DeepBindWeight / README.md
thewall's picture
Update README.md
b259ce9
metadata
license: openrail

DEEPBIND v0.11

The deepbind command-line executable can be used to score DNA/RNA sequences according to any RBP/TF model listed in the DeepBind web repository:

http://tools.genes.toronto.edu/deepbind

For each input sequence, the deepbind executable scores each subsequence of a pre-determined length (e.g. 20) and returns only the maximum or the average over these per-position scores.

Larger scores indicated stronger binding. The scores themselves are on an arbitrary scale, and vary from model to model due to variation in the quality of training data for different proteins.

EXAMPLE

To generate predictions with DeepBind, you need two things:

  1. a list of model IDs, and
  2. a list of DNA/RNA sequences.

The file example.ids contains 4 example model IDs, one on each line, reproduced here:

  • D00210.001 # RBFOX1 (RNAcompete)
  • D00120.001 # MBNL1 (RNAcompete)
  • D00410.003 # GATA3 (SELEX)
  • D00328.003 # CTCF (SELEX)

The file example.seq contains 4 example sequences, which were chosen such that the nth sequence scores highly for the nth model. The file example.seq is reproduced here:

  • AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
  • AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
  • GAGGTTACGCGGCAAGATAA
  • TACCACTAGGGGGCGCCACC

To generate 16 predictions (4 models, 4 sequences), run the deepbind executable as follows:

% deepbind example.ids < example.seq

D00210.001 D00120.001 D00410.003 D00328.003
7.451420 -0.166146 -0.408751 -0.026180
-0.155398 4.113817 0.516956 -0.248167
-0.140683 0.181295 5.885349 -0.026180
-0.174985 -0.152521 -0.379695 17.682623

To see details of each ID, use the --dump-info flag:

% deepbind --dump-info example.ids

ID Protein Type Species Family Class Experiment
D00210.001 RBFOX1 RBP Homo sapiens RRM RNAcompete
D00120.001 MBNL1 RBP Homo sapiens Znf RNAcompete
D00410.003 GATA3 TF Homo sapiens GATA SELEX
D00328.003 CTCF TF Homo sapiens C2H2 ZF SELEX

CHANGES v0.1 -> v0.11

  • Fixed bug where last position in input sequence was not evaluated for a score; suggested by Irene Kaplow.

  • Added --window-size and --average flags based on feedback.