---
license: openrail
---
DEEPBIND v0.11
--------------

The deepbind command-line executable can be used to score DNA/RNA sequences
according to any RBP/TF model listed in the DeepBind web repository:

   http://tools.genes.toronto.edu/deepbind

For each input sequence, the deepbind executable scores each subsequence
of a pre-determined length (e.g. 20) and returns only the maximum or the
average over these per-position scores.

Larger scores indicated stronger binding. The scores themselves are on an 
arbitrary scale, and vary from model to model due to variation in the 
quality of training data for different proteins.


EXAMPLE
-------

To generate predictions with DeepBind, you need two things:

  1) a list of model IDs, and
  2) 
  3) a list of DNA/RNA sequences.

The file example.ids contains 4 example model IDs, one
on each line, reproduced here:

   * D00210.001 # RBFOX1 (RNAcompete)
   * D00120.001 # MBNL1  (RNAcompete)
   * D00410.003 # GATA3  (SELEX)
   * D00328.003 # CTCF   (SELEX)

The file example.seq contains 4 example sequences, which
were chosen such that the nth sequence scores highly for
the nth model. The file example.seq is reproduced here:

   * AGGUAAUAAUUUGCAUGAAAUAACUUGGAGAGGAUAGC
   * AGACAGAGCUUCCAUCAGCGCUAGCAGCAGAGACCAUU
   * GAGGTTACGCGGCAAGATAA
   * TACCACTAGGGGGCGCCACC

To generate 16 predictions (4 models, 4 sequences), run
the deepbind executable as follows:

   % deepbind example.ids < example.seq

   |D00210.001|   D00120.001|   D00410.003|   D00328.003|
   | :----:| :----: | :----: |:----: |
   | 7.451420    | -0.166146 | -0.408751|    -0.026180|
   | -0.155398   | 4.113817  |  0.516956|    -0.248167|
   | -0.140683   | 0.181295  |  5.885349|    -0.026180|
   | -0.174985   | -0.152521 | -0.379695|    17.682623|

To see details of each ID, use the --dump-info flag:

   % deepbind --dump-info example.ids
   
   |ID          | Protein  | Type  | Species       | Family   | Class  Experiment  |
   | :----:| :----: | :----: |:----: | :----: | :----: |
   | D00210.001  |RBFOX1   |RBP   |Homo sapiens  |RRM             |RNAcompete  |
   | D00120.001  |MBNL1    |RBP   |Homo sapiens  |Znf             |RNAcompete  |
   | D00410.003  |GATA3    |TF    |Homo sapiens  |GATA            |SELEX       |
   | D00328.003  |CTCF     |TF    |Homo sapiens  |C2H2 ZF         |SELEX       |



CHANGES v0.1 -> v0.11
---------------------

- Fixed bug where last position in input sequence was 
  not evaluated for a score; suggested by Irene Kaplow.

- Added --window-size and --average flags based on feedback.