5 26.8 19.1 Awassa16801211.526.819.1 Bekewle (Conso) 1380 6 16.9 27.3 22.1 Bekewle (Conso)1380616.927.322.1 Gato 1320 3 18.6 31.1 24.9 Gato1320318.631.124.9 Mega 1700 6 14.2 23.1 18.6 Mega1700614.223.118.6 Melka Guba not known 3 18.6 32.0 25.3 Melka Gubanot known318.632.025.3 Miereb Abaya 1290 4 17.1 31.2 24.1 Miereb Abaya1290417.131.224.1 Moyale 1200 2 19.1 29.8 24.5 Moyale1200219.129.824.5 Neghelli 1480 20 12.7 25.7 19.2 Neghelli14802012.725.719.2 Tertele 1460 2 16.9 26.9 21.9 Tertele1460216.926.921.9 Wondo Chabicha 1800 11 11.3 26.3 18.9 Wondo Chabicha18001111.326.318.9 Yavello 1740 13 13.1 25.2 19.1 Yavello17401313.125.219.1  "},{"text":" It is remarkable that, according to these estimates, over 50% of the area of the valley has a growing season in excess of 150 days. The shortest growing seasons (60 days) are found at the northern and southern extremities of the valley. The longest growing seasons (over 210 days) are found around the lakes Abaya and Chamo where the eastern and western escarpments of the Rift Valley most closely approach one another. 60-75 days 5% 60-75 days 5% 75-90 days 5% 75-90 days 5% 90-120 days 10% 90-120 days 10% 120-150 days 15% 120-150 days 15% 150-80 days 25% 150-80 days 25% 180-210 days 20% 180-210 days 20% 210-240 days 10% 210-240 days 10%  "},{"text":"Table 2 . Estimated extent of FAO soil units within the Ethiopian Rift Valley and the proportion of the whole area covered by each unit. FAO soil unit Total area (km 2 ) % of whole area FAO soil unitTotal area (km 2 )% of whole area Ferric acrisols 3 367 6.1 Ferric acrisols3 3676.1 Chromic cambisols 3 671 6.7 Chromic cambisols3 6716.7 Eutric cambisols 6166 11.2 Eutric cambisols616611.2 Eutric fluvisols 8 529 15.2 Eutric fluvisols8 52915.2 Calcaricfluvisols 391 0.7 Calcaricfluvisols3910.7 Histosols 200 0.4 Histosols2000.4 Eutric gleysols 262 0.5 Eutric gleysols2620.5 Eutric nitosols 436 0.8 Eutric nitosols4360.8 Vitric andosols 3 888 7.1 Vitric andosols3 8887.1 Pellic vertisols 6 229 11.3 Pellic vertisols6 22911.3 Chromic vertisols 4 330 7.9 Chromic vertisols4 3307.9 Eutric regosols 8 669 15.8 Eutric regosols8 66915.8 Lithosols 5 210 9.5 Lithosols5 2109.5 Luvic xerosols 1780 3.2 Luvic xerosols17803.2 Haplic xerosols 940 1.7 Haplic xerosols9401.7 Orthic solonchaks 647 1.2 Orthic solonchaks6471.2 Orthic solonetz 253 0.4 Orthic solonetz2530.4 Total 54 968  Total54 968  "},{"text":"Table 3 . Total area in km' and proportion of sub-Saharan Africa occupied by some soil units of importance in the Rift Valley of Ethiopia. FAO soil unit Total area (km 2 ) % of sub-Saharan FAO soil unitTotal area (km 2 )% of sub-Saharan   Africa Africa Ferric acrisols 589 290 2.7 Ferric acrisols589 2902.7 Chromic cambisols 226 370 1.0 Chromic cambisols226 3701.0 Eutric cambisols 245 920 1.1 Eutric cambisols245 9201.1 Eutric fluvisols 332 270 1.5 Eutric fluvisols332 2701.5 Calcaric fluvisols 85 790 0.4 Calcaric fluvisols85 7900.4 Histosols 17 450 0.08 Histosols17 4500.08 Eutric gleysols 237 380 1.1 Eutric gleysols237 3801.1 Eutric nitosols 404 290 1.9 Eutric nitosols404 2901.9 Vitric andosols 1 440 0.006 Vitric andosols1 4400.006 Pellic vertisols 344 810 1.6 Pellic vertisols344 8101.6 Chromic vertisols 597 080 2.8 Chromic vertisols597 0802.8 Eutric regosols 524 590 2.4 Eutric regosols524 5902.4 Lithosols 1 646 310 7.6 Lithosols1 646 3107.6 Luvic xerosols 17 630 0.08 Luvic xerosols17 6300.08 Haplic xerosols 398 330 1.8 Haplic xerosols398 3301.8 Orthic solonchaks 72 950 0.3 Orthic solonchaks72 9500.3 Orthic solonetz 93 190 0.4 Orthic solonetz93 1900.4  "},{"text":"Table 4 . Areas for the major ecoclimatic zones of the southern Rift Valley and corresponding zones inPratt et al (1966)'s classification.Zone 2 or the subhumid zone has a tree cover characterised by the presence of broadleaved Combretum and Terminalia species. Important species include Acacia hockii,A.  abyssinica, Albizia gummifera, A. schimperiana, Combretum aculeatum, C. molle, Croton  macrostachyus, Cordia abyssinica, Erythrina abyssinica, Ficus sycamores, Heeria reticulata,  Terminalia brownii, T. schweinfurthii  and Vernonia abyssinica. At lower altitudes (1300 to 1500 m) evergreen thicket is common and is dominated by Carissa edulis, Dodonaea viscosa, Euclea schimperi, Rhus natalensisand Olea africana. The dominant grasses include Eragrostis superba, Heteropogon contortus, Hyparrhenia hirta, H. rufa, Themeda triandra and Andropogon spp. Zone 3 or the semi-arid zone is characterised by the presence of acacias as the dominant species of the tree and shrub layers. Physiognomically there are vegetation types ranging from closed acacia woodland to scattered and open acacia bushland. The most common Acacia species are A. brevispica, A. mellifera, A. nilotica, A. nubica, A. reficiens, A. seyal and A. tortilis. They are accompanied by many broad-leaved trees and semi-evergreen shrubs such as Acokanthera brownii, Balanites aegyptium, Cadaba farinosa, Capparis tomentosa, Commiphora africana, Croton macrostachyus, Dichrostachys cinerea, Euphorbia tirucalli, E. candelabra, Harrisonia abyssinica, Sclerocaryea birrea and Terminalia brownii. Dominant grasses include Aristida kenyensis, Chloris pycnothrix, Hyparrhenia anthistirioides, Panicum atrosanguineum and Pennisetum schimperi. Zone 4 or the arid zone, with less than 450 mm annual rainfall, is characterised by dry thorn bnshland. The common shrub species include Acacia etbaica, A. horrida, A. mellifera, A. nilotica, A. nubica, A. reficiens, A. senegal, A. seyal, and A. tortilis. Trees and shrubs commonly associated with these include Boscia coriacea, Cadaba farinosa, C. rotundifolia, Commiphora spp., Dobera glabra, Grewia spp., Sansevieria ehrenbergii, Salvadora persica and Sterculia africana. Eco-climatic Total area % Pratt a zonal equivalent Eco-climaticTotal area%Pratt a zonal equivalent zone (km 2 )   zone(km 2 ) 2 11 200 34 III 211 20034III 3 13 760 41 IV 313 76041IV 4 8 220 25 V & VI 48 22025V & VI  "},{"text":" Ethiopian Rift Valley which have a general Sudano-Zambezian distribution pattern include, Andropogon gayanus, Aristida spp., Bothriochloa insculpta, Cenchrus ciliaris, Chloris gayana, C. pycnothrix, Cymbopogon giganteus, Eragrostis cylindrifiora, Hyparrhenia filipendula, H. rufa, Imperata cylindrica, Panicum maximum, Pennisetum ramosum, Setarui sphacelata, Sporobolus pyramidalis and many others  "},{"text":"Table 5 . Proportion of major tribes in the grass floras of 20 African locations together with rainfall and latitude (where known).  "},{"text":"Table 6 . Adaptability a of some genera of tropical forage legumes in commercial use to water stress, heat stress and poor soil. Genus Water stress Thermal stress Poor soils GenusWater stressThermal stressPoor soils Stylosanthes +++ + +++ Stylosanthes+++++++ Gentrosena - - ++ Gentrosena--++ Desmodiurm - + ++ Desmodiurm-+++ Macroptilium ++ ++ +++ Macroptilium+++++++ Neonotonia + ++ - Neonotonia+++- Lotononis - +++ ++ Lotononis-+++++ Leucaena ++ + ++ Leucaena+++++ Acacia +++ +++ +++ Acacia+++++++++ Sources: Humphreys (1980), Skerman (1977) and Summerfield and Bunting (1978). Sources: Humphreys (1980), Skerman (1977) and Summerfield and Bunting (1978). a -low adaptability    a -low adaptability + moderate adaptability    + moderate adaptability ++ good adaptability    ++ good adaptability +++ very good adaptability    +++ very good adaptability  "}],"sieverID":"06cad087-e5fe-4d4f-b0bd-a23fccc6abf5","abstract":"EIGHTEEN plants traditionally used for the treatment of human and animal helminthiasis in Africa were screened for anthelmintic activity using the Nippostrongylus-rat model. Aloë barteri, Terminalia avicennioides, Annona senegalensis, Cassia occidentalis, Anogeissus leiocarpus and Diospyros mespiliformis showed significant activity, giving deparasitizations of 92, 89, 75, 69, 60  and 58% respectively compared to untreated controls.Three major vegetation zones are found in the Rift Valley: the subhumid zone, the semi-arid zone and the arid zone.The grass floras from 20 areas in West and East Africa, including three from the Ethiopian Rift Valley, were compared using Hartley's agrostological index. Classification based on cluster analysis of these sites showed that the semi-arid and arid areas at the northern and southern ends of the Rift Valley were closest to areas in the Sahel region of West Africa, while an area at a higher altitude in the central Rift Valley was close to an area in the Rift Valley of Kenya and to two sites in Sudan."}

data/part_1/0889c906ff784497d4fe1ddc46329542.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0889c906ff784497d4fe1ddc46329542","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/72c00564-a67a-48b8-8342-5b0d1773867d/retrieve"},"pageCount":1,"title":"","keywords":[],"chapters":[{"head":"The People and Organizational Development Directorate (P&OD)","index":1,"paragraphs":[{"index":1,"size":27,"text":"The vision of the P&OD directorate is to position ILRI as the leading livestock research institute and as an employer of choice in the global labour market."},{"index":2,"size":34,"text":"The objectives of the directorate are based on the recognition that the capability and engagement of ILRI's staff are central to the institute achieving its vision, mission and strategy through its critical success factors."},{"index":3,"size":5,"text":"better lives through livestock ilri.org"}]},{"head":"P&OD's objectives","index":2,"paragraphs":[]},{"head":"","index":3,"paragraphs":[{"index":1,"size":16,"text":"To attract, retain and develop competent scientific and support talent by nurturing high performance and innovation."}]},{"head":"","index":4,"paragraphs":[{"index":1,"size":24,"text":"To create an enabling environment -a great place to work -within a culture that is driven by our values of respect, responsiveness and responsibility."}]},{"head":"","index":5,"paragraphs":[{"index":1,"size":10,"text":"To attain and deliver on operational excellence in service delivery. "}]}],"figures":[],"sieverID":"d566b04e-94c7-4490-a38d-254f3f9d6337","abstract":""}

data/part_1/08986193934aa50a4a8076c9cda16e81.json

@@ -0,0 +1 @@
+{"metadata":{"id":"08986193934aa50a4a8076c9cda16e81","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/50a0811a-9225-415d-8f22-ebd3cfa9bffa/retrieve"},"pageCount":2,"title":"","keywords":[],"chapters":[{"head":"Inspire Challenge Award: Real-time diagnostics for devastating wheat rust","index":1,"paragraphs":[{"index":1,"size":86,"text":"Project Title: P1545 -Inspire Challenge Module 3 Description of the innovation: Wheat yellow rust, caused by Puccinia striiformis f. sp. tritici (PST), is currently considered the most damaging wheat disease globally, with yield losses sometimes higher than 60%. This project aims to develop and mainstream an affordable, mobile in-field pathogenomics platform called MARPLE (Mobile And Real-time PLant disEase) to revolutionize crop pathogen surveillance and diagnostics in real time. It will rely on the MinION mobile genome sequencer platform and assess its deployment in situ in Ethiopia. "}]},{"head":"New Innovation: No","index":2,"paragraphs":[]}],"figures":[{"text":" Innovation type: Production systems and Management practicesStage of innovation: Stage 2: successful piloting (PIL -end of piloting phase) Demonstrated that a small gene sequencing device could be used in the field to identify a strain of wheat rust within 48 hours, dramatically reducing the response cycle time. The pilot demonstrated the first-ever accurate identification of individual yellow rust strains just as the disease emerged in the field.Name of lead organization/entity to take innovation to this stage: <Not Defined>Names of top five contributing organizations/entities to this stage: • https://tinyurl.com/y299pxxc 1 This report was generated on 2022-08-19 at 08:29 (GMT+0) "}],"sieverID":"36b94dc5-f7f5-42bc-b05a-36a8851989c1","abstract":""}

data/part_1/09048b3115e7349f957f550f666262fe.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09048b3115e7349f957f550f666262fe","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3779900d-e292-4738-bcd0-25776aa1b1fc/retrieve"},"pageCount":21,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":102,"text":"It works to strengthen civil society organizations (CSOs) in Kenya, Rwanda, Burkina Faso, Ghana, Honduras and Indonesia in their role as advocates and lobbyists. CSOs represent the interests of crucial groups such as pastoralists, female entrepreneurs and smallholder farmers. Together with the International Food Policy Research institute, Washington, it aims to support these organizations to foster collaboration among relevant stakeholders, influence agenda-setting and hold the government and private sector accountable for their promises and actions. We will tackle four issues -food and nutrition security, resilience, renewable energy, and water, sanitation and hygiene (WASH) -by also addressing gender balance and climate change mitigation."},{"index":2,"size":40,"text":"The \"MoreMilk\" project is led by ILRI and funded by the Bill and Melinda Gates Foundation with co-funding from the CGIAR Research Program Agriculture for Nutrition and Health (led by IFPRI) and the CGIAR Research Program Livestock (led by ILRI)."},{"index":3,"size":149,"text":"The overall objective of the project is to improve child health and nutrition through milk consumption. It will evaluate the potential of milk markets and milk development interventions to contribute to health and nutrition outcomes. It will do this by a) assessing how markets and policies influence the quantity and safety of milk consumed in urban settings; b) assessing the health and nutrition benefits of a successfully piloted informal dairy sector intervention (trader-intervention), through a randomized control trial (RCT) in Nairobi; c) assessing the potential reach of the trader-intervention as well as bridges and barriers to scale and sustainability through surveys in Kenya, Assam (India) and Tanzania; d) assessing the drivers of milk consumption in urban and rural Kenya and Tanzania and developing a Social Behaviour Change Communication strategy for milk consumption; e) scoping priority areas for food safety investments with a focus on Ethiopia, Nigeria and Burkina Faso. "}]},{"head":"Food safety in low and middle income countries: Delia Grace","index":2,"paragraphs":[]}],"figures":[{"text":" Contents Background ............................................................................................................................................................. Training summary ................................................................................................................................................... Agenda .................................................................................................................................................................... Training material .................................................................................................................................................... Feedback from participants .................................................................................................................................. List of participants ................................................................................................................................................ 1 Background This training was organised by the \"Voice for Change Partnership\" and \"MoreMilk\" projects. The 'Voice for Change Partnership' (V4CP) programme is led by SNV Netherlands Development Organisation and implemented in partnership with the International Food Policy Research Institute (IFPRI). It is funded by the Dutch Ministry of Foreign Affairs. "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "}],"sieverID":"62c57cb5-f6bb-4482-b43f-e9a822dcc73b","abstract":"Fair dealing and other rights are in no way affected by the above. The parts used must not misrepresent the meaning of the publication. ILRI would appreciate being sent a copy of any materials in which text, photos etc. have been used."}

data/part_1/09235c656a39e89c8d4dadfa678681fd.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09235c656a39e89c8d4dadfa678681fd","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/465c3ccd-67ac-46b8-a6c2-95073ea53b1d/retrieve"},"pageCount":40,"title":"Promoting Nutritious Food Systems in the Pacific Islands","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[]},{"head":"Building the evidence base","index":2,"paragraphs":[{"index":1,"size":69,"text":"The CTA/IFAD/PIPSO Project 'Promoting Nutritious Food Systems in the Pacific' The CTA/IFAD/PIPSO Promoting Nutritious Food Systems in the Pacific Islands -Fiji National Roundtable Workshop took place on 28 and 29 June 2017 at the Tanoa Plaza Hotel in Suva, Fiji. Sixty-three participants representing government ministries, private sector, civil society, academia and regional/development organisations attended the two-day workshop. The agenda and list of participants are attached (Annex 1 and 2)."}]},{"head":"KEY MESSAGES FROM THE WORKSHOP ARE:","index":3,"paragraphs":[{"index":1,"size":26,"text":"• Double burden of malnutrition, lack of infrastructure, low economic purchasing power and high availability of cheap imported convenience products negatively affect the health of Fijians."},{"index":2,"size":20,"text":"• Insufficient production capacity (inconsistency, low quality and quantity) makes local nutritious food (fish, fruits and vegetables) unaffordable and uncompetitive."},{"index":3,"size":17,"text":"• Inconsistent agricultural supply (quality and quantity) hinders growth in domestic (agribusiness and tourism) and exports markets."},{"index":4,"size":14,"text":"• The agriculture, nutrition and demographic transitions put additional pressure on the agri-food system."},{"index":5,"size":24,"text":"• Women are custodians of fisheries and agricultural knowledge, but they do not have enough decision-making power and face many barriers to business opportunities."},{"index":6,"size":18,"text":"• Fiji farmers, fisher folk and agribusinesses/SMEs are not well networked and are not engaged in cooperative enterprises."},{"index":7,"size":38,"text":"• Training for farmers, fisher folk and agribusinesses/SMEs (with an emphasis on women and youth) on value chain development, financial literacy and management, food safety, post-harvest handling, farming techniques, nutritional analysis etc. is required for value chain development."},{"index":8,"size":18,"text":"• Multiple policies and frameworks that are not coherent with national development goals inhibit social and economic development."}]},{"head":"KEY RECOMMENDATIONS ARE:","index":4,"paragraphs":[{"index":1,"size":30,"text":"1. Set a high-level inter-connected socio-economic policy agenda using a multi-sectoral-coordinated approach (partnerships and shared responsibilities) for addressing agriculture, nutrition and agribusiness and for tackling non-communicable diseases (NCDs) in Fiji."},{"index":2,"size":18,"text":"2. Establish stronger public-sector collaboration and relationship with academia and private sector for evidence-based policy and strategic planning."},{"index":3,"size":24,"text":"3. Organise networks/collectives of farmers, fishers, SME (agribusiness) to leverage support and address value chain challenges and consider clustering as a means to collaborate."},{"index":4,"size":32,"text":"4. Develop cohesive programmes and joint public-private financing platforms to increase availability of training and financing services for value chain development (farmers, fishers, SME agribusiness with a focus on women and youth)."},{"index":5,"size":146,"text":"The workshop was officially opened by Christoph Wagner, Head of Cooperation, European Delegation (EU) for the Pacific. In his opening address, he reflected on the challenges the Pacific is facing in producing a sufficient quantity of high-quality agricultural produce for national and international markets, due to the small scale of production, inconsistent supply, high transport costs, capacity constraints and regulatory hurdles. However, more and more actors are willing to tackle these challenges and make use of the existing opportunities. The EU is proud to promote nutritious food systems in the Pacific, which will have positive economic, social and health effects for the people in the region. Therefore, the EU will continue to collaborate with the private sector and other key stakeholders to upgrade local food crops and fisheries value chains. The EU values the work the Technical Centre for Agricultural and Rural Cooperation (CTA) is doing."},{"index":6,"size":119,"text":"The Regional Coordinator for the International Fund for Agricultural Development (IFAD), Sakiusa Tubuna, noted that the agricultural sector can play a critical role in stemming the increasing rate of NCDs in Fiji. Even though agriculture has contributed to increased food production and supply, and economic development, little improvement in nutrition outcomes has been observed. Further, IFAD views that the CTA/IFAD/PIPSO project is an opportunity to mainstream nutrition outcomes into the agricultural sector by developing innovative approaches and strategies that can increase people's access to nutritious and healthy foods. This is to be done through working with smallholder farmers to take advantage of nutrition-related market opportunities and in collaboration with the agribusiness sector to facilitate access to these new markets."},{"index":7,"size":47,"text":"Howard Politini, Chair of PIPSO, reflected on the business agenda in agriculture and tourism acknowledging that while there are sectoral challenges, some are quite fundamental and associated to the cost and ease of doing business generally. He provided some context to PIPSO's engagement in agribusiness since 2015:"},{"index":8,"size":57,"text":"Recognising the massive potential that can be derived from a well-managed and cohesive and multi-disciplinary approach to addressing sectoral challenges; advocating access to finance for farmers and others in the agribusiness sector; acknowledging climate change and food security are issues that will continue to confront Pacific growers and agribusinesses; and NCD crisis facing the entire Pacific region."},{"index":9,"size":12,"text":"A Learning Journey at the Inaugural Pacific Week of Agriculture in Vanuatu"}]},{"head":"Building the evidence base","index":5,"paragraphs":[{"index":1,"size":10,"text":"The CTA/IFAD/PIPSO Project 'Promoting Nutritious Food Systems in the Pacific'"}]},{"head":"Research presentation: Agriculture nexus in Fiji","index":6,"paragraphs":[{"index":1,"size":44,"text":"Under the project, Dr. Lako, a CTA consultant, was assigned to undertake a rapid scan on the agriculture-nutrition nexus in Fiji as a means to building the evidence base and setting the scene for the broader work and interventions under the project, for Fiji."},{"index":2,"size":7,"text":"KEY HIGHLIGHTS FROM HER PRESENTED FINDINGS ARE:"},{"index":3,"size":35,"text":"• High incidence and prevalence of NCDs in Fiji, which continue to rise and the increasing evidence of micronutrient deficiencies especially iron deficiency anaemia -despite multiple policies and programmes on NCDs and food and nutrition."},{"index":4,"size":81,"text":"• Sixteen national policies and frameworks are in place across various line ministries (agriculture, fisheries, health, education etc.) but these are not specific enough on addressing nutritional challenges. Policies cite and reference food security and healthy foods, but greater consideration about concrete implementation and collaboration indicates a gap. There is no reference in key national documents about nutrition or mainstreaming nutrition, and ministries are seen to be working in isolation. Further, there is absence of intervention efforts in agriculture and nutrition."},{"index":5,"size":10,"text":"• Contradictions in policies in both implementation and roll out."},{"index":6,"size":17,"text":"• Numerous programmes/projects are being implemented by agencies and local authorities/entities, but need to be more complementary."},{"index":7,"size":23,"text":"• Increasingly poor eating habits of adolescents with increased consumption of ready-to-eat convenience foods, sugary drinks, and foods high in fats and salt."},{"index":8,"size":29,"text":"• Increasing imports and dependence on imported foods (calorie intake from imported foods: fat (71%), carbohydrates (68%) and protein (60%)) which shows that Fiji has a weak agricultural system."},{"index":9,"size":55,"text":"• Need for more research (including on the relationship between agri-nutrition outcomes by academia) to support the ministries in their work, as well as private sector/businesses. Need for building evidence base at the ground; and monitor the communications and outreach work that is being done (by the Ministry of Health) -are there differences in attitude? "}]},{"head":"Ministry of Health, Dr Isimeli Tukana, Director Wellness and National Advisor NCD. Combating NCDs in the prevention stage and a more holistic approach","index":7,"paragraphs":[{"index":1,"size":243,"text":"Dr. Tukana highlighted how agriculture has been core to Fiji's identity. Fiji is undergoing a nutrition transition. The big shift in recent times has been moving away from agriculture, which has spiked the high incidence of NCDs -instead of eating fruits, there is an increasing trend in consuming high sugar products; root crops have been replaced by rice etc.; and fresh fish replaced by tinned tuna and meats. This shift in eating patterns has made heart attacks and strokes by far the greatest causes of death in Fiji, with salt as the culprit. The country is undergoing a changing demography towards a higher percentage of youth (60% up to 35 years). Further, it is expected that by 2030 Fiji will be highly urbanised and this puts tremendous pressure on the food supply and service industry (and moving away from agriculture). A multisectoral and multi-dimensional approach is therefore ever more important. Food security needs to be considered within a broader framework and public and private sector should collaborate and support each other e.g. trade ministry, itaukei affairs, rural development etc. There is a need to engage the fisheries sector more (especially aquaculture) for food security as marine protected areas are being set up, and illegal fishing is reported. There are many meaningful ways to forge ahead -legislation to be updated; cross-country learning; outcomes from this workshop; noting commitments Fiji has signed up to (SDGs etc.); and the need for coordinated efforts and information sharing. "}]},{"head":"Joe","index":8,"paragraphs":[]},{"head":"Food crops value chains -Addressing bottlenecks, market and business opportunities","index":9,"paragraphs":[{"index":1,"size":84,"text":"This panel brought together representatives of various private sector representatives -from SMEs to the large corporations, from farmer organisations to industry representatives -all with the intention to share knowledge and experiences about their role and engagement in the local food and crop value chain. Moreover, what have been fundamental challenges, how they have overcome these and more importantly, where they see opportunities for business growth and for greater collaboration, particularly in addressing agri-nutrition in Fiji. Session moderator was Sakiusa Tubuna, Regional Coordinator of IFAD."}]},{"head":"Pacific Islands Farmers Network Organisation (PIFON), Kyle Stice, Manager. Demystifying value chain analysis -the farmer organisation experience","index":10,"paragraphs":[{"index":1,"size":165,"text":"In his presentation, Kyle Stice referred to the value chain (VC) trainings and methodology for analysing the VC that PIFON has developed, so that their members are empowered to undertake the exercises themselves and understand the elements and stakeholders in the VC. Capacity building is useful, noncomplicated and can assist farmers to understand better the issues, risks, and costs along the chain. The methodology has six steps for VC analysis and uses examples from the Pacific; it focuses on multiple actors along the value chain and analyses each one's role. The lessons learned are to be documented and shared via a short film currently being produced. There are many opportunities for VC analysis in Fiji and across the Pacific. In doing so, these opportunities can determine how to contribute to a broader development such as agri-nutrition -where VCs play a role in, for example, supply of nutritious and domestic crops to schools, and how farmers can take advantage of such programmes (e.g. bu for schools)."},{"index":2,"size":7,"text":"Fiji Rice Limited, Ashrit Pratap, Mill Manager."}]},{"head":"Rice strategy for sustainable food security","index":11,"paragraphs":[{"index":1,"size":163,"text":"Currently Fiji imports 40 million FJD (nearly US$ 20 million) worth of rice per annum from Australia, Thailand and Vietnam. Ashrit Pratap specifically mentioned the rice revitalisation project, which aims at reducing imports. The government also aims at promoting increased activity, given that production had decreased from 2009 but between 2015 and 2016 there have been increases, due to greater investments, and through subsidies. There is need for more farm mechanisation and land for upscaling of rice farming; free water supply for irrigation; and supplying local organic rice, plans for which are under discussion. A new mill is being installed and staff are being trained; new electric dryers that are quicker and more efficient (3 tonnes/hour) and farmers are getting a fair price for their rice (currently $ 750 (US$ 375) per tonne). Current local supply is to supermarkets and Fiji Rice Limited is working toward HACCP (hazard analysis and critical control points) certification, and is now part of the Fijian Made campaign."}]},{"head":"PANEL","index":12,"paragraphs":[{"index":1,"size":121,"text":"Vee's Organic Farm, Amran Yusuf, Marketing Manager. Niche and organic agriproducts Amran Yusuf shared the farm's journey as a means for empowering other farming hobbyists and women farmers. Vee's Organic Farm is owned by Vitila Vuniwaqa who has always had a firm belief in the role of women in development, especially agri-nutrition. Vee's Farming products include honey, cassava, watermelon, beans, papaya, and seasonal fruits, as well as other value-added products. The whole farmland is not being fully utilised, but this is work in progress and the farm is expected to be certified organic in one year out. The local markets and community are the main clientele, but there is opportunity to be engaged in other agroprocessing as well as agri-tourism activities."}]},{"head":"Participatory Guarantee System Project, David Hickes, Coordinator. Sharing case study and project roll out in Fiji's Coral Coast","index":13,"paragraphs":[{"index":1,"size":141,"text":"David Hickes shared the project roll out and developments to date. The project operates in three villages in the Sigatoka valley, assisting smallholder farmers to transition from subsistence farming to semi-commercial, by providing technical support. This has included training in seedling handling, post-harvest handling, quality control, and financial management. A key complementary aspect has been to support the women in the villages/communities to consider their roles in agriculture and in transitioning to semi-commercial. Income has been steady with 2015 gross sales reported at $ 150,000 (US$ 75,000), and in 2016 it increased to $ 175,000 (US$ 87,500), but these communities faced hardships during cyclone Winston. A new initiative was recently launched by women in early 2017, on chicken incubators, and this is being closely monitored. The project is also considering ways to engage village youth to get into agriculture and agribusiness."},{"index":2,"size":8,"text":"Fiji Hotel and Tourism Association, Fantasha Lockington, CEO."}]},{"head":"Supplying local hotels -what can and should be done better","index":14,"paragraphs":[{"index":1,"size":146,"text":"The Fiji Hotel and Tourism Association has about 300 members representing various tourism entities in marine, dive, hotels, restaurants etc. Its board comprises representatives from these groups. Collectively, they advocate/lobby for issues affecting its members. Three key points were highlighted. Firstly, understanding the demands in low and high seasons, and fluctuating seasons in between. Chefs want the freshest produce -and based on budget, but a fundamental challenge has been consistent supply and quality of supply. Secondly, despite the negative reporting, Fiji hotels do want to cater local food and use local fruits and vegetables. Lastly, it is about acknowledging and respecting that guests want to have options and being empowered to make choices (about what to eat). Whilst the trends have seen guests preferring healthier meal/dining options, customers still want to have other, less-healthier, options available to them. Fiji National Roundtable Workshop June 2017: Outcomes Report"},{"index":2,"size":46,"text":"Value chain trainings can be an effective and efficient way to build capacity and address the agri-nutrition nexus. Presented business and project cases show opportunities to increase Fiji's agricultural potential for schools, (agri-) tourism, agro-processing (including local supply of nutritious foods), and women empowerment in agribusiness."}]},{"head":"SUMMARY PANEL 2","index":15,"paragraphs":[]},{"head":"Fisheries value chains -Addressing bottlenecks, markets and business opportunities","index":16,"paragraphs":[{"index":1,"size":75,"text":"Marine resources play an important role in agri-nutrition, as they are a vital source for both livelihoods and nutritional diets. This panel brought together representatives and practitioners in the fisheries sector to address the regulatory and technical aspects, the fisheries development agenda, the business challenges and opportunities, the role of academia and civil society and community networks in supporting industry research. Session moderator was Dr. Milika Sobey, Chairwoman of the Fiji Women in Fisheries Network. "}]},{"head":"Ministry of Fisheries","index":17,"paragraphs":[]},{"head":"Fisheries Consultant, Aliti Vunisea. Women fishers and supplies to markets","index":18,"paragraphs":[{"index":1,"size":213,"text":"Aliti Vunisea highlighted that women walk the fine line between traditional barter and exchange and the modern market economy. There is engagement in the informal sector, but lack of data makes it difficult to determine how many women exactly, where, and what types of activities they are engaged in. Cultural and social barriers and the customary nuances remain. Key challenges are around lack of infrastructure and support systems; and expertise/knowledge in setting prices, identifying/considering costs and general financial literacy and management, and that these are areas that needed to be strengthened to assist rural women. Furthermore, better data collection and profiling is needed to enable stakeholders and partners to make informed decisions on how to best support women. Additionally, leveraging existing networks, and/or formalising networks to negotiate and advocate for needs and support is needed. In order to facilitate a shift from semi-subsistence to business enhancements, training in finance (recording sales, expenditures, cash flows, etc.) and food handling is needed. The greatest opportunities are in more targeted and enhanced participation -PANEL 3 in fisheries value chains -and engaging in processing for domestic and export industry, and non-traditional outlets; coming together in a cluster or to strengthen positions and voice. Further, needs are community resource management and planning to ensure resource supplies/long term sustenance."},{"index":2,"size":18,"text":"Secretariat of the Pacific Community (SPC), Dr. Tim Pickering, Aquaculture Adviser. Technical support to aquaculture and coastal fishers"},{"index":3,"size":163,"text":"Dr. Pickering shared SPC's work about aquaculture and coastal fisheries and specifically about small fish and their potential to contribute to food security and nutrition. Nowhere else do as many countries rely so heavily on subsistence fishing as the main source of protein needed by the population for good nutrition. Where does aquaculture come in? Especially with the expected population increases, and other challenges to impact fisheries resources -small fish fisheries (dominated by women) aim at species that grow, mature and reproduce at small size, or juveniles of big-fish species (e.g. Milkfish fingerlings (yawa), Rabbitfish fingerlings (Vula nuqa levu) should be considered. Small fish are rich in animal protein and micronutrients: essential fatty acids, vitamins and minerals, and this is a common part of diet in marginalised communities. Small-fish fisheries and aquaculture are often overlooked but the potential exists particularly in combatting nutrient deficiency. Additional research on nutrient value, alternative fisheries management and further science related aspects e.g. fisheries induced evolution is needed."}]},{"head":"Pacific Ocean Culture (POC), Cathy Joyce, Owner. POC journey and the pond-to-table initiative","index":19,"paragraphs":[{"index":1,"size":132,"text":"POC is an integrated aquaculture company operating in Navua, Fiji focusing on food security through sustainable seafood production for the domestic market including communities, upscale restaurants and resorts, catering operations and the export market. Marine resources need to be protected from overfishing and other negative impacts and in that way communities can have continued access to healthy food and fish/protein sources for their diet. Core to its operations is to engage communities in aquaculture and periphery activities. The pond-to-plate journey is based on having a quality meal from a menu of options, and in doing so is largely influenced by having key ingredients (e.g. pristine environment, diversity of species, and proven technologies) that have come through a traceable process under the strictest of benchmarks and protocols (e.g. feed systems and internal managements)."},{"index":2,"size":110,"text":"National Fisheries Policy aims to address the major issues in the fisheries sector, e.g. food security and employment including women and youth. Opportunities in aquaculture remain largely untapped despite their potential to contribute to economic development, food security and nutrition (e.g. in the case of small-fish fisheries dominated by women). Discussions following the panel were around supporting women in marketing their fish. The main suggestion coming from this panel is to consider detailed research on Fiji women fishers (and across the Pacific), analyse their status, and see what needs to be done to support women fishers and their enterprises; and also consider fisheries for the domestic markets (not just exports)."}]},{"head":"SUMMARY PANEL 3","index":20,"paragraphs":[{"index":1,"size":15,"text":"Women's empowerment in agriculture, nutrition and agribusiness: The policy environment & learning from good practice"},{"index":2,"size":46,"text":"This panel brought together representatives and practitioners from various agencies who are implementing programmes and/or providing support services to women's economic empowerment and are rolling out initiatives in sectors that could be considered and/or replicated in women in agribusiness. Session moderator was Judith Francis of CTA."}]},{"head":"Women Entrepreneurs Business Council, Eseta Nadakuitavuki, Chairperson. Networking and business counselling for women business owners","index":21,"paragraphs":[{"index":1,"size":93,"text":"Eseta Nadakuitavuki took the opportunity to encourage women entrepreneurs to reach out and expand their networks. Networking and partnership are important for business development to enable women to connect to other like-minded women and facilitate informal marketing as peers become aware of each other's business and products/services. More than 60% of women are in the informal sector and by increasing access to information to make that shift to formalise them can be overwhelming -this is where networking and mentoring helps. Business counselling and mentoring, and networking are powerful tools to encourage women entrepreneurs."}]},{"head":"Fiji Women in Fisheries Network (WIFN), Cherie Morris, Executive Board Member. Fisherwomen supporting local markets and the potential for agritourism ventures","index":22,"paragraphs":[{"index":1,"size":124,"text":"WIFN works with partners to provide support for women in the fisheries sectorin financial literacy, conservation awareness, community management planning, gender and fisheries, and research. Throughout the Pacific, women have a wealth of fisheries knowledge, which needs to be documented and referenced; and women use their traditional and social networks to sell their products and distribute products. Broader business challenges include: finding new markets for products especially in tourism; understanding and calculating cost and price, taking into account resources/time used; processing, selling -and value adding; adverse weather conditions and how this affects/interrupts supply and ability to harvest; lack of full time expertise to support these women and to help with post handling/quality; compliance with food safety; limited support to women and access to services."}]},{"head":"UNWOMEN, Preeya Ieli, Regional Programme Specialist for women's economic empowerment. Markets for Change (M4C) Project","index":23,"paragraphs":[{"index":1,"size":81,"text":"Preeya Ieli presented the M4C project and noted the parallels and linkages to the CTA/IFAD/PIPSO project. The M4C project operates in Vanuatu, Solomon Islands and Fiji, where it is working with 12 municipal markets (except Nasinu and Lami). Fundamentally, the project is on (i) strengthening women market vendors and their roles as leaders. While most vendors are women, men head many associations; (ii) improving socio-economic security of women -financial education support, promoting saving schemes instead of credit schemes and PANEL 4"},{"index":2,"size":8,"text":"Women have a wealth of knowledge about fisheries."},{"index":3,"size":17,"text":"To take advantage of opportunities women need access to expertise and to comply with food safety standards."}]},{"head":"CHERIE MORRIS","index":24,"paragraphs":[{"index":1,"size":130,"text":"Fiji Women in Fisheries Network \" improving agricultural productivity. Value adding support is needed, e.g. food safety aspects. Need to work with municipal councils -to train them and give necessary support, including through gender responsive budget for councils; and (iii) physical infrastructure of the markets. 80-90% are women vendors, but public amenities are disproportionate -e.g. only two sets of toilets (which is the same for men, comprising 10% vendors). Challenges which can be opportunities through agribusiness and agri-nutrition -seeing how seasonal fruits and vegetables can be preserved, value added, processed instead of facing wastage; and increasing farming activity for income but ensuring a buffer of food is also available for consumption -there needs to be greater awareness to be done at markets on thisnutrition education of market vendors is important."}]},{"head":"Femlink Pacific Media Initiatives for Women, Sian Rolls, Programme Associate. Utilising media and ICTs for collective advocacy to support women's business development","index":25,"paragraphs":[{"index":1,"size":172,"text":"Sian Rolls presented the importance of advocacy tools in decision-making and how they affect women in agriculture, business and access to nutritious food for households. Femlink uses its three community radio stations to share and discuss emerging issues -e.g. climate change and natural disasters, NCDs and food security and advocates the need for information and awareness to be taken to communities and for women to have a comfortable space to amplify their voices and concerns. The importance of data and disaggregated data to support decision-making to influence policy, and especially in natural resource management, where women and communities are involved was emphasised. Some recent trends which should be considered: (i) the term 'middlemen' is not confined to only men anymore as women take on new roles; (ii) eating healthy is becoming an expensive exercise. Partly due to a shift from rural to urban areas and shifts in diets that go with it; (iii) cultural issues on land ownership and disparity especially for women, engaging in land-based activities; (iv) policies not being implemented."},{"index":2,"size":20,"text":"A key recommendation is to ensure that there continues to be spaces and resources for women to amplify their voices."},{"index":3,"size":65,"text":"Women have a wealth of agricultural and fisheries knowledge, which needs to be documented and referenced. Women use their traditional and social networks to sell their products and distribute products. In order to accelerate women's business development, networking and partnership building for agriculture, agribusiness and nutrition, collective advocacy using mass media and ICTs, and strengthening women market vendors and their roles as leaders, are necessary."}]},{"head":"SUMMARY PANEL 4","index":26,"paragraphs":[{"index":1,"size":327,"text":"The biggest gap is in decision-making. Women are being frustrated because despite the development changes they are not seeing improvements in their economic and nutrition status. With the growing number of people becoming conscious of their health and what they eat, farmers need to think of organic and nutritious foods (including agroprocessing e.g. cassava into cassava flour) as a business. FRIEND has recently published a guide -Organics Simplified -which would help farmers to implement organic methods of controlling pests and farming. Major constraints to the development of organic agriculture are the associated costs and complexity of obtaining an organic certification. A participatory guarantee system focuses on engaging with rural and small farmers who could not afford third party certification. Most of FRIEND products can be found in Fiji supermarkets, and a small number for export. Demand is envisaged to increase especially as it attempts to respond to the higher demands for organics abroad. However, there are many opportunities to enter other local markets -like tourism and hospitality. The former will be a platform targeting SME agro-enterprises who are interested in scaling up and a maximum US$ 20,000 will be available for accessing technical expertise, training, research and development, ICTs, etc. The latter will be targeting more community-based groups to strengthen agriculture-nutrition-income/ livelihood opportunities and again, the maximum would be US$ 20,000, under a negotiated/direct grant. The IGCF will be duly circulated through PIPSO's and other partners' networks. In addition, the project is exploring an indexbased insurance, noting that part of the financing challenges for agriculture and agribusiness are around insurance and specifically weather risk insurance. Indexbased insurance is suitable for developing countries where many smallholder farmers operate. Insurance is rarely feasible as a stand-alone product for farmers and is often bundled with credit, inputs, weather information, mobile and other services, etc. There is a strong link between insurance and credits and cases suggest that the availability of insurance increases both the supply and demand for financial services."}]},{"head":"University of the","index":27,"paragraphs":[]},{"head":"PANEL Fiji Development Bank (FDB), Tevita Madigibuli, General Manager Relationships & Sales. Banks agribusiness portfolio and what have been fundamental challenges and how to support businesses","index":28,"paragraphs":[{"index":1,"size":216,"text":"Tevita Madigibuli provided an overview of the development in the bank's agribusiness portfolio. FDB provides development financing in line with government policies, and this includes contributing and supporting the natural resource sector -land and marine -SMEs, new business creation, and the rural and agricultural sector. Not limited to these but also included are services for tourism, disaster rehabilitation (to existing customers), sustainable energy, and climate adaptation and mitigation. Agriculture is very risky, but there have been moves to provide greater support -in 2014, the total contribution to the sector by all commercial banks was 38% (around $ 45m -US$ 22,5m), then in 2015 was 44% ($60m -US$ 30m) and 2016 was 48% ($ 78m -US$ 39m). FDBs agriculture portfolio is $ 85m (US$ 42,5m), about 20% of all lending is towards horticulture, livestock, dairy and poultry, land development, land purchase, machinery, and includes fishing and forestry. A new strategic plan has been developed and envisaged areas to support and further include organic farming, and women in agriculture and develop incentives around these -e.g. lower interest rates, extended terms, and other incentives to be considered. FDB will be signing a Memorandum of Understanding (MoU) with the Ministry of Youth and Sports to support youth entrepreneurship. The bank's products are also linked to the attainment of the SDGs."}]},{"head":"National Centre for Small & Micro Enterprise Development (NCSMED), Ravi Chand, CEO. Sharing NCSMED's work in Fiji and lessons learned","index":29,"paragraphs":[{"index":1,"size":208,"text":"Ravi Chand shared insights on the agency's work on promoting SMEs and lessons learned. NCSMED recognises the importance of SMEs in job creation and development of the economy. SMEs have unique problems -limited financial capacity, preparedness for negotiation, skills for banking proposals, and they are not in a position to always 'get a fair deal.' Clustering is a way to get SMEs to work together to address some of the challenges. Legislation is outdated and hinders SME development, which is a continuous challenge to their growth. Training programs are being delivered and two incubators (in Suva and Rakiraki) are up and running. Business mentoring is an area that needs greater mobilisation to help SMEs in their journey, and business advice and guidance. Whilst financing is always a challenge -what SMEs do not utilise often or practice -is reaching out to other businesses to garner support or leverage support and partnership arrangements. As SMEs grow, they immediately start thinking about banks as a means to access finance to grow their business. However, they need to think of alternatives and reach out and work with partners. SME support is strongly linked to agri-nutrition, as improved livelihoods give options for better nutrition, and many Fiji SMEs are in the agri-food space."},{"index":2,"size":85,"text":"Sealink Exports, Tina Tawake, Food safety and standards at the heart of agribusiness and its growing importance Tina Tawake highlighted the importance of food safety certificates for agribusiness development. In considering industry to market practices, food safety considerations include the origins of food, the practices relating to food labelling, food hygiene, food additives and pesticide residues, as well as policies and food and SMEs create the most jobs in Fiji. SMEs need support and capacity building. Legislation that works against small business should be revised."}]},{"head":"RAVI CHAND","index":30,"paragraphs":[{"index":1,"size":9,"text":"CEO, National Centre for Small and Micro Enterprise Development"}]},{"head":"\"","index":31,"paragraphs":[{"index":1,"size":131,"text":"guidelines for the management of import and export, and certification systems for foods. Globally, food safety continues to be a growing concern and more so for businesses and communities, especially concerning the changing regulatory regimes and global business environment. If not addressed appropriately and in a timely manner, non-adherence to food safety principles can have devastating impacts on businesses and communities. Many Fijian businesses do not document processes of their produce/products and traceability is poor, but businesses are recognising the growing importance, as consumers are becoming more food safety conscious and wanting to know where their food is coming from. Whilst the manufacturing industry has been the more protocol-conscious (because of trade and exports), there need to be greater efforts to work with farmers, particularly to raise awareness and provide trainings."},{"index":2,"size":98,"text":"The panel presented enabling mechanisms for value chain and cluster development, e.g. specified loans to SMEs; Innovation Grant Credit Facility and Seed Funding; supporting the natural resource sector; designing incentives for women in agriculture, e.g. lower interest rates and extended terms. The importance of having food safety certificates and/or adhering to food safety protocols for agribusiness development was also highlighted. The panel further discussed challenges and opportunities to detect and roll out cohesive and joint programmes and improve particularly financing platforms to support SME's and women's businesses development (financing, clustering and trainings on finance; food safety; value adding)."}]},{"head":"SUMMARY PANEL 6","index":32,"paragraphs":[{"index":1,"size":2,"text":"Roundtable exercises"}]},{"head":"04","index":33,"paragraphs":[{"index":1,"size":51,"text":"Over the two days, two group roundtables were organised and the discussions in groups presented to the workshop. These have been collated below for information and the broader scope of ideas and deliberations are part of the workshop recommendations and forward agenda. Tabulated below is a summary of the group presentations:"}]},{"head":"ROUNDTABLE EXERCISE 1:","index":34,"paragraphs":[{"index":1,"size":24,"text":"In allocated groups, each group considered the tasks/questions (see below) and discussed how to address them. Findings and key considerations were presented in plenary."}]},{"head":"Tasks & questions:","index":35,"paragraphs":[{"index":1,"size":42,"text":"Policy 1) Identify three ways in how we can improve multi-stakeholder consultation/coordination to development appropriate policy and laws. 2) Identify resources that will be required by government ministries, private sector (including farmers/fisher folk) and CSOs to support implementation at the local level."}]},{"head":"Value chains","index":36,"paragraphs":[{"index":1,"size":52,"text":"3) What are your three priority value chains that promote nutritious food systems and address NCDs and food security? 4) How can we encourage/promote the use and consumption of locally grown produce and/or locally produced products? The workshop identified the following strategies and interventions for consideration to addressing agri-nutrition and agribusiness challenges."}]},{"head":"(i) Creating an enabling environment for agriculture nutrition nexus","index":37,"paragraphs":[{"index":1,"size":55,"text":"Setting a high-level political agenda and urgent multi-sectoral approach for addressing agri-nutrition and tackling NCDs in Fiji. This could for example start with including this in the National Sustainable Development Plan, and developing a policy and regulatory framework across ministries (especially fisheries, health, agriculture, trade and education) that is consistent and supportive across the board."},{"index":2,"size":22,"text":"In line with the regulatory framework, to have a supporting platform for resources and technical expertise to support implementation and roll out."}]},{"head":"(ii) Evidence-based policy and strategic planning","index":38,"paragraphs":[{"index":1,"size":51,"text":"Establishing a stronger collaboration and relationship with academia and private sector to conduct research and gather evidence-based information to generate evidence to make the business case on the challenges and opportunities in agrinutrition and agribusiness. For example, to document/take a stocktake of women fishers in Fiji, or industry-led research with academia."}]},{"head":"(iii) Leveraging on partnerships and shared responsibilities for increased food and nutrition security","index":39,"paragraphs":[{"index":1,"size":86,"text":"There are great projects and initiatives being implemented within government ministries, communities, private sector and academia, but in some instances, these are standalone and there is not much linkage or collaboration within the wider stakeholder community. There is so much opportunity and need to showcase benefits and share responsibilities and engagement through these projects and activities -and could include joint interventions such as media campaigns, agribusiness/farming communities initiatives with schools, promoting local produce and local cuisine (e.g. local cooking shows, food festival), to name a few."}]},{"head":"(iv) Organising into networks, collectives","index":40,"paragraphs":[{"index":1,"size":69,"text":"Recognising the smallness of our markets, businesses and capabilities, that businesses and farmers come together collectively as needed to leverage off each other whether in forming clusters or addressing value chain challenges. Insecurities of collaborating with competitors should be cast aside and recognise that collectively Fiji farmers, fisher folk and agribusinesses can contribute to working to address Fiji's agri-nutrition challenges and the opportunities that lie therein is largely untapped."}]},{"head":"(v) Resourcing -financing and capacity building efforts","index":41,"paragraphs":[{"index":1,"size":74,"text":"Financing, and technical and capacity efforts with farmers, community enterprises and fisher folk is a constant challenge. Training needs are many and diverse, ranging from financial literacy and management to food safety and postharvest handling, farming techniques, nutritional analysis, etc. As agencies are implementing programmes of assistance via grants, technical assistance and training, that there needs to be a more cohesive and coordinated effort so that there is less duplication and more benefits amassed."}]},{"head":"ADDENDUM:","index":42,"paragraphs":[{"index":1,"size":40,"text":"Addendum: PIPSO in consultation with and on behalf of the project partners submitted policy statements to Fiji's Ministry of Economy following the workshop to be considered for the Fiji National Development Plan, which is being drafted (Annex 3). 12:30 -13:00"}]},{"head":"Annex 1. Agenda Fiji National Roundtable Workshop","index":43,"paragraphs":[{"index":1,"size":46,"text":"Roundtable exercise: In allocated groups, each group to consider the two questions and discuss in your groups how to address these challenges, given the presentations you have heard earlier today. Following lunch, each group to do a brief presentation of their group discussions and key considerations."},{"index":2,"size":14,"text":"1. Women's economic empowerment and roles to support, and enhance agribusiness and promote nutrition:"},{"index":3,"size":20,"text":"-How to ensure women are empowered to engage in agribusiness/community enterprise and consider nutritional needs working with the broader community "}]},{"head":"Annex 3. Addendum","index":44,"paragraphs":[{"index":1,"size":33,"text":"The Agriculture Nutrition Nexus in Fiji: Rapid Country Scan formed the basis of the interactive discussions over the two day workshop, along with the 6 panel discussions, and 2 key roundtable group exercises."},{"index":2,"size":95,"text":"Some key highlights from the research included: the increasing importation of processed foods and access to these cheaper products affecting Fijians; contradicting policies with implementation and roll out; Ministries, especially Health, needing more evidence sourced from the ground/communities and to monitor the communications outreach work being done to see what (if any) differences in attitude; consider the role of academia in health research and community research; working closely with Fiji businesses/private sector in agribusiness and fisheries to consider broader food security and access to local affordable nutritious foods; and embedding agrinutrition into the school curriculum."},{"index":3,"size":39,"text":"Over the two days, six panel sessions and 2 roundtable exercises were convened and great discussions and deliberations ensued. PIPSO and partners are collating feedback for a broader set of practical recommendations and strategies for a national project roadmap."},{"index":4,"size":13,"text":"Three strategies that the workshop identified as key to national development consideration are:"},{"index":5,"size":9,"text":"(i) Creating an Enabling Environment for Agriculture Nutrition Nexus"},{"index":6,"size":78,"text":"Setting a high level political agenda and urgent multisectoral approach to addressing agrinutriton and tackling NCDs in Fiji. This could for example, start with including this in the National Sustainable Development Plan, and developing a policy and regulatory framework across Ministries (especially Fisheries, Health, Agriculture, Trade and Education) that is consistent and supportive across the board. In line with the regulatory framework, to have a supporting platform for resources and technical expertise to support implementation and roll out."}]},{"head":"(ii) Evidence Based Policy and Strategic Planning","index":45,"paragraphs":[{"index":1,"size":34,"text":"Establishing stronger collaboration and relationship with academia and private sector to conduct research and gather evidence-based information to generate evidence to make the business case on the challenges and opportunities in agrinutrition and agribusiness."}]},{"head":"(iii) Leveraging on Partnerships & Shared Responsibilities for Increased Food and Nutrition Security","index":46,"paragraphs":[{"index":1,"size":85,"text":"There are great projects and initiatives being implemented within Government Ministries, communities, private sector and academia but in some instances these are standalone and not much linkage or collaboration within the wider stakeholder community. There is so much opportunity and need to showcase benefits and share responsibilities and engagement through these projects and activities -and could include joint interventions such as media campaigns, agribusiness/farming communities initiatives with schools, promoting local produce and local cuisine (e.g local cooking shows, food festival etc), to name a few."}]}],"figures":[{"text":" Research presentation: Agriculture nexus in Fiji Panel sessions Panel 1: Importance of agricultural development to address food security, nutrition, and business development Panel 2: Food crops value chains -Addressing bottlenecks, market and business opportunities Panel 3: Fisheries value chains -Addressing bottlenecks, markets and business opportunities Panel 4: Women's empowerment in agriculture, nutrition and agribusiness: The policy environment & learning from good practice Panel 5: Supporting food value chains -The role of private sector, academia and civil society Panel 6: Enabling mechanisms to support value chain development, women's agribusinesses, and supporting "},{"text":" MAJOR GAPS IN AGRICULTURE-NUTRITION NEXUS IDENTIFIED BY DR. LAKO: Weak or absence of nutrition link in the National Development Plan and policies in use by the various line ministries Lack of commitment and poor coordination of the Fiji Plan of Action for Nutrition Discussions and commentaries following Dr. Lako's presentation included questioning: How to engage the Ministry of Education to work with farmers/ communities and support school canteens to serve more local nutritious foodsfor example fresh bu (water or juice of a young coconut); what considerations are (FPAN) with multi-stakeholders and partners (FPAN) with multi-stakeholders and partners Lack of gender-sensitive agriculture and gender-disaggregated data Lack of gender-sensitive agriculture and gender-disaggregated data Limited awareness and availability of nutrient dense local foods Limited awareness and availability of nutrient dense local foods Conflicting messages in promoting use of local foods Conflicting messages in promoting use of local foods Importance of agricultural development to address Importance of agricultural development to address food security, nutrition, and business development food security, nutrition, and business development 03 Panel sessions 03Panel sessions  "},{"text":"The workshop featured six panels, as a means to trigger an exchange of viewpoints among practitioners, and experts to present a divergence of viewpoints and prompt discussions around issues pertaining to the multifaceted and multidimensional aspects of addressing agri-nutrition. This was also seen as a way to inform and educate participants who may not be familiar or well versed with issues from other sectors and provided an opportunity to hear various dimensions -government, academia, and business, which is important for driving innovation. Infant diets have changed with formula replacing breast milk and because the former is expensive, the shift is to purchase packaged liquid milk. The Public Health Act 1930 is archaic and does not capture the latest health trends and issues and misses to advocate more for agriculture. The health landscape needs to change to advocate for agricultural development and protect consumers and more specifically to change regulations on marketing of unhealthy foods and alcoholic beverages and breast milk supplements. Fiji is going through \" Fiji is going through \" nutrition transitions; nutrition transitions; linked to the shift from linked to the shift from agriculture. Unless the agriculture. Unless the laws change, nothing will laws change, nothing will happen. The solution for happen. The solution for NCDs is in agriculture. NCDs is in agriculture. DR ISIMELI TUKANA DR ISIMELI TUKANA Ministry of Health Ministry of Health Director Wellness Director Wellness  "},{"text":"FAO, Joann Young, Assistant Representative to Fiji. Food & Nutrition Security Impact, Resilience, Sustainability and Transformation (FIRST) Project  The triple burden of malnutrition (undernourishment, obesity, and The triple burden of malnutrition (undernourishment, obesity, and micronutrient deficiency) is weighing upon national development in the micronutrient deficiency) is weighing upon national development in the Pacific, due to reduced consumption of locally grown products and increased Pacific, due to reduced consumption of locally grown products and increased consumption of sugary, salty and fatty foods. Investments are high in consumption of sugary, salty and fatty foods. Investments are high in convenience foods and these are becoming cheaper -for example to consume convenience foods and these are becoming cheaper -for example to consume rice instead of dalo several times each week. Because of differences in investment rice instead of dalo several times each week. Because of differences in investment (technology change) and marketing (trade) policy decisions, few nutritious foods (technology change) and marketing (trade) policy decisions, few nutritious foods are becoming cheaper. When family incomes rise, the share of food in total are becoming cheaper. When family incomes rise, the share of food in total expenditure falls and simultaneously the share of expenditure on animal source expenditure falls and simultaneously the share of expenditure on animal source foods and fruit and vegetable increases. National strategies to improve nutrition foods and fruit and vegetable increases. National strategies to improve nutrition often aim at achieving \"behavioural change\" through \"demand side\", yet these often aim at achieving \"behavioural change\" through \"demand side\", yet these strategies often miss the critical \"supply side\" actions required to foster demand strategies often miss the critical \"supply side\" actions required to foster demand for a healthier diet (interventions focusing on improving relative price, access for a healthier diet (interventions focusing on improving relative price, access and convenience of nutritious foods). The aim of the FIRST project is to and convenience of nutritious foods). The aim of the FIRST project is to facilitate an increase in investment in supply side interventions, improving facilitate an increase in investment in supply side interventions, improving affordability of nutritious diet. FAO is assisting Pacific Island countries to affordability of nutritious diet. FAO is assisting Pacific Island countries to develop strategies and design programmes that address the multi-dimensionality develop strategies and design programmes that address the multi-dimensionality of food and nutrition insecurity. of food and nutrition insecurity.  "},{"text":"Strategic Planning & National Development Department, Anare Leweniqila, Principal Economic Planning Officer. Coordination of multi-sectoral and multidisciplinary approaches for a healthier Fiji   "},{"text":"'s Farm, Save Waqainabete, Business Development Analyst. How agribusinesses can play a vital role  is needed. Agribusinesses need to address input and technical issues -and reduce is needed. Agribusinesses need to address input and technical issues -and reduce costs so that fresh locally grown produce and value-added products become costs so that fresh locally grown produce and value-added products become affordable. Subsistence farming is the main activity and there needs to be a shift affordable. Subsistence farming is the main activity and there needs to be a shift to semi-commercial -this is one way to address supply issues. Imports are high to semi-commercial -this is one way to address supply issues. Imports are high because needs are not being met locally, and businesses need to update data and because needs are not being met locally, and businesses need to update data and information on commodities (what is being imported) to assist decision-making information on commodities (what is being imported) to assist decision-making (for import substitution). Engaging women and youth in the sector needs to be (for import substitution). Engaging women and youth in the sector needs to be promoted more especially in engagement with schools -for dietary support promoted more especially in engagement with schools -for dietary support but also in getting children/young people involved in agriculture. Collectively but also in getting children/young people involved in agriculture. Collectively and with the support of the government, promotion and support of broader and with the support of the government, promotion and support of broader agricultural development reconsideration of trade environment, and how to agricultural development reconsideration of trade environment, and how to create jobs and opportunities locally are needed. create jobs and opportunities locally are needed. SUMMARY PANEL 1 SUMMARY PANEL 1 Agricultural development is hindered by inconsistency, low quality and Agricultural development is hindered by inconsistency, low quality and insufficient quantity of produce, due to lack of infrastructure, high production insufficient quantity of produce, due to lack of infrastructure, high production cost and high risks (e.g. climate change). Fiji is undergoing a nutrition cost and high risks (e.g. climate change). Fiji is undergoing a nutrition and demographic transition as well as urbanisation; policies must better and demographic transition as well as urbanisation; policies must better address these trends and issues. The panel identified the need to strengthen address these trends and issues. The panel identified the need to strengthen coordination and determine ways to increase engagement: At the sectoral coordination and determine ways to increase engagement: At the sectoral level, communities/enterprises that need planting materials/aids, technical level, communities/enterprises that need planting materials/aids, technical expertise, information, and awareness (including on pricing, diversifying etc.) expertise, information, and awareness (including on pricing, diversifying etc.) should be supported. should be supported. Business is not just about trading, but it is now having a more inclusive Business is not just about trading, but it is now having a more inclusive community engagement role, and many see corporate social responsibility community engagement role, and many see corporate social responsibility policies as a way to engage/reach out to communities. Further, as economies policies as a way to engage/reach out to communities. Further, as economies work towards addressing national challenges, it is increasingly recognised that work towards addressing national challenges, it is increasingly recognised that governments alone cannot do it, and that the private sector has a key role to governments alone cannot do it, and that the private sector has a key role to play in sustainable economic development. Agricultural productivity issues have play in sustainable economic development. Agricultural productivity issues have driven business development, but now a dimension to incorporate agri-nutrition driven business development, but now a dimension to incorporate agri-nutrition  "},{"text":"& Forests, Aisake Batibasaga, Director for Fisheries. Fisheries Sector Policy agenda addressing sectoral challenges in communities and with private sector   "},{"text":"Supporting food value chains -The role of private sector, academia and civil society   This panel brought together representatives and practitioners from various This panel brought together representatives and practitioners from various  agencies who are implementing programmes and/or providing supporting services agencies who are implementing programmes and/or providing supporting services  to strengthen value chains and business development. Session moderator was to strengthen value chains and business development. Session moderator was  Stephen Hazelman, Communication and Extension Coordinator, Secretariat of Stephen Hazelman, Communication and Extension Coordinator, Secretariat of \" the Pacific Community. Foundation for Rural Integrated Enterprise Development \"the Pacific Community. Foundation for Rural Integrated Enterprise Development  (FRIEND), Dr Jone Hawea, Associate Director. Cassava flour and (FRIEND), Dr Jone Hawea, Associate Director. Cassava flour and  agro-processed products from local produce agro-processed products from local produce  Dr. Jone Hawea reasoned why FRIEND, a local entity that supports agribusiness Dr. Jone Hawea reasoned why FRIEND, a local entity that supports agribusiness  and agri-nutrition in a twofold way -(i) fosters and supports rural communities and agri-nutrition in a twofold way -(i) fosters and supports rural communities  in livelihood initiatives using the land and resources available to them; and (ii) in livelihood initiatives using the land and resources available to them; and (ii)  promotes local produce as healthier options -is creating a multiplier effect locally. promotes local produce as healthier options -is creating a multiplier effect locally. SIAN ROLLS  SIAN ROLLS Programme Associate  Programme Associate Femlink Pacific Media  Femlink Pacific Media Initiatives for Women  Initiatives for Women  "},{"text":"South Pacific (USP), Viliamu Iese, Research Fellow, Pacific Centre for Environment & Sustainable Development. Food security best practices guide  Viliamu Iese addressed the role of academia in food security research, and identified Viliamu Iese addressed the role of academia in food security research, and identified the opportunity for collaboration between the private sector and academia. the opportunity for collaboration between the private sector and academia. Academia/USP has been engaged in food security research and over the last 10 Academia/USP has been engaged in food security research and over the last 10 years, research in various Pacific Islands has been taking place. The research topics years, research in various Pacific Islands has been taking place. The research topics have included food availability/production; food accessibility/cost; food utilisation; have included food availability/production; food accessibility/cost; food utilisation; nutrition and health; food stability especially concerning disasters; and food nutrition and health; food stability especially concerning disasters; and food security concepts. The university has developed a food security and climate change security concepts. The university has developed a food security and climate change postgraduate course and embarked on a 'Community Food Production and Health' postgraduate course and embarked on a 'Community Food Production and Health' (CFaH) project with partners from overseas. Partnerships with FRIEND Fiji and (CFaH) project with partners from overseas. Partnerships with FRIEND Fiji and other academic institutes from around the world are being strengthened. USP also other academic institutes from around the world are being strengthened. USP also offers demand driven and targeted capacity building (formal, informal, technical and offers demand driven and targeted capacity building (formal, informal, technical and vocational education and training), as well as courses targeted to be taught in the vocational education and training), as well as courses targeted to be taught in the university, and for communities and businesses. There is also demand driven applied university, and for communities and businesses. There is also demand driven applied  "},{"text":"Mere Salusalu, Technical Manager. Role of AMA in Fiji's agribusiness space and where to link with businesses Mere Salusalu explained that AMA's role is to assist rural farmers in the remote areas of Fiji to market their produce. The agency was formed by the AMA act, and mandated by the government to access islands for agriculture and support. AMA collects and/or facilitates collection and buys various varieties of dalo, yams, sweet potato and cassava and processes them for exports -fresh or frozen. Other products include fish, virgin coconut oil, as well as honey. All products are available in the local market where the products are distributed to supermarkets or sold to individuals by AMA. Challenges include high transportation costs and limited access to rural produces. Freight costs to transport the produce from the remote rural islands makes the product cost uncompetitive. AMA exports containers of Fiji produce but plans to increase the export sales. A key issue is to work towards modernising the market system of Fiji for better return to farmers. Farmers are getting more income than they normally would from coconuts. Virgin coconut oil is a key product but quality issues need to be considered and testing for accredited lab is required. In Fiji, this is only available at USP. AMA is considering cassava flour for export.  "},{"text":"Managed Marine Protected Area Network, Alifereti Tawake, Fiji Coordinator. Conservation and environmental protection for sustainable economic development Locally managed marine areas vary and include conditional closures, permanent closures (e.g. tabu's, marine protected areas), rotational closure, and other managed areas which could cover gear restrictions, by season, and/or depending on species/catches. In considering agribusiness/agri-nutrition further, it is important to recognise the vast partnership opportunity with CSOs in environmental conservation to provide technical/ scientific information and resources for community-based adaptive management and trainings, monitoring, and data management and analysis. Improving local fishery resources (communities) for protecting coral reef biodiversity is and should be a shared motivation and economic development and growth cannot be sustainable without these considerations.The panel presented examples of successful cases in value chain development within civil society, private sector and academia that assist rural farmers in the remote areas of Fiji to market their produce; help farms to achieve organic certification; provide research in food security; enhance Pacific business competitiveness through cluster development. The panel also emphasised that there is a need to formalise partnerships so that agencies collaborate and at the same time have defined roles to avoid confusion, and duplication. It was highlighted that sustainable economic development can only be reached through environmental protection, e.g. sustainable local fisheries or community-based adaptive management. Enabling mechanisms to support value chain Enabling mechanisms to support value chain development, women's agribusinesses, and development, women's agribusinesses, and supporting nutritional development supporting nutritional development This panel brought together representatives from agencies who are implementing This panel brought together representatives from agencies who are implementing programmes and/or providing support services for economic empowerment and programmes and/or providing support services for economic empowerment and are rolling out initiatives in sectors that could also benefit women in agribusiness. are rolling out initiatives in sectors that could also benefit women in agribusiness. Session moderator was Dr. Jimaima Lako. Session moderator was Dr. Jimaima Lako. HFC Bank, HFC Bank, SUMMARY PANEL 5 SUMMARY PANEL 5 Alifereti Tawake emphasised the importance of conservation and environmental Alifereti Tawake emphasised the importance of conservation and environmental protection of marine areas for sustainable economic development. Conservation protection of marine areas for sustainable economic development. Conservation interventions are not new, but have been part and parcel of traditional interventions are not new, but have been part and parcel of traditional management systems (mana) practiced by communities. However, with greater management systems (mana) practiced by communities. However, with greater  "},{"text":"Amitesh Karan, Business Relationship Manager. HFC trade finance portfolio to support Fiji's agribusinesses and SMEs HFC Bank's Amitesh Karan presented the scope of HFC's assistance to SMEs and specifically highlighted the 2017 trade financing agreement signed with the Asian Development Bank (ADB). This agreement with ADB supports up to $ 4 million -almost US$ 2 million -of trade annually in Fiji. It includes a credit guarantee facility and a revolving credit facility. The partnership provides HFC Bank a solid platform in the international banking arena, while paving the way for customers to venture into new global markets by using safe and reliable financial products such as letters of credit to obtain financing at competitive and attractive rates. The program provides guarantees and loans to over 200 partner banks to support trade, enabling more companies throughout Asia to engage in import and export activities. With dedicated trade finance specialists, the program has established itself as a key partner in the international trade community, providing fast, reliable, and responsive support to fill gaps in the region's most challenging markets. In terms of broader HFC suite of products for SMEs, credit criteria are still per bank requirements and clients still have to meet these. Timeline and credit approvals vary according to assessments. Turnaround for SMEs is $ 500,000 (US$ 250,000) -if less than this they can qualify for an SME loan. The The  "},{"text":"Technical Centre for Agricultural and Rural Cooperation (CTA), Judith Ann Francis, Senior Programme Coordinator. Seed funding and the innovation grant credit facility through the CTA/ IFAD/PIPSO project   "},{"text":"Importance of Agricultural Development to address food security, nutrition, and business development. Save Waqainabete, Business Development Analyst. How agribusinesses can play a vital role. TIME DAY 1: WEDNESDAY, 28 JUNE 2017 TIMEDAY 1: WEDNESDAY, 28 JUNE 2017 8:30 -9:00 Registration. 8:30 -9:00Registration.  Welcome coffee/tea available. Welcome coffee/tea available. 9:00 -9:10 Welcome -Howard Politini, Chairperson, PIPSO. 9:00 -9:10Welcome -Howard Politini, Chairperson, PIPSO. 9:10 -9:20 Opening Remarks -Sakiusa Tubuna, Regional Coordinator, IFAD. 9:10 -9:20Opening Remarks -Sakiusa Tubuna, Regional Coordinator, IFAD. 9:20 -9:30 Opening of the workshop -Christoph Wagner, Head of Cooperation, European 9:20 -9:30Opening of the workshop -Christoph Wagner, Head of Cooperation, European  Delegation for the Pacific. Delegation for the Pacific. 9:30 -9:45 CTA/IFAD/PIPSO Project Presentation \"Leveraging the Development of Local Food Crops and 9:30 -9:45CTA/IFAD/PIPSO Project Presentation \"Leveraging the Development of Local Food Crops and  Fisheries Value Chains for Improved Nutrition and Sustainable Food Systems in the Pacific Islands\" - Fisheries Value Chains for Improved Nutrition and Sustainable Food Systems in the Pacific Islands\" -  Judith Ann Francis, Senior Programme Coordinator, Science and Technology Policy & Judith Ann Francis, Senior Programme Coordinator, Science and Technology Policy &  Pacific Regional Coordinator, CTA. Pacific Regional Coordinator, CTA. 9:45 -10:15 The Agriculture Nutrition Nexus in Fiji: Rapid Country Scan -Dr. Jimaima Lako, Consultant. 9:45 -10:15The Agriculture Nutrition Nexus in Fiji: Rapid Country Scan -Dr. Jimaima Lako, Consultant. 10:15 -10:30 Followed by Q&A, discussion. 10:15 -10:30Followed by Q&A, discussion. 10:30 -11:00 MORNING TEA BREAK 10:30 -11:00MORNING TEA BREAK 11:00 -12:05 Panel 1: United Nations Food and Agricultural Organisation, Joann Young, FAO 11:00 -12:05Panel 1: United Nations Food and Agricultural Organisation, Joann Young, FAO  Assistant Representative to Fiji. Food & Nutrition Security Impact, Resilience, Sustainability and Assistant Representative to Fiji. Food & Nutrition Security Impact, Resilience, Sustainability and  Transformation Project. Transformation Project.  Strategic Planning & National Development Department, Anare Leweniqila, Strategic Planning & National Development Department, Anare Leweniqila,  Principal Economic Planning Officer. Coordination of multisectoral and multidisciplinary Principal Economic Planning Officer. Coordination of multisectoral and multidisciplinary  approaches for a healthier Fiji. approaches for a healthier Fiji. Joe's Farm, 12:05 -13:05 Panel 2: Joe's Farm, 12:05 -13:05 Panel 2:  "},{"text":"Food Crops Value Chains -Addressing bottlenecks, market and business opportunities.  13:05 -14:00 LUNCH BREAK (55 MINUTES) 13:05 -14:00LUNCH BREAK (55 MINUTES)  Lunch will be served in the main restaurant, Ground Floor Lunch will be served in the main restaurant, Ground Floor 14:00 -15:00 Panel 3: 14:00 -15:00Panel 3:  Moderator: Sakiusa Tubuna, Regional Coordinator, IFAD Moderator: Sakiusa Tubuna, Regional Coordinator, IFAD  10 minutes presentation/talk and 10 minutes Q&A and discussions 10 minutes presentation/talk and 10 minutes Q&A and discussions  Pacific Islands Farmers Network Organisation (PIFON), Kyle Stice, Manager. Pacific Islands Farmers Network Organisation (PIFON), Kyle Stice, Manager.  Demystifying Value Chain Analysis -the farmer organisation experience. Demystifying Value Chain Analysis -the farmer organisation experience.  Fiji Rice Limited, Ashrit Pratap, Mill Manager. Rice strategy for sustainable food security. Fiji Rice Limited, Ashrit Pratap, Mill Manager. Rice strategy for sustainable food security.  "},{"text":"Fisheries Value Chains -Addressing bottlenecks, markets and business opportunities. Moderator: Dr Milika Sobey, Project Inception Adviser/Consultant, SPC; and Chairperson -Women in Fisheries Network Fiji Aliti Vunisea. Women fishers and supplies to markets. In allocated groups, each group to consider the two questions and discuss in your groups how to address these challenges, given the presentations you have heard earlier today. Following afternoon tea each group to do a brief presentation of their group discussions and key considerations.  10 minutes presentation/talk and 20 minutes Q&A and discussions 10 minutes presentation/talk and 20 minutes Q&A and discussions  Ministry of Fisheries & Forests, Aisake Batibasaga, Director Fisheries, Ministry of Ministry of Fisheries & Forests, Aisake Batibasaga, Director Fisheries, Ministry of  Fisheries and Forestry. Fisheries Sector Policy Agenda addressing sectoral challenges in communities Fisheries and Forestry. Fisheries Sector Policy Agenda addressing sectoral challenges in communities  and with private sector. and with private sector.  Fisheries Consultant, Secretariat of the Pacific Community Dr Tim Pickering, Aquaculture Adviser. Fisheries Consultant, Secretariat of the Pacific Community Dr Tim Pickering, Aquaculture Adviser.  Technical support to aquaculture and coastal fishers. Technical support to aquaculture and coastal fishers. 15:00 -15:40 Roundtable exercise: 15:00 -15:40Roundtable exercise:  "},{"text":"Priority Value Chains -Food Crops and Fisheries  TIME DAY 2: THURSDAY, 29 JUNE 2017 TIMEDAY 2: THURSDAY, 29 JUNE 2017 9:00 -9:15 Recap of Day 1 9:00 -9:15Recap of Day 1 9:15 -10:15 Panel 4: 9:15 -10:15Panel 4:  -How to strengthen value chains -How to strengthen value chains  -What efforts/assistance needed for farmers/fishers, communities, private sector, et al -What efforts/assistance needed for farmers/fishers, communities, private sector, et al  -Roles of others actors, women, youth in value chains &/or clusters -Roles of others actors, women, youth in value chains &/or clusters 15:40 -16:00 AFTERNOON TEA 15:40 -16:00AFTERNOON TEA 16:00 -16:45 Presentations back to plenary. Q&A and discussions 16:00 -16:45Presentations back to plenary. Q&A and discussions 16:45 -17:00 Summary of the day. 16:45 -17:00Summary of the day.  Workshop -Day 1 wraps up Workshop -Day 1 wraps up  5.30pm -7pm A reception will be held and all participants invited. 5.30pm -7pm A reception will be held and all participants invited.  "},{"text":"Women's Empowerment in Agriculture, Nutrition and Agribusiness: The Policy Environment & Learning from Good Practice. Moderator: Judith Francis, Senior Programme Coordinator, Science and Technology Policy & Pacific Regional Coordinator, CTA   10 minutes presentation/talk and 20 minutes Q&A and discussions 10 minutes presentation/talk and 20 minutes Q&A and discussions  Women Entrepreneurs Business Council, Eseta Nadakuitavuki, President. Women Entrepreneurs Business Council, Eseta Nadakuitavuki, President.  Networking & business counselling for women business owners. Networking & business counselling for women business owners.  Fiji Women in Fisheries Network Cherie Morris, Executive Committee Member. Fiji Women in Fisheries Network Cherie Morris, Executive Committee Member.  Fisherwomen supporting local markets and the potential for agritourism ventures. Fisherwomen supporting local markets and the potential for agritourism ventures.  Femlink Pacific Media Initiatives for Women, Sian Rolls, Programme Associate. Femlink Pacific Media Initiatives for Women, Sian Rolls, Programme Associate.  Utilising media and ICTs for collective advocacy to support women's business development. Utilising media and ICTs for collective advocacy to support women's business development.  UNWOMEN, Preeya Ieli, Regional Programme Specialist for Women's Economic UNWOMEN, Preeya Ieli, Regional Programme Specialist for Women's Economic  Empowerment. Markets For Change Project Empowerment. Markets For Change Project 10:15 -11:15 Panel 5: 10:15 -11:15Panel 5:  "},{"text":"Supporting Food Value Chains -the role of private sector, academia and civil society. Mere Salusalu, Technical Services Manager. Role of AMA in Fiji's agribusiness space and where to link with businesses  "},{"text":"Fiji Locally Managed Marine Protected Area Network, Alifereti Tawake, Fiji Coordinator. Conservation and environmental protection for sustainable economic development 11:15 -11:30 MORNING TEA BREAK 11:15 -11:30MORNING TEA BREAK 11:30 -12:30 Panel 6: 11:30 -12:30Panel 6:  "},{"text":"Enabling mechanisms to support value chain development, women's agribusinesses, and supporting nutritional development. Moderator: Dr Jimaima Lako, AgriNutrition Consultant 10 minutes presentation/talk and 10 minutes Q&A and discussions HFC Bank, Amitesh Karan, Business Relationship Manager. HFC trade finance portfolio to support Fiji's agribusinesses and SMEs. The Technical Centre for Agricultural and Rural Cooperation, Judith Francis, The Technical Centre for Agricultural and Rural Cooperation, Judith Francis, Senior Programme Coordinator. Seed funding and the innovation credit facility through the CTA/ Senior Programme Coordinator. Seed funding and the innovation credit facility through the CTA/ IFAD/PIPSO project. IFAD/PIPSO project.  "},{"text":"- Policy and regulatory frameworks and resource support needed -Consideration in local context, communal, national and even regional 2. Enabling mechanisms and conducive environments -Ideally, what would a conducive environment look like with what appropriate mechanisms -Who are the key actors/agencies to facilitate and drive this -Can national v regional environment or mechanisms facilitate positive change derive results 13:00 -13:45 LUNCHLunch will be served in the main restaurant, Ground Floor. 13:45 -14:15 Presentations back to plenary 13:45 -14:15Presentations back to plenary  Q&A and discussions Q&A and discussions 14:15 -14:45 Consensus Building 14:15 -14:45Consensus Building  "},{"text":"and Joint Action Plan (Road Map) for Future Interventions: Development and Upgrade of Priority Local Value Chains -Reflecting on (i) presentations (ii) group work presentations (iii) Q&A feedback and discussions, what are some concrete actions that can be formulated for implementation with a focus on influencing key policy and regulatory frameworks, and mechanisms for supporting private sector agribusiness development, and addressing nutrition and NCDs. 14:45 -15:00 Summary of Day 2 proceedings, and of 2-day workshop 14:45 -15:00Summary of Day 2 proceedings, and of 2-day workshop  The Forward Agenda The Forward Agenda  Workshop closing Workshop closing 15:00 Workshop closes 15:00Workshop closes  "}],"sieverID":"2a21ec3c-6149-4deb-ac11-aff9f5638c5f","abstract":"The Technical Centre for Agricultural and Rural Cooperation (CTA) is a joint international institution of the African, Caribbean and Pacific (ACP) Group of States and the European Union (EU). CTA operates under the framework of the Cotonou Agreement and is funded by the EU. For more information on CTA, visit www.cta.int"}

data/part_1/0927ec55153e868c77b62c3a0218ac7b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0927ec55153e868c77b62c3a0218ac7b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/67b7f130-2459-40d3-863c-f7555830bc7d/retrieve"},"pageCount":14,"title":"High accuracy of genome-enabled prediction of belowground and physiological traits in barley seedlings","keywords":["seminal root angle","seminal root number","transpiration rate","MAGIC","barley","genomic prediction","threshold GBLUP","MPP","Multiparental Populations","Multiparent Advanced Generation Inter-Cross (MAGIC)"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":300,"text":"Despite their importance for the uptake of water and nutrients, belowground traits have been largely neglected for crop improvement as breeding efforts have predominantly targeted aboveground traits related to yield formation. Nevertheless, there is evidence that thousands of years of empirical selection have also indirectly reshaped the root system architecture of domesticated species, corroborating the importance of belowground traits for crop yield and the existence of a correlation between these traits (de Dorlodot et al. 2007;Herder et al. 2010;Jia et al. 2019). In cereals, experimental results and crop simulation models (CSMs) have pointed out that genotypes with a deeper root system architecture can cope with drought and heat stresses, increasing grain yield (GY) in dry environments (Manschadi et al. 2008;Mu et al. 2015;Liu et al. 2017;Tao et al. 2017). For instance, in durum wheat, contrasting root system architectures correlate with drought-intolerant and drought-tolerant genotypes showing higher GY under sub-optimal water regimes (El Hassouni et al. 2018). In this species, it has been shown that deeper root system architectures can increase GY from 16% to 35% in environments with limited soil moisture and from 9% to 24% in irrigated sites (El Hassouni et al. 2018). Similarly, in bread wheat narrower and deeper root system architectures with more branching at depth allow to provide greater access to soil moisture in environments experiencing terminal drought (Manschadi et al. 2008). In maize, it has been shown that the increase of root size improves nitrogen absorption and GY (Mu et al. 2015) and that a more efficient root system is more important than canopy architecture for determining plant growth rate and biomass accumulation (Hammer et al. 2009). Consequently, the improvement of crops targeting the root system architecture and belowground traits is high desirable to enhance productivity and cope with climate change (Tracy et al. 2020)."},{"index":2,"size":307,"text":"In cereals, the root system architecture of seedlings can be dissected into primary or seminal roots and nodal or secondary roots. While seminal roots develop first from the primordia of the embryo and grow out from the coleorhizae, the development of nodal roots begins at the tillering stage from the basal nodes of the crown (Wahbi and Gregory 1995). In bread and durum wheat, it has been shown that the seminal root number (SRN) and the seminal root angle (SRA), that is the angle measured between the first pair of seminal roots or between the 2 outmost seminal roots at the seedling stage, are 2 proxy traits that can predict the root system architecture at the adult stages (Manschadi et al. 2008;El Hassouni et al. 2018;Alahmad et al. 2019). For instance, reduced SRA and higher SRN in bread wheat seedlings correlate with drought-tolerant genotypes (e.g. Baxter, Babax, and Dharwar Dry, SeriM82), which exhibit a deeper and more compact root system architecture at the adult stages (Manschadi et al. 2008). In barley, the assumption that SRA and SRN measured in seedlings are proxies of the root system architecture of mature plants has not been directly assessed, although in spring, genotypes moderate correlations between these belowground traits and GY have been observed in field trials organized in 20 rainfed and irrigated siteby-season combinations (Robinson et al. 2018). Recently, phenotypic variation for SRA and SRN has been assessed in a large panel of spring barley and exploited to map loci that underlie these traits using genome-wide association studies (Jia et al. 2019). Although phenotyping platforms and technologies to analyze the whole root system architecture at mature stage of development are progressively becoming widespread, the incorporation of belowground traits in actual breeding programs is still in its infancy and might benefit from using SRA and SRN, which can be easily scored."},{"index":3,"size":420,"text":"The evaporative demand or vapor pressure deficit (VPD) points out the difference between the saturated and the actual vapor pressure of air at a given temperature and drives the transpiration rate (TR) of crops (Kholova ´et al. 2012). In field conditions, either soil drought or atmospheric drought, that is the combination of high temperatures and low humidity, does not allow crops to satisfy the required evaporative demand and climate change is expected to exacerbate this phenomenon (Lobell and Gourdji 2012;Medina et al. 2019). CSMs have pointed out that, beyond the root system architecture, the TR response to VPD is an important physiological trait that might be targeted to cope with high evaporative demand and increase GY (Tao et al. 2009(Tao et al. , 2017)). In fact, the reduction of water flux to leaves for limiting TR at high levels of VPD is a water-saving strategy that imposes physiological trade-offs in leaf dehydration and senescence and allows crops to better manage soil moisture to overcome drought stress. While this water-saving strategy might cause yield penalty when soil moisture is not a limiting factor, in sorghum and maize, experimental evidence has shown that limiting TR at high evaporative demand can allow to increase GY in dry environments (Sinclair et al. 2005). As substantiated for belowground traits, TR response to VPD is a key physiological trait that can serve as proxy trait for drought tolerance (Schoppach andSadok 2012, 2013;Schoppach et al. 2016). In durum wheat, the variation of TR response has allowed to identify at least 2 different sets of genotypes showing linear and segmented trends of TR in response to VPD and interestingly, these different responses have been correlated with different GY performances and biomass production in rainfed and irrigated field trials (Medina et al. 2019). In sorghum and chickpeas, closing of stomata for limiting TR has been correlated with genotypes that have a better ability to retain soil moisture and contribute to yield formation under drought stress (Devi et al. 2015;Sivasakthi et al. 2017;Medina et al. 2019). While phenotypic diversity in TR response to VPD has been widely assessed in bread and durum wheat (Schoppach and Sadok 2012;Schoppach et al. 2017), the knowledge of this trait in barley has lagged behind and to date its natural variation has been assessed in a limited panel of 25 wild barley and in 1 cultivar, which corroborate the existence of untapped diversity for TR in barley germplasm (Sadok and Tamang 2019) that might be exploited for barley improvement and development of more drought-tolerant genotypes."},{"index":4,"size":328,"text":"Genomic prediction (GP) aims to regress genome-wide single nucleotide polymorphisms (SNPs) or other types of DNA markers on phenotypes of individuals to simultaneously predict their effects (Meuwissen et al. 2001). The population of individuals having both phenotypic and genotypic information is known as training population (TP) and is used for constructing predictive models, which allow to compute \"Genomic Estimated Breeding Values\" (GEBVs) in individuals for which only genotyping information is available (Desta and Ortiz 2014). Typically, the predictive models used in GP require to regress a number of predictors (DNA markers) that greatly exceeds the number of observations or phenotypes and several parametric and nonparametric models have been proposed to deal with overfitting and the \"large p, small n\" problem (Meuwissen et al. 2001;Jannink et al. 2010; P erez and de los Campos 2014b) as in these conditions, the estimation of marker effects using the ordinary least squares method is not practicable. Unlike methods based on whole genome regression of markers, the genomic best linear unbiased prediction (GBLUP) method treats genomic values of individuals as random effects in a linear mixed model and uses a genomic relationship matrix based on DNA marker data to compute GEBVs (VanRaden 2008;Wang et al. 2018). Interestingly, under certain assumptions, it has been demonstrated that GBLUP and ridge regression of markers are actually equivalent models (Habier et al. 2007). To date, in plant breeding, GP has been mainly applied for improving GY (Crossa et al. 2017), but this methodology offers the possibility to predict other traits of agricultural interest that cannot be easily scored (e.g. belowground and physiological traits correlated with abiotic stress tolerances). For instance, GP models have been fitted to seed size (Nielsen et al. 2016), thousand grain weight, number of grains per m 2 , grain plumpness (Bhatta et al. 2020), root vigor (Biscarini et al. 2014), straw breaking and lodging (Tsai et al. 2020), beta-glucan and grain protein content (Bhatta et al. 2020), and starch (Tsai et al. 2020)."},{"index":5,"size":138,"text":"In the present study, we examined the diversity and distribution of belowground (SRA and SRN) and physiological (TR response to increasing VPD) traits at the seedling stage in an 8-way Multiparent Advanced Generation Inter-crosses (MAGIC) population of winter barley and in its founder parents (Puglisi et al. 2021). We correlated phenotypic data of SRA, SRN, and TR scored in controlled conditions with GY obtained in different site-byseason combinations to re-assess the relevance of belowground and physiological traits of seedlings for the uptake of nutrients and water. Leveraging on phenotypic and genotypic information, we fitted and cross-validated different GP models including different sets of linear predictors and showed that these models can successfully predict SRA, SRN, and TR and might pave the way for incorporating these traits in actual breeding programs, underpinning ideotype breeding and characterizing large plant collections."}]},{"head":"Materials and methods","index":2,"paragraphs":[]},{"head":"Plant materials and genotyping","index":3,"paragraphs":[{"index":1,"size":77,"text":"The MAGIC population examined in this study and used for genome-enabled predictions has been extensively described elsewhere (Puglisi et al. 2021). Particularly, the set of 89 MAGIC lines used in the present study (Supplementary Tables 1 and 2) corresponds to the TP previously assembled for fitting multienvironment GP models and genotyped using the barley 50K SNP chip (Puglisi et al. 2021). In the present study, 20,426 polymorphic SNPs were used for fitting GP models (Supplementary File 1)."}]},{"head":"Phenotyping of plant material","index":4,"paragraphs":[{"index":1,"size":207,"text":"The set of MAGIC lines was phenotyped in the following site-byseason combinations to examine GY and heading date: Fiorenzuola d'Arda (Italy, 2016(Italy, , 2017(Italy, , 2018(Italy, , 2019) ) at CREA-Centro di Genomica e Bioinformatica (44 55'39.0 00 N 9 53'40.6 00 E, 78 m above sea level), Marchouch (Morocco, 2016(Morocco, , 2019) ) at ICARDA Experimental station (33 36'43.5 00 N 6 42'53.0 00 W, 390 m above sea level), Adana (36 59 0 52.9 00 N 35 20 0 28.0 00 E, 24 m above sea level), and Konya (37 53 0 37.9 00 N 32 37 0 26.0 00 E, 1,005 m above sea level) (Turkey, 2019). These data, excluding phenotypic data collected in Marchouch during the growing season 2018-2019, are part of the data set previously analyzed (Puglisi et al. 2021). All these experiments were conducted following local management practices, except for field trials organized in Fiorenzuola d'Arda during 2017-2018 and 2018-2019 growing seasons as they were conducted using 2 different levels of nitrogen fertilization as previously described (Puglisi et al. 2021). The detailed procedure for analyzing field trial data and deriving the adjusted means of GY is described in the Supplementary text 1 \"Procedure for deriving the adjusted means of grain yield.\""},{"index":2,"size":103,"text":"SRA and SRN were phenotyped using the clear pot method (Richard et al. 2015;Robinson et al. 2016) at ICARDA's physiology laboratory under controlled temperature and humidity according to the original protocol (Richard et al. 2015) and using transparent ANOVApot pots (Anovapot Pty Ltd, Brisbane, QLD, Australia, www.anovapot.com/php/anovapot.php) with a diameter of 200 mm, height of 190 mm, and a volume of 4 L. The detailed procedure and the experimental design to phenotype SRA and SRN and for computing the adjusted means of SRA is described in the Supplementary text 2 \"Procedure for phenotyping SRA and SRN and deriving the adjusted means of SRA.\""},{"index":3,"size":202,"text":"The TR response under progressive VPD was examined at ICARDA's physiology laboratory under controlled conditions. This experiment was designed randomizing the 90 MAGIC lines using 3 biological replicates per genotype, using 2 L pots with diameter and height of 104 and 200 mm, respectively. In each pot, plants were sown at a depth of circa 2 cm and were uniformly irrigated every 2 days. At Zadoks stage 14 (Zadoks et al. 1974), which was reached after 4-5 weeks after sowing, depending on the genotype, pots were irrigated until reaching the maximum water holding capacity of the substrate. The day after, pots were subsequently closed with plastic bags and balls in order to limit evaporation. TR was measured under increasing VPD ranging from 0.4 to 5.4 kPa in a greenhouse under controlled conditions (temperature and humidity) accurately monitored with data loggers (Type TGU-4550, Gemini Data Loggers, UK). Phenotyping of plants and the computation of TR under increasing VPD conditions was carried out following published protocols (Fletcher et al. 2007;Sadok andSinclair 2009a, 2009b;Schoppach and Sadok 2012;Schoppach et al. 2017;Tamang and Sadok 2018;Sadok and Tamang 2019) and described in detail in the Supplementary text 3 \"Procedure for estimating the TR at different values of VPD.\""}]},{"head":"Descriptive statistics and correlation analyses","index":5,"paragraphs":[{"index":1,"size":142,"text":"Variation in GY and SRA in the panel MAGIC lines was investigated computing maximum and minimum values, mean, median, and standard deviation (SD). This descriptive analysis was computed using \"metan\" package (Olivoto and Lu ´cio 2020) implemented in R 4.0.3 statistical (R Core Team 2019). The adjusted means of GY and SRA, along with SRN and TR measured at a VPD of 2.7 kPa were analyzed and correlated each other. Two different types of correlations were applied on the basis of variable type: Pearson's correlation coefficient was applied to compute correlation between continuous traits (GY, SRA, and TR measured at a VPD of 2.7 kPa), while polyserial correlations were computed to measure correlations between continuous and categorical variables (Drasgow 2006). These latter set of correlation analyses was computed using \"polycor\" package (Fox 2010) implemented in R 4.0.3 statistical (R Core Team 2019)."}]},{"head":"GP models fitted to SRN","index":6,"paragraphs":[{"index":1,"size":85,"text":"In the present study, 2 different GP models were fitted to SRN combining phenotypic data with genotypic information obtained with the Barley 50 k SNP chip (Puglisi et al. 2021). For this trait, GP models were fitted following 2 different hypotheses. First, we assumed that SRN varies as an ordinal discrete variable that indicates the performance of plants at the adult stage under nitrogen or water deficiency and for this aim, threshold genomic best linear unbiased predictor (TGBLUP) models and extended TGBLUP models were fitted."},{"index":2,"size":122,"text":"Formal presentation of the model theory of GP for ordinal discrete data was disserted elsewhere (Montesinos- Lo ´pez et al. 2015a). Here, we shortly introduce the TGBLUP models used in the present study for implementing GP. For SRN, we assumed that the ordinal response variable y ik , that is the number of observed seminal roots, can take C¼7 mutually exclusive c values, where i indicates the genotype, k points out the number of replicates, and c takes values equal to the number of observed seminal roots observed in the MAGIC population, that is c ¼ 2; 3; 4; 5; 6; 7; 8. Moreover, we supposed that the ordinal response variable y ik follows a multinomial distribution with parameters N ik and"},{"index":3,"size":10,"text":"where N ik points out the number of observation and"},{"index":4,"size":131,"text":"out the probabilities of getting values c ¼ 2; 3; . . . 8 in the i th genotype in the k th replicate. Threshold models assume that y ik is generated from an underlying continuous random variable l ik , having a normal distribution, which is called latent \"liability\" variable (Sorensen et al. 1995;Montesinos-Lo ´pez et al. 2015a) and imply that for C ordinal and mutually exclusive categories the existence of C À 1 ¼ 6 unknown c thresholds that must be estimated such as c min < c 1 < c 2 < c 3 : < c max , with c min ¼ À1 and c max ¼ þ1. In threshold models, values of l ik are mapped to the ordinal categorical response according to the following conditions:"},{"index":5,"size":54,"text":"In these models, the link function relating linear predictors with the probability of observing data is the cumulative probit Uð:Þ, that is the cumulative distribution function of a standard normal distribution and U À1 is the corresponding inverse function. Consequently, threshold models are specified with C À 1 linear predictors g ikc as follows:"},{"index":6,"size":55,"text":"where X T ik is a known row incidence vectors of fixed effects, Z T ik is a known row incidence vectors of random effects, b points out the vector of fixed effects, and b is the vector of random effects. The probabilities p ikc are linked to the linear predictors g ikc as follows:"},{"index":7,"size":4,"text":". . . ::"},{"index":8,"size":22,"text":"As mentioned above, threshold models assume that the latent and normally distributed variable l ik generates the observed C categories as follows:"},{"index":9,"size":84,"text":"where the error terms e ik are independent and identically distributed and follow a normal distribution with mean 0 and SD equals to 1, that is e ik $ Nð0; 1Þ. In the present study, different combinations of linear predictors, including replicates, lines, markers, and first-order epistatic effects, were incorporated in X T ik and Z T ik for fitting 5 extended threshold models (Table 1), which were already substantiated and described in other studies (Jarqu ın et al. 2014;Montesinos-Lo ´pez et al. 2015a)."},{"index":10,"size":11,"text":"The resulting 5 models include the following sets of linear predictors:"},{"index":11,"size":53,"text":"where l ik is the latent \"liability\" variable of k th replicates in the i th line. SRN-Model 1 includes R k , which is the fixed effect of k th replicates and L i that is the random effect of the i th line supposed to be independent and normally distributed as"},{"index":12,"size":160,"text":". SRN-Model 2 includes g i , which points out the additive genetic value of the i th line, that is g i ¼ P p n¼1 x in b n , where x in is the genotype of the i th line at marker n and b n is the corresponding effect of marker n. The vector of additive genetic value g ¼ ðg 1 ; g 2 ; g 3 . . . . . . g i Þ is supposed to be normally distributed as g $ N 0; Gr 2 g with mean 0 and variance-covariance structure Gr 2 g , where r 2 g points out the additive genetic variance r 2 g and G is the genomic marker relationship matrix (VanRaden 2008). SRN-Model 3 extends SRN-Model 2 including first-order multiplicative epistatic effects g A ¼ ðg A1 ; g A2 ; . . . g Ai Þ, which are assumed to be distributed as"},{"index":13,"size":105,"text":", that is the vector of epistatic effects follows a normal distribution with mean 0 and epistatic additive  additive genetic variance r 2 gA (Montesinos-Lo ´pez et al. 2015a). Finally, SRN-Model 4 includes R k ; L i ; and g i as linear predictors, while SRN-Model 5 extends SRN-Model 4 including g Ai effects. In the present study, the aforementioned threshold models were implemented in a Bayesian framework using BGLR package (P erez and De Los Campos 2014a) in R 4.0.3 statistical (R Core Team 2019) using default prior distributions and modifying codes published in other studies (Montesinos- Lo ´pez et al. 2015a)."},{"index":14,"size":182,"text":"Second, we handled SRN as count data for predicting this trait per se, fitting 5 log-normal GP models based on GBLUP and indicated as SRN-log-Model 1-5 (Table 1) (Montesinos- Lo ´pez et al. 2015b). In SRN-log-Model 1-5, the response variable is the logarithm of SRN, that is logðy kj þ 1Þ, and was fitted using the same sets of linear predictors (R k , L j , g j , g Aj ) described for the 5 extended TGBLUP models [Table 1;]. In these models, R k , L j , g j , g Aj follow the same distributions defined for the extended TGBLUP models except for the error terms e ik of K th replicates in i th line, which in these models is distributed as e ik $ N 0; r 2 e À Á , that is the residuals are independent and normally distributed with mean 0 and variance r 2 e . Like TGBLUP models, log-normal models were implemented using BGLR package (P erez and De Los Campos 2014b) in R 4.0.3 statistical (R Core Team 2019)."},{"index":15,"size":28,"text":"Table 1. Summary of the linear predictors incorporated in the GBLUP and TGBLUP models used to analyze SRN, SRA, and TR. GP models fitted for SRA and TR"}]},{"head":"Model","index":7,"paragraphs":[]},{"head":"Main effects Interaction","index":8,"paragraphs":[{"index":1,"size":32,"text":"The 5 sets of linear predictors used in the extended TGBLUP models (Table 1) were used for predicting SRA and TR measured at a VPD of 2.7 kPa, using the following models:"},{"index":2,"size":114,"text":"where y i is the adjusted mean of SRA [Equations (7-11)] or TR [Equations (12-16)], i is the error term of the i th measurement with i $ N 0; r 2 e À Á , that is that the errors are independent and identically distributed with mean 0 and variance r 2 e . In these models, the linear predictors L j , g j , and g Aj follow the same distribution defined for TGBLUP models. These extended GBLUP models (SRA-Models 1-5, TR-Model 1-5) were implemented using BGLR package (P erez and De Los Campos 2014a) in R 4.0.3 statistical (R Core Team 2019) as censored data described with the following interval"},{"index":3,"size":59,"text":"where y i is the adjusted mean of SRA or TR computed as best linear unbiased estimator (BLUE), a i is the lower bound estimate of y i computed as the difference between y i and 2 SD, and b i is the upper bound estimate of y i computed as the sum of y i with 2 SD."}]},{"head":"Cross-validation of GP models","index":9,"paragraphs":[{"index":1,"size":41,"text":"For the extended TGBLUP models, leave-one-out (LOO) cross-validation was carried out and predictive ability was estimated using both Brier Score (BS) and the proportion of cases correctly classified (PCCC) (Brier 1950;Montesinos-Lo ´pez et al. 2015a, 2020). BS was computed as follows:"},{"index":2,"size":139,"text":"where pic À d ic ð Þ 2 is the average square difference between pic predictions and d ic classes for observation i into category c. BS obtained with Equation ( 17) was divided by 2 in order to have a range that varies from 0 to 1 (Brier 1950;Montesinos-Lo ´pez et al. 2015a). For the other models used in the present study (extended GBLUP and log-normal models), the predictive accuracy of GP models was calculated as the Pearson's correlation coefficient between GEBVs and the corresponding adjusted means of the trait (SRA, TR measured at a VPD of 2.7 kPa). Unlike the Pearson's correlation coefficient used for the extended GBLUP models for SRA and TR, lower values of BS point out higher predictive ability of the models, while higher values of BS point out lower predictive ability of models."}]},{"head":"Results","index":10,"paragraphs":[]},{"head":"Phenotypic distribution and analysis of belowground and physiological traits in the barley MAGIC population","index":11,"paragraphs":[{"index":1,"size":57,"text":"To assess the variability of SRA and SRN, the panel of MAGIC lines was phenotyped at the seedling stage under controlled conditions. This analysis showed that SRN varies greatly in the MAGIC population as it ranges between 2 and 8 with a mean of 5 seminal roots and a SD of 0.84 (Fig. 1a; Supplementary Table 1)."},{"index":2,"size":107,"text":"The adjusted means of SRA and the corresponding 95% confidence intervals of estimates were computed using BLUEs, analyzing the adopted experimental design with a linear mixed model, which was fitted to the raw measurements of SRA. This analysis indicated that the phenotypic distribution of SRA ranges from 57.75 (genotype \"M18\") to 106.40 (genotype \"M324\") with an average value of 86.61 (Fig. 1b; Supplementary Table 2). Both belowground traits exhibit a bell-shaped distribution (Fig. 1, a and b) and particularly, Shapiro-Wilk normality test showed that, for SRA, the null hypothesis, that is that the adjusted means of SRA follow a normal distribution, cannot be rejected (P-value ¼ 0.1844)."},{"index":3,"size":192,"text":"The whole-plant TR was measured in the set of MAGIC lines at the seedling stage using increasing VPD values ranging from 0.4 to 5.4 kPa. Regression of whole-plant TR on VPD values was carried out using linear and segmented models and R-squared was used as goodness-of-fit measure for model selection. Regression of whole-plant TR on VPD values showed a segmented response in a large fraction of genotypes, while in 28 MAGIC lines model fitting and selection indicated a linear response of TR to increasing levels of VPD (Supplementary Table 2). The breakpoint values of genotypes showing a segmented trend of TR to increasing VPD ranged from 2.3 to circa 2.5 kPa, in agreement with the results presented in previous studies (Sadok and Tamang 2019). Consequently, we investigated the variability of whole-plant TR at a VPD of 2.7 kPa, which is a VPD value higher than the breakpoints of genotypes showing a segmented TR response. This analysis showed that the panel of MAGIC exhibits circa a 5-fold variation of TR as measured values range from 4.05 (genotype \"M382\") to 13.6 (genotype \"M150\") mg H2O m À2 s À1 (Fig. 1c; Supplementary Table 2)."}]},{"head":"Correlation of belowground and physiological traits with GY","index":12,"paragraphs":[{"index":1,"size":276,"text":"A genotype  environment (GGE) biplot analysis was carried out using the adjusted means of GY to assess the level of correlation among site-by-season combinations and identify environments with peculiar bio-climatic parameters (Fig. 2a). This analysis indicated that AdaIN and FioIN show the highest environmental similarities, while compared to the remaining environments, MarIN is the most dissimilar one as already substantiated in other studies (Puglisi et al. 2021) owing to the dryer and hotter conditions of this site. For assessing whether belowground and physiological traits might contribute to determining yield formation under limiting nitrogen (FioLN) and water conditions (MarIN), we correlated GY with SRN, SRA, and TR measured at a VPD of 2.7 kPa, computing Pearson's correlation coefficient for pairs of continuous traits (GY, SRA, and TR) and polyserial correlation coefficient for pairs of continuous and discrete (SRN) traits (Fig. 2b). This pairwise correlation D. Puglisi et al. | 5 analysis indicated that SRN shows a positive and moderate correlation with SRA (r ¼ 0.22, P-value ¼ 0.07) (Fig. 2b; Supplementary Fig. 1), while GY in FioLN exhibited positive correlations with SRN, showing a value of 0.28 (P-value ¼ 0.02) (Fig. 2b; Supplementary Fig. 1). Unexpectedly, no significant correlations were observed between GY measured in MarIN with belowground and physiological traits. Overall, GY showed positive correlations among KonIN, AdaIN, and FioIN, while no significant correlations were observed between MarIN and the remaining sites (KonIN, AdaIN, FioIN, and FioLN) (Fig. 2b).     6). Overall, model comparison indicated that for SRN, log normal models that explicitly incorporate markers and first-order additive  additive epistatic interactions capture a larger fraction of the total phenotypic variability and have better predictive ability."}]},{"head":"Prediction of SRA in barley seedlings","index":13,"paragraphs":[{"index":1,"size":235,"text":"As with log-normal models, the GBLUP counterpart of the 5 TGBLUP models used for predicting SRN were fitted to SRA. These 5 models incorporate the main effects and interactions used for SRN [Table 1; Equations (7-11)] but assume that the response variable, that is SRA, is continuous and follows a normal distribution. The adjusted means of SRA were combined with 20,426 polymorphic SNPs detected in this panel of MAGIC population to fit these extended GBLUP models. The analysis of variance components of these 5 models showed that \"SRA-Model 5,\" which incorporates line, marker, and first-order additive  additive epistatic interaction effects, has a lower error variance compared to the other models considered in the present study and allows to better fit data (Fig. 7a; Supplementary Table 7). The variance of first-order additive  additive epistatic interaction was 27.79% for SRA-Model 3 and 17.81% for SRA-Model 5 (Fig. 7a; Supplementary Table 7). LOO cross validation pointed out that the predictive ability values of these models, measured using Pearson's correlation coefficient between predicted and observed data, range from 0.19 (SRA-Model 2) to 0.73 (SRA-Model 1), while SRA-Model 3, SRA-Model 4, and SRA-Model 5 show predictive ability values of 0.37, 0.49, and 0.53, respectively (Fig. 7b; Supplementary Table 7). As observed for log-normal models (SRN-log-Models 1-5), models that predict SRA incorporating marker and first-order epistatic effects in the linear predictors show higher predictive ability and better model fitting."}]},{"head":"Models for predicting TR under high evapotranspiration demand","index":14,"paragraphs":[{"index":1,"size":206,"text":"The 5 combinations of linear predictors incorporated in GP models fitted to SRA and SRN data [Table 1; Equations (12-16)] were used to predict TR at a VPD of 2.7 kPa. The analysis of variance components of these 5 models showed that \"TR-Model 5,\" which incorporates line, marker, and first-order additive  additive epistatic interaction effects as linear predictors, has a lower error variance compared to the other models considered in the present study and allows to better fit the data (Fig. 8a; Supplementary Table 8). The analysis of variance components showed that firstorder additive  additive epistatic interaction effects explain 21.93% and 15.69% of the total variance for TR-Model 3 and TR-Model 5, respectively (Fig. 8a; Supplementary Table 8). LOO cross validation pointed out that the predictive ability values of these models, measured using Pearson's correlation coefficient between predicted and observed data, range from 0.68 (TR-Model 2) to 0.96 (TR-Model 1), while TR-Model 3, TR-Model 4, and TR-Model 5 show predictive ability values of 0.89, 0.95, and 0.95, respectively (Fig. 8b; Supplementary Table 8). Like observed for GP models fitted to belowground traits, this analysis demonstrated that models that explicitly incorporate marker and interaction effects fit better the TR data and have better predictive ability."}]},{"head":"Discussion","index":15,"paragraphs":[{"index":1,"size":69,"text":"In the present study, the phenotypic variability of SRN, SRA, and TR under increasing evaporative demand was surveyed in a panel of MAGIC lines of barley (Supplementary Tables 1 and 2). The results showed that, in this genetic material, SRN can vary from 2 to 8 (Fig. 1a), consistently with other studies carried out on populations of mostly unrelated accessions of barley (Robinson et al. 2016;Jia et al. 2019)."},{"index":2,"size":387,"text":"In the scientific literature, protocols for SRA phenotyping propose to examine the first pair of seminal roots (Robinson et al. 2016) or the 2 outmost seminal roots (Jia et al. 2019). Following the first protocol, in the present study, SRA between the first pair of seminal roots has been measured, and the comparison of our results with those obtained in other works carried out following the same methodology (Robinson et al. 2016(Robinson et al. , 2018) ) points out that  the SRA has a wider phenotypic distribution in MAGIC lines. On the other side, the lack of common genotypes between these experiments hampers our ability to compare results across different studies and does not allow to attribute the wider distribution of SRA detected in our genetic material to confounding or genetic effects. Unlike the findings reported in other studies (Robinson et al. 2016), SRA and SRN measured in barley seedlings showed a moderate correlation (r ¼ 0.22; Fig. 2b), slightly above the threshold of significance (P-value ¼ 0.07; Supplementary Fig. 1). Nevertheless, this comparison is not exhaustive as in other studies SRN was handled as a continuous trait and the phenotypic variability was presented using the adjusted means (BLUE or BLUP), while in this research work SRN was analyzed as a discrete trait. The analysis of SRN as continuous or discrete phenotypic trait implies different assumptions, which in turn hamper the comparisons of trait correlations; as in our analysis, SRN was considered as a discrete trait and consequently the polyserial correlation between SRA and SRN was computed instead of using Pearson's correlation coefficient. Interestingly, the present study indicated a moderate and positive and significant correlation of SRN (r ¼ 0.28; P-value ¼ 0.02) with GY measured in FioLN, which was managed with reduced amount of nitrogen (Fig. 2b; Supplementary Fig. 1). As highlighted for other cereal crops, this correlation suggests a link between the root architecture system and the ability of barley to grow in soils with a reduced nitrogen fertilization without experiencing yield penalty. Anyway, the sample size of this analysis along with the inclusion of only 2 site-by-season combinations organized with this nitrogen management impose to carry out other studies to definitively underpin the tie between these belowground traits measured at the seedling stage and the ability to promote yield formation under limiting nitrogen conditions."},{"index":3,"size":209,"text":"In recent years, TR has been widely targeted in different crops to exploit its correlation to drought tolerance (Schoppach andSadok 2012, 2013;Schoppach et al. 2016). Nevertheless, in barley, the analysis of TR in response to high evaporative demand has lagged behind and to date has been investigated on a limited panel of 25 wild barley and in 1 cultivar (Sadok and Tamang 2019), which showed that at a VPD of circa 2.7 kPa, TR ranges from circa 25 to 75 mg H2O m À2 s À1 depending on the genotype. Our study confirms that in barley, the TR at high evaporative demands is significantly lower than the values observed in other cereal crops (Schoppach and Sadok 2012;Sinclair et al. 2017;Tamang and Sadok 2018) and that the TR measured in our MAGIC population exhibits lower values of TR compared to other results obtained in barley at the same VPD values (Sadok and Tamang 2019). As substantiated with SRA and SRN analyses, technical causes and the lack of common genotypes hamper cross-study comparison of TR in different barley germplasm, but it is plausible that, in general, our MAGIC population has a lower TR response to high evaporative demand compared to the barley genotypes investigated in other studies (Sadok and Tamang 2019)."},{"index":4,"size":117,"text":"Unexpectedly, our analyses did not detect significant correlation between TR and GY measured in MarIN, which is the hottest and driest environment investigated in this study pointing out that, in barley, this trait might exhibit correlation with GY under harsher conditions. In field trials, GY depends on the genotypic values of plants and environmental factors that exert their influence from sowing to harvest and consequently it is not surprising to detect inconsistent correlations with the belowground and physiological traits examined in the present study. The present study does not address the correlations between SRN, SRA, and TR measured at the juvenile stage and the root architecture of mature barley, which remain still unclear and deserve additional analyses."},{"index":5,"size":380,"text":"In the present study, genomic-enabled prediction of SRA, SRN, and TR measured at a VPD of 2.7 kPa was carried out, leveraging on prediction models for different types of data (continuous, count, and ordinal) and we showed that these traits can be modeled with high predictive ability. These findings are relevant for barley improvement and ideotype breeding as can pave the way to exploit untapped plant collection minimizing phenotyping costs. For standard, log normal, and TGBLUP GP models, we used 5 sets of linear predictors, which differ for the types of effects considered (Table 1). Using TGBLUP models, we observed that the inclusion of additive  additive epistatic interaction (G  G) in the set of linear predictors (SRN-Model 3 and SRN-Model 5) increases the total variance that models account for (Table 2). These results are corroborated in log-normal GP models, as also these models benefit of the inclusion of additive  additive epistatic interaction in the set of linear predictors . Overall, for all traits examined in the present study, we found that the inclusion of interaction effects brings advantages both in model fitting and predictive ability, as already substantiated in several studies (Varona et al. 2018). Despite being called additive  additive epistatic interactions, the functional interpretation of these effects and of the variance component counterpart may be misleading as their existence in nonadditive GP models and genomewide association studies does not prove the role of epistasis in the actual genetic architecture of these traits (de los Campos et al. 2019;Schrauf et al. 2020). Particularly, the low marker density used in the present study to fingerprint the panel of MAGIC and the incomplete linkage disequilibrium of markers (Puglisi et al. 2021) favor the detection of phantom epistasis in nonadditive GP models, that is the portion of additive effects that is not captured in the models due to incomplete linkage disequilibrium generates apparent epistasis, which is in turn detected in our models including additive  additive epistatic interactions (de los Campos et al. 2019;Schrauf et al. 2020). While the functional interpretation of first-order additive  additive effects might be questionable, the inclusion of epistatic effects in GP should be considered in conditions that foster the emergence of apparent epistasis to improve predictive ability of models (Schrauf et al. 2020)."},{"index":6,"size":156,"text":"Several traits that are relevant for plant breeding are not normally distributed and need to be analyzed using special statistical techniques (Montesinos- Lo ´pez et al. 2015a). Traits that fall in this category are proportion of plants that overcome a stress, disease resistance scored using discrete scales, and SRN. In the present study, we used TGBLUP models assuming that SNR varies as an ordinal discrete variable indicating the ability of plants to grow under water or nutrient scarcity. (Montesinos- Lo ´pez et al. 2015a). Despite the low values of variance explained by molecular markers (Table 2), the TGBLUP models fitted to SRN showed high predictive ability values (Brier Score equals to 0.36) (Fig. 5), highlighting that GP can be successfully applied to traits showing low heritability as already substantiated in other studies carried out in plants (Zhang et al. 2017; Kla ´p st e et al. 2020) and animals (Guo et al. 2014;Iheshiulor et al. 2016)."},{"index":7,"size":223,"text":"Count data arise in plant breeding when the trait of interest is the sum of discrete quantities that can take only integer values (e.g. the number of tillers per plant or the number of seminal roots in seedlings). Currently, for this type of data, GP models are fitted using standard GBLUP along with log transformed data or specific generalized mixed linear models that use a link function D. Puglisi et al. | 11 based on Poisson or Negative Binomial distributions (Montesinos- Lo ´pez et al. 2016). This latter group of models have been recently formalized, implemented in a Bayesian framework, and compared with log-normal models for count data (Montesinos- Lo ´pez et al. 2016). In the present study, GP for SRN was modeled as count data fitting log-normal GP models as preliminary tests showed that the computational demand of these models does not counterbalance the higher predictive ability of these models. Multitrait GP might be a natural approach to exploit SRA, SRN, and TR response at high VPD as multivariate GP has been shown, using either real or simulated data sets, to have superior predictive ability compared to univariate GP. While the use of traits varying on a continuous scale is straightforward in multivariate GP, count data still pose several challenges that currently hamper our ability to exploit this trait in multivariate analyses."}]}],"figures":[{"text":" covariates; G  G, first-order additive  additive epistasis; L, line; R, replicate. "},{"text":"Fig. 1 . Fig. 1. Phenotypic distribution of SRA, SRN, and whole-plant TR measured at a VPD of 2.7 kPa in the panel of MAGIC lines: a) histogram of SRN counted in the MAGIC lines; b) histogram of the adjusted means of SRA measured in sexagesimal degrees; c) bar plot of TR measured at a VPD of 2.7 kPa. Error bars point out the 95% confidence interval of TR values. "},{"text":"Fig. 2 . Fig. 2. GGE biplot of GY and pairwise correlations of SRA, SRN, GY, and TR at a VPD of 2.7 kPa. a) The environment-vector view of the GGE biplot indicates similarities among test environments in discriminating the genotypes. b) Depending on the trait distribution type (discrete or continuous), values indicate pairwise Pearson's correlation or polyserial correlation between GY, SRA, SRN, and TR measured under high evaporative demand of VPD (2.7 kPa). Correlation values showing P-values larger than 0.05 are marked by a cross. "},{"text":"Fig. 5 . Fig. 5. Predictive ability of SRN-Models 1-5. a) Proportion of cases correctly classified using the LOO cross-validation of the 5 TGBLUP models. b) Brier scores obtained from LOO cross-validation of the 5 TGBLUP models. "},{"text":"Fig. 4 . Fig. 4. Boxplots of the estimated probabilities of SRN in SRN-Models 1-5. Each boxplot summarizes the distribution of the estimated probability in each category in the 5 TGBLUP models. "},{"text":"Fig. 6 . Fig. 6. Estimated variance components and predictive ability of SRN-log-Models 1-5. a) Bar plots indicate the explained variance of each component, expressed as percentage of the total model variance. L indicates the estimated variance of line effects; G is the estimated variance of marker effects while G  G and \"Error\" point out the variance of first-order additive  additive epistatic effects and the residual variance, respectively. Error bars point out the 95% confidence interval of the estimated variances. b) Bar plots of predictive ability values computed as Pearson's correlation between estimated and observed data using LOO cross validation strategy. "},{"text":"Fig. 8 . Fig. 8. Estimated variance components and predictive ability of the TR-Models 1-5: a) bar plots indicate the variance of each component, expressed as percentage of the total model variance. L indicates the estimated variance of line effects; G is the estimated variance of marker effects, while G  G and \"Error\" point out the variance of additive  additive epistatic effects and the residual variance, respectively. Error bars point out the 95% confidence interval of the estimated variances; b) bar plot of predictive ability values expressed as Pearson's correlation between estimated and observed TR under high evaporative demand (2.7 kPa). "},{"text":"Fig. 7 . Fig. 7. Estimated variance components and predictive ability of the SRA-Models 1-5. a) Bar plots indicate the variance of each component, expressed as percentage of the total model variance. L indicates the estimated variance of line effects; G is the estimated variance of marker effects while G  G and \"Error\" point out the variance of additive  additive epistatic effects and the residual variance, respectively. Error bars point out the 95% confidence interval of the estimated variances; b) bar plot of predictive ability values computed using Pearson's correlation between estimated and observed SRA. "},{"text":"  "}],"sieverID":"dfa9d757-f3d0-49df-9b5f-21d588628677","abstract":"In plants, the study of belowground traits is gaining momentum due to their importance on yield formation and the uptake of water and nutrients. In several cereal crops, seminal root number and seminal root angle are proxy traits of the root system architecture at the mature stages, which in turn contributes to modulating the uptake of water and nutrients. Along with seminal root number and seminal root angle, experimental evidence indicates that the transpiration rate response to evaporative demand or vapor pressure deficit is a key physiological trait that might be targeted to cope with drought tolerance as the reduction of the water flux to leaves for limiting transpiration rate at high levels of vapor pressure deficit allows to better manage soil moisture. In the present study, we examined the phenotypic diversity of seminal root number, seminal root angle, and transpiration rate at the seedling stage in a panel of 8-way Multiparent Advanced Generation Inter-Crosses lines of winter barley and correlated these traits with grain yield measured in different site-by-season combinations. Second, phenotypic and genotypic data of the Multiparent Advanced Generation Inter-Crosses population were combined to fit and cross-validate different genomic prediction models for these belowground and physiological traits. Genomic prediction models for seminal root number were fitted using threshold and log-normal models, considering these data as ordinal discrete variable and as count data, respectively, while for seminal root angle and transpiration rate, genomic prediction was implemented using models based on extended genomic best linear unbiased predictors. The results presented in this study show that genome-enabled prediction models of seminal root number, seminal root angle, and transpiration rate data have high predictive ability and that the best models investigated in the present study include first-order additive  additive epistatic interaction effects. Our analyses indicate that beyond grain yield, genomic prediction models might be used to predict belowground and physiological traits and pave the way to practical applications for barley improvement."}

data/part_1/0963e58ffe131d06b03a7ab026223bf2.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0963e58ffe131d06b03a7ab026223bf2","source":"gardian_index","url":"https://publications.iwmi.org/pdf/H033896.pdf"},"pageCount":19,"title":"7. A regional approach to model water productivity","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":124,"text":"In the previous chapters two different approaches were applied to look at water productivity in Sirsa district: field scale modelling and regional scale remote sensing. The strength of modelling is that it can be used to get a better understanding of systems and processes, while remote sensing can give a swift regional and spatial distributed overview of water productivity. However, a drawback of the modelling as presented is that it is limited to isolated fields, and a drawback of the remote sensing is that there are no predicting capacities to perform scenario analysis. In this chapter we will provide a methodology where the strength of the two approaches will be combined: a framework for crop, soil and water modelling for regional water productivity analysis."},{"index":2,"size":85,"text":"It might be clear that the development of such an approach is based on the modelling efforts presented in the previous chapters where the calibration and validation of the SWAP-WOFOST model played a dominant role. The remote sensing, as presented in Chapter 6, provided two outputs that are used here: (i) the landcover classification and (ii) the evapotranspiration and yield estimates. The latter one will be used here as a calibration reference set, while the first one is directly input to the regional modelling framework."},{"index":3,"size":105,"text":"In addition to the results of the modelling and the remote sensing analysis, regional analyses of water productivity require extensive additional data sets. Due to a lot of Indian field research and several (inter)national projects the availability of data for the Sirsa region is relatively favourable. Data were stored in appropriate formats which enabled regional analyses using Geographical Information Systems (GIS) and databases. This chapter gives an overview of available regional datasets and explains the method applied to come to a regional water productivity assessment. Results are presented for the seasons rabi and kharif of 2001-02, the period during which field monitoring was carried out."}]},{"head":"Available regional datasets","index":2,"paragraphs":[]},{"head":"Soils","index":3,"paragraphs":[{"index":1,"size":76,"text":"The soil map of Sirsa (Ahuja et al, 2001) was digitized into 10 soil series (Fig. 7.1). For each soil profile a vertical schematization in soil horizons was based on Ahuja et al., (2001). All soil types were reduced to two-layer soil types with top and subsoils based on the proportion of sand, silt and clay. Next this information was used in so-called pedotransfer functions to obtain the soil hydraulic characteristics as described in Chapter 4."},{"index":2,"size":32,"text":"For each soil series, measurements were available of soil salinity. Soil salinity was measured as electric conductivity in a soil-water mixture and transformed into salinity in the liquid phase using Eqs. 3.1-3.3."}]},{"head":"7.2.2","index":4,"paragraphs":[{"index":1,"size":80,"text":"Land use Climatic conditions allow two crops a year, divided in two crop growing seasons; the summer growing season, called kharif, from May up to November and the winter growing season from November up to April, called rabi. The main crop during rabi season is wheat and during the kharif season rice and cotton. Other important crops are raya (oilseeds), gram (chickpea), sugarcane, fodder, guar (clusterbean) and sorghum. At present, cotton-wheat is the most dominant crop rotation in the area."},{"index":2,"size":41,"text":"At village level information is registered with regards to agriculture management. Available data related to land use are: cultivated area, irrigated area and amount of tube wells to extract groundwater for irrigation. Because of its importance the village map was digitised."},{"index":3,"size":13,"text":"Cropped areas were derived from remote sensing images. The combination of NOAA (high "}]},{"head":"7.2.3","index":5,"paragraphs":[{"index":1,"size":69,"text":"Climate The climate of Sirsa district is characterized by its dryness and extremes of temperature and scanty rainfall. The average annual rainfall over the period 1990-2002 is 367 mm. The region can be classified as sub-tropical, semi-arid, continental and is characterised by the occurrence of the Indian monsoon. The period from June to September constitutes the south-west monsoon. However rainfall is highly erratic both in quantity and in distribution."},{"index":2,"size":58,"text":". An extensive data set with daily values measured over the period 1990 -2002 was available from the meteorological station of Sirsa. These data include minimum and maximum temperature, relative humidity, vapour pressure in the morning and evening, sunshine hours, wind speed and rainfall (Chapter 3). The coordinates of the meteorological station of Sirsa are 29°33'39\"N and 75°00'52\"E."},{"index":3,"size":63,"text":"For the period 1990-2000 rainfall measurements were available from five additional rainfall stations spread over the area, namely Ottu, Abu Shahar, Khuyan Malkanhana, Panjuana and Kalanwali. The precipitation data of the six stations were assigned to meteo-regions. For the regional analyses rainfall data were assigned to 6 meteo-regions (Fig. 7.2). For the special observation period rabikharif 2001-02, only data of Sirsa were available."}]},{"head":"7.2.4","index":6,"paragraphs":[{"index":1,"size":37,"text":"Irrigation: groundwater Groundwater depth During the period 1990 -2000 the groundwater depth was measured twice a year, in June and October, before and after the monsoon. The groundwater depth of June 2000 is given in Fig. 7.3. "}]},{"head":"Groundwater trend","index":7,"paragraphs":[{"index":1,"size":61,"text":"Groundwater depth fluctuates over time and space. The spatial trend of groundwater depth over the period 1990 -2000 is shown in Fig. 7.4. The groundwater trend map is based on the difference between the average groundwater depth of 1990 and 2000. The average increase of the groundwater level for entire Sirsa district amounted 9 cm y -1 in the period 1990-2000."}]},{"head":"Groundwater quality","index":8,"paragraphs":[{"index":1,"size":208,"text":"For several tubewells the quality of groundwater was measured three times a year in June, October and January over the period 1982 -1995. A significant trend could not be derived from these data and therefore the groundwater quality map was based on most current values of 1995 (Fig. 7.5). Somewhat unexpectedly, the spatial distribution in this map does not correspond to the general impression that water logged areas are saline. This is partly due to the presentation form which shows interpolated values of only one year (1995) where a few extreme values may generate an unbalanced picture. A more thorough analysis of salinity levels in groundwater might be desirable but is beyond the scope of this study.  The model SWAP simulates groundwater quality as a concentration of solutes, which is expressed in mg cm -3 . Conversion between the different units is carried out using the relation 1 dS m -1 = 0.653 mg cm -3. Applying this relation, the values for quality of groundwater vary from 0.8 to 10.1 mg cm -3 . The information on groundwater depth, trend and quality maps originate from measurements of 164 observation wells spread over the Sirsa district. Interpolation between known observations was carried out to estimate values for unknown locations."}]},{"head":"Groundwater tube wells","index":9,"paragraphs":[{"index":1,"size":28,"text":"All farmers use tube wells and sometimes mix it with canal water to increase the irrigated area. In Sirsa district three types of tube wells can be distinguished:"},{"index":2,"size":1,"text":"•   "}]},{"head":"7.2.5","index":10,"paragraphs":[{"index":1,"size":58,"text":"Irrigation: canal water Sirsa district consists of four divisions (Fig. 7.7), where inflow and outflow of the maindistributaries are measured twice a day. Each division has three subdivisions. It was not possible to analyse the water availability on the more detailed level of subdivision, because most of the discharges of the minor canals were measured in gauge readings."},{"index":2,"size":129,"text":"The quality of canal water is mostly good and constant throughout the year. In this case the quality of canal water was estimated at 0.3 dS m -1 or 0.2 mg cm -3 . Leakage losses from the main canals were estimated based on soil type according to Roest (1996). In his report average values of entire Sirsa district were derived by model calculations for on-farm water losses and canal seepage losses. On farm losses were in this report defined as losses caused by seepage losses from the field irrigation channels, percolation and leaching losses during field irrigation and leaching losses due to rainfall events. Based on their findings and taking into account the soil texture distribution, for each division a percentage of leakage losses was estimated (Table 7.1)."},{"index":3,"size":57,"text":"The Cultivable Command Area (CCA) is the area around an outlet on which the amount of canal water supply is based. The CCA is known per village boundary and varies throughout the years. However big differences did not occur in CCA during years and therefore the CCA values of 2001 were used for the whole calculation period.  "}]},{"head":"Methodology","index":11,"paragraphs":[{"index":1,"size":69,"text":"An essential part of the regional analysis was the schematization of Sirsa district into more or less homogeneous areas. These are required to allow detailed analyses of a limited amount of unique soil-water-crop systems (calculation units). To obtain these homogeneous areas a process is followed referred to as stratification. The procedure of stratification is important, because it has a large influence on amount and size of the calculation units."},{"index":2,"size":101,"text":"The soil map and the village map were digitized and the land use map was derived from remote sensing analysis as described in Chapter 6. The land use map derived from Landsat images was considered as the basis for the soil and village maps. The pixel-size of satelliteimages is 30x30 m. The soil and village maps were converted into maps with the same cell size and extent. In this way overlays of the three maps could be made without increasing the number of unique plots too much. Once the stratification procedure was finished, parameter values were assigned to the calculation units."},{"index":3,"size":49,"text":"The SWAP-WOFOST was employed to simulate the soil-water-crop system. The regional groundwater flow has not been simulated. This was justified by the fact that the main objectives of the WATPRO study were related to crop-soil-water interactions. However, detailed groundwater modelling activities have been presented earlier (Boonstra et al., 1996)."}]},{"head":"Stratification Land use map","index":12,"paragraphs":[{"index":1,"size":144,"text":"This map is a combination of land use in rabi season and kharif season. Both maps are derived from satellite-images. The rabi-image represents land use at 18 March 2002 and the kharif-image at 10 September 2002 (Chapter 6). In the original images 9 and 6 classes are distinguished, respectively for kharif and rabi-image. Reclassification was required because the local crop data were limited to the main crop rotations wheat/rice and wheat/cotton. Therefore the kharif-image is brought back to 3 and rabi-image to 2 classes (Table 7.2 and Fig. 7.8). This implies that what is presented in this regional analyses as wheat, cotton and rice is in fact a mixture of crops (see Table 7.2) and will show deviations from reality. However, this simplification was assumed to be acceptable, because the remaining land uses wheat/rice and wheat/cotton are the dominating crop rotations in the area."}]},{"head":"Soil map","index":13,"paragraphs":[{"index":1,"size":70,"text":"The soil map, used for stratification, was derived by reclassifying the original one in which 10 soil types were distinguished, into a soil map with 6 soil types. All soil types were reduced into a two-layer soil type with a top and subsoil. Soil series with the same classification of both topsoil and subsoil, were merged (Table 7.3). The classification was based on the proportion of sand, silt and clay. "}]},{"head":"Village boundaries","index":14,"paragraphs":[{"index":1,"size":31,"text":"Since many spatially allocated data were available at village level, it was decided to use a map with village boundaries as one of the maps for the stratification procedure. The total "}]},{"head":"A B C","index":15,"paragraphs":[{"index":1,"size":40,"text":"number of villages is 323. At village level information is available, such as CCA, potential pump-discharge, pump-density and net-irrigated area. By using the interpolated grid maps for groundwater depth and quality, these gridded data were also available at village level."}]},{"head":"Final stratification","index":16,"paragraphs":[{"index":1,"size":77,"text":"An overlay of the 3 maps resulted in 2404 calculation units (Fig. 7.9). Bare soil and wheatrice each occupy 26 % of the total area (Table 7.4) and wheat-cotton covers 48% of the area. However one should keep in mind that, due to the stratification process the different forms of land use were limited and wheat accounts for several other kinds of land use. Results presented here might therefore be different from results presented in Chapter 6. "}]},{"head":"Parameterisation","index":17,"paragraphs":[{"index":1,"size":12,"text":"Once the calculation units were fixed, parameter values had to be assigned."}]},{"head":"Climate/Weather","index":18,"paragraphs":[{"index":1,"size":71,"text":"Daily weather data were used. Within the Sirsa district the meteorological station of Sirsa is the only station with extensive weather data; these were applied to calculate evapotranspiration for the whole area. Precipitation data from the 6 stations were assigned to calculation units within corresponding meteo-regions. The SWAP model requires the following weather data as input: shortwave radiation, minimum and maximum temperature, humidity expressed as vapour pressure, wind speed and precipitation."},{"index":2,"size":58,"text":"The data obtained from the meteorological station Sirsa showed some missing values. These missing values were filled up using a statistical comparison with data from the meteorological station of Hisar. Especially sunshine hours and wind speed were adapted from Hisar. For the years 2001 and 2002, the data of the Sirsa station were applied to the whole region."},{"index":3,"size":18,"text":"Table 7.5 Annual supply of canal water per division where L is leakage losses from the main canals."}]},{"head":"Irrigation -canal water","index":19,"paragraphs":[{"index":1,"size":149,"text":"The supply of irrigation water plays an important role in water productivity. According to the warabandi system irrigation water is supplied homogeneously. To analyse this principle of equal water availability in the district, the divisions were taken into account. Per village the amount of CCA falling in one of the divisions is registered. A village might have CCA in different divisions. In that case the smallest part of CCA was assigned to the largest, so a village had only CCA in one particular division. With GIS it was possible to derive the map of the divisions. The borders of the divisions were fitted with the village boundaries. For each division the entry and exit points of the distributaries were determined. The difference between the discharge per day of all outgoing distributaries and the discharges per day of all entering distributaries within a division was regarded as storage per day."},{"index":2,"size":288,"text":"Leakage losses from the main canals were estimated, as not all water stored in the area was used for irrigation water, but instead percolated to deeper soil layers (Table 7.1). In this study it was assumed that the rest of canal water was used for irrigation. To transform the discharge into irrigation depth, the total amount of CCA within a division was calculated. The calculation of the annual irrigation depth per division with canal water mentioned in Table 7.5 is expressed as:  where D cw is irrigation amount of canal water per year per division (mm y -1 ), Q inflow is discharge of incoming distributaries (m 3 d -1 ), Q outflow is discharge of outgoing distributaries (m 3 d -1 ), L is fraction leakage losses of canal system (-), n is day number, and CCA vill is Cultivable Command Area of a village (ha), which is summed over the division. For the CCA as well for the discharges of the main canals data of 2001 were used. The annual depth of canal water per division varies from 472 mm in the north to 188 mm in the south of Sirsa district. According to the Indo -Dutch project the size and water supply is larger than the values calculated with division information, because it was based on the Sirsa district, which is slightly larger than Sirsa District. Besides, the water supply in this project was based on figures of 1996, which was a wet year. The reason that the annual depth in the most northern division is still higher than the other divisions, despite the higher percentage leakage losses, is probably due to the fact that this region is compensated for the lower quality of groundwater."},{"index":3,"size":57,"text":"A fixed irrigation schedule was used. This means that a fixed date and fixed depth is described. For each division the amount of canal water (m 3 d -1 ) was calculated, including some leakage losses as explained above. Next these values were transformed into an irrigation depth by dividing over the area of CCA per division."}]},{"head":"Groundwater","index":20,"paragraphs":[{"index":1,"size":38,"text":"The total maximum groundwater discharge per day per block was calculated based on the density of the various tube wells (deep and shallow). Villages without data received a ground water discharge based on shallow and deep tube wells."},{"index":2,"size":48,"text":"The final irrigation supply per calculation unit is the sum of groundwater supply from the nearest village and canal water supply from the division. For each crop-rotation irrigation days were determined based on field observations. On irrigation days water was supplied per calculation unit in the following way:"},{"index":3,"size":50,"text":"where D I is total irrigation depth (mm d -1 ), Q canal is canal water discharge (mm d -1 ), CCA is Cultivable Command Area (ha), A crop is cropped area derived from remote sensing images (ha) and Q gw is maximum groundwater discharge (m 3 d -1 )."},{"index":4,"size":94,"text":"One week before and one week after the irrigation date, the calculated daily irrigation depth is assigned to that particular date. As a result of a mismatch between remote sensing data (A crop ) and statistical data obtained from local governments (maximum groundwater discharge derived from tube wells) an upper limit of D I had to be defined. When a small area has a relative high maximum groundwater discharge, unrealistically high values of total irrigation depth per day could be assigned. Therefore a maximum irrigation depth of 80 mm d -1 has been used."},{"index":5,"size":25,"text":"Next to the quantity of irrigation water, the quality of irrigation water was taken into account as a weighted average based on depth and quality:"},{"index":6,"size":51,"text":"where C I is quality of irrigation water (mg cm -3 ), C gw is quality of groundwater (mg cm -3 ), D gw is depth of groundwater supply (mm), Q cw is quality of canal water (mg cm -3 ), and D cw is depth of canal water supply (mm)."}]},{"head":"Crop","index":21,"paragraphs":[{"index":1,"size":62,"text":"For the regional analysis emergences dates of crop growth and periods of irrigation scheduling were determined by means of average values obtained from the farmer fields. These dates for the crops wheat, cotton and rice are listed in Table 7.6. The number of irrigation applications was spread over the period between the first and last irrigation according to local observations. (1) Transplanting"},{"index":2,"size":104,"text":"Because of the close interaction between water availability, LAI development and DM production, crop growth was simulated with WOFOST. The WOFOST module was calibrated for wheat, cotton and rice with data from local experiments. For light use efficiency and maximum CO 2 -assimilation rate of wheat and cotton lower values were used than obtain during calibration in order to take into account, implicitly, the effect of management. Using WOFOST we calculated potential above ground DM, water limited above ground DM, potential DM production in storage organs, and water limited DM production in storage organs. In case of bare soil only soil evaporation was calculated."}]},{"head":"Soil","index":22,"paragraphs":[{"index":1,"size":107,"text":"For each soil layer defined in the soil profile, the relations between the soil water pressure head, the soil moisture content and the unsaturated hydraulic conductivity should be specified. All soil types were reduced into a two layer soil type since the actual evaporation, like surface soil moisture, is usually controlled by only the top few centimetres of soil (Jhorar, 2002). The topsoil exits of first 15 centimetres and the subsoil of 3.85 meter. In this study the Mualem -Van Genuchten functions were applied to describe the soil physical relations (Eqs. 4.9 and 4.10). The parameter values were taken directly from the farmer field study (Chapter 4)."}]},{"head":"Boundary conditions","index":23,"paragraphs":[{"index":1,"size":92,"text":"A soil profile with a thickness of 4 meter was considered, assuming that most important processes occur within this upper part of the soil. For the lower boundary two conditions were distinguished: shallow and deep groundwater. Calculation units were assumed to have a shallow groundwater when the average groundwater level during the years 1999-2000 was less than 4 meter below the soil surface; all other units were assumed to have a deep groundwater level. About 10% of all units turned out to have an average groundwater less than 4 meter below surface."},{"index":2,"size":25,"text":"For the situation with deep groundwater a free drainage condition was applied for the bottom boundary. As initial condition h = -500 cm was adopted."},{"index":3,"size":29,"text":"For the situation with shallow groundwater the bottom flux was calculated as a function of a given hydraulic head and a vertical resistance of flow towards deeper soil layers:"},{"index":4,"size":56,"text":"where q bot is the flux at bottom of soil profile (cm d -1 ), aquif is the hydraulic head in a semiconfined layer (cm), gwl is the groundwater level (cm) and c is the vertical resistance (d), taken here as 1000 d. The fluctuation of aquif in time was assumed to have a sinusoidal wave."},{"index":5,"size":48,"text":"The amplitude of the aquif sinus wave was derived from the difference between measured groundwater levels in June and October. The top of the sinus was either June or October, depending on the occurrence of the highest measured groundwater levels. Measured groundwater levels were used as initial conditions."}]},{"head":"Regional modeling","index":24,"paragraphs":[{"index":1,"size":77,"text":"For each of the 2404 calculation units, water and salt balances and crop growth were simulated. In this study the rabi and kharif seasons of the period of 2001-02 were analysed, because during this period measurements were available from both remote sensing and monitored farmer fields. The analysis was carried out using the SWAP model version 2.07 (van Dam et al., 1997). A description of the SWAP and WOFOST models is presented in Chapters 4 and 5."},{"index":2,"size":196,"text":"The SWAP model was adjusted for the simulation of paddy rice fields. An option was introduced to adjust the saturated conductivity of the soil horizon which represents the puddle layer. This layer received a value for the saturated conductivity of 1.0 cm d -1 . In spite of this adjustment it turned during the calibration phase that it was impossible to achieve reliable model results for the wheat-rice combination. Especially rice turned out to be very sensitive to the saturation percentage of the soil. Realistic values for rice could only be achieved after introducing a correction factor, which accounts for the uncertainty in the irrigation from groundwater tube wells. In order not to disturb the regional water balance, a sensitivity analysis was carried out for the second calculation unit. The analysis showed that a multiplication factor of 3 for the amount of tube well irrigation water would give reasonable yields without strongly influencing the leakage to deeper soil layers (Fig. 7.10). In other words, the estimation of the groundwater extraction rates was a factor 3 too low. In Chapter 9 this is elaborated and explained in more detail and the factor 3 appeared to be justified. "}]},{"head":"Results","index":25,"paragraphs":[]},{"head":"Reference situation","index":26,"paragraphs":[{"index":1,"size":214,"text":"The resulting water balance for the simulated period November 1, 2001 till November 1, 2002 showed that the high evapotranspiration is achieved with a large contribution of irrigation water. Rainfall and irrigation with canal water each supply about 20 % of the water. Irrigation with groundwater dominates the supply with a contribution of 60 % of the total supply to the upper part of the soil system (Table 7.7). Transpiration by the crops and soil evaporation take care of respectively 42 and 26 % of the total water discharge. Leaching (including drainage) is about 17% of the discharge. A large part of the area (about 26%) consists of bare soil and receives no irrigation. The cropped area receives, however, high amounts of irrigated water, especially from groundwater (Table 7.8). Especially, wheat-rice receives large amounts of irrigation water through tube wells; ranging from 810 to 1465 mm/year. In the Rori division the supply from groundwater is relatively low, whereas the largest groundwater extractions occur in the Ghaggar division. Actual evapotranspiration is highest for rice during kharif in the Ghaggar Division due to the large amounts of supplied of irrigation water. Lower values were calculated for the rabi season. Bare soils have an average evaporation of about 20 mm during rabi and 104 mm during kharif."},{"index":2,"size":52,"text":"Transpiration reduction due to water and salinity stress is high for cotton, where an average value for T a /T p of 0.6 was calculated for all surface water divisions (Table 7.10). Rice hardly experiences stress in the Ghaggar division where T a /T p is 0.9; in the Sirsa division the"}]}],"figures":[{"text":"Figure 7 . 1 Figure 7.1 Soil map of Sirsa with 10 soil series. "},{"text":"Figure 7 . 2 Figure 7.2 Meteo-regions based on the six rainfall stations. "},{"text":"Figure 7 . 3 Figure 7.3 Groundwater depth of Sirsa district in June 2000 in meters below surface. "},{"text":"Figure 7 . 4 Figure 7.4 Groundwater trend (m / 10 year) of Sirsa district, calculated over the period 1990 to 2000 in meters (negative value is declining groundwater level in period 1990-2000). "},{"text":" The shallow tube well, installed by local indigenous farmers. The pump capacity values vary considerably (Fig.7.6) and were derived from Ground Water Cell(2002). Eight hours a day was assumed for working hours.• Direct Irrigation Tubewells (DIT), installed by Haryana State Minor Irrigation and Tubewell Corporation (HSMITC). The total discharge a year for one tube well is 15 10 6 m 3 y -1 .• Augmentation tube well, installed by HSMITC with an annual discharge of 71.5 10 6 m 3 y -1 . For each type of tube well the number is known per village boundary. The annual discharges of the tube wells were transformed to daily discharges. "},{"text":"Figure 7 . 5 Figure 7.5 Groundwater quality of Sirsa district in dS m -1 , based on figures of June 1995. "},{"text":"Figure 7 . 6 Figure 7.6 Variation in Sirsa district of pump capacity of shallow tube well in litre per second. "},{"text":"Figure 7 . 7 Figure 7.7 Four Water Service Divisions within Sirsa district: Rori, Sirsa, Ghaggar and Nehrana. "},{"text":"Figure 7 . 8 Figure 7.8 Reclassified land use for rabi (A) and kharif (B) and the resulting land use for the regional analyses (C). "},{"text":" Figure 7.9 Stratification procedure which results in geographically fixed calculation units. "},{"text":"Figure 7 . 10 Figure 7.10 Yield and leaching as a function of a correction factor for tube irrigation of rice. "},{"text":"  "},{"text":"Table 7 .1 Estimation of leakage losses of main canals per water service division Name of division Main subsoil texture Estimated percentage Name of divisionMain subsoil textureEstimated percentage   leakage losses of main canals leakage losses of main canals Rori Loamy sand 30 RoriLoamy sand30 Sirsa Silt loam 20 SirsaSilt loam20 Ghaggar Silty Clay Loam 15 GhaggarSilty Clay Loam15 Nehrana Sandy loam 25 NehranaSandy loam25  "},{"text":"Table 7 .2 Reclassification of land use values of remote sensing images for both rabi and kharif (old = before reclassification and new = after reclassification) Land use kharif old Land use kharif new Land use rabi old Land use rabi new Land use kharif oldLand use kharif newLand use rabi oldLand use rabi new Cloud Bare soil/rice / cotton Bare soil Bare soil CloudBare soil/rice / cottonBare soilBare soil Cotton Cotton Early wheat Wheat CottonCottonEarly wheatWheat Desert Bare soil Late Wheat Wheat DesertBare soilLate WheatWheat Other crops Rice or cotton Oil seed Wheat Other cropsRice or cottonOil seedWheat Rice Rice Other crops Wheat RiceRiceOther cropsWheat Shadow/water Bare soil/rice / cotton Unclassified Bare soil Shadow/waterBare soil/rice / cottonUnclassifiedBare soil Sugarcane Rice   SugarcaneRice Unclassified Bare soil/rice / cotton   UnclassifiedBare soil/rice / cotton Urban Bare soil   UrbanBare soil  "},{"text":"Table 7 .3 Classification of soil series. Series Series name New soil type Topsoil Subsoil SeriesSeries nameNew soil typeTopsoilSubsoil number  after merging   numberafter merging 1 Nimla 1 Sand Loamy sand 1Nimla1SandLoamy sand 2 Saimpal 2 Sand Sand 2Saimpal2SandSand 3 Ganga 1 Sand Loamy sand 3Ganga1SandLoamy sand 4 Lambi 3 Loamy sand Sandy Loam 4Lambi3Loamy sandSandy Loam 5 Darbi 4 Loam Silt Loam 5Darbi4LoamSilt Loam 6 Fatehpur Baidwala 5 Silt Loam Silt Loam 6Fatehpur Baidwala5Silt LoamSilt Loam 7 Harni Khurd 6 Loam Silty Clay Loam 7Harni Khurd6LoamSilty Clay Loam 8 Phaggu 3 Loamy sand Sandy Loam 8Phaggu3Loamy sandSandy Loam 9 Khaireke 5 Sandy loam Sandy loam 9Khaireke5Sandy loamSandy loam 10 Jhunpra 5 Loamy sand Sandy clay loam 10Jhunpra5Loamy sandSandy clay loam  "},{"text":"Table 7 . 4 Size (in % of total area of 3878 km 2 ) of the land use and surface water division.   Land use (rabi -kharif)  Land use (rabi -kharif) Division Wheat-cotton Wheat-rice Bare soil Total DivisionWheat-cottonWheat-riceBare soilTotal Ghaggar 5 10 2 16 Ghaggar510216 Nehrana 12 6 9 27 Nehrana126927 Rori 17 4 8 30 Rori174830 Sirsa 14 7 6 27 Sirsa147627 Total 48 26 26 100 Total482626100  "},{"text":"Table 7   .6 Croping patterns, based on average of farmer fields  .6 Croping patterns, based on average of farmer fields Crop-rotation Emergence End First Last Number of Irrigation Crop-rotation Emergence EndFirstLastNumber of Irrigation    irrigation irrigation applications irrigationirrigationapplications Wheat 01-11 24-04 03-11 07-04 8 Wheat01-1124-0403-1107-048 Rice 20-06 (1) 9-10 20-06 22-9 25 Rice20-06 (1)9-1020-0622-925 Cotton 01-05 31-10 10-05 19-9 4 Cotton01-0531-1010-0519-94  "},{"text":"Table 7 .7 Overall water balance (mm y -1 ), 1 Nov 2001 -1 Nov 2002, based on the regional SWAP modelling. IN IN  "},{"text":"Table 7 .8 Irrigation with groundwater and surface water, 1 Nov 2001 -1 Nov 2002.  Average depth of irrigation with canal Average depth of irrigation with groundwater Average depth of irrigation with canalAverage depth of irrigation with groundwater  water (mm y -1 )  (mm y -1 )  water (mm y -1 )(mm y -1 ) Division wheat-cotton wheat-rice wheat-cotton wheat-rice Divisionwheat-cottonwheat-ricewheat-cottonwheat-rice Ghaggar 339 245 720 1465 Ghaggar3392457201465 Nehrana 251 252 667 1285 Nehrana2512526671285 Rori 591 531 375 810 Rori591531375810 Sirsa 247 227 684 1355 Sirsa2472276841355 Average 334 294 624 1254 Average3342946241254  "}],"sieverID":"c2622c0c-fd2a-421d-b687-05cde38658d4","abstract":"This chapter describes a step wise regional approach towards modelling of water productivity. First step is data collection and an analysis of available data. Next step integrates the available data sets into a geographical information system and derives distributed calculation units. This requires a stratification of geographically oriented data sets, which in this study were: soil properties, village boundaries and land use. Data were downscaled to a level of 30 x 30 meter to allow comparison with remote sensing data. Parameter values were assigned to the stratified units, resulting in a set of calculation units that were analysed using the SWAP model for evapotranspiration and the WOFOST model for yields. A comparison between results from SWAP model and remote sensing images was carried out showing fair results that allowed scenario analyses. Finally the developed regional model was used to calculate spatial distributed water productivity values."}

data/part_1/099610fad9fe0e7c545628fb4d846ae1.json

@@ -0,0 +1 @@
+{"metadata":{"id":"099610fad9fe0e7c545628fb4d846ae1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8ffde6f3-fc4c-46e6-8641-17a483c6b7d8/retrieve"},"pageCount":6,"title":"Identification of suitable fodder production areas using irrigation from shallow groundwater in Ethiopia","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":222,"text":"Agriculture is the most important economic sector in Sub-Saharan Africa. In Ethiopia, agriculture contributes more than a quarter of the gross domestic product (GDP) and export earnings. Livestock is an integral part of the agricultural system in Ethiopia, accounting about 40% of the economy, and provides employment to over 30% of the agricultural labour force. Livestock serves as a source of food, cash income, and farm power for ploughing and transportation. Despite Ethiopia's significant livestock population, largest in Africa, productivity in the sector is constrained by a shortage of feed, seasonality, feed quality, market linkages, and lack of access to basic veterinary services. Since livestock constitutes a large part of smallholders' livelihood, developing a better fodder production system would contribute to poverty reduction and social-ecological resilience by improving livestock productitivty through addressing bottlenecks in the quantity and quality of feed. The Innovation Lab for Small Scale Irrigation (ILSSI) project at the Texas A&M in collaboration with the Innovation Lab for Livestock Systems at the University of Florida have been working to identify suitable sites for fodder production in Ethiopia using promising small-scale irrigation practices that could improve productivity, environmental sustainability, household income, and nutrition. The fodder crops studied include Napier (Pennisetum purpureum), alfalfa (Medicago sativa), and desho (Pennisetum glaucifolium). The study also evaluates the irrigation potential of groundwater using simple water-lifting technologies."}]},{"head":"Feed production potential assessment","index":2,"paragraphs":[{"index":1,"size":587,"text":"The potential suitable land for sustainable fodder production in Ethiopia was identified using a GISbased Multi-Criteria Evaluation (MCE) technique. The suitability analysis was done by mapping major factors affecting the suitability of the land for fodder production followed by reclassifying, assigning weights, and overlaying factors to develop a single-index fodder suitability map. The key factors were identified based on literature recommendation and expert feedback in the region (Akıncı et al., 2013;Chen et al., 2010;Mendas and Delali, 2012;Worqlul et al., 2015;Worqlul et al., 2017). The study included biophysical factors such as climate (rainfall, and evaporation), soil (soil texture, pH, and soil depth), land use, and slope while the socio-economic factors included access to market and feed demand, which was represented by proximity to paved roads and livestock density, respectively. The source and spatial resolution of the data is shown in Table 1. The fodder crop types for the study were selected by the International Livestock Research Institute (ILRI) through on-farm trials during phase I of the ILSSI project and the potential for selected fodder crops to fit into the different agro-ecological settings in the country. The fodder crops selected were Napier (Pennisetum purpureum), alfalfa (Medicago sativa), and desho (Pennisetum glaucifolium). The selected crops have potential to improve household income and nutrition if scaled sustainably. The crop characteristics such as absolute and optimal growing temperature, soil pH, and depth conditions were obtained from Ecocrop (2000) and FAO (2011). The crop characteristics of the selected fodder crops is presented in Table 2. The groundwater data from the British Geological Survey (BGS) was used to evaluate irrigation potential of the groundwater using simple water lifting technologies such as pulley and bucket, rope and washer pump, and solar pump. In a previous study, the BGS depth to groundwater and potential borehole yield were compared with an observed groundwater yield data in the central part of Ethiopia, and the result indicated a reasonable performance in capturing the observed potential borehole yield (Worqlul et al., 2017). The BGS's depth to groundwater and potential borehole yield data were overlaid to evaluate accessibility and potential of the groundwater to cultivate fodder in the most suitable land. The suitability analysis indicated that slope and soil properties (i.e depth, and pH) were the most important factor for the suitability of land for fodder production in Ethiopia. Those factors reflect the integrated effect of the role of land management and soil health on the suitability of land for fodder production. The road proximity and livestock population showed a modest influence on the land suitability for fodder production while land use, rainfall deficit, soil texture, and temperature were the least important factors affecting the suitability of the land for fodder production. The preliminary suitability analysis showed that the suitability score ranged from 45% to 94%, 48% to 94%, and from 42% to 91% for desho, napier alfalfa, respectively. The smallest value represents the least suitable land and the highest value represents the most suitable land (Figure 1). A constraint map that exclude unsuitable areas such as waterbody and protected area were applied and the most suitable land were identified with a user-defined threshold suitability value. The suitable land extracted for a variable threshold from 80% to 94% (with a 1% increment) from the preliminary suitability map and the respective area above the threshold was plotted (Figure. 1d). For example, at a 85% threshold, ~8.7% of the Ethiopian land (about 17,720 km 2 ) is highly suitable for desho production through small scale irrigation followed by napier (4%) and alfalfa (2%). "}]},{"head":"Groundwater Availability and Fodder Potential Area","index":3,"paragraphs":[{"index":1,"size":99,"text":"The average groundwater potential yield in the highly suitable land for desho production is 4.3 l/s; and 4 l/s and 5.8 l/s for desho, napier alfalfa, respectively. The depth to groundwater estimated using the BGS data indicated that on average groundwater could be accessed at an average depth of 27 m, 17 m, and 22 m for desho, napier, and alfalfa, respectively. The groundwater assessment indicated a substential potential and accessibility for a small-scale fodder production in Ethiopia. Since there is a higher rainfall variability in Ethiopia, groundwater can serve as a source of irrigation buffering the rainfall variability."}]},{"head":"Conclusions","index":4,"paragraphs":[{"index":1,"size":96,"text":"The study estimated the potential suitable area for fodder production, considering biophysical and socioeconomic factors. The results indicated that there is substantial suitable land for fodder production in Ethiopia. The suitable areas for fodder production are also located in areas where there is sufficient groundwater resource, which could be utilized using simple water-lifting technologies. Sustainable use of the groundwater for fodder production will ease major livestock production constraints through producing better quality and quantity feeds. We believe this study will provide valuable insight to decision-makers, practitioners, and the private sector to scale fodder production in Ethiopia."}]}],"figures":[{"text":"Figure 9 : Figure 9: A preliminary suitable land for fodder production. a) Napier, b) Alfalfa, c) Desho, d) Vetch, e) Oatsand f) Fodder production suitable area (in 1000 km 2 ) at different suitability levels. For example, 22,600 km 2 of land is suitable for Napier production at a level of 80%. The highest shows the most suitable area for fodder production while the lost value indicates the least suitable land for the respective fodder. "},{"text":"Table 1 : Source and spatial resolution of input data for the fodder suitability analysis.  Data Source Spatial DataSourceSpatial   resolution (m) resolution (m) Land-use Global Land Cover Datasets (GlobeLand30) 30 Land-useGlobal Land Cover Datasets (GlobeLand30)30 Soil Africa Soil Information Service (AfSIS), 2015 250 SoilAfrica Soil Information Service (AfSIS), 2015250 Soil pH Africa Soil Information Service (AfSIS), 2015 250 Soil pHAfrica Soil Information Service (AfSIS), 2015250 Soil depth Africa Soil Information Service (AfSIS), 2015 250 Soil depthAfrica Soil Information Service (AfSIS), 2015250 Digital Elevation Model (DEM) Enhanced Shuttle Land Elevation Data from the 30 Digital Elevation Model (DEM)Enhanced Shuttle Land Elevation Data from the30  United States Geological Survey (USGS), 2000  United States Geological Survey (USGS), 2000  released in 2015  released in 2015 Road network Digital Chart of the World (DCW), 2006 -- Road networkDigital Chart of the World (DCW), 2006-- MODIS potential evaporation MOD16 Global Terrestrial Evapotranspiration Data 1,000 MODIS potential evaporationMOD16 Global Terrestrial Evapotranspiration Data1,000 (mm) Set (2000 -2010)  (mm)Set (2000 -2010) Rainfall (mm/year) Ethiopian National Meteorological Agency (ENMA) -- Rainfall (mm/year)Ethiopian National Meteorological Agency (ENMA)--  from 2000 to 2010  from 2000 to 2010 Fodder crop characteristics FAO-EcoCrop database -- Fodder crop characteristicsFAO-EcoCrop database-- Livestock population density Ethiopian Central Statistical Agency (ECSA) -- Livestock population densityEthiopian Central Statistical Agency (ECSA)--  "},{"text":"Table 2 : Characteristics of selected fodder crops considered to estimate the potential production area in Ethiopia (Ecocrop, 2000; FAO, 2011).  Fodder Optimal Absolute Optimal soil PH Optimal soil Optimal FodderOptimalAbsoluteOptimal soil PHOptimal soilOptimal  temperature ( o C) temperature ( o C)  depth (cm) rainfall (mm) temperature ( o C)temperature ( o C)depth (cm)rainfall (mm) Napier 25 -40 15 -25 & 5.0 -6.5 > 150 > 1500 Napier25 -4015 -25 &5.0 -6.5> 150> 1500   40 -45    40 -45 Alfalfa 21 -27 5 -21 & 6.5 -7.5 > 150 600 -1200 Alfalfa21 -275 -21 &6.5 -7.5> 150600 -1200   27 -35    27 -35 Desho 20 -25 15-20 & 5.5 -7.0 50 -150 700 -1200 Desho20 -2515-20 &5.5 -7.050 -150700 -1200   25 -35    25 -35 Potential Land Suitability for Irrigation    Potential Land Suitability for Irrigation  "}],"sieverID":"918c3d38-8963-4195-93ce-53750417dc4b","abstract":""}

data/part_1/09c2c15a37eb8894d6cc85db65029f05.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09c2c15a37eb8894d6cc85db65029f05","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5a9f968c-aaf1-4a54-8b50-82bb1ca2b38d/retrieve"},"pageCount":5,"title":"Insect-resistant cotton approved for release to farmers in Malawi and planted by 20,000 farmers during the first growing season","keywords":["• P661 -1.2.4 Comparative Science","Technology","and Innovation Systems in Developing-Country Agriculture OICR: Outcome Impact Case Report"],"chapters":[{"head":"Outcome story for communications use:","index":1,"paragraphs":[{"index":1,"size":96,"text":"In Malawi, the revenues of smallholder cotton farmers suffer from low yields and from the need to buy large quantities of spray to prevent damage from insects. Twenty years ago, the Government decided to explore the potential of biotechnology to address challenges in agricultural production, and passed the Biosafety Act (2002) and the Science and Technology Act (2003), which led to the creation of the National Commission for Science and Technology [1]. The use of improved varieties of cotton was identified as having a strong potential to increase farmers' socio-economic status and boost national economic growth."},{"index":2,"size":127,"text":"Since 2005, IFPRI's Program for Biosafety Systems (PBS) team has partnered with the Government of Malawi to establish an evidence-based biosafety regulatory framework and develop a network of experts to evaluate the safety of biotechnology products. PBS has provided technical assistance to the Government in several areas to support operationalization of the Biosafety Act: capacity building to equip regulators with the knowledge and evaluation skills needed to review submissions for confined field trials and on farm field trials; support to the Biosafety Office of the Environmental Affairs Department to ensure that the necessary policies, procedures and regulations were in place and aligned with the government's goals and existing environmental and agricultural policies; optimization of processes between various biosafety-related functions, such as biosafety evaluation and variety release registration."},{"index":3,"size":85,"text":"Insect-resistant cotton (modified to contain the Bacillus thuringiensis (Bt) gene) was the first genetically-modified crop variety for which confined fields trials were conducted in Malawi, starting in 2008. These trials, which showed protection against insects and higher yields of Bt cotton compared to conventional varieties, were followed by an extensive array of trials and biosafety reviews, with support from PBS taking the form of dialogue and capacity building activities for a wide range of stakeholders, from scientists and government agencies' staff to farmers groups [2]."},{"index":4,"size":37,"text":"In December 2018, the Ministry of Agriculture approved variety registration of four insect-resistant Bt cotton hybrids, which were released to farmers in 2019 [3] [4]. During the first planting season, 20,000 Malawian farmers planted insect-resistant cotton [5]."}]},{"head":"Links to any communications materials relating to this outcome: <Not Defined>","index":2,"paragraphs":[]},{"head":"Part II: CGIAR system level reporting","index":3,"paragraphs":[]},{"head":"Link to Common Results Reporting Indicator of Policies : Yes","index":4,"paragraphs":[]},{"head":"Policies contribution:","index":5,"paragraphs":[{"index":1,"size":24,"text":"• 218 -Curriculum for biosafety inspectors in Malawi (https://tinyurl.com/2zxk72vx) • 741 -Government of Malawi's approval of Bt cotton varieties for release to farmers (https://tinyurl.com/2gpf3dnf)"}]},{"head":"Stage of maturity of change reported: Stage 2","index":6,"paragraphs":[]},{"head":"Elaboration of Outcome/Impact Statement:","index":7,"paragraphs":[{"index":1,"size":47,"text":"Twenty years ago, the Government of Malawi decided to explore the potential of biotechnology to address challenges in agricultural production, and passed the Biosafety Act (2002) and the Science and Technology Act (2003), which led to the creation of the National Commission for Science and Technology [1]."},{"index":2,"size":135,"text":"Since 2005, IFPRI's Program for Biosafety Systems (PBS) team has partnered with the Government of Malawi to establish an evidence-based biosafety regulatory framework and develop a network of experts to evaluate the safety of biotechnology products. PBS has provided technical assistance to the Government in several areas to support operationalization of the Biosafety Act: capacity building to equip regulators with the knowledge and evaluation skills needed to review submissions for confined field trials and on farm field trials; support to the Biosafety Office of the Environmental Affairs Department to ensure that the necessary policies, procedures and regulations were in place and aligned with the government's goals and existing environmental and agricultural policies, using science-based regulatory principles and global best practices; optimization of processes between various biosafety-related functions, such as biosafety evaluation and variety release registration."},{"index":3,"size":85,"text":"Insect-resistant cotton (modified to contain the Bacillus thuringiensis (Bt) gene) was the first genetically-modified crop variety for which confined fields trials were conducted in Malawi, starting in 2008. These trials, which showed protection against insects and higher yields of Bt cotton compared to conventional varieties, were followed by an extensive array of trials and biosafety reviews, with support from PBS taking the form of dialogue and capacity building activities for a wide range of stakeholders, from scientists and government agencies' staff to farmers groups [2]."},{"index":4,"size":37,"text":"In December 2018, the Ministry of Agriculture approved variety registration of four insect-resistant Bt cotton hybrids, which were released to farmers in 2019 [3] [4]. During the first planting season, 20,000 Malawian farmers planted insect-resistant cotton [5]."}]}],"figures":[],"sieverID":"08837253-d93c-4d26-91d6-e119486566b1","abstract":"Following several years of confined field trials and on-farm trials to test the safety and performance of Bt cotton hybrid varieties, the Government of Malawi approved their release to farmers for the 2019-2020 season. 20,000 farmers planted it. The Program for Biosafety Systems provided technical support to the government throughout this process."}

data/part_1/09c626d6607b35d76b80e8ce3419c5f6.json

@@ -0,0 +1 @@
+{"metadata":{"id":"09c626d6607b35d76b80e8ce3419c5f6","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ff79098f-459a-449b-b3fd-2facaa289e69/retrieve"},"pageCount":16,"title":"Linking Graduate Research to Market-oriented Agricultural Development: IPMS Experience with Ethiopian Higher Learning Institutions ®","keywords":["Ethiopia","smallholder commercialization","knowledge","absorptive capacity","graduate Research","relevance","engagement"],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":89,"text":"The sense of urgency in Ethiopia today is more than ever about fostering sustainable development, to end poverty and hunger. Agriculture being the dominant sector of Ethiopian economy its performance determine the ability of the nation to address the problem of poverty, food insecurity, and to sustain overall economic growth. Yet, Ethiopian agriculture remains predominantly smallholder, rain-fed, subsistent-oriented, natural resource-based, and hence low input-output systems. Within such a context, market-based improvement of agricultural productivity is the key to achieving food security and poverty reduction (Global Food Security Act, 2009)."},{"index":2,"size":63,"text":"Globally, increasingly knowledge is driving the expansion of food production (McCalla, 1998), food security and environmental sustainability (Acker, 1999), and knowledge is a base for competitiveness in export market (Santiago et al, 2008). It is now widely acknowledged that readily available global knowledge and technologies should be harnessed to resolve problems of productivity, profitability and sustainability in smallholder agriculture (Inter-academy Council (IAC), 2004)."},{"index":3,"size":89,"text":"Enhancing human competences and organizational innovative capabilities are prerequisites to access, and effectively apply and exploit emerging scientific knowledge and technology, along with indigenous knowledge (IK). Higher learning institutions (HLIs) in agriculture and allied disciplines are vital in this regard. As a result, political commitment has increased in Ethiopia and beyond to support HLIs, graduate programs (GPs), and agricultural education and training (AET) in general. At the same time, however, HLIs, particularly GPs, are expected to efficiently utilize public resources for societal purposes and to deliver 'value for money'."},{"index":4,"size":167,"text":"The increasing emphasize on developmental roles of HLIs implies that GPs need to establish network with diverse knowledge sources, and forge linkages and closely work in partnership with farm households, agri-business, agro-industry, policy, and state and non-state research and development (R&D) actors. Yet, neither clear policy nor sufficient pilot initiatives exist in many countries to this effect (Santiago et al, 2008). We don't know enough about what kind of strategies and approaches are effective in re-orienting GPs and AET in general to their new and expanded developmental roles (Davis et al, 2007). Nor proven model is available as to how GPs can be better linked and become more interactive, thereby relevant and responsive. With the purpose of making a modest contribution, the paper presents down-to-earth experience of IPMS with national GPs in agriculture and allied discipline, discusses the insights and lessons, and suggests specific strategic options that may help address challenges to improving the quality and relevance of research and learning in agriculture and related graduate programs."},{"index":5,"size":128,"text":"The remainder of the paper is organized as follows: first, some background information is in order in section 2, highlighting the most pressing challenges awaiting innovative resolution to get Ethiopian smallholder agriculture moving along a sustainable commercialization path and the imperative for knowledge and innovation. Within the context of the overall higher education reform agenda, Section 3 discusses the issue of relevance and quality in the national GPs. Section 4 discuses the rationale and intervention modalities of IPMS to enhance the relevance of graduate thesis research projects, and it highlights some encouraging improvements observed due to the intervention. Finally, Section 5 draws conclusions and recommends strategic options for addressing the key challenges and to exploiting emerging opportunities to enhance both the developmental relevance and quality of graduate research."}]},{"head":"Smallholder Agricultural Transformation: the Imperative of Knowledge and Innovation","index":2,"paragraphs":[{"index":1,"size":88,"text":"Ethiopia has since the early 1990s pursued a national development strategy, which is rural-focused and market-based development of smallholder agriculture. Despite unprecedented public investments in the sector in the recent decades, the country experienced little progress. Notwithstanding some localized success and the recent encouraging sign of improvement in yields of staple crops (Ministry of Finance and Economic Development (MoFED), 2007), as the long-term trend confirms (World Bank, 2005;Byerlee et al. 2007), cropland expansion remains the primary source of agricultural growth, with little change in land and labor productivity."},{"index":2,"size":115,"text":"The realization of the sought smallholder agricultural transformation will be more challenging than ever before. It will have to be achieved within the context of mounting demographic pressure set against natural resource degradation (World Bank, 2005), competing land use needs for food, feed and bio-fuel, highly diverse agro-ecologies, climate change (Admassie et al, 2008;Deressa et al, 2008), globalizing agro-food system, and rising volatility in food prices (Spielman et al, 2009). Within this context, the strategy for Ethiopian smallholder agriculture development must of necessity be more knowledge and information intensive. This is crucial to circumvent the resource scarcity through improving efficiency in resource use, to produce marketable surplus, and to successfully adapt and respond to changes."},{"index":3,"size":112,"text":"Advances in basic sciences (Science Council, 2005) and information and communication technologies (Juma, 2009) are increasingly making new insights, tools and methods available that help to improve productivity, quality of agricultural produce, profitability, and ecological sustainability. Nevertheless, ability to access from diverse sources and effectively apply technical, organizational, institutional and entrepreneurial knowledge will be a sin qua non condition. This so-called 'absorptive capacity' encompasses ability to acquire, assimilate, transform and exploit knowledge (Zahra and George, 2006), and it entails new competencies such as 'new' knowledge and technology assessment skills, technical tool like effective utilization of ICT, and effective interaction, both within organization and with other organizations and actors (Hidalgo and Albort, 2008)."},{"index":4,"size":119,"text":"Cognizant of the emerging opportunities on the one hand and capacity challenges on the other, bilateral and multilateral development partners are shifting their priority in favor of capacity strengthening. Indeed there has been a continuous call for HLIs in developing countries to transform themselves into 'developmental institutions' to increase their contribution to development through the production and distribution of knowledge (Sutz, 2005). Societies expect of agricultural HLIs of the 21 st century to play the critical role of technological gatekeeping; and bridging the 'genetic divide' and 'digital divide' (IAC, 2004). To serve these and other 'developmental' purposes, GPs should be deeply embedded into national productive and social sectors; socially networked-nationally and internationally-through a variety of formal/informal mechanisms (Bawden, 2007)."},{"index":5,"size":72,"text":"The quality of learning experience in GPs is equally critical. GPs have a vital role of creating 'new generation' of professionals who are staffing and leading public and private AET, agricultural R&D, and politics and policy development processes. Investment in the strengthening of GPs in human and institutional capacity has a powerful positive multiplier effects on the quality and relevance of national AET system as a whole (Global Food Security Act, 2009)."},{"index":6,"size":46,"text":"GPs need to have relevant, multidisciplinary, flexible and dynamic curricula, and mode of delivery emphasizing interactive, discovery, and experiential learning in 'real-lifesettings' (Acker, 1999). Also, GPs need an enabling policy environment externally; and internally, should have 'the right' governance, incentive, and organizational/institutional arrangements up and running."},{"index":7,"size":151,"text":"The ultimate test of 'developmental' HLIs and their GPs would be their ability to produce 'new generation' of scientists and professionals who are not just technically competent, but entrepreneurs, those capable of creating jobs through enterprises rather than job seekers (Juma, 2009). Moreover, developmental HLIs are those institutions producing new generation of graduates who fit well to the emerging 'knowledge economy' and 'knowledge society' (Santiago et al, 2008), and graduates capable of providing effective and demand-driven knowledge service to public, private, civil society organizations (CSOs), and the citizenry at large (Bawden, 2007).  (Kassa, 2007). A number of higher education reform measures have been initiated too (Saint, 2004;Kassa, 2007), in the areas of funding, institutional autonomy, governance, and opening of new programs and revision of old ones. Further, national system support agencies have been established, encompassing Higher Education Strategy Institute, Education Quality and Relevance Assurance Agency and National Pedagogical Resource Centre (ibid)."}]},{"head":"Graduate programs in agriculture and related disciplines in","index":3,"paragraphs":[{"index":1,"size":36,"text":"The unprecedented political commitment in Ethiopia in supporting the expansion of HLIs, including GPs, is something highly commendable. Nonetheless, the real challenge lies in transforming the GPs into vibrant and responsive centers of knowledge and innovation."},{"index":2,"size":80,"text":"Despite the government effort, empirical results indicate both the learning experience and research at HLIs, including GPs, have serious limitations in terms of quality, relevance and responsiveness. And even worse, the old and well established universities have had experienced deterioration in their research and innovation capabilities due to such factors as unclear research mandate, lack of national research priority, limited funding for research and outreach activities, and teaching overload and insufficient incentive for staff engagement in development-oriented research (Kassa, 2007)."},{"index":3,"size":84,"text":"Although programs and curriculum revisions were taken place in many HLIs, it was often done without rigorous market research, tracer studies, and the involvement of key stakeholders like the private sector. More often than not, the content is production/technology-oriented, emphasizing theoretical and conceptual issues to the detriment of practical and analytical skills (Davis et al, 2007). Further, the dominant mode of delivery in HLIs remains top-down and lecture-based, and aided by text books with little relevance to the situation of Ethiopian agriculture (Kassa, 2007)."},{"index":4,"size":71,"text":"The prevailing dominant learning philosophy and approach in HLIs in Ethiopia are less appropriate to developing the capacity of learners for 'life long learning'. In a nutshell, the available evidence seems to suggest that the quality and relevance of Ethiopian GPs are worrying. As the World Bank (2003, cited in Amdissa, 2008) concludes, 'Expansion of higher education without maintaining and improving quality will be counterproductive and in the long run destabilizing.'"}]},{"head":"Pilot initiatives by higher learning institutions","index":4,"paragraphs":[{"index":1,"size":60,"text":"Despite the earlier mentioned challenges of quality and relevance however, there are isolated innovative experiments by HLIs in creating external knowledge networks and forging partnership with international and national development partners and foreign universities. It is imperative to learn from and capitalizing on such experience. Here is the highlight of some of the examples that the authors are aware of."},{"index":2,"size":68,"text":"The first is the partnership for public staff capacity strengthening through modular and distance-based joint master program by Mekele University and University College Cork, Ireland. This 'new' program integrating e-learning has been run in partnership with the Tigray Region Food Security Bureau, with financial support from the Irish Aid. The program has been found successful and effort is underway to replicate the program in other universities (personal communication)."},{"index":3,"size":53,"text":"The second example is the partnership between Hawassa University and University of Saskatchewan, Canada, with financial support from the CIDA (Beyene, 2007). The partnership was aimed at improving capacity in graduate instruction in agriculture, including the carrying out of relevant research through graduate programs, to enhance agricultural sustainability and food security in Ethiopia."},{"index":4,"size":78,"text":"The third example is the partnership between Haramaya University and the Netherlands Cooperation for Higher Education (NUFFIC). The partnership was initiated with the primary aim of R&D capacity strengthening within the university and for institutional building, with ultimate aim of creating adequate capacity to effectively address development challenges of pastoral and agro-pastoral communities through R&D. One result of the partnership has been the establishment of the Institute of Pastoral and Agropastoral Studies (IPAS) at Haramaya University (personal communication)."},{"index":5,"size":72,"text":"Yet another exciting example is again from Haramaya University. This is a joint effort aimed at improving public extension by producing all-rounded professional extension workers capable of serving diverse needs of Ethiopian farmers, through innovative, practical-oriented, custom-made BSc training program. This commonly referred to as 'BSc Mid-career Program' has been initiated and run in partnership with Sasakawa Africa Fund for Extension Education (Safe), MoARD, and regional bureaus of agriculture and rural development."},{"index":6,"size":94,"text":"Right from its inception, the program has been based on the philosophy of experiential learning in real-life -setting. The unique aspect of the program is the practical component involving action research. It entails participatory planning and implementation of supervised extension/enterprise projects (SEPs) by the candidates in their own place of work over several months. Team of university instructors conducts systematic periodic supervision of the implementation of SEPs, while technical backstopping and continuous implementation supervision is done by local supervisors assigned from among experts with regional, zonal or woreda offices as the case may be."},{"index":7,"size":52,"text":"This arrangement expanded practical learning opportunity for the students, and encouraged the academic staff to get out of the 'ivory tower' and continuously interact with key stakeholders outside in the practical world. Secondly, the feedback through continuous interaction has been useful to keep the curriculum relevant and dynamic (Tefera et al, 2006)."},{"index":8,"size":49,"text":"Moreover, independent external evaluation (Mwangi et al, 2005:ii)   IPMS research strategy is multi-pronged; the project encourages multi-disciplinary approach and multi-institutional arrangements, whilst ensuring that capacity building activities are embedded into the research processes. One important research modality is the use of graduate students -through full scholarship and research sponsorship."}]},{"head":"An overview of the quality and relevance of graduate research","index":5,"paragraphs":[{"index":1,"size":94,"text":"As a part of its public sector innovation capacity development effort (Figure-1), IPMS has over the past four years worked closely with the national GPs in agriculture and related disciplines. During this period, the senior IPMS staff members have co-supervised graduate research projects and have served as members of board of examiners, who evaluate the quality of both thesis preparation and open defense. Table-1 shows the summary of personal observation of IPMS staff over the last four years with regard to the relevance and quality theses by graduate students in agriculture and allied disciplines. "}]},{"head":"Documentation in a form of thesis is a common practice","index":6,"paragraphs":[{"index":1,"size":39,"text":"In few cases, some universities publish abstracts of theses However, these materials only reach limited number of professionals and are written in a scientific manner, excluding their value to the wider nonscientific community -who are often the end users. "}]},{"head":"IPMS intervention to enhancing relevance","index":7,"paragraphs":[{"index":1,"size":111,"text":"IPMS has over the past four years fully financed several candidates who were nominated by the public research and extension organizations. In addition, many other financially constrained graduate students, but with good academic performance, have received support to undertake their thesis research projects. So far more than 60 IPMS-sponsored graduate students (tuition/thesis or thesis only) have successfully defended their theses, and another 40 are presently at various stages in their research. IPMS strategies and modalities to enhance relevance are aligned with the critical stages in graduate research process. Due attention has been given to problem identification, skills to conduct rigorous analysis and develop appropriate recommendations, and proper dissemination of research results."}]},{"head":"Problem identification and proposal development","index":8,"paragraphs":[{"index":1,"size":86,"text":"The problem identification process by IPMS with partners involved the use of secondary data, GIS, expert consultation, and participatory diagnostic survey (PRA) and work plan development for each PLW. Subsequently, a stakeholder workshop was organized involving extension experts, administration, research institutions, women and men farmers, private traders, input suppliers, exporters to agree on priority commodities, problems, possible solutions, and responsible organizations. Problems that had ready solutions were dealt with the experts and the research institutions. Researchable issues were identified in areas where there were knowledge gaps."},{"index":2,"size":88,"text":"IPMS facilitates students' consultation with partners and stakeholders. The graduate fellows identify researchable problems and develop concept papers in consultation with IPMS staff and partners at PLWs. IPMS staff at the head quarters communicates during full proposal development with the graduate fellows and university supervisors. This enables to steer thesis research projects to priority researchable problems that had been identified during the diagnostic survey and work plan development, and also to studies which would be conducted with the view of developing specific intervention options and solving emerging problems."},{"index":3,"size":33,"text":"Further, IPMS facilitated the establishment of Woreda Learning and Advisory Committee 2 (WALC). WALC serves as important platform for graduate students to present their research proposal for feedback before the actual implementation commences."}]},{"head":"Research project implementation and write-up","index":9,"paragraphs":[{"index":1,"size":69,"text":"The project provided technical assistance to graduate students by assigning its senior staff members as co-supervisors to ensure effective implementation and quality of thesis. Further, IPMS in collaboration with Capacity Strengthening Unit (CaSt) of ILRI organized specialized training such as research methodology and proposal writing to enhance graduates' research skills. Moreover, IPMS sponsors the participation of the graduate fellows in relevant national forums such as conferences, workshops, seminars, etc."}]},{"head":"Dissemination of research outputs","index":10,"paragraphs":[{"index":1,"size":79,"text":"WALC is also an important platform for graduate students to present research results to potential users for verification, validation and sharing the findings. In addition, IPMS facilitates the dissemination of research outputs in the form of working papers, conference papers, and through mandatory ILRI wide graduate seminars. Further, the project collaborated with CaSt in facilitating the launching of Graduate Fellow Forum (GFF)-a platform for the graduates to share research results and to maintain linkage and also interact with ILRI."}]},{"head":"Capacity strengthening for university supervisors","index":11,"paragraphs":[{"index":1,"size":24,"text":"IPMS through its continuous interaction with the academia colleagues realized the need for strengthening the capacity of university supervisors in new concepts and approaches."},{"index":2,"size":41,"text":"A training workshop was carried out on 'the application of innovation system concepts and approaches in agricultural research for dev't (AR4D)' as part of the effort towards enhancing the relevance of graduate research to real challenges in agriculture and rural development."}]},{"head":"Stimulating sustainable partnership at higher level","index":12,"paragraphs":[{"index":1,"size":52,"text":"The challenge with project approach is the issue of sustainability. Cognizant of this, IPMS convened a national stakeholder workshop in October 2008 with the purpose of stimulating higher level deliberation as to how to forge sustainable partnership to enhancing the relevance of graduate research in advancing agricultural sciences and development in Ethiopia."},{"index":2,"size":94,"text":"The importance of having some kind of coordination mechanism and a platform were considered critical to translate the intentions to concrete actions. Thus, it was agreed to establish a \"Forum for Graduate Research in Agriculture\", FGRA for short. The forum is consisting of deans of schools of graduate studies of relevant higher institutes as well as EIAR representative. Actors like IPMS and the Rural Capacity Building Project (RCBP) of MoARD were identified as collaborators with important facilitation roles. It was also agreed that Hawassa University would play a coordination role during the transitional period."}]},{"head":"Some encouraging observations","index":13,"paragraphs":[{"index":1,"size":153,"text":"Tracer study is being undertaken to generate essential empirical evidence on the overall impact of the learning experience through action research and field exposure. However, the indications are that the improvement shown due to IPMS support in developmentalrelevance of graduate research projects provides 'glimmer of hope, the quality of the theses though still fails short of expectations. IPMS-sponsored graduate students have, through action-research, benefited from the exposure to development interventions on the ground and from the opportunity to interact with communities and various R&D actors. The students have been exposed to new research and development concepts, through their thesis research projects. Research by graduate students has been steered to priority and relevant topics; and orientation of the research systematically aligned to a broader development framework -value chain and innovation systems. The later has been achieved by linking graduate thesis research to commodity value chain development through research formulation, implementation and sharing of findings."},{"index":2,"size":96,"text":"Further, some graduate fellows have worked across PLWs, helping in systematically addressing crosscutting issues such as livestock feed scarcity, accessibility and effectiveness of public AI (artificial insemination) service in livestock genetic improvement, etc. The results of the theses are being synthesized to feed into policy dialogue. Secondly, specific commodity research in PLWs by the students in different disciplines generated results which, in combination, help in addressing key issues along commodity value chains, from improving efficiency in resource use (water/feed/management capacity) in commodity production, strengthening supportive services, all the way to enhancing value addition, market-linkage and profitability."},{"index":3,"size":76,"text":"The selected theses that have been published as IPMS Working Papers to disseminate research results are being used as references by graduate students in different universities. This directly contributes to alleviating the scarcity of reference materials that are relevant to the situation of Ethiopian agriculture. There is some anecdotal evidence indicating that several of these 'new style' graduates are already playing important roles in different capacities influencing the direction of market-based smallholder agriculture development in Ethiopia."}]},{"head":"Conclusion and Recommendation","index":14,"paragraphs":[{"index":1,"size":99,"text":"Unlike in the past, access to and effective application of knowledge will increasingly determine the ability of nations, including Ethiopia, in achieving productive, remunerative and ecologically sustainable agricultural development. It is thus decisive to have some strong graduate programs of high quality that are relevant and responsive to societal economic, social, political and ecological needs. Both the relevance of graduate research projects and the quality of learning experience thus deserves careful attention to leverage and optimize graduate research contribution to addressing real challenges in agriculture and rural development. And this is something that cannot be left to HLIs alone."},{"index":2,"size":79,"text":"The purpose of this paper is to make a modest contribution to the discourse on the issue of reforming HLIs in Ethiopia and beyond in Africa. More importantly, the authors through this paper hope to provoke further debates and to stimulate in this critical area more systematic and analytically rigorous research. The constraints, challenges and emerging opportunities to enhancing the relevance and quality of research and learning in GPs are summarized here, along with suggestions for the way forward."}]},{"head":"Key lessons from IPMS experience","index":15,"paragraphs":[{"index":1,"size":71,"text":"IPMS capacity-building support has been channeled in terms of financial and technical support, facilitating the connectivity of the demand for knowledge and the supply of knowledge, specialized training for research capacity strengthening, and the creation of platforms for knowledge sharing and stakeholder deliberation. The experience and approach of IPMS offers an operational strategy and modus operandi important to pilottest and adapt intelligently borrowed 'best bets' in order to innovate 'best fits'."},{"index":2,"size":39,"text":"IPMS experience also shows that linking systematically thesis research projects through action research to projects in agriculture and rural development, development-oriented research and extension activities could enhance developmental relevance of graduate research and expand learning opportunities for the students."},{"index":3,"size":73,"text":"The achievement of the intervention has been limited, however, primarily due to insufficiently prepared graduate students in terms of skills in conducting developmentoriented research, and staff shortage set against increased enrolment in GPs for providing the students with adequate and effective guidance. The existence of sufficient number of qualified staff with research skills, field exposure, and the knowledge of current development and options in agriculture, rural development and related fields is paramount important."},{"index":4,"size":135,"text":"GPs should make a relentless effort to ensure that adequate capable staff members are available for both teaching and supervision. Some of the options to overcome the constraints include: i) striking a balance between enrolments and capacities, particularly availability of senior staff, and exploring the possibility of integrating e-learning; and creating an enabling environment for 'brain circulation' for efficient use of Ethiopian professionals in the country and to attract the diasporas, eliciting the support of expatriates with international and UN agencies based in Ethiopia, and overseas voluntary associations On the positive side, initiatives to create functional multi-stakeholder platforms like the \"Forum for Graduate Research in Agriculture\" is potentially useful and need to be supported, but the forum should be inclusive, with enough representation of producer organizations, business and industry associations, NGOs, CSOs, and professional associations."},{"index":5,"size":65,"text":"Such platform can facilitate experience sharing on better ways of strengthening linkages and partnerships between education, research, extension and development; the establishment of priority research agenda and/or thematic areas through participatory process; and for periodic deliberation on vision, policies, strategies and action towards enhancing the quality of learning experience and developmental relevance of research in GPs, and feed the consensus into higher level policy decisions."},{"index":6,"size":69,"text":"Further, this kind of forum is useful to make coordinated effort towards mobilizing fund from diverse local and external sources in support of graduate research, and to lobby for public fund allocation which matches the expanded mandate of GPs , while also ensuring that public fund allocation is done on the basis of tangible contribution to development that GPs of respective institutions are actually making and/or likely to make."}]},{"head":"Other opportunities that need to be explored and exploited","index":16,"paragraphs":[]},{"head":"Learning from and capitalizing on pilot initiatives of HLIs","index":17,"paragraphs":[{"index":1,"size":52,"text":"There is imperative need for learning from and capitalizing on the isolated 'successful' experiments by higher learning institutions aimed at creating external knowledge networks and forging partnership with international and national development partners and foreign universities. To this effect, further research is called for to document and analyze experience and filtering lessons."}]},{"head":"Enhancing universities' regional linkages and innovation collaboration","index":18,"paragraphs":[{"index":1,"size":76,"text":"Lastly, an option that is worth considering within Ethiopian context is exploring opportunities and developing strategies to enhance universities' linkages and collaboration with regional governments and other actors in the region (neighboring regions) where the universities are situated. Such research linkage and partnership seems practical in Ethiopia given: i) the wave of expansion of universities and graduate programs with increasingly fair regional distribution; and ii) highly diverse production, food security and environmental challenges across the regions."},{"index":2,"size":100,"text":"Nonetheless, the habits and practices of regional governments are such that they may not have felt needs for research-based knowledge and innovation. On the other side, the capacity and incentive structures within higher learning institutions are such that GPs may be less responsive to regional priorities. Perhaps assessing existing capacities within university system may be an important entry point to design an appropriate capacity strengthening strategy. In addition, establishing national competitive grants for university regional engagement and collaboration is an option worth considering to stimulating effective demand for research-based knowledge and innovation, while also providing incentive for response by universities."},{"index":3,"size":152,"text":"Finally, we would like to make a caveat. Ensuring the quality of learning experience and developmental relevance of research in graduate programs is a daunting challenge. As research elsewhere shows, tackling one area without appropriate attention to inter-related aspects would lead to partial success. Thus, a holistic approach, multi-pronged and multilevel strategies, and long term commitment has more chance to succeed. The authors are of the opinion that such strategies should entail: i) creating and strengthening effective demand from the bottom; ii) strengthening staff competencies and organizational response capacity within the university system; and iii) supporting response from the top through appropriate policy, legislation, funding and incentive structures. These are crucial to reinforce the culture of quality, systems responsiveness and efficiency as well as to encourage universities to engage proactively in national and international knowledge networks, and in forging strategic partnership with national/regional government, economic agents, and public and private R&D actors."}]}],"figures":[{"text":" Ethiopia: the challenge of relevance and quality Ethiopia has over three decades of experience with graduate programs in agriculture. The pioneer, the then Alemaya College of Agriculture, launched GPs in the year 1979 at M.Sc level in five areas of specializations. Today GPs are being run by the Colleges of Agriculture of Haramaya and Hawassa universities, Wondogenet College of Forestry, Faculty of Dryland Agriculture and Natural Resources of Mekele University, and the Faculty of Veterinary Medicine of Addis Ababa University. About 29 new M.Sc. programs in agriculture had been launched until 2007, and Haramaya University for the first time launched 4 PhD programs in agricultural disciplines "},{"text":"Figure 1 : Figure 1: Distribution of universities in Ethiopia Huge public investments have been made to create new universities 1 , upgrade former colleges and technical institutes to university status, expand old universities, and to "},{"text":"Figure 2 : Figure 2: Project components "},{"text":". Making Graduate Programs Responsive 3.1. Reform agenda  relevant, need-based, proactive human and organizational capacity strengthening as well relevant, need-based, proactive human and organizational capacity strengthening as well as impact-oriented research and innovation. In particular, GPs are well placed to conduct as impact-oriented research and innovation. In particular, GPs are well placed to conduct research to adapt and/or generate knowledge, to strengthen capacity of extension service research to adapt and/or generate knowledge, to strengthen capacity of extension service for knowledge dissemination, and to generate research-based evidence to inform dialogue for knowledge dissemination, and to generate research-based evidence to inform dialogue for on creating enabling policies and institutions (Global Food Security Act, 2009). As for on creating enabling policies and institutions (Global Food Security Act, 2009). As Teferra (2007) concludes, 'Without strong graduate programs, it is simply impossible to Teferra (2007) concludes, 'Without strong graduate programs, it is simply impossible to establish a viable research culture and innovative capabilities in a nation.\" establish a viable research culture and innovative capabilities in a nation.\" 3In Ethiopia, graduate research is an integral component of the overall research 3In Ethiopia, graduate research is an integral component of the overall research undertakings at colleges and university faculties of agriculture and allied disciplines, and undertakings at colleges and university faculties of agriculture and allied disciplines, and often thesis research projects represent the larger share of time-bound research often thesis research projects represent the larger share of time-bound research undertakings of universities. Thus graduate research can make its own contribution in undertakings of universities. Thus graduate research can make its own contribution in addressing practical development and policy challenges if properly planned and addressing practical development and policy challenges if properly planned and implemented with the stakeholders. As put succinctly by Fear et al (2006, cited in implemented with the stakeholders. As put succinctly by Fear et al (2006, cited in Bawden, 2007:19), \"academy need to engage with the citizenry and not just work for it Bawden, 2007:19), \"academy need to engage with the citizenry and not just work for it or on it or extend out to it.\" or on it or extend out to it.\" One such example is the US Global Food Security Act (2009), One such example is the US Global Food Security Act (2009), emphasizing strengthening innovative capabilities of agriculture-related higher education emphasizing strengthening innovative capabilities of agriculture-related higher education and national research systems in developing countries. Agricultural HLIs can/should and national research systems in developing countries. Agricultural HLIs can/should make special contributions to fostering sustainable agricultural transformation, through make special contributions to fostering sustainable agricultural transformation, through  "},{"text":"Enhancing Relevance: IPMS Experience with Graduate Programs IMPS This highly regarded program has been replicated at Hawassa University, and effort is underway for further replication at Mekele and Bahir Dar universities. is a five-year project funded by the Canadian International Development Agency (CIDA). The aim of IPMS is to enhance the effectiveness of the effort by the Ethiopian Ministry of Agriculture and Rural Development (MoARD) to improve the productivity of smallholder through market-oriented agricultural development. IPMS uses participatory value chain dev't approach with innovation systems perspective; and gender, HIV/AIDS and environment are systematically mainstreamed in all project components. The project has been operational in 10 districts or Pilot Learning Woredas (PLWs) from Amhara, Oromia, Southern (SNNP) and Tigray Regions.  "},{"text":"IPMS research and development system Technology, organizational, institutional interventions RESEARCH Recommendations for scaling out   "},{"text":"Table 1 : The summary of observations regarding the relevance and quality of graduate theses Critical stages in thesis research Description of observed weaknesses  Concept note and Proposals are often ill-conceived, production-oriented, with little practical ConceptnoteandProposals are often ill-conceived, production-oriented, with little practical proposal development relevance proposal developmentrelevance stage   Poor interaction between students, supervisors and sponsors stagePoor interaction between students, supervisors and sponsors    Students lack support from statisticians; hence poorly designed research Students lack support from statisticians; hence poorly designed research    Students lack practical skills (field and laboratory) and experience in working Students lack practical skills (field and laboratory) and experience in working    with communities with communities Implementation stage Weak field supervision by university supervisors -due to heavy coursework Implementation stageWeak field supervision by university supervisors -due to heavy coursework    load and many advisees load and many advisees    Supervisors fail to provide timely and critical feedback. Supervisors fail to provide timely and critical feedback.    Weak critical and systematized use of the literature Weak critical and systematized use of the literature Write-up stage  Weak in scientific writing skills Write-up stageWeak in scientific writing skills    Difficulties in drawing appropriate conclusions and forwarding concrete Difficulties in drawing appropriate conclusions and forwarding concrete    recommendations recommendations Documentation and  Documentationand dissemination of results  dissemination of results  "},{"text":"Table 2 : Summary of the findings of stakeholder meeting about the status of graduate research Relevance and quality Funding & staff Documentation & dissemination Weak linkages & collaboration IPMS -in collaboration with Hawassa University convened a stakeholder workshop in 2008 to stimulate discussions about the quality and relevance of research by graduate students. The participants were from the relevant federal ministries (MoARD and Ministry of Education), Ethiopian Institute of Agricultural Research (EIAR) and Regional Agricultural Research Institutes (RARIs), CGIAR centers (ILRI and IFPRI), and relevant faculties and colleges from the Addis Ababa, Haramaya, Hawassa and Mekele universities. The participant confirmed earlier observations (Table-1) and generated additional insights (Table-2). Questionable quality Near exclusive Poor Intra-institutions Questionable qualityNearexclusivePoorIntra-institutions of research  reliance on limited documentation  of researchreliance on limiteddocumentation   government funding    government funding Generally driven by Disparity in allocation Dissemination Inter-institutions Generally driven byDisparity in allocationDisseminationInter-institutions individual interest of funds - mostly in the peer  individual interestoffunds-mostly in the peer   uncoordinated  community  uncoordinatedcommunity Haphazard, isolated, Problem  of Inadequate use of Research - Haphazard, isolated,ProblemofInadequate use ofResearch- supply driven, availability of ICT extension - supplydriven,availabilityofICTextension- technology focused adequate staff   education technology focusedadequate staffeducation Mismatch with Senior staff retention Poor writing & Other relevant MismatchwithSenior staff retentionPoor writing &Other relevant duration of research problem   communication actors (private duration of researchproblemcommunicationactors (private demand and available    skills of students sector, farmers, demand and availableskills of studentssector, farmers, student time      …) student time…) Lack of a coordinated Limited flexibility of   Lack of a coordinatedLimited flexibility of national agricultural staff to adapt and   national agriculturalstaff to adapt and research plan  respond to changing   research planrespond to changing   demand and   demandand   expectations    expectations Further,       Further,  "}],"sieverID":"62d8ad18-b936-4001-a09a-60049daab6df","abstract":"Graduate programs in agriculture and allied disciplines in Ethiopia are expected to make concrete contribution to market-oriented development of smallholder agriculture. This, among others, calls for realignment and engagement of the programs with smallholder farmers and, value chain, R&D and policy actors. No panacea exists, however, as to how to ensure effective linkages, and thereby responsiveness. Lessons from initiatives on the ground in the country and beyond is thus crucial to inform the development of appropriate policy and innovative strategy. With the same purpose, this paper discusses the key challenges facing the graduate programs and IPMS initiative to enhance the relevance of graduate research to challenges in commodity value chain development. The paper draws lessons and identifies strategic options based on the insights from IPMS experience as well as other emerging opportunities to improving the relevance and quality of research and learning in the graduate programs. The paper concludes by explicitly recognizing that improving the quality and relevance of graduate research and learning is a daunting task, requiring a holistic approach, multi-pronged and multi-level strategies, and long term commitment."}

data/part_1/0a84f5773895c72a812eb0fd4b3557af.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a84f5773895c72a812eb0fd4b3557af","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/606cd3b8-f33b-4fc0-b770-84c68c39bc81/retrieve"},"pageCount":2,"title":"Surveillance of Climate-smart Agriculture for Nutrition (SCAN) Innovations for monitoring climate, agriculture and nutrition at scale","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":115,"text":"Climate change will affect agriculture and human nutrition in profound ways. Without adaptation, predicted changes in temperature, precipitation, seasonality and the frequency and severity of extreme events have the potential to decrease crop and livestock production significantly in the near future and disrupt supply chains. Nutrient-rich foods including animal products and fruits and vegetable are particularly vulnerable. The most significant impacts are likely to coincide with regions already struggling with chronic malnutrition such as Sub-Saharan Africa. Climate change presents an existential crisis for nutrition-sensitive development and threatens the ability to meet the Sustainable Development Goals of Zero Poverty and No Hunger. Recognition of these plausible scenarios has catalyzed the development of climate-smart agriculture for nutrition."}]},{"head":"What is climate-smart agriculture?","index":2,"paragraphs":[{"index":1,"size":80,"text":"Climate-smart agriculture (CSA) refers to agriculture and food systems that increase production, build resilience and adaptive capacity of food system and reduce emissions or sequester carbon-where appropriate. In contrast to previous development agendas, CSA integrates climate and development goals together and explicitly targets the objectives and not the mechanisms to achieve them. This orientation means that CSA includes diverse interventions ranging from the micro-to the macro-level such as improved feeding of cattle or agroforestry to extension services and markets, respectively."},{"index":2,"size":66,"text":"Emerging CSA partnerships and investments have the ambition to affect agricultural and nutrition outcomes at scale. For example, the African Union's New Economic Partnership for Africa's Development (NEPAD) and the Global Alliance for Climate-Smart Agriculture (GACSA) aim to reach 25 and 500 million smallholder farmers with CSA, respectively. Simultaneously, billions of US dollars in investments are being planned to scale up CSA in Africa and Asia. "}]},{"head":"Why SCAN?","index":3,"paragraphs":[{"index":1,"size":63,"text":"CSA intends to sustainably increase production and improve the resilience of food systems under climate change. However, the evidence base on the linkages among climate, agriculture and nutrition ('C-A-N') is complex and limited (Figure 2). With the rapid increase in CSA programming, it is essential to monitor and learn what works to improve the evidence base, increase programming effectiveness and outcomes for farmers."}]},{"head":"Figure 2. Possible ways that CSA interventions (grey boxes) buffer against climate risks and build resilience (left) and affect nutrition outcomes (right).","index":4,"paragraphs":[]},{"head":"Innovation","index":5,"paragraphs":[{"index":1,"size":54,"text":"SCAN will develop metrics, monitoring techniques and analytics capable of generating information describing the C-A-N pathways. The premise underlying this project is that innovative methods and metrics used in computer science, decision science and ecology can increase the information available to understand the linkages among C-A-N and facilitate use of that evidence in programming."},{"index":2,"size":17,"text":"SCAN's research addresses three interrelated themes of data acquisition, integration and analysis. Examples of SCAN research questions:"},{"index":3,"size":20,"text":"• Data acquisition: What are the theoretical limits for conducting surveys using Android-based surveys, call centers, SMS or voice-based recordings?"},{"index":4,"size":20,"text":"• Data integration: Can we develop probabilistic approaches to compile information from disparate sources for monitoring C-A-N metrics and outcomes?"},{"index":5,"size":20,"text":"• Data analysis: Do alternative statistical techniques such as 'hypervolumes' provide new means to interpret and visualize multi-dimensional C-A-N relationships?"},{"index":6,"size":67,"text":"Field research activities will start in October 2016. At that time, SCAN will work with NGO partners in Zambia to integrate existing data and data newly acquired through the pilot Android-based system into a database and analytical engine. In Kenya, SCAN will use the same rapid assessment approach applied in Zambia at sites that cross a climate gradient and evaluate ICT approaches to collect time series data."},{"index":7,"size":12,"text":"SCAN is a pilot interdisciplinary research project embedded within large-scale development processes."},{"index":8,"size":23,"text":"Results will help determine the optimal infrastructure to build coherent and harmonized datasets and support monitoring and decision making around C-A-N and CSA."},{"index":9,"size":9,"text":"We welcome feedback and additional collaborations in this work."}]}],"figures":[{"text":"Figure 1 . Figure 1. Kenyan farmer using a mobile phone to receive a seasonal weather forecast, an example of a CSA intervention. N. Palmer, CCAFS. "}],"sieverID":"cf0b1e76-136f-4877-b75d-cddc4240e50e","abstract":"n Climate change will affect the ability to deliver not only the quantity but also the type and quality of food necessary for nutritious diets n Global and regional 'climate-smart agriculture' initiatives offer an opportunity to mitigate climate impacts and improve nutrition outcomes at scale n SCAN develops new ways to acquire, integrate and analyze data to help determine what is climate-smart and nutrition-sensitive"}

data/part_1/0a968ed10d165c8c16ad6935f480123f.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0a968ed10d165c8c16ad6935f480123f","source":"gardian_index","url":"http://www.ifrj.upm.edu.my/24%20(04)%202017/(3).pdf"},"pageCount":6,"title":"Assessment of hygiene practices of pork retail outlets in Kampala district, Uganda","keywords":[],"chapters":[{"head":"Introduction","index":1,"paragraphs":[{"index":1,"size":124,"text":"Pork has in recent years become an important meat in Uganda, second only to beef in the amount consumed. With a population of over three million, the country's pig industry has experienced tremendous growth in recent decades (The Republic of Uganda Ministry of Agriculture Animal Industry and Fishieries, 2011). Although consumption per capita is still only 3.4kg/person/year, pork is a popular source of protein for both rural and urban population (FAOSTAT, 2015). Kampala, the capital of Uganda is the main marketing hub for pork from the leading pig producing communities in the country (Ouma et al., 2014). A considerable proportion of pigs slaughtered in the district are kept in the peri-urban areas (The Republic of Uganda Ministry of Agriculture Animal Industry and Fishieries, 2011)."},{"index":2,"size":120,"text":"Most of the pork produced in the country is distributed and sold through informal market channels where food safety practices such as inspection of the pork and the hygiene of sale premises are perceived to be uncommon (Ouma et al., 2014). There is only one gazetted slaughter place for pigs in Kampala called \"Wambizzi Cooperative Society Ltd.\"; but most pigs that reach Kampala are slaughtered in backyards or vacant land near pork outlets (Wandera, 2015). Studies done in other developing countries indicate that slaughter of pigs in ungazetted places makes meat inspection difficult to implement, thereby increasing risks of pork-borne infections such as T. solium cysticercosis, Echnoccocosis and Trichnellosis ( Joshi et al., 2003;Maridadi et al., 2011;Krecek et al., 2012)."},{"index":3,"size":119,"text":"Pork becomes unsafe for human consumption when the pig slaughtered was infected with zoonotic pathogens or if the meat is contaminated with pathogens during the handling process (Haileselassie et al., 2012). Handlers of pork are at risk from pork-borne disease as are consumers (Aiello and Larson, 2002;Eshitera et al., 2012;Mwanjali et al., 2013). In developing countries, conditions such as salmonellosis, Escherichia coli gastroenteritis, taeniosis, amoebiosis, shigellosis, cholera, toxoplasmosis, rotavirus infection and typhoid are associated with contaminated food and can cause severe effects (Bogere and Baluka, 2014;Ifeadike et al., 2014). Contamination has been associated with ungazetted slaughter areas but licensed slaughter houses may also be problematic (Jumaa, 2005). Food handlers can be a source of contamination (Nyarango et al., 2008)."},{"index":4,"size":30,"text":"The objective of this work was to map the location of pork outlets in Kampala and to assess hygienic practices, their socio-economic determinants and risk factors for pork borne disease."}]},{"head":"Materials and Methods","index":2,"paragraphs":[]},{"head":"Study area","index":3,"paragraphs":[{"index":1,"size":111,"text":"Kampala district is the capital city of Uganda. According to the Uganda Bureau of Statistics the population of people in Kampala was estimated to be 1,659,600 in 2011. The district is located in the central region of the country, making it a market hub for pigs reared in the rural communities of the different parts of the country. Although on a small scale, pig rearing is done in backyards in some peri-urban areas with an estimated population of 38,306 (The Republic of Uganda Ministry of Agriculture Animal Industry and Fishieries, 2011). Kampala has five divisions: Kawempe, Rubaga, Makindye, Nakawa and Kampala central administrative division. All divisions were part of the study."}]},{"head":"Study design","index":4,"paragraphs":[{"index":1,"size":64,"text":"A survey was carried out in Kampala district from May to June 2012, to map the pork retail outlets and assess hygiene practices along the market chain from the pig slaughter places to the pork retail outlets. Pork retail outlets in this study constituted two categories: pork eateries where only cooked pork was sold and butcheries/eateries where both raw and cooked pork was sold."},{"index":2,"size":156,"text":"After identifying the first pork outlet and obtaining data, directions to the location of the next outlets were obtained from the respondent. Global Positioning System (GPS) points of the pork outlets were taken during the survey and used to generate a map using Esri's ArcGis software (version 10.1). An observation checklist was used to assess the practices of the gazetted Wambizzi abattoir in Rugaba division and an ungazetted slaughter place in Church zone, Kamwokya in Nakawa division. The latter was selected for convenience and because typical of the ungazetted slaughter places. A structured questionnaire was used to assess hygiene practices of the pork retail outlets. Prior to conducting the study, the tools were pretested in two pork outlets in Namasuba-Kikajjo zone, Wakiso district. The questionnaire was administered to the respondents by two veterinary officers fluent in Luganda, the commonly used local language, and English. Direct observations were also carried out by interviewers using a structured checklist."}]},{"head":"Statistical analysis","index":5,"paragraphs":[{"index":1,"size":81,"text":"Hygienic practices were divided into three categories: infrastructure (n=9 variables); equipment presence and condition (n=8 variables); and, worker hygiene (n=5 variables). Hygienic responses were summed into an overall hygiene score, which was also standardized to a percentage score. Robust linear regression, accounting for clustering of data within divisions was used to assess the relation between the hygiene score and predictors (gender of owner, years in operation, type of establishment, and presence of a medical certificate). Data were analyzed with Stata 11."}]},{"head":"Ethical considerations","index":6,"paragraphs":[{"index":1,"size":24,"text":"The study was approved by the Research and Ethics Committee of the College of Veterinary Medicine and Biosciences of Makerere University (Reference No: VAB/REC/13/104)."},{"index":2,"size":20,"text":"Prior to questionnaire administration, verbal consent was obtained from the respondent after clear explanation of the purpose of the study."}]},{"head":"Results","index":7,"paragraphs":[]},{"head":"Location of pork retail outlets","index":8,"paragraphs":[{"index":1,"size":65,"text":"In all, 179 retail outlets were identified in Kampala district during the study. Twenty-one of these were not mapped because they were closed (n=18) or owners did not consent to the study (n=3). Of the 158 outlets mapped, Makindye division had the highest number of outlets (42) and Kampala Central had the least (6). The locations were displayed in the map illustrated in Figure 1."},{"index":2,"size":41,"text":"Of the 158 outlets identified, only 17 (10.7%) were pork eateries and the rest were butcheries/ eateries. All the pork eateries were managed by men while 12 of the 141 butcheries/eateries (8.5%) were managed by females (Table 1). All outlets except "}]},{"head":"Hygiene practices associated with pig slaughter places and pork marketing","index":9,"paragraphs":[{"index":1,"size":29,"text":"Practices that affect slaughter hygiene were assessed in an un-gazetted slaughter place (Church zone Lufula, Kamwokya) and a gazetted slaughter place (Wambizi abattoir). Table 2 depicts the two scenarios."}]},{"head":"Hygienic practices at pork outlets","index":10,"paragraphs":[{"index":1,"size":68,"text":"The average overall hygiene score was 61.3% with a range of 13.6-100%. Worker hygiene score was highest (average 71%), followed by infrastructure (68.2%) and equipment (47.3%). There were differences between divisions with butchers in Kampala Central, Nakawa and Kawempe scoring 78%, 78% and 72% respectively, Makindye scoring 57% and Rubaga just 38%. The level of compliance with different aspects of good hygienic practices is given in Table 3."}]},{"head":"Determinants of hygienic practices","index":11,"paragraphs":[{"index":1,"size":34,"text":"After controlling for the putative socioeconomic determinants of hygienic practices, the only significant was the presence of a medical certificate, which had a large, significant and positive effect on the hygiene score (Table 4)."}]},{"head":"Discussion","index":12,"paragraphs":[{"index":1,"size":354,"text":"Although the study was intended to exhaustively map all outlets, it is probable that some were missed since the exercise was conducted along roads and in trading centers, which were identified using the district administrative map. This study confirms increasing demand of pork with a considerable number of outlets established in all Kampala districts. The demand could be driven by the improving incomes, growing social clusters and less interference of religious sentiments that made pork less popular in the past (Ouma et al., 2014;FAOSTAT, 2015). Demand is also thought to be influenced by alcohol consumption and a strong association between alcohol sale and pork was found in this study. Ownership of pork outlets was dominated by men. This was also noted in a value chain assessment in Masaka, Mukono and Kamuli district whereby except at the production level, women's involvement in the pig value chain was minimal (Ouma et al., 2014). There was a tendency for women operated outlets to have better hygiene but this result was not significant possibly due to the small number of women. The gazetted abattoir tended to have better practices and hygiene than the ungazetted slaughter place. This may be because the abattoir had better infrastructure, more trained staff and a higher level of inspection. In addition, the abattoir had benefited from support from a series of development projects. The study demonstrated that most pork consumed in Kampala was un-inspected and could pose a risk of meat borne infections to consumers. Similar studies in Dar es Salaam city in Tanzania, and East Cape Province South Africa also disclosed that poor hygiene of most slaughter places and lack of inspection posed a serious public health challenge (Ngowi et al., 2004;Krecek et al., 2012). The role of meat inspection in eliminating infections such as T. solium cysticercosis and echinococcosis has been described in various studies (Sakai et al., 2001;Joshi et al., 2003;Boa et al., 2006). Just like in other developing countries where such a challenge occurs, lack of meat inspection has been due to failure to implement the Public Health (PH) legislations that enhance meat safety ( Joshi et al., 2003)."},{"index":2,"size":177,"text":"Unlike in a study in Kenya where only 40% practiced hand hygiene (Nyarango et al., 2008), almost all outlets used clean water and soap. Keeping nails short which was a common practice could have helped reduce load of micro-organisms that inhabit the hands and makes hand washing more effective as reported elsewhere (Jumaa, 2005). A considerable number of pork handlers worked without protective clothing. This was in agreement with reports in Ethiopia and India ( Haileselassie et al., 2012;Ghimire et al., 2013). Poor disposal of waste was a key challenge in the study and it is in agreement with observations elsewhere ( Lawan et al., 2013;Ifeadike et al., 2014;). It could be promoting transmission of pathogens from wastes to pork by flies especially in outlets where pork was exposed as also observed in another study (Aiello and Larson, 2002). Many pork sellers admitted not to have been medically examined. It was likely that carriers of parasites transmitted through faeco-oral route could be among those handling pork at retail outlets ( Sciutto et al., 1995;Flisser et al., 2006)."},{"index":3,"size":176,"text":"Most of the pork outlets were operated without a PH certificate. According to the PH act, in order to acquire a medical certificate, the premises where the outlet operates has to be assessed by health inspectors and a laboratory report given indicating that the pork sellers (handlers) have undergone a medical checkup and are free of parasitic conditions that can contaminate food (including tapeworms) (The Public Health Act, 1964). Presence of a PH certificate was significantly associated with better hygiene practices; however, it is difficult to establish a causal link as the relation may have been due to a confounding factor (e.g. location). Similar observations were made in Ethiopia, Nigeria and Nepal where poor implementation of PH health regulations on meat hygiene encouraged poor hygiene in outlets (Joshi et al., 2003;Haileselassie et al., 2012;Edia-asuke et al., 2014) . The PH act in Uganda sets guidelines for establishment and operation of slaughter places and retail outlets. Likewise, the meat handlers are meant to undergo medical examination to be allowed to handle meat (The Public Health Act, 1964)."}]},{"head":"Conclusion","index":13,"paragraphs":[{"index":1,"size":72,"text":"Consumption of pork in Kampala is high in the district. The district lacks gazetted abattoirs for pigs meaning there is a lack of meat inspection and monitoring of hygiene practices is difficult. Hygiene practices in retail butcheries/eateries are still wanting, but the fact that a minority of outlets of excellent hygienic practices exist suggests improvements are feasible. Implementation of the PH regulations was useful in promoting practices that led to good hygiene."},{"index":2,"size":76,"text":"There is need for Kampala City Council Authority (KCCA) to set up low cost slaughter facilities in each of the five divisions. Traders in each division could be organized in groups and given training on good meat hygiene practices. The Ministry of Agriculture, Animal Industry and Fisheries (MAAIF) and KCCA should ensure the PH regulations on meat hygiene are implemented. Studies need to be conducted to assess pathogen contamination in pork sold in the retail outlets. "}]}],"figures":[{"text":"Figure 1 . Figure 1. Distribution of pork eateries/retail outlets in Kampala district at the time of study "},{"text":"  "},{"text":"Table 1 . A summary of respondents by gender in pork outlets in five divisions of Kampala district  "},{"text":"Table 2 . A comparison of an un-gazetted pig slaughter place (Church zone Lufula, Kamokya) and a gazetted pig slaughter place (Wambizi abattoir) in Kampala district  "},{"text":"Table 3 . Compliance with good hygienic practices in pork retail outlets in Kampala district  "},{"text":"Table 4 . Robust linear regression predicting hygiene score of retail outlets in Kampala district  "},{"text":" Fair Food project, the CGIAR Research Program on Agriculture for Nutrition and Health (A4NH), led by the International Food Policy Research Institute and the CGIAR Research Program on Livestock and Fish (L&F) led by the International Livestock Research Institute and the German Academic Exchange Service (DAAD).  "}],"sieverID":"459d23cc-bcd7-47b3-88e6-da601238e11b","abstract":"This study was conducted to map the distribution of pork retail outlets as well as assess their role in food borne disease transmission. Using a structured questionnaire, practices associated with hygiene related to infrastructure, workers, and equipment were assessed. Sources of pork were assessed to determine whether pork had undergone inspection, as were socio economic determinants of hygiene outcomes and risk factors for foodborne disease. There were 158 pork outlets in the five divisions of Kampala. Overall, 68% of the pork was from places where slaughtering was not authorized (ungazetted) and meat inspection not carried out. Worker hygiene score was highest (average 71%), followed by infrastructure (68.2%) and equipment (47.3%). There was a significant relation between good hygiene and the presence of a public health certificate. However only 42% of the outlets had a public health certificate. Holding a public health certificate is an important predictor of good practices."}

data/part_1/0b05b39d21656706932e02e56df3be4b.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b05b39d21656706932e02e56df3be4b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/783c1771-6392-40b3-aaf3-c541fdcc9e8c/retrieve"},"pageCount":30,"title":"","keywords":[],"chapters":[{"head":"ABOUT THE TRAINING SERIES","index":1,"paragraphs":[{"index":1,"size":85,"text":"The Foresight for Future Planning Training Series was organised by the Centre for Coordination of Agricultural Research and Development for Southern Africa (CCARDESA) and supported by the Comprehensive Africa Agriculture Development Programme ex Pillar 4 (CAADP-XP4) programme funded by the European Union (EU) and administered by the International Fund for Agricultural Development (IFAD). The series was produced by foresight specialists supported by the Accelerating Impacts of CGIAR Climate Research for Africa (AICCRA) project and funded by the International Development Association (IDA) of the World Bank."},{"index":2,"size":59,"text":"The Foresight for Future Planning Training Series is a four-part training series for applying foresight to address climate change impacts and uncertainties. The training series equips users to practically apply a range of foresight tools and methods for innovative research in development prioritisation, specifically assisting in strategic planning and policy formulation for climate-relevant transformation in agriculture and food systems."},{"index":3,"size":37,"text":"The training series has been designed for policy makers, technical officers, advisory services, researchers and academicians from regional and national government linked to agriculture, food systems and climate change across the Southern African Development Community (SADC) region."}]},{"head":"The objectives of the Foresight for Future Planning Training Series are to:","index":2,"paragraphs":[{"index":1,"size":11,"text":"Introduce the foresight method as an approach to catalyze transformational planning."},{"index":2,"size":9,"text":"Demonstrate the practical and concrete foresight tools and methods."},{"index":3,"size":20,"text":"Demonstrate the methods and approaches using the context of climate resilience in food systems and agriculture in the SADC region. "}]},{"head":"STRUCTURE OF THE TOOLKIT","index":3,"paragraphs":[{"index":1,"size":11,"text":"The toolkit is presented in four series: Bringing Evidence to Bear "}]},{"head":"2.","index":4,"paragraphs":[{"index":1,"size":1,"text":"3."}]},{"head":"4.","index":5,"paragraphs":[{"index":1,"size":1,"text":"5."}]},{"head":"THE TRAINING APPROACH","index":6,"paragraphs":[{"index":1,"size":39,"text":"The training approach follows the process of presenting a foresight method or tool, introducing the key steps as to how and when to apply it and then demonstrating its application in the context of agricultural development and climate resilience."}]},{"head":"SETTING THE STAGE","index":7,"paragraphs":[{"index":1,"size":1,"text":"Series"},{"index":2,"size":17,"text":"Give an overview of climate impacts in the SADC region and why future planning is so critical."},{"index":3,"size":9,"text":"Provide an introduction to foresight and 'future' thinking methods."},{"index":4,"size":8,"text":"Differentiate between planning for incremental and transformational change."},{"index":5,"size":10,"text":"Elaborate upon how foresight can lead to more transformational planning."},{"index":6,"size":18,"text":"The first series of the toolkit 'sets the stage' for the foresight planning process. The objectives are to:"},{"index":7,"size":68,"text":"Setting the stage is presented as a series of topics interspersed with question and answer (Q&A) sessions and learning exercises. The SADC region is severely impacted by climate change. Climate change impacts are caused by climate-related stresses, which are long-term trends, or climate-related shocks which are acute events. Climate shocks are hard to predict when planning for the future and enhanced regional resilience is crucial in this regard."},{"index":8,"size":19,"text":"Climate-related stresses are \"longterm trends or pressures that undermine the stability of a system and increase vulnerability within it.\""}]},{"head":"Examples of climate-related stresses include:","index":8,"paragraphs":[{"index":1,"size":10,"text":"Decreased average annual rainfall Delayed onset of the rainy season"}]},{"head":"Higher temperatures","index":9,"paragraphs":[{"index":1,"size":32,"text":"Climate-related shocks are \"external short-term deviations from long-term trends that have substantial negative effects on people's current state of well-being, level of assets, livelihoods, safety or their ability to withstand future shocks.\""},{"index":2,"size":16,"text":"Shocks are normally acute events that either slowly emerge e.g., droughts or rapidly emerge e.g., flooding.  "}]},{"head":"Examples of climate-related shocks include:","index":10,"paragraphs":[]},{"head":"Climate-compatible or climate-smart development","index":11,"paragraphs":[{"index":1,"size":30,"text":"Development which minimises harm caused by climate impacts, while maximising the many human development opportunities and delivers benefits across all three priority areas: climate mitigation, climate adaptation and poverty eradication."}]},{"head":"Climate-proofing","index":12,"paragraphs":[{"index":1,"size":17,"text":"A process that makes projects, strategies, policies and measures resilient to climate change, including climate variability, by:"},{"index":2,"size":23,"text":"• Systematically examining projects, strategies, and policies to identify ways to minimise climate change risks and optimise adaptation, i.e., climate risk screening; and"},{"index":3,"size":10,"text":"• Integrating these ways into programming and projects, i.e., mainstreaming."}]},{"head":"Climate-mainstreaming","index":13,"paragraphs":[{"index":1,"size":20,"text":"Integrating climate concerns and adaptation responses into relevant policies, plans, programs, and projects at the national, sub-national, and local scales."}]},{"head":"Series 1","index":14,"paragraphs":[{"index":1,"size":70,"text":"Planning for the agricultural future of the SADC region requires responding to climate change impacts but also enhancing the resilience of the system to future change and uncertainty. This will allow the agricultural system to continue to function in much the same way, despite external stressors or shocks. Useful tools and approaches for moving towards climate resilience include the application of a climate lens, climate-smart development, climateproofing and climate mainstreaming."}]},{"head":"Climate-resilient food systems","index":15,"paragraphs":[{"index":1,"size":24,"text":"A food system connects people, their food and where the food comes from, it affects and is affected by governance, economics, sustainability and health."},{"index":2,"size":108,"text":"Food system -A food system is a complex web of activities involving the production, processing, transport, and consumption -connecting people to their food. Issues concerning the food system include the governance and economics of food production, its sustainability, the degree to which we waste food, how food production affects the natural environment and the impact of food on individual and population health. Foresight is important in helping people to understand the situation in reality. This is done by bringing in evidence such as robust data and models, sharing it with people, and encouraging their continual participation to allow for enhanced understanding and changes in perspectives and behaviour patterns."},{"index":3,"size":26,"text":"People start to understand their own ways of thinking and decision-making processes, and the foresight planning process can be used to show them a new way."},{"index":4,"size":69,"text":"Climate change impacts on the food system may manifest as health risks, poor consumer experiences, volatile food prices and increased food wastage or interruptions to the supply chain due to damaged infrastructure or water shortages restricting the productivity of processing plants.  Foresight is the process of looking to the past and the present to envision and prepare for different futures, which then allow us to make strategic decisions today."}]},{"head":"15","index":16,"paragraphs":[]},{"head":"IMPACTS OF CLIMATE CHANGE ON THE FOOD SYSTEM","index":17,"paragraphs":[{"index":1,"size":18,"text":"Foresight is not a prediction of the future, but rather a process of imagining many different possible futures."},{"index":2,"size":63,"text":"A foresight process is guided by four questions that allow you to move from looking at past and present patterns and trends to creating a strategy or plan that addresses what might happen in the future -a plan or strategy that is 'futureproofed'. This entails different approaches and tools such as scenario planning and a change in mindset to consider different possible futures."},{"index":3,"size":37,"text":"Foresight practitioners need to develop skill sets such as identifying drivers that are causing change within the system with which they have defined and then determining what needs to be done to move towards their preferred future. "}]},{"head":"It is inspiring to think that the","index":18,"paragraphs":[]},{"head":"KEY TERMS","index":19,"paragraphs":[{"index":1,"size":9,"text":"Strategic foresight: the combination of foresight and strategic management."}]},{"head":"Futures thinking:","index":20,"paragraphs":[{"index":1,"size":23,"text":"-describes the practice of thinking about the future in a structured way, and the methods and approaches that are used to do so."},{"index":2,"size":11,"text":"Drivers: factors that cause change, thereby affecting or shaping the future."},{"index":3,"size":20,"text":"Scenario planning: a technique of strategic planning that relies on tools and technologies for managing the uncertainties of the future."},{"index":4,"size":18,"text":"Forecasting: an estimate / best guess of what might happen in the future but not a definitive prediction."},{"index":5,"size":13,"text":"Futuring: the act, art, or science of identifying and evaluating possible future events."}]},{"head":"Series 1","index":21,"paragraphs":[{"index":1,"size":74,"text":"The premise of foresight is that the future is still in the making and can be actively influenced or even created. The 'reflection' step is crucial in future-proofing plans and strategies and the 'strategy' step involves unpacking, naming and developing new future-proofed planning structures. Each of the stages in the foresight process has linked tools and methods such as 'scoping' in the 'context' phase through to 'developing a road map' in the strategy phase."},{"index":2,"size":67,"text":"Across the whole foresight process data, evidence, knowledge and creativity are incorporated. There is an emphasis on creativity as planning for the future involves envisioning very different possible futures. Another crucial component of a foresight process is stakeholder engagement and continuous participation throughout the different stages and steps. Continuous participation is needed even if you just plan to conduct a foresight process within your department or team. "}]},{"head":"Context","index":22,"paragraphs":[]},{"head":"Varied and inclusive of non-state actors in co-design and implementation","index":23,"paragraphs":[{"index":1,"size":47,"text":"There is no standardised way of doing foresight, the tools and methods applied depend on your specific situation, objective, scale and scope. There is no foresight manual that can be used across all contexts; different sets of tools and methods are applied according to the objectives proposed."},{"index":2,"size":39,"text":"Applying foresight to policy and strategic planning processes allows them to become more flexible and adaptive, it encourages cross-departmental approaches, frequent participation and engagement from a wider pool of stakeholders and the creation of more meaningful and transformative partnerships."}]},{"head":"Series","index":24,"paragraphs":[]},{"head":"1","index":25,"paragraphs":[]},{"head":"Q&A","index":26,"paragraphs":[{"index":1,"size":28,"text":"The COVID-19 pandemic arrived and changed the way we live. Does this mean that the world had not applied foresight and prepared for this as a potential future?"},{"index":2,"size":117,"text":"The public health modelling agency in the United States had previously highlighted the possibility of a global pandemic occurring. They could not say when it would happen but estimated it to be within the next five to ten years. So foresight was used, they had looked at the data and the trends and had identified that a global pandemic was likely BUT a pandemic response unit was never established. This illustrates that foresight planning is only effective if action is taken. The pandemic has taught people that some things that are seemingly impossible or inconceivable can in fact occur. Most people in 2019 would not have thought it plausible that a global pandemic could occur in 2020."}]},{"head":"\"BE CLEAR AS TO WHERE YOU ARE GOING AND BE FLEXIBLE AS TO HOW TO GET THERE\"","index":27,"paragraphs":[{"index":1,"size":2,"text":"-Bob Johansen"},{"index":2,"size":18,"text":"Foresight will equip you with adaptable skills and the ability to assess, change and plan for different futures."},{"index":3,"size":53,"text":"What skills or characteristics are required to be able to apply a foresight approach? Foresight invites us to have a radically curious mind, to be able to think outside of silos and respect the ideas of others. It is important to have a neutral viewpoint and not to judge based on past experiences."}]},{"head":"! ! ??","index":28,"paragraphs":[{"index":1,"size":8,"text":"• Justifiably terrified and determined, and stubbornly optimistic "}]},{"head":"WHAT WE FINDING?","index":29,"paragraphs":[{"index":1,"size":23,"text":"This exercise teaches us that if we had any anticipation that things were going to change in the future we would plan better."},{"index":2,"size":2,"text":"Series 1"}]},{"head":"Planning for transformational change","index":30,"paragraphs":[{"index":1,"size":22,"text":"Transformational change: includes major long-term changes in the way we operate and may shift us between or into new 'systems' and processes."}]},{"head":"Incremental change:","index":31,"paragraphs":[{"index":1,"size":18,"text":"refers to change that occurs slowly and without necessarily modifying the essence of social structures or organizational practices."}]},{"head":"KEY TERMS","index":32,"paragraphs":[{"index":1,"size":31,"text":"The We often build our plans and strategies based on actions that result in incremental change -when we need actions that are transformative and suitable for the future that is coming."}]},{"head":"Q&A","index":33,"paragraphs":[{"index":1,"size":10,"text":"How do political will and resource allocation influence transformative change?"},{"index":2,"size":57,"text":"The transformation of institutions requires substantial political will and funding. In some ways the COVID-19 pandemic has opened our eyes; there is not just a need to change policies and programmes and access support schemes, there is also a need to transform institutions by building capacity and developing necessary skills to achieve the goals that we set."},{"index":3,"size":81,"text":"By using foresight methods to identify possible futures we can say very clearly what changes need to take place, for example, changes to political will or institutions and how they invest. Often in a foresight process you deal with a specific strategy or policy, but it is also important to ask if the right institutions and people are involved. When thinking in terms of future planning we should ask if we need to establish new institutions and engage with different stakeholders."},{"index":4,"size":37,"text":"Traditional strategic planning reinforces our biases; we predict and plan for the future based on our past experiences. Foresight requires letting go of cognitive biases towards the past to ready ourselves for the future that is coming."},{"index":5,"size":58,"text":"What is a cognitive bias? It is a deviation from rationality because of past experiences and world views. For example, if I am making a case, I may only look for the data that reinforces my beliefs or understanding and that corresponds to my world view. This is an important aspect to address in becoming a critical thinking."}]},{"head":"So where does foresight come into play?","index":34,"paragraphs":[{"index":1,"size":25,"text":"Foresight tools and methods, we can plan the transformational change that will be needed to move towards the future we want. -Gomez, 2021: Just Labs"}]},{"head":"Traditional","index":35,"paragraphs":[]},{"head":"LEARNING OUTCOMES","index":36,"paragraphs":[{"index":1,"size":3,"text":"Increased capacity to:"},{"index":2,"size":19,"text":"Understand future impacts that climate change may bring to the food system and why future planning is so critical."},{"index":3,"size":14,"text":"Define foresight including key methods, tools and skill sets to be a foresight practitioner."},{"index":4,"size":17,"text":"Explain the difference between between iterative and transformational planning and what foresight offers to improve transformational planning. "}]}],"figures":[{"text":" Photo: ©Faizal Abdul Aziz (CIFOR) "},{"text":" Photo: ©Daniel Hayduk (FAO) "},{"text":"\" Photo: Top right -©Apollo Habtamu (ILRI), Bottom -©Nahom Tesfaye (UNICEF) "},{"text":"Foresight Photo: Top left -©Michael Tewelde (FAO/IFAD/WFP), Bottom right -©Random Institute (Unsplash) "},{"text":" The foresight process involves tools and methods that allow us to consider three different time frames -to look back into the past, assess what is happening in the present and anticipate the future. stages involved in a foresight process; the two key stages covered in this training series are situational analysis and long-term future planning. The foresight framework comprises multiple stages, key steps and the four key questions. During the situational analysis stage we develop an understanding of the context by asking 'what is happening?' and 'why is it happening?' The long-term future planning stage is where we try to determine 'what might happen in the future?', 'why might it be happening?', 'what might we want to do differently?' and 'what will we do differently?' "},{"text":"• Maintains a solid vision and has capacity to shift the storyline/ narrative to one of purposeful shared meaning • Thinks in systems and sees the larger picture • Wants an accurate version of reality and takes responsibility for one's destiny • Open to possibilities and curious, intrigued with contradictions • Willing to test individual beliefs and cut through individual biases, always ready to ask the next question • Enjoys interacting with new data and information, balancing the creative and analytical • Grounded -their self worth is not tied to how right or wrong they are be happening? Think back to what you were expecting you would be doing in the year 2020 before the COVID-19 pandemic started…what were your plans? \"I intended to travel overseas for a conference\" Now think ahead to late 2021 or early 2022, describe what you think your working environment will look like or your personal activities. need to do? Think back February 2020, what would you have done differently if you had known that COVID-19 was coming -what would you have changed in how you planned for 2020-2021? \"I would have saved more money\" \"Would have done less field work and more lab work\" "},{"text":" Photo: ©Hu Chen (Unsplash) "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"  "},{"text":"When we are thinking about the future and starting to plan for it, it is important to use a wide lens to take into account the many linked stressors, sectors and systems. Other key stressors include:  It is important to understand when planning for climate   It is important to understand when planning for climate resilience that there are other interacting stressors on the   resilience that there are other interacting stressors on the system. For example, if we are sitting in a Climate Change   system. For example, if we are sitting in a Climate Change Directorate or research program addressing climate resilience   Directorate or research program addressing climate resilience there are other integrated stressors and development priorities   there are other integrated stressors and development priorities that need to be considered such as poverty, population growth   that need to be considered such as poverty, population growth and land degradation.    and land degradation.  Land degradation   Land degradation Rural poverty and deforestation   Rural povertyand deforestation Population growth Lack of water access/ Floods Heatwaves Population growthLack of water access/FloodsHeatwaves  infrastructure   infrastructure Unequal  Droughts El Niño events UnequalDroughtsEl Niño events distribution/ access to natural Gender inequality   distribution/ access to naturalGender inequality resources  Wildfires Livestock or crop resourcesWildfiresLivestock or crop    disease outbreak disease outbreak  "},{"text":"Q&A In addressing the effects of climate change, shouldn't we come up with different systems for different ecological regions?  Climate change is impacting the  Climate change is impacting the region's agricultural system in  region's agricultural system in numerous ways, for example, the  numerous ways, for example, the crop and livestock production This can be done by incorporating planning crop and livestock productionThis can be done by incorporating planning systems are affected by erratic for different agro-ecological zones, for systems are affected by erraticfor different agro-ecological zones, for rainfall events, changes to the timing example, by applying a biophysical lens and rainfall events, changes to the timingexample, by applying a biophysical lens and and length of growing seasons, looking specifically at the crops, agricultural and length of growing seasons,looking specifically at the crops, agricultural reduced feed and water availability, activities and social interactions within reduced feed and water availability,activities and social interactions within amongst others. The situation is the area and plan accordingly. This is amongst others. The situation isthe area and plan accordingly. This is unlikely to improve with hydrological where the first step in a foresight process, unlikely to improve with hydrologicalwhere the first step in a foresight process, models showing large decreases in the 'scoping' stage, is so important. It models showing large decreases inthe 'scoping' stage, is so important. It annual precipitation and run-off in delineates the boundaries of the area you annual precipitation and run-off indelineates the boundaries of the area you Southern Africa in the future, which want to work on and defines the timelines Southern Africa in the future, whichwant to work on and defines the timelines will have serious implications for you want to plan within i.e. are you looking will have serious implications foryou want to plan within i.e. are you looking agricultural productivity as well as to plan ahead by 10 or 20 years when agricultural productivity as well asto plan ahead by 10 or 20 years when electricity generation. Furthermore, considering the climate change impacts on electricity generation. Furthermore,considering the climate change impacts on climate models are your agro-ecological zone? Then it is also climate models areyour agro-ecological zone? Then it is also  important to consider the policy landscape important to consider the policy landscape  and institutional structures. For example, and institutional structures. For example,  you need to ask yourself what laws, by-laws you need to ask yourself what laws, by-laws  and policies pertain to the area you want to and policies pertain to the area you want to  plan within. plan within.  It is worth noting here that stakeholders It is worth noting here that stakeholders  are to be engaged throughout a foresight are to be engaged throughout a foresight  process and so in the context of a specific process and so in the context of a specific  agro-ecological zone it would be important agro-ecological zone it would be important  to include indigenous knowledge through to include indigenous knowledge through  a multi-stakeholder engagement process. a multi-stakeholder engagement process.  When considering climate change trends When considering climate change trends  and impacts indigenous knowledge is a and impacts indigenous knowledge is a  critical evidence source. critical evidence source.  "},{"text":"indicating an increase in extreme rainfall events and droughts in the SADC region by 2050. These impacts affect the region's future development pathways and are exceedingly difficult to plan for in terms of policy and development strategies. HOW DOES CLIMATE CHANGE IMPACT AGRICULTURE IN SOUTHERN AFRICA? WATER CROPS LIVESTOCK  Timing and Timing and length of length of growing growing season season  "},{"text":"Possible decreases of ~20% in annual precipitation by 2080 in southern Africa 75% of the region is arid   A regional mean A regional mean  annual runoff annual runoff  volume of 650 km3 volume of 650 km3  is low for a region is low for a region and characterised that relies on rainfed and characterisedthat relies on rainfed by high climate agriculture and by high climateagriculture and variability hydropower variabilityhydropower  "},{"text":"FOOD SYSTEM Series 1 Series 1 Q&A Living in a country where people do not believe in the causes and impacts of climate change how can we prepare for it and shift the government's perspective towards zero net emissions?  Food systems are complex, comprising numerous Food systems are complex, comprising numerous dimensions (e.g. socio-cultural, economic, political dimensions (e.g. socio-cultural, economic, political and environmental), integrated components and environmental), integrated components (e. (e.  "},{"text":"\"Today's interim report from the UNFCCC is a red alert for our planet. It shows governments are nowhere close to the level of ambition needed to limit climate change to 1.5 degrees and meet the goals of the Paris Agreement\"  Series Series 1 1 WHAT MIGHT WHAT MIGHT TRANSFORM? TRANSFORM? United Nations (UN) Climate Panel said The future is going to require that \"we have 10 years left to transformative change involving begin a radical transformation new interventions, policies and United Nations (UN) Climate Panel said The future is going to require that \"we have 10 years left to transformative change involving begin a radical transformation new interventions, policies and of this civilisation to move partnerships and disruptive technology. of this civilisation to move partnerships and disruptive technology. Transformative change is needed to quickly to a zero emissions move us beyond incremental change society…\". What does this mean and how to changing the way systems operate does it relate to incremental change? in the long-term. Futurists expect Transformative change is needed to quickly to a zero emissions move us beyond incremental change society…\". What does this mean and how to changing the way systems operate does it relate to incremental change? in the long-term. Futurists expect that transformational shifts will take that transformational shifts will take place in several dimensions such as place in several dimensions such as markets, ownership, buying and selling, markets, ownership, buying and selling, gross domestic product (GDP) and gross domestic product (GDP) and productivity. productivity. Sectors that are likely to transform in Sectors that are likely to transform in the future include communications, the future include communications, power and energy, transportation, power and energy, transportation, mobility and logistics, and education. mobility and logistics, and education.  "},{"text":"opposed to incremental adaptation, which the IPCC says aims to maintain existing systems through measures such as introducing more drought-resistant varieties of crops or using more efficient irrigation, transformative adaptation is intended to change the fundamental attributes of agricultural systems in response to actual or expected climate and its effects, often at a scale and ambition greater than incremental activities.\"  LEARNING LEARNING EXERCISE EXERCISE In your work, would you say you In your work, would you say you have been planning for incremental have been planning for incremental change or transformational change, change or transformational change, and why? and why? -World Resources Institute -World Resources Institute A transformation, in the context of agriculture A transformation, in the context of agriculture and food systems, can be defined as follows: and food systems, can be defined as follows: \" \"  "},{"text":"An agriculture and food systems transformation is a significant redistribution- by at least a third-of land, labour and capital, and/ or outputs and outcomes (e.g. types and amounts of production and consumption of goods and services) within a timeframe of a decade\"   "},{"text":"2020 Series 1 HOW CAN WE PLAN FOR SUCH A TRANSFORMATION, WHAT ACTIONS CAN WE TAKE? THERE ARE THREE MAJOR CATEGORIES OF TRANSFORMATIVE ACTIONS:  Some examples of integrated and adaptive   Some examples of integrated and adaptive interventions include:   interventions include: • A monitoring, reporting, and verification system These interventions need to be supported by new Novel partnerships, cross-sectoral or multi- • A monitoring, reporting, and verification systemThese interventions need to be supported by newNovel partnerships, cross-sectoral or multi- • New design/infrastructure policies and institutions that are flexible, robust and synergistic, and drive implementation, for stakeholder relationships are also needed. These include: • New design/infrastructurepolicies and institutions that are flexible, robust and synergistic, and drive implementation, forstakeholder relationships are also needed. These include: • Scaling existing innovations example: • New set of actors working together in an • Scaling existing innovationsexample:• New set of actors working together in an • Awareness, knowledge, skills, empowerment • Changes in decision making processes (Develop informal or formal setting • Awareness, knowledge, skills, empowerment• Changes in decision making processes (Developinformal or formal setting development • Knowledge/data platforms • New technology • A lifestyle or behaviour change formalized office in financial planning for cross sectoral coordination, joint planning and joint budgetary allocations) • A form of decentralization or distributed decision making • New cross sectoral, multi-stakeholder relationships • Pooling resources, money or labour for synergy • Trans-generational and thematic partnerships development • Knowledge/data platforms • New technology • A lifestyle or behaviour changeformalized office in financial planning for cross sectoral coordination, joint planning and joint budgetary allocations) • A form of decentralization or distributed decision making• New cross sectoral, multi-stakeholder relationships • Pooling resources, money or labour for synergy • Trans-generational and thematic partnerships • Finance/incentives/subsidies (Financial technology to get private sector to directly pay farmers for • Nested scale policy design  • Finance/incentives/subsidies (Financial technology to get private sector to directly pay farmers for• Nested scale policy design restoring land health) • Time bound reflections on policies  restoring land health)• Time bound reflections on policies • New businesses and business models (loan facility • Cross sectoral policy development and  • New businesses and business models (loan facility• Cross sectoral policy development and for smaller holder farmers that can geo-stamp) financing frameworks  for smaller holder farmers that can geo-stamp)financing frameworks  "},{"text":"Integrated and adaptive interventions Flexible, robust and synergistic institutions and policies that drive implementation Novel partnerships, cross sectoral or multi-stakeholder relationships Series 1   "}],"sieverID":"2fe2b44c-43e6-4036-9267-b9be12c5b0f3","abstract":""}

data/part_1/0b3012dcdd5b3c19f13bc1f5b3c9ab9a.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b3012dcdd5b3c19f13bc1f5b3c9ab9a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/8ff2b7e0-89d6-4bb3-aea6-86a3fd65dfaa/retrieve"},"pageCount":2,"title":"A gender-responsive and socially-inclusive approach to potato producers in Georgia","keywords":[],"chapters":[{"head":"Background","index":1,"paragraphs":[{"index":1,"size":64,"text":"The Georgia Potato Program (2019-22) is funded by the United States Agency for International Development (USAID) and executed by the International Potato Center (CIP) and implementing partners in Georgia. The project's overall goal is to sustainably improve the socioeconomic well-being of potato farmers by addressing the root causes of low productivity and facilitating commercial and institutional platforms that underpin a sustainable potato market system."},{"index":2,"size":131,"text":"From the start of this project, we have taken a genderresponsive and socially inclusive approach. According to the literature, and confirmed by our observations, the agricultural sector in Georgia is led primarily by men, from policymakers to farmers' cooperatives. Therefore, this project has worked to ensure that all social groups of farmers including women, ethnic Armenian and Greek, and young people stood to benefit from the interventions for improved access to relevant information and new technologies. In doing so, the project has sought to transform gender and social norms within some agricultural domains at the community level, although challenging norms and changing organizational structures is not easy. This brief shares our experience of engaging men, women and young farmers to help improve their agricultural knowledge and economic gains from potato farming."}]},{"head":"Objetive","index":2,"paragraphs":[{"index":1,"size":78,"text":"A participatory gender study conducted at the beginning of this project showed that women spend as much time on the farm as men do, and they are keen to learn new technologies and practices related to potato production and other crops. However, husbands attend agricultural trainings and hold spaces in a local farmer association, which is the primary hub for access to technologies, agronomic information and market contacts. Similarly, male farmers speak for youth farmers on agricultural matters."},{"index":2,"size":51,"text":"It is important for professional women and young farmers to be directly involved in interventions rather than obtaining training and information second-hand. To do this, we need to reach out women and young farmers directly through specific channels for communication and networking. To this end, three objectives were set as follows:"},{"index":3,"size":16,"text":"• To create enabling environment for women farmers to participate in and benefit from project activities;"},{"index":4,"size":19,"text":"• To increase gender awareness of both men and women, and promote recognition of women as professional farmers; and"},{"index":5,"size":21,"text":"• To provide support to progressive young men and women farmers to be role models for the young generation of farmers."}]},{"head":"OUTCOMES Yield of targeted agricultural commodities among program participants with USG assistance","index":3,"paragraphs":[{"index":1,"size":3,"text":"Target: 20 t/ha "}]},{"head":"Approach","index":4,"paragraphs":[{"index":1,"size":58,"text":"Following a literature review on gender, agriculture and seed system policies in Georgia, we organized a gender-awareness training for the project staff, including biophysical scientists, to create common understandings of gender and social inclusion for this project. Next, we conducted a participatory gender study with women and men to understand their particular constraints and opportunities in potato production."},{"index":2,"size":18,"text":"Based on the findings from the participatory study the project team developed action plans to achieve multiple objectives:"},{"index":3,"size":11,"text":"• To engage men for their support in implementing genderresponsive approaches;"},{"index":4,"size":22,"text":"• To provide more information and technical skills to women and young farmers in topic of seed production and seed health management;"},{"index":5,"size":20,"text":"• To facilitate peer-to-peer communication among women farmers to share information on new potato technologies and their benefits to women;"},{"index":6,"size":18,"text":"• To ensure constant communication between the project team and women and young farmers in target municipalities; and"},{"index":7,"size":10,"text":"• To document success stories for dissemination among later participants."},{"index":8,"size":23,"text":"Finally, the project conducted a short survey on perceptions on gender for project participants to assess changes in their perceptions and receive feedbacks."}]},{"head":"Achievements","index":5,"paragraphs":[{"index":1,"size":9,"text":"Our success is best illustrated with four success stories."},{"index":2,"size":102,"text":"Nestan Vibliani (43 yoa) is a leading woman farmer who works to encourage other women to join project interventions. She voices concerns of female farmers in the local farming cooperative. In this project, she received potato cuttings and a drip irrigation system to create a seed potato production unit. She also received 50 kilograms of Meshkhuri Red, a highly-productive and elite-grade seed material to test on her farm. \"Our community can benefit from women's improved knowledge and skills in potato production and more women will become involved in potato production as we gain knowledge and experience in this field, \" she says."},{"index":3,"size":50,"text":"Sophiko Talakvadze (25 yoa) farms in Tsalka and has participated in trainings on how to use locally produced quality seed potatoes of high-yielding genotypes. She says, \"I am very lucky to be engaged in this project as it gives me a great chance to acquire more knowledge on potato production."},{"index":4,"size":49,"text":"Giorgi Khitarishvili (also 25 yoa) from Akhaltsikhe started farming 1.5 hectares of land with quality seed potatoes and harvested approximately 50 tons last season. Next season, he plans to devote more acres to potato. \"Potato production is a great business opportunity for young people living in this region. \""},{"index":5,"size":103,"text":"Apetnak Zandaryan (65 yoa) says the gender awareness training helped him appreciate the specific challenges women famers face, challenges he did not understand before. \"Women are responsible for domestic work and physical labor in the fields. This is a double burden. I am in a farmer cooperative where today 16 of our 24 members are female. And we try to make sure that women can express their opinions freely in the cooperative. \" Zandaryan's comments were included in a project video and broadcast to more than 70,000 viewers. • Marneuli Agro LLC, located in Kvemo Kartli, is the largest agricultural enterprise in Georgia."}]},{"head":"Duration","index":6,"paragraphs":[{"index":1,"size":27,"text":"• Rural Advisory Service Ltd (RAS), located in Samtskhe-Javakheti and servicing Kvemo Kartli, is the leading potato input/supply distributor based in Akhaltsikhe with capabilities in potato production."},{"index":2,"size":39,"text":"• Javakheti Agro Company Ltd is a local company in Samtskhe-Javakheti with capabilities in potato production. It is a main seed potato and input supplier in Javakheti, together with the Potato Association from Akhalkalaki and individuals in the coalition."},{"index":3,"size":5,"text":"• GFA -georgioan farmers association "}]}],"figures":[{"text":" (CIP Gender Consultant) [email protected] Nozomi Kawarazuka, [email protected] Rusudan Mdivani, [email protected] Contact Rusudan Mdivani, Chief of Party of the USAID Potato Program [email protected] "},{"text":"  "}],"sieverID":"cabc5779-47f7-40fd-9d7c-cd1e601507f3","abstract":"A careful focus on gender dynamics and youth is fostering inclusive growth in the potato sector"}

data/part_1/0b381826d6b69607ed2f5ac64ade70a7.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b381826d6b69607ed2f5ac64ade70a7","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/48ce5452-876c-4b1e-b379-77f7a28d8a5e/retrieve"},"pageCount":2,"title":"SETTING UP YOUR SWEETPOTATO TRIPLE S SYSTEM","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":29,"text":"Cutting the foliage off the pegged healthy plants 3-5 days before harvest, helps their roots to produce a thicker skin which protects them from disease and loss during storage."},{"index":2,"size":2,"text":"HANDOUT 2"}]},{"head":"C: Careful harvesting","index":2,"paragraphs":[{"index":1,"size":15,"text":"Harvest carefully to avoid damaging the roots. Work slowly, using a fork hoe may help."},{"index":2,"size":15,"text":"Place roots in shade. Do not overload sacks, or drop or squash roots during transport."}]},{"head":"D: Root selection","index":3,"paragraphs":[{"index":1,"size":26,"text":"Due to the long storage period, only healthy roots should be stored. Harvest them from healthy mature plants (e.g. signs of soil cracking, yellow lower leaves)."}]},{"head":"Use roots that:","index":4,"paragraphs":[{"index":1,"size":26,"text":"• are smallmedium sized • have no weevil holes, rots or damage Gather all your equipment (clean basin, newspaper, coarse dry cool sand, 50 undamaged roots)"},{"index":2,"size":15,"text":"1 2 Line the basin with a layer of dry newspaper, to absorb any moisture."},{"index":3,"size":26,"text":"3 Add a layer of cool, dry coarse sand. This can be swept from around your yard, but make sure it is cool before using it."},{"index":4,"size":8,"text":"When cutting, leave 15cm of stem above ground."},{"index":5,"size":22,"text":"SWEETPOTATO TRIPLE S -SAND, STORAGE, SPROUTING 4 Next, add a layer of roots. Make sure the roots do not touch each other."},{"index":6,"size":13,"text":"5 Then cover the roots with a layer of cool, dry, coarse sand."},{"index":7,"size":30,"text":"6 Add another layer or roots, making sure they do not touch each other or the edge of the basin. Cover them with another layer of cool, dry, coarse sand."},{"index":8,"size":11,"text":"7 If there is space, add a third layer of roots."},{"index":9,"size":45,"text":"8 Always finish loading your basin with a deep layer of sand (~10cm thick). This will protect the roots from drying out, and from weevil and rat damage. 9 Store your loaded Triple S basin in a cool, almost dark place, where it is safe. "}]}],"figures":[{"text":" Make sure: • chickens cannot dig in the sand in it • it will not get rained on, or too hot • a tight cover is not placed on it or the roots may rot • no-one eats the roots, as they are the link to next years food. 10 Keep clear records of your Triple S: what you stored, where, when, and any changes you observed each month. Remember to check your Triple S regularly. "}],"sieverID":"e089b475-cdbb-46e4-b27e-a87800ccaab7","abstract":"Only store healthy roots in your Triple S.Walk through your field and peg healthy plants (~25 plants per Triple S basin you will set-up)."}

data/part_1/0b55ee122f93c35a7238eb02aab3d063.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b55ee122f93c35a7238eb02aab3d063","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/91ebd0b8-f813-4517-8e5a-87499aa4a00b/retrieve"},"pageCount":28,"title":"","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":17,"text":"Evaluation of Specialized Expert System for Agro-Meteorology Early-Warning (SESAME) application in Myanmar using User-Centered Design (UCD) approach"},{"index":2,"size":65,"text":"Objective: This activity aims to define the potential entry points for intervention to improve quality of interaction with and perception of SESAME applications based on deep understanding of the users' needs, priorities and preferences. The SESAME app evaluation is divided into two phases: i) characterization of next-and end-users (Department of Agriculture extension workers and farmers leaders; and ii) content providers (DAR agronomic experts, DOA, DMH)."},{"index":3,"size":22,"text":"The results of this user-centered design assessment can provide inputs to the improvement of the system for upscaling in the dry zone."}]},{"head":"I. General user information","index":2,"paragraphs":[{"index":1,"size":422,"text":"The assessment was conducted with 15 farmers from Nyaung U township and five extension staff from public and private sectors. Age level of farmer respondents is between 34 -62 years with an average of 47 year and that of extension officers is 23 -37 with the average of 28 year. Only two farmer respondents graduated and the majority of others did not finish high school education. The extension officers are graduates with agricultural background and working in the fields of seed registration, micro-finance, marketing and extension, research and extension, and plant protection, respectively. Both groups are familiar with mobile phone and software applications. Groundnut and pigeon pea are the major crops commonly grown by farmer respondents while second most important crop is tomato, and other crops include black gram, soya bean and maize. The profile of the respondents can be seen in the Useful Both the farmer and extension officer respondents answered they know the overall purpose of the SESAME application. However, the answers to the follow up question show their different opinions. Some responded that the purpose of SESAME is to provide weather information while others answered that it is to support crop and livestock activities. If we divide their responses into three categories, it was found that 20% of both farmers and extension officers thought that SESAME is just to provide climate information only, while 20% of farmers and 40% extension officers viewed the purpose of SESAME is to provide agricultural related information only. 60% of farmers and 40% of extension officers' opinion on the SESAME is a tool to provide both climate and agricultural related information and technical advisories (Figure 2) Figure 2. Opinion on the overall purpose of SESAME. CI: climate information; AI: agricultural related information. With regard to the usefulness of the app., all the farmer respondents said that the SESAME app. is essential to perform their crop production, while only one extension officer answered that the app. is Opinion on the overall purpose of SESAME % farmers % extension officer essential to perform her job function. Weather forecasts and climate outlook are relevant section of the SESAME for 93% of farmers, and crop data and crop advisory generation are relevant for 60% and 50% of farmers, respectively. Feedback system, such as a call center, is relevant for only 7% of farmer respondents (Figure 3). Feedback system in this case refers the call center through which users can get advice directly from the experts. Unfortunately, the contact numbers provided in the SESAME do not answer any query."},{"index":2,"size":43,"text":"There are two contact phone numbers and one of them replied she no longer with SESAME and refers to contact directly to the DOA while another one has no answer. However, the user think it is relevant having this section in the SESAME."}]},{"head":"Figure 3. Relevant sections of the SESAME for farmers","index":3,"paragraphs":[{"index":1,"size":199,"text":"Township level is the most important forecast resolution for both farmers and extension officers as 80% each from both groups preferred township level forecasts. The second most crucial forecast resolution is district level forecasts for above 50% both farmers and extension officers (Figure 4). The lead time to receive forecasts equally preferred from both groups is weekly basis, i.e., both farmers and extension officers preferred to receive all kinds of forecasts at least one week ahead. The weather and climate information from SESAME influence the timing and application of farming practices in both groups. For farmers, daily forecast is crucial for 27% -40% farmers and, pentad (5-day) forecast is important for 33%-60% of farmers in the farming activities such as land preparation, variety selection, planting, pest management, fertilizer application and weeding. Weekly and decadal (10-day) forecasts are considered as less important in compare to daily and pentad forecasts (Figure. 5). For extension officers, the influence of pentad forecast is on all the farming activities mentioned above. Based on the direct observation, it was learned that recommendations for wetter and drier than normal conditions are available in the English language version, but it could not be seen in Myanmar language."},{"index":2,"size":18,"text":"There are also lack of information for livestock, market information and space for direct consultation with crop experts."},{"index":3,"size":150,"text":"Apart from the climate information available in SESAME application, the demand for additional climate information was also accessed with both respondent groups. It was found that 40% to 60% of farmers and extension officers want to know about past weather information for the last week and last month and nowcasts. 40% of farmers also demanded the 24-hour forecasts and monthly forecasts, and 60% of extension officers are interested in bi-weekly forecasts (Figure 6).  In addition to the information available in SESAME, more than 80% of farmers and extension officers want to know more about the crop preparation and maintenance practices such as planting and harvesting date recommendations, crop and variety selection and, the timing and amount of the application of fertilizers and pesticides. Information related to irrigation timing, crop market, step-by-step preparation for crop activities and articles for crops are also demanded by some farmers and extension officers as well."},{"index":4,"size":11,"text":"Figure 7. Demand for additional information related to crop-specific farming advisories"},{"index":5,"size":29,"text":"The information for natural disaster early warning and responses are not currently available in the SESAME. There are some important information regarding the natural disaster demanded by the users."},{"index":6,"size":58,"text":"According to the results on the interviews with both groups, 100% of farmers as well as extension officers want to see drought warnings in the SESAME, while more than 60% of both users demand for the early warning related to heat damage. The demand for information related to natural disaster early warning can be seen in Figure 8.  "}]},{"head":"b. Usable","index":4,"paragraphs":[{"index":1,"size":191,"text":"Usability is assessed through investigating the reasons why people do not use the app, how often people use the app., based on the ease of access to the information. The opinion of farmers and extension officers almost the same on the reason why other people do not use the app. The reason for those who are not using the app. could be due to the weaknesses in advertisement and promotion of the apps, because most of the people do not know about the application according to the farmers and extension officers. Other causes are the limited accessibility to internet and compatibility of the devices. The opinions of farmers and extension officers on why other people not using the SESAME app. are mentioned in the It was found that the frequency of using the SESAME app. by both respondent groups is good enough to catch up the update information of the app. Even the least frequent farmer user checks the information in the app. at least once a week. 50% of farmers use the app. at least once every day and 80% of extension officers use three times a week (Figure 11)."},{"index":2,"size":13,"text":"Figure 11. Frequency of using the SESAME app. by farmers and extension officers"},{"index":3,"size":111,"text":"Ease of access to the information in the SESAME is much better for extension officers than farmers. Extension officers need less than a minute to get or download the specific information they need from the app. For farmers, only 47% can access the required information within a minute. 20% of farmers need 2-5 minutes, 27% need at least five minutes and 7% need between 10 to 15 minutes to get the information they need from the app. depending on the internet connectivity. Loading time variations are probably depending on the internet speed of the location (rural vs urban) and the specification of the mobile devices that the different users are using."},{"index":4,"size":42,"text":"Figure 12. Loading time to fetch the required information from SESAME Currently, SESAME app. cannot be used offline. Except two respondents from farmers who thought SESAME could be used offline, all the respondent groups prefer to get offline access for some information. "}]},{"head":"c. Desirable","index":5,"paragraphs":[{"index":1,"size":103,"text":"SESAME produces daily weather forecasts for next 7 days and 5-day forecasts for next 10 days. These information products are available at the township level in the application while using the app. online. 73% of farmers and 60% of extension officers are fine to receive daily forecasts while using the app, but it was also learned by the assessment that 80% of farmers and 60% of extension officers prefer to receive the daily forecast via SMS. 7% and 20% each from both groups preferred to receive daily forecasts for 7 days in the form of smart phone pop-up alarm and video with explanation."},{"index":2,"size":9,"text":"Figure 13. Users preferred formats to receive daily forecasts"},{"index":3,"size":79,"text":"In the case of 5-day forecasts, 13% of farmers want to receive 5 days forecast in the form of printed bulletin while 40% of extension officers want it via SMS. 93% of the farmers and 60% of the extension officers prefer the 5-days forecasts for next 10 days available in the application and download in the smart phone while 7% of farmers and 20 % of extension officer wants to receive the information as a video clip with explanation."},{"index":4,"size":149,"text":"Figure 14. Users preferred formats to receive 5-day forecasts With regard to the provision of clear and straightforward message of forecasts and agro-advisories, majorities of the respondents (93% of farmers and 60% of extension officers) show their satisfaction, but some feedbacks should be considered important. One of the extension officers remarked that she does not understand about the meaning of ideal condition. In fact, in English version, Ideal conditions mean the most suitable climatic condition for a particular growth stage in terms of pentad forecast only. But in Myanmar language version, the ideal conditions are provided not just in terms of pentad forecast, but also for daily, monthly and seasonal forecasts but with no data for the latter ones. Another comment from extension officer is \"advisories should be improved for better user experience\". It should also be considered important although the meaning of the comment is a bit broad."},{"index":5,"size":188,"text":"In relation to attractiveness of the overall color palette of the SESAME application and website attractive, it was found that all the farmer respondents thought it is attractive while 80% of extension officers thought not. Major comments highlights on the logos of crops in the crop advisory section and suggestion to make them green (or) replace the symbol or photos of respective crops. Another comment is the overall internal color of the app. is light or dominated with white and suggested to be green or darker color. With regard to the overall map visualization of weather and climate data, 80% of extension officers can easily understand the information on the map whereas, 20% prefer to see the information by words. For farmer respondents, 40% of them can easily understand the information on the map and another 40% do not understand the information, while the rest 20% prefer to get the information in different format. One farmer prefers to highlight his township in the map, another one suggested to express the boundaries of states, regions and townships clearly and, the last one prefers to see the information by words."}]},{"head":"d. Findable","index":6,"paragraphs":[{"index":1,"size":66,"text":"It was learned that 73% of farmers and 20% of extension officers can easily navigate through the SESAME mobile application and find the information that they are looking for and 23% of farmers and 80% of extension officers cannot easily access the information easily. However, 80% of extension officers thought that SESAME application is efficient to use in terms of fast navigation, practical and organized content."},{"index":2,"size":83,"text":"With regard to the improvement of navigation of the app., one of the extension officers suggested to add a section to express the major climate risks commonly occur in townships in relation to crops. 23% of farmers also thought the application is not efficient for fast navigation, practical and organization of contents. Their suggestions include to use local language as much as possible, to add separate sections for Q & A and market information and to complete the missing information in each section."},{"index":3,"size":172,"text":"e. Accessible It was found that all the respondents from both groups can understand the wording and terminologies used in the mobile application except one respondent from farmers. All the farmers normally use the app. at home and some 40% of them also use the app in any place where the internet connectivity is good. The use of SESAME application in terms of users' preferred places is expressed in the figure below. The device commonly used by both farmer and extension officer respondents is smart phone and 60% of farmers do not have stable internet connectivity when using the SESAME application. This is due to the compatibility of phones for some 27% of farmers, expensiveness of mobile data for 53% and unfamiliarity with the app. for 33%. For extension officers, only 20% has the internet connectivity problem with the reason of data package prices. However, all of those having poor internet connectivity responded that they do not think the cost of internet data to connect to the SESAME application is a problem."},{"index":4,"size":179,"text":"All the users of SESAME do not need to ask other people's approval or permission for you to log in on SESAME application, but there are some difficulties that the users experienced in signing up for the SEAME application. The level of difficulty experienced by the proportion of farmer and extension staff users are expressed in the table below. f. Credible It was supported by the farmers and extension officers on the fact that SESAME could be more effective if the tool is accompanied by a technical training like Farmers' Field School (FFS). By doing this, farmers and extension officers can integrate the information from the app. into the FFS curriculum and establish a locally adapted mechanism for the best use of climate information and advisory products with best practices of crop activities through experiential learning process. For this purpose, the users should have the reliable resource to address their problems experienced in using the SESAME. The following are the findings on the assessment on how the users try to cope with their difficulties experienced while using the app."}]},{"head":"Level of difficulty","index":7,"paragraphs":[{"index":1,"size":17,"text":"Figure 16. The ways the user tried to cope with the difficulties in using the SESAME app."},{"index":2,"size":29,"text":"The figure shows that most of the users asked their colleagues to help for their difficulties in using the app and, some of them try to resolve by themselves."},{"index":3,"size":36,"text":"It was also found that 100% of both farmers and extension officer used to share the information from SESAME via people's network. A few farmers share in meetings, online messaging, mobile phone calls and in trainings."},{"index":4,"size":64,"text":"Figure 17. the way how people share information from SESAME In relation to the better use of SESAME application, all the farmer and extension officer respondents suggested to provide additional training on the use of the application. Again, 80% of farmers also wish to have step-by-step manual on the use of the application. The ways how users share information from SESAME farmers extension officers"},{"index":5,"size":75,"text":"Figure 18. Support activities needed for better use of the SESAME application It was learned that farmers have less access to extension officers and crop experts to discuss about the information received from the SESAME. 93% of farmers discuss the information from the app. among themselves, and 60% for farmers discuss with their family members and relatives. 40% of farmers discuss with neighbors and colleagues. Extension staff normally discuss with farmers, crop experts and friends."},{"index":6,"size":142,"text":"Figure 19. to whom the users discuss the information got from SESAME With regard to the accuracy of the forecasts from the SESAME, the majority of both farmers and extension officers thought daily and pentad forecasts of the SESAME need to be improved in accuracy (Figure 19). Extension officers were also asked whether they know who provides local information to update the content of agro-advisories on SESAME for specific townships. It was found that 40% of the extension officers know the local information were provided by the Department of Agriculture (DOA) and 60% do not know who provides the information. According to direct observation and experience in working for the Decision Trees, the crop related advisories were provided by DOA, but these are not updated according to the weather forecasts except township DOA officials participated in the validation of crop decision trees."},{"index":7,"size":75,"text":"SESAME was first introduced to the respondents in August 2020 as part of the project activities and the purpose to follow up with this assessment. All the farmer respondents were provided the training on the use of SESAME with demonstration. Almost all those farmers know how to interpret the crop data and agro-advisories. We also assessed the users' opinion on what will happen if the tool provides wrong information, the responses are found as below. "}]},{"head":"Users' opinion on what will happen if the","index":8,"paragraphs":[]},{"head":"III. Conclusion and recommendations Useful","index":9,"paragraphs":[{"index":1,"size":274,"text":"Farmers are very much interested in climate information services based on the fact that they also use Television programmes and Su Su San. Su Su San is a meteorologist residing in US and she is providing the weather forecasts information via her own Facebook page. It was learned that farmers have large expectation on SESAME to provide reliable climate advisory services. For their farming activities, farmers largely rely on daily and pentad forecasts, while monthly and seasonal forests are not available in SESAME. Due to technical and language issues, crop advisories for wetter and drier conditions are not available and it is recommended to fix the technical issues in local language version. Farmer users want to know past weather records for last week, last month, nowcast and forecast for the next month. Crop advisories for drier, wetter and normal conditions should be expressed separately in the Myanmar language version. Crop advisories should cover the recommendations for planting (sowing) and harvesting dates, crop and variety selection, and, dosage and timing of fertilizer and pesticide application. The users also want to see the early warnings for drought, heat damage and cyclones. There are contact phone numbers provided in the 'call center' section, but none of these cannot be contacted. It is recommended that the developer should contact to relevant information providers to update the contact persons. In addition, farmer users want to use SESAME as a platform where they can share their crop related problems and get advisories from experts and experience from other users. They also want to use this space also as a market place for selling and buying of agricultural inputs and products."}]},{"head":"Usable","index":10,"paragraphs":[{"index":1,"size":132,"text":"Results show that most of the farmers apart from those interviewed do not know about the SESAME and some farmers could not afford to buy data package. Poor and marginal farmers can only use lower-priced smart phones and this could affect the compatibility of SESAME to install in their phones. It was supported by the fact that the loading time to fetch the information for farmer users is a bit longer than that for extension officers. This may also be due to the connectivity of mobile phones is slow in rural areas. Despite these barriers, it was learned that farmers are willing to access the SESAME as more frequently as possible. In this respect, it is recommended to carry out more proactive advertisement of SESAME to promote its use in rural areas. "}]},{"head":"Desirable","index":11,"paragraphs":[{"index":1,"size":87,"text":"It should be noted that the users want to have SMS notifications for daily forecasts. Overall color palette is light and the thumbnails in the crop lists as well. Font size is a bit small and the color is a bit light. Font alignment a bit narrow, maybe they refer line spacing. The respondents suggested that the thumbnails to be green or replaced with logos/symbols or photos of respective crops. Font size should be made a bit bigger and font color should be black or dark color."}]},{"head":"Findable","index":12,"paragraphs":[{"index":1,"size":70,"text":"There are still navigation issues to reach the information. If possible, it is recommended to create or add separate sections for different categories of information such as pests and diseases, market information and, Q&A section or discussion platform (similar to a Facebook page) to discuss the crop related problems and get advisories from experts and, make linkages from one section to another to enhance the fast navigation and user satisfaction."}]},{"head":"Accessible","index":13,"paragraphs":[{"index":1,"size":56,"text":"Major accessible issue is registration. The registration can be done by English language only. It would be good if the registration could be done in Myanmar language after selecting the user's country. It would be even better the name of countries be provided their own language. Another recommendation is to make the process of registration easier."}]},{"head":"Credible","index":14,"paragraphs":[{"index":1,"size":125,"text":"Based on the findings, it was learned that most of the users still need to be familiar with the application. They approach people around them like their colleagues when they have problems in using the app, sometimes figure out by themselves. This shows need of supporting network for farmers to promote the use of SESAME in their farm activities. Additional training on effective use of SESAME integrated with Farmer Field School programmes is recommended to promote the reach of the application among farmers and promote the credibility of SESAME through integration with field activities. With regard to the accuracy of the forecasts from the SESAME, the majority of users indicated that the daily and pentad forecasts of the SESAME need to be improved in accuracy."},{"index":2,"size":22,"text":"Annex I: Questionnaire for the Evaluation of Specialized Expert System for Agro-Meteorology Early-Warning (SESAME) application in Myanmar using User-Centered Design (UCD) approach"},{"index":3,"size":1,"text":"Objective:"},{"index":4,"size":64,"text":"This activity aims to define the potential entry points for intervention to improve quality of interaction with and perception of SESAME applications based on deep understanding of the users' needs, priorities and preferences. The SESAME app evaluation is divided into two phases: i) characterization of next-and end-users (Department of Agriculture extension workers and farmers leaders; and ii) content providers (DAR agronomic experts, DOA, DMH)."},{"index":5,"size":22,"text":"The results of this user-centered design assessment can provide inputs to the improvement of the system for upscaling in the dry zone. "}]},{"head":"General user information","index":15,"paragraphs":[]}],"figures":[{"text":"Figure 4 . Figure 4. Preferred forecast resolution by the users "},{"text":"Figure 6 . Figure 6. Demand for additional climate information "},{"text":"Figure 10 . Figure 10. Other sources of information for climate information and advisory services being used by farmers and extension officers "},{"text":"Figure 15 . Figure 15. Users' preferred place to use SESAME "},{"text":" Figure 20. Users' opinion on the accuracy of the forecasts of SESAME need to be improved "},{"text":" table below II.    II.   Farmer Extension FarmerExtension   respondents officers respondentsofficers Total number of respondents 15 5 Total number of respondents155 Age: level/ average 34 -62 / 47 23 -37/ 28 Age: level/ average34 -62 / 4723 -37/ 28 Gender: ratio (M: F) 15:0 (100%: 0%) 2:3 (40%: Gender: ratio (M: F)15:0 (100%: 0%) 2:3 (40%:    60%) 60%) Experience with mobile applications   Experience with mobile applications • Social media 12 (80%) 5 (100%) •Social media12 (80%)5 (100%) • agri apps. (Green Way/Htwet Toe/PP/fibre crops/SEAD) 9 (60%) 3 (60%) •agri apps. (Green Way/Htwet Toe/PP/fibre crops/SEAD) 9 (60%)3 (60%) • agri websites 0 (0%) 1 (20%) •agri websites0 (0%)1 (20%) • online meeting 0 (0%) 1 (20%) •online meeting0 (0%)1 (20%) • money transfer apps. 1 (7%) 3 (60%) •money transfer apps.1 (7%)3 (60%) • language apps. 0 (0%) 1(20%) •language apps.0 (0%)1(20%) Computer literacy   Computer literacy • Microsoft package (word, excel, power point) 0 (0%) 4 (80%) •Microsoft package (word, excel, power point)0 (0%)4 (80%) • Internet, email, cloud storage 0 (0%) 5 (100%) •Internet, email, cloud storage0 (0%)5 (100%) Mode of communication with others   Mode of communication with others • Mobile phone calls 15 (100%) 5 (100%) •Mobile phone calls15 (100%)5 (100%) • Video conferencing 0 (0%) 5 (100%) •Video conferencing0 (0%)5 (100%) • Voice notes 1 (7%) 5 (100%) •Voice notes1 (7%)5 (100%) • Instant messaging (Messenger, Viber, Whatsapp, 4 (27%) 5 (100%) •Instant messaging (Messenger, Viber, Whatsapp,4 (27%)5 (100%)  Telegram, etc)   Telegram, etc) • E-mail 0 (0%) 5 (100%) •E-mail0 (0%)5 (100%)  "},{"text":" In addition to SESAME, both the farmers and extension officers use other sources of information for weather/climate forecasts and crop advisories. The most common source is the Facebook page of Su Su San to which 73% of farmers and 80% of extension officer relying for climate and weather forecasts. Other sources for climate and weather information being used by farmers are TV (67%), radio (47%). Regarding the weather-based crop advisories for farmers, 40% use Htwet Toe and 13% use Green Way and SEAD apps. SEAD application is an online platform providing technical inputs to farmers, agriculture and livestock advisories and weather forecasts. The SEAD is developed by the technical cooperation of the Department of Agriculture, Department of Agricultural Research, Livestock Breeding and Veterinary Department and Department of Meteorology and Hydrology, under the project Sustainable Enterprises and Agricultural Development -SEAD funded by UNDP and Ooredoo Myanmar Company. Other online platforms providing agricultural advisories are Shwe Thee Hnan (golden paddy) and PP (plant protection) apps. developed by the department of agriculture and, Yetagon (water fall) farmer extension services of Proximity Design.  Demand for the information related to natural disaster Demand for the information related to natural disaster      early warning and responses early warning and responses 120%       120% 100%       100% 80%       80% 60%       60% 20% 40% Demand for additional information related to crop-specific 20% 40%Demand for additional information related to crop-specific 0% Drought 120% Flood farming advisories Heat Damage Cold (low Strong Wind Heavy rain Other 0%Drought120%Floodfarming advisories Heat Damage Cold (low Strong WindHeavy rainOther       temperature (typhoon) temperature(typhoon)        or frost) damage or frost)damage   100%    damage 100%damage      farmer % extension officer % farmer %extension officer % 80% Figure 8. Demand for information related to natural disaster early warning and responses 80% Figure 8. Demand for information related to natural disaster early warning and responses Other additional information needs from farmer respondents include market price information, market Other additional information needs from farmer respondents include market price information, market place for selling and buying of products, space for consultation with experts and, those from extension 60% officers include Q&A section and advisories for vegetables, horticulture and perennial crops. place for selling and buying of products, space for consultation with experts and, those from extension 60% officers include Q&A section and advisories for vegetables, horticulture and perennial crops. The reason for using SESAME application by the farmers differ from that by extension officers. The reasons 40% in this case refer the users' expectation from the SESAME. Majority of farmers (87 -100%) use SESAME The reason for using SESAME application by the farmers differ from that by extension officers. The reasons 40% in this case refer the users' expectation from the SESAME. Majority of farmers (87 -100%) use SESAME app. to access weather and climate forecasts for planning and decision-making purposes and weather- app. to access weather and climate forecasts for planning and decision-making purposes and weather- based crop advisories for their farm management activities. More than 53% of farmers expected to get 20% additional information related to weather/climate, business purposes and social networking from the based crop advisories for their farm management activities. More than 53% of farmers expected to get 20% additional information related to weather/climate, business purposes and social networking from the SESAME. For the extension officers, 80% are using the app. for additional weather and climate SESAME. For the extension officers, 80% are using the app. for additional weather and climate information while less than 50% use the app. for other purposes like accessing weather and climate 0% forecasts for cropping purposes, receiving the weather-based crop advisories, etc. information while less than 50% use the app. for other purposes like accessing weather and climate 0% forecasts for cropping purposes, receiving the weather-based crop advisories, etc.       Reason for using SESAME Reason for using SESAME 120%       120%  100%      100% 100%    87%   100%87%       80% 80% 80%       80%        60% 60% 60%      farmer% 53% extension officer% 53% 60%farmer% 53%extension officer%53%  40%    40%  40% 40%40%40% 40%       40%        20% 20% 20%20% 20%       13% 20%13%        0% 0% 0%0% 0%       0%  Access weather Access weather- Additional Additional Business Social Others Access weatherAccess weather-AdditionalAdditionalBusinessSocialOthers  and seasonal  based crop information information purposes networking and seasonalbased cropinformationinformationpurposesnetworking  forecasts to  advisories to about about crops forecasts toadvisories toaboutabout crops  guide planning  guide farm weather/climate guide planningguide farmweather/climate  and decision-  management  and decision-management  making     farmer % extension officer % makingfarmer %extension officer % Figure 9. Reason for using SESAME by farmers and extension officers Figure 9. Reason for using SESAME by farmers and extension officers  "},{"text":" table below  Other sources of information for climate information and Other sources of information for climate information and  advisory services being used by farmers and extension officers advisory services being used by farmers and extension officers 70% 80% 90% 67%  73% 80%        70% 80% 90%67%73% 80% 50% 60%  47%  40%      40% 50% 60%47%40%40% 40%           40% 10% 20% 30% 20% 20%   20% 13% 20% 0% 13% 0% 20% 0% 20% 20% 7% 0% 10% 20% 30%20%20%20%13% 20%0% 13%0% 20%0% 20%20%7%0% 0%           0%  TV Radio Su Su San Htwet Toe Green SEAD app. shwe PP Phone Yetagon TVRadio Su Su SanHtwet ToeGreenSEAD app. shwePPPhoneYetagon    (Facebook) app. Way app.    built in (Facebook) (Facebook)app.Way app.built in(Facebook)            app. app.      farmer % extension officer %  farmer %extension officer % Respondents' opinion do not  accessibility device  design not elderly Respondents' opiniondo notaccessibilitydevicedesignnotelderly on people do not know about to the  compatibility complicated necessary persons not on people do notknow aboutto thecompatibilitycomplicatednecessarypersons not install the SESAME the app.  internet     to install able to use install the SESAMEthe app.internetto installable to use            the app. the app. Opinion of farmers 67%  60%   33%  27% 7% 7% Opinion of farmers67%60%33%27%7%7% Opinion of extension 80%  40%   20%  0% 0% 0% Opinion of extension80%40%20%0%0%0% officers          officers  "},{"text":" The comments from extension officers are mentioned in the table below. Comments    frequency % Commentsfrequency % logos of crop in the advisory section should be green, 1 20% logos of crop in the advisory section should be green,120% To use crop symbol and image related to the mode of action and damage 2 40% To use crop symbol and image related to the mode of action and damage240% due to pests    due to pests Internal color is dominated with white or a bit light, should be dark color 2 40% Internal color is dominated with white or a bit light, should be dark color240% for farmers, it would be good if the app. name is a local name 1 20% for farmers, it would be good if the app. name is a local name120% Concerning the attractiveness of the typology of the app., the farmers and extension officers feedbacks Concerning the attractiveness of the typology of the app., the farmers and extension officers feedbacks are mentioned in the table below.  are mentioned in the table below.  farmers  extension officers farmersextension officers  frequency % frequency % frequency%frequency% Font style    Font style fine 8 53% 1 20% fine853% 120% fare 4 27%  0% fare427%0% font size 3 20% 4 80% font size320% 480% small    small alignment    alignment fine 10 67% 2 40% fine1067% 240% fair 4 27% 2* 40% fair427% 2*40% narrow 1 7%  0% narrow17%0% poor 0  1 20% poor0120% Color    Color fine 9 60% 1 20% fine960% 120% fair 2 13% 1 20% fair213% 120% light 2 13% 1 20% light213% 120% prefer black 2 13% 0 0% prefer black 213% 00% dislike red 0 0% 1 20% dislike red00% 120% not match 0 0% 1 20% not match00% 120% *one respondent comments that the font size in the crop list uneven *one respondent comments that the font size in the crop list uneven  "},{"text":"tool provides wrong information   Users' opinion on the accuracy of the forecasts of Users' opinion on the accuracy of the forecasts of  SESAME need to be improved SESAME need to be improved 120%     120% 100% 93% 80%  87% 100% 100%93%80%87%100% 80%     80% 60%     60% 40%     40% 20%     20% 0%     0%  Daily weather forecast  5-day weather forecast Daily weather forecast5-day weather forecast   farmers extension officers farmersextension officers Figure 21. Users' rating on SESAME   Figure 21. Users' rating on SESAME    farmers extension officers farmersextension officers    # % # % #%#% crop damage, economic loss 1 7% 0% crop damage, economic loss17%0% losses in seeds, labor costs  1 7% 0% losses in seeds, labor costs17%0% not much affected  4 27% 0% not much affected427%0% damage could be high  1 7% 0% damage could be high17%0% disturbance to crop activities 4 27% 1 20% disturbance to crop activities427%120% crop loss, yield decrease  2 13% 3 60% crop loss, yield decrease213%360% people will be frustrated  1 7% 1 20% people will be frustrated17%120% n.a   1 7% 0% n.a17%0%  "},{"text":"Understanding User Experience (UX) of SESAME application Please specify ____Social Media (Mostly Facebook and Viber) Figure2. User Experience Honeycomb(Peter Morville, 2004)   Usable b.2. For those who did not install the SESAME application on mobile phone, please share your reason for not installing the application. device is slow and has low capacity  do not usually connect to the internet  The design of the application is complicated  don't think it is necessary to install the application Available in the application and download in the smartphone  Others, please specify:c.3. Do you think that the forecasts and agro-advisories communicated through SESAME were clear and straightforward?  Yes. I believe that the information from SESAME is structured using clear language.  No. I would suggest improving the messages based on the following If no, what color palette would you prefer for it to be more attractive? c.7. Please provide comments on overall typography of the SESAME application in terms of the following: ▪ Font style and size: _________________ ▪ Alignment : _________________ ▪ Color: ___________________ ▪ Spacing: ____________________ c.8. Please rate the overall map visualization of weather and climate data in the SESAME app.  I can easily understand the information on the map.  I do not understand the information provided on the map.  I prefer to get the information in different format rather than a map. Please specify …………………………………………………………………… Findable d.1. Can you easily navigate through the website and find the information that you are looking for? __ Yes __ No d.2. Can you easily navigate through the SESAME mobile application and find the information that you are looking for? __ Yes __ No d.3. Do you find SESAME application efficient to use in terms of fast navigation, practical and organized content? __ Yes __ No d.4. If no, what do you think shall be improved in terms of navigating the application? Accessible e.1. Can you understand the wording and terminologies used on the website and mobile application of SESAME? __ Yes __ No e.2. Where do you access the SESAME application and website? What is the equipment that you use in accessing the SESAME application?  Smartphone provided by the office  Desktop computer provided by the office  Laptop issued by the office  Personal smartphone  Personal laptop  Others. Please specify. ___________________________________________ e.4. Do you have stable internet connectivity when using the SESAME application or website?  Yes  No. e.5. If no, what are the challenges that you experience while using the SESAME application?  Not advanced smart phone (can't update information, font problem, etc.)  Not familiar with using application  Expensive data package for internet usage e.6. Do you think the cost of internet data to connect to the SESAME application using your smartphone or computer matters to you?  Yes  No. e.7. How did you resolve those challenges? e.8. Do you have to ask other people's approval or permission for you to log in on SESAME application or website? __ Yes __ No. I can access the application by myself. e.9. If yes, please describe the process of approval and identify the person or office involved. e.10. Please describe the level of difficulty that you experienced in signing up for the SESAME application. i. ☐ Easy ☐ Medium ☐ Hard Credible f.1. Do you think SESAME is more effective if the tool is accompanied by a technical training like Farmers' Field School (FFS)? __ Yes __ No f.2. What/who is your resource if you have questions or clarification on how to use the SESAME application?  I use the available SESAME manual or handbook.  I visit RIMES website for additional information.  I visit SESAME Frequently Asked Questions (FAQs) section  I will contact the in-country coordinator from RIMES  I figure it out myself  I asked my colleagues to help me figure it out  Others. Please specify: f.3. What are the communication channels that you use to transmit information from SESAME application? What type of support activities do you need to use the application better or more effectively?  Additional training on the use of the application  Step-by-step manual on the use of SESAME  Video tutorial of the SESAME website and mobile application  Additional knowledge on the use of SESAME  Others. Please specify: _________________________ Name: Age: Gender: Profession: Name of institution: Academic background/ Technical expertise: Main job responsibilities: Major tasks relevant to the job: Not applicable for farmer respondents Not applicable for farmer respondents Not applicable for farmer respondents Computer experience (specify software and programs): Not applicable for farmer respondents Computer skills proficiency (basic, intermediate, advance): Not applicable for farmer respondents Any experience in using mobile application What do you usually use to communicate with your colleagues? Or to farmers? __ Mobile phone calls __ Video conferencing __ Instant messaging (Facebook groups, Messenger, Viber, Whats app., Telegram, etc.) __ E-mail Description  drier than normal condition __ Others. Qualities of UX Useful  real time weather forecast Content should be original and fulfill a need or purpose Usable 3. Pest Tool (website or an application) must be easy to use Desirable  Common seasonal pests Image, identity, brand, and other design elements are used to evoke emotion and appreciation Findable Content needs to be navigable and locatable onsite and offsite Accessible Content needs to be accessible to people with disabilities Credible Users must trust and believe what you tell them Useful a.1. Do you know the overall purpose of the SESAME application? __ Yes __ No a.2. If yes, please describe briefly its purpose based on your understanding. a.3. Is the SESAME application essential to perform your job function? __ Yes __ No a.4. If yes, please specify which section of the app is relevant to you. (Participants can select more than one answer). a. Weather forecasts and climate outlooks b. Crop data c. Crop advisory generation d. Dissemination Please specify channels: ___ E-mail ___ SMS ___ Fax ___Social Media (Facebook) ___ Mobile application ___ Viber What'App Others e. Feedback system f. All the sections are relevant. a.5. What is the forecast resolution ( ☐regional, ☐provincial, ☐district, ☐township) and lead time (☐weekly, ☐monthly, ☐3 to 6 months ahead) that is most crucial for your work? a.6. Does the weather and climate information you get from SESAME influence the timing and application of your farming practices? __ Yes __No a.7. If yes, please specify the farming practices influenced by which weather or climate information (daily forecast, 10-day forecast, seasonal forecast). a.8. What are the missing information in the features of the app. 1. Weather  Daily weather forecast  Pentad weather forecast  Monthly forecast for the next month  Seasonal forecast for the next season 2. Crop Advisory  Crop advisories not available for the crops i. ……………………, ii. ……………………, iii. ……………………, iv. ……………………, v. ……………………,  Crop advisories not available for  Preventive measures  Action on infection  No data at all 4. Others  Livestock  Market a.9. In addition to the information available in SESAME, what additional information do you want to request to be included in SESAME app? -Weather/climate information (Check boxes)  Past weather information (last week or month weather condition)  Present weather nowcast (current weather condition)  Forecast for next two weeks  Forecast for the next month  24 hours weather forecast  Others: _____________________ -Crop-specific farming advisories (Check boxes)  Planting (sowing) and harvesting date recommendation  Crop and variety selection  Fertilizer application timing and amount  Pesticide application timing and amount  Irrigation timing  Others: _____________________ -Natural disaster early warning and responses to reduce crop damage (Check boxes)  Drought  Flooding  Heat damage  Cold (low temperature or frost) damage  Strong wind (typhoon) damage  Others: _____________________ -If there are other information needs, please specify: ________________________________________ a.10. What is your main reason for using SESAME?  Access weather and seasonal forecasts to guide planning and decision-making  Access weather-based crop advisories to guide farm management  Additional information about weather/climate  Additional information about crops  Business purposes  Social networking  Others, please specify: a.11. Do you use other sources of information for weather/climate forecasts and crop advisories? __ Yes __ No a.12. If yes, please specify the source/name of application.  TV  Radio  Su Su San  Htwet Toe  Green Way  Golden Paddy  PP  Other (please specify)…………………………………….  Other reason/s: _________________________________________________________ b.3. How often do you use the SESAME application?  At least once a day  Three times a week  Once every two weeks  Once a month  Once every season (please specify: before, during, end)  Three times every season (before, during, end)  Others ______________________________ b.4. Do you go to SESAME website or use the mobile application if you need weather-or climate-based advisories? __ Yes __ No b.5. How long does it take for you to get or download the specific information that you need from SESAME?  Less than a minute  Five minutes  Between 10 and 15 minutes  30 minutes  At least one hour  Others, please specify: _______________________ b.6 Are you able to get offline access for some information in SESAME app? _____Yes _______No b.7. If no, do you prefer to get offline access for some information? _____Yes _______No Desirable c.1. In which format do you prefer to receive the daily weather forecast for next 7 days from SESAME?  SMS  Smartphone pop up alarm  Video with explanation  Weather advisory on television  Weather advisory on radio  Weather advisory broadcast through loudspeakers  Others, please specify: c.2. In which format do you prefer to receive the 5-day forecasts for next 10 days from SESAME?  Printed copy of the bulletin  PDF file received via e-mail  Official letter  Video with explanation  Weather advisory on television  Weather advisory on radio  Weather advisory broadcast through loudspeakers  simpler terminologies  length  others -please specify): ___________________________ c.5. Do you find the overall color palette of the SESAME application and website attractive? __ Yes __ No c.6.  Office  Home  Road  Field  Any place where internet connection is available  Others: _____ e.3.  Meetings  Online messaging (Messenger, Telegram, Whats app, Viber)  Mobile phone calls  Trainings  Official letter  SMS exchange  Voice message  E-mail  Peoples' Network  Others, please specify: _______________________   language f.4. Name: Age: Gender: Profession: Name of institution: Academic background/ Technical expertise: Main job responsibilities: Major tasks relevant to the job: Not applicable for farmer respondents Not applicable for farmer respondents Not applicable for farmer respondents Computer experience (specify software and programs): Not applicable for farmer respondents Computer skills proficiency (basic, intermediate, advance): Not applicable for farmer respondents Any experience in using mobile application What do you usually use to communicate with your colleagues? Or to farmers? __ Mobile phone calls __ Video conferencing __ Instant messaging (Facebook groups, Messenger, Viber, Whats app., Telegram, etc.) __ E-mail Description  drier than normal condition __ Others. Qualities of UX Useful  real time weather forecast Content should be original and fulfill a need or purpose Usable 3. Pest Tool (website or an application) must be easy to use Desirable  Common seasonal pests Image, identity, brand, and other design elements are used to evoke emotion and appreciation Findable Content needs to be navigable and locatable onsite and offsite Accessible Content needs to be accessible to people with disabilities Credible Users must trust and believe what you tell them Useful a.1. Do you know the overall purpose of the SESAME application? __ Yes __ No a.2. If yes, please describe briefly its purpose based on your understanding. a.3. Is the SESAME application essential to perform your job function? __ Yes __ No a.4. If yes, please specify which section of the app is relevant to you. (Participants can select more than one answer). a. Weather forecasts and climate outlooks b. Crop data c. Crop advisory generation d. Dissemination Please specify channels: ___ E-mail ___ SMS ___ Fax ___Social Media (Facebook) ___ Mobile application ___ Viber What'App Others e. Feedback system f. All the sections are relevant. a.5. What is the forecast resolution ( ☐regional, ☐provincial, ☐district, ☐township) and lead time (☐weekly, ☐monthly, ☐3 to 6 months ahead) that is most crucial for your work? a.6. Does the weather and climate information you get from SESAME influence the timing and application of your farming practices? __ Yes __No a.7. If yes, please specify the farming practices influenced by which weather or climate information (daily forecast, 10-day forecast, seasonal forecast). a.8. What are the missing information in the features of the app. 1. Weather  Daily weather forecast  Pentad weather forecast  Monthly forecast for the next month  Seasonal forecast for the next season 2. Crop Advisory  Crop advisories not available for the crops i. ……………………, ii. ……………………, iii. ……………………, iv. ……………………, v. ……………………,  Crop advisories not available for  Preventive measures  Action on infection  No data at all 4. Others  Livestock  Market a.9. In addition to the information available in SESAME, what additional information do you want to request to be included in SESAME app? -Weather/climate information (Check boxes)  Past weather information (last week or month weather condition)  Present weather nowcast (current weather condition)  Forecast for next two weeks  Forecast for the next month  24 hours weather forecast  Others: _____________________ -Crop-specific farming advisories (Check boxes)  Planting (sowing) and harvesting date recommendation  Crop and variety selection  Fertilizer application timing and amount  Pesticide application timing and amount  Irrigation timing  Others: _____________________ -Natural disaster early warning and responses to reduce crop damage (Check boxes)  Drought  Flooding  Heat damage  Cold (low temperature or frost) damage  Strong wind (typhoon) damage  Others: _____________________ -If there are other information needs, please specify: ________________________________________ a.10. What is your main reason for using SESAME?  Access weather and seasonal forecasts to guide planning and decision-making  Access weather-based crop advisories to guide farm management  Additional information about weather/climate  Additional information about crops  Business purposes  Social networking  Others, please specify: a.11. Do you use other sources of information for weather/climate forecasts and crop advisories? __ Yes __ No a.12. If yes, please specify the source/name of application.  TV  Radio  Su Su San  Htwet Toe  Green Way  Golden Paddy  PP  Other (please specify)…………………………………….  Other reason/s: _________________________________________________________ b.3. How often do you use the SESAME application?  At least once a day  Three times a week  Once every two weeks  Once a month  Once every season (please specify: before, during, end)  Three times every season (before, during, end)  Others ______________________________ b.4. Do you go to SESAME website or use the mobile application if you need weather-or climate-based advisories? __ Yes __ No b.5. How long does it take for you to get or download the specific information that you need from SESAME?  Less than a minute  Five minutes  Between 10 and 15 minutes  30 minutes  At least one hour  Others, please specify: _______________________ b.6 Are you able to get offline access for some information in SESAME app? _____Yes _______No b.7. If no, do you prefer to get offline access for some information? _____Yes _______No Desirable c.1. In which format do you prefer to receive the daily weather forecast for next 7 days from SESAME?  SMS  Smartphone pop up alarm  Video with explanation  Weather advisory on television  Weather advisory on radio  Weather advisory broadcast through loudspeakers  Others, please specify: c.2. In which format do you prefer to receive the 5-day forecasts for next 10 days from SESAME?  Printed copy of the bulletin  PDF file received via e-mail  Official letter  Video with explanation  Weather advisory on television  Weather advisory on radio  Weather advisory broadcast through loudspeakers  simpler terminologies  length  others -please specify): ___________________________ c.5. Do you find the overall color palette of the SESAME application and website attractive? __ Yes __ No c.6.  Office  Home  Road  Field  Any place where internet connection is available  Others: _____ e.3.  Meetings  Online messaging (Messenger, Telegram, Whats app, Viber)  Mobile phone calls  Trainings  Official letter  SMS exchange  Voice message  E-mail  Peoples' Network  Others, please specify: _______________________   language f.4.  normal condition  normal condition  wetter than normal condition  wetter than normal condition  "}],"sieverID":"38b19492-b71f-4851-922b-7f288a9f4a13","abstract":"project aims to develop climate risk management systems, best practices, and insurance products that will shield smallholder farmers and businesses across the agricultural value chain in key Southeast Asia countries from physical and financial disaster associated with climate change. It assists governments in developing national and regional adaptation and risk management strategies. To know more about our project, please visit: https://deriskseasia.org/."}

data/part_1/0b8a97c5ba1a0fffb986742735fa7b92.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b8a97c5ba1a0fffb986742735fa7b92","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/766612b5-a75e-41fc-950e-5c724e596f73/retrieve"},"pageCount":8,"title":"","keywords":[],"chapters":[],"figures":[],"sieverID":"4f6314b1-b9e6-4256-b226-75ccd89dab93","abstract":""}

data/part_1/0b934c2afce7dc749d801f5acbd9e801.json

@@ -0,0 +1 @@
+{"metadata":{"id":"0b934c2afce7dc749d801f5acbd9e801","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/575367b4-ff5a-46fd-9e16-3884a339fe2b/retrieve"},"pageCount":3,"title":"Enhancing Capacity for Resilient Agriculture Planning and Programming in Kenya","keywords":[],"chapters":[{"head":"","index":1,"paragraphs":[{"index":1,"size":103,"text":"The main objective of this training was to build the capacity of the local partners and County government officials on climate-resilient programming. The training was envisaged to increase their skills in implementing Climate Smart Agriculture (CSA) programs that mitigate against and increase adaptation to climate change events. \"As ChildFund, we work through implementing partners, and such training will go a long way in helping to implement the 5-year strategic plan we have just launched. One key area in the strategic plan is disaster risk reduction; this training will help us properly design adoption and mitigation processes,\" said Caroline Ngonge, Area Partnership Portfolio Manager."},{"index":2,"size":64,"text":"Climate change has devastated agricultural production, resulting in food insecurity. An estimated 3.5 million people in Kenya face hunger and starvation, particularly those in the Arid and Semi-Arid areas. These statistics are based on the ten counties red zoned or categorized under the alarm drought phase: Garissa, Isiolo, Kajiado, Kitui, Mandera, Marsabit, Laikipia, Samburu, Tana River, Turkana, and Wajir (National Drought Management Authority, 2022)"},{"index":3,"size":164,"text":"Kenya is vulnerable to climate change effects like the rest of the world. An increase in average annual temperature has largely characterized these effects. The high intensity and frequency of extremely unstable weather events throughout the country have been rising, i.e., extended periods of drought, flooding, frequent and violent storms, floods, and landslides. The four-day training saw participants awarded with participation certificates and knowledge which is expected to trickle down to the communities in the counties. John King'ori, the Programme and Fundraising Coordinator from Pioneer Child Development Programme, noted that the training would help the officers in the agriculture field to align themselves with the 3 CSA pillars of increasing productivity and Income sustainably, strengthening resilience to climate change and reducing carbon emission contribution of agriculture to climate change. \"Beyond that, the training would help us to align our projects to the existing CSA policies so that we can contribute maximumly to the national and international commitments of reducing greenhouse gas emissions,\" he added."}]},{"head":"Photo: Some of the participants receiving their certificates of participation after the training","index":2,"paragraphs":[{"index":1,"size":55,"text":"Children are among the most vulnerable groups to the impacts of Climate Change. They suffer from chronic hunger, lack of education, child labor, and early marriages, among other abuses. The effects on children are likely to increase significantly over time with the extent depending on how we can successfully mitigate the impacts of climate change."},{"index":2,"size":45,"text":"ChildFund is a non-sectarian and non-profit development organization working in more than 30 countries worldwide to improve the well-being of about 15.2 million children and families, regardless of race, creed, religion, and gender. In Kenya, ChildFund works through 13 local partners (LPs) in 26 counties."}]}],"figures":[{"text":" Kenya has shown its commitment to combating climate change by formulating climate change policies and ratifying the Paris Agreement (PA). The PA is a legally binding international climate change treaty adopted by 196 Parties at COP 21 in Paris on December 12, 2015, and entered into force on November 4, 2016. Its goal is to limit global warming to preferably 1.5 degrees Celsius, compared to pre-industrial levels. Countries aim to reach global peaking of greenhouse gas emissions as soon as possible to achieve a climate-neutral world by mid-century. This process leading up to a long-term temperature goal needs concerted efforts. This year, the COP27 in Egypt has been focusing on delivering on the Promises of PA. It also seeks renewed solidarity between countries to deliver on the landmark Paris Agreement for people and the planet. AICCRA played a significant role in crafting the African Union's Climate Change and Resilient Development Strategy and Action Plan, recently ratified by member states ahead of COP27. "},{"text":"  "},{"text":"  "}],"sieverID":"36e5ac6f-7a5d-4555-aa0e-6965861e00f5","abstract":"The Alliance of Bioversity International and CIAT has been working on several projects led by Accelerating Impacts of CGIAR Climate Research for Africa (AICCRA) in six countries-Senegal, Mali, Ghana, Ethiopia, Kenya, and Zambia. These actions are to show that innovation is a necessary but insufficient factor in transforming food systems under climate change. Ahead of COP27, AICCRA developed a diagnostic framework and checklist that enables African policymakers to set policy priorities for the transformation they seek of national and regional food systems under climate change."}