Datasets:

tharindu

/

patents

like 0

an integrated circuit isolation technology wherein the nitride - sidewall methods of the prior art are improved by performing an undercut and backfill before the second nitride is added to the first nitride . thus , the butt joint between the two nitrides is made more secure , and localized bird &# 39 ; s - beaking at the butt joint between the moat nitride and the sidewall nitride does not occur .

in a first embodiment of the present invention , sidewall - nitride isolation methods are improved by using an undercut and backfill technique to make a better joint between the first and second nitride layers . that is , as seen in fig1 on a silicon substrate 10 a pad oxide 12 is grown , and a silicon nitride layer 14 is deposited . the thickness of the pad oxide layer 12 will typically be in the range of 100 to 500 angstroms and typically 350 angstroms , and this is preferably a grown oxide . the thickness of the first nitride layer 14 is typically in the range of 500 to 3000 angstroms preferably 1100 angstroms , and this nitride layer is preferably deposited by low pressure chemical vapor deposition . the photoresist pattern 16 is used to define where the moat regions 18 will be , and to expose regions 20 where the field oxide will be . after the resist 16 has been deposited and patterned , the nitride 14 and oxide 12 are etched according to this pattern . the etching conditions preferably used are 30 sccm of chf 3 , 60 sccm of helium , and 30 sccm of c 2 f 6 , at a pressure of about 1 torr . this etch provides a conveniently slow etching rate , so that good operator control can be achieved . the silicon can now be etched to a depth not less than 500 angstroms to form recesses in regions 20 . in the presently preferred embodiment , the silicon is etched to a depth of about 1200 angstroms , but this depth can be widely varied as will be further discussed below . the recesses in regions 20 are preferably not etched with vertical sidewalls , since recesses with sloping sidewalls ( having an angle between 40 degrees and 75 degrees ) are less likely to generate stress induced defects in silicon during the field oxidation step . the presently preferred embodiment for the silicon etching chemistry uses freon 11 at 110 sccm , argon at 200 sccm , and nitrogen at 200 sccm , at a pressure of 25 millitorr and a power of 500 watts . however , a wide variety of other silicon etches could be used , as is well known to those skilled in the art . when this etch has exposed the substrate 10 in regions 20 where the field oxide is to be formed , a further etching step is performed to undercut the oxide layer 12 . in the presently preferred embodiment , this step is a wet etch , in a concentrated hf / nh 4 f solution for about 40 seconds at room temperature . this produces a cavity 13 in the oxide 12 , around the periphery of nitride layer 14 , which is about 400 angstroms wide . at this point , a second pad oxide , the sidewall pad oxide 24 , is preferably grown ( to , e . g ., 250 a thick ), and the second nitride layer 26 is then deposited by low pressure cvd to a thickness of between 100 and 1000 angstroms , for example , 400 angstroms . the second pad oxide 24 is preferably thinner than the first oxide 12 , since the second pad oxide 24 must leave room for second nitride 26 inside cavity 13 . at this point , an additional oxide layer 28 is preferably deposited . preferably this is a plasma oxide ( i . e ., an oxide layer deposited by plasma - enhanced deposition ), of a presently preferred thickness of 2000 angstroms . this oxide is optionally not densified . the following etch will clear this oxide from the bottom of the recess , and from atop the nitride layers over the moat region , but filaments of this oxide will be left on the sidewalls of the recess . the filaments of the plasma oxide 28 on the sloping sidewalls of the recess will protect the second nitride layer 26 from thinning , and also prevent the channel stop implant from providing too much concentration of the channel stop species too close to active device areas . at this point , an anisotropic oxide / nitride / oxide etch is preferably performed . in the presently preferred embodiment , this etch uses 4 sccm of oxygen , 50 sccm of chf 3 , 100 sccm of helium , and 10 sccm of c 2 f 6 , at 11 / 2 torr . this etch will etch oxide and nitride at approximately the same rate , although of course low - density oxides ( such as undensified plasma oxide ) will be etched faster than high - density oxides . this etching step will leave only sidewall filaments ( of plasma oxide 28 sidewall nitride 26 and pad oxide 24 , will clear the bottom of the recess , and will also ( unless the process is further modified ) thin the nitride layer 14 somewhat . in a further embodiment of the invention , an additional buffer oxide layer 22 ( e . g . a 1000 a layer of densified plasma oxide ) is initially deposited atop pad oxide 12 and first nitride 14 , so that the photoresist pattern 16 is used to pattern a 3 layer oxide / nitride / oxide stack rather than merely a 2 layer oxide / nitride stack . thus , instead of the nitride layer 14 being thinned when the oxide 28 , nitride 26 and oxide 24 are etched off of the bottom of the recess , the buffer oxide 22 will be thinned instead . this means that the full thickness of the first nitride layer 14 is left intact , so that this thickness is accurately known . this layer , being of controlled thickness , will provide a known and controlled degree of mechanical resistance to deformation , and this mechanical resistance affects the degree of encroachment during field oxidation . in a further alternative embodiment , a deglaze etch ( e . g . a solution of hf / nh 4 ) etch may be performed before the field oxidation step , to remove the remnants of buffer oxide layer 22 from on top of the first nitride 14 ( and oxide 28 from sidewall nitride 26 ), so that the thickness ( and therefore stiffness ) of first nitride 14 ( and of sidewall nitride 26 ) are precisely known , so that the degree of residual oxide encroachment can be more precisely predicted . thus , as seen in fig6 and 7 , the use of buffer oxide layer 22 permits the first nitride layer 14 to be preserved intact when the bottom of the recess has been cleared . by contrast , n the prior art , as seen in fig4 and 5 , the first nitride layer 14 would have been thinned significantly at this point . in a further embodiment , the etch used to clear the second nitride layer 26 from the bottom of the moat is selective to oxide . the o 2 / ch 3 f / c 2 f 6 etch recipe specified above for the oxide nitride stack etch is not selective to oxide , but selectivity to oxide can be achieved merely by increasing the flow rate of oxygen in this recipe . that is , in this alternative embodiment , an etch is used which etches nitride faster than oxide , so that the second nitride layer 26 is reliably cleared from the bottom of the recess without removing too much thickness from buffer oxide layer 22 . in all of the nitride / oxide etching variation embodiments discussed above , other etch chemistries can also be substituted . however , in any case , the etch used should be reasonably selective to silicon . the channel stop implant can now be performed . the channel stop species , dosage , and energy will naturally be selected with reference to the particular device type , substrate type , field oxide thickness , and operating voltage used . in a sample embodiment , for 5 volt operation with an 8500 a field oxide , the channel stop implant would be boron at , for example , an energy of 80 kev and a dosage of 5e12 per square centimeter . alternatively , a light first channel stop implant could be performed after the first nitride layer is patterned , and a second channel stop implant performed after the silicon recess etch has been performed . in a further class of embodiments , as shown in fig3 a two step silicon etch is performed . that is , the recess is formed as described above , and the sidewall pad oxide 24 , second nitride 26 and plasma oxide 28 are cleared from the bottom , but not the sides , of the trench . however , at this point a second silion etch , preferably having high selectivity to oxide and nitride , is performed . in a sample embodiment , the first silicon etch is performed to a depth of 1800 angstroms , and the second etch is performed to go an additional 600 to 800 angstroms deeper . after this second silicon etch , a high dose channel stop implant ( e . g . 2 × 10 13 per centimeter squared ) can be performed , which provides additional thick parasitic threshold increase , and hence radiation hardness , as discussed above . alternatively , to avoid excess subthreshold current in the parasitic field oxide transistor , 2 channel stop implants are performed . a first channel stop implant is performed at the stage of fabrication shown in fig1 after the silicon recess has been etched but before the second nitride 26 is deposited . this channel stop implant will diffuse into the silicon recess sidewalls somewhat , to prevent turn - on of the parasitic leakage paths at the channel edges . in this case , the first channel stop implant would preferably be a relatively light dose , for example 1e11 to 1e12 per square centimeter at 80 kev , and the second channel stop implant would be a heavy dose implant as discussed . in a further embodiment of the invention , three separate channel stop implants are performed . the first channel stop implant is performed after the oxide / nitride ( or oxide / nitride / oxide ) stack has been patterned . the second implant is performed after the first silicon etch . this second implant can be performed either before or after the sidewall oxide / nitride layers have been placed on the sidewalls of the recess . the third channel stop implant is performed after the second silicon etch has been performed as described above . this third channel stop implant is the main source of channel stop doping , and can be applied at moderate to very heavy dosages , e . g . 1e12 per square centimeter up to 1e14 per square centimeter . the second channel stop implant is preferably a lighter dose , and seves to prevent inversion of the recess sidewalls . the first channel stop implant is preferably even a lighter dose yet , and serves principally to avoid field - enhanced turn - on at the corners of the moat as discussed above . a particular advantage of the two - step silicon etch embodiment is that the stress - limited maximum vertical length of the nitride can respected . that is , a major limitation of sidewall - nitride isolation technology has been leakage currents caused by defects induced during field oxidation by the mechanical stress caused by the mismatch between the sidewall nitride and the silicon substrate . to avoid this effect , the maximum vertical length of the sidewall nitride must be limited . the limit is not absolute , but is dependent on the thickness of the sidewall pad oxide 24 . where the pad oxide 24 is 150 angstroms thick , and the sidewall nitride layer 26 is 400 angstroms thick , the vertical nitride length must be less than about 1000 angstroms . if the sidewall pad oxide 24 is made 350 angstroms thick , the vertical nitride length can be increased to 2000 angstroms . however , in any case , the vetical nitride length should be limited to the defect free limit . the key advantage of the double - silicon - etch embodiment discussed is that the vertical nitride length can be limited without limiting the degree of recess . that is , if the silicon recess is made only 1000 angstroms deep , the isolation will not be fully recessed , i . e . an 8500 a grown field oxide will protrude substantially above the surface of the substrate 10 , thus sacrificing one of the advantages of sidewall nitride . moreover , such a shallow silicon recess means that a very high - dose channel stop must not be used to avoid contamination of active device regions by the channel - stop species . thus , this embodimet of the invention , as shown in fig3 provides fully recessed isolation with a high - dose channel stop without stress induced defects . the field oxide can be grown to a final thickness of between 3000 and 13000 angstroms or roughly triple the silicon etching depth , and a thick field oxide can be used without generating stress induced defects in the moat sidewalls . an alternative baseline proces flow for the semi - recessed isolation case is illustrated in fig8 - 12 . an initial 60nm thermal oxide layer is grown at 900 ° c . followed by 1200 angstroms of lpcvd silicon nitride . moat regions are then patterned , and the nitride / oxide layer is removed from the inverse moat regions using an anisotropic plasma etch . this is followed by a 60 nm vertical dry silicon etch . next a conventional 5 . 0e12 ions / cm2 , 90 kev boron channel stop implant is performed in order to raise the thick field threshold voltage . the slices are then etched for 30 - 60 sec in an hf / nh 4 f solution , to produce a cavity as discussed . the slices are then cleaned , and a 15 nm stress relief oxide layer is grown over the vertical silicon sidewall at 900 c . the sidewall nitride oxidation mask is then formed by depositing 40 nm of lpcvd silicon nitride , 200 nm of lpcvd silicon dioxide , and vertically etching the oxide / nitride stack to retain the sidewall . the purpose of the 200 nm lpcvd oxide layer is to prevent thinning of the sidewall nitride layer during etch . after the vertical etch , the lpcvd buffer oxide layer is removed by wet etching , which leaves the active device regions fully framed by the top and sidewall nitride layers . local field oxidation is then carried out in the normal manner at 900 c . in steam for at least 20 minutes . the present invention has been discussed with primary reference to silicon nitride , which is the generally preferred oxidation masking material in the semiconductor industry . however , other oxidation masking materials could be used if desired . the foregoing embodiments of the invention have been discussed with primary reference to fabrication of mos integrated circuits . however , the present invention is also applicable to fabrication of bipolar integrated circuits , as will now be discussed . fig1 shows a sample of a bipolar integrated circuit structure at an early stage of fabrication . a silicon substarate 100 is implanted to form n + buried layers 102 and p + varied layers 104 in a desired configuration . a lightly doped epitaxial layer 106 is then grown on top of substrate 100 and buried layers 102 and 104 . n + contact regions 108 and p + contact regions 110 will typically then be formed , and oxide isolation regions 112 are then formed using the present invention . that is , a pad oxide e . g . of 350 anstroms is grown , and a first nitride layer ( e . g . 1000 angstroms of lpcvd nitride ) is deposited on top of it . this nitride / oxide stack is then patterned to expose the desired locations of oxide isolation regions 112 . a particular requirement of the oxide isolation regions 112 , which is not applicable to mos field oxide formation , is that the oxide isolation regions 112 must reach all the way through the epitaxial layer 106 . in addition , these oxide isolation regions are preferably fully planar , to facilitate the later steps in bipolar processing . after the 1000 angstrom nitride layer has been patterned , a silicon etch , selective to oxide and nitride , is used to etch out the recesses 112 to approximately 1 / 2 the thickness of the epitaxial layer 106 . the oxide regions 112 are then formed according to the present invention . that is , after the silicon recess etch , the first pad oxide is briefly wet etched , to undercut the first nitride slightly around its periphery , a thin second pad oxide is grown , a thin second nitride layer is conformally deposited , and a long oxidation step is then performed to grow the oxide 112 . the key advantage of the present invention in this embodiment is that lateral encroachment of the oxide regions 112 is extremely tightly controlled . this means that close lateral spacing can be used . a further advantage of the present invention , in bipolar processing , is that , unlike in mos processing , the oxides will frequently be grown in between two extremely heavily doped contact regions 108 and 110 . use of a sidewall nitride process assists in minimizing deleterious dopant migration effects during the oxide growth process . in a further embodiment of the present invention , the initial patterning of the oxide regions 112 is performed using not merely an oxide / nitride stack , but an oxide / nitride / oxide stack . as discussed above , this means that the thickness of a nitride layer during the field oxidation step which forms oxide regions 112 is precisely known , and therefore further refinement of process control over the lateral encroachment of regions 112 is obtained . thus , the present invention provides as advantages all of the objects discussed above , as well as numerous other advantages . as will be apparent to those skilled in the art , the present invention can be widely modified and varied . the scope of the present invention is not limited except as set forth in the accompanying claims . 9n

US-62101984-A

an instrument for measuring sub - pico tesla magnetic fields using a superconducting quantum interference device inductively coupled to an unshielded gradiometer includes a filter for filtering magnetically - and electrically coupled radio frequency interference away from the squid . this rfi is principally coupled to the squid via the unshielded gradiometer . the filter circuit includes a resistor - capacitor combination interconnected to first and second terminals so that it is parallel to both an input coil of the squid and the gradiometer . in addition , a shielding enclosure is used to electromagnetically shield the filter circuit from the squid , and a method is employed to increase the impedance between the input coil and the squid without diminishing the overall sensitivity of the instrument .

the present disclosure is to be considered as an exemplification of the principles of the invention and the associated functional specifications for its construction , and is not intended to imply limitations to the invention beyond those that are specifically claimed . those skilled in the art may envision other possible variations beyond those exemplified here that fall within the scope of the present invention as claimed . fig4 presents a circuit diagram for a squid - based gradiometer constructed according to a first embodiment of the present invention . conventionally , apparatus 100 includes a gradiometer 10 ( represented in fig4 by inductance l g ) coupled to a squid 20 ( with washer inductance l sq ) via an input coil 30 ( represented by inductance l i and having a mutual inductance m i and capacitance c i with respect to the squid washer 20 ). rfi may be coupled into squid 20 , in two ways : electrically and magnetically . for example , with reference to fig4 , rfi may couple into the squid washer 20 by means of connecting wires ( such as transmission lines 14 , 14 a coupling gradiometer 10 via the input coil and / or connecting wires 45 coupling amplifier 50 via transformer 40 and / or , with reference to fig3 , transmission lines 15 coupling rfi via the feedback / modulation coil 33 ) acting like electromagnetic antennae . rfi can also be coupled into the squid washer 20 via magnetic flux threading various loops formed by the transmission lines 14 , 14 a and 45 . in addition , under some circumstances , rfi may produce a large dc field on the squid washer 20 . since squids are very low impedance devices , they are generally most affected by magnetically - coupled rfi . electrically - coupled rfi may however also be substantial , especially near and above fm radio band frequencies , at which point squid connecting wires can function as transmission lines . fundamentally , rfi and other forms of electromagnetic interference ( emi ) may get coupled into a squid via any electronic connections . as has been understood , rfi may be reduced or eliminated by employing symmetric electronics that allow one to remove a ground connection to squid . the symmetry of the electronics enables transmitted rf energy that is coupled into the squid to be reduced . for example , with reference to fig3 , rfi picked up through transmission line 15 , including residual energy that may be coupled through the feedback / modulation coil 33 and the rest of the electrical connections to squid washer 20 , may be eliminated in accordance with the principles of the present invention by using special symmetric filter circuits . symmetric squid electronics eliminate ground loop issues . fig1 and 2 show the symmetric squid bias and heater electronics , respectively . in fig2 , heating occurs in resistor 7 ( depicted as r h ). symmetry ensures that if connecting wires act as antennae , rfi voltages induced on them may be canceled out at the location of the squid . as illustrated for example by fig1 - 3 , symmetric signal sources 1 , 2 and 3 place signals onto transmission lines 17 , 16 and 15 . while doing so , rfi and other ambient noise also gets transmitted via the wires 15 - 17 . this induces rf electric fields on transmission lines 15 - 17 , and magnetic flux φ and magnetically - coupled interference rf 101 in the loops formed by these transmission lines 15 - 17 . as illustrated in fig1 and 3 , symmetrical rc filters 5 ( f c ˜ 1 - 10 megahertz ) and capacitors 6 prevent standing waves from being set up at resonant frequencies : ( a ) on transmission lines 15 - 17 and 45 at near 10 - 100 s of megahertz , and ( b ) between squid washer 20 and either the input coil 30 and / or the feedback / modulation coil 33 at a few gigahertz . additionally , if transmission lines 15 - 17 and 45 are configured as tightly twisted wire pairs , virtually no magnetic flux φ threads the associated circuit loops . circuit symmetry ensures , for example , that if the transmission lines 17 of fig1 act as antennae , the rfi voltage induced on them cancels out at the squid washer 20 . fig3 illustrates feedback / modulation coil 33 , which shares squid feedback and modulation circuitry . magnetic interference through the loop is eliminated by tightly twisted wire pairs forming transmission lines 15 ( so that φ is effectively 0 ). it should be noted that an antenna - like pick up of rfi can still be coupled to the squid through capacitive coupling between the feedback coil 33 and the squid washer 20 . capacitance c f of the modulation coil 33 may typically be about 10 picofarads ( pf ). the modulation signal has components up to 1 megahertz ( mhz ). thus , an rc filter 5 is chosen such that it has an effective bandwidth greater than 10 mhz , and a capacitance c large enough ( compared to c f ) to short most of the rfi from the squid washer 20 . representative values for rc filter 5 are r = 100 ohms (´ ω ) and c = 1 nanofarads ( nf ). fig4 illustrates a first embodiment of the present invention as a component of measuring apparatus 100 . rc filter 5 ( also illustrated in fig3 ) can be used to cut down the antenna - coupled rfi , but gradiometer 10 also introduces magnetic flux threading loop formed by transmission lines 14 . as a result , to eliminate both the antenna coupled rfi and magnetic flux rf 101 , the invention of fig4 couples resistive shunts 60 to grounding capacitor 70 in order to short out this magnetic flux from component loop 14 a and input coil 30 . alternatively , a single resistive shunt 60 may be coupled with symmetrical rc filters 5 as shown for measuring apparatus 200 in fig5 . in order to better understand how the present invention works , parameters suitable for a working system are illustrated below . it should be noted that these specific examples are provided for illustrative and descriptive purposes only , and therefore should not be inferred to limit the scope of the invention as claimed . the impedance values at various operating frequencies are tabulated in table 1 for the circuit 100 of fig4 . the values of various parameters are : ci = 140 pf ( measured ), li = 300 nanohenries ( nh ), cg = 10000 nf , r s = 1 . 5 ´ ω . impedance values for the circuit 200 of fig5 are provided in fig2 . all values are the same as in table 1 , except r s = 3 ´ ω and r g = 1 . 5 ´ ω . the circuit fig5 is therefore essentially equivalent to the circuit 100 of fig4 . for lower frequencies ( i . e ., below 5 mhz ), the input coil impedance z li is low enough and the wavelength of accompanying rfi is long enough for the circuit 100 of fig4 to be represented as the equivalent circuit 300 of fig6 . as may be observed from tables 1 and 2 and fig4 and 5 , the grounding tap capacitor 70 ( represented as cg ) is able to effectively shunt out the electrical component of rfi pickup from the squid because the capacitive impedance z ci between the input coil 30 and the squid washer 20 is much greater than z cg + r s ( or z cg + r g of table 2 ). at higher frequencies , the circuit 100 of fig4 behaves in accordance with the equivalent circuit 400 shown in fig7 with distributed l — c circuit elements : the distributed input coil elements 30 and distributed inductive squid washer elements 20 , coupled via distributed capacitive impedance 21 and mutual inductance 22 . representative approximations for elements dz ci , dz li in this case are tabulated in the last two columns of tables 1 and 2 . these approximations are estimated by considering that once the partial inductive impedance of a certain length of the feedback coil 30 ( where dz li is proportional to the length of input coil 30 ) starts to become larger than the capacitive impedance 21 between the feedback coil 30 and the squid washer 20 ( where dz ci is inversely proportional to the length of input coil 30 , because the coil width is fixed for both l and c ) over the same length segment , then it can effectively be considered to behave as a distributed lc network . this may occur , for example , with values of about 10 - 20 ´ ω for z li and z ci . these numbers are still larger than z cg + r s ( or z cg + r g for table 2 ) at those frequencies by a factor of approximately 10 , so that shunting by rc circuit 60 , 70 is still effective . at frequencies in excess of 1 ghz , the system 30 - 21 - 22 - 20 of fig7 behaves as a transverse magnetic ( tm ) mode resonator coupled to a well - damped ( with r s or rg ) input loop circuit , thus still avoiding instability of operation . as illustrated for example by fig4 , the shunt resistors 60 effectively remove the rf magnetic flux threading the input loop defined by transmission line 14 a from affecting the squid by shorting the gradiometer loop defined by transmission line 14 . z li is much greater than r s for frequencies higher than about 5 mhz ( for example , as shown in tables 1 and 2 ). for lower frequencies , shunting resistors r s still help by shunting part of the rf flux away from squid washer 20 . in principle , this effect may be further improved by reducing the value of the r s . unfortunately , there is a trade - off between smaller r s and the flux noise it adds into the squid ( from johnson current noise coupled through the input coil 30 according to the following relationship : ( i n )=√{ square root over ( 4 k b t / r )} ( θ n )= m i ( i n ) ( 2 ) where k b is the boltzmann constant and t is the temperature of the resistor r , i n is the johnson current noise and φ n is the flux noise induced in the squid . therefore , we can conclude that for the apparatuses 100 , 200 of fig4 and 5 , the optimum value for r s is 3 ´ ω ( 2 * r s in table 1 or r s in table 2 ). it should be noted that this optimum value may vary based upon other parameters associated with the circuitry of the system of the present invention . in light of the preceding discussion , it is clear that it could prove very difficult to eliminate magnetically coupled low frequency rfi ( below 5 mhz ). in this case , we would like to point out that we could be better served by using a conventional squid flux - locked loop ( fll ) at 5 mhz or higher ( for example , see the book by h . weinstock entitled , “ applications of superconductivity ,” kluwer , netherlands , 2000 ). in this case , the troublesome low frequency rfi can be nulled by the fll as it would now be fast enough to track the rfi in this frequency range . another advantage that will be gained from increasing fll frequency is that the slew rate will also be faster , and thus more immune to fast switching noise from nearby major power sources and electric lightening in the atmosphere . additional variations on the inventive embodiments of fig4 , 5 include featuring a shunt capacitors 71 ( represented by c s ) in series with the shunt resistors 60 ( see , e . g ., circuits 500 and 600 of fig8 and 9 ), and featuring an additional shunt resistor 61 ( represented by r ) in parallel with the circuit defined by shunt resistors 60 and grounding capacitor 70 ( see , e . g ., circuit 700 of fig1 ). the shunt capacitor 71 is chosen such that it forms a high pass circuit ( with r s and l i ) that blocks low frequency flux noise rf φ from getting to the squid washer 20 . introduction of c s however may , in some cases , cause instability of squid operation . this problem can be avoided by circuit 700 of fig1 , where parallel circuit shunt resistor 61 can be made to have a very small resistance . this helps to reduce rfi at frequencies lower than 5 mhz . the embodiments illustrated in fig4 and 10 are simple and compact , and thereby more resistant to parasitic effects than the embodiments illustrated in fig5 , 8 and 9 . on the other hand , the embodiment illustrated in fig5 has the advantage that r g can be made much smaller , thus making z cg + r g much smaller than z ci . this approach will improve the rf voltage filtering without introducing additional flux noise into the squid because of the symmetry of the circuit 200 . also , as illustrated by the circuit 600 in fig9 , r s can be lowered independently for filtering rf magnetic pickup , and only one additional shunt capacitor 71 needs to be added . in the circuit 500 of fig8 , r s can be reduced , thus making z cg + r s much smaller than z ci , and thereby enabling rf voltage filtering to improve . but , in this case , two additional shunt capacitors 71 are required . while only a few specific resistive and capacitive filters are illustrated in the present description , one skilled in the art will readily recognize that any other form of filter circuit that has similar properties ( cut - off frequency and sharpness of characteristics and elimination of both the electric and magnetic components of the interference ) may be used . as an example , one embodiment could include a superconducting filter made up of superconducting striplines that cuts out all components of rfi from getting coupled into the shielded squid from unshielded gradiometers . tables 1 and 2 suggest that if the squid is redesigned such that the capacitance between the input coil 30 and the squid washer 20 ( represented by c i ) is reduced , then z ci will become larger . this increased impedance makes the squid 20 more immune to electrical components of rfi . fig1 ( a )- 11 ( d ) shows a squid including squid washer 20 and spiral input coils 30 , 31 . coils 30 , 31 are separated from the squid washer 20 by an insulator 29 providing a separation of thickness t . only n = 5 turns of the input coils 30 , 31 are shown for clarity , but in practical designs n may approach 100 ( for a detailed discussion , including inductance calculations and formulae that follow , please refer to chapters 1 and 2 in the book by h . weinstock entitled , “ applications of superconductivity ” kluwer , netherlands , 2000 ). fig1 ( c ) and 11 ( d ) show a top view of the squid , and fig1 ( a ) and 11 ( b ) show a cross - sectional view taken through the dashed line “ e - e ”. reducing the line width , w , of the input coil 31 as compared to input coil 30 will decrease the capacitance in that proportion as c ∝ n · w / t ( compare fig1 c with 11 d ). the mutual inductance between the input coil 30 , 31 and the squid washer 20 , mi , is given by : where l sq is the inductance of the squid washer . accordingly , mi is unchanged by reduction in line width w . the input coil inductance , li , is given by : where l strip is the stripline inductance of the lines that make up the input coil 30 . although , l strip ≈ μ 0 · t w + 2 ⁢ ⁢ t increases as w is decreased , for sufficiently large n ( for nominal squid design this corresponds to n greater than 20 ), l strip can be ignored and l i ≈ n 2 · l sq . here μ 0 is the permittivity of the free space . thus , for practical designs , li is also independent of w . thus , in summary , the reduction in line width of the input coil lines ( as illustrated by input coil 30 and input coil 31 in fig1 ( c ) and 11 ( d )) results in a decrease in c i , but as mi and li are unchanged , does not lead to any loss of sensitivity ( here l g is the gradiometer inductance and is independent of the squid design ). the decrease in c i leads to increase in z ci making it that much larger than z cg , and this in turn further reduces the electrical rfi into the squid washer 20 ( please refer to tables 1 and 2 and fig6 and 7 ). rf currents flowing through the filter circuit wires could also get coupled into the squid if the filter wires are close to the squid washer 20 . to prevent this ( see , e . g ., fig1 ( a )- 12 ( c )), a squid shield 90 including two electromagnetically isolated chambers 91 , 92 may be used to separately house the squid 91 a ( shown in chamber 91 ) and the filter circuits 92 a ( shown in chamber 92 ). prior art squid shields have only one chamber . the use of additional chamber , even though it adds complexity to the manufacturing process , is required to achieve the level of rf immunity needed for unshielded operation of the squid instrument . fig1 ( a )- 12 ( c ) illustrate an exemplary squid shield 90 including an outer housing 96 with a bore 97 for receiving an insert 93 having relieved portions 98 , 99 . when insert 93 is inserted into bore 97 , each of relieved portions 98 , 99 fits sealably within bore 97 to respectively define electromagnetically sealed chambers 91 , 92 . a second bore 94 ( for example , less than a tenth of the diameter of the shield ) in insert 93 allows passage of electrical wires to connect between the squid 91 a in chamber 91 with the filter circuit 92 a in chamber 92 without any electromagnetic leakage . a ground connection 95 is provided for the filter circuit 92 a in chamber 92 so ground loop currents are now shielded from the squid . this isolation , in addition to the symmetric electronics , fully eliminates any grounding issues in the apparatus . in summary , a system and method are disclosed for effective implementation of a practical sub - pico tesla magnetic field detector that is insensitive to rfi . while various embodiments have been shown and described , it will be understood that there is no intent to limit the invention by such disclosure , but rather , it is intended to cover many modifications and alternate constructions falling within the spirit and the scope of the invention , as defined in the appended claims . for example , the present invention should not be limited by specific hardware or type of filter circuit . thus , one skilled in the art can envision using other formns of filter circuits ( just as an example , a filter made up of superconducting striplines ) having similar properties ( for example , cut - off frequency and sharpness of characteristics ).

US-50095004-A

a computer based image correction system for scanning tunneling microscopes caused by the non - linear , time - dependent behavior of piezoelectric transducers used in stms to acquire the image . the correction process operates on a digitized stored stm image . a subset of the stored image scan lines are selected for processing . each scan line is shifted and stretched according to the values of selected parameters . adjacent scan lines are shifted and stretched in the direction the scan line was acquired . adjacent scan lines are compared pixel by pixel and the differences are determined . the user is presented with a representation of the differences . the selected parameter values are varied until the differences between adjacent scan lines can best be minimized . the parameter values that best minimized the differences are then applied using the above process to the whole image . the result is an image with the distortions introduced by the piezoelectric transducers removed .

one illustrative embodiment of a stm image distortion correction system in accordance with my invention is shown in fig1 ; various control and other elements of an stm well known in the art but not specifically pertinent to my invention have not been illustrated but are understood to be present . my illustrative embodiment includes an stm 10 and a computer 20 . in the stm 10 , the tip 16 is raster scanned across the surface of interest 18 . the x coordinate tip position in the x - y plane is controlled by the x axis control circuitry 11 . the y coordinate tip position in the x - y plane is controlled by the y axis control circuitry 12 . in this embodiment , both the x axis control circuitry 11 and the y axis control circuitry 12 are configured from the scanning control processor 22 in the computer 20 through the computer input / output port 21 via communication paths 111 and 112 . included within the x axis and y axis control circuits are counters used to keep track of the tip position in the x - y plan . the values of the counters are sent to the scanning control processor 22 through the computer input / output port 21 via communication paths 121 and 122 . as the tip scans the surface of interest 18 , the z axis control circuitry 13 receives feedback voltage on line 133 from the tunneling current sensing circuitry 19 . the z axis control circuitry maintains the tunneling current constant by actuating the z axis piezoelectric transducer with a signal on line 132 . the z axis control circuitry also provides signals to the computer 20 via communication path 131 indicating the z axis position of the scanning tip 16 . the z axis tip position is communicated to scanning control processor 22 via the computer input / output port 21 and combined with the x - y plane tip position information to produce an image which is then recorded in the raw image data buffer 23 . the image data can then be read into the image display buffer 25 and displayed on the user input and display device 27 . in accordance with my invention , the image correction processor 26 manipulates the image to remove distortions by shifting and stretching the image &# 39 ; s scan lines according to selected values of the parameters described below . the parameter values are selected by the user as input to the image correction processor 26 via communication path 271 from the user input and display device 27 . in prior art equipment , as discussed earlier , image data is typically collected in only one direction of the lateral scan . fig2 shows this scan pattern over surface 18 . as can be seen in fig2 the solid lines 31 indicate data collection activity as the tip 16 moves along the x axis , while the dotted lines 32 indicate no data collection activity as the tip 16 moves to the beginning x coordinate position for the next line to be scanned located at the next y coordinate position . i have found that the creep in opposite scan directions tends to distort the image in a complimentary fashion . one aspect of my invention is to collect image data on the surface of interest 18 in both directions of the lateral scan as depicted in fig3 . the solid lines 33 indicate data collection activity as the tip moves along the x axis in one direction . the dotted lines 34 show the tip 16 moving along the y axis to the next line to be scanned . the solid lines 35 indicate data collection as the tip moves along the x axis in the opposite direction of line 33 . a benefit of this aspect of my invention is that it permits faster image acquisition rates because the tip is not required to traverse the surface twice for each scan line acquired . the image correction process performed in processor 26 for this specific embodiment of my invention is depicted in fig4 . fig5 illustrates the effect of each step detailed in fig4 on the scan line image data . to facilitate an understanding of the process described in the following discussion it is best to read the description below while looking at fig4 and 5 placed next to each other . the first step 40 is to choose a subset of the scan line information . using a subset of the image reduces the amount of processing necessary to operate on the image for each set of selected parameter values thereby allowing for interactive parameter value adjustments . from the image 50 the first 30 scan lines , shown as the solid lines 501 , are chosen for processing . the dotted lines 502 are not processed initially and remain in the raw image data storage buffer 23 . image 51 shows the selected subset of scan lines before processing . the image stretching process 41 begins with step 411 which is to select values : for the linear shift parameter , herein known as a ; for the linear stretch parameter , herein known as b ; and for the exponential stretch parameter , herein known as c . step 412 calculates the maximum expected total stretch of the image by applying the formula s = bx + exp ( cx ) to a scan line . this expected total stretch is shown as l in image 53 . step 413 offsets alternate scan lines in opposite directions . image 54 shows solid lines 542 , 544 , 546 , etc . moved to the leftmost margin . step 414 shifts each line of the image 55 toward the center by the selected value for parameter a . for example , line 551 is moved distance a to the right and line 552 is moved distance a to the left . the distortion of the scan lines introduced by this step is complementary to the distortion caused by the creep in the response of the piezoelectric materials as the tip 16 moves along the x - axis . step 415 stretches each scan line according to the expression s = bx + exp ( cx ). each line comprises an array of individual pixels , such as 400 in a single line , with each pixel being the smallest data element measuring the height of the surface 18 being examined by the tip 16 at a given instant in the scan . each pixel is located at a position x along the line . as step 415 stretches each scan line according to the expression s = bx + exp ( cx ), each individual pixel in the line is moved a different amount in the direction of the scan the distance s , where x as noted is the initial position of that particular pixel . as each pixel is moved and the line stretched , gaps between pixels appear . to fill the gaps intermediate pixels are inserted . in my present embodiment these pixels are duplicates of the moved pixel . however , the inserted pixels are determined by mathematical interpolation between pixels on either side of each gap . image 56 shows the effect of the stretch on the lines . for example , line 561 is a stretched version of line 551 . once the image stretching process 41 is complete , step 42 compares adjacent lines by subtracting the value of a pixel in one line from the adjacent pixel in the adjacent line . these differences are quantified and displayed ( step 43 ) to the user on display device 27 , illustratively an apple macintosh , ( fig6 ). step 44 requires a determination of whether parameter values chosen in step 411 as part of the image stretching process 41 best minimize the quantified differences between scan lines . if the determination in step 44 results in a conclusion that different parameter values would result in a lower quantified difference between scan lines , the image stretching process 41 is repeated with new parameter values . fig6 shows an example of a user display in accordance with my invention . this user display shown is a window 60 on an apple macintosh produced using standard apple macintosh system routines . within this window 60 the quantified difference between scan lines is displayed as a sum of residuals 61 and is displayed as image 623 within the gray scale display 62 . the gray scale display 62 contains two other images . image 621 shows the selected 30 scans lines before correction . image 622 shows the effect of the correction process a ( 41 ) applied to the 30 scan lines . the user looking at this display and image 623 decides if the parameter values chosen in step 411 of the image stretching process 41 resulted in adjustments to the scan lines that best minimizes the differences between scan lines . the optimum correction is indicated by a minimum calculated sum of residual value 61 and / or a uniform color in image 623 . the user can input new parameter values into the image stretching process by sliding each of the scroll bars 63 . there is a scroll bar for each of the parameters used to adjust the image . because in this illustrative embodiment of the invention only a subset of the scan lines are at this point being processed , all corrections to the image are fast enough to be interactive . the user can vary the parameter values and see the resultant changes . if the determination in step 44 results in the conclusion that the selected parameter values best minimize the differences between adjacent lines , the image stretching process 41 is applied to the entire image using these parameter values ( step 45 ). image 57 shows the affect of step 45 . the solid lines 571 show the subset of scan lines . dashed lines 572 show the addition of the rest of the scan lines in the image shifted and stretched by process 41 . finally , in step 46 the regions of the image where alternate lines do not overlap are cut . image 58 is the final corrected stm image . clearly , those skilled in the art recognize that the computer 20 shown in fig1 need not be connected or integrated into the stm 10 once an stm image is acquired and stored . the image correction system disclosed herein can operate separate from the stm . those skilled in the art will recognize that the inventive system can include equivalent systems where the processing power of the computer 20 is sufficient to obviate the need to only operate on a subset of the image . equivalent systems would extend to systems where the user is removed from the decision process for determining the best parameter values and replaced with an algorithm that optimizes the parameter values for minimizing the differences between scan lines . equivalent systems would also extend to those systems where the processors identified in computer 20 are software processes operating in one general purpose processor .

US-63375490-A

an improved stern design for many types of small watercraft to eliminate “ tail dragging ”, porpoising , oversteer and “ slide out ”, improve longitudinal tracking , and provide faster planing at lower speeds . this hull extension , consisting of two buoyant sponsons extending astern of the motor output , supports the weight of the entire motor propulsion unit , extends the planing surface , shifts the center of buoyancy rearward , resulting in an ability to maintain an even fore - aft keel in a very lightweight hull . under acceleration and cruising , high pressure under the extensions along with an improved center of gravity keeps the boat from tail dragging . interior chines formed as part of the inner lower surface of the sponsons provide straight tracking under power , even without other hydrodynamic aids , and provide resistance to oversteer or “ slideout ” in turns . the long sponson extensions protect an outdrive system from contact at the stern or sides of the boat .

while referring to the drawings , this invention consists of two sponsons 1 acting as buoyancy and flotation chambers attached in direct and complete contact without gaps at the edges with the transom 2 of any suitable hull 5 . these sponsons have nearly parallel inner lower surfaces running parallel to the fore - aft centerline of the existing hull that form an interior hard chine . this is a hard chine in that it is preferred that these edges have a small radius of curve consistent with the best manufacturing practice with the materials used . there is no need for the edges to form a sharp corner . the interior vertical edges of these parallel surfaces denoted by 8 in the drawings , form a well 11 starting at the inner transom 2 formed by the attachment or integration of the sponsons 1 to the hull 5 . the well should form walls as close to perpendicular to the waterline as is practical . this definition of as practical shall be considered to mean no more than a 15 ° tumblehome vertical angle toward the opposite sponson . the walls of the well may attach the sponsons 1 at the top of the well 11 as in fig2 with an arch most of which should start the curve above the static waterline . this well 11 is open to the stern of the boat . this well 11 is closed toward amidships of the boat , except for any tunnel provided in the original hull design this attachment may be attached to . the lower surfaces and outer surfaces of the sponsons follow the same design of the main hull to form a smooth planing pad running from the main hull &# 39 ; s planing pad 6 to the surface created by the extension sponsons 1 planing pad 4 . the height of the sponsons should be sufficient for the top surface to be completely out of the water in normal operation . since these sponsons form buoyancy chambers to support the motor completely and provide control surfaces provided by the interior chines , calculations are made , as detailed later , so that they may be designed to fit a wide variety of hull sizes and types to support a wide variety of motor types and sizes . after research and experimentation , it was decided that a kayak or canoe style hull offered the lowest potential drag in a small craft . as i had designed a lightweight recreational kayak that would almost plane at 6 mph , i used the forward ⅔rds of this design as the first core hull in which to attach the extension sponsons . as mentioned previously , a common problem of many small powerboats , and canoe or kayak hulls sporting motors ( inboard and outboard ) is the tendency to “ tail drag ” either as a general trim condition or under powered operation . this is particularly true of very lightweight designs . originally , the purpose of the development of my twin tail stern hull extensions was to provide an efficient , stable , very lightweight powerboat that could be easily loaded on the roof of a car by one person . the engine could be stored in the trunk , likewise loaded and unloaded by one person . the immediate result of this development is a 10 foot 3 inch long recreational kayak - like craft weighing less than 40 pounds that can use various 4 stroke outboard engines currently weighing between 29 and 60 pounds . this small craft can be steered simply by the operator leaning , or with a paddle , eliminating the need for complicated steering gear . despite the light weight and a total capacity of over 280 pounds , this craft exhibits a nearly level keel from unloaded rest , through acceleration and while on plane . tracking is straight despite a nearly flat pad , semi - round main hull , and little or no contact of the lower part of the bow with the water when the boat is fully on plane . the boat is also resistant to “ slide out ”. both favorable conditions are the result of the development of longer sponson extensions that incorporate hard interior chines , buoyancy sufficient to support at least the weight of the motor , and are an extension of the general hull design of the main hull . the design can allow tapering of the rear extensions and nearly any realistic and appropriate shape of curved , angled , or straight rear transom ( s ) as long as the buoyancy calculations at least support the weight of the heaviest motor expected to be installed . for practical matters , most designs will work best with a standard nearly vertical transom , generally perpendicular to the stern . as a result of this development , lighter hulls can be designed of higher strength materials . forces pushing the bow up are resisted by the larger buoyant sponsons that also act as extensions of the planing surfaces of the main hull . this keeps the boat &# 39 ; s planing pad area in contact with the water despite the lighter weight . planing speed is achieved at only 6 . 2 mph with a 2 hp outboard motor . top speed with 2 - 2 . 5 hp outboards over a short distance run of under 500 feet is 9 . 9 to 10 . 7 mph , dependant upon water conditions and temperature . extended full throttle runs over 1 mile reach typical speeds of at least 11 . 5 mph with several different 2 - 2 . 5 hp outboards . fuel economy at cruise speeds of 8 to 9 mph average over 40 mpg on a variety of courses . best fuel economy at planing speeds in testing topped 48 mpg . with a yamaha 4 hp outboard , top speeds of 14 mph are quickly and easily reached with a general 75 - 80 % power cruise speed of 12 mph yielding 36 - 40 mpg over a variety of routes , and conditions . planing is achieved very quickly with almost no squat ( bow rise ) at full throttle . the general buoyancy calculation for the purposes of this invention can be carried out by either of two methods . method 1 ) in already designed hulls the buoyancy compensation in the extension sponsons should equal at least the amount of ballast added necessary to bring the bow down to a desirable angle when the design or largest motor package and necessary and desirable equipment is installed , including the load weight calculated for storage bins using method 2 , paragraph 2 ) listed below . this angle would usually be parallel with the water , though in certain circumstances , an angle slightly high or low could be desirable in the static , unloaded position . this is left to the designer to determine . this method is particularly useful when this trim , and longitudinal and lateral tracking system is adapted to an existing hull or hull design . the intention in this case would be to remove the need for ballast needed for trim , and , or , allow lighter stronger materials to construct a lighter hull . method 2 ) in the design for a hull using an outboard engine mounted as intended on a motor mount transom installed just ahead of , or toward amidships of the added extension sponsons ( whether integral , or separately attached ) the buoyancy in the sponsons should roughly equal the design or maximum design weight of the intended motor engine packages at the desired static draft plus any or all of the following : 1 ) any fixed equipment or optional platforms such as 15 mounted with the engine or on the sponsons should be entered into this calculation . a ) any sealed storage bins 12 should include a design weight equal to the amount expected to be placed in specified sealed storage bin , or ½ the maximum listed weight capacity for the specified sealed storage bin , or 10 pounds per cubic feet of sealed storage bin space , whichever is greater . storage bin hatches or covers that are not approved for marine conditions are not recommended . storage bins should be designed not to retain water , or take on water , if possible . b ) storage bins should not be located astern of the centerline of the outboard motor in outboard motor applications , as depicted in fig1 , 18 . c ) storage bins should not be located directly on the extension sponsons on inboard engine designs . fig2 , 25 . d ) storage bins should not be located further back on the stern due to two design considerations as listed : a ) safety - storage bins should not be located far back on the sponsons or in any location that would be hazardous in operation . b ) buoyancy and flotation — storage bins should not be so large , so deep , or located so far back on the sponsons as to interfere with the design load calculations or buoyancy . therefore , storage bins should generally not be located astern of the motor . they also should not extend below the maximum loaded waterline . storage and fixed equipment may be included if sufficient safety equipment as per coast guard requirements and common sense dictates ; and if all added equipment and storage load weights are entered into the buoyancy calculations ; and the added storage and deck is located at , or above the freeboard or lowest watertight deck . all information about storage bin design is intended as advisory to help in more complex applications of the extension sponson and hard interior chines . note that inboard motor installations can use this sponson extension to create an overall lighter hull that planes quicker , but the easiest calculations will probably come from using method 1 with inboard engine and drive systems . the overall length of the extension sponsons should equal at least 18 - 23 % of the overall boat length , including the extensions . in explanation , the sponson for a boat with a total length of 10 feet would constitute a typical sponson length of approximately 20 %. length of the stern sponson extensions is limited only by practical considerations . as an example , there would probably be no point in having the sponsons take up 50 % of the boats length , as this would possibly limit the cargo capacity of most craft , and be completely unnecessary . in general , a larger , longer boat with a wider beam in relation to its length can use a slightly shorter extension in proportion to a shorter boat . while a narrow 10 foot boat requires around a 26 - 28 ″ extension ( 21 . 5 - 22 . 75 %) to support a 60 pound motor , a 20 foot boat could use an extension with a length ( measured along the interior hard chines ) of around 3 feet 6 inches to 4 feet 6 inches ( 18 - 21 . 5 %) to support outboard motors from weighing 300 to over 600 pounds while meeting the design length for the interior chine . inboard motors or smaller motors would require less interior chine length and a lower calculated buoyancy since a large part of the weight and thrust would be forward of the outboard motor mount position . interior chine length should typically be a minimum of about 13 % of the total boat length for significant effect on tracking or oversteer . longer interior hard chine lengths will have more effect upon tracking and oversteer . shorter chine lengths than 13 % will still have an effect . in some designs interior hard chines shorter than 13 % may still have sufficient effect , particularly in existing designs needing lower hydrodynamic reinforcement . for buoyant support of motor and cargo or gear to prevent tail dragging and the control of porpoising , only a simple buoyancy calculation is necessary . in most applications , this will result in extension lengths that will exceed the minimum interior chine calculations . if it does not , the sponson can be narrowed to lengthen the hard interior chine . the calculation for buoyancy should take into consideration the static draft desired at a static rated load for motor and any gear or equipment desired to be placed in , on , or near the sponsons . for protection of an outboard motor in a tilted position the length of the extension sponsons should exceed the horizontal length of the tilted motor far enough to prevent most collision damage . a bar , platform , net , or bridge of any type could be used to slow or restrict penetration into the well between the sponsons , or as a handle to lift a light craft . this deck can be fixed , foldable , or removable . for inboard installations , the sponsons may be joined at the top and could be designed as a deck . the well would then be closed at the top . this closed well would become a short tunnel . the only design restrictions to this tunnel are that the walls should still form the hard interior chines and the tunnel should still be tall enough to totally ventilate the tunnel . any deck formed at the rear may be lower than the highest part of the sponson . this deck and any top part of the sponson should not be lower than lowest waterline expected in normal operation if the best effects of the buoyancy advantages of this design are to be realized . while the extension sponsons 1 can still have full effect on the stern buoyancy of the craft , and the hard interior chines would still provide their design function , water forces , such as are found in , but not limited to , a “ following sea ” could present other control or “ swamping ” issues . an extended structure past the aft of the hull could also present a hidden collision hazard . therefore , while the hull extension sponson design can be underwater at rest , the disadvantages of doing this would probably make this impractical . this invention , therefore , covers the application of the design of sponsons having the hard interior chine function , and buoyancy to fully support the motor , and , or fixed equipment located at , or past the motor or motor outlet , even if any area of the sponson is submerged during any normal operation , as defined earlier in the text . to be most effective , the hard interior chines should not taper longitudinally more than 6 ° toward the respective outer sides of the boat on each side . the strongest tracking performance should be from a nearly parallel set of chines . a very slight taper of 2 - 3 degrees reduces friction while providing strong tracking . even a 6 ° to 10 ° outward taper per side would still provide excellent control of oversteer or “ slide out ”. the hard interior chine can also be formed with a small longitudinal arc such as the examples in fig2 . this can provide a more parallel chine orientation for most of the length of the chine while narrowing the well near the motor mounting area . this strengthens the inner transom 2 by reducing the span . it can be used to prevent a larger class outboard motor from being installed while allowing more room to turn an outboard motor . the example in fig2 is an example of a narrower inner transom suitable for a water jet installation . the interior well is best formed with nearly vertical sides as this also forms the widest sponson planing pad 4 . this also forms the sharpest angles for the hard interior chine . any inner well shape that still provides strong ventilation of the well while providing a hard chine immersed in the water during planing is suitable . a curved well formed by the sponsons 1 is optional and the hull walls of well can be used to provide support for a center deck 15 , such as in fig2 and 25 . a center deck may also be a flat fixed or removable panel such as in fig2 . for conventional hulls , any steering system currently in the art can be used . steering is quicker and sharper than a boat of the same length due to the drive system being located in a mid - rear engine position . outboard motors and inboard / outboard outdrive systems will offer the quickest and sharpest steering with this hull extension . quicker steering with a water jet outdrive can be facilitated by locating the outlet below the well and interior chines . an inboard motor driving a conventional non - steerable drive can be used with the output located in a similar location as the other drive systems . a rudder can be located at the rear of the craft as in fig1 , 12 item 10 or under the boat in any suitable rearward location . on very small boats with a narrow beam , such as modified kayaks and canoes , steering with a paddle is recommended . the boat featured in fig1 - 12 is a practical example of small one person kayak - like craft that is designed to be steered with a kayak paddle . alternately , a rudder , such as in fig1 , 12 item 10 can be used on the transom of one or both of the extension sponsons controlled by any available practical steering system . many systems exist in the art , including , but not limited to , systems controlled by foot control , lever or steering wheels . a steerable jet pump or small outdrive can also be used as a drive and control system . this will provide very quick steering in a very small craft . steering with a tiller at speeds higher than can be produced with an unmodified electric trolling motor are not recommended on canoe and kayak based designs with a sharp turning radius . as an example , since the steering radius can only be a maximum of about 8 feet on a 10 foot kayak , tiller steering should only be used to trim such a short boat . this design can be made from a wide variety of materials and construction techniques including , but not limited to , formed metal or plastic , shaped , riveted , screwed , bolted or welded metal , plastic thermoforming , blow molding , vacuum - forming , composite reinforced molding , injection molding , wood or plywood , fabric skin on frame fabrication , or rotational molding . it can be integrated into an existing hull design or attached separately . the sponsons can be permanently attached or detachable . if the sponsons are installed as separate chambers attached to the hull , they may be installed as permanent attachments or detachable hull members . sponsons may be attached by almost any workmanlike means to the transom , referred to as the inner transom 2 in the specifications of the invention . these means include , but are not limited to , screws , bolts , clamps , latches , dovetail mounts , bonding , welding , glue , pinning , nailing , seaming , hooks , cables , ties or locking . it would be impractical to present all the possible modifications of the embodiment that will be immediately apparent to those skilled in the art . therefore the core embodiment is intended to cover any further modifications , changes or omissions that may be made by one skilled in the art without departing from the scope and spirit of the invention .

US-201113010628-A

an electrically conductive article comprises an insulating material , preferably polyurethane or a similar plastic material , with a plurality of thinly coated electrically conductive fibers dispersed randomly and uniformly therethrough . the fibers are thinly coated with a lubricating cohesive silicone oil or equivalent material which adheres to the fibers and repels the insulating material , thereby preventing encapsulation of the fibers and rendering the coated fibers mutually attractive to define conductive paths through the article even at extremely low fiber loadings .

according to the present invention , articles formed from electrically nonconductive starting materials such as natural or synthetic rubber or polyurethane , polyvinyl chloride , or other synthetic resins are rendered electrically conductive and thus incapable of retaining a static electrical charge . the starting material or a chemical precursor thereof must be one with which an electrically conductive solid additive may be mixed while the starting material or precursor is in liquid form . conveyor belts , timing belts and carpet backing are examples of flexible articles desirably having anti - static properties which may be made according to the invention . while the invention is especially useful when embodied in an article of an electrically insulating material , it is to be understood that the invention is not limited to articles of such materials , but may find utility in enhancement of the conductivity of materials having low or moderate conductivity . it is to be understood that the electrically nonconductive material need not be flexible , but may comprise any of a wide range of moldable material , including those which are rigid after molding . however , the preferred form of the invention is embodied in a flexible article , the resistivity of which is not affected by repeated or continual distortion . by the process of the present invention , a moldable insulating material is rendered electrically conductive by randomly and effectively uniformly dispersing precoated electrically conductive filaments , such as carbon yarn fibers , for example , throughout the material . the filaments are coated with a selected cohesive lubricating material , such as silicone oil , which adheres to the filaments yet repels the insulatihg material . although filaments of any conductive material may be utilized with advantage , filaments of resilient material are preferred . one highly preferred electrically conductive material is fibrous carbon yarn , as described in kauffman et al . u . s . pat . nos . 2 , 796 , 331 and litant 3 , 406 , 126 , which is easily handled and cut or chopped to desired lengths . the conductivity of the product article is dependent upon the conductivity of the filaments incorporated in the article and , within limits , on the fiber loading values . the fibers are preferably between 1 / 20 &# 34 ; and 1 / 8 &# 34 ; in length , and are typically between about 2 and 13 microns in diameter , with 7 to 9 microns being a preferred diameter . it has been found that the utilization of coated filaments of less than about 1 / 8 &# 34 ; in length results in very high conductivities ( low resistivities ) with fiber loading values as low as about 1 / 2 % by weight . fibers longer than about 1 / 8 &# 34 ; are not easily processed under high shear conditions , and are thus not preferred . in addition to carbon yarn , it has been found that graphite fibers , as well as other conductive non - metallic and metallic fibers may be used in this invention . it is to be emphasized that the invention does not depend upon the specific type of fiber used . although litant u . s . pat . no . 3 , 406 , 126 discloses that conductivity may be imparted to an otherwise insulating resin by dispersing carbon yarn fibers therethrough , the resistivities of articles made according to the teachings of litant tend to be undesirably high ( around 1 , 000 ohm - cm or more ) at fiber loadings of less than about 2 %- 3 % by weight unless about 1 - 20 weight percent of a highly polar plasticizer , such as orthonitroanisole , is mixed with the resin - carbon fiber composite . further , litant &# 39 ; s teachings require a minimum fiber length of 1 / 4 &# 34 ;, which has been found to be too long for use in high shear mixing equipment . it has been found that conductive fibers coated with certain materials , identified below , when incorporated in a normally nonconductive material , impart electrical conductivity to the insulator at fiber loadings as low as 1 / 2 %, by weight . the fibers may be as short as 1 / 20 &# 34 ;, and are preferably no longer than 1 / 8 &# 34 ;, both lengths being substantially shorter than the 1 / 4 &# 34 ; minimum length required by litant . the use of efficient , high shear mixing equipment to prepare a fiber - bearing resin for molding is possible with the relatively short fibers of the invention . a sufficient quantity of fibers must be mixed with the insulator to ensure contact between each fiber and adjacent fibers in order that continuous conductive paths are defined throughout the insulator . when fibers are distributed randomly throughout the mass , the resulting article will typically be conductive in multiple directions . a wide variety of fiber coating materials are suitable for use in the invention . the coating material must adhere to the filament material , yet repel the surrounding insulator , and must be cohesive to ensure that the insulator does not encapsulate individual fibers but , rather , that each coated fiber maintains contact with adjacent fibers . preferred fiber coatings are silicone oils , generically referred to as organopolysiloxanes . such compounds are cohesive , have desirable lubricating properties , adhere to fibers of carbon yarn or other carbon - containing materials , and repel polyurethane , polyvinyl chloride and other resins typically used in the invention . nonsubstituted organopolysiloxanes , commonly referred to as release agents , are highly preferred . such release agents include alkyl or aryl siloxane polymers such as methylethyl polysiloxane , dimethyl polysiloxane , diethyl polysiloxane , etc . less preferred , but useful , coating materials include phenyl - substituted polysiloxanes and fluoro - chloro substituted polysiloxanes , which enhance lubrication capabilities of the article , yet maintain sufficient adherent qualities to be useful . any coating material used must adhere well to the filaments . fibers are coated with silicone oil or another coating material by simple mixing , either before or after the fibers are chopped or cut to their desired length . due to the insulating characters of silicone oils , it is necessary that the silicone oil fiber coating be as thin as possible , yet retain its lubricity . for ease of mixing , and to obtain as thin a silicone oil as possible , the silicone oil is first mixed with a suitable solvent , such as methylene chloride , for example , to decrease the viscosity of the silicone oil , which is normally quite viscous at room temperature . after the fibers are coated , excess silicone oil solution is removed , and any remaining solvent is readily removed by the application of moderate heat . while coated fibers may be mixed with insulator material by any suitable method , it is preferred that fibers be mixed with the polymer in its liquid state or in solution , or with an uncured , liquid polymer precursor followed by curing of the precursor , either by heat or the addition of a curing or cross - linking agent , to form a resin . the use of high shear mixing equipment provides high speed , efficient mixing of fibers less than about 1 / 8 &# 34 ; in length with a resin precursor or liquid resin . for example , coated fibers may be mixed with a liquid urethane &# 34 ; pre - polymer &# 34 ; having approximately 1 , 000 monomer units per molecule , followed by addition of a diamine or equivalent cross - linking or curing agent which promotes further polymerization of prepolymer to form polyurethane , as is well known in the art . alternately , fibers may be mixed with a heat curable liquid resin , such as plasticized polyvinyl chloride , followed by curing and molding . the following examples will serve to clearly illustrate the practice of the invention . a quantity of carbon yarn fibers , 1 / 8 &# 34 ; in length and about 8 microns in diameter , were coated with a dimethyl polysiloxane oil and incorported by mixing into a polyurethane precursor liquid in an amount calculated to result in a polyurethane resin having 1 % by weight of coated carbon yarn fibers . the polyurethane precursor was then reacted with a diamine cross - linking agent to form product polyurethane which was then molded to form a 1 / 32 &# 34 ; thick strip . a voltage of 110 v . was placed across the strip , and a substantial temperature rise was observed . a lamp was connected to one end of the strip and it was found that current flowing through the strip energized the lamp . the resistivity of the strip was measured to be about 350 ohm - cm at 25 ° c . ambient temperature . a similar experiment was carried out with carbon yarn fibers which were previously washed with toluene and chloroform , and to which no silicone coating was applied . a 1 / 32 &# 34 ; thick strip of polyurethane was fabricated with 1 % by weight of fibers incorporated therein . the resistivity of the material was measured to be about 50 , 000 ohm - cm at 25 ° c . ambient temperature . the results of this example indicate that , at low fiber loadings , relatively short ( about 1 / 8 &# 34 ;) fibers require a silicone oil , or equivalent , coating to ensure contact between adjacent conductive fibers to define continuous conductive paths throughout the insulator matrix . a polyurethane belt was fabricated according to the disclosure of litant using 1 % by weight of 3 / 4 &# 34 ; length uncoated carbon yarn . the fiber - bearing polyurethane material was difficult to manipulate in the molding process . conductivity was determined to be spotty . after flexing of the belt , conductivity across the belt was increased by about 4 times . after repeated bending ( up to 12 times ) no conductivity was observed . it is the inventor &# 39 ; s theory that adjacent fibers were pulled apart by the surrounding polyurethane , thus destroying the conductive paths within the belt . the beneficial effects imparted by the lubricity and adherence of the fiber coating material to the fibers of the invention are illustrated with reference to fig1 - 4 , which are photomicrographs of a cross - sectional surface of the polyurethane belt of example 1 . fig1 shows the random distribution and substantially linear configuration of fibers incorporated in the polyurethane . in fig2 the belt is subjected to approximately 10 % elongation . it is observed that relative movement has occurred between a typical fiber 10 and the surrounding polyurethane , as evidenced by the elongate cavity 12 . referring to fig3 which shows the belt of fig1 and 2 at approximately 15 % elongation , the increased size of the cavity 12 is apparent . fig4 shows the belt of fig1 - 3 in a relaxed state after being elongated by 25 %. the fibers have returned to their original configuration within the polyurethane . it is believed by the inventor that the lubricating quality of the fiber coating materials prevents surrounding resin from pulling adjacent fibers apart , thereby preventing loss of conductivity during elongation or bending . this is especially important in applications wherein the article must undergo constant flexing , as in conveyor belt or timing belt applications . it was observed that 25 % elongation of the belt did not diminish conductivity , but that 100 % elongation resulted in a total loss of conductivity . however , after relaxation , conductivity was restored . with the application of substantial ( 110 v .) voltage across the belt , it was noted that the belt heated only during relaxation or a partially elongated state , but that it cooled when elongated by 100 %, thus confirming that conductivity is lost at a certain maximum elongation . heavy duty polyurethane material typically having a resistivity of between about 10 7 and 10 9 ohm - cm was prepared as in example 1 with the addition of varying weight percentages of carbon yarn fibers coated with dimethyl polysiloxane oil . the fibers were 1 / 8 &# 34 ; in length and about 8 microns in diameter . ______________________________________ resistivity at 25 ° c . example no . wt . % fibers ( ohm - cm ) ______________________________________4a & gt ; 2 %* -- 4b 2 % 704c 1 % 3504d 1 / 2 % 5004e 1 / 4 % 10 , 000______________________________________ * mixing of the fibers and polymer precursor was impractical . example 4 demonstrates that resistivity of an article made according to the invention is desirably low ( e . g . well below 1 , 000 ohm - cm ) at fiber loadings of as low as 1 / 2 %, without the addition of polar plasticizing materials to the resin - fiber composite . it is believed that the use of fibers shorter than 1 / 8 &# 34 ;, as short as about 1 / 20 &# 34 ;, for example , results in decreased resistivity compared to the values of example 4 , and that resistivity may remain below about 1 , 000 ohm - cm at fiber loadings of substantially less than 1 / 2 % with the use of fibers as short as 1 / 20 &# 34 ;. an additional advantage of the invention is that the surface of an article containing coated fibers becomes lubricated by extension of the fibers to the article surface and by &# 34 ; sweating out &# 34 ; of lubricating material through the resin . the foregoing detailed description is given for clearness of understanding and no unnecessary limitations should be understood therefrom , as modifications will be obvious to those skilled in the art .

US-3873079-A

a method for production of fiber composite components , particularly suitable for the production of profiles of complicated shape with varying profile cross - section and / or with at least parts with curved lines , such as used for the production of aircraft , for example . the method produces plural core components , separates application of a first fiber material to each of the core components , assembles the core components provided with the first fiber material to form a sequence of core components , applies a second fiber material common to the core component sequence along at least one side of the core component sequence , provided with the first fiber material , impregnates and hardens the first and second fiber materials to form a fiber - reinforced component body , and separates the component body into plural sections as represented by the fiber composite components .

fig1 illustrates , from left to right , various stages during the simultaneous production of six fiber - composite structural elements 10 in the form of i - beam sections ( see extreme right in fig1 ). this “ package manufacture ” of profile sections 10 , which will be subsequently usable as crossbeams in the floor of an aircraft fuselage , for example , comprises the following steps : a ) firstly there are provided core parts 12 of the type illustrated at the extreme left in fig1 ( in fig7 there are illustrated seven such core parts , which in the illustrated exemplary embodiment are formed as core - part profile sections , which are elongated in one direction and whose profile cross section varies over the longitudinal extent of the profile ). in the illustrated example the profile cross section is rectangular , with visible indentations 14 , where the cross - sectional area is correspondingly reduced , at two positions along the extent of the profile . as an example , core parts 12 can be produced by milling a commercial hard foamed material or else a metal material . their nature is of secondary importance , since they are used only as shaping aids in the production of the actual structural elements 10 . b ) in the next step , a first fiber material 16 is applied separately on each of core parts 12 . in the illustrated exemplary embodiment , this step comprises circular braiding of core parts 12 with the fiber material . in view of the subsequent use of structural elements 10 , a favorable fiber orientation ( or plurality of fiber orientations ) can be provided in a manner known in itself for this purpose . such core parts 12 are used as “ braided cores ”. c ) core parts 12 lined with first fiber material 16 are then joined to one another to form a core - part row 18 . in the illustrated exemplary embodiment , each two immediately neighboring core parts 12 enveloped with fiber material 16 ( completely , except for the end faces ) are in contact along a plane boundary face , so that the individual lined core parts 12 bear against one another with their entire surface as viewed in stacking direction . d ) a second fiber material 20 is then applied along at least one side of core - part row 18 . in the illustrated exemplary embodiment , this fiber material 20 is applied both on the bottom side and top side of illustrated core - part row 18 . e ) the structure created in this way and comprising shaping core parts 12 lined up against one another and also fiber materials 16 , 20 is then infiltrated with a suitable matrix material ( such as epoxy resin ) and thermally cured . in a preferred embodiment , the curable matrix material is added by using a vacuum infusion process , for example by means of a standard infusion process such as vap , vari , etc . for this purpose it is possible to use , for example , an infiltration system with membrane structure , wherein appropriate inlets and outlets for a resin matrix are provided in a covering film and / or in a mold . such a vacuum system may also be used if necessary for compaction of core - part row 18 lined with fiber material . when the lined core - part row is covered with an airtight film and then the space under the film is more or less evacuated , the system is subjected to the atmospheric ambient pressure . alternatively or in addition to evacuation of the space bounded by the film , an elevated ambient pressure may be applied , for example by introducing lined core - part row 18 together with film in an autoclave . complete curing or even only partial curing may be provided in this step . f ) finally , the structural - element block created in the previous step by infiltration and curing is subdivided into a plurality of portions , which ( after final post - machining if necessary ) represent fiber - composite structural elements 10 . in general , depending on the geometry of core parts 12 and the thickness of the binding of fiber material at the surface of core parts 12 , it will not be possible to remove these core parts before the structural - element block is subdivided . in one embodiment , it is therefore provided that both fiber material 16 , 20 and also core parts 12 will be severed by parting cuts ( core parts 12 not reusable ). in another embodiment , it is provided that parting cuts will be made in such a way that only fiber material 16 , 20 is severed thereby and that core parts 12 released as a result are reusable . by means of the described production method , six fiber - reinforced i - beams 10 are produced simultaneously by using seven core parts 12 , in the manner illustrated in fig1 . in this case , the structural - element block is subdivided by seven parting cuts ( vertical in fig1 ), each passing through the region of one of core parts 12 , wherein each parting cut causes fiber material 16 , 20 adjoining core part 12 in question to be split and thus associated with several of the resulting fiber - composite structural elements 10 . in a deviation from the illustrated exemplary embodiment , individual beams 10 could be endowed in simple manner with an approximate c - shaped profile , by positioning the planes of the vertical parting cuts somewhat offset relative to the illustrated exemplary embodiment ( by approximately half the width of a core part 12 ). starting from the structural - element block illustrated in fig1 , it would also be possible to produce ( twice as many ) t - beams or l - beams , for example , by the subdivision step , for example by providing a horizontal parting cut in addition to the vertical parting cuts . as an example , the i - beams or c - beams originally obtained by separating the structural - element block are each split one more time horizontally . in the exemplary embodiment according to fig1 , core parts 12 are each elongated and have identical shape , and the longitudinal extent of their profile is rectilinear ( and orthogonal to the subsequent stacking direction ). however , the profile cross section varies over the longitudinal extent of the profile ( see indentations 14 ). profiled core parts 12 are arranged with identical orientation in core - part stack 18 . in the description hereinafter of further exemplary embodiments , like reference numerals are used for components having like effect , but in each case they are supplemented by a lower - case letter to distinguish the embodiment . thus substantially only the differences relative to the already described exemplary embodiment or embodiments will be pointed out and otherwise the description of the preceding exemplary embodiments will be expressly applicable by reference . fig2 and 3 illustrate an exemplary embodiment of a method for simultaneous production of a plurality of fiber - composite structural elements , which are again formed as i - beam sections as in the example described hereinabove with reference to fig1 . in a deviation from the foregoing example , however , the longitudinal extent of the produced profiled structural elements has curved shape . in a diagram similar to fig1 , fig2 shows , at the extreme left , a core part 12 a , which is again provided several times in identical form for the method described hereinafter . further to the right in fig2 there are again illustrated further intermediate production stages , namely a core part 12 a lined ( for example , wrapped ) with a first fiber material 16 a , a core - part row 18 a formed by joining core parts 12 a lined with the first fiber material 16 a to one another , core - part row 18 a lined additionally on its bottom side and top side with a second fiber material 20 a , and a fiber - composite structural element 10 a obtained after infiltration , curing and subdivision of the structural - element block . fig3 once more illustrates , in an enlarged detail diagram , the arrangement of fiber materials 16 a , 20 a along the longitudinal sides of core - part row 18 a . as an example , it is shown that fiber - material layers 20 a on the two opposite flat sides ( top side and bottom side ) of core - part row 18 a may also have different material thicknesses . such different layer thicknesses of second fiber material 20 a as well as the ratio of these layer thicknesses to the layer thickness of first fiber material 16 a can be advantageously adapted to the mechanical stresses expected on finished structural element 10 a . in this respect it is also favorable under some circumstances to provide — viewed in the section plane of fig3 and / or viewed in longitudinal direction of the core - part row — a non - uniform thicknesses and / or a non - uniform material for at least one of fiber materials 16 a , 20 a , thus deviating from the illustrated exemplary embodiment . the parting cuts made at the end of the production process in order to separate structural elements 10 a ( into a plurality of i - beam sections ) are indicated by broken lines in fig3 . fig4 is a detail diagram for illustration of the manner in which local thick zones can be created on the finished fiber - composite structural element in a production method of the type explained in the foregoing . at the top of fig4 there is illustrated a portion of a core part 12 c used in the production method and having a stepped recess 22 c in a curved portion . otherwise core part 12 c has , for example , a rectangular cross - sectional contour . in this exemplary embodiment it is provided that , during laying of a first fiber material on each of core parts 12 c , recess 22 c is first filled completely with “ additional first fiber material ” before core part 12 c is also lined ( for example wrapped and / or circularly braided ) with first fiber material in the regions adjacent to recess 22 c . thus a local thick zone , which is “ inwardly directed ”, so to speak , is produced in the region of recess 22 c of the finished structural element ( not illustrated ). alternatively or additionally , it would obviously also be possible to provide “ outwardly ” directed thick zones , by forming corresponding thick zones during application of the first fiber material . the fiber material to be introduced into the illustrated recess 22 c could be composed , for example , of two cut - to - size pieces of a fiber mat laid successively ( into the two illustrated recess regions ). the provision of recess 22 c in a curved portion of core part 12 c in order to form a reinforcement on the finished structural element is usually advantageous from the practical viewpoint , because structural elements of the type of interest here are usually subjected to greater stresses in the curved portions . the special feature illustrated in fig4 , namely the formation of one or more local recesses for integration of additional fiber material , can be provided without difficulty for each of the exemplary embodiments described in the foregoing in connection with fig1 or fig2 and 3 ( or for a combination thereof ). a special advantage of the thick zone created by a recess of the core part being used is that the first fiber material additionally applied locally on the core part does not interfere with formation of a core - part row of core parts abutting one another with their entire surface even if the recess is oriented “ in stacking direction ”, or in other words is facing a neighboring core part in the core - part row . on the other hand , in the case of creation of local thick zones by “ fiber material protruding outwardly on the core part ”, it is usually advisable to produce additional fiber material on a side of the core part that is not directly facing a neighboring core part in the core - part row . in core - part rows 18 or 18 a illustrated in fig1 and 2 , these are the top sides and bottom sides of the core - part row in question . as regards the preferred use of the fiber - composite structural elements as a structural member in aircraft construction , local thick zones may be particularly expedient , especially in portions of a profiled structural element that are curved or have reduced contour area . as already explained , the described production method is suitable in particular for “ package manufacture ” of a plurality of identical fiber - composite structural elements , which resemble profiled sections on the whole but in which the profile cross section varies over the longitudinal extent of the profile and / or the longitudinal extent of the profile is curved in one or more regions . fig5 shows longitudinal sections through several fiber - composite structural elements 10 d , 10 e , 10 f and 10 g that can be produced with the described method . obviously the illustrated longitudinal - section shapes are to be understood merely as examples and are intended to illustrate the great flexibility of the method as regards the geometry of the fiber - composite structural elements that can be produced . many working steps in the described method can be advantageously performed in at least partly automated manner . this will be illustrated hereinafter with reference to fig6 and 7 , taking the step of separate laying of the first fiber material on each of the plurality of core parts as an example . fig6 schematically shows an apparatus 40 h , by means of which part of the first fiber material to be laid on a core part 12 h in step b ) is applied in automated manner . each core part 12 h is first provided on portions of two opposite longitudinal sides with cut - to - size pieces 42 h of a semifinished textile product ( such as cut - to - size pieces glued on in the manner of labels ). core part 12 h already provided in portions with the first fiber material ( cut - to - size piece 42 h ) is then conveyed in the direction of arrow 44 h lengthwise through apparatus 40 h . in the process , the opposite top and bottom sides of core part 12 h shown in fig6 are each provided with a continuous strip 46 h of fiber material ( such as semifinished textile product ), which is unwound from respective supply rolls . finally , an enveloping fiber - material layer 48 h is formed by apparatus 40 h , also in automated manner , by circular braiding in the illustrated exemplary embodiment . several of these core parts 12 h lined with first fiber material 42 h , 46 h and 48 h are then joined to one another to form a core - part row , and are lined with a second fiber material common to all core parts , as already described in the foregoing examples according to fig1 or fig2 and 3 . moreover , the second fiber material can also be laid ( not illustrated ) in automated manner . the factors important for the mechanical characteristics of the fiber - composite structural elements produced by using apparatus 40 h include the layer thickness and fiber orientation of the individual fiber materials , in this case fiber materials 42 h , 46 h and 48 h . in an improvement of the enveloping method illustrated in fig6 , there is provided an apparatus having a plurality of circular braiding stations disposed in succession in the direction of travel of the core part . such an improvement will be described hereinafter with reference to fig7 . at the top of fig7 there is schematically illustrated an apparatus 40 i , which comprises a core - feed unit 50 i , a plurality ( four in this case ) of coating stations ( such as circular braiding units , and possibly also including devices for integration of additional fiber materials ) 52 i and one cutting unit 54 i for severing the fiber material . a stock of core parts 12 i to be conveyed successively through apparatus 40 i is denoted by 56 i . after coating of core parts 12 i by means of apparatus 40 i , a stock 58 i of core parts lined with fiber material is obtained . in this example , the circular braiding stations apply circular braiding having different fiber orientations ( such as + 45 °, − 45 °, − 45 °, + 45 °) around core parts 12 i . at the bottom of fig7 there is illustrated a slightly modified apparatus 40 j , in which the individual processing stations 50 j , 52 j and 54 j are disposed along a curved path 44 j . this processing path is chosen such that it is adapted to the curved shape of core parts 12 j to be coated .

US-37582807-A

a process and system for removing contaminants from air comprises flowing a compressed air stream comprising water and carbon dioxide to a first adsorbent zone for contacting with a first adsorbent effective in the adsorption of water by flowing the air in a direction within the first adsorbent zone parallel with the axis of the first adsorbent zone to form a dry gas ; flowing the dry gas from the first vessel to a second adsorbent zone comprising a second adsorbent disposed in a radial arrangement about the same axis to remove carbon dioxide . regeneration of the adsorbent beds may be carried out independently .

referring now to fig1 and the preferred embodiment , wet feed air from a compressor ( not shown ) at a pressure between about 50 and about 250 psia is flowed in stream 10 to inlet connection 4 on the vessel 2 containing a first adsorbent bed . preferably vessel 2 is cylindrical and of constant diameter about a center axis , or may alternatively be of decreasing diameter , or cervical in shape , along the gas flow path as depicted in fig2 . within the vessel 2 , there is placed adsorbent material effective to selectively adsorb the most easily sorbed contaminant . in the preferred embodiment , the most easily sorbed contaminant in feed air is water and the adsorbent material is preferably alumina based spheres . preferably , a supportive alumina adsorbent section 5 comprises alumina spheres sized about 10 to 12 millimeters in diameter . above the first supportive alumina section in the first adsorbent bed within vessel 2 , a second section along the gas flow path preferably comprises useful alumina beads 7 having diameter in the range of about 5 to 6 millimeters . following the useful alumina adsorbent section 7 , there is preferably placed another supportive alumina adsorbent section 9 comprised of alumina spheres between about 10 and 12 millimeters in diameter . preferably , the useful alumina section 7 is at least about 10 inches above the nearest entrance point of wet air and the upper supportive alumina section 9 is at least about 6 inches in length . in accordance with the process of the present invention , dry gas exits the upper portion of vessel 2 through partitions 17 and flows to interspacing 21 wherein the flow direction shifts . dry gas flows from interspacing 21 into radial adsorbent bed 31 comprising in the preferred embodiment molecular sieve material having diameters in the range of about 1 to 3 millimeters . in the preferred embodiment , the radial bed adsorbent retains carbon dioxide sorbed from the dry gas . one particularly preferred adsorbent for the retention of carbon dioxide is 13 × molecular sieve having an average particle size in the range of about 2 to 3 millimeters . dry gas in interspacing 21 flows through partitions 31 and radial bed 29 and through the second adsorbent bed in a radial fashion from the interior to the exterior and through partitions 32 to gas recovery space 37 . in the preferred embodiment , both the first adsorbent bed and the radial adsorbent bed are contained in a containment vessel 25 , wherein the walls of containment vessel 25 serve to define the interspacing 21 between the adsorbent beds and also the gas recovery space 37 , and which assembly further has gas recovery outlet 40 fluidly connected to gas recovery space 37 . the preferred geometry of the adsorber system allows for construction using commonly rolled steel , welded heads and connections . accordingly , construction costs may be minimized . the process for the production of dry air from a contaminated wet air stream , and for the regeneration of the mixed bed adsorber of the present invention is best described with reference to fig3 wherein a plurality of mixed bed adsorbers are operated in an overall adsorber system . ambient feed air 10 enters compressor 72 and is normally discharged at a temperature in the range between about 200 ° f . and 220 ° f . cooling water is used in cooler 74 to reduce the temperature of the feed stream and free water removed in separator 75 wherefrom cooled , wet gas is flowed to adsorbers 50 and 60 via streams 52 and 62 . mixed bed adsorbers 50 and 60 are assembled and operate in accordance with the above description with reference to fig1 . during gas production operation , purified dry gas is flowed from adsorbers 50 and 60 via stream 53 and 63 , respectively , and as purified air product a process requiring clean and dry gas via stream 41 . the regeneration of the adsorbent beds is carried out in the preferred embodiment according to the following procedure . first , it is necessary to depressurize the first horizontal adsorbent bed by opening valves 51 or 61 , depending on the adsorber to be regenerated . in the case adsorber 50 is to be regenerated , valve 51 is opened and the first adsorbent bed in the mixed bed adsorber 50 , preferably comprising alumina in horizontal placement , is depressurized , thereby ensuring moisture will not purge to the molecular sieve in the radial bed . next , the horizontal first adsorbent bed in adsorber 50 is heated through use of regeneration gas supplied via stream 12 . in the preferred embodiment of an air separation process , the regeneration gas may be nitrogen from the air separation process . in accordance with the present invention , the regeneration gas is heated in heat exchanger 70 utilizing hot discharge gases from compressor 72 . the hot discharge gases are diverted to heat exchanger 70 utilizing means well known to process engineers . it is preferred a control valve 77 operates to allow flow of hot gases via line 71 into heat exchanger 70 , returning via stream 73 whereby the loop 71 , 70 , 73 has a lower overall pressure drop than cooling heat exchanger 74 . heated regeneration gas flows to the adsorbers from heat exchanger 70 via line 13 . again , in the case where adsorber 50 is to be regenerated , valve 57 is selectively operated to allow flow of hot regeneration gas into the first adsorbent bed within mixed bed adsorber 50 . with valve 51 and 55 remaining open , the regeneration gas flows through the first adsorbent bed and exits through valve 51 and 55 . in the preferred method of regeneration , the radial adsorbent bed is also heated at the time the horizontal bed is subjected to heated regeneration gas . this is preferably accomplished by opening exit valve 56 , which is fluidly connected to the gas outlet 40 depicted in fig1 . when sufficient time has elapsed for the sieve material in the radial adsorbent bed to be regenerated , valve 56 is closed , while hot regeneration gas continues to flow through the horizontal alumina adsorbent bed . in this manner , energy is not unnecessarily used to heat molecular sieve adsorbent in the radial bed beyond that necessary to regenerate the adsorbent . in accordance with the present invention , it is possible to selectively contact only the alumina adsorbent in the horizontal adsorbent bed with regeneration gas to continue the regeneration of the alumina material for the longer time required relative to the molecular sieve adsorbent . at the time the alumina adsorbent is regenerated , and therefore , the regeneration of completed adsorbent , the heating of the regeneration gas in heat exchanger 70 is discontinued by throttling or closing valve 77 to eliminate the heat source . with valve 77 closed , only unheated regeneration gas continues to contact one or both of the horizontal or radial adsorbent beds . when the gas exiting the adsorber 50 is the same or within a predetermined temperature of the unheated regeneration gas entering adsorber 50 , valves 57 , 56 and 51 and 55 are closed . thereafter , valve 58 may be opened to equalize the pressure in regenerated adsorber 50 and the alternate adsorber 60 . valves 52 and 53 are then opened to place regenerated adsorber 50 into production service . it may be preferable for heat exchanger 70 to remain in heating operation of regeneration gas during the whole cycle except the cooling step of the cycle . in this way , the refrigeration duty in optional refrigeration unit 78 is lessened . following regeneration of the first adsorber 50 , and its return to service as described above , it remains available for the operator to next regenerate alternate adsorber 60 in the same manner as described above with reference to the first adsorber . one skilled in the art will recognize various valving and piping adaptations depicted in fig3 as necessary modifications to carry out the regeneration procedure described above on the alternate adsorber 60 . since each bed is independent of each other with regard to its own constraints ; including velocity , regeneration heat , with the process and system of the present invention , regeneration may be optimized throughout the cycle . in air separation application , it is possible to use the entire waste flow from an air separation plant to regenerate the beds because gas velocity and associated fluidization of adsorbent is not present during regeneration of the adsorber systems of the present invention . this translates to a shorter regeneration time , and therefore , increased operation time , and more compact adsorber designs . with the preferred use of heat of compression to heat regeneration gas , regeneration heat is available at all times and no electric or steam heaters are required . this is a significant savings in energy costs and increases reliability . compared with horizontal beds , the air velocity in the adsorbers of the present invention may be increased dramatically since fluidization in the bed is suppressed by larger alumina spheres . accordingly , the physical size of the adsorber may be reduced , with all the associated savings .

US-42202495-A

a printed circuit board system includes a printed circuit board device having a multiple access signal line . a plurality of semiconductor apparatuses are arranged on the printed circuit board device . each semiconductor apparatus includes a signal connection point to be connected to the multiple access signal line ; and a signal transmission device for controlling presence of an output signal at the signal connection point .

fig1 shows a sectional view of a printed circuit board system 10 based on a preferred embodiment of the present invention . the inventive printed circuit board system or the inventive board structure 10 comprises a printed circuit board device 12 , which can preferably be a printed circuit board , circuit card , board or plug - in card . the printed circuit board device 12 comprises a multiplicity of layers ( not shown ) with signal lines 14 arranged so as to be insulated from one another ; there are preferably 12 to 20 layers provided . in the preferred embodiment , the printed circuit board system 10 also comprises two semiconductor apparatuses 16 , which preferably each comprise a semiconductor chip , preferably a semiconductor memory chip , holding an integrated circuit . however , it is likewise conceivable for more than two semiconductor apparatuses 16 to be provided in the inventive printed circuit board system 14 . since the semiconductor apparatuses 16 shown in fig1 are essentially identical , only one semiconductor apparatus 16 is described below with reference to fig1 and 2 . fig2 shows a view from below of a semiconductor apparatus 16 based on a preferred embodiment of the present invention . the semiconductor apparatus 16 comprises a multiplicity of signal connection points or pins 18 for connecting the semiconductor apparatus 16 to the printed circuit board device 12 . preferably , the signal connection points 18 are arranged on the underside of the semiconductor apparatus 16 , and the semiconductor apparatus 16 is in the form of a bga ( ball grid array ). furthermore , the semiconductor apparatus 16 can be in the form of a chip size package ( csp ), where the size of the semiconductor apparatus 16 corresponds approximately to the size of the semiconductor chip it contains . the signal connection points 18 are described in detail below with reference to fig2 . in this context , identical hatchings are intended to indicate identical or similar types of signals . the inventive semiconductor apparatus 16 comprises dq connections 20 for inputting and outputting data , and output clock connection points 22 which are used to output the output clock signal or data strobe signal or dqs signal or the semiconductor chip &# 39 ; s transmitted synchronization signal to the printed circuit board device 12 in order to synchronize the data which have been read . furthermore , voltage supply connection points vddq 24 are provided on the semiconductor apparatus 16 in order to supply the data connection points with an appropriate voltage . ground connection points vssq 26 corresponding thereto are likewise provided on the semiconductor apparatus 16 . vddq 24 and vssq 26 are also referred to as data supply connection points 24 , 26 . the semiconductor apparatus 16 also has supply connection points vss 28 and vdd 30 . the semiconductor apparatus 16 also has addressing connection points 32 for inputting address information , and command connection points , e . g . clock ck , chip select / cs , 34 for inputting commands or instructions . as fig2 shows , the signal connection points of the semiconductor apparatus 16 are preferably used essentially mirror - image symmetrically with respect to the longitudinal central axis sa 1 of the semiconductor apparatus 16 . such an arrangement is advantageous , in particular , when the two semiconductor apparatuses 16 are arranged in a “ clamp shell arrangement ” on the printed circuit board device 12 , as described below . it is thus possible to arrange for the signal connection points 18 which jointly use a multiple access signal line 14 to be situated opposite one another . in one preferred embodiment , the signal connection points of the semiconductor apparatus 16 can likewise be used mirror - image symmetrically with respect to the transverse central axis sa 2 of the semiconductor apparatus 16 . the printed circuit board device 12 comprises at least one multiple access signal line 14 , which is a signal line which is connected to a respective signal connection point of the at least two semiconductor apparatuses 16 for signalling purposes . that is to say that the multiple access signal line 14 is connected to the two semiconductor apparatuses 16 from fig1 for signalling purposes . the multiple access signal line 14 is preferably designed such that the propagation - time delays of the signals from the two semiconductor apparatuses 16 which are sent via the multiple access signal line 14 are as short as possible , preferably less than 100 ps , usually preferably less than 50 ps . the higher the operating frequency of the printed circuit board system 10 , the smaller should be the propagation - time difference for the signals from the two semiconductor apparatuses 16 which are sent via the multiple access signal line 14 . by way of example , at an operating frequency of 200 mhz a propagation - time difference of approximately 100 ps can still be permissible , whereas at an operating frequency of 300 - 400 mhz the propagation - time difference should not exceed 50 ps . this can preferably be achieved by providing the multiple access signal line 14 in a central layer of the printed circuit board device 12 . in addition , it is advantageous when line sections 38 provided for the signal connection between the two semiconductor apparatuses 16 have the same or similar electrical and / or propagation - time properties , and preferably the same length . in the embodiment shown in fig1 , two line sections are provided which are at right angles to the centrally running multiple access signal line 14 . the line sections 38 are preferably in the form of a through - connection through the entire thickness of the printed circuit board device 12 , “ vias ”. however , it is likewise conceivable for the line sections 38 to be provided obliquely or at an angle , so long as they have the same electrical and / or propagation - time properties . in addition , it would likewise be possible to provide more than two line sections if a multiple access signal line 14 needed to be connected to more than two semiconductor apparatuses 16 . the multiple access signal line 14 is preferably connected to a respective output clock connection point 20 on the two semiconductor apparatuses 16 for signalling purposes . in the preferred embodiment in the present case , the mirror - image symmetrical semiconductor apparatuses 16 described above are used . these are arranged with mirror - image symmetry on opposite sides of the printed circuit board device 12 , preferably in a “ clamp shell arrangement ”. however , it is likewise conceivable for the semiconductor apparatuses 16 to be provided on the printed circuit board device 12 such that , although they are not arranged with mirror - image symmetry with respect to one another , the signal connection points 18 needing to be connected to the respective multiple access signal line 14 are opposite one another or are arranged at corresponding positions on the printed circuit board device 12 . in order to prevent both semiconductor apparatuses 16 from sending signals to the multiple access signal line 14 simultaneously , each semiconductor apparatus 16 contains a tristate logic circuit 40 . the tristate logic circuit 40 is respectively positioned upstream of the output clock connection point 20 . the way in which the tristate logic circuit 40 works in the semiconductor apparatus 16 based on the present invention is explained below with reference to fig3 and 4 . fig3 shows a schematic view of and a table of values for a tristate logic circuit 40 , and fig4 shows signal profiles for the signals which are relevant to the tristate logic circuit . the output clock signal dqs to be transmitted to the multiple access signal line 14 is applied to one input of the tristate logic circuit 40 . a semiconductor apparatus selection signal or chip select signal / cs is applied to the other input of the tristate logic circuit 40 . the semiconductor apparatus selection signal / cs is transmitted via a semiconductor apparatus selection connection point 34 to either one or the other semiconductor apparatus 16 , but never to both simultaneously . the semiconductor apparatus selection signal / cs is preferably a low - active signal , i . e . this signal triggers an action at the low level , for example “ 0 ” or “− 1 ”. when a semiconductor apparatus 16 is selected using the semiconductor apparatus selection signal / cs , / cs is thus set to “ 0 ”, and the output clock signal dqs is thus produced at the output out of the tristate logic circuit 40 . that is to say that , in this state , the appropriate selected semiconductor apparatus 16 can transmit the output clock signal dqs to the multiple access signal line 14 . when the semiconductor apparatus selection signal is set to the second state again , i . e . to “ 1 ” in the present case , the output out adopts a high - impedance state “ h ”. this means that no signals can be transferred from this semiconductor apparatus 16 to the multiple access signal line 14 . during the time in which the semiconductor apparatus selection signal / cs is being sent to the first semiconductor apparatus 16 , the semiconductor apparatus selection signal / cs for the second semiconductor apparatus 16 is held in a state which is the logic inverse of the semiconductor apparatus selection signal , i . e . at “ 1 ”. this holds the output of the second semiconductor apparatus 16 in the high - impedance state “ h ”, and no signals can be transmitted from the second semiconductor apparatus 16 to the multiple access signal line 14 . it is thus possible to prevent the second semiconductor apparatus 16 from sending signals to the multiple access signal line 14 simultaneously with the first semiconductor apparatus 16 . when the first semiconductor apparatus 16 has finished sending to the multiple access signal line 14 , the semiconductor apparatus selection signal / cs is set to “ 1 ”, and the output out consequently adopts a high - impedance state “ h ”. a semiconductor apparatus selection signal / cs can now be sent to the second semiconductor apparatus 16 , and the latter can then transmit its output clock signal dqs to the multiple access signal line 14 by switching the appropriate tristate logic circuit 40 in a suitable manner . by providing the tristate logic circuit 40 in the respective semiconductor apparatuses 16 , it is thus possible to prevent both semiconductor apparatuses 16 from sending signals to the multiple access signal line 14 simultaneously . it is also possible to prevent the semiconductor apparatuses 16 from conflicting , i . e . to prevent , by way of example , an output signal from one semiconductor apparatus 16 from being present at a corresponding connection point of the other semiconductor apparatus , and hence to prevent parallel - path currents and / or unwanted effects from being able to occur .

US-21982802-A

a method of flow baffle installation is disclosed herein . the method , in various aspects includes the steps of orienting a side support at a specified elevation about a sidewall of a sump using a leveling support , bolting the side support to the sidewall of the sump following the step of orienting a side support at a specified elevation about a sidewall of a sump using a leveling support , orienting an opposing side support at the specified elevation about the sidewall of the sump using a corresponding leveling support , bolting the opposing side support to the sidewall of the sump following the step of orienting an opposing side support at the specified elevation about the sidewall of the sump using a corresponding leveling support , adjusting an adjustable cross - member to span between the side support and the opposing side support . this abstract is presented to meet requirements of 37 c . f . r . § 1 . 72 only . this abstract is not intended to identify key elements of the apparatus and methods disclosed herein or to delineate the scope thereof .

methods of flow baffle apparatus installation along with associated flow baffle apparatus and kits are disclosed herein . the flow baffle apparatus may be positioned within a sump in order to train the flow within the sump , and the flow baffle apparatus may be formed for that purpose . the flow baffle apparatus may be secured to the walls of the sump in ways that may account for irregularities in the walls . the sump may be accessed through a manhole , and the methods of flow baffle apparatus installation , along with the associated flow baffle apparatus and kits , are designed to be implemented through manhole access , in various aspects . fig1 a illustrates an implementation of flow baffle apparatus 10 . as illustrated in fig1 a , flow baffle apparatus 10 is positioned in sump 405 to train the flow therein . pipe 432 leads into sump 410 and pipe 434 leads from sump 410 so that flow may pass through pipe 432 into sump 410 , pass about baffle apparatus 10 , which is positioned within sump 410 , and exit sump 410 through pipe 434 . as illustrated , pipe 432 and pipe 434 are positioned generally opposite one another at angle α = 180 ° in the horizontal plane . in other implementations , pipe 432 and pipe 434 may be positioned at other angles α in the horizontal plane with respect to one another , may have various sizes , may be set at various elevations with respect to sump bottom 415 including other benchmarks , or there may be additional pipes flowing into or out from sump 410 . flow baffle apparatus 10 includes baffles 50 , 60 mounted to adjustable cross - members 91 , 93 ( see fig2 ). adjustable cross - members 91 , 93 are attached to side supports 30 , 40 ( see fig2 ), and side supports 30 , 40 are bolted to sidewall 410 of sump 405 generally opposite one another such that baffles 50 , 55 are oriented generally perpendicular to the flow into sump 405 from pipe 432 . other implementations of the flow baffle apparatus may include more or fewer baffles , such as baffles 50 , 55 , or may include more or fewer adjustable cross - members , such as adjustable cross - members 91 , 93 . the flow baffle apparatus , such as flow baffle apparatus 10 , may have other orientations with respect to the inflow pipe ( s ), such as pipe 433 , and with respect to outflow pipe ( s ), such as pipe 434 , in other implementations . sidewall 410 of sump 405 is generally circular in this implementation , but other implementations may have multiple sidewalls or the sidewall ( s ) may have various shapes such as elliptical , polygonal , or so forth . as illustrated in fig1 a , adjustable cross - member 93 includes cross - member 82 , cross - member connector 86 , and cross - member 84 ( see fig2 , 3 a ) with cross - members 82 , 84 slideably received upon cross - member connector 86 . adjustable cross - member 91 includes cross - member 72 , cross - member connector 76 , and cross - member 74 with cross - members 72 , 74 slideably received upon cross - member connector 76 , as illustrated in fig2 , 3 b . fig1 b illustrates flow baffle apparatus 10 positioned in sump 405 by cut - away elevation view . as illustrated , sump 405 may be accessed through manhole 420 , which is covered by manhole cover 422 . the portions of flow baffle apparatus 10 may be passed into sump 405 through manhole 420 for installation within sump 405 . in various implementations , the portions of the flow baffle apparatus 10 are designed to pass through the manhole 420 , where the manhole 420 may have an inside diameter of 24 inches . in some implementations , the inside diameter of the manhole 420 may be 21 inches or less and the portions of the flow baffle apparatus 10 may be designed to pass therethrough . the sump 405 in which the flow baffle apparatus 10 is installed may range from about 4 ft . in diameter to about 8 ft . in diameter or other characteristic dimension , in various implementations . portions of the flow baffle apparatus 10 may be disassembled when passed through the manhole 420 and then assembled in the sump 405 as part of the installation process . these disassembled components may be sized to pass through the manhole 420 . the components of the flow baffle apparatus 10 may be designed to fit the sump 405 when assembled . in the view illustrated in fig1 b , baffle 50 is mounted to cross - member 82 of adjustable cross - member 93 and to cross - member 72 of adjustable cross - member 91 . cross - members 72 , 82 are attached to side support 30 ( see fig1 a , 2 , 4 , 5 a ). leveling support 22 joins side support 30 in this implementation . leveling support 22 may be utilized to position side support 30 relative to sump bottom 415 prior to bolting of side support 30 onto sidewall 410 of sump 405 . bolting , bolt , and bolted , as used herein , encompasses securing or securement using concrete anchors , anchor bolts , or other such methods or mechanisms of attachment to concrete , masonry , and suchlike . bolting , bolt , and bolted , as used herein , encompasses bolted attachment to steel plate that may form portions of side 410 of sump 405 , welded attachment to such steel plate , cemented anchors , and other such methods or mechanisms of attachment and combinations of methods or mechanisms of attachment . bolting , bolt , and bolted , as used herein , excludes interference fit . side supports 30 , 40 may include bolt holes or other features that facilitate bolting of the side supports 30 , 40 to sidewall 410 of sump 405 . fig2 illustrates portions of flow baffle apparatus 10 includes baffles 50 , 60 , adjustable cross - members 91 , 93 , cross - members 72 , 74 , 82 , 84 , cross - member connectors 76 , 86 , side supports 30 , 40 , and leveling supports 22 , 24 . the various components of flow baffle apparatus 10 including baffles 50 , 60 , adjustable cross - members 91 , 93 , cross - members 72 , 74 , 82 , 84 , cross - member connectors 76 , 86 , side supports 30 , 40 , and leveling supports 22 , 24 may be formed , for example , of metals such as steel , cast iron , stainless steel , brass , copper , and aluminum , plastics such as polyvinyl chloride ( pvc ), wood , combinations thereof , and so forth , as would be readily recognized by those of ordinary skill in the art upon study of the present disclosure . component ( s ) may be , for example , galvanized , coated with various plastics that inhibit corrosion , inhibit the growth of algae or other aquatic organisms on the component ( s ), coated with various materials that inhibit abrasion , and so forth , as would be readily recognized by those of ordinary skill in the art upon study of the present disclosure . the shapes of the various members such as round , rectangular , and so forth are exemplary and not limiting . alternative shapes may be used in various other implementations . as illustrated in fig2 , leveling supports 22 , 24 are attached to side supports 30 , 40 , respectively . leveling supports 22 , 24 , respectively , may be slideably engaged with side supports 30 , 40 so that side supports 30 , 40 may be positioned at a desired position with respect to leveling supports 22 , 24 , and locking mechanisms , such as bolt 151 ( see fig6 ), may be provided to secure side supports 30 , 40 to leveling supports 22 , 24 at the desired position . ends 21 , 23 of leveling supports 22 , 24 , respectively may be rested upon the sump bottom 415 of sump 405 while side supports 30 , 40 are positioned about sidewall 410 . side supports 30 , 40 may be bolted to sidewall 410 of sump 405 . leveling supports 22 , 24 may be used to support side supports 30 , 40 respectively , in position prior to or while bolting side supports 30 , 40 to sidewall 410 . side supports 30 , 40 may be secured to sidewall 410 such that ends 34 , 44 are generally horizontally aligned with one another ( i . e . at the same elevation with respect to a benchmark ) using the leveling supports 22 , 24 , respectively . side support 30 may be positioned upon sidewall 410 such that end 32 and end 34 of side support 30 are generally vertically aligned with one another so that side support 30 runs vertically upon sidewall 410 , in some implementations or may be set at an angle with respect to the vertical in other implementations . side support 40 may be positioned upon sidewall 410 such that end 42 and end 44 of side support 40 are generally vertically aligned with one another so that side support 40 runs vertically upon sidewall 410 . as illustrated in fig2 , adjustable cross - member 93 includes cross - member 82 , cross - member connector 86 , and cross - member 84 with cross - members 82 , 84 slideably received upon cross - member connector 86 . cross - members 82 , 84 are secured to one another by cross - member connector 86 that extends at least between ends 104 , 112 of cross - members 82 , 84 . cross - members 82 , 84 may be slideably mounted upon cross - member connector 86 so that the length 443 of adjustable cross - member 93 , which includes cross - members 82 , 84 and cross - member connector 86 , may be adjusted by sliding cross - members 82 , 84 upon cross - member connector 86 until length 443 of adjustable cross - member 93 is set to span between side support 30 and side support 40 at the points of attachment of adjustable cross - member 93 . locks 83 , 85 are positioned generally proximate ends 104 , 112 of cross - members 82 , 84 respectively , as illustrated . locks 83 , 85 may secure cross - members 82 , 84 upon cross - member connector 86 with the adjustable cross - member 93 positioned at length 443 to hold the adjustable cross - member 93 at length 443 . locks 83 , 85 may be eye bolts , set screws , bolts , winged bolts and so forth that frictionally engage the cross - members 82 , 84 to cross - member connector 86 at the desired length 443 . various numbers of locks , such as locks 83 , 85 , may be provided in various implementations and the locks may be variously positioned along cross - members 82 , 84 . ends 102 , 114 of cross - members 82 , 84 are secured to ends 34 , 44 of side supports 30 , 40 , respectively , and adjustable cross - member 93 spans portions of sump 405 between end 34 of side support 30 and end 44 of side support 40 , as illustrated . ends 102 , 114 of cross - members 82 , 84 may be secured to end caps 177 , 179 ( see fig4 ) that are slidably received over ends 34 , 44 of side supports 30 , 40 , respectively . ends 102 , 114 of cross - members 82 , 84 may be secured to end caps 177 , 179 , respectively using bolts , pinned connectors , welds , and so forth , in various implementation . in various other implementations ( not shown ), ends 102 , 114 of cross - members 82 , 84 may be secured directly to ends 34 , 44 of side supports 30 , 40 , respectively using bolts , pinned connectors , welds , and so forth , in various implementation . with locks 83 , 85 engaged to secure cross - members 82 , 84 upon cross - member connector 86 , the adjustable cross - member 93 forms a rigid support spanning between side supports 30 , 40 to support baffles 50 , 60 thereupon . side supports 30 , 40 may be secured to sidewall 410 such that ends 34 , 44 are generally horizontally aligned with one another so that the adjustable cross - member 93 extends generally horizontally between side support 30 and side support 40 . adjustable cross - member 91 , as illustrated in fig2 , includes cross - member 72 , cross - member connector 76 , and cross - member 74 with cross - members 72 , 74 slideably received upon cross - member connector 76 . cross - members 72 , 74 are secured to one another by cross - member connector 76 that extends at least between ends 124 , 132 of cross - members 72 , 74 . cross - members 72 , 74 may be slideably mounted upon cross - member connector 76 so that the length 441 of adjustable cross - member 91 , which includes cross - members 72 , 74 and cross - member connector 76 , may be adjusted by sliding cross - members 72 , 74 upon cross - member connector 76 until length 441 of adjustable cross - member 91 is set to span between side support 30 and side support 40 at the points of attachment of adjustable cross - member 91 to side supports 30 , 40 . locks 73 , 75 are positioned generally proximate ends 124 , 132 of cross - members 72 , 74 respectively . locks 73 , 75 may secure cross - members 72 , 74 upon cross - member connector 76 with the adjustable cross - member 91 positioned at length 441 to hold the adjustable cross - member 91 at length 441 . locks 73 , 75 may be eye bolts , set screws , bolts , winged bolts and so forth that frictionally engage the cross - members 72 , 74 to cross - member connector 76 at the desired length 441 . various numbers of locks , such as locks 73 , 75 , may be provided in various implementations and the locks may be located at various positions along cross - members 72 , 74 . ends 122 , 134 of cross - members 72 , 74 are secured to ends 32 , 42 of side supports 30 , 40 , respectively , and adjustable cross - member 91 extends between end 32 of side support 30 and end 42 of side support 40 to span portions of the sump 405 between side support 30 and side support 40 , as illustrated . ends 122 , 134 of cross - members 72 , 74 may be secured to ends 32 , 42 of side supports 30 , 40 , respectively , by being received in detents such as detents 35 , 45 ( see fig5 a , 5 b ) or by bolts , pinned connectors , welds , combinations thereof , and so forth , in various implementation . with locks 73 , 75 engaged to secure cross - members 72 , 74 upon cross - member connector 76 , the adjustable cross - member 91 forms a rigid support between side supports 30 , 40 to support baffles 50 , 60 thereupon . side supports 30 , 40 may be secured to sidewall 410 such that ends 32 , 42 are generally horizontally aligned with one another so that the adjustable cross - member 91 extends generally horizontally between side support 30 and side support 40 . length 441 may differ from length 443 due to imperfections of construction , and length 441 may differ from length 443 in different sumps constructed to the same general standard . the length 441 of the adjustable cross - member 91 or the length 443 of adjustable cross - member 93 may be adjusted to span between side support 30 and side support 40 at the points of attachment of adjustable cross - members 91 , 93 in order to accommodate such variations . as illustrated in fig2 , baffle 50 is formed as a perforated flat sheet of material and is oriented such that surface 56 of baffle 50 is oriented generally upstream and surface 58 of baffle 50 is oriented generally downstream . surfaces 56 , 58 of baffle 50 are generally planar . baffle 50 is secured to cross - member 82 generally along side 55 and baffle 50 is secured to cross - member 72 generally along side 53 , as illustrated in fig2 . baffle 50 , in this implementation , includes channel 141 along side 55 and an opposing channel 143 along side 53 ( see fig7 a ). channel 141 is engaged with cross - member 82 thereby securing side 55 of baffle 50 to cross - member 82 , and the opposing channel 143 is secured to cross - member 72 thereby securing side 53 of baffle 50 to cross - member 72 . side 52 of baffle 50 may be secured to side support 30 by screws , bolts , welds , etc . surface 58 of baffle 50 is upstream of side support 30 and surface 58 may be generally biased against side support 30 by the force of the water striking surface 56 of baffle 50 , as illustrated . as cross - member 82 , which forms a portion of adjustable cross - member 93 , may be set generally horizontal , side 55 of baffle 50 , which is engaged with cross - member 82 may be generally horizontal . water may flow over side 55 of baffle 50 as a weir . as cross - member 72 may be set generally horizontal , side 53 of baffle 50 , which is engaged with cross - member 72 , may also be generally horizontal . water may flow between side 53 of baffle 50 and sump bottom 415 and the baffle 60 and cross - member 72 may be positioned to provide a gap between side 63 and sump bottom 410 for the passage of flow therethrough . holes 94 that pass through baffle 50 between surface 56 and surface 58 are disposed about baffle 50 , and water may flow through holes 94 of baffle 50 . the holes 94 may be generally similar in size , as illustrated , or may vary in size in other implementations . holes , such as holes 94 , may be placed about the baffle ( s ), such as baffles 50 , 60 , such that the baffle ( s ) may have a percent of open area ranging from about 40 % to about 50 %, and the diameter of holes 94 may range from about 2 inches to about 6 inches . as illustrated in fig2 , baffle 60 is oriented such that surface 66 of baffle 60 faces upstream and surface 68 of baffle 60 faces downstream . baffle 60 is secured to cross - member 84 generally along side 65 and baffle 60 is secured to cross - member 74 of adjustable cross - member 91 generally along side 63 , as illustrated in fig2 . baffle 60 , in this implementation , includes a channel 161 along side 65 and an opposing channel 163 along side 63 ( see fig7 b ). channel 161 is engaged with cross - member 84 of adjustable cross - member 93 thereby securing side 65 of baffle 60 to cross - member 84 , and the opposing channel 163 is secured to cross - member 74 thereby securing side 63 of baffle 60 to cross - member 74 . portions of baffle 60 generally along side 62 may be secured to side support 40 by screws , bolts , welds , etc . surface 68 of baffle 60 is upstream of side support 40 and may be generally biased against side support 40 by the force of the water striking surface 66 of baffle 60 , as illustrated . as cross - member 84 , which forms a portion of adjustable cross - member 93 , may be set generally horizontal , side 65 of baffle 60 , which is engaged with adjustable cross - member 84 may be generally horizontal . water may flow over side 65 of baffle 60 as a weir . as adjustable cross - member 74 may be set generally horizontal , side 63 of baffle 60 , which is engaged with adjustable cross - member 74 , may be generally horizontal . water may flow between side 63 of baffle 60 and sump bottom 415 and the baffle 60 may be positioned to provide a gap between side 63 and sump bottom 415 for the passage of flow therethrough . holes 94 that pass through baffle 60 between surface 66 and surface 68 are disposed about baffle 60 , and water may flow through holes 94 of baffle 60 . side 54 of baffle 50 faces side 64 of screen 60 , as illustrated in fig2 . side 54 of screen 50 may be generally aligned with side 64 of screen 60 and sides 54 and 64 may be generally vertical , in implementations in which length 441 is substantially equal to length 443 . in implementations in which length 441 differs from length 443 , side 54 of screen 50 may be overlapped with side 64 of screen 60 to compensate for differences between length 441 and length 443 . notches 153 , 155 are provided along side 54 of baffle 50 , and notches 163 , 165 are provided along side 64 of baffle 60 , as illustrated in fig2 , to allow screen 50 to overlap with screen 60 , to allow for adjustment of the length 441 of adjustable cross - member 91 , or to allow for adjustment of the length 443 of adjustable cross - member 93 . connectors 171 , 173 may be disposed proximate sides 54 , 64 , as illustrated in fig2 , to secure sides 54 , 64 to one another . in implementations wherein side supports 30 , 40 are oriented vertically , baffles 50 , 60 are oriented such that perpendiculars to surfaces 56 , 58 of baffle 50 and perpendiculars to surfaces 66 , 68 of baffle 60 point in the horizontal direction . in implementations wherein side supports 30 , 40 are oriented at an angle to the vertical , baffles 50 , 60 are oriented such that perpendiculars to surfaces 56 , 58 of baffle 50 and perpendiculars to surfaces 66 , 68 of baffle 60 point in a direction perpendicular to the angle to the vertical of side supports 30 , 40 . fig3 a illustrates an implementation of adjustable cross - member 93 that includes cross - member 82 and cross - member 84 slideably receives cross - member connector 86 . as illustrated , cross - member 82 receives portions of cross - member connector 86 internally so that cross - member 82 slides over cross - member connector 86 to adjust the length 443 of adjustable cross - member 93 . cross - member 82 and cross - member connector 86 may be locked into position with respect to one another using lock 83 to hold adjustable cross - member 93 at the desired length . lock 83 is formed as a eye bolt threadedly engaged with cross - member 82 that may be turned until frictionally engaged with cross - member connector 86 to lock the cross - member connector 86 and cross - member 82 to one another , in this implementation . lock 83 may be a bolt , screw , or other mechanism suitable to releasably engage cross - member 82 and cross - member connector 86 to one another in various implementations . cross - member 84 is slideably received on cross - member connector 86 , as illustrated in fig3 a . cross - member 84 receives portions of cross - member connector 86 internally , so that cross - member 84 slides over cross - member connector 86 , in this implementation , to adjust the length 443 of adjustable cross - member 93 . cross - member 84 and cross - member connector 86 may be locked into position with respect to one another using lock 85 to hold adjustable cross - member 93 at the desired length . lock 85 is formed as an eye bolt threadedly engaged with cross - member 84 that may be turned until frictionally engaged with cross - member connector 86 to lock the cross - member connector 86 and cross - member 84 to one another , in this implementation . lock 85 may be a bolt , screw , or other mechanism suitable to releasably engage cross - member 84 and cross - member connector 86 to one another in various implementations . fig3 b illustrates cross - member 72 and cross - member 74 slideably received on cross - member connector 76 to form adjustable cross - member 91 . as illustrated , portions of cross - member connector 76 are received internally by cross - member 72 , so that cross - member 72 slides over cross - member connector 76 to adjust the length 441 of adjustable cross - member 91 . cross - member 72 and cross - member connector 76 may be locked into position with respect to one another using lock 73 to hold adjustable cross - member 91 at the desired length . lock 73 is formed as an eye bolt threadedly engaged with cross - member 72 that may be turned until frictionally engaged with cross - member connector 76 to lock the cross - member connector 76 and cross - member 72 to one another , in this implementation . lock 73 may be a bolt , screw , or other mechanism suitable to releasably engage cross - member 72 and cross - member connector 76 to one another in various implementations . cross - member 74 is slideably received on cross - member connector 76 , as illustrated in fig3 b . portions of cross - member connector 76 are received internally by cross - member 74 , so that cross - member 74 slides over cross - member connector 76 to adjust the length 441 of adjustable cross - member 91 , in this implementation . cross - member 74 and cross - member connector 76 may be locked into position with respect to one another to hold adjustable cross - member 91 at the desired length using lock 75 . lock 75 is formed as an eye bolt threadedly engaged with cross - member 74 that may be turned until frictionally engaged with cross - member connector 76 to lock the cross - member connector 76 and cross - member 74 to one another , in this implementation . lock 75 may be a bolt , screw , or other mechanism suitable to releasably engage cross - member 74 and cross - member connector 76 to one another in various implementations . fig4 illustrates the engagement of adjustable cross - member 93 with side supports 30 , 40 . as illustrated in fig4 , end 121 of cross - member 82 of adjustable cross - member 93 includes hole 125 that may be aligned with holes 103 of flange 108 of end cap 177 . end cap 177 is adapted to be slidably received over portions of side support 30 generally proximate end 34 , and end cap 177 may be held in place upon end 34 by a combination of friction and gravity . bolt 107 may be passed through holes 103 , 125 to secure end 121 of cross - member 82 to end cap 177 . nut 109 may be threadedly affixed to bolt 107 to hold bolt 107 in place within holes 103 , 125 . as illustrated in fig4 , end 123 of cross - member 84 of adjustable cross - member 93 includes hole 131 that may be aligned with holes 133 of flange 113 of end cap 179 . end cap 179 is adapted to be slidably received over portions of side support 40 generally proximate end 44 end cap 179 may be held in place upon end 44 by a combination of friction and gravity . bolt 127 may be passed through holes 131 , 133 to secure end 123 of cross - member 84 to end cap 179 . nut 129 may be threadedly affixed to bolt 127 to hold bolt 127 in place within holes 131 , 133 . various pins , screws , welds , and other fasteners may be substituted for bolts 107 , 127 and nuts 109 , 129 in other implementations . use of end caps 177 , 179 to secure adjustable cross - member 93 to side supports 30 , 40 allows for the assembly of adjustable cross - member 93 in attachment to end caps 177 , 179 . the assembly of adjustable cross - member 93 with end caps 177 , 179 attached thereto may be manipulated by attaching a cable to lock 83 , 85 which are configured as eye bolts in this implementation . for example , end caps 177 , 179 could be attached to adjustable cross - member 93 above ground and the assembly of adjustable cross - member 93 with end caps 177 , 179 attached thereto may be lowered into the sump and onto ends 34 , 44 using a cable attached to locks 83 , 85 . as an additional example , the assembly of adjustable cross - member 93 with end caps 177 , 179 attached thereto may be pulled off of ends 34 , 44 and removed from the sump by a cable attached to locks 83 , 85 . in other implementations , adjustable cross - member 93 may be secured to side supports 30 , 40 , for example , by bolts , screws , various other fasteners , welds , combinations thereof , and so forth , in other implementations . although fig4 illustrates adjustable cross - member 93 secured to side supports 30 , 40 generally at ends 34 , 44 , adjustable cross - member 93 may be secured to side supports 30 , 40 at other locations generally between ends 32 , 34 and between ends 42 , 44 , respectively , in various other implementations . fig5 a illustrates the engagement of adjustable cross - member 91 with side supports 30 , 40 . as illustrated in fig5 a , detents 35 , 45 are located proximate ends 32 , 42 of sides supports 30 , 40 , respectively . end 122 of cross - member 72 of adjustable cross - member 91 is received within receptacle 137 of detent 35 , and end 134 of cross - member 74 is received within receptacle 139 of detent 45 . with at least some of cross - members 72 , 74 and cross - member connector 76 slideably engaged with one another , ends 122 , 134 may be placed in receptacles 137 , 139 and then cross - members 72 , 74 and cross - member connector 76 locked into fixed engagement with one another to hold ends 122 , 134 within receptacles 137 , 139 . adjustable cross - member 91 may be manipulated by attaching a cable to locks 73 , 75 that are configured as eye bolts in this implementation . as illustrated in fig5 a , detents 35 , 45 are positioned proximate ends 32 , 42 of side supports 30 , 40 . detents 35 , 45 may be positioned at other locations along side supports 30 , 40 in other implementations , and detents 35 , 45 may or may not be symmetrically positioned along side supports 30 , 40 with respect to one another . adjustable cross - member 91 may be secured to side supports 30 , 40 , in other ways , for example , by bolts , screws , various other fasteners , welds , combinations thereof , and so forth , in other implementations . a detail of detent 35 with end 122 of cross - member 72 received therein is illustrated in fig5 b . as illustrated , detent 35 is secured to side support 30 generally proximate end 32 . detent 35 may be welded to side support 30 , bolted to side support 30 , or secured to side support 30 in various other ways . detent 35 includes receptacle 137 , which is formed as rectangular cavity within detent 35 . end 122 of cross - member 72 is rectangular in shape to conform to the rectangular cavity form of receptacle 137 in order to be received within receptacle 137 , as illustrated . the rectangular shape of cross - member 72 and receptacle 137 may prevent rotation of cross - member 72 when cross - member 72 is received within receptacle 137 . in this implementation , detent 45 with end 134 of cross - member 74 received therein is similar to detent 35 with end 122 of cross - member 72 received therein as illustrated in fig5 b . fig6 illustrates portions of side support 30 proximate end 22 engaged with leveling support 22 . as illustrated in fig6 , leveling support 22 is slideably received within side support 30 . bolt 151 is threadedly engaged with side support 30 such that , when tightened , bolt 151 frictionally engages leveling support 22 to hold the side support 30 fixedly to leveling support 22 . thus , the leveling support 22 and side support 30 may be slideably positioned with respect to one another and then locked into position by tightening bolt 151 . side support 40 may slideably receive leveling support 24 and side support 40 may be fixed to leveling support 24 in a manner similar to that of leveling support 22 and side support 30 illustrated in fig6 . in implementations such as that illustrated in fig6 , ends 21 , 23 of side supports 22 , 24 , respectively , may be placed upon sump bottom 415 of sump 405 and sides supports 30 , 40 may be slid upon leveling supports 22 , 24 , respectively , until ends 34 , 44 , of side supports 30 , 40 are positioned at the desired elevation , respectively , about side 410 . with side supports 30 , 40 so positioned , the side supports may then be attached to the wall 410 of the sump 405 . fig7 a illustrates portions of baffle 50 including channel 141 and channel 143 . as illustrated , channel 141 is formed along side 55 of baffle 50 and channel 143 is formed along side 53 , which is opposite side 55 , of baffle 50 . as illustrated , channel 143 is formed generally along surface 56 of baffle 50 and channel 141 is formed generally along surface 58 of baffle 50 so that channel 141 and channel 143 extend forth perpendicularly in opposite directions from opposing surfaces of baffle 50 . channel 141 and channel 143 may be generally rectangular in shape . channel 141 may be engaged with cross - member 82 of adjustable cross - member 93 and channel 143 may be engaged with cross - member 72 of adjustable cross - member 91 to secure the baffle 50 to adjustable cross - members 93 , 91 , respectively . cross - member 82 may be generally rectangular in shape in correspondence to the shape of channel 141 in order to be received within channel 141 . cross - member 72 may be generally rectangular in shape in correspondence to the shape of channel 143 in order to be received within channel 143 . fig7 b illustrates portions of baffle 60 including channel 161 and channel 163 . as illustrated , channel 161 is formed along side 65 of baffle 60 and channel 163 is formed along side 63 , which is opposite side 65 , of baffle 60 . as illustrated , channel 163 is formed generally along surface 66 of baffle 60 and channel 161 is formed generally along surface 68 of baffle 60 so that channel 161 and channel 163 extend forth perpendicularly in opposite directions from opposing surfaces of baffle 60 . channel 161 and channel 163 may be generally rectangular in shape . channel 161 may be engaged with cross - member 84 of adjustable cross - member 93 and channel 163 may be engaged with cross - member 74 of adjustable cross - member 91 to secure the baffle 60 to adjustable cross - members 93 , 91 , respectively . cross - member 84 may be generally rectangular in shape in correspondence to the shape of channel 161 in order to be received within channel 161 . cross - member 74 may be generally rectangular in shape in correspondence to the shape of channel 163 in order to be received within channel 163 . in assembly , the components , including , for example , baffles , such as baffles 50 , 60 , adjustable cross - members , such as adjustable cross - members 91 , 93 , side supports , such as side supports 30 , 40 , and leveling supports , such as leveling supports 22 , 24 , may be ported into a sump , such as sump 405 , through a manhole , such as manhole 420 . the components may be in various states of disassembly to accommodate passage through the manhole , which includes other access passages , into the sump . for example , adjustable cross - members may be separated into subcomponents . for example , adjustable cross - members 91 , 93 may be disassembled into subcomponents that include cross - members 72 , 74 , 82 , 84 and cross - member connectors 76 , 86 , and the subcomponents may be passed through the manhole . the components , the subcomponents , or combinations thereof , may be sized to pass through the manhole into the sump and may be sized for assembly in the sump and may be sized for installation within a sump having a particular diameter or other characteristic dimension . lightweight materials may be selected to form the components or the subcomponents , for example , in order to facilitate passage through the manhole into the sump . side supports may be slideably received upon the leveling supports with one side support received upon a corresponding leveling support . for example , side support 30 may be received upon corresponding leveling support 22 and side support 40 may be received upon corresponding leveling support 24 . the ends , such as ends 21 , 23 , of the leveling supports may be placed upon the sump bottom , such as sump bottom 415 , and the corresponding side supports then positioned about the sidewall , such as sidewall 410 . with ends of the leveling supports resting upon the sump bottom , the side supports may be slideably positioned upon the leveling supports until the side supports are positioned at the desired elevation . the side supports may be positioned in a generally vertical orientation . with the side supports positioned upon the leveling supports such that ends , such as ends 34 , 44 , are positioned at a desired elevation ( s ) with respect to a benchmark , the side supports may be locked to the corresponding leveling supports such that the leveling supports , which rest upon the sump bottom , support the corresponding side supports in the desired position . the side supports may be locked to the leveling support using a locking mechanism , such as bolt 151 . with the side supports supported in position by the leveling supports , the side supports may be bolted to the sidewall of the sump . the ends of the side supports may be generally in horizontal alignment with one another . for example , end 34 of side support 30 may be placed at essentially the same elevation as end 44 of side support 40 so that end 34 and end 44 are in horizontal alignment with one another . similarly , for example , ends 32 42 may be placed at essentially the same elevation so that ends 32 , 42 are in horizontal alignment with one another . adjustable cross - members , such as adjustable cross - members 91 , 93 , may be assembled from cross - members and cross - member connectors . for example , adjustable cross - member 91 may be assembled from cross - members 72 , 74 and cross - member connector 76 by receiving cross - members 72 , 74 upon cross - member connector 76 . as a further example , adjustable cross - member 93 may be assembled from cross - members 82 , 84 and cross - member connector 86 by receiving cross - members 82 , 84 upon cross - member connector 86 . the adjustable cross - members may be assembled above ground , within the sump , or both . an end of the adjustable cross - member , such as end 121 , 122 , may be secured to the side support . an opposing end of the adjustable cross - member , such as ends 123 , 134 , may be secured to the opposing side support . the ends of the adjustable cross member may be secured to end caps such as end caps 177 , 179 and the end caps may be placed over ends of the side supports to secure the adjustable cross member to the side supports . the adjustable cross - member may be secured directly to the side supports by , for example , a pinned connection , by being received within a detent , weld , or bolt or other fastener , or combinations thereof . the adjustable cross - member may be locked into the desired length , such as length 441 , 443 , prior to attachment to the side supports , locked at the desired length following attachment to the side supports , or locked at the desired length while being attached to the side supports , in various implementations . the adjustable cross - member may be locked at the desired length by locks , such as locks 73 , 75 , 83 , 85 , provided about the adjustable cross - member for that purpose . lengths of the adjustable cross - members , such as lengths 441 , 443 , are adjustable to vary in order to compensate for variations in the distance between the side supports that may result , for example , from imperfections of construction of the sump . the baffle ( s ), such as baffles 50 , 60 , may be secured to the adjustable cross - members . the baffle ( s ) may be secured to the adjustable cross - members by channels , such as channels 141 , 143 , 161 , 163 , that fit over portions of the adjustable cross - members such that portions of the adjustable cross - members are received within the channels to secure the baffle ( s ) to the adjustable cross - members . additional or alternative mechanisms of attachment apart from the channels may be provided to secure the baffle ( s ) to the adjustable cross - members in various implementations . the baffle ( s ) may be secured to the adjustable cross - members at any convenient point in the assembly . the baffle ( s ) may be secured to the side support ( s ) by bolt , weld , various fasteners , and so forth . in implementations involving multiple baffles , the baffles may be secured to one another in various ways . various implementations may employ one baffle , two baffles as generally illustrated herein , or three or more baffles . fig8 illustrates by process flow diagram an exemplary process of assembly 400 . as illustrated in fig8 , process 400 is entered at step 401 . at step 405 , a side support , which is slideably received on a leveling support , is slid upon leveling support into position at the desired elevation within the sump . at step 410 , the side support is locked to the leveling support . at step 415 , the side support is bolted to the sidewall of the sump . the side support may be supported by the leveling support to which the side support is locked generally during step 415 . the leveling support may rest upon the sump bottom of the sump to hold the side support in position while the side support is bolted to the sidewall of the sump . at step 420 , an opposing side support , which is slideably received on a corresponding leveling support , is slid upon the corresponding leveling support into position at the desired elevation within the sump . the opposing side support is locked to the corresponding leveling support at step 425 . the opposing side support is bolted to the sidewall of the sump at step 430 . the opposing side support may be support by the corresponding leveling support to which the opposing side support is locked generally during step 430 . the corresponding leveling support may rest upon the sump bottom of the sump to hold the opposing side support in position while the opposing side support is bolted to the sidewall of the sump . the leveling supports may be removed from the side support and from the opposing side support after the side support and the opposing side support have been bolted to the sidewall . an adjustable cross - member is adjusted to span between the side support and the opposing side support , at step 435 . the adjustable cross - member is then secured to the side support and secured to the opposing side support at step 440 . the adjustable cross - member may be locked into the length require to span between the side support and the opposing side support during either step 435 or step 440 , in various implementations . at step 450 , an opposing adjustable cross - member is adjusted to span between the side support and the opposing side support . the opposing adjustable cross - member is then secured to the side support and secured to the opposing side support at step 455 . the adjustable cross - member may be locked into the length require to span between the side support and the opposing side support during either step 450 or step 455 , in various implementations . at step 460 , a baffle is secured to the adjustable cross - member and secured to the opposing adjustable cross - member . the length of the adjustable cross - member and the opposing adjustable cross - member may vary from one another to account for variations in the distance between the side supports at the points where the adjustable cross - member and the opposing adjustable cross - member are connected to the side supports . the foregoing discussion along with the figures discloses and describes various exemplary implementations . these implementations are not meant to limit the scope of coverage , but , instead , to assist in understanding the context of the language used in this specification and in the claims . upon study of this disclosure and the exemplary implementations herein , one of ordinary skill in the art may readily recognize that various changes , modifications and variations can be made thereto without departing from the spirit and scope of the inventions as defined in the following claims .

US-201414154383-A

trees , such as fruit bearing trees in drought - stricken areas , are individually watered to conserve the water supply while saving the valuable trees . a radially slotted tub - like irrigator engages around the tree trunk and delivers water in a controlled manner to both the tap roots and the peripheral root network of the tree . no water is wasted and the time span for irrigation can be adjusted . the device is characterized by simplicity and economy of manufacturing and ease of installation .

referring to the drawings in detail wherein like numerals designate like parts , a tree watering device embodying the invention comprises a tub or reservoir 10 of annular form whose size and capacity may vary according to the type and size of tree requiring irrigation . the tub 10 is preferably unitary in construction as when molded from fiberglass reinforced material and includes a flat bottom wall 11 , an upwardly conically flaring side wall 12 and a top marginal reinforcing and lifting flange 13 . the tub has preferably four equidistantly spaced short legs 14 depending from its bottom wall to position the bottom wall 2 or more inches above ground level . a center upstanding cylindrical wall 15 or sleeve rises from the bottom wall 11 of the tub and is open - ended , as shown . the upper end of the sleeve 15 projects somewhat above the open top of the tub 10 . the tub has a radial slot 16 formed through the side wall 12 and through the center sleeve 15 and this slot has spaced parallel vertical side walls 17 extending between and joining the tub side wall 12 and the side wall of sleeve 15 where the slot is formed . as shown in fig1 and 3 , the slot side walls 17 extend to the upper end of the center sleeve 15 . as the parts are integrally formed , the fluid integrity of the tub 10 is maintained . the radial slot 16 extends entirely through the tree watering device from top - to - bottom thereof . the device additionally comprises a preferably slightly dished or concave lid 18 of somewhat larger diameter than the tub 10 so that the lid , when placed on the upper flange 13 , will project radially outwardly of the flange 13 , such as 1 inch , more - or - less . the lid 18 is circular and has a radial slot 19 for registration with the slot 16 . the parallel edges of the lid slot 19 , fig1 and 4 , lie immediately outside of the walls 17 and therefore these walls serve to locate and stabilize the lid circumferentially when it is applied to the tub 10 . the lid has a central circular opening 20 formed therethrough and adapted to engage snugly around the upstanding sleeve 15 of the tub . preferably , the tub sleeve 15 has two or more small support lugs 21 for the central portion of the lid projecting radially from the sleeve 15 somewhat below the top of the sleeve , as shown in fig2 . the concave lid 18 may be provided near its center with a plurality of small apertures 22 for conducting rain water which may collect on the concave lid into the tub 10 . in lieu of the apertures 22 , a small space for this purpose can be provided between the sleeve 15 and the edge of the lid opening 20 . the lid has a single water filler cap 23 hinged at 24 to the body of the lid and biased to a closed position by a spring 25 associated with the hinge . to prevent displacement of the lid 18 by wind forces and resulting loss of water from the tub , a plurality such as seven lid hold - down springs 26 are provided around the periphery of the device . suitable spring retaining apertures are formed in the lid and in the tub flange 13 , as depicted in fig2 . the springs 26 are arranged for easy separation from the flange 13 . to supply water in a controlled manner to the tap roots of a tree , a vertical axis adjustable trickle valve 27 is mounted in an opening of the tub bottom wall 11 between the sleeve 15 and tub side wall 12 . this trickle valve has a threaded stem 28 carrying a tapered flow metering pin 29 which is adjustable vertically in relation to a bottom outlet port 30 of an outer threaded valve body 31 secured within a bottom wall opening 32 of the tub . the adjusting or turning knob 33 of the trickle valve has a strainer element 34 therein to keep debris out of the adjustable trickle valve . by adjusting the valve 27 , water flow from the tub 10 to the tap roots can be controlled and the time period for irrigation can be widely regulated to satisfy the needs of a particular situation . for delivering water to peripheral tree roots well outwardly of the tree trunk , additional trickle valves 35 , preferably numbering four , are mounted in openings 36 of the tub side wall 12 about one - half inch above the bottom wall 11 in circumferentially equidistantly spaced relation . the trickle valves 35 are of a one - piece type having a conical tubular body 37 which may be cut off at various points or lengths , such as at 38 in fig5 to provide the desired degree of water flow . once so cut , the valves 35 cannot have their flows reduced any further . each valve 35 also has a strainer element 39 . preferably , the side wall trickle valves 35 have extension tubes 40 of any required length removably telescoped thereover , so that water can be delivered at a desirable rate of flow to exactly the points in the outer root network of the tree where it will do the most good . in this connection , the system does not waste any water on parts of the tree which do not require irrigation , such as on the bark of the tree trunk or the center of the rows . instead , the water is delivered in a controlled manner to the most productive areas and every drop of water in the tub is efficiently used with an extreme reduction in the amount of water necessary to irrigate trees compared to conventional practice . in some cases , the side wall trickle valves 35 may be used in lieu of the threaded valve 27 on the bottom wall 11 of the tub and likewise the valve 27 could be used at the side wall location of each valve 35 . preferably , the tub 10 is colored dull black to absorb the sun &# 39 ; s rays and heat while the center sleeve 15 is shiny white as is the entire lid 18 . the white sleeve 15 provides a sunshade for young trees and the heat build - up caused by the black tub during the summer months will discourage the nesting of mice in and around the base of the tree . the heat reflective qualities of the white lid will also retard water evaporation in the tub . the device has other advantages or fringe benefits . its use controls weed and grass growth around the bases of trees in the area covered by the tub . ground water evaporation is lessened . dew condensation on the bottom of the tub 10 is recaptured and returned to the soil by dripping . some frost protection is provided by the device . ground temperature is increased around the tree which stimulates growth . the water reservoir absorbs and retains heat from the sun and retards evening temperature drop and resulting tree damage . the tubes 40 may contain soluble chemicals and act as a slow release device for same . the device restricts animals from digging or attacking the base of the tree . rodent control pellets may be placed beneath the tub 10 and children or pets do not have easy access to the poison . the watering device is installed merely by passing the tree trunk through the slot 16 until the trunk is centered in the upstanding sleeve 15 . the tub is then filled with water after raising the cap 23 and adjusting the trickle valves to the desired flow . the irrigating process can be adjusted at the trickle valves to last for only a few minutes at a steady flow or for several hours at a slow dripping rate . the advantages of the invention should now be apparent without the need for further discussion . the device accomplishes two major things . it drastically reduces irrigation water and therefore conserves water and it maintains tree life during the drought period . it is to be understood that the form of the invention herewith shown and described is to be taken as a preferred example of the same , and that various changes in the shape , size and arrangement of parts may be resorted to , without departing from the spirit of the invention or scope of the subjoined claims .

US-77989877-A

a new method of disposing of waste for the hog industry is disclosed which avoids use of lagoons . manure is semi - continuously degritted , anaerobically digested and digested with biomass to produce bio - organic fertilizer and biogas .

while this invention is susceptible to embodiment in many different forms , there is shown in the drawings , and will herein be described in detail , specific embodiments , with the understanding that the present disclosure of such embodiments is to be considered as an example of the principles and not intended to limit the invention to the specific embodiments shown and described . in the description below , like reference numerals are used to describe the same , similar or corresponding parts in the several views of the drawings . this detailed description defines the meaning of the terms used herein and specifically describes embodiments in order for those skilled in the art to practice the invention . the terms “ a ” or “ an ”, as used herein , are defined as one or as more than one . the term “ plurality ”, as used herein , is defined as two or as more than two . the term “ another ”, as used herein , is defined as at least a second or more . the terms “ including ” and / or “ having ”, as used herein , are defined as comprising ( i . e ., open language ). the term “ coupled ”, as used herein , is defined as connected , although not necessarily directly , and not necessarily mechanically . the term “ comprising ” is not intended to limit inventions to only claiming the present invention with such comprising language . any invention using the term comprising could be separated into one or more claims using “ consisting ” or “ consisting of ” claim language and is so intended . references throughout this document to “ one embodiment ”, “ certain embodiments ”, and “ an embodiment ” or similar terms means that a particular feature , structure , or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention . thus , the appearances of such phrases in various places throughout this specification are not necessarily all referring to the same embodiment . furthermore , the particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments without limitation . the term “ or ” as used herein is to be interpreted as an inclusive or meaning any one or any combination . therefore , “ a , b or c ” means any of the following : “ a ; b ; c ; a and b ; a and c ; b and c ; a , b and c ”. an exception to this definition will occur only when a combination of elements , functions , steps or acts are in some way inherently mutually exclusive . the drawings featured in the figures are for the purpose of illustrating certain convenient embodiments of the present invention , and are not to be considered as limitation thereto . the term “ means ” preceding a present participle of an operation indicates a desired function for which there is one or more embodiments , i . e ., one or more methods , devices , or apparatuses for achieving the desired function and that one skilled in the art could select from these or their equivalent in view of the disclosure herein and use of the term “ means ” is not intended to be limiting . as used herein , the term “ grit ” refers to insoluble sandy matter that exists within the animal waste such as hog , poultry and dairy manure waste . the term “ animal waste ” refers to any of the waste type of animal manure , such as hog , poultry and dairy manure , which would be used in an anaerobic digestion system and containing grit . animal waste is transferred periodically , e . g . in one embodiment , daily , from the animal containment building to the degritter chamber . though one skilled in the art could choose appropriate times e . g . every 12 , 24 , 36 , and 48 hours , etc . as used herein , the term “ degritter chamber ” refers to a space designed for holding and hydrolyzing organic waste with hot water or steam at an elevated temperature . a chamber can be made of any material , such as a stainless steel , fiberglass or concrete chamber , and the tank , in one embodiment , has to be insulated to better hold the elevated temperature without the need for additional heating apparatus throughout the entire process once heated water is added . the elevated temperatures ( from about 50 ° c . to about 60 ° c .) facilitate hydrolysis and the separation of grit and enough heated water is added or steam is injected to raise the mixture to this temperature . the hydrolyzed and degritted slurry is transferred and , in one embodiment , forced , by the periodic incoming manure and hot water ( see figures ), under flow pressure into the anaerobic digester chamber ( see e . g . fig3 ). after the operation for a selected period of time , the grit accumulates at the bottom of the hydrolysis chamber by sedimentation . it can be removed by a pump or with a gravity bottom drain , such as a conical area , to remove the grit by bleeding off the grit . this can be done periodically , e . g . daily or the like . the operation in each chamber or system is semi - continuous , feeding with manure and discharging organic fertilizer periodically ( e . g . daily or the like ). as a plug - flow system , i . e . fluid gravity transfer , in one embodiment , the liquefied material flows from a degritter chamber where it stays one day , to a horizontal anaerobic digester tank ( in one embodiment fluid gravity ) where it is retained for at least about 10 days ( in one embodiment , about 10 - 15 days ), then the digester mixture ( the digestate ) to the secondary solid - phase digester for 1 - 5 days and finally discharged as organic fertilizer . the operation of the complete system is a semi - continuous process to keep hog houses clean . plug - flow then relies on newly added wastes and water added to the degritter pushing the degritted material through the system . so , in one embodiment where waste is added daily to the degritter , the chamber is just large enough for one day &# 39 ; s worth of mixture ( water and manure ). adding the next day &# 39 ; s mixture pushes the first mixture to the second chamber and , depending on the length ( size ) of the second chamber will determine the length of the mixture &# 39 ; s stay in that chamber and so on . in one embodiment , the anaerobic chamber is 10 times the size of the degritter chamber i . e . remains for ten days ( the retention time ) when one day in the degritter . the method of the present invention involves adding the organic waste , such as hog manure , to the degritter chamber . this can be done by scraping or the like without diluting the manure till it reaches the degritter chamber . hot water is added to , or steam is injected into , the chamber to obtain a slurry mixture , wherein the final mixture is at about 50 ° c . to about 60 ° c ., and the mixture is held at that temperature in the tank by insulation , rather than heating the tank contents further . in general , one skilled in the art can obtain the optimum percentage of solids , and thus , the proper amount of water , and its temperature , based on the weight of the manure added by simple testing of the process . in one embodiment , a 1 : 1 ratio of hot water is added to manure in the degritter chamber to give the percent total solids 5 % to 10 % on a weight / weight basis . alternatively , steam can be injected into the degritter to raise the temperature and to reach 5 % to 10 % total solids concentration . in one embodiment , the hydrolytic degritter process takes one day . next day , fresh manure from the hog house is scraped into the degritter and hot water added to force out at least a portion of the degritted mixture to flow into the large digester tank . grit can be removed as described above . once the mixture is degritted , it is transferred , and , in one embodiment , it flows under a hanging wall , to a connected horizontal chamber of an anaerobic digester for anaerobic digestion and for production of biogas . as used herein , “ anaerobic digestion ” is a process in which microorganisms break down biodegradable material in the absence of oxygen to produce a lower solids liquid effluent . the digestion process begins with bacterial hydrolysis of the input materials to break down insoluble organic polymers , such as carbohydrates , proteins and lipids and make them available for other bacteria . acidogenic bacteria then convert the sugars and amino acids into carbon dioxide , hydrogen , ammonia , and organic acids . finally , methanogens convert these products into a gas mixture of methane and carbon dioxide called biogas which can be collected and utilized . the methanogenic archaea populations play an indispensable role in anaerobic treatments . biogas can be collected into a flexible and inflatable plastic membrane cover on top of the digester tank , where the biogas , in turn , can be pumped to a large central gas storage station for further process and utilization . at this digestion stage , it takes a time of at least 10 days ( ten times the digester volume / daily feeding volume ) for the mixture called “ digestate ” to flow to the next stage . the digestion in this stage is kept in the insulated chamber at about 50 to about 60 ° c . the whole system can be housed with a roof to lower the heat loss . it is used as part of the process to treat biodegradable waste . as part of an integrated waste management system that produces , captures and utilizes biogas , it reduces the emission of greenhouse gases into the atmosphere . anaerobic digesters can also be fed with purpose - grown energy crops , such as maize , crop waste and grasses for co - digestion . the process of the invention produces a biogas , consisting of methane , carbon dioxide and traces of other “ contaminant ” gases . this biogas can be used directly as gaseous fuel for heat and de - sulfured for power generation , or upgraded to natural gas - quality biomethane for transportation fuel . the use of biogas as a fuel helps to replace fossil fuels . also , the nutrient - rich digestate produced can be concentrated into liquid fertilizer , or further processed into bio - organic fertilizer . the liquid effluent or digestate from this stage is passed to the third stage tank . in one embodiment , the biomass is pre - loaded in another embodiment , the discharged digestate is sprayed over the biomass ( see fig3 ). the discharged digestate from the anaerobic digester chamber is transferred to a secondary solid phase digester pre - loaded with dry biomass for further fermentation of the mixture at about 50 - 60 ° c . in one embodiment , the secondary digester is insulated and does not contain heaters . as used herein , the term “ biomass ”, refers to plant materials , including miscanthus , switchgrass , prarie grasses , hemp , corn , poplar , willow , sorghum , sugar cane , a variety of tree species , and crop or vegetable wastes . typically , these plant materials are rich in polysaccharides , and are collectible and dryable . in one embodiment , the biomass solids are loaded in the chamber of the secondary digester prior to adding digestate . the digestate is added ( e . g . by spraying ) daily on top of the biomass ( in one embodiment at a ratio of 1 : 1 by weight ) and kept in the insulated chamber for fermentation . the temperature of the effluent is kept at about 50 to about 60 ° c .— the mixture is not further heated and the chamber is insulated to hold the temperature without further heating . the mixture is fermented for a period of about one day or longer . the resulting product is high in solids , at about 30 % to about 50 %. the liquid is separated by leaching , pressing or drying . the high solids material , which is & gt ; 50 %, can then be utilized as a bio - organic fertilizer or as desired . more biogas can be collected into an inflatable membrane cover on top from this step as well . as used herein , the term “ semi - continuous ” refers to the present periodic process which removes materials from the animal containment building at regular periodic intervals , such as daily , every other day , etc ., and adds the materials , with hot water or steam , into the degritter chamber during the animal growing season . the process of semi - continuous manure feeding will push the internal mixture by gravity flow and mixing in the digester . the digestate will be discharged daily into the secondary solid - phase digester to produce bio - organic fertilizer and more biogas depending on the amounts and frequency added . as used herein , the term “ animal containment building ” refers to the building that farm animals are grown in , such as the building hogs are grown in , usually for 6 months or so at a time , i . e . a hog house . as used herein , the term “ animal growing season ” refers to the time animals remain in the animal containment building before removal for slaughter , e . g . growth time for a hog . as used herein , the term “ modular ” refers to the components in a unitary building flow system i . e . a degritter , an anaerobic digester , and a secondary digester , that can be swapped out and are interchangeably modular and designed to fit together as a single unit or unitary structure , rather than separate components just connected by piping or the like . an example is shown in fig3 . the modules can be custom made or pre - made as desired . fig1 is the system of the present invention which depicts a flow system in a unitary building . in this method , there are two hog houses 1 which have hogs for a period of about six months wherein the manure 2 is collected daily , e . g . by scraping , without water dilution and transferred to a hydrolytic degritter 5 a along with heated water or steam generating system 4 that is to raise the mixture to about 50 ° c . to about 60 ° c . grit is disposed 5 and the degritted mixture flows under a wall from the addition of more mixture to the degritter , to an anaerobic digester 6 for at least around ten days ( retention time : ten days in one embodiment ) and then flow to secondary digester 7 loaded with a quantity of biomass 8 . the mixture in the secondary digester 7 is left for at least twenty four hours before removing and , optionally , drying 9 to produce dry organic fertilizer 10 which can be easily bagged and sold . biogas is first collected from the flexible top of primary and secondary digesters and then pumped to central storage 10 a . the whole system can be covered by a roof 55 . fig2 depicts the method of the present invention with a hog house embodiment . hog house 11 is full of hogs for about six months during annual growing season . manure is scraped and collected 12 from the hog house 11 and placed in the hydrolytic degritter chamber with heated water or steam sufficient to raise the mixture to about 50 ° c . to about 60 ° c . for about twenty four hours ( in one embodiment ) 13 . grit is removed 14 periodically , as needed . degritted slurry mixture flows to the anaerobic digester and , upon addition of more manure and water to the degritter , continues to flow into the secondary digester where it ferments for about ten days where retention time = ten days 15 . the digestate overflows ( flows over a wall ) into the secondary digester loaded with biomass and incubated for one day or longer 16 , followed by discharge as organic fertilizer with optional drying 17 . as indicated , biogas collected from the top of the two digesters can be pumped to a central storage 18 . flow pressure causes all of the mixture to be pushed through the system . fig3 depicts a side cutaway view of a modular system of the present invention wherein modular components fit together to form a unitary structure with flow through architecture . in this view , manure scrapings 31 from a containment building and hot water or steam 32 are combined and placed into the connected degritter chamber 33 by removing slab 34 and placing manure 31 and hot water 32 inside . grit 35 is removed via grit valve 36 at the bottom of degritter chamber 33 . degritter slurry 37 from degritter chamber 33 enters the anaerobic digester chamber 38 by pressure from further added manure and water , which allows a primary digestion of slurry 37 passing over and under walls 30 , while biogas emitted is collected by biogas membrane 40 and transported to a central gas storage . the anaerobic digester chamber is about ten times the volume of the degritter , allowing a ten day retention time in the system as the mixture flow through the system . digested liquid 43 , after about a ten day retention time , overflows wall 43 a to the modular secondary solid phase digester 44 ( which is loaded with biomass 45 ) via spray nozzle 48 and fermented for at least twenty - four hours or longer before removal via outlet 46 of fertilizer which can optionally be dried further . it is noted that the structure is insulated 50 so that no heaters are required other than to heat the water added to the manure . more biogas will be collected 40 and pumped to the central gas storage . in one example , the manure scrapings from two hog houses of approximately 11 tons per day is added , with 11 tons of hot water or steam injected to furnish a temperature of about 50 ° c . to about 60 ° c . added to an insulated hydrolytic degritter of the type from fig3 for 24 hours without further heating . the slurry flows daily , minus grit , to an anaerobic digester for a period of 10 days without further heating . a portion ( e . g . 10 %) of the amount in the digester overflows semi - continuously to a secondary digester loaded with 22 tons of dry biomass and incubated for twenty four hours or longer and the discharge is semi - dried . so each cycle is about twenty four hours and fed with manure on a daily basis to produce both fertilizer and biogas . those skilled in the art to which the present invention pertains may make modifications resulting in other embodiments employing principles of the present invention without departing from its spirit or characteristics , particularly upon considering the foregoing teachings . accordingly , the described embodiments are to be considered in all respects only as illustrative , and not restrictive , and the scope of the present invention is , therefore , indicated by the appended claims rather than by the foregoing description or drawings . consequently , while the present invention has been described with reference to particular embodiments , modifications of structure , sequence , materials and the like apparent to those skilled in the art still fall within the scope of the invention as claimed by the applicant .

US-201715688045-A

a method of forming a resist on a substrate and processing the resist in a resist processing system having a processing region and a non - processing region which are air - conditioned , the method comprising the steps of , transferring the substrate into the non - processing region , coating the resist on the substrate , exposing the coated resist , developing the exposed resist , subjecting the coated resist at least once , to heat treatment in a period from the transferring step to the developing step , detecting at least once , the concentration of an alkaline component which causes defective resolution of the resist in a processing atmosphere in a period from the transferring step to the developing step , setting a threshold value for the concentration of the alkaline component in the processing atmosphere which causes the defective resolution of the resist , and controlling and changing at least one processing atmosphere in the steps in accordance with a detected concentration of the alkaline component and the threshold value .

referring to the drawings , preferred embodiments of the present invention will now be described . as shown in fig1 a resist processing system includes a cassette station 4 , a coating section 10 , an interface section 30 and an exposing section 40 . the cassette station 4 has a wafer moving mechanism 2 and a holder 3 . a first cassette 1a for accommodating non - processed wafer w and a second cassette 1b for accommodating a processed wafer are disposed on the holder 3 at predetermined positions . the wafer moving mechanism 2 takes out the non - processed wafer w from the first cassette 1a to store a processed wafer in the second cassette 1b . the processing section has a plurality of the processing sections 10 to 15 and 20 to 22 and a main conveying machine 6 . the main conveying machine 6 is capable of running on a straight central passage 5 in the processing section , the main conveying machine 6 having an arm 7 for holding and moving the wafer w . the arm 7 is able to move in the directions of the x , y and z axes and rotate around the z axis by an angular degree of θ . on one side of the central passage 5 , there are formed non - heat processing sections 10 , 15a , 15b , 20 and 22 . on the other side of the central passage 5 , there are formed heat processing sections 11 , 12 , 13 and 21 . the coating section 10 is formed adjacent to the cassette station 4 and having two resist coating units 15a and 15b . the resist coating unit 15a applies a reflection protective film to the wafer w , while the resist coating unit 15b applies photoresist to the wafer w . the developing section 20 is formed adjacent to the interface section 30 and has two developing units 22 . each of the developing units 22 develops the wafer w subjected to the exposing process in an exposing unit 40 . the scrubbing unit 11 scrub - cleans the wafer w with rotating brushes . an adhesion processing unit 12a subjects the surface of the wafer w to a hydrophobic process using hexamethyldisilazane ( hmds ). the processing atmosphere of the adhesion processing unit 12a usually includes alkaline component at a concentration of 4 ppb to 50 ppb . a cooling unit 12b cools the wafer w . baking units 13 and 21 heat the wafer w to which the resist has been applied . a jet - water cleaning unit 14 cleans the wafer w with jet stream of pure water . as shown in fig2 the baking unit 13 has hot plates disposed vertically . a plurality of the adhesion processing units 12a and the cooling units 12b are formed in the processing unit 12 . the interface unit 30 is formed adjacent to the developing unit 20 and the baking unit 21 in the processing section . the interface unit 30 has a holder 31 for transferring / receiving the wafer w . the exposing unit 40 is connected to the processing section through the interface unit 30 . the exposing unit 40 has an exposing stage 41 , two loading mechanisms 42 and 44 and a cassette station on which the cassettes 43 are placed . the side portions of the coating unit 10 and the developing unit 20 are covered with a cover 81 . the upper portion of the coating unit 10 and the developing unit 20 are covered with a cover 82 . the upper cover 82 has an opening through which air is supplied from a common duct ( not shown ) of the plant into an air intake opening of each air cleaning mechanism 80 . the air cleaning mechanism 80 is disposed above each of the processing sections 10 and 20 and the interface section 30 . as shown in fig2 a duct 83 is formed in the uppermost portion of the air cleaning mechanism 80 . a communication passage 84 for connecting the duct 83 to the processing units 15a and 15b has , in the downward direction , a chemical filter 85 , an air blowing fan 86 and an ulpa filter 87 . moreover , another ulpa filter 87a is formed above the resist coating units 15a and 15b . the chemical filter 85 is operated to remove the alkaline component , while the ulpa filters 87 and 87a are operated to remove particles . the number of the ulpa filters 87 may be two as is employed in this embodiment or one . an air - discharge passage 88 is formed in the floor portion of the central passage 5 , the air - discharge passage 88 including an exhaust fan 89 . thus , a downflow of air is formed from the air cleaning mechanism 80 to the air - discharge passage 88 . the air - discharge passage 88 is allowed to communicate with a circulating circuit ( not shown ) having an alkaline component removing apparatus ( not shown ). the alkaline component in the exhaust air is removed by the alkaline component removal apparatus , and then regenerated air is again supplied to the air cleaning mechanism 80 through the circulating circuit . another air cleaning mechanism 80 is provided for the interface section 30 so as to supply fresh air into the interface section 30 . air which is supplied to the air cleaning mechanism 80 satisfies a concentration of the alkaline component of 10 ppb or lower , which is the requirement for the interior atmosphere of the clean room 90 . the concentration of the alkaline component in supplied air 280 ( see fig8 and 9 ) is lowered to 1 ppb or lower after it has passed through the air cleaning mechanism 80 . each of the coating section 10 , the developing section 20 and the interface section 30 has an alkaline concentration analyzer 50 . as shown in fig2 a detection terminal 53 of the concentration analyzer 50 is disposed in the upper space of each of the sections 10 , 20 and 30 to detect the concentration of the alkaline component contained in air immediately after blown out from the filter unit 80 . the &# 34 ; alkaline component &# 34 ; to be detected is organic amine , such as ammonia and nmp ( n - methyl . 2 pyrrolidinone ), and their polar molecule components . the alkaline concentration analyzer 50 may be ion chromatography . for example , a diffusion scrubber ( not shown ) and an auto - exchanger ( not shown ) are attached to the concentration analyzer 50 . as shown in fig2 a tank 52 of the alkaline concentration analyzer 50 accommodates pure water 51 . an end of a sampling pipe 54 is submerged in pure water 51 in the concentration analyzer 50 . another end ( detection terminal ) 53 of the sampling pipe 54 is disposed above the resist coating units 15a and 15b and directly under the air blow - out opening of the air cleaning mechanism 80 . an exhaust pipe 55 is submerged in pure water 51 in the concentration analyzer 50 . detection signals output from the alkaline concentration analyzer 50 are sequentially supplied to an input portion of a cpu 60 . a memory portion of the cpu 60 previously stores a predetermined threshold value . in this embodiment , the threshold value of the concentration of the alkaline component is determined to be 1 ppb . an output portion of the cpu 60 is connected to a monitor 70 and an alarm system 71 . the alkaline concentration detected in each portion is displayed on the screen of the monitor 70 so that an operator of the system is permitted to immediately recognize the state of the system . if any one of the detected concentrations exceeds the threshold value , the cpu 60 operates the alarm system 71 to issue an alarm . if the threshold value is set to be lower than 1 ppb ( for example , 0 . 7 ppb ), a chemical filter 85 can be changed prior to occurrence of defective resolution with sufficient time margin . the cpu 60 feedback - controls the conveying machine 6 of the coating unit 10 and a drive motor 17 of a spin chuck 16 . in accordance with a program transferred from the cpu 60 , the process can be continued or interrupted . referring to flow charts shown in fig3 a and 3b , an operation of the foregoing apparatus to process the wafer w will now be described . initially , the wafer moving mechanism 2 takes out a non - processed wafer w from the first cassette 1a of the cassette station 4 in a loader / unloader section , and then places the non - processed wafer w on the holder 3 while centering the wafer w . the main conveying machine 6 picks up the wafer w from the holder 3 by the arm 7 and holds the same to introduce the wafer w into the processing section ( step s1 ). then , the main conveying machine 6 introduces the wafer w into the baking unit 13 to pre - bake the wafer w in accordance with a predetermined recipe ( step s2 ). the wafer w is scrubbed with a brush in the scrubbing unit 11 ( step s3 ), and then the wafer w is cleaned with jet water in the jet - water cleaning unit 14 ( step s4 ). while heating the wafer w , the wafer w is subjected to an adhesion process in the adhesion processing unit 12a ( step s5 ). an alkaline component generated due to the adhesion process is brought to the air - discharge passage 88 in the floor portion by the downflow air . then , the alkaline component is absorbed and removed by an alkaline component absorbing apparatus ( not shown ) disposed in the circulating circuit . then , the wafer w is cooled in the cooling portion 12b , and then a chemically amplified resist is applied to the wafer w , in the resist coating units 15a and 15b ( step s8 ). after the pre - baking step s2 , the reflection preventive resist may be applied to the wafer w ( step s6 ) followed by baking the wafer w in accordance with the predetermined recipe ( step s7 ). after the baking step s7 has been performed , the chemically amplified resist is further applied onto the reflection preventive film ( step s8 ). in the resist applying steps s6 and s8 , the alkaline component in supplied air is removed by the air cleaning mechanism 80 so as to lower the concentration of the alkaline component in the processing atmosphere to be lower than 1 ppb . after the resist has been applied , the wafer w is again baked in the baking unit 13 ( step s9 ). after the wafer w has been cooled in the cooling unit 12b , the wafer w is brought to the interface section 30 to align the position of the wafer w on the holder 31 . then , the wafer w is introduced into the exposing section 40 so as to be subjected to the exposing process ( step s10 ). after the exposing process has been performed , the wafer w is introduced into the baking unit 21 of the developing section 20 through the interface section 30 so as to be pre - baked before the developing process is performed ( step s1 ). then , the wafer w is developed in the developing unit 22 ( step s12 ). also the concentration of the alkaline component in the developing atmosphere is adjusted to be lower than 1 ppb by the air cleaning mechanism 80 . after the developing process has been performed , the wafer w is post - baked in the baking unit 21 so that the sequential resist process is completed ( step s13 ). the processed wafer w is moved to the cassette station 4 by the main conveying machine 6 so as to be placed on the holder 3 . the wafer moving mechanism 2 accommodates the processed wafer w in the second cassette 1b . the processed wafer w is , while being accommodated in the second cassette 1b , taken out from the cassette station 4 . as shown in fig3 b , the concentration of the alkaline component in the processing atmosphere is detected by the alkaline concentration analyzer 50 and the results of the detection are , in real time , displayed on the screen of the monitor 70 ( step s14 ). if the chemical filter 85 deteriorates after it has been used for a long time and the performance for removing the alkaline component has deteriorated , the concentration of the alkaline component in the processing atmosphere is gradually raised . the cpu 60 compares the detected concentration of the alkaline component in the processing atmosphere and the threshold value ( 1 ppb ) with each other . if the detected level is lower than the threshold value ( 1 ppb ), the foregoing steps s1 to s13 are repeated ( step s15 ). if the detected concentration of the alkaline component is higher than the threshold value ( 1 ppb ), the cpu 60 issues a command to the alarm system 71 to issue an alarm ( steps s15 and s16 ). when the operator recognizes abnormal concentration of the alkaline component in the processing atmosphere in accordance with the alarm issued from the alarm system 71 and / or the screen of the monitor 70 , the operator selects any one of the following methods ( 1 ), ( 2 ) and ( 3 ). ( 1 ) a first method in which all of the processing operations are immediately interrupted ( step s17 ), and the chemical filter 85 is changed ( step s18 ). then , the process is restarted ( step s19 ). ( 2 ) a second method in which the operations of the resist coating section 10 and the developing section 20 for processing the wafer w are interrupted . moreover , the operations of the other processing sections 11 , 12 , 13 , 14 and 40 for processing the non - processed wafer w are completed . then , all of the processing operations are interrupted ( step s17 ), and then the chemical filter 85 is changed ( step s18 ). then , the process is restarted ( step s19 ). ( 3 ) a third method in which the operations for processing all of the wafer w ( including the non - processed wafer w in the first cassette 1a of the cassette station 4 ) in the resist processing system are completed . then , all of the processing operations are interrupted ( step s17 ), and then the chemical filter 85 is changed ( step s18 ). then , the process is restarted ( step s19 ). the first method ( 1 ) enables the wafer w to be quickly and reliably protected from being damaged by the alkaline component in the atmosphere . however , since the wafer w , which is being processed in the processing sections 10 and 20 , is collectively restored , the process involves waste . the second method ( 2 ), in which the wafer w , which is being processed in the processing sections 10 and 20 , and the introduced non - processed wafer w are processed , enables the waste in the process to be prevented . the third method ( 3 ) is able to further prevent waste in the process as compared with the second method ( 2 ). however , since a long time is required to interrupt the processing operation , there is a risk that the wafer w is damaged by the alkaline component in the atmosphere . as described above , each of the first to third methods ( 1 ), ( 2 ) and ( 3 ) has its merits and demerits . in order to protect the wafer w from being damaged with the second method ( 2 ) or the third method ( 3 ), the threshold value of the concentration of the alkaline component in the processing atmosphere may be lowered from 1 ppb to 0 . 7 ppb . as shown in fig4 a structure may be employed in which , for example , five resist processing systems are included in single clean room 90 ; and the atmospheres of the processing sections 10 , 20 and 30 of the five resist processing systems are , in parallel , controlled by using the common alkaline component concentration analyzer 50 , the cpu 60 , the monitor 70 and the alarm system 71 . since the threshold value of the concentration of the alkaline component in the atmosphere in the coating section 10 , the developing section 20 and the interface section 30 and that in the atmosphere in the clean room 90 are , in this case , different from each other , the cpu 60 controls the system to be adaptable to the difference . for example , the threshold value of the concentration of the alkaline component in the former sections 10 , 20 , 30 is made to be 1 ppb and the threshold value of the concentration of the alkaline component in the latter section is made to be 10 ppb . by detecting the concentration of the alkaline component in the clean room 90 as well as detecting the concentration of the alkaline component in the resist processing system , the life - time of the chemical filter 85 can be predicted . when the wafer applied with the resist and exposed to light was allowed to stand in an atmosphere containing ammonia at a concentration of about 1 ppb and an atmosphere containing ammonia at a concentration of about 10 ppb , a required width of lines of the pattern of ± 0 . 3 % was satisfied in the former atmosphere ( alkaline concentration of 1 ppb ). however , the pattern was deformed excessively in the latter atmosphere ( alkaline concentration of 10 ppb ). the threshold value of the concentration of the alkaline component in the processing units 10 and 20 and the threshold value of the concentration of the alkaline component in the interface section 30 may be different from each other even in the same system . since the alkaline component is generated in the pre - baking step s11 after the exposing step s10 has been performed , it is preferable that the concentration of the alkaline component in the processing atmosphere be detected at least from the resist coating step s8 to the developing step s12 . the concentration of the alkaline component may be detected at a position near a door ( not shown ) in the system . although the foregoing embodiment has been described as a structure in which the present invention is applied to the system for coating and developing resist for a semiconductor wafer , the present invention may be applied when resist is applied to a glass substrate for a lcd and the resist is developed . according to the present invention , the concentration of the alkaline component in the processing atmosphere can be online - detected and the processing atmosphere for the substrate can quickly be improved in accordance with the detected value . therefore , the manufacturing yield and the reliability of the apparatus can be improved . since the concentration of the alkaline component in the processing atmosphere is always monitored , the operator is able to predict the time at which the chemical filter must be changed and the life - time of the filter . if the detected level of the concentration of the alkaline component in the processing atmosphere exceeds a threshold value , this fact is notified to the operator by the alarm system . therefore , the operator is able to quickly take a countermeasure against the problem . thus , the damage of the chemically amplified resist applied to wafer w can be prevented . moreover , if the detected levels of the concentrations of the alkaline components respectively detected in the coating section 10 , the developing section 20 and the interface section 30 are different from one another after the recipe has been changed , the operator is able to analyze the state of the problem to detect the cause of the problem . referring to fig5 to 9 , another embodiment of the present invention will now be described . as shown in fig6 a resist processing system according to this embodiment has a processing section 202 , a loading / unloading section 221 and an interface section 222 . an exposing portion ( not shown ) is connected to the interface section 222 . the system is covered with a cover 206 . the cover 206 has , in the upper portion , an air inlet opening 260 . the air inlet opening 260 has three filter units 207 . moreover , openings for introducing a wafer are formed in the front and rear portions of the cover 206 . punching metal plates or gratings are disposed on the floors of the processing section 202 , the loading / unloading section 221 and the interface section 222 . downflow air is arranged to flow from an upper filter unit 207 to pass through the processing space so as to be introduced into a position below the floor . as shown in fig5 the filter units 207 are surrounded by a case 272 and attached to the upper portion of the processing section 202 . the outer case 272 accommodates a fan 262 , a first filter portion 261 and a second filter portion 263 . the first filter portion 261 is formed adjacent to the upper air inlet opening 260 , while the second filter portion 263 is formed adjacent to the lower air inlet opening 260 . the fan 262 is disposed between the first filter portion 261 and the second filter portion 263 . supplied air 280 is , through a common duct ( not shown ) of the plant , introduced into the first filter portion 261 in a direction indicated by arrows shown in fig8 and 9 to be allowed to pass through the upper first filter element 270 . then , supplied air 280 is allowed to pass through the lower fan 262 and the second filter element 271 . the second filter portion 263 acts to remove particles from supplied air and has a filter element in the form of a sheet made of glass fiber . it is preferable that a gasket 274 be made of a material which does not considerably generate ammonia . for example , it is preferable that silicon rubber or pvc be employed . when the gasket 274 was submerged in a very pure water to measure the quantity of elution , a quantity of 20 ng / cm2 was detected . if the quantity of elution of ammonia is the foregoing level , it can be said that the gasket 274 does not substantially generate ammonia in the atmosphere . as shown in fig7 the processing section 202 has , in the central portion thereof , a conveyance passage 231 extending in the direction of the x axis from an end 261 to another end 262 . a main conveyance machine 203 is disposed so as to be capable of traveling along the conveyance passage 231 . the main conveyance machine 203 has an arm for holding and moving the wafer w . the conveyance arm is able to move in the directions of the x , y and z axes . moreover , the conveyance arm is able to rotate around the z axis by an angular degree of θ . an adhesion unit 204 , a resist coating unit 251 , a heating unit 252 , a cooling unit 253 and a developing unit 254 are disposed on the two sides of the conveyance passage 231 . referring to fig8 and 9 , the upper first filter portion 261 will now be described . the first filter portion 261 has filter elements 270 and 271 stacked vertically . supplied air 280 is initially allowed to pass through the first filter element 270 , and then allowed to pass through the second filter element 271 . each of the first and second elements 270 and 271 is in the form of bellows made of a sheet , that is , projections 270a and 271a and recesses 270b and 271b are alternately repeated when viewed from supplied air 280 so as to be formed into a pleated shape . the recesses 271b of the second element are formed in the downstream portion of the projections 270a of the first element , while the projections 271a of the second element are formed in the downstream portion of the recesses 270b of the first element . each of the elements 270 and 271 has a slit 273 through which air passes . the slit 273 of the first filter element 270 is formed in the upstream projection 270a , while the slit 273 of the second filter element 271 is formed in the downstream recess 271b . the side portion of the second filter element 271 is , through a seal layer 272a , attached to a support frame 272 . the first and second elements 270 and 271 have substantially the same size . for example , length l1 in the direction in which air flows is made to be about 70 mm , bending interval l2 is made to be a pitch of about 4 mm , and the gap l3 is made to be about 5 mm or less . a gasket 274 is attached to a support frame 272 adjacent to the air outlet opening . each of the first and second elements 270 and 271 is made of a carbon fiber sheet or an olefin fiber sheet . the foregoing fiber sheet is impregnated with phosphoric acid solution . a method of manufacturing the first and second elements 270 and 271 will now be described . initially , the fiber sheet is submerged in phosphoric acid solution , and then the fiber sheet is set to a centrifugal separator so as to centrifugally separate and remove an excessive amount of the phosphoric acid solution . then , the fiber sheet is pressed so as to be formed into a plate form . as a result of the pressing operation above , the concentration of small pores in the fiber sheet can be raised so that the shapes of the small pores are uniform . thus , the small pores are arranged regularly and the specific surface area can be enlarged . as expressed by the formula ( 1 ) below , the ammonia component in supplied air 280 reacts with phosphoric acid contained in the first and second elements 270 and 271 and thus is captured . when supplied air 280 has passed through the first filter portion 261 , the concentration of ammonia is finally lowered to a level of about 0 . 1 ppb . ## str1 ## although the performance of the first filter element 270 for removing ammonia deteriorates gradually due to use for a long time , the wanting of the removal performance of the first filter element 270 can be compensated by the second filter element 271 consumption of phosphoric acid takes place in the order as the projection 270a of the first element , the recess 271b of the second element , the recess 270b of the first element and the projection 271a of the second element . note that the differential of the consumption rate of the phosphoric acid between the projection 271a and the recess 271b is small . therefore , the synergistic effect of the difference in the consumption rate of the phosphoric acid between the two portions and the difference in the start timing for the consumption of the phosphoric acid between the same reduces the scattering of the quantity of the consumption of the phosphoric acid between the projection 271a and the recess 271b . as a result , the second filter element 271 is uniformly aged and the life of the second filter element 271 is longer than that of the first filter element 270 . when the first filter portion 261 is changed , the first and second first filter elements 270 and 271 may be changed simultaneously . as an alternative to this , the second filter element 271 , which is able to work , may be allowed to be retained and only the first filter element 270 may be changed . as described above , according to this embodiment , the life - time of the chemical filter can significantly be elongated . therefore , the frequency , at which the filter must be changed , can be lowered . additional advantages and modifications will readily occur to those skilled in the art . therefore , the invention in its broader aspects is not limited to the specific details and representative embodiments shown and described herein . accordingly , various modifications may be made without departing from the spirit or scope of the general inventive concept as defined by the appended claims and their equivalents .

US-27773499-A

a valve assembly includes a check valve element in the output chamber . the check valve element opens to permit forward flow of fluid under pressure in the output chamber from a source toward a load . the check valve element closes to block back flow of fluid under pressure in the output chamber from the load toward the source . the back flow of fluid under pressure exerts a closing force upon the check valve element from within the output chamber . a counter force generating element is located within the output chamber and coupled to the valve element . the counter force generating element applies a counter force to the check valve element , which urges the valve element toward the opened condition . the counter force is , by purpose , less than the closing force , so the check valve element remains closed . nevertheless , the presence of the counter force reduces the overall sealing forces applied by check valve element , thereby reducing the magnitude of force which is ultimately required to unseat the check valve element .

fig1 and 2 show a load handling system 10 in a load lifting stage ( fig1 ) and in an at rest stage ( fig2 ). the system 10 includes a force transmitting device 12 to handle a load 22 . in the illustrated embodiment , the device 12 comprises a load lifting cylinder , which operates in response to fluid pressure . the cylinder 12 houses a piston 14 , which divides the cylinder 12 into two chambers 16 and 18 . a link 20 couples the piston 14 to a load 22 . fluid lines 28 and 30 communicate with the chambers 16 and 18 , respectively , to convey pressurized fluid to and from the chambers 16 and 18 to lift and lower the load 22 . the system 10 includes a source 24 of pressurized fluid for conveyance to the cylinder 12 and a return sump or vent 34 to receive pressurized fluid exhausted from the cylinder 12 . the source 24 can comprise a hydraulic pump . however , in the illustrated and preferred embodiment , the source 24 comprises a pneumatic pump . the system 10 includes a main control valve 26 , which directs flow through the fluid lines 28 and 30 between the cylinder 12 , the source 24 , and the vent 34 . when placed in a first condition ( shown in fig1 ), the main control valve 26 directs pressurized fluid from the source 24 to the chamber 18 , while directing pressurized fluid exhausted from the chamber 16 to the vent 34 . as a result , the piston 14 advances the link 20 to transmit force f to the load 22 . this constitutes the load lifting stage . when placed in a second condition ( shown in fig2 ), the control valve 26 directs pressurized fluid from the source 24 to the chamber 16 , while directing pressurized fluid exhausted from the chamber 18 to the vent 34 . as a result , the piston 14 retracts the link 20 , and thereby relieves the load force f . this constitutes the at rest stage . the system 10 includes a locking valve 32 coupled to the fluid lines 28 and 30 . the locking valve 32 locks pressurized fluid in the chamber 18 during the load lifting stage should the system 10 experience an unexpected loss of fluid pressure supplied to the chamber 18 . the loss of fluid pressure can occur , for example , due to failure of the source 24 or the main control valve 26 . the locking valve 32 prevents a sudden loss of the load force f , despite loss of supply pressure . the load 22 remains lifted under this condition . as best shown in fig3 and 4 , the locking valve 32 includes a valve body 36 , e . g ., made of molded or drilled metal . a formed valve bore 38 extends through the valve body 36 . a valve stem 40 is carried for movement within the bore 38 . the valve stem 40 is made , e . g ., of molded metal . the valve stem 40 includes a first end region 42 , which carries a relief piston 44 . the relief piston 44 is secured by a locking screw ( not shown ) about the end region 42 for common movement with the valve stem 40 within the bore 38 . in the illustrated embodiment , an end nut 41 is threadably engaged on the first end region 42 next to one side of the relief piston 44 . a force applying element or spacer 98 carried on the valve stem 40 extends from the other side of the relief piston 44 . the outer periphery of relief piston 44 carries a sealing element 46 , which can , for example , take the form of a lubricated o - ring . the element 46 sealingly engages the interior of the bore 38 , to prevent leakage of fluid about the relief piston 44 . the seal element 46 nevertheless permits movement of the stem 40 and relief piston 44 within the bore 38 . as fig3 shows , the normal position of the valve stem 40 keeps the relief piston 44 a set distance spaced away from the adjacent closed end region 90 of the bore 38 . a push pin 98 projects into the end region 90 next to the end nut 41 . the push pin 98 transmits external force to move the valve stem 40 within the bore 38 , as will be described in greater detail later . the valve stem 40 includes a second end region 48 , which carries a counter force piston 50 . in the illustrated embodiment ( see fig4 b ), the counter force piston 50 is an integrally molded part of the valve stem 40 . as fig4 b also shows , a spacer 96 , which extends from the counter force piston 50 , is also an integrally molded part of the valve stem 40 . the outer periphery of counter force piston 50 carries a sealing element 52 , which can , for example , take the form of a lubricated o - ring . the element 52 sealingly engages the interior of the bore 38 , like sealing element 46 , to prevent leakage of fluid about the counter force piston 50 , without impeding sliding movement of the counter force piston 50 along the bore 38 . a spring 82 normally urges the counter force piston 50 a set distance away from the adjacent closed end region 92 of the bore 38 . the closed end regions 90 and 92 of the bore 38 , which the first and second pistons 44 and 50 occupy , have generally the same interior diameter . the pistons 44 and 50 therefore possess generally the same outer diameter . the bore 38 includes an interior region 54 between its closed end regions 90 and 92 , in which the interior diameter of the bore 38 increases . the change in interior diameters forms an interior valve seat 56 . the valve stem 40 carries a check valve poppet 58 for sliding movement within the enlarged region 54 of the bore 38 . the poppet 58 can be moved in a first direction along the valve stem 40 into engagement against the valve seat 56 ( as fig3 shows ). the poppet 58 can also be moved along the valve stem 40 in a second direction away from the valve seat 56 ( as , for example , fig6 shows ). a spring 62 carried about the spacer 94 extends between the poppet 58 and the counter force piston 50 . when the counter force piston 50 occupies its normally biased position ( which is controlled by the biasing spring 82 , already described ), the spring 62 normally urges the poppet 58 in the first direction into engagement against toward the valve seat 56 . the poppet 58 carries a sealing element 60 , which can , e . g ., be an o - ring . the element 60 sits in and seals the valve seat 56 against fluid leakage . an interior sealing element 64 in the poppet 58 ( which can also be , for example , a lubricated o - ring ) also makes sealing contact about the valve stem 40 , to prevent fluid leakage between the poppet 58 and valve stem 40 , without impeding sliding movement of the poppet 58 along the valve stem 40 , as previously described . in the illustrated and preferred embodiment ( as shown in fig4 a ), the valve body 36 includes an end cap 100 , which forms the end region 92 of the bore 38 . exterior threads 102 on the end cap 100 mate with interior threads 103 in the bore 38 to permit removal of the end cap from the valve body 36 . with the end cap removed , the valve stem 40 and the valve components it carries can be easily removed and replaced . there is therefore no need to separate the valve body 36 from its associated fluid lines for routine maintenance and repair . the end cap 100 includes an appropriate sealing element 104 ( of the type previously described ) to prevent leakage of pressurized fluid about the cap 100 when screwed onto the valve body 36 . as fig4 b shows , with the end cap unscrewed from the valve body 36 , the valve components carried on the valve stem 40 can also be easily replaced . by unscrewing the locking nut 41 and loosening the locking screw ( not shown ) on the relief piston 44 , the operator can slide the relief piston 44 , spacer 96 , poppet 58 , and biasing spring 62 from the end 42 of the valve stem 40 for replacement . the operator can likewise slide the biasing spring 82 from the other end 48 of the valve stem 40 for replacement . the valve stem 40 and integrally molded counter force piston 50 and spacer 94 can be replaced as a unit . when assembled , the presence of the sealing pistons 44 and 50 and the sealing poppet 58 divides the bore 38 of the locking valve 32 into four chambers 66 , 68 , 70 , and 72 . the first chamber 66 extends between the sealing relief piston 44 and the adjacent closed end 90 of the bore 38 . a pilot port 74 communicates with the first chamber 66 . the pilot port 74 is constricted to reduce the flow rate of fluid delivered to the first chamber 66 , relative to the flow rate of fluid delivered to the second and third chambers 68 and 70 . a pilot line 84 couples the pilot port 74 to the fluid line 28 ( see fig1 and 2 ), which is , in turn , coupled to the control valve 26 . the second chamber 68 extends between the sealing relief piston 44 and the valve seat 56 , which is normally sealed by the spring - biased poppet 58 . an input port 76 communicates with the second chamber 68 . an input line 86 couples the input port 76 to the control valve 26 , as fig1 and 2 show . the third chamber 70 extends between the valve seat 56 ( normally sealed by the poppet 58 ) and the sealing counter force piston 50 . an output port 78 communicates with the third chamber 70 . the fluid line 30 is coupled to the output port , as fig1 and 2 show . the fourth chamber 72 extends between the sealing counter force piston 50 and the adjacent closed end 92 of the bore 38 . a vent port 80 on the end cap 100 communicates with the fourth chamber 72 . in use ( see fig1 ), the operator places the control valve 26 in the first condition . pressurized fluid is conveyed from the source 24 , through the input line 86 and input port 76 , into the second chamber 68 of the locking valve 32 . the fluid pressure in the second chamber 68 moves the poppet 58 against the bias of the spring 62 away from its normally seated condition , opening the valve seat 56 . the moving poppet 58 will eventually contact the spacer 94 , which limits the travel of the poppet 58 in the second direction away from the valve seat . as fig1 shows , with the poppet 58 unseated , pressurized fluid flows past the valve seat 56 into the third chamber 70 , through the output port 78 and into the fluid line 30 . the pressurized fluid enters the chamber 18 , moving the piston to apply force f to the load 22 . the control valve 26 exhausts fluid in the chamber 16 through fluid line 28 to the vent 34 . the operator maintains the control valve 26 in its first condition for as long as it is necessary to apply force f to the load 22 . when it is time to relieve the force f , the operator shifts the control valve 36 to its second condition . by placing the control valve 26 in the second condition ( see fig2 ), pressurized fluid is conveyed from the source 24 , through the fluid line 28 into the chamber 16 . the pressure in the third chamber 70 will exceed and the pressure in the second chamber 68 , and the poppet 58 will return under the bias force of the spring 62 to its normal seated position against the valve seat 56 ( as fig3 shows ). the poppet 58 will be urged toward its normal seated position against the valve seat 56 whenever the pressure in the second chamber 68 is equal to or less than pressure in the third chamber 70 . the pressure in the third chamber 70 under this circumstance exerts a closing force upon the poppet 58 from within the third chamber . however , when the control valve 26 is in its second condition , pressurized fluid is conveyed in the pilot line 84 through the pilot port 74 into the first chamber 66 . the pressurized fluid bears against and moves the relief piston 44 , to thereby shift the valve stem 40 toward the end region 92 of the bore 38 . movement of the valve stem 40 toward the end region 92 of the bore 38 , in turn , will move the spacer 96 from its normal position spaced from the poppet 58 into contact against the poppet 58 . this movement of the spacer 96 mechanically lifts the poppet 58 from the valve seat 56 ( as fig2 shows ), to overcome the closing force upon the poppet 58 and open communication between the second and third chambers 68 and 70 . fluid exhausted by the chamber 18 flows in the line 30 , through the output port 78 into the third chamber 70 , and thence into the second chamber 68 and through the input port 76 into the input line 86 . the control valve 26 couples the input line 86 to the vent 34 . the force f on the load 22 is relieved . the load 22 returns in a controlled manner to an at rest position , as fig2 shows . should the source 24 or main control valve 26 fail when the control valve 36 is in the first condition , the reduced pressure in the second chamber 68 relative to the pressure in the third chamber 70 causes the poppet 58 to return to its normal seated position against the valve seat 56 ( as fig5 shows ). pressurized fluid existent in the chamber 18 and fluid line 30 exerts the closing force upon the poppet 58 and is thereby trapped by the seated poppet 58 from escaping the now sealed third chamber 70 . there is no loss of load force f , despite the absence of pressurized fluid input . as fig5 also shows , the closing force caused by pressurized fluid trapped in the third chamber 70 , which bears against the poppet 58 to maintain the poppet 58 against the valve seat 56 , also bears against and moves the counter force piston 50 against the bias of spring 82 , toward the end region 92 . movement of the counter force piston 50 moves the valve stem 40 and attached relief piston 44 , which , in turn , pulls the spacer 96 from its normal position spaced from the poppet 58 toward contact against the poppet 58 . responding to movement of the piston 50 due to pressurized fluid in the third chamber 70 , the spacer 96 exerts a mechanical counter force upon the poppet 58 , urging it away from the valve seat 56 . however , since the area of the counter force piston 50 is less than the area of the poppet 58 , the closing force of the pressurized fluid upon the poppet 58 is greater than the contrary opening force exerted by the counter force piston 50 through the spacer 96 . the poppet 58 therefore remains in sealing engagement against the valve seat 56 . however , the counter force exerted by the counter force piston 50 through the spacer 96 reduces the overall sealing forces applied against on the poppet 58 , compared to the overall sealing forces that would be encountered in the absence of the counter force the counter force piston 50 creates . upon repair of the source of pressure failure , the operator can overcome the locking action of the valve 32 by shifting the control valve 26 into the second condition . as fig2 shows , and as previously described , this applies pressurized fluid in the pilot line 84 through the pilot port 74 into the first chamber 66 . pressurized fluid in the first chamber 66 bears against and moves the relief piston 44 to bring the spacer 96 into contact against the poppet 58 , lifting it away from the valve seat 56 . with communication open between the second and third chambers 68 and 70 , the operator can exhaust pressure from the chamber 18 in the controlled fashion previously described . since the counter force exerted by the counter force piston 50 reduces the overall sealing forces applied against on the poppet 58 , the magnitude of pressurized fluid required in the first chamber 66 to unseat the poppet 58 is reduced accordingly . in the illustrated embodiment , the locking valve 32 includes a push pin 98 in the bore end 90 . instead of applying pressurized fluid through the pilot port 74 as just described , the operator can manually press against the push pin 98 to move the relief piston 44 to unseat the poppet 58 . since the counter force exerted by the counter force piston 50 reduces the overall sealing forces applied against on the poppet 58 , the magnitude of manual force required to move the relief piston 44 and unseat the poppet 58 is reduced accordingly . alternatively , the push pin 98 can be coupled to an electrically actuated solenoid 106 ( shown in phantom lines in fig6 ). in the illustrated embodiment ( see fig1 ), the portion of the push pin 98 located outside the valve body 36 includes a through hole 110 . the hole 110 allows attachment of a padlock 108 or the like to lock the push pin 98 , to protect against accidental or unplanned actuation of the manual poppet release function . the presence of the counter force exerted by the counter force piston 50 significantly reduced the magnitude of force required to overcome the locking forces . in the absence of the counter force exerted by the counter force piston 50 , a force of about 44 pounds would be required to unseat a poppet valve 58 having a seat diameter of 0 . 75 inch , when exposed to a locking pressure of 100 psi in the third chamber 70 . in the presence of the counter force exerted by the counter force piston 50 , the force to unseat the same poppet at the same locking pressure is reduced to about 10 pounds . the significantly reduced unlocking force makes possible the use of manual pressure or an electric solenoid . the significantly reduced unlocking force also reduces wear and tear upon the poppet 58 and other valve components carried by the valve stem 40 . in use , air trapped in the first chamber 66 and the fourth chamber 72 also help reduce impact forces generated during opening and closing the poppet 58 . when either the relief piston 44 or the counter force piston 50 are moved , the resulting compression of air in the chambers 66 and 72 cushion the speed of the poppet 58 . the vent 80 slowly allows cushioned air to escape the fourth chamber 72 . wear and tear are further reduced . various features of the invention are set forth in the following claims .

US-92893597-A

apparatus for making tiles or slabs such as roofing tiles or paving slabs from castable material , comprises a sequence of platens on an endless conveyor which affords a substantially continuous surface onto which are laid plates and from which dividers are extensible between those plates to sever or at least partially sever a layer of castable material charged and compacted onto the plate . improvements include selective operation of dividers and their additional provision medially of the platens , selectively operable multiple drill head , charging roller , special plates for tiles to be bent , interlocked drive system .

in fig1 the tile or slab making machine has an endless conveyor 10 running about horizontally spaced drive / guide rollers 12 , 14 . the endless conveyor 10 travels in the direction c when driven and carries a plurality of platens 20 in end - to - end succession so that same will traverse upper and lower runs of the conveyor 10 and go about its end rollers 12 , 14 . on the upper run , the platens 20 go through successive stations for plate dispensing ( 22 ), concrete charging ( 24 ), finish layer charging ( 26 ), consolidation ( 28 ), drilling ( 30 ), cutting ( 32 ), and charged plate removal ( 34 ). in general , that is , of course , the basic arrangement described in our above - mentioned pat . no . 1302188 . as before , bases 35 of the platens 20 have upstanding sides 36 ( see fig2 ) but no ends so that concrete charged at 24 will be in a continuous layer from platen to platen , actually on plates 37 deposited on the platen at 22 and covering holes 38 in the platen bases 35 through which ejection - aiding plungers 39 are operable at the removal station 34 . also , spaces 40 are shown for divider plates 41 between successive platens 20 , and the divider plates are shown with extensions 42 at each side that carry rollers 43 for operation by a cam - track 44 in raising and lowering the divider plates 41 . in their lowered position , the tops of the divider plates 41 do not obtrude above the charging plates 37 , and may be substantially level with the platens 20 . if slightly higher , that can assist automatic plate dispensing at 22 by cooperation with a forward step or restriction thereat to force plates 37 to go only between tops of the divider plates 41 protruding above the bases 35 of the platens themselves . alternatively , and preferably , dispensing of the plates 37 is triggered by trips operated by the side extensions 42 of the divider plates 41 . the concrete charging station 24 is in the form of a hopper having at its exit 46 a positive discharge means in the form of a roller 47 equipped with suitable blading 48 and rotated in the direction of the arrow 47a . a helix of appropriate pitch is suitable for the blading 48 , see 148 in fig1 a for roller 147 . there , the helical blading is an upstanding rib 148 extending about 6 . 5 mm above the roller surface and with a pitch of about 150 mm . the roller itself has a slight taper , actually about 3 mm radius reduction in a roller length of 900 mm , and has a corresponding cant of the drive axis 147a so that its lower surface 147l is substantially parallel with the platen surface , i . e . also with the intended concrete surface . quite a small diameter roller can be used , for example 40 mm to 60 mm for fig2 . the larger end of the roller 147 is at the side of the machine to which its slight tendency to translate fed concrete is operative thereby to present progressive increase of peripheral speed to take fed concrete away without unwanted build - up at that end , and without interference to smooth and regular flow . at least for dry fed material , e . g . finishing sand , or where there is cleaning provision for the feed roller , an helical groove or grooves could be used instead of projecting blading ( rib ). a smooth positive flow of concrete onto the plates 37 is assured by the bladed roller 147 whose speed can be varied according to the desired or prescribed rate of production for the machine and in a manner suitably interlocked with the speed at which the conveyor 10 is driven . after the positive feed roller 47 is a compacting roller 49 also rotated in the direction of the arrow 49a and serving to exert a prescribed downward pressure on the concrete so as to produce a suitably strong , homogeneous , compacted tile of slab substrate . a doctor blade 50 is shown associated with the compacting roller 49 to clean excess concrete therefrom . another similarly rotating roller 51 thereafter is operative both to further condition the surface of the compacted charged concrete substrate and to serve as an abutment for the divider plates 41 which are lifted successively by the cam - tracks 44 to their raised position against the roller 51 to sever the concrete substrate between the plates 37 . it is not necessary for the divider plates 41 actually to reach the surface of the roller 51 , so long as the division made is readily finally broken , say at 31 in fig1 by a transverse cutter blade . fig1 shows , diagrammatically , only divider plates 41 between the platens 20 . however , as will be seen from fig2 the platens 20 actually have provision for intermediate divider plates , see slot or space 40 &# 39 ; and divider plate 41 &# 39 ; with associated side extensions 42 &# 39 ; carrying wheels or rollers 43 &# 39 ;. the slots or spaces 40 &# 39 ;, as shown , divide consecutive platens 20a , 20b in the ratios 2 : 1 and 1 : 2 in the direction of travel of the conveyor 10 , thereby enabling manufacture of slabs or tiles of two or three different equal lengths by selective operation of the divider plates 41 , 41 &# 39 ;, and loading of correspondingly sized charging plates 37 . that selection is conveniently done by appropriate removal / emplacement of divider plates 41 , 41 &# 39 ;, which enables use always of the same cam - tracks 44 to each side of the conveyor 10 . an alternative would be for there to be two cam - tracks 44a and 44b at each side of the conveyor 10 , see fig3 a and 3b , and for each cam - track itself to be selectively enabled . to that end , rollers 43 on every divider plate 41 between platens engage one cam - track 44a and rollers 43 &# 39 ; on every intermediate divider plate 41 &# 39 ; engage on the other cam - track 44b . it will be appreciated that alternate ones of the divider plates 41 also have further rollers 43 &# 34 ; engaging the cam - track 44b . the rollers 43 and 43 &# 39 ;, 43 &# 34 ;, respectively , and the corresponding cam - tracks 44a , 44b will be at different spacings and / or heights relative to sides of the conveyor 10 . selective cam - track selection is indicated by alternative full lines and dashed lines in fig3 a with means for achieving same by pushing / pulling part thereof having inclined parts cooperating with rollers . the secondary charging station 26 for any desired finish or facing layer , such as sand , is shown as another hopper in the same system as the concrete charging hopper , but could by physically separate if desired . that secondary charging station 26 is also preferably provided with positive discharge means again shown as a rotating roller 52 with suitable blading 53 , and is further associated with a counter - rotating roller 54 that will skid on the surface of the concrete to assure even distribution of sand thereon . a doctor blade 55 is shown associated with the spreading roller 54 . thereafter , the finish or facing layer is consolidated with the concrete substrate by a series of rollers 56 bearing thereon at station 28 in a carriage 57 that is reciprocated to - and - fro in the direction of travel of the conveyor 10 . downward pressure is required of the carriage 57 and rollers 56 for consolidation purposes , but need not be as great as was required hitherto . the rollers 56 will bear on the concrete via an elastomeric compression sheet , which can apply a particular pattern if same if required to be imposed on the finished or faced surface . the next stage is the drilling stage 30 where holes are made in the slabs or tiles at positions appropriate to their size and type . a plurality of drills 60 are shown , one for each possible position of several sizes and types of tile or slab , preferably corresponding to all normal production options for the machine . the drills 60 are each indicated as spring biassed , see 61 in fig4 b , for cushioned engagement with the plates 37 . the drills 60 are carried on drill frames 62 themselves movable down pillars 63 by actuator 64 against spring bias 65 . except when operated by actuators 64 , the drill frames 62 and drills 60 are returned from their drilling positions . the actuators 64 may comprise pneumatic rams one each for plural drill frames 62 , see subscripts a - e . if desired , depression of the drills may be accompanied by application of a turning drive say be selectively operable air motors . additionally or alternatively one or more frames like 62 may carry cutting blades , for example that shown at 31 in fig1 . the pillars 63 are shown extending upwardly from sides of a main frame 66 that is reciprocable in the direction of the conveyor 10 , as shown by trunions 67 and rollers 68 relative to tracks 69 between beams 70a , 70b at both sides of the overall machine frame . in operation , the main frame 66 is picked up by each divider plate 41 , 41 &# 39 ; in turn , conveniently by their extensions 42 , 42 &# 39 ; or , as shown , their wheels or rollers 43 , 43 &# 39 ; via contact with wheel or wheels 71 on a pick - up arm or arms 72 . at its other end , such arm 72 has a wheel or roller 72r in a rising track 73 on the machine frame , see at 70a , so as to raise that arm 72 through a block or guide 74 on the main frame 66 as the latter is moved in the direction of the conveyor 10 until roller / wheel engagement at 71 , 72 is lost , whereupon the main frame 66 is automatically returned by means not shown and is then ready to be pushed up by the next divider plate 41 , 41 &# 39 ;. during its upward movement the pick - up arm 72 will operate a microswitch in the block or guide 74 serving to operate one or more of the actuators 64 . the microswitch , see 75 in fig5 may be interlocked with tile type - specifying means , such as further switches 76 via suitable interconnections or logic at 77 to determine an appropriate one or more of the actuators 64 for operation over lines 78a - 78e . when operated , any drill frame 62 descends to push its drills 60 into the cast tiles or slabs below it . those drills 60 are shown guided through holes in an angle member 80 itself supported at 81 on posts 82 slidable through the drill frame 62 against spring loading 83 affording further cushioning relative to the cast tiles or slabs and thus further facilitating operation relative to a variety of thicknesses thereof . undersides of the angle members 80 have pierced drill pads 84 that first engage the tiles or slabs . it will be appreciated that such an angle member or members 80 could alternatively , even additionally , carry cutting blades ( not shown ) and serve simply a transverse cutting function if without drills 60 , and same may be controlled along with the drill frames 64 from extension of the circuitry 77 of fig5 see dashed at 85 . as will be clear , machines hereof most conveniently make pluralities of slabs or tiles side - by - side actually charged in one homogeneous layer that is first divided transversely of the conveyor 10 by the divider plates 41 , 41 &# 39 ;, if necessary completed at 31 or within the drilling station 30 , and then slit in the other direction by blades 86 at the station 32 . accordingly , the pneumatic rams 64 will operate corresponding sets of the drills 60 via frames 62 according to selection of tile type or size . if desired , of course , some of the drills 60 may be individually associated with controlled latches , or alternative frames 62 fitted simply over the pillars 63 . pneumatic rams are preferred for operating the drills 60 , at least partly because pressure is preferably applied wherever necessary throughout the machine by pneumatic means as it is inherently less &# 34 ; hard &# 34 ; than hydraulics or mechanical means unaccompanied by &# 34 ; soft &# 34 ; absorbers etc . turning to fig6 one practical arrangement is shown for controlling the various drives of the machine of fig1 . individual motors are used for various parts and are given the same reference as the parts they drive , but subscripted m . each motor is shown with an individual potentiometer type control , subscripted p , for basic setting up and fine tuning of the machine , and conveniently available from well - known a . c . starter control units . a basic requirement at set - up is for the take - off conveyor at station 34 to run slightly faster than the main conveyor 10 . afterwards , however , speed setting will normally require proportionate changes at each of the controlled motors , see controller 90 , which may be of a . c . inverter type , and dashed connection 91 to all motor control potentiometers . it will be noted that the main charge spreading and compression plain roller 49 and the cutting abutment roller 51 are shown sharing a common drive , which is normally convenient . it is , in fact , normally also convenient for the finish material charge roller 52 and the counter - rotating roller 54 also to share the same drive motor , hence sharing 54m etc . dashed in fig6 . the consolidation roller motor control is also shown dashed in fig6 as its resilient membrane is actually moved by the cast tiles or slabs and applied downward pressure on the frame 57 and a constant rate of movement of its rollers 56 may well be tolerable . additionally , fig6 shows circuitry 92 responsive to type selection for applying individual variation at least to the finish material charging control 49 , 51p , the main speed control 90 to take account of overall constraints that may apply for particular types , and for the main charging roller 47 . the latter is shown via thickness control circuitry 93 which it may be useful to have individually variable ( shown conventionally ). additional connection is shown to the consolidation roller stage 28 as same may be applicable to using different resilient membranes say for pattern effects . special bent tiles , e . g . for ridges , hips or valleys , are readily made on the same machine , but preferably via special plates 37 &# 39 ;, see fig7 that are made of medially reduced thickness , see 101 , so that the tile produced is of greater thickness medially . actual bending can be done from the plate - side of the tile by dropping the finished side onto a sheet or flexible material , for which hessian will serve . such flexible material , see 102 in fig8 is , advantageously according hereto , on two boards 103 , 104 hinged to a tie 105 that limits the relative angular position attainable by the boards , preferably adjustably via preset pin holes 106 . the boards can be flat at placement of the tile or slab on the hessian and moved to the desired position during rolling ( 107 ) of the tile over its thickened part .

US-1405187-A

this invention relates to an improvement in nucleic acid hybridization technology . nucleic acids bind to complementary partners in a predictable manner such that the detection of complementary partners is possible . the acceleration of the binding process is desired objective and will find broad application in a variety of industrial , medical , and research uses . in particular this invention relates to the acceleration of nucleic acid hybridization by heterogeneous nuclear ribonucleoproteins .

the hnrnps of use in this invention are obtained from the core proteins of the heterogeneous nucleoprotein particle . this particle is typically made up of several different core proteins ranging from 32 , 000 to 42 , 000 daltons . the core proteins of use in this invention are distinguished by their typically being the smallest protein of the group and by their carboxy termini which are capable of hnrnp / hnrnp intermolecular attraction . the determination of hnrnp / hnrnp interactions is made through routine titration experiments where acceleration of annealing is measured ( see example section ). alternatively , one can predict in some hnrnp core proteins which will accelerate hybridization by identifying the presence of a glycine - rich ( approximately 40 %) cooh terminus . the determination of a glycine rich termini is made by comparing the number of glycines present in the first half of the protein with the second half . ( j . biol . chem . 263 : 3307 - 3313 ). a preferred hnrnp is a human core protein typically designated a1 hnrnp . it may be obtained as a naturally occurring protein by purification from hela cells or as a heterologous expression product by isolation from a genetically engineered cell expressing the a1 hnrnp gene or cdna . the preferred method of isolating natural - occurring hnrnp is as described in detail by kumar et al . j . biol . chem . 261 : 11266 - 11273 , 1986 . in brief this method involves the isolation of the 20 - nm monoparticles from purified nuclei . the monoparticles are isolated in a sucrose density gradient . core protein a1 is obtained by one - step chromatographic procedure which relies on the inherent tendency of the other core proteins to aggregate into polymorphic forms . the 40s particles are dialyzed into a buffer of 2 . 0 m nacl to dissociate the particles . the extract is further enriched with a1 by elution through a gel filtration column in the high salt buffer with sh - reagents and collecting the appropriate fraction . alternatively cdna encoding the rat a1 hnrnp has been cloned and expressed in mouse myeloma mopc - 21 cells according to cobianchi , et al ., j . biol . chem . 261 : 3536 - 3543 , 1986 . the cobianchi reference also provides the nucleotide sequence for the rat a1 hnrnp . the protein ( about 0 . 5 mg / ml ) is fairly stable and can be stored at - 80 ° c . in 10 mm tris ph 8 . 0 , 0 . 1 mm edta , 0 . 1 mm dithiothreitol and 1 m nacl . repeated freeze thawing cycles are acceptable but not recommended . the proteins of use in this invention function by binding to nucleic acid and by interacting in an unknown manner to facilitate hybridization of complementary nucleic acid sequences . the carboxy terminus of these proteins are required for acceleration of annealing and for intermolecular interaction ( hnrnp / hnrnp interaction ). the hnrnp proteins of this invention are conserved across taxonomic genera and families . allelic polymorphism is found within species . in addition , through recombinant genetics one , may introduce , substitute or delete various amino acids without inhibiting the ability of hnrnp to accelerate duplex formation . for example the glycine rich domain may be enriched with equivalent amino acids such as proline . this invention and the term hnrnp is meant to embrace all analogous proteins having the functional ability to accelerate annealing between nucleic acids . these proteins embrace both naturally occurring forms and synthetically modified forms . this invention also provides for a method of accelerating hybridization at elevated temperatures ( above 45 ° c .). the proteins of use in this method include single stranded nucleic acid binding proteins . these proteins include hnrnp and also include single stranded binding proteins and reca . such proteins are known in the art as mediators of nucleic acid annealing . ( see for example j . mol . biol . 115 : 441 ; proc . natl . acad . sci . u . s . a . 82 : 5666 - 5670 ; and biochemistry 28 : 1062 - 1069 ). the reaction conditions are as provided below for hnrnp , although optimal reaction conditions may require some routine titration experiments ( e . g ., the addition of magnesium ). nucleic acid hybridization assays are well known in the art . this invention is not limited to any particular mode of practicing these assays . hybridization techniques are generally described in nucleic acid hybridization a practical approach , ed . hames , b . d . and higgins , s . j ., irl press 1987 . as improvements are made in hybridization techniques , they can readily be applied to this invention . the acceleration of nucleic acid annealing has many uses . the uses include northern and southern analyses , subtractive hybridization , plaque colony screening using nucleic acid probes , and the polymerase chain reaction amplification process . clinical applications include : diagnostic assays for pathogens , and disease states ; and genetic profiling for medical or forensic uses . various hybridization solutions may be employed in the reaction mixture . standard hybridization solutions often contain protein denaturants such as detergents , polar organic solvents such as formamide or guanidine salts . such solutions are not recommended for protein mediated assays . the preferred solutions for this invention have a ph of between about 4 . 0 and about 10 , most preferably between ph 6 and 8 . edta may be included in the hybridization solutions . standard salt conditions for hybridization assays include the use of monovalent salts ( e . g ., potassium or sodium ) in concentrations of 1 mole or greater . under the conditions such as provided in the examples below , high concentrations of monovalent cations have been noted as inhibiting hnrnp mediated acceleration of annealing . although hybridization conditions may possibly be varied to obtain acceleration of annealing under high salt conditions , it is recommended that the total monovalent salt concentration be kept between about 80 and 120 mm . minor amounts of magnesium salts , non - specific blocking agents such as bovine serum albumin may be included in the hybridization reaction mixture . in addition , the hybridization solutions may optionally contain unlabeled carrier nucleic acids from about 0 . 1 to 5 mg / ml fragmented nucleic acid , dna , e . g ., fragmented calf thymus dna or salmon sperm dna , or yeast trna or yeast rna . other additives may also be included , such as the volume exclusion agents ( e . g ., dextran sulfate at about 5 - 10 % w / v ). the recommended quantity of hnrnp is dependent upon the quantity of nucleic acid present in the reaction mixture . the hnrnp is thought to coat the nucleic acid with multiple hnrnp bound to each strand . for effective acceleration of annealing , a minimum of a five fold excess of hnrnp by weight over the total weight of nucleic acid present in the reaction mixture is recommended . more preferred is a 10 - 20 fold excess of protein by weight over the total nucleic acid . where nucleic acid concentrations are very low , increased amounts of hnrnp may be required . reaction temperatures will influence the hybridization rates even in the presence of hnrnp . the reaction temperature conditions are between 20 °- 80 ° c . or above , and preferred temperatures are 37 °- 65 ° c . there is a noticeable increase in acceleration of annealing as temperatures increase with 65 ° c . being a preferred reaction temperature for hybridization . by &# 34 ; nucleic acid sequences &# 34 ;, it is meant that the nucleic acids are in a polymeric form . typically these are the naturally occurring 5 &# 39 ;- 3 &# 39 ; covalent bonds forming a phosphodiester backbone . both natural and synthetic polymers are operable in this invention . such synthetic polymers would include unnatural bases and variations in the natural 5 &# 39 ; to 3 &# 39 ; bonding . the size of the sequence is not critical . typically the polymers are of a size to permit hybridization to be sufficiently specific to function successfully in the assay and avoid nonspecific binding to non - targets . preferably the polymers are about 33 nucleotides long ---- up to several kilobases . exact complementarity between strands is not required . by varying the stringency of the hybridization mixture , one can achieve satisfactory results with strands of nucleic acid that are not exact complements of each other . nucleic acids hybridizations may be run in a variety of modes . it is expected that one of skill is familiar with nucleic acid hybridization assays and no attempt is made here to describe in detail the various modes available to workers in the field . the acceleration of annealing with hnrnp can be achieved in both homogeneous and heterogeneous nucleic acid hybridization assays . homogeneous nucleic acid hybridization assays involve assays where both complementary nucleic acids are free in solution . heterogeneous assays involve the immobilization of at least one nucleic acid polymer to a solid support . these supports include but are not limited to filter papers , gels , nylon , magnetic beads , glass , carboxy and amino activated inert solids such as teflon or plastics . immobilization can be non - covalent through ionic or hydrogen bonding interactions or through covalent bonding . heterogeneous assays are well known in the art . the reaction modes include but are not limited to binary , ternary or quaternary levels . binary modes are reactions which rely only upon annealing between two separate nucleic acids , one of which is typically labeled . ternary and quaternary modes involve sandwich assays where multiple nucleic acid polymers are annealing to each other . the hnrnp mediated annealing does not effect the means for detection of hybridization . all standard methods are useful . these include radioisotopes , fluorophores ( e . g ., fluorescein ) and enzymes ( e . g ., horseradish peroxidase or alkaline phosphatase ) as reporters or labels . the reporters can be either directly attached to one of the nucleic acid polymers or indirectly attached through a ligand / receptor configuration . methods for detection are well known in the art and variations and improvements are within the scope of this invention . all references are incorporated by reference herein . the following examples are offered by way of illustration and not by way of limitation . a comparison of nucleic acid hybridization rate in the presence of a1 hnrnp and in its absence demonstrates the dramatic hnrnp mediated increase in the rate of hybridization . the assays used nucleic acid from a hind iii / bgl ii digestion of plasmid psv2gpt ( science 209 : 1422 - 1427 , 1980 ). the double stranded segment used has 120 nucleic acid bases per strand and comprises a dna segment adjacent to the xanthine guanine phosphoribosyl - transferase gene from e coli . both strands were end labeled with 32 p by filling the recessed 3 &# 39 ; ends according to maniatis , t ., fritsch , e . f ., and sambrook , j ., 1982 , molecular cloning : a laboratory manual , cold spring harbor laboratory , cold spring harbor , n . y . [ maniatis ] ( at page 113 ). the count was approximately 10 8 cpm per microgram of nucleic acid . the nucleic acid was placed in a hybridization reaction mixture of 20 μl containing , 10 mm potassium phosphate ph 7 . 0 , 1 mm edta , 100 mm nacl , 1 . 25 ng / ml of the end - labeled complementary nucleic acid ( previously rendered single stranded by heating at 95 ° c . for 5 minutes with 10 mm potassium phosphate buffer / 1 mm edta and rapid chilling in ice water until added to the reaction mixture ), and 711 ng / ml of a1 hnrnp ( added last to the experimental mixtures ). the reaction mixtures were incubated at 65 ° c . for 0 , 1 , 2 , 4 , 8 , 16 and 32 minutes . the reactions were stopped by diluting 5 μl of the reaction mixture to 20 μl final volume of solution containing 0 . 1 % sds , 50 μg / ml trna , 5 % glycerol , and 0 . 05 % bromphenol blue . the reaction products were then extracted with phenol : chloroform ( 1 : 1 ) and the aqueous phase was loaded onto a 10 % polyacrylamide gel and electrophoresed for 2 hours at 10 v / cm . the gels were run in a tris / borate buffer according to maniatis ( 1982 at page 454 ) the gels were then dried and subjected to autoradiography to determine the extent of hybridization . the extent of hybridization was readily determined by comparing the density of single stranded dna to double stranded dna in each lane on the gels . under the given conditions , there is no appreciable annealing detected after 32 minutes without a1 hnrnp . the half - time for annealing under the identical conditions with a1 hnrnp present is less than about 1 minute . 2 . the influence of a1 hnrnp on acceleration of nucleic acid hybridization rates compared to standard hybridization conditions the reaction conditions were identical to those given in example 1 except reaction mixture a contained 120 mm potassium chloride and 400 ng / ml a1 hnrnp . reaction mixture b contained 1 m nacl representing standard hybridization conditions . reaction mixture a was incubated for 5 minutes at 65 ° c . and mixture b was run for 5 minutes at 68 ° c . the autoradiographic results indicated that after five minutes , reaction mixture a contained 100 % duplexed nucleic acid and no detectable single stranded nucleic acid . mixture b had no detectable double stranded nucleic acid . the relative acceleration was estimated to be at least 100 fold faster due to a1 hnrnp . 3 . the influence of temperature upon the a1 hnrnp mediated acceleration of nucleic acid hybridization rates the reaction conditions were identical to the reaction conditions provided in example 1 except the mixtures had 4000 ng / ml a1 hnrnp . the reaction mixtures were incubated for 5 minutes at 0 ° c ., 23 ° c ., 37 ° c ., 50 ° c . and 65 ° c . the results demonstrated that acceleration was optimized at the higher temperatures with 100 percent of the label being associated with the double stranded nucleic acid at 65 ° c . after 5 minutes and about 50 % of the label being found in the double stranded nucleic acid after 5 minutes at 37 ° c . 4 . a1 hnrnp mediated acceleration of nucleic acid hybridization in the presence of excess heterologous dna to establish that a1 hnrnp would accelerate nucleic acid hybridization in the presence excess heterologous dna such as would be found in a clinical sample , reactions were run in the presence of m13mp18 single stranded dna ( m13 - ) or m13mp18 single stranded dna having the same 120 bp target sequences , as described above , cloned into it ( m13 + ). the reaction conditions were identical to example 1 except the a1 hnrnp was at 16 , 000 ng / ml . the temperature was at 65 ° c . and each reaction was allowed to hybridize for 5 minutes . reaction mixture a contained no heterologous dna . reaction mixture b contained a 1000 fold excess of only m13 - ( 25ng ). reaction mixture c contained m13 - ( 22 . 5 ng ) and m13 + ( 2 . 5 ng ). reaction mixture d contained only m13 + ( 25 ng ). after 5 minutes at 65 ° c ., the hybridizations were completed . no significant inhibition of hybridization was detected in mixture b over mixture a . no significant inhibition of hybridization was noted in mixtures c and d wherein it was clearly established that the placement of the target within flanking noncomplementary sequences does not significantly inhibit the ability of a1 hnrnp to effectively accelerate the hybridization rates . similar results were obtained with boiled genomic dna replacing the m13mp18 dna . no strong preference was noted for the annealing of the short nucleic acids ( probes ) to the target sequences regardless of whether the target was a short fragment or a part of a larger fragment ( cloned into a m13 dna ). moreover , the experimental results were analogous when the hybridizations were run at 37 ° c . although hybridization rates are slower . although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding , it is obvious that certain changes and modifications may be practiced within the scope of the appended claims .

US-44417989-A

a battery pack adaptor can be attached to any one of a number of brands of video cameras and can have any one of a number of brands of battery packs attached to it , so that any one of the cameras can be operated by any one of the battery packs interchangeably . the adaptor also has an arm for an electric lamp to be powered by the battery pack . the arm can be swung between left and right hand positions depending on the location of the lens system of the camera on which the adaptor is to be used .

a battery pack adapter 10 according to the invention has a front seating surface by which the adapter can be attached to any one of the above - described video cameras and a rear seating surface to which can be attached any one of the battery packs previously described . referring initially to fig5 the front seating surface of the adapter includes two electrically conducting receivers 12 at the lower edge for the terminals g2 of a canon camera and corresponding generally to the terminal receivers h1 of the canon battery pack . above the receivers 12 , are two horizontally extended electrically conducting receivers 13 which can accommodate either the pins a1 of the sony camera or the pins c1 of a panasonic camera . at the top and bottom of the receiving surface , are provided respective switches for raising and lowering terminal receivers 15 for the terminals e2 of a hitachi camera and generally corresponding with the terminal receivers f2 of the hitachi battery pack . the terminals 15 are controlled by the switches 14 for use with the hitachi camera . respective notches 16 , 17 and 18 are provided for the latches a2 , c2 and e3 of the sony , hitachi and panasonic cameras . top and bottom , the adapter has recess 11 to fit the respective flanges of the various cameras . referring to fig6 the rear seating surface of the battery pack has channels at the top and bottom with flanges 19 corresponding to the flanges at the back of each of the respective video cameras . a horizontally extending recess is provided in the rear seating surface and a horizontal swing arm 30 is pivotally mounted in the center of the recess . the swing arm 30 has a vertical leg carrying a casing 31 at the top of which is a seat 32 for a flash or flood light . the seat 32 includes two sets of symmetrical electrically conducting terminal 33a , 33b . symmetrical control switches 34a , 34b ( fig4 and 5 ) are provided on the opposite faces of the casing 31 . either switch 34a or 34b can be used to control the light , depending on the orientation of the arm 30 either to the left or to the right of the adapter 10 depending on the type of camera with which is being used . the casing 31 includes an electric circuit for the light which does not form part of the present invention but which is incorporated in applicant &# 39 ; s co - pending application relating thereto and incorporated herein by reference . an electrically conducting socket 35 is provided in one side wall of the casing 31 . the top and bottom edges of the radial arm 30 are provided with recess to receive projections 21 in the recess 20 and positively locate the arm 30 either in the left or right hand position . below the arm 30 , the rear seating surface of the adapter is provided with two sets of electrically conducting terminals 22 , 23 . the terminals 22 correspond with the electrically conducting pins al of a sony video camera and are to be used with the terminal receivers b1 of a sony battery case . similarly , the terminals 23 correspond with the terminals cl of a panasonic camera and are to be used to the terminal receivers d1 of the panasonic battery case . at the top edge of the adapter are terminals 24 to be used with a canon battery case and there are top and bottom terminals 25 to be used with a hitachi battery case . fig7 shows the electrical connections between the terminal receivers 12 , 13 and 15 on the front seating face of the adapter and the terminals 22 , 23 , 24 and 25 on the back seating face . internally , the adapter includes a pc board locked in place and having a &# 34 ;+&# 34 ; polar zone and a &# 34 ;-&# 34 ; polar zone . the terminal receivers 12 , 13 and 15 are connected by wiring to the respective zones of the pc board on its front face and the terminals 22 , 23 are welded to the respective zones on the back of the pc board . the respective connecting wires are shown at 121 , 151 , 241 , 251 . additionally , the casing 31 of the swing arm 30 also includes a pc board for operation of the lamp . in this case , the respective terminals 33a , 33b are connected to the circuit board by wiring 36 and it is understood that the polarity of this circuit is also divided into suitable positive and negative zones . after passing through the control switches 33a , 33b for the lamp circuit board , the lamp circuit is connected to the positive and negative polar zones of the pc board 40 by wires 37 , which conveniently extend through the pivot connection of arm 30 . this wiring enables the lamp seat to be supplied with electrical energy from an attached battery case in either left or right - hand position of arm 30 . additionally , the electrically conducting socket 35 on the side of casing 31 can be connected to the control circuit board and into the board 40 by suitable wiring similar to wires 37 . it is evident that the electrical circuity for the interior of the invention includes the various elements connected in series . the above described adapted structure provides compatibility between the different brands of cameras and battery cases previously described and also provides for battery charging and installation of a sunlamp either on the left or right - hand side of the adapter . fig8 a - 8e show how the adapter 10 can be fitted to the back seating surface of any one of the above noted video cameras . thus , for attaching the adapter to a sony brand camera a , the flanges a3 at the top and bottom edge of the camera are inserted into the slideways 11 at the top and bottom edge of the adapter . the two terminal receivers 13 are positioned so as to contact the two electrically conducting pins a1 and the latch a2 is located in the notch 16 . any one of the battery packs previously described can then be inserted on the rear seating face of the adapter as will be described . for the panasonic brand camera c , the flanges c3 on the camera are inserted again in the slides 11 at the top and bottom edge of the adapter 10 . the two electrically conducting terminal receivers 13 in this case will contact with the pins c1 on the camera and the latch c2 is received in the notch 17 of the adapter . again , any one of the battery cases can be used . for the hitachi brand camera e , the flanges e1 are again receivable in the slide 11 and the terminal receivers 15 are brought into position by means of the respective switches 14 so as to contact the terminals e2 at the top and bottom of the camera . the latch e3 is received in notch 18 of the adapter . for the canon brand camera g , the casing 10 of the adapter is inserted directly into the surrounding flange g1 at the back of the camera . the two terminal receivers 12 at the bottom edge of the adapter will contact with the two electrically conducting terminals g2 at the bottom of the camera and the latch g4 will be received in the slideway 11 . the compatibility between the adapter 10 and any one of the respective battery cases is shown in fig9 a - 9e . for the sony brand battery case b , the projecting flanges 19 at the back of the adapter are inserted into the recesses d3 at the top and bottom edges of the battery case and the battery case is slid into place . the electrically conducting terminals 23 are positioned so as to contact the receivers b1 . likewise , for the panasonic brand battery case d , the flanges 19 are inserted in the respective recesses d3 and the battery cases again are slid into position . in this case , the two electrically conducting terminals 23 are in electrical contact with the two receivers d1 . for the hitachi brand battery case f , the flanges 19 are again inserted in the slideways d3 at the top and bottom edges of the battery case . the terminals 25 at the top and bottom of the adapter will in this case contact the terminals f2 on the battery case . finally , for the canon battery case h , this is inverted so that the terminals h1 face upwards and the case is used in this position on the back of the adapter . in this case , the terminals 24 are used in connection with the receivers h1 . by the above , it is evident that the battery cases can be used interchangeably with any one of the video cameras using the inventive adapter . the inventive adapter can also be used as a charger for any one of the battery cases either when the battery case is attached to or disconnected from one of the respective cameras . when charging , the camera is in the off status and a rectifier can be used to connect mains ac electricity to the electrically conducting socket 35 in the casing 31 . when the electrical supply is reduced and rectified , it is transmitted to an attached battery case at the back of the adapter through the electrically conducting pole 35 , the wires 37 and the pc board 40 for charging the battery case through the respective terminals in the adapter and the terminal receivers on the battery case . fig1 a and 10b show how the swing arm with an attached lamp 50 can be used either in the right hand or left hand orientation on the back of the adapter 10 with , for example , a sony brand video camera as shown in fig1 a or with a panasonic brand camera as shown , for example , in fig1 b . this is done by swinging the arm so that the strips 21 at the top and bottom edges of the channel 20 engage the respective recesses ( not shown ) in the arm 30 . then , the lamp is inserted in the lamp seat 33 at the top of casing 31 . upon insertion , a terminal 51 at the front edge of the bottom of the lamp 50 is brought into electrical contact with the front set of electrodes 33a on the sunlamp seat . this causes the lamp 50 to be supplied with electricity from a battery case when attached to the back of the adapter . the lamp should only be attached after the radial arm has been swung either to the left or right hand position . depending on the left or right hand positioning of the arm , either set of terminals 33a or 33b will be in use for the sunlamp and these are controlled by either one of the switches 34a and 34b . it may here be noted that the switches 34a and 34b provide three different control modes for the lamp . in the first mode , synchronous operation , the on and off operation of the lamp is synchronous with the photography of the camera . for example , when the switch for operating the camera is on , the lamp 50 lights synchronously to supplement illumination . when camera operation is terminated , the lamp 50 is also switched off . in the second mode of operation , the lamp is permanently off , there being no power supplied from the battery case . in the third mode of operation , power is continuously supplied from the battery case to the lamp irrespective of the operation of the attached camera . while only preferred embodiments of the invention have been described herein in detail , the invention is not limited thereby and modifications can be made within the scope of the attached claims .

US-93309192-A

this invention encompasses a substantially homogeneous lipid chemoattractant released from stressed mammalian tissue which is a neutral lipid which is acid labile and stable to base and is stable in boiling water . this lipid recruits macrophages but not neutrophils to stressed tissue . the invention also encompasses a method for detecting injured tissue by detecting the presence of the above described lipid chemoattractant in body fluids such as urine , serum and saliva . the invention also includes a method for reducing recruitment of macrophages to injured tissue by reducing the amount of the above lipid chemoattractant or by blocking the interaction of this lipid chemoattractant with its macrophage binding site . the addition of this lipid chemoattractant to injured skin tissue promotes healing .

this invention is a purified lipid chemoattractant derived from stressed mammalian cells as well as a method for purifying the lipid chemoattractant . furthermore , this invention includes inhibitors of the lipid chemoattractant as well as inhibitors of monocyte chemotaxis . the purified lipid chemoattractant of this invention is useful for developing methods and agents for detecting the lipid chemoattractant in stressed mammalian cells . the purified agent is also useful for developing and identifying inhibitors of the agent as well as inhibitors of monocyte chemotaxis , the physiological mechanism that produces the agent . the purified lipid chemoattractant of this invention can also be used topically or internally to promote wound healing . the isolation and purification of the lipid chemoattractant of this invention has permitted us to study and characterize the agent based on it chemical and biological characteristics as well as its structure . our understanding of the chemical structure of the lipid chemoattractant of this invention is based on a number of types of studies performed on the agent including refining and improving methods for purifying the agent , characterizing biochemical properties of the agent , characterizing the metabolic pathway to synthesis of the agent , identifying inhibitors to the synthesis of the agent , by identifying inhibitors of monocyte chemotaxes and by preparing synthetic analogs of the agent . none of these characterization efforts nor the identification of inhibitions would have been possible without first having a substantially homogeneous form of the lipid chemoattractant to work with . a purification method that reproducibly yields a substantially homogeneous monocyte chemotactic factor released by glomeruli or renal interstitium has also been developed . previous attempts at characterizing this factor were difficult because isolated fractions possessing biological activity were extremely heterogeneous and insufficient purity precluded biochemical definition of the lipid chemoattractant . the identification of this novel factor as a neutral lipid and its unusual stability to alkaline methanol has allowed further refinement in its isolation such that we can prepare the lipid factor , with potent chemotactic activity , with minimal contamination by other lipids from both tissue conditioned medium and bodily fluids such as urine . unpurified sources of the lipid chemoattractant include , but are not limited to the mouse monocyte leukemia line , raw 264 . 7 is used as an indicator . the cell line is distinctive for its normal responsiveness to physiological concentrations of macrophage activation signals , including endotoxin and gamma interferon . these cells have been used as a model system for evaluating monocyte chemotaxis . these cells are periodically compared to glycogen - elicited rat peritoneal macrophage to assure their reliability . in a standard protocol for eliciting the release of a chemotactic factor , rats are injected with rabbit anti - rat glomerular basement membrane antibody . control rats received rabbit immunoglobulin prepared from non - immune serum . the glomeruli are harvested 12 hrs . later after saline - perfusion of the kidney and cultured in rpmi 1640 with 10 mm hepes and 0 . 25 % fatty acid free albumin . after 2 hours , the glomeruli and medium are extracted by the method of bligh and dyer or , in a preferred step , with ethyl acetate . aliquots tested in micro chemotaxis chambers , according to the method of falk , falk , w ., et al 1980 . j . immunol . meth . 33 : 239 , demonstrate chemotactic activity as measured by the enumeration of cells migrating through filters . parallel extractions of normal glomeruli and efa - deficient glomeruli yield no activity . we have identified numerous physical , chemical , and biological properties for this novel neutral lipid macrophage chemoattractant . the factor is insensitive to trypsin , pronase , or collagenase . inhibitors of cyclo - oxygenase and lipoxygenase activity exert no effect on the generation of the chemo lipid in vivo or in vitro , but conditions favoring oxidation increase its activity . it is not inactivated by heating up to 100 ° c . for five minutes . it cannot be modified by diazomethane indicating the lack of a free carboxy group . the factor can be sililated with trimethylsililate ( bstsmfa ), delaying its elution on hplc , with recovery of biological activity after hydrolysis in an aqueous medium . this suggests the presence of free hydroxyl or amino groups . it is extracted into ethyl acetate and migrates as a neutral lipid by tlc and hplc chromatographic techniques . exposing the material to 0 . 5n koh in methanol results in no loss of chemotactic activity . however , subjecting the material to 0 . 5n hcl in methanol for 30 minutes effected virtually complete loss of detectable chemotactic activity as did exposure to concentrated hcl fumes , indicating that the biological active molecule has a vinyl ether or similarly acid labile linkage , and that an ester bond is not necessary for biological activity . lipid phosphorus is not detected on either the tlc fraction or the active hplc fractions either by phosphomolybdate spray ( tlc ) or by ashing ( hplc / tlc ) and assaying by the method of rouse et at ., rouse , r ., fleischman , b ., and yamamoto , f . 1970 . lipids 49 : 497 . it is sensitive to reduction by vitride or sodium borohydride . this factor has no chemotactic activity for polymorphonuclear leukocytes ( fig2 ). according to all thin layer and column - based chromatographic analyses , the lipid chemoattractant of this invention is a short - chain ( n & lt ; 12 ) monoalkyl glycerol or an oxidized long - chain ( n & gt ; 16 ) monoalkylglycerol . in summary , its chromatographic properties as an acid sensitive , non - polar lipid with no effect on neutrophils distinguishes it from platelet activating factor and ltb 4 ( fig1 ), the only other defined lipid macrophage chemotactic factors , and identify the isolated factor as novel . it has been demonstrated that the proximal tubules are a source of the chemotactic lipid by isolating proximal tubules by density sedimentation of renal cortical digests from albumin - injected rats . when proximal tubules were placed in overnight culture , lipid extracts of harvested supernatants demonstrated release of considerable chemotactic activity . the elution characteristics on hplc were identical to those described above . on the other hand , extracts of supernatant from the culture proximal tubules from control rats were inactive . chemoattractant activity can be stimulated in proximal tubules from normal rats placed in overnight culture in medium containing 5 mg / ml of lipid replete bovine serum albumin ( bsa ). supernatant from the tubules cultured in the presence of lipid - replete albumin contained chemotactic activity similar in magnitude to that seen in the supernatants of tubules from the protein overloaded animals . however , the supernatants from the tubules cultures in the presence of lipid - depleted albumin contained little activity . the isolated activity from the lipid - repleted bsa supernatants showed mobility identical to that of the activity in the urine of proteinuric rats on tlc . the elution profile of chemotactic activity recovered from proximal tubules on hplc was superimposable on that observed in the urine of proteinuric animals . ( fig3 ) feeding the proximal tubules albumin that has been selectively loaded with individual fatty acids has demonstrated that oleate and the myristate are the most stimulatory fatty acids . using the system of extraction into ethyl acetate , separation by tlc and purification by reverse phase hplc as described in examples i and ii below , we have identified a molecule with identical chromatographic properties in the urine of patients with progressive proteinuric kidney disease . we have also identified the molecule in the plasma of humans with atherosclerosis and the relative absence of the molecule in patients without the condition ( fig6 ). conditions in which high levels of this lipid chemoattractant has been identified include diabetes , membranous nephropathy , focal segmented sclerosis and glomerulonephritis . two patients with proteinuria and stable renal function have control levels of this agent . these data indicate that the presence of this material in urine and other fluids has diagnostic and prognostic utility for detecting tissue injury such as the kidney . ( table i ). the lipid chemoattractant is detected mammalian tissues and serum sources by subjecting the tissues and serum or any other potential source of lipid chemoattractant to the purification methods described in examples ii and iii . the resulting pooled product then undergoes standard bioassay testing to determine whether or not the lipid chemoattractant is present and also to determine the amount present . the lipid chemoattractant has additional distinctive attributes . it is not sequence or species specific . the same factor , as defined by chromatographic characteristics and biological activity , has been isolated from humans , rats , and mice . monocytes from any of these species are equally responsive to the factor regardless of the species from which it is isolated . cells or organs known to produce this factor include vascular smooth muscle cells , pancreatic islets , renal glomeruli , renal proximal tubular epithelium , and intact aortas . signals or stresses that we have shown to promote release of this factor include uptake of lipoproteins , including albumin , intracellular oxidation , anoxia , tissue culture , immune complexes , and mechanical stretch of luminal structures , as is seen in obstruction of hypertension . table i______________________________________monocyte ctx activity in extracted , chromoatographed urine ( 18 &# 39 ;- 20 &# 39 ;) monocyte migration ( cells / filter ) ______________________________________progressiverenaldiseasefsgs 11 , 039fsgs 23 , 140iga / tin 24 , 386diabetes 21 , 184stable renalfunctioncontrol 2 , 492fsgs ( obese ) 2 , 552fsgs ( non - progressive ) 2 , 492______________________________________ the identification of the lipid chemotaxis factor as a vinyl ether monoalkyl glycerol has permitted the design of inhibitors . a variety of naturally occurring fatty acids were screened for the capacity to inhibit the oleate stimulation of the novel lipid chemoattractant . inhibitors of the synthesis of the lipid chemotaxis factor include long chain polyunsaturated fatty acids and particularly c18 : 3 , c : 20 : 3 , and c : 20 : 5 fatty acids . c18 fatty acids with substitutions between c 6 - c 12 , e . g ., ricinoleate , are also inhibitory . the most inhibitory fatty acids reflect modifications of fatty acids between the c9 and the omega carbon . in order of potency , the fatty acid inhibitors are : ricinoleic acid & gt ; eicosopentanoic acid & gt ; mead acid & gt ; docosohexanoic acid & gt ; linolenate & gt ; eicosadienoic acid . ricinoleic acid is 100 % inhibitory at micromolar concentrations . ethanol is inhibitory as are lipid soluble antioxidants such as ethoxyquin , butylated hydroxytoluene , and butylated hydroxyanisole . cytrochromic p 450 so enzyme inhibitors such as ketoconazole and clotrimazole are also inhibitors of the synthesis of the lipid chemoattractant as are alcohols of long chain fatty acids . a prototype receptor antagonist has been synthesized from commercially available beef heart phosphotidylcholine , which contains 30 % plasmalogens ( sigma chemical co ., st . louis , mo .). the phosphotidylcholine / plasmalogen mixture was subjected to phospholipase c exposure followed by alkaline hydrolysis in 0 . 5 naoh in methanol and tlc separation . this yielded a mono - alkyl vinyl ether of glycerol , which was labile in 0 . 5n hcl . its two principal substituents at the sn - 1 position were the corresponding vinyl ether derivatives of palmitate and oleate . this mixture had no intrinsic chemoattractant agonist activity . however , at 10 - 6 m concentrations , it completely blocked monocyte migration in vitro to biologically active fractions prepared from chromatographic isolates from proteinuric urine . this demonstrates that monoglycerides with long chain fatty acid - derived substituents linked as vinyl ethers in the sn - 1 position of glycerol inhibit the leukocyte response to biologically active mono - alkyl glycerides . other monocyte chemotaxis inhibitors include inhibitors lysomal acidification such as chloroquine and ammonium chloride . thus the lipid chemoattractant of this invention has the general structure i : ## str1 ## where r 1 is a c4 - c22 alkyl group optionally containing 1 - 3 branched group . each branched group may be a hydroxyl group , oxygen , or a carbonyl group . r 1 may include 1 - 3 unsaturated double or triple bonds but r 1 is unconjugated so none of the double bonds can share adjacent carbon atoms . r 2 may be oxygen (═ o ) or hoh . an important aspect of the lipid chemoattractant is that it includes at least one oxygen or carbonyl group . if r 2 is oxygen , then r 1 may , but need not include a carbonyl group or an oxygen group that is not part of a hydroxyl group . if r 2 is hoh , the r 1 must include an oxygen that is not part of a hydroxyl group , or carbonyl group as part of the alkyl backbone , or as a branched group . in addition , those skilled in the pharmaceutical arts will recognize that interfering with the production of i through interference with the pathway that produces i will effectively reduce macrophage migration . the lipid chemoattractant of this invention has been purified by the following procedure : approximately 20 - 30 ml of urine or medium conditioned by proximal tubules fed albumin complexed with fatty acids are extracted with ethyl acetate ( 1 : 1 . v / v ). after phase separation via centrifugation , the organic phase is collected and subsequently dried using a buchii rotatory evaporator . the dried samples are stored under argon in a silylated vial . a 2 - step tlc procedure is used to isolate fractions of the extracted urine sample with corresponding chemotactic activity . samples are spotted on silica gel plate ( whatman lk6df plate with a pre - absorption zone ) and developed initially with a solvent system of chloroform : methanol : acetic acid ( 60 : 25 : 1 ), v / v / v ) to an r f of 0 . 3 . the plate is dried and then exposed to a second solvent system of petroleum ether : ether : and acetic acid ( 80 : 20 : 1 ) and developed to an r f of 1 . 0 . all chemotactic activity elutes from an area comigrating with short and long - chain monoglycerols , r f = 0 . 25 ± 0 . 05 ( fig4 ), an area which was scraped and eluted with chloroform : methanol ( 1 : 1 , v / v ). to eliminate contaminating lipid esters which predominate at this point and allow subsequent chromatographic purification to near homogeneity , we utilized the surprising base stability of the lipid chemoattractant to permit substantial enrichment of bioactivity . thus , the dried eluents are subjected to mild alkaline hydrolysis ( 0 . 5n koh in methanol , at 37 ° c . for 30 min .). after the completion of the hydrolytic process , the products are extracted with ethyl acetate and separated from the resulting fatty acids with hptlc ( whatman lhp - kdf with a pre - absorption zone ) using a solvent system of petroleum either : ether : isopropanol ( 3 : 2 : 0 . 6 , v / v / v ) to an r f of 1 . 0 followed by a 5 min over development . the fraction with corresponding chemotactic activity , typically between r f 0 . 4 - 0 . 8 , is scraped and eluted with chloroform : methanol 1 : 1 , v / v and subjected to further purification using hplc . the fraction with chemotactic activity is further purified by hplc . the sample is loaded onto a supelco lc - dp diphenyl reversed phase hplc column ( 5μ , 25 cm × 4 . 6 mm ) with the elution solvent delivered via a waters liquid chromatograph system equipped with a model 600e controller driven by the millennium v 1 . 1 data acquisition and analysis software , and monitored with a waters model 996 photodiode array detector . a gradient solvent system of acetonitrile ( acn ) and water is used to separate the chemoattractant from other contaminants . initially the solvent system ratio is acn : h 2 o ( 25 %: 75 %) for 10 min , after which the acn level is raised to 60 % in a duration of 5 min , and to 80 % in period of 2 min . finally , the acn % was raised to 100 % in 10 min . fractions were collected in 30 second intervals using a waters fraction collector . all chemotactic activity elutes between 23 and 24 minutes at an acn % of 92 % and the chromatogram shows a single absorbance peak overlapping the chemotactic activity ( fig5 ). the lipid chemoattractant purified by the method of example i exhibits the following properties : table ii______________________________________properties of the homogeneous lipid chemoattractant * ______________________________________ ( a ) acid labile ( b ) base stable ( c ) 100 ° c . in water stable ( d ) macrophages recruits ( e ) neutrophils not - recruited ( f ) injured tissue secreted by ( g ) chemical structure sn - 1 vinyl ether of glycerol ( h ) lacks phosphorous ( i ) heat lability activity destroyed 180 ° c . ______________________________________ * these properties were demonstrated as follows : ( a ) placed in 0 . 5 n hcl in methanol per 30 &# 39 ; at 37 ° c . ( b ) placed in 0 . 5 n koh in methanol for 30 &# 39 ; at 37 ° c . ( c ) boiled in h . sub . 2 o at 100 ° c . for 15 &# 39 ;. ( d ) d + e = side by side comparison of the migration of neutrophils ( elicited by the installation of zymosanactivated serum in the rat peritoneum ) and monocytes ( isolated by density sedimentation from the peripheral blood of rats and humans ) and macrophages ( isolated by instillation of heatinactivated fetal calf serum in the rat peritoneum ). ( h ) lack of phosphorous established by molybdate spray on thin layer chromatograms and by ashing analysis . ( i ) dried to film by evaporation under nitrogen and heated in an oven at 180 ° c . for thirty minutes . table iii______________________________________chemical derivatisations of thehomogeneous lipid chemoattractant ** agent structural indication______________________________________ ( a ) sodium borohydride carbonyl group ## str2 ##( b ) periodate adjacent alcohols on adjacent carbonyl alcohol groups . ## str3 ##( c ) acetic anhydride alcohol group r c oh ( d ) acid vinyl ether coccc or ## str4 ## ______________________________________ ** these structural indications were demonstrated as follows : ( a ) the lipid chemoattractant is dissolved in ethanol and exposed to soli nabh . sub . 4 overnight at room temperature . the material is then reextracte with diethylether in water and tested for biological activity . ( b ) lipid chemoattractant is dissolved in 1 % periodate ( w / v ) in sodium acetate buffer for 1 hour at room temperature after which it is reextracted in ethyl acetate and tested for biological activity . ( c ) lipid chemoattractant is suspended in acetonitrile and exposed to acetic acid anhydride and pyridine for 16 hours at room temperature . acelylation is reversible by placing acetylated chemoattractant in 0 . 5 n koh in methanol for 30 minutes at 37 ° c . ( d ) lipid chemoattractant is placed in 0 . 5 n hcl in methanol for 30 minutes at room temperature . all of the above derivitisations destroy biological activity and alter the chromatographic properties of radiolabeled lipid chemoattractant . this example describes an improved and alternate method for preparing a essentially homogeneous solution of the lipid chemoattractant of this invention . the lipid chemoattractant agent is extracted into ethyl acetate from conditioned medium generated from a variety of mammalian sources including human sources such as rat renal proximal tubules or vascular smooth muscle cells or human renal proximal tubules with albumen oleate or lipid containing serum . other fluid sources of the lipid chemoattractant include plasma , serum , urine , and cyst fluid from human and animal sources . in addition to the lipid chemoattractant , the medium contains impurities and contaminants such as monoalkylglycerols and other low molecular weight compounds ( m . w . less than 1000 ) that do not exhibit biological activity . the first extract in eluted over a silica column in a mobile phase of petroleum ether : ether ( 25 : 75 v / v ). the eluted extract is subjected to alkaline hydrolysis 0 . 5n koh in methanol , at 37 ° c . for thirty minutes and is re - eluted over the silica column in the same manner as above to provide a second extract . the second extract is then concentrated by evaporation under nitrogen and separated by passage over normal phase , supelco silica column ( 5μ ; 4 . 6 × 250 mm ) via a waters liquid chromatograph system describe in example i . a solvent system of hexane : methyl - t - butyl ether : isopropanol ( 60 : 40 : 10 v / v / v ) is used to separate the lipid chemoattractant for other remaining contaminants . the lipid chemoattractant elutes at 18 - 20 minutes . the concentrated lipid chemoattractant is now essentially pure and it may be pooled and used for a variety of purposes . further purification of the lipid chemoattractant is still possible , however and is achieved by first preparing a third extract by concentrating the active fraction by evaporation under nitrogen , resuspending it in acetonitrile , and elution by passage of a supelco lc - dp dipheny reversed phase hplc column delivered via a waters liquid chromatograph system as described in example 1 . the same gradient of solvent ( acetonitrile : water ) is used as is described in example i with the exception of the addition of 50 nm ammonium acetate . the third extract is applied to a reversed phase c - 18 guard column in 25 % acetonitrile / 75 % h 2 o . the column is then equilibrated in 100 % water and the activity is then eluted in 100 % acetonitrile moving a 1 ml / minute . the lipid chemoattractant is further purified by loading onto phenomenex cyanaopropyl column ( 31μ , 3 mm × 150 mm ) in hexane : methyl t - butyl ether ( 60 : 40 v / v ), 1 ml / mm , with elution time of the activity being 3 - 5 minutes . these subsequent purification steps takes the essentially pure solution of lipid chemoattractant and results in a nearly homogeneous preparation of lipid chemoattractant as determined by nmr and ms testing . the sensitivity of the lipid chemoattractant to borohydride indicates the presence of a carbonyl group , which distinguishes it from long chain acetylenic enol ethers of glycerol . the presence of a carbonyl group on the backbone of the structure is supported by the observation that c 14 - labeled dihydroxyacetone ( dha ) is incorporated into the lipid chemoattractant . the 2 ( c ) labeled c 14 - dha incorporation into the lipid chemoattractant has been demonstrated in two types of experiments . in the intact cell assay outlined in example i , c 14 - dha is ( 100 μm ) included with albumen - oleate in the medium of rat proximal renal tubules placed in short - term tissue culture where it is incorporated into the lipid chemoattractant . the labeled chemoattractant was then purified by the method detailed in example ii , and each fraction that demonstrated biological activity also demonstrated incorporation of c 14 - dha . analogous results are observed in a cell free lipid chemoattractant - generating system consisting of 100 μm dha , 50 μm oleyl alcohol , 10 mm atf , 4 mm mgcl 2 , 20 mm nadh , 33 mg / ml catalase , and 500 μg of microsomal protein from rat kidney cortex . incubation of this mixture in kreb &# 39 ; s - henseleit medium for one hour at 37 ° c . yields a lipid chemoattractant with dha incorporation that is chromatographically and biochemically identical to that of the lipid chemoattractant isolated from intact kidney cells or proteinuric urine .

US-47097495-A

a lift - type wind turbine having a substantially vertical rotating shaft and a plurality of substantially vertical blades secured to the shaft . each blade includes a front portion , a rear portion , and a pivot axis pivotally securing the rear and front portions . the rear portion pivots relative the front portion . the blades additionally include bottom and top edges positioned on each of the front portions . each bottom edge is arranged substantially equidistant from the shaft proximate a first circumference extending substantially horizontally about the shaft , whereas each top edge is arranged substantially equidistant from the shaft proximate a second circumference extending substantially horizontally about the shaft . the blades are angled relative to the rotating shaft . the blades have an open , drag means position as well as a closed , lift means position , and passively switch between the positions based on wind speed for efficient rotation .

like drawing numbers on different figures identify identical or functionally similar structural features of the invention . the invention is not limited to the particular methodology , materials and modifications described and as such may , of course , vary . the terminology used herein is for the purpose of describing particular aspects only , and is not intended to limit the scope of the present invention , which is limited only by the appended claims . unless defined otherwise , all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this invention belongs . fig1 depicts the overall structure of wind turbine 1 , which is a wind turbine in accordance with the present invention . wind turbine 1 is shown arranged with a substantially vertical rotating shaft 2 fixedly secured to four blades 3 . blades 3 include front portions or front blades 3 a and rear portions or rear blades 3 b . front portions 3 a and rear portions 3 b are fixedly secured to each other by means of pivot axis 4 . in fig1 , rear portions 3 b are portrayed in a partially open position that produces drag as will be discussed in detail infra . blades 3 are fixedly secured to shaft 2 by means of support arms 5 at hubs 6 . a combination or welding , bolting and riveting can be used to fixedly secure the above - mentioned elements dependent upon choice of material , which can vary from plastics , composites and fiberglass to metals such as aluminum and stainless steel . to increase resistance to environmental factors , wind turbine 1 can also be painted or coated . fig2 depicts wind turbine 1 from the top with rear portions 3 b shown in a closed position . fig2 best illustrates the slightly tilted arrangement of blades 3 . bottom edges 20 of front portions 3 a are arranged proximate circumference c 1 . top edges 22 of front portions 3 a are arranged proximate circumference c 2 . as is illustrated in the figures , circumference c 2 is smaller than circumference c 1 . this tilting arrangement allows gravity to assist rear portions 3 b to tilt inward and downward , towards an open position as is illustrated in fig1 . in order for rear portions 3 b to close to the closed position shown in fig2 , a sufficient rotational speed of wind turbine 1 must first be achieved to establish an outward centrifugal force that overcomes the downward and inward gravitational force exerted on rear portions 3 b . it should be appreciated that the specific spatial proportion of circumferences c 1 and c 2 vary depending on , amongst various other factors , blade weight , alignment and overall structural sizes . the embodiment illustrated in fig4 depicts blades 3 rotating with sufficient speed in the direction of arrows 24 to completely close rear portions 3 b . it should be readily appreciated that the embodiment shown in the figures is only a primary embodiment and that the rotational direction of arrows 24 is only preferred . it should be readily appreciated that the direction of rotation can be changed by simply reversing the direction blades 3 , ensuring appropriate airfoil shape for lift generation . fig3 is a front view of wind turbine 1 as illustrated in fig2 . fig3 further illustrates the tilted positional arrangement of blades 3 . fig4 is a cross - sectional view taken substantially along line iv - iv of fig3 . fig5 is a cross - sectional view taken substantially along line v - v of fig3 . fig6 is an magnified view of the cross - section of blade 3 as illustrated in fig5 . fig6 more clearly depicts front portion 3 a pivotally secured to rear portion 3 b by means of pivot axis 4 . front portion 3 a is secured to arm 5 by means of bolt 15 . most clearly depicted in fig6 is stopper 13 , which is arranged proximate pivot axis 4 and is arranged to limit the pivot angle of rear portion 3 b . in addition to stopper 13 , rear cover 31 a provides additional support to rear portion 3 b by limiting the pivot of rear portion 3 b to a streamlined , substantially airfoil shape and prevent rear portion 3 b from overextending ( not shown ). blade 3 further includes rib material 12 that is included into blade 3 so as to strengthen and stiffen blade 3 . the chord , the distance between the leading edge ( le ) to the trailing edge ( te ), of blade 3 is most clearly shown in fig6 . preferably , front portion 3 a constitutes about 50 %- 70 % of the chord length whereas rear portion 3 b constitutes the remainder . however , it should be readily appreciated that it is preferred that rear cover 31 a is preferably a trailing edge extension of front portion 3 a that extends beyond the leading edge of rear portion 3 b . preferably , rear cover 31 a covers about 30 %- 100 % of rear portion 3 b . most preferably , rear cover 31 a covers about 50 - 70 % of rear portion 3 b . the length and coverage of rear cover 31 a is preferably selectively chosen such that the centrifugal force acting upon rear portion 3 b is greater than the drag force exerted upon the outward surface of rear portion 3 b at a pre - determined wind turbine rotational speed . fig2 - 6 depict blades 3 in a closed position . specifically , rear portion 3 b is closed substantially against rear cover 31 a or , stated alternatively , at a 0 degree pivot angle . fig1 depicts blades 3 in an open position . the open position includes a range of pivot angles up to about 20 to about 60 degrees , measured relative the closed position . pivot angles within the range of about 30 to 45 degrees are preferred . the angle can also be measured from the angle created between rear cover 31 a and rear portion 3 b . the structural arrangement of stopper 13 directly controls the pivot angle range of the open position shown in fig1 . fig7 - 9 best depict the construction of blades 3 . fig7 best illustrates pivot axis 4 positioned within blade 3 between front portion 3 a and rear portion 3 b . ribs 8 , 11 and 12 are structurally arranged to give shape to the outer structure of blades 3 . ribs 8 , 11 and 12 may be aluminum alloy or plastic and are covered by a thin and light material such as an aluminum alloy , fiber reinforced plastic , fiber glass , or a composite material to complete the outer structure of the blade . the outer structure can then be riveted , bolted or welded , depending on material choice to ribs 8 , 11 and 12 . since blades 3 are similar to structure to aircraft wings , any suitable material or manufacturing methods in manufacturing aircraft wings could be applied to fabricating blades 3 . stopper 13 , as best described in reference to fig7 and 9 - 10 , is covered with , not shown , or made from a resilient but flexible material so as to prevent damage from repeatedly pressing against the inner surface of front portion 3 a during regular operation . turning to fig8 - 10 , pivot axis 4 is arranged to pass through holes 7 and 10 of respective front portions 3 a and rear portions 3 b . hole 10 of rear portion 3 b is located about 20 - 30 % to the front of the center of gravity of rear portion 3 b . shaft 2 may be connected coaxially via a transmission , not shown , to any electric generator or other engine that can convert the rotational motion into a useful purpose . although wind turbine 1 is illustrated as having four blades , it should be appreciated that this is only one example . wind turbine 1 has about three to about five blades , but can be designed with any number of blades suitable for a specific application . returning to fig2 - 3 , a secondary embodiment of the invention , not shown , can be achieved where circumference c 2 is larger than circumference c 1 . stated alternatively , instead of an overall cone - shaped wind turbine where the base area is larger than the topmost area as illustrated in the figures , a secondary embodiment can be readily appreciated where the wind turbine has a shape where the base area is smaller than the topmost area . in this secondary embodiment , the general structure of blades 3 is mirrored . specifically , rear cover 31 a , instead of being arranged on the outside surface of blades 3 , is arranged on the inside surface of blades 3 . also , rear portion 3 b , instead of being arranged to pivot inwards , is arranged to pivot outwards . effectively , in this secondary embodiment not shown in the figures , blades 3 are tilted outwardly at their respective tops instead of being tilted inwardly at their respective tops . moreover , it should be appreciated that a combination of the primary and secondary embodiments can be constructed wherein a secondary embodiment wind turbine can be stacked atop a primary embodiment wind turbine , each sharing a rotational shaft 2 . the nature and operation of the invention will now be detailed with reference to fig1 - 14 . fig1 - 13 illustrate progressive stages of wind turbine 1 , specifically blade 3 from start - up to high rotation . fig1 depicts rear portion 3 b in a fully open position where stopper 13 is resting against the interior surface of rear cover 31 a . this position is a drag means position wherein wind current ‘ a ’ can push against the interior surface of rear cover 31 a and the outer surface of rear portion 3 b to exert a start - up , rotational torque on wind turbine 1 . rear portion 3 b , as previously discussed , is naturally pivoted in the open position shown in fig1 because the center of gravity of rear portion 3 b is closer to the trailing edge of rear portion 3 b than the pivot point , pivot axis 4 . the drag means position shown is similar to that of a savonius structure and shares similar operational characteristics . as blade 3 begins to rotate , air streams b 1 and b 2 begin to flow across the outer and inner surfaces of blade 3 , respectively , as illustrated in fig1 . as rotational speed increases , or more specifically , as tip speed ratio increases towards 1 , centrifugal force l 1 of rear portion 3 b increases and begins to overcome weight force w of rear portion 3 b . centrifugal force l 1 must also overcome the drag created by wind current ‘ a ’. blade 3 will stably rotate irrespective of the wind strength or direction . when sufficient wind speed is achieved , when tip speed ratio is approaching or about 1 , rear portion 3 b will be forced into a closed , lift means position as illustrated in fig1 . fig1 depicts rear portion 3 b . in addition to centrifugal force l 1 , lift force l 2 is generated as the air stream passes over blade 3 , causing rear portion 3 b to close and engage rear cover 31 a , forming a lift means position similar to a gyromill or darrius type structure . this position allows for higher rotation efficiency at higher wind speeds . it should be readily appreciated that once wind speed falls below a tip speed ratio of 1 , rear portion 3 b will begin to return back towards the open position in the direction of arrow p 2 and can readily return to the closed position in the direction of arrow p 5 as wind speed increases . fig1 illustrates blade 3 as wind turbine 1 rotates with drag generated by wind current ‘ a ’ from the rear and diagonal rear . the substantially ‘ v ’ shaped structure created by front and rear portions 3 a and 3 b are adequate for interacting with a broad range of rear and diagonally rear wind currents to produce drag and rotational motion . with this type of wind turbine , when in a low wind speed situation , the rear portion 3 b assumes a drag means position similar to that of a savonius design , thus allowing the wind turbine means to produce enough torque to startup at low winds and operate at wind speeds below a tip speed ratio of 1 . the structure of the present invention also enables rear portion 3 b to automatically , or passively , change position to a lift means position similar to that of a gyromill , darrius or airfoil structure , making electricity generation more efficient and allowing efficient rotation and electricity generation greater than a tip speed ratio of 1 . thus , it is seen that the objects of the present invention are efficiently obtained . modifications and changes to the invention should be readily apparent to those having ordinary skill in the art , and are intended to be within the spirit and scope of the invention as claimed . it should also be understood that the foregoing description is only merely illustrative of the invention and should not be considered as limiting . therefore , other embodiments of the invention are possible without departing from the spirit and scope of the invention as claimed .

US-77902807-A

a sucker rod coupling 10 having a high ultimate tensile strength , resistance to corrosion , and resistance to surface cracking arising out of a method of making the sucker rod coupling 10 , which employs a five - step process of forming a coupling 10 . first , a hollow cylindrical core 12 from a heat treatable steel is formed . second , a thin coating 18 of metallic alloy is applied to the outer surface of the core 12 . third , the core 12 is heat treated . fourth , threads 20 are partially cut in the inner surface of the core 12 . fifth , the threads 20 are cold worked to transform the partially cut threads 20 into finished threads 20 and to place the thread roots 22 in compression .

referring to fig1 therein is depicted an exemplary high strength sucker rod coupling 10 in accordance with the present invention . the coupling 10 includes a core 12 , end surfaces 14 , 16 , an external coating 18 , and threads 20 . in a preferred embodiment , the core 12 is drawn into a hollowed substantially cylindrical form . the core 12 is preferably fashioned from aisi 4140 or 4142 steel , though any steel capable of obtaining required strength / hardness through heat treatment may be suitable . after application of a suitable heat treatment , the core 12 preferably has a minimum ultimate tensile strength of approximately 117 , 000 psi and a hardness greater than about 23 hrc . it is especially preferred that the core 12 has a minimum ultimate tensile strength of about 146 , 000 psi and a minimum hardness of between about 32 and about 36 hrc . the end surfaces 14 , 16 should be machined smooth by grinding or lapping or machining to ensure that any preload applied to the coupling 10 and the sucker rods is retained . the coating 18 is preferably a nickel based alloy applied to the core 12 by a metal spray technique to be more fully disclosed below . in a particularly preferred embodiment , the coating 18 is composed of a minimum thickness of 0 . 010 inches ( approximately 0 . 00025 m ) of colmonoy # 5 spray powder , which contains nickel , chromium , silicon , and iron . other coatings may be suitable as well such as scm 76 - m - 50 ( m ) metal powder , or cobalt based powder which also contains iron , nickel , carbon , silicon , boron , chromium , and molybdenum . other metal based powders , or other coatings , such as for example , ceramic or plastic coatings may be suitable as well , though plastic or other coatings which have a relatively low melting point will have to be applied after the core 12 is heat treated . the temperature at which the coating 18 is fused to the core 12 will depend upon the particular coating 18 material . the coating 18 preferably has a minimum hardness of between about 45 and about 53 hrc , but the hardness may be less than 45 hrc or exceed 53 hrc . to ensure that there is minimum friction and wear for both the coupling 10 and the well tubing through which it is inserted , the coating 18 should be ground to a smooth finish , or preferably , about 63 r a . since the core 12 has a much higher hardness than lower strength cores , formation of the threads 20 in the core 12 requires a slightly different procedure than that conventionally used . ordinarily , the threads 20 would be full - formed rolled in a cold working operation to place the roots 22 of the threads 20 in a state of compression and provide resistance to fatigue stress . however , owing to the hardness of the core 12 , in this application the threads 20 should first be partially cut with an existing tap such that sufficient space remains in the thread roots 22 for metal displacement during a subsequent cold working operation . the threads 20 , and particularly the thread roots 22 , are then cold worked using a cold form tap to place the thread roots 22 in a state of compression . experimentation has shown that by using this technique of forming the threads 20 , the effect of the cold working extends to a depth of approximately 0 . 0030 inches ( approximately 0 . 000076 m ), which is approximately 75 % of the cold working depth achieved on a lower strength coupling wherein the threads 20 are formed by the conventional full - formed rolling process . in another embodiment more suitable for mild well environments , the sucker rod coupling does not have an external coating . in all other aspects , this embodiment of the sucker rod coupling is structurally identical to , and has the same physical properties as , the sucker rod coupling 10 shown in fig1 . a preferred method for fabricating the sucker rod coupling 10 shown in fig1 includes application of a suitable corrosion resistant coating 18 to the core 12 , heat treating the coupling 10 to increase the ultimate tensile strength of the core 12 to above about 117 , 000 psi , and preferably above about 146 , 000 psi , and the core 12 hardness preferably above about 23 hrc to between about 32 and about 36 hrc , and forming the threads 20 by a combination of a partial tapping operation and a cold working operation . since the coating 18 should be able to withstand the heat treatment of the core 12 after the coating 18 is applied to the core 12 , the spray metal technique for applying the coating 18 should be modified . metal spray powder , preferably colmonoy # 5 , is applied to the core 12 and fused between 1840 ° f . and 1860 ° f . the coating 18 formed thereby should have a minimum thickness of about 0 . 010 inches ( approximately 0 . 00025 m ) and have a minimum hardness between about 45 and about 53 hrc . it is preferred that immediately following application of the coating 18 , the coupling 10 be slow cooled to prevent the formation of cracks in the coating 18 . this is preferably done by immersing the coupling 10 in a suitable insulating material which will prevent rapid heat loss from the coupling 10 by either conduction , convection , or radiation . experimentation has shown that vermiculite in about 1 / 4 inch ( approximately 0 . 0064 m ) granular size is particularly suitable as an insulating material . the coupling 10 should be cooled in the vermiculite or other suitable material to below about 150 ° f . at a cooling rate not exceeding : about 41 ° f ./ min from about 1400 ° f . down to about 1200 ° f . ; about 10 ° f ./ min from about 1200 ° f . to about 700 ° f . ; and about 4 ° f ./ min from about 700 ° f . down to about 200 ° f ., before removal from the vermiculite or other material . after the coupling 10 is slow cooled , it should be checked for cracks in the coating 18 and the hardness of both the core 12 and the coating 18 should be checked . following application of the coating 18 to the core 12 , the coupling 10 should be heat treated to increase the ultimate tensile strength of the core 12 . aside from achieving high ultimate tensile strength , the goal of the heat treatment is to create in combination with martensite grain structure with limited grain growth , such as bainitic in combination with martensite . a preferable heat treatment , well known to those skilled in the art , comprises the following steps . the coupling 10 should be heated to about 900 ° f . and held at that temperature for about thirty minutes . the coupling 10 is then raised to between about 1200 ° f . to 1225 ° f . and held in that temperature range for about one hour . the coupling 10 is then heated to about 1550 ° f ., held at that temperature for about one hour and simultaneously exposed to a 0 . 40 carbon potential . the coupling 10 is next quenched in salt at about 525 ° f . and held at that temperature for about one hour . the coupling 10 is then air cooled to below about 150 ° f . and the core 12 hardness is again checked . the core 12 should then be tempered to achieve a hardness of between about 32 and about 36 hrc . following heat treatment , the threads 20 are formed in the core 12 by a combination of cutting and cold working . the threads 20 are first partially cut by a suitable tap which will leave space at the thread roots 22 for metal displacement during a subsequent cold working operation . threads may be formed in a conventional lower strength sucker rod coupling by a pure full - formed rolling operation which does not remove any material from the coupling but rather displaces it , particularly at the roots , thus increasing the fatigue strength at the roots . however , because the ultimate tensile strength of the core 12 , in accordance with the present invention , is substantially greater than about 100 , 000 psi , the core 12 is simply too hard for a pure cold working operation to form the threads 20 therein . after the threads 20 have been partially tapped , they should be cold worked using a cold form tap to displace , but not remove , some material at the thread roots 22 , with the goal of placing the thread roots 22 in a state of compression to give the thread roots 22 a heightened resistance to fatigue stress cracking . for example , experimentation has shown that a 1 inch nominal size ( approximately 0 , 025 m ) sucker rod coupling 10 in accordance with the present invention has endured about 107 cycles of a stress load alternating between about 13 , 006 psi to about 54 , 904 psi without failure . subsequent to the cold working of the threads 20 , the end surfaces 14 , 16 should be machined smooth and perpendicular to the threads 20 to minimize bending moment on the threads 20 , and to preserve any preload that may be placed on the coupling 10 after rod insertion . in addition , the coating 18 should be ground to a smoothness of a 63 r a finish to minimize friction and wear for both the coupling 10 and the particular tubing through which the coupling 10 is inserted . for mild well environments , the above method need not include the spray metal application . the strength and hardness of the core 12 and the threads 20 may be increased using either the heat treatment and subsequent threading operation disclosed above or by using a pure full - formed rolling operation with a core strength in excess of about 23 hrc and at the required strength level , approximately 32 to approximately 36 hrc . many modifications and variations may be made in the techniques and structures described and illustrated herein without departing from the spirit and scope of the present invention . accordingly , the techniques and structures described and illustrated herein should be understood to be illustrative only and not limiting upon the scope of the present invention .

US-99217992-A

a device for the remote handling of equipment for instance designed for mounting elastic rings comprises a fixed jaw and a mobile jaw which moves linearly relative to the fixed jaw by actuating elements coupled to the equipment by a cable connected to the mobile jaw inside a sheath one end of which comes to stop on the fixed jaw . the actuating elements consist of two branches articulated on a common axis such that the distance between their free end is not less than the maximum displacement of the mobile jaw , when bringing closer the two handles respectively integral with the two branches of which the free end of one acts as a stop to the other end of the sheath while allowing the cable that is connected to the free end of the other arm to slide .

referring to the figures , the remote handling device 1 conforming to the invention is connected by an assembly comprising a cable 2 inside a sheath 3 , to a tool 4 enabling one to act on lugs 5 of an elastic ring 6 for the purpose of mounting it or dismantling it for example on a hose . conforming to fig1 and 2 , the equipment 4 for clamping or unclamping the ring 6 is essentially made up of a clevis 7 advantageously obtained from a flat piece of iron folded into a u the two wings of which are joined at their end around a component 8 that constitutes the fixed jaw . the fixed jaw is equipped in its rear part 9 with a bore 10 with the inside of which the flexible sheath 3 comes into abutment . on the same axis as the bore 10 , a hole 11 allows passage of the cable 2 which can extend as far as the movable jaw 12 arranged astride on the inside of the clevis 7 with vertical slots being used as a guide rail for its linear displacement . the cable 2 is fitted into a bore made in the movable jaw 12 and fixed to it by means of a screw to clamp it . the movable jaw 12 is formed from an inner block 121 that takes up the same space as the width of the clevis 7 to form a lateral guide to the jaw 12 . above and below the component 121 there are attached two plates 122 and 123 , which come into contact with the slots in the clevis 7 in such a way as to form a slide with the two sides 71 , 72 of the clevis . from the plates 122 and 123 forming the slides and on the side of the movable jaw 12 facing the fixed jaw 8 , surfaces 124 that slope towards the interior of the block 121 are provided that permit formation of a housing shaped like a half swallow - tail to receive the first lug 5 of the ring 6 without there being any risk of it accidentally being dislocated at the moment of clamping . optionally , the fixed jaw 8 is constituted in the same way as the movable jaw 12 by a central block fixed on each side to the two side wings 71 , 72 of the clevis 7 and held top and bottom by two backing plates formed like the jaw 12 to receive the second lug 5 of the ring 6 . the remote handling device 1 is essentially made up of two arms 13 , 14 capable of moving apart from one another by rotation about an axis 15 so as to define between their two ends 131 , 141 a displacement equivalent to that of the free jaw 12 over the clevis 7 in the direction of and up to contact with the fixed jaw 8 . this linear movement of the fixed jaw 12 is naturally obtained by tension on the cable 2 fixed to the end 141 of the inner arm 14 of the remote handling device 1 , thanks to a cotter pin or a screw 142 . of course , the cable 2 transmits its movement to the tool 4 by means of the sheath 3 coming into abutment with the end 131 of the outer arm 13 of the remote handling device 1 . according to an essential characteristic of the invention , each arm 13 or 14 is associated with a handle , respectively 16 or 17 , in accordance with a particular arrangement that causes each arm to correspond with the handle situated on the same side of a line xx ′ that coincides with the median line of handles 16 , 17 and arms 13 , 14 passing through their centre or their articulation axis 15 ; conforming with fig1 . the result is that when the two handles 16 and 17 move toward each other by rotation about the axis 15 , the arms 13 and 14 move apart and contrary to this , when the handles move apart from one another , the two arms 13 and 14 tend to move toward one another . according to a particularly advantageous construction of the remote handling device 1 , that makes reference notably to fig2 the remote handling device 1 is cut away into a strip of ; thickness 5 mm for example , defining on each side of a plate , centred on the axis 15 , used to rotate the tool , on the one hand handle supports 18 , 19 and on the other hand the arms 13 and 14 that one will have previously twisted 90 ° onto themselves to be used by the outer arm as a stop for the sheath 3 and by the inner arm as a fixing system for the actuating cable 2 . optionally , two ergonomic handgrips are fixed astride the two ends of the handle supports 18 and 19 in order to provide a better grip on the tool . conforming to fig3 it is possible to produce the remote handling device conforming 1 to the invention in accordance with three main configurations . in accordance with fig3 a , the remote handling device 1 , in the at - rest position , that is to say with the two handles 16 , 17 close to one another , is such that a first arm 13 is positioned in an extension of handle 16 with which it is connected along an axis yy ′ perpendicular in direction to the axis of articulation 15 , the two axes not necessarily intersecting and that the second arm 14 forms , with the handle 17 with which it is connected , an angle a in the plane of movement perpendicular to the axis of articulation 15 of a size such that the distance between the free ends 131 , 141 of the two arms 13 , 14 is at least equal to the displacement of the movable jaw 12 from its position furthest from the clevis 7 to being in contact with the fixed jaw 8 of the tool 4 . according to another variant represented in fig3 b , the remote handling device 1 , still in its at - rest position , is such that each arm 13 , 14 is symmetrically angled with respect to the median axis yy ′ of the tool , so that in a definitive way , it determines an angle a identical to the variant a . finally , according to a final variant shown in fig3 c , the remote handling device 1 is such that the two arms 13 , 14 are angled on the same side of the median axis yy ′. naturally the angles of the outer and the inner arms are calculated so that , in the at - rest position , that is to say in the position where the two handles 16 , 17 are close to one another , the arms make between them an angle equal to β as in the preceding variants . according to a preferred arrangement of the invention , the area of articulation 143 of the inner arm 14 does not coincide with the area 144 where the same arm joins with its handle 17 , but is offset by an appendage 145 that unites the two areas 143 , 144 . it can be easily understood that the position of the arms 13 , 14 particularly when the two handles are in the most spaced apart position depends on the length of the appendage 145 joining the articulation axis 15 to the assembly made up of the arm 14 and the handle 17 . as a consequence , the traction couple exerted by the arm on the cable 2 can be made the most suitable and the angle of the cable 2 with respect to the arm 13 can be reduced when the arm 14 describes the angle β , which improves the operation of the remote handling device 1 . a man skilled in the art is perfectly capable of matching the geometry of all these elements , that is to say the length of the arms 13 , 14 as well as the length of the appendage 145 in relation to the length of the handles 16 , 17 that constitute the lever arms of the remote handling device 1 . according to the optional arrangements of the remote handling device 1 , between the two handles 16 , 17 and close to their articulation point 15 , a return spring 20 urges these handles apart in the at - rest position , that is to say the movable jaw is urged to the end of the clevis 7 of the tool 4 . the spring 20 is a simple coil spring clamped between two bosses provided in the slot of the handle supports 18 , 19 . in the same way , advantageously a ratchet mechanism 21 is provided , mounted for example on the handle support 19 , in such a way that its end hook 22 cooperates with a stub 23 provided on the other handle support 18 to keep one handle against the other when they are close together , that is to say when the movable jaw 12 is brought close to the fixed jaw 8 . naturally , a manual device 24 allows one to release the hook 22 from the stub 23 at any time , and thereby release the two handles and by doing this any tension on the lugs 5 so that the elastic ring 6 is disengaged . it is obvious that if the remote handling device 1 coupled to its tool 4 is particularly suited to the mounting and dismantling of elastic strip rings , it is always possible to use the remote handling device in any situation where it is necessary to linearly actuate two jaws relative to one another and that this can be done remotely by means of a flexible sheath . in this sense , the particular application to elastic rings constitutes one example , no doubt a very important example , but one which does not , in any way , restrict the scope of the invention .

US-33142299-A

a method of forming an image having multiple phases is disclosed herein . the method includes forming exposed and unexposed areas , the exposed areas comprising a first polymer network exhibiting first and second phases that are chemically connected and have different refractive indices , the first phase being continuous , and the second phase comprising a plurality of structures dispersed within the first phase , and the unexposed areas comprising a second polymer network comprising third and fourth phases that are chemically connected and have different refractive indices , the third phase being continuous , and the fourth phase comprising a plurality of structures dispersed within the third phase . the first and second polymer networks are chemically connected , and morphology formed by the first and second phases is different than that formed by the third and fourth phases .

the present disclosure provides imaging methods having numerous advantages . free radically polymerizable components are polymerized to form a film comprising a silicone acrylate polymer network . at the discretion of the user , the film can be patterned or imaged either after or during the curing process to generate a visibly imaged film . in one embodiment , the film can be heat patterned to permanently set or imaged after it has been formed . in another embodiment , the free radically polymerizable components are polymerized in an imagewise manner by exposure through a mask . in this latter case , the image is formed during the exposure which , at the same time , imparts a surface topology to the film due to the preferential regional shrinkage of the curing medium . thus , this latter patterning approach may reveal a wealth of opportunities associated with the controlled modification of properties , especially optical properties , of the silicone acrylate copolymer films . it is believed that similar phenomena would be observed in other two - phase copolymer networks made by free radical polymerization ; the state - of the - art in this field has not been recognized to this point , although “ photo - printing ” ( or photoimaging ) of curable systems is known . the imaging method ( as used herein , the term method is used to refer to one or more methods ) disclosed herein is also advantageous in that it may be used for creating durable microreplication metal tools . as described above , selective ( patterned ) cure can create surface topology of the copolymeric films , and in some cases , regional shrinkage associated with curing through the mask is so strong that surface topology is easily visible ( and easy to feel ) on the surface of the cover film which is typically polyethylene terephthalate ( pet ). thus , the method may be feasible for creating microstructured surfaces . structured pet surfaces can be further replicated , for example , by electroforming . another advantage of the imaging method disclosed herein is that the imageable composition can be polymerized when coated on a microstructured surface such as a retro - reflective surface . this allows for regional masking , so that images resembling watermarks can be made . imaging can be carried out without having to have separate tools required for making the watermarks . if desired , however , a tool can be made from a film generated with a watermark . another advantage of the imaging method disclosed herein is their ability to carry additional materials soluble in one of the components , which preferentially ends up being trapped in one of the phases ( or , at the interfaces ) upon polymerization . examples of additional materials include liquid crystals , nanoparticles , and mixtures thereof . when liquid crystals are used , for example , the resulting film can be oriented such that the oriented film shows distinct diffractive patterns and / or directional diffusion . thus , such films can be used in optical applications . yet another advantage of the imaging method disclosed herein is that the method utilizes known materials and equipment . the free radically polymerizable components can be readily synthesized using known methods and readily available starting materials from commercial suppliers . thus , the user has access to ample supply of material . further , synthetic procedures allow for a variety of combinations of components or monomers that can be polymerized in a range of relative amounts . this allows the user to obtain a wide variety of films having different morphological profiles . the method disclosed herein is also advantageous in that imaging can be carried out using conventional equipment such as radiation sources that are well known in the art . as in most other imaging processes , the design and production of patterned tools and masks are required , also using processes that are well known in the art . still yet another advantage is that the polymer network forms in situ upon polymerization of the free radically polymerizable components . the polymer network can comprise a silicone ( meth ) acrylate copolymer that represents a broad class of materials . the silicone ( meth ) acrylate copolymers can be made by copolymerization of a family of telechelic free radically polymerizable siloxanes with various ( meth ) acrylate monomers . optical films comprising the silicone ( meth ) acrylate copolymers can have a wide variety of properties depending on , for example , properties of the telechelic siloxane including its molecular weight and nature of functional end groups , as well as on the particular ( meth ) acrylate monomer and the ratio of the telechelic siloxane to ( meth ) acrylate monomer . properties of the films disclosed herein can be varied depending on the desired application ; for example , films ranging from strong elastomers to plastics can be made . the method disclosed herein comprises applying an imageable composition to a substrate to form a layer of the imageable composition on the substrate , the imageable composition comprising a solution of free radically polymerizable monomers . in one embodiment , the imageable composition comprises a telechelic siloxane which is a siloxane having more than one free radically polymerizable end group . this chemistry is described in m . mazurek ; d . j . kinning ; t . konoshita j . appl . polym . sci . 2001 , 80 ( 2 ), 159 ; and u . s . ser . nos . 11 / 222 , 284 ( sherman et al . ); 11 / 222 , 450 ( sherman et al . ); 11 / 460 , 685 ( mazurek et al . ); and 11 / 460 , 682 ( sherman et al . ); the disclosures of which are incorporated herein by reference . the polymer network formed by polymerization of the monomers comprises different phases , for example , the first and second phases described above . for a polymer network formed from a telechelic siloxane and ( meth ) acrylate monomer , the relatively non - polar siloxane may form one phase , and the polyacrylate may form the other phase . in general , the first and second phases have different refractive indices , i . e ., refractive indices that differ by at least about 0 . 01 . the difference between refractive indices of the first and second phases can be varied depending on the desired application in which the optical element is used . for example , in some cases , it may be desirable for the refractive indices of the phases in the polymer network to differ by at least about 0 . 05 and up to about 0 . 2 . typical refractive indices for polyorganosiloxane materials can be from about 1 . 40 to about 1 . 77 , and for ( meth ) acrylate monomers can range between about 1 . 34 and 1 . 63 . useful telechelic siloxanes comprise derivatives of bisamino - terminated polyorganosiloxanes , for example , acrylamidoamido siloxane ( acmas ), methacrylamidoamido siloxane ( macmas ), ( meth ) acryloxyurea siloxane ( maus ), and methylstyrylurea siloxane ( mestus ), as described in mazurek et al . in general , these telechelic siloxanes are formed by reacting siloxane diamines with capping reagents such as vinyldimethylazlactone , isopropenyl dimethyl azlactone , isocyanatoethylmethacrylate , and m - isopropenyl α , α - dimethyl benzyl isocyanate , respectively . collectively , acmas , macmas , maus , and mests can be represented by the formula : these telechelic siloxanes may have number average molecular weights in the range of from about 1 , 000 to about 200 , 000 . u . s . pat . no . 7 , 998 , 587 ( mazurek et al .) describes the preparation of these telechelic siloxanes . other siloxane diamines are described , for example , in u . s . pat . no . 4 , 890 , 269 ( martin ), 4 , 661 , 577 ( jo lane et al . ), 5 , 026 , 890 ( webb et al . ), 5 , 276 , 122 ( aoki et al . ), 5 , 214 , 119 ( leir et al . ), 5 , 461 , 134 ( leir et al . ), 5 , 512 , 650 ( leir et al . ), and 6 , 355 , 759 ( sherman et al . ), incorporated herein by reference . some siloxane diamines are commercially available , for example , from shin etsu silicones of america , inc ., gelest inc ., and wacker chemie ag . wherein r 2 is independently an alkyl , haloalkyl , aralkyl , alkenyl , aryl , or aryl substituted with an alkyl , alkoxy , or halo ; g is independently an alkylene , aralkylene , or a combination thereof ; and x is equal to an integer of about 15 to about 1000 . these siloxane diamines can be prepared as described in u . s . pat . no . 6 , 355 , 759 b1 ( sherman et al .) and u . s . pat . no . 6 , 531 , 620 b2 ( brader et al .). examples of polydiorganosiloxane diamines include polydimethylsiloxane diamine , polydiphenylsiloxane diamine , polytrifluoropropylmethyl - siloxane diamine , polyphenylmethylsiloxane diamine , polydiethylsiloxane diamine , polydivinylsiloxane diamine , polyvinylmethylsiloxane diamine , poly ( 5 - hexenyl ) methyl - siloxane diamine , and mixtures thereof . the telechelic siloxanes are free radically polymerized with ( meth ) acrylate monomers . in general , useful monomers include those which , when homopolymerized , form a homopolymer having a glass transition temperature , a melting temperature , or both greater than about 40 ° c . examples include ( meth ) acrylate acids such as ( meth ) acrylic acid , and esters of non - tertiary alkyl alcohols , the alkyl groups of which comprise from about 1 to about 20 , or about 1 to about 18 carbon atoms . in one embodiment , ( meth ) acrylate monomers include benzyl methacrylate , cyclohexyl acrylate , cyclohexyl methacrylate , ethyl methacrylate , isobornyl acrylate , isobornyl methacrylate , methyl methacrylate , 1 - methylcyclohexyl methacrylate , 2 - methylcyclohexyl methacrylate , 3 - methylcyclohexyl methacrylate , 4 - methylcyclohexyl methacrylate , and 2 - phenoxy ethyl methacrylate . in another embodiment , the silicone -( meth ) acrylate copolymer comprising one or more ( meth ) acrylate monomers selected from the group consisting of iso - bornyl acrylate , tert - butyl acrylate , iso - octyl acrylate , cyclohexyl acrylate , trimethyl cyclohexyl acrylate , methyl methacrylate , and methacrylic acid . these monomers are suitable in forming a copolymer network with a free radically polymerizable siloxane . a single ( meth ) acrylate monomer or a combination of ( meth ) acrylate monomers may be used . the relative amounts of telechelic siloxane and ( meth ) acrylate monomer is selected so that the desired morphology is obtained as described below . in one embodiment , the silicone -( meth ) acrylate copolymer comprises from about 10 / 90 to about 75 / 25 ( w / w ) of one or more telechelic siloxanes to one or more ( meth ) acrylate monomers . in another embodiment , the silicone -( meth ) acrylate copolymer comprises from about 25 / 75 to about 50 / 50 ( w / w ) of one or more telechelic siloxanes to one or more ( meth ) acrylate monomers . the imageable composition can also comprise a photoinitiator . suitable photoinitiators include benzoin ethers , benzophenone and derivatives thereof , acetophenone derivatives , camphorquinone , and the like . some examples of commercially available photoinititaors include daracur 1173 , darocur 4265 , irgacure 651 , irgacure 1800 , irgacure 369 , irgacure 1700 , and irgacure 907 , commercially from ciba geigy . the photoinitiator may be used at a concentration of from about 0 . 1 to about 5 wt . % of the total polymerizable composition , and , if curing is carried out under an inerting fluid , the fluid is preferably saturated with the photoinitiator or photoinitiators being utilized in order to avoid the leaching of initiator from the reaction . the rapid cure observed for these materials allows for the use of relatively low levels of photoinitiator , hence uniform cure of thick sections can be achieved due to deeper penetration of radiation . the substrate may comprise any of a variety of materials including polyesters such as polyethylene terephthalate ( pet ), polyethylene naphthalate , copolyesters or polyester blends based on naphthalene dicarboxylic acids ; polycarbonates ; polystyrenes ; styrene - acrylonitriles ; cellulose acetates ; polyether sulfones ; poly ( meth ) acrylates such as polymethylmethacrylate ; polyurethanes ; polyvinyl chloride ; polycyclo - olefins ; polyimides ; glass ; paper ; or combinations or blends thereof . properties to consider when selecting a suitable substrate and thickness include mechanical properties such as flexibility , dimensional stability , self - supportablity , chemical stability , etc . the substrate is selected to be sufficiently transparent to the radiation used to expose the layer comprising the imageable composition . the degree of transparency or transmissivity of the substrate that is necessary depends on a variety of factors such as , for example , the particular components used in the imageable composition and the desired morphology of the layer after it is polymerized as this may be dependent on the rate at which polymerization occurs . useful substrates are optically clear and designed to control the flow of light and may have a transmission of greater than about 90 %. microstructured substrates may also be used . these substrates generally comprise a plurality of features wherein at least 2 dimensions of the features are microscopic . the topical and / or cross - sectional views of the features , therefore , are microscopic . as used herein , microscopic refers to dimensions small enough so as to require an optic aid to the naked eye when viewed from any plane of view to determine its shape . one criterion is found in modern optic engineering by w . j . smith , mcgraw - hill , 1966 , pages 104 - 105 whereby visual acuity is defined and measured in terms of the angular size of the smallest character that can be recognized . normal visual acuity is considered to be when the smallest recognizable letter subtends an angular height of 5 minutes of arc on the retina . at a typical working distance of 250 mm ( 10 inches ), this yields a lateral dimension of 0 . 36 mm ( 0 . 0145 inch ) for this object . the microstructures may be formed along portions or all of any number of surfaces of the substrate . for example , some surfaces may include sections that have microstructures and sections that are free from microstructures . alternatively , substantially all of a surface may include microstructures . in addition , the shape and / or configuration of the microstructures can also vary . for example , microstructures can include one or more projections , one or more depressions , a combination of projections and depressions , ridges , posts , pyramids , hemispheres , cones , protrusion , or any other suitable feature . the shapes of the various projections and / or depressions can also vary . for example , some embodiments of projections and / or depressions can be rounded in shape ( e . g ., circular , semicircular , spherical , hemispherical , oval , pill - shaped , partially pill - shaped , etc .) or include a rounded portion , polygonal in shape or include a polygonal portion ( e . g ., triangular , squared , cubed including cube corners , tetrahedrical , rectangular , paralleopiped , pentagonal , hexagonal , etc . ), an irregular shape , a regular shape , a pointed shape , a truncated shape , combinations thereof , or any other suitable shape . in at least some of these as well as in other embodiments , the projections and / or depressions may include or define one or more channels , valleys , wells , ridges , and the like , combinations thereof , or any other configuration . the imageable composition is coated onto the substrate ; any of a variety of techniques may be used ; for example , dip , roll , die , knife , air knife , slot , slide , wire wound rod , and curtain coating . a comprehensive discussion of coating techniques can be found in cohen , e . and gutoff , e . modern coating and drying technology ; vch publishers : new york , 1992 ; p . 122 ; and in tricot , y - m . surfactants : static and dynamic surface tension . in liquid film coating ; kistler , s . f . and schweizer , p . m ., eds . ; chapman & amp ; hall : london , 1997 ; p . 99 . the layer of the imageable composition is exposed to actinic radiation so that the components are free radically polymerized . typically , uv - visible radiation is used , but e - beam radiation may also be used . further details concerning free radical curing techniques may be found in , for example , u . s . pat . nos . 4 , 654 , 233 ; 4 , 855 , 184 ; and 6 , 224 , 949 . in one embodiment , as described below , the layer comprising the imageable composition can be cured and subsequently imaged or patterned using heat . in another embodiment , curing can be carried out in an imagewise manner to form exposed and unexposed areas . imagewise exposure can comprise exposing the layer through a mask corresponding to the desired image , or by selective exposure of the layer using laser or other light source capable of responding to digital data signals corresponding to the desired image . in some embodiments , as described below , the cured layer can be then be unaxially or biaxially oriented to form an anisotropic optical layer . by controlling the temperature , rate of stretch , amount of stretch , and other parameters of the orientation process , different features can be imparted . for example , in some cases , orientation of the optical layer and thus the polymer network results in form birefringence and can be achieved in a system by an anisotropic spatial arrangement of its optically isotropic components . as a result of orientation , the optical layer comprising the polymer network may exhibit polarization effects and / or directional scattering in which light is scattered in a preferred direction . directional scattering by the polymer network is thought to occur from gross alignment of morphological structure such that scattering becomes compounded in a particular direction . by controlling the orientation process , these optical properties can be fine tuned as disclosed in mazurek et al . the layer of the imageable composition may be imaged by a heat patterning method . in this method , the layer is polymerized and then uniaxially or biaxially oriented . heat is then applied in an imagewise manner to create the image . for example , a film of 25 / 75 50k acmas / iba was prepared via free radical copolymerization of acmas with isobornyl acrylate ( iba ). a solution of the components was prepared and photoinitiator ( darocur 1173 ) was added at 0 . 5 wt . %. the solution was cast between two transparent films of polyethylene terephthalate . the solution was then polymerized by exposure to low intensity uv light for 5 to 15 minutes . the resulting film , after removal of the two pet films , had a thickness of about 100 um and was hazy / white . the film was uniaxially stretched by hand at room temperature which caused the sample to whiten presumably due to microcavitation . the whitened parts of the sample blocked red laser light by diffusion . microcavitation was fully reversible once the stress force was relieved . the ends of a stretched coupon were fixed to a glass plate with tape . using a simple tool comprising an assembly of the glass plates heated above 120c , a sample pattern of a few parallel lines was pressed into the sample , parallel to the stretch direction , followed by a few parallel lines pressed in the cross direction . fig1 shows a micrograph of the resulting imaged film with clearer and white ( non - transparent ) blocks , which appear as white stripes and dark blocks , respectively . the sample does not return to its original shape upon removal from the glass plate in that the sample was fixed by formation of the sealed clear stripes . in another example of the heat patterning method , a strip of 50 / 50 50k maus / iba was prepared as described in mazurek et al . a strip was uniaxially stretched by hand at room temperature which caused the originally light blue sample of flexible plastic to become white with a bluish tint presumably due to crazing . directional diffusion was observed for laser light passing through the sample . the stretched sample was then heat patterned as described in the previous paragraph to form a film with almost clear stripes and white blocks . the sample does not return to its original shape upon removal from the glass plate in that the sample was fixed by formation of the sealed clear stripes . patterning can also be carried out during cure . polymerizable compositions of telechelic siloxanes and ( meth ) acrylate monomers were prepared as shown in table 1 . photoinitiator ( darocur 1173 ) was added at 0 . 5 wt . %. for each example , about 100 um layer of the solution was placed on pet film and covered with another pet film . a mask was placed on top of the construction and covered with a glass sheet . the solution was exposed through the mask to low intensity uv lights for 15 minutes . some of the more densely patterned areas wouldn &# 39 ; t cure after typical 10 minute exposure . the mask was then removed and polymerization in the originally shaded areas was completed by exposure of the sample from both sides to uv lights for an additional 10 minutes . two masks were used : additionally , some fine print ( marked in table 1 as “ b + fine ”) on the linear pattern mask was used to estimate crudely the limits of pattern resolution . fig2 a - 2 c show images of example 27 ; the masks with linear patterns are matched with the corresponding patterns created upon cure on the samples . fig2 a shows 2 clear / 1 black ; fig2 b shows 1 clear / 1 black ; and fig2 c shows 1 clear / 2 black ). fig3 shows output from a zygo instrument : a three dimensional map of example 29 after curing through the mask . it has been discovered that by selective masking of the samples during the uv curing one can “ write ” visible patterns into the films . the patterns are due to the differences in the composition ( mass movement ) between the areas exposed to the light , and the ones originally shaded . at the same time , surface topology is imparted to the thus formed films due to the preferential regional shrinkage of the curing medium . this patterning approach revealed a wealth of opportunities associated with the controlled modification of optical properties of the silicone - acrylate copolymer films . it is believed that similar phenomena would be observed in other two - phase copolymer networks made by free - radical polymerization ( no polymerization occurs in the shaded areas ). the state - of the - art in this field has not been recognized at this point , although “ photo - printing ” ( or photoimaging ) of curable systems is known . the film of example 27 was used to demonstrate multiple step patterning . after the film was imaged using mask a , the top pet liner was removed from the film , and a new 100 um layer of the same composition was coated and then covered with pet . this layer was then cured through mask a positioned 90 degrees with respect to the first pattern . both patterns were observed . in a separate experiment , the same composition was simultaneously cured from top and bottom through two masks oriented 90 degrees with respect to each other and positioned on both sides of the film . both patterns were clearly visible , similar to that observed for patterning in two separate steps . laser light scattering on the two samples was then carried out and showed differences . presumably , differences were due to areas in the single step patterning method which were partially exposed to the uv lights throughout the curing process as compared to the two step method in which areas at the intersections of the lines were shadowed before the masks were removed to complete the cure . patterning during cure can be used as a microstructuring method . as exemplified above , patterning creates surface topology of the films . presumably , this is due to regional shrinkage . in some cases , the topology was visible and could be felt on the surface of the pet cover film . fig4 shows the three dimensional image of the pet cover film from example 22 after curing . the surface of this pet film could be further replicated , e . g ., by electroforming , and made into a durable microreplication tool . the composition used in example 8 was cured against a cube - cornered diamond grade metal tool using mask a . a distinct retroreflective pattern was created . a hazy - bluish sample showed hazy - white areas which appeared brown in a retro - viewer . patterning could also be imposed by using simple masks having different scales of grayness . a mask with the 3m logo was made by printing three images at different levels of grayness . the mask was used to create 3m retro - reflective logos against the retro - reflective background . the composition from example 12 showed a retro - reflective 3m logo somewhat more bluish than the background ; the composition from example 15 showed a logo somewhat clearer than the background . another crude mask with large 3m logo characters was patterned with perpendicular single - space single black lines using paint microsoft program . the mask was made by printing a pattern on the laser printer . the composition from example 9 was cured against the cube - corner tool through such a mask . a rather uniform , strongly reduced retro - reflectivity of the logo was observed on the elastomeric film ( easily wets substrates ; fairly robust cubes ) which is shown in fig5 . in another experiment , the composition from example 12 was cured against a full - cube metal tool through the mask with 3m logo . the 3m logo was visible in a retro - viewer . bl036 nematic liquid crystals ( merck ) at 2 % were added to a composition of 40 / 60 90k acmas / iba with photoinitiator and cured . the sample was somewhat hazier compared to a cured sample of the composition without the liquid crystals . the sample with the liquid crystals was stretched 400 - 500 % while heated , and quenched . the sample showed a very distinct diffractive pattern in laser light as shown in fig6 a . a micrograph of the film is shown in fig6 b . an especially strong pattern was visible when the sample ( still elastomeric at this elongation ) was tested in its relaxed form . when slightly stretched , it shows less of the diffraction pattern and more of the directional ( cross - direction ) diffusion . a similar effect was observed in the sample made of 50 / 50 90k acmas / iba composition containing 2 % bl036 nematic lc . similar effects were observed in the compositions made of 50k acmas / iba containing 2 % bl036 nematic lc . 50 / 50 50k acmas / ioa and 5 % bl036 nematic lc was cured to check the feasibility of the room temperature orientation of domains carrying soluble additives . while stretched the sample scatters light directionally . bl036 at 2 . 5 % was incorporated into the 50 / 50 33k mestus / iba composition and cured through the 8 - pattern mask . all the patterns were well imaged clear on the clear film . no visible difference was observed - between this sample and the sample without the liquid crystals . however , after a few weeks the sample became hazy upon room temperature stretching showing some diffractive patterns . when a new sample of the same composition was cured no visible haze was detected upon stretching . diffractive patterns were visible on the unstretched sample when pet covers were removed . the invention may be more completely understood in consideration of the foregoing examples , but they are not intended to limit the scope of the invention in any way .

US-201213368401-A

fluid sensing shut - off devices with timer and methods of operation to shut off fluid flow if a primary shutoff valve sticks in the on condition . an embodiment is disclosed using a microphone to sense fluid flow , with a microprocessor periodically awakening from a sleep mode to power the sensor and determine if there is flow . if there is flow , the microprocessor times flow , and if flow is not shut off within a predetermined length of time , the microprocessor shuts off the valve . the valve itself normally held in a magnetically latched , valve open state , but may be unlatched by a current pulse to close the valve . various embodiments and applications are disclosed .

one embodiment of the present invention is its use on the water inlet of a toilet to detect a leaking toilet valve , and shut the running water off after a preset time to prevent the costly and environmentally unwise waste and loss of water . the sensor could sense fluid by an electronic sensor , by using a probe , by sensing water level , or by detecting fluid flow audibly . the fluid valve could shut off a variety of fluid flow , i . e ., household water , gardening , irrigation , gas . the shut - off device could be powered by virtually any source of power , i . e ., ac or dc powered , solar , or powered by mechanical means . fig1 is a cross - section of the valve of one embodiment of the present invention taken through the inlet 20 and outlet 22 of the valve . the valve body 24 supports , at the left side thereof , what is referred to herein as a lower diaphragm support 26 and a spring housing 28 fastened to the valve body 24 by screws 30 . at the right side of fig1 , the valve body 24 supports an actuator housing 32 held in place by screws 34 . within the valve body is a shaft 36 sealed against leakage by diaphragms 38 and 40 , retained in position on the shaft by center diaphragm supports 42 and 44 , which in turn are held in position by spring clips 46 and 48 in grooves in shaft 36 . the shaft 36 supports a seat rubber 47 within seat rubber housing 49 , also held in position on the shaft by spring clips 50 and 52 . o - ring 54 provides a seal between the valve body 24 and the lower diaphragm support 26 , with o - ring 56 providing a further seal along shaft 36 whenever the seat rubber 46 is forced against seat 58 in the valve body . at the left end of the assembly of fig1 , a preloaded spring 60 pushes against a spring guide 62 , which in turn pushes against the spring clip 46 and center diaphragm support 42 to encourage shaft 36 and the various parts coupled thereto toward the right . at the right side of the figure is an actuator support 64 and a cup shaped magnetic lower frame 66 with an annular magnet 68 at the right end thereof . a magnetic plunger 70 has a slip fit in the magnet 68 , with the end of the plunger touching the right end of shaft 36 . the assembly of the lower frame 66 and magnet 68 is held in position by an upper frame 72 and the actuator housing 32 . also within the cup shaped lower frame 66 is a bobbin 74 with a coil of wire 76 thereon . fig1 actually shows the valve in an intermediate position between its open position and its closed position . in particular , when plunger 70 is pushed to its left - most position against the force of spring 60 , the left face of plunger 70 will abut the adjacent face of lower frame 66 to form a substantially zero air gap magnetic circuit having a circuit portion comprised of lower frame 66 and the magnet 68 and a second portion comprising the plunger itself . this is a substantially zero air gap magnetic circuit because the left face of plunger 70 is in contact with the adjacent face of lower frame 66 and for the reason that the plunger 70 is a slip fit within magnet 68 . thus there is a substantial magnetic force that will hold the plunger 70 in its left - most position , the magnetic force and the spring force of spring 60 being portioned so that when the plunger is in its left - most position , the magnetic force will exceed the spring force to hold the valve in the open position . however , a current pulse through coil 76 of sufficient amplitude and duration and of appropriate sense will sufficiently reduce the magnetic flux density between the left face of plunger 70 and the adjacent face of lower frame 66 to reduce the magnetic force on plunger 70 to a magnitude less than the force of spring 60 . thus upon occurrence of such a pulse , spring 60 will cause shaft 36 and the parts attached thereto , as well as plunger 70 , to move their right - most position , forcing seat rubber 47 against seat 58 in the valve body 24 to close the valve . when closed , seat rubber 46 will be firmly against seat 58 to seal against the seat , with o - ring 56 sealing along the shaft 36 to help prevent valve leakage . when the current pulse through coil 76 is terminated , the valve will stay in the closed position because the air gap now existing between the left face of plunger 70 and the adjacent face of lower frame 66 limits the flux density recovery in this area , thereby providing a magnetic valve opening force which is now less than the force of spring 60 holding the valve closed . the valve may be manually reset , however , by pushing plunger 70 to the left - most position , opening the valve and again magnetically latching the valve in the open position with the left face of plunger 70 against the adjacent face of lower frame 66 . fig2 is a view of the assembled valve without electronics . the parts viewable in that assembly are the valve body 24 with inlet and outlet ports 22 , the actuator housing 32 held on by screws 34 , plunger 70 , lower diaphragm support 26 and spring housing 28 held in the assembly by screws 30 . the electronics for controlling the fluid sensing shut - off device of the preferred embodiments of the present invention may be seen in fig3 and 4 . the upper part of fig3 , generally indicated by the numeral 78 , merely illustrates the battery power supply , in a preferred embodiment comprising three aa batteries with various size capacitors suppressing noise and diode d 1 providing reverse voltage protection . in the lower part of the circuit of fig3 is a microprocessor ( μp ) with a conventional crystal oscillator circuit 80 providing a reference clock input for the microprocessor . the microprocessor is programmed to periodically wake up from a sleep mode and provide sensor power on line 82 , which powers the circuit on fig4 , specifically applying sensor power through resistor r 1 to a flow sensor , in a preferred embodiment a microphone m 1 , as well as to power dual operational amplifiers a 1 , operational amplifier a 2 and comparator c 1 . the microphone m 1 is disposed within the body of the valve in the final assembly and may touch the body or be slightly spaced from the body , though in either event , responding to the flow noise of fluid flowing through the open valve . amplifiers a 1 and a 2 have the positive inputs thereto biased by the voltage across resistor r 2 , with the positive input to comparator c 1 being one diode voltage drop higher than that voltage as a result of the voltage drop across diode d 2 . consequently when there is no fluid flow , and thus no microphone input , the outputs of amplifiers a 1 and a 2 will be equal to the voltage on their positive inputs , namely , one diode voltage drop below the positive input to comparator c 1 . thus with no flow the output of the comparator on line 84 will be high . this holds the output of the precision monostable multi - vibrator mv fixed pr stable , which is sensed by the microprocessor μp before reentering the sleep mode . if , however , flow has been initiated through the valve through the opening of another valve in series therewith , the flow sensor , microphone in the preferred embodiment , will provide an output that when amplified by amplifiers a 1 and a 2 of fig4 , will cause the output of comparator c 1 to oscillate , thereby triggering the multi - vibrator mv to provide an alternating state output to the microprocessor μp . the microprocessor , on sensing that alternating input , will start timing the duration of that alternating input until either the alternating input stops or the time of flow reaches a predetermined duration , after which the microprocessor will turn on mosfet mos 1 to apply the voltage vl , v 2 across the coil of the valve of fig1 . in that regard , mosfet mos 2 is merely diode connected to absorb the back emf from the coil when mosfet mos 1 is subsequently turned off . the microprocessor μp will turn on mosfet mos 1 long enough to reduce the magnetic field and thus the magnetic force pulling plunger 70 to the left - most position , allowing spring 60 to force the valve to the right - most or closed position , after which the current pulse may be terminated , with the valve remaining in the closed state until plunger 70 is again manually pushed to the left as viewed in fig1 . also shown in fig3 is a low voltage sensing capability . in particular , a voltage divider generally indicated by the numeral 86 provides two measures of the battery voltage vbat to a dual ultra - low power comparator 88 with internal reference , which will provide two outputs , one indicating a low battery ( the word battery as used herein an in the claims including multiple batteries ) and the other output indicating the battery is so low as to risk malfunction of the sensing system if the valve is not immediately closed . thus on first sensing the low battery , the microprocessor will provide an output to cause a low frequency flashing of light - emitting diode led 1 , with a still lower battery voltage indication causing the microprocessor to pulse mosfet mos 1 on to close the valve . now referring to fig5 , the manner in which the electronics and battery power supply attach to the valve body 24 may be seen . in particular , case 90 houses a printed circuit board with the microprocessor μp and other electronics therein , with cover 92 covering the three aa batteries for the battery power supply . the microphone in the preferred embodiment is mounted on the printed circuit board itself and extends into the valve body 24 for picking up the sound and vibrations from the turbulent fluid flow through the valve . the preferred embodiment of the present invention is intended for use in the water supply line for a toilet to shut off the water flow in the event the normal toilet water flow shut - off valve malfunctions for any reason . however , the present invention may be used in other instances to preserve water or protect property in systems wherein normal water flow either occurs for a predetermined time period , or at least for a predetermined maximum time period . for instance , one such other use may be in the water supply line to an ice cube maker in a refrigerator . in this application , if the solenoid valve supplying water to the ice cube maker locks in the valve open condition , substantial property damage can result unless an automatic backup shut - off valve is used , such as the present invention valve . other applications could include dishwashers and clothes washers , irrigation systems , and the like , wherein much water can be wasted and substantial damage property can result from a valve stuck in the on position . in that regard , valve systems in accordance with the present invention may readily be scaled to accommodate large or small flows as required . by having the microprocessor in the sleep mode a large majority of the time , battery life in the system of the present invention may approach the shelf life of the batteries . obviously the valve systems of the present invention could be powered from 110v ac power , though battery power is preferred to minimize installation difficulty and cost . also while a microphone and microprocessor based system has been disclosed herein , obviously other types of flow sensors and control electronics may be used as desired . in that regard , the flow duration before automatic shut - off could be varied for different applications , and if desirable , could be made field programmable . thus while certain preferred embodiments of the present invention have been disclosed and described herein for purposes of illustration and not for purposes of limitation , it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the spirit and scope of the invention .

US-40580806-A

a process for preparing gmt / foam composites in an integral process without the prior preparation of a separate consolidated gmt part produces lightweight load - bearing structures suitable for use as vehicle components such as load floors , seatbacks , and the like . the structures have fully gmt - encapsulated foam cores abutting at least partially consolidated gmt layers and at least one fully densified gmt portion . the structures may be economically and rapidly molded without resort to necessary adhesives for assembly .

gmt material is by now well known . as explained previously , this material is produced by laying down a random , oriented , or combination of random and oriented array of glass fiber strands , following which the glass fibers of the strands are intensively needled by means a needle board containing a matrix of barbed needles to break and intermingle the fibers . the product contains numerous broken fibers , but also contains a variety of fiber lengths which give the product a considerable amount of strength . the directionality of the fibers prior to needling is responsible to a large degree to the directionality or non - directionality ( anisotropic or isotropic ) nature of the gmt material . following preparation of the needled mat , the mat is then impregnated with a thermoplastic material in a double band press . although the thermoplastic material can be a high strength material such as liquid crystalline polyester , aramid , polysulfone , polyethersulfone , or the like , the vast majority of the gmt material produced today contains a relatively low melting , low modulus thermoplastic such as polyethylene , polypropylene , or other polyolefin homo - or copolymers . the latter polymers are used primarily due to their lower cost , yet still produce products with entirely acceptable performance in many applications . in like fashion , although it is less desired from an economic standpoint , the glass fibers of the gmt material may be replaced in whole or in part by carbon fibers or other high strength fibers and similarly needled to form yet higher modulus products . the manufacture and use of such products is now well known skilled in the art and many such products are commercially available , for example from azdel , inc ., basf a . g ., and symalit a . g . representative of the patents directed to processes of preparation and use of gmt material are u . s . pat . nos . 4 , 692 , 375 , 4 , 802 , 843 , and 5 , 580 , 646 , which are herein incorporated by reference . the foam core substrate is preferably one of expanded polyolefin ( epo ), more particularly expanded polypropylene ( epp ). expanded polyolefin is generally supplied in the form of expandable beads which are then placed into a suitable mold and heated by hot air or steam , whereby they expand and the cell walls fuse . the resulting products have a high degree of strength as well as a high capacity for energy absorption . the foams may be molded in flat sheets ; large blocks which are then sliced , if necessary , to form sheet material or material of other shapes ; or the beads may be molded into a substantially net shape product of complex form . the preparation and use of expandable polyolefins is disclosed in u . s . pat . nos . 4 , 676 , 939 ; 4 , 769 , 393 ; 5 , 071 , 883 ; 5 , 459 , 169 ; 5 , 468 , 781 ; and 5 , 496 , 864 , which are herein incorporated by reference . the use of epo or epp products as the substrate , or core of the subject invention composites is highly preferable , as this combination , together with the use of polypropylene impregnated gmt material , results in a totally recyclable product . total recycle of automotive components is becoming increasingly important , and is necessary in europe where cradle to grave environmental legislation exists . while the preferred foam substrates are epo , the subject invention is not limited thereto . other foams are highly suitable for use in the subject invention , provided they are sufficiently strong to resist the compression loading which occurs during the molding operation , and may be fused to the polymer impregnant of the gmt skin . examples of suitable foam are extruded and bead - type polystyrene foam , polyvinylchloride foam , and polyurethane foam . in the case of polyurethane foam , the polyurethane foam should be a semi - flexible foam or rigid foam which is non - friable . such foams are produced , as is well known to those skilled in the art , from polyol components having substantial quantities of di - and trifunctional polyols as opposed to rigid insulation foams which are prepared from essentially all higher - functional polyols , and which generally employ excess isocyanate in conjunction with trimerization catalysts to form isocyanurate linkages . the polyurethane foams will in general be softenable by heat , i . e . such that they may sufficiently bond to the polypropylene or other gmt matrix polymer . reference may be had to polyurethanes : chemistry and technology , saunders and frisch , john wiley & amp ; sons , n . y . syntactic foams may also be used . such foams are prepared by admixing polymeric or inorganic microballoons with a suitable polymer matrix resin and hardening into shape . these syntactic foams may be supplied in sheet form , block , or in net shaped products . examples of microballoons which are commonly used are phenolic microballoons and glass microballoons . such products are well known to those skilled in the art , and due to their polymer matrix , are still considered &# 34 ; polymer foams &# 34 ; as that term is used herein . in the preparation of composite materials from gmt , past practice has been to fully consolidate the gmt material . full consolidation requires a considerable amount of pressure , i . e . in excess of 800 psi , and commonly in the range of 1000 psi to 2000 psi . the gmt material may be consolidated in a hot mold , but preferably , the gmt material is heated to above the fusion temperature of the polypropylene or other thermoplastic impregnant , the sheets are laid into a cold mold , the mold is closed , and the gmt material consolidated under high pressure . the result of this high pressure consolidation is considerable flow of the many broken fibers and complete melding of the thermoplastic impregnant , resulting in the production of a material which is essentially &# 34 ; integral &# 34 ;, or &# 34 ; unitary &# 34 ;, and which does not exhibit signs of delamination . full consolidation results in a fully dense material which consists primarily of polypropylene having imbedded glass or other reinforcing fibers distributed therein . there are essentially no voids in the fully consolidated product . because the full consolidation of gmt material requires such high pressure , i . e . 1000 - 2000 psi , it has been considered impractical to even attempt to consolidate gmt material around a polymeric foam core . the foam materials , although having relatively high modulus , have low compressive strength . such materials would be destroyed during consolidation . thus , prior products employing gmt and foam core materials have required the gmt structural shell to be prepared in a separate operation , following which the fully consolidated shell is bonded to the polyolefin . as discussed previously , these additional steps increase the cost of the product as well as providing for an inferior product . in such products maximum shear strength cannot be obtained due to the possibility of shear induced movement and fracture of the polymeric core . the present inventors have discovered that a fully encapsulated product can be produced from a polymeric foam core without the separate formation of consolidated gmt shells , by laying up at least a first and a second gmt layer in a mold , between which is positioned the polymeric foam substrate . the mold is gapped over the region containing the polymeric foam substrate , so as to produce a highly reduced pressure over the foam . as a result of the reduced pressure , fracture of the foam due to the pressure exceeding its compressive strength is avoided , yet the pressure is sufficient to at least partially consolidate the gmt material . at the surrounds of the foam core substrate , however , the pressure is much higher , preferably equal to traditional gmt consolidation pressures , and the gmt material is fully consolidated and thus fully densified over these portions , resulting in a high strength fiber - reinforced , polymer matrix surround . it has been surprisingly discovered that highly stiff , high modulus materials comprising gmt skins over a polymeric core may be made without full consolidation of gmt over the foam itself when the foam is fully encapsulated . under these conditions , the fibers in the gmt coverings ( skins ) which sandwich the foam substrate absorb most of the bending stress through compression or tension of the glass fibers , and do not require a fully dense polymer matrix . while it may be perhaps preferable to fully densify the gmt material which lies on both sides of the polymeric foam substrate , this has not been found to be necessary , and indeed is impractical with most if not all existing polymeric foams . consolidation pressure must be below the compressive strength of the foam , otherwise foam failure will result . the gmt substrate which lies above the foam may consist of one or more layers of gmt material . traditional gmt material is sold in thicknesses of approximately 8 to 10 mm , which produces a thickness of approximately 3 mm when fully consolidated . applicants have surprisingly found that in the production of materials in accordance with their invention , that yet thinner gmt layers are feasible , due to the high modulus of the core . thus , the skin thickness over the core may be reduced , reducing both part weight and cost . an unconsolidated thickness of c . a . 1 . 5 - 3 mm has proven quite desirable . the thickness , and thus also the number of gmt layers in the fully encapsulating surround or other structural portions of the composites of the subject invention may be tailored for the particular application . thus , it is quite conceivable that layers of up to 3 to 4 cm in thickness , more commonly 1 to 2 cm in thickness may be necessary in certain portions of designs where high structural loads are expected in these areas . this is true for example in seatback products , where the more or less planar back , i . e . a back having substantial areal dimensions , is not expected to encounter large forces along this areal dimension , but other points must accept high loads . thus , the skin atop the portion of the foam substrate having appreciable areal dimensions may be made relatively thin . however , other portions of the seatback , i . e . the side frame , or points where hardware may be attached , should be relatively thick and fully densified gmt material . in other instances , e . g . load floors , only two gmt layers may be quite suitable in the surround . because gmt material flows under pressure , it is necessary to produce a mold where the flow of material from the high pressure region of the mold ( where full consolidation is necessary ) into the lower pressure portion of the mold ( where partial densification is allowable and where it is important that the pressure not exceed the compressive strength of the foam ), is restricted . flow of thermoplastic and fibers from the region of full densification and high pressure may be prevented by the presence of a labyrinth &# 34 ; seal &# 34 ; of reduced dimensions , for example , one of an &# 34 ; s &# 34 ; shape , such that the fiber and polymer must take a tortuous path of high resistance in order to enter the reduced pressure zone . this is best illustrated with respect to fig4 a . the mold , in general may not simply be necked down to provide a very narrow passage , as the resulting molded product would be very thin at the portion corresponding to the restriction , and will thus be quite weak due to the necessity of providing a very limited flow path to prevent the unwanted flow of gmt material . the use of a tortuous path and only slightly reduced section allows retention of section and strength while preventing ingress of flowable gmt material into the foam - containing portion of the mold . the invention may be further described in relation to the drawings . fig1 illustrates a layer of unconsolidated gmt material 1 viewed from the side . the material 1 is lofty and of relatively low density , containing numerous broken and intertwined glass fibers 3 as well as some longer glass fibers 5 , all associated with a polypropylene or other polymer 7 . numerous voids 9 are evident . fig2 illustrates a two - ply layup of unconsolidated gmt material consisting of two plies ( 15 , 17 ), with one layer , 17 , extending beyond the others . fig3 illustrates a part 14 , a portion 17 of which constitute a partially consolidated gmt material , while a further portion 19 comprises two layers of fully consolidated gmt materials 19a and 19b . although the partially consolidated layer appears to be &# 34 ; solid &# 34 ; macroscopically , upon higher magnification , numerous voids continue to exist . the material has considerable strength , but is not fully dense . dotted line 20 indicates the pre - consolidation boundaries of the two gmt layers of portion 19 . at 21 is a portion of reduced section designed to impede flow of glass fibers and polymer from the area in the mold of higher pressure used to consolidate portion 19 to the area of lesser pressure to partially consolidate portion 17 . the reduced section 21 is not optimal as its thickness precludes high strength from being obtained in this area , although this reduced strength may be acceptable for numerous applications . fig4 illustrates one embodiment of a fully encapsulated load floor 23 . at 25 , the surround is fully consolidated , having been constructed of four or more plies of gmt material which has been fully densified . at 25 is a raised portion having but one ply of partially consolidated gmt material which surrounds a polyolefin foam core . further details may be illustrated by viewing a section of the load floor and the mold used to form the load floor of fig4 the section corresponding to a section of the load floor 23 across 4a - 4a . in fig4 a , the mold consists of two halves 27 and 29 . the outer surround of the load floor 23 is molded in cavities 35 of the mold , which are dimensioned along b -- b so as to provide a cavity substantially having the depth of four fully consolidated gmt plies . for example , with four plies having an unconsolidated thickness of 10 mm each , and each having a fully consolidated thickness of 2 . 5 mm , this cavity depth would be approximately 10 mm . during consolidation , these cavities will be under high pressure , e . g . 1000 psi to 2000 psi . extensions 33 and 31 of the upper and lower mold halves together form an &# 34 ; s &# 34 ;,- shaped labyrinth seal 34 of somewhat reduced section , into which some gmt material will flow from cavities 35 during molding , but which severely limit flow such that cavities 35 may be maintained at the necessary consolidation pressure . a second mold cavity 37 corresponds in shape to the raised portion 25 of the load floor . in cavity 37 , foam core 26 is located , on the top and bottom of which are single layers 39 of gmt material . the mold is gapped in this area ; i . e ., the depth b -- b of cavity 37 is such that full consolidation pressure is not applied to gmt layers 39 nor foam core 26 . for example , with a 25 mm thick polyolefin foam core and two gmt skins of 10 mm thickness , as described above for the surround , the depth b -- b of cavity 37 may be about 33 mm . thus , the gmt skins will only be consolidated to about 4 mm thickness rather than their fully densified 2 . 5 mm thickness . the pressure in this portion of the tool will be far less than at the edges , for example 60 to 200 psi , and generally in the range of 100 psi . the gap is adjusted to provide the desired degree of gmt consolidation without exceeding the crush strength of the foam . the side walls 41 of the raised section 25 of the load floor advantageously are sloped rather than at a right angle to the plane of the floor to facilitate gmt consolidation in this area . by the term &# 34 ; partially consolidated &# 34 ; is meant a degree of consolidation which is less than full consolidation , i . e . fully densified material containing substantially no voids . by &# 34 ; fully consolidated &# 34 ; as used in the claims , is meant a material which is more fully consolidated than the &# 34 ; partially consolidated &# 34 ; material abutting the foam core . in general , this fully consolidated material is fully densified , i . e . the maximum consolidated density has been achieved . maximum consolidation will provide maximum strength . however , it would not depart from the spirit of the invention to use a less than optimal strength material by not fully consolidating the &# 34 ; fully consolidated &# 34 ; material . if the gmt material has been consolidated to a higher degree than the partially consolidated material surrounding the foam , then this degree of consolidation is still considered to be fully consolidated . although adhesives are generally preferred to be avoided , it would not depart from the spirit of the invention to include a rapidly curing thermoset adhesive or a thermoplastic adhesive , for example a film adhesive , particularly when the respective polymers of the foam core and gmt material are not fully compatible , i . e . a strong bond cannot be readily made . in this case , in particular , commercial film adhesives or hot melt adhesives may be applied between the foam and the unconsolidated gmt facing layers . by the term &# 34 ; flow restricting means &# 34 ; is meant a means for reducing the flow of gmt material from areas of high consolidation into foam receiving cavities . preferably , this means comprises a portion of reduced section , more preferably an only somewhat reduced section presenting a tortuous path . however , other equivalent means may be used as well so long as the desired results , i . e . pressure differential and only limited flow of gmt material results . for example , particularly when polypropylene impregnated gmt and expandable polypropylene foam are used , a polypropylene &# 34 ; dam &# 34 ; may be inserted in the communication channel between the respective cavities . this dam may be cold or only partially heated so as to retain its shape and flow - restricting function , yet meld with the molten gmt polymer to produce a unitary structure . the dam may also contain reinforcing fibers , or be prepared of different polymer than the gmt matrix polymer . thus , a process is provided for the preparation of a fully encapsulated composite structure . the process includes a polymer foam core and at least a portion of fully consolidated gmt material . the foam core is surrounded by gmt material . the process includes providing a gapped mold having at least one polymer foam - receiving cavity , the dimensions of the foam - receiving cavity being such so as to at least partially consolidate layers of unconsolidated gmt material abutting at least two sides of the foam core when the gapped mold is closed . at least one gmt - receiving cavity is provided , the dimensions of the gmt - receiving cavity being such so as to consolidate unconsolidated gmt material placed in the cavity to a greater extent than the gmt material abutting the at least two sides of the foam core when the mold is closed . the gmt receiving cavity and the polymeric foam - receiving cavity are in communication with each other . at least a first layer of unconsolidated gmt material is placed in the mold , at least one foam core is placed in each of the at least one foam - receiving cavities superficial to the at least one first unconsolidated gmt layer , and at least a second unconsolidated gmt layer is placed superficial to the at least one foam core . the mold is closed to exert pressure so as to consolidate the gmt layers to form at least one gmt portion which has been fully consolidated , and portions abutting the foam core which have been partially consolidated . the at least one polymeric foam core is fully encapsulated by gmt material . the subject process and the products prepared thereby have numerous advantages . first , the products may be prepared from relatively inexpensive , readily available raw materials . second , because of the unique fully encapsulated structure and its both fully densified as well as partially densified product portions , maximum advantage is taken of material physical properties . third , the total encapsulation results in a heightened ability of the foam interior to resist shear and bending stress . finally , with respect to the product , when compatible materials , i . e . polypropylene impregnated gmt and polypropylene foam , are used , the products may be fully recycled . with respect to the process , because only limited portions of the composite need be subjected to full consolidation pressure , i . e . the fully consolidated surround of a load floor , while the remainder is molded at relatively low pressure , molding machines of much lesser tonnage may be used . for example , a 700 ton machine may be used to prepare a relatively large load floor , whereas full gmt consolidation of a part having the same areal dimensions would require a much larger machine , for example a 1400 ton machine . larger machines are much more expensive as well as requiring more floor space . having now fully described the invention , it will be apparent to one of ordinary skill in the art that many changes and modifications can be made thereto without departing from the spirit or scope of the invention as set forth herein .

US-88694797-A

a method is disclosed for representing a sequence of images constituting a moving image by processing signals corresponding to the image . an object appearing in one image is identified in the sequence in a first perspective view , and the same object appearing in another image is identified in the sequence in a second perspective view . a view descriptor of the outline of the object in the first perspective view is derived and at least one additional view descriptor of the outline of the object in another perspective view is also derived . the two or more view descriptors are associated to form a descriptor which is a single indexable entity for the sequence of images .

a system according to an embodiment of the invention is shown in fig1 . the system includes a control unit 2 such as a computer for controlling operation of the system , a display unit 4 such as a monitor , connected to the control unit 2 , for displaying outputs including images and text , and a pointing device 6 such as a mouse for inputting instructions to the control unit 2 . the system also includes an image database 8 storing digital versions of a plurality of video sequences and a descriptor database 10 storing descriptor information , described in more detail below , for objects appearing in each of the video sequences stored in the image database 8 . each of the image database 8 and the descriptor database 10 is connected to the control unit 2 . in this embodiment , the elements of the system are provided on a single site , such as an image library , where the components of the system are permanently linked . a method of deriving a descriptor for an object according to an embodiment of the invention will be described with reference to fig2 and 3 . the method will be described for an object having a relatively simple shape , in this case a cylindrical object . in this example , in a video sequence stored in the image database 8 , the cylindrical object appears twice . referring to fig2 , in the first appearance , the object outline corresponds to view 1 , that is a view from the side and in the second appearance , the object outline corresponds to view 3 , that is a perspective view from the side and above . the steps of the method will now be described with reference to the flowchart shown in fig3 . the database indexer recognises that the two outlines are of the same object and that the 3 - dimensional object corresponding to those outlines is a cylinder ( step 10 ). for each of view 1 and view 3 , shape descriptors using the curvature scale space ( css ) representation are derived ( step 20 ). also , the database indexer selects any additional views that are deemed representative of the object , even if they do not appear in the video sequence under consideration ( step 30 ). in this example , view 2 , which is a view of a cylinder from above , is selected as representative . a css representation of that view is also obtained ( step 40 ). the paper “ robust and efficient shape indexing through curvature scale space ” by farzin mokhtarian , sadegh abbassi and josef kittler , proc . british machine vision conference , pp . 53 - 62 , edinburgh , u . k . 1996 describes a method of curvature scale space representation and is incorporated herein by reference . briefly , a curve representing the outline of a shape is evolved by smoothing the curve . the curve is considered at a number of different stages in the evolution . more specifically , the curvature zero crossings are identified in a curvature function at each of the stages of the evolution . a graph of the curvature zero crossings is obtained by combining zero crossing from all stages of the evolution . one axis of the graph corresponds to σ which represents the evolution parameter of the curve and the other axis corresponds to a curve arc length parameter u . a shape is then represented by the locations of the maxima of the contours in the graph . in addition to css shape representations of representative views of the object , a global 3d shape parameter of the object , which is independent of the view of the object , is obtained ( step 50 ). in this example , the global parameter is the volume of the object in real life . the volume may already be known , or it may be approximated with reference to other objects appearing in the video sequence , such as people , for which dimensions can be approximated . the global parameter and the view shape descriptors are combined to form a 3d object shape descriptor ( step 60 ). 3d object shape descriptors are obtained in the above manner for all objects of interest appearing in images in the image database 8 . the number of views for any given object and which views are used depends on the complexity of the object . some objects may have no global parameter in the 3d object shape descriptor , for example , if a value for a volume is not known or not easily derived . each view has a reference pointer indicating in which frame in the video sequence it appears , and also which object in the frame it is , for example , a view of an object may have a pointer indicating that it appears in frame 1000 and it is object number 3 . in other embodiments using different shape representation methods , the number and nature of the views will also depend on the shape representation method used . for example , a method that is less sensitive to shape deformation resulting from changes in viewing geometry will require a smaller number of views . the descriptor database 10 stores the 3d object shape descriptors for the objects in video sequences stored in the image database 8 . a method of searching for an object in a video sequence will now be described with reference to fig4 and 5 . the user initiates a search by inputting a query . the query is input by using the pointing device 6 to draw one or more shape outlines on the display unit 4 ( step 62 ). in this example , two query outlines 100 are input . these are the query views . the user also inputs a parameter representing the volume of the object for which he is searching ( step 64 ). the control unit 2 then derives the css view descriptor for each of the query views ( step 66 ). in an alternative embodiment , the user inputs a query by selecting a query shape or shapes from a menu of shapes displayed on the display unit 4 by the control unit 2 . in such an embodiment , the view descriptors may already be available in the descriptor database 10 . the query volume parameter and the query view descriptors are combined to form a query 3d object descriptor . the system then performs a matching procedure for determining the similarity between the query object descriptor and the object descriptors stored in the descriptor database 10 , hereinafter described as model object descriptors . each model object descriptor in the descriptor database is selected in turn by a selector 205 ( step 68 ) and the following steps are performed for each model object descriptor in its turn . firstly , a global similarity measure gs is obtained ( step 70 ) by a comparator 200 , using the global parameters for the query object descriptor and the model object descriptor . in this embodiment , the gs is derived by taking the ratio of the query volume parameter to the model volume parameter for the descriptor taken from the database . if the ratio is in the interval ( 1 / c , c ) where c & gt ; 1 , then the objects are considered similar and gs takes the value 0 . otherwise , gs takes the value infinity . the value of c depends on the application . for example , for feature film , c = 5 . if at least one of the query object descriptor and the model object descriptor does not have a global parameter value , then gs = 0 . if gs ≠ 0 then a new model object descriptor is selected from the descriptor database ; if gs = 0 , then a view descriptor comparison is performed as follows ( step 72 ). each query view descriptor is compared with each view descriptor for the model object descriptor under consideration in a comparator 810 using a matching function to derive view - similarity measures ( step 74 ). a comparison of the ith query view descriptor and the jth model view descriptor results in a view similarity measure s ij . in more detail , the query view descriptor is selected using a selector 600 and the database view descriptor is selected using a selector 700 . firstly , the view descriptor for the first query view is compared with each view descriptor in the model object descriptor from the database . for each pair , a view - similarity value s is computed , using a suitable matching algorithm . in this embodiment , a view - similarity value s is computed using the matching algorithm described in the mokhtarian , abbasi and kittler paper described above . when this particular similarity measure is used , the smaller the view similarity values , the closer is the match . this results in a set of k view - similarity measures for the first query view , where k is the number of view descriptors in the model object descriptor under consideration , and the k measures are stored in a global and local similarity combiner 820 . then view - similarity values are computed and stored for the second query view descriptor and the model view descriptors from the database in the same way , resulting in k further view - similarity measures . for each query view , the minimum view - similarity value for the database descriptor value under consideration is selected ( step 76 ). this minimum value is a measure of the closest match between the respective query view and one of the views in the object descriptor being considered . this results in p minimum view - similarity values where p is the number of query views . in this example , p = 2 . an overall similarity measure s for the query descriptor and the model object descriptor being considered is taken as the median of the p similarity values ( step 78 ). this represents the closeness of the match between the query descriptor and the model object descriptor taking all views into account . thus , if one query view matches a view in the database descriptor closely but the other query view does not match any view in the database descriptor closely , then this is reflected in s by an intermediate value . the above steps are repeated for each object descriptor in the descriptor database 8 , resulting in n similarity measures s , where n is the number of 3d object descriptors in the descriptor database ( step 80 ). the n similarity measures are then ordered ( step 82 ) starting from the lowest value which indicates the closest match . the m lowest values , where m is a value selected by the user or determined by the set - up of the control unit , are then selected , and an image from each of the corresponding m video sequences including the object is displayed on the display unit 4 ( step 84 ). according to the invention , multiple views of a single object are stored to form a complete or quasi - complete description of the outline shape . the representation may be quasi - complete if only views considered important for retrieval are stored . for example , for a typical database storing feature films , only front , back , side and top views of a car may be stored as a unified representation , but the view from under the car is not stored , as it is unlikely that that view will be used as a query . a system according to the invention may , for example , be provided in an image library . alternatively , the databases may be sited remote from the control unit of the system , connected to the control unit by a temporary link such as a telephone line or by a network such as the internet . the image and descriptor databases may be provided , for example , in permanent storage or on portable data storage media such as cd - roms or dvds . components of the system as described such as the selectors and comparators may be provided in software or hardware form . although the invention has been described in the form of a computer system , it could be implemented in other forms , for example using a dedicated chip . specific examples have been given of methods of representing a 2d shape of an object and of methods for calculating values representing similarities between two shapes but any suitable such methods can be used . the various views of an object making up the complete or quasi - complete shape description may , for example , be provided by the film producer . for example , in a film including a car , the producer may arrange for 20 different views of the car to be shot for use in indexing the film in the database . alternatively , a link may be provided between all the different views of an object in a sequence to enable the views to be found , and the shape for any useful views not appearing in the sequence may , for example , be provided when data for the first view of the object is included . the invention can also be used , for example , for matching images of objects for verification purposes , or for filtering . the invention is applicable to single images , and images in a sequence of images , such as images from a film or a video , or a collection of images that are associated in some way , such as being on the same web page .

US-98057407-A

a gas turbine engine has a first shaft including a first turbine rotor , and a second shaft including a second turbine rotor disposed downstream of the first turbine rotor . a third shaft includes a propulsor turbine positioned downstream of the second turbine rotor for driving a propeller . a mount ring is secured between the second turbine rotor and the propeller .

a gas turbine engine 19 is schematically illustrated in fig1 . a core engine , or gas generator 20 , includes high speed shaft 21 is part of a high speed spool along with a high pressure turbine rotor 28 and a high pressure compressor rotor 26 . a combustion section 24 is positioned intermediate the high pressure compressor rotor 26 and the high pressure turbine rotor 28 . a shaft 22 of a low pressure spool connects a low pressure compressor rotor 30 to a low pressure turbine rotor 32 . engine 19 also includes a free turbine 34 is shown positioned downstream of the low pressure turbine rotor 32 and serves to drive a propeller 36 . various embodiments are within the scope of the disclosed engine . these include embodiments in which : a good deal more work is done by the low pressure compressor rotor 30 than by the high pressure compressor rotor 26 ; the combination of the low pressure compressor rotor 30 and high pressure compressor rotor 26 provides an overall pressure ratio equal to or above about 30 ; the low pressure compressor rotor 30 includes eight stages and has a pressure ratio at cruise conditions of 14 . 5 ; in this embodiment , the high pressure compressor rotor 26 had six stages and an overall pressure ratio of 3 . 6 at cruise ; a ratio of the low pressure compressor pressure ratio to the high pressure compressor ratio is greater than or equal to about 2 . 0 , and less than or equal to about 8 . 0 ; more narrowly , the ratio of the two pressure ratios is between or equal to about 3 . 0 and less than or equal to about 8 ; and even more narrowly , the ratio of the two pressure ratios is greater than about 3 . 5 . in the above embodiments , the high pressure compressor rotor 26 will rotate at slower speeds than in the prior art . if the pressure ratio through the fan and low pressure compressor are not modified , this could result in a somewhat reduced overall pressure ratio . the mechanical requirements for the high pressure spool , in any event , are relaxed . with the lower compressor , the high pressure turbine rotor 28 may include a single stage . in addition , the low pressure turbine rotor 32 may include two stages . by moving more of the work to the low pressure compressor rotor 30 , there is less work being done at the high pressure compressor rotor 26 . in addition , the temperature at the exit of the high pressure compressor rotor 26 may be higher than is the case in the prior art , without undue challenges in maintaining the operation . variable vanes are less necessary for the high pressure compressor rotor 26 since it is doing less work . moreover , the overall core size of the combined compressor rotors 30 and 26 is reduced compared to the prior art . the engine 19 has what may be called a propulsor turbine 34 which is axially downstream of the low pressure turbine rotor 32 . further , the high pressure spool radially surrounds the low pressure spool , but neither of the spools surrounds the propulsor turbine , nor the shaft 100 connecting the propulsor turbine to the propeller 36 . in this sense , the propulsor rotor is separate from the gas generator portion of the engine . the disclosed engine architecture creates a smaller core engine and yields higher overall pressure ratios and , therefore , better fuel consumption . further , uncoupling the low pressure turbine 32 from driving prop 36 enables it to run at a lower compressor surge margin , which also increases efficiency . moreover , shaft diameters can be decreased and , in particular , for the diameter of the low pressure shafts as it is no longer necessary to drive the prop 36 through that shaft . in the prior art , the ratio of the low pressure compressor pressure ratio to the high pressure compressor ratio was generally closer to 0 . 1 to 0 . 5 . known three spool engines have a ratio of the low pressure compressor pressure ratio to the high pressure compressor ratio of between 0 . 9 and 3 . 0 . with the very small diameter core engine 20 , there will be challenges in mounting the engine 19 to an aircraft . in particular , if the engine 19 was mounted as in the prior art , at front and rear locations , there would be challenges from so - called “ backbone bending ” due to the small diameter . thus , as shown in fig2 a , a mount ring 60 is secured to a turbine case 70 that is downstream of the core engine 20 . the turbine case 70 may also receive the propulsor turbine 34 and the gear reduction 200 . the propellers 36 are downstream and beyond the turbine case . the ring 60 supplies the sole mount plane for the engine 19 . a plate 64 extends forwardly from the ring and includes a plurality of struts , one of which , 62 , is illustrated in fig2 a . an aircraft body 84 is shown schematically and is secured to the plate 64 . as shown in fig2 b , there is a pair of struts 62 extending in opposed lateral directions and pivotally connect between the plate 64 and the ring 60 . as shown in fig3 , the plate 64 is secured to aircraft body at 84 . the ring 60 has an inner surface 71 that will surround the turbine case 70 and be secured to the turbine case . pivot point 74 and 75 also secure a torque link between the plate 64 and the ring 60 . both struts 62 are shown pivotally attached at 63 to the plate 64 and pivotally attached at 65 to the ring 60 . further , the plate 64 is itself pivotally attached at 80 to the ring . the ring 60 and plate 64 provide a cantilever mount for the engine 19 . although an embodiment of this invention has been disclosed , a worker of ordinary skill in this art would recognize that certain modifications would come within the scope of this disclosure . for that reason , the following claims should be studied to determine the true scope and content of this disclosure .

US-201314758368-A

methods are disclosed for providing lignin product of a small particle size for improving burning efficiency and for avoiding typical equipment fouling problems while maximizing energy recovery .

as employed above and throughout the disclosure , the following terms , unless otherwise indicated , shall be understood to have the following meanings . as used herein , the singular forms “ a ,” “ an ,” and “ the ” include the plural reference unless the context clearly indicates otherwise . while the present invention is capable of being embodied in various forms , the description below of several embodiments is made with the understanding that the present disclosure is to be considered as an exemplification of the invention , and is not intended to limit the invention to the specific embodiments illustrated . headings are provided for convenience only and are not to be construed to limit the invention in any manner . embodiments illustrated under any heading may be combined with embodiments illustrated under any other heading . the use of numerical values in the various quantitative values specified in this application , unless expressly indicated otherwise , are stated as approximations as though the minimum and maximum values within the stated ranges were both preceded by the word “ about .” in this manner , slight variations from a stated value can be used to achieve substantially the same results as the stated value . also , the disclosure of ranges is intended as a continuous range including every value between the minimum and maximum values recited as well as any ranges that can be formed by such values . also disclosed herein are any and all ratios ( and ranges of any such ratios ) that can be formed by dividing a recited numeric value into any other recited numeric value . accordingly , the skilled person will appreciate that many such ratios , ranges , and ranges of ratios can be unambiguously derived from the numerical values presented herein and in all instances such ratios , ranges , and ranges of ratios represent various embodiments of the present invention . as used herein , the phrase “ substantially free ” means have no more than about 1 %, preferably less than about 0 . 5 %, more preferably , less than about 0 . 1 %, by weight of a component , based on the total weight of any composition containing the component . a supercritical fluid is a fluid at a temperature above its critical temperature and at a pressure above its critical pressure . a supercritical fluid exists at or above its “ critical point ,” the point of highest temperature and pressure at which the liquid and vapor ( gas ) phases can exist in equilibrium with one another . above critical pressure and critical temperature , the distinction between liquid and gas phases disappears . a supercritical fluid possesses approximately the penetration properties of a gas simultaneously with the solvent properties of a liquid . accordingly , supercritical fluid extraction has the benefit of high penetrability and good solvation . reported critical temperatures and pressures include : for pure water , a critical temperature of about 374 . 2 ° c ., and a critical pressure of about 221 bar ; for carbon dioxide , a critical temperature of about 31 ° c . and a critical pressure of about 72 . 9 atmospheres ( about 1072 psig ). near - critical water has a temperature at or above about 300 ° c . and below the critical temperature of water ( 374 . 2 ° c . ), and a pressure high enough to ensure that all fluid is in the liquid phase . sub - critical water has a temperature of less than about 300 ° c . and a pressure high enough to ensure that all fluid is in the liquid phase . sub - critical water temperature may be greater than about 250 ° c . and less than about 300 ° c ., and in many instances sub - critical water has a temperature between about 250 ° c . and about 280 ° c . the term “ hot compressed water ” is used interchangeably herein for water that is at or above its critical state , or defined herein as near - critical or sub - critical , or any other temperature above about 50 ° c . ( preferably , at least about 100 ° c .) but less than subcritical and at pressures such that water is in a liquid state as used herein , a fluid which is “ supercritical ” ( e . g . supercritical water , supercritical co 2 , etc .) indicates a fluid which would be supercritical if present in pure form under a given set of temperature and pressure conditions . for example , “ supercritical water ” indicates water present at a temperature of at least about 374 . 2 ° c . and a pressure of at least about 221 bar , whether the water is pure water , or present as a mixture ( e . g . water and ethanol , water and co 2 , etc ). thus , for example , “ a mixture of sub - critical water and supercritical carbon dioxide ” indicates a mixture of water and carbon dioxide at a temperature and pressure above that of the critical point for carbon dioxide but below the critical point for water , regardless of whether the supercritical phase contains water and regardless of whether the water phase contains any carbon dioxide . for example , a mixture of sub - critical water and supercritical co 2 may have a temperature of about 250 ° c . to about 280 ° c . and a pressure of at least about 225 bar . as used herein , “ continuous ” indicates a process which is uninterrupted for its duration , or interrupted , paused or suspended only momentarily relative to the duration of the process . treatment of biomass is “ continuous ” when biomass is fed into the apparatus without interruption or without a substantial interruption , or processing of said biomass is not done in a batch process . as used herein , “ resides ” indicates the length of time which a given portion or bolus of material is within a reaction zone or reactor vessel . the “ residence time ,” as used herein , including the examples and data , are reported at ambient conditions and are not necessarily actual time elapsed . as used herein , the term “ substantial free of ” refers to a composition having less than about 1 % by weight , preferably less than about 0 . 5 % by weight , and more preferably less than about 0 . 1 % by weight , based on the total weight of the composition , of the stated material . as used herein , the term “ saccharification ” and “ saccharified ” refers to the breakdown of polysaccharides to smaller polysaccharides , including oligosaccharides , and monosaccharides , whether through hydrolysis , the use of enzymes , or other means , generally into a liquid fraction and a solid fraction . as used herein , the term “ glass transition temperature ” or “ tg ” means the temperature at which an amorphous regions of a semi - crystalline material change from a glassy , brittle state to a rubbery or plastic state . it is dependent upon the composition of the material being tested , including moisture content , and the extent of annealing . glass transition temperature may be measured by differential scanning calorimetry , thermomechanical analysis , dynamic mechanical analysis , and the like . as used herein , the term “ pulverize ” means providing a small particle size , such as through spraying or atomizing , or reducing the particle size of a given material , whether or not through the use of mechanical means . as used herein , the term “ gradually ” or “ gradual ” used with respect to a pressure or temperature reduction refers to incremental changes of the pressure or temperature , respectively . the incremental changes per unit time may be the same or different . preferably , an individual increment is less than about 50 %, more preferably less than about 25 %, even more preferably less than about 20 %, yet even more preferably less than about 10 %, or even less than about 5 % or 1 %, of the range to be covered from the initial to final pressure or temperature . as used herein , the term “ simultaneously ” or “ simultaneous ” used with respect to a temperature reduction refers to incremental changes of the temperature that substantially match the corresponding pressure reduction . as used herein , the term “ gasified ” or “ gasification ” means that a material changes from the liquid state to the gaseous state . as used herein , “ lignocellulosic biomass or a component part thereof ” refers to plant biomass containing cellulose , hemicellulose , and lignin from a variety of sources , including , without limitation ( 1 ) agricultural residues ( including corn stover and sugarcane bagasse ), ( 2 ) dedicated energy crops , ( 3 ) wood residues ( including sawmill and paper mill discards ), and ( 4 ) municipal waste , and their constituent parts including without limitation , lignocellulose biomass itself , lignin , c 6 saccharides ( including cellulose , cellobiose , c 6 oligosaccharides , c 6 monosaccharides , and c 5 saccharides ( including hemicellulose , c 5 oligosaccharides , and c 5 monosaccharides ). generally , the methods of the invention utilizes the relationship between glass transition temperature ( t g ) and pressure to eliminate lignin fouling in the processing equipment while decreasing heat losses . rather than cooling the slurry as it exits , for example , from the cellulose hydrolysis reactor , the methods of the invention cools the slurry in such a fashion that simultaneous depressurizing and cooling takes places so there is no gasification of the components of the slurry mixture , i . e ., no flash cooling at high temperatures . this results in higher heat recovery , using , for example , heat exchangers . as the slurry is gradually depressurized while cooling , the tg of lignin gradually decreases toward the tg at atmospheric pressure ( i . e ., about 100 ° c .). thus , the temperature of the slurry is always kept above the t g , thereby preventing fouling and sticking within the processing equipment at higher temperatures . optionally , the slurry may be subjected to flash cooling from a temperature above the t g to precipitate out and pulverize ( provide as a small particle size ) lignin . this is accomplished by cooling the stream containing the lignin to just above its glass transition temperature ( t g ) to prevent sticking and then rapidly dropping the pressure so that the lignin is well below its t g at the new pressure when it precipitates out of solution at a small particle size . while this optional step results in some heat loss of low heat , it comes with the advantage of more concentrated product liquor as well as improved lignin quality . accordingly , in one embodiment , the invention is directed to methods of preparing lignin from lignocellulolosic biomass , comprising : providing lignocellulosic biomass under a first pressure of at least about 220 bar and at a first temperature of at least about 360 ° c ., comprising : gradually reducing said first pressure of said lignocellulosic biomass to a second pressure while substantially simultaneously and gradually reducing said first temperature of said lignocellulosic biomass to a second temperature at least about 1 ° c . above the glass transition temperature of lignin at said second pressure ; wherein said first liquid fraction is not substantially gasified ; and optionally , substantially simultaneously reducing said second pressure and said second temperature to a third pressure and a third temperature in a time less than about 1 second to precipitate said soluble lignin in said first liquid fraction and form a mixture comprising : in another embodiment , the invention is directed to methods of reducing lignin fouling during processing of lignocellulolosic biomass , comprising : providing lignocellulosic biomass under a first pressure of at least about 220 bar and at a first temperature of at least about 360 ° c ., comprising : gradually reducing said first pressure of said lignocellulosic biomass to a second pressure while substantially simultaneously and gradually reducing said first temperature of said lignocellulosic biomass to a second temperature at least about 1 ° c . above the glass transition temperature of lignin at said second pressure ; wherein said first liquid fraction is not substantially gasified ; and optionally , substantially simultaneously reducing said second pressure and said second temperature to a third pressure and a third temperature in a time less than about 1 second to precipitate said soluble lignin in said first liquid fraction and form a mixture comprising : a schematic of one embodiment of the invention is shown in fig1 . the lignin slurry exits the hydrolysis process 1 at a first temperature and a first pressure . it is first cooled to a first intermediate temperature using a pre - cooler heat exchanger 2 and depressurized to a first intermediate pressure using pressure letdown valve 3 . it is next cooled to a second intermediate temperature using a pre - cooler heat exchanger 4 and depressurized to a second intermediate pressure using pressure letdown valve 5 . it is further cooled to a third intermediate temperature using a pre - cooler heat exchanger 6 and depressurized to a third intermediate pressure using pressure letdown valve 7 . it is further cooled to a fourth intermediate temperature using a pre - cooler heat exchanger 8 and depressurized rapidly using pressure letdown valve 9 , and subsequently the liquid ( i . e ., water ) content in the slurry is flash evaporated . this results in the sudden precipitation of the soluble lignin into fine particles inside the lignin pulverizer 11 . in certain embodiments , the pulverizer is of relatively small volume to keep the slurry moving and avoid lignin settling . in other embodiments , it may be of a large volume to permit settling of the lignin , which may be recovered by mechanical means , especially when using full flash . the inlet pipe to the pulverizer may either be above , below , or to either side of the pulverizer . atmospheric pressure for full pressure reduction , or an intermediate pressure in the case of a partial pressure reduction , is maintained in the pulverizer by the back pressure control valve 10 . in embodiments using full flash to atmospheric pressure , no back pressure control is needed . any recovered steam enters a condenser 12 ( not shown ) for heat recovery . following the pulverizer , the slurry flows through flow control 14 and then is further cooled to recover more heat in a heat exchanger 16 , and is reduced to atmospheric pressure , if not yet a atmospheric temperature , via a pressure letdown valve 18 in the settling tank 20 . in the tank , the lignin is permitted to settle to the bottom . finally , the slurry may be passed through a solid / liquid filtration apparatus 22 for final separation of liquor 24 and lignin 26 . advantages of the methods of the invention are that the pulverization ( preparation of small particles and / or reduction in average particle size ) of soluble and insoluble lignin improves handling , accelerates the drying , and improves combustion of the lignin . another advantage of the methods of the invention is that the glass transition phase of the lignin , both soluble and insoluble , is avoided , which in turn avoids fouling of the process equipment . in certain embodiments of the method , lignocellulosic biomass is fractionated to remove at least a portion of c 5 saccharides by any suitable means , including , but not limited to , hydrothermal treatment ( such as hot compressed water , subcritical , near critical , or supercritical water , which may contain other fluids , including alcohol , acid , or base ), enzymatic treatment , and the like . in certain embodiments of the method , the average particle size of said insoluble lignin and precipitated lignin is less than about 500 microns . the methods of the invention are preferably run continuously , although they may be run as batch or semi - batch processes . the methods of the invention may be carried out in any suitable reactor , including , but not limited to , a tubular reactor , a digester ( vertical , horizontal , or inclined ), and the like . suitable digesters include the digester system described in u . s . pat . no . 8 , 057 , 639 , which include a digester and a steam explosion unit , the entire disclosure of which is incorporated by reference . in certain embodiments , methods employ multiple pressure down valves and multiple heat exchangers . in certain embodiments of the methods , the first temperature is about 360 ° c . to about 380 ° c ., preferably , about 360 ° c . to about 377 ° c ., and more preferably , about 365 ° c . to about 377 ° c . in certain embodiments of the methods , the second temperature is at least about 5 ° c . above the glass transition temperature of lignin at said second pressure . in certain embodiments of the methods , the second temperature is at least about 10 ° c . above the glass transition temperature of lignin at said second pressure . in certain embodiments of the methods , the second temperature is about 110 ° c . to about 150 ° c ., preferably , about 110 ° c . to about 135 ° c ., and more preferably , about 110 ° c . to about 120 ° c . in certain embodiments of the methods , the third temperature is about 20 ° c . to about 100 ° c ., preferably , about 20 ° c . to about 80 ° c ., and more preferably , about 20 ° c . to about 60 ° c . in certain embodiments of the methods , the first pressure is about 220 bar to about 300 bar , preferably , about 220 bar to about 250 bar , and more preferably , about 240 bar to about 250 bar . in certain embodiments of the methods , the second pressure is greater than atmospheric pressure . in certain embodiments of the methods , the second pressure is about 50 bar to about 150 bar , preferably , about 50 bar to about 125 bar , and more preferably , about 50 bar to about 100 bar . in certain embodiments of the methods , the second pressure is atmospheric pressure . in certain embodiments , the methods may further comprise the step of recovering at least a portion of heat added to the system , for example , through the use of at least one heat exchanger . in certain embodiments , the method further comprises the step of reducing the pressure on said mixture to a third pressure . pressure control impacts temperature in the flashing process where the saccharified lignocellulosic biomass is cooled in a very short period of time ( e . g ., less than one second ). the inlet pressure must be equal to or greater than the saturation pressure at the given temperature so that the liquid components of fraction remain as liquids . with respect to processing of lignocellulosic biomass , it is preferably to avoid the temperature range of about 180 ° c . and about 240 ° c ., the glass transition temperature range of lignin under typical processing conditions . thus , if the inlet temperature is at least the 240 ° c .+ 1 ° c ., then the minimum inlet pressure needs to be about 34 bar but may be much higher . for example , it is typical to have the inlet pressure at 40 bar . the exit temperature is determined and dependent upon the exit pressure . if , for example , there is flash cooling of the saccharified lignocellulosic biomass down to a temperature of 180 ° c ., then the exit pressure needs to equal to the saturation pressure at 180 ° c ., which about 10 bar . the exit pressure is controlled by the back pressure valve , and the exit temperature is determined by the exit pressure . if the exit pressure is changed , the exit temperature will also change . the exit temperature is the saturation temperature at the selected pressure . in certain embodiments , the method further comprises the step of permitting said insoluble lignin and said precipitated lignin , where the lignin has been pulverized ( provided as a small particle size or reduce the particle size ) to separate out by gravity . in certain embodiments , the method further comprises the step of separating said second solid fraction and said second liquid fraction . suitable separation methods including filtration methods well known to those skilled in the art , such decanter filters , filter press , reverse osmosis and nanofiltration , centrifuge decanters , and the like . in another embodiment , the invention is directed to lignin products produced by the methods of the invention , including fuels , such as those used in a process heat boiler . the lignin product may also be used as a functional replacement for phenol , as a functional replacement for polyol , or as a building block for carbon fiber . in certain embodiments , the lignin product is used as a fuel , tackifier , phenol formaldehyde resin extender in the manufacture of particle board and plywood , in the manufacture of molding compounds , urethane and epoxy resins , antioxidants , controlled - release agents , flow control agents , cement / concrete mixing , plasterboard production , oil drilling , general dispersion , tanning leather , road covering , vanillin production , dimethyl sulfide and dimethyl sulfoxide production , phenol substitute in phenolic resins incorporation into polyolefin blends , aromatic ( phenol ) monomers , additional miscellaneous monomers , carbon fibers , metal sequestration in solutions , basis of gel formation , polyurethane copolymer , and combinations thereof . lignin ; wherein said lignin is processed from lignocellulosic biomass using supercritical or near critical fluid extraction . in preferred embodiments , the composition is substantially free of organic solvent . in preferred embodiments , the lignin has an average particle size less than about 500 microns , more preferably 300 microns , even more preferably , less than about 250 microns , and yet even more preferably less than about 50 microns . the particle size of the lignin may be measured by standard sieve shaker , microscopy , infrared spectroscopy , and other standard size analysis techniques . in a preferred embodiment , the lignin has a heating value as measured by astm - d240 of at least about 5 , 000 btu / lb at 30 % moisture content . in a preferred embodiment , the lignin has a heating value as measured by astm - d240 of at least about 7 , 500 btu / lb at 15 % moisture content . in a preferred embodiment , the lignin has a heating value as measured by astm - d240 of at least about 8 , 000 btu / lb at 5 % moisture content . the present invention is further defined in the following examples , in which all parts and percentages are by weight , unless otherwise stated . it should be understood that these examples , while indicating preferred embodiments of the invention , are given by way of illustration only and are not to be construed as limiting in any manner . from the above discussion and these examples , one skilled in the art can ascertain the essential characteristics of this invention , and without departing from the spirit and scope thereof , can make various changes and modifications of the invention to adapt it to various usages and conditions . the methods of the invention may be carried out using the following pressure and temperature changes using the apparatus shown in fig1 : conventional processes suffer a major disadvantage because of the heat loss due to flashing that reduces heat recovery . in contrast , the methods of the present invention cool and depressurize simultaneously so that there is no flashing . in other words , all the heat put into the system may be recovered as there is no steam formation . even if there is some flashing , it would be very minimal with little heat loss . accordingly , the method of the present invention reduces heat loss through the system . when ranges are used herein for physical properties , such as molecular weight , or chemical properties , such as chemical formulae , all combinations , and subcombinations of ranges specific embodiments therein are intended to be included . the disclosures of each patent , patent application , and publication cited or described in this document are hereby incorporated herein by reference , in their entirety . those skilled in the art will appreciate that numerous changes and modifications can be made to the preferred embodiments of the invention and that such changes and modifications can be made without departing from the spirit of the invention . it is , therefore , intended that the appended claims cover all such equivalent variations as fall within the true spirit and scope of the invention .

US-201213479852-A

a powershift transmission for a work vehicle is disclosed having two modes of applying power : a direct connection through a series of gears , and a connection through a torque converter integral with the transmission . the two paths branch at the input shaft , on which is mounted and which drives a torque converter that has a gear coupled to its output . another gear on the input shaft is connected to that shaft by a hydraulic clutch . when the clutch is engaged , the transmission provides several high - range forward gear ratios through a direct gear drive . when that clutch is disconnected , the torque converter supplies power to the transmission to low forward and low reverse ranges of gear ratios . the transmission includes a first countershaft , on which are mounted a reverse master clutch engaged in all reverse gear ratios ) and a forward low range clutch , which is engaged in the low range of forward gear ratios . the reverse master clutch couples the countershaft directly to the output shaft . the forward low - range clutch connects the countershaft to a second countershaft . the second countershaft and the output shaft each has two speed clutches . only one of these speed clutches is engaged in any individual gear ratio . the output shaft is also engaged to a mechanical front wheel drive output shaft via a clutch . this output shaft is engaged via that clutch and counter - rotates with the output shaft to drive the front wheels or tracks of the vehicle .

[ 0013 ] fig1 shows the layout of gears , shafts , and clutches of transmission 10 . the transmission shafts are supported in transmission case 11 on bearings 13 in a conventional manner . transmission 10 selectively drives rear drive wheels or tracks 15 , as well as a mechanical front wheel ( or track ) drive 17 . while not shown , the wheels or tracks can be , and preferably are , driven through additional drive elements 100 , which may include transfer cases , rear differentials and simple reduction gear sets . similar drive elements 102 may be disposed between mfd shaft 20 and front wheels or tracks 17 . in the preferred embodiment , there are five ( 5 ) shafts , an input or first shaft 12 , a first counter shaft 14 , a second counter shaft 16 , a first output shaft 18 , and a mechanical front wheel drive output shaft 20 . input shaft 12 drives a power take off ( pto ) or pump 22 . the pump is a hydraulic pump and is used to provide auxiliary hydraulic fluid typically for implements attached to the vehicle . the pto is similarly connected to an implement that is driven by a rotating shaft . the vehicle &# 39 ; s engine 23 is rotationally coupled to and drives input shaft 12 . a first gear 24 is fixed to shaft 12 for free rotation therewith . a hydraulic clutch , preferably a multi - plate clutch 26 , is also mounted on input shaft 12 . clutch 26 , when engaged , locks first gear 24 to shaft 12 so that they rotate conjointly . when clutch 26 is disengaged , input gear 24 can turn freely on the shaft . a torque converter 28 is also mounted on and driven by input shaft 12 . the input side 30 of the torque converter is fluidly coupled to output side 32 of the torque converter in the conventional manner . a first gear of a drop gear set , shown in fig1 as second gear 34 , is also mounted on shaft 12 and is coupled to the output side 32 of the torque converter to rotate conjointly therewith . first gear 24 is driven by the engine 23 whenever the forward high range clutch 26 is engaged . clutch 26 , like all the other clutches in transmission 10 , is designed to provide conjoint rotations , and not to slip for any extended period of time . thus , gear 24 rotates at substantially the same speed as engine 23 . although we have not shown it in fig1 one or more reduction gears could easily be disposed between engine 23 and input shaft 12 without violating the spirit of the present invention . engine 23 also drives input side 30 of torque converter 28 which , in turn , is fluidly coupled to the output side 32 of the torque converter and drives it . since the output side of the torque converter is fixed to and rotates conjointly with second gear 34 , gear 34 rotates with the input shaft . gear 34 is fluidly coupled to the input shaft whenever the forward high range clutch 26 is engaged . unlike gear 24 , gear 34 is fluidly coupled to engine 23 , and therefore does not always rotate at the same speed as engine 23 , as does gear 24 . these two gears , both located on input shaft 12 , provide the dual power flows for transmission 10 . for the high range of forward gears , power flows from engine 23 through gear 24 and thence to the rest of the transmission and driven wheels or tracks . for the low range of forward gears and the reverse gears , power flows from the engine through torque converter 28 and to gear 34 . from gear 34 , this power is coupled to the remaining portions of the transmission . for this reason , clutch 26 is termed the “ forward high range ” clutch . when it is engaged , power is provided to the forward high range of gear ratios . transmission 10 also includes a first counter shaft 14 on which gears 35 , 36 and 38 are mounted . gear 35 is mounted on counter shaft 14 for free rotation thereon . transmission 10 includes a second clutch 40 that is also mounted on counter shaft 14 and , when engaged , fixes third gear 35 to rotate conjointly with counter shaft 14 . when clutch 40 is disengaged , gear 35 rotates freely about counter shaft 14 . clutch 40 , when engaged , enables the transmission to provide all of the reverse gear ratios . as shown by dotted lines 37 , gear 35 is in continuous mesh with gear 60 on the output shaft . when clutch 40 is engaged , power flow bypasses the second counter shaft 16 and goes to output shaft 18 , thus reversing the direction of rotation of output shaft 18 . it is this reversal of rotation of the output shaft that causes the transmission , and hence the vehicle , to operate in reverse . for this reason , clutch 40 is called the “ reverse clutch ” or “ reverse master clutch ”. gear 36 is also mounted on counter shaft 14 for free rotation therewith . a third clutch , clutch 42 , is mounted on counter shaft 14 and , when engaged , fixes gear 36 to rotate conjointly with counter shaft 14 . when clutch 42 is disengaged , gear 36 rotates freely about counter shaft 14 . clutch 42 is the forward low range clutch . when it is engaged transmission 10 can operate in a low range of forward gear ratios . reverse clutch 40 and the forward low range clutch 42 are not simultaneously engaged in any of the gear ratios of transmission 10 . the second gear of the drop gear set , fifth gear 38 , is mounted on counter shaft 14 to rotate conjointly therewith . second gear 34 on input shaft 12 and fifth gear 38 on first counter shaft 14 together comprise drop gear set 33 and jointly serve to transfer the engine power from torque converter 28 to first counter shaft 14 . gears 34 and 38 are in constant meshing engagement at all times during transmission operation . in a similar fashion , gears 24 ( on shaft 12 ) and 36 ( on shaft 14 ) are also in constant meshing engagement . clutch 42 is called the “ forward low range clutch ” because when it is engaged , it enables the transmission to operate in the forward low range gear ratios . it is always engaged when the transmission is in these forward gear ratios . power from engine 23 goes through torque converter 28 to gear 34 , the first gear of the drop gear set , which transmits power to the second gear of the drop gear set , gear 38 . since gear 38 is fixed to the first counter shaft 14 , this causes counter shaft 14 to rotate the “ gear ” side of clutch 26 , the forward high range clutch . however , clutch 26 is always disengaged when clutch 42 is engaged , thus permitting gear 29 to spin freely on shaft 12 . power is transmitted from gear 38 to counter shaft 14 and thence through clutch 42 to gear 36 . this power flow provides all the forward low range gear ratios . all of these low range gear ratios therefore couple the engine to the wheels or tracks through torque converter 28 . once engine power has been supplied to gear 36 in this manner , gear 36 transmits the power to shaft 16 through gear 48 with which it continuously meshes . referring now to second counter shaft 16 , a sixth gear , gear 44 is mounted on second counter shaft 16 for free rotation thereon . a seventh gear 46 is also mounted on second counter shaft 16 for conjoint rotation therewith . an eighth gear 48 is mounted on second counter shaft 16 for conjoint rotation therewith . a ninth gear 50 is mounted on second counter shaft 16 for free rotation thereon . a fourth transmission clutch 52 is mounted on second counter shaft 16 to connect sixth gear 44 to shaft 16 for conjoint rotation therewith . a fifth clutch 54 is mounted on second counter shaft 16 to connect ninth gear 50 to shaft 16 for conjoint rotation therewith . eighth gear 48 is in continuous meshing engagement with fourth gear 36 . second countershaft 16 receives power from engine 23 in three different ways . in each of the forward gear ranges , the high range through gear 24 and gear 36 , and the low range through gear 34 , gear 38 and thence to gear 36 , counter shaft 16 is driven by gear 48 which is in constant meshing engagement with gear 36 on first counter shaft 14 . thus , in all forward gear ratios , second counter shaft 16 receives power through gear 48 . for the low range forward gear ratios , the power goes through torque converter 28 . for the high range of gear ratios , power is transmitted through clutch 26 . in the high range of forward gears , clutch 42 is not engaged , and hence gear 36 rotates freely on shaft 14 and serves merely to transfer power from gear 24 to gear 48 . in the forward lower range of gear ratios , clutch 42 is engaged and serves to transmit power from shaft 14 to gear 36 and thence to shaft 16 through gear 48 with which it continuously meshes . referring now to first output shaft 18 , a tenth gear 56 is mounted on output shaft 18 for conjoint rotation therewith . an eleventh gear 58 is mounted on output shaft 18 for free rotation therewith . a twelfth gear 60 is mounted on output shaft 18 for free rotation therewith . twelfth gear 60 is also fixed to eleventh gear 58 such that gears 58 and 60 rotate conjointly at all times . a thirteenth gear 62 is mounted on output shaft 18 for free rotation therewith . a fourteenth gear 64 is mounted on output shaft 18 for conjoint rotation therewith . a fifteenth gear 66 is mounted on output shaft 18 for conjoint rotation therewith . a sixth transmission clutch 68 is mounted on output shaft 18 to connect eleventh gear 58 and twelfth gear 60 to output shaft 18 for conjoint rotation therewith . a seventh clutch 70 is mounted on output shaft 18 to connect thirteenth gear 62 to output shaft 18 for conjoint rotation therewith . tenth gear 56 on output shaft 18 is coupled to sixth gear 44 on second counter shaft 16 for continuous meshing engagement therewith . eleventh gear 58 on output shaft 18 is coupled to seventh gear 46 on counter shaft 16 for continuous meshing engagement therewith . twelfth gear 60 on output shaft 16 is engaged with third gear 35 on first counter shaft 14 for continuous meshing engagement therewith . thirteenth gear 62 on output shaft 18 is connected to eighth gear 48 on second counter shaft 16 for continuous meshing engagement therewith . the fourteenth gear 64 on output shaft 18 is connected to ninth gear 50 on second counter shaft 16 for continuous meshing engagement therewith . we will now describe the engagement of the speed clutches to provide each of the forward and reverse gear ratios . the speed clutches are the two clutches , 52 and 54 on shaft 16 and 68 and 70 on shaft 18 . clutch 52 is the first and fifth gear clutch . clutch 54 is the second and sixth gear clutch . clutch 68 is the third and seventh gear clutch , and clutch 70 is the fourth and eighth gear clutch . starting with the forward gear ratios and going from the lowest gears to the highest gears , the power flow in first gear forward is as follows . first , clutch 42 , the forward low range clutch , is engaged . power flows from the engine through the torque converter and the drop gear set 33 to shaft 14 . with clutch 42 engaged , the fourth transmission gear , gear 36 rotates conjointly with shaft 14 . gear 36 is in constant meshing engagement with eighth gear 48 on shaft 16 . thus , for any of the forward low range gear ratios , shaft 16 is driven through the torque converter . with first / fifth gear clutch 52 engaged , gear 44 rotates together with driven shaft 16 and transmits its power to output shaft 18 through gear 56 with which it is in constant meshing engagement . gear 56 is fixed to shaft 18 and therefore rotates the output shaft . for the second gear , second / sixth gear clutch 54 is engaged and the other three speed range clutches are disengaged . again , shaft 16 is driven by gear 48 . gear 50 rotates jointly with shaft 16 when clutch 54 is engaged . gear 50 also meshes continuously with gear 64 on output shaft 18 . since gear 64 is fixed to rotate conjointly with output shaft 18 , this causes output shaft 18 to rotate . for the third gear , third / seventh gear clutch 68 is engaged and all the other speed clutches ( 52 , 54 , 70 ) are disengaged . power is transmitted , again , from gear 48 to shaft 16 , thence to gear 46 which is fixed on shaft 16 and to gear 58 with which gear 46 is in continuous meshing engagement . with clutch 68 engaged , gear 58 rotates conjointly with shaft 18 . thus , shaft 18 is driven by shaft 16 . finally , for fourth gear , fourth / eighth gear clutch 70 is engaged to lock gear 62 with respect to shaft 18 . power flows from gear 48 directly to gear 62 with which it is in constant meshing engagement . clutch 70 fixes gear 62 with respect to output shaft 18 and thus causes output shaft 18 to rotate conjointly with gear 62 . the forward high range gear ratios , gear ratios five through eight , are also driven in a similar manner through gear 48 . for the high range of forward gear ratios , clutch 26 on the input shaft is engaged , thus causing gear 24 to rotate conjointly with input shaft 12 . this power is transmitted from gear 24 to gear 36 , which is in constant meshing engagement with gear 24 and thence to gear 48 which is in constant meshing engagement with gear 36 . clutch 42 is always disengaged in these gear ratios , permitting shaft 14 to spin freely driven by drop gear set 33 . in this manner power is transmitted to shaft 16 through gear 48 and the higher range forward gears ( gear ratios 5 - 8 ) are engaged in the same manner as the lower range forward gear ratios ( gears 1 - 4 ) described immediately above . for the reverse gear ratios , power is not supplied directly to shaft 16 through gear 48 , but is supplied through reverse master clutch 40 on shaft 14 through gear 35 and thence to gear 60 on output shaft 18 with which gear 35 is in continuous engagement . this “ bypassing ” of shaft 16 and the continuous meshing engagement of gears 35 and 60 are indicated by dashed line 37 in fig1 . this bypassing of shafts 14 , 16 , and 18 do not lie in the same plane , as the figure would seem to show , but are in a substantially triangular axial relationship . thus , the distance between shaft 14 and 16 is generally the same as the distance between shafts 16 and 18 , which is generally the same as the distance between shaft 18 and shaft 14 . these relationships have been “ flattened ” in fig1 to permit the easy illustration of the gear shafts and clutches of transmission 10 . in the lowest reverse gear ratio , first gear reverse , power is transmitted through torque converter 28 through the drop gear set and thence to shaft 14 . reverse clutch 40 on shaft 14 is engaged to transfer power to gear 35 and thence to gear 60 on shaft 18 . power flows from gear 60 to gear 58 with which it always rotates conjointly , and thence to gear 46 . clutch 52 is engaged , and therefore gear 44 is fixed with respect to shaft 16 and drives gear 56 fixed on output shaft 18 , causing output shaft 18 to rotate . in a similar fashion , in the second reverse gear , gear 58 drives gear 46 which causes shaft 16 to rotate . unlike first gear reverse , clutch 54 , the second gear clutch , is the only speed clutch engaged , causing gear 50 to rotate conjointly with shaft 16 . since gear 50 is in continuous meshing engagement with gear 64 , which , in turn , is fixed to rotate conjointly with shaft 18 , gear 50 causes output shaft 18 to rotate . for the third reverse gear , clutch 68 is engaged , causing gear 60 to be fixed with respect to shaft 18 . since gear 60 is driven by gear 35 on shaft 14 , shaft 18 is caused to rotate . the final gear ratio , fourth gear reverse , is provided by engaging clutch 70 on shaft 18 . power transmitted to gear 60 is transmitted to gear 58 which rotates shaft 16 through gear 46 . gear 48 , in turn , is fixed to shaft 16 and is in continuous meshing engagement with gear 62 on shaft 18 . clutch 70 fixes gear 62 to rotate conjointly with shaft 18 thereby causing output shaft 18 to rotate . the description above explains how each of the gear ratios are provided , and how power flows in dual paths through transmission 10 . the remaining shaft in the transmission is the mechanical front wheel drive output shaft 20 . sixteenth gear 72 is mounted on mfd output shaft 20 for free rotation therewith . eighth clutch 74 is mounted on shaft 20 to connect sixteenth gear 72 to output shaft 20 for conjoint rotation . while the embodiments illustrated in the figures and described above are presently preferred , it should be understood that these embodiments are offered by way of example only . the invention is not intended to be limited to any particular embodiment , but is intended to extend to various modifications that nevertheless fall within the scope of the appended claims .

US-75095900-A

a method of thermally insulating an object that requires a class a standard insulation material , said method comprising suitably locating a metallized polymeric reflective insulation material adjacent said object , wherein said polymeric material is selected from a closed cell foam , polyethylene foam , polypropylene foam , expanded polystyrene foam , multi - film layers assembly and a bubble - pack assembly . the object is preferably packaging , a vehicle or a residential , commercial or industrial building or establishment . the polymeric material may contain a fire - retardant and the bright surface of the metallized layer has a clear lacquer coating to provide anti - corrosion properties , and which maintains satisfactory reflectance commercial criteria .

fig1 is a bubble - pack - scrim laminated blanket assembly having polyethylene layers 112 , 114 , 116 and 118 and scrim layer 126 with nylon tapes 124 laminated between layers 112 and 114 . adhered to outer layer 112 is a metallized pet layer 12 . fig1 and 16 represent the embodiment of fig1 but , additionally , having an aluminum foil layer 122 laminated to layer 112 in fig1 and to layer 118 , via a polyethylene layer 136 in fig1 . the following numerals denote the same materials throughout the drawings , as follows :— the bubble pack layer is preferably of a thickness selected from 0 . 5 cm to 1 . 25 cm . the other polyethylene layers are each of a thickness , preferably , selected from 1 to 6 mls . the fire retardant material of use in the preferred embodiments was antimony oxide at a concentration selected from 10 - 20 % w / w . insulation material no . 1 was a prior art commercial single bubble pack assembly of a white polyethylene film ( 1 . 2 mil ) laminated to a polyethylene bubble ( 2 . 0 mil ) on one side and aluminum foil ( 0 . 275 mil ) on the other . insulation material no . 2 was a metallized polymeric material of use in the practise of the invention in the form of a bubble pack as for material no . 1 but with the aluminum foil substituted with metallized aluminum on polyethylene terephthalate ( pet ) film ( 48 gauge ) adhered to the polyethylene bubble . a blow torch was located about 10 - 15 cm away from the insulation material ( 5 cm × 10 cm square ) and directed at each of the aluminum surfaces . single bubble aluminum foil . material no . 1 started to burn immediately and continued burning until all organic material was gone . flame and smoke were extensive . single bubble metallized aluminum material . for material no . 2 , where the flame was directly located , a hole was produced . however , the flame did not spread outwards of the hole or continue to burn the material . flame and smoke were minimal . conclusion . single bubble metallized material reacts better to the flame , that is the material burned where the flame was situated but did not continue to burn . clearly , this test shows the advance of the metallized insulation material according to the invention over its prior art aluminum foil counterpart . this example illustrates the testing of the bubble - pack assembly shown in fig1 — being commonly known as a metallized - double bubble - white poly ( fr ) in accordance with nfpa 286 standard methods of fire tests for evaluating contribution of wall and ceiling interior finish to room fire growth . the test material was mounted on the lhs , rear , rhs walls to a height of the test room as well as the ceiling of the test room . the sample did not spread flames to the ceiling during the 40 kw exposure . the flames did not spread to the extremities of the walls during the 160 kw exposure . the sample did not exhibit flashover conditions during the test . nfpa 286 does not publish pass / fail criteria . this specimen did meet the criteria set forth in the 2003 ibc section 803 . 2 . 1 . the test was performed by intertek testing services na , inc ., elmendorf , tex ., 78112 - 984 ; u . s . a . this method is used to evaluate the flammability characteristics of finish wall and ceiling coverings when such materials constitute the exposed interior surfaces of buildings . the test method does not apply to fabric covered less then ceiling height partitions used in open building interiors . freestanding panel furniture systems include all freestanding panels that provide visual and / or acoustical separation and are intended to be used to divide space and may support components to form complete work stations . demountable , relocatable , full - height partitions include demountable , relocatable , full - height partitions that fill the space between the finished floor and the finished ceiling . this fire test measures certain fire performance characteristics of finish wall and ceiling covering materials in an enclosure under specified fire exposure conditions . it determines the extent to which the finish covering materials may contribute to fire growth in a room and the potential for fire spread beyond the room under the particular conditions simulated . the test indicates the maximum extent of fire growth in a room , the rate of heat release , and if they occur , the time to flashover and the time to flame extension beyond the doorway following flashover . a calibration test is run within 30 days of testing any material as specified in the standard . all instrumentation is zeroed , spanned and calibrated prior to testing . the specimen is installed and the diffusion burner is placed . the collection hood exhaust duct blower is turned on and an initial flow is established . the gas sampling pump is turned on and the flow rate is adjusted . when all instruments are reading steady state conditions , the computer data acquisition system and video equipment is started . ambient data is taken then the burner is ignited at a fuel flow rate that is known to produce 40 kw of heat output . this level is maintained for five minutes at which time the fuel flow is increased to the 160 kw level for a 10 - minute period . during the burn period , all temperature , heat release and heat flux data is being recorded every 6 seconds . at the end of the fifteen minute burn period , the burner is shut off and all instrument readings are stopped . post test observations are made and this concludes the test . all damage was documented after the test was over , using descriptions , photographs and drawings , as was appropriate . digital color photographs and dv video taping were both used to record and documents the test . care was taken to position the photographic equipment so as to not interfere with the smooth flow of air into the test room . the test specimen was a metallized / double bubble / white poly ( fr ) insulation . each panel measured approximately 4 ft . wide × 8 ft . tall × ⅛ in . thick . each panel was white in color . the insulation was positioned using metal c studs every 2 ft . o . c . with the flat side of the stud facing the interior of the room . the insulation was attached to the c studs using screws and washers . see photos in appendix b for a visual depiction of the description above . all joints and corners in the room were sealed to an airtight condition using gypsum drywall joint compound and / or ceramic fiber insulation . see photos in the appendix fort a detailed view of the finished specimen . the data acquisition system was started and allowed to collect ambient data prior to igniting the burner and establishing a gas flow equivalent to 40 kw for the first 5 minutes and 160 kw for the next 10 minutes . events during the test are described below : time ( min : sec ) observation 0 : 00 ignition of the burner at a level of 40 kw . 0 : 20 specimen surface began to melt . 0 : 45 the specimen began to melt at 4 ft . above the specimen . 0 : 55 ignition of the specimen at the melting edge . 1 : 25 melting of the specimen at 8 ft . above the test burner . 3 : 20 ignition of the specimen at the rhs edge of melt pattern . 3 : 38 flaming drops began to fall from the specimen . 4 : 00 burning on metal side of specimen only . 5 : 00 burner output increased to 160 kw . 5 : 18 specimen began to rapidly melt away . 5 : 25 the specimen began to melt away at 6 ft . from the test corner . 6 : 20 no burning of the specimen observed . 8 : 20 material fell in front of the doorway . 9 : 00 tc # 5 fell in front of the doorway . 12 : 00 no new activity . 14 : 00 no changes observed in the specimen . 15 : 00 test terminated . the specimen was completely melted on the top portions along all three walls . on the lower lhs wall , the specimen was still intact and appeared to have no visible damage . the lower rear wall appeared to have melting 4 ft . from the test corner , with the specimen intact from 4 - 8 ft from the test corner . the lower rhs wall was melted 4 ft . from the test corner and appeared intact from 4 ft . to the doorway . the specimen on the ceiling panels was observed to have been 100 % melted . the sample submitted , installed , and tested as described in this report displayed low levels of heat release , and upper level temperatures . the sample did not spread flames to the ceiling during the 40 kw exposure . the flames did not spread to the extremities of the 12 - foot walls during the 106 kw exposure . the sample did not exhibit flashover conditions during the test . nfpa 286 does not publish pass / fail criteria . one must consult the codes to determine pass fail . this specimen did meet the criteria set forth in the 2003 ibc section 803 . 2 . 1 . the test described under example 1 was repeated but with a metallized double bubble / white poly not containing fire retardant as shown in fig2 . the sample did not spread flames to ceiling during the 40 kw exposure . the flames did spread to the extremities of the walls during the 106 kw exposure . the sample did not exhibit flashover conditions during the test . nfpa 286 does not publish pass / fail criteria . however , this specimen did not meet the criteria set forth in the 2003 ibc section 803 . 2 . 1 . time ( min : sec ) observation 0 : 00 ignition of the burner at a level of 40 kw . 0 : 14 specimen surface began to melt . 0 : 20 the edge of the specimen ignited . 0 : 38 the specimen began to melt 6 - 7 ft . above the burner / flaming drops began to fall from the specimen . 1 : 21 flame spread at 2 ft . horizontally at 4 ft . above the test burner . 2 : 31 flame spread at 4 ft . horizontally at 4 ft . above the test burner . 3 : 50 the specimen on the ceiling began to fall . 4 : 24 the specimen began to fall from the corners and ceiling . 5 : 00 burner output increased to 160 kw / specimen continuing to fall . 5 : 57 flame spread at 6 ft . horizontally at the bottom of the 8 ft . wall . 7 : 10 flames reached 8 ft . along the 8 ft . wall . 8 : 38 flames on the lhs wall reached 10 ft . from the test corner . 9 : 40 flames on the lhs wall reached 12 ft . extremity . 10 : 38 test terminated . the specimen was 100 % melted from the c studs along all the walls . the gypsum board behind the specimen was flame bleached and charred in the test corner . along the rear wall , the bottom of the wall was charred the length of the wall . on the rhs wall , 5 ft . of specimen was still intact near the doorway . the insulation on the lhs wall was melted completely with the exception of a small 2 ft . section attached to the c stud near the doorway . the insulation on the ceiling was 100 % melted exposing the c studs . the sample submitted , installed , and tested as described in this report displayed low levels of heat release , and upper level temperatures . the sample did not spread flames to the ceiling during the 40 kw exposure . the flames did spread to the extremities of the 12 - foot walls during the 160 kw exposure . the sample did not exhibit flashover conditions during the test . nfpa 286 does not publish pass / fail criteria . one must consult the codes to determine pass - fail . this specimen did not meet the very strict criteria set forth in the 2003 ibc section 803 . 2 . 1 . examples 3 - 6 underwent tests carried out in accordance with test standard method astme84 - 05 for surface burning characteristics of building materials , ( also published under the following designations ansi 2 . 5 ; nfpa 255 ; ubc 8 - 1 ( 42 - 1 ); and ul723 ). the method is for determining the comparative surface burning behaviour of building materials . this test is applicable to exposed surfaces , such as ceilings or walls , provided that the material or assembly of materials , by its own structural quality or the manner in which it is tested and intended for use , is capable of supporting itself in position or being supported during the test period . the purpose of the method is to determine the relative burning behaviour of the material by observing the flame spread along the specimen . flame spread and smoke density developed are reported . however , there is not necessarily a relationship between these two measurements . it should be noted that the use of supporting materials on the underside of the test specimen may lower the flame spread index from that which might be obtained if the specimen could be tested without such support . this method may not be appropriate for obtaining comparative surface burning behaviour of some cellular plastic materials . testing of materials that melt , drip , or delaminate to such a degree that the continuity of the flame front is destroyed , results in low flame spread indices that do not relate directly to indices obtained by testing materials that remain in place . table 1 gives detailed observations for the experiments conducted in examples 3 to 15 . the test specimen consisted of ( 3 ) 8 ft . long × 24 in . wide × 1 . 398 in . thick 17 . 50 lbs metallized / double bubble / white poly ( no - fr ) reflective insulation , assembly of fig2 secured to 1 . 75 in . wide × 1 in . thick , aluminum frames using ¾ in . long , self - drilling , hex head screws and washers . the nominal thickness of the reflective insulation was 5 / 16 in . thick . the white poly was facing the flames during the test . the specimen was self - supporting and was placed directly on the inner ledges of the tunnel . the test results , computed on the basis of observed flame front advance and electronic smoke density measurements were as follows . this metallized - double bubble - white poly having no fire - retardant assembly of fig2 was most acceptable in this e84 - 05 test to permit use in class a buildings . during the test , the specimen was observed to behave in the following manner : the white poly facer began to melt at 0 : 05 ( min : sec ). the specimen ignited at 0 : 07 ( min : sec ). the insulation began to fall from the aluminum frames at 0 : 08 ( min . sec .). the test continued for the 10 : 00 duration . after the test burners were turned off , a 60 second after flame was observed . after the test the specimen was observed to be damaged as follows : the specimen was consumed from 0 ft .- 9 ft . the white poly facer was melted from 19 ft .- 24 ft . this embodiment is a repeat of example 3 , but with a metallized / single bubble / white poly ( no - fr ) reflective insulation assembly as shown in fig3 substituted for the material described in example 3 . the specimen consisted of ( 3 ) 8 ft . long × 24 in . wide × 1 . 100 in . thick 16 . 60 lbs metallized / single bubble / white poly ( no - fr ) reflective insulation , secured to 1 . 75 in . wide × 1 in . thick , aluminum frames using ¾ in . long , self - drilling , hex head screws and washers . the nominal thickness of the reflective insulation was 3 / 16 in . thick . the white poly was facing the test burners . the specimen was self - supporting and was placed directly on the inner ledges of the tunnel . during the test , the specimen was observed to behave in the following manner : the poly facer began to melt at 0 : 03 ( min / sec ). the poly facer ignited at 0 : 06 ( min : sec ). the insulation began to fall from the aluminum frames at 0 : 07 ( min : sec ). the insulation ignited on the floor of the apparatus at 0 : 07 ( min : sec ). the test continued for the 10 : 00 duration . after the test the specimen was observed to be damaged as follows : the insulation was consumed from 0 ft .- 20 ft . the poly facer was melted from 20 ft .- 24 ft . the polyethylene bubbles were melted from 20 ft . to 24 ft . this embodiment is a repeat of example 3 , but with a metallized / double bubble / metallized ( no fr ) reflective insulation substituted for the material described in example 3 . the specimen consisted of ( 3 ) 8 ft . long × 24 in . wide × 1 . 230 in . thick 17 . 40 lbs metallized / double bubble / metallized no fr reflective insulation assembly of fig4 , secured to 1 . 75 in . wide × 1 in . thick , aluminum frames using ¾ in . long , self - drilling , hex head screws and washers . the nominal thickness of the reflective insulation was 5 / 16 in . thick . the specimen was self - supporting and was placed directly on the inner ledges of the tunnel . during the test , the specimen was observed to behave in the following manner : the metallized insulation began to melt at 0 : 06 ( min : sec ). the metallized insulation began to fall from the aluminum frame at 0 : 10 ( min . sec .). the metallized insulation ignited at 0 : 11 ( min . sec ). the test continued for the 10 : 00 duration . after the test burners were turned off , a 19 second after flame was observed . after the test , the specimen was observed to be damaged as follows : the metallized insulation was consumed from 0 ft .- 16 ft . the polyethylene bubbles were melted from 16 ft .- 24 ft . light discoloration was observed to the metallized facer from 16 ft .- 24 ft . this metallized - double bubble - metallized assembly of fig4 met the e84 standard for building reflective insulation . this embodiment is a repeat of example 5 , but with a metallized / double bubble / metallized ( fr ) reflective insulation assembly as seen in fig5 substituted for the material described in example 5 , fig4 . the specimen consisted of ( 3 ) 8 ft . long × 24 in . wide × 1 . 325 in . thick 17 . 70 lbs metallized / double bubble / metallized ( fr ) reflective insulation assembly , secured to 1 . 75 in . wide × 1 in . thick , aluminum frames using ¾ in . long , self - drilling , hex head screws and washers . the nominal thickness of the reflective insulation was 5 / 16 in . thick . during the test , the specimen was observed to behave in the following manner : the metallized facer began to melt at 0 : 04 ( min : sec .). the specimen ignited at 0 : 06 ( min : sec .). the metallized insulation began to fall from the aluminum frames at 0 : 11 ( min : sec ). the floor of the apparatus ignited at 6 : 41 ( min : sec ). the test continued for the 10 : 00 duration . after the test burners were turned off , a 60 second after flame was observed . after the test the specimen was observed to be damaged as follows : the insulation was consumed from 0 ft .- 16 ft . the polyethylene bubbles were melted from 16 ft .- 24 ft . light discoloration was observed to the metallized facer from 16 ft .- 24 ft . the metallized - double bubble - metallized ( fr ) reflective insulation assembly of fig5 passed this astm e84 - 05 test for class a building insulation . in the following embodiments examples 7 - 9 , less stringent astm e84 test conditions were employed . an aluminum foil - single bubble - aluminum foil / poly with polyester scrim reflective insulation assembly , without a fire - retardant was stapled to three 2 × 8 ft . wood frames with l - bars spaced every 5 feet o . c . was tested . the reflective insulation was secured to the l - bars by using self - drilling screws . aluminum foil - single bubble - aluminum foil with fire - retardant reflective insulation assembly was stapled to ( 3 ) 2 × 8 ft . wood frames , l - bar cross members on 5 ft . centers , stapled to wood on sides and screwed to l - bar . the sample was self - supporting . this assembly as shown in fig7 , failed this e84 test conditions for building insulations , for having a flame spread index of 55 and a smoke developed index of 30 . aluminum foil - single bubble - white poly ( fr ) as shown in fig8 was attached to nominal 2 × 2 wood frames with l - bar cross members spaced every 5 ft . o . c . the sample was self - supporting . the specimen had a flame speed index of 65 and a smoke developed index of 75 to not be acceptable as class a building material . the following embodiments describe astm 84 - 05el surface burning characteristics of building materials . the following modified astm e84 - 05el test was designed to determine the relative surface burning characteristics of materials under specific test conditions . results are again expressed in terms of flame spread index ( fsi ) and smoke developed ( sd ). the tunnel was preheated to 150 ° f ., as measured by the floor - embedded thermocouple located 23 . 25 feet downstream of the burner ports , and allowed to cool to 105 ° f ., as measured by the floor - embedded thermocouple located 13 ft . from the burners . at this time , the tunnel lid was raised and the test sample placed along the ledges of the tunnel so as to form a continuous ceiling 24 ft . long , 12 inches . above the floor . the lid was then lowered into place . upon ignition of the gas burners , the flame spread distance was observed and recorded every 15 seconds . flame spread distance versus time is plotted ignoring any flame front recessions . if the area under the curve ( a ) is less than or equal to 97 . 5 min .- ft ., fsi = 0 . 515 a ; if greater , fsi = 4900 /( 195 − a ). smoke developed is determined by comparing the area under the obscuration curve for the test sample to that of inorganic reinforced cement board and red oak , arbitrarily established as 0 and 100 , respectively . the reflective insulation was a metallized - double bubble - metallized assembly with fire - retardant , as shown in fig9 . the material had a very acceptable ofsi and 85 sd . the sample began to ignite and propagate flame immediately upon exposure to the test flame . maximum amounts of smoke developed were recorded during the early states of the test . the test conditions were as for example 10 but carried out with a metallized / bubble / single bubble , white ( fr ) as shown in fig1 , substituted for the material of example 10 . the white face was exposed to the flame source . the material had a very acceptable 0 fsi and 65 ds . the sample began to ignite and propagate flame immediately upon exposure to the test flame . maximum amounts of smoke developed were recorded during the early states of the test . the test conditions were as for example 10 but carried out with a metallized - single bubble as shown in fig1 , substitute for the material of example 10 . the test material had a very accept 0 fsi and 30 sd . the sample began to ignite and propagate flame immediately upon exposure to the test flame . maximum amounts of smoke developed were recorded during the early states of the test . the test conditions were as for examples 7 - 9 , with a self - supporting aluminum foil - single bubble containing fire retardant as shown in fig1 . an unacceptable fsi of 30 and a sdi of 65 was observed . the test was conducted under astm e84 - 00a conditions in jan . 22 , 2002 , with layers of aluminum foil - double bubble - aluminum foil , according to the prior art as shown in fig1 . the specimen consisted of a 24 ″ wide × 24 ′ long × 5 / 16 ″ thick ( nominal ) 3 . 06 lbs sheet of reflective insulation — foil / double pe bubble / foil . the specimen was tested with a ⅛ ″ wide × 24 ′ long second of the foil facer removed from the center to expose the core material directly to the flames . during the test , the specimen was observed to behave in the following manner : steady ignition began at 0 : 35 ( min : sec ). flaming drops began to fall from the specimen at 0 : 45 and a floor flame began burning at 0 : 46 . the test continued for the 10 : 00 duration . upon completion of the test , the methane test burners were turned off and an after flame continued to burn for 0 : 19 . after the test , the specimen was observed to be damaged in the following manner : the specimen was slightly burned through from 1 ft . to 3 ft . the pe bubble was melted from 0 ft . to 24 ft . and the foil facer had a black discoloration on it from 2 ft . to 24 ft . the sample was supported on ¼ ″ steel rods and 2 ″ galvanized hexagonal wire mesh id not meet the criteria see for this e84 - 00a test for a building insulation . during the test , the specimen was observed to behave in the following manner : steady ignition began at 0 : 54 ( min : sec ). flaming drops began to fall from the specimen at 0 : 58 and a floor flame began burning at 1 : 03 . the test continued for the 10 : 00 duration . after the test , the specimen was observed to be damaged as follows : the foil was 80 % consumed from 1 ft . to 3 ft . and lightly discoloured from 3 ft . to 24 ft . the bubble core was melted / collapsed from 0 ft . to 24 ft . although the results were an improvement over example 14 material , they were still not satisfactory . standard surface emittance ( reflectivity ) tests ( astm c 1371 - 04a —“ standard test method for determination of emittance of materials near room temperature using portable emissometers ”) with the embodiments shown in fig3 and fig1 gave a measured emittance of 0 . 30 ( 65 % reflectance ) for the dull surface of the metallized coated pet material and a value of 0 . 06 ( 96 % reflectance ) for the shiny surface . the 0 . 5 ml thick lacquer coated metallized coated pet surface also gave an acceptable reflectance of 96 %. although this disclosure has described and illustrated certain preferred embodiments of the invention , it is to be understood that the invention is not restricted to those particular embodiments . rather , the invention includes all embodiments , which are functional or mechanical equivalence of the specific embodiments and features that have been described and illustrated .

US-50765806-A

a method for agglomerating and sintering iron and zinc ore and ore concentrates , steel mill ferrous waste and zinc mill waste . the method has the steps : a ) mixing the wastes or ore with a combustion fuel source , and a sinter agglomeration agent selected from the group consisting of sodium silicate , water soluble polymers and aqueous emulsions of oils to form an agglomerated sinterable mixture comprising agglomerated particles ; b ) forming the sinterable mixture into a sinter bed on the grate of a sinter machine ; and c ) igniting the sinter bed to create a temperature sufficient to sinter the agglomerated particles .

the sinter agglomeration agents for the purposes of this invention are selected from the group consisting of sodium silicates , water soluble polymers and aqueous emulsions of oils . sodium silicates , also known as water glass , are preferably derived from water soluble sodium silicate glasses . typically , they are solutions of sodium oxide ( na 2 o ) and silicon dioxide ( sio 2 ) combined in various ratios . examples of acceptable sodium silicates include sodium silicate d , sodium silicate k and sodium silicate n , all available from pq corporation . the sodium silicates of the present invention generally have sio 2 to na 2 o weight ratios in the range of about 1 . 6 to about 3 . 9 . the preferred range of sio 2 to na 2 o weight ratios ranges from about 2 to about 3 . 2 . the sodium silicate will preferably be applied in water solution . the solids level of these aqueous solutions preferably range from about 10 % to about 50 %, and more preferably from about 25 % to about 40 %. preferable water soluble polymers for use in the invention include polyethers , polyether derivatives and water soluble cellulose derivatives . preferred polyethers , and derivatives thereof , are polyethylene oxides , polypropylene oxides , and polyethylene oxide - propylene oxide copolymers . the polyethylene oxides , and derivatives thereof , have the following general formula : wherein r is — oh or c 1 - c 6 alkoxy , r 1 , is — h or c 1 - c 6 alkyl , and n is from about 5 to about 100 , 000 . polypropylene oxides , and derivatives thereof , have the general formula : wherein r is — oh or c 1 - c 6 alkoxy r 1 , is — h or c 1 - c 6 alkyl , and m is from about 5 to about 100 , 000 . polyethylene oxide - polypropylene oxide copolymers and their derivatives have the general formula : wherein r is — oh or c 1 - c 6 alkoxy , r 1 , is — h or c 1 - c 6 , and p and q are integers from about 5 to about 100 , 000 . preferred polyethers for use in the invention are polyethylene oxide compounds including polyethylene oxide and methoxy polyethylene glycol . the polyethylene oxide materials , polyethylene glycol and methoxy polyethylene glycol , are relatively non - volatile volatile and thermally stable . their physical form ranges from viscous liquids to waxy solids . the polyethylene oxide polymers of the invention and their derivatives preferably have molecular weights in the range of about 200 to about 5 , 000 , 000 , and more preferably in the range of about 100 , 000 to about 1 , 000 , 000 . polyethylene oxide compounds employed are commercially available from union carbide corporation . preferred compounds include polyethylene oxide ( mw = 300 , 000 ) available as polyox ® wsr n750 and polyethylene glycol ( mw = 3 , 350 ) available as carbowax ® 3350 . additives can be used to improve the stability and properties of the polyethylene oxide compounds for the purpose of the invention . these include lignosulfonates , wetting agents , solution stabilizers ( alcohols ), thermal stabilizers ( antioxidants ) and plasticizing agents . anionic , cationic and / or nonionic surfactants can be employed to improve the wetting properties of the polyethylene oxide compounds . preferred water soluble cellulose derivatives for use is the invention include cellulose ethers and esters . the molecular weight of the operable materials is not critical , but is generally in the range of about 10 , 000 to about 500 , 000 . examples of such preferred materials include hydroxyethyl cellulose ( hec ), hydroxypropyl cellulose ( hpc ), water soluble ethylhydroxyethyl cellulose ( ehec ), carboxymethyl cellulose ( cmc ), carboxymethylhydroxyethyl cellulose ( cmhec ), hydroxypropylhydroxyethyl cellulose ( hphec ), methyl cellulose ( mc ), methylhydroxypropyl cellulose ( mhpc ), methylhydroxyethyl cellulose ( mhec ), carboxymethylmethyl cellulose ( cmmc ) and mixtures thereof . particularly preferred water soluble cellulose derivatives include methyl cellulose , methylhydroxypropyl cellulose and hydroxyethyl cellulose . the cellulose derivatives of the invention can also be used with other additives for improving their performance as sintering agents . plasticizers may be useful under certain temperature conditions . these include , for example , diethylene glycol , propylene glycol , triethanolamine , glycerol and sorbitol . additives such as sucrose and glycerol can be used to lower the gel point temperature of aqueous solutions of the cellulose derivatives , which could be beneficial under some conditions . the water soluble polymers of the invention will preferably be applied to the mill waste in water solution . the solids level of these aqueous solutions preferably range from about 0 . 1 % to about 25 %, and more preferably from about 0 . 5 % to about 10 %. the oils preferred for use in the aqueous oil emulsions of the invention are oils that are capable of being emulsified in an oil - in - water or water - in - oil emulsion , for example , asphalts , extender oils of the types noted in u . s . pat . no . 4 , 571 , 116 , which is incorporated herein by reference in its entirety , heavy process oils , and light process oils . the heavy process oils are of the type specified by kittle , u . s . pat . no . 4 , 561 , 905 , which is incorporated herein by reference in its entirety . that is , they include asphalt “ cut - backs ”, i . e ., asphalt dissolved in a moderately heavy oil such as no . 3 fuel oil , residual fuel oils of relatively high viscosity such as no . 6 fuel oil , etc . the heavy process oils may be further defined as having viscosities in the range of about 600 - 7 , 000 sus . one exemplary heavy process oil is hydrolene ® 90 sold by sun oil company . this product is a low volatility aromatic oil having an sus viscosity of about 3 , 500 at 38 ° c . preferred oils are classified as “ light viscosity process oils .” these have sus viscosities of about 60 - 600 measured at 38 ° c . most preferred are those having an sus viscosity of from about 200 - 400 . these are commercially available under the shellflex ®, tellura ®, and tufflo ® trademarks . surfactants may be used to emulsify the oil / water mixture . for this purpose , well known and commercially available anionic , cationic or nonionic surfactants suffice . anionic and nonionic surfactants are most preferred . examples of acceptable anionic surfactants include alkyl aryl sulfonic acids , alkyl sulfonic acids , alkenyl sulfonic acids , sulfonated alkyds , sulfated monoglycerides , and sulfated fatty esters . also , long chain alpha olefin sulfonates , water soluble salts of alkenyl sulfonic acids , water soluble alkyl aryl sulfonic acid salts , water soluble salts of sodium lauryl sulfate , etc . may be mentioned . nonionic surfactants include , for example , ethylene oxide condensates of alkyl phenols , ethylene oxide condensates of fatty acids , fatty acid amides , etc . additional operable surfactants are well known to those skilled in the art . performance of the oil emulsions may be enhanced by including in the emulsion composition one or more water insoluble elastomeric polymers . these oil emulsions containing water - insoluble elastomeric polymers are disclosed and discussed in u . s . pat . no . 4 , 780 , 233 , which is incorporated herein in its entirety by reference . elastomers useful in the invention are described in u . s . pat . nos . 4 , 551 , 261 and 2 , 854 , 347 , both of which are incorporated herein by reference in their entireties . polymers preferred for use in the invention are synthetic rubber - like polymers encompassing copolymers of butadiene with monoolefinic monomers such as styrene , methylstyrene , dimethylstyrene and acrylonitrile . copolymers of methyl , ethyl , and butyl acrylates with acrylonitrile or with styrene may also be suitable . plasticized polyvinyl acetate , plasticized polyvinyl chloride , plasticized polystyrene , plasticized substituted polystyrenes , and plasticized polyolefins such as polyethylenes and polyisobutylenes are also suitable . if water insoluble elastomers are used as a component of the oil emulsions , it is generally not necessary to use more than about 0 . 1 wt . % based on the weight of the oil present . with regard to the sintering process , in the first step the feed material is intimately mixed with a fuel source in a mixer such as a balling - drum or disc - pelletizer mixer . the fuel is typically finely divided coke or coal , particularly anthracite coal or coke breeze . during the mixing it is common to spray the contents of the mixer with water to help in the agglomeration of feed material . the mixers are operated to produce small nodules or agglomerated particles , preferably about 6 to about 25 mm in size . mixer retention times vary depending upon the ease with which the feed balls . desirable mixer retention times vary from about one to about five minutes . the agglomeration agents of the invention may be mixed with the feed before it is added to the mixer , but most preferably in the practice of the invention , the agglomeration agents will be added after the feed has been loaded to the mixer . it is convenient to add the agents by dissolving in or mixing with the water agglomeration that is sprayed in the mixer . however it is also possible to add the agglomeration agents separately from the sprayed water , or even in place of it . the effective amount of agglomeration agent used will depend on a variety of factors , including the composition of the feed to the mixer , the type of mixer used , and the particular agglomeration agent employed . nevertheless , it has been found that the effective amount is preferably from about 0 . 0001 wt . % to about 5 wt . % on a dry basis of the dry weight of the sinterable mixture . more preferably the amount is from about 0 . 005 wt . % to about 2 wt . %, and most preferably from about 0 . 001 wt . % to about 1 wt . % percent . in transferring the agglomerated mix from the mixer to the grate of the sintering machine it is essential to provide a uniform , homogeneous bed , and to prevent compacting of the bed . the height of the sinter bed is limited by the amount of fines or dust , which may form when the bed material dries . the fines blind the permeability of the sinter bed , and thus limit its height . consequently , it is necessary to minimize the amount of fines in order to achieve a high sinter bed height . it is a great advantage of the invention that the agglomeration agents substantially reduce the level of fines , and therefore use of the agglomeration agents is found to allow the use of higher height sinter beds with less compacting , improved permeability , and more rapid and uniform sintering when compared to sinter beds that is the same except that they do not contain the sinter agglomeration agents of the invention .

US-22059502-A

the device comprises individual stations , which are passed through in succession , and consisting of : a removal station for labels , whereby one label at a time is removed from a label stack ; an application station , in which at least one securing element , and of ; a storage station for the labels provided with the securing elements , whereby said labels provided with the securing elements are placed in a label stack .

fig1 shows a schematic representation of a first embodiment of the device 1 according to the invention . arranged on a rotary unit 10 (= carousel ) are four suction heads 11 moving on a circular path when the unit 10 rotates . arranged tangent to the circular path described by the suction heads are three stations : the pick - up station 4 , the applicator station 5 and the storage station 6 . the stations 4 , 5 , 6 are , respectively , stacks 7 , 8 , 9 of labels 2 , of security elements 3 and of labels 2 with applied security elements 3 . the labels 2 ; 3 ; 2 , 3 are arranged in magazines open at the front and are moved into the correct pick - up position by means of an automatic feed . such stations 7 , 8 , 9 are in principle already well known from the bottle labeling sector . once a suction head 11 reaches the position opposite the pick - up station 4 it is activated . the suction air and the rotation of the rotary unit 10 are controlled by means of a control unit which is not specially illustrated in the drawings . the vacuum causes the front - most label 2 to be drawn against the contact face 18 of the suction head where it is securely held in place . while the label 2 is passing the adhesive station 12 , an adhesive material is applied to a previously selected area . to specifically define this area the adhesive station is provided with a corresponding elevation 13 which , when in contact with the label 2 , applies adhesive to the rear side of the label 2 . the adhesive station 12 preferably performs a pivotal motion , whereby adhesive is applied to the label 2 during rotation of the rotary unit 10 . at the applicator station 5 a security element 3 is placed in the area previously coated with adhesive . at the storage station 6 the suction air is cut off from the suction head 11 . this causes the label 2 with the security element 3 to be released and pressed into the stack 9 . the embodiment of the device of the invention shown in fig2 is equipped with four suction heads 11 and three stations 4 , 5 , 6 . it will be understood , of course , that the number of suction heads 11 and the number of stations 4 , 5 , 6 may be increased , resulting in higher costs on the one hand but permitting higher production rates on the other . fig2 shows a schematic representation of a second embodiment of the device 1 of the invention . unlike the embodiment shown in fig1 the security elements 3 in the applicator station 5 are not arranged in a stack 8 but are transferred to the labels 2 via a dispensing device . the dispensing device is comprised of a supply reel 16 , a dispensing lip 17 and a take - up reel 15 . security elements 3 in the form of adhesive labels are applied to the carrier web 14 . at the dispensing lip 17 the security elements 3 are lifted off the carrier web 14 and come into contact with the label 2 . with the adhesion to the label 2 being greater than the adhesion to the carrier web 14 , which is silicone tape for example , the security element 3 is applied to the label 2 presented at the applicator station 5 . a computing / control unit , which is not specially shown in fig2 , controls the feed of the security elements 3 and the rotation of the rotary unit 10 to ensure that the security elements 3 are transferred to the area selected on the labels 2 . while in the embodiments illustrated in the drawings the individual stations 4 , 5 , 6 are arranged on a circular path and reached by rotating the rotary unit 10 with the suction heads 11 , the device according to the invention can be used just a well with the individual stations 4 , 5 , 6 arranged in a line one behind the other , for example . fig3 shows a plan view of a label 2 of the invention having a security element 3 applied to it . the label 2 carries a security element 3 on its unprinted rear side . in the case illustrated the security element 3 is an element of the type referred to as strip element , which is manufactured from a soft magnetic material . as described in the foregoing , any other form of security element 3 for electronic article surveillance can be used to equip the labels 2 of the invention . 9 stack of labels 2 with applied security elements 3 it will be appreciated by those skilled in the art that changes could be made to the embodiments described above without departing from the broad inventive concept thereof . it is understood , therefore , that this invention is not limited to the particular embodiments disclosed , but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims .

US-96268004-A

a handheld computer which uses a palm operating system and which incorporates a compact flash interface for secondary data storage or interface to other devices and uses a fat file system for file management with said cf + media . the disclosure further include references to alternate types of secondary storage such as disk drives and multimedia cards and further discloses that the handheld computer may be embodied in a portable telephone or scanner .

now referring to the drawings , where like numerals refer to like text throughout , and more particularly to fig1 there is shown a simplified block diagram of the present invention , generally designated 100 , including a palm os block 102 , which represents prior art and well - known operating system software commercially available from 3com corporation for use in conjunction with handheld computers manufactured and sold by 3com , hereafter palm computers . the term “ handheld computer ” is intended to be construed broadly so as to include any handheld electronic device which processes information such as portable phones , scanners , etc . the above - referenced patent application also includes discussion with respect to the palm os . also shown in fig1 is sandisk compact flash software block 104 , which represents prior art , well - known and commercially available software from sandisk corporation of sunnyvale calif . sandisk compact flash software block 104 includes well - known and industry standard software used to implement ffs &# 39 ; s in compact flash devices in conjunction with the windows family of operating systems . the present invention achieves its beneficial aspects through combination of palm os block 102 , sandisk compact flash software block 104 , and trgpro interface software 106 , which is novel and innovative software used to port the sandisk compact flash software block 104 to the palm os block 102 . the following description is first intended to provide broad background information , then provide detailed information relating to one preferred approach to carrying out the present invention . this section of the detailed description is intended to introduce the use of , and provide a reference to , the ffs ( fat file system ) library procedures . it is directed toward palm os application developers who wish to access cf cards from within their applications . it is assumed that the reader is familiar with the c programming language , in particular within the context of the palm os . section 1 of this document gives background detail on the fat file system . section 2 describes the use of shared libraries in palm os applications , summarizing the functionality provided by the ffs library . section 3 details the shared data structures used by multiple functions in the ffs library and describes each of the library calls , describing their function , parameters , and return value . section 4 lists the possible error codes and their interpretation , and section 5 discusses a sample project . the fat file system in this document refers to a system of file management on a storage device . the device is divided into clusters , each of which can be composed of one or more sectors . a cluster can be in one of three states : the mapping of the clusters is contained in a file allocation table ( fat ), which is where the file system gets its name . the handheld computer of the present invention , hereafter referred to as “ trgpro ”, is merely an example of many different approaches to practicing the present invention . in this example , the trgpro is a computing device built upon industry standards . it was designed with a slot to accept compactflash devices , which are rapidly becoming the standard for handheld computers . in keeping with this eye toward standards , its internal implementation for accessing compactflash memory cards is based upon a fat file system . the true advantage to using the fat file system is that it is a standard also supported by pc &# 39 ; s running any of the following operating systems : for the trgpro , the removable media is a compactflash memory card , but other media could be used as well . it should be noted that while it is believed that compactflash devices and memory cards may be presently be the preferred media for secondary storage of information , the present invention is intended to include uses of other secondary storage media such as multimedia cards , disk drives and etc . the benefits of a ffs in combination with a palm os like operating system can be achieved irrespective of any particular secondary storage implementation . the fat file system ( ffs ) shared library provides an interface to compact flash ( cf ) cards containing a fat file system . the interface is based upon the unbuffered file / disk system and library calls typically used with the c language . support is provided for manipulating both files and directories , simplifying the exchange of data between the palm device and a pc . in addition , the high - capacities of existing cf cards allow ffs - aware applications to create , read , and modify files much larger than the total storage space available on existing palm devices . a document reader , for example , could access documents directly on a cf card , without first having to move the documents in the palm device ram or flash . currently , the ffs library is implemented as a palm os shared library . to access the ffs calls , an application must search for the library , load the library if not found , then open the library . opening the library returns a library reference number that is used to access the individual functions within the library . when the application is finished with the library , it should close the library . the current version of the library does not support the sharing of open files between applications , and only one application should have the library open at any one time ( though the system may have it open , also ). in one embodiment the calling application must include the header file ffslib . h . the source code of ffslib . h is included in its entirety at the end of this detailed description . this file contains the required constant definitions , structure typedefs , and function prototypes for the library . in addition , this file maps library functions calls to the corresponding system trap instructions , through which all library routines are accessed . if the caller requires notification of cf card insertion / removal events , it must also include notify . h and the palmos header notifymgr . h ( requires os 3 . 3 headers ). to find a loaded library , an application calls syslibfind , specifying the library . if not found , an application loads the library using syslibload , specifying the library type and creator ids . for the ffs library , the name , type and creator ids are defined in ffslib . h as ffslibname , ffslibtypeid and ffslibcreatorid , respectively . after loading the library , it must be opened with a call to iffslibopen . opening the library allocates and initializes its global variables , and sets up the cf socket hardware . once the library is open , the application may make calls to the library functions . the first parameter to a library call is always the library reference number returned when the library is loaded . most library calls return an integer result of 0 on success and − 1 on failure . a more specific error code may be obtained through another library call . the application that opens the library is responsible for closing and optionally unloading the library . the library is closed with the ffslibclose call , and unloaded with the syslibremove call . the library can only be removed , however , if it is not in use by the system , as indicated by the value 0 returned from ffslibclose . if still in use , ffslibclose returns ffs_err_lib_in_use . it is possible for an application to leave the library loaded when exiting . the library may then be accessed by other applications through the syslibfind call , which returns a reference to an already - loaded library . once the reference number is obtained , the library is opened as usual with ffslibopen call . in either case , however , the caller must open the library on startup and close it on exit . the library should not be left open between applications . currently , the name of the ffs library used for syslibfind is “ fsf . lib ,” the creator id is “ ffsl ,” and the type id is “ libr .” these constants are all defined in ffslib . h . the ffs library calls may be grouped into six categories : disk management , directory management , file access , file management , library management , and error handling . the calls , grouped by category , are listed below , with brief descriptions of each call &# 39 ; s function . an alphabetical listing with a detailed specification of each call is given in section 3 . disk management ffscardisata check if inserted card is an ata device . ffscardinserted check if a cf card is inserted . ffsflushdisk flush all buffers to flash . ffsformat format the card . ffsgetdiskfree get the total size of the cf disk , and the amount of free space . ffsgetdrive get the current working drive number . ffssetdrive set the current working drive number . directory management ffschdir change the current working directory . ffsfinddone free resources after a directory search . ffsfindfirst start a directory search . ffsfindnext continue a directory search . ffsgetcwd get the current working directory . ffsisdir check if the specified path is a directory or file . ffsmkdir create a directory . ffsrename rename a directory . ffsrmdir remove a directory . file access ffsclose close a file . ffscreat create a new file . ffseof check if the current file pointer is at the end of the file . ffslseek move a file pointer . ffsopen open / create a file . ffstell get the current file pointer value . ffswrite write to a file . file management ffsflush flush an open file to disk . ffsfstat get information about an open file . ffsgetfileattr get file attributes . ffsremove delete a file . ffsrename rename a file . ffssetfileattr set file attributes . ffsstat get information about a file . ffsunlink delete a file ( same as ffsremove ). library management ffsgetlibapiversion get the ffs library version number . ffslibclose close the library . ffslibopen open the library . error handling ffsgeterrno get the current global error result code . ffsinstallerrorhandler install a critical error handler callback function . ffsuninstallerrorhandler remove the critical error handler callback function . for the most part , these functions implement the low - level unbuffered i / o functions found in the c language . the buffered stream i / o functions , such as fopen and fprinff , are not supported , though they could be built on top of the ffs library layer . although many ffs library calls accept a drive letter as part of the path string , and routines are provided to get and set the default drive , the ffs library and nomad hardware currently support only a single drive . this drive is signified as number 0 or 1 ( 0 indicates current drive , 1 indicates the first drive ), and path “ a :”. most of the ffs library calls return an integer error indicator , set to 0 for success and − 1 for failure . library calls that return some other type of value , such as a pointer or file offset , always reserve one value to indicate an error . in either case , a specific error code is loaded into the global errno variable . the errno variable is not cleared on a successful call , so at any given time it contains the last error code generated . the current errno value may be retrieved by calling ffsgeterrno . if an i / o error occurs when accessing the cf card , a critical error handler is called . the critical error handler is responsible for deciding whether to abort or retry the current operation , to mark a failed sector as bad , or to reformat the card . the actual choices available in a specific situation are dependent on the type of critical error that occurred , and are determined by the internal critical error handler . regardless of the type of critical error that occurred , “ abort current operation ” is always a choice , and is the default action taken by the critical error handler . the calling program may supply its own critical error handler , however , to prompt the user for the desired course of action . a custom critical error handler is installed by a call to ffsinstallerrorhandler . the custom error handler takes as parameters a drive number , a code indicating the valid responses , and a string containing the specific error message , and returns the desired course of action . in current versions of the library , the drive number will always be 0 . the codes defining the valid responses are listed below , along with corresponding course of action codes : the course of action codes are interpreted by the internal critical error handler as follows : the custom critical error handler will typically display an alert box containing the error message text passed in from the internal critical error handler and prompting the user with the choices appropriate for the error type . for example , if the cf card is removed during an operation , the custom error handler will be called with a response code of crerr_notify_abort_retry and an error message of “ bad card ”. the error handler would then display an alert with buttons for “ abort ” and “ retry ”. note that the “ abort ” button should return the default value 0 , in case the user presses an application launch button when the alert is displayed ( in this case , the system will force the default return value from all alerts until the running application terminates ). when a cf card is removed while the ffs library is loaded , the library automatically clears all data structures associated with the card and reinitializes in preparation for the next card . thus , if a card is removed during a library call , the library will not be able to complete the call even if the card is reinserted . this is an unfortunate side effect of the fact that most cf storage cards are missing the unique serial number in the drive id information that is used to identify the cards . because of this omission , the library is unable to determine if a reinserted card is identical to the previously loaded card . the library reinitialization is invisible to the calling application . in order to notify the caller of insertion / removal events , a launch code can be sent by the system to the application . applications “ register ” at startup for notification of cf insertion / removal events , and are then sent the launch code sysapplaunchcmdnotify when these events occur . the cmdpbp points to a sysnotifyparam type object , containing a field notifyparamp which in turn points to - a uint32 containing one of the following event types ( defined in notify . h ): cfeventpowerisbackon : the device just powered up , the card may have changed while the device was off . an application registers for notification by calling sysnotifyregister , defined in system header file notifymgr . h . the parameters , briefly , are as follows : when an application exits , it should unregister by calling sysnotifyunregister , defined in system header file notifymgr . h . the parameters , briefly , are as follows : note that an application may , in theory , remain registered after exiting . however , any system event that causes the application &# 39 ; s database id to change ( such as hot - syncing a new copy of the application ) may cause a system crash during the next cf event . /**************************************************************************** * * copyright ( c ) 1999 , trg , all rights reserved * *----------------------------------------------------------------- * filename : * ffslib . h * * description : * ffs library api definitions . * * version : 1 . 1 . 1 ***************************************************************************/ # ifndef_ffs_lib_h_ # define_ffs_lib_h_ /*----------------------------------------------------------------- * if we &# 39 ; re actually compiling the library code , then we need to * eliminate the trap glue that would otherwise be generated from * this header file in order to prevent compiler errors in cw pro 2 . *-----------------------------------------------------------------*/ # ifdef building_ffs_lib # define ffs_lib_trap ( trapnum ) # else # define ffs_lib_trap ( trapnum ) sys_trap ( trapnum ) # endif /**************************************************************************** * type and creator of sample library database -- must match project defs ! ***************************************************************************/ # define ffslibcreatorid ‘ ffsl ’ // ffs library database creator # define ffslibtypeid ‘ libr ’ // standard library database type /**************************************************************************** * internal library name which can be passed to syslibfind ( ) ***************************************************************************/ # define ffslibname “ ffs . lib ” /**************************************************************************** * defines for ffs library calls ***************************************************************************/ /*----------------------------------------------------------------- * ffs library result codes * ( apperrorclass is reserved for 3rd party apps / libraries . * it is defined in systemmgr . h ) * * these are for errors specific to loading / opening / closing the library *---------------------------------------------------------------*/ # define ffserrorclass ( apperrorclass | 0x300 ) # define ffs_err_bad_param ( ffserrorclass | 1 ) // invalid parameter # define ffs_err_lib_not_open ( ffserrorclass | 2 ) // library is not open # define ffs_err_lib_in_use ( ffserrorclass | 3 ) // library still in used # define ffs_err_no_memory ( ffserrorclass | 4 ) // memory error occurred # define ffs_err_not_supported ( ffserrorclass | 5 ) // call not supported in this version # define ffs_err_card_in_use ( ffserrorclass | 6 ) // card in use by another app /*----------------------------------------------------------------- * ffs library call errno codes * * these are error codes returned by ffsgeterrno ( ) -- they are descriptive * error codes set when a call fails . they are stored in a global , and * ffsgeterrno ( ) returns the current value ( ie . the last error to occur ). *---------------------------------------------------------------*/ # define enoent 2 /* file not found or path to file not found */ # define enomem 8 /* not enough memory */ # define ebadf 9 /* invalid file descriptor */ # define eacces 13 /* attempt to open a read only file or a special ( directory ) */ # define einvdrv 15 /* invalid drive specified */ # define eexist 17 /* exclusive access requested but file already exists . */ # define einval 22 /* invalid argument */ # define enfile 24 /* no file descriptors available ( too many files open ) */ # define enospc 28 /* write failed . presumably because of no space */ # define eshare 30 /* open failed do to sharing */ # define enodev 31 /* no valid device found */ # define erange 34 /* result too large */ # define eioerr 35 /* i / o error */ /* low level errors during initialization */ # define bus_erc_diag 101 /* drive diagnostic failed */ # define bus_erc_args 102 /* bad argument during initialization */ # define bus_erc_drq 103 /* drive drq is not valid . */ # define bus_erc_timeout 104 /* timeout during an operation */ # define bus_erc_status 105 /* controller reported an error */ # define bus_erc_addr_range 106 /* lba out of range */ # define bus_erc_cntrl_init 107 /* fail to initialize controller */ # define bus_erc_iddrv 108 /* identify drive info error */ # define bus_erc_cmd_mult 109 /* read / write multiple command error */ # define bus_erc_base_addr 110 /* base address not valid */ # define bus_erc_card_ata 111 /* card is not ata */ /*----------------------------------------------------------------- * ms - dos file attributes * * these are the file attributes used by ms - dos to mark file types in the * directory entry . they are set by ffssetfileattr ( ) and retrieved by * ffsgetfileattr ( ), ffsstat ( ), and ffsfstat ( ). they are also used for * filtering by ffsfindfirst ( ) and ffsfindnext ( ). * * note that ffsfindfirst ( ) and ffsfindnext ( ) only return items which match * the specified attribute exactly ( although fa_arch is ignored ). for this * reason , a wildcard attribute fa_all is supplied ( non - standard ) which * matches all directory entries . *---------------------------------------------------------------*/ # define fa_normal 0x00 /* “ normal ” file */ # define fa_rdonly 0x01 /* read only */ # define fa_hidden 0x02 /* hidden file */ # define fa_system 0x04 /* system file */ # define fa_label 0x08 /* disk volume label */ # define fa_direc 0x10 /* subdirectory */ # define fa_arch 0x20 /* archive */ # define fa_all 0x8000 /* matches anything for ffsfindfirst ( ) */ /*----------------------------------------------------------------- * lseek codes * * determine the starting point of an lseek command . *---------------------------------------------------------------*/ # define seek_set 0 /* offset from begining of file */ # define seek_cur 1 /* offset from current file pointer */ # define seek_end 2 /* offset from end of file */ /*----------------------------------------------------------------- * file mode bits * * used by ffsopen ( ) and ffscreat ( ) to set the file read / write mode when * creating a new file . * note : these are in octal *----------------------------------------------------------------*/ # define s_iread 0000200 /* read permitted . ( always true anyway ) */ # define s_iwrite 0000400 /* write permitted */ /*----------------------------------------------------------------- * fstat , stat file type mode bits * * current file type mode as returned by ffsfstat ( ) and ffsstat ( ). one of * these mode bits will be or &# 39 ; d with the read / write permission of the * file ( s_iread , s_iwrite ). * note : these are in octal *---------------------------------------------------------------*/ # define s_ifchr 0020000 /* character special ( unused ) */ # define s_ifdir 0040000 /* subdirectory */ # define s_ifblk 0060000 /* block special ( unused ) */ # define s_ifreg 0100000 /* regular file */ # define s_ifmt 0170000 /* type of file mask */ /*----------------------------------------------------------------- * file access flags * * used by ffsopen ( ) to set the file access permissions when opening a file . *----------------------------------------------------------------*/ # define o_rdonly 0x0000 /* open for read only */ # define o_wronly 0x0001 /* open for write only */ # define o_rdwr 0x0002 /* read / write access allowed . */ # define o_append 0x0008 /* seek to eof on each write */ # define o_creat 0x0100 /* create the file if it does not exist . */ # define o_trunc 0x0200 /* truncate the file if it already exists */ # define o_excl 0x0400 /* fail if creating and already exists */ # define o_text 0x4000 /* ignored */ # define o_binary 0x8000 /* ignored . all file access is binary */ # define o_noshareany 0x0004 /* wants this open to fail if already open . */ /* other opens will fail while this open */ /* is active */ # define o_nosharewrite 0x0800 /* wants this opens to fail if already open */ /* for write . other open for write calls */ /* will fail while this open is active . */ /*----------------------------------------------------------------- * critical error defines * * critical error notify and response types - notify is sent to the caller &# 39 ; s * critical error handler , which should respond with an appropriate response . *---------------------------------------------------------------*/ # define crerr_notify_abort_format 1 /* abort , format */ # define crerr_notify_clear_abort_retry 2 /* clear + retry , abort , retry */ # define crerr_notify_abort_retry 3 /* abort , retry */ # define crerr_resp_abort 1 /* abort current operation */ # define crerr_resp_retry 2 /* retry current operation */ # define crerr_resp_format 3 /* format the card */ # define crerr_resp_clear 4 /* clear bad sector and retry */ /**************************************************************************** * special types for ffs access ****************************************************************************/ /*----------------------------------------------------------------- * diskfree_t structure for ffsgetdiskfree ( ) *----------------------------------------------------------------*/ typedef struct { uint32 avail_clusters ; /* number of free clusters */ uint32 total_clusters ; /* total number of clusters on drive */ uint16 bytes_per_sector ; /* number bytes per sector */ uint16 sectors_per_cluster ; /* number sectors per cluster */ } diskfree_t ; /*----------------------------------------------------------------- * ffblk structure for ffsfindfirst ( ), ffsfindnext ( ) *---------------------------------------------------------------*/ typedef struct { char ff_reserved [ 21 ]; /* used by system -- don &# 39 ; t modify ! */ char ff_attrib ; /* dos file attributes */ int16 ff_ftime ; /* creation time */ int16 ff_fdate ; /* creation date */ int32 ff_fsize ; /* file size */ char ff_name [ 13 ]; /* name in 8 . 3 format */ char ff_longname [ 256 ]; /* long file name */ } ffblk ; /*----------------------------------------------------------------- * stat structure used by ffsstat ( ), ffsfstat ( ). structure date_t is used * in stat_t ( it is defined as a long in some versions ). *---------------------------------------------------------------*/ typedef struct { uint16 date ; uint16 time ; } date_t ; typedef struct { int16 st_dev ; /* drive ( always 1 ) */ int16 st_ino ; /* not used */ uint32 st_mode ; /* file mode information */ int16 st_nlink ; /* always 1 */ int16 st_uid ; /* not used */ int16 st_gid ; /* not used */ int16 st_rdev ; /* same as st_dev */ uint32 st_size ; /* file size */ date_t st_atime ; /* creation date / time */ date_t st_mtime ; /* same as st_atime */ date_t st_ctime ; /* same as st_atime */ uint8 st_attr ; /* file attributes ( non - standard ) */ } stat ; /**************************************************************************** * ffs library function trap id &# 39 ; s . each library call gets a trap number : * ffslibtrapxxxx which serves as an index into the library &# 39 ; s dispatch * table . the constant syslibtrapcustom is the first available trap number * after the system predefined library traps open , close , sleep & amp ; wake . * * warning !!! the order of these traps must match the order of the dispatch * table in ffslibdispatch . c !!! ****************************************************************************/ typedef enum { ffslibtrapgetlibapiversion = syslibtrapcustom , ffslibtrapgetdiskfree , ffslibtrapfindfirst , ffslibtrapfindnext , ffslibtrapfinddone , ffslibtrapfileopen , ffslibtrapfileclose , ffslibtrapread , ffslibtrapwrite , ffslibtrapremove , ffslibtrapchdir , ffslibtrapgetcwd , ffslibtrapmkdir , ffslibtraprmdir , ffslibtrapformat , ffslibtraprename , ffslibtrapgetfileattr , ffslibtrapflush , ffslibtrapflushdisk , ffslibtrapsetfileattr , ffslibtrapstat , ffslibtrapfstat , ffslibtrapisdir , ffslibtraplseek , ffslibtrapgeterrno , ffslibtraptell , ffslibtrapgetdrive , ffslibtrapsetdrive , ffslibtrapunlink , ffslibtrapeof , ffslibtrapcreat , ffslibtrapinsterrhandle , ffslibtrapuninsterrhandle , ffslibtrapsetdebuggingon , ffslibtrapsetdebuggingoff , ffslibtrapcardisinserted , ffslibtrapexercisefat , ffslibtrapcardisata , ffslibtrapchangeoccured , ffslibtraplast } ffslibtrapnumberenum ; /**************************************************************************** * cf fat filesystem api prototypes ***************************************************************************/ # ifdef_cplusplus extern “ c ” { # endif /*------------------------------------------------------------------ * standard library open , close , sleep and wake functions *----------------------------------------------------------------*/ /* open the library */ extern err ffslibopen ( uint16 libref ) ffs_lib_trap ( syslibtrapopen ); /* close the library */ extern err ffslibclose ( uint16 libref ) ffs_lib_trap ( syslibtrapclose ); /* library sleep */ extern err ffslibsleep ( uint16 libref ) ffs_lib_trap ( syslibtrapsleep ); /* library wakeup */ extern err ffslibwake ( uint16 libref ) ffs_lib_trap ( syslibtrapwake ); /*----------------------------------------------------------------- * custom library api functions *---------------------------------------------------------------*/ /* get our library api version */ extern err ffsgetlibapiversion ( uint16 libref , uint32 * dwverp ) ffs_lib_trap ( ffslibtrapgetlibapiversion ); /* get disk free / total size */ extern err ffsgetdiskfree ( uint16 libref , uint8 drive , diskfree_t * dtable ) ffs_lib_trap ( ffslibtrapgetdiskfree ); /* get first directory entry */ extern err ffsfindfirst ( uint16 libref , char * path int16 attrib , ffblk * ff_blk ) ffs_lib_trap ( ffslibtrapfindfirst ); /* get next directory entry */ extern err ffsfindnext ( uint16 libref ffblk * ff_blk ) ffs_lib_trap ( ffslibtrapfindnext ); /* finish directory scan */ extern err ffsfinddone ( uint16 libref , ffblk * ff_blk ) ffs_lib_trap ( ffslibtrapfinddone ); /* open a file */ extern int16 ffsopen ( uint16 libref , char * path int16 flags , int16 mode ) ffs_lib_trap ( ffslibtrapfileopen ); /* close a file */ extern err ffsclose ( uint16 libref , int16 handle ) ffs_lib_trap ( ffslibtrapfileclose ); /* read from file */ extern int16 ffsread ( uint16 libref , int16 handle , void * buffer int16 num_bytes ) ffs_lib_trap ( ffslibtrapread ); /* write to file */ extern int16 ffswrite ( uint16 libref , int16 handle , void * buffer int16 num_bytes ) ffs_lib_trap ( ffslibtrapwrite ); /* delete file */ extern err ffsremove ( uint16 libref , char * path ) ffs_lib_trap ( ffslibtrapremove ); /* set the current working directory */ extern err ffschdir ( uint16 libref , char * path ) ffs_lib_trap ( ffslibtrapchdir ); /* ge the current working directory */ extern char * ffsgetcwd ( uint16 libref , char * path int16 numchars ) ffs_lib_trap ( ffslibtrapgetcwd ); /* make a new directory */ extern err ffsmkdir ( uint16 libref , char * dirname ) ffs_lib_trap ( ffslibtrapmkdir ); /* delete a directory */ extern err ffsrmdir ( uint16 libref , char * dirname ) ffs_lib_trap ( ffslibtraprmdir ); /* format a drive */ extern err ffsformat ( uint16 libref , uint16 drive ) ffs_lib_trap ( ffslibtrapformat ); /* rename a file / directory */ extern err ffsrename ( uint16 libref , char * path , char * new_name ) ffs_lib_trap ( ffslibtraprename ); /* get file / directory attributes */ extern err ffsgetfileattr ( uint16 libref , char * name , uint16 * attr ) ffs_lib_trap ( ffslibtrapgetfileattr ); /* flush a file to disk */ extern err ffsflush ( uint16 libref , int16 handle ) ffs_lib_trap ( ffslibtrapflush ); /* flush all buffers to disk */ extern err ffsflushdisk ( uint16 libref , uint16 drive ) ffs_lib_trap ( ffslibtrapflushdisk ); /* set file attributes */ extern err ffssetfileattr ( uint16 libref , char * name , uint16 attr ) ffs_lib_trap ( ffslibtrapsetfileattr ); /* get information about a path */ extern err ffsstat ( uint16 libref , char * path , stat * pstat ) ffs_lib_trap ( ffslibtrapstat ); /* get information about an open file */ extern err ffsfstat ( uint16 libref , int16 handle , stat * pstat ) ffs_lib_trap ( ffslibtrapfstat ); /* test if a path is a directory */ extern err ffsisdir ( uint16 libref , char * path , boolean * is_dir ) ffs_lib_trap ( ffslibtrapisdir ); /* move file pointer */ extern int32 ffslseek ( uint16 libref , int16 handle , int32 offset , int16 origin ) ffs_lib_trap ( ffslibtraplseek ); /* get the current errno ( global error descriptor ) value */ extern int16 ffsgeterrno ( uint16 libref ) ffs_lib_trap ( ffslibtrapgeterrno ); /* get the current file pointer */ extern int32 ffstell ( uint16 libref , int16 handle ) ffs_lib_trap ( ffslibtraptell ); /* get default drive */ extern void ffsgetdrive ( uint16 libref , uint16 * drive ) ffs_lib_trap ( ffslibtrapgetdrive );. /* set default drive , and return number of valid drives */ extern void ffssetdrive ( uint16 libref , uint16 drive , uint16 * ndrives ) ffs_lib_trap ( ffslibtrapsetdrive ); /* delete a file ( same as ffsremove ) */ extern err ffsunlink ( uint16 libref , char * path ) ffs_lib_trap ( ffslibtrapunlink ); /* determine if end - of_file */ extern err ffseof ( uint16 libref , int16 handle ) ffs_lib_trap ( ffslibtrapeof ); /* create a file */ extern int16 ffscreat ( uint16 libref , char * path int16 mode ) ffs_lib_trap ( ffslibtrapcreat ); /* install the critical error handler callback function */ extern void ffsinstallerrorhandler ( uint16 libref , int16 (* criterr )( int16 , int16 , char *)) ffs_lib_trap ( ffslibtrapinsterrhandle ); /* uninstall the critical error handler callback function */ extern void ffsuninstallerrorhandler ( uint16 libref ) ffs_lib_trap ( ffslibtrapuninsterrhandle ); /* turn on serial debugging */ extern void ffssetdebuggingon ( uint16 libref , uint16 s_port , uint16 level ) ffs_lib_trap ( ffslibtrapsetdebuggingon ); /* turn off serial debugging */ extern void ffssetdebuggingoff ( uint16 libref ) ffs_lib_trap ( ffslibtrapsetdebuggingoff ); /* check for inserted card */ extern boolean ffscardisinserted ( uint16 libref , uint8 drive_num ) ffs_lib_trap ( ffslibtrapcardisinserted ); /* for internal fat testing only */ extern err ffsexercisefat ( uint16 libref , uint8 drive_num ) ffs_lib_trap ( ffslibtrapexercisefat ); /* check if inserted card is an ata type card */ extern boolean ffscardisata ( uint16 libref , uint8 drive_num ) ffs_lib_trap ( ffslibtrapcardisata ); /* system use only ! */ extern boolean ffschangeoccurred ( uint16 libref ) ffs_lib_trap ( ffslibtrapchangeoccurred ) /*----------------------------------------------------------------- * for loading the library in palmpilot mac emulation mode *---------------------------------------------------------------*/ extern err ffslibinstall ( uint16 libref , syslibtblentryptr entryp ); # ifdef_cplusplus } # endif # endif // _ffs_lib_h_ it is thought that the method and apparatus of the present invention will be understood from the foregoing description and that it will be apparent that various changes may be made in the form , construct steps and arrangement of the parts and steps thereof , without departing from the spirit and scope of the invention or sacrificing all of their material advantages . the form herein described is merely a preferred exemplary embodiment thereof .

US-40439303-A

a bracket system holds a filter in quick - attach and quick - release fashion . brackets are combined in modular fashion , with conduit between the brackets , to create a “ bank ” of filters easily changed in number , arrangement , and flow scheme . top brackets and bottom brackets capture / support the top end and bottom end of a filter , respectively , and filter inlet and outlet ports preferably slide onto and off of cooperating tubes / ports in the bracket modules without tools or threaded connections . a retainer may pivot on and off of its respective filter , holding the filter in place and releasing the filter , respectively . after pivoting the retainer up from the filter , the filter may be lifted up off of its respective bottom module , so that the filter is substantially vertically and pivotally removable from the bracket system . a keyed system may ensure that only the appropriate filter fits into the appropriate filter holder , wherein the keyed system includes key protrusions and cooperating key recesses on the mating surfaces that form a fluid connection between the filter and the filter holder . sets of holders and filters may be provided wherein each set has key structure at different radial locations on the members , so that filters from a particular set cannot be used with any other set &# 39 ; s holder . a universally - keyed filter may also be supplied that has key structure that fits with and cooperates with more than one of the differently - keyed filter holders so that the universally - keyed filter may be used with the various sets &# 39 ; holders .

referring to the figures , there are shown several , but not the only , embodiments of invented bracket and filter system . fig1 illustrates a four - filter system 10 having four pairs of brackets , comprising four top brackets 12 and four bottom brackets 14 that are arranged side - by - side (“ aligned ”) in two parallel horizontal rows . alternative arrangements may include non - aligned locations for the brackets with a variety of spacings and patterns , as long as the top bracket and the bottom bracket of each pair of brackets are appropriately spaced apart vertically to receive the filter 11 . each pair of brackets may be located generally independently of the others as long as the conduit between them and to / from intermediate storage and treatment is long enough . this allows a great variety of arrangements and spacings , as well as many flowschemes and liquid treatment options . as may be seen in fig1 and 2 , each top bracket 12 comprises at its rear an attachment plate 20 for attachment to a wall or other preferably vertical surface . connected to the plate are two side - by - side fittings , one for fluid flow into the filter and one for fluid flow out of the filter . each of the fittings has a first end 22 and a second end 24 , wherein the first ends are tubular protrusions extending out from the bracket generally horizontally toward the front of the bracket for connection to the inlet port and outlet port of a filter . the fittings extend back from their first ends 22 and preferably bend at about 90 ° to turn opposite directions to place their second ends 24 at opposite sides of the bracket . the second ends 24 are adapted for connection to conduit 40 ( not shown in fig1 , 2 , and 3 , but shown in fig4 b , 5 a , and 5 b ), which is preferably flexible tubing , but may also be a rigid tube , pipe , or other connector . flexible tubing is normally used for flow schemes in which the conduit runs from the top bracket to some location other than another top bracket immediately adjacent , because the conduit normally includes several bends and curves . for example , the flexible tubing may extend from the first top bracket to a storage tank , and then back to a top bracket or to a bottom bracket . for conduit paths that require few or no bends / curves , rigid or partially rigid conduit is effective . for example , a rigid connector may extend straight from a second end of one top bracket to an adjacent second end of an adjacent top bracket . an example of a rigid tube connector may be two collet - style connectors joined by a short length of pipe or flexible tubing . in embodiments in which the two first ends are side - by - side parallel to each other , the two second ends are preferably opposite - facing on the same axis . each of the two fittings of the top bracket is preferably isolated from the other , in that fluid must flow through one bracket into the filter , and through the filter to reach the other fitting and out to another bracket or separate storage / treatment . alternatively , if a bracket is temporarily not to be used for a filter , the inventor envisions that a jumper tube or connector may be installed between the two fittings to allow flow from one fitting to the other without going through a filter . also , the inventor envisions that , instead of bending at 90 °, fittings may extend straight back from the first ends 22 through the attachment plate 20 for connection to conduit 40 behind or passing through attachment plate . this would be practical for embodiments designed to hang on a grid or other non - solid surface that would allow conduit to pass back and forward through the grid . the top bracket 12 includes a lid 30 pivotally connected to the attachment plate 20 , by way of one or more arms rotatably disposed around the fittings near the second ends . the lid 30 is generally an inverted - cup - shape with a top wall 32 , side walls 34 , front wall 36 , and an interior space 38 . the lid pivots between a raised position , as indicated at “ u ” ( for up ), to a lowered position indicated at “ d ” ( for down ). with the lid in the raised position , the first ends of the fittings and the top end 42 of the filter ( especially the inlet port 44 and outlet port 46 ) are exposed , and the filter may be pulled away from the fittings . in the lowered position , the lid is lowered over the first ends and the filter ports 44 , 46 , in effect , enclosing the fitting - port connection on the top , front , and two sides . in this lowered position , the lid and especially the front wall 36 , retains the filter top end 42 in the bracket 12 , because it cannot be pulled out or fall out from the fittings . preferably , an elastic band ( not shown ) or other biasing member is installed to bias the lid into the lowered position . this way , a person my temporarily raise the lid to remove a filter top end , but , as soon as he / she lets go of the lid , it snaps back down , pivoting relative to the attachment plate and the fittings to rest in the lowered position . the bottom bracket 14 that is adapted for cooperation with the double - fitting top bracket discussed above does not need to include a fitting for connection to a port . because both inlet and outlet fittings , in such an embodiment , are positioned at the top bracket , the bottom bracket need only be a support system for the bottom end 52 of the filter . for such embodiments , the base 54 and its post 56 do not carry fluid or convey fluid to conduits or other filters or vessels , but rather serve for support , alignment , and securement of the filter . the base 54 portrayed in fig1 and 2 includes a post 56 that may be received in an indentation in the bottom of the filter for alignment of the filter in the base , but in an embodiment in which the filter top end 42 includes both inlet and outlet ports 44 , 46 , the indentation is not a port and the indentation , and therefore the post , are not in fluid communication with the filter . the bottom bracket 14 has a rear attachment plate 60 for attachment to the vertical wall and two spaced arms 64 , 64 ′ that extend out from the plate 60 . pivotally connected to the arms 64 , 64 ′ is the base 54 with a bottom wall 66 and a side wall 68 surrounding and defining an interior space 70 for receiving the bottom end 52 of the filter . the base 54 is biased by an elastic band ( not shown ) or other member to remain in a position with the base generally on a horizontal plane and vertically receiving the filter . when force is applied to pivot the base , it pivots on a horizontal axis that is parallel to the plate of the bracket , to a tilted position slightly outward away from the plate . this pivoting typically occurs when the filter top end is pivoted out slightly away from the top bracket so that the filter clears the top bracket when lifted up out of the bottom bracket ( see two filters on left of fig1 and 2 ). in some embodiments , it is envisioned there may be room for some pivoting of the filter bottom end relative to the base , but , in most embodiments , it is preferred that the filter have a close fit in the base and is not pivotal relative to the base . therefore , when the filter is tilted outward , the base pivots outward with it , typically about 15 – 25 ° from a vertical plane . the filter is then lifted up out of the base at that angle relative to vertical , which may reasonably be considered generally vertically . the biasing member returns the base to its upright position after the filter is removed . for alternative embodiments , in which the filter top and top bracket have only one fitting and port 44 , or no fittings or port , the bottom bracket is adapted to carry and direct fluid in and / or out of the filter . in embodiments in which the bottom bracket includes one fitting for a filter port , the bottom bracket preferably includes tubular post 56 in the center of he base , as illustrated by fig3 . the post upends into the interior space to be slidably received in a port in the filter bottom end 52 . the post upends perpendicularly from the base bottom surface , to be vertical when the base is in its upright position . the port into which the post is received runs axially into the filter , preferably at the central axis of the filter . the post &# 39 ; s axial fluid passage 70 is thereby placed in fluid communication with the filter and serves as a fitting for connection to conduit for conducting fluid to / from the filter . an effective system using a fluid - conducting bottom bracket is to have fluid enter the filter top end via a top bracket fitting and a top inlet port 44 , flow down through the filter 11 either in axial and / or radial flow to a bottom outlet port . from the bottom outlet port , fluid flows into the hollow post 56 in the base , to a conduit 40 that conducts the fluid to another bracket ( either top or bottom ) or intermediate storage or treatment . alternatively , the post may serve as an inlet to the filter , which would then be a flow up filter . alternatively , the bottom bracket may include both an inlet and an outlet fitting , for embodiments in which the top bracket does not include any fluid fitting or conduit . this could be accomplished by providing two vertical posts upending from the base and in fluid communication with an inlet and outlet port in the bottom end of the filter , for example , an inlet offset from the central axis of the filter and the outlet at the central axis of the filter . as illustrated schematically in fig4 a and 4b , the post represents the first end of the bottom bracket fitting , which further includes a second end 57 adapted for connection to the conduit 40 . various fitting styles may be provided on the bottom bracket fitting second ends . fig4 a illustrates schematically a bottom bracket 12 with a fitting extending from its first end ( post 56 ) to bend about 90 ° to open at its second end 57 at the side . in this embodiment , the fitting second end 57 and a protrusion 59 opposite the second end both pivot in the arms , so that the pivotal axis extends through the central cavity 61 of the fitting second end . fig4 b shows an embodiment in which the fitting second end 57 ′ extends in an l - shape rearward and transverse to the pivotal axis . in such an embodiment , the fitting second end 57 ′ conveniently connects to a flexible tubing 40 that extends back through the plate 60 , or through a grid wall . or , the tubing may extend up to loop up to a top bracket of the adjacent filter or to intermediate storage / treatment . several of many flow schemes are possible with the invented system shown schematically in fig4 a and 4b . filters of many designs and contents may be used with the invented bracket system . for example , down flow ( either radial and / or axial ), up flow ( either radial and / or axial ), or central return tube styles with both inlet and outlet at one end may be used . many filtration and treatment media may be used including carbons , bolides , blocks , granules , fibrous , or other materials and / or even media void spaces . the base 54 of the bottom bracket illustrated in fig1 , 2 and 4 b is preferably removable from the plate , by means of a snap - in or slide - in connection between the base and the arms 64 , 64 ′. as shown in fig1 and 4b , the pivotal members 67 received in holes 69 in the arms are flattened . when the base is pivoted about 90 °, the flattened pivotal members 67 align their lengths with the slot opening 71 leading out from the holes in the arms , and can then slide out of the arms . this feature , or other removable adaptation , allows one to remove the base with its fitting for maintenance or replacement . fig6 – 12 illustrate a particularly preferred version of a piece of the top bracket 12 , with tubular connector for connecting to a filter cartridge top . bracket member 210 is the piece that seals with , and fluidly - communicates with , a filter cartridge at its top end . it is the two tubular connectors , therefore , that create a physical connection and fluid communication between the bracket and cartridge , and the lid 30 ( not shown in fig6 – 12 ) helps lock the filter onto the tubular connectors . the bracket member 210 shown in fig6 – 12 includes both inlet and outlet tubular connectors , for conducting fluid both into and out of the filter cartridge . thus , the bottom bracket corresponding to such an embodiment would not include any fluid communication ports / tubular connectors . the bracket 210 shown in fig6 – 12 includes , as an option but not a necessity , a keyed system to control what filters are inserted into particular brackets . the keyed system includes tabs that protrude from the inlet and outlet tubular connectors that would be part of a keyed system , to make the tubular connectors &# 39 ; outer surface not perfectly cylindrical , wherein the protruding tabs would be sized to fit into correspondingly positioned and properly sized slots in the inner surface of the filter cartridge ports . thus , the tabs of the tubular connectors ( shown ) and the slots ( not shown ) of the filter cartridge ports , therefore , may form a “ key system ” which can be used to keep unauthorized or improper filter cartridges from being placed on a particular bracket 210 . for various sets of brackets and their proper filter cartridges , the tab and slot location / position would be differently arranged , so , for example , a “ type a ” filter cartridge could only be inserted into a “ type a ” bracket , and a “ type b ” filter cartridge could only be inserted into a “ type b ” bracket . type a could be a pre - filter , for example , and its tab and slot could be positioned , for example , at “ one - o &# 39 ; clock on the tubular connectors and ports . type b could be a microbial treatment filter cartridge , for example , and its tubular connectors and ports , for example , could be positioned at “ four o &# 39 ; clock .” thus , by placement of the type a and type b brackets in a particular order , one could ensure that the cartridges are always in the correct order . in fig6 is shown the bracket 210 that serves several function : mounting means for securing the bracket to a wall of other surface , fluid receiving means , inlet tube for conveying liquid to the filter connected ; outlet tube for conveying liquid from the filter ; and fluid dispensing means for sending the filtered / treated liquid downstream to another filter , process , storage , or use . specifically , plate 212 may be attached to a wall or other surface for supporting several brackets in various flow configurations . inlet 214 and outlet 216 are at opposite ends of a conduit device 218 , and may be used so that inlet 214 receives fluid from an upstream pipe or other conduit and that outlet 216 delivers filtered fluid ( that has exited the filter cartridge ) to its downstream destination . the conduit device 218 directs flow into the inlet tube 220 so that the fluid may flow into the filter cartridge , and then receives flow from the cartridge into the outlet tube 222 so that it may flow out through outlet 216 . as part of the preferred , but not necessary , key system , male tubes 220 and 222 have “ stand out ” or tabs 225 , 225 ′ on their outer cylindrical surfaces for a key system , such as discussed above , which are preferred but not required . as best seen in fig6 and 7 , tube 220 and tube 222 have tabs 225 , 225 ′ protruding about 30 degrees offset from each other ( tab 225 of tube 220 out to the left in fig1 and tab 225 ′ of tube 222 down about 30 degrees from the tab 225 of tube 220 ). the cooperating filter cartridge 228 shown schematically in fig1 has female inlet and outlet tubes 230 and 232 ( which may also be called an inlet port and outlet port ), and one may notice that tubes 230 and 232 have matched or “ mating ” internal slots 227 , 227 ′ to receive the tabs 225 , 225 ′. alternatively , of course , filter cartridges might be made with male tubes and tabs and cooperating holders may be made with female tubes and slots . the bracket 10 in fig6 – 13 typically is installed in a process with the plate 212 vertically attached to a vertical wall . thus , tubes 220 and 222 extend out horizontally , and the filter cartridge is pushed onto the tubes 220 , 222 so that the tubes 220 and 222 support and connect with the filter cartridge . associated with the tubes 220 , 222 , 230 , 232 are o - rings or other sealing structure to provide liquid - tight communication between the bracket and the cartridge . although it is not shown , one may see from fig6 – 13 that liquid - tight seals are made between piping or other conduit and the inlet 214 and outlet 216 . additionally , a fastening device may be added to further secure the cartridge in sealed relationship with the tubes 220 , 222 , such as lid 30 . one may see that , by varying the radial location of the tabs and slots , one could arrive at many “ keys ” and “ locks ” for the cartridge - holder sets . for example a holder could have an inlet tube with a tab at 60 degrees from a reference point and the outlet tube could have a tab at 120 degrees relative to that reference point , as long as the proper cartridge for that holder is made with the same offset and the same absolute location of slots . fig6 – 14 illustrate only one set of the many possible combinations of possible tab radial locations , which are extremely numerous because the radial location of each of the tubes may be varied in each set , and may be varied independently . fig1 and 16 illustrate two of the many other possible key system structures . for example , in the top end of elongated filter cartridge 228 ′ of fig1 , the female inlet tube ( port ) 230 ′ is keyed at about 110 degrees , and the female outlet tube ( port ) 232 ′ is keyed at about 290 degrees . in the top end of elongated filter cartridge 228 ″ of fig1 , the inlet tube 230 ″ is keyed at about 195 degrees and the outlet tube 232 ″ is keyed at about 170 degrees . the bracket 10 in fig1 – 19 typically is installed in a process with the plate 212 vertically attached to a vertical wall . thus , tubes 220 and 222 extend out horizontally , and the filter cartridge is pushed onto the tubes 220 , 222 so that the tubes 220 and 222 support and connect with the filter cartridge . associated with the tubes 220 , 222 , 230 , 232 are o - rings or other sealing structure to provide liquid - tight communication between the bracket and the cartridge . although it is not shown , one may see from fig1 – 19 that liquid - tight seals are made between piping or other conduit and the inlet 214 and outlet 216 . additionally , a fastening device may be added to further secure the cartridge in sealed relationship with the tubes 220 , 222 . in general , key system structures are located on surfaces of surfaces of filter cartridges ( or “ filters ”) and holders that contact each other during connection of the cartridge to the holder . this may be either surfaces that are involved in mainly providing a physical connection between the cartridge and holder or that also are involved in providing a fluid connection between the cartridge and the holder . the preferred keyed system detailed herein involves the structure that create a fluid seal between the filter cartridge and the holder , for example , the inlet and outlet ports of the filter cartridge and the respective , cooperating ports / tubes in the holder that convey liquid to and from the cartridge . in this type of embodiment , the protruding and recessed structures are located around the inner and outer circumference of a tubular connector , comprising a male tube and female receiver , that allow connection of the filter cartridge and the holder , wherein fluid is conducted through the tubular conductor ( s ) once the cartridge seals to the holder . an example of such a tubular connector key system includes one in which both the filter holder &# 39 ; s inlet and outlet and both the filter cartridge &# 39 ; s inlet and outlet are all tubular and are all keyed . for example , a filter holder &# 39 ; s inlet tube and an outlet tube ( that direct flow to a cartridge and from the cartridge , respectively ) each have an elongated axial tab that protrudes out from the outer cylindrical surface of the inlet tube and outlet tube at a chosen circumferential ( also called “ radial ” or “ angular ” to imply non - axial ) location or locations ( that is , at different places on the circumference of the tube surfaces ). likewise , the inner cylindrical surfaces of the cartridge &# 39 ; s cooperating female tubes ( into which the holder inlet tube and outlet tube slide and seal ) have channels or “ slots ” recessed into the surfaces at corresponding circumferential positions . this way , the holder inlet and outlet tubes slide into the cartridge ports , with the holder tabs sliding into the cartridge slots without significant resistance . another cartridge with slots at a different circumferential location , on either one of its ports , would not receive the holder tubes and , hence , could not be accidentally or incorrectly installed in that particular holder . in such a case , where the filter cartridge has two tubes ( inlet and outlet ports ), each of the ports could have a different slot circumferential location , as long as the holder is made to match . for example , the holder &# 39 ; s inlet tube tab ( and corresponding slot on the cartridge inlet port ) could be at “ straight up ” at 0 degrees , while the tab on the holder &# 39 ; s outlet tube ( and corresponding slot on the cartridge outlet port ) could be at 30 degrees offset relative to the inlet tabs and slots . with this type of system , for example , varying additional different cartridge and holder sets each by an additional 30 degrees , many different sets of keyed cartridges and cooperating holders may be made . many other amounts besides 30 degrees could be chosen , but this amount of offset gives many different combinations while providing an offset easily seen and judged by a person . the inlet tabs and slots and the outlet tabs and slots may be varied independently , for example , many sets may have the inlet tabs and slots at zero ( 0 ) degrees , while the sets may have differently - positioned outlet tabs and slots . or , sets may have inlet tabs and slots that vary from set to set by 10 degrees , while those sets &# 39 ; outlet tabs and slots may vary by 15 degrees , for example . the mathematics of such a system suggest that practically an “ endless ” number of sets with different key system structures may be designed . other keyed system styles , besides the tubular connector type , are envisioned . in keyed systems , in general , generally flat or smooth surfaces of the filter cartridge and the holder that conventionally would contact each other to instead include a key system structure that ensures that only a particular type of filter cartridge may be installed in a particular holder . the key system structure of the various sets of filter cartridge and cooperating holders / valve - heads is typically invisible once the filter cartridge is installed . while this may result in differently - keyed filter cartridges having substantially similarly - shaped outer housings , a manufacturer may include indicia on the outer surface of the filter cartridge to indicate the different media or other filter differences . also , a user may look at the key system structure as long as the filter cartridge is uninstalled . in any event , when the user attempts to install a cartridge , only properly - keyed cartridges can be installed into the holder / valve - head / manifold . as an alternative to the tubular connector type system , another example of a key system structure is on structures that are involved in providing physical connection , rather than fluid connection . such a key system structure may be on a shoulder of a filter cartridge that fits up into a valve - head holder . these areas are surfaces that do not normally liquid - seal to each other , but must clear each other if the end of the filter cartridge is to fit up inside the interior cavity of the valve - head . the top circumferencial shoulder of the filter cartridge and the inner surface of a valve - head , typically have areas that come in very close contact , but that are not directly involved in forming a liquid seal between the cartridge and the valve - head . these non - liquid - sealing areas may be keyed so that only a cartridge with a certain keyed surface shape may extend far enough up into the valve - head to be installed and locked into place . for example , tabs or other protrusions may be provided on the top surface of a filter spaced outward from an inlet - outlet neck , but external to the liquid - receiving passages . these filter cartridge protrusions may mate or “ nest ” in identically - located recesses on the inside surface of the valve - head that receives the cartridge , wherein the valve - head recesses are also external to the cartridge / valve - head liquid - receiving passages . the keyed structure on the filter shoulder and the inner surface of the valve - head holder may be said to be located around the outer circumference of a shoulder of the top end of the filter cartridge and the cooperating or corresponding inner circumference of the valve - head cavity . preferably the protruding “ key ” structure comprises a plurality of protrusions located within an arc of about 90 degrees or less around the circumference on which it lies , or more preferably within about 70 degrees or less . the cooperating recess structure is preferably located in the cavity surface , facing the filter cartridge shoulder , and , likewise , the same number of recesses are located within the same amount of circumference , preferably about 90 or less , and , more preferably , about 70 degrees or less . in this type of embodiment , the protruding and recessed structures do not form a liquid seal ( s ) between the filter cartridge and the valve - head , because other structure typically nearer the central axis of the filter cartridge and head serve that purpose . while this preferred key system locates the protrusions on the filter cartridge shoulder and the recesses on the head , the opposite is envisioned , wherein the protrusions may be inside the filter head and the recesses may be on the filter cartridge . while the preferred keyed system includes keying of the holder and the filter cartridge , it may also include keying of an adaptor that is keyed to properly fit and cooperate with the keyed structure of the holder , and that has an unkeyed connected to a conventional , unkeyed filter cartridge . for the tubular connector type keyed system , and for many of the various possible keyed systems for filter cartridges and filter holders , a universal key is desirable as an option for some circumstances . this universal key preferably takes the form of a filter cartridge that is adapted to fit any and all of the various differently - keyed holders that a manufacturer supplies to a single client / customer , or , alternatively , a filter cartridge that is adapted to fit any and all of the various differently - keyed holders that a manufacturer supplies to all of its clients / customers . as discussed above in the summary , this allows an economical answer to the issue of providing differently - keyed main process filtration or treatment cartridges to a customer or to several customers while providing a single cleaning or other infrequent - use cartridge to a customer for all the customer &# 39 ; s special applications , or to all customers for all their special applications . in other words , while there are good reasons to provide differently - keyed cartridges to different customers or to a single customer for his various uses , it may be important to have a single cartridge that is usable in all the customers &# 39 ; filtration / treatment systems , or at least in a plurality of differently - keyed holders . a universal key system preferably comprises a filter cartridge that is adapted to fit a plurality or all of the differently - keyed holders that a manufacturer makes or that are supplied to a client / user . for example , in fig1 is shown schematically a top end 528 of ( or may be formed as an adapter for ) a filter cartridge that is adapted to fit onto all three of the holders for which the three cartridges 228 . 228 ′, 228 ″ in fig1 – 16 are made . that is , the fig1 cartridge 528 has ports 530 and 532 that have multiple slots 561 , 562 , 563 , 564 , 565 , 566 that extend radially from the center of the ports and that are positioned so that cartridge 528 will slide onto and properly liquid - seal with the three holders . this way , cartridge 528 is “ universally - keyed ” with a total of six slots to fit a plurality of holders , which holders each have only one slot per port . as further examples of the preferred tubular connector style system , fig1 a – c illustrate views of a preferred male connector bracket , with one tab each on the inlet and outlet tubes . in fig1 a – c , there are shown various views of a cartridge that is keyed to cooperate with the holder of fig1 a – c . likewise , fig2 a – c and fig2 a – c show views of an alternatively - keyed holder and cooperating cartridge , respectively . while these tubular connector systems include keyed systems in which each female or male connector only has a single slot or tab , alternative versions may have multiple tabs and slots on each female and male connector . fig2 illustrates a universally - keyed cartridge top end ( or adaptor ) that is keyed to fit the holders of both fig1 a – c and 20 a – c . note that the cartridge top end of fig2 has two slots on one of the female connectors and one slot on the other of the female connectors , because the two holders of fig1 and 20 both have one tab position in common on one of the male connectors . fig2 illustrates a universally - keyed cartridge top end ( or adaptor ) that is keyed to fit with any and all holders that have tabs on male connectors that are positioned straight up ( at “ 12 o &# 39 ; clock ”) and at various positions 45 degrees from that . for example , each of the two cartridge top end female connectors has eight slots radially extending out at straight up ( 0 degrees ), 45 degrees , 90 degrees , 135 degrees , 180 degrees , 225 degrees , 270 degrees , and 315 degrees . this way , there are many combinations of one or more tabs on each of the male connectors that may be provided to a customer or customers , and the single cartridge in fig2 will fit onto any of these 45 degrees version male holders . this way , the manufacturer may supply the same universally - keyed cleaning cartridge for many different customers that have requested differently - keyed cartridges for their main filtration / treatment processes . after reading this description , one may understand that a universal key cartridge may be supplied for various keyed systems . for example , a universal key cartridge may be made for a keyed system wherein a filter cartridge shoulder that does not liquid seal to a valve head may include the appropriate universal - keying to fit into several valve heads with different key structures . or , a tubular connector type system may include otherwise - shaped tabs and slots , for example , such as rounded bump - shaped tabs and slots . by “ holder ” is meant any of a variety of devices that receive and seal to a replaceable filter or filter cartridge . this can include a valve head ( including valving to shut off piping when the cartridge is removed ), a filter bracket that supports the cartridge and provides fluid flow conduits into and out of the cartridge , and other devices that contact and are in fluid communication with the cartridge . by “ filter ” or “ filter cartridge ” is meant any container of filtration or treatment media that is connected to a holder for fluid communication with the holder to filter and / or treat the fluid brought into it via the holder . the keyed system invention may be applied to whatever structure of a filtering unit is inserted into the head or other holder , which might be a unitary filter or a filter cartridge encased partially in an outer housing below the level where the filter cartridge engages in the head . although this invention has been described above with reference to particular means , materials and embodiments , it is to be understood that the invention is broad scope of the following claims .

US-20086405-A

a molded body containing a polyarylether , at the surface of which substituents of formula —— x are bound , where r 1 ═ h or an alkyl residue with 1 to 4 c atoms , r 2 ═ h or an alkyl residue with 1 to 4 c atoms , and x is a residue of formula nh —— ch 2 - a , where a = f , cl , br or i or p chnh 2 — cooh with p = 1 or 2 , or a residue of formula nh — n — ch 2 — y , where y ═ h or nh 2 and n is an integer between 0 and 6 , or a residue of formula o — m ch 2 - z , where z = h , oh , cooh , nh 2 , n - pyrrolidone or n - pyrrolidine and m is an integer between 1 and 5 , or a residue of formula nh — nh —— nh 2 , or a residue of formula nh —— cr 3 ═ ch 2 where r 3 ═ h or ch 3 , or a residue of formula o —— k - l , where l = cooh or nh 2 and k is an integer between 1 and 10 , or a residue of formula nh —- ph , where ph is an unsubstituted or pentahalogenated phenyl residue , or a residue of formula o - g , where g is a glucose residue or glucosamine residue . also the method for producing such a molded body .

in one method of the invention , the reaction solution can in principle be used to treat a molded body that is in any form and contains a polyarylether . the reaction solution is preferably reacted with a molded body , containing a polyarylether , that is present in the form of a powder , it being especially preferred , for the reasons stated above , that the powder be porous . in a further preferred embodiment of the method of the invention , the reaction solution can be used to treat a molded body that is in the form of a hollow or flat membrane and contains a polyarylether , the molded body especially preferably being porous . if , in another preferred embodiment of the method of the invention , the reaction solution is used to treat a molded body of which the polyarylether is a polysulfone ( psu ), polyethersulfone ( pes ), polyetherethersulfone ( pees ), polyetherketone ( pek ), polyetheretherketone ( peek ) or a copolymer of these polymers , preferably a pes / pees copolymer , a substituted molded body is obtained that has a polyarylether component with good chemical and thermal stability . examples of tradenames and supply sources for suitable polyarylethers have been cited above . it is possible in principle in one method of the invention to use the reaction solution to treat a molded body consisting entirely of a polyarylether . in many cases , however , the molded body of the invention contains a polyarylether and other components known to be used in its production . a membrane containing polyethersulfone , for example , also contains polyvinylpyrrolidone . in one method of the invention a molded body containing a polyarylether is obtained , in which a substituent of formula ( i ) ( a ), ( b ), ( c ), ( d ), ( e ), ( f ), ( g ) or ( h ) is bound to aromatic rings of the respective polyarylether , these substituted rings being located on the surface , as defined above , of the molded body . as has been stated above , the substitution can be verified by 1 h nmr spectroscopy . in one method of the invention , the aqueous h 2 so 4 used is preferably at a concentration of 60 to 93 wt . % and especially preferably of 80 to 90 wt . %. in one method of the invention , the agent hx is dissolved in the h 2 so 4 in such quantity that the molar ratio of hx to h 2 so 4 lies preferably between 0 . 001 and 1 , and especially preferably between 0 . 05 and 0 . 5 . for preparation of the reaction solution in one method of the invention , it is of course possible to use the preferred formaldehyde or trioxane or paraformaldehyde in solution , e . g ., in water . however , it is preferable to dissolve the formaldehyde or trioxane or paraformaldehyde as the pure substance in each case in the solution comprising hx and aqueous h 2 so 4 . in another preferred embodiment of one method of the invention , formaldehyde or trioxane or paraformaldehyde and hx are used in such quantities that the molar ratio of formaldehyde or o — ch 2 ) to h — x lies between 0 . 1 and 1 . 0 , a ratio between 0 . 33 and 0 . 50 being especially preferred . —( o — ch 2 )— is here the effective structural unit of the trioxane or paraformaldehyde in one method of the invention . furthermore , formaldehyde or trioxane or paraformaldehyde and h 2 so 4 are used , in one method of the invention , in such quantities that the molar ratio of formaldehyde or o — ch 2 y to h 2 so 4 lies between 0 . 001 and 0 . 50 , a ratio between 0 . 01 and 0 . 08 being especially preferred . the reaction solution in one method of the invention can be prepared at temperatures above room temperature . for many of the reactants of the invention , however , the reaction solution can be prepared sufficiently rapidly even at room temperature , for which reason this temperature is preferred for preparation of the reaction solution . furthermore , the reaction solution can also be prepared in one method according to one embodiment of the invention at a temperature below room temperature , provided that the components dissolve sufficiently rapidly at this temperature . the treatment of the polyarylether - containing molded body with the reaction solution can in principle be carried out by any method guaranteeing that the surface of the molded body is in contact with the reaction solution . the molded body can , for example , be immersed in the reaction solution . the rapidity with which a desired degree of substitution is attained depends also on the temperature at which the molded body is treated with the reaction solution . if the polyarylether - containing molded body is treated with the reaction solution at a temperature between 30 ° c . and the boiling point of the reaction solution , the substitution of the invention occurs sufficiently rapidly , for which reason this temperature range is preferred in the method of the invention . depending on the type of substituent in formula ( i ), the molded body of the invention or produced by the method of the invention can be used for a plurality of purposes in which a specific effect is desired . these include adsorption chromatography , if the molded body carries in each case a substituent of formula ( i ) ( a ) or ( i ) ( b ) with the exception of y ═ h , or ( i ) ( c ) with the exception of z = h , or ( i ) ( f ). for example , a molded body substituted with a substituent of formula ( i ) ( a ) where a is a halogen can be used for covalent binding of di - and / or triaminoguanidine . the molded body modified in this way can in turn be used to remove precursors of age ( advanced glycation endproducts ) from blood , so that the formation of age , the cause of such diseases as arteriosclerosis and amyloidosis , can be inhibited . a molded body carrying a substituent of formula ( i ) ( a ), where a is an acid of formula ( ch 2 ) p chnh 2 — cooh with p = 1 or 2 , can be used for removal by adsorption chromatography of basic molecules . a molded body carrying a substituent of formula ( i ) ( b ), where y ═ nh 2 , can be used for removal by adsorption chromatography of acidic molecules . a molded body carrying a substituent of formula ( i ) ( c ) can be used for removal by adsorption chromatography of molecules that react specifically with the respective end - group z of the substituent , i . e ., with the oh , cooh , nh 2 , n - pyrrolidone or n - pyrrolidine groups . a molded body carrying a substituent of formula ( i ) ( f ) can be used , depending on whether l = cooh or l = nh 2 , for removal by adsorption chromatography of basic or acidic groups . moreover , a molded body according to one embodiment of the invention or produced by the method according to one embodiment of the invention and having a substituent of formula ( i ) ( a ) can be used for reaction with a nucleophile . the preferred nucleophile is an aliphatic amine , diaminoguanidine , an amino acid , a peptide or an alcohol . a molded body according to one embodiment of the invention or produced by the method according to one embodiment of the invention having a substituent of formula ( i ) ( d ) can advantageously be used as an anion exchanger . a molded body according to one embodiment of the invention or produced by the method according to one embodiment of the invention having a substituent of formula ( i ) ( e ) can advantageously be used for graft copolymerization . a molded body according to one embodiment of the invention or produced by the method according to one embodiment of the invention having a substituent of formula ( i ) ( g ) or of formula ( i ) ( b ) with y ═ h can be used to provide a molded body with increased hydrophobicity . a molded body according to one embodiment of the invention or produced by the method according to one embodiment of the invention having a substituent of formula ( i ) ( h ) can be used to provide a molded body with increased hydrophilicity , or for reaction with cyanogen bromide . the esca ( electron spectroscopy for chemical application ) technique allows determination of the percentage of atoms on the external surfaces of the molded body that carry a substituent . the esca technique is preferable because its sensitivity is of the order of only a few nm . a porous molded body has in addition substituents bound to the surface of the pores in the interior of the molded body . if the molded body carries halomethyl groups , i . e ., substituents of formula ( i ) a ) with a = f , cl , br or i , it is possible to determine in the following way the density of the substituents on the outer surface and on the surface of the pores in the interior of the molded body . all the halomethyl groups of the molded body are first derivatized with hexamethylene diamine ( hmda ). the number ( nmol ) of the free amino groups is then determined , which corresponds to the nmol of the halomethyl groups . the detailed procedure is as follows : if the molded body that is substituted with halomethyl groups is in the form of a film or flat membrane , a piece of area 1 . 13 cm 2 is punched out with a punch of diameter 12 mm and used for determination of the substitution density per unit area . the term “ substitution density per unit area ” is in this case the number ( nmol ) of halomethyl groups per cm 2 of the punched - out film or membrane surface . if the molded body that is substituted with halomethyl groups is in the form of a capillary membrane , a piece of length 8 cm is cut off from the capillary and used for determination of the substitution density per unit length . the term “ substitution density per unit length ” is in this case the number ( nmol ) of halomethyl groups per cm of capillary length . for the derivatization , the molded body substituted with halomethyl groups is reacted at 50 ° c . for 0 . 5 h with a 5 wt . % aqueous solution of hmda , whereupon the halomethyl groups react with an amino group of the hmda . the derivatized molded body is then washed free of excess hmda with fully demineralized water . to check that the reaction with hmda was quantitative , the derivatized molded body can be examined for residual halogen by the esca technique . for determination of the nmol of free amino groups , the derivatized molded body is placed in a test tube to which 100 μl of fully demineralized water is added , followed by 300 μl of ninhydrin reagent solution from sigma ( of which the composition is given in s . moore , biological chemistry , vol . 243 ( 1968 ), p . 6281 ). the test tube is covered with a glass bead and heated in a water bath at a temperature of 99 . 5 ° c . for 30 minutes . the reaction of the amino groups with ninhydrin produces a compound absorbing at 570 nm . the solution containing this compound is treated with 2 ml of a 1 : 1 mixture of i - propanol and water , and the absorption at 570 nm is measured using an agilent 8454 uv - visible spectrophotometer . comparison of this absorption with that of calibration solutions of known amino group concentration ( calibrant : 6 - aminocaproic acid ) allows determination of the nmol of the amino groups , and hence the nmol of the halomethyl groups . the derivatization of the molded body carrying the halomethyl groups can alternatively be carried out in the same way but using diaminoguanidine ( dag ) instead of hmda , and using the dag derivative as described above for determination of the density of the substituents on the outer surface and on the surface of the pores in the interior of the molded body . the invention will now be described in more detail with the help of the following examples . a pes / pees membrane was produced from a solution of 30 wt . % radel a ( a pes / pees copolymer containing approx . 10 % of hydroquinone units ), 56 wt . % dimethylacetamide and 14 wt . % polyethylene glycol 200 . 14 . 4 g of chloroacetamide and then 1 . 0 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . two pieces of the above mentioned pes / pees membrane , each approximately 10 × 4 cm , were laid in the resulting reaction solution . the pes / pees flat membrane was treated with the reaction solution with stirring at a temperature of about 45 ° c . for approximately 16 hours . the substituted pes / pees flat membrane was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . the substituted pes / pees flat membrane was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows peaks from 1 , 2 , 4 - substituted aromatic moieties at 7 . 08 ppm and 6 . 95 ppm , signals from the methylene protons introduced , and a signal from the amido proton at 8 . 9 ppm . the degree of substitution as calculated from the spectrum is 0 . 8 %. this means that in the solution measured 0 . 8 % of all repeating units of the pes / pees copolymer carry a ch 2 nh ( o ═ c )— ch 2 cl substituent , so that the degree of substitution on the pore surface of the membrane is & gt ; 0 . 8 %. from derivatization of the substituted membrane with hmda and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as 67 nmol of ch 2 nh ( o ═ c )— ch 2 cl / cm 2 . a pes film was produced from a 25 wt . % solution of ultrason e6020 ( pes ) in dimethylacetamide . 14 . 4 g of chloroacetamide and then 1 . 0 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . two pieces of the above mentioned pes film , each approximately 10 × 4 cm , were laid in the resulting reaction solution . the pes film was treated with the reaction solution with stirring at a temperature of about 45 ° c . for approximately 16 hours . the substituted pes film was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . from derivatization of the substituted pes film with hmda and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as 50 nmol of ch 2 nh ( o ═ c )— ch 2 cl / cm 2 . 10 g of hexylamine and then 1 . 0 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . two pieces of the pes / pees copolymer flat membrane produced as in example 1 , each approximately 10 × 4 . 5 cm , were laid in the resulting reaction solution . the pes / pees flat membrane was treated with the reaction solution with stirring at a temperature of about 45 ° c . for approximately 16 hours . the substituted pes / pees copolymer flat membrane was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . the pes / pees copolymer flat membrane was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows peaks between 4 . 1 and 5 ppm from methylene groups that are directly bound to the aromatic moiety . the membrane therefore contains nh —( ch 2 ) 5 — ch 3 substituents . 4 . 75 g of aminoguanidine hydrochloride and then 1 . 0 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . two pieces of the pes film produced as in example 2 , each approximately 20 × 5 cm , were laid in the resulting reaction solution . the pes film was treated with the solution with stirring , initially for approximately 16 hours at room temperature and then for about 96 hours at 45 ° c . the substituted pes film was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . the pes film was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows a singlet from a 1 , 3 , 4 - substituted aromatic moiety at 6 . 95 ppm and 7 . 05 ppm . using esca , the degree of substitution can be determined as 0 . 95 ± 0 . 05 % on the upper surface and 0 . 62 ± 0 . 25 % on the lower surface of the pes film . this means that 0 . 95 ± 0 . 05 % of all the atoms on the upper surface and 0 . 62 ± 0 . 25 % of all those on the lower surface are nitrogen atoms . the reaction with ninhydrin of the pes film having nh — nh —( c ═ nh )— nh 2 substituents is negative , indicating that no primary amino groups are present . the nh — nh —( c ═ nh )— nh 2 substituents are therefore bound to the pes film via the hydrazine functional group . 4 . 6 g of ethanol and then 1 . 0 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . two pieces of pes film produced as in example 2 , each approximately 20 × 5 cm , were laid in the resulting reaction solution . the pes film was treated with the reaction solution with stirring at a temperature of 45 ° c . for about 72 hours . the substituted pes film was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . the substituted pes film was then dissolved in dmso - d6 and a 1 h nmr spectrum was recorded . the spectrum clearly shows that an ethoxybenzyl ether has been formed . the degree of substitution as calculated from the spectrum is 0 . 1 %. this means that in the solution measured 0 . 1 % of all pes repeating units carry an o — ch 2 ch 3 substituent , so that the degree of substitution on the pore surface of the membrane is & gt ; 0 . 1 %. a pes film was produced from a 25 wt . % solution of ultrason e6020 ( pes ) in dimethylacetamide . 6 . 7 g of iodoacetamide and then 0 . 35 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . a 50 cm 2 piece of the above pes film was laid in the resulting reaction solution . the pes film was treated with the reaction solution with stirring and at a temperature of 85 ° c . for about 6 hours . the substituted pes film was washed 3 times with fully demineralized water to make it neutral , boiled with fully demineralized water for about 30 minutes and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . a degree of substitution in the pes film of 0 . 3 % was determined by esca . this means that 0 . 3 % of all atoms at the surface of the pes film are iodine atoms . the substituted pes film was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows peaks from 1 , 2 , 4 - substituted aromatic moieties at 7 . 0 ppm and 6 . 95 ppm . by derivatization of the substituted pes film with dag and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as 52 nmol of ch 2 nh ( o ═ c )— ch 2 i / cm 2 . a pes film was produced from a 25 wt . % solution of ultrason e6020 ( pes ) in dimethyl sulfoxide . 0 . 92 g of iodoacetamide and then 0 . 1 g of paraformaldehyde were added to and dissolved in 50 ml of 80 wt . % h 2 so 4 at room temperature . approximately 2 ml of the resulting solution was withdrawn into a pipette , from which it was dribbled evenly over both sides of a 10 × 10 cm piece of the pes film . the film treated in this way was heated under nitrogen for about 1 hour at 80 ° c . the substituted film was washed to make it neutral as in example 6 , boiled and dried . a degree of substitution in the pes film of 0 . 1 % to 0 . 15 % was determined by esca . this means that 0 . 1 % to 0 . 15 % of all the atoms at the surface of the pes film are iodine atoms . 0 . 92 g of iodoacetamide and then 0 . 1 g of paraformaldehyde were added to and dissolved in 50 ml of 80 wt . % h 2 so 4 at room temperature . approximately 2 ml of the resulting reaction solution was withdrawn into a pipette , from which it was dribbled evenly over both sides of a 10 × 10 cm piece of a pes flat membrane , available as micro pes 2f from membrana gmbh . the membrane treated in this way was heated under nitrogen at 80 ° c . for 1 hour . the substituted membrane was washed to make it neutral as in example 6 , boiled and dried . a degree of substitution in the membrane of 0 . 1 % to 0 . 15 % was determined by esca . this means that 0 . 1 % to 0 . 15 % of all the atoms at the surface of the micro pes 2f membrane are iodine atoms . by derivatization of the substituted membrane with hmda and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as approx . 100 nmol of amino groups / cm 2 , i . e ., approx . 100 nmol of ch 2 nh ( o ═ c )— ch 2 i / cm 2 . a pes film was produced from a 25 wt . % solution of ultrason e6020 ( pes ) in dimethylacetamide . 2 . 7 g of fluoroacetamide and then 0 . 35 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . a 50 cm 2 piece of the above pes film was laid in the resulting reaction solution . the pes film was treated with the reaction solution with stirring and at a temperature of about 85 ° c . for about 6 hours . the substituted pes film was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . a degree of substitution in the pes film of 0 . 2 % was determined by esca . this means that 0 . 2 % of all the atoms at the surface of the pes film are iodine atoms . the substituted pes film was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows peaks from 1 , 2 , 4 - substituted aromatic moieties at 7 . 0 ppm and 6 . 95 ppm . by derivatization of the substituted pes film with dag and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as 52 nmol of ch 2 nh ( o ═ c )— ch 2 f / cm 2 . 6 . 7 g of iodoacetamide and then 0 . 35 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . a 50 cm 2 piece of a pes flat membrane with nominal pore size 0 . 2 μm was laid in the resulting reaction solution . this membrane is available as micro pes 2f from membrana gmbh . the pes flat membrane was treated with the reaction solution with stirring and at a temperature of about 85 ° c . for about 6 hours . the substituted pes flat membrane was washed 3 times with fully demineralized water to make it neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . a degree of substitution in the pes flat membrane of 0 . 6 % was determined by esca . this means that 0 . 6 % of all the atoms at the surface of the pes flat membrane are iodine atoms . the substituted pes flat membrane was then dissolved in dmso - d 6 and a 1 h nmr spectrum was recorded . the spectrum shows peaks from 1 , 2 , 4 - substituted aromatic moieties at 7 . 0 ppm and 6 . 95 ppm . by derivatization of the substituted pes flat membrane with dag and reaction of the derivative with ninhydrin , the substitution density per unit area was determined as 147 nmol of ch 2 nh ( o ═ c )— ch 2 i / cm 2 . a blank value of 25 nmol / cm 2 , which is ascribed to reaction of the ninhydrin with the polyvinylpyrrolidone present in the membrane , must be subtracted from this value . the pes flat membrane that was substituted with iodoacetamide and then reacted with diaminoguanidine in example 8a is tested for its capacity to remove the age precursor methylglyoxal from pbs buffer ( 8 g / l nacl , 2 . 9 g / l na 2 hpo 4 . 12h 2 o and 0 . 2 g / l na 2 hpo 4 ; ph = 7 . 4 ). the procedure is as described in example 5 of wo 02 / 08301 , reference to the disclosure of which is hereby explicitly made , with the difference that the pes flat membrane substituted with iodoacetamide and then reacted with diaminoguanidine is used , the result being that this membrane removed 71 % of the methylglyoxal contained in the pbs buffer . 6 . 7 g of iodoacetamide and then 0 . 35 g of paraformaldehyde were added to and dissolved in 35 ml of 80 wt . % h 2 so 4 at room temperature . a bundle of 8 cm long pes capillary membranes was laid in the resulting reaction solution . each capillary membrane in this bundle has an outer and an inner surface with a total area of 1 . 18 cm 2 , a wall thickness of 35 μm and a lumen of 200 μm . these capillary membranes are available as diapes from membrana gmbh . the reaction solution was allowed to react with the capillary membranes at a temperature of about 80 ° c . for about 6 hours . the substituted pes capillary membranes were washed 3 times with fully demineralized water to make them neutral , boiled for about 30 minutes with fully demineralized water , and dried in a vacuum drying cabinet at 20 mbar and 70 ° c . for approximately 1 hour . by derivatization of the substituted pes capillary membranes with dag and reaction of the derivative with ninhydrin , the substitution density per unit length was determined as 1 . 38 nmol of ch 2 nh ( o ═ c )— ch 2 i / cm .

US-51245204-A

a face milling type gear cutting assembly including contiguous cutting tools positioned in a common slot with means for preserving clearance for chip removal between these tools . the cutting assembly also includes a tool clamping arrangement featuring a novel clamping block which is releasably attached to a screw element in situ .

in face milling type gear cutting assemblies , cutting tools are often arranged in groups about a cutter head . each group may include separately designed cutting tools for separately cutting the two side walls and the bottom portion of each tooth slot to be formed in a work piece . for instance , an inside cuting tool may be provided to cut one side wall of a tooth slot , an outside cutting tool may be provided to cut the opposite side wall of the same tooth slot , and a bottom cutting tool may be provided for forming the bottom of the tooth slot to be formed in the work piece . in certain gear cutting operations , such as continuous cutting operations in which a work piece and cutter assembly are rotated together in a timed relationship , it is especially important to accurately position bottom cutting tools for protecting clearance side surfaces of inside and outside cutting tools against excessive wear . accordingly , the preferred embodiment of the present invention provides for the accurate positioning of a bottom cutting tool contiguously with one of the aforementioned side cutting tools within a common slot . although the preferred embodiment includes a particular combination of bottom and side cutting tools positioned contiguously within the same slot , the principles of the present invention relate to any combination of tool designs . in addition , the preferred embodiment includes a particular bar stock type cutting tool in which a front cutting face is preserved during reprofiling operations . the present invention , however , is applicable to any type of bar stock type cutting tools whether a front cutting face is sharpened or not . referring to fig1 and 2 , a bottom cutting tool is shown modified in accordance with the preferred embodiment of the present invention . the tool is generally of rectangular cross section and may be formed from a length of bar stock . the tool includes a base portion 10 and a profiled cutting end 12 . the generally rectangular form of the tool is defined by front wall 14 , back wall 18 and side surfaces 30 and 32 . a cutting face 16 is formed in front wall 14 and defines with flank surfaces 20 and 22 and top surface 24 the profiled cutting end 12 of the tool . of particular importance to the present invention , recess surface 28 is formed in back wall 18 . recess surface 28 extends the length of the tool while preserving narrow portions of back wall 18 on either side . the narrow portions of back wall 18 , however , terminate below cutting end 12 due to the formation of flank surfaces 20 and 22 in side surfaces 30 and 32 of the tool respectively . although not shown , the tool is also intended to include well known radiused portions between top surface 24 and flank surfaces 20 and 22 . the cutter assembly of the present invention in its preferred embodiment is shown in fig3 and 4 . the cutter assembly illustrated is applicable to continuous gear cutting operations . the bottom cutting tool shown in fig1 and 2 is now designated as 40 in the remaining figures . inside cutting tool 38 and outside cutting tool 42 are also included within the cutter assembly . corresponding surfaces on these tools are designated with the same reference numerals as bottom cutting tool 40 . the illustrated cutter assembly includes a main body member 34 and a ring member 36 which is shrunk onto or otherwise secured to the main body member 34 after tool receiving slots 44 and 46 ( shown in fig5 ) are formed into main body member 34 . inside cutting tool 38 is positioned within tool receiving slot 44 . of particular importance to the present invention , bottom cutting tool 40 and outside cutting tool 42 are positioned contiguously within tool receiving slot 46 . narrow back wall surfaces 18 of bottom cutting tool 40 abut front wall 14 of outside cutting tool 42 . back wall surfaces 18 , however , terminate below the cutting end of bottom cutting tool 40 . accordingly , recess surface 28 of bottom cutting tool 40 together with cutting face 16 of outside tool 42 define a clearance space between the succeeding tools . fig7 and 8 further illustrate the contiguous relationship of bottom cutting tool 40 and outside cutting tool 42 . the preferred embodiment of the present invention also includes a novel clamping arrangement for releasably securing cutting tools in tool receiving slots . referring to fig3 and 6 , a novel clamping block 48 is illustrated . clamping block 48 is adapted to secure cutting tools 40 and 42 within slot 46 . a similar clamping block 50 is also provided for securing tool 38 within slot 44 . both blocks are associated with screw elements having shaped head portions 56 , narrowed neck portions 55 and threaded portions 52 which are fitted in threaded bores 60 of ring member 36 . the threaded portion 52 of each screw element is provided with a recessed outer end of irregular shape for receiving a tool which functions to turn the screw element toward or away from associated cutting tools . shaped head portions 56 may be appropriately sized to permit passage through threaded bores 60 during assembly . each block is provided with a through slot 54 and a partially enclosed opening 58 for receiving shaped head portion 56 . furthermore , partially enclosed opening 58 is adapted to embrace slightly more than one half the circumference of narrowed neck portion 55 . this arrangement permits a snap type securement of each clamping block 48 , 50 to its associated screw element so that clamping block 48 , 50 will not fall out of its respective slot when it is withdrawn from clamping contact or thereafter inverted . partially enclosed opening 58 , however , permits quick release of clamping block 48 , 50 when the clamping block is pushed upward through the front face of the assembly with a predetermined amount of force . in this way , clamping blocks can be readily cleaned or replaced without removing screw elements from their threaded bores . although not shown , the preferred embodiment may also include well known shim elements for radially adjusting the position of cutting tools within their associated slots . clamping blocks 48 , 50 may be readily replaced , as described above , with appropriately sized clamping blocks for accommodating different size shim elements . having described the present invention and a preferred embodiment thereof , it can be appreciated that the concepts disclosed are adaptable to a wide range of gear cutter assemblies without departing from the intended scope of invention .

US-67274184-A

this invention pertains to a product and a method for preparing same . the product is an electrically conducting metallized fibers and a non - conducting composite containing the metallized fibers . in a preferred embodiment , the product is a composite of metallized cellulose fibers disposed in an electrically non - conducting matrix . the method includes the steps of hydrating cellulose fibers to prevent absorption of chemical reagents ; activating the cellulose surface of the fibers for metal deposition ; removing from the fibers excess activator and reagents used in the activation ; drying the fibers to a free - flowing condition whereby the fibers acquire the color of the activator by virtue of its deposition on the fibers ; metallizing the fibers to deposit thereon a metal capable of absorbing electromagnetic radiation ; drying the metallized fibers whereby they are free - flowing ; and forming a composite composed of an electrically non - conductive matrix having dispersed therein the matallized fibers .

this invention pertains to an electrically conducting cellulose fiber product , a composite product composed of a non - conducting matrix and the conducting metallized fibers and to a method for preparing the products . the unobvious and unexpected feature herein is the suitability of metallized cellulose fibers to absorb radio frequency radiation in the microwave range of about 1 - 40 ghz . electromagnetic radiation is composed of electric and magnetic fields that are oriented at 900 to each other . dielectric absorbers , like the metallized cellulose fibers herein and the composites containing same , interact by absorbing the electrical field components whereas magnetic absorbers interact with the magnetic field components . dielectric materials do not interact with magnetic fields since they interact only with electrical fields . fig1 illustrates a coated cellulose fiber that is part of the composite product . as shown in fig1 , the coated solid fiber 10 is composed of cellulose fiber 12 and metal coating 14 . fiber coating thickness is typically below 5 microns and more typically below about 1 micron . although it is desired to have a uniform thickness coated on the fibers that is a continuous coating , this is difficult to achieve in practice . in terms of amount of metal deposited on the fibers , the amount is typically in the range of 1 - 10 grams of metal per gram of fibers , more typically 2 - 5 grams of metal per gram of fibers . fig2 shows that the fiber length , as defined therein , varies from less than about 50 microns to about 1000 microns , with average length being about 270 microns and average diameter thereof is about 15 microns . any electrically conducting or ferromagnetic metal or both can be deposited on the fibers and its thickness should be sufficient to render the fibers electrically conducting and / or magnetically effective . thus , by plating on the fibers , an electrically conducting metal , such as copper , highly electrically conducting fibers can be formed . however , by plating on the fibers a magnetic metal , such as nickel , fibers of low electrical conductivity but of high magnetism can be obtained . by plating both an electrically conducting metal and a magnetic metal , fibers can be produced with high electrical conductivity and high magnetism . in order to deposit sufficient thickness of the metal , plating is prolonged until bubbling stops , indicating exhaustion of the plating bath . when using solid cellulose fibers metallized with copper , there is a significant increase in mass , however , composites made pursuant to the invention disclosed herein are up to about 75 % lighter than comparable prior art composites , which is due to the much lower loadings . although comparable lightness of the metallized fibers herein is a great advantage , another advantage is in maintenance . whereas in the past , metals , especially ferromagnetic metals such as iron powder , were not only heavy but also were subject to oxidation whereas the typical materials herein , are less subject to oxidation . the method for making metallized fibers essentially includes four conventional steps : first , the cellulose fibers are fully hydrated to prevent excessive absorption of chemical reagents ; second , a palladium catalyst / compound is used to activate the cellulose surface for metal plating or deposition , followed by extensive washing with water to remove excess palladium and reagents used in the surface activation ; third , the treated fibers are dried , typically freeze - dried , to yield a fine , free - flowing fiber powder , which is now gray due to the bound palladium : and fourth , in the final method step the fibers in the powder are metallized electrolessly with a metal , typically copper , in a solution , washed and dried again . any suitable metal deposition on the fibers can be used , however , not all metal deposition methods work . vapor deposition is difficult to apply although chemical precipitation appears to work well . for ease and practicality , electroless plating of the cellulose fibers was conducted using conventional commercial metallization reagents . the plating bath was prepared by adding to a vessel , with mixing , water , metallization reagents and the fibers . sufficient amounts of the metallization reagents were added to obtain a metal coating of sufficient thickness to make the fibers elecdtrically conducting and robust . the fibers in the plating bath before plating was commenced were white and the liquid in the bath corresponded to the color of the metallization reagents , which is blue in the case of copper metallization . typically , 0 . 75 - 1 gram of the fibers were used per 10 liters of plating bath . during plating , the fibers went through a color change that depended on the metal plated . duration of the electroless plating was typically 1 - 4 hours at room temperature . bubbling commenced in about 5 minutes after all components were added to the bath . the reaction rate of the plating is a function of the concentration of the unmetallized fibers , and can be demonstrated by gas evolution . reaction kinetics experiments show an initial short but variable lag followed by rapid progress of the plating reaction to exhaustion of plating reagents , fig3 represents copper deposition onto cellulose fibers wherein plating reaction baths were composed of fidelity 1025 electroless copper plating system , a commercial plating composition . progress of the reaction was followed by measuring amount of evolved gas for 3 concentrations , i . e ., 1 . 5 mg / ml ( square ), 2 . 5 mg / ml ( circle ), and 3 . 75 mg / ml ( triangle ). for any concentration of fibers , the reaction proceeds to the same volume of evolved gas since the reaction ceases only when the metal ions in solution have been removed by reduction . the reaction rate at 50 % completion , as a function of concentration of fibers , is shown in fir . 4 , conducted under the same conditions as in the graph of fig3 . there is no theoretical limit to the reaction rate , although since the fibers are a suspension , there is a practical limit to the maximum concentration . since at completion the mass of metal deposited is constant for a given amount of plating bath , a change in the amount of fibers in the reaction results in differences in plating thickness . analysis of the metallized fibers shows about 2 . 7 milliliters metal plated per milliliter of gas evolved and that this ratio is essentially constant over the range of fiber concentrations tested . this results in an approximate 3 . 4 increased fiber mass , as already noted , due to metal deposition when the fibers are used at a concentration of 2 . 5 mg / ml . in other words , a reaction of 0 . 5 grams in a 200 milliliter plating bath gives a yield of 1 . 7 grams of metallized fibers in a reaction that evolves 449 milliliters of gas . fig4 shows reaction rates at 50 % completion . the slope in ml / min , after evolution of about 225 ml of gas has evolved , is plotted against fiber concentration the thickness of the coating was estimated based on the volume of 1 . 2 grams of copper and the diameter of the original fibers , although the fibers do not have a uniform cross section . taking the average fiber width of 39 . 5 microns , the thickness of a uniform copper coating is estimated to be about 3 . 7 microns , although a thickness falling in the range of about 1 - 5 microns would suffice for purposes herein . the metallized cellulose fibers are then used to make a composite composed of the metallized fibers and a matrix material , such as a polyurethane resin or a nitrile rubber . loading of the metallized fibers on weight basis in the composites is typically in the range of 5 - 50 % and more typically 10 - 30 %. some of the microwave properties of the composites filled with the metallized fibers are given in fig5 a - d in order to demonstrate the electromagnetic applicability . fig5 a is a plot of frequency v . permittivity for a composite with a 1 % loading and shows a relatively constant real permittivity of about 5 that remains essentially constant over the frequency range of 2 - 18 ghz . the imaginary permittivity is close to 0 and also remains essentially constant over the same frequency range . at a loading of 12 %, shown in fig5 d , the situation is quite different , with real permittivity declining from about 5 . 5 to about 40 over the frequency range of 2 - 18 ghz with imaginary permittivity increasing from about 10 to about 15 over the same frequency range . imaginary permittivity is proportional to conductivity and imaginary permittivity of metals is near infinite . fig5 b is also revealing in the sense that real and imaginary permittivities are on the intersection course at a higher frequency , the intersection denoting the percolation threshold , which is indicative of onset of electrical conductivity . so , fig5 b is indicative of the fact that composites with 12 % loading are far removed from the percolation threshold . at loadings that begin to approach the percolation threshold , it is typical to observe a frequency dependency of the dielectric constant , as in fig5 b . it should be noted that the exact frequency dispersion is not readily reproduced . the experimental error becomes quite large at the higher loadings . it is presumed that at samples near the percolation threshold have minor variations in the local fiber distribution , can lead to relatively large differences in measured properties . fig5 c shows real ( circles ) and imaginary ( squares ) permittivities at a frequency of 5 ghz as a function of metallized loading of from 0 to 12 %. this shows a typical pattern where the real permittivity increases faster with loading than the imaginary permittivity . the imaginary permittivity component is proportional to the electrical conductivity of the composite and will take on high values when the loading reaches the percolation threshold where inter - fiber yields conductive paths of relatively long dimensions . conductivity measurements in dc are shown as in insert in fig5 c . measurable conductivity was detected in samples of 4 % fiber and higher . the measured values are extremely low and do not show critical behavior . from this , it is concluded that all samples are significantly below the percolation threshold . as all samples in this series are below the percolation threshold , it is observed , as expected , that the increase in imaginary dielectric constant with loading is slight . for samples in the range of 10 - 12 %, with imaginary permittivity of 5 and measured at 5 ghz , the conductivity is about 1 . 4 ( ωm ) − 1 . the highest conductivity observed at 12 % fiber land measured at 18 ghz loading is about 15 ( ωm ) − 1 . the conductivity of the fibers themselves is on the order of 10 6 ( ωm ) − 1 . a further phenomenon that may be observed with fiber - filled composites at microwave frequencies is resonance based on the fiber length , as is discussed below . this results in dramatic changes in dielectric properties in the neighborhood of the resonance , and can yield negative values under some conditions . the permittivity as a function of frequency can be described in terms of the scale dependant effective medium theory ( sdemt ) where the permittivity versus frequency of resonating composite is given by the lorenzian law . fig5 c shows that even at a loading of 12 %, the real and imaginary permittivities are far removed from each other , indicating that composites of 0 - 12 % loadings are far removed from the percolation threshold . the insert graph in fig5 c confirms this by showing that a composite with a 12 % loading has electrical conductivity of about 35 × 10 − 10 ( ωm ) − 1 , which is electrically non - conductive . fig5 d shows a graph of permittivity v . frequency for a composite sample at 10 % loading . in fig5 d , real and imaginary permittivities are labeled and dashed experimental values ( solid ) were determined by sdemt theory . resonance frequency in fig5 d is over the range of about 10 - 14 ghz whereat wavelength of energy in the material is of the same length as the length of the fibers so that energy is resonating on the fibers at that particular frequency at which there is an increase in absorbance at that point or a great increase in imaginary permittivity . as shown fig5 d , resonance peak is at about 12 ghz although in most composites , what is desired is absorption across the frequency range . although fig5 d shows two points of intersection , these intersecting points do not indicate electrical conductivity which would be accompanied by an infinite imaginary permittivity . having described the invention , the following example is given as a particular embodiment thereof and to demonstrate the practice thereof . it is understood that the example is not intended to limit the specification of the appended claims in any manner . this example demonstrates preparation of metallized cellulose fibers and composites made using the metallized fibers , with the matrix material a polyurethane resin . moldings were made between two flat plates , with shims to determine thickness . composite samples were cured for 24 hours at room temperature . electromagnetic measurements were conducted with a hewlett - pakhard 8510 network analyzer and permittivities were calculated by the nicholson ross technique . the samples were 1 . 27 mm thick and toroidal with inner diameter of 3 mm and outer diameter of 7 mm and measured in a coaxial cable arrangement . dc conductivity of the composites was measured across the 1 . 27 mm thickness between metal plates of 5 cm by 1 . 8 cm . measurements were made with a kiethly 194 a digital multimeter . the limit of detection was about 3 × 10 − 10 ( ωm ) − 1 . pursuant to the method , the fibers were produced from fibrous cellulose . twenty grams of dry cellulose fibers , with a density of about 1 . 5 g / cc , was mixed with a small quantity of about 20 ml of water and then added to a 1 liter solution of 160 grams cataprep 404 and 10 ml of shipley cataposit 44 palladium activation catalyst in water . after 10 minutes , the fibers were removed by filtration and suspended in a wash solution of cataprep 404 . filtration was repeated and followed with 4 water washes of 1 liter each . the final filter cake of about 20 grams was freeze - dried to yield a fine , free - flowing light gray powder . the electroless copper plating bath was fidelity 1025 . dry fibers were added at the concentrations specified in the text and subjected to continuous stirring . the plating bath at beginning was of a deep blue color . once exhausted , the plating bath became clear and the reaction mixture was filtered , and the fibers washed with water and freeze - dried . absolute density was determined by water displacement . a known mass of fibers was place in a pre - weighed graduated cylinder . the volume of water was determined by re - weighing the cylinder . the volume occupied by the fibers was determined by subtracting the volume of water from the total volume . an approximation of the conductivity of the metal plated onto cellulose was determined by the use of a spectra / por cellulose membrane ( spectrum ) as a surrogate material . measurement of the conductivity of individual fibers is impractical and the conductivity of bulk fiber is dominated by contact resistance . a membrane of 10 mm width and 8 . 5 cm long was plated with electroless copper essentially as described above . the final thickness was 30 . 5 microns , with a copper layer on both sides of less than 100 mm , as determined by weight gain . the resistance of this membrane was 3 . 5 ω which corresponds to conductivity of 8 . 1 × 10 5 ( ωm ) − 1 . sample composites were fabricated by adding the requisite mass of fibers to polyurethane ls - 40 resin , obtained from b & amp ; b enterprises , to yield the desired volume percentage . moldings were made between two flat plates , with shims to determine the thickness . samples were cured for 24 hours at room temperature . electromagnetic measurements were conducted with a hewlett - packard 8510 analyzer and permittivities were calculated by the nicholso - ross technique . samples 1 . 27 mm thick were measured in a coaxial cable arrangement . while presently preferred embodiments have been shown of the novel metallized fibers in a matrix and a method for making same , and of the several modifications discussed , persons skilled in this art will readily appreciate that various additional changes and modifications may be made without departing from the spirit of the invention as defined and differentiated by the following claims .

US-95659304-A

an apparatus and method for treating for disposal organic waste material carried within a sludge , by adding to the sludge an alkali metal silicate and a setting agent , is disclosed . the apparatus includes several mixers , each having a trough with an input end and a discharge end , at least one rotatable shaft mounted longitudinally along the trough , a plurality of blades mounted to the shaft , and a drive for rotating the shaft . the sludge is deposited within a first mixer , and then directed from the mixer into a tank . a series of chopper pumps recirculate the sludge into the tank , and alternatively , the sludge may be passed through an additional mixer . leaving the tank , the sludge is directed into a second mixer at its input end . water is introduced at the input end , and a setting agent is added along the trough at a point adjacent the input end . further along the trough , an alkali metal silicate is introduced . the mixture is recovered from the second mixer , and carried to a remote location for setting .

as used herein , the term &# 34 ; organic waste &# 34 ; includes raw human wastes and sludges from various organic sources . the organic waste is preferably obtained from sewage , and is a mixture of &# 34 ; waste activated sludge &# 34 ;, which is the activated sludge obtained from the aeration field of a waste water treatment facility , and &# 34 ; primary sludge &# 34 ; from the settling of solids as the waste water first enters the waste water treatment plant . the ratio of waste activated sludge to primary sludge is not critical . the present invention is based upon the mixing of commercial or domestic wastes with a alkali metal silicate which , in the presence of a silicate setting agent , causes the mixture to undergo consolidation and solidification . greater detail regarding this process may be found in u . s . pat . no . 3 , 837 , 872 , which is hereby incorporated by reference . any alkali metal silicate can be used in the present invention , including sodium silicate and potassium silicate . sodium silicate is preferred , because it is the least expensive and is generally available in the quantities required . the sodium silicate is used in its commercial liquid form . a variety of setting agents may be used with the present inventon . such setting agents are typified by such pozzolanic compounds as portland cement , lime , gypsum , calcium carbonate , kiln dust , and fly ash , all of which have a quick gel action continuing with a hardening reaction over a period of time . the properties of portland cement as a setting agent are excellent , and in addition , it is economical and readily available in large quantities . also , the reaction rate with the silicate is easily controllable . thus , the use of portland cement as the setting agent is preferred . the apparatus for treating the organic waste is shown schematically in fig1 from which the over - all scheme of the continuous sludge treating process can be ascertained . the waste material , in the form of a sludge , is carried into the system by a conveyor 10 or the like from a sewage treatment facility or other source . this sludge may typically be the cake output of a filter press or the like . conveyor 10 deposits the sludge within a storage bin 12 , from which the sludge can enter the apparatus at a relatively uniform rate . the sludge as deposited within bin 12 is a highly viscous , thixotrophic material . while the viscosity of the sludge is not uniform , averaqe viscosity is typically estimated at in the order of 100 , 000 centipoise . the sludge exits the storage bin 12 through a chute 14 connected to the bottom of bin 12 . a diverter 16 directs the sludge into either of two branch chutes 18 and 19 , each of which empties into one of two mixers 20 and 22 , respectively . as will be described in greater detail below , mixers 20 and 22 each include a trough having an input end and a discharge end . each trough further includes a pair of shafts mounted longitudinally along the trough , with a plurality of blades attached to each shaft . the shafts are counter - rotated , which both mixes the contents of the trough , and draws the contents from the input end to the discharge end . as shown in fig1 diverter 16 is positioned to direct the sludge from bin 12 into branch chute 18 and into the input end of mixer 20 , which operates to decrease the sludge viscosity through mixing . upon exiting mixer 20 at its discharge end , the sludge is directed by conduit 24 into a tank 26 . in addition , a drainage line 28 is provided from mixer 20 , so that any excess water released from the sludge during mixing may also be directed into tank 26 . three chopper pumps 30 , 32 , and 34 are mounted within tank 26 for pumping and simultaneously chopping the sludge contained within the tank 26 , again for purposes of further lowering viscosity . each of pumps 30 , 32 , and 34 are identical , with pump 30 being shown in greater detail in fig2 . a pump housing 36 provides a chamber 38 into which an impeller 40 is mounted . lower cover plate 42 , mounted to housing 36 , includes a pair of inlet openings 44 through which the sludge to be pumped is drawn . impeller 40 is mounted to a rotatable drive shaft 46 , which extends upwardly through shaft housing 48 and is connected to motor 50 . energization of motor 50 causes the impeller 40 to draw the sludge through the input openings 44 , into pumping chamber 38 , and forces the sludge outwardly through output conduit 52 . impeller 40 includes a plurality of impeller vanes 54 , each of which includes a leading chopper edge 56 . in addition , shaft 46 extends slightly below impeller 40 , and carries at the end thereof a disintegrator tool 58 . rotation of the tool 58 through the incoming sludge , as well as action of the chopper edqe 56 of each impeller vane 54 , operates to masticate the sludge being drawn through pump 30 . in addition , the pumping action of pump 30 operates to decrease the viscosity of the sludge . pump 30 , as described above , is commercially available from vaughan co ., inc ., montesano , wash ., referred to as a heavy duty chopper pump . referring back to fig1 the output of pump 30 is directed into a return conduit 60 which selectively directs the sludge into the input end of either mixer 20 or 22 or back into tank 26 through conduit 61 . direction of the sludge is performed by appropriately opening or closing valves 62 , 64 or 65 . the output from pumps 32 and 34 may be selectively directed into conduits 66 and 67 , respectively , by appropriate valves shown in fig1 . conduits 66 and 67 return the pumped sludge directly back into tank 26 . the various alternate conduits connecting mixers 20 and 22 and tank 26 enable a variety of routings for the sludge . normally , the sludge will be passed through mixer 20 , into tank 26 , and then will be pumped by pump 30 . the sludge will be directed immediately back into tank 26 through return conduit 61 , from which it will be pumped by either pump 32 or 34 out of tank 26 . the purpose of mixers 20 and 22 and tank 26 , however , is to insure that the sludge has been sufficiently liquified to enable proper mixing of the sludge with the silicate and setting agent . accordingly , depending upon the initial quantity of solid or semi - solid material within the sludge , and the overall viscosity of the sludge , various alternative routings for the sludge may need to be used . for example , mixer 22 will normally be used as a back - up for mixer 20 . when necessary , however , sludge from tank 26 may be pumped by pump 30 through conduit 60 , and directed into mixer 22 . upon exiting mixer 22 at the discharge end , the sludge is directed by conduit 68 back into tank 26 . in any event , upon exiting the tank 26 for the final time , the sludge viscosity will have been reduced to an average estimated in the order of 500 centipoise . the liquified sludge is removed from tank 26 for the final time by pump 34 , and is directed along conduit 69 to the input end of mixer 70 . an in - line flow measurement device 72 is located in conduit 69 for monitoring the flow of sludge through the conduit . in addition , a motorized valve 74 is provided in conduit 69 , and is controlled for actuation by level monitor 76 . monitor 76 is in turn responsive to level sensor 78 , which senses the level of the sludge within tank 26 . in the event the sludge level becomes too low within tank 26 , monitor 76 operates to close valve 74 , preventing removal of sludge from tank 26 . in the event the sludge level becomes too high , monitor 76 ascertains that valve 74 is open , and provides an alerting signal to the operator of the apparatus . the mixer 70 is similar to mixers 20 and 22 , and includes a trough having an input and a discharge end . a pair of counter - rotated shafts mounted longitudinally within the trough serve to both mix the contents and move them along the length of the trough . within mixer 70 , the waste material sludge is combined with the setting agent and the alkali metal silicate . the setting agent is held prior to use within a silo 80 or other appropriate storage means . the setting agent is fed into a weigh feeder 82 , including a conveyor belt 84 and a belt scale 86 . a discharge rate monitor 88 is responsive to belt scale 86 for monitoring the rate at which the setting agent is fed into the system . the agent is then directed from weigh feeder 82 through conduit 90 into the mixer 70 at a point near the input end . a pair of storage tanks 92 and 94 are provided for holding the silicate prior to use . a pair of pumps 96 and 98 are provided for delivering the contents of tanks 92 and 94 , respectively , and are preferably of the rotary type such as those manufactured , for example , by the viking pump division , houdaille industries , inc ., cedar falls , iowa . the output conduits from tanks 92 and 94 are interconnected as illustrated in fig1 to enable the silicate to be supplied to mixer 70 from either tank 92 or 94 . in addition , a water inlet 100 is provided to facilitate flushing of the system . pumps 96 and 98 direct the silicate into a conduit 102 for delivery to mixer 70 . an in - line flow measurement device 104 is located in conduit 102 , coupled to a responsive silicate flow monitor 106 . conduit 102 delivers the silicate into mixer 70 at a point between the setting agent introduction point and the discharge end of mixer 70 . a water inlet line 108 , including a valve 110 , is provided into the input end of mixer 70 . water may be supplied through line 108 , to insure adequate moisture for proper reaction of the setting agent . additionally , a drainage line 112 is provided from mixer 70 , so that any excessive moisture contained within the mixer trough may be drained into a sump 114 . a pump 116 is mounted in sump 114 for carrying liquid collected therein back to tank 26 for recirculation . the mixed materials are recovered from mixer 70 at its discharge end , and directed by a chute 120 into a positive displacement pump 122 . pump 122 may be any appropriate commercially available pump , such as those available from american pecco corporation , millwood , n . y . the pump 122 delivers the mixture to an appropriate area where the solidification reaction is allowed to proceed for a period of from four to six days . once the reaction is complete , the treated waste is in the form of a friable material , ready for use as landfill , or to be broken or ground into small particles useful as fertilizer , or as a filler supplement to other products such as asphaltic type paving material . a second mixer identical to mixer 70 may be added to the system shown in fig1 in order to increase the processing capacity . in such a case , a second conduit 123 is connected to direct sludge output from pump 32 within tank 26 into the input of the second mixer . silicate is supplied through a conduit 125 from tanks 92 and 94 . due to the quantity of setting agent required , however , a second independent silo is provided for supplying the mixer . it will be recognized , of course , that the various connections of the mixer inputs , the monitoring system ( as will be described below ), and the like associated with the second mixer will be identical to those shown for mixer 70 in fig1 . the proportions of silicate and setting agent used must be adjusted for the particular waste sludge that is used to provide a solid , stable mass which can be readily disposed of . in most cases , the silicate is used in an amount of about 3 to 8 volumetric parts per 100 parts sludge , and the setting agent is used in an amount of about 5 to 20 parts by weight per 100 parts sludge . one important factor in determining the amount of silicate and setting agent to be used is the percent solids content of the waste sludge . this can generally be determined by monitoring the rate of flow of the sludge through the conduit 69 between tank 26 and mixer 70 . typically , the lower the solids content of the waste , the less viscous the sludge will be , and the higher the flow rate through conduit 69 . thus , a sludge flow monitor 124 is provided , responsive to flow measuring device 72 located within conduit 69 . the sludge flow monitor 124 is interconnected with a setting agent ratio controller 126 and a silicate ratio controller 128 . ratio controller 126 is further responsive to discharge rate monitor 88 , and is operative to control the setting agent discharge speed controller 130 for varying the rate at which agent is fed into mixer 70 . similarly , silicate ratio controller 128 is responsive to both sludge flow monitor 124 and silicate flow monitor 106 , and operates to control silicate pump speed control 132 . speed control 132 in turn controls pumps 96 and 98 for regulating the delivery rate of the silicate into mixer 70 . controllers 126 and 128 may be adapted to control the proportions of silicate and setting agent automatically , or may be adapted for manual control by the operator of the apparatus . additionally , appropriate indication devices ( not shown ) may be provided , for example on a main control panel or the like , to provide the operator of the device with visual indications of the various flow and delivery rates within the apparatus . under typical operating conditions , flow rate of sludge through conduit 69 will be on the order of 100 to 300 gallons per minute , flow rate of setting agent through conduit 90 on the order of 85 to 500 pounds per minute , and flow rate of silicate through conduit 102 on the order of 5 to 18 gallons per minute . a top view showing the mixer 70 in detail is presented in fig3 . it will be recognized that mixers 20 and 22 are similar to mixer 70 , although they do not include provisions for introducing cement , silicate or water , as is necessary in mixer 70 . mixer 70 includes an elongated trough 134 which serves as a container for the materials to be mixed . an end wall 136 defines the input end of the trough 134 , and an opposite end wall 138 defines the discharge end . a pair of rotatable shafts 140 and 142 are mounted longitudinally along the interior of trough 134 . the end of each shaft 140 and 142 adjacent end wall 138 is supported in an appropriate bearing housing 144 , mounted to the outer surface of end wall 138 . similarly , bearing housings 146 are mounted to the outer surface of end wall 136 for supporting the opposite ends of shafts 140 and 142 . the ends of shafts 140 and 142 extend beyond bearing housings 146 , and each shaft 140 and 142 has a driving gear 148 and 150 , respectively , mounted at its end . end wall 136 further defines one portion of a drive housing 152 mounted at one end of mixer 70 . a drive shaft 154 is rotatably mounted within housing 152 , supported at each entrance thereto by bearing housings 156 . drive shaft 154 is driven by a motor 158 through an appropriate speed reducer , so that shaft 154 is preferably driven at a speed of about 300 rpm . a gear 160 is mounted to shaft 154 , and a drive chain 162 is passed about gear 160 . chain 162 passes along the bottom of gear 150 , and then over the top and around gear 148 , so rotation of drive shaft 154 causes chain 162 to counter - rotate shafts 140 and 142 . gears 148 , 150 and 160 are selected with a gear ratio between either gear 148 or 150 and gear 160 of 28 to 13 , for a preferred rotational speed of shafts 140 and 142 of approximatelv 140 rpm . a plurality of blades 164 are mounted to each of shafts 140 and 142 for mixing the contents of trough 134 and drawing the contents along the length of the trough . as seen in fig3 and 4 , the blades 164 are mounted sequentially along each shaft 140 and 142 , with equal spacings both longitudinally and radially between succeeding blades 164 . each succeeding blade is displaced radially by 90 ° from the preceeding blade about the shaft to which it is mounted ; thus , the blades effectively define a helical pattern along the length of each shaft . the configuration of the individual blades 164 can best be seen by reference to fig4 . each blade 164 includes a leading edge 166 , which defines a portion of the circumference of a circle . the trailing edge 168 of blade 164 defines a chord of the circle , so that the area of the portion of the circle defined by blade 164 is less than half the area of the entire circle . a mounting block 170 is attached to one end of blade 164 , preferably by welding . blade 164 is thus secured to either shaft 140 or 142 by bolts ( not shown ) passing through mounting block 170 and into the shaft . when mounted to shaft 140 or 142 , the trailing edge 168 of blade 164 defines a tangent to the cross - section of the shaft . referring back to fig3 an input opening 172 is provided in the end wall 136 for introduction into the trough 134 of the waste material sludge . in addition , nozzles 174 are mounted through end wall 136 for connnection to the water inlet line 108 into mixer 70 . a cover plate 176 is mounted to the top of the trough 134 . near the end wall 136 , an opening 178 is provided in cover plate 176 for introducing setting agent to trough 134 . additionally , a pair of silicate injection nozzles 180 are mounted to the underside of cover plate 176 , at a point along trough 134 between opening 178 and discharge end wall 138 . thus , by the time the silicate is added to the mixure within trough 134 , the setting agent and sludge have been relatively well combined . the outer surface of discharge end wall 138 is shown in fig5 . a discharge gate 182 is slidably mounted on end wall 138 for vertical movement . a latch 184 is provided , for retaining gate 182 in a vertical position . by positioning gate 182 , the rate of discharge from the mixer 70 can be regulated , with , of course , the rate of discharge increasing as the gate 182 is opened to a greater degree . thus , the discharge rate , as well as to some extent the residence time of the mixture within mixer 70 , may be controlled . while the method herein described , and the form of apparatus for carrying this method into effect , constitute preferred embodiments of this invention , it is to be understood that the invention is not limited to this precise method and form of apparatus , and that changes may be made in either without departing from the scope of the invention which is defined in the appended claims .

US-41302582-A

a plurality of transportation vehicles travel with power from an energy storage member along a predetermined travel route under control of a ground controller . a charging area having charging equipment for charging the energy storage member of the transportation vehicle is provided in the travel route , and the transportation vehicles report a position and remaining capacity of the energy storage member to the ground controller . the ground controller controls a transportation vehicle having remaining capacity of a threshold value or less to travel to the charging area for charging the energy storage member , and controls transportation vehicles in the charging area to travel to positions outside the charging area in accordance with transportation requests .

hereinafter , the best embodiment for carrying out the present invention will be described . the scope of the invention shall be determined according to understanding of a person skilled in the art , based on the claims , in consideration of the description of the specification , and well known art in this technical field . fig1 to 6 show an overhead traveling vehicle system 2 according to the embodiment , and the present invention is applicable to a rail guided vehicle system on the ground , and non - rail automated transportation vehicle system . in the drawings , reference numerals 4 denote inter - bay routes , reference numerals 6 denote intra - bay routes , reference numerals 8 denote charging bay routes , and a reference numeral 10 denotes a maintenance bay route . reference numerals 12 denote shortcuts provided , for example , in the routes 4 , 6 . the intra - bay routes 6 , 6 are connected by inter - bay routes 4 , and the overhead traveling vehicles may travel along all of the routes 4 to 10 . the charging bay route 8 may serve also as the maintenance bay route 10 . further , the inter - bay route 4 , the intra - bay route 6 , or the like may include a route 9 dedicated for charging and retraction that has non - contact electricity feeding line 14 for allowing rapid charging along the route 9 . the routes 9 is provided , for example , in parallel with the route 4 or the route 6 , diverges from the route 4 , 6 at the entrance , and merges with the route 4 , 6 at the exit . importantly , the routes 8 and 9 are dedicated for charging and retraction , and transportation instructions are not obstructed even if the routes 8 , 9 are occupied by the overhead traveling vehicles 16 for a long period of time . it is sufficient to provide one of the charging bay route 8 and the dedicated route 9 , and in the embodiment , it is assumed that the charging bay route 8 is provided . the charging bay route 8 is a route for charging secondary batteries of the overhead traveling vehicles 16 and is used as a space for the overhead traveling vehicles to wait before allocation of vehicles . except curve segments , diverging points , and merging points where reception of electricity is difficult , the non - contact electricity feeding line 14 for rapid charging is provided in the travel route . by the way , the non - contact electricity feeding line 14 may be provided also in the curve segment or the like . the maintenance bay route 10 is a route for performing maintenance operation of the overhead traveling vehicles 16 , and the non - contact electricity feeding line 14 for rapid charging is provided in part of the maintenance bay route 10 for allowing charging during a period in which the overhead traveling vehicle 16 waits for maintenance or during test traveling after the maintenance . no non - contact electricity feeding lines 14 are provided at lifters for elevating and lowering the overhead traveling vehicles 16 , in areas for workers to perform maintenance operation for the overhead traveling vehicles 16 , in curve segments , nor at diverging points and merging points . the non - contact electricity feeding lines 14 are provided in straight segments of the routes 4 , 6 in addition to the routes 8 , 10 for rapidly charging the secondary batteries of the overhead traveling vehicles 16 . capacitors may be used in place of the secondary batteries , and lithium ion secondary batteries are preferable as the secondary batteries . a reference numeral 20 denotes a ground controller that communicates with the overhead traveling vehicles 16 , instructs to charge at the charging bay rout 8 , to run to the maintenance bay route 10 , to charge in the straight segments other than the charging bay route 8 , and to run and wait in the routes 4 , 6 . the overhead traveling vehicle 16 travels along the routes 4 , 6 , charging from the non - contact electricity feeding line 14 in the straight segments , and charging the secondary batteries , at the time of deceleration , with regenerative electricity from motors such as travel motors or elevation motors for transfer of articles . when the remaining capacity of the secondary battery is decreased to a predetermined threshold value or less , with an instruction from the controller 20 , the overhead traveling vehicle 16 travels to the charging bay route 8 , and charges the secondary battery . if a failure occurs in the secondary battery , or any other trouble occurs , and at the time of performing a periodical diagnosis , with an instruction from the controller 20 , the overhead traveling vehicle 16 travels to the maintenance bay route 10 , and maintenance operation for the overhead traveling vehicle 16 is performed . fig2 shows structure of the overhead traveling vehicle 16 . an on board controller 22 communicates with the ground controller 20 and implements overall control of the overhead traveling vehicle 16 . the overhead traveling vehicle 16 travels along the travel rail provided in an overhead space by a travel unit 24 having a travel motor or the like . a transfer unit 26 of the overhead traveling vehicle 16 transfers articles to or from load ports , buffers , stockers or the like ( not shown ), e . g ., by lateral movement of an elevation drive unit ( not shown ), rotation of the elevation drive unit about a vertical axis , elevation of an elevation frame by the elevation drive unit , and opening and closing of chucks provided on the elevation frame . regenerative electricity of the travel unit 24 and the transfer unit 26 is used to charge the secondary battery 28 . for example , the secondary battery 28 is a lithium ion secondary battery , but may be a nickel hydrogen battery or the like . it is charged from the non - contact electricity feeding line 14 through a charger 32 and an inverter 36 , drives the travel unit 24 and the transfer unit 26 through the inverter 36 , and is charged with the regenerative electricity . a position sensor 34 detects a position of the overhead traveling vehicle 16 along the routes 4 to 10 , and the travel unit 24 and the transfer unit 26 control the travel and the transfer based on the position data . a battery control unit 30 controls a state of the secondary battery 28 . the secondary battery 28 comprises single cells or cell units connected in series ; the cell unit comprises single cells in series . for example , electromotive force , internal resistance , and temperature are measured for each of the single cells or each of the cell units . the internal resistance can be measured based on the change in each voltage when the load is turned on or turned off , or charging is turned on or turned off . further , the total voltage of the single cells or the cell units connected in series is regarded as the output voltage of the secondary battery 28 . the battery control unit 30 monitors the output voltage of the entire secondary battery 28 or the output voltage of each cell unit , in addition to the states ( electromotive force , internal resistance , temperature ). further , at the time of charging the secondary battery or discharging the secondary battery , the integrated value of charging electrical current and the integrated value of discharging electrical current are stored . then , the changes in the states of each single cell or cell unit associated with the integrated values are stored . the output voltage of the secondary battery may be monitored as voltage of the entire battery or as voltages of cell units to be added . the temperature of each single cell or cell unit , or of the entire secondary battery may be monitored . in most cases , troubles in the secondary battery 28 are not caused in the entire battery , but caused in any of single cells or cell units . the single cell or the cell unit having such a trouble is inspected in the maintenance bay route 10 , and replacement or the like is performed . for this purpose , it is identified which single cell or the cell unit requires maintenance . in the single cell having a problem , some signs may be found . for example , electromotive force becomes lower , internal resistance is increased , temperature is increased , or capacity is reduced . the remaining capacity of the secondary battery 28 ( ratio between the actual capacity and the capacity when the secondary battery is charged to the maximum level ) can be estimated from the output voltage or electromotive force , internal resistance , temperature , and the integrated value of the charged current and the integrated value of the discharged current in the past . the capacity ( maximum capacity ) when the secondary battery is charged to the maximum level can be estimated from information as to how the remaining capacity has been changed relative to the integrated value of the charging electrical current or the integrated value of the discharging electrical current . that is , when the maximum capacity becomes low , the change in the remaining capacity relative to the charged electricity or the discharged electricity becomes large , and thus , the remaining capacity may be determined from the change in the electromotive force , the change in the internal resistance or the like . instead of integrating the charging electrical current or the discharging electrical current , the charging time can be used on assumption that charging and discharging are performed using electrical current at a constant level . fig3 shows structure of the ground controller 20 . a transportation instruction control unit 40 allocates transportation instructions to the overhead traveling vehicles 16 in response to transportation requests from a host controller ( not shown ), and controls executions of the transportation instructions . a charge control unit 42 controls remaining capacity of the secondary battery 28 for each of the overhead traveling vehicles 16 . when the remaining capacity of the secondary battery 28 is a predetermined threshold value p 1 or less , the charge control unit 42 provides an instruction to the overhead traveling vehicle 16 to travel to the charging bay route 8 for charging the secondary battery 28 . when the remaining capacity of the secondary battery 28 is a predetermine threshold value p 2 or less , the charge control unit 42 instructs charging of the secondary battery 28 from the non - contact electricity feeding lines 14 provided in straight segments of the routes 4 , 6 . it should be noted that the threshold value p 1 is , e . g ., about 20 to 40 %, and the threshold value p 2 is , e . g ., about 30 to 60 %. the threshold value p 2 is larger than the threshold value p 1 . preferably , the threshold value p 1 gets larger in a direction away from the charging bay route 8 , and the threshold value p 2 gets smaller in a direction toward the charging bay route 8 . charging may be performed all the time if the threshold value p 2 is 100 %, and there is any non - contact electricity feeding line 14 facing the routes 4 and 6 . a vehicle placement control unit 44 allocates the overhead traveling vehicles 16 from the charging bay route 8 to travel to the routes 4 , 6 , for assigning instructions to the overhead traveling vehicles 16 . for example , with allocation of the overhead traveling vehicles 16 which entered the charging bay route 8 first , the overhead traveling vehicle 16 charged to the greatest extent is preferentially allocated . when the charging bay route 8 is a circulation route as shown in fig1 , the overhead traveling vehicles 16 having the remaining capacity of a predetermined value or more may be allocated to a designated position . though the target remaining capacity in the charging bay route 8 is 100 %, the overhead traveling vehicle 16 having the remaining capacity of less than 100 % may be allocated as necessary . a charging power supply control unit 46 controls the power supply for the non - contact electricity feeding lines 14 , in particular , such that electricity is supplied to the non - contact electricity feeding lines 14 in the routes 4 , 6 , only when the overhead traveling vehicle 16 travels and receives the charge . a battery life control unit 48 monitors the life of the secondary battery . the battery control unit 30 of the overhead traveling vehicle 16 measures electromotive force , internal resistance , and temperature of each of the single cells or each of the cell units , and determines the relationship between the remaining capacity and the amount of charged electricity and the amount of discharged electricity . these items of data are inputted into the battery life control unit 48 through the on board controller 22 or the like to identify which single cell or cell unit requires maintenance . further , for example , based on the change in the maximum capacity of the entire secondary battery , the remaining battery life is detected . only one of the amount of charged electricity and the amount of discharged electricity may be monitored instead of being monitored both of the amount of charged electricity and the amount of discharged electricity . in this manner , necessity of maintenance is determined for each of the single cells or for each of the cell units of the secondary battery , or for the entire secondary battery . based on these items of data , the battery life control unit 48 instructs the overhead traveling vehicle having the secondary battery that requires maintenance to travel to the maintenance bay route 10 . transportation instructions and information regarding executions of the transportation instructions are stored in a transportation instruction file 50 of the ground controller 20 . current positions , velocities , destinations , presence or absence of assigned transportation instructions , and other vehicle information for the overhead traveling vehicles 16 are stored in a vehicle status file 52 . records of changes in electromotive force , internal resistance , temperature , and records of changes in the amount of charged electricity and the amount of discharged electricity , and remaining capacity or the like of each single cell or cell unit are stored in a battery record file 54 . these items of data are part of vehicle information of the overhead traveling vehicles 16 , and may be stored in the vehicle status file 52 . fig4 shows the secondary battery 28 and a manner of controlling the secondary battery 28 . charging from the non - contact electricity feeding line 14 to the secondary battery 28 is performed by an inverter 36 and a charger 32 . a reference numeral 63 denotes a high frequency power supply for supplying electricity to the non - contact electricity feeding line 14 . by the output from the secondary battery 28 , or in each segment where the non - contact electricity feeding line 14 is present , by electricity from the electricity feeding line 14 , the inverter 36 drives the travel motor 60 and the motor 61 in the transfer system such as an elevation motor , and charges regenerative electricity therefrom to the secondary battery 28 . the battery control unit 30 controls the remaining capacity , and the amount of charged electricity and the amount of discharged electricity or the like in the entire secondary battery 28 , and reports these items of information to the charge control unit 42 and the battery life control unit 48 . based on the remaining capacity of the secondary battery 28 , the charge control unit 42 instructs charging of the secondary battery 28 in a charging area or charging of the secondary battery 28 during traveling . further , the battery life control unit 48 instructs to perform maintenance operation in the maintenance bay route , and which overhead traveling vehicle 16 requires maintenance and what kind of maintenance operation should be performed for the secondary battery of the overhead traveling vehicle 16 are displayed on a monitor of the ground controller 20 for allowing an operator to perform the maintenance operation . a charging power supply control unit 46 starts or stop supply of electricity to the non - contact electricity feeding lines 14 provided in straight segments of the routes 4 , 6 . fig5 shows a rule of charge control . degree of transportation load is one parameter indicating a state of the entire overhead transportation vehicle system 2 . for example , this parameter is an occurrence frequency of transportation instructions , or a prediction value of the occurrence frequency . if the transportation load is heavy , priority is given to transportation rather than charging in the charging bay route 8 . if the transportation load is light , charging of overhead traveling vehicles 16 as many as possible is performed in advance in the charging bay route 8 . in this manner , charging is performed when the transportation load is light to prepare for the period in which the transportation load is heavy . for this purpose , when the transportation load is heavy , the threshold value p 1 for starting charging in the charging bay route ( charging area ) is reduced to , e . g ., the lower limit of about 20 %. when the transportation load is light , the threshold value p 1 for starting charging is increased to , e . g ., the upper limit of about 40 %. charging in the charging area is finished when , e . g ., the remaining capacity is 100 %. the vehicle placement control unit 44 can allocate the overhead traveling vehicles 16 with the remaining capacity having a predetermined value or more , e . g ., 60 % or more , 80 % or more or the like . therefore , when the transportation load is heavy , even if the charging level is relatively low , allocation of the overhead traveling vehicle 16 is performed , and when the transportation load is light , charging of the overhead traveling vehicle 16 is performed up to 100 %. fig6 is a diagram showing an algorithm for monitoring battery life . in step 1 , electromotive force , internal resistance , and temperature or the like of each single cell are monitored , and any single cell or cell unit having a failure is detected . in step 2 , change in the maximum capacity of the battery is detected based on the records of charged electricity and discharged electricity , electromotive force , internal resistance , temperature or the like of the battery . if a failure occurs in a single cell or a cell unit , or if the maximum capacity of the battery as a whole becomes low , the overhead traveling vehicle 16 is instructed to travel to the maintenance bay route 10 to receive maintenance operation . ( 1 ) problems in connection with charging of the secondary battery , and waiting and allocation of the overhead traveling vehicle are solved together . ( 2 ) since charging is performed in the charging bay route 8 , unlike the case where vehicles stop in the routes 4 , 6 for charging , no traffic jam occurs . further , once charging is started , it continues until sufficient amount of electricity is charged , and the battery capacity becomes high efficiently . ( 3 ) since non - contact electricity feeding lines 14 are also provided in straight segments of the normal routes 4 , 6 , charging can be performed while the overhead traveling vehicle 16 is traveling . further , even if shortage of electricity in the battery occurs , the overhead traveling vehicle 16 is assisted to travel to the charging bay route . it is sufficient to provide the non - contact electricity feeding lines 14 only in the straight segments , and only in the segments where a large number of overhead traveling vehicles 16 travel . ( 4 ) the state of the secondary battery 28 is monitored for each of the single cells or each of the cell units , and the change in the maximum capacity of the secondary battery is monitored as well . in this manner , maintenance operation can be performed suitably , and it is ensured that all of the overhead traveling vehicles can travel continuously without running out of electricity in the battery . while , in the embodiment , non - contact electricity feeding line 14 is used for charging the secondary battery , contact type chargers may be provided on the ground , and a charging coupler may be provided on the overhead traveling vehicle . in this case , the overhead traveling vehicle is stopped , and the charging coupler is connected to the charger for charging the secondary battery . the contact type charger is advantageous in that large electrical current can be used for charging in comparison with non - contact electricity feeding . however , if the charger is provided , since the overhead traveling vehicles 16 are moved forward to reduce the inter - vehicle distance for space saving , charging needs to be interrupted frequently . further , if the charging coupler is provided in the routes 4 , 6 , the overhead traveling vehicles 16 stop for charging in the routes 4 , 6 , and traffic jams may occur . fig7 shows an overhead traveling vehicle system 70 in a modified embodiment ; it is the same as the overhead traveling system shown in fig1 to 6 , excepts the points particularly specified , and description of the overhead traveling vehicle 16 , the ground controller 20 or the like is omitted . instead of providing the dedicated charging bay route 8 , a large number of charging routes 77 are provided . each of the charging routes 77 has both ends connected to the inter - bay route 4 or the intra - bay routes 6 , 78 to form a loop , and a large number of chargers 80 are provided in it . the charging route 77 may be provided inside the routes 4 and 6 or outside the routes 4 and 6 . a contact type charging coupler is provided in the overhead traveling vehicle 16 . an intra - bay route 78 having larger number of charging route 77 than other routes 4 and 6 is used as the charging bay route 8 in the embodiment . it should be noted that the intra - bay route 78 is also used as the intra - bay route having normal load ports or the like . in this manner , even in the case where no dedicated charging routes 8 are provided , the intra - bay route can have the function of the charging route 8 as well . if the remaining battery capacity is lowered to the threshold value or less , charging is basically carried out in the intra - bay route 78 . since a large number of charging routes 77 are present in the route 78 , an overhead traveling vehicle having the greatest charge among those at front positions in the routes 77 returns to work . in a route 77 having an empty space , charging of a new overhead traveling vehicle is started . further , when the new overhead traveling vehicle enters the route 77 , the stop positions are changed towards forwarding chargers 80 . the intra - bay route 78 is also used as waiting space for the overhead traveling vehicles . the charging routes 77 in the routes 4 , 6 are used as the waiting space for the overhead traveling vehicles regardless of the amount of charging capacity . further , when an overhead traveling vehicle 16 requires charging , the ground controller 20 issues an instruction to move another overhead traveling vehicle which is currently being charged out of the charging route 77 to make an empty charger .

US-201314101069-A

a slave circuit of a lin bus and method for operating a slave circuit is provided . the slave circuit includes a receiver circuit that is connected to the bus in order to output bit sequences as a function of a bus voltage , an interface circuit for controlling a sleep mode and a normal mode , a detector circuit for evaluating the bus voltage which is connected to the bus , a timer device that is connected to an output of the detector circuit and to the interface circuit . whereby , the detector circuit , the timer device , and the interface circuit are designed to detect an exceedance of a time threshold by a waveform of the bus voltage of the bus , and to continue a sleep mode in the event of an exceedance , wherein the time threshold is greater than the duration of a wake - up command .

shown in fig1 is a block diagram with a slave circuit 100 ( slave ) and a master circuit 200 on a lin bus lin . the master circuit 200 ( master ) is connected to the lin bus lin . the lin bus lin is connected to the supply voltage vdd , for example through a resistor r ( pull - up ) connected to an output 201 of the master circuit . the lin bus lin has a recessive level ( high state ) when the transistor mn is off . if the transistor mn is in a conducting state , it connects the lin bus lin to ground gnd , so that the lin bus lin has a dominant level ( low state ). if the master circuit 200 is disconnected from the supply voltage vdd , a bus voltage on the lin bus lin drops . communication through the lin bus lin is no longer possible after disconnection of the master circuit 200 from the supply voltage vdd . if the slave circuit 100 is not simultaneously disconnected from the supply voltage , it advantageously detects from the waveform of the bus voltage that a valid bus signal is not present . the slave circuit 100 is connectable to the lin bus lin by the terminal 102 . the slave circuit 100 has a receiver circuit 160 , which is connected to the lin bus lin through a filter 110 . the filter 110 is an analog low - pass filter for filtering out high - frequency interference signals . the slave circuit 100 has a detector circuit 180 connected to the lin bus lin through the filter 110 , which detector circuit has a comparator with a first threshold value ( s 1 ). the receiver circuit 160 has a window comparator with two second threshold values to constitute the comparator window . the first of the two second threshold values is defined as 60 % of the supply voltage ( vdd ), so that an exceedance is interpreted as logic 1 . the second ( s 2 ) of the two second threshold values is defined as 40 % of the supply voltage ( vdd ), so that a drop below this threshold is interpreted as logic 0 . the output of the receiver circuit 160 can be connected to a processing unit 300 , for example a microcontroller , for the purpose of output . the output of the detector circuit 180 is connected to a control input of a first timer device 120 . in addition , the detector circuit 180 is connected to the interface circuit 150 . an additional , second timer device 130 is connected to the output of the receiver circuit 160 . the second timer device 130 determines , together with the receiver circuit 160 , a time duration during which the bus voltage of the lin bus lin has a dominant level . if a counter of the second timer device 130 runs out , which device reaches a minimum time duration of a dominant level defined for a wake - up command , a signal associated with expiration of the counter arrives at the interface circuit 150 through a connection . by means of the connection between the interface circuit 150 and the second timer device 130 , it is possible to reset , stop , or start the counter , for example . the detector circuit 180 is designed to determine that the bus voltage has dropped below the first threshold value ( s 1 ). if the detector circuit 180 determines by means of a comparator that such a drop has taken place , then a detection signal arrives at the interface circuit 150 to start a safe mode . at the same time , a counter of the first timer device is started by means of the detection signal . as the bus voltage continues to fall , the counter of the second timer device 130 is also started upon reaching 40 % of the supply voltage vdd . if the bus voltage remains below the first threshold value ( s 1 ), the counter of the first timer device 120 expires . in contrast , if the bus voltage rises above the first threshold value ( s 1 ) before expiration of the counter of the first timer device 120 , then safe mode is started . when the counter of the first timer device 120 expires , the interface circuit 150 stores the information as to whether or not the voltage has fallen below the second threshold value ( s 2 ) at the point in time when the counter of the first timer device 120 expires . to this end , an output signal of the receiver circuit 160 arrives at the interface circuit 150 . with the aid of the interface circuit 150 , the first timer device 120 identifies when the permissible length of a wake - up command ( wake - up signal ) has been exceeded on the lin bus lin , and reports this exceedance back to the interface circuit 150 as a counter expiration . the interface circuit and power controller 150 stores the current output value of the receiver circuit 160 in a nonvolatile memory and ensures that the internal supply voltages of the slave circuit 100 are switched off to reduce power consumption . accordingly , the interface circuit 150 controls the power consumption of the slave circuit 100 . a third timer device 140 is connected to the interface circuit 150 . the third timer device 140 is provided for an external signal at the signal input 103 , filtered by an additional filter 170 — for example , an analog bandpass filter . the external signal at the signal input 103 is likewise used for wake - up by means of the interface circuit 150 . a control input 104 of the interface circuit 150 is connected to a processing unit 300 . using the control input 104 , the processing unit 300 signals the interface circuit 150 by means of an enable signal that a transition from safe mode to normal mode ( active mode ) is taking place . the slave circuit 100 with the processing unit 300 is now fully awakened . fig2 a to 3 c show several diagrams explaining the invention with exemplary waveforms of the bus voltage u lin . the example embodiments shown in fig2 a to 3 c are based on a lin bus architecture in which a master circuit 200 can be powered off while at the same time at least one slave circuit 100 is still supplied with the supply voltage vdd . as in the example embodiment in fig1 , however , the powering down of the master circuit 200 also means the loss of the so - called pull - up that holds the line lin in the recessive state as long as no activity takes place on the lin bus . the result is that the voltage on the lin bus slowly drops , wherein the example embodiment in fig1 has the advantage that this drop is not interpreted as a wake - up command by the slave unit 100 . this achieves the effect that the average current consumption of the slave unit 100 is reduced , since no circuits that monitor the activity on the lin bus need be put into operation . in this way the further effect is achieved that a motor vehicle battery is discharged less . a wake - up command according to the lin specification has a defined maximum length of 5 milliseconds . according to the example embodiments in fig2 a to 3 c , this period plus a certain time safety window ( for example , a total of 10 milliseconds ) is waited , then the slave circuit 100 is placed completely back in the sleep mode sm until the bus state is “ recessive ” again . to this end , a counter is used , which is started as soon as the slave circuit 100 is in a wake - up detection phase wdp . at the point in time t 1 , the slave circuit 100 detects a drop by the bus voltage u lin below a threshold value s 1 , and the wake - up detection phase wdp is started . the wake - up detection phase wdp directly follows a sleep mode sm . the counter defines a time duration starting at t 1 lasting until time t 2 . after expiration of the time duration defined by the counter , a check is made as to whether the lin bus lin is already in the dominant state — which is to say below a second threshold value s 2 — or not . the result is stored in a nonvolatile memory . in the embodiment from fig2 a , 2 b , and 2 c , the bus voltage u lin quickly drops below another , second threshold value s 2 in the form of a steep falling edge , so that the dominant state has already been achieved by the point in time t 2 . after the time t 2 , the sleep mode sm is continued . similar also applies for the exemplary embodiment in fig3 a , 3 b , and 3 c . in this exemplary embodiment the bus voltage u lin falls slowly , so that the bus voltage u lin has not yet fallen below the second threshold value s 2 after the start of the wake - up detection phase wdp at the time t 1 ′, or even after counting to the time t 2 ′. the failure to fall below the second threshold value s 2 is stored accordingly as information about the point in time t 2 ′. during the wake - up detection phase wdp , the current consumption i of the slave circuit 100 rises significantly , as shown schematically in fig2 b and 3 b , while the current consumption i is reduced from the time t 2 or t 2 ′ until the time t 3 or t 3 ′ in the sleep mode sm . the sleep mode sm of the slave circuit 100 is continued if the time duration of the drop below the second threshold value s 2 during the wake - up detection phase is not associated with the wake - up detection phase wdp . this is the case in both exemplary embodiments in fig2 a , 2 b , 2 c and 3 a , 3 b , 3 c . the result of whether the bus voltage u lin has fallen below the additional , second threshold value s 2 at the point in time t 2 or t 2 ′ after the expiration of the time duration ( t 1 to t 2 , or t 1 ′ to t 2 ′) is stored in a memory which does not lose its memory contents even in the sleep mode sm . only after this has been accomplished is the sleep mode sm reestablished in which current consumption is minimal . the sleep mode sm can only be terminated again after a rising edge of the bus voltage u lin at the point in time t 3 or t 3 ′, which is to say when the bus voltage u lin again rises to the level of the supply voltage vdd . in the concrete application case in a motor vehicle , this takes place when the ignition is turned on again , and hence the pull - up is again present in the lin network . as a function of the stored result regarding a drop below the second threshold value s 2 or a failure to drop below it at the point in time t 2 or t 2 ′, the slave circuit 100 in the exemplary embodiment in fig2 c is now activated and placed in a safe mode , the so - called fail - safe mode fsm , if the dominant threshold s 2 has been achieved at the point in time t 2 . in the exemplary embodiment in fig3 a , 3 b , and 3 c , the awakening is first made possible by means of a repeated voltage drop on the lin bus lin , since the dominant threshold s 2 had not ( yet ) been reached by the bus voltage u lin after expiration of the counter of the first timer device 120 at the point in time t 2 ′. for the awakening , the bus voltage drops below the second threshold value s 2 for a specified length of time ( not shown ) for the wake - up command . when this occurs , the slave circuit 100 is awakened from a sleep mode sm to a normal mode if the time duration of the drop below the second threshold value s 2 is associated with a wake - up command during the wake - up detection phase ( not shown ). the invention is not restricted to the variant embodiments shown in fig1 through 3 c . for example , it is possible to use alternative time thresholds or additional time thresholds . the invention being thus described , it will be obvious that the same may be varied in many ways . such variations are not to be regarded as a departure from the spirit and scope of the invention , and all such modifications as would be obvious to one skilled in the art are to be included within the scope of the following claims .

US-56641809-A

a transport protocol that achieves improved performance in an environment where paths are lossy and a plurality of paths are employed to transfer data , essentially in parallel , from a source to a destination . the protocol is implemented with the aid of an aggregate flow manager at the source that considers and controls the data flow through the plurality of paths . with some preselected regularity the afm determines a number of packets to be included in a forward error correction block of packets , creates the block , and transmits the segments of the block over the plurality of paths . as necessary , the destination sends information to the source of what additional information needs to be sent . this additional information might be reactive error correcting packets , or a retransmission of the missed packets .

while a detailed description of tcp ( transmission control protocol ) is not necessary for this disclosure , a short summary of the data transmission phase of the protocol is believed helpful for those unfamiliar with tcp . tcp is a protocol for sending packets over an ip network . tcp divides data into tcp segments ( packets ), with each segment having a sequence number and containing k bytes ( in some applications a tcp segment is just one byte of information ). the source sends the tcp segments , and the destination returns an acknowledgement for each received segment , which specifies the next sequence number that the destination expects to receive . of course , there is a time delay before an acknowledgement for the segment arrives , and this delay is a function of the network conditions . to prevent failures that might arise as a consequence of this delay the tcp includes a congestion control mechanism that allows only a certain number , w , of sent tcp segments for which no acknowledgments have arrived . this number is typically referred to as the congestion window . when that number is reached , the source waits for an acknowledgement to arrive before it sends another tcp segment , and it reduces the value of w . once acknowledgments are received , the window size , w , is increased , but incrementally . as indicated above , each acknowledgement specifies the next tcp segment sequence number that the destination expects . if the destination does not receive the expected segment , it basically gets stuck at that expected sequence number . that is , as long as segments arrive at the destination — and that continues until the source stops sending segments and all previously transmitted segments pass through the network — the destination sends the same acknowledgement . an acknowledgement that is identical to the immediately previous acknowledgment is , effectively , an alert acknowledgment , because it indicates that an expected segment failed to arrive . to illustrate , assume that segments 1 through 5 were received correctly , that segments 6 and 7 were not received , but segment 8 was received . the acknowledgment for segment 5 specifies sequence number 6 , and when segment 8 is received the acknowledgement that is sent back still specifies sequence number 6 . unfortunately , the source will receive the second acknowledgement that specifies sequence number 6 , i . e ., the alert acknowledgment only after the return - path transit delay . so , between the time of sending segment 6 and the time of receiving the alert acknowledgment ( i . e ., the forward - path and the back - path transit delays ), the source may have sent 200 segments ( 7 through 206 ). if all of those segments are properly received at the destination , then the source with eventually receive 200 alert acknowledgments . because the acknowledgements in the accumulative acknowledgement approach do not provide a valid indication about the status of segments following the segment that failed to be properly received ( lost segment ), the best that the source can do when it receives an alert acknowledgement is to stop sending new segments , and to assume that the packets that were already transmitted must be retransmitted . in the case of the above example , that means that the source must retransmit tcp segments 6 through 206 . another acknowledgment approach that is sometimes used in the prior art is the selective acknowledgment ( sack ) approach where , instead of specifying the sequence number of the next expected segment , the acknowledgement specifies ranges of segments that were properly received . to use the above example , the sack messages responsive to the first seven received segments are ( 1 , 1 ), ( 1 , 2 ), ( 1 , 3 ), ( 1 , 4 ), ( 1 , 5 ), ( 1 , 6 ), ( 1 , 6 )( 8 , 8 ). when the source receives message ( 1 , 6 )( 8 , 8 ) it knows that it has to retransmit segment 7 , but it does not need to assume that all remaining 200 segments need to be retransmitted as well . in fact , if segments 8 through 48 are received properly , the sack messages will so indicate by having only two spans specified ( assuming that segment 7 was not yet retransmitted , or retransmitted but not yet received ), and when segment 49 fails to arrive properly but segment 50 does arrive properly , the next sack message is ( 1 , 6 )( 8 , 48 )( 50 , 50 ); i . e ., specifying that segments 7 and 49 are missing by means of the three spans . the protocol disclosed herein is a transport protocol . in particular , the protocol disclosed herein transmits data in block of segments and , advantageously , employs a plurality of paths to transfer data , essentially in parallel , from a source to a destination . the process flowcharts disclosed below are , in practice , typically executed with a software controlled processor . however , it may be helpful to consider the logical structure of a source , as depicted in fig1 wherein an aggregate flow manager 60 controls ( a ) buffer 61 that is responsive to data received from the application layer and crates the segments and the blocks of segments , ( b ) memory 62 that holds error correcting information and , optionally , block segments that have already been sent but which may need to be resent , ( c ) path controller 63 , 64 , and 65 for paths 1 , 2 , and j , and ( d ) distributor 66 which applies block segments to the different paths , via the respective controllers , under direction of manager 60 . in the implementation disclosed herein , the blocks are uniform in length , each having n block segments . it is possible to have block segments be bigger than the tcp segments ( packets ) but it is convenient , at least for exposition purposes , to have block segments and tcp segments be one and the same packets . the path controllers ( 63 - 65 ) operate in a conventional tcp manner as described above , in the sense that the path i controller sends packets , receives acknowledgements , based on the acknowledgements controls the congestion window , w i , and computes the round trip delay time , rtt i . illustratively , the acknowledgements are selective acknowledgements ( sack ). the source knows how many packets are transmitted on each path and combining that information with the sack information yields the number of packets that are lost on each path . this allows the paths to implement congestion control in the conventional manner . one feature of the fig1 arrangement is that the acknowledgement messages are sent by the destination over all j paths , concurrently , and the received acknowledgement messages from the different paths are sent to manager 60 . manager 60 , in turn , forwards each acknowledgement message to the appropriate path controller . consequently , the acknowledgement message arrives at the appropriate path controller as quickly as the shortest path permits . the general thrust of the invention is to use the plurality of paths that are employed for communicating data from a source to a destination in an efficient manner , by using the collection of those paths as a channel with parameters that represent what effectively are the average parameters of the individual paths . in the forward direction — from the source to the destination — significant performance improvement is achieved from this parameters averaging effect . in the backward direction even greater performance improvement is achieved from the fact that the acknowledgement messages are sent concurrently over all of the paths , thus obtaining the benefits of the best ( e . g ., shortest ) path . as indicated above , at the source data is handled in blocks . more particularly , each block contains data , and additional information that is included in the block to provide a measure of error correcting capability . more specifically , the data of a block consists of k packets , and the additional information consists of n - k forward error correcting ( fec ) packets . the size of the block , n , and the number of data packets that it contains , k , are parameters that are dynamically adjusted ( as disclosed below ) based on the network conditions as they affect the collection of paths that are used , i . e ., the channel . the acknowledgement to a block segment is a block - sack , and in accord with the principles disclosed herein , a block - sack is sent by the destination after it a first packet of a new block . to simplify the discussion , the following uses the term sack as shorthand for block - sack . in accord with one feature of this disclosures , a sack message that is sent by the destination after the new block packet is received and processed by the destination is sent concurrently over all of the paths , and the source uses the received sack message to send additional information so that the destination ends up with all of the transmitted information . fig2 depicts an illustrative embodiment flow chart of the process occurring at the source . the process begins at step 11 where an id number is set for a block . control then passes to step 12 which computes a block size , n , and a number k of data packets , in the manner disclosed below . initially , when there is no data based on which n and k can be computed , some initial values are taken . control then passes to step 13 , where k new packets are created from data provided by the application layer , and control passes to step 14 , where the aforementioned fec information is computed . it is noted that the fec packets that are included in the block are not the only error correcting information that may be necessary . in spite of having fec packets included in the block it is possible that transmission errors will occur in excess of the ability to mask them by use of the fec packets . this fact is actually implicit in the fact that sack messages are employed .. in the illustrative embodiment disclosed herein in connection with fig2 , this additional information is additional fec packets ( that at times might be used — as disclosed below ). to distinguish between the fec packets that are initially included in a block , and the other fec packets , the former are termed proactive fec packets , or pfec packets , and the latter are termed reactive fec packets , or rfec packets . returning to fig2 , in step 14 computes both the pfec packets and the rfec packets are computed for the block , and the pfec packets are appended to the block . control then passes to step 15 to initialize sequence index a , and then to step 16 , which peels off a packet from the block , and appends to it the block id and the sequence number a in preparation for transmission . control then passes to step 17 , which determines whether flag z = 0 , which indicates that the packet is permitted to be transmitted . if not , control passes to step 18 , which imposes a wait period before returning control to step 17 . when z = 0 control passes to step 19 where a path , i , is chosen and the subject packet is sent to the destination over path i . the sequence number , a , is then incremented in step 20 and a test is performed in step 21 to determine whether the sent packet is the last packet of the block . when the end of the block has not been reached , control returns to step 16 . otherwise , control passes to step 22 , which initiates a timer for receiving and handling a sack message . from step 22 , control passes to step 23 where the block id number is incremented , and then to step 24 , where a determination is made as to whether to update the channel parameters and recompute the values of n and k . if so , control passes to step 25 where the parameters are recomputed , and then control passes to step 12 . otherwise , control passes to step 13 . relative to step 17 where it is determined whether there is permission to send the segments of the current block , it is possible that there is no permission to send a block &# 39 ; s packet because the source is busy transmitting information to augment that which was sent before but not properly received . this may be a retransmission of packets , or the transmission of rfec packets . in such an event , as explained below in connection with fig3 , when the source finishes sending the augmenting information , permission to send new packets is granted . it is also possible that there is no permission to send a block &# 39 ; s packet because the network is congested . this condition as evidenced , for example , by the failure to receive a sack message within an expected time interval . this , too , is handled in the fig3 flowchart . the fig3 flowchart begins with step 51 that determines whether a sack message has arrived . if so , control passes to step 53 . otherwise , control passes to step 56 , which checks whether the timer ( initialized by step 22 ) has expired . if not , control returns to step 51 . otherwise , an alarm condition is declared . it is noted that the event of a sack message not arriving before the timer expires is handled in the same manner that it is handled in the prior art tcp protocol , and it is not addressed here . step 53 sets flag z to 1 , indicating that transmission of block packets is arrested ( in step 17 ). control then passes to step 54 , which processes the sack information and determines what needs to be sent . illustratively , when the block was sent with a number of pfec packets that can recover f failed packets ( i . e ., packets that were not received properly ) but the block arrived with f + g failed packets , none of the failed packets can be recovered and the sack message informs the source of this condition . if the source has g rfec packets already computed , it is generally preferable to send the g rfec packets . if however , the source has fewer than g rfec packets computed , it is generally preferable to simply resend the f + g failed packets . from step 54 control passes to step 55 which retrieves and sends the needed information . specifically , step 55 accesses the appropriate buffer to obtain a packet of the information that needs to be sent , augments the packet by appending to it a header , and sends the augmented packet . following step 55 , step 56 determines whether the packet sent is the last packet for the information that needs to be sent in response to the received sack message , and if not , the step returns control to step 55 . otherwise , control passes to step 57 , which resets flag z to 0 . as indicated above , the information that step 55 sends is either data packets ( a retransmission of packets that were not received properly ), or rfec packets . in the case of data packets , the packets &# 39 ; header ( pertaining to this protocol ) is simply the block id number and the sequence number of the retransmitted packet . in the case of rfec packets , the header is the block id number and a sequence starting with a = 0 . it should be noted that in fig2 the sequence numbers of a block &# 39 ; s data packets and pfec packets begin with k . k is arranged to be greater than the maximum number of rfec packets that the source will ever send . this way , the destination knows that it is receiving rfec packets rather than a retransmission of data packets . at the destination end , a sack message is sent to the source after each packet has been received . the question , however , is how , given that there is a plurality of paths that the source employs , the destination knows that it should wait no longer for another packet of some given block b . one illustrative embodiment has the destination simply wait till a packet from block b + 1 is received from all of the paths . this guarantees that there are no packets of block b still in transit . another embodiment employs a histogram of past receptions to identify the path with shortest and the longest delays , respectively , from which the approximate time difference between them , δ seconds , is computed . armed with this information , the destination knows that certainly δ seconds after a packet of block b + 1 arrives , it is assured that no packets of block b are still in transit . this is the embodiment depicted in fig3 . fig4 illustrates the process of receiving packets at the destination . the destination receives a packet in step 31 and determines whether it received the segment correctly . when it determines that the received packet is not correct , the packet is simply discarded . when the received packet is correct , control passes to step 32 which determines whether the packet belongs to a block that is still in need of packets . if not , control passes to step 33 , which sends a sack message to the source that a packet was received ( albeit was not needed ). when the received packet is needed for decoding a block , control passes to step 34 , which stores the packet in a buffer and passes control to step 35 which determines whether , relative to the block of the packet that just arrived , there are enough packets in store to decode the block . if not , control passes to step 33 again , which sends a sack message to the source to inform it that a packet arrived . if there are enough packets to decode the block , control passes to step 36 where the block is decoded , whereupon control passes to step 37 . the buffer might contain packets of more than one block , and it is possible that while block n is in buffer and still needs information in order to have a sufficient number of packets for decoding , while the arriving packet belongs to block n + 1 and it is one that allows the decoding of block n + 1 . it is preferable to not send the decoded block n + 1 to the application layer before block n is sent and , therefore , step 37 determines whether the just - decoded block is the next expected block to be decoded . if not , control passes to step 33 once again to send a sack message to the source . if it is the expected block that was successfully decoded then control passes to step 38 which forwards the decoded block to the application layer and passes control to step 39 . step 39 updates the next expected block ( e . g ., increments from n to n + 1 ) and return control to step 37 . when there is no next block in connection with which step 37 can determine whether the decoded block is the next block in the next block in the sequence control also is passed to step 33 to send a sack message to the source . the consequence of block processing is that either the block is valid and ready to be decoded , or not ; and in the latter case process 35 constructs a sack message . illustratively , the sack message is of the form [( a 1 , a 2 )( a 3 , a4 ) . . . r 1 ( b ), . . . r 2 ( b ) . . . r i , ( b ) . . . r j , . . . ( b )], where each a i is a sequence number that marks the beginning or the end of a span of successfully received packets , and each r i ( b ) corresponds to the number of packets that were received via path i for block b ( there are j such paths ). for example , when a block has 1000 packets , 4 paths , and three packets were not properly received , the sack message might be [( 1 , 302 )( 304 , 825 )( 827 , 998 )( 1000 , 1000 ), 240 , 255 , 250 , 247 ], indicating that packets 303 , 826 , and 999 are missing ( i . e ., did not arrive , or arrived but are corrupted ), and that the 4 paths carried 240 , 255 , 250 and 247 packets , respectively . as indicated above , one interesting feature of this embodiment is that the sack message is sent to the source concurrently over all of the paths . consequently , the sack message arrives at the source as quickly as the shortest path permits . processing ( i . e ., decoding ) of the packets in a block that includes pfec packets can be performed in any of a number of well known ways that relate to the selected process for creating the pfec ( and rfec ) packets . it may be noted in passing that the process of sending a sack message to the source with each packets that is received and accepted as a good packet in step 31 not only provides for congestion control at the source , but it is also able to inform the source even before the entire block was transmitted that rfec packets ought to be sent . regarding the process of steps 25 and 12 ( fig1 ), as indicated above , each of the path controllers computes the round trip time , rtt i , for the path . the manager 60 thus has access to this rtt i information , and to the congestion window values , w i . from the sack message the manager 60 knows how many packets were received via each path i , r i ( b ), and it knows how many packets it sent over each path i , s i ( b ). this information is provided to step 12 , from which the median round trip time rtt med is derived , and the value of n is computed in step 12 by evaluating from the available information the source can also determine an aggregate loss for the channel by evaluating where λ is , for example , the constant 0 . 5 , an instantaneous variance by evaluating from those parameters , step 12 computes the value of k by evaluating the test performed in step 24 regarding whether it is time to recompute the parameters is a designer choice . it can be as simple as a preselected number of blocks . for example , each time the value of b is a multiple of 10 , step 24 passes control to step 25 . step 19 chooses a path i for transmitting a packets . this choice can be made based on any algorithm , such the round robin scheduling algorithm . however , it is recognized that some paths may offer lower error probabilities than others and , therefore , may be considered better . this is particularly so if those paths also have shorter transit times . in the context of the above - disclosed protocol , when the block of packets is sent over the channel , there may be some advantage for favoring the better paths , particularly in situations where there is a large disparity between the goodness of one paths and some other of the paths . for better performance , the selection algorithm may be made stochastic , with the probability of selecting a path being proportional to a measure of goodness of the path , which measure might take account of only the probabilities of error , or take account of probabilities of error and transit delay . as an aside , the probability of error of a path i may be computed following each sack message reception by evaluating where λ is a preselected constant that is less than 1 , r i ( b ) is the number of packets received by the destination over path i for block b ( and sent to the source in the sack message ), s i ( b ) is the number of packets sent by the source over path i for block b , and pr i ( existing ) is the probability of error that had been previously computed for path i . generally , however , the overall performance of the protocol is not enhanced so much by employing a stochastic path selection approach for the transmission of a block &# 39 ; s packets . a more significant performance enhancement is realized , however , when distinguishing between the transmission of a block &# 39 ; s packets vs . the transmission of rfec packets , or the retransmission of failed packets . that is , it is beneficial , when sending the rfec packets or retransmitting failed packets to employ the paths that have a low probability of error . here , too , however , experimental results indicate that it suffices to classify paths into two groups ; one being the “ standard ” group and the other being the “ better ” group . the paths belonging to the “ good ” group are used for transmitting the rfec packets , or packets need to be retransmitted .

US-14841008-A

a method of preparing wireless communication chips for later processing includes receiving a carrier tape that is carrying a wireless communication chip positioned inside a container on the carrier tape and beneath a protective adhesive . the protective adhesive is stripped from the carrier tape . using an apparatus having a first roller , the carrier tape is passed over the first roller , and the wireless communication chip is forced into contact with an adhesive tape for later processing . also disclosed is a system for preparing wireless communication chips for later processing .

the present invention is a method of manufacturing wireless communication devices such as those used in co - pending , commonly assigned u . s . patent application ser . nos . 09 / 678 , 271 and 09 / 678 , 630 , entitled “ wireless communication device and method ” and “ mufti - band wireless communication device and method ,” respectively , both of which were filed on oct . 3 , 2000 , and are incorporated herein by reference in their entireties . in particular , the present invention allows variations in the size of the tabs used for antenna elements in the wireless communication devices . some wireless communications devices have both transmit and receive capability and can be used in the present invention . a typical example of such a device is described in u . s . pat . no . 5 , 585 , 953 , entitled “ ir / rf radio transceiver and method ,” incorporated herein by reference in its entirety . other wireless communication devices have receive capability and use the energy received to communicate back , such as described in u . s . pat . no . 6 , 078 , 259 entitled “ radio frequency identification tag ,” incorporated herein by reference in its entirety . such passive devices may likewise be used with the present invention . the wireless communication device in the present invention can be any type of device that allows reception of wireless electronic communications and is able to communicate in response thereto . both types of wireless communication devices are sometimes referred to herein and in the art as transponders . the terms are used equivalently herein . fig1 illustrates a wireless communication device 10 , such as that described in the previously incorporated applications . in particular , wireless communication device 10 comprises a substrate 20 , a wireless communication chip 30 , and one or more tabs 40 , to serve as an antenna 60 for wireless communication device 10 . tabs 40 a , 40 b may be constructed out of any type of material so long as the material is conductive . such material may be a ferrous material , including metal , steel , iron , or the material may be aluminum or other type of conducting material . tabs 40 may also be constructed from a tape impregnated with metal loaded ink , as described in u . s . pat . no . 5 , 566 , 441 , entitled “ attaching an electronic circuit to a substrate ,” incorporated herein by reference in its entirety . in one embodiment of the present invention , as illustrated in fig1 , tabs 40 a , 40 b are made from a foil tape 42 , 52 , respectively , as is well understood in the art . an optional ground plane ( not shown ) may be oppositely positioned on substrate 20 if needed or desired . substrate 20 may be almost any material , but is most likely a plastic or similar material . wireless communication chip 30 may comprise a device from intermec as used in their intellitag ® labels and those devices from sos as used in their dl 100 label , although other devices are certainly possible , especially in light of the present invention &# 39 ; s suitability to both active and passive wireless communication devices 10 . wireless communication chip 30 may comprise a controller , memory , a battery , a sensor , and other conventional components , such as those described in the previously incorporated applications . tabs 40 a , 40 b together comprise dipole antenna 60 . in this particular embodiment , tabs 40 a , 40 b are asymmetrical with respect to one another to form an asymmetrical dipole antenna . an asymmetrical dipole antenna 60 is an antenna having a first tab 40 a or first pole , different in shape , including , but not necessarily limited to length , width , volume , and / or density , from the second tab 40 b , or second pole . tabs 40 a , 40 b may also be coupled to a slot to form a slot antenna ( not shown ). alternatively , a single tab 40 may be used as a monopole antenna given the appropriate ground plane ( not shown ). while the present invention is primarily directed to dipole antenna tab structures , it should be appreciated by those in the art that some of the techniques may be equally applicable to a single tab 40 arrangement or an arrangement having more than two tabs 40 a , 40 b . the present invention focuses on techniques to manufacture these wireless communication devices 10 . there are several different aspects to the manufacturing process . the first is properly positioning the wireless communication chip 30 for later processing , and is discussed in the chip positioning section below . the second is the creation of the tabs 40 that form the antenna 60 , addressed in a separate section below . the last is the merging of the chip 30 with the antenna 60 to form the wireless communication device 10 , discussed in the mounting techniques section below . fig2 illustrates an exemplary carrier tape 100 comprising an adhesive sealing layer 102 and a container layer 104 . container layer 104 comprises a plurality of containers or pockets 106 having wireless communication chips 30 disposed therein . carrier tape 100 may be made from any number of materials and is available from a number of manufacturers , such as tek pak . details can be found at www . tekpak . com . adhesive sealing layer 102 initially seals the chips 30 within the containers 106 , protecting them from environmental vagaries . subsequently , when desired , adhesive sealing layer 102 peels off of container layer 104 , leaving the contents of the containers 106 exposed for further processing . there are two specifically - contemplated techniques to remove the chips 30 from the carrier tape 100 for later mounting on the wireless communication device 10 . other techniques are also contemplated to enable the roll - to - roll continuous automation process of the present invention . a first technique is illustrated in fig3 . chip positioning system 110 comprises a waste roller 112 , a first roller 114 , and a second roller 116 . carrier tape 100 is fed to rollers 114 , 116 simultaneously with an adhesive line 118 . waste roller 112 wraps adhesive sealing layer 102 therearound , exposing chips 30 within the containers 106 ( fig1 ). rollers 114 , 116 may be oval shaped and rotate at a frequency so as to space chips 30 appropriately on adhesive line 118 . the proximity of the roller 114 to roller 116 pushes the chip 30 out of the container 106 and to the sticky surface of the adhesive line 118 . this removes the chip 30 from the container 106 and allows the adhesive line 118 with the chips 30 to be passed downstream for further processing . a second technique is illustrated in fig4 and 5 . as illustrated in fig4 , chip positioning system 110 a comprises a waste roller 112 , a toothed roller 120 having teeth 122 and may have an optional second roller ( not shown ) comparable to second roller 116 . carrier tape 100 is fed to the roller 120 with waste roller 112 removing the adhesive sealing layer 102 as previously described . now with reference to fig5 , wherein a more detailed view of the interface between the teeth 122 , the containers 106 , the chips 30 , and the adhesive line 118 is illustrated , it can be seen that a tooth 122 pushes through the floor 105 of the container 106 , pushing chip 30 upwardly to contact the adhesive line 118 . again , this removes the chip 30 from the container 106 and allows the adhesive line 118 with the chips 30 to be passed downstream for further processing . concurrent to the positioning of the chips 30 on the adhesive line 118 , tabs 40 may be created for the wireless communication device 10 . this section focuses on techniques by which the tabs 40 may be created that are again well suited for use in the roll - to - roll automated manufacturing process of the present invention . a first technique for the creation of tabs 40 a , 40 b is illustrated in fig6 and 7 . fig6 illustrates a tab production system 130 comprising a pair of rollers 132 , 134 oppositely positioned on either side of a production line 140 . top roller 132 may comprise a die - cutting roller while bottom roller 134 may be a driving roller to push material though rollers 132 , 134 . it should be appreciated that rollers 132 , 134 may be reversed if production line 140 is inverted . production line 140 may also comprise a backing layer 142 , an adhesive ( not shown explicitly ) and a conductive foil 144 , such as a copper foil , an aluminum foil , or the like . as production line 140 passes through rollers 132 , 134 , die - cutting roller 132 cuts conductive foil 144 into one or more tabs 40 . in this particular embodiment , die - cutting roller 132 cuts conductive foil 144 into two tabs 40 a , 40 b . waste foil 146 is peeled from backing layer 142 while tabs 40 a , 40 b and backing layer 142 continue for further processing . tabs 40 are then used to form antenna elements for antenna 60 on the wireless communication device 10 as explained below . to accommodate substrates 20 that may have varying dielectric constants and / or thicknesses ( such as may occur when switching materials having different dielectric constants forming substrate 20 ), variations may need to be made to the dimensions of tabs 40 a , 40 b to produce the optimum read range at the desired operating frequency . to ensure optimal antenna 60 performance using tabs 40 a , 40 b with chip 30 , energy transfer should be maximized between chip 30 and tabs 40 a , 40 b to maximize emitted radiation from tabs 40 a , 40 b . to ensure maximum energy transfer , the impedance of tabs 40 a , 40 b must be substantially matched to the impedance of chip 30 . further information on impedance matching between wireless communication devices and antennas is described in the previously incorporated u . s . pat . nos . 6 , 501 , 435 and 6 , 975 , 834 , and co - pending u . s . pat . no . 6 , 642 , 897 entitled “ tuning techniques for a slot antenna ,” filed on apr . 18 , 2002 , by the same assignee as that of the present application and incorporated herein by reference in its entirety . a first technique to address this situation is illustrated in fig8 and 9 . in this technique , a plurality of rollers 200 , 202 , 204 is used . in particular , tab production system 130 a receives production line 140 . a first roller 200 makes an initial cut 206 in conductive foil 144 . this initial cut 206 comprises the inner portions of tabs 40 a , 40 b . a second roller 202 makes a second cut 208 in conductive foil 144 that completes the creation of one of tabs 40 a , 40 b ( in this case tab 40 a ). second cut 208 overlaps to a certain extent initial cut 206 of first roller 200 . a third roller 204 makes a third cut 210 in conductive foil 144 that completes the creation of the other one of tabs 40 a , 40 b ( in this case tab 40 b ). third cut 210 overlaps to a certain extent the initial cut 206 of first roller 200 . note that the precise order of the cutting by rollers 200 , 202 , 204 may be varied . for example , a first cut could begin on the left edge , beginning tab 40 a , a second cut ends tab 40 a and begins tab 40 b , and the third cut ends tab 40 b . other variations are also contemplated . the technique of fig8 and 9 allows the sizes of the tabs 40 a , 40 b to be varied by varying the phases of rollers 202 , 204 with respect to first roller 200 . thus , if a longer tab 40 a is desired , second roller 202 is phased such that there is little overlap between the cuts 206 , 208 . if a shorter tab 40 a is desired , second roller 202 is phased such that there is substantial overlap in the cuts 206 , 208 . the same principle applies to the size of tab 40 b , but the phase of third roller 204 is modified to achieve the desired amount of overlap between the cuts 206 , 210 . allowing for differently - sized tabs 40 a , 40 b allows optimal antenna 60 performance as previously explained . it should be appreciated that rollers 200 , 202 , 204 rotate at the same rate to avoid undesired phase changes between rollers 200 , 202 , 204 . this technique is especially well suited for situations in which substrate 20 varies between wireless communication devices 10 . in one embodiment , it is expected that at a 200 ft / min rate of movement of production line 120 and an antenna 60 dimension of approximately 68 mm × 16 mm outside dimensions , thus giving about 60 antennas 60 per foot , approximately 12 , 000 antennas may be made per minute . an alternate technique to provide variations in the size of tabs 40 a , 40 b is illustrated in fig1 - 13b . in this technique , production system 130 b comprises a first roller 300 and a second roller 302 , each of which is independently movable relative to one another . this technique is better suited for situations in which substrate 20 on which wireless communication device 10 is to be placed varies , as this technique allows testing on the fly to get the desired impedance for antenna 60 in conjunction with substrate 20 . rollers 300 , 302 receive a production line 140 a ( illustrated in fig1 a ) comprising a backing material 130 with tabs 40 a , 40 b and chip 30 disposed thereon . in contrast to the other techniques previously discussed , this technique positions , but does not specifically require , chip 30 mounted with the elements that form tabs 40 . production line 140 a passes under first roller 300 and second roller 302 to deposit the tabs 40 and the chip 30 onto the substrate 20 . rollers 300 and 302 may initially be close together as illustrated by dimension ‘ x ’ in fig1 and 11 . during the deposit of tabs 40 a , 40 b on substrate 20 , a low signal level and low frequency radiator 138 , operating at , for example , 125 khz , assesses the capacitance of tabs 40 a , 40 b in conjunction with substrate 20 and with or without ground plane 306 ( fig1 ). this provides an estimate of the thickness and dielectric constant of substrate 20 . tabs 40 a , 40 b may be sized appropriately to provide the desired capacitance by moving the rollers 300 , 302 to insure optimal antenna 60 performance as previously discussed . as illustrated by the difference between fig1 and 12 , rollers 300 , 302 may be spread if larger tabs 40 a , 40 b are required . after the testing equipment determines that the tabs 40 are appropriately sized to give the desired performance to antenna 60 , a cut is made and tabs 40 a , 40 b are mounted on substrate 20 . this cut may be made with a die , a knife , a laser , or other appropriate cutting tools ( none shown ). it may be desirable to test capacitance by changing one and then the other tab 40 a , 40 b as needed or desired . as can be seen in fig1 b , the cut removes tabs 40 a , 40 b and a portion of the backing material 130 to create hole 121 , leaving tab residuals 40 ′, 50 ′. as previously noted , some of the above techniques may be occurring concurrently with the positioning of the chips 30 on the adhesive line 118 . the following section deals with mounting the chips 30 on the wireless communication device 10 after the antenna 60 has been positioned thereon . one technique is illustrated in fig1 . in particular , a hole 22 is punched into substrate 20 . hole 22 is any type of cavity in substrate 20 or any type of geometry such that wireless communication chip 30 may be wholly or partially placed inside such cavity . hole 22 may have tapered top edges 24 that taper from a wide opening 26 to a narrow mouth 28 . the size of narrow mouth 28 may be the same or smaller in size than the width of wireless communication chip 30 , so that wireless communication chip 30 rests in hole 22 at the point where narrow mouth 28 begins . foil tape 42 , 52 overlaps edges 24 so that tape 42 , 52 extends partially into hole 22 . chip 30 is then inserted in the direction of the arrow into the hole 22 . hole 22 may be designed to allow chip 30 to sit flush with upper surface 21 of substrate 20 without substantially protruding therefrom , as is illustrated in fig1 . this reduces the profile of substrate 20 and protects chip 30 from some inadvertent harm . hole 22 may also be designed to allow chip 30 to sit fully below upper surface 21 or to protrude slightly from hole 22 , depending on the design and size of hole 22 , edges 24 , and mouth 28 . a number of techniques exist to attach chip 30 to tabs 40 a , 40 b . a first , technique comprises using a low melting point solder . tape ends 44 , 54 of foil tape 42 , 52 may be pre - loaded with a solder paste . chip 30 is then simply dropped onto the paste ( not shown ), and the solder ( not shown ) is melted to form connectivity between tabs 40 a , 40 b and chip 30 . appropriate methods to form the solder joint comprise the use of infrared radiation to heat the joint locally , or pushing chip 30 into the paste with pins 32 of chip 30 preheated . preheating of pins 32 allows the solder to remain in a liquefied state longer after initial melting so that solder may more easily , flow to more surface area of tabs 40 a , 40 b and around pin 32 to form a stronger bond . such preheating may be accomplished by any technique , including use of a preheating tool that emits heat such as a hot gas jet or the like . an alternative technique for attaching chip 30 to tabs 40 a , 40 b comprises the use of a conductive adhesive ( not shown ). the adhesive forms a bond between tabs 40 a , 40 b and chip 30 , and the conductivity of the adhesive ensures electrical continuity between tabs 40 a , 40 b and chip 30 . either a suitable conductive adhesive can be applied by printing to ends 44 , 54 of tape 42 , 52 prior to assembly , or chip 30 may be pushed onto a pressure sensitive conductive adhesive on top surfaces 46 , 56 of tape 42 , 52 . it may be advantageous , but not required to use an adhesive that can be cured rapidly . for example , an adhesive cured by a flash of ultraviolet ( uv ) light would be appropriate . examples of conductive adhesives include isotropic conductive adhesives , conductive silicones , and anisotropic conductive adhesives . the interested reader is directed to “ electrically conductive adhesives characteristics and applications ,” a loctite corporation publication available at www . loctite . com that is hereby incorporated by reference in its entirety . further information may also be found at the following web site : www . chemical . felpro . com / electronics / elec_tech_index . html # eleccond . yet another alternative is illustrated in fig1 - 17 . in this embodiment , the tape 42 has one end sliced into a plurality of fingers 48 . note that the fingers 48 are made from the same material as the tape 42 , but include cuts 49 between the fingers 48 . the fingers are then placed proximate the hole 22 . a top view of the tape 42 , the fingers 48 , and an exemplary positioning relative to the hole 22 is illustrated in fig1 . with that arrangement in place , it is now possible to mount the chip 30 . chip 30 , and particularly pins 32 thereof , are heated above the yield point of substrate 20 and positioned over substrate 20 ( fig1 ). pins 32 are then forced into substrate 20 with fingers 48 wrapping around pins 32 , as illustrated in fig1 . the heat of pins 32 melts substrate 20 , which then cools around tape 42 and pins 32 , forming an effective mechanical bond . also note that this technique could also be done on the other tab 40 b ( not shown ) in a similar fashion . note that both tabs 40 a , 40 b should be in place prior to this insertion . still another alternative would be to weld or tack pins 32 to tape 42 , 52 using a suitable tool . the tool presses chip 30 into surface 21 of substrate 20 . a high current may be passed through pins 32 , using a low voltage pulse therethrough to form the weld . a lower voltage pulse is desirable so as to not apply a damaging voltage to chip 30 . a modified chip 30 with a single thin foil ( not shown ) rather than multiple pins 32 may also be used for this technique . this technique may be better suited for chips 30 having an aluminum thin foil rather than a copper thin foil , since aluminum has a melting point temperature lower than copper , thereby allowing use of a current that is lower in amperes . with all of these embodiments , a sealing layer ( not shown ) may also be placed onto substrate 20 and over chip 30 to hold chip 30 firmly in its desired location . this sealing layer may be an epoxy , but may instead be a robust plastic such as polyimide , mylar , or polypropylene . these plastics may be attached by adhesives or by thermal welding as needed or desired . it should be noted that extra layers may be added to wireless communication device 10 after or in place of the sealing layer . for example , a paper layer for printing or plastic layers may be added to the structure . such sealing layer or layers may be applied onto substrate 20 using any type of label printing machine . for almost any of the above styled processes , the chip 30 may be positioned on the substrate 20 with rollers as illustrated in fig1 and 19 . chip merging system 160 is illustrated schematically in fig1 and comprises a first and second heat and pressure roller 162 , 164 . these rollers 162 , 164 may perform the thermal welding alluded to above . adhesive line 118 with chips 30 disposed thereon passes between rollers 162 , 164 and mates with substrate 20 , and particularly hole 22 of substrate 20 as better seen in fig1 . tabs 40 have been pre - positioned on substrate 20 prior to the introduction of the chip 30 thereto . chip 30 may be secured to the tabs 40 and the substrate 20 by any of the means previously discussed as needed or desired . the above - mentioned techniques are useful with a number of other manufacturing techniques . of particular interest is the creation of tabs 40 a , 40 b . this may be done before , concurrently with , or after the creation of hole 22 in substrate 20 as needed or desired . the present invention is well suited for “ roll to roll ” processes , making the automation of the present invention easy . as illustrated in fig2 , the chip 30 positioning process may be occurring concurrently with the tab 40 creation process . the tabs are then positioned on the substrate 20 through an appropriate means as is well understood . finally , the two production lines merge and the chip 30 may be positioned on the substrate 20 . furthermore , the automation may test and mark defective parts as needed or desired . the present invention may , of course , be carried out in other specific ways than those herein set forth without departing from the scope and the essential characteristics of the invention . the present embodiments are therefore to be construed in all aspects as illustrative and not restrictive and all changes coming within the meaning and equivalency range of the appended claims are intended to be embraced therein . while illustrative embodiments have been illustrated and described , it will be appreciated that various changes can be made therein without departing from the spirit and scope of the invention .

US-55840609-A

apparatus and methods for fitting mechanical parts to minimize prevent free play are described . additionally , a design for an apparatus having a piston , which restrains the piston before actuation and which allows the piston to gain momentum before striking an object , is detailed . the described apparatus are applicable to devices involving shearable elements . an embodiment of the invention as a pyrotechnically activated valve incorporating such features to minimize free play in conjunction with such features to restrain the piston and also allow the piston to gain momentum is described .

an embodiment of a valve device of the present invention is a pyrovalve , that is , a pyrotechnically activated valve . pyrovalves can be used , for example , in rockets for valves which are activated only once . for example , a pyrovalve can be a normally closed valve mounted in proximity to a main rocket motor . the valve can be installed in a flow path between a pressurized helium tank and the interior of the main motor , for example . during the first phase of flight , the main motor burns to provide propulsion . during this time , the valve remains in the normally closed position , preventing the flow of helium to the motor . when the main rocket motor burns out , the valve is actuated to provide a helium purge to the motor . this brings the motor rapidly to a zero thrust permitting stage separation shortly thereafter . an embodiment of a valve device of the present invention as a pyrovalve is shown in fig1 a , 1b , 2 , 5 , 6 a - 6 f , 7 a - 7 c and 8 a - 8 i , with fig1 a illustrating the pyrovalve in the pyrovalve &# 39 ; s normally closed position prior to activation . referring to fig1 a , 1b , 2 , 5 , 6 a - 6 f , 7 a - 7 c and 8 a - 8 i , in this embodiment , the pyrovalve is designed to be installed connected to a gas source at the right side in the fig1 a , at “ inlet fitting ” i . the inlet fitting i leads to seal tube 2 , which is generally machined from a solid material , such as a precipitation hardened stainless steel , with no outlet , to block the flow of gas through the pyrovalve . at an end of seal tube 2 is a shearable cap 30 , which is an integral part of seal tube 2 , the shearable cap being formed of the material of the seal tube 2 , such as a precipitation hardened stainless steel . groove 40 in seal tube 2 “ necks down ” the seal tube 2 , and is generally formed by machining . this necking down allows the shearable cap 30 to be mechanically sheared when the pyrovalve is actuated , but to withstand the gas pressure of the gas source , such as a helium gas source , prior to shearing . for example , in an actual embodiment of a pyrovalve , the seal tube 2 has been designed to withstand internal gas pressures in excess of 12 , 000 pound per square inch , but shearable cap 30 shears off at a ballistic pressure in the vicinity of 4 , 000 pounds per square inch to open the flow path f when required . after actuation , the gas , such as helium , will flow from right to left toward the “ outlet fitting ” o in the pyrovalve . continuing with reference to fig1 a , 1b , 2 , 5 , 6 a - 6 f , 7 a - 7 c and 8 a - 8 i , within housing 1 of the pyrovalve is , piston 3 being formed of a precipitation hardened stainless steel , for example . piston 3 is also shown in greater detail in fig8 a - 8 i . the piston 3 can be cylindrical in shape . piston 3 can be seen in fig1 a and 2 to have an upper flowpath 45 , which becomes the gas flowpath f after activation of the pyrovalve . piston 3 also has lower portion 3 a which has a hollow region surrounding shearable cap 30 . the hollow region is shaped to provide a gap 37 above shearable cap 30 , and a portion of the piston 3 between flowpath 45 and the hollow region forming as overhang or hammer region 35 , since overhang 35 appears to overhang the shearable cap 30 as seen in fig1 a and 2 . referring again to fig1 a , 1b , 2 , 5 , 6 a - 6 f , 7 a - 7 c and 8 a - 8 i , mounted in the end of seal tube 2 and extending away from the seal tube is a shear pin 5 , shear pin 5 being formed of any suitable fracturable material , such as aluminum , for example . shear pin 5 is installed in the bore 18 a of sleeve 18 . the outside of sleeve 18 is cylindrical in shape , and sleeve 18 has a cylindrical bore 18 a which is parallel to but not coaxial with the outside of the sleeve 18 . thus , sleeve 18 has an eccentric bore 18 a . sleeve 18 is shown in greater detail in fig7 a - 7 c . the outside of sleeve 18 is mounted in a bore 3 b in piston 3 . set screws 20 pass through a portion of the piston 3 and contact the outside of sleeve 18 . also , the axis z 1 of the seal tube 2 is desirably positioned perpendicular to the axis z 2 of the bore 1 a of the housing 1 , as illustrated in fig1 a , for example . also shown in fig1 a and 2 are o - rings 7 , seal 19 and ball bearing or ball member 21 and lock plug 4 . also shown is faraday cap 15 , present before installation to prevent accidental discharge of the initiators 16 . in order to activate the pyrovalve , a sufficient amount of electric current is applied to one or both of electrical initiators 16 . these pyrotechnic initiators produce hot pressurized gas , which are the products of combustion of the pyrotechnic materials contained within them , in the cavity c over piston 3 . gas within this cavity c is sealed by o - rings 7 . the pressure , acting over the area of the piston 3 , produces a force to drive the piston 3 downward as shown in the figures , such as fig1 a and 1b . the motion of the piston 3 is resisted by the shear pin 5 , which is held in place by seal tube 2 , a portion of the shear pin 5 being held snugly in the seal tube 2 , such as by being press fit into the seal tube 2 . the shear pin 5 is designed to shear across the plane where shearable cap 30 at the left side of seal tube 2 mates with piston 3 . in this particular design , the force to shear the shear pin 5 is nominally around 1 , 600 pounds . the shear pin 5 is designed to shear off at a lower force than is necessary for the shearing of shearable cap 30 from seal tube 2 . for example , in this particular design , the shearable cap 30 requires a shear force of approximately 4 , 000 pounds to shear . when the force produced by the gas is sufficient , shear pin 5 shears and piston 3 begins to travel downward in the direction of arrow d of fig1 b . since the shear pin 5 is designed to shear more easily than the shearable cap 30 , the shear pin 5 shears off before shearable cap 30 at the end of the seal tube 2 . that is , piston 3 begins to move before the flow path f opens . after shear pin 5 shears , the piston 3 accelerates downward in the direction of arrow d , building up kinetic energy until overhang or hammer region 35 in the piston 3 strikes the shearable cap 30 , the shearable cap 30 designed to be sheared off from the seal tube 2 . for example , in the specific example shown , the piston 3 travels approximately ¼ inch before striking the shearable cap 30 . at this point , the kinetic energy of the moving piston 3 is well in excess of the energy required to shear off the end of the seal tube 2 . during the portion of the stroke that the piston 3 is shearing off the shearable cap 30 , the piston 3 will generally temporarily slow down . piston kinetic energy is partially depleted and used as shear energy . the piston 3 then accelerates as a result of the expanding ballistic gas still acting on the piston 3 . at the end of the piston stroke a skirt 50 which is machined into the piston 3 flares out into a conical cavity 51 formed by the space between the lock plug 4 and housing 1 , the lock plug 4 and housing 1 being made of precipitation hardened stainless steel , for example . the lock provided by the skirt 50 flaring out into the conical cavity 51 both holds the piston 3 permanently in the final position p and gently slows the piston 3 , minimizing shock . in the final position p . illustrated in fig1 b , the final lock is engaged and the skirt 50 of piston 3 is in a flared position in over the lock plug 4 . also , in the final position p , the shearable cap 30 of the seal tube 2 and the portion of shear pin 5 in the shearable cap 30 are restrained in a portion of the cavity 51 of fig1 a at or near position s illustrated in fig1 b . when actuated , as shown in fig1 b , shear pin 5 can be seen to be broken into pieces 5 a and 5 b as illustrated in fig1 b . piece 5 b is retained in shearable cap 30 , which has been sheared from seal tube 2 . a valve such as that shown in fig1 a and 1b is typically required to survive a very high - level level shock and random vibration environments , such as during the period of time between launch and the actuation of the valve . these environments can be particularly brutal on internal components that have any “ free play ”. this free play can allow impact loads on internal components that rapidly cause damage . the valve of the present invention , such as the valve device of fig1 a and 1b , incorporates a design to minimize such free play , which is described more generally in fig3 a and 3b . referring now to fig3 a and 3b . in fig3 a , an embodiment of a device of the present invention such as can be used in a valve device , to minimize free play is shown having part 303 and part 310 , where parts 303 and 310 are to be connected so as to avoid free play in the directions shown in double headed arrow 320 . part 303 has a cylindrical bore 303 a in which sleeve 318 is fitted . sleeve 318 has a cylindrical outer surface which fits snugly into the bore 303 a in part 303 . sleeve 318 also has a cylindrical bore 318 a which is parallel to , but not coaxial with , the outer cylindrical axis of sleeve 318 . that is , sleeve 318 has an eccentric bore 318 a . pin 305 , such as a shear pin or any shearable feature of part 310 310 , extends from part 310 . pin 305 is cylindrical and fits snugly into the bore of sleeve 318 . in using the device of the present invention of fig3 a and 3b , sleeve 318 is rotated within the bore 303 a in part 303 . as seen in fig3 b , since sleeve 318 is eccentric , rotation of sleeve 318 would cause the bore 318 a in sleeve 318 to rotate around the axis a of the bore 303 a in part 303 , and this allows for negligible variation in the position of pin 305 in the direction of arrow 320 , but sufficient variation in the lateral direction l , as indicated by the double - headed arrow l in fig3 b , to allow assembly of parts manufactured to reasonably large tolerances . the device of fig3 a and 3b can also include a securing means , such as a set screw 320 . after pin 305 is inserted into sleeve 318 , set screw 320 would be tightened to lock and possibly deform sleeve 318 , thus locking the position of pin 305 with no or minimal free play . this general design of a device for minimizing free play of fig3 a and 3b is incorporated into the pyrotechnic valve shown in fig1 a and 1b . in the pyrotechnic valve of fig1 a and 1b , the piston 3 has to be contained due to the vibration of the environment during use . free play of 0 . 010 to 0 . 020 inches , for example , would lead to impact loads which would destroy the shear pin . thus , in the design of a device for minimizing free play incorporated and shown in fig1 a , one end of shear pin 5 is press fit into shearable cap 30 of seal tube 2 . also , the pin 305 can be integrally formed as a part of part 310 , as illustrated in fig3 a , for example . sleeve 18 is incorporated to slip fit into bore 3 a of piston 3 . the eccentric design of sleeve 18 allows alignment of shear pin 5 into sleeve 18 by rotation of the sleeve 18 , thereby avoiding or minimizing free play in the connection of shear pin 5 to piston 3 , thereby reducing any free play such as to only approximately 0 . 001 to 0 . 002 inches , for example . set screws 20 in conjunction with ball bearing 21 or ball member as the securing means further lock and deform sleeve 18 and further prevent or further minimize any free play . the valve shown in fig1 a and 1b also incorporates a design which allows the piston 3 to gather momentum before striking the shearable cap 30 , as can be used in conjunction with the sleeve 318 of fig3 a and 3b , as described above . a type of this design is described more generally with reference to a general embodiment of the present invention shown in fig4 a and 4b . referring to fig4 a and 4b , in fig4 a , a device is shown including mount 410 and piston 403 . mount 410 can be a cylinder in which piston 403 rides , or can more generally be any part providing a guide surface for the downward motion of the piston 403 . likewise , piston 403 may be a cylindrical piston , or can be of any of a variety of shapes which can travel downward in the direction of the arrows indicating a propelling force 460 as shown in the fig4 a and 4b . piston 403 is mounted to mount 410 by shear pin 405 , which is inserted in holes or apertures 410 a and 403 a respectively in mount 410 and piston 403 . continuing with reference to fig4 a and 4b , the lower part of piston 403 has hammer surface or hammer region 435 which is designed to deliver a blow to strikable part or shearable element 430 when the piston 403 moves . here , part 430 can be any part to be struck . there is a gap 470 between the hammer surface 435 of the piston 403 and the shearable element 435 . in the particular embodiment illustrated in fig4 a and 4b , strikable part 430 or shearable element 430 is attached to a stationary part 440 . as illustrated in fig4 a and 4b , stationary part 440 is mounted to mount 410 , but stationary part 440 could be mounted to anything stationary relative to the piston 403 . also , as shown in fig4 a , piston 403 can have a ledge 445 which is not aligned with hammer surface 435 . in operation , a propelling force 460 indicated by the arrows in fig4 a and 4b is applied to the top of piston 403 . this propelling force can be gas pressure , pneumatic pressure , an electric or mechanical force , etc . when the force reaches a certain value , shear pin 405 which can be spaced from the shearable element 430 in the direction of travel or motion of the piston 403 , as illustrated in fig4 a , shears and the piston 403 moves downward in the direction of the arrows 460 indicating the propelling force in fig4 a and 4b . alternatively , when the mount corresponds to a seal tube , such as seal tube 2 of fig1 a and 1b , the pin 405 can be press fit into the shearable cap 30 of the seal tube 2 , as described previously with respect to fig1 a and 1b . piston 403 moves through gap 470 before hitting the strikable part of shearable element 430 ; and thus , piston 403 is able to gather momentum before the impact with the strikable part or shearable element 430 . when used as a valve device , such as illustrated in fig1 a and 1b , the shearing of the shearable element 430 would typically create a flow path g formed integrally as a passage in the piston 403 , the location of the flow path g being indicated in fig4 b . in the particular embodiment shown of fig4 a and 4b , the strikable part or shearable element 430 shears off of stationary part 440 upon impact at a shearable link 430 a connecting the strikable part or shearable element 430 and the stationary part 440 . due to the ledge 445 , the stationary part 440 is not hit by the piston 403 when shearable element 430 is impacted by the piston 403 . stationary part 440 can thus serve as a detent for stopping the downward motion of the piston 403 . in such a case , the total stroke of the piston 403 is given by gap 450 illustrated in fig4 a . in general , there will be some sort of a detent for stopping the piston after it has hit the object to be worked . although shown in fig4 a and 4b for a shearable object , the device of the present invention illustrated in fig4 a and 4b is applicable to any object to be struck . for example , hammer surface or hammer region 435 could be striking a rivet or nail , punching a hole , making an impression , etc ., for example . in the pyrovalve embodiment shown in fig1 a and 1b , however , piston 3 is mounted through shear pin 5 to shearable cap 30 which is part of seal tube 2 , which is held in place by the housing 1 and the shear pin 5 is not initially spaced from the shearable cap 30 in the direction of travel or motion of the piston 3 . upon activation , the piston 3 moves downward , and overhang 35 moves through gap 37 before striking shearable cap 30 . in the invention as shown in fig1 a and 1b , the interaction of skirt 50 with the conical cavity formed by the space between the lock plug 4 and housing 1 serves as the detent . in the pyrovalve of the invention , the piston design , incorporating the sleeve design to minimize free play , allows the piston to gain momentum before striking the shearable cap . one result of this design is that less of the pyrotechnic explosive is required to shear the cap than in a comparable design with no shear pin in which the piston initially contacts the shearable cap . while there have been illustrated and described what are considered to be preferred embodiments of the present invention , it will be understood by those skilled in the art that various changes and modifications may be made , and equivalents may be substituted for elements thereof without departing from the true scope of the present invention . in addition , many modifications may be made to adapt a particular situation to the teaching of the present invention without departing from the scope thereof . therefore , it is intended that the present invention not be limited to the particular embodiments disclosed as the best mode contemplated for carrying out the present invention , but that the present invention includes all embodiments falling within the scope of the appended claims .

US-4493402-A

a method of dicing a printhead wafer containing a plurality of individual print elements into discreet elements . a back side relief feature is formed on the bottom front edge of a thermal ink jet print element from a heater side during a first dicing cut , followed by a second dicing cut from a channel side of the wafer to form a front face nozzle . the back cut feature enables front face maintenance by a wiper blade or other maintenance operation , provides a pocket for excess die bonding adhesive during manufacture , and reduces front face chipping during dicing caused by the saw blade contacting the die wafer mounting media and becoming contaminated . the relief feature may be a square step feature or a beveled back cut feature and may additionally be located on a top front edge of the print element .

ink jet printheads 5 are composed of two parts , a heater plate 10 and a channel plate 20 , aligned and bonded together . the heater plate 10 is a substantially flat substrate which contains on the surface thereof a linear array of heating elements and addressing electrodes . the channel plate is a substrate having at least one recess anisotropically etched therein to serve as an ink supply manifold when the two parts are bonded together . a linear array of parallel grooves are also formed in the channel plate 20 . one end of the grooves communicates with the manifold recess and the other end of the grooves is open for use as ink droplet expelling nozzles . many printheads are formed by producing a plurality of sets of heating element arrays with their addressing electrodes on an electrically insulative planar substrate such as a silicon wafer and by placing alignment marks thereon at predetermined locations . a corresponding plurality of sets of channel grooves and associated manifolds are produced in a second silicon wafer . alignment openings are etched in the second silicon wafer at predetermined locations . the two wafers are aligned via the alignment openings and alignment marks , then bonded together and diced into many separate printheads . the fabrication of the two wafers 30 , 40 to form and bond the channel plates 20 and heater plates 10 into a composite printhead wafer 100 is conventional . an exemplary method of forming the wafers can be found in u . s . pat . no . re . 32 , 572 , assigned to the same assignee as the invention , and incorporated herein in its entirety . once channel wafer 40 and heater wafer 30 are formed , alignment openings are used with a vacuum chuck mask aligner to align the channel wafer via alignment marks on the heater wafer . the two wafers are accurately mated and tacked together by partial curing of the adhesive . the grooves forming ink nozzles are automatically positioned so that each one has a heating element therein located a predetermined distance from the nozzles or orifices . the two wafers are cured in an oven or a laminator to permanently bond them together . the composite wafer 100 as shown in fig1 is then diced to produce a plurality of individual printheads 5 which are bonded to a heat sink substrate 130 that forms part of a daughter board of the ink jet printer ( fig8 ). the invention is concerned with the dicing operations of the bonded channel and heater plate wafers which form a front nozzle face and dice the wafer into discreet print elements . once the bonded composite wafer 100 has cured , dicing tape 50 is first applied to the channel side 20 of the wafer ( fig2 ). the dicing tape 50 can be any of many thin film tapes having adhesive on one side thereof . preferably , the tape 50 has an adhesive thickness of 5 microns or less . a thickness much greater than 5 microns prevents accuracy in firmly holding the wafer 100 during dicing cuts . a suitable dicing tape is nitto tape , part number 18074 which has a medium tac and is available from semiconductor equipment corp . in moorpark , calif . a more preferred tape is furakawa uv release tape available from furakawa electric co ., ltd . this tape is preferred for its better release properties , e . g . it does not leave any residue upon release from the wafer surface . this is preferred since in this step the tape covers the important channel side of the wafer . reference cuts are made , with wafer 100 mounted on tape 50 , to heater side 10 prior to back cutting . the reference cuts are made relative to fiducial alignment markings on the wafer . preferably , two reference cuts are made at 90 ° to one another . only the back cut dicing cuts are precisely aligned relative to the reference cuts . while the reference cuts provide a simple , low cost method of aligning the subsequent back cut , they are not required . alternatively , the dicing cuts can be made using an infrared aligner ( not shown ), without the need for the reference cuts . this reduces manufacturing steps , but requires the infrared aligner . the infrared aligner can be part of the dicing blade and may comprise an ir illuminator and an ir sensor . once reference cuts have been made , or if an infrared aligner is used , the fabrication process forms the front face of individual print elements and separates the bonded wafer into a plurality of discreet print element dies . the composite printhead wafer 100 is unmounted and a first dicing back cut is performed from the heater side 10 of the wafer 100 , with the channel side down , to produce a back cut relief feature 60 on what will become part 70 of the front face of individual print elements 5 ( fig2 ). the relief feature is formed using a rotating dicing blade 80 . while a standard metal or a resin blade can be used to form the back cut , it has been found that use of a metal blade having 60 ° chamfered sides ( both sides ) results in a dicing operation with the least amount of chipping or cracking ( fig4 ). the metal blade is also preferred because of its extremely longer useful life than a resin blade . a metal blade can cut upwards of 1000 wafers , while a typical resin blade can only cut about 10 wafers before it becomes dull or contaminated and starts causing chipping , cracking or burrs . use of a metal blade with straight edges , i . e ., non - chamfered , causes more surface defects than an equivalent resin blade , and both retain sharp edges between the front nozzle face and the back cut , so it would be the least preferred for the first dicing cut . the first dice cut extends only partially through the heater plate 10 and does not extend into the channel plate 20 . the first dice cut is precisely aligned relative to the earlier formed reference cuts or by an infrared aligner and is located directly under channel plate ink channels . this first cut can be performed while the wafer 100 is unmounted ( attached solely to tape 50 ) or can be remounted prior to cutting . the back cut relief feature 60 includes front face portion 70 which is offset from a later formed front nozzle face 90 such that the later formed front nozzle face 90 is a frontmost face of the print element 5 . preferably , the other three sides of the heater plate 10 are also cut to provide a back - cut on all sides . since the back cut dicing operation is performed prior to forming of the front nozzle face 90 , the quality of the cut is not as crucial as if the back cut were performed after forming of the front face 90 . however , providing a good , clean cut minimizes cracks or chips which , if severe enough , could result in a front nozzle face which is not completely planar or defect free . the back cut may consist of a vertical cut as shown in fig2 - 3 performed with a blade having straight edges , which provides a back cut relief feature 60 having a face part 70 that is substantially parallel to the later formed front nozzle face 90 , but offset towards the wafer a predetermined distance . however , in a preferred embodiment , the back cut is made at an angle to the vertical ( fig4 ). this is done using a blade 80 which is mounted normal to the wafer , but the blade has chamfered edges to provide an angled cut . as previously described , a preferred blade has 60 ° chamfered edges and provides an angled face portion 70 which is angled about 60 ° to the horizontal , i . e ., from the bottom of the wafer . however , other angles are contemplated , e . g ., 30 ° or 45 °, and can work very well . by changing the depth of the cut and the angle , one can provide a predetermined recess distance in from the front face which can accommodate excess bonding epoxy . with reference to fig3 after the first dicing cut , the printhead wafer 100 is removed from the mount , if mounted . the dicing tape 50 is removed from the channel side 20 and a new layer of release tape 50 is placed on the heater side 10 . since the heater side is less critical and residual adhesive does not adversely affect the print element , a lesser quality , and less - expensive tape such as nitto tape may be utilized . the printhead wafer 100 is then mounted with the channel side 20 facing up to prepare for a second dicing cut which forms a front nozzle face 90 . optionally , the top edges ( or sides ) of the channel plate 20 , including a top edge of what will become the front nozzle face , may have back cut features cut thereon similar to those previously described . this would eliminate any sharp edge at the top of the front nozzle face . the optional back cuts may be cut before or after cutting of the front nozzle face 90 . the second dicing cut is performed from the channel side 20 of the wafer 100 . the second dicing cut forms the front nozzle face 90 of the print element 5 dicing perpendicularly across the channel grooves to form an end thereof . the second cut cuts completely through the channel plate 20 and only partially through the heater plate 10 . the cutting depth through the heater plate 10 is a distance which at least slightly overlaps with the back cut from the first dicing cut to completely sever the front of an individual print element 5 of the wafer 100 and provide a highly planar front nozzle face surface 90 . the second dicing cut should not completely extend through the heater plate 10 since contact with the dicing tape 50 would load up the blade and cause excessive wear and chipping problems . preferably , the second dicing cut is made with a resin blade . this type of blade is well known in the art of semiconductor dicing and can provide a very high quality front face surface 90 which does not need further processing , such as polishing . the rotational speeds and the feed rate of the dicing blades will vary depending on the specific material being cut and the specific material of the blade used . however , preferred variables and blades are taught in u . s . pat . no . 4 , 878 , 992 , assigned to the same assignee as this invention , and incorporated herein in its entirety . after the complete front face ( front face portion 70 and front nozzle face 90 ) is formed , a section cut is made , perpendicular to the first and second dicing cuts , to separate the wafer 100 into discreet individual print elements 5 . once separated , a final window cut can be made on the back end of the channel plate to expose wire bond pads . see fig6 - 7 . once individual print elements 5 are separated , they are fixedly mounted on a heat sink substrate 130 of a printer daughterboard ( fig8 - 9 ). to accomplish this , a thin layer , preferably 0 . 75 - 1 mil thick , of a bonding adhesive such as screen - printed silver - filled epoxy 150 is placed on top of a receiving portion of substrate 130 . the epoxy layer is sized to have dimensions approximately the same as the bottom of element 5 to provide solid mounting . the print element is then firmly placed on the epoxy and bonded . any excess adhesive slightly flows around edges of element 5 . however , due to the back cut relief feature 60 , any excess will not flow past front nozzle face 90 . this prevents any excess epoxy from extending beyond front face 90 , allowing for more reliable wiping as shown in fig9 . the exact size of feature 60 will vary depending on the thickness and flow characteristics of the bonding agent used to accommodate the excess . there are many advantages associated with the above method . by having a front nozzle face which does not include a stepped portion 120 ( such as in fig5 ) which extends forward of the nozzle face 90 , a wiping operation is able to be performed directly on the front nozzle face 90 itself ( fig9 ). also , of primary importance is the high quality of the front face surface which results from the above method which eliminates sharp edges and provides a feature for containing excess bonding adhesive . of equal importance is the reduced fabrication steps and manufacturing costs necessary when utilizing the present method to dice a wafer containing a plurality of print elements into discreet individual printhead die . the methods according to the invention overcome the disadvantages with the prior art and result in a more precise and well - defined front nozzle face which has good ink jet directionality and a planar front face surface which can easily and reliably be cleaned by a movable wiping blade 140 ( fig9 ). the invention has been described with reference to the preferred embodiments thereof , which are illustrative and not limiting . various changes may be made without departing from the spirit and scope of the invention as defined in the appended claims .

US-5589693-A

a rotary selection valve is disclosed having a stator and a rotor having complementary abutting fluid tight surfaces for relative rotation between the stator and the rotor about a rotational axis . the stator or rotor has at least one connection port in fluid communication with an associated orifice at said stator or rotor abutment surfaces . the stator and / or rotor further comprise a separate fluid recess extending radially beyond said associated orifice or orifices and open to the complementary abutment surfaces for improving the automatic cleaning of the valve .

referring to fig1 , a rotary valve 1 is illustrated showing the main parts . the valve 1 includes a housing 10 , a stator 20 , a rotor 40 and a drive dog 60 , for connection to a stepper motor or other rotary drive ( not shown ). the drive will in practice include a means ( not shown ) for recognizing the angular position of the rotor . manual operation of the valve is possible also . the rotor 40 is rotatable with respect to the stator 20 about a rotary axis ra of the valve , as a result of the rotary motion of the drive dog 60 . the stator 20 , is fixed with respect to the housing 10 and is provided with ports . ports 22 , 26 and 28 are visible in fig1 but more than three ports will generally be provided . the ports allow selective fluid communication between a source and any components with which the valve is to co - operate . the ports may be situated on any suitable position on the exterior surface of the stator . the ports are provided with means to connect capillaries or tubing , in this case , threaded recesses 23 , 25 and 29 . other connections are known in the art . via fluid communication channels , the ports 22 , 26 and 28 are in fluid communication with a corresponding set of orifices 21 , 24 and 27 on the end face 30 of the stator 20 , i . e . the surface of the stator 20 that during operation abuts with the rotor 40 . the rotor 40 is typically formed as a disc and has a rotor end face 50 , i . e . the surface pressed against the inner stator face 30 during operation . the faces 30 and 50 are complementary such that they provide generally fluid tight abutment . most conveniently these faces are flat , but other complementary shapes are possible , for example they may be matched part - spherical or conical shapes . the inner rotor face 30 too is provided with a fluid communication channel , in the form of a groove 32 in the end face 30 . in use the rotor 40 can be rotated about axis ra such that the orifice 21 which remains always in communication with the groove 32 , is selectively caused to communicate with either orifice 24 or orifice 27 , or , in practice other circumferentially arranged orifices not shown . thus various stator outlet ports can be made to communicate selectively with the central inlet port 22 . in fig1 , fluid flow is in the direction of arrows ff in use . the foregoing detailed description is generally conventional . however , the valve shown in fig1 includes a novel feature of a generally annular recess 34 which extends generally around the orifices 21 , 24 and 27 in the abutment face 30 of the stator 20 . this recess provides a space for leaking fluid to collect and is described in more detail below . the groove is generally separate to the orifices 21 , 24 , and 27 shown , i . e . there is no substantial fluid communication between the groove 32 and the cooperating orifices in the stator 20 . fig2 and 3 show respectively the end face 30 of the stator 20 , as viewed in the direction of arrow a in fig1 ; and the end face 50 of rotor 40 , as viewed in the direction of arrow b . further orifices in addition to those shown in fig1 form a circular array , and are in selective fluid communication with the central orifice 21 via groove 32 , in the manner described above . the recess 34 is visible , formed as an annulus and having an inlet 36 and an outlet 38 each in fluid communication with a connection port ( not shown ) of the stator 20 . in use the recess 34 will contain a flushing or cleansing fluid which is constantly or periodically changed , to keep the valve clean . the cleansing fluid can have a reduced pressure compared to the working pressure at the orifices , 21 , 24 or 27 so any leakage is more likely to flow toward the recess 34 , away from the orifices . fig4 and 5 shown alternative stator ( 120 ) and rotor ( 140 ) arrangements . the end faces of the stator and rotor are again shown , but it will be noted that a cleansing recess 134 extends not only radially outwardly of the generally circular array of twelve orifices ( only two of which are referenced as 124 and 127 ), but also between these orifices also . the recess 134 has an outlet 138 , and an inlet 121 , which inlet is shared with the supply inlet for the twelve orifices . a groove 132 in the rotor 140 supplies both the orifices and the recess , and can be stopped during rotation at the appropriate position . as the groove 132 rotates , it will be cleaned between contact with each neighbouring orifice . additional further optional grooves 133 formed in the end face 150 of the rotor 140 can be used to interconnect different orifices and thereby to enhance the functionality of the valve . fig6 , 7 and 8 show variations of respective stators 220 , 320 , and 420 . in each case they are intended to cooperate with the rotor 40 or 140 as the same as shown in fig3 or 5 , or a similar rotor . the stator 220 shown in fig6 has a cleansing recess 234 which encroaches radially into the pitch circle of the orifices described above only between adjacent pairs of orifices 235 only one pair being references . this reduces the number of times which the corresponding groove 32 or 132 is cleansed during operation . this is beneficial where cleaning need not be done between every adjacent stator orifice . the recess 334 shown in fig7 has a generally constant width , which promotes linear flow characteristics , in turn providing fewer ‘ dead ’ spaces where the cleansing fluid stagnates . this improves the cleansing action of fluid flowing in the recess 234 . the recess 334 has an outlet 338 and relies on the central orifice 221 for inflow of fluid . the recess 434 shown in fig8 is a similar shape to the recess 334 described above and has the same advantages . in this variant , the recess 434 has an inlet 437 and an outlet 438 to maintain flow in the recess . in this case fluid in the corresponding channel 32 or 132 in the rotor , remains while the rotor rotates , but the radially outer end of the channel is effectively wiped clean as it moves over the portions of the recess which encroach into the travel circumscribed by the channel 32 or 132 . the rotor and stator parts mentioned above are intended to be manufactured from machined or moulded plastics , such as polyetheretherketone ( peek ), with or without fibre reinforcement , and preferably filled with carbon to reduce friction at their abutting sliding surfaces . whilst one embodiment and variants have been described and illustrated , it will be apparent to the skilled addressee that other additions , modifications or omissions are possible , within the scope of the claims . for example , the recesses 34 , 134 , 234 , 334 and 434 each generally circumscribe the respective orifices in the stator , but their shape could vary and a generally annular recess or the annular shape with radially inwardly directed projections , is not essential . the recess could additionally or alternatively be formed in the rotors described above . also , while the stator has been described as having plural ports , and the rotor as having fewer ports , it is possible that the rotor may have plural inlet ports and the stator may have fewer ports . in that case , flexible hoses will be connected to the rotor inlet ports . embodiments of the rotary selection valve described above provide for better cleaning or sanitisation of the valve , because bacteria or other microorganisms cannot pass radially beyond the fluid recesses described above . the valve can be cleaned by automated means and need not be dismantled so frequently .

US-201314396610-A

a location - aware product includes a location information resource for providing the present location of the location - aware product to within some margin of error , and such present location information is included by the location - aware product in various outputs , including but not limited to , location stamps in files for create , open , and / or modify file operations . in a further aspect , location information may be used in determining the time zone or zones in which one or more operations have occurred , and to provide the basis for updating clocks , or other resources , useful for time stamping of various operations and outputs . in a still further aspect of the present invention , information displays may be sorted by accounting for the differences in times and dates introduced through time stamping of events in different time zones .

generally , various embodiments of the present invention may obtain location information from a location information resource , such as but not limited to , a gps receiver and processing circuitry , incorporate that location information into one or more files , such as , but not limited , to text files , email files , word processing files , and so on ; or 2 ) subsequently provide such stored location information to a display , such as , but not limited to , a directory listing of files that includes the location of creation or modification of the file , in addition to , or in place of , other file parameters such as , for example , file size , file type , or time of creation or modification of the file . reference herein to “ one embodiment ”, “ an embodiment ”, or similar formulations , means that a particular feature , structure , or characteristic described in connection with the embodiment , is included in at least one embodiment of the present invention . thus , the appearances of such phrases or formulations herein are not necessarily all referring to the same embodiment . furthermore , various particular features , structures , or characteristics may be combined in any suitable manner in one or more embodiments . fig1 is a block diagram representation of a computer equipped with an exemplary module that provides location information to the computer in accordance with the present invention . more particularly , a central processing unit ( cpu ) 102 is shown coupled to a bus 104 . similarly , a memory 106 , peripherals 108 , 110 , and a location - aware module 112 are included in the computer and are also coupled to bus 104 . it should be noted that various other computer or digital system architectures may be used in accordance with the present invention . for example , some computer systems use a different bus to couple system memory to the cpu , than is used to couple peripheral devices to the cpu , and such systems may be used in embodiments of the present invention . in the illustrated embodiment , location - aware module 112 includes a gps receiver and processing circuitry to convert the received gps signals into location coordinates , such as , but not limited to , latitude and longitude . an antenna suitable for receiving gps signals is typically included within location - aware module 112 , but such antenna may be spaced apart from location - aware module 112 . if the antenna is spaced apart from location - aware module 112 , then the antenna is appropriately coupled to module 112 . although fig1 represents a computer equipped with a location resource , it will be understood , that this functionality may be included in a wide variety of electronic products , including consumer products , that include some computational capability , such as , but not limited to , cellular phones , personal digital assistants ( pda ), electronic games , and so on . it will be further understood , that the utility of the present invention is greatest in mobile devices ( e . g ., laptop computer cellular phones , personal digital assistants ( pda ), and electronic games ) but the invention is not limited to devices that are typically mobile . fig2 is a flowchart of an illustrative process in accordance with the present invention that includes ( i . e ., inserts or incorporates ) location information into a file in connection with a file open operation . more particularly , in this embodiment , a file is opened 202 . file open operations are common in computer systems and are well understood . such a file open operation is commonly initiated by a computer user by , for example , double - clicking on an iconic representation of the file in a graphical user interface . it is known that there are other means of opening files , including the opening of files by an operating system without the need for specific user action . files opened in this way include , but are not limited to , text files , word processing files , spreadsheet files , database files , sound files , graphics files , video files , and so on . subsequent to , or concurrent with , the opening of the file , location information is read 204 from a location information resource , such as the location - aware module 112 of fig1 . it is within the scope of the present invention to read the location information prior to the file opening , however , this may result in location information that is not contemporary with the actual location of the computer at the time that the file is open . subsequent to reading the location information , at least a portion of the location information is written into the file 206 . all the information obtained from the location resource may be written to the file , but depending on the particular implementation , the location resource may provide other information that does not need to be included in the file , such as information on altitude , time of day , speed , and so on . it is a designer &# 39 ; s choice as to how much location and location - related data obtained from the location resource to include in the file . in a presently preferred embodiment , latitude and longitude information are stored in the file . in this way , a translation from latitude / longitude information , to geographical place name can be performed when the file is read . in this way , another aspect of the present invention is supported . that is , providing the geographical place name in the language of the present location . in other words , if a file on a laptop computer is opened in the united states , and the latitude / longitude information are included in the file , then on subsequent accesses of the file , it may be determined where that file open operation took place , and that location displayed in english if the laptop is still in the united states , but however , it may be displayed in french if the current location of the laptop is somewhere in france . of course , other implementations of the present invention may elect to perform a latitude / longitude to geographical place name translation at the time of originally reading the latitude / longitude information , and incorporating the text of the geographical place name into the file . the location information is read from the location information resource is indicative of the physical location of the computer . the location information may be in any suitable format , and such formats include , but are not limited to , latitude / longitude , and geographical location name . it will be understood that although a computer is used in this example , other the present invention applies to other electronic devices , such as for example mobile consumer electronic devices , as well . it should be noted that reading location information from location - aware module 112 is similar to reading information from any commonly available type of computer peripheral device . for example , one or more fixed addresses in a memory , or i / o space , of a computer may be read and the resulting data represents the location information . in an alternative embodiment , a command is written to location - aware module 112 and as a consequence , location information is transferred by location - aware module 112 to some pre - determined address . those skilled in the art will appreciate that communication between a cpu and peripheral device in a computer system is a well - understood matter . fig3 is a flowchart of an illustrative process in accordance with the present invention that includes ( i . e ., inserts or incorporates ) location information into a file in connection with a both a file open ( as shown in fig2 ) and a file modify operation . more particularly , in this embodiment , a file is opened 302 . subsequent to , or concurrent with , the opening of the file , location information is read 304 from a location information resource , such as location - aware module 112 of fig1 . subsequent to reading the location information , at least a portion of the location information is written 306 into the file . the location information read from the location information resource is indicative of the physical location of the computer . the location information may be in any suitable format , and such formats include , but are not limited to , latitude / longitude , and geographical location name . in this embodiment of the present invention , the file that was opened at 302 is now modified 308 . subsequent to , or concurrent with , the modification of the file , location information is read 310 from the location information resource . subsequent to reading the location information , at least a portion of the location information is written 312 into the file . in this example , the incorporated location information is appropriately labelled as being associated with the file open operation or with the file modify operation . the computer system may include a history of location information associated with each open or modify operation , or only the most recent open or modify operation , or a combination . these implementation specific options can be chosen by the system designer , or can be made a user definable option in the computer system , similar to the user selecting a preferred screensaver , or desktop color . fig4 is a flowchart of an illustrative process in accordance with the present invention that includes ( i . e ., inserts or incorporates ) location information into a file in connection with a file modify operation . more particularly , in this embodiment , a file is opened 402 . subsequent to the opening of the file , the file is modified 404 . location information is read 406 from a location information resource , such as location - aware module 112 of fig1 . subsequent to reading the location information , at least a portion of the location information is written 408 into the file . the location information read from the location information resource is indicative of the physical location of the computer . the location information may be in any suitable format , and such formats include , but are not limited to , latitude / longitude , and geographical location name . this example is similar to that described in connection with fig3 , but does not include incorporating location information in connection with file open operations . fig2 through 4 provide illustrative embodiments of the present invention . in a further aspect of the present invention , various embodiments including reading back the location information that was written into the files and displaying or otherwise utilizing that information . location information that was stored , either in an opened or modified file , or some other file ( e . g ., a system file maintained by the computer &# 39 ; s operating system ) that is associated with the opened or modified file , can be read back and displayed alone or with other file attributes such as , for example , the date and time of the file open or modify operation . when a directory listing is obtained that includes location information , the directory listing may be sorted according to location , whether by latitude , longitude , alphabetically in accordance with geographical place name , or by regions ( e . g ., north america , western europe , asia , and so on ). the operations writing and reading back location information from files , as described above , are typically implemented in software . such software may be included in a computer &# 39 ; s operating system , or may be installed on a computer as an application program . fig5 is a flowchart of an illustrative process in accordance with the present invention that incorporates location information in a cookie file . cookies or cookie files are terms that describe files stored on a client computer because of an interaction between , for example , a web browser software program running on the client computer , and a software program than runs on a web server computer . typically such an interaction occurs when a computer user visits , or accesses a web site . cookies are generally relatively small files that allow the software running on the web server to determine whether and when the client computer has accessed the web site . in one embodiment of the present invention , a cookie file is created on a client computer 502 . location information is obtained 504 from a location information resource present ( such as , for example , location information resource 112 of fig1 ) in the client computer . this location information is indicative of the location of the client computer at the time of the interaction with the web site . the location information may be in any suitable format , and such formats include , but are not limited to , latitude / longitude , and geographical location name . the location information is then written 506 into the cookie file . such information in the cookie file can be useful to a web site operator in determining geographical usage patterns of the web site , i . e ., from where the site is being accessed . furthermore , the location information may be updated upon subsequent accesses of the cookie file . similarly , a history , or log , of location information may be formed in the cookie file by additional accesses of the cookie file during , or as a consequence of , one or more interactions with the web site . fig6 is a flowchart of an illustrative process in accordance with the present invention that reads location information from a cookie file . more particularly , a cookie file that includes location information relative to where the client computer was located at the time the cookie file was created , last opened , or last modified , is opened 602 . the cookie file may be opened in connection with a visit to a web site , or such similar interaction with a web server , or other computer system or process . subsequently , at least one item of location information is read 604 from the cookie file . the location information may constitute a record in the file , although no particular file format is required by the present invention . the location information read from the cookie file may be transmitted back to the web server , mentioned above , so that geographical usage patterns may be determined . methods and apparatus for communication between a web browser ( client ) and a web site ( server ) are well known and are not described further herein . fig7 is a flowchart of an illustrative process in accordance with the present invention that incorporates location information into a signature block of an email message . some of the well - known and widely available email programs provide users with a feature that automatically appends a signature block to their email . these signature blocks are typically defined by the email users and often include information such as , but not limited to , the name of the user , the user &# 39 ; s phone number and address , business title , mail - stop , and so on . in this example , a computer system , or other information handling device , having a location information resource ( such as location information resource 112 of fig1 ), and capable of preparing and sending email , receives a command to send an email 702 . a decision is then made 704 as to whether such an automatic signature feature is active for this message . if the automatic signature feature is not active , then the email is sent 710 . if the automatic signature feature is active , then the current location of the computer , or other information handling device is obtained from the location information resource 706 . that location information is appended to , or inserted into , the email message , for example into the signature block 708 . the email is then sent 710 . it is to be understood , that in this context sending an email may mean actually transmitting the email to another computer or information handling device , directly or through some communication network , or simply spooling the email for subsequent transmission . fig8 is a flowchart of an illustrative process in accordance with the present invention that includes converting latitude and longitude information into geographical name information and inserting that geographical name information into a signature block of an email message . this example is similar to the general example of fig7 , but illustrates a more specific example . more particularly , a computer system or other information handling device , having a location information resource ( such as location information resource 112 of fig1 ), and capable of preparing and sending email , receives a command to send an email 802 . a decision is then made 804 as to whether a signature block feature is active for this message . if the signature block feature is not active , then the email is sent 812 . if the signature block feature is active , then the current location of the computer or other information handling device , in the format of latitude and longitude , is obtained from the location information resource 806 . the latitude and longitude information are then converted to a geographical place name of the location that corresponds to the latitude and longitude 808 . the geographical place name information is then inserted into the signature block 810 . the email with the included geographical name information is then sent 812 . it is to be understood , that in this context sending an email may mean actually transmitting the email to another computer , or information handling device , directly or through some communication network , or simply spooling the email for subsequent transmission . fig9 is a flowchart of an illustrative process in accordance with the present invention that incorporates location information into a file in connection with a special code previously inserted into the file or associated with the file . the special code or character or field may be in the file itself or in associated data structures . moreover , the special code may be inserted into the file or associated with the file by the user or by default . the special code may indicate a permanent substitution of the code with location information or temporary replacement of the code with location information . herein , the phrase “ associated with ” is used to describe data structures or another file associated with the file of interest . some conventional word processing , spreadsheet , and presentation graphics programs provide users with a feature that automatically replaces a special code inserted in a file with current date or time information . that is , a user inserts a special code in a file , and , when the file is , for example , opened or displayed or modified or printed , the special code is replaced with the current date and time . some programs provide the user with various options with respect to how the special code is interpreted such as , but not limited to , language format , display of date only , display of time only , formats for date and time information , and so on . some programs also provide the user with options to control whether the special code is temporarily replaced with date and time information each time the file is , for example , opened or whether the special code is permanently replaced the first time the file is , for example , opened . in this example , a computer system , or other information handling device , having a location information resource ( such as location information resource 112 of fig1 ), and capable of running a word processing , spreadsheet , presentation graphics , or some other type of file editing program , receives a command to operate on a file 902 . a decision is then made 904 as to whether the requisite special code is present , e . g ., inserted into the body of the file . if the special code is not present or associated with the file , the operation specified by the command then continues 914 . if the special code is included in the file , then the current location of the computer , or other information handling device , is obtained from the location information resource 906 . at 908 , a determination is made whether the special code is to be replaced with the location information permanently or temporarily . if the user selection is for permanent replacement of the special code with the location information , then such location information is substituted 910 for the special code and no subsequent replacements will be made until another special code is inserted in , or associated with , the file . if the user selection is for temporary replacement , then such location information temporarily replaces the special code 912 . for example , if a file is opened for viewing and includes a special code in the body of the file indicating a selection for temporary replacement of the special code with location information , then the location information is displayed in lieu of the special code while the file is opened for e viewing . if the file is again opened for viewing , but this time the user is in a new geographic location , as might be the case for a salesperson using a presentation graphics file , the location information is displayed with the current location information reflecting the new geographic location . in another embodiment , incorporation of location information into a file , also referred to as location stamping the file , is used to identify the point of origin of an annotation to a file . for example , in virtual organizations where people in various geographically dispersed locations work collaboratively via electronic means , several users might be updating the same electronic file , each with annotations . some embodiments of the present invention provides location information so that the points of origin for such annotations can be readily identified . fig1 is a flowchart of an illustrative process in accordance with the present invention that provides time and time zone information to a programmable clock , where the time and time zone information is representative of the geographic location of the computer system or information handling device that includes the location information resource . that is , fig1 is a flowchart showing a process for updating a programmable clock with time and time zone information . the programmable clock may be updated automatically as the computer system or information handling device is moved from one geographic location to another . this automatic updating function can be selected by the user . or , as an alternative or in addition to automatic updating , the user can initiate the updating of the programmable clock to include current time and time zone information . another option allows the user to view time and time zone information that varies with the location of the computer system or information handling device and , at the same time , also view time information corresponding with a fixed reference time zone . for example , the user might choose to view both current location - based time and time zone information , as the user might be traveling from location to location , while maintaining a reference point to a “ home ” time and time zone , such as the time in the pacific daylight time zone . the fixed reference time zone is typically expressed as an offset from universal time ( utc ) or greenwich mean time ( gmt ) or z - time , each of which correspond with the time at zero degrees longitude , i . e . at the prime meridian . for example , thursday 11 : 00 pm pacific daylight time ( pdt ) corresponds with friday 6 : 00 am universal time , an offset of seven hours . if the user is currently in austin , tex ., where the local time in austin corresponding with thursday 11 : 00 pm pacific daylight time is friday 1 : 00 am central daylight time ( cdt ), both the fixed reference time , thursday 11 : 00 pm pdt , and the current local time , friday 1 : 00 am cdt , are displayed . here , the “ 11 : 00 ” and “ 1 : 00 ” displays are examples of numeric time information using arabic numerals , and the “ pdt ” and “ cdt ” displays are examples of abbreviated time zone information in the english language . it is to be appreciated that alternative languages and numbering systems can be used in accordance with the present invention . likewise , alternative formats for the display of time information can also be used in accordance with the present invention . herein , time information includes both time and time zone information and may also include date information . in the above example , the change in time information corresponding with the change in time zone from pdt to cdt includes a change in the date also . that is , thursday 11 : 00 pm pdt corresponds with friday 1 : 00 am cdt . if , for example , time information is updated to from pdt to cdt to reflect updated location information , the updated time information includes the change in date from thursday to friday , in addition to the changes in numeric time , am / pm indicator , and time zone abbreviation . many computer systems and other information handling devices provide a programmable clock feature . for example , a programmable clock is included with most computer systems , and the programmable clock typically accepts actions by the user to update or adjust the clock attributes . such attributes include , but are not limited to , time setting in hours , minutes , seconds , and an “ am ” or “ pm ” indicator ; time display format ; fixed reference time zone , typically expressed as an offset from universal time ( utc ); date setting with month , day , and year ; date display format ; language setting ; and an option for automatic time adjustment for daylight savings time . in this example , a computer system , or other information handling device , having a location information resource ( such as location information resource 112 of fig1 ), determines a first time zone 1004 . the first time zone is either a previously stored time zone , previously stored or updated into the programmable clock , or a predetermined default time zone . the predetermined time zone can be any time zone and , in one embodiment , is selected by the user . next , the computer system or other information handling device reads present location 1006 using the location information resource . using the latitude and longitude information obtained from the location information resource , a determination is made whether the present location is within the first time zone 1008 . the coordinates of the present location are compared with the coordinates that define the well - known time zone boundaries . these time zone boundary coordinate sets can be stored in a file or other memory within the exemplary computer system . in one embodiment , a data table within the computer system or information handling device that cross - references latitude and longitude information with time zone information is used . if the present location is within the first time zone , then no action is required other than to continue the process of taking another location reading 1006 and determining whether the location coordinates are within the first time zone 1008 . if the present location is not within the first time zone , then a determination is made whether a distance between the present location and the boundary with the first time zone is greater than a predetermined amount 1010 . if the distance is less than the pre - determined amount , then the process of taking another location reading 1006 and again determining whether the location coordinates are within the first time zone 1008 is repeated . if the distance is greater than the pre - determined amount , then the programmable clock is updated 1012 to reflect the current time in the new present time zone . the pre - determined amount is dependent upon the margin of error of the location information resource plus a distance needed for hysteresis . location information resources such as gps modules have various margins of error , depending upon the manufacture of the module and situation - specific operating characteristics . for example , a gps module without the capability to receive a reference or correction signal typically has an accuracy or margin of error of about 100 yards whereas a gps module with such capability , also known as a differential gps , typically has a margin of error of about two to three yards . that is , a differential gps is typically capable of providing location information with accuracy to within a couple yards of the actual geographic location . the distance needed for hysteresis may be arbitrarily chosen and static . alternatively , the distance needed for hysteresis , in one embodiment , is dynamically calculated such that changes in time zones do not occur within a certain minimum time . such a calculated distance is needed to prevent the time zone information from oscillating between two values when the location information resource is near a time zone boundary . hysteresis is helpful to avoid this oscillation . for example , in one embodiment , a default minimum time or hold time between time zone changes is set to five minutes . that is , if time zone information changes , it will not be changed again within the next five minutes . the calculated distance is dependent upon the rate of location change . if the location is changing at a rate of 60 miles per hour or one mile per minute , the distance needed for hysteresis would be five miles . if the location is changing at a rate of six miles per hour , the distance factor would be one - half of one mile . in one embodiment , the pre - determined amount used in decision 1010 is initially set at a default value , for example , the distance corresponding with a five minute minimum time or hold time between time zone changes plus a distance greater than the margin of error specific to the particular location information resource . in one embodiment , the pre - determined amount is selectable by a user . that is , a user is able to select the pre - determined amount to achieve some desired effect . for example , if the user will be frequently crossing back and forth between two time zones over a short period of time , but wishes to maintain the time zone information that represents one of the two time zones , the user is able to increase the pre - determined amount to a distance great enough to avoid having the time zone information oscillate back and forth between the two time zones . fig1 is a flowchart of an illustrative process in accordance with the present invention that incorporates time and time zone information into a file in connection with a file modify operation . more particularly , in this embodiment , a command to modify a file is received 1102 . however , a wide variety of other commands can be substituted for the “ modify ” command as shown in fig1 . in another embodiment , for example , a command to open a file is received . in yet another embodiment , a command to print a file is received . location information is read 1104 from a location information resource , such as location information resource 112 of fig1 , and latitude and longitude information from the location information resource is used to determine the corresponding time and time zone 1106 . here , the latitude and longitude coordinates from the location information resource are used to determine the corresponding time zone , and the time zone dictates any adjustments to the time information . for example , if the time zone is changed from mountain to pacific time , the one hour decrement is reflected in the time information . once the time and time zone information is determined 1106 , it is then written into the file 1108 . in one embodiment , the time information is written into the file itself , as part of the historical information associated with the file . in another embodiment , this file history information is maintained by the computer &# 39 ; s operating system . the time and time zone information , therefore , becomes part of the file history accessible to other software applications , operating system functions , and so on . for example , once time and time zone information is associated with files in accordance with the process illustrated in fig1 , a directory listing utility or software application is able to produce a listing of files including the time and time zone information associated with each file . in one embodiment , the time and time zone information representative of the current or local geographic position , as read by the location information resource 1104 , is associated with the file . that is , the time and time zone information associated with the file corresponds with current location information . in another embodiment , a user selects an option such that a fixed or “ home ” reference time zone and corresponding time are associated with the file . the fixed reference time zone is universal time ( utc ) or a time zone that is an offset from utc . examples include pacific daylight time ( pdt ), mountain standard time ( mst ), and so on . in yet another embodiment , a user selects an option for time and time zone information reflective of both current location information as well as the fixed reference time zone to be associated with the file . in other words , a user selects whether one or both versions of time and time zone information are to be associated with the file . alternatively , a user selects an option that uses the time and time zone information available from the computer &# 39 ; s system clock or other programmable clock as the information to be associated with the file . fig1 is a flowchart of an illustrative process in accordance with the present invention that provides a directory listing with time and time zone information . once time and time zone information is associated with files in accordance with the process illustrated in fig1 , a directory listing utility is able to provide a listing of files that includes time and time zone information . as illustrated in fig1 , a directory listing command is received 1202 , and the subsequent display of directory contents 1204 will include time and time zone information . fig1 is a flowchart of an illustrative process in accordance with the present invention that provides a directory listing that may be sorted according to , at least , time and time zone information . a directory listing command is received 1302 , and the resulting default directory listing with time and time zone information is displayed 1304 . subsequent to the default display , a user is able to select sorting options 1306 by which the directory listing contents are sorted 1308 . some computer operating systems are equipped with a directory listing utility that allows a user to use simple point and click actions using a mouse or other cursor controlling device to designate a particular sorting option . for example , a user is able to point and click on a portion of the computer screen that includes file size information , thereby causing the display of file contents to be sorted by file size . the present invention provides for the association of time and time zone information with files so that a user is able to choose time and time zone information when selecting sort options 1306 . the directory listing contents are sorted 1308 and then displayed with time and time zone information 1310 . fig1 is an illustrative example of a default directory listing that includes time zone and other location information . the files shown are sorted by file name , alphabetically . line numbers 1 - 6 are shown for reference only and become more useful when comparing the default listing in fig1 with other examples discussed hereafter . time zone information is included in the directory listing , in addition to latitude and longitude location information . the date , time , time zone , latitude , and longitude information correspond with the same operation on the named file . for example , the second file is named “ b file ” 1402 and was last modified feb . 15 , 2001 , at 8 : 45 am pacific standard time , at latitude n 45 : 59 . 009 ′ and longitude w 122 : 25 . 064 ′. in another embodiment , similar date , time , time zone , and location information is displayed in a directory listing and corresponds with a create file operation . in yet another embodiment , time , date , and location information is displayed in a directory listing and corresponds with an open file operation . fig1 is an illustrative example of a directory listing sorted in an order from most recently modified to least recently modified . that is , the first file shown in fig1 is “ c file ” 1502 and was last modified aug . 1 , 2001 , at 10 : 00 am eastern daylight time , at latitude n 45 : 46 . 736 ′ and longitude w 84 : 43 . 856 ′. this is more recent than any of the other files shown . also , because of the time zone information provided by the present invention , files that would otherwise have been ordered differently if sorted by date alone are correctly ordered . for example , line 3 1504 in fig1 shows “ d file ” as having been more recently modified than line 4 1506 , “ e file ”, even though jun . 28 , 2001 , is before jun . 29 , 2001 . the date information cannot be used without the time zone information to correctly order the files in an order from most recently modified to least recently modified . as with fig1 , the information shown in fig1 may represent other file operations such as file last opened , file created , and so forth . also similar with fig1 , the format and organization of the information shown in fig1 may be varied and still be within the spirit of the present invention . for instance , the file size information shown in fig1 may be excluded from the directory listing contents or other file attributes may be added , but the inclusion of location information remains within the spirit of the present invention . another example where the benefits of the present invention are particularly useful , is in the situation where two or more people in various geographically dispersed locations work collaboratively via electronic means and are working on the same or similar electronic files . if , for example , lines 3 1504 and 4 1506 in fig1 correspond with the same file , the present invention provides a directory listing that readily reveals that the file in line 3 1504 is the more recent version . that is , “ d file ” 1504 was last modified jun . 28 , 2001 , at 11 : 00 pm pdt , which is more recent than “ e file ” 1506 , which was last modified jun . 29 , 2001 , at 12 : 30 am cdt . without the present invention , determination of the most recently modified file is confusing and prone to error . fig1 is a flowchart of an illustrative process in accordance with the present invention that allows for a directory listing to be sorted by user defined specified regions . a software application is easily written , by one skilled in the art , to include a simple graphical user interface whereby a user can select an area using a mouse or other cursor controlling device . in one embodiment , such an application is incorporated into a directory listing . that is , the directory listing application includes an option to create specified regions that become file history attributes upon which the directory listing contents can be sorted . in this example , a directory listing command is received 1602 , causing a default directory listing to be displayed 1604 . a user then selects an option to create a specified region 1606 . for example , a user may point and click on a portion of the window comprising the directory listing display that causes an option menu to open . upon selecting the option to create specified regions , the user is asked to enter a name for the first specified region 1608 . once a name is entered , the user is presented with a map wherein the user is able to shade or highlight geographic regions that the user wishes to associate with the entered name . the user effectively selects the boundaries for the specified region 1610 , the specified region comprising a set of areas defined in terms of latitude and longitude coordinates . if the user wishes to create another specified region 1612 , the user is asked to enter another specified region name 1608 . if the user is finished creating specified regions , then the directory listing attributes are updated 1614 to include the specified regions for both display purposes as an additional sorting option . that is , the directory listing can be sorted by specified region . in one embodiment , the directory listing further includes an algorithm that links named specified regions with files having the appropriate latitude and longitude information . that is , a file having latitude and longitude coordinates that fall within the geographic areas assigned to a particular named specified region is associated with that specified region for purposes of directory listing display and sorting . implementation of an algorithm that effectively cross - references sets of latitude and longitude coordinates and establishes links or associations between files and specified regions is easily accomplished by one skilled in the art . example directory listing displays incorporating specified regions are provide in fig1 and 18 . fig1 provides an example display of a directory listing with specified regions information added . the example data used is the same for fig1 , 15 , and 17 , except for the additional specified regions information 1702 . in this example , two sales areas are defined , sales area 1 1704 and sales area 2 1706 . fig1 provides an example display of directory listing sorted by user defined specified regions . in this example , the files associated with sales area 1 1802 are grouped together and further sorted by file name , alphabetically . similarly , the files associated with sales area 2 1804 are grouped together and further sorted by file name , alphabetically . the present invention may be implemented as circuit - based processes , including possible implementation on a single integrated circuit . as would be apparent to one skilled in the art , various functions of circuit elements may also be implemented as processing operations in a software program . such software may be employed in , for example , a digital signal processor , micro - controller , or general - purpose computer . the present invention can be embodied in the form of methods and apparatuses for practicing those methods . the present invention can also be embodied in the form of program code embodied in tangible media , such as punched cards , magnetic tape , floppy disks , hard disk drives , cd - roms , flash memory cards , or any other machine - readable storage medium , wherein , when the program code is loaded into and executed by a machine , such as a computer , the machine becomes an apparatus for practicing the invention . the present invention can also be embodied in the form of program code , for example , whether stored in a storage medium , loaded into and / or executed by a machine , or transmitted over some transmission medium or carrier , such as over electrical wiring or cabling , through fiber optics , or via electromagnetic radiation , wherein , when the program code is loaded into and executed by a machine , such as a computer , the machine becomes an apparatus for practicing the invention . when implemented on a general - purpose processor , the program code segments combine with the processor to provide a unique device that operates analogously to specific logic circuits . it is to be understood that the present invention is not limited to the embodiments described above , but encompasses any and all embodiments within the scope of the following claims .

US-89439207-A

a charger configured to charge at least one battery used in transportation means or stationary equipment , includes a plurality of power connections configured to couple to a plurality of power sources . the charger is adapted to receive power from the plurality of power sources simultaneously .

fig1 illustrates an example of a vehicle plugged into the grid utilizing the vehicle communication system according to an embodiment of the invention . vehicle 148 may be a hybrid or battery electric vehicle having available battery storage and plug in capabilities . vehicle batteries 144 may be any type of rechargeable battery . charger 142 may be configured to accept any one or a combination of available power sources , such as 110v , 220v and 400v inputs . charger 142 may be modular , with each charger module 366 ( fig3 ) independently connected through the modular connection 372 to charger management unit 360 . charger management unit 360 may in turn be connected to a telemetric unit ( not shown in fig3 ) via connection 318 . each charger module 366 may have an ac / dc converter , or two or more of charger modules may share one converter . due to increased heat from high voltage charging , charger 142 may have a magnesium casing with heat dissipation capabilities . for example , upon plugging in to a charge socket , vehicle 148 may plug into multiple 110v , 220v outlets . by allowing multiple plugs to connect simultaneously , charger 142 may double or triple the line capacity thereby reducing charge times significantly . by engaging multiple charger modules 366 ( fig3 ), the charger may increase efficiency as each charger module 366 may individually charge attached battery packs 344 . management unit 360 may determine available battery and line capacity to adjust charge algorithm . as illustrated in fig1 , charger 11002 may be able to accept multiple connections simultaneously . multiple power lines 11006 may be connected to charger modules 110002 via vehicle charge spots 110004 . based upon available line capacity , management unit 360 ( fig3 ) may establish how many modules should accept energy input or provide energy output . in fig1 , charger 142 may be designed for inorganic electrolyte batteries . each charger module 366 ( fig3 ) may accept energy input from multiple power sources ( e . g ., one or more of 110v , 220v or 400v power sources 794 ( fig7 )). ac power 796 may be converted through a full wave rectifier to high energy dc power 702 which may in turn be used to charge each battery pack 744 rapidly to 50 - 55 % of battery capacity . after 55 %, battery packs 744 may develop sludge 704 in the battery electrolyte due to fast charging . in order to complete the charge process , stored sludge energy may be drawn ( as depicted by reference numeral 700 ) from battery packs 744 into a capacitor 762 . capacitor 762 may redistribute the sludge energy to battery packs 744 . as an additional safety feature , charger 142 may have a so2 capture system . in case of battery short circuit , so2 gas may leak from battery packs 744 . capture system may capture the so2 gas in a sealed enclosure or an absorbent material . based upon a low energy connection , battery sludge 704 may not be a factor and regular charging may commence as the electrolyte may remain stable . fig2 illustrates an exemplary connection between charger 242 and telemetric unit 238 . charger 242 is configured to receive one or a combination of available power sources . fig2 shows 110v / 220v / 400v as possible power sources , but charger may be adapted to receive power sources with different voltage levels than those shown in fig2 . charger management unit 260 may be arranged as the main connection with telemetric unit 238 . charger 242 may communicate with telemetric unit 238 information about the battery state of health ( soh ) through charger management unit 260 . management unit 260 may be configured to set the direction of the energy flow . based upon battery state of health and battery state of charge ( soc ), management unit 260 may initiate either regulation up ( supply ) or regulation down ( charging ). fig2 also illustrates the communication between telemetric unit 238 , charger management unit 260 and power grid 210 . while plugged into the power grid , any hybrid or battery electric vehicle 148 ( fig1 ) may charge the batteries or supply power grid 210 through charger 242 . that is , charger 242 may be configured to receive energy from or supply energy to grid 210 . for example , battery packs may have available capacity of 35 kwh . telemetric unit 238 may be remotely instructed by utility company 158 ( fig1 ) to initiate supplying energy to the grid via a charge socket modified to enable energy supply power grid 210 . grid upgrades are not needed , however installing a grid control switch at the dedicated supply socket &# 39 ; s fuse box may be needed for regulation up . information , such as , battery status , plug location and general vehicle diagnostics , or any other suitable information , may be conveyed between charger management unit 260 and the onboard telemetric unit 238 . this information may be transferred through the telemetric unit &# 39 ; s input / output ( i / o ) channels . in one embodiment , telemetric unit 242 has 32 i / o channels . in one embodiment , there are two separate communication channels between the vehicle and utility company 358 ( fig3 ). the initial communication occurs when a vehicle is plugged into the grid . in order for utility company 358 to locate the exact location of the plugged - in vehicle , the vehicle may respond to the utility company &# 39 ; s monitoring and supervisory protocols . as often as 60 times a second to every 6th second , the utility company may send out a monitory signal on to the grid . signal processor 370 ( fig3 ) may be passive and may be activated to respond upon receiving a known signal protocol from the utility company transmitted through the grid . by configuring signal processor 370 to read and respond to the signal protocols ( a communication process that is currently in use by utility companies to communicate with their substations over the grid ), the utility company may detect the location of the vehicle . signal processor 370 may be updated to allow for different monitoring protocols through the onboard telemetric unit 238 ( fig2 ). upon acknowledgment , signal processor 370 may respond by relaying a binary pulse 106 ( fig1 ) in to the grid . pulse 368 may draw energy from capacitor 362 located within the charger , or from vehicle batteries 344 . as illustrated in fig9 , upon connection to the grid , signal processor 370 ( fig3 ) may read the monitoring protocol initiated by utility company 958 . upon reading the protocol , signal processor 370 may respond with a series of pulses into the grid through a socket . pulse 368 ( fig3 ) may be compatible with utility standards such as scada ( supervisory control and data acquisition ), ieee synchrophaser c37 . 118 , iec60870 , and iec 61850 ( communication networks and systems in substations ). pulse 368 travels on the power lines and utility company 958 may read and detect the vehicle &# 39 ; s location , charge capacity and identify the owner of the vehicle . pulse 368 ( fig3 ) may be utilized in conjunction with the telemetric unit to ensure the redundancy of the communication process . power line communication may be used for identifying the exact charge socket and used in case of arbitrary situations . exact charge location may be important to ensure that the correct responsible party is billed and that the utility company 358 has precise real time information in order to balance the grid . local regulation may be of significant importance in order to achieve a balanced grid . the utility company may communicate with the vehicle during utility company &# 39 ; s standard grid surveillance procedure initiated as often as 60 times a second up to every 6th second . the utility company may record time and date according to coordinated universal time ( utc ). upon the end of the charge / discharge sequence , signal processor 370 may send out another pulse and utility company 358 may record the time and date and measure the charge / discharge sequence . the second and primary communication channel between utility company 158 and vehicle 148 is telemetric unit 138 ( fig1 ). telemetric unit 138 may triangulate the vehicle &# 39 ; s exact position within one cubic foot through navstar global positioning system ( gps ) satellites 520 , 522 , 524 ( fig5 ) corresponding to satellites 120 , 122 and 124 of fig1 , global system for mobile communication ( gsm ) networks 192 ( fig1 ) and radio signals 136 . gsm 192 and radio signal 136 are configured so that vehicle 148 may triangulate its position in locations where gps satellite signals are unavailable , such as parking structures and underground tunnels . fig1 illustrates how telemetric unit 138 may pinpoint the vehicle &# 39 ; s exact location . gps 10022 in combination with wide area augmentation system ( waas ) 10024 may triangulate the vehicles location 10028 within one cubic foot . by adding in both radio and gsm signals , vehicle &# 39 ; s location 10028 may be pinpointed with greater accuracy . radio signal 136 may operate in the fm commercial broad cast , very high frequency ( vhf ) band , ultra high frequency ( uhf ) band and the 900 mhz bands . telemetric unit 138 may support common radio communication protocols including pocsag , ermes , tap , flex , reflex , golay and ntt . telemetric unit 138 may record the exact position when a vehicle is plugged into the grid , capacity charged or discharged , vehicle status and diagnostics . vehicle plug chip 108 may triangulate the plugs &# 39 ; exact position through the wide area augmentation system ( waas ) chip . the chip may enable locating the plug &# 39 ; s exact position through waas reference stations . combination of gps , waas , radio and gsm may allow vehicle 148 to have its exact position recorded at all times . telemetric unit 438 ( fig4 ) may transfer data packet 452 to billing and provisioning center 454 over internet protocol ( ip ) on a set schedule . billing and provisioning center 454 may evaluate and decode the data and forward the information through independent service operator ( iso ) 456 or directly to utility company 458 . utility company 458 may identify the customer , charge socket used , and credit the customer for regulation up or charge for regulation down ( charging ). secondly , the utility company 458 may debit the socket owner that was initially charged and credit the vehicle owner in those cases where the socket owner and vehicle owner are different . an iso is an organization typically formed at the direction or recommendation of the federal energy regulatory commission ( ferc ). in the areas where an iso is established , it typically coordinates , controls , and monitors the operation of the electrical power system , usually within a single us state , but sometimes encompassing multiple states . an iso is usually an impartial link between power plants and the utilities that serve the consumers . in case of an emergency in the grid , such as power line maintenance or outages , charger management unit 360 ( fig3 ) may accept a low frequency radio shut off command 150 ( fig1 ) from the governing utility company or the iso . during regulation up ( vehicle supplying the grid ), it is critical that the governing utility company has the ability to shut off regulation remotely to avoid injury to workers or customers in the vicinity of an exposed power line . radio command 150 may be transmitted through single sideband radio , in 4000 khz and 8100 khz frequencies . low frequency may be used to ensure that command 150 is delivered in locations where high frequency can not be transmitted to . command 150 may immediately shut down regulation up through the emergency shut off in charger management unit 360 ( fig3 ). this is more clearly illustrated in fig8 . upon connection to the grid , the vehicle may initiate regulation up as illustrated in step 1 . step 2 illustrates the energy flow from the vehicle to the grid and the energy traveling along the grid . at point 3 , the power grid has a downed line . as illustrated by step 3 , upon recognizing the downed line , utility company 858 may immediately send out an emergency shut off command 850 through radio towers 832 . upon receiving the shut off command , charger 842 may immediately terminate regulation up and stop the energy supply into to the grid . customer support / service center 128 ( fig1 ) may be set up as a twenty four hour customer support center that offers two way communication through telemetric unit 138 through gsm and internet protocol , such as voice ( voip ), email and sms . telemetric unit 138 may be configured to record and transmit video . video may be recorded and used in case of charge location disputes and may also be an important tool in accident and security investigations . video may be streaming and accessed online through a third party web portal or through recordings in the vehicle &# 39 ; s black box 146 . video may be recorded from a 360 degree angle outside or inside the vehicle . as illustrated in fig1 , telemetric unit 12002 and black box 12006 may be connected with the vehicle &# 39 ; s outside cameras 12004 or inside cameras 12008 . cameras inside the vehicle may be activated in case of vehicle theft or suspicion of fraudulent usage . cameras outside the vehicle may be used to identify charge location and obtain footage of an accident . video may be streamed from the vehicle to a third party portal using the adactus protocol . adactus may enable the vehicle to transmit live high definition video through multiple channels . black box 146 located in telemetric unit 138 may store up to 72 hours of diagnostic data and video which can be physically accessed through the black box &# 39 ; s hard drive . fig6 illustrates the sequence of events starting with the vehicle connecting to the power grid as illustrated by step 674 . upon connection , charger management unit 360 ( fig3 ) may recognize battery and power line capacity ( step 676 ). signal processor 370 ( fig3 ) may transmit the sequence of binary pulse into the grid ( step 678 ). charger 242 ( fig2 ) may either draw power from the power grid or provide charge to the grid ( step 680 ). upon disconnecting from the grid , signal processor 360 ( fig3 ) may send a sequence of binary pulses ( step 682 ). the load statistics is recorded in the telemetric unit ( step 684 ). pending upload schedule , the telemetric unit may transfer the data to the billing and provisioning center 454 ( step 686 ). billing and provisioning center 454 decodes the charge / discharge statistics and may forward the data to the utility company or the iso ( step 688 ). the utility company 458 receives the information and may credit or debit the appropriate vehicle and / or socket owner ( step 690 ). while the above description and the accompanying figures provide various embodiments , the invention is not limited only to the disclosed embodiments . for example , while most embodiments are described in the context of a vehicle such as a car , the various embodiments of the invention may be implemented in any transportation means or moving object that could benefit from use of rechargeable batteries , such as buses , trains , planes , ships , and motorcycles .

US-76840610-A

a power distribution box and a method for producing a pdb include molding a lower cover with an integrated protector plate such that a unitary structure is formed . a busbar is inserted into a bottom side of a frame , and a lower cover is attached to the frame from the bottom side , thereby capturing the busbar between the frame and the lower cover . integrating the protector plate into the lower cover eliminates a molding process , an assembly process , and adds structural integrity to the lower cover without the addition of extra structural support members , thereby reducing material use and the weight of the assembled device .

as required , detailed embodiments of the present invention are disclosed herein ; however , it is to be understood that the disclosed embodiments are merely exemplary of the invention that may be embodied in various and alternative forms . the figures are not necessarily to scale ; some features may be exaggerated or minimized to show details of particular components . therefore , specific structural and functional details disclosed herein are not to be interpreted as limiting , but merely as a representative basis for teaching one skilled in the art to variously employ the present invention . fig1 shows a power distribution box ( pdb ) 10 in accordance with an embodiment of the present invention . the pdb 10 includes a frame 12 , a busbar 14 , and a lower cover 16 . a plurality of wires 18 are shown below the lower cover 16 , and as explained in more detail below , are configured to be inserted through a bottom side 17 of the lower cover 16 and apertures in the lower cover 16 and apertures in the frame 12 where they are retained by wire retaining features . as discussed in more detail below , wire retaining features in a frame , such as the frame 12 , may engage the wire itself — e . g ., insulation on the outside of the wire — or it may engage a terminal on an end of the wire ; in either case , the effect is that the wire is retained within the frame . the frame 12 includes a top side 20 and a bottom side 22 . a plurality of frame apertures 24 ( for clarity , not all of the apertures are labeled ) are disposed through the top and bottom sides 20 , 22 . the busbar 14 includes a plurality of busbar terminals 26 ( also for clarity , not all of the terminals are labeled ) extending upwardly for insertion into corresponding apertures 24 in the frame 16 . the horizontally extending member 28 of the busbar 26 includes a pair of apertures and is configured for connection to a power source , such as a vehicle battery . the lower cover 16 includes an integrated protector plate 30 , which forms a unitary structure with the rest of the lower cover 16 . in particular , the protector plate 30 is integrally molded with the rest of the lower cover 16 in a single mold . this provides a number of advantages over pdb &# 39 ; s that use a two - piece , snap - together assembly . first , as previously noted , the protector plate 30 is made in the same mold as the rest of the lower cover 16 , thereby eliminating the need for a second mold and a second molding process . in addition to eliminating a mold , a separate molding process and an assembly process , the integrated protector plate 30 does not need to be attached to the frame 12 separately from the lower cover 16 . in fact , retaining features 32 on the lower cover 16 which cooperate with mating features 33 on the frame 12 are the only connections that need to be used to keep the frame 12 attached to the lower cover 16 . therefore , retaining features do not need to be molded into the integrated protector plate 30 such as , for example , the snap - in retaining features shown in fig1 of the masters et al . reference . in addition to the retaining features 32 , the lower cover 16 also includes a mounting flange 34 , which can be used , for example , to mount the pdb 10 to a surface under the hood or in the trunk of a vehicle . fig2 shows a lower cover 36 in accordance with another embodiment of the present invention . similar to the lower cover 16 shown in fig1 , the lower cover 36 includes a mounting flange 38 , and also includes a mounting clip 40 . the lower cover 36 includes walls 42 , 44 , 46 , 48 , which extended downwardly from cover apertures 50 ( which , for clarity , are not all labeled in the drawing figure ). the walls 42 - 48 extend downwardly beyond the cover apertures 50 sufficiently such that wires , such as the wires 18 shown in fig1 , can be bundled within the walls 42 - 48 . this is one of the functions of a lower cover , such as the lower cover 36 — i . e ., it allows wires that may be spaced relatively far apart from one another to be bundled , and potentially dressed with tape , placed in a conduit , etc ., and then routed out of the lower cover , for example , through a wire takeout 52 . therefore , even in a top - down design ( as opposed to the bottom - up design of the present invention ) a lower cover serves the important purpose of allowing the pdb to be flush mounted on a surface while providing an egress for the bundled wires . also shown in fig2 is a dimension ( t ) representing the thickness of the wall 44 . another of the advantages of having an integrally molded , integrated protector plate , such as the protector plate 30 shown in fig1 , is that it adds structural integrity to a lower cover . it may therefore be possible to reduce the thickness of the walls of the lower cover while still achieving the required strength . for example , in some automotive applications it may be necessary to mold a lower cover with walls having a thickness greater than 1 . 3 mm . embodiments of the present invention , however , utilizing the additional strength of the integrated protector plate , may have wall thicknesses between 1 . 0 mm and 1 . 3 mm , and in the embodiment shown in fig2 , the walls 42 - 48 have a thickness ( t ) no greater than 1 . 0 mm . fig3 shows a perspective view of the lower cover 36 shown generally from the top . similar to the lower cover 16 , which had integrated protector plate 30 , the lower cover 36 shown in fig3 includes an integrally molded protector plate 54 forming a unitary structure with the rest of the lower cover 36 . the integrated protector plate 54 includes a number of wire protecting features , which are generally configured as horizontal surfaces — see , for example , surfaces 56 , 58 , 60 , 62 . the surfaces 56 - 62 do not represent all of the wire protecting features of the integrated protector plate 54 ; however , they can be used to illustrate how the protector plate helps to inhibit wires , such as the wires 18 shown in fig1 , from undesirably contacting a busbar , which can lead to chafing of the insulation on the wires . this is explained in more detail with regard to fig4 . also shown in fig3 , are retaining features 64 , which are used to connect the lower cover 36 to a frame 70 ( see fig5 ), and a recessed portion 66 , which is configured to hold a cassette that will be attached to a power source , such as a vehicle battery . turning to fig4 , the lower cover 36 is shown with a busbar 68 superimposed over the integrated protector plate 54 . as shown in fig4 , the horizontal surfaces 56 - 62 of the integrated protector plate 54 overlap the edges of the busbar 68 such that wires coming up through the lower cover 36 will not be chafed or cut by the edges of the busbar 68 as they continue through to the frame 70 , which is shown in fig5 . turning to fig5 , a cross - sectional view of the lower cover 36 is shown as taken through the cut line 5 - 5 shown in fig4 , but with a frame 70 attached to the lower cover 36 . on top of the frame 70 is a wedge 72 which , among other things , helps to retain wires , such as the wires 18 shown in fig1 , when they are inserted through the lower cover 36 and into the frame 70 . in particular , the frame 70 includes a number of wire retaining features , commonly referred to as “ terminal lock fingers ”, 74 , which retain wires inserted through frame apertures 76 . the terminal lock fingers 74 are of the type discussed above — i . e ., they retain the wires by engaging with terminals on the respective ends of the wires . as shown in fig5 , the wedge 72 includes wedge tabs 78 , which are disposed adjacent the terminal lock fingers 74 to keep them from being displaced laterally , so that the inserted wires ( not shown in fig5 ) will not be released . thus , in order to release wires inserted through the frame apertures 76 and retained by the terminal lock fingers 74 , it is necessary to remove the wedge 72 from the top of the frame 70 , thereby creating a space adjacent to the terminal lock fingers 74 whereby they can be displaced laterally so that terminals on the ends of the wires can be released and the wires removed . one of the horizontal surfaces 80 of the integrated protector plate 54 , which acts as a wire protecting feature , is shown in fig5 adjacent portion of the busbar 68 , which is illustrated by the vertically oriented terminals 82 . in addition to providing the wedge tabs 78 , the wedge 72 is configured to receive a number of fuses , which , in the embodiment shown in fig5 , are j - case fuses 84 . in some configurations of a pdb , a busbar , such as the busbar 68 , will be attached to a power source such as a vehicle battery , and then wires , such as the wires 18 shown in fig1 , will be attached to various vehicle accessories . then , when a fuse connects the busbar and one of the wires , the accessory has a fused power supply . also shown in fig5 is a cassette 86 inserted into the cavity 66 ( fig3 ), and which contains terminal posts 88 , 92 for connection to a power source such as a vehicle battery . as described in detail above , having an integrally molded protector plate , such as the integrated protector plates 30 ( fig1 ) and 54 ( fig3 ), provides a number of advantages over snap - together configurations . one of the advantages , as discussed above , is the increased structural strength of a lower cover having an integrated protector plate . returning to fig1 , it is shown that the lower cover 16 includes a first portion 92 and a second portion 94 . the first portion 92 includes structural supports 96 , which , in the embodiment shown in fig1 , are transverse members extending across a width of lower cover 16 from a first wall 98 to a second wall 100 . in contrast , the second portion 94 , which contains the integrated protector plate 30 , has no such transverse structural supports , and it does not need them to maintain the required strength for the application . thus , in addition to reducing wall thickness , integrating a protector plate into a lower cover allows for a reduction in the support structures molded into the lower cover , and can even reduce the weight of the assembled pdb . while exemplary embodiments are described above , it is not intended that these embodiments describe all possible forms of the invention . rather , the words used in the specification are words of description rather than limitation , and it is understood that various changes may be made without departing from the spirit and scope of the invention . additionally , the features of various implementing embodiments may be combined to form further embodiments of the invention .

US-201313873513-A

a cooking appliance including both a resistive heating element and a high - frequency wave source such as a microwave generator in which a metal skewer is easily insertable through a front opening in a heating chamber and in which changes in dimensions in supporting members for the skewer are absorbed totally . a ceramic coupling member extends between a polygonally - shaped rotary shaft end and the metal skewer with a coupling hole in the coupling member being detachably insertable over the polygonally - shaped rotary shaft end . the skewer extends into a through - hole in the coupling member which has a shape similar to that of the skewer . a spring is provided to urge the coupling member outwardly into engagement with the rotary shaft end .

as shown first in fig3 a high - frequency heating appliance 1 which incorporates both a resistive heating element 2 and a high - frequency heating device such as a magnetron or the like , and reference numeral 3 denotes a front cover which is designed to prevent leakage of high - frequency waves . the front opening of the heating chamber 4 is opened and closed by the front cover 3 . reference numeral 5 denotes a cover handle which is used to open and close the front cover 3 . reference numeral 6 denotes a control panel where control elements of various types such as switches , timers and the like or indicators such as a temperature scale or time scale or the like are mounted . reference numeral 7 denotes a spring provided to ease the opening and closing of the front cover 3 and to hold the front cover 3 in close contact with the front opening of the heating chamber 4 when the cover is closed . reference numeral 8 denotes a receiver , which may be rotated if desired . with reference now to fig4 and 5 , reference numeral 11 denotes a metal skewer made of a metal such as stainless steel which does not easily rust or corrode . the overall length of the metal skewer 11 is shorter than the inner dimension between the side walls 4 &# 39 ; and 4 &# 34 ; of the heating chamber . the configuration of the skewer 11 in cross section is a polygon such as square or the like . one end of the metal skewer 11 has a conical shape with a semi - spherical tip . the other end of the metal skewer 11 is provided with a groove adapted to receive an e - shaped stop ring 13 ( fig5 ). projection 14 are formed on the skewer 11 at a position between the end with the groove and the center of the skewer 11 extending slightly above the ridgelines of the skewer 11 . the projections 14 form a stop for a washer 15 which is fitted onto the skewer 11 from the other end thereof . the washer 15 also acts as a stop for an elastic member 16 such as a coiled spring made of , for example , stainless steel wire , which is likewise fitted onto the skewer 11 from the other end thereof . the other end of the elastic member 16 is limited by the step 18 formed on a coupling 17 . the coupling 17 is made of a dielectric material such as porcelain which has a superior heat - resistance and low high - frequency loss . the configuration and dimension of the hole 19 into which the metal skewer 11 is inserted coincide with those of the metal skewer 11 . the coupling 17 is slidable in the longitudinal direction but can move only a little ( by an amount which corresponds to the small gap ) in the rotational ( radial ) direction . a hole 20 for connection to the coupling 17 is formed from the other end ( the end opposite the end with the step 18 ) of the coupling 17 . the configuration and dimensions of the hole 20 coincide with those of a rotary shaft end 26 , as is mentioned afterwards . the fit between the rotary shaft end 26 and the hole 20 for connection is made somewhat loose in comparison with the fit between the metal skewer 11 and the through - hole 19 . the ends of the hole 20 and the rotary shaft end 26 are rounded so as to make it easy to insert the shaft into the hole or pull out the shaft from the hole . the through - hole 19 and the hole 20 for connection are arranged coaxially with each other and the configurations thereof are made similar to each other . for example , if the skewer 11 has a square cross - section , the rotary shaft end 26 also has a square cross - section . after the washer 15 and then the elastic member 16 are fitted onto the skewer 17 , the coupling 17 is fitted thereon . thereafter , the e - shaped stop ring 13 is positioned on the skewer 11 so as to prevent removal of the coupling 11 . a stationary member 21 holds a food product 23 such as chicken or the like at a desired position by means of a stationary screw 22 . a rotary shaft 24 is made of a dielectric material such as polyimide resin which is heat resistant and which has a low high - frequency loss . a disc - like portion 25 is provided at the central part of the rotary shaft 24 . the cross - sectional configuration of the rotary shaft end 26 is a polygon , for example , a square . a bushing 27 which rotatably supports the rotary shaft 24 is made of a dielectric material such as ethylene tetrafluoride resin which has a low high - frequency loss , which is heat - resistant and which can slide easily . the bushing 27 is provided with a flange portion 28 and a projection 29 for preventing rotation of the bushing 27 . the bushing 27 is guided by a sleeve 30 which is made of a thin metal member having an inner diameter of about 15 mm and which is horizontally mounted , substantially at the center one of the side walls 4 &# 39 ; of the heating chamber . the end of the bushing 27 horizontally projects into the heating member . a shield plate 31 is made of steel plate which is somewhat thicker than the side wall 4 &# 39 ; of the heating chamber . the shield plate 31 is mounted on a bottom plate parallel to the side wall 4 &# 39 ; of the heating chamber . in the space between the shield plate 31 and the side wall 4 &# 39 ; of the heating chamber is filled an insulating material such as fiberglass which has a superior heat resistance . the bushing 27 passes through a somewhat larger hole which is formed in the shield plate 31 and is guided by the sleeve 30 so as to project into the heating chamber 4 . then , the rotary shaft 24 is inserted in the bushing 27 so that the rotary shaft end 26 projects horizontally from the end of the bushing 27 into the heating chamber 4 . a bracket 33 is formed in a cup shape from a steel plate . between the shield plate 31 and the bracket 33 is clasped and held the flange portion 28 of the bushing 27 and the collar 25 of the rotary shaft 24 . a gap is provided so that the various members do not bind together upon thermal expansion so that rotation is always possible . specifically , a gap 34 is provided in the radial direction between the rotary shaft 24 and the edge of the central hole in the bracket 33 . the width of gap 34 corresponds to that of the radial gap between the edge of the central hole in the shield plate 31 and the bushing 27 . by so doing , errors can be absorbed even if the sleeve 30 is moved due to thermal expansion or the application of a load or if the center of the hole in the shield plate 31 deviates from the center of the sleeve 30 due to mechanical tolerances or assembly errors . in addition , even if the side walls 4 &# 39 ; and 4 &# 34 ; expand and contract with respect to each other in the axial direction of the skewer 11 due to heating and cooling thereof , the side wall 4 &# 39 ; of the heating chamber can be displaced without being bound by the shield plate 31 or the rotary shaft 24 because of the radial gap between the inner surface of the sleeve 30 and the outer surface of the busing 27 . since the conical tapered end 12 of the skewer 11 is fitted in the v - shaped groove in the receiver 35 which is made of a dielectric material and which is fixed at a position opposite to the sleeve 30 substantially at the center of the side wall 4 &# 34 ; of the heating chamber , movement of the side wall 4 &# 34 ; of the heating chamber will be absorbed by the expansion and contraction of the elastic member 16 . a driven sprocket wheel 36 transmits rotary power from a driving wheel 40 which is mounted on the output shaft 39 of and electric motor 38 to the rotary shaft 24 via a chain 37 . a flat adjustment plate 41 insulatingly supports the electric motor 38 through a spacer 42 which is made of a material such as a phenol resin which has a low heat conductivity and superior heat resistance . the adjustment plate 41 is fixed to the shield plate 31 by means of a screw which extends through an arcuate hole 43 . the tension of the chain 37 can be adjusted by adjusting the position of the screw in the hole 43 . reference numeral 44 denotes radiating fins which are formed by punching a plate material such as copper or aluminum having a good heat conductivity along the longitudinal direction thereof so as to obtain a comb - like shape . the teeth of the &# 34 ; comb &# 34 ; are bent at their bases and the flat plate portion thereof is coupled to the electric motor 38 is that the structure functions as a heat radiator . the following advantageous features are provided with a heating appliance of the invention constructed as described above . since the tapered end 12 of the metal skewer 11 is conical and pointed , it is possible to easily pierce food products with it . the front cover 3 can easily be opened and the food product 23 on the metal skewer 11 attached so as not to idly rotate by means of fixing screws 22 of metal fittings 21 . the tapered end 12 is fitted into the v - shaped groove of the the receiver 35 simply by dropping it thereinto from above . since the conical surface of the tapered end then comes into contact with the step of the receiver 35 , smooth rotation is ensured because the tapered end 12 to be supported for rotation has a circular cross section , even if the configuration of the cross - section of the skewer 11 is a polygon which is convenient for preventing idle rotation of the food product 23 . the coupling 17 is slidable in the axial direction of the skewer 11 by the elastic member 16 which can be expanded and contracted . when the coupling 17 is inserted , the elastic member 16 is slid manually in a direction so as to compress the elastic member 16 and with the hole 20 being fitted onto the rotary shaft end 26 so as to achieve connection therebetween . in this case , since the configurations of the cross sections of the metal skewer 11 and the rotary shaft end 26 are similar to each other and moreover the through - hole 19 and the hole 20 are arranged coaxially , it is possible to easily fit hole 20 , which is not visible during this stage of the installation procedure , onto the rotary shaft end 26 only if one surface of the rotary shaft end 26 is matched thereto . in addition , since the corners at the entrance of the hole 20 as well as the rotary shaft end 26 are rounded , the inserting operation further becomes easy . upon releasing the operator &# 39 ; s hold of the coupling 17 after having inserting the coupling 17 only the rotary shaft end 26 , the coupling 17 will slide in the axial direction until it comes into contact with the end of the bushing 27 which projects into the heating chamber 4 due to the expanding force of the elastic member 16 . thus , the inserting operation is completed . at this time , the metal skewer 11 is pushed towards the receiver 35 by the repulsive force of the elastic member 16 , and the spherical tip surface of the conical tapered end is pushed against the wall surface of the v - shaped groove of the receiver 35 which is somewhat sloped . therefore , it is possible to easily and reliably mount the skewer 11 , which is shorter than the inner dimension between the side walls of the heating chamber 4 , in the heating chamber 4 without requiring modification and adjustment . even if the side walls 4 &# 39 ; and 4 &# 34 ; of the heating chamber are deformed or displaced due to thermal expansion when in use , there is no danger that the fitted members will come apart because the elastic member 16 always pushes outerwardly from both ends of the skewer 11 . when it is desired to disassemble these parts , a plate - like tool is inserted into the gap between the side wall 4 &# 39 ; of the heating chamber where the end of the bushing 27 which projects into the heating chamber 4 and the adjacent end of the coupling 17 . then , the plate - like tool is moved in the direction to compress the elastic member 16 in a prying motion , thereby disconnecting the coupling 17 from the rotary shaft end 26 which is fitted into the hole 20 . thus , these parts can easily be disconnected . as it is easy to fit the rotary shaft end 26 into the hole 20 due to the fact that the corners at the entrance of the hole 20 as well as the rotary shaft end 26 are rounded , it is also quite easy to disconnect the rotary shaft end 26 and the hole 20 . in case the coupling 17 is made of porcelain , oils and fats which adhere to the surface of the coupling 17 during cooking can easily be cleaned off . however , if the glaze is formed on the inner surface of the hole 20 or in the through - hole 19 , the dimensions thereof may vary widely . as a consequence , it may become impossible to provide an appropriate gap between the through - hole 19 and the skewer 11 or between the hole 20 and the rotary shaft end 26 , thereby making it impossible to insert the skewer 11 on the rotary shaft end 26 . in accordance with the present invention , however , the above - mentioned potential problems are eliminated by providing the step 18 , which functions also as the seat for the elastic member 16 , at the end of the through - hole 19 so as to prevent the inflow of molten glaze into the through - hole 19 due to surface tension during coating of the glaze . the side surface at the end of the hole 20 without glaze is prevented from coming into contact with the side wall 4 &# 39 ; of the heating chamber and thereby causing damage thereto or leading to the production of abnormal sound by the end of the lubricative bushing 27 which projects into the heating chamber 4 . the shield plate 31 , which has a mechanical strength superior to that of the side wall 4 &# 39 ; of the heating chamber , is independently mounted . therefore , it is possible for the shield plate 31 to hold the bushing 27 and the rotary shaft 24 without them being affected by initial deformation of the side wall 4 &# 39 ; of the heating chamber , displacement due to thermal deformation , or the application of a load . likewise , deformation or movement of the side wall 4 &# 39 ; of the heating chamber does not at all affect the relative positional relationships thereof with respect to the electric motor 38 which is mounted on the shield plate 31 . in addition , since the bushing structure is mounted without using the side wall 4 &# 39 ; of the heating chamber which is made of a thin steel plate , the efficiency of assembly of the appliance is outstandingly enhanced and error is absorbed due to the provision of the radial gap with respect to nonalignment between the sleeve 30 and the rotary shaft 24 . at the same time , it contributes to the lowering of cost by so doing . furthermore , the driven members around the rotary shaft 24 and the driving members such as the electric motor 38 and the like are mounted on the same shield plate 31 which is very rigid . in addition , a chain 37 is employed as the means for transmitting rotational power . with this construction , even if the driven members are positioned so as to match the sleeve 30 , it is possible to easily adjust the positions of the driving members . in addition , rotational power is precisely transmitted from the electric motor 38 to the food product 23 without the rotation being affected by changes of the load . with the described construction , leakage of high - frequency electromagnetic waves does not occur around the metal skewer 11 and the rotation shaft 24 because the rotary shaft 24 and the bushing 27 are made of dielectric material . the hole in the sleeve 30 is the only opening where there is any possibility of high - frequency wave leakage . however , if the sleeve 30 has an inner diameter of about 15 mm and a length of about 10 mm , a sufficient shielding effect will be provided . moreover , inasmuch as both ends of the skewer 11 are rotatably supported by the receiver 35 , and the coupling 17 and the rotary shaft end 26 which are made of dielectric materials and are isolated from the side walls 4 &# 39 ; and 4 &# 34 ; of the heating chamber , no spark will be generated . still further , almost all of the radiant heat and the conduction heat from the side wall 4 &# 39 ; of the heating chamber is shielded by the insulating material 32 and the shield plate 31 . in addition , heat conducted from the rotary shaft 24 is outstandingly reduced by the use of the resin . furthermore , the adjustment plate 41 is arranged in such a manner as to shield the the electric motor 38 and the heating chamber 4 , and the electric motor 38 is positioned above this adjustment plate 41 with a spacer 42 . moreover , the surface of the spacer 42 which is in contact with the electric motor 38 is arranged in such a manner as to act as a shield with respect to the heating chamber 4 . thus , the heat shielding effect is enhanced . in addition , the electric motor 38 is arranged at a position rearward and below an area where the temperature of the atmosphere is relatively low . furthermore , rotational power of the motor is transmitted by means of a chain 37 , which arrangement has a low thermal conductivity . in addition , the radiating fins 44 are provided around the electric motor 38 . thus , the heat generated from the electric motor itself also can readily escape . in accordance with the present invention as explained in detail hereinabove , a high - frequency heating appliance which includes a resistive heating element and which has provisions for cooking food on a skewer and which can meet all the objects of the present invention as mentioned above is provided .

US-27381281-A

a fuel vapor discharge limiting device for limiting communication between a fuel tank and a fuel vapor discharge pipe for discharging a fuel vapor in the fuel tank . the fuel vapor discharge limiting device includes a first float valve for cutting off the communication between the fuel tank and the fuel vapor discharge pipe when a liquid level in the fuel tank rises near a predetermined full level ; a relief valve for allowing the communication between the fuel tank and the fuel vapor discharge pipe when an internal pressure in the fuel tank becomes not less than a predetermined value ; and a second float valve for blocking the communication allowed by the relief valve when the liquid level in the fuel tank abnormally rises over the predetermined full level . accordingly , oversupply of liquid fuel to the fuel tank can be prevented , and the internal pressure in the fuel tank can be maintained always within a predetermined permissible range . furthermore , discharge of the liquid fuel to the fuel vapor discharge pipe can be prevented .

there will now be described some preferred embodiments of the present invention with reference to fig2 to 6 . referring first to fig2 reference numeral 1 generally denotes a fuel vapor discharge limiting device according to a first preferred embodiment of the present invention . the fuel vapor discharge limiting device 1 has a case 2 similar to that shown in fig1 . the case 2 is formed with a flange 3 for mounting the limiting device 1 to a fuel tank ( not shown ). thus , the limiting device 1 is mounted through the flange 3 to an upper portion of the fuel tank in a manner similar to that in fig1 so that an upper portion of the limiting device 1 above the flange 3 is located outside the fuel tank , and a lower portion of the limiting device 1 below the flange 3 is located inside the fuel tank . a fuel vapor discharge pipe 4 is integrally connected at one end thereof with an upper end of the case 2 . the other end of the fuel vapor discharge pipe 4 is connected through a canister ( not shown ) to an air intake portion of an engine . the upper end of the case 2 is generally closed by an end plate 5 integrally formed therewith . the end plate 5 is formed with two communication holes 6 and 7 for making the discharge pipe 4 communicate with the case 2 . a first float valve 8 and a second float valve 9 are provided in the case 2 so as to be opposed to the communication holes 6 and 7 , respectively . further , a relief valve 10 for closing the communication hole 7 from the discharge pipe 4 side is normally downwardly biased by a spring 10a . the lower end of the case 2 is formed as an opening 11 through which the inside of the case 2 communicates with the inside of the fuel tank . a plurality of vent holes 12 are formed through a side wall of the case 2 at an upper portion thereof to communicate with a gas phase region in the fuel tank at an upper portion thereof . the first and second float valves 8 and 9 are supported at their lower ends by a retainer 13 mounted at the opening 11 to the side wall of the case 2 . the first and second float valves 8 and 9 extend vertically in parallel to each other in the case 2 . a spring 14 is interposed between the first float valve 8 and the retainer 13 to normally upwardly bias the first float valve 8 so that a biasing force of the spring 14 balances the weight of the first float valve 8 . similarly , a spring 15 is interposed between the second float valve 9 and the retainer 13 to normally upwardly bias the second float valve 9 so that a biasing force of the spring 15 is equal to the biasing force of the spring 14 . both the float valves 8 and 9 are substantially cylindrical , and has the same density . a horizontal sectional area of a lower half portion of the first float valve 8 is equal to that of a lower half portion of the second float valve 9 . an upper half portion of the second float valve 9 is equal in outer diameter to the lower half portion thereof , whereas an upper half portion of the first float valve 8 is smaller in outer diameter than the lower half portion thereof , accordingly , than the lower half portion of the second float valve 9 . thus , the volume of the first float valve 8 is smaller than that of the second float valve 9 , so that the first float valve 8 is lighter in weight than the second float valve 9 because of the same density . in operation , when liquid fuel is supplied to the fuel tank equipped with the fuel vapor discharge limiting device 1 , gas in the fuel tank is discharged from the communication hole 6 to the fuel vapor discharge pipe 4 in accordance with a rise in level of the liquid fuel in the fuel tank during a time period where the liquid level is low . accordingly , the supply of the liquid fuel smoothly proceeds . during this time period , the communication hole 7 is kept closed by the relief valve 10 . when the liquid level becomes near a full level 16 crossing the lower half portions of the float valves 8 and 9 , a buoyancy is exerted on each of the float valves 8 and 9 by the liquid fuel entered the case 2 from the opening 11 with the result that the weights of the float valves 8 and 9 are reduced by the buoyancy . since the horizontal sectional areas of the lower half portions of the float valves 8 and 9 are equal to each other , the buoyancy exerted on the float valve 8 is equal to that exerted on the float valve 9 . as mentioned above , the first float valve 8 is lighter in weight than the second float valve 9 . accordingly , the biasing force of the spring 14 overcomes the weight of the first float valve 8 reduced by the buoyancy , thereby pushing up the first float valve 8 to close the communication hole 6 . on the other hand , the weight of the second float valve 9 reduced by the buoyancy remains larger than the biasing force of the spring 15 , so that the second float valve 9 is not pushed up by the spring 15 and accordingly not to close the communication hole 7 . however , the relief valve 10 keeps closing the communication hole 7 as mentioned above . thus , when the communication between the inside of the case 2 , that is , the inside of the fuel tank , and the fuel vapor discharge pipe 4 is cut off by the first float valve 8 in this manner , an internal pressure in the fuel tank starts rising . thereafter , when the liquid level reaches the full level 16 , the internal pressure becomes equal to a liquid head corresponding to the height of a fuel filler pipe ( not shown ), resulting in impossibility of further supply of the liquid fuel into the fuel tank . thus , the liquid level in the fuel tank is limited to the predetermined full level 16 , thereby preventing oversupply of the liquid fuel . even when the opening 11 of the case 2 formed at the lower end thereof is immersed in the liquid fuel , the inside of the case 2 is in communication with the gas phase in the fuel tank through the vent holes 12 of the case 2 . accordingly , when the internal pressure in the fuel tank rises according to various conditions such as an atmospheric temperature in the condition that the liquid level in the fuel tank is near the full level 16 and the communication hole 6 is closed by the first float valve 8 , the relief valve 10 is operated by the increased internal pressure to open the communication hole 7 and discharge the gas in the fuel tank from the communication hole 7 to the fuel vapor discharge pipe 4 . in this manner , the internal pressure in the fuel tank is maintained not greater than a predetermined permissible value depending upon a biasing force of the spring 10a of the relief valve 10 . in the case of cornering , acceleration , deceleration , etc . of a vehicle , the liquid level in the fuel tank at a portion where the limiting device 1 is located may abnormally rise over the full level 16 . in this case , the first float valve 8 is raised to close the communication hole 6 , of course . furthermore , since the buoyancy exerted on the second float valve 9 increases , the second float valve 9 is also raised by the biasing force of the spring 15 to close the communication hole 7 regardless of the operation of the relief valve 10 . accordingly , there is no possibility that the liquid fuel in the fuel tank may discharge from the communication holes 6 and 7 to the fuel vapor discharge pipe 4 and flow into the canister . in the event that the vehicle rolls over , the float valves 8 and 9 are moved to the communication holes 6 and 7 by their respective own weights in addition to the biasing forces of the springs 14 and 15 to thereby close the communication holes 6 and 7 , respectively . thus , the discharge of the liquid fuel in the fuel tank from the communication holes 6 and 7 is securely prevented . fig3 shows a second preferred embodiment of the present invention ; fig4 and 5 show a third preferred embodiment of the present invention ; and fig6 shows a fourth preferred embodiment of the present invention . in these drawings , the parts corresponding to those shown in fig1 are denoted by the same reference numerals . referring to fig3 reference numeral 1 generally denotes a fuel vapor discharge limiting device according to the second preferred embodiment . a case 2 of the limiting device 1 is generally composed of an upper part 2a and a lower part 2b connected together . the upper part 2a is formed with a flange 3 and an end plate 5 . a retainer 13a is provided at a connecting portion between the upper part 2a and the lower part 2b . a second float valve 9 is supported on the retainer 13a through a spring 15 . another retainer 13b is provided at an opening 11 formed at the lower end of the case 2 . a first float valve 8 is supported on the retainer 13b through a spring 14 . the second float valve 9 is formed as an annular body having a vertically extending , central through hole 17 . the first float valve 8 has a small - diameter portion 8 &# 39 ; slidably inserted through the hole 17 and opposed to a communication hole 6 of the end plate 5 . a projection 9a is formed on the upper end surface of the second float valve 9 so as to be opposed to a communication hole 7 of the end plate 5 . in comparison with the first preferred embodiment shown in fig2 wherein the first float valve 8 and the second float valve 9 are arranged horizontally in parallel to each other , the first float valve 8 and the second float valve 9 in the second preferred embodiment shown in fig3 are arranged vertically in concentric relationship with each other . accordingly , when the liquid level in the fuel tank is near a full level 16 crossing a lower portion of the first float valve 8 , a buoyancy is exerted on the first float valve 8 only , but no buoyancy is exerted on the second float valve 9 located over the lower portion of the first float valve 8 . when the liquid level rises to the level of the second float valve 9 , a buoyancy is just exerted on the second float valve 9 , thereby operating the second float valve 9 to close the communication hole 7 . referring next to fig4 and 5 , there is shown a fuel vapor discharge limiting device 1 according to the third preferred embodiment . a case 2 of the limiting device 1 in this preferred embodiment is an integral case similar to that in the first preferred embodiment shown in fig2 . however , an end plate 5 of the case 2 is formed at its central position with a communication hole 6 only . a first float valve 8 is composed of a thick - walled , cylindrical , lower part 8a and a thin - walled , cylindrical , upper part 8b connected together . a retainer 13 is provided at the lower end of the case 2 . the lower part 8a is supported on the retainer 13 through a spring 14 , and the upper part 8b is fixed at its lower end to the upper end of the lower part 8a over the outer circumference thereof to extend upwardly . the upper part 8b of the first float valve 8 has an upper opening closed by a cover plate 18 . a valve case 19 is located inside the upper part 8b at an upper end portion thereof in such a manner as to be tightly retained between the cover plate 18 and the upper part 8b . the cover plate 18 is formed at its central position with a projection 20 opposed to the communication hole 6 and adapted to engage the communication hole 6 . further , the projection 20 of the cover plate 18 is formed with a communication hole 21 aligned to the communication hole 6 . the bottom of the valve case 19 is formed with a communication hole 7 . a relief valve 10 for closing the communication hole 7 is provided in the valve case 19 so as to be normally downwardly biased by a spring 10a . a plurality of vent holes 22 are formed through a side wall of the upper part 8b at an upper portion thereof , and a plurality of vent holes 12 are formed through a side wall of the case 2 at an upper portion thereof . accordingly , the inside of the upper part 8b is always in communication with the gas phase in the fuel tank . a second float valve 9 is provided in the upper part 8b of the first float valve 8 so as to be supported through a spring 15 on the upper end surface of the lower part 8a of the first float valve 8 . a projection 23 is formed on the upper end surface of the second float valve 9 so as to be opposed to the communication hole 7 of the valve case 19 . as shown in fig5 a plurality of guide projections 24 are formed on the outer circumferential surface of the upper part 8b of the first float valve 8 so as to extend in a longitudinal direction thereof . the guide projections 24 of the first float valve 8 are in sliding contact with the inner circumferential surface of the case 2 . similarly , a plurality of guide projections 25 are formed on the outer circumferential surface of the second float valve 9 so as to extend in a longitudinal direction thereof . the guide projections 25 of the second float valve 9 are in sliding contact with the inner circumferential surface of the upper part 8b of the first float valve 8 . although not shown , such guide projections may be formed on the float valves 8 and 9 in the first and second preferred embodiments shown in fig2 and 3 and in the fourth preferred embodiment shown in fig6 . in the third preferred embodiment , when the liquid level in the fuel tank is near a full level 16 crossing the lower part 8a of the first float valve 8 , a buoyancy is exerted on the first float valve 8 only , but no buoyancy is exerted on the second float valve 9 . accordingly , the first float valve 8 is raised by a biasing force of the spring 14 to make the projection 20 close the communication hole 6 . at this time , the second float valve 9 supported on the first float valve 8 is also raised , and no relative displacement between the second float valve 9 and the first float valve 8 occurs . therefore , the communication hole 7 is not closed by the projection 23 of the second float valve 9 . however , since the communication hole 7 is closed by the relief valve 10 from the inside of the valve case 19 , the communication between the inside of the fuel tank and the fuel vapor discharge pipe 4 is cut off by the engagement between the communication hole 6 and the projection 20 of the first float valve 8 . accordingly , the internal pressure in the fuel tank starts rising . when the internal pressure in the fuel tank exceeds a predetermined value depending upon a biasing force of the spring 10a , the relief valve 10 is opened to discharge the gas in the fuel tank through the vent holes 12 and 22 and the communication holes 7 , 21 and 6 to the fuel vapor discharge pipe 4 , thus maintaining the internal pressure not greater than the predetermined value . further , when the liquid level in the fuel tank abnormally rises to the level of the second float valve 9 over the full level 16 upon cornering , etc ., a buoyancy is exerted also on the second float valve 9 . accordingly , the second float valve 9 is raised by a biasing force of the spring 15 , and is displaced relative to the first float valve 8 to close the communication hole 7 , thereby securely preventing the discharge of the liquid fuel to the fuel vapor discharge pipe 4 . referring next to fig6 there is shown a fuel vapor discharge limiting device 1 according to the fourth preferred embodiment . in this preferred embodiment , the limiting device 1 has a structure such that the second float valve 9 supported through the retainer 13a to the upper part 2a of the case 2 in the second preferred embodiment shown in fig3 is supported on the first float valve 8 as in the third preferred embodiment shown in fig4 . when the liquid level in the fuel tank becomes near a full level 16 crossing the first float valve 8 , the first float valve 8 is raised by a biasing force of a spring 14 , and the second float valve 9 is also raised with the first float valve 8 . accordingly , an upper projecting end of the first float valve 8 closes a communication hole 6 . however , since an upper projecting end of the second float valve 9 is lower in level than the upper projecting end of the first float valve 8 , the upper projecting end of the second float valve 9 does not close a communication hole 7 at this time . when the liquid level in the fuel tank abnormally rises to the level of the second float valve 9 over the full level 16 upon cornering , etc ., a buoyancy is exerted also on the second float valve 9 , so that the second float valve 9 is raised from the first float valve 8 by a biasing force of a spring 15 to close the communication hole 7 . while the invention has been described with reference to specific embodiments , the description is illustrative and is not to be construed as limiting the scope of the invention . various modifications and changes may occur to those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims .

US-21397094-A

aerosol formulations substantially free of chlorofluorocarbons , for oral and / or nasal administration , are described . the formulations comprise 1 , 1 , 1 , 2 - tetrafluoroethane , a medicament , optionally an excipient and optionally a surfactant . methods of treatment using the formulations also are described .

the formulations of the present invention all utilize propellant 134a in combination with the medicament , optionally a liquid excipient and optionally a surfactant . the excipient facilitates the compatibility of the medicament with the propellant and also lowers the discharge pressure to an acceptable range i . e . about 2 . 76 - 5 . 52 × 10 5 newton / meter 2 absolute ( 40 to 80 psia ), preferably 3 . 45 - 4 . 83 × 10 5 newton / meter 2 absolute ( 50 to 70 psia ). the excipient chosen must be non - reactive with the medicament , relatively non - toxic , and should have a vapor pressure below about 3 . 45 × 10 5 newton / meter 2 absolute ( 50 psia ). as used hereinafter the term “ medium chain fatty acids ” refers to chains of alkyl groups terminating in a — cooh group and having 6 - 12 carbon atoms , preferably 8 - 10 carbon atoms . the term “ short chain fatty acids ” refers to chains of alkyl groups terminating in a — cooh group group and having 4 - 8 carbon atoms . the term “ alcohol ” includes c 1 - c 3 alcohols , such as methanol , ethanol and isopropanol . among the preferred excipients are : propylene glycol diesters of medium chain fatty acids available under the tradename miglyol 840 ( from hüls america , inc . piscataway , n . j . ); triglyceride esters of medium chain fatty acids available under the tradename miglyol 812 ( from hüls ); perfluorodimethylcyclobutane available under the tradename vertrel 245 ( from e . i dupont de nemours and co . inc . wilmington , del . ); perflurocyclobutane available under the tradename octafluoro cyclobutane ( from pcr gainsville , fla . ); polyethylene glycol available under the tradename peg 400 ( from basf parsippany , n . j . ); propylene glycol monolaurate available under the tradename lauroglycol ( from gattefossé elmsford , n . y . ); polyglycolized glyceride of medium chain fatty acids available under the tradename labrafac hydro wl 1219 ( from gattefossé ); a surfactant optionally may be added to lower the surface and interfacial tension between the medicament and the propellant . where the medicament , propellant and excipient are to form a suspension , a surfactant may or may not be required . where the medicament , propellant and excipient are to form a solution , a surfactant may or may not be necessary , depending in part on the solubility of the particular medicament and excipient . the surfactant may be any suitable , non - toxic compound which is non - reactive with the medicament and which substantially reduces the surface tension between the medicament , the excipient and the propellant and / or acts as a valve lubricant . among the preferred surfactants are : oleic acid available under the tradename oleic acid nf6321 ( from henkel corp . emery group , cincinnati , ohio ); soya lecithin available under the tradename epikuron 200 ( from lucas meyer decatur , ill . ); polyoxyethylene ( 10 ) stearyl ether available under the tradename briji 76 ( from ici ); polyoxyethylene ( 2 ) oleyl ether available under the tradename brij 92 ( from ici ); polyoxyethylene - polypropylene - ethylenediamine block copolymer available under the tradename tetronic 150 r1 ( from basf ); polyoxyethylene ( 20 ) sorbitan monolaurate available under the tradename tween 20 ( from ici specialty chemicals , wilmington , del . ); polyoxyethylene ( 20 ) sorbitan monostearate available under the tradename tween 60 ( from ici ); polyoxyethylene ( 20 ) sorbitan monooleate available under the tradename tween 80 ( from ici ); polyoxypropylene - polyoxyethylene block copolymers available under the tradenames pluronic l - 92 , pluronic l - 121 and pluronic f 68 ( from basf ); castor oil ethoxylate available under the tradename alkasurf co - 40 ( from rhone - poulenc mississauga ontario , canada ); and mixtures thereof . the medicaments of the present invention may include any pharmaceutically active compounds which are to be delivered by oral inhalation or nasally . typical classes of compounds include bronchodilators , anti - inflammatory compounds , antihistamines , antiallergics , analgesics , antitussives , anti - anginal medications , steroids , corticosteroids , vasoconstrictors and antibiotics . specific compounds within these classes of compounds are albuterol , mometasone furoate , beclomethasone dipropionate , isoproterenol , heparin , terbutaline , rimiterol , perbuterol , disodium cromoglycate , isoprenaline , adrenaline , pentamidine and ipratropium bromide . these compounds may be utilized either as the free base , as a salt , or as a clathrate depending upon the stablity and solubility of the active compound in the specific formulation . where clathrates are utilized , p - 11 and hexane clathrates are particularly preferred . where the active compound forms a suspension , the particle size should be relatively uniform , with substantially all the particles preferably ranging between about 0 . 1 - 25 microns , preferably 0 . 5 - 10 microns , more preferably 1 - 5 microns . particles larger than 25 microns may be held up in the oropharyngeal cavity , while particles smaller than about 0 . 5 micron preferably are not utilized , since they would be more likely to be exhaled and , therefore , not reach the lungs of the patient . the formulations of the present invention may be filled into the aerosol containers using conventional filling equipment . since propellant 134a may not be compatible with all elastomeric compounds currently utilized in present aerosol valve assemblies , it may be necessary to substitute other materials , such as white buna rubber , or to utilize excipients and optionally surfactants which mitigate the adverse effects of propellant 134a on the valve components . one may optionally use an actuator device with a spacer to reduce force of the spray from an mdi . to assure uniform dispersion of the active ingredient , the formulations typically will include the following components : depending on the particular application , the container may be charged with a predetermined quantity of formulation for single or multiple dosing . typically , the container is sized for multiple - dosing , and , therefore , it is very important that the formulation delivered is substantially uniform for each dosing . for example , where the formulation is for bronchodilation , the container typically is charged with a sufficient quantity of the formulation for 200 charges . suitable suspensions may be screened in part by observing several physical properties of the formulation , i . e . the rate of particle agglomeration , the size of the agglomerates and the rate of particulate creaming / settling and comparing these to an acceptable standard . suitable solutions may be screened by observing the solubility of the medicament over the entire recommended storage temperature range . suspensions of the present invention preferably may be prepared by either the pressure filling or cold filling procedures well - known in the art . for metered dose inhalators , suspensions may be particularly preferred for efficacy and stability considerations . those skilled in the art may choose to add one or more preservative , buffer , antioxidant , sweetener and / or flavors or other taste masking agents depending upon the characteristics of the formulation . examples i - xxxii below further describe representative formulations of the present invention , some examples showing alternative formulations “ a ” and “ b ”. while the examples above have been directed at albuterol , albuterol sulfate , mometasone furoate , beclomethasone dipropionate and beclomethasone dipropionate clathrates , it is contemplated that other orally or nasally administered medicaments could be utilized . similarly , it is contemplated that excipients and surfactants other than those exemplified may be utilized . the descriptions of the foregoing embodiments of the invention have been presented for purpose of illustration and description . they are not intended to be exhaustive or to limit the invention to the precise forms disclosed , and obviously many modifications and variations are possible in light of the above teaching . the embodiments were chosen and described in order to best explain the principles of the invention and its practical application to thereby enable others skilled in the art to best utilize the invention in various embodiments and with various modifications as are suited to the particular use contemplated . it is intended that the scope of the invention be defined by the claims appended hereto .

US-15718893-A

a method for controlling acne or acneform eruptions in humans is disclosed . the method involves the topical application of one or more sebum - imbibing , sebum - retaining polymers either alone or in combination with a pharmaceutically acceptable carrier .

the following examples are set forth as a means of illustrating the present invention and are not to be construed as a limitation thereon . the polymers described in table 1 were prepared by techniques well - known to the art or were commercially obtained and then tested according to the method described in example 2 . table 1__________________________________________________________________________polymerpolymer composition * divinylbenzene ** no . % m . sub . 1 % m . sub . 2 % m . sub . 3 % m . sub . 4 ( percent by weight ) __________________________________________________________________________ 1 70 iboma 30 vs 0 . 075 2 50 iboma 50 lma 0 . 075 3 55 iboma 45 lma 0 . 075 4 50 vs 50 lma 0 . 05 5 70 vt 30 lma 0 . 075 6 60 sty 40 lma 0 . 05 7 70 sty 30 lma 0 . 075 8 64 tbs 36 lma 0 . 05 9 65 tbs 35 lma 0 . 0510 70 tbs 30 lma 0 . 0511 70 tbs 30 vs 0 . 07512 50 tbs 50 sma 0 . 0513 60 tbs 40 sma 0 . 0514 65 tbs 35 sma 0 . 012515 65 tbs 35 sma 0 . 02516 65 tbs 35 sma 0 . 0517 65 tbs 35 sma 0 . 1018 67 . 5 tbs 32 . 5 sma 0 . 0519 70 tbs 30 sma 0 . 0520 75 tbs 25 sma 0 . 0521 80 tbs 20 sma 0 . 0522 70 tbs 20 eha 10 lma 0 . 0523 70 tbs 20 eha 10 sma 0 . 0524 70 but 30 sty25 100 pbd . sup . a26 100 pbd . sup . b27 65 tbs 20 eha 10 lma 5 vt 0 . 07528 70 tbs 20 eha 5 lma 5 sma 0 . 075__________________________________________________________________________ * percent by weight of each monomer unit ( m . sub . 1 , m . sub . 2 , m . sub . 3 and m . sub . 4 ) having the following designations iboma = isobornyl methacrylate ; vs = vinyl stearate ; lma = lauryl methacrylate ; vt = vinyl toluene ; sty = styrene ; tbs = tertbutylstyrene ; sma = stearyl methacrylate ; eha = 2ethylhexyl acrylate ; but = but adiene ; pbd = polybutadiene . ** present as a crosslinking agent . . sup . a diene ® 35 ( a trademark of the firestone synthetic rubber and latex co .) . sup . b diene ® 55 ( a trademark of the firestone synthetic rubber and latex co .) a composition simulating human sebum was prepared by admixing the following constituents in the stated proportions ( percent by weight ): ______________________________________cholesterol 2 . 5oleic acid 25 . 0triolein 30 . 0cetyl palmitate 25 . 0cholesterol oleate 2 . 5squalene 15 . 0______________________________________ in order to test the capacity of a given polymer to imbibe sebum , the following procedure was performed . in a microscope well slide was placed one bead of the polymer to be tested having an initial bead diameter of from about 150 to about 450 microns . to this was added a quantity of the human sebum composition described above sufficient to cover the bead . the temperature was maintained at about 37 ° c . during the course of the experiment and bead diameter measurements were made microscopically at the initiation of the experiment and periodically throughout until the point of maximum imbibition of the sebum by the bead had been reached ( usually about 95 to about 300 minutes from the start of the experiment ). the bead diameter measurements were then utilized to ascertain the degree of imbibition of the sebum composition by the bead and are set forth in table 2 . table 2______________________________________ approximate bead initial diameters in microns bead measured at various timepolymer diameter intervals ( in minutes ). sup . b percentno .. sup . a ( microns ) 60 120 180 240 final increase . sup . c______________________________________ 1 150 153 153 -- -- 160 6 . 7 2 149 300 309 309 -- 309 107 . 4 3 151 297 310 -- -- 310 105 . 3 4 150 -- -- -- -- 330 120 . 0 5 150 270 280 281 -- 281 87 . 3 6 151 294 -- -- 316 316 109 . 3 7 149 230 -- -- 238 238 59 . 7 8 150 311 320 322 -- 322 114 . 7 9 150 303 317 317 -- 317 111 . 310 148 -- -- -- -- 312 110 . 811 150 220 245 264 270 275 83 . 312 153 331 -- -- -- 340 122 . 213 150 -- -- -- 336 336 124 . 014 152 -- -- 430 435 435 186 . 215 153 -- -- -- -- 345 125 . 516 152 -- -- -- -- 387 154 . 617 148 -- -- -- -- 278 87 . 818 148 310 -- -- -- 320 116 . 219 150 310 -- -- -- 324 116 . 020 149 285 318 -- -- 322 116 . 121 148 252 -- -- -- 303 104 . 722 150 300 318 -- -- 318 112 . 023 150 -- -- -- -- 310 106 . 724 381 638 683 -- -- 705 85 . 025 428 645 675 -- -- 675 57 . 726 353 818 855 -- -- 855 142 . 2______________________________________ . sup . a from table 1 . . sup . b where no value is stated , a diameter measurement was not made at the time specified . . sup . c value represents the percent increase of the final bead diameter from the initial bead diameter . ## str1 ## as can be seen from the data in table 2 , all of the polymers tested increased in diameter due to imbibition of the sebum composition . significantly , of the twenty - six polymers for which test results are shown in table 2 , all but seven of the polymers tested doubled in diameter from the initial bead diameter . the polymers designated as polymer no . 27 and polymer no . 28 in table 1 were tested for their ability to absorb the composition simulating human sebum using the testing procedure substantially as described in example 2 ; the test results are shown in table 3 . table 3______________________________________polymer no . 27 polymer no . 28 approximate approximate bead beadtime . sup . a diameter time . sup . a diameter ( in minutes ) in microns ( in minutes ) in microns______________________________________ 0 . sup . 85 . sup . b 0 . sup . 93 . sup . b 5 125 18 31023 158 43 29049 160 74 29075 168 126 290122 160 1230 182175 162 1478 1851283 1651526 162______________________________________ . sup . a length of time the polymer bead being tested was exposed to the composition simulating human sebum . . sup . b initial diameter of polymer bead prior to contact with the composition simulating human sebum . the data in table 3 shows that polymer beads , representative of polymer no . 27 and polymer no . 28 , increased in diameter due to imbibition of the sebum composition . the decrease in polymer bead diameter for polymer no . 28 at sebum composition exposure times of 1230 and 1478 minutes ( i . e ., decrease in polymer bead diameter at 1230 and 1478 minutes in comparison to polymer bead diameter at sebum exposure times of shorter duration ) is probably due to the linear component of the polymeric composition migrating under conditions of maximum swelling for an extensive time period which allows the polymer matrix to collapse to some extent ; typically , deswelling can be minimized by increasing the amount of crosslinking agent which increases the integrity of the polymer matrix .

US-67917384-A

a silicon solar cell includes a first silicon layer with an emitter layer which has a thickness in a range of 50 nanometers to few hundreds nanometers . the emitter layer has at least one region which is porosified by chemical or electrochemical etching , wherein at least one part of the porosified region is embodied as metal silicide layer . a second silicon layer is disposed underneath the emitter layer , with the metal silicide extending from a top side of the emitter layer in a direction to the second silicon layer . at least one metal layer is applied on the metal silicide layer .

throughout all the figures , same or corresponding elements may generally be indicated by same reference numerals . these depicted embodiments are to be understood as illustrative of the invention and not as limiting in any way . it should also be understood that the figures are not necessarily to scale and that the embodiments are sometimes illustrated by graphic symbols , phantom lines , diagrammatic representations and fragmentary views . in certain instances , details which are not necessary for an understanding of the present invention or which render other details difficult to perceive may have been omitted . turning now to the drawing , and in particular to fig1 , there is shown a cross - sectional view of a wafer , generally designated by reference numeral 20 and including an n - doped silicon layer 1 and a p - doped silicon layer 2 . the n - doped layer has a height of e . g . 200 nanometers and acts as an emitter layer , while the p - doped layer as carrier material ( bulk ) has a height of 100 to 200 micrometers . an antireflection layer 3 composed of silicon nitride , for example , is formed on the n - doped layer 1 , said antireflection layer having a height of e . g . 100 nanometers . the antireflection layer 3 is not absolutely necessary , but is advantageous since it serves to reduce a reflection of the light radiated in onto the n - doped emitter layer 1 . in the case of the embodiment illustrated in fig1 , a masking layer 4 is applied on the surface of a side of the wafer 20 which has the emitter layer 1 . since an antireflection layer 3 is provided in the case of this embodiment , the masking layer 4 is not situated directly on the n - doped silicon layer 1 , but rather on the antireflection layer 3 . the masking layer 4 has at least one free space 5 that extends as far as the layer situated underneath , the antireflection layer 3 in the case of this embodiment . the free space can arise as a result of patterning of the masking layer . however , it is likewise possible for the masking layer to be applied to the antireflection layer with a free space already present . if the wafer is subjected to an etching medium that passes into the free space 5 , in a second method step the etching medium is allowed to act until the antireflection layer has been completely etched away at the bottom of the free space 5 , as shown in fig2 . in the event of longer action of the etching medium , the latter also attacks the layer situated underneath , here the n - doped silicon layer 1 , as shown in fig3 . this n - doped silicon layer 1 thereupon becomes porous with regard to its structure , as indicated by reference symbol 7 . in the case of a short time of action of the etching medium on the n - doped silicon layer 1 , the etching attack can be delimited in terms of its depth . this is additionally supported if the etching process is effected electrochemically and if the n - doped layer 1 has a region which is highly n - doped and is weakly n - doped underneath . the highly n - doped region is attacked relatively rapidly by an etching medium , while the region arranged underneath is attacked only little . what can thus be achieved is that the porous structure does not reach the boundary region 8 between n - doped layer and p - doped layer , with the result that an electrical short circuit can be avoided . if a current - voltage curve is recorded during the porosification , the reaching of the lightly n - doped layer can be identified in a simple manner by virtue of the fact that the voltage rises . after the porosification , in a further method step , a first metal layer 9 , e . g . nickel , is introduced into the porous structure 7 . given appropriately chosen process parameters , the first metal layer 9 can also be applied even further , with the result that the first metal layer 9 is provided not only within but also on the porous structure 7 , as shown in fig4 . the metal layer 9 is situated within the free space 5 present from the masking layer 4 and has a width corresponding to the width of the free space 5 . in the next method step , as shown in fig5 , in the case of the first embodiment , the masking layer 4 is removed . this is followed by heating of at least the porosified silicon layer together with the first metal layer , with the result that a metal silicide layer 10 , e . g . a nickel silicide , forms , as shown in fig6 . on account of the porous structure 7 , good adhesion between the metal 9 and the silicon 1 arises . in a further method step , as shown in fig7 , a second metal layer 11 can be constructed onto the first metal layer 9 , whereby a solar cell 30 is formed . as an alternative to the fifth method step in the case of the first embodiment , in which the masking layer is removed , in the case of a second embodiment it is possible for a second metal layer 11 to be applied to the first metal layer 9 with a masking layer 4 still present , as shown in fig8 . this is followed , in a further method step , by the heating of at least the porosified silicon 7 with the first metal layer 9 , as shown in fig9 , with the result that a metal silicide 10 is formed . the masking layer 4 is thereupon removed , with the result that , in the case of this second embodiment as well , a solar cell 30 is formed , as shown in fig7 . if the masking layer 4 does not withstand without damage the temperature arising during the heating for forming the metal silicide , it is removed before the heating step . fig1 shows a third embodiment of the wafer after a first method step . the wafer has a silicon layer which can simultaneously act as an antireflection layer . in a first method step , the entire surface of the silicon layer 1 is etched , with the result that the layer is porosified . afterwards , a masking layer 4 is applied , which is already patterned or still has to be patterned . a region without masking layer thus arises , which region can be coated with a first metal layer 9 and a second metal layer 11 . this is followed by heating of the silicon layer 1 and the first metal layer 9 , with the result that a metal silicide 7 forms , as shown in fig1 . after the removal of the masking layer 4 , the two metal layers 9 and 11 remain on the surface , whereby the solar cell according to the invention is formed . while the invention has been illustrated and described in connection with currently preferred embodiments shown and described in detail , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit and scope of the present invention . the embodiments were chosen and described in order to explain the principles of the invention and practical application to thereby enable a person skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated .

US-201113205133-A

a support for machinery , and for isolating vibration from the machinery , comprises a plurality of mounts , each mount comprising an elastomeric block for completely supporting the static load of the machinery , and active isolation means comprising inertial shakers arranged to maintain essentially a zero stiffness of the mount to excited structural resonances over a desired frequency band above said mount resonant frequency , and to modify the transmission of out of balance forces to the hull . a control system coupled to the inertial shakers includes a means for applying damping force signals , such as to dampen structural resonances , to inhibit the onset of resonant vibration .

the motions of a flexible structure can be described as a superposition of normal modes . these consist of the six zero frequency rigid body modes : three translational modes , surge , sway and heave ; three rotational modes , roll , pitch and yaw , and the finite frequency structural resonant modes . if the composite mounts of a mounting system for rotating machinery are made to act on the six rigid body modes only , while simultaneously ignoring displacements due to excited resonances , the force transmissibility , for the heave mode , would be as shown by the monotonic descending line curve in fig1 . it will be seen that near and below the 5 hz mount resonant frequency the force transmissibility is unchanged but above this frequency there is a major improvement in vibration isolation . all the structural resonant peaks , and hence the associated acoustic signature , have disappeared and the force transmissibility is systematically falling at the rate of db / decade . in order to achieve this the mounting system according to the invention must apply a force that is equal to an external global demand and is independent of any local displacement ( i . e . effectively giving the mount “ zero stiffness ” to local displacements ). this can be achieved by using local controllers , one for each mount . these can ensure a “ zero stiffness ” to any local vibration , including excited structural resonances , so that they cannot transmit a force directly through an actuator to the hull . thus the only force transmitted to the hull is the external global demand force . referring to fig3 , the displacements and velocities of the six rigid body modes are determined as at 30 by instrumenting a support system with an array of accelerometers , and proximiters , each of which can measure the local displacement , and hence the local velocity , at its attachment point . this output data can then be processed , by a matrix transformation , to determine the displacements and velocities of the six rigid body modes only . the processing exploits the laws of conservation of linear and angular momentum to filter out , as at 32 the contributions due to excited resonances . from the remaining displacements of the six rigid body modes one can then calculate as at 34 , using suitable mathematical models , modal restoring forces and torques for each of the six rigid body modes , to return them to their equilibrium positions in a well - controlled way . if a standard passive stiffness function is used for calculating the rigid body modal restoring forces , then the force transmissibility is shown by the descending line in fig1 . finally one calculates a set of “ demand ” forces as at 36 , one for each composite mount , to generate the required modal forces and torques on the machinery &# 39 ; s six rigid body modes . these demand forces are applied to an array 38 of mounts of the invention for applying restoring forces . this approach of “ zero stiffness ” actuators , coupled with a modal global control law , forms the basis of a mounting system of the invention . it aims to filter out the effects of resonances at the global observation stage and to use the local controls to generate the required forces on the rigid body modes while preventing excited structural resonances , or local vibrations , from generating forces directly on the hull . the result is that the only forces generated on the hull are those needed to return the machinery &# 39 ; s rigid body modes to their equilibrium positions in a well - controlled way . the method employed in the present invention to provide “ zero stiffness ” is to have an active element in parallel with a passive element and by designing its local controller to actively cancel the forces that would otherwise be generated by the passive element alone in response to local displacements . this local controller must also ensure that the force on the machinery , as measured by a strain gauge or load cell or other equivalent force - measuring device , is equal to an external “ demand ” while the actuator maintains its “ zero stiffness ” to local vibrations . in particular , it must not transmit any forces directly to the hull from an excited structural resonance . referring now to fig9 , this shows a mounting system , in accordance with the invention , for moving ( rotating , reciprocating etc ) machinery conceptually indicated as at 94 . the machinery is mounted on a rigid open framework raft 96 , and the raft is disposed on a rectangular array of six mounts 98 , each as indicated in fig8 . load cells 64 of each mount are coupled to a hull structure of a marine vessel ( not shown ). marine machinery 94 not only includes the main propulsion units but also electrical generators , lubrication pumps , hydraulic systems , compressed air generators etc . these are commonly all mounted hard mounted on the single raft 96 . all this machinery , along , with its raft , constitute the structure supported by the mounts . it is resonances within this entire supported structure , including the main propulsion machinery itself , that gives the vessel its acoustic signature and which is , in accordance with the invention , isolated from the hull . referring to fig5 showing a perspective view of a mount according to the invention , a circular raft mount plate 50 is provided for coupling the mount to raft 96 that supports rotating machinery . the plate is coupled to a triangular actuator mount plate 52 , the apices of which provide fixing points for three electromagnets 54 . each electromagnet comprises an upper mounting plate 56 , coupled by means of an armature to the body 58 of the electromagnet . the base of each body 58 is secured to a further triangular actuator mount plate 60 . plates 52 , 60 are secured to a central part of the actuator , comprising a passive element 62 formed as a block of elastomer , which is mounted between plates 52 , 60 . element 62 is designed to support the weight of the machinery load by itself . the passive element 62 is mounted on a three - axis load cell 64 to measure the compression and shear forces generated on the machinery and changes in these forces due to local displacements . the active elements , that is the electromagnets 54 , must be able to generate a force to cancel the forces that would otherwise be generated by the passive element alone in response to local displacements . this requires a minimum of three elements arranged as shown , angled toward the central axis 66 of the mount , to define a tetrahedral configuration with the axes of the armatures 68 intersecting at an imaginary point 69 . the purpose of the tetrahedral configuration is to be able to generate a net force of a given magnitude and a given direction in space . this enables vertical and shear components of the force that would otherwise be produced by the local passive element to be cancelled — zero stiffness . finally the net translational forces and torques on the rigid body modes are generated as the sum of the force and from the complete array of mounts . the mounting system of the invention shown in fig9 requires fewer electromagnets than the known system referred to above and , since the total mass of the machinery is supported on the passive elements , the active elements are not required to generate very large forces . further , if one accepts the performance of the passive system alone for frequencies at and below the mount resonant frequency , it is possible to design the global control algorithms to only modify the mount performance for frequencies greater than the mount resonant frequency , and to accurately match that of the passive elements in below this frequency band . this will ensure that at and below the mount resonant frequency , the performance is controlled by the passive elements alone , while above these frequencies the global control algorithms can be designed to modify the mount &# 39 ; s vibration isolation performance as required . further , the static loads remain completely supported by the passive elements alone even when the active control is switched on and this further reduces the forces required from the active elements . an important consequence of this is that the forces generated by the active elements no longer require a steady component . in order to maintain zero stiffness to local vibrations , including excited resonances , only alternating forces , of the appropriate frequency , are required . the force demands for the active elements are set by two considerations . firstly there is the need to generate the restoring forces on the rigid body modes and secondly the need to maintain zero stiffness to excited resonances . the restoring forces on the rigid body modes will be comparable with the out - of - balance forces generated by the moving machinery at frequencies greater than the mount resonant frequency . with reasonably well - balanced machinery these forces can be less than 1 / 500th of the static force of gravity . large marine machinery is commonly supported on an appropriate number of rubber mounts each of 20 tonne capacity . thus this would require electromagnets capable of generating total forces up to ± 400 newtons [± 20 , 000 × 10 / 500 ]. the actuators in fig5 are inclined at 30 ° to the vertical ; each actuator would need to generate a maximum force of 308 newtons [ 2 × 400 /( 3 × cos 30 )]. there is also a requirement to maintain zero stiffness to excited resonances . as indicated in fig1 , these can generate large forces on the hull since the associated mechanical amplification can result in large vibration amplitudes at the mounts . if excited resonances do generate large amplitude displacements at a mount , larger electromagnets would be required to maintain zero stiffness . as regards the control system , shown schematically in fig3 , for the mount of fig5 , the large non - linearity of the electromagnets makes a simple feedback control unsatisfactory . to overcome this , a more complex local control is needed as indicated in fig6 and fig7 . the strategy involves both feed - forward of the relative mount displacement and feedback of the transmitted force . for small displacements , the main non - linearity comes from the behaviour of the electromagnet , however , this is static and an accurate model can be derived . as a result the system can be linearised using model inversion techniques . following an inversion of this type , standard linear methods can be applied to the residual dynamics in order to meet the local controller objectives . the local controller uses the demand force and the relative displacement to generate , as accurately as possible , the current demand for the electromagnet , via a digital switching amplifier , to actively cancel the force that would otherwise be generated by the passive element alone . the details of the local controller are shown in fig7 . the local controller also measures the difference between the demand force and the measured force . this is fed back to a local controller , via a feedback compensation unit , to minimise any residual errors . where , in accordance with the invention , one accepts the performance of the passive system alone , for frequencies at and below the mount resonant frequency , the forces generated by the active elements no longer require a steady component . this opens up an alternative design for a mount where the electromagnets of fig5 are replaced by pairs of electrodynamic or hydraulic inertial shakers , as shown in fig8 , to generate the equal and opposite forces required to compress or extend the passive element to give the mount a zero stiffness . referring now to fig8 , this a perspective view of a second preferred embodiment of a mount according to the invention , where similar parts to those of fig5 are denoted by the same reference numeral . in fig8 , electrodynamic inertial shakers 70 are employed as active elements ( a detailed view of the internal construction of one form of such a shaker is shown in fig4 , and described below ). an upper set of three shakers 70 a are mounted on upper mounting plate 52 , and a lower set of three shakers 70 b are mounted on a lower triangular mounting plate 72 , so as to so as to oppose the movement of the upper set of shakers , whereby the shakers can exert compressive and tensile forces between plates 54 , 72 . the axes of the inertial shakers intersect a single point on the axis of the mount . each shaker has a mounting plate 56 coupled to an armature 74 that slides in a shaker body 76 . there are three advantages of using inertial shakers in this way . firstly , there is no longer a need to pre - stress the passive element , since inertial shakers can only generate alternating forces . secondly , inertial shakers are much more linear in their operation than electromagnets so the design of the local controllers becomes simpler and their accuracy better . thirdly they are more easily installed and are readily available as commercial items . a schematic form of an electromagnetic electrodynamic inertial shaker is shown in fig4 . fig4 shows an electromagnetic electrodynamic active inertial shaker 40 , which comprises a mass 41 consisting of a cylindrical permanent magnet whose magnetic axis is vertical . this mass is secured by a bolt 44 to two diaphragms 42 which are fixed to the housing 45 . thus the mass can move up and down in the vertical direction with the diaphragms 42 acting as springs . the permanent magnet 41 is surrounded by an electrical coil 43 , whose axis is also vertical and which is attached to the housing 45 . when an alternating current is passed through the coil , the permanent magnet will oscillate vertically thus producing an oscillating vertical inertial force on the housing . the alternating current is provided from the overall control system for the mount , and generate stiffness functions . the force demands for inertial shakers are set by the need to generate the restoring forces on the rigid body modes and secondly the need to maintain zero stiffness to excited resonances . returning to the case of reasonably well - balanced machinery , cited above , these forces can be less than 1 / 500th of the static force of gravity . thus to convert a 20 tonne capacity passive element to a mount the inertial shakers must be capable of generating total forces of 400 newtons . the mounts in fig8 are inclined at 30 ° to the vertical ; each mount would need to generate a force of 77 newtons [ 400 /( 6 × cos 30 )]. this figure is a quarter of the maximum force of 308 newtons for the electromagnets of fig5 . the more demanding requirement may be the need to maintain zero stiffness to excited resonances . if excited resonances do generate very large amplitude displacements at a mount , very much larger forces would be required to maintain zero stiffness . one possibility may be to use small hydraulic shakers as these can generate forces of 1 , 000 newtons , nearly 13 times larger than the figure of 77 newtons required for dealing with out - of - balance forces alone . the stiffness functions for the shakers are electronically generated so one can use any causal and stabilising function . it is thus possible to improve the isolation further from that shown by the descending curve in fig1 . for example the more steeply descending curve in fig1 shows the response to a function whereby the high frequency roll - off rate is improved to db / decade and the mount resonance is slightly damped . the other curves are taken from fig1 for comparison . in practice , noise in the sensors , will limit the maximum performance that can be achieved , but one would expect to achieve a substantially better performance than that of fig1 . clearly the mounting system of the invention requires fewer electromagnets than the known system referred to above and , since the total mass of the machinery is supported on the passive elements , the active elements are not required to generate very large forces . further , if one accepts the performance of the passive system alone for frequencies at and below the mount resonant frequency , it is possible to design the global control algorithms so that they only modify the mount performance for frequencies greater than the mount frequency , and to accurately match that of the passive elements in below this frequency band . this will ensure that the static loads remain completely supported by the passive elements alone even when the active control is switched on and this further reduces the forces required from the active elements . an important consequence of this is that the forces generated by the active elements no longer require a steady component . in order to maintain zero stiffness to local vibrations , including excited resonances , only alternating forces , of the appropriate frequency , are required . this can be achieved by using electrodynamic or hydraulic inertial shakers . there are three advantages of using inertial shakers in this way . firstly , there is no longer a need to pre - stress the passive element in order that changes in the force generated can be either positive or negative depending on increasing or decreasing the current through an electromagnet . secondly , inertial shakers are much more linear in their operation than electromagnets so the design of the local controllers becomes simpler and their accuracy better . thirdly they are readily available as commercial items . the array of accelerometers mounted on the machinery for detecting rigid body motions is also used to detect the onset of a problem resonance , i . e . one that generates large amplitude displacements at one or more of the mounts . this merely involves an additional matrix multiplication with weighting factors chosen to pick out this resonance . now the upper set of three inertial shakers 70 a shown in fig8 can also be used to inject damping forces , 90 ° out of phase with the modal displacement , to damp this resonance , in the manner disclosed in copending application wo 01 / 84012 . the resonance becomes critically damped when the energy extracted from it , in this way , is just equal to the energy coupled into it from the out - of - balance forces so relatively small damping forces should suffice . this additional damping can be added simply as a “ software patch ” after the problem has been discovered — a further potential cost saving . it will be noted that electromagnets may not be used for selective damping , since if electromagnets attempt to selectively damp excited resonances they will generate equal but opposite forces on the hull and the machinery and thus forces on the hull at the resonant frequency . a control system of the preferred embodiment is shown in fig1 that is an “ overlay ” of the system of fig3 , and specifically directed to the issue of generating appropriate damping forces . similar parts to those of fig3 are denoted by the same reference numeral . fig1 illustrates the basic principal of selective damping , in this case for damping two resonances . the acceleration data derived at 30 is processed , by a matrix transformation , to determine the modal velocities as at 100 of the problem resonances . from these two modal velocities one can calculate modal damping forces as at 102 from which one finally calculates a set of local “ demand ” forces as at 36 , one for each mount , to generate the required modal damping forces the local controllers for the mounts of fig8 are as shown in fig1 . in the absence of a “ selective damping control demand force ”, the upper mount inertial shakers 70 a and lower mount inertial shakers 70 b are driven to maintain zero stiffness against local vibrations ( relative displacements ) while maintaining the external force demands to control the rigid body motions , as determined by “ rigid body control demand force ”. however , the “ selective damping control demand force ” generates an additional force , via the above mount shakers only , on the mounted machinery to damp the specific resonances . the applied raft force is the force generated on the raft while the transmitted force is the force transmitted to the hull . these two forces can differ since the upper inertial shaker can generate an additional damping force that is not transmitted to the hull . it is also possible to tailor the force transmissibility to further attenuate the transmission of a specific “ problem ” out - of - balance force by the use of a “ notch filter ”. an example of this is shown in fig1 where the curve shows a sharp notch filter , centred on 30 hz , and the monotonic curve is taken from fig1 for comparison . this additional notch filter can be added simply as a “ software patch ” to step 100 of fig1 after a problem has been encountered — a further potential cost saving . the mounting system of the invention can be calibrated in situ . one can use the inertial shakers , to inject disturbance forces while the machinery is supported on the passive elements alone . an analysis of the acceleration responses , along with measurements of the force inputs , makes it possible to derive all the parameters needed by the entire electronic control system including any additional weighting factors for use in selectively damping problem resonances . as regards the construction of the passive element of the mount of the invention ( 62 in fig5 ), measurements were made of the passive force transmissibility of three candidates for the passive elements , namely steel coil springs , lightly damped rubber and more heavily damped neoprene . the results are shown in fig1 and 15 . it will be seen from fig1 that the steel coil springs have the lowest internal damping and hence the largest mount resonance . in the case of steel springs , fig1 not only displays the mount resonance ( around 10 hz ) but also higher frequency spring resonances at about 150 , 340 and 360 hz . the absence of resonances in rubber and neoprene results in much lower force transmissibilities at frequencies above 150 hz . below − 60 db the signals fall beneath the noise floor of the instrumentation . in all cases there is a resonance at around 250 hz . this is a resonance in the load cell that causes the force transmissibility to rise . however , the roll - off rate , above 250 hz , is significantly improved , in the case of rubber and neoprene , due to the additional high frequency isolation produced by this resonance — it acts as a double mounting system . in the case of steel springs this improvement is masked by resonances in this region . it is clear that the use of elastomers results in a better overall performance than steel coil springs . natural rubber has a greater roll - off rate in the region immediately above the mount resonance and is often preferred in marine environments due to its superior tear strength . however , the critical issue is how well the response of the three candidates can be modeled so that the actuator can be controlled accurately . a test of the modeling accuracy is shown by a comparison of the measured and predicted force outputs for a random excitation . fig1 shows this comparison for the rubber passive elements . the modeling accuracy for steel springs and neoprene were broadly similar but their detailed precision was less good , particularly in the case of the steel springs where the errors were greatest near the spring &# 39 ; s resonant frequencies .

US-91076906-A

a system and method which allows users to compose search free mail via a native identifier scheme . users access a plurality of native oriented domains identified by a country code . the system is connected to an internet or web - based environment as a global registered internet host for composing search free user e - mail and allowing government and private industries single point transmission access via a native user &# 39 ; s mailbox . the network system is operable to be connected with a plurality of normalized native domains which normalizes transaction invoices between distinct native domains independent of language differences via arabic standardized numeric codes . each native domain is a architectural product of a parent or global host identified as iqiqiq . com or iqiqiq . 123 for exemplary purposes only . a product or native domain of the global host for korea would be identified accordingly as iqiqkr . 123 , etc . users who are native to korea would access their native domain via the global host by a method of doing business which utilizes native identifiers , ein #, driver &# 39 ; s license # and / or a telephone #).

the present invention is directed to a global mail system 9 connected to an internet or web - based environment for composing search free user e - mail . the preferred embodiments of the present invention are depicted in fig1 - 5 , and are generally referenced by numerals 6 and 7 , comprising : as diagrammatically illustrated in fig1 a network system 10 is operable to be connected with a plurality of normalized native domains 12 a , 12 b , 12 c , 12 d , 12 e , 12 f , 12 g and 12 h , etc ., respectively . each respective native domain 12 a , 12 b , 12 c , 12 d , 12 e , 12 f , 12 g and 12 h provide computer user interfaces accessible only via native identifiers 14 ( i . e social security number (#), driver &# 39 ; s license #, ein #, and a telephone #) as shown if fig2 a . form or interactive storage means 20 is a user database interface within the network 10 and respective native domain 12 which retains in storage data such as a country designation or code 16 , business name 18 and personal user data 19 ( i . e sex , age , occupation , annual income and hobby ) at least . the selective native identifier is recorded within three fields ( i . e . area # 15 a , class # 15 b and native # 15 c ). the resulting field is a permutation of user specific input data which is used to determine a native mail number . as diagrammatically illustrated in fig2 b , form or means 40 is shown , and is generated in a similar fashion as described for form 20 in fig2 a . numerous software utilities can be used to develop similar form - like database interfaces . once transaction data is obtained by a user confirmation of the native user input , data is stored in a conditional ( yes or no ) storage register 42 including input registers for user defined passwords 44 a and 44 b . register 44 b affirms a previous password entry and home mail registration concludes with the production of a home mail address via register 46 germane to a respective native domain 12 and corresponding to a user &# 39 ; s native identifiers 14 . the country code scheme used for various countries identified as native domains 12 such as china ( ch ) 12 a , japan ( jp ) 12 b , honk kong ( hk ) 12 c , united states ( us ) 12 d , korea ( kr ) 12 e , germany ( dd ) 12 f , russia ( ru ), 12 g , indonesia ( in ) 12 h , etc is preferably the wipo standard . once the native user is registered a clickable link 48 activates a webpage resource for the registered user . as diagrammatically illustrated in fig2 c , another on - line database register form or means 60 is shown which provides a search register on occupation 62 , name of business 64 and native identifiers 14 or generated fields 15 a , 15 b and 15 c . text search routine of various sorts are readily available for accessing specific data as herein disclosed , and similar capability can beg provide for generating results 66 according to specific search commands . as diagrammatically illustrated in fig3 the system and method for composing search free home mail according to the first embodiment is shown for a native domain 12 d which identifies united states wipo standard . a home mail address is identified as exemplary using a native social security number . the preferred logical designation for the domain 12 d includes an identifier iqiq common with the global network 10 ( iqiqiq . com ) as previously discussed above . this particular identifier scheme will become more readily apparent , particularly in resolving business transaction between two distinct native domains 12 . as shown in fig3 the iqiqus native domain 12 has a single point data , transmission access point 72 for receiving and transmitting selective data ( i . e . mail 74 , taxes 76 , utilities 77 , finances 78 or similar invoices ) from government 80 and private corporations 82 . in a similar fashion , each respective plurality of normalized native domains 12 will have a single communication connection point 72 for transmitting and receiving selective data via module 81 . other home mail features for each respective native domain 12 such as iqiqus 12 d include a distinct web design feature 82 , mail box 84 , telephone or alphanumeric touch pad capability 86 , fax 88 , on - line shopping 89 and scheduling 90 including domain registration services 92 . similar capability is developed for business , personal and family mail as indicated in module 91 . as indicated by dotted lines l and s , a first company invoice 100 is shown which provides internal messaging capability via element 101 for concurrent interactive communication with a company . in such an instance data can be resubmitted via a native user mailbox 84 while on - line . as shown in fig4 a similar invoice transmissions are illustrated via a second invoice 102 with purchase date from a target company and a third invoice 104 bank transaction data thereon . such data can be selectively transmitted by a government of private corporation to any user within the network system 10 via home ( business , family , personal , etc .) mail through a single data transmission point 72 . this interface includes internal messaging capabilities as identified in fig3 for concurrent and real time activity between at least two distinct native users , and / or a native user and a company . the native domains can be identified as a plurality of virtual host systems and / or hub , systems interconnected within a an internet or web - based system . normalization business transactions are directed between , distinct selective native domains eg . ( 12 d and 12 e ) where language differences can be a potential conflict . as illustrated in fig4 b a business translation is shown between invoices of the designated domains 12 d and 12 e identified as invoices 12 d 1 and 12 e 1 . invoice 12 e 1 is an equivalent of invoice 12 d 1 differing only by native language . ( i . e . a ( korean )= company / name , b ( korean )= address , ( korean )= invoice / date , d ( korean )= product , etc .). arabic numeral normalization between native domains has virtually eliminated effects of language barriers between registered native users for 1 business transactions . as shown in fig5 a second embodiment 7 of the invention is disclosed having password protective measures 106 and 108 which provide a certain level of security for authorized business transactions . other features of this embodiment are similar to the first embodiment 6 as shown in fig3 except that web design capability 82 deployed during registration without the need for password authorization required for searching for registered native users . another variation is indicated by invoice 110 transactions via the web page 48 . such features are beneficial particularly for business and personal mail setups . other features such as stock options are other identifiable features available for registered users according to the present invention although such features have not been shown . other advantages of the system and method of composing search free mail within an internet or web - based environment for a variety of native users for domestic and international transmission comprise the general steps of : ( a ) registering at least one global host for internet based applications and a native computer user interface , ( b ) configuring said host with a plurality of native domains for native user registration , the plurality of domains having a native country code indicator and a common identifier indicative of said at least one global host , ( c ) providing a mail registering procedure for native user input data , the registering procedure including : ( 1 ) inputting selective native user data , said data being native identifiers comprising a social security number , driver &# 39 ; s license number , ein number and a telephone number , ( 4 ) inputting personal native information of sex , age occupation , annual income and a hobby , ( d ) providing a mail registering confirmation procedure for native user input data , the confirmation registering procedure including : ( 1 ) selecting between two alternatives yes or no for confirming native number inputs according to the providing step ( c ) ( 1 ), ( e ) determining a home mail address and obtaining a mail box germane to a native domain of said plurality of native domains , wherein said domain has an identifier portion common to said at least one global host , ( f ) entering a webpage related to said home mail address of the determining step ( e ). ( g ) providing a searching procedure for locating data on a native user , said searching procedure includes : the method of composing search free mail according to according to step ( b ) is at least one of a home mail , personal mail and family mail domain . the entering step ( f ) further comprises decoupled links or steps for : ( f ) ( 1 ) entering a web design page , ( f ) ( 2 ) entering a telephone page , ( f ) ( 3 ) entering a facsimile page , ( f ) ( 4 ) entering a shopping page , ( f ) ( 5 ) entering a scheduling page . other alternatives to the method of composing search free mail within an internet or web - based environment for a variety of native users for domestic and international transmission include the steps of : ( a ) registering at least one global host for internet based applications and a native computer user interface , ( b1 ) configuring said host with a plurality of native domains for native user registration , the plurality of domains having a native country code indicator and a common identifier indicative of said at least one global host , and ( b2 ) selectively linking at least two of said plurality of native domains for normalized business transactions , said transactions being decoded normalized data such that said transaction between two distinct native domains is independent of native language . ( c ) providing a mail registering procedure for native user , input data , the registering procedure including : ( 1 ) inputting selective native user data , said data being native identifiers comprising a social security number , driver &# 39 ; s license number , ein number and a telephone number , ( 4 ) inputting personal native information of sex , age occupation , annual income and a hobby , ( d ) providing a mail registering confirmation procedure for native user input data , the confirmation registering procedure including : ( 1 ) selecting between two alternatives yes or no for confirming native number inputs according to the providing step ( c ) ( 1 ), ( e ) determining a home mail address and obtaining a mail box germane to a native domain of said plurality of native domains , wherein said domain has an identifier portion common to said at least one global host , ( f ) entering a webpage related to said home mail address of the determining step ( e ). ( g ) providing a searching procedure for locating data on a native user , said searching procedure includes : ( h ) providing search results . the method of composing search free mail according to steps ( b1 ) and ( b2 ) is at least one of a home mail , personal mail and family mail domain , and provides a single communication link or point for government and private industry transmissions , said transmissions include mail , tax , utility and finance data transmissions . the determining step ( e ) further can further include password protection entry to the single communication link or point for selective data transmissions as similarly addressed above . for native language differences the selective step ( b2 ) can include normalized decoding of business transactions between at least to distinct native domains via arabic numbers . it is to be understood that the present invention is not limited to the embodiments described above , but - encompasses any and all embodiments within the scope of the following claims .

US-54252100-A

an electrophotographic recording material is described that comprises an electrically conducting base layer and a photoconductive system deposited thereon , which system comprises an optional insulating intermediate layer , a layer containing a charge - generating compound , and a layer containing a charge - transporting compound mixed with binders , along with any sensitizers , acceptors and usual additives . the photoconductive system contains , as acceptor additive , one or more monomeric or polymeric compounds that have electron - attracting substitutents and that are selected from the group consisting of anthracene , acridine , the anhydrides of phthalic acid , maleic acid , pyromellitic acid , benzophenonetetracarboxylic acid , and the polymers of vinyl chloride , vinylidine chloride and nitrocellulose , in a quantity of 0 . 2 to 10 % by weight based on total coating weight . after erasure of the latent electrostatic image , the recording material has a low residual charge , even when operated cyclically . background imaging is thereby avoided .

it has been discovered that photoconductive systems which have very good photosensitivity are improved in their residual discharge properties by the present invention . this effect may be described as follows : in the case of initial cyclic copying , the photoconducting layers are very rapidly discharged , in accordance with their high sensitivity , which is confirmed by the low half - value energy . under certain copying conditions , however , the layers still have an insufficiently erasible residual charge which increases with an increasing number of cycles , gradually resulting in undesirable background imaging . this effect is prevented by the present invention . the above - decribed compounds of the present invention are preferably used in an amount ranging between 0 . 5 and 6 % by weight , based on the total coating weight . these acceptor additives produce a reduction of the residual discharge in a photoconductive system , and also effect an improved constancy of the cyclic parameters , without imparing other good electrophotographic properties , such as photosensitivity , charge acceptance and dark decay . the acceptor additives are preferably contained in the layer containing the charge - transporting compound . but it has been found that the additives also markedly improve the electrophotographic properties if they are added individually to the first coating of an insulating intermediate layer in contact with the charge - carrier generating layer . the structure of electrophotographic recording material within the present invention is explained diagrammatically with reference to the attached fig1 to 3 . in each case , element 1 is an electrically conducting base layer , element 2 is a charge - carrier generating layer and element 3 is a charge - transporting layer . element 4 is an optional insulating intermediate layer , and element 5 is a charge - carrier generating layer which is comprised of a pigment dispersed , for example , in a binder . aluminum foil or , if appropriate , transparent polyester film which is aluminum - clad or is coated with aluminum by vapor deposition or sputtering , can be used as the electrically conducting base layer . but any other carrier material rendered sufficiently conductive ( for example , by means of carbonblack or metal powder ) can also be used . the photoconductive system can also be arranged on a drum , on flexible endless belts , for example of nickel or steel , or on plates ( for example , of aluminum ). an insulating intermediate layer and , if appropriate , a thermally , anodically or chemically generated aluminum oxide intermediate layer ( see fig2 element 4 ), is introduced with the objective of reducing charge carrier injection in the dark from the metal into the photoconductive layer . on the other hand , the insulating layer should not prevent charge flow during the exposure process . the intermediate layer acts as a barrier layer and also serves , as needed , to improve adhesion between the base layer surface and the dyestuff layer or photoconductor layer . various natural or synthetic resin binders can be used for the intermediate layer , but those materials are preferred that adhere well to a metal surface , especially to an aluminum surface , and undergo little dissolution when additional layers are applied subsequently . these include polyamide resins , polyvinylalcohols , polyvinylphosphonic acid , polyurethanes , polyester resins , polycarbonates , phenoxy resins , cellulose nitrates , pvc / pvac copolymers , and copolymers of styrene and butadiene , ( meth ) acrylic acid esters and maleic acid anhydride . addition of the acceptor additives according to the present invention to the preliminary coating improves the electrophotographic characteristics . the thickness of the organic intermediate layers can be up to 5 μm , and that of an aluminum - oxide intermediate layer is generally in the range from 0 . 01 to 1 μm . the inventive layer 2 or 5 ( fig1 to 3 ) has the function of a charge - carrier generating layer ; the pigment used in this connection determines the spectral photosensitivity of the photoconductive system by virtue of its absorption characteristics . pigments preferably used for this purpose are : perylimide derivatives , cis - and trans - perinones , phthalocyanines ( metal - containing and metal - free ), thioindigo , dioxazine and quinacridone derivatives , perylene - 3 , 4 , 9 , 10 - tetracarboxylic acid bisbenzimidazole derivatives , polynuclear quinones , e . g . 4 , 10 - dibromoanthanthrone ( c . i . 59 , 300 ), and azo and bisazo dyestuffs . the application of a homogeneous , densely packed pigment layer is preferably achieved by vapor deposition of the pigment onto the base layer in vacuo . depending on the vacuum level , the dyestuff can be deposited by evaporation without decomposing under conditions of 1 . 33 × 10 - 6 to 10 - 8 bar and a heating temperature of 240 ° to 290 ° c . at the same time , the temperature of the layer base layer is below 50 ° c . as a result , layers are obtained that contain densely packed dyestuff molecules . this has the advantage , over all other possibilities , of generating extra thin homogeneous dyestuff layers , ensuring an optimum charge generation rate . the extremely finely dispersed distribution of the pigment makes possible a high concentration of activated dyestuff molecules which inject charges into the charge - transport layer . in addition , charge transport through the dyestuff layer is not impeded , or only slightly impeded , by binders . an advantageous layer - thickness range for the vapor - deposited pigment is between 0 . 005 and 3 μm . particularly preferred is a thickness range between 0 . 05 and 1 . 5 μm , since in this range the adhesive strength and homogeneity of the vapor - deposited pigment are particularly favorable . apart from vapor deposition of the pigment , a uniform pigment thickness can also be achieved by other coating techniques . these techniques include application by mechanically rubbing the superfinely powdered material into the electrically conducting base layer , and application by electrolytic or electrochemical processes or by an elctrostatic spraying method . in combination with , or in lieu of an intermediate layer , homogeneous pigment layers which provide good coverage and have thicknesses on the order of 0 . 05 to 3 μm can also be prepared by grinding the pigment together with a binder , in particular with cellulose nitrates and / or crosslinking binder systems , such as acrylic resins crosslinkable with polyisocyanate , and with reactive resins such as epoxides and dd lacquers . the resulting pigment dispersions can then be coated onto the base layer to provide element 5 in fig3 . binders like polystyrene , styrene / maleic acid anhydride copolymers , polymethacrylates , polyvinyl acetates , polyurethanes , polyvinylbutyrals , polycarbonates , polyesters and phenoxy resins , and mixtures thereof , are also suitable . the pigment / binder ratio can vary within wide limits , but pigment primer coatings are preferred wherein the pigment proportion is over 50 %, as reflected in a correspondingly high optical density . in addition , the compounds according to the present invention can be added to the dispersions . organic compounds that have an extended π - electron system are particularly suitable as the chargetransport material in the present invention . these compounds include both monomeric and polymeric aromatic and heterocyclic compounds . particularly suitable are those monomers that have at least one tertiary - bonded nitrogen atom and / or a dialkylamino group . heterocyclic compounds such as oxadiazole derivatives , which are mentioned in german patent no . 1 , 058 , 836 ( corresponding to u . s . pat . no . 3 , 189 , 447 ), have proved especially successful . these derivatives include , in particular , 2 , 5 - bis ( p - diethylaminophenyl )- 1 , 3 , 4 - oxadiazole ; in addition , unsymmetrical oxadiazoles like 5 -[ 3 -( 9 - ethyl ) carbazolyl ]- 1 , 3 , 4 - oxadiazole derivatives ( u . s . pat . no . 4 , 192 , 677 ), for instance 2 -( 4 - dialkylaminophenyl )- 5 -[ 3 ( 9 - ethyl ) carbazolyl ]- 1 , 3 , 4 - oxadiazole , can be used with success . other suitable monomeric compounds are arylamine derivatives ( triphenylamine ) and also triarylmethane derivatives ( german patent no . 1 , 237 , 900 ), for example , bis ( 4 - diethyl - amino - 2 - methylphenyl ) phenylmethane ; more highly condensed aromatic compounds such as pyrene ; and benzo - condensed heterocyclic compounds ( e . g ., benzoxazole derivatives ). in addition , pyrazolines like 1 , 3 , 5 - triphenylpyrazolines or imidazole derivatives ( german patents no . 1 , 060 , 714 and no . 1 , 106 , 599 , corresponding to u . s . pat . no . 3 , 180 , 729 and british patent no . 938 , 434 , respectively are suitable . to these also belong triazole , thiadiazole and especially oxazole derivatives , for example , 2 - phenyl - 4 -( 2 - chlorophenyl )- 5 -( 4 - diethylaminophenyl )- oxazole , as disclosed in german patents no . 1 , 060 , 260 , no . 1 , 299 , 296 and no . 1 , 120 , 875 ( corresponding to u . s . pat . no . 3 , 112 , 197 , british patent no . 1 , 016 , 520 and u . s . pat . no . 3 , 257 , 203 , respectively ). furthermore , 4 - chloro - 2 -( 4 - dialkylaminophenyl ) 5 - aryloxazole derivatives represented by the following formula are of great interest : ## str3 ## where r is hydrogen , halogen , alkyl or alkoxy and r &# 39 ;, r &# 34 ; are alkyl . the preparation of these derivatives is known from european patent no . 0 010 652 . similarly of interest in this regard are hydrazone derivatives of the following structure : ## str4 ## where r 1 is alkyl or aryl , such as benzyl , for instance , ## str5 ## these compounds , described in u . s . pat . no . 4 , 150 , 987 and in german offenlegungsschriften no . 2 , 941 , 509 , no . 2 , 919 , 791 and no . 2 , 939 , 483 ( corresponding to u . s . pat . no . 4 , 338 , 388 , u . s . pat . no . 4 , 278 , 747 and british patent no . 2 , 034 , 493 , respectively ), have proved successful as charge - transport material . as transport polymers , polyvinylcarbazole and copolymers containing at least 50 % vinylcarbazole component yield a good photosensitivity . without dyestuff film , the charge - transporting layer region ( 420 to 750 nm ). if negative charging is intended , layer 3 preferably comprises a mixture of an electron - donor compound ( organic photoconductor ) with a binder . it is preferably transparent , but this is not necessary with a transparent conducting base layer . the layer 3 has a high electrical resistance of more than 10 12 ω . in the dark it prevents scattering of the electrostatic charge ; when exposed , it transports the charges generated in the dyestuff layer . the mixing ratio of the charge - transporting compound to the binder can vary . however , the requirement of maximum photosensitivity ( favoring as high a proportion as possible of charge - transporting compound ) and the requirements of avoiding crystallizing out and of increasing flexibility ( favoring as high a proportion of binder as possible ) effectively set relatively definite limits in this regard . a mixing ratio of approximately 1 : 1 parts by weight has generally proved preferable , but ratios between 4 : 1 and 1 : 4 are also suitable . if polymeric charge - transporting compounds such as polyvinylcarbazole are used , binder proportions around or below 30 % are suitable . the composition of the charge - transporting layer is approximately 40 to 70 % photoconductor compound , 20 to 60 % binder , and up to 10 % of the acceptor additive ( s ). in addition to the charge - generation and charge - transport materials described , the binder which is used affects both the mechanical characteristics , such as abrasion , flexibility , film formation and adhesion , and , to a certain extent , the electrophotographic characteristics , such as photosensitivity , residual charge and cyclic characteristics , under normal conditions and also under conditions of elevated temperatures ( 20 ° to 50 ° c .) and humidity ( greater than 80 % relative humidity ). moreover , pre - exposure sensitivity can be increased by the use of certain binders , such as cellulose nitrate , with certain photoconductors , such as oxadiazole derivatives . used as binders are polyester resins , polyvinylacetals , polycarbonates , silicone resins , polyurethanes , epoxy resins , phenoxy resins , poly ( meth ) acrylates and copolymers ( e . g ., with styrene ), polystyrenes and polystyrene copolymers ( e . g ., with butadiene ), and cellulose derivatives like celluloseacetobutyrates . polyester resins , polycarbonates and phenoxy resins are used , respectively , to special advantage . polyvinyl chloride , copolymers of vinyl chloride and vinyl acetate , polyvinylidene chlorides , polyacrylonitriles and cellulose nitrates in particular can also be blended with the above binders ; a proportion of up to approximately 10 % by weight , based on the proportion of solids in the charge - transport layer , has proved advantageous in this connection , without substantial increase in pre - exposure sensitivity . in addition , mixtures of polymeric and also monomeric acceptor additives , for example , cellulose nitrate and 9 , 10 - dibromoanthracene , can be present as an activating addition to the charge - transport layer ; but the optical transparency of the layer should not be substantially impaired in this case . the thickness of the charge - transport layer is also important from the perspective of optimum photosensitivity : layer thicknesses between approximately 2 and 25 μm are generally used . a thickness range of 5 to 18 μm has proved advantageous . if the mechanical requirements and electrophotographic parameters of the charging and development stations in a copier permit , however , the specified limits may be extended upward or downward from case to case . conventional additives for use in the present invention include flow control agents such as silicone oils ; wetting agents , in particular non - ionogenic substances ; and plasticizers of various compositions , such as those based on chlorinated hydrocarbons and those based on phthalic acid esters . the present invention is described in further detail below by reference to the following examples , which are illustrative only . a polyester base layer , which had been coated beforehand with aluminum by vapor deposition , was coated by vapor deposition in vacuo ( 1 . 33 × 10 - 7 to 10 - 8 bar ) with the pigment n , n &# 39 ;- dimethylperylimide ( formula 1 of the attached formula table ) and , in addition , with the pigment n , n &# 39 ;- di ( 3 - methoxypropyl ) perylimide ( formula 2 ) at a temperature ranging from 270 ° to 290 ° c . under mild conditions ; the thicknesses of the homogeneous pigment layers were about 120 and 190 mg / m 2 , respectively . a solution comprising equal parts by weight of 2 , 5 - bis ( 4 - dialkylaminophenyl )- 1 , 3 , 4 - oxodiazole ( to 1920 ) and polyester resin ( dynapol ® l 206 ) in tetrahydrofuran was applied thereon and dried to give a thickness of 9 to 10 μm . in addition , a coating solution was prepared as described above in which 10 % by weight of the polyester resin was replaced by low - viscosity cellulose nitrate ( cn ) ( standard type hp 10 ). the coating solution was spun onto the vapor - deposited pigment layers to a thickness of 9 to 10 μm ( dry ). the photosensitivity of these photoconductor double layers were measured as follows : to determine the light decay curves , the test sample was moved through a charge device to the exposure station , where it was continuously illuminated with a halogen / tungsten lamp ( 150 w ). a heat absorption glass and a neutral filter were placed in front of the lamp . the light intensity in the measurement plane was in the range from 3 to 10 μw / cm 2 ; it was measured with an optometer in parallel with the measurement operation . the charge level and the photoinduced light decay curve were recorded with an oscillograph through a transparent probe , using an electrometer . the photoconductor film was characterized by the charge level ( u o ) and the time ( t ) required to reach half , one - quarter and one - eighth of the original charge ( u o ). the product of the particular t [ s ] and the light intensity ( μw / cm 2 ) measured in parallel determined the characteristic energy quantities ( μj / cm 2 ), e . g ., the half - value energy ( e 1 / 2 ). the energy quantities at which 1 / 4 or 1 / 8 of the initial charge ( u o ) was reached characterized the residual charge characteristic of the tested photoconductor film . the residual charge ( u e ), predominantly measured after 1 or 3 seconds , was also a measure of the residual discharge characteristics . ______________________________________ cn addedpigment ( transport - u . sub . o e . sub . 1 / 8 - u . sub . e ( v )( formula ) layer ) ( v ) e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) 3 sec______________________________________1 -- 510 2 . 14 5 . 07 8 . 57 39 10 % 530 1 . 25 2 . 48 3 . 76 32 -- 510 1 . 54 3 . 7 6 . 49 31 10 % 540 1 . 12 2 . 2 3 . 45 7______________________________________ a solution comprising 50 parts of to 1920 , 40 parts of polycarbonate ( makrolon ® 2405 ) and 10 parts of polyester resin ( dynapol l 206 ) in tetrahydrofuran was coated onto a thin vapor - deposited pigment film of n , n &# 39 ;- dimethylperylimide as in example 1 , and was then dried to a thickness of approximately 10 μm ( o - layer ). in addition , coating solutions were prepared that contained 48 parts of to 1920 , with the same binder proportions as above , and in each case 2 parts of acceptor compound ( see table 1 ). these coating solutions were coated , respectively , onto the pigment layer to a comparable thickness and were dried . the measured photosensitivities of the o - layer and the activated charge - transport layers are shown in table 1 : __________________________________________________________________________charge - u . sub . e ( v ) transport after e . sub . 1 / 8layeracceptor - u . sub . o ( v ) 1 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) __________________________________________________________________________0 -- 470 47 1 . 33 3 . 18 8 . 311 9 -( β , β - dicyano - 470 51 1 . 59 3 . 87 9 . 4vinyl ) anthracene2 phthalic 470 31 1 . 21 2 . 69 5 . 62anhydride3 maleic 460 43 1 . 16 2 . 57 6 . 0anhydride4 3 , 3 &# 39 ;, 4 , 4 &# 39 ;- benzo - 460 15 1 . 1 2 . 16 3 . 73phenonetetracarboxylicacid anhydride5 3 , 4 , 5 , 6 - tetra - 450 11 1 . 11 2 . 16 3 . 64chlorophthalicanhydride__________________________________________________________________________ thin layers of vapor - deposited n , n &# 39 ;- dimethylperylimide were coated with tetrahydrofuran solutions containing various quantities of 9 , 10 - dibromoanthracene ( dba ). the first solution of this dba concentration series comprised 50 parts of to 1920 , 39 parts of polycarbonate ( makrolon 2405 ), 10 parts of polyester resin ( dynapol l 206 ) and 1 part of dba ; the other solutions contained 2 . 5 , 5 . 0 and 10 parts of dba , respectively , instead of polycarbonate . after drying for 5 minutes at 95 ° to 100 ° c ., the layer thicknesses were approximately 8μm . ( the analogous 0 layer of this series has already been described in example 2 .) the photosensitivities of the variously activated charge - transport layers are recorded in table 2 : table 2______________________________________ u . sub . e ( v ) proportion after e . sub . 1 / 8layer of dba - u . sub . o ( v ) 1 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 0 470 47 1 . 33 3 . 18 8 . 311 1 . 0 470 47 1 . 08 2 . 4 5 . 632 2 . 5 470 35 0 . 98 2 . 05 3 . 953 5 . 0 460 31 0 . 95 1 . 9 3 . 674 10 . 0 470 27 0 . 88 1 . 8 3 . 29______________________________________ samples of homogeneous , thin layers of vapordeposited n , n &# 39 ;- dimethylperylimide , about 100 mg / m 2 in thickness , were prepared as described in example 1 and then were coated with one of the tetrahydrofuran ( thf ) solutions having the following composition : ( a ) 70 parts of to 1920 and 30 parts of polycarbonate ( makrolon 2405 ); ( b ) 69 parts of to 1920 , 30 parts of polycarbonate and 1 part of 3 , 5 - dinitrobenzoic acid nitrile ( dbn ) as acceptor compound ; ( c ) 67 parts of to 1920 , 30 parts of polycarbonate and 3 parts of dbn . after drying , the layer weights per unit area of these samples were 11 to 11 . 5 g / m 2 . as shown below , photosensitivity in the samples deteriorated with the addition of the dbn acceptor compound : ______________________________________ u . sub . e ( v ) e . sub . 1 / 8layer - u . sub . o ( v ) after 1 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________ ( a ) 540 31 1 . 11 2 . 12 3 . 56 ( b ) 530 43 1 . 19 2 . 41 4 . 73 ( c ) 530 59 1 . 45 3 . 0 7 . 7______________________________________ a thin , polycarbonate primer coating ( less than 0 . 1 μm ) was deposited on a polyester film previously coated by vapor deposition with aluminum . trans - perinone ( hostapermorange gr , represented by formula 3 in the formula table ) was then homogeneously deposited thereon by vapor deposition in vacuo under conditions similar to those described in example 1 . the layer weight of the pigment per unit area was in the region of 120 mg / m 2 . a charge - transport layers comprising 60 parts of to 1920 and 40 parts of phenoxy resin was coated onto the perinone pigment layer to a thickness of approximately 10 μm . variously activated charge - transport films were also prepared in which the phenoxy resin was partially replaced by 1 , 2 , 3 or 5 parts of cellulose nitrate ( cn ) of standard type h 27 , containing about 18 % dioctylphthalate . table 3______________________________________ proportion u . sub . e ( v ) of cn after e . sub . 1 / 8layer % - u . sub . o ( v ) 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 0 540 98 2 . 66 7 . 781 1 580 23 1 . 44 2 . 56 4 . 032 2 545 15 1 . 36 2 . 41 3 . 543 3 550 11 1 . 35 2 . 36 3 . 524 5 525 7 1 . 36 2 . 35 3 . 43______________________________________ with the same charge carrier - generating layer as in example 5 , 5 % of a copolymer of vinyl chloride ( approximately 85 %), vinyl acetate and dicarboxylic acid ( 1 %) ( hostaflex ® m 131 ) or 5 % of polyvinylidene chloride were used instead of cn as activating binder in the charge - transport layer . the resulting layers were about 10 μm thick . ( the data below for the o - layer are taken from example 5 .) ______________________________________addition - u . sub . e ( v ) e . sub . 1 / 8of - u . sub . o ( v ) after 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________5 % pvc 570 39 1 . 66 3 . 34 6 . 315 % pvdc 545 39 1 . 81 3 . 39 6 . 170 540 98 2 . 66 7 . 78______________________________________ a layer of vapor - deposited n , n &# 39 ;- dimethylperylimide was produced on a polyester film coated with aluminum by vapor deposition and precoated with polycarbonate ( less than 0 . 1 μm ). the perylimide layer was then coated with a charge - transport layer , comprising 60 parts of to 1920 and 40 parts phenoxy resin , to a thickness of about 10 μm . in order to investigate other activating substances , a composition comprising 60 parts of to 1920 , 37 parts of phenoxy resin and 3 parts of acceptor compound was chosen . the measured photosensitivities of the variously activated layers were as follows : ______________________________________ activator - u . sub . e ( v ) compound - u . sub . o after e . sub . 1 / 8layer ( 3 %) ( v ) 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 0 480 142 4 . 93 -- -- 1 9 - bromo - 520 11 1 . 27 2 . 78 4 . 75 anthracene2 9 , 10 - di - 510 15 1 . 3 2 . 91 5 . 18 chloro - anthracene3 9 - chloro - 395 7 1 . 12 2 . 33 3 . 9 acridine4 1 , 5 - di - 525 39 1 . 64 3 . 74 7 . 29 chloroanthra - quinone______________________________________ a vapor - deposited pigment layer according to example 1 was coated ( o - layer ) with a tetrahydrofuran solution , comprising equal parts by weight of to 1920 and polycarbonate ( makrolon 3200 ), to a thickness of 9 to 10 μm ( dry ). additional layers were prepared in which the charge - transport layerm was activated with small proportions of phthalic anhydride ( pa ) instead of polycarbonate . composition and photosensitivity data are shown in table 4 ( light intensity : 4 . 1 μw / cm 2 ): table 4______________________________________ - u . sub . e ( v ) e . sub . 1 / 8layer pa (%) - u . sub . o ( v ) after 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 -- 525 47 1 . 41 3 . 62 8 . 611 0 . 1 550 19 1 . 27 3 . 0 6 . 932 0 . 5 545 15 0 . 98 2 . 08 3 . 843 2 . 0 530 11 1 . 0 2 . 05 3 . 684 5 . 0 370 0 0 . 82 1 . 6 2 . 41______________________________________ from the activation series , it can be seen that charge acceptance is reduced , under the same charging conditions , with too high a proportion of pa . polyester film coated with aluminum by vapor deposition was coated with a thin , adhesion - promoting layer of polycarbonate to a thickness of & lt ; 0 . 1 μm ( dry ). the pigments cis - perinone ( novoperm red tg 02 , according to formula 4 ), perylene - 3 , 4 , 9 , 10 - tetracarboxylic acid diimidebisbenzimidazole ( formula 5 ) and 4 , 10 - dibromoanthanthrone ( hostaperm scarlet go , formula 6 ) were deposited thereon , respectively , by vapor deposition in vacuo ( 1 . 33 × 10 - 7 to 10 - 8 bar ) under mild conditions . the thicknesses of the homogeneous vapor - deposited pigment layers are in the region of 100 to 140 mg / m 2 . a solution of 50 parts of to 1920 , 25 parts of phenoxy resin ( pkhh ) and 25 parts of polyester resin ( l 206 ) in tetrahydrofuran was coated onto the layers , resulting in a dry thickness of approximately 10 μm . other layers were prepared with varying proportions of cellulose nitrate ( standard type h 27 , containing 18 % dioctylphthalate ) instead of binder . the improvement in photosensitivity achieved with relatively low proportions of cn on the various pigment layers is shown in table 5 ; table 5__________________________________________________________________________layer + proportion - u . sub . e ( v ) e . sub . 1 / 8pigment of cn % - u . sub . o ( v ) after 1 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) __________________________________________________________________________cis - -- 560 79 4 . 2 10 . 75 -- perinone ( formula 4 ) 0 - layer1 1 540 23 1 . 2 2 . 3 4 . 362 5 545 11 1 . 18 2 . 22 3 . 74 50 pts . to 1920 25 pts . pkhh 20 pts . l 2063 10 520 7 1 . 22 2 . 26 3 . 66 50 pts . to 1920 20 pts . pkhh 20 pts . l 206formula 5 -- 500 51 2 . 98 7 . 64 16 . 970 - layer1 1 520 27 1 . 61 4 . 1 8 . 192 5 540 15 1 . 15 2 . 75 5 . 16 see above3 10 480 7 1 . 16 2 . 74 4 . 92 see aboveformula 6 -- 550 47 3 . 41 8 . 13 14 . 730 - layer1 1 550 19 1 . 58 3 . 35 6 . 332 5 570 11 1 . 42 2 . 84 4 . 98 see above3 10 540 7 1 . 34 2 . 64 4 . 3 see above__________________________________________________________________________ a vapor - deposited n , n &# 39 ;- dimethylperylimide layer according to example 1 was homogeneously coated with a solution containing 60 parts of to 1920 , 20 parts of polycarbonate ( makrolon 3200 ) and 20 parts of polyester resin ( dynapol l 206 ). two further coating solutions which additionally contained , respectively , ( a ) 3 % cellulose nitrate , based on the foregoing solid content , and these layers were studied in a copier arrangement , under identical electrophotographic and erasure conditions , for their cyclic behavior ( 100 cycles ), especially for their residual discharge behavior : ______________________________________ layer weight - u . sub . w . sbsb . 1 - 100 ( v ) per unit white master , area - u . sub . d . sbsb . 1 - 100 middle apperture - u . sub . r . sbsb . 1 - 100 ( v ) layer ( g / m . sup . 2 ) ( v ) setting after erasure______________________________________0 - layer 12 . 0 450 - 470 130 - 150 40 - 80 ( a ) 12 . 2 440 - 450 120 - 120 20 - 40 ( b ) 11 . 9 450 - 460 120 - 130 10 - 20______________________________________ u . sub . d charge acceptance in dark u . sub . w charge acceptance for middle aperture setting ( 13 - 5 ) u . sub . r charge acceptance after erasure to a tetrahydrofuran solution containing 52 parts of to 1920 , 35 parts of polycarbonate ( makrolon 2405 ) and 10 parts of polyester resin ( dynapol l 206 ), there were also added ( a ) 3 parts of cellulose nitrate ( standard type hp 10 ), or ( b ) 1 . 5 parts of cellulose nitrate ( standard type hp 10 ) and 1 . 5 parts of 9 , 10 - dibromoanthracene ( dba ) or these coating solutions were uniformly coated onto a vapor - deposited pigment layer according to example 1 ( formula 1 ) by flow application in a coating machine , and then were dried . the photosensitivities of the recording materials with variously activated charge - transport layers are shown in table 6 ( light intensity ˜ 6 . 5 μw / cm 2 ). table 6______________________________________ layer weight u . sub . e ( v ) per unit area after e . sub . 1 / 8layer ( g / m . sup . 2 ) - u . sub . o ( v ) 1 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________ ( a ) 14 . 3 480 47 1 . 06 2 . 45 5 . 18 ( b ) 14 . 6 480 43 1 . 01 2 . 10 4 . 39 ( c ) 14 . 5 470 51 1 . 09 2 . 57 5 . 79______________________________________ a polyester film coated with aluminum by vapor deposition was coated with a thin primer coating of polycarbonate ( less than 100 mg / m 2 ) ( dry ), and then with n , n &# 39 ;- dimethylperylimide ( approximately 130 mg / m 2 ) homogeneously deposited by vapor deposition . the layer was thereafter coated with a solution containing 98 parts of polyvinylcarbazole ( luvican ® m 170 ) and 2 parts of polyester resin ( adhesive ® 49000 ) to a thickness of about 6 μm after drying . the charge - transport layer , with a film thickness of about 6 μm , was activated by adding 1 part or 3 parts of 9 , 10 - dibromoanthracene . ______________________________________ u . sub . e ( v ) after e . sub . 1 / 8layer - u . sub . o ( v ) 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 - layer 480 19 1 . 86 3 . 41 5 . 06 + 1 pt . dba 470 11 1 . 86 3 . 29 4 . 79 + 3 pts . dba 500 11 1 . 59 2 . 84 4 . 08______________________________________ ( b ) 50 parts of tpp , 49 parts of polycarbonate and 1 part of 9 , 10 - dichloroanthracene ( dca ), and ( c ) 50 parts of tpp , 47 parts of polycarbonate and 3 parts of dca were deposited , to a thickness of about 10 μm , on a charge carrier - generating layer , as described in example 12 . the photosensitivity measurements at a light intensity of 3 . 8 μw / cm 2 yielded the following values : ______________________________________ u . sub . e ( v ) e . sub . 1 / 8layer - u . sub . o ( v ) after 3 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________ ( a ) 560 59 1 . 62 3 . 93 9 . 61 ( b ) 550 31 1 . 08 2 . 22 4 . 15 ( c ) 540 31 1 . 04 1 . 99 3 . 52______________________________________ thin coatings ( less than 0 . 1 μm ) of polycarbonate ( a ) or of 98 parts of polycarbonate and 2 parts of dba ( b ) were deposited , respectively , onto a polyester film coated ( by vapor deposition ) with aluminum . each sample was then coated with a uniform , vapor - deposited n , n &# 39 ;- dimethylperylimide ( formula 1 ) layer according to example 1 . layer thicknesses were approximately 120 mg / m 2 . these charge carrier - generating systems were then uniformly coated with a tetrahydrofuran solution containing 52 parts of to 1920 and 48 parts of phenoxy resin , resulting in a layer weight per unit area of 13 . 5 g / m 2 in each case . ______________________________________ u . sub . e ( v ) e . sub . 1 / 4layer - u . sub . o ( v ) after 3 sec e . sub . 1 / 2 ( μj / cm . sup . 2 ) ______________________________________ ( a ) 560 134 3 . 68 11 . 14 ( b ) 560 75 1 . 71 4 . 61______________________________________ a precoated aluminum / polyester film coated with n , n &# 39 ;- dimethylperylimide by vapor dposition was coated with a solution comprising 50 parts of 4 - chloro - 2 ( 4 - diethylaminophenyl )- 5 -( 4 - methoxyphenyl ) oxazole ( m . p . 104 ° c .) and 50 parts of polycarbonate to a thickness of about 10 μm ( dry ). further , variously activated charge - transport films of the same thickness were prepared in which polycarbonate ( 49 parts and 47 parts ) was replaced by 1 and 3 parts , respectively , of 9 , 10 - dichloroanthracene ( dca ). ______________________________________ proportion u . sub . e ( v ) e . sub . 1 / 8layer of dca , % - u . sub . o ( v ) after 5 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________0 0 490 35 1 . 33 3 . 03 7 . 761 1 500 23 1 . 14 2 . 35 4 . 582 3 470 15 1 . 09 2 . 22 4 . 03______________________________________ 60 g of the dyestuff n , n &# 39 ;- di ( n - butyl ) perylimide ( formula 7 ) were kneaded with 40 g of polyvinylbutyral ( mowital ® b 20 h ) in a cylinder mill to achieve homogeneous mixing . the resulting fine granulate was taken up in tetrahydrofuran and finely dispersed in a pearl mill ; the dispersion was thereafter homogeneously deposited , to a thickness of about 250 mg / m 2 , on a polyester film coated beforehand with aluminum by vapor deposition , and then was dried . ( a ) 52 parts of to 1920 , 24 parts of polyester resin and 24 parts of phenoxy resin and ( b ) 52 parts of to 1920 , 35 parts of phenoxy resin , 8 parts of polyester resin , 3 parts of cellulose nitrate of standard type h 27 and 2 parts of 9 , 10 - dibromoanthracene were then deposited thereon to a dry layer thickness of 13 . 0 g / m 2 and 13 . 4 g / m 2 , respectively . ______________________________________ u . sub . e ( v ) e . sub . 1 / 8layer - u . sub . o ( v ) after 10 sec e . sub . 1 / 2 e . sub . 1 / 4 ( μj / cm . sup . 2 ) ______________________________________a 480 90 7 23 -- b 460 0 2 . 32 4 . 39 6 . 51______________________________________

US-92233286-A

this invention is a method to restore the metal content of a supported noble metal hydrogenation catalyst comprising adding the appropriate amount of a noble metal salt of a weak acid to a fluid feed passing across the catalyst .

a catalyst having its active sites masked or otherwise lost in the extreme is not unlike the carbon support without palladium . carbon support without palladium is , of course , the material used by the catalyst manufacturer to produce the catalyst . in the catalyst manufacture , the carbon support is impregnated with palladium salt which is subsequently reduced to palladium metal . similarly , in the present catalyst reconditioning procedure , palladium salt was added to a used catalyst to restore the active sites content . there is , however , a fundamental deviation from the catalyst manufacture procedure . we have observed in the past , and again recently , that palladium chloride cannot be reduced readily to palladium metal under the phenol hydrogenation reaction conditions . palladium acetate , palladium acetylacetonate , and palladium phenate on the other hand were reduced fully to palladium metal under the hydrogenation reaction conditions . it appears from these findings that the ease of reduction of the palladium in the oxidation state of two was a function of the nature of the anion of the salt . the stronger the corresponding acid of the anion the less its willingness to be reduced . the above mentioned palladium salt reductions were carried out in the presence of a palladium on carbon catalyst . in the absence of palladium on carbon , none of the palladium salts were reduced to a meaningful extent . the present procedure , therefore , is characterized in that the palladium salt used was the salt of a very weak acid , such as an acetate , acetylacetonate or a phenate salt . also characteristic of the procedure is that the palladium salt of choice was added to the process in situ . in a typical experiment , therefore , phenol , used catalyst , the palladium salt and an amount of sodium hydroxide stoichiometic to the palladium salt were charged to the reactor . at a temperature of 160 ° c ., hydrogen was supplied and the reaction proceeded . reduction of the palladium salt by hydrogen took place prior to or simultaneous with phenol reduction , whereupon the reduced palladium became an integral part of the used catalyst present . the improvement of catalyst performance can best be assessed by the data of table 1 . in all of the experiments , the amount of palladium salt added represented a 1 percent increment of palladium on the catalyst . experiment no . 494 shows that the phenol conversion was extremely slow when palladium acetylacetonate only was used as catalyst . however , in conjunction with recycle catalyst b , sampled from a reactor and washed with hexane , palladium acetylacetonate was a very active promoter as shown in the duplicate experiments no . 496 and no . 498 and compared with the experiments no . 495 and no . 497 having the palladium salt left out . the latter two experiments differ in the amounts of caustic added . it is known that base is a catalyst promoter in the phenol hydrogenation . the aspect of caustic requirement in these experiments is ambiguous . we have assumed that when a palladium salt is reduced the anion of the salt will form its corresponding acid . therefore , in the experiments with palladium salts , 2 moles of sodium hydroxide were added per mole of palladium salt . this reasoning may not be entirely correct since , for instance , the sodium salt of acetylacetonate when formed will still be a considerably strong base and as such will be of some benefit to the hydrogenation rate , similar to the rate enhancement experienced with sodium carbonate or sodium phenate . on the other hand , sodium chloride , formed when palladium chloride is used , will not be beneficial to the catalyst . thus , experiment no . 497 , having the same amount of caustic as in the experiments containing the palladium acetylacetonate , nos . 496 and 498 , had a rate of only one - half of that with the palladium salt , while experiment no . 495 , having no sodium hydroxide added , was only one - third as fast as the palladium salt - containing experiments . with respect to the selectivity ( k &# 34 ; one &# 34 ;/ k &# 34 ; ol &# 34 ;), the palladium salt addition showed an enormous improvement over the control experiments , with and without sodium hydroxide added . the amount of cyclohexanol formed in the batch reaction is , of course , subject to the total reaction time . this makes it difficult to assess the selectivity of a catalyst on the basis of percent cyclohexanol formed at 95 percent phenol conversion , particularly when the total reaction times vary significantly . for these reasons , an experiment was devised which had a reaction time more corresponding to the control experiments nos . 495 and 497 . in this experiment , no . 499 , only one - half of the amount of recycle catalyst and one - half of the amount of palladium salt of experiments nos . 496 and 498 were used . still , the total amount of cyclohexanol formed over a longer reaction time was less with the palladium salt than in the control experiments . in table 2 is shown the effect of the anion of the palladium salt . clearly , the activity and the selectivity decreased when going from acetylacetonate to acetate and to chloride . the rates paralleled the strength of the acid corresponding with the anion , the stronger the acid the lower the activity and the selectivity . another consideration here is the previously established rate inhibiting effect of chloride which may have affected the rate in the experiment no . 500 . to investigate further the improvements in activity and selectivity of various recycle catalysts through palladium salt addition , the experiments in table 3 were carried out . the a recycle catalysts used in these experiments date back to the time when the &# 34 ; one &# 34 ;/&# 34 ; ol &# 34 ; ratio in the commercial process was consistently low . treatment with hot water and hot caustic improved this recycle catalyst to some extent , but not to an acceptable level . in experiments nos . 418 and 502 , the effect of palladium acetylacetonate on identical recycle catalyst is shown . although only one - half of the usual catalyst charge was used in experiment no . 502 , having the palladium salt added , the rate of phenol conversion was essentially the same while the selectivity improved considerably . more pronounced differences in activity and selectivity would have been found with more than the stoichiometrically required amount of sodium hydroxide , as elaborated above , in the experiments nos . 419 , 503 and 504 , the effect of palladium salt on an inferior caustic washed catalyst was determined . as in the previous experiments , added palladium salt to one - half of the standard catalyst charge had the same rate obtained with the standard catalyst charge . in the experiment no . 504 , the amount of sodium hydroxide added was increased to satisfy the palladium salt stoichiometry and an amount equivalent to that in experiment no . 419 ( without palladium salt added ). the activity in this experiment improved further , as did the selectivity . in the experiments nos ., 495 and 499 , the effect of palladium salt is shown on a more recent recycle catalyst . again , one - half the standard catalyst charge with palladium salt showed a higher rate than that obtained with the standard charge . the selectivity had improved substantially . added to recycle catalyst , palladium phenate , dissolved in phenol , was found to outperform palladium acetate . the palladium phenate solution was prepared by removing acetic acid from a palladium acetate solution in phenol through distillation ; see table 4 . the rate enhancement effect of palladium acetate on recycle catalyst was extended to carbon black . palladium phenate solution in phenol and carbon black added separately to the reactor generated a catalyst which had good activity , and high selectivity with the carbon black normally used to prepare standard catalyst . a different type carbon black from another source was much less effective . the results are shown in table 5 . the catalyst thus generated was similar in performance to a 1 percent pd / c catalyst prepared commercially . when the palladium phenate and the carbon black were combined outside of the reactor ( as opposed to in situ ), the activity was the same as that obtained with the in situ generated catalyst but the selectivity was not as good . multiple phenol hydrogenation cycles were carried out with recycle catalyst promoted with 1 percent palladium as palladium acetate in the first cycle only . the results are shown in table 6 . the catalyst retained its high activity and selectivity over 12 cycles . the disposition of the added palladium was determined by atomic adsorption and electron spectroscopy for chemical analysis ( esca ). the results are shown in table 7 . all of the palladium added as acetylacetonate was found on the catalyst recovered from the hydrogenation experiment and nearly so with the acetate as determined by atomic adsorption . when added as the chloride , the recovered catalyst contained considerably less than the amount added . more revealing are results obtained by esca which provide a measure of the palladium content on the surface only ( probing depth of approximately 15 angstrom ). the catalysts resulting from 1 percent palladium acetate and palladium acetylacetonate addition showed a 23 - fold increase in surface palladium . these data can be interpreted as a surface palladium content of 13 to 14 percent on catalysts containing approximately 2 . 4 percent palladium . this kind of surface palladium level exceeds that of virgin catalyst by a factor of 2 - 3 . palladium chloride was found much less effective in the surface palladium enrichment . also , the palladium on the catalyst reconditioned with a weak acid salt of palladium was of the metallic form . the reduction of the pd 2 + to pd ° under the phenol hydrogenation conditions appear to be very facile for weak acid salts . an autoclave having 3 liter capacity is employed , of inox stainless steel , with electromagnetic stirring ( 120 stirring strokes in 1 minute ), providing internally with a candle filter ( size of candle filter external diameter 24 mm , height 120 mm ), for hydrogenation ; and an autoclave of 1 liter capacity of inox stainless steel for the charging of the mixture of benzoic acid and hexahydrobenzoic acid , as will be said afterwards . seven hundred grams of hexahydrobenzoic acid , 300 grams of benzoic acid produced by oxidation of toluene and purified by means of crystallization from water and 20 grams of palladium catalyst with 5 percent of metal on charcoal , equivalent to 0 . 333 percent of metal on benzoic acid , are charged into the 3 - liter capacity autoclave . the latter is washed with n 2 , is charged with h 2 at 130 atmospheric pressure and is heated to a temperature of 130 ° c . the hydrogenation is carried out at 130 °- 135 ° c . in a pressure interval of from 150 to 100 atmospheres ( 10 . 3 to 6 . 89 × 10 5 pascals ) and in about 1 hour &# 39 ; s time . at the end of hydrogenation , the autoclave is cooled down to 90 ° and its content is filtered through the candle placed inside the autoclave . eight hundred grams of hexahydrobenzoic acid ( 100 percent according to the index of refraction ) are discharged while 200 grams thereof remain in the autoclave . the discharge is divided into 2 parts ; 300 grams go to production and 500 grams to which 300 grams of fresh benzoic acid and 0 . 42 gram of palladium acetate is added , are charged into the hydrogenation autoclave by means of a slight nitrogen pressure ( about 2 atmospheres ) ( 1 . 3 × 10 4 pascals ) through a candle filter , in a direction reversed with respect to discharge , so as to permit the return into suspension of the catalyst cake remained adherent on the walls of the candle . then the autoclave is washed with nitrogen , the h 2 is charged at 130 atmospheres ( 8 . 9 × 10 5 pascals ) and the temperature is brought up to 130 ° and the mixture is hydrogenated . the cycles can be repeated indefinitely by charging a fresh mixture of benzoic acid , palladium acetate and hexahydrobenzoic acid according to the technique indicated previously . example 1 of u . s . pat . no . 3 , 305 , 586 is hereby incorporated by reference , in toto . after several months of operation , the hourly weight production yield begins to diminish and the amount of cyclohexanol formed begins to increase . the continuous process is interrupted . the solid catalyst bed is flooded with a solution of 10 . 6 kilograms of palladium acetate in 2000 kilograms of phenol . after 2 hours , the liquids are drained from the bed and the continuous operation as described above is resumed . the hourly weight production yield is improved and the amount of cyclohexanol formed per hour is less . the following example which illustrates a preferred embodiment of this invention is presented without any intention of being limited thereby . all parts and percentages are by weight unless otherwise specified . an alcohol solution of dinitrotoluene was prepared by agitating molten technical grade dinitrotoluene ( approximately 80 percent 2 , 4 - and 20 percent 2 , 6 - dinitrotoluene ) and 0 . 75 percent of palladium acetate in methanol at a temperature of about 50 ° c . three pounds ( 1361 grams ) of methanol were employed for each pound ( 454 grams ) of molten dinitrotoluene . the reactor employed for the reaction was a five - gallon ( 19 liter ) autoclave provided with internal and external coils to adjust the reaction temperature as desired . the reactor was also provided with a mechanical agitator having a speed of 600 revolutions per minute . secured to the agitator shaft was a four - inch ( 10 . 16 cm ) diameter turbine - type agitator and a four - inch ( 10 . 15 cm ) diameter propeller - type agitator , the turbine being positioned about one - third of a reactor diameter up from the reactor bottom and the propeller being positioned about one reactor diameter up from the reactor bottom along the shaft . feed lines for the dinitrotoluene and hydrogen were secured to dip tubes positioned within the autoclave to discharge directly into the eye of the four - inch ( 10 . 16 cm ) turbine to ensure immediate mixing of both the dinitrotoluene and the hydrogen with the reactor contents . six porous stainless steel filter elements were secured within the autoclave to permit separation of the product effluent from the catalyst particles . the catalyst used was a commercial 5 percent palladium on carbon catalyst . one pound ( 454 grams ) of 5 percent palladium on carbon catalyst was mixed in three gallons ( 11 . 36 liters ) of methanol and the slurry charged to the reactor which was then pressurized to 400 psig ( 27 . 55 × 10 5 pascals ) with hydrogen , agitated , and heated to a temperature of 105 ° c . these temperature , pressure , and agitator conditions were maintained throughout the reaction . the alcohol solution of dinitrotoluene was then fed to the reactor through a steam traced line to maintain the solution at about 50 ° c . in the line . the rate of feed of the alcohol solution of dinitrotoluene was about 22 . 7 pounds ( 10 296 grams ) per hour , which was equivalent to a catalyst loading of 0 . 062 pound - equivalent of nitro groups per hour per pound of catalyst ( 0 . 062 gram - equivalent of nitro groups per hour per gram of catalyst ), and the simultaneous feed rate of hydrogen was at the rate of about 0 . 37 pound ( 168 g ) per hour . the feed of palladium acetate was 0 . 21 pound ( 95 grams ) per hour . product was withdrawn from the autoclave at the rate of about 23 . 1 pounds ( 10 487 grams ) per hour . equilibrium was quickly attained , and the average analysis of the product obtained during the reaction was 16 . 5 percent toluene diamine , 0 . 5 percent residue , 0 . 004 percent reducibles , 73 . 2 percent methanol , and 9 . 8 percent water . the reaction was continued indefinitely . virgin catalyst when added in the process loses its good qualities rapidly as a result of loss of small pores and to some extent due to masking of some of its palladium by poisons . thus , the transition of virgin catalyst to recycle catalyst does not take long in the process . superiority of the virgin catalyst lies in a given number of active sites advantageously distributed over a large surface area which includes small pores . we have demonstrated in the past that most of the overall surface area is found in the small pores , and that they become plugged up rapidly in the process . the active sites located in the small pores are then no longer available for catalytic action . the reconstituted recycle catalyst of this invention draws its improved activity from a great multitude of active palladium sites chemisorbed on a surface no longer subject to loss of small pores . because of the usual difference in the relative concentrations of virgin and recycle catalyst in a reaction having similar rates , the aggregate surface area of the catalyst ( virgin or recycle ) will be comparable in size though entirely different in nature as explained in the foregoing . deposition of palladium on the aggregate surface area of recycle catalyst has , therefore , the advantages of more favorable dispersion and longer lasting quality ( loss of pores will be minimal ). in summary , the superior qualities of virgin catalyst will become irretrievably lost in recycling due to the small pores loss mechanism as opposed to the long lasting qualities of palladium deposited on an aged surface area . the reconstitution of recycle catalyst by means of this invention is not proposed to merely substitute virgin catalyst addition , but it aims to rather permanently improve the quality of all of the catalyst in residence in a commercial process . with respect to the selectivity considerations only , the selectivity obtained with virgin catalyst is shortlived as evidenced by the following . when the formation of &# 34 ; ol &# 34 ; in a hydrogenation reaction is evaluated over the 20 - 50 % conversion period versus the 50 - 80 % conversion period , it is found to be much higher in the early stages of the reaction . this is rationalized by the change in dielectric constant of the medium ( phenol changing to &# 34 ; one &# 34 ;) and also the consequent increasing sodium content on the catalyst . with a virgin catalyst , however , the formation of &# 34 ; ol &# 34 ; in the first part of the reaction is much the same as that in the second part . hence , selectivity became less as the reaction proceeded . reconstitution of catalyst by means of this invention , on the other hand , intensifies the difference in &# 34 ; ol &# 34 ; formation between the early and later conversion periods which is evidence for permanency of selectivity . also , the selectivity obtained with virgin catalyst is less than that found with a promoted recycle catalyst of this invention having the same activity . table 1______________________________________hydrogenation performance improvementthrough palladium salt addition______________________________________ recycle pd acetyl - experiment catalyst , acetonate . sup . ( 3 ) naoh . sup . ( 4 ). sup . ( 1 ) grams . sup . ( 2 ) mg m mole ml m mole______________________________________494 none -- 129 0 . 40 0 . 30 0 . 75496 / 498 9 b 260 0 . 86 0 . 68 1 . 7495 9 b -- -- -- -- 497 9 b -- -- 0 . 68 1 . 7499 4 . 5 b 130 0 . 43 0 . 34 0 . 85______________________________________experiment k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; ×. sup . ( 1 ) 10 . sup .- 3 min . sup .- 1 10 . sup .- 3 min . sup .- 1 k &# 34 ; one &# 34 ;/ k &# 34 ; ol &# 34 ; ______________________________________494 8 percent conversion in 4 hours496 / 498 34 . 1 0 . 29 119495 11 . 1 0 . 23 49497 17 . 0 0 . 22 78499 15 . 6 0 . 15 103______________________________________experiment time to 95 % conversion , % &# 34 ; ol &# 34 ;. sup . ( 1 ) minutes at 95 % conversion______________________________________494 8 percent conversion in 4 hours496 / 498 71 1 . 0495 270 3 . 2497 140 1 . 5499 165 1 . 4______________________________________ . sup . ( 1 ) 900 grams phenol ( purified ), 160 ° c ., 80 psi ( 5 . 51 . times 10 . sup . 5 pascals ) hydrogen . . sup . ( 2 ) recycle catalyst was obtained from a commercial reactor slurry sample , washed with hexane and dried . . sup . ( 3 ) the amount of palladium added represents 1 % based on catalyst . . sup . ( 4 ) ten percent aqueous solution . table 2______________________________________ effect of the anion of the palladium salt______________________________________experiment palladium salt . sup . ( 2 ) naoh . sup . ( 3 ). sup . ( 1 ) type mg m mole ml m mole______________________________________499 acetyl - 130 0 . 43 0 . 34 0 . 85 acetonate501 acetate 95 0 . 42 0 . 34 0 . 85500 chloride 75 0 . 42 0 . 34 0 . 85______________________________________experiment k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; ×. sup . ( 1 ) 10 . sup .- 3 min . sup .- 1 10 . sup .- 1 min . sup .- 1 k &# 34 ; one &# 34 ;/ k &# 34 ; ol &# 34 ; ______________________________________499 15 . 6 0 . 15 103501 13 . 9 0 . 19 73500 8 . 7 0 . 15 58______________________________________experiment time to 95 % conversion , % &# 34 ; ol &# 34 ;. sup . ( 1 ) minutes at 95 % conversion______________________________________499 165 1 . 4501 173 1 . 6500 285 2 . 5______________________________________ . sup . ( 1 ) 900 grams phenol ( purified ), 4 . 5 grams recycle catalyst c ( hexan washed and dried ), 160 ° c ., 80 psi ( 5 . 51 × 10 . sup . 5 pascals ) hydrogen . . sup . ( 2 ) the amount of palladium added represents 1 % based on catalyst . . sup . ( 3 ) ten percent aqueous solution . table 3______________________________________effect of palladium salt onvarious recycle catalyst______________________________________recyclecatalyst palladium . sup . ( 5 ) experiment amount , acetylacetonate naoh . sup . ( 6 ). sup . ( 1 ) grams mg m mole ml m mole______________________________________418 . sup . ( 2 ) a 9 -- -- 0 . 63 1 . 58502 . sup . ( 2 ) a 4 . 5 130 0 . 43 0 . 34 0 . 85419 . sup . ( 3 ) a 9 -- -- 0 . 63 1 . 58503 . sup . ( 3 ) a 4 . 5 130 0 . 43 0 . 34 0 . 85504 . sup . ( 3 ) a 4 . 5 130 0 . 43 0 . 66 1 . 64495 . sup . ( 4 ) b 9 -- -- -- -- 499 . sup . ( 4 ) b 4 . 5 130 0 . 43 0 . 34 0 . 85______________________________________experiment k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; ×. sup . ( 1 ) 10 . sup .- 3 min . sup .- 1 10 . sup .- 3 min . sup .- 1 k &# 34 ; one &# 34 ;/ k &# 34 ; ol &# 34 ; ______________________________________418 . sup . ( 2 ) 6 . 5 0 . 21 31502 . sup . ( 2 ) 6 . 4 0 . 13 48419 . sup . ( 3 ) 12 . 6 0 . 27 47503 . sup . ( 3 ) 9 . 4 0 . 18 54504 . sup . ( 3 ) 11 . 9 0 . 14 87495 . sup . ( 4 ) 11 . 1 0 . 23 49499 . sup . ( 4 ) 15 . 6 0 . 15 103______________________________________ . sup . ( 1 ) 900 grams phenol ( purified ), 160 ° c ., 80 psi ( 5 . 51 × 10 . sup . 5 pascals ) hydrogen . . sup . ( 2 ) recycle catalyst was obtained from a commercial slurry washed with hexane and six times with water at 100 ° c ., then dried . . sup . ( 3 ) recycle catalyst was obtained from a commercial reactor slurry , washed with hexane , twice with 10 % caustic at 100 ° c ., and four times with hot water , then dried . . sup . ( 4 ) recycle catalyst was obtained from a commercial reactor slurry , washed with hexane and dried . . sup . ( 5 ) the amount of palladium added represents 1 % based on catalyst . . sup . ( 6 ) ten percent aqueous solution . table 4__________________________________________________________________________effect of acetic acid removal on catalyst performance . sup . ( 1 ) 95 % conversion k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; × k &# 34 ; one &# 34 ;/ time , experiment palladium salt 10 . sup .- 3 min . sup .- 1 10 . sup .- 3 min . sup .- 1 k &# 34 ; ol &# 34 ; minutes &# 34 ; ol &# 34 ;, % __________________________________________________________________________505 pd acetate dissolved 16 . 2 0 . 16 103 153 1 . 1 in phenol . sup . ( 2 ) 506 pd phenate dissolved 18 . 1 0 . 14 131 134 1 . 0 in phenol . sup . ( 3 ) __________________________________________________________________________ . sup . ( 1 ) hydrogenation experiment : 900 grams phenol 4 . 5 grams recycle catalyst b equivalent of 1 % pd added as pd salt 65 . 5 mg naoh ( sum of 4000 ppm na + on catalyst and stoichiometric requirement for pd salt ), 160 ° c ., 80 psi ( 5 . 51 × 10 . sup . 5 pascals ) hydrogen . . sup . ( 2 ) pd acetate was added as a solution of 0 . 095 gram pd acetate ( 0 . 045 gram palladium ) in 20 grams phenol . . sup . ( 3 ) pd phenate solution was prepared as follows : a solution of 0 . 475 gram of pd acetate in 99 . 5 grams phenol was subjected to distillation under vacuum ; approximately onehalf of the phenol was distilled over . the weight of the residue was restored to 100 grams . of this solution , 20 grams containing 0 . 045 gram palladium as palladium phenate was used . table 5______________________________________performance of catalyst prepared frompalladium salt and carbon black . sup . ( 1 ) ______________________________________ k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; × 10 . sup .- 3 10 . sup .- 3experiment catalyst min . sup .- 1 min . sup .- 1______________________________________507 pd phenate ( equivalent 11 . 5 0 . 12 to 1 % pd ) + carbon black normally used to prepare standard catalyst . sup . ( 2 ) 510 pd phenate . sup . ( 2 ) ( equivalent 8 . 0 0 . 28 to 1 % pd ) + carbon black ; alternate source511 pd on carbon prepared 11 . 5 0 . 17 from pd phenate . sup . ( 2 ) and carbon black . sup . ( 3 ) ______________________________________ 95 % conversion k &# 34 ; one &# 34 ;/ time , experiment catalyst k &# 34 ; ol &# 34 ; min . &# 34 ; ol &# 34 ;, % ______________________________________507 pd phenate . sup . ( 2 ) ( equiv . 99 216 2 . 3 to 1 % pd ) + car - bon black , normally used to prepare standard catalyst510 pd phenate . sup . ( 2 ) ( equiv . 28 & gt ; 300 & gt ; 5 to 1 % pd ) + car - bon black ; alternate source511 pd on carbon pre - 69 223 3 . 1 pared from pd phenate . sup . ( 2 ) and car - bon black . sup . ( 3 ) ______________________________________ . sup . ( 1 ) see table 4 , footnote . sup . ( 1 ). catalyst recovered from experimen 507 contained 0 . 79 % pd ( not corrected by tga loss ) . sup . ( 2 ) see table 4 , footnote . sup . ( 2 ) . sup . ( 3 ) whereas in experiments 507 and 510 the catalyst was generated in situ ; in the experiment 511 , palladium phenate was deposited on carbon black ( normally used to prepare standard catalyst ) from a phenol solution then filtered and dried ( 0 . 82 % pd by analysis ); subsequently 4 . 5 grams wa used as catalyst . table 6__________________________________________________________________________multiple cycles with once palladium acetatepromoted recycle catalyst . sup . ( a ) caustic sodium , k &# 34 ; one &# 34 ; × k &# 34 ; ol &# 34 ; × time , 95 % conversioncycle expt . ppm 10 . sup .- 3 min . sup .- 1 10 . sup .- 3 min . sup .- 1 k &# 34 ; one &# 34 ;/ k &# 34 ; ol &# 34 ; min . &# 34 ; ol &# 34 ;, % &# 34 ; one &# 34 ;/&# 34 ; ol &# 34 ; __________________________________________________________________________1 -- -- -- -- -- -- -- -- 2 512 4000 22 . 7 0 . 30 76 90 - 100 1 . 70 553 513 4000 26 . 3 0 . 25 104 88 1 . 28 784 514 4000 42 . 2 0 . 34 123 76 1 . 30 725 515 4000 31 . 7 0 . 22 144 76 1 . 20 786 516 4000 34 . 8 0 . 26 133 68 1 . 17 807 517 2000 29 . 6 0 . 26 115 77 1 . 22 778 518 2000 27 . 8 0 . 25 113 82 1 . 23 769 519 4000 31 . 7 0 . 22 143 73 1 . 13 8310 520 2000 27 . 0 0 . 23 119 70 1 . 10 8511 521 2000 30 . 0 0 . 25 118 79 1 . 22 7712 522 2000 25 . 5 0 . 26 99 83 1 . 35 69__________________________________________________________________________ . sup . ( a ) 900 grams phenol . 9 grams catalyst , promoted in the first cycle with 0 . 190 gram palladium acetate . naoh was added as a 10 % aqueous solution . 160 ° c ., 80 psi ( 5 . 4 atmospheres ) ( 3 . 72 × 10 . sup . 4 pascals ) hydrogen . table 7______________________________________determination of palladium onreconditioned catalysts . sup . ( a ) palladium bulkpalladium on surface pd content % on . sup . ( b ) pd : c ( atomicexpt . salt catalyst ( esca ) adsorption ), % ______________________________________497 none 0 0 . 006 1 . 47496 acetyl 1 0 . 131 2 . 42 acetonate501 acetate 1 0 . 140 2 . 29500 chloride 1 0 . 016 1 . 89 -- virgin 5 0 . 055 5 . 0 catalyst . sup . ( b ) ( englehard ) ______________________________________ . sup . ( a ) the catalyst was recovered from the hydrogenation reaction mixture , washed with hexane , and dried . . sup . ( b ) by esca ( electron spectroscopy for chemical analysis ).

US-36410982-A

the present disclosure describes and teaches a drill safety system including a magnetic unit , a vacuum unit , and an improved hole saw drill set . the various parts of the drill safety system may be used individually or in combination with one another . the user may use the magnetic unit to surround the drilling site so that metal drill shavings on the drill surface may be collected by the magnetic unit . in addition , the magnetic unit includes a flippable top mechanism , allowing convenient disposal of the debris . the vacuum unit is fitted to the inner surface of the drilling site , collecting debris that fall through . the improved hole saw prevents over - penetrating by the drill , reducing the likelihood of damaging equipments underneath the drill site . this makes the drill particularly suitable for drilling holes during electrical work .

the preferred embodiments of the present invention will now be described with reference to the drawings . identical elements in the various figures are identified , as far as possible , with the same reference numerals . reference will be made in detail to embodiments of the present invention . such embodiments are provided by way of explanation of the present invention , which is not intended to be limited thereto . in fact , those of ordinary skill in the art may appreciate upon reading the present specification and viewing the present drawings that various modifications and variations can be made thereto without deviating from the innovative concepts of the invention . fig1 shows a top perspective view of a vacuum unit of the drill safety system . shown in fig1 is the vacuum unit 50 having a collecting cup 60 , a first connector 70 , a second connector 75 , a connecting tube 80 , and a handle element 85 , wherein the collection cup 60 has a lower cup body 62 and an enlarged cup rim 63 , and the handle element 85 has a handle tube 86 and a handle 87 . the collecting cup 60 , the first connector 70 , the connecting tube 80 , the second connector 75 and the handle tube 86 are all hollow inside and are sequentially connected , forming a through channel for the movement and collection of drill shavings . fig2 shows a bottom perspective view of the vacuum unit of the drill safety system . shown in fig2 is the vacuum unit 50 having a collecting cup 60 , a first connector 70 , a second connector 75 , a connecting tube 80 , and a handle element 85 , wherein the collection cup 60 has a lower cup body 62 and an enlarged cup rim 63 , and the handle element 85 has a handle tube 86 and a handle 87 . the collecting cup 60 , the first connector 70 , the connecting tube 80 , the second connector 75 and the handle tube 86 are all hollow inside and are sequentially connected , forming a through channel for the movement and collection of drill shavings . fig3 shows a top perspective view of a magnetic unit of the drill safety system when the flippable top is set in place . shown in fig3 is the magnetic unit 10 having an outer cover 20 , wherein the outer cover has a unit base 24 and a flippable top 27 . the inner structures of the magnetic unit 10 are shielded from view . the magnetic unit 10 is generally a ring or annulus structure , especially if viewed from the top . fig4 shows a top perspective view of the magnetic unit of the drill safety system when the flippable top is flipped over . shown in fig4 is the magnetic unit 10 having an outer cover 20 , wherein the outer cover has a unit base 24 and a flippable top 27 . the flippable top 27 is flipped up , showing the inner magnets 30 , the magnet connectors 33 , and the support ring 40 . as indicated by fig3 , the magnets 30 are fully covered when the flippable top 27 is flipped down . as shown in fig4 , the magnets 27 are placed around the support ring 40 and on the unit base 24 . fig5 shows a top perspective view of the magnetic unit of the drill safety system when the flippable top is flipped over and the magnets are removed . shown in fig5 is the magnetic unit 10 having an outer cover 20 , wherein the outer cover has a unit base 24 and a flippable top 27 . the flippable top 27 is flipped up , showing the inner magnets 30 , the magnet connectors 33 , and the support ring 40 . the magnets 30 are removed from the unit base 24 . fig6 shows a top perspective view of an improved drill set of the drill safety system . shown in fig6 is the drill set 90 having a pilot bit 93 , a hole saw arbor 94 , and a hole saw 95 . the key feature for this embodiment is that the hole saw arbor 94 includes a stopper flange 96 positioned right behind and abutting the hole saw 95 . fig7 shows a side view of the improved drill set of the drill safety system . shown in fig7 is the drill set 90 having a pilot bit 93 , a hole saw arbor 94 , and a hole saw 95 . the key feature for this embodiment is that the hole saw arbor 94 includes a stopper flange 96 positioned right behind and abutting a back end 98 of the hole saw 95 , defining a hole saw length 99 measured from a front end 97 to the back end 98 of the hole saw 95 . such an improvement limits the depth of the hole resulted from drilling with the drill set 90 to the hole saw length 99 , preventing unintended over - drilling that may damage the equipment underneath the drilling site . fig8 shows a side sectional view of all components of the drill safety system when the system is in use . shown in fig8 is a drill 100 equipped with the improved drill set 90 having a pilot bit 93 and a hole saw 95 , which includes bit stopper flange 96 . also shown in fig8 are the magnetic unit 10 and the vacuum unit 50 , wherein the magnetic unit 10 comprises an outer cover 20 having a unit base 24 and a flippable top 27 , inner magnets 30 with magnet connectors 33 , and a support ring 40 ; the vacuum unit 50 comprises a collecting cup 60 , a first connector 70 , a second connector 75 , a connecting tube 80 , and a handle element 85 ; and the collection cup 60 has a lower cup body 62 and an enlarged cup rim 63 , and the handle element 85 has a handle tube 86 and a handle 87 . as shown in fig8 , the collecting cup 60 , the first connector 70 , the connecting tube 80 , the second connector 75 and the handle tube 86 are all hollow inside and are sequentially connected , forming a through channel for the movement and collection of drill shavings . in fig8 , drilling is being conducted on a metal board 200 , which has a drilling surface 210 that engages the pilot bit 93 and the hole saw 95 , as well as an inner surface 220 that is the opposite of the drilling surface 210 . in addition , the location on the board 200 that initially engages the drill bits are generally termed a drill site 240 . the board 200 is intended as an example for the workpieces on which drilling can be conducted . workpieces having different shapes , sizes , depth , thickness , and texture are all possible . referring to fig1 , 2 , and 8 , the drill safety system may include a vacuum unit 50 . as indicated above , the vacuum unit 50 is used to collect the shavings from the inner side 220 . the collecting cup 60 of the vacuum unit 50 has a lower cup body 62 and an enlarged cup rim 63 , wherein the cup rim 63 may fit on the inner surface 220 . the collecting cup 60 covers the drilling site 240 , providing a complete shielding and collecting structure that ensures all metal and non - metal shavings on the inner surfaces are properly gathered . although the collecting cup 60 has a round opening , it should be noted that other shapes , such as square , may also be adopted . in a preferred embodiment , the inner surface 240 is a flat surface and the cup rim 63 may fit on the flat surface . the collecting cup 60 and the connecting tube 80 are the essential elements of the vacuum unit 50 , which can be connected to a vacuum motor providing suction power , allowing shavings on the inner surface to be collected . the connecting tube 80 may be rigid or flexible . in addition , as indicated by fig1 and 2 , the vacuum unit 50 may further include a first connector 70 , a second connector 75 , and a handle element 85 , which may include a handle tube 86 and a handle 87 , wherein the collecting cup 60 , the first connector 70 , the connecting tube 80 , the second connector 75 , and the handle tube 86 all hollow inside and are sequentially connected , forming a through channel . preferably , a user may take hold of the handle 87 and manually press the collecting cup 60 to the inner surface 240 . such an embodiment does not require the worker to reach inside the housing of live switchgear and improves safety . alternatively , the cup rim 63 may include magnets so that the collecting cup 60 can magnetically attach to the inner surface 240 , allowing the person conducting the drilling to do the work alone . the first connector 70 and the second connector 75 are structures that provide more flexibility to the design of the vacuum unit 50 and these structures may have different length and twisting angles . by adjusting the first connector 70 and the second connector 75 , as well as the connecting tube 80 and the handle element 85 , a user may reconfigure the vacuum unit 50 to avoid pressing the various parts of the vacuum unit 50 against the equipment in the workpiece . various methods can be used to connect the collecting cup 60 , the first connector 70 , the connecting tube 80 , the second connector 75 , and the handle element 85 . these structures can be screwed , molded , welded , or glued together , or using any combination of suitable methods . referring to fig3 , 4 , 5 , and 8 , the magnetic unit 10 is used to collect the metal shavings on the drilling surface 210 . before drilling , the magnetic unit 10 is placed on the drilling surface 210 , and around and / or adjacent to the drilling site 240 . since the magnetic unit 10 includes magnets 30 , when the workpiece is metal , the magnetic unit 10 may securely attach to the workpiece without the aid of gravity . this feature is particularly useful when the drilling surface is not horizontal . in a preferred embodiment as shown in fig3 - 5 , the magnetic unit has a ring or annulus shape , especially if viewing from the top . the ring shape allows the magnetic unit 10 to surround the drilling site 240 , as shown in fig8 . however , it should be noted that the shape of the magnetic unit 10 may vary according to the specific job to be conducted , the size and shape of the work piece , and surface conditions . for example , the magnetic unit 10 may be an elongated strip that may be flexed and twisted to conform to a specific drilling work . the strip - shaped magnetic unit 10 may even be twisted in a circle to mimic the ring - shape embodiment . the cover 20 of the magnetic unit may comprise a unit base 24 and a flippable top 27 , wherein the magnet core — the magnets 30 combined with the connector 33 — may be placed on the unit base 24 and be shielded by the flippable top 27 when the flipped top 27 is flipped down . it is possible that the unit base 24 and the flippable top 27 form a single continuous structure . alternatively , the unit base 24 and the flippable top 27 may be distinct but attached structures that as a whole form a cover 20 shielding the a magnet core . it should also be noted that while the embodiment shown in fig3 - 5 show the flippable top 27 to expose the inner structures of the magnetic unit 10 by flipping up , other designs are still possible . the key feature for the cover 20 is that it may be opened so that the magnets may be removed . specific designs may vary and as long as the general structures fit with the essential concept , such designs are incorporated in the current invention . when the flippable top 27 is flipped down , no magnet is directly exposed . the metal shavings resulted from drilling on the drilling surface are pulled towards the magnetic unit 10 and attached to the cover 20 , which is preferably non - magnetic and non - conductive . after drilling , as shown in fig4 - 5 , the flippable top 27 is flipped up , allowing the magnets 30 to be removed so that the metal shavings can no longer attach to the cover 20 . the user may then easily discard the shavings , put the magnets 30 back , flip down the flippable top 27 , and make the magnetic unit 10 ready to be used again . to ensure the physical robustness of the magnetic unit 10 , a support structure 40 may be included to provide physical support to the magnetic unit 10 . the support structure 40 is preferred to be rigid and it may conform to the shape of the magnetic unit 10 . as indicated above , the shape of the magnetic unit 10 may vary . therefore , the size and shape of the support structure 40 may vary accordingly . the magnets 30 used in the current invention are preferably permanent magnets and may be any type of magnetic material , including but not limited to : metallic magnets , composite magnets , and rare earth magnets , and any combination thereof . the magnet connectors 33 are optional elements used to link two or more magnet pieces together , allowing easier placement and removal . a magnet 30 may have a wrap that covers the magnet 30 , wherein the wrap may directly link with the magnet connector 33 . it is preferred that the magnet connector 33 is flexible , allowing the magnet pieces to bend against one another . the embodiment shown in fig5 includes two magnets sets , each including two magnet pieces linked by a magnet connector 33 . it should be clear that such format may vary according to the size of the magnetic unit 10 , the magnetic power required , and the specific needs of the drilling work . referring to fig6 , 7 , and 8 , the drill safety system may include an improved hole saw drill set 90 that includes a stopper flange 96 . as indicated above , similar to the conventional hole saw drill bit , the current hole saw 95 is a cylinder structure that can be connected , usually with a threaded section , to a drill arbor 94 , wherein the front end 97 of the cylinder facing the board 200 has sawteeth that may cut through the board 200 to produce a hole at drilling site 240 . in the current improved hole saw drill set 90 , the hole saw arbor 94 includes a stopper flange 96 extending from a periphery of the hole saw arbor 94 and positioned right behind and abutting the back end 98 of the hole saw 95 , blocking the advancement of the hole saw 95 when the entire cylinder of the hole saw 95 has cut into the workpiece . the length 99 of the hole saw 95 , measured from the front end 97 to the back end 98 , sets a maximum limit for the depth of the hole . to cut a through hole on the board 200 , the thickness of the board 200 must be smaller than the length 99 of the hole saw 95 . such a design prevents over - penetration , protects the inner structures of the workpiece , and in essence puts more emphasis on the safety of the device . it is a better design compared with placing the stopper flange directly on the back end 98 of the hole saw 95 because the current design allows hole saws with different lengths to be used with the same drill arbor 94 . the user may choose drill bits having different lengths for different projects and use the same drill arbor , ensuring that the drilling can be conducted effectively and protection is provided at the same time . as indicated above , the various parts of the drill safety device may be used individually and in combination with one another . for example , the user may utilize a conventional hole saw drill bit for drilling that is protected by the magnetic unit 10 and the vacuum unit 50 . the magnetic unit 10 may be used together with traditional make - shift arrangement used by electricians or the device disclosed in u . s . pat . no . 6 , 974 , 048 . the magnetic unit 10 and the vacuum unit 50 , when used together , provide a complete solution for debris removal when drilling on metallic workpieces . the inclusion of the improve hole saw drill bit further adds to the level of security that prevents damages and accidents . in terms of dimension , the sizes of various parts of the drill safety system may vary according to drill beings used , the intended drilling results , and the size and the shape of the workpiece . the collecting cup 60 is preferred to provide sufficient coverage of the drilling site 240 . the covered area of the collecting cup 60 , measure by the area within the cup rim 63 , is preferred to range from 1 cm 2 to 1 m 2 , with the more preferred range of 10 to 200 cm 2 . the overall length of the vacuum unit 50 may range from 10 cm to 5 m , with the preferred range of 30 to 100 cm . when the magnetic unit 10 has a ring shape , as indicated in fig3 - 5 , the inner diameter may range from 1 cm to 1 m , with the preferred range of 5 to 30 cm , the outer diameter may range from 1 cm to 1 . 5 m , with the preferred range of 5 to 50 cm , and the ration of ( outer diameter )/( inner diameter ) may range from 1 . 1 to 5 , with the preferred range of 1 . 2 to 2 . 5 . the length 99 of the hole saw 95 may range from 0 . 5 to 100 cm , with the preferred range of 1 to 20 cm . it is preferred that various parts of the drill safety system are not too heavy so that they may be held , transported , and used with easy . in particular , the vacuum unit 50 is preferred to be light because in some cases , a user is supposed to hold the vacuum unit 50 during drilling . the overall weight of the vacuum unit 50 may range from 10 g to 20 kg , with the preferred range of 100 g to 5 kg . the overall weight of the magnetic unit 10 may range from 50 g to 20 kg , with the preferred range of 200 g to 10 kg . the overall weight of the drill set 90 may range from 10 g to 5 kg , with the preferred range of 20 g to 2 kg . in terms of materials , any part of the vacuum unit 50 and the magnetic unit 10 that make contact with the workpiece is preferred to be non - conductive and non - magnetic . the various parts of the vacuum unit 50 may be made from the same or different materials . the material is preferred to be safe , strong , and impermeable to liquid . moreover , it would be desirable that the material is inexpensive and easy to process during manufacture . the materials that may be used include but are not limited to : rubber , and plastic such as , but not limited to , polyethylene terephthalate ( pet ), polyethylene ( pe ), high - density polyethylene , polyvinyl chloride ( pvc ), polyvinylidene chloride ( pvdc ), low - density polyethylene ( ldpe ), polypropylene ( pp ), polystyrene ( ps ), high impact polystyrene ( hips ) and polycarbonate ( pc ), or paperboard coated with a suitable coating such as , but not limited to , polyethylene , or some combination thereof . the various parts of the magnetic unit 10 may be made from the same or different materials . the magnets 30 , as indicated above , are preferred to be permanent magnets . the cover 20 of the magnetic unit 10 is preferred to be non - conductive , non - magnetic , flexible but durable so that the flippable top 27 may be flipped up and down numerous times . the materials suitable to make the cover 20 include but are not limited to rubber , and plastic such as , but not limited to , polyethylene terephthalate ( pet ), polyethylene ( pe ), polyvinylidene chloride ( pvdc ), low - density polyethylene ( ldpe ), polypropylene ( pp ), polystyrene ( ps ), high impact polystyrene ( hips ) and polycarbonate ( pc ), or paper or fabric coated with a suitable coating such as , but not limited to , polyethylene , or some combination thereof . the preferred material for the cover 20 of the magnetic unit 10 is rubber . as indicated above , the primary focus of the current invention is to improve safety during the drilling of live equipment . however , the use of the current invention is much broader . for example , with proper arrangement , the vacuum unit , the magnetic unit , and the improved hole saw will also help to save time in new installations . when the workers are doing new installations of switch gear , holes are drilled into the housing . the conventional approach is to use some make - shift arrangement or vacuum out the equipment after drilling has been completed . in systems like data centers each piece of gear may have 8 - 16 conduits and a significant amount of shavings may be left on top of the gear . the electricians usually need to spend several days vacuuming out all of the gear before it can be energized for the first time . using the current invention significantly lessens the time and man - power to clean the new gear before energizing it for the first time because the debris is collected while holes are being drilled . in addition , the current invention may be used to install new circuits underneath raised computer floors sites such as data centers , which have very strict rules about debris caused by new installations in such critical environments . air conditioning usually moves underneath the floor , creating a strong flow of air that may spread the shavings . this is a situation where the worker is either drilling from underneath equipment and debris would be falling into the clean computer floor or drilling into a junction box that is under the raised floor where the air flow is moving and blowing everything around . the conventional approach is to have a worker hold a shop vacuum nozzle next to the drill site while another worker drills . then , the floors are vacuumed and coated after a new install before a company moves in . the conventional method gets most of the debris but usually misses whatever is on the side of the drill opposite the vacuum nozzle . using the current invention properly collects all the shavings while drilling is being conducted , saving a significant amount of time and cost . although this invention has been described with a certain degree of particularity , it is to be understood that the present disclosure has been made only by way of illustration and that numerous changes in the details of construction and arrangement of parts may be resorted to without departing from the spirit and the scope of the invention .

US-201414201981-A

in inserted blade rotary end mills having tapered blades inserted in axially extending tapered sockets . the improvement of providing longitudinal interfitting serrations on opposed surfaces of both the inserted blades and sockets to prevent twisting of the blades in the sockets .

as shown in fig1 an end mill comprises a shank 1 , cylindrical on an axis a , from which four posts 2 extend axially from the shank . the posts may or may not be joined at the central part of the end mill . the shank is one half to three inches in diameter . between the posts are formed four elongate sockets 3 , each inclined to the axis a of the end mill as best shown in fig2 . the sockets taper lengthwise toward the shank at an angle of approximately 3 °, for example . inserted in each socket is an elongate cutting blade 4 which has the same taper as the sockets . each blade has a helical cutting edge 6 formed by a curved surface 7 and a machined face 8 , the surface 7 and face 8 being shaped to form the helical edge concentric with the axis a . as shown in fig3 the helical shape of the cutting edge 6 allows the machined face 8 to be inclined at a positive rake angle r with respect to a radius from the axis a , notwithstanding the negative rake nr of the blade slot . on two opposite faces the blade has longitudinal serrations 9 and 11 . the serrated faces taper lengthwise of the blade the same degree as the sockets which receive the blades . the serrations have a pitch of approximately 0 . 030 of an inch , and the two sets of serrations 9 and 11 lie or run in parallel planes . the blade serrations 9 and 11 precisely , slidingly interfit with serrations 12 and 13 on opposed walls of the sockets 3 , which serrations are complementary to the blade serrations , having the same pitch and taper as those on the blade , and lying in parallel planes . in a blade two inches long the tolerance is about 0 . 002 inches maximum . to maintain this tolerance both serrations 9 and 11 of the blade are preferably cut by a numerically controlled machine in one set up of the blade , that is cutting passes are made on both faces of the blade without unclamping it from the cutting machine . similarly opposite faces of each socket are cut in one set up . the blades 4 are inserted in the sockets 3 of the end mill in the same way as with singly serrated blades . but in addition to an increase of resistance to radial displacement of the blades under cutting loads , in the present end mill there is a positive resistance to twisting or rotation of the blades in the sockets and consequent chattering . two adjacent posts apply their gripping force to the opposite serrated faces of each blade , whereas with a singly serrated blade the unserrated face is free to slide and allow rotation . furthermore with double serrations , insertion of the last blade in its socket exerts a force around the circumferance of the posts adding to the grip of the other posts on the other blades . with a singly serrated blade the added force of insertion of the last blade would only cause flexing of the posts and slippage along the unserrated face without adding to the gripping force . the added blade gripping force , reduction of post flexing and reduction of blade chatter make possible the use of small end mills one half to three inches in diameter which hitherto were not feasible . it should be understood that the present disclosure is for the purpose of illustration only and that this invention includes all modifications and equivalents which fall within the scope of the appended claims .

US-21724780-A

a decorative clasp closes by magnetic action , and can be worn on the front , i . e . at the throat or beneath the throat . the clasp allows the loop size of the jewelry article to be adjusted to suit the wearer &# 39 ; s preferences . a pair of arcuate arms are joined at a pivot member , and close magnetically to form a generally oval shape .

with reference now to the drawing , fig1 shows an item of neck - worn jewelry in the form of a necklace , i . e ., string or strand 10 of generally spherical beads 11 , which are strung in line on a flexible cord e . g ., a string or wire . in this embodiment , there are smaller spacer beads 12 included between the second and third beads 11 , between the fourth and fifth beads 11 , and so forth . in many embodiments , the necklace would be constructed with a knot formed between successive beads , and there is a generally v - shaped valley or recess defined between any two successive beads . as shown in fig1 , there is a decorative clasp 14 that is attached onto one end of the necklace 10 , and this clasp attaches over the necklace between any two successive beads 11 at or near the opposite end . in the illustrated embodiment , the clasp is fastens over the necklace a few inches from the end , so that the necklace is worn up on the neck with the clasp 14 visible at the front , that is , with the decorative clasp 14 visible on the wearer &# 39 ; s neck . the remainder of the necklace hangs down as a single strand , i . e ., as a pendant . details of the construction of the magnetic clasp 14 can be seen in the remaining views , namely , fig2 to 5 . fig2 shows the reverse of the necklace or strand 10 and clasp 14 . the clasp 14 has an eyelet 16 at one end of a first more - or - less linear bar or arm 18 , and the eyelet 16 serves as a point of attachment for the cord or wire at one end of the strand 10 . the first arm 18 extends distally , i . e ., away from the end of the strand 10 , and a first magnet member 20 is affixed at the distal end portion of the arm 18 . then a second , curved ( that is , arcuate ) arm 22 continues distally from the magnet member 20 and ends at a hinge or pivot member 24 . turning now to fig3 to 5 , it can be seen that a third , curved ( i . e ., arcuate ) arm 26 is pivotally attached at one end to the second curved arm 22 at the pivot member 24 . this allows the third arm 26 to swing in and out between a closed position ( fig2 ) and an open position ( fig3 , 4 , and 5 ). as especially in the closed position , the third arcuate arm 28 is seen to extend back , i . e ., proximally , from the hinge or pivot member 24 . there is a second magnet 28 positioned at an end portion of the arm 26 , and in the closed position of the clasp 14 the two magnets 20 and 28 magnetically engage and grip one another . however , the magnets can be pulled apart easily by the wearer wishing to put on the jewelry article , or take it off , or adjust it . as seen in fig2 , the two curved arms 22 and 26 define a more - or - less oval shape that fits into the valley or gap between successive beads 11 , 11 when the clasp 14 is closed . the gentle curvature here lies against the beads and does not scratch or abrade them . in this embodiment , the clasp 14 opens to the front , but in some other embodiments the clasp can open to the rear . as seen in fig1 and also in fig3 , 4 , and 5 , the clasp 14 includes decorative leafwork , i . e ., flat or shallow three - dimensional ornamental members covering the clasp mechanism at the front of the clasp 14 . a first decorative leaf member 30 is disposed at the front or side of the first arm member 18 , and in some embodiments the arm member 18 can be unitarily formed with the leaf member 30 . here , the magnet 20 is shown at the distal edge of the leaf member 30 . another leaf member 32 is formed on the front of the third or movable curved arm 26 and extends over the hinge or pivot member 24 , the curved arm member 26 and the second magnet 28 , so that these are concealed behind the leaf member 32 . in some embodiments , the arm member 26 can be formed unitarily with the ornamental leaf member 32 . as seen in fig1 the two leaf members 30 and 32 combine to make a single visual impression . in the illustrated embodiment , the leaf members 30 , 32 are in the form of a floral design , but in other embodiments , these can be made to represent foliage , twigs , animal shapes , or arbitrary and abstract non - representational designs , depending upon the tastes and preferences of the jeweler . in the present embodiment , the clasp 14 is formed of a sterling silver , but in other embodiments , other materials can be used . the materials may include a plastic resin , a metal , or a ceramic , for example . here , the magnet members 20 and 28 are in the form of shallow cylindrical cups ( e . g ., formed of sterling silver or other jeweler &# 39 ; s material ) with a small disk - shaped permanent magnet contained within it . the clasp 14 is here shown used with a strand 10 formed of generally spherical beads 11 of more or less uniform size , with smaller size spacer beads 12 . however , the clasp 14 can be used to advantage with beads of non - round shape , or with strands of beads or pearls that are of varying size and / or type . the clasp 14 can be used with necklace in the form of a double strand . while the invention has been described in respect to a preferred embodiment , the invention is not limited only to that embodiment . rather , the scope and spirit of this invention is to be defined in accordance with the appended claims .

US-43213109-A

the disclosure relates to a method for determining a level of a liquid in a tank with an ultrasonic fill state sensor and at least two reference surfaces for reflecting an ultrasonic wave transmitted by the ultrasonic fill state sensor . a first reference surface is arranged below a second reference surface . the method includes determining a first propagation speed of an ultrasonic wave to the first reference surface on a first measurement path and a second propagation speed from the first reference surface to the second reference surface on a second measurement path . the method also includes measuring a propagation time of an ultrasonic wave from the ultrasonic fill state sensor to a liquid level of the liquid in the tank , selecting the first propagation speed or the second propagation speed based on at least one selection criterion , and calculating a fill state using the propagation time measured .

the following description is merely exemplary in nature and is in no way intended to limit the disclosure , its application , or uses . fig1 shows a tank 4 having an extraction unit 27 integrated in the tank wall 15 of the tank 4 in the region of a bottom of the tank . liquid can be removed from the tank 4 with the extraction unit 27 and , for examples , an exhaust treatment device ( not shown here ) can be provided . the housing of the extraction unit 27 forms at least segments of the tank wall 15 . an ultrasonic level sensor 3 is disposed in the extraction unit 27 . there are a first reference surface 1 and a second reference surface 2 above the ultrasonic level sensor 3 . the liquid in the tank forms a liquid level 7 up to which the liquid in the tank 4 extends ( upwards ). fig2 shows a calibration component 29 , which can be integrated within the tank 4 for providing the first reference surface 1 and the second reference surface 2 . in some examples , the calibration component 29 consists of metal and can be produced with accurate maintenance of tolerances for the distances and positions of the first reference surface 1 and the second reference surface 2 . in some examples , the calibration component 29 has a contact surface 28 , which can rest ( on the tank wall 15 ) near the ultrasonic level sensor 3 and hence determines the precise positioning of the calibration component 29 . moreover , the calibration component 29 may have a spring segment 30 , which ensures that the calibration component 29 contacts the contact surface 28 precisely at a specified position on the tank wall 15 . the position and orientation of the first reference surface 1 and the second reference surface 2 are accurately specified relative to the ultrasonic level sensor 3 in this way . in fig3 it can be seen how the calibration component 29 can be disposed on a tank wall 15 of the tank 4 . in some examples , the calibration component 29 is fixed to the tank wall 15 by at least one screw 32 . the contact surface 28 of the calibration component 29 is pressed fixedly on a specified point of the tank wall 15 by the spring segment 30 . the ultrasonic level sensor 3 is disposed opposite the calibration component 29 on the tank wall 15 and is also fixed here , by way of example , by at least one screw 32 . a first measuring distance 5 from the ultrasonic level sensor 3 to the first reference surface 1 and a second measuring distance 6 from the second reference surface 2 to the first reference surface 1 are defined by the positioning of the ultrasonic level sensor 3 and of the calibration component 29 . fig4 illustrates various propagation times 8 of ultrasonic waves or response signals that are emitted by the ultrasonic level sensor 3 and that are reflected by structures in the tank ( e . g . by the first reference surface 1 or by the second reference surface 2 ). for better understanding , fig4 partly shows structural features ( e . g ., the ultrasonic level sensor 3 ) and is partly in the form of a diagram . fig4 shows an ultrasonic level sensor 3 at bottom left . moreover , in fig4 the tank wall 15 , the first reference surface 1 , the second reference surface 2 and a transmission means 31 that transmits ultrasonic waves from the ultrasonic level sensor 3 to the tank wall 15 are to be seen . the transmission means 31 can be , for example , a transfer paste or a transfer pad and together with the tank wall 15 forms a coupling layer 14 , through which ultrasonic waves are introduced from the ultrasonic level sensor 3 into the tank ( not shown here ). a first measuring distance 5 is defined from the ultrasonic level sensor 3 to the first reference surface 1 . a second measuring distance 6 is defined from the first reference surface 1 to the second reference surface 2 . moreover , another liquid level 7 in the tank ( not shown here ) and the level 17 in the tank arising therefrom are illustrated in fig4 . ( i ) characterizes a propagation time 8 of an ultrasonic wave from the ultrasonic level sensor 3 to the liquid level 7 and back to the ultrasonic level sensor 3 . ( ii ) shows a propagation time 8 resulting from a reflection of ultrasonic waves at the second reference surface 2 . ( iii ) shows a propagation time 8 resulting from the first reference surface 1 . the propagation time 8 characterized by ( iii ) can be divided into a propagation time ( iv ) and a propagation time ( v ). the two propagation times 8 together give the propagation time 8 according to ( iii ). ( v ) thereby characterizes the propagation time 8 through the coupling layer 14 and ( iv ) the propagation time 8 through the liquid from the tank wall 15 up to the first reference surface 1 . ( vi ) characterizes an ( imaginary ) propagation time 8 from the ultrasonic level sensor 3 to an ( imaginary ) liquid level , which is located at twice the height of the second reference surface 2 . the propagation time 8 characterized by ( vi ) normally results not from a liquid level at the height but from a double reflection of ultrasonic waves at the liquid level and at the bottom of the tank . ( vi ) thus illustrates an imaginary , not actually existing state , which is identified with an incorrect interpretation of the response signals received by the ultrasonic level sensor . a time interval 21 is defined in the region of the propagation time 8 characterized by ( vi ), wherein the propagation times 8 lying in the region of the time interval 21 are taken into account in the context of the third selection criterion in order to decide whether a change back to the second propagation speed should take place . fig5 shows a flowchart of the described method . the steps a ), b ), c ), d ) and e ) of the method can be seen . in step a ) of the method , the propagation time 8 to the first reference surface , the described correction factor 16 for the coupling layer and the first measuring distance 5 are taken into account for determining the first propagation speed 9 . of course , other parameters and / or signals can also be taken into account here . in step b ) the corresponding propagation time 8 and the second measuring distance 6 are taken into account for determining the second propagation speed 10 . here too , taking other parameters into account is possible . in step c ) the propagation time 8 to be associated with the liquid level 7 is determined . in step d ) a selection of the first propagation speed 9 or the second propagation speed 10 takes place . the selected propagation speed 9 / 10 is used in step e ), together with the propagation time 8 to the liquid level 7 , to compute the level 17 . fig6 shows a logical circuit diagram , which illustrates the combination of the individual selection criteria 11 , 12 and 13 for selection of the first propagation speed 9 or the second propagation speed 10 . the selection of the propagation speed 9 , 10 takes place in the selection module 38 . for selection of the first propagation speed 9 it is necessary that both the first selection criterion 11 and also the second selection criterion 12 indicate a corresponding selection . for this the two selection criteria 11 , 12 are combined with each other in a first criterion combiner 34 using an and operation . the output of the first criterion combiner 34 is then filtered with an integrator 36 . it is ensured by means of an integrator 36 that the first criterion combiner 34 specifies a change to the first propagation speed 9 for a specified minimum time interval before the selection module 38 makes a corresponding specification . for selection of the second propagation speed 10 it is necessary that the first selection criterion 11 and the second selection criterion 12 as well as an additional third selection criterion 13 specify selection of the second propagation speed 10 . for this the three selection criteria 11 , 12 and 13 are fulfilled together in a second criterion combiner 35 in the manner of a nand operation . the nand operation indicates that none of the three selection criteria 11 , 12 , 13 may specify the selection of the first propagation speed 9 , thus the second propagation speed 10 is selected . the output of the second criterion combiner 35 is also filtered with an integrator 36 in order to ensure that the selection of the second propagation speed 10 is specified at least for a minimum time interval . the output of the second criterion combiner 35 additionally passes through a switching module 39 before it passes to the selection module 38 . the selection of the second propagation speed 10 can be prevented by the switching module 39 if a mode check 33 determines a dynamic mode 23 . the switching module 39 only enables the selection of the second propagation speed 10 if a stationary mode 22 exists . otherwise , the corresponding input of the selection module 38 is connected to a deactivation means 37 . fig7 shows a flowchart of the first selection criterion 11 . it can be seen that a level 17 is used as the input signal . the level 17 is filtered with a low pass filter 24 and a hysteresis 25 and is then processed by an integrator 36 . it can be ensured by the integrator 36 that the first selection criterion has to be fulfilled for a specified period of time in order to cause a changeover between the propagation speeds in step d ). the filtered input signal for the level is then compared with a level limit value . in fig8 the second selection criterion 12 can be seen . here the first propagation speed 9 and the second propagation speed 10 are compared with a speed comparator 46 . the resulting signal is first filtered by a low pass filter 24 . then a fuzzy logic 47 is applied to the signal . small , permanently occurring deviations between the speeds are amplified by the fuzzy logic 47 . the fuzzy logic 47 thus improves the identification of speed deviations caused by a reduction of the liquid level . following the fuzzy logic 47 a hysteresis 25 is applied to the signal . then the use of an integrator 36 takes place in order to only detect deviations between the first propagation speed 9 and the second propagation speed 10 occurring over long periods of time . fig9 shows the third selection criterion of the described method . the level 17 is an input of the selection criterion . the level 17 is first compared with the level corresponding to the second reference surface in a level comparator 48 . then a digital mapping function 49 is used , with which it can be determined whether the level corresponds accordingly to twice the height of the second reference surface . a low pass filter 24 and a hysteresis 25 as well as an integrator 36 are applied to the output signal of the digital mapping function 49 . fig1 a to fig1 d explain the problem which occurs if the level in the tank 4 corresponds exactly to the height of the second reference surface 2 or to twice the height of the second reference surface 2 . it may not be possible for the ultrasonic level sensor 3 to draw a distinction between these two levels under certain conditions . however , it is possible to draw a distinction between the two levels by specific analysis of the response signals at the ultrasonic level sensor 3 . fig1 a and fig1 b each show a first response signal 54 , a second response signal 52 and a third response signal 53 on the signal axis 51 with respect to a time axis 50 . it has already been explained further above that the first response signal 54 is usually intended to be associated with the first reference surface 1 , while the second response signal 52 is associated with the second reference surface 2 , and the third response signal 53 is associated with the liquid surface 7 in the tank 4 , with the liquid surface corresponding to the level . fig1 a and fig1 b each show the response signals 54 , 52 , 53 that are produced if the level is exactly at the height of the second reference surface 2 . fig1 a shows static conditions ( also called the static mode further above ) which are produced if the motor vehicle is at an absolute standstill and no vibrations and / or sloshing movements of the liquid in the tank occur . fig1 b shows dynamic conditions ( also called the dynamic mode further above ) which are produced if the motor vehicle is moving and vibrations and / or sloshing movements occur in the tank 4 . the figures show that the first response signal 54 relating to the first reference surface 1 is constant both in fig1 a given static conditions and also in fig1 b given dynamic conditions , and also exhibits only minimum fluctuations , if at all , given dynamic conditions . this is because the first reference surface 1 is always below the level , independently of the dynamic mode . however , the second response signal 52 and the third response signal 53 differ between the dynamic mode and the static mode . in the static mode ( fig1 a ), the second response signal 52 is substantially constant , and the third response signal 53 exhibits only a few brief deviations . it has already been explained further above that the third response signal 53 is produced by a double reflection of the ultrasonic waves at the liquid level and at the bottom of the tank if the level corresponds to the height of the second reference surface 2 . the liquid level is also briefly above the second reference surface 2 even in the event of minimal vibrations and / or sloshing movements in the tank . in this case , the simple reflection of the ultrasonic waves at the liquid level is interpreted as a third response signal 53 , and the third response signal 53 briefly falls . however , this effect does not reliably occur in the stationary mode because it cannot be assumed that minimal vibrations and / or sloshing movements occur in a reliable and uniform manner . vibrations and / or sloshing movements regularly occur in the dynamic mode ( fig1 b ). as a result , the liquid level is regularly located above and below the second reference surface . this has the effect that both the second response signal 52 and the third response signal 53 are subject to severe fluctuations . fig1 c and fig1 d each show the response signals 54 , 52 , 53 which are produced if the filling level is exactly twice the height of the second reference surface 2 . in this case , fig1 c shows , in accordance with fig1 a , static conditions , while fig1 d , in accordance with fig1 b , shows dynamic conditions . the figures show that no fluctuations in the second response signal 52 occur under static conditions or under dynamic conditions . this is because the second reference surface is always below the level , independently of vibrations and sloshing movements . fluctuations in the third response signal ( 53 ) regularly occur given dynamic conditions ( fig1 d ). in this respect , it is possible to distinguish between whether the level corresponds to twice the height of the second reference surface 2 and whether the level corresponds to the height of the second reference surface by evaluating the second response signal 52 with respect to time . if there are fluctuations in the second response signal when the second response signal 52 is evaluated with respect to time , the level corresponds to the height of the second reference surface 2 and the third response signal 53 must not be evaluated as information relating to the level . if there are no fluctuations in the second response signal 52 when the response signal is evaluated with respect to time , the third response signal 53 corresponds to the actual level and can be accordingly evaluated . fig1 shows a motor vehicle 26 including an internal combustion engine 41 and an exhaust treatment device 43 for cleaning the exhaust gases of the internal combustion engine 41 . an scr catalyser 44 , with which the exhaust gases of the internal combustion engine 41 can be cleaned using the method of selective catalytic reduction , is disposed in the exhaust treatment device 43 . for this , a liquid additive for exhaust gas cleaning can be delivered to the exhaust treatment device 43 by means of an injector 42 . the liquid additive for exhaust gas cleaning is provided from a tank 4 via a line 45 from an extraction unit 27 . the extraction unit 27 includes an ultrasonic level sensor 3 , which is arranged to carry out the described method . the corresponding method is stored in a controller 40 . the description of the disclosure is merely exemplary in nature and , thus , variations that do not depart from the gist of the disclosure are intended to be within the scope of the disclosure . such variations are not to be regarded as a departure from the spirit and scope of the disclosure .

US-201715405897-A

a method for treating an atopic disorder in a patient is provided . the method comprises administering to the patient an effective amount of at least one of an antifungal and an antibiotic over a period of time . the method further comprises reducing over the period of time the application of emollients to the patient by at least about 50 %, relative to the amount of application of emollients prior to treatment .

in accordance with the methods of the invention , the administration of emollients is reduced by at least about 50 %, more preferably at least about 80 %, still more preferably at least about 90 %, even more preferably at least about 95 %, relative to the amount of application of emollients prior to treatment . in a particularly preferred embodiment , the administration of emollients is ceased altogether . as used herein , the term “ emollients ” includes lotions ; creams ; moisturizers ; oils ; ointments ; cocoa butter ; greases ; skin softeners ; soaps , shampoos , sunblocks , cosmetics and other products containing lotions , moisturizers or the like ; products containing “ slip ” ( a binder that allows pigment to slide across the skin ); and any other product that softens the skin or soothes irritation in the skin . the period of time over which the administration of emollients is reduced or ceased is preferably at least about 1 month , more preferably at least about 2 months , still more preferably at least about 3 months , even more preferably at least about 6 months , yet more preferably at least about 1 year . the reduction or cessation of the administration of emollients is preferably continued for as long as possible to minimize the possible recurrence of the atopic disorder . suitable antifungals for use in connection with the invention include griseofulvin ( such as . fulvicin , commercially available from schering corporation , kenilworth , n . j . ); ketoconazole ( such as nizoral tables , commercially available from janssen pharmaceutica inc ., titusville , n . j . ); itraconazole ( such as sporanox , commercially available from janssen pharmaceutica inc . ); and fluconazole ( such as diflucan , commercially available from pfizer inc ., new york , n . y .). particularly preferred anti - fungals are fungicidals , such as terbinafine ( sold under the name lamisil by novartis pharmaceuticals corporation , east hanover , n . j . ), naftifine , butemaifine , and amorolifine . the antifuingal is preferably administered over a period of time of at least about 1 month , more preferably at least about 2 months , still more preferably at least about 3 months . preferably the antifungal is administered to the patient in a dose ranging from about 10 mg to about 2000 mg per day , more preferably from about 250 mg to about 1000 mg per day . culture and sensitivity of the underlying lesion should determine the antibiotic . suitable antibiotics for use in connection with the present invention include ciprofloxacin ( such as cipro , commercially available from bayer corporation , west haven , conn . ); trovafloxacin mesylate ( such as trovan , commercially available from pfizer inc . ); clavulanate potassium , amoxicillin and combinations thereof ( such as augmentin , commercially available from smithkline beechm pharmaceuticals , philadelphia , pa . ); levofloxacin ( such as levaquin , commercially available from ortho - mcneil pharmaceuticals , raritan , n . j . ); cefuroxime ( such as cefin , commercially available from glaxo wellcome , research triangle park , n . c . ); clarithromycin ( such as biaxin , commercially available from abbott laboratories , north chicago , ill . ); tobramycin ( such as nebcin , commercially available from eli lilly , indianapolis , ind . ); azithromycin ( such as zithromax , commercially available from pfizer , new york , n . y . ); cephalexin ; cefixime ; cefpodoxime proxetil ; flurconazole ; trimethoprim ; and sulfamethaxazole . the antibiotic is preferably administered over a period of time of at least about 1 month , more preferably at least about 2 months , still more preferably at least about 3 months . if both an antifungal and an antibiotic are administered , the antibiotic is preferably administered over a period of time concurrent , at least in part , with the period of time over which the antifungal is administered . preferably the antibiotic is administered to the patient in a dose ranging from about 10 mg to about 2000 mg per day , more preferably from about 250 mg to about 1000 mg per day . the following examples describe case studies showing the effect of application of an emoilient and the reduction thereof on atopic disorders . a male , 33 year old patient recalled his mother putting lotion on his skin every day until the age of ten , at which time he had terrible asthma . his parents separated and he went to live with his father . his father put no lotion on him and over a period of time his asthma disappeared . now in his 30 &# 39 ; s , the patient lives with his girlfriend who insists on putting lotion on his skin at every given opportunity . he now shows mildew on his elbows and knees and states that his sinuses are really “ playing - up .” he is starting to have asthma attacks once again . a male , 30 year old patient related that his mother put lotion on him everyday as a child , and he was continually being taken to the emergency room . at the age of seven or eight , his mother stopped putting lotions on him and at the age of approximately 14 , his asthma had gone away . when he started dating girls at 17 or 18 years of age , he started putting lotion on his skin again , and has had asthma ever since . a female , 38 year old patient indicated that her mother and her aunts all used lotion everyday and all had asthma . she could never remember a time in her life when her mother did not put lotion on her skin , a habit which she took over as she got older . she has four children , three of which she “ lotioned - up ” daily with great vigor . these three children developed asthma . the only time she had a remission at all from her illness was when she was a young teenager and during her third pregnancy , for reasons she did not understand . at the time of first consultation , she required four breathing treatments daily , with one occurring during the night . her peak flows were in the range of 80 . she was never without inhalers . she was attracted by the idea of giving up lotion altogether to save money and see what would happen . this patient did not take any antibiotics or antifungal medication . within weeks , her “ ash ” was falling off her skin and after six weeks , she went into her first remission in 14 years . peak flows went from 80 to 350 . she needed no more breathing treatments and rarely used an inhaler . a male , 30 year old patient had been free of asthma and rhinitis all of his life , when he started putting lotions on his face on a daily basis for months . he developed asthma about one year later . he stopped putting lotion on his face , and his asthma nearly went away . however , he still had his sinusitis . at rest his peak flow was 435 , but after albuterol and beclomethasone inhalers , it was a normal 570 . a female , 26 year old patient told of suffering from severe sinusitis and then asthma for months , yet physical examination showed no signs of tinea colporis . she stated she never put any lotions , etc . anywhere on her skin . when asked why her hair was so closely cropped , she related that she developed terrible psoriasis on her scalp when she switched her hair shampoo 2 years previously . examination showed she really suffered from tinea capitis . eight patients that skin fungal conditions were treated by administration of griseovulvin ( 500 mg , twice a day ) and an appropriate antibiotic chosen by the culture and sensitivity . most patients received an antihistamine for the first ten days to control itch . the patients ceased the use of lotions and other emollients , as well as the use of local and systemic corticosteroids . the results were impressive , as described below . patient a — as shown in fig1 a , patient a had “ dry skin ” syndrome fostered by years of skin care products . fig1 b , shows patient a after 35 days of treatment . although some white fungus can still be observed , the appearance of “ dry skin ” cleared up considerably . patient b — as shown in fig2 a , patient b was covered in fungus , and patient b had a bacterial infection . fig2 b shows patient b one week later , with the fungus having improved dramatically . patient c — patient c had spent almost 24 years visiting dermatologists in an attempt to clear his skin condition , as shown in fig3 a . upon culturing the fungus , we discovered it to be proteus . fig3 b shows patient c after treatment , with the fungus significantly improved . patient d — fig4 a shows the fungus on the back of patient d &# 39 ; s neck . this is believed to be a result of the use of shampoo and other hair products containing moisturizer . the products ran off the back of the patient &# 39 ; s hair and stayed on his neck , creating a fungus growth followed by a bacterial infection . fig4 b shows patient d after seven weeks , with the fungus growth significantly diminished . patient e — prior to treatment , patient e , an african american , was while over almost all of his body . fig5 a shows only patient e &# 39 ; s knee area , although his arms , hands , back , abdomen and neck were also all while . he also had a very severe case of itching , and he was put on 100 mg of diphenydramine four times a day to help control his itch . fig5 b shows patient e in the sub - patella area after eleven weeks of treatment . the white skin shown in this photograph is actually scar tissue from years of scratching . patient f — patient f had a severe fungal conduction , as shown in fig6 a , and had been treated with lidex for twenty - eight years . after seven weeks of treatment , the fungas was improving and peeling off , as shown in fig6 b . patient g — patient g , shown in fig7 a , had the fungal infection tinea barbae , but had previously only been treated for acne . fig7 b shows patient g after seven weeks , with the fungal infection significantly cleared , although scars still remain . patient h — patient h , shown in fig8 a , had hair follicles that became infected by fungus . after nine weeks of treatment , his skin was dramatically improved , as shown in fig8 b . thirty - two randomly - selected successive asthma patients were treated by administration of griseovulvin ( 500 mg , twice a day ) and ciprofloxacin ( cipro , one double - strength tablet twice a day ). all of the patients ceased use of all lotions and other emollients during treatment . for each patient , peak flow measurements were taken using a peak flow meter , where a higher peak value typically indicates improved breathing . counts were taken of eosinophils , which secrete chemical mediators that can cause bronchoconstriction in asthma . counts were also taken of ige antibodies . the use of an inhaler by each patient was also monitored . patient 1 ( age 44 ) had been on prednisone until 6 weeks before treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 240 270 260 1 14 360 1 19 620 0 ige inhaler use day peak flow eosinophils antibodies per day 1 450 2 14 600 0 19 620 0 patient 3 ( age 54 ) had been on prednisone for many years prior to treatment and had undergone multiple hospitalizations for her asthma . during treatment , her dosage of prednisone was slowly decreased . daily dose of inhaler prednisone ige use day ( mg ) peak flow eosinophils antibodies per day 1 40 370 6 - 8 13 5 240 5 20 7 . 5 400 3 26 3 . 3 380 2 32 2 . 5 450 1 ige inhaler use day peak flow eosinophils antibodies per day 1 550 322 214 1 8 630 0 15 650 0 ige inhaler use day peak flow eosinophils antibodies per day 1 160 3 4 320 2 patient 6 ( age 63 ) had been on prednisone for most of the fifteen years preceding treatment , had previously been in the intensive care unit , and had been hospitalized over sixty times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 230 912 530 6 21 450 561 764 4 25 530 179 3 32 750 176 3 43 710 2 patient 7 ( age 50 ) had been in the intensive care unit four times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 340 256 2 7 440 1 14 500 1 ige inhaler use day peak flow eosinophils antibodies per day 1 455 3 8 540 0 patient 9 ( age 50 ) had been in the intensive care unit four times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 340 256 65 2 7 440 1 14 500 85 1 ige inhaler use day peak flow eosinophils antibodies per day 1 349 352 3 8 550 1 patient 11 ( age 42 ) had been in the emergency room three times and the hospital twice for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 480 70 140 3 16 430 0 patient 12 ( age 39 ) had been in the intensive care unit and hospital prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 180 322 169 2 14 460 0 patient 13 ( age 30 ) had been in the emergency room five times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 250 246 285 2 21 480 0 ige inhaler use day peak flow eosinophils antibodies per day 1 485 8 30 540 50 580 90 570 110 620 130 635 0 140 620 150 640 170 620 330 650 370 640 0 patient 15 ( age 27 ) had polydermaphytis and nasal and perioral rash with green sputum . ige inhaler use day peak flow eosinophils antibodies per day 1 360 432 31 0 9 480 0 patient 16 ( age 67 ) had forty emergency room visits and ten hospitalizations for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 250 767 750 12 6 270 1 9 320 845 611 1 12 400 1 patient 17 ( age 23 ) has multiple emergency room visits prior to treatment . on day 30 of treatment , patient 11 walked in and announced , “ i am cured .” patient 11 &# 39 ; s age and size matched a mean peak flow of 590 . ige inhaler use day peak flow eosinophils antibodies per day 1 280 477 161 4 30 770 301 98 0 44 750 0 patient 18 ( age 45 ) has been in the intensive care unit three times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 370 141 3 7 420 1 patient 19 ( age 24 ) had made nearly two hundred emergency room visits for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 280 447 5 8 460 4 patient 20 ( age 25 ) had been in the emergency room twice and the intensive care unit once for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 310 128 108 3 14 500 2 ige inhaler use day peak flow eosinophils antibodies per day 1 440 341 115 2 7 530 1 14 540 0 patient 22 ( age 38 ) had five emergency room visits for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 250 246 285 2 27 480 1 patient 23 ( age 23 ) had been in the emergency room twice and the intensive care unit once for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 380 3350 5 3 470 3 6 530 1 patient 24 ( age 36 ) had been hospitalized twice and in the intensive care unit once for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 280 186 501 2 7 500 1 14 620 405 555 0 patient 25 ( age 18 ) had made an emergency room visit for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 450 2 8 660 1 patient 26 ( age 27 ) had made three emergency room visits for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 270 192 220 4 7 430 2 ige inhaler use day peak flow eosinophils antibodies per day 1 550 4 7 590 282 230 2 14 780 565 202 0 25 760 0 patient 28 ( age 48 ) had made five emergency room visits and been in the intensive care unit three times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 230 154 1 8 290 0 patient 29 ( age 28 ) had multiple hospitalizations for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 460 2 7 500 1 ige inhaler use day peak flow eosinophils antibodies per day 1 420 114 18 4 7 550 3 14 550 3 21 560 13 2 patient 31 ( age 21 ) had been in the emergency room nearly fifty times and hospitalized nearly eighty times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 350 352 104 4 16 610 200 2 patient 32 ( age 21 ) had been in the emergency room five times and hospitalized ten times for asthma prior to treatment . ige inhaler use day peak flow eosinophils antibodies per day 1 380 202 39 4 14 540 0

US-34316103-A

an equalizer socket including a socket body , a plurality of grooved wire receiving wedges removably inserted therein and at least one center wedge having a greater taper in bearing contact with the ropes of the grooved wedges , and constraining means associated with the end of the socket body for the center wedge .

in the drawing , the numeral 10 designates generally a housing which is advantageously constructed of steel and which has at its upper end means 11 for connection to a chain or the like -- as where the inventive socket is used in conjunction with a dragline bucket . the means 11 may advantageously take the form of a clevis 12 ( see fig4 ) having aligned openings 13 . the remainder of the housing is devoted to receiving and maintaining the operative wedges and ropes . in the illustration given , the left hand rope 14 is seen to be looped at 15 about a grooved wedge 16 . the right hand rope 17 is looped as at 18 about a second grooved wedge 19 . a third double tapered wedge 20 is positioned in bearing relation between the two looped ropes 15 and 18 and is maintained against outward movement through the end opening 21 by means of a removable key 22 . the key or lock 22 extends through an opening or slot 23 in the housing 10 and into a pocket 24 ( see fig4 ) so as to restrain outward movement of the wedge 20 but which permits lateral movement thereof . the invention is advantageous in utilizing fewer pieces and less weight than current systems . the invention eliminates one socket and one pin in addition to the equalizer and the connecting link . in other words , the previous assembly utilized two sockets , two pins , for those two sockets , one equalizer and one connecting link with a pin in each end . therefore , there were four parts and four pins which are now replaced by one part and pin . the invention also provides easier disassembly than the present system . large wire rope sockets are often difficult to disassemble due to the wedging necessary to prevent slippage . with the new system , the restraint for the center double tapered wedge will allow much easier and quicker disassembly . this advantage is significant when it is considered the size and weights involved . a representative socket for a dragline bucket weighs upward of 3 , 000 pounds with each of the rope wedges weighing more than 200 pounds and being over 3 feet long . the inventive socket also provides a higher effective dump height for the associated hoisting equipment . since pieces are eliminated from the linkage , the dragline of the clamshell bucket , for example , can be lifted higher . in an actual test , one of the ropes was preshortened by 6 &# 34 ; which then began to pull the entire assembly . then , as illustrated in fig2 the wedge 19 associated with the shorter rope 17 moved forward which moved the third wedge 20 laterally until the two single wedges were offset approximately twist sideways because of the different tension in the ropes but always pulled perfectly straight . the taper on the third wedge 20 is greater than the taper on the looped wedges 16 and 19 . a taper of the order of about 15 ° was chosen for each of the looped wedges 16 and 19 because this is a definite wedging taper . from a consideration of fig1 for example , it will be seen that the outboard edges of the two wedges 16 and 19 are parallel so the taper is provided by the inboard edges . a 15 ° taper is a definite wedging taper where wire rope is employed . normally , wire rope experiences a wedging taper in the range of about 18 °- 20 ° but with sockets , this interior angle can develop some rope slippage . in the practice of the invention , the looped wedge has a definite wedging taper in combination with a center wedge that has a definite non - wedging taper . the center wedge 20 is roughly twice the taper of each looped wedge 16 , 19 . this allows substantial latitude . a 20 ° wedge in a drag socket is a wedging taper but is still removable with a great deal of force and therefore it is advantageous to increase that angle to a minimum of at least about 24 ° so as to make the removal of the center wedge 20 much easier . for example , testing with a 14 ° looped wedge and a 28 ° center wedge allowed for easy removal in practice , it is preferred to have a looped wedge with an angle that is a definite wedging taper of approximately 15 ° with the center wedge being definitely non - wedging taper or greater than about 24 °. this provides a socket which permits removal of all wedges and wire ropes without the need for burning any of the wire ropes . this is allowed for by the ability to remove the pin 22 which retains the center wedge and thereby allowing all three wedges and the wire ropes to be removed from the front opening 21 of the socket . as can be first appreciated from a consideration of fig3 the pin 22 is itself a tapered element or wedge and is equipped with a lifting eye 25 projecting upwardly from the main body of the pin 22 . the pin 22 is constrained within its mounting provided by the opening 23 and pocket 24 by means of z - bars 26 -- see the left hand portion of fig3 . these are illustrated as l - shaped prior to insertion into aligned openings 27 and 28 provided on upstanding lugs 29 and 30 on the upper surface of the socket 10 . after the z - bars 26 are mounted in the openings 27 and 28 to constrain the pin 22 , the outwardly extending end portions are bent to form a z , hence the z - bar designation . these can be burned out and , once removed , the pin 22 is readily lifted out of its lodging within the opening 23 and pocket 24 . for this purpose , the angles between the bearing surfaces of the pin 22 , opening 23 and pocket 24 are made with a non - wedging taper . in this respect , the sliding action developed is somewhat akin to that shown in co - owned patent of briscoe et al u . s . pat . no . 4 , 561 , 154 -- and reference may be had to that patent for explanation of the sliding movement of the lock parts . still referring to fig4 it will be seen that a replaceable wear plate 31 is provided on the underside of the socket 10 . this may be welded into place and serves to provide a replaceable wearing surface for the socket when used in action as for example on a dragline bucket . the wear plate 31 as can be appreciated from fig6 is supported and reinforced by integral ribs 32 on the under side of the socket body 10 . the invention also provides an equalizer socket for three or more ropes . as can be noted in fig7 a socket body 110 is provided for three ropes as at 117 , 114 , and 133 , reading downward at the extreme right . grooved wedges are provided at 119 , 116 and 134 with non - wedging taper wedges provided at 120 and 135 , having locking pins 122 . it will be noted that as the number of center wedges 120 , 135 increases , the included angle of the center wedge becomes closer to the included angle of the looped wedges and therefore easy removal by use of the retaining pin becomes somewhat more difficult . should it be desired to provide a larger number of ropes equalized to a single point or line , the arrangement of fig8 and 9 can be employed . this consists of two concentric pipes 236 and 237 . the difference in diameters of the two pipes 236 and 237 is sufficient to accommodate the wire ropes and the wedges in a fashion so that there can be the relative sliding action previously referred to . more particularly , five wire ropes are seen in fig9 and designated 217 , 214 , 233 , 238 and 239 . the rope 217 is looped about wedge 219 , the rope 214 around the wedge 216 , the rope 233 around the wedge 234 , the rope 238 around the wedge 240 and the rope 239 about the wedge 241 . these wedges as well as the &# 34 ; center &# 34 ; wedges as at 220 , 235 , 242 , 243 and 244 are all arcuate so as to conform to the annulus provided by the difference in diameters of the pipes 237 and 236 . it will be noted that the looped wedges and the center wedges would be virtually the same angle and the function of this equalizer is that all of the ropes and wedges would tighten upon themselves rather than tighten on the constraints of the outside of the equalizer socket . thus , pins have been omitted from the showing in fig8 although it is believed that these could be advantageous at least initially to provide a constraint during initial loading . in any event , the invention provides an equalizer assembly whose center wedge does not carry the entire load of both ropes -- as in the illustration of fig1 - 6 -- but only carries the load until the assembly seats and wedges together . according to testing , this was approximately 35 % of the total load at the outset and it is expected that even this percentage would be reduced as more load is applied . this then provides for a retaining pin for the center wedge which need not be as strong as a pin for the entire system -- and therefore it is more easily removed as well as being lighter and less expensive . this is a significant advantage because an equalizer socket that has the ability to be disassembled quickly and easily so as to change ropes , eliminates the need in the past for the use of such extreme expedients as a pendulum ram or cannon for wedge removal . while in the foregoing specification , a detailed description of an embodiment of the invention has been set down for the purpose of illustration , many variations in the details hereingiven may be made by those skilled in the art without departing from the spirit and scope of the invention .

US-89324686-A

a bucket spreading tool is disclosed for separating covers of adjacent turbine buckets , the tool includes : an arm for extending a head of the tool between adjacent turbine wheels and for positioning the head between the adjacent buckets of a wheel , wherein the head includes an attachment to an end of the arm and a forward portion having a front side surface shaped to engage a first bucket of said adjacent buckets , and a rear side surface shaped to engage a second bucket of said adjacent buckets .

with reference to fig1 a plurality of turbine buckets 10 are secured to a turbine rotor wheel 12 . the wheel is mounted on a turbine shaft with a series of other wheels . each bucket may include a dovetail connector 14 formed in a lower portion of bucket 10 . this connector interlocks with a dovetail shaped slot formed on the rim of rotor wheel 12 . buckets 10 , only three of which are shown here , extend a full 360 ° about the rotor wheel 12 . each bucket has a blades 16 that extends radially upwardly from the dovetail 14 to a tip 18 of the blade . covers 20 are formed on the blade tips . the covers are preferably of unitary , or one - piece , construction with the remainder of bucket 10 . the covers 20 interconnect with adjacent covers to couple the row of buckets together about the rotor wheel 12 . each cover 20 of a bucket has a pair of sides 22 . the sides of covers interlock with the sides of covers of adjacent blades . the covers , especially icvs , may have a steep slope , as is shown in fig1 . this slope renders machining of the covers when mounted on a wheel difficult . after installation on the wheel 12 , the covers ( icvs ) 20 are machined on their upper surface to include sealing teeth 24 that will line up in sealing engagement with similar teeth on spill strips of the turbine casing . during the machining of the covers 22 , shims 26 are inserted between the sides of adjacent covers . the shims reduce the formation of burs on the covers , especially burs that extending into the gap 32 between the sides of covers . the shims 26 are removed after the machining of the covers is completed . burs may be formed while machining the teeth 24 on the covers . in some instances , the burs are small and produce a negligible frequency shift in the resonance modes of the buckets . in other instances , the burs are sufficiently large that they bridge the gap 32 and produce substantial resonance modes shifts and need to be removed . the burs are substantially prevented by inserting shims 26 ( see fig5 ) between the covers . the bucket covers need to be separated slightly to allow the shims to be inserted . fig2 shows a plan view of a bucket spreading tool 40 which includes an extended slender arm 42 , and a head 44 . the bucket spreading tool separates the buckets to allow for the insertion and later removal of the shims 26 . the head 44 of the tool is inserted between individual turbine buckets and is pivoted to spread apart the buckets and their covers . with the adjacent bucket covers separated , the shims 26 may be inserted . the buckets are spread apart and can be machined while the turbine buckets are assembled on the wheel and the wheels are mounted on the turbine shafts . in addition , the buckets are spread after the turbine casing has been removed to expose the individual rows of turbine buckets , and the turbine nozzles are removed from between each row of turbine buckets . after removal of the turbine casing and nozzles , there is a gap 34 ( see fig1 ) between the adjacent rows of turbine buckets is typically 5 inches ( 15 cm ) or larger in large steam turbines . into this gap 34 is inserted the bucket spreading tool 40 . the bucket spreading tool is inserted tangentially to the array of buckets so that the tool head 44 can be extended between adjacent wheels and inserted perpendicularly between two selected adjacent buckets on the same wheel . the slender arm 42 of the spreading tool 40 is sufficiently long to allow a technician to reach the tool head 44 between any of the adjacent buckets in any of the rows of buckets in a turbine . the arm has a handle 43 at an end opposite to the head 44 . a technician grasps the handle 43 to operate the tool . the tool head 44 is secured to the arm 44 by bolts 46 . a notch 48 in the head may fit with a opposite notch 50 on the arm , as shown in fig3 . the bolts 46 and notch connection between the head and arm ensure that the head is securely attached to the arm . the arm 42 may be used to apply a slight torque to the head 44 to spread apart adjacent buckets . the bolt and notch connection between the tool head 44 and arm 42 allows for relatively easy changing of heads 44 on the arm . each row of turbine buckets may have a different blade profile . the side surfaces of the front portion 52 of the head 44 are tailored to fit the surfaces of adjacent blades of a particular row of blades . accordingly , there may be a different heads 44 for each row of blades . by allowing for easy substitution of heads , the arm 42 may be attached to the proper vane head 44 for the particular row of turbine blades desired to be separated and machined . the height 54 of the tool head 44 is sufficiently short to allow the head to easily fit between adjacent turbine wheels . for example , the height 54 of the head may be three inches ( 8 cm ) or less . the front portion 52 of the head has sides which are shaped to seat on the surfaces of adjacent blades . a forward side surface 56 of the head is cupped to seat on the front surface 58 ( see fig4 ) of a blade . a rear surface 60 of the front portion of the head 52 is rounded to pivot against a back surface 62 of an adjacent blade . the rear surface may have a volute shape so that as the head pivots the width of the head increases to force the buckets apart . as the forward side 56 of the head 44 presses against one blade 58 and the rear side 60 presses against the adjacent blade 62 , the pivoting of the head separates the adjacent blades and creates a separation of the gap 32 ( see fig5 ) between the covers of the two blades . the head 44 is pivoted by the technician who pivots the arm 42 along an arc 64 . once the bucket has been separated and the gap 32 has been widened , a shim 26 remaining in the gap may be removed . to facilitate insertion and removal of shims 26 , a slot 66 on the head of the spreading tool allows easy access to the gap and for removal of the shims . once the shim has been inserted or removed , the technician pivots the arm and head to allow the adjacent buckets to come together . as the tool head 44 unseats from the blades , the head can be removed from between the blades and the head and arm pulled out from between the turbine wheels . while the invention has been described in connection with what is presently considered to be the most practical and preferred embodiment , it is to be understood that the invention is not to be limited to the disclosed embodiment , but on the contrary , is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims .

US-31084902-A

in a method of making a tubular structural part for a motor vehicle , a metal plate is contoured and preformed in at least one shaping step into a tubular body . subsequently , the tubular body is end - formed into the structural part by internal high - pressure application while free contact regions snugly bear upon one another . the structural part is at least partially heated and quenched in a holding tool acted upon with a coolant .

throughout all the figures , same or corresponding elements may generally be indicated by same reference numerals . these depicted embodiments are to be understood as illustrative of the invention and not as limiting in any way . it should also be understood that the figures are not necessarily to scale and that the embodiments are sometimes illustrated by graphic symbols , phantom lines , diagrammatic representations and fragmentary views . in certain instances , details which are not necessary for an understanding of the present invention or which render other details difficult to perceive may have been omitted . a method of manufacturing of a structural part 1 for a chassis of a passenger vehicle in form of an a pillar , and a geometry of this structural part are described in detail with reference to fig1 - 6 of the drawings . turning now to the drawing , and in particular to fig1 , there is shown a schematic illustration of a flow diagram of a method of making a structural part in accordance with the present invention . a metal strip 2 is drawn from a coil 3 and supplied to a punching device 4 in which the metal strip 2 is cut to correct size into plates 5 for further processing . each plate 5 is shaped in a suitably designed press 6 into a u - shape in a first shaping step . fig2 illustrates the exact cross section of the u - shape of the preformed plate 7 with longitudinal - side free contact regions 10 . the preformed plate 7 is then shaped in a further downstream press 8 into a tubular body 9 as shown in fig3 the tubular body 9 has substantially the contour of an a pillar with the longitudinal - side free contact regions 10 of the tubular body 9 being formed on the flanges 11 which abut one another . the tubular body 9 , shown in fig3 , is end - formed in an internal high - pressure tool 12 into the structural part 1 ( a pillar ) and calibrated by it . the flanges 11 are tightly pressed against one another , as shown in fig4 - 6 . in a downstream stationary heating device 13 , the structural part 1 is heated . this can be carried out inductively , resistively , capacitively , conductively or by infrared radiation . the heated structural part 1 is cooled in a holding tool 14 by spraying , blowing on or immersing and thereby tempered or hardened . the corresponding coolant circulation is identified with reference numeral 20 . in correspondence with the above described method for manufacturing a structural part 1 in form of an a pillar , other structural parts can be made as well , such as b pillars , longitudinal beams , sills , roof frames , cross beams or end walls . according to a modification of the method shown in fig1 - 6 , a trimmed plate 5 may also be heated before being shaped and preformed into a u shape by isothermal heating and then formed into a tubular shape also by isothermal heating , before being end - formed in an internal high - pressure tool 12 into the structural part 1 . heating can be carried out to a temperature above the ac 3 point in the iron - carbon diagram . this is true both for a hardening of the structural part 1 and for a subsequent tempering . it is also conceivable to simultaneously end - form and quench the tubular boy 9 , formed by heating , in an internal high - pressure tool 12 . finally , it is also conceivable to heat a trimmed plate 5 before being formed into the tubular body 9 . this is carried out preferably to a temperature below the ac3 point . after the u - shaped preforming , the plate 7 is quenched . the u - shaped preformed plate 7 is then again heated at least locally to greater than ac3 and finally shaped into the tubular body 9 . the tubular body 9 is then end - formed in an internal high - pressure tool 12 , and thereafter optionally perforated and / or joined at the free contact regions 10 . joining can be carried out by mig , mag , wig , or laser processes , by soldering or by a structural bond , and also by riveting , screwing , clinching etc . finally , the structural part 1 is quenched in a cooled holding tool 14 . examples of materials for the structural part 1 may include alsi , pre - coated 22mnb5 or btr165 . the internal high - pressure forming process can be implemented in particular with gas , for example n 2 or also with a suitable liquid . the wall thickness of the structural part 1 can be limited to be equal to or smaller than 4 mm , and the bending radii can be up to 2 mm . the quenching times amount to 3 to 45 seconds . the transfer time between the individual tools amounts to 1 to 20 seconds . the forming time during the u - shaped preforming amounts to 1 to 20 seconds , while the transforming time into the tubular body 9 also amounts to 1 to 20 seconds . the time of the internal high - pressure forming process can be between 0 . 1 and 5 seconds . this ensures that no fluid medium is lost . the flanges 11 of the structural part 1 can be joined also linearly , for example along the longitudinal - side contact regions 10 . they may optionally be provided with depressions to increase rigidity . the structural part 1 in the form of an a pillar for a passenger vehicle as shown in fig4 - 6 has a tubular body 9 which is curved in a longitudinal direction and which is provided on the inner side 15 of the curvature with a transversely extending web 16 from abutting flanges 11 . an end portion 17 of the tubular body 9 has a greater curvature than the remaining longitudinal region 18 . both end portions 17 , 19 of the tubular body 9 have at least approximately round cross section . the longitudinal region 18 between the end portions 17 , 19 has a cross section 21 which is multiply convexly and concavely curved , as best seen in fig4 . as can be seen in particular from fig6 , the end portion 17 of the tubular body 9 of greater curvature has a smaller cross section than the other end portion 19 . furthermore , fig5 shows that the end portion 17 has a radius of curvature kr between 200 mm and 400 mm , preferably 300 mm . the radius of curvature kr 1 of the longitudinal region 18 which is adjacent to the end portion 17 with the greater radius of curvature amounts to between 1500 mm and 3000 mm , preferably 2000 mm . while the invention has been illustrated and described in connection with currently preferred embodiments shown and described in detail , it is not intended to be limited to the details shown since various modifications and structural changes may be made without departing in any way from the spirit and scope of the present invention . the embodiments were chosen and described in order to explain the principles of the invention and practical application to thereby enable a person skilled in the art to best utilize the invention and various embodiments with various modifications as are suited to the particular use contemplated . what is claimed as new and desired to be protected by letters patent is set forth in the appended claims and includes equivalents of the elements recited therein :

US-201213553154-A

a foil of a tagger ring foil closure system for a container , such as a can , is provided . the foil comprises a composite of two or more layers made from different materials instead of aluminum only .

fig1 shows a traditional trf closure system of the known art . the traditional trf system comprises a ring 1 , a plug 5 , and a foil 9 . the ring 1 of the traditional trf system comprises a seaming curl 2 , a vertical sealing surface 3 that defines an orifice to allow access to a container , and an inwardly facing cut edge 4 of a foil . the plug 3 of the traditional trf system comprises a panel 6 , a substantially vertical sealing surface 7 , and an outwardly extending flange 8 allowing the plug to be levered from the orifice in the ring . the foil 9 of the traditional trf system extends across the inside of the trf system to the sealing material 10 around the periphery in the seaming curl 2 . alternately , the foil 9 can be heat sealed to a flat section of the ring , not shown . the foil 9 provides the primary seal for extended shelf life prior to opening . the traditional trf closure system has 3 critical dimensions , namely a nominal diameter d measured as shown , a ring diameter d r , and a plug diameter d p . the interference seal between the ring 1 and the plug 5 is provided by selecting d p to be sufficiently larger than d r so that a seal and grip is achieved , but not so large that insertion of the plug is excessively difficult . the range of acceptable interference is known to those skilled in the art and is embodied in manufacturing specifications for such parts . fig2 shows in greater detail the critical seal areas of the traditional trf system . fig3 shows one embodiment of the composite foil 17 of the present invention . the composite foil comprises successive layers of paper layer 1 , a polymer layer 2 , an aluminium foil layer 3 , and another polymer layer 4 . the paper may be any suitable paper . suitable paper includes a 35 gsm or 50 grams per square metre ( gsm ) bleached kraft sheet made by australia paper . alternative options include grammages ranging from 25 to 100 gsm . the functions of the paper layer 1 are : ( a ) bulk at low cost , ( b ) high tensile strength to permit seaming without fracture , ( c ) easy tearing for consumer access , and ( d ) minimise risk of a consumer being cut by exposed edges of a ruptured composite foil . the polymer layer 2 comprises a co - extruded copolymer of ( a ) a low density polyethylene ( ldpe ) in the section of the layer 2 that joins the paper layer 1 and ( h ) an ethylene acrylate acid resin adjacent the aluminium foil . the ldpe layer is about 2 / 3 of the total of thickness of the layer 2 . the thickness of the layer 2 ranges from 8 to 30 um , and is preferably 12 um . the polymer layer 2 is provided to adhere together the paper layer 1 and the aluminium foil layer 3 . the ldpe is selected on the basis of its capacity to adhere to paper and the ethylene acrylate acid resin is selected on the basis of its capacity to adhere to aluminium . the aluminium foil layer 3 in the composite foil is 30 um in thickness , but could conceivably range from 15 to 60 um in thickness . the function of the aluminium foil is to provide high oxygen and moisture barrier properties , both of which are important for long term shelf stability of an unopened container . the aluminium foil layer 3 also contributes to the mechanical properties of the composite foil . the bottom layer 4 is a co - extruded co - polymer . the bottom layer comprises ( a ) a ldpe filled with 30 % talc to weaken the overall structure , with this material forming an exposed surface of the composite foil and ( b ) a terpolymer of ethylene methyl or butyl acrylate grafted with a maleic anhydride to adhere the layer 4 to the aluminium foil layer 3 . preferably the thickness of this layer is 20 um , but can conceivably range from 15 to 50 um . an important function of the bottom layer 4 is to protect the aluminium of the foil layer 3 from oxidation and other undesirable chemical reactions and to provide a layer of a material that is approved for direct food contact . many modifications may be made to this invention shown without departing from the spirit and scope of the invention .

US-201615164446-A

an earth boring bit having a rotatable cutter secured to a lubricated , cantilevered bearing shaft , sealed with an improved pressure compensating rigid face seal assembly . the assembly has a rigid ring with a radial face that opposes and engages a radial face integral with a cutter seal groove . a resilient energizer ring is compressed between opposed conical surfaces , one on the rigid ring and the other in a shaft seal groove , to force the radial faces together . the periphery of the energizer ring is inside the journal bearing surface , which is ideally aligned with the mid - section of the ring , to define a essentially constant , lubricant filled , volume between the seal assembly and the shaft seal groove -- even as the cutter and seal assembly move relatively to the shaft during drilling . as a result , pressure variations in the vicinity of the seal assembly are minimized .

in fig1 the numeral 11 designates a rock bit having a head section 13 that is one of usually three that form a body which is threaded at 15 . a lubricant pressure compensator system 17 is included in each head section 13 , being vented at 19 to the exterior of the bit and the ambient drilling mud in a bore hole ( not shown ). lubricant fills a reservoir 23 , which is separated from the drilling mud by a flexible diaphragm 25 . the diaphragm 25 is part of a hydrostatic pressure compensator that tends to equalize the pressure of the lubricant with that of the drilling mud and maintains this pressure in the lubricant in passage 27 , as well as the space 29 and others between the bearing shaft 31 and rotatable cutter 33 . for additional information about the lubrication system see u . s . pat . no . 4 , 055 , 225 , &# 34 ; lubricant pressure compensator for a rock bit &# 34 ;, oct . 25 , 1977 . the bearing shaft 31 is cantilevered and extends inwardly and downwardly in supporting the cutter 33 . the cutter 33 has conventional teeth 35 , here inserts of cemented tungsten carbide , and internal bearing surfaces that oppose those of the bearing shaft 31 , including the journal bearing surface 37 , thrust face 38 and pilot pin surface 39 . the rotatable cutter 33 is secured to the bearing shaft 31 by a resilient snap ring 41 . additional information about the snap ring retainer system may be seen in u . s . pat . no . 4 , 344 , 658 , &# 34 ; cone snap ring &# 34 ;, aug . 17 , 1982 . there are radial and axial clearances between the various components of the bearing and its retainer system , resulting in radial and axial play or movement of the cutter on the shaft during drilling . as a consequence , the cutter 33 acts as a pump as it moves on the bearing shaft 31 during drilling , creating volume changes accompanied by pressure pulses or fluctuations in the lubricant around the shaft . the pressure pulses occur also in the seal area at the base 43 of the bearing shaft 31 , where it joins the leg 45 of the head section 13 . this invention minimizes the amplitude of these pulses . as shown in fig1 the base 43 of the bearing shaft 31 contains an annular shaft seal groove 47 that opposes an annular cutter seal groove 49 . confined within these two grooves is a rigid ring 50 and a resilient energizer ring 52 , which together form the sealing system of this invention , as better seen in fig2 and 3 . the shaft seal groove 47 in the base 43 of the bearing shaft 31 is radially inward of the cylindrical bearing surface 37 toward the axis of rotation ( not shown ) and has an inner endwall 51 , an outwardly facing and circumferential conical surface 53 at an angle alpha with the journal bearing surface 37 , and an outer endwall 55 . the opposed cutter shaft seal groove 49 has an outwardly facing radial sealing face 57 , integral with the cutter , and a circumferential surface 59 extending outwardly to the mouth 61 of the cutter . the rigid ring 50 has a sealing face 63 and a conical , inwardly facing and circumferential region 65 that is parallel with and opposed to the conical surface 53 of the shaft seal groove 47 at assembly . the resilient energizer ring 52 has its inner periphery inside the journal bearing surface 37 and is compressed between the conical surfaces 53 , 65 of the shaft seal groove 47 and the rigid ring 50 . as shown in fig2 and 3 its mid - section 67 is aligned with the cylindrical journal bearing surface 37 . a volume of lubricant v occupies the space bounded by seal groove 47 , rotatable cutter 33 , rigid ring 50 , and energizer 52 . as rock bit 11 drills , rotatable cutter 33 moves axially with respect to bearing shaft 31 in response to drilling forces . this motion , designated by the arrow z in fig2 affects volume v in two ways . as rotatable cutter 33 moves a distance z toward base 43 of bearing shaft 31 , v decreases according to the relationship : ## equ1 ## where δv c = the decrease in v due to the cutter movement , d 2 = the average smallest diameter at which energizer 52 contacts rigid ring 50 during cutter movement z , and simultaneously , energizer 52 undergoes rolling compression , moving half the distance moved by rotatable cutter 33 , normal to base 43 . this action causes volume v to increase according to the relationship : ## equ2 ## where δv e = the increase in v due to the energizer movement , s 2 = the maximum squeeze experienced by energizer 52 when rotatable cutter 33 moves toward base 43 , s 1 = the minimum squeeze experienced by energizer 52 when rotatable cutter 33 moves away from base 43 , because of the speed with which rotatable cutter movements occur and the small clearances between bearing shaft 31 and rotatable cutter 33 , any change in volume v will be accompanied by a momentary pressure differential across the seal as lubricant seeks to enter or leave the space occupied by volume v . if such pressures are excessive , the seal will either leak or be damaged by excessive loads between sealing faces 57 and 63 . ideally , therefore , the assembly should be designed such that in fig2 and 3 d 1 designates the smallest diameter at which energizer 52 engages surface 53 after assembly of rotatable cutter 33 on bearing shaft 31 . because energizer 52 is compressed as it rolls against conical surface 53 , diameter d 1 remains essentially constant so that using this value for d 2 in equation 1 and substituting equations 1 and 2 for δv c and δv e in equation 3 , one finds that the condition for volume and pressure balance is achieved when d s , d c , d , s 1 , s 2 and α are selected such that ## equ3 ## for rock bit bearing seals , the second term under the radical sign in equation 5 is very small compared to d c 2 and can be neglected without significant error . thus a very good engineering approximation for the volume and pressure balanced design is achieved simply by making for the harsh environment in which rock bits work , it is found that a suitable material for energizer ring 52 is a highly saturated nitrile ( hsn ) elastomer marketed by parco under the compound designation 2281 - 80 . with this material , adequate sealing forces can be maintained between faces 57 and 63 and good energizer life will be achieved if the maximum squeeze is limited to about 35 percent of the o - ring cross section diameter . it is also found that a suitable value for the inclination of conical surfaces 53 and 65 is 20 °. for a 2 - inch diameter bearing which is typical in 77 / 8 &# 34 ; diameter rock bits , a suitable cross section diameter for energizer 52 is 0 . 169 inch . a reasonable maximum allowance for axial cutter play is 0 . 030 inch which produces a squeeze variation of approximately 6 percent in a 0 . 169 - inch o - ring cross section when α is 20 °. the minimum squeeze for this application is therefore 29 percent and equation 5 dictates a mean o - ring diameter of 1 . 997 inches which is very close to 2 inches as called for by equation 6 . the dimensions of energizer 52 and allowable squeeze establish the depth and length of groove 47 and the length of conical surface 65 . the minimum diameter of groove 47 is the same as the relaxed inner diameter of energizer 52 , as shown in fig3 . the length of groove 47 and conical surface 65 are selected to accommodate the fully deformed energizer 52 with 35 percent squeeze , as shown in fig2 . a suitable material for rigid ring 50 is 440c stainless steel . this material provides acceptable wear properties when hardened to approximately 50 rockwell c . the mating rotatable cutter seal face should have comparable hardness and wear properties . radial sealing faces 63 and 57 are lapped to a finish of about 1 or 2 r a and both are flat , except for a relieved portion on one . such relief provides clearance for cross sectional rotation of ring 50 resulting from the force exerted by energizer 52 and ensures contact between the lapped surfaces of faces 63 and 57 . in fig2 the outermost portion 64 of face 63 is beveled to allow for counterclockwise cross sectional rotation of ring 50 . if the centroid of the cross section of ring 50 is positioned to cause clockwise rotation , the innermost portion of face 63 would be relieved and portion 64 would be made flat . conical surface 65 of ring 50 and conical surface 53 of groove 47 are provided with a surface finish of approximately 150 r a to discourage slippage relative to energizer 52 . an alternate embodiment of the invention is shown in fig4 which has components identical with those of fig1 designated with numbers with identical digits but primed to distinguish them . the only difference in the structures is that a bearing insert 69 is retained by interference fit within a mating groove in the cutter 33 &# 39 ;. the outer end 71 of the insert 69 forms a radial sealing face to oppose the sealing face 63 &# 39 ; of the rigid ring 50 &# 39 ;. the outer end 71 of the insert can be lapped when separate from the cutter 33 &# 39 ;. in operation the seal assembly and groove configuration define a volume v of lubricant that experiences minimum change as the cutter and seal assembly move during drilling . as a consequence , pressure changes in the lubricant adjacent the seal assembly are minimized . enhanced seal life and effectiveness can thus be expected . while the invention has been shown in only two of its forms , it should be apparent to those skilled in the art that it is not thus limited , but is susceptible to various changes and modifications without departing from the spirit thereof .

US-2317887-A

a block copolymer for use as a solid polymer electrolyte , said block copolymer having at least first and second segments , the first segments being hydrophilic segments provided with acidic substituents for proton transport and the second segments being hydrophobic segments having substantially no acidic substituents and serving for the mechanical integrity of the solid polymer electrolyte . also described and claimed are an ion - conductive membrane made from block copolymers of the aforementioned kind as well as methods of preparing such block copolymers and membranes based thereon . the membranes have improved proton conductivity and improved mechanical properties in the presence of water making them particularly suitable for use in fuel cells .

the present description relates to a novel route for preparing ion conductive membranes fully based on hydrocarbons without any further sulfonation procedures of precursor polymers and without any further cross linking procedures of corresponding sulfonated polymers . a novel method of synthesizing block copolymers comprising an alternating sequence of hydrophobic blocks substantially consisting of aromatic ethers and hydrophilic blocks having ion exchange groups is disclosed , wherein hydrophobic blocks substantially have no ion exchange groups , but hydrophilic blocks have ion exchange groups prepared by conversion of sulfonyl chloride groups to sulfonic acid groups . hydrophilic blocks having an acidic functionality are substantially comprised of aromatic ethers , wherein at least some aromatic rings have one ion exchange group each and some can have more than one ion exchange group . in the present description , the term sulfo - pendent block copolymer means a polymer in which an alternating sequence of hydrophobic blocks and hydrophilic blocks are directly chemically bonded . in the best mode of the present invention block copolymers are prepared in a two stage process . the first stage of the process is preferably used to prepare the precursors , that is , end - functionalized hydrophobic blocks with the desired length by imbalancing the chemical equivalence of monomers constituting hydrophobic blocks having a repeating unit represented by the general formula [ 1 ]. x represents — o —, — s —, — co —, — so 2 —, — c ( ch 3 ) 2 —, — c ( cf 3 ) 2 —, diphenyl methylene , diphenyl silicon , fluorenyl or a bond directly to the next aromatic ring and the end groups g represent a halogen ( f , cl , br , i ), — no 2 or — oh , with the number of repeating units n of an aromatic ring constituting a second segment forming a hydrophobic block preferably lying in the range from 5 to 200 and with the bridges x between sequential aromatic rings being the same or different and being selected from any of the above atoms or groups listed for x . an example of the end - functionalized hydrophobic blocks represented by the general formula [ 1 ] constituting sulfo - pendent block copolymers may be obtained , for example , by the condensation of 4 , 4 ′- difluorobenzophenone with 2 , 2 - bis -( 4 - hydroxyphenyl )- propane at desired stoichiometry in the presence of potassium carbonate in order to adjust the length of the hydrophobic blocks , which lead to an end - functionalized hydrophobic block oligomer , e . g . as represented by the general formula [ 2 ], wherein the alkyl groups of 2 , 2 - bis -( 4 - hydroxyphenyl )- propane may support the solubility of a hydrophobic block oligomer when it is employed for continuous condensation to introduce the sulfonated monomers into hydrophobic block oligomers . the end groups g ′ are preferably — oh , or — f rather than — cl , — br , — i , x ′ is preferably — co —, or — so 2 — when x ″ is the combination of — o —, and — c ( ch 3 ) 2 —. on the other hand , x ′ is preferably — c ( ch 3 ) 2 — when x ″ is the combination of — o —, — co —, and — so 2 — in the formula [ 2 ], and n ′ is preferably from 2 to 200 . the second stage of the process is preferably carried out to add the monomers having an acidic functionality , which are substantially comprised of aromatic rings of the general formula [ 3 ], in which one aromatic ring has one ion exchange group , to the end - functionalized hydrophobic blocks at desired stoichiometry in order to adjust the length of hydrophilic blocks and to continue the condensation to prepare the corresponding block copolymers . y represents — o —, — s —, — co —, — so 2 —, — c ( ch 3 ) 2 —, or — c ( cf 3 ) 2 —, diphenyl methylene , diphenyl silicon , fluorenyl or a bond directly to the next aromatic ring , the end groups z represent a halogen ( f , cl , br , i ), — no 2 or — oh , q represents — so 3 h , — so 3 − m + , — cooh , — coo − m + , po 3 h 2 , — po 3 h − m + , or — po 3 2 − 2m + where m is a metal such as na or k , with m being preferably between 5 and 200 , with the bridges y between sequential aromatic rings when m & gt ; 1 being the same or different and being selected from any of the above atoms or groups listed for y , with q not having to be present in every aromatic ring and with g and z being selected as partners capable of a coupling reaction among sulfonated monomers , preferred monomers include hydroquinone 2 - potassium sulfonate ( available from aldrich chemical co . ), potassium 5 , 5 ′- carbonylbis ( 2 - fluoro benzene sulfonate ), potassium 5 , 5 ′- sulfonylbis ( 2 - fluorobenzene sulfonate ), and the like . potassium 5 , 5 ′- carbonylbis ( 2 - fluorobenzene sulfonate ), as an example of the general formula [ 4 ] may be prepared by sulfonation of 4 , 4 ′- difluorobenzophenone with fuming sulfuric acid and 5 , 5 ′- sulfonylbis ( 2 - fluorobenzene sulfonate ) may be prepared by sulfonation of 4 , 4 ′- difluorodipehnyl sulfone with fuming sulfuric acid . y ′ is preferably — co —, or — so 2 — due to its higher electron withdrawing property leading to an increase in the overall reaction activity of condensation , z ′ is preferably — f or — no 2 rather than — cl , — br —, or — i , and q ′ is preferably — so 3 na , or — so 3 k , rather than — coona , — cook due to its higher acidity . finally , each block copolymer consists of an alternating sequence of several hydrophobic and hydrophilic blocks . casting an ion conductive membrane directly from a solution having sulfo - pendent block copolymers comprising an alternating sequence of hydrophobic blocks and hydrophilic blocks with the form of sulfonic acid may be impossible . apparently , there is no common organic solvent for both types of blocks which will allow a membrane for a solid polymer fuel cell to be cast . to overcome this difficulty it is proposed , in accordance with the present teaching , to convert the sulfonic acid into acid chloride groups by any appropriate method , including reaction with thionyl chloride . resulting block copolymers having the thionyl chloride groups converted from acid groups can be dissolved in a organic solvent such as tetrahydrofurane ( thf ), n , n - dimethylformamide ( dmf ), n , n - dimethylacetamide ( dmac ), dimethylsulfoxide ( dmso ), n - methyl - 2 - pyrrolidone ( nmp ) and the like , which allows corresponding block copolymers to be cast onto a glass plate , and dried slowly at an elevated temperature and finally in vacuum . during the drying process , a micro phase separation between the hydrophobic blocks and the hydrophilic blocks may be expected . ideally , the hydrophilic phase will form cylinders embedded in the hydrophobic matrix . the phase separation may be critical for the concept of the block copolymer membranes , as it may create a morphology comparable to that observed in nafion membranes . the sulfonyl chloride in the membrane prepared may be converted into — so 3 na or — so 3 k when they are immersed into aqueous naoh or koh solution to regenerate the salt form . further , if they are treated with an aqueous acidic solution such as sulfuric acid , hydrochloric acid , or nitric acid , then the salt form may be converted into an acid , that is , — so 3 h of the sulfonyl groups . the conversion of sulfonyl chloride to sulfonic acid groups and the corresponding hydrolysis procedure is preferably carried out at a temperature from 20 to 120 ° c . in the present invention , the final form of membranes typically results in insolubility of the membrane in water and methanol under all conditions . in the experiments which will subsequently be described with reference to examples the chemicals used are commercially available through aldrich chemical co ., or fluka chemical co . unless otherwise noted . the membrane conductivity in the h + - form was recorded at room temperature by ac impedance measurements using a frequency response analyzer ( solartron 1250 ) in combination with an electrochemical interface ( solartron 1186 ). the membrane conductance was determined by extrapolating the high frequency end of a nyquist plot to the real axis . the extrapolation was performed by a linear regression . for an evaluation of cell and contact resistances , measurements with a variable number ( n = 1 - 4 ) of membrane discs were carried out and the sum of cell and contact resistance evaluated by extrapolation to n = 0 . the specific conductivity was calculated from the average resistance and from their dimensions . the temperature dependence of specific conductivity was also determined in the temperature range between room temperature and 80 ° c . water uptake was measured as follows . membranes were swollen in distilled water at the desired temperature , e . g . 80 ° c .— a typical operating temperature for a pem fuel cell — for 1 day , cooled down to room temperature and then removed from the water . surface attached water was quickly removed with tissue paper and the weight of the wet membrane was determined . the membrane was then dried to constant weight in a vacuum oven at 120 ° c . and the dry weight of membrane determined . water uptake is calculated by the difference between the wet and dry weights divided by the dry weight , which is reported as a percentage . the ion - exchange capacity ( iec , mequiv of so 3 h / g ) measured here is based on the following procedures . membrane ( preferably 0 . 5 g - 1 . 0 g ) was immersed into 50 ml of saturated nacl solution and the mixture was stirred for 1 day to allow the h + ions to exchange with na + ions . the released h + ions were titrated with 0 . 1 n naoh . from consumed naoh , the ion - exchange capacity of the membrane was calculated via the following formula : preparation of a preferred monomer in the form of potassium 5 , 5 ′- carbonylbis ( 2 - fluorobenzene sulfonate ) 4 , 4 ′- difluorobenzophenone ( 10 . 9 g , 50 mmol ) was dissolved in 20 ml fuming sulfuric acid (˜ 30 % so 3 ). the solution was stirred at 100 ° c . for 16 hours , then cooled to room temperature and poured into 120 ml of ice water . koh ( 28 g ) was added to neutralize the excess fuming sulfuric acid . the mixture was cooled again and the addition of kcl ( 25 . 5 g ) resulted in the precipitation of a white solid , which was filtered off and dried . re - crystallization from distilled water yielded a white solid . in order to completely remove the other inorganic salts , the white solid was re - crystallized using distilled water once more . the yield was 16 . 18 g ( 71 %). the compound was clearly characterized using ft - ir and 1 h - nmr . a series of the end - functionalized hydrophobic blocks represented by the general formula [ 1 ] constituting sulfo - pendent block copolymers were prepared in the following manner : 1 , 3 - bis ( 4 - fluorobenzoyl ) benzene ( 3 . 546 g , 0 . 011 mol ) was reacted with 2 , 2 - bis -( 4 - hydroxyphenyl )- propane at desired stoichiometry (& gt ; 0 . 011 mol ) in the presence of potassium carbonate ( 3 . 075 g , 0 . 022 mol ), in order to adjust the number average molar mass of the resulting hydrophobic block from 4000 to 12000 ( g / mol ) with an interval of 2000 ( g / mol ), under a dry nitrogen atmosphere in a round bottom flask equipped with nitrogen inlet and a dean - stark trap using nmp ( 15 ml ) and toluene . after brisk refluxing / recycling of toluene at 150 ° c . for 4 hours , a creamy suspension was obtained . further toluene ( 15 ml ) was added and the refluxing was continued . the azeotrope in the dean - stark trap was drawn off , traces of toluene were removed by distillation at 182 ° c . under a stream of nitrogen and a yellow - colored slurry was obtained in the polymerization flask . the mixture was cooled and further nmp ( 45 ml ) was added to the reaction mixture , which was heated at 182 ° c . for 6 hours . the mixture turned slightly green . the temperature was slowly raised to 210 ° c . and about 30 ml nmp was distilled off under a brisk nitrogen flow . the nitrogen acts as an inert gas and precludes the entry of oxygen . the concentrated polymerization mixture was maintained at 182 ° c . for 2 to 3 hours . a dark , homogeneous solution was obtained . the viscous solution was poured into a large excess of meoh in order to obtain an off - white polymer . this was washed with meoh , filtered and dried . the yield was higher than 90 % in each reaction . table 1 shows the results . the sulfonic salt form of block copolymers was prepared by combining end - functionalized hydrophobic oligomers ( prepared in example 2 ) and potassium 5 , 5 ′- carbonylbis ( 2 - fluorobenzene sulfonate ) as prepared in example 1 , hydroquinone 2 - potassium sulfonate ( commercially available through aldrich chemical co .) at balanced stoichiomery of the functional groups using the same technique described in example 2 . however , dmso was used as reaction solvent instead of nmp due to the poor solubility of the monomers . also , desired sulfonated block copolymers having a different iec value were prepared by varying the stoichiomery of the functional groups . the yield was higher than 92 % in each reaction . 6 . 0 g of sulfonic salt form of block copolymer ( as prepared in example 3 ) and 60 ml of thionyl chloride were charged into a 100 ml round bottom flask . the mixture was refluxed for 8 hours , which led to formation of a viscous and homogeneous solution . then , the mixture was poured into 500 ml of a stirred mixture of ice and water . a white precipitate was formed and the precipitate was washed with a large amount of water until the washings were ph - neutral . the corresponding sulfonyl chloride form of block copolymers was then washed with methanol and dried at 80 ° c . in vacuum for 24 hours . the yield of the sulfonyl chloride form was 4 . 9 g ( 82 %). 10 . 0 g of the sulfonyl chloride form of block copolymer was dissolved in 80 ml of n , n - dimethylformamide ( dmf ) and the solution was subjected to filtration through 0 . 45 μm filter . then the solvent was removed slowly under vacuum at an elevated temperature until the percentage by weight of polymer in solution became 30 (% w / v ). the viscous solution was cooled and then poured onto a flat glass plate followed by adjusting the thickness of the cast film by means of a doctor blade and dried first at 60 ° c . in a vacuum oven for 2 hours , then the oven temperature was increased slowly to 120 ° c . and kept for 6 hours , and finally the vacuum was employed for 30 minutes . the membrane formed was then peeled from the glass substrate and immersed in distilled water . during the drying process , a micro phase separation between the hydrophobic blocks and the hydrophilic blocks is expected . ideally , the hydrophilic phase will form cylinders embedded in the hydrophobic matrix . the phase separation , which appears critical for the concept of the block copolymer membranes , was demonstrated by a scanning electron microscopy ( sem ) image of the fracture surfaces of membrane . the result is shown in fig1 . the dark circular domains surrounded by light gray domains are understood to be cylinders of the hydrophilic segments embedded in the hydrophobic matrix . the calculated length of the repeating hydrophobic moiety in the polymer backbone , on the assumption that poly backbones are fully extended , corresponds to 0 . 034 μm and the length of the hydrophilic segment is 0 . 015 μm . based on the composition , one expects cylinders of the hydrophilic segments . the maximum diameter of one individual cylinder should be the length of the hydrophilic segment , which agrees with that of the average circular domain , i . e . 0 . 010 μm , in fig1 . membranes having the sulfonyl chloride form were hydrolyzed in 1 . 0 n sodium hydroxide aqueous solution for 12 hours at 60 ° c . and then the membranes were exchanged twice in 1 . 0 n hydrochloric acid for 6 hours at room temperature . finally membranes were exchanged in di water several times . the results are summarized in table 2 . fig2 shows the resistance measurements of membrane 3 as an example at 25 ° c . and 60 ° c ., which includes the calculated membrane resistivities obtained by linear regression of the experimental data at both temperatures . from the above - mentioned results , the present invention allows the improved control over chemical structures of the solid electrolytes leading to improved proton conductivity , and lower water uptake when compared with conventional polymer electrolytes into which sulfonic acid groups are randomly introduced . consequently , introducing the sulfonated monomers into hydrophobic blocks permits full control of the position , number , and distribution of the ion exchange groups along the polymer backbone and the ion conductive membranes formed from the above block copolymers provided cylinders embedded in a hydrophobic matrix , which leads to higher proton conductivity .

US-76850704-A

centerline of the pinion and gear is offset from the centerline of the bore in which the pinion bearing housing is contained . a change holds the bearing housing in operating position and is also operable to rotatably adjust the pinion housing , the o . d . of which is eccentric relative to its i . d . thus rotation of the bearing housing within the bore effects the adjustment of the vertical height of the pinion relative to the driving gear .

referring to fig1 of the drawing , there is shown a gyratory crusher 10 having a frame generally indicated at 11 and including a lower frame section 12 and an upper frame section 14 . the lower frame section 12 includes a fixed vertical hub 16 having an upper portion 17 and a lower portion 18 . the lower hub portion 18 is provided with a closure plate 19 which forms sealed chamber 21 . the closure plate 19 also provides for a hydraulic fluid inlet 22 which communicates with the expansible chamber 21 . the upper frame section 14 opens upwardly and has secured therein a concave ring 23 which is supported in coaxial relationship above the hub 16 . a generally conical crushing head 24 projects upwardly within the concave ring 23 to define therebetween a crushing chamber 25 . the crushing head 24 is supported and arranged with its central axis inclined relative to and intersecting with the vertical axis of the hub 16 and concave ring 23 . the axes intersect at a point x above the crushing head 24 . the crushing head 24 has a central upwardly tapering bore 26 which is adapted to receive a tapered or frusto - conical portion 32 of a crusher post 33 . a nut 34 is threadedly engaged on the crusher post 33 at a position adjacent the upper end of the crusher head 24 and serves to lock the crusher head in operative position on the post 33 . the upper portion of the crusher post 33 is fitted with a bearing sleeve 36 and received in a pivot bearing member 37 . a spider 38 being an integral part of the top of the frame 11 presents an axial hub 39 , the axis of which coincides with the axis of the frame . the hub 39 serves as a housing for the pivot bearing 37 . a cap 41 is secured to the outer end face of the hub 39 and locks the outer race of the pivot bearing 37 in the hub . a crusher head brake device 45 is accommodated in a suitable stepped bore 46 formed in the upper end of the crusher head post 33 . the lower end of the crusher head post 33 is provided with a bearing sleeve assembly 47 which is journalled in the inner race of a radial bearing 48 . a nut 49 threadedly engaged on the outer member of the bearing assembly 47 is formed with an axially extending sleeve portion which abuts the inner race of the radial bearing 48 to lock it in position . the outer race of radial bearing 48 is supported in a bore 51 of a drive eccentric 52 . a bearing surface formed on the exterior of the drive eccentric 52 receives the inner race 53 of a radial bearing 55 . the outer race 56 of the bearing 55 is disposed in a circular seat 57 formed on the upper portion 17 of the vertical hub 16 . to maintain the bearing 55 stationary within the circular seat 57 , the outer race 56 of the bearing has an interference fit with the circular wall of the bearing seat 57 . a nut 58 is threadedly engaged on a circular extension of the drive eccentric 52 and is disposed to abut the inner race 53 of the bearing 55 . an axial thrust bearing 60 is disposed beneath the crusher head shaft 33 between the lower axial end face thereof and a piston 61 within a cylinder 62 defined by the closure plate 19 . lubrication of the thrust bearing 60 is accomplished through a communicating oil passage 66 formed in the head of the piston 61 . the passage 66 communicates with a vertical oil groove 67 in the exterior surface of the piston . lubricating oil from a source ( not shown ) is supplied to the vertical groove 67 via a passage 68 that connects with the vertical groove 67 via a port 69 drilled in the sleeve liner 71 of the cylinder 62 . to drive the crusher , a pinion gear drive shaft 76 is journalled in bearings 77 and 78 carried by a bearing carrier 79 which is disposed within a bore 80 of a laterally extending hub 81 formed with the lower portion 18 of the frame hub section 16 . a bearing retainer plate 82 is disposed around the shaft 76 and is screw fastened to the outer axial end face of the bearing retainer 79 . the shaft 76 is driven by any suitable source of power . at its inner end , drive shaft 76 carries a pinion drive gear 83 that is in meshing engagement with a gear 84 connected to the drive eccentric 52 . thus , shaft 33 is free to move axially up and down within the bearing sleeve assembly 47 while still maintaining its gyratory drive connection with the drive eccentric 52 . in the operation of the crusher 10 , power is applied to drive the pinion 83 and rotate the gear 84 . this effects rotation of the drive eccentric 52 which rotates in an orbit about the vertical axis of the crusher . thus , the axis of the crusher head shaft 33 is driven in gyratory motion and transcribes a cone about the central vertical axis of the crusher . this motion provides the crushing action of head 24 in the crushing chamber 25 . as the crusher head shaft 33 is driven in its gyratory motion about the central vertical axis of the crusher , crushing forces which are the result of stone being broken between the head 24 and the concave 23 develop forces which react on the head 24 . these forces cause the head 24 and thereby the shaft 33 to rotate about the axis of the crusher head shaft 33 slowly in the opposite direction to the eccentric 52 rotation while the crusher head shaft is being bodily moved in a gyratory path of travel about the central vertical axis of the crusher . vertical support and positioning of the crusher head 24 for adjusting the opening of the crushing chamber 25 is accomplished by hydraulic fluid under pressure . for this purpose , hydraulic fluid under pressure is supplied to the expansible chamber 21 via the passage 22 in the closure plate 19 . the fluid under pressure in chamber 21 reacts on the piston 61 elevating the shaft 33 and thereby the crusher head 24 ( or lowers the assembly ) as desired . as previously mentioned , an adjustment between the pinion gear 83 and the gear 84 to provide a predetermined amount of backlash between the gears is highly desirable . this is true because if the gears 83 and 84 have an extremely close tooth engagement gear noise increases . it is also true that with bevel gears such as the gears 83 and 84 a tight tooth engagement results in undue wear . thus , the ability to adjust the intermeshed relationship between the gears to provide a desired amount of backlash therebetween is desirable . to this end , as shown in fig2 the longitudinal axis of the bearing carrier 79 indicated by the letter a which is concentric with longitudinal axis of the pinion gear drive shaft 76 is offset with respect to the axis of the bore 80 indicated by the letter b of the lateral extending hub 81 . in fig2 the vertical line x -- x passes through the axis b of the bore 80 while the vertical line y -- y passes through the axis a of the bearing carrier 79 and the space z between the lines x -- x and y -- y clearly indicates the offset relationship of the two axes . rotation of the bearing carrier 79 in a clockwise direction as viewed in fig2 will effect the bodily movement of the pinion gear 83 upwardly with respect to the beveled gear 84 . conversely , rotation of the bearing carrier 79 in a counterclockwise direction , as viewed in fig2 will effect bodily movement of the pinion gear 83 away from the bevel gear 84 . such adjustment of the bearing carrier 79 is effected by means of jackscrews 91 and 92 . as shown , the jackscrews 91 and 92 are each threadedly engaged in suitable bores 93 and 94 , respectively , formed in a clamp ring 95 . the inner ends of the jackscrew abut bearing surfaces 96 and 97 formed in a radial flange portion 98 of the bearing carrier 79 . the clamp ring 95 operates to clamp the bearing carrier 79 in an adjusted position . to this purpose the clamp ring 95 is provided with a radially inwardly extending flange 101 which engages the face of the radial extending flange portion 98 of the bearing carrier 79 . a plurality of screws 102 extend through the clamp ring 95 into threaded engagement in the hub 81 . by loosening the screws 102 the clamp ring 95 is released and the position of the bearing carrier 78 with the bore 80 and thus the pinion gear 83 can be adjusted to establish the desired amount of backlash between the gears 83 and 84 . by backing off the jackscrew 92 and tightening the jackscrew 91 the bearing retainer 79 and thus pinion gear 83 will rotate about the axis b of the bore 80 . in so doing the pinion gear 83 as viewed in fig1 will be adjusted upwardly in a vertical plane into closer meshing engagement with the bevel gear 84 . it is true that in effecting the vertical height adjustment of the pinion gear 83 some amount of lateral displacement will occur . however , the amount of lateral displacement will be small in comparison with the vertical movement . for example , in the case of a 0 . 5 inch offset pinion center , that is , the distance z , the vertical adjustment can be ± 0 . 086 inch compared to a total lateral displacement of 0 . 0075 inch when the pinion housing is adjusted through 10 ° in either direction . after the desired adjustment of the pinion gear 83 with respect to the bevel gear 84 has been established the jackscrews 91 and 92 are firmed against the surfaces 96 and 97 , respectively , and are locked in place with lock nuts 103 and 104 . thereafter the screws 102 are tightened to reclamp the bearing carrier 79 in the adjusted position . in adjusting the pinion the bearing carrier 79 is rotated in a clockwise direction , as viewed in fig2 until initial resistance between the teeth of the gears 83 and 84 is sensed . this radial position of bearing carrier 79 is marked , that is , a mark 105 is marked on the clamp ring 95 opposite the mark 106 on the bearing carrier . thereafter the bearing carrier 79 is rotated further in a clockwise direction around the axis b of the bore 80 , by operation of the jackscrew 91 until all longitudinal clearance has been removed from bearing 55 . at this point the bearing carrier mark 106 will be in a position assumed to be as indicated by the broken line showing of the mark and indicated as 106 &# 39 ; and a mark 107 will be made on the clamp ring 95 . the bearing carrier 95 will then be rotated in a counterclockwise direction by backing off the jackscrew 91 and taking up on the jackscrew until the bearing carrier mark 106 is positioned halfway between the marks 105 and 107 . this halfway position is an ideal driving relationship position without backlash which will not obtain under operating conditions and further adjustment is necessary . from known tables , the running clearance expressed as backlash for gears similar to gears 83 and 84 can be determined . with this figure at hand the bearing carrier is located about the axis b until the proper backlash between the gears is established . in fig1 and 3 , in the bearing carrier an adjustment member is shown . as depicted , the bearing carrier 79 is provided with an outwardly extending flange 98a in which is formed a plurality of arcuate slots 109 . each slot 109 receives a screw 111 which extends through the associated slot into threaded engagement with the axial end face of the laterally extending hub 81 . by tightening the screws 111 the angular position of the bearing carrier is fixed within the bore 80 . to adjust the angular position of the bearing carrier within the bore 80 there is provided a drive gear 114 which is secured on a suitable shaft 116 that is journalled in an arm 117 . the arm 117 is integrally formed as an extension of the radial flange 98b . the drive gear 114 is adapted to mesh with gear teeth formed on the peripheral edge of a sector plate 118 . screws 119 secure the sector plate 118 to the flange 98a . rotation of the drive gear 114 can be effected by means of a wrench ( not shown ) which is engageable on a squared end 121 of the shaft 116 .

US-69378476-A

an anti - slip type electric drill chuck mainly includes a body which is obliquely provided with three pawls for clamping a drill head . the outer surface of one end of the three pawls is provided with a threaded surface for engaging a tapered threaded hole in a bearing nut , which has an outer end with teeth , an end portion provided with a ball ring . a check nut protective sleeve encloses the ball ring and bearing nut , and has elastic pointed portions engage the teeth . a drive annular block engages the inner wall of the bearing nut . a front housing sleeve engages the drive annular block and surrounds the aforesaid components . the front housing sleeve is rotated by hand to advance or retract the pawls to thereby loosen or tighten drill head . when the pawls clamp the drill head , the check nut protective sleeve stabilizes the bearing nut to prevent slippage thereof .

referring to fig1 , 3 and 4 , the chuck according to the present invention includes a body 20 , a bearing nut 40 , a check nut protective sleeve 50 , a drive annular block 60 , a front housing sleeve 70 , a tool sleeve 80 , and a rear housing sleeve 90 . the body 20 has one end connected to a transmission shaft of an electric drill motor . the body 20 is provided with a first ring 21 and a second ring 22 projecting from the outer periphery of a shaft securing end thereof . the center of the body 20 is provided with a shaft hole 23 . the periphery of the seat body is formed with three equidistantly spaced guide grooves 24 . one end of the three guide grooves 24 passes through the second ring 22 . the other end extends into the shaft hole 23 . three pawls 30 respectively extend into the guide grooves 24 from exposed holes formed by the three guide grooves 24 in the second ring 22 . the pawl 30 has a threaded surface 31 exposed from the body 20 , and has an inner end portion extending into the shaft hole 23 to form a clamping end 32 for clamping a tool such as a drill head , reamer , screwdriver , tapping cutter , etc . the bearing nut 40 is sleeved on the body 20 , and is centrally provided with a tapered threaded hole 41 for engaging the threaded surface 31 of the pawl 30 . the outer periphery of the bearing nut 40 has a surface with different diameters , with a juncture forming an oblique wedged surface 46 . the surface with the smaller diameter is provided with teeth 42 . the end portion of the bearing nut 40 that corresponds to the second ring 22 of the body 20 is fitted with a ball ring 43 and a heat - treated washer 45 . the check nut protective sleeve 50 includes a tooth fitting ring 502 and a packing ring 501 . the tooth fitting ring 502 is in the form of an annular sleeve fitted on the bearing nut 40 and has a ring end provided with a plurality of bent openings 52 corresponding to the teeth 42 of the bearing nut 40 such that one side of the respective opening 52 forms an elastic piece 53 . an open end portion of the elastic piece 53 is recessed toward the center of the tooth fitting ring 502 so as to form a pointed portion 54 . the pointed portion 54 can engage the teeth 42 . the packing ring 501 is disposed at the ball ring 43 and washer 45 of the bearing nut 40 to urge against the end of the tooth fitting ring 502 . corresponding to the wedged surface 46 of the bearing nut 40 , the tooth fitting ring 502 is also formed with an oblique wedged surface 55 . the two wedged surfaces 46 , 55 abut against each other to be thereby positioned so as to further prevent loosening or slippage of the tooth fitting ring 502 . the check nut protective sleeve 50 encloses the bearing nut 40 and ball ring 43 as an assembly disposed on the body 20 such that the exterior of the packing ring 501 surrounds the second ring 22 . the drive annular block 60 has one end fitted in the end edge of the bearing nut 40 . the outer edge of the drive annular block 60 is provided with a plurality of protrusions 61 . the inner periphery of the end portion of the bearing nut 40 is provided with a plurality of recesses 44 for retaining the protrusions 61 . the other end portion of the drive annular block 60 is exposed from the body 20 . the front housing sleeve 70 is a hollow sleeve with two open ends , and is fitted at the end portion of the body 20 to enclose the drive annular block 60 , check nut protective sleeve 50 and bearing nut 40 . the inner periphery of the front housing sleeve 70 is annularly provided with a plurality of recesses 72 for retaining protrusions 61 of the drive annular block 60 such that when the front housing sleeve 70 is turned by hand , the bearing nut 40 can be brought to rotate therewith . the tool sleeve 80 is tightly fitted at the end portion of the body 20 to limit the front housing sleeve 70 . the center thereof is provided with an extension hole 81 for extension of a tool , such as drill head 100 , therethrough . the outer edge thereof is provided with a polygonal hole 82 into which a workpiece , such as a sleeve , can be fitted directly . the inner edge of the hole is provided with a semi - curved groove 821 such that a securing ball of the sleeve can be insertably retained therein to thereby position the sleeve . the inner edge of the tool sleeve 80 is annularly provided with an abutting protrusion 83 for tightly abutting against an abutting groove 25 at the end portion of the body 20 so that the tool sleeve 80 will not become disengaged . the rear housing sleeve 90 is a sleeve member with a substantially u - shaped cross - section , and is fitted on the first ring 21 of the shaft securing end of body 20 . the rear housing sleeve 90 is internally provided with a projecting retaining portion 91 . the first ring 21 is provided with a groove 211 for retaining the retaining portion 91 . the operation of the present invention will be described hereinafter with reference to fig2 and 5a . if it is desired to lock the drill head 100 tight , the end portion of the drill head 100 is inserted into the extension hole 81 in the tool sleeve 80 and further into the shaft hole 23 in the body 20 . the front housing sleeve 70 is rotated by hand to drive the drive annular block 60 , bearing nut 40 and check nut protective sleeve 50 to rotate . at the same time , by means of the tapered threaded hole 41 in bearing nut 40 , the pawls 30 are caused to displace in the direction of the drill head 100 . when the clamping ends 32 of the pawls 30 engage the drill head 100 , the ball ring 43 and washer 45 at the end portion of bearing nut 40 will be tightly pressing against the packing ring 501 of check nut protective sleeve 50 . at this time , the pressed check nut protective sleeve 50 will not be able to rotate with bearing nut 40 . if the operation turns the front housing sleeve 70 very slightly , the teeth 42 on bearing nut 40 will push away the pointed portion 54 of the elastic piece 53 of check nut protective sleeve 50 ( as shown in fig5 b ), and a clicking sound of engagement between teeth will be heard . the user can then judge that the front housing sleeve 70 and bearing nut 40 have been rotated to a critical limit and can therefore stop turning the front housing sleeve 70 . the pointed portion 54 of check nut protective sleeve 50 is still retained in teeth 42 of bearing nut 40 ( as shown in fig5 c ). it is noted that when the drill head 100 is performing a drilling operation , vibration , torque , resistance , etc ., will occur . however , since the pointed portion 54 of check nut protective sleeve 50 of the present invention engages the teeth 42 of bearing nut 40 , and since the ball ring 43 causes the packing ring 501 of check nut protective sleeve 50 to press tightly against the second ring 22 of body 20 so that when check nut protective sleeve 50 rotates with the body 20 , there is a limiting relationship with respect to the bearing nut 40 to keep the tapered threaded hole 41 of bearing nut 40 engaging the pawls 30 firmly , disengagement of drill head due to vibration , torque or resistance will not occur , and the drill head 100 can perform the drilling operation stably . when it is desired to remove the drill head 100 , the front housing sleeve 70 is rotated in a reverse direction . after turning the same very slightly , since the check nut protective sleeve 50 is still pressed by the ball ring 43 and washer 45 , there is still the clicking sound due to friction between the teeth when the bearing nut 40 is turned . but when the bearing nut 40 starts driving the pawls 30 to retract , the ball ring 43 and washer 45 will release the pressure on the packing ring 501 of check nut protective sleeve 50 and return to the state wherein the two are loosely engaged . at this time , since the check nut protective sleeve 50 has the pointed portion 54 thereof engaging the teeth 42 , it can rotate with the bearing nut 40 until the pawls 30 are completely retracted from the drill head 100 . in the tool sleeve 80 shown in fig1 to 5 c , the polygonal hole 82 is adapted to receive workpieces , such as sleeves . as shown in fig5 a to 5 c , in the first embodiment , the root bottom portion between adjacent teeth 42 of bearing nut 40 is in a pointed shape ; therefore , the pointed portion 54 of tooth fitting ring 502 is also in a pointed shape . in the second embodiment shown in fig6 the root bottom portion between adjacent teeth 42 of bearing nut 40 is curved ; therefore , the pointed portion 54 ′ of tooth fitting ring 502 is also in a curved shape so as to be engageable therewith . referring to fig7 the third embodiment of this invention does not include a tool sleeve 80 , and a recess 26 is formed at the head end of body 20 . the front housing sleeve 70 is provided with a projecting block 73 for insertion into the recess 26 to thereby position the front housing sleeve 70 and the body 20 . referring to fig8 which shows the fourth embodiment of this invention , the head end of the body 20 is provided with a taper portion 27 that tapers toward the open end . the open end of the body 20 is provided with an inverted - angle stop portion 28 . the inner edge of the front housing sleeve 70 near the open end thereof is provided with a taper surface that matches and engages the taper portion 27 , with the stop portion 28 of the body 20 stopping the open end of the front housing sleeve 70 to thereby position the front housing sleeve 70 and the body 20 . referring to fig9 and 10 , which show the fifth embodiment of this invention , the protrusion 61 of the drive annular block 60 is provided with a retaining groove 62 . the groove 72 of the front housing sleeve 70 is provided with a retaining block 73 corresponding to the retaining groove 62 for engaging the retaining groove 62 so as to position the front housing sleeve 70 on the drive annular block 60 with no likelihood of slippage .

US-97452701-A

a device for feeding cigarettes to a packeting machine . cigarettes are placed in the lower part of a hopper in stacks mobile stepwise along respective outgoing channels from the hopper . a device is provided for checking the cigarettes descending stepwise along the channels , and another device which ejects faulty cigarettes is controlled by the checking device and includes , for each channel , a pneumatic extractor connectable to a suction source and a withdrawal element able to gain access to the respective channel to extract the faulty cigarettes from the interior of the hopper .

fig1 and 2 show an intake hopper 1 , of known type , for feeding cigarettes 2 , comprising a filter 3 , to a cigarette packeting machine ( not shown ). the hopper is defined by a left - hand wall 4 , facing the filters 3 , and a right - hand wall 5 , which are vertical and parallel to each other and define a compartment having a width approximate to but slightly greater than the length of one cigarette 2 . this compartment is divided into a plurality of elementary channels 6 ( of which only one is shown ) by baffles or dividing walls 7 positioned at a distance apart approximate to but slightly greater than the diameter of the cigarettes 2 ( see fig3 ). the elementary channels 6 are bounded at their bottom by a horizontal wall which supports the comumns of cigarettes 2 contained in the channels 6 . said cigarettes 2 are engaged in batches at the end comprising the filter 3 by a pusher element 9 mobile with reciprocating motion perpendicular to the walls 4 and 5 through horizontal slits 10 and 11 provided in the walls 4 and 5 in a position adjacent to the wall 8 and of a height at least equal to the diameter of the cigarettes 2 . the pusher element 9 is movable from a non - active position outside the hopper 1 to an operative position inside the hopper 1 for pushing the cigarettes 2 from the channels 6 into containers 12 ( of which only one is shown ) carried by a conveyor belt 13 provided with intermittent motion , for transferring the batches of cigarettes 2 to a packeting unit , not shown . to understand better the structure of the hopper 1 , the channels 6 , the pusher element 9 and the conveyor belt 13 , reference should be made to the description and drawings of u . k . patents nos . 1 , 298 , 785 and 2 , 023 , 994 in the name of the present applicant , messrs . g . d . s . p . a . along each channel 6 , externally to the wall 5 , there is provided a sensor means or device for checking the soundness of the individual cigarettes 2 , and indicated overall by 14 . said checking device 14 is shown schematically in the figures as a sensor ( of optical , or mechanical , or pneumatic type ) able to detect defects in the extremity of each individual cigarette 2 via a horizontal hole 15 provided through the wall 5 . externally to the hopper 1 , in proximity to the wall 4 facing the filters 3 , there is provided a device 16 for axially adjusting the cigarettes 2 . said adjustment device 16 consists , for each channel 6 , of an arm 17 pivoted on a horizontal pin 18 perpendicular to the axes of the cigarettes 2 . actuator means , not shown , impress on the device 16 a rocking movement of a frequency such as to cause the free end of the arm 17 to make contact , during each halt period of the stack , with the filter 3 of each cigarette 2 and exert a sufficient pressure to move those extremities to be checked into line with the wall 5 . at a lower level than the checking device 14 there is provided a device for ejecting the faulty cigarettes 2 , which is indicated overall by 19 . said device comprises , for each channel 6 , a pneumatic extractor 20 provided with a withdrawal element 21 mounted on a block 22 supported by the pusher 9 via a bracket 23 . said withdrawal element 21 , the level of which is lower than that of the respective sensor 14 by a distance equal to or a multiple of the diameter of one cigarette 2 , has one end in the form of an elongated curved plate with its longitudinal axis ( see fig2 ) parallel to the axes of the cigarettes 2 and its concave surface , indicated by 24 , facing the interior of the respective channel 6 as best seen in fig6 . by means of the described connection , each extractor 20 is mobile together with the pusher 9 with axial reciprocating motion relative to the wall 4 of the hopper 1 . more specifically , when the pusher 9 is located in its end - of - travel position below the hopper 1 , each pneumatic extractor 20 occupies a position , indicated by 25 and defined as the withdrawal position , in which an access into the respective channel 6 is provided for the withdrawal element 21 . this access consists of an aperture or hole 26 &# 39 ; formed in the wall 4 and , aligned with it , a seat or recess 26 formed in one of the two baffles 7 defining said channel 6 ( see also fig3 ). in contrast , when the pusher 9 is in its non - active position outside the hopper 1 , the withdrawal element 21 occupies a position of disengagement from the channel 6 outside the hopper 1 at a distance from this latter which is at least equal to the length of one cigarette 2 . above the device 19 there is provided a fixed horizontal plate 27 , in contact with which the blocks 22 of each extractor 20 slide in an air - tight manner along their entire path . in the inward and outward end - of - travel positions occupied by each block 22 , said plate 27 is provided with vertical holes indicated respectively by 28 and 29 , the former being connected by a pipe 30 to a suction source and the latter being connected by a pipe 31 to a compressed air source , which are indicated schematically by the blocks 32 and 33 respectively . when each extractor 20 is in one of its end - of - travel positions the holes 28 and 29 in the plate 27 are aligned with a hole 34 communicating with a duct 35 extending inside the block 22 and withdrawal element 21 and connected to the outside via apertures in the form of holes 36 provided in the concave surface 24 of the withdrawal element 21 . with reference to the block diagram of fig5 which represents a control circuit relative to each channel 6 , the checking device is shown schematically as a normally open contact which closes when a cigarette 2 which is too short or not sufficiently full of tobacco at its extremity is detected . connected to the output of the checking device 14 there is provided a memory device 37 , which controls valve means 38 comprising a first valve 39 connected into the pipe 30 and a second valve 40 connected into the pipe 31 . when in use , during the halt stage of each machine cycle and therefore when the stacks of cigarettes 2 are at rest within the channels 6 , each sensor 14 via its individual hole 15 checks a respective cigarette 2 , which has previously been brought into contact with the wall 5 by the axial adjustment device 16 . when a cigarette 2 is found to be faulty , the checking device 14 provides for its rejection by way of said memory device 37 and the valve means 38 . more specifically , after a determined delay which depends on the level difference , evaluated in terms of machine cycles , between the checking device 14 and the extractor device 20 , the normally closed valves 39 and 40 receive an opening command with the result that the two holes 28 and 29 become connected to the suction source 32 and to the compressed air source 33 by the respective pipes 30 and 31 . as a result of this , when the faulty cigarette 2 travelling down the channel 6 reaches that halt position in which the extractor 20 operates , the withdrawal element 21 , which is in its end - of - travel position within the seat 26 provided in the respective baffle 7 , communicates with the suction source 32 via the connection means consisting of the hole 34 and the duct 35 . the filter 3 of said cigarette 2 therefore adheres tightly to the concave surface 24 provided with the holes 36 deriving from the block 22 , which on moving away from the wall 4 withdraws the faulty cigarette 2 from the stack . by virtue of the air - tight contact between the block 22 and plate 27 , the suction force of the withdrawal element acting on the cigarette 2 does not cease after interruption of communication between the duct 35 and hole 28 as the block 22 slides towards its outer end - of - travel position . when the block 22 reaches its outer end - of - travel position on retraction of the pusher 9 , means , of which the compressed air source 33 forms part , for separating the cigarettes 2 from the extractor 20 come into operation . in this respect , as the hole 29 in the plate 27 coincides with the hole 34 , the compressed air source 33 is directly connected to the withdrawal element 21 so that air jets flowing through the holes 36 cause the faulty cigarette 2 to separate and fall into a collection vessel , not shown . in the embodiment shown in fig6 and 7 , a tubular withdrawal element 43 of diameter less than the diameter of the cigarettes 2 replaces the withdrawal element 21 of the first embodiment . said tubular element 43 , connected in the illustrated manner to the suction source 32 by the pipe 30 , is provided with a sheath of resilient material 44 which projects by a determined length beyond its free end . for each outward stroke of the pusher 9 and consequently of the extractor 20 , the tubular element 43 moves its sheath 44 through the access formed by the hole 26 &# 39 ; provided in the wall 4 , and into delicate adhesion with the extremity of a cigarette 2 . if a faulty cigarette 2 is detected by the checking device 14 , the valve 39 receives an opening command via the memory device 37 , and connects the suction source 32 to the tubular element 43 . as a result of this , in the space bounded by the sheath 44 and lying between the extremity of the cigarette 2 and the end of the tubular element 43 a vacuum is created which draws the cigarette 2 into contact with the mouth of the tubular element , overcoming the resistance of the sheath 44 . during the subsequent return stroke of the extractor 20 the faulty cigarette 2 is extracted from the relative channel 6 and then ejected in the aforesaid manner . in the embodiment shown in fig6 and 7 the device 19 for ejecting the faulty cigarettes 2 is not rigid with the reciprocating pusher 9 , but instead each extractor 20 is moved by a respective actuator 46 . this enables all the extractors 20 to be kept under halt conditions ( for example in a position intermediate between those shown in fig6 and 7 ) in the absence of faulty cigarettes 2 . only when a faulty cigarette 2 is detected is the respective withdrawal element operated by the actuator 46 , itself controlled by the checking device 14 associated with the respective channel 6 . it can be seen that the device according to the present invention is able to obviate all the described drawbacks of the known art . in this respect , those air blasts directed axially against the extremities of the cigarettes are no longer present , such air blasts as stated resulting in dust and the escape of tobacco particles , nor are the needles which can constitute a danger to the machine operators , particularly on breakage . within the principles of the inventive idea numerous modifications can be made to the said device without leaving the scope of the present invention . the sensor means could be located on both the walls 4 and 5 of the hopper 1 to check both extremities of the cigarettes 2 . it should be noted that in the case heretofore described , in which only one extremity of the cigarettes 2 is checked , the withdrawal element 21 ( 43 ) and the checking device 14 could be positioned mutually aligned , so as to effect the checking operation and the ejection of the possibly faulty cigarette 2 during the same machine cycle . with regard to the axial adjustment device 16 , this instead of being mechanical could be of pneumatic type , for example consist of a nozzle 41 connected to a compressed air source , not shown ( see fig6 ). in contrast , the means for separating the faulty cigarettes 2 from the extractor 20 could be of mechanical instead of pneumatic type , and consist for example of a bar ( not shown ) which when the extractor 20 is in its outer end - of - travel position strikes the cigarette 2 transversely to its axis .

US-43155689-A

a planar sheet mounting device comprising : a frame unit ; at least one retaining unit connected to the frame unit , wherein the at least one retaining device comprises : a first plurality of formed segment pairs , wherein a formed segment pair comprises a first formed segment disposed on a second formed segment , wherein the second formed segment is substantially identical to the first formed segment , wherein the first formed segment is oriented in a plane substantially parallel to the plane of the second formed segment , whereby a planar sheet is retained when interposed between the first formed segment the second formed segment ; a holder , wherein the first plurality of formed segment pairs are coupled to holder at least one point on each formed segment pair of the first plurality of formed segment pairs , and wherein the first plurality of formed segment pairs are oriented adjacent to each other ; an affixant coupled to the holder for removably affixing the first plurality of formed segment pairs and the frame unit to a substrate .

a device is provided for mounting a planar sheet , such as photographs , certificates , artwork , etc ., which may be used in an office , a home , an automobile , or other personal space . surfaces for mounting such items are typically vertically oriented and are comprised of fabric , drywall , wood , plastic , or other material suitable material . fig1 a - 1 c illustrate respective front , side , and back views of a first embodiment of a planar sheet mounting device 100 . in general , planar sheet mounting device comprises a set of one or more formed segment pairs . fig1 a illustrates a front view of an exemplary embodiment of the planar sheet mounting device having a set of formed segment pairs , which includes six formed segment pairs 110 a - 110 f , and a holder 120 that provides a structure to connect together each individual segment pair 110 a - 110 f . the six formed segment pairs , 110 a - 110 f are attached to the holder using , for example , an adhesive or a solder . in other embodiments , a pressure fit or threaded arrangement is used for attaching each formed segment pair to the holder 120 . holder 120 may extend from front of formed segment pairs 110 a - 110 f to the back of formed segments 110 a - 110 f , to grip the formed segment pairs abd aid in attachment of the formed segment pairs to the holder . as shown in exemplary side view illustrated in fig1 b , each formed segment pair 110 a - 110 f includes a pair of formed segments , exemplified by first formed segment 111 and second formed segment 112 . first and second formed segments 111 , 112 are in direct contact with each other and are oriented in parallel planes . in a preferred embodiment , the first and second formed segments 111 , 112 are the same size and shape , so that when seen from the front they appear as a single piece . in other embodiments , the first and second formed segments 111 , 112 are of different sizes and / or shapes . a planar sheet ( not shown ) is inserted between formed segments 111 , 112 of one or more of the formed segment pairs 110 a - 110 f , to retain the planar sheet , by way of the pressure or friction fit . in the preferred embodiment , where the formed segments are of the same size and shape the pressure or friction is provided by the intimate contact between the formed segments 111 , 112 , while not deforming the planar sheet 130 in any way . formed segments 111 , 112 are coated with a protective coating such as nylon , acrylic , or other plastic coating or by anodization . coatings are also selected for their surface properties . coatings , such as nylon , can enhance the ease of insertion of the planar sheet between the formed segments , while coatings , such as polyvinyl chloride ( pvc ) can enhance the retention of the planar sheet between the formed segments by increasing the friction coefficient of the surface . coating protects planar sheet from damage and provides a means to modify the strength of the friction fit . in some embodiments coating can provide one or more colors or textures to the formed segment pairs . by way of example , coatings may include anodization , powder coating , nylon coating , or pvc . in other embodiments additional coatings are used or no coating is applied . fig1 c illustrates a back view of an exemplary embodiment of the planar sheet mounting device 100 . affixant is shown as pin 140 , which is shown coupled to holder 120 for removably affixing planar sheet mounting device 100 to a substrate ( not shown ). in other embodiments , pin 140 is replaced with other means for affixing the planar sheet mounting device 100 to a substrate , for example , a clip , a magnet , or a hook and loop strip , among others . the choice of affixant is based on the properties of the substrate and the preference of the user . in one embodiment , formed segments 111 , 112 are produced using a stiff but pliable linear material , such as a metallic wire , that provides an acceptable amount of stiffness and pliability to allow for production of various meaningful symbols . the formed segments define an outline wherein each formed segment pair produces a meaningful symbol by its outline . meaningful symbols include various themes or groups of shapes , such as by way of example , garden items , ocean creatures , animals , stars , sports items , flowers , geometric shapes , astrological symbols , buildings , people , holidays , clothing , shoes , and tools . the selection of possible themes or groups of shapes is unlimited and any shape that can be rendered by shaping of the wire may be used . metallic wire types suitable for the current invention include copper , aluminum , and stainless steel . in other embodiments , additional metal or plastic linear materials are used . in the preferred embodiment , formed segment pairs 110 a - 110 f are shown in the form of a rhodonea curve , or rose shape . a rhodonea curve is a sinusoid plotted in polar coordinates and can be expressed by the polar equation r = cos ( kθ ). if k is an even integer , the curve is a rose shape having 2k petals and if k is an odd interger the curve is a rose shape having k petals . in other embodiments , other shapes are used and include any geometric shape and the meaningful symbols , as discussed above . the rhodonea curve is preferred for its ease of forming and decorative appearance . holder 120 is a solid or layered part that comprises a variety of shapes including a three dimensional geometric shapes . in one embodiment the three dimensional shape depicts a meaningful symbol . as above , meaningful symbols include various themes or groups of shapes , such as by way of example , garden items , ocean creatures , animals , stars , sports items , flowers , geometric shapes , astrological symbols , buildings , people , holidays , clothing , shoes , and tools . the selection of possible themes or groups of shapes is unlimited and any shape that can be rendered by forming or molding of the holder 120 may be used . in the preferred embodiment , holder 120 is formed of the same material as frame unit and formed segment pairs . in other embodiments different materials are used . materials selected are based on ease of forming the selected meaningful symbol and include materials that provide one or more colors . in some embodiments , one or more coatings are provided that offer protection to holder 120 , as discussed above with respect to the formed segments . coatings may comprise one or more colors for providing a decorative finish to holder 120 . fig2 a - 2 c illustrates respective front , side , and back views of a second embodiment of a planar sheet mounting device 200 . the second embodiment includes a second set of formed segment pairs , which includes six formed segment pairs 210 a - 210 f . each formed segment pair in the second set of formed segment pairs 210 a - 210 f includes respective third and fourth forth formed segments 213 and 214 , similar to first and second formed segments 111 and 112 and shown in fig2 b . second set of formed segment pairs is identical to first set of formed segment pairs 110 a - 110 f , except smaller in size . in another embodiment , second set of formed segment pairs 210 a - 210 f is a different shape than first set of formed segment pairs 110 a - 110 f . choice of size and shape is based on desired appearance . first set of formed segment pairs 110 a - 110 f and second set of formed segment pairs 210 a - 210 f , both accommodate insertion of a planar sheet . in another embodiment , either first set of formed segment pairs 110 a - 110 f or second set of formed segment pairs 210 a - 210 f is configured so as not to accommodate insertion of a planar sheet . second embodiment of the planar sheet mounting device includes a holder 220 for attachment of first and second sets of formed segment pairs 110 a - 110 f and 210 a - 210 f . also , an affixant , such as pin 240 is included for affixing planar sheet mounting device 200 to substrate ( not shown ). fig3 illustrates one embodiment of a planar sheet mounting device . the planar sheet mounting device 300 includes a frame unit 310 , shown having a curvilinear form . other forms may be used , such as a linear form a rectilinear form and various geometric shapes . the shape of the frame unit is not limited and can be customized , for example , to match the place of use , to conform to the size and / or shape of the planar sheet , to conform to the size and / or shape of the mounting area , or to conform to the specifications of the user . other variables can be incorporated into the frame unit design . connected to the frame unit is one or more planar sheet retaining units 100 and 200 , as discussed above in relation to fig1 and 2 . planar sheet retaining units 100 and 200 , are connected to the frame unit 310 , using a solder , an adhesive , a pressure fit , or a threaded arrangement . in various embodiments , different combinations of planar sheet retaining units are used and different shaped planar sheet retaining units are used . planar sheet mounting device 300 includes a third formed segment 320 having a unique shape interspersed with planar sheet retaining units 100 and 200 and attached to frame unit 310 . third formed segment 320 is attached using any suitable means , such as adhesive or solder . in another , embodiment , third formed segment 320 , is integrally formed with frame unit 310 . in the preferred embodiment , third formed segment 320 is a single wire and does not function as a planar sheet retaining device . in other embodiments , both third formed segment 320 and frame unit 310 , are constructed as a pair of segments , providing for the retention of a planar sheet . in another embodiment , the frame unit 310 includes one or more apertures ( not shown ) corresponding to each planar sheet retaining unit 100 , 200 . affixants , such as pins 140 , 240 , on each planar sheet retaining unit 100 , 200 , respectively , pass through respective apertures and contact or pierce substrate , providing for removal and interchange of different planar sheet retaining units 100 , 200 using the same frame unit . frame unit includes any number of apertures and not all apertures need be used . spacing of apertures and planar sheet retaining units is typically from about 1 - 5 inches , but other values are used based on a number of variables , such as the size of the planar sheet , the stiffness of the planar sheet , the desired appearance , and the type of substrate , among others . a planar sheet ( not shown ), as described above , is retained by one or more of the planar sheet retaining units , by way of the pressure or friction fit . in the preferred embodiment , frame unit 310 is formed of the same material as the holder and the formed segment pairs . in other embodiments different materials are used . materials selected are based on ease of forming the selected shape or meaningful symbol and include materials that provide one or more colors . in other embodiments , one or more coatings , such as those discussed above , are provided that offer protection to frame unit 310 . coatings may comprise one or more colors for providing a decorative finish to frame unit 310 . in another embodiment , holder 120 with coupled affixant 140 may be used with or without other parts , such as formed segment pairs or frame unit . while the embodiments of the invention disclosed herein are presently considered to be preferred , various changes and modifications can be made without departing from the spirit and scope of the invention . the scope of the invention is indicated in the appended claims , and all changes that come within the meaning and range of equivalents are intended to be embraced therein .

US-95583610-A

a fuel filler door actuator is provided having a locking arm and an alternate action mechanism . the locking arm is selectively driveable by an electric motor to engage or disengage with the fuel filler door of an automobile . the alternate action mechanism , including a spring - biased plunger having a cam track with a cam follower riding in the track , is engageable by and mounted adjacent to the fuel filler door and is capable of linear movement with respect to the door by alternating between an inward recessed position and an outwardly extended position each time an inward force is applied to the door . in the event of a loss of electrical power to the actuator , a manual override mechanism is provided which allows unpowered opening of the fuel door .

referring now to fig1 - 3 , there is shown an exemplary fuel filler door actuator according to the invention . as shown , an exemplary actuator 10 in accordance with the present invention includes : a housing 12 ; a plunger 14 ; a compression spring 15 biasing the plunger in direction outward from the housing ; a reversible fractional horsepower dc motor 16 ; a motor cover 18 ; o - rings 17 and 21 ; a pinion gear 20 driven by the motor ; an output gear 22 coupled to the pinion gear ; a locking arm 24 ; a cam follower 26 for riding in cam track 54 in plunger 14 ; and a housing cover 28 . in the illustrated exemplary embodiment , motor cover 18 and o - rings 17 , 21 seal the motor 16 within a cavity 11 in the housing 12 . o - ring 17 seals the cover - to - housing interface , and o - ring 21 seals the motor shaft - to - housing interface . sealing the motor serves the function of keeping the motor sufficiently insulated from potentially combustible materials in the environment around the motor . in addition , sealing the motor prevents entry of contaminants that could cause motor malfunction . the illustrated exemplary embodiment of the invention will first be described in broad general terms with a more detailed description to follow . in general , the actuator 10 locks / unlocks a vehicle fuel door 40 ( fig3 ) by allowing selective engagement and disengagement of an end 30 of locking arm 24 with a catch 32 on fuel filler door 40 . motion of the locking arm 24 is achieved by connecting the motor 16 to the vehicle power source 34 , e . g . through the vehicle central locking system 36 . when the motor 16 is energized , the pinion gear 20 drives the output gear 22 . the eccentric pin 42 extending from the face of the output gear extends through a slot 44 in locking arm 24 , and its end 46 rests in an over - center slot 48 in the cover 28 . as the output gear 22 is rotated , the pin 42 travels in the slot 44 to cause pivoting of the locking arm 24 about a pin 50 fixed to the housing 12 and corresponding movement of the end 30 of the locking arm from a locked position 30 ′( fig3 ) to an unlocked position 30 ″, depending on the direction of rotation of motor shaft 90 . when the actuator is in an unlocked mode , it presents the fuel door 40 to a user using an alternate action , push - to - open / push - to - close ( or “ push - push ”) mechanism provided generally by the spring - biased plunger 14 and the travel of the end 52 of the cam follower 26 within the cam track 54 . a manual override mechanism , described below , is provided for allowing unpowered operation , e . g ., in the event of a loss of electrical power . with reference now to fig3 - 6 , the alternate action mechanism of an exemplary actuator consistent with the invention will now be described in further detail . the illustrated embodiment may be useful in conjunction with flush fuel filler doors ( i . e . doors having no finger access dimples or pull tabs ) with an over - center spring , which biases the door alternately open or closed . those skilled in the art will recognize , however , that an actuator according to the invention may be adapted for use with other fuel filler door arrangements , e . g ., a door with a spring clip that engages a feature on the end of the plunger , or a plunger with a spring clip that engages a feature attached to the door . in the case of a door with an over - center spring ( not shown ), the door is held in the closed position by the over - center spring . in this position , the door may rest on , or be adjacent to , an elastomer bumper 71 on the end 70 of the plunger . the plunger is held in a door closed position 14 ′ by pressing engagement of a front portion 72 of the cam track 54 against a surface of the end 52 of the cam follower 26 . in the illustrated embodiment , the cam follower is slidably disposed in a slot 27 in the housing cover . those skilled in the art will recognize other configurations for the cam follower 26 . for example , in another embodiment , plunger 14 could move up and down with respect to a fixed cam follower , instead of the cam follower 26 moving up and down in track 54 . to open the fuel filler door , the exterior surface of the door is forced inward . this depresses the plunger 14 and its outwardly biasing compression spring 15 , thereby causing the cam follower 26 to move upward in the slot 27 and the track 54 and through the portion 80 of the track 54 ( fig4 ). when the follower 26 reaches the upper portion 82 of the track 54 , the plunger 14 is forced outward from the housing 12 by the spring 15 . the follower 26 travels through the upper portion 82 and then down through an end portion 84 to a bottom portion 86 of the track 54 . the spring 15 thus extends the plunger 14 to push the door open in opposition to the door &# 39 ; s over - center spring . the door is held open by the extended plunger to permit a user to insert fingers behind the door to pull it open against the force of the over - center spring . when the door is fully opened , the over - center spring biases the door in the open position . to close the door , the door is pivoted in the closing direction by the operator . as the door is pivoted , the over - center spring provides a force to urge the door toward the closed position . the door stops closing when it meets the end 70 of the extended plunger 14 , which is held in the “ door open ” position by the plunger coil spring 15 and the positioning of the cam follower 26 in the bottom portion 86 of the track 54 . the bumper 71 on the end 70 of the plunger may absorb the impact of the door 40 on the plunger . as additional force is applied to the door , the plunger 14 is forced toward its closed position against the bias of the spring 15 , and the end of the cam follower 26 slides along the bottom portion 86 of the track to the opening 88 of the front portion 80 of the track . when the door is released , the spring 15 forces the plunger 14 outward to return the door to the body flush position , and forces the end of the cam follower 26 to travel upward to rest in the portion 72 of the track 54 . thus , the ends of travel for the plunger are defined by the cam track profile in the plunger . in the illustrated embodiment , the track is similar to what is commonly referred to as a heart cam . the bottom of the cam track 54 is open in the illustrated embodiment , which advantageously makes the actuator of this embodiment easier to assemble . in particular , the plunger may be positioned over the follower 26 after the follower is positioned in the slot 27 . the alternate action mechanism would operate similarly in a door with a spring clip ( not shown ). if such a door were used , the door may be held in the closed position by the spring clip , which would engage a feature on the end of the plunger . when the plunger is placed into an open position , pulling on the door would overcome the spring clip to free the door for opening the rest of the way . the door would then be held open by friction or a mechanical detent . as the door is closed , the spring clip would again engage the feature on the end of the plunger . with continuing reference to fig1 - 3 , and also to fig7 - 8 , an exemplary door locking mechanism consistent with the invention will now be described in further detail . the door locking mechanism generally includes motor 16 , pinion gear 20 which is coupled to the motor output shaft 90 for rotation therewith , output gear 22 coupled to the pinion gear 20 , locking arm 24 , and housing cover 28 . in the illustrated embodiment , the eccentric pin 42 extends through the slot 44 in the locking arm 24 with its end 46 positioned in the over - center slot 48 of the housing cover 28 . as output gear 22 rotates , eccentric pin 42 travels within slot 44 and over - center slot 48 , forcing locking arm 24 to pivot about pin 50 with the end 30 of locking arm 24 moving between the unlocked 30 ″ and locked 30 ′ positions shown in fig3 . when the end 30 of locking arm 24 is in the unlocked position 30 ″, the end 46 of pin 42 is positioned in the top of over - center slot 48 , thereby resisting motion of arm 24 toward the locked position 30 ′. although in the illustrated embodiment , the end of the pin 42 is supported in the slot 48 , those skilled in the art will recognize that this configuration is not necessary . the slot 48 simply provides support for the end of the pin during operation . where such support is deemed useful or necessary , other means of support could be provided . for example , a support surface may be formed on the interior of the housing . the positioning of the pin 42 , as well as the dimensions of the slot 44 , effect the range of motion in the end of the arm , and may be adjusted depending on the requirements of the particular application . as shown in fig7 however , in one embodiment , pin 42 may be positioned at a distance d of about 0 . 12 ″ from the center point p 1 of the gear 22 and about 6 . 1 degrees from the gear centerline that passes through the center of the override tooth 64 . an advantage of this configuration is that it is “ tamper - resistant ”, since the eccentric positioning of the pin 42 and the pivoting of the arm 24 about pin 50 prevent the arm from manually being moved from locked position 30 ′ to unlocked position 30 ″. in particular , with reference to fig1 , when the arm 24 is in the “ locked ” position 30 ′, a force imparted to end 30 of the arm results in a force f n which is normal to the bottom surface of the slot 44 . if the distance d 1 from the center point p 2 of the pin 46 to the center point p 1 of the gear 22 is greater than zero , a clockwise moment m cw is generated due to the fixed pivot point p 0 of the arm about pin 50 . the clockwise moment causes the arm to maintain its locked state upon application of an external force to the end of the arm . likewise , with reference to fig1 , when the arm 24 is in the “ unlocked ” position 30 ″, a force imparted to end 30 of the arm results in a force f n2 which is normal to the top surface of the slot 44 . if the distance d 1 from the center point p 2 of the pin 46 to the center point p 1 of the gear 22 is greater than zero , a counter clockwise moment m ccw is generated due to the fixed pivot point p 0 of the arm about pin 50 . the counter clockwise moment causes the arm to maintain its unlocked state upon application of an external force to the end of the arm . operationally , the locking sequence starts with door 40 in the closed position , but with locking arm 24 secured in the unlocked position 30 ″ by output gear 22 . motor 16 may be energized to drive output gear 22 , thereby causing locking arm 24 to pivot from the unlocked position 30 ″ to the locked position 30 ′ with pin 42 traveling in slot 44 and from the top of over - center slot 48 to the bottom of over - center slot 48 . as discussed above , the locking arm 24 is secured into the locked position 30 ′( i . e . providing tamper resistance ) due to the eccentric positioning of the pin 42 on the output gear 22 . once the door is locked , it is held from being pulled open by engagement of the end 30 of locking arm 24 with the catch 32 on the door 40 , and the door cannot be pushed far enough inward to change the state of the alternate action mechanism . to unlock the door , alternate polarity is applied to motor 16 , e . g ., through the vehicle central locking mechanism 36 , and the locking arm motion is reversed . advantageously , the catch 32 and the locking arm 24 may be configured to allow the door to close even if locking arm 24 has already been moved to the locked position with the door open , i . e ., the arm is in the locked position 30 ′ but the end 30 of the arm is not engaged by catch 32 . in this condition , as the door is pushed closed , an angled surface 91 on catch 32 can deflect locking arm 24 upward far enough to allow it to engage the catch 32 and establish a locked condition . a shelf 95 ( fig2 - 3 ) may also be provided to prevent door 40 from being driven downwardly by the locking arm 24 during normal operation or while closing with the locking arm 24 in a “ locked ” position , further rendering the actuator tamper - resistant . an actuator consistent with the invention may also include a manual override feature . in the illustrated exemplary embodiment , a first end of an override cable 56 may be attached to an upwardly extending tab 58 on top of the plunger 14 . a second end of the manual override cable 56 may be attached to a manual override handle 60 positioned in a convenient and / or secure location , e . g . the automobile trunk or luggage compartment . operation of the mechanical override is accomplished by pulling on the handle 60 , thereby causing plunger 14 to retract further into the housing than it does during normal operation . in the illustrated embodiment , pulling handle 60 causes the end 52 of the cam follower 26 to be moved from its closed position in portion 72 of the track 54 into an override portion 100 of the track , allowing plunger 14 to be drawn further into the housing until a hard stop is reached . as the handle 60 is pulled , cable 56 draws the plunger 14 back toward the rear of the housing 12 , causing a downwardly extending portion 62 ( fig4 ) of the plunger 14 to impact the override tooth 64 on output gear 22 . in an alternative embodiment , an output gear 22 a , as shown in fig8 may be provided , and the downwardly extending portion 62 may be positioned to contact an override pin 63 extending from a face 65 of the gear . other configurations for causing engagement of a feature on the plunger with a feature on the gear will be apparent to those skilled in the art . as the portion 62 contacts the gear , the output gear 22 is rotated in a counterclockwise direction to force the end 30 of locking arm 24 out of catch 32 . this results in manual sequencing of the locking arm 24 to the unlocked position 30 ″, with the end 52 of the cam moving into the upper portion 82 of the track and then into portion 86 of the track to allow the plunger to extend outward . when the cable handle is released , the plunger spring 15 extends the plunger and moves the unlocked door to the open position . in one embodiment of the invention , a cable guide 59 may be provided to guide movement of plunger 14 via cable 56 . also , an extra length of cable 61 may be provided for cable 56 , sufficient to prevent activation of the manual override by mere inadvertent pulling of cable 56 or handle 60 . the embodiments that have been described herein , however , are but some of the several which utilize this invention and are set forth here by way of illustration but not of limitation . it is obvious that many other embodiments , which will be readily apparent to those skilled in the art , may be made without departing materially from the spirit and scope of the invention .

US-62140600-A

the systems and methods described herein include an intelligent energy - saving power supply system which conserves energy by recognizing when a chargeable electronic device , such as a cellular telephone , has been detached from its battery charger and by then cutting off power to the battery charger to prevent energy from being consumed while not serving the useful function of charging the chargeable electronic device . in addition , these systems may optionally include a device which turns off the receiver circuit of an electronic device to additionally save power and an interface which displays the amount of energy conserved by using the energy - saving power supply system .

to provide an overall understanding of the systems and methods described herein , certain illustrative embodiments will now be described , including a power supply system , particularly an intelligent energy - saving power supply system . however , it will be understood by one of ordinary skill in the art that the systems and methods described herein may be adapted and modified for other suitable applications and that such other additions and modifications will not depart from the scope thereof . fig1 shows an intelligent energy - saving power supply system , according to an illustrative embodiment . the system is plugged to a power source 102 , e . g ., a wall outlet . the system includes an electrical power outlet 104 , an activation switch 106 , indicators 108 , and remote control sensor 110 . electrical power outlet 104 is a device for removably coupling with an electrically operated device , e . g ., a battery charger or an electronic device . for example , electrical power outlet 104 may provide the battery charger with electrical power . a chargeable electronic device may be plugged to the battery charger , i . e ., coupled to the battery charger . alternatively , a chargeable electronic device may be unplugged from the battery charger , i . e ., decoupled from the battery charger . an outlet state of electrical power outlet 104 may indicate decoupling or coupling of the chargeable electronic device to the battery charger . the outlet state may include a voltage , a current , and / or a temperature over a period of time of the electrical power outlet . sensing devices such as an ammeter , a voltmeter , and / or a thermometer may be employed to determine an outlet state of the electrical power outlet . the system of fig1 includes a processor that can learn one or more outlet states representative of decoupling and coupling of a chargeable electronic device to the battery charger . for example , the processor can detect ( via a sensing device ) the upsurge in the energy when a chargeable electronic device is plugged to the battery charger . in this manner , the process can learn when then chargeable electronic device is coupled to the battery charger . the processor may store the value corresponding to the current , voltage , and / or temperature , i . e ., outlet state , of the electrical power outlet immediately previous to the upsurge . this outlet state is the dormant power signature of the battery charger , i . e ., when the chargeable electronic device is decoupled from the battery charger . in this manner , the processor can learn the dormant power signature of the battery charger . activation switch 106 may provide a user the option to manually turn the system on or off . indicators 108 may provide a visual representation of the operating state of the system . for example , an indicator may light up when power flows through the energy - saving power supply system to a battery charger . further illustrations of activation switch 106 and indicators 108 are provided in reference to push button and indicators 5 in fig4 below . remote control sensor 110 may include a receiver and / or a transmitter for exchanging control signals with a remote control device . for example , the receiver component of remote control sensor 110 may receive a control signal from a remote control device to turn on an electronic device coupled to the electrical power outlet . in some embodiments , remote control sensor 110 is a teachable infrared ( ir ) emitter / detector and the control signals are ir signals . further illustrations of such embodiments are provided in reference to fig7 below . fig2 is a block diagram illustrating a energy - saving power supply system . a switch 1 is interposed between an ac line 5 , such as an electric wall outlet , and a power supply , such as a power brick . a battery charger , such as a cell phone charger , can be plugged into the power brick 4 . while the switch 1 is closed , power flows from the ac line 5 through the switch 1 to the power brick 4 . when the switch 1 is open , the flow of power to the power brick 4 is disrupted , preventing power from being consumed by a battery charger . a switch control 2 controls the operation of the switch 1 . in one possible embodiment , the switch control 2 could include a processor which operated the switch 1 according to an algorithm . for example , the processor might turn off power to the switch 1 for several hours during the night to prevent wasting energy , or may be turned on in the middle of the night when electric rates are lower . as shown in fig3 , two sensing devices 4 and 5 may be placed on either side of an ac line switch 1 . the sensing device 5 senses the level of energy flowing through the energy - saving power supply to the power brick 6 . the alternative location sensing device 4 is optional and , the sensing device 5 could be the only sensing device . the device 5 may be placed either between the ac line 7 and the switch 1 or between the switch 1 and the power brick 6 . as long as the sensing device 5 is placed to detect the energy flowing to the power brick 6 when the switch 1 is closed , its position relative to the switch 1 is immaterial . in one embodiment , the sensing device 5 is simply an ammeter which would detect the current flowing to the power brick 6 . the sensing device 5 is connected to the switch control 2 so that the sensing device 5 may send signals to the switch control 2 corresponding to energy sensed by the sensing device 5 . continuing with the ammeter example , the ammeter may send a constant stream of signals to the switch control 2 indicating the level of current sensed by the ammeter . the switch control 2 contains a processor which may be configured to read the signals sent from the sensing device 5 . the configuration of the switch control 2 and the sensing device 5 may enable the energy - saving power supply system to measure the power signature of a battery charger . the energy - saving power supply system may do so by detecting the differential in the energy consumed by a battery charger when it is charging a chargeable electronic device and when the battery charger is not charging a chargeable electronic device . the example of a cellular telephone as the chargeable electronic device and a cellular telephone charger as the battery charger will be used to explain how the energy - saving power supply system in fig3 measures the power signature of a battery charger . when a cellular telephone charger is first plugged into the power brick 6 , the processor in the switch control 2 reads the energy sensed by the sensing device 5 . then , when a cellular telephone is coupled to the cellular telephone charger , the cellular telephone charger is now coupled into circuit with the battery of the cellular telephone . the battery presents a load on the circuit and the current increases to provide power to carry this load . the processor in the switch control 2 detects the upsurge in the energy flowing through the circuit to charge the cellular telephone charger . the processor in the switch control 2 stores the value corresponding to the current consumed by the cellular telephone charger immediately previous to the upsurge . this value is the dormant power signature of the cellular telephone charger , being the energy consumed by the cellular telephone charger when it is not charging a cellular telephone . the energy represented by the dormant power signature continues being drawn and wasted unless the flow of energy to the cellular telephone charger is cut off . the energy - saving power supply system does just that . later , when the cellular telephone is decoupled from the cellular telephone charger , the energy flowing through the circuit to the cellular telephone charger drops back to the level present when the load of the battery is removed from the charging circuit . the processor in the switch control 2 detects the drop in energy flowing through the circuit when the cellular telephone is decoupled from its charger and recognizes that the energy flowing through the circuit indicates the dormant power signature previously stored in the processor . upon detecting this match , the processor in the switch control 2 cuts off power to the circuit by opening the switch 1 which can be a relay or transfer switch . in this manner , the energy - saving power supply system may save energy by preventing energy from being consumed by a battery charger when the battery charger is not charging a chargeable electronic device . the chargeable electronic device could be anything that requires charging , including removable chargeable batteries , like those removed from a typical drill . the energy - saving power supply system may also recognize when a chargeable electronic device has been plugged back into the battery charger . after the processor in the switch control 2 has cut off power by opening the switch 1 , it closes the switch 1 intermittently , e . g ., briefly at regular intervals , to determine whether the energy consumed by the battery charger has increased . in one embodiment , the processor in the switch control 2 sends a signal every ten seconds to the switch 1 to close the switch 1 for half a second . during that half second , the processor in the switch control 2 identifies whether the energy detected by the sensing device 5 has increased significantly above the dormant power signature of the battery charger . if so , the processor in the switch control 2 may determine that a chargeable electronic device has been plugged back into the battery charger and may direct the switch 1 to send uninterrupted power to the battery charger again . optionally , the power supply system then checks the current draw every ten seconds to so if the battery device has been unplugged . fig4 depicts the arrangement shown in fig3 , but with the addition of a memory 6 and a push button and led indicators 5 connected to the switch control 2 . the memory 6 may add the capability of storing the dormant power signatures of one or more battery chargers . when the processor in the switch control 2 identifies the dormant power signature of a battery charger as described above , the processor may save that dormant power signature in the memory 6 . in one embodiment , this memory 6 could be an electronic database designed to store a few thousand numeric values . in other possible embodiments , the memory 6 could be located in the switch control 2 or stored remotely . the next time the same battery charger is plugged in , the processor in the switch control 2 determines whether the energy being drawn by the battery charger matches a dormant power signature stored in the memory 6 . if the processor identifies a match , the processor again sends a signal to the switch 4 to cut off power . thus , for example , if the user took the battery charger with her to work during the day and then plugged it into the energy - saving power supply system again at night , the energy - saving power supply system would recognize the battery charger and cut off power to prevent wasted energy . the push button 5 connected to the switch control 2 provides a way to manually manipulate the switch 1 . the user can turn on or off the switch 1 by pushing the push button 5 , thereby overriding the switch control 2 . the user might , for example , think that her cellular telephone had been charging long enough and desire to cut off power to her cellular telephone by pressing the button . fig4 also includes an led indicator 5 connected to the switch control 2 . in one embodiment , the led indicator 5 lights up when power flows through the energy - saving power supply system to a battery charger and turns off when the switch is open and power stops flowing through the energy - saving power supply system . alternative embodiments use different numbers , colors and arrangements of leds to signal the operating state of the power supply system . fig5 depicts that the device may include a voltage regulator 3 that powers the downstream components of the energy - saving power supply system , including for instance the memory 6 and switch control 2 . optionally , the voltage regulator can also provide power to other devices outside of the switched circuit that controls ac / line 1 . thus , the voltage regulator could provide a direct current source of power for any use . fig6 is a block diagram depicting the arrangement shown in fig5 , but with a communications link 7 connected to the switch control 2 . as discussed in the background , consumers find it gratifying to know how much energy their conservation efforts actually save . therefore , this energy - saving power supply system includes a communications link 7 to calculate and display the amount of energy saved by the energy - saving power supply system . the energy - saving power supply system includes a software program which collects data from the processor in the switch control 2 , specifically , the amount of time the switch control 2 prevented power from going to a battery charger and the dormant power signature of the battery charger . the software program algorithm multiplies the time by the dormant power signature of the attached battery charger to calculate the total amount of energy , money or carbon emissions saved . the software program also calculates the amount of energy saved over different time periods , for example , energy saved over the previous day , the previous week or over the lifetime of the power supply system . the software program could , in different possible embodiments , be located on a personal computer , on a web server or on the processor in the switch control 2 . the software program also includes programs to graphically display these calculations on a web page . the communications link 7 could be coupled to a network interface , such as a connection to the world wide web or a computer , to display the graphics representing the energy savings in a readily accessible manner . in addition to calculating the amount of energy saved by a particular energy - saving power supply system , the software program also calculates how much energy would be saved if others used the energy - saving power supply system in the same way . for example , in one embodiment , the software program multiplies the energy saved by this particular power supply system by a number representing the estimated number of people in the united states who use chargeable electronic devices . in another possible embodiment , the communications link 7 communicates over a local network or the world wide web to a web server to convey information about how much energy the energy - saving power supply system has saved . the web server could then add the energy savings of that energy - saving power supply system to all the other energy - saving power supply systems that have communicated with it and post on a website the total amount of energy , money or carbon emissions saved by all the energy - saving power supply systems . in this way , the energy - saving power supply system encourages a sense of community and participation to encourage conserving energy . fig7 is a block diagram depicting the arrangement shown in fig6 , but with a remote control detector connected to the switch control . this optional power supply system embodiment has a teachable ir emitter / detector . a user could put the power supply system in learning mode , direct the remote of , for example , a stereo amplifier control at the power supply system and push the remote &# 39 ; s “ on ” button . the power supply system would detect and learn that device &# 39 ; s “ on ” signal ( typically , each home electronic device has a designated remote code so that it will not be affected by other remotes ). then , using the power supply system &# 39 ; s remote , the user could turn off the power to the amplifier when it is not being used , saving the energy that is normally used to keep the ampler on to detect its remote and the power used to keep components warm for an “ instant on ” feature . to turn on the amplifier , the user pushes the “ on ” button on the amplifier &# 39 ; s own remote . the power supply system would see that specific “ on ” signal and turn on power to the amplifier , and then after a sufficient time for the amplifier to power up and “ wake up ” the power supply system would — using its own ir emitter — retransmit the amplifier &# 39 ; s ir “ on ” signal . since the ir detection circuit of the amplifier is now active , it can turn itself fully on and start playing music . in another configuration , the power supply system could be made to act as a universal remote , where the power supply system &# 39 ; s remote , or buttons on the saver itself are used to control multiple devices . the time delay needed for the specific home electronic device to fully boot and become active after it is supplied with power varies from device to device . in some embodiments , a timer within the power supply system may wait for a pre - determined period of time , e . g ., one of a standard set of times , such as one second , two seconds , six seconds , and so on . in some embodiments , the power supply system may have a look up table to determine the pre - determined period of time for the time delay . the system may recognize the code of a specific electronic device &# 39 ; s remote and set the time delay accordingly . fig8 is a block diagram depicting a prototype implementation of an energy - saving power supply system 12 . power flows from the line voltage input 10 , which could be a standard electrical wall outlet , through the energy - saving power supply system 12 to the switched line voltage output 11 . the switched line voltage output 11 is an outlet into which a battery charger may be plugged to access electrical power . the power switch 1 is a switch which controls the level of power running through the energy - saving power supply system 12 to the switched line voltage output 11 . the μcontroller 3 contains a processor configured to control the power switch 1 . the software on the μcontroller 3 interfaces with the power switch 1 through a power switch driver 2 , which translates the software commands into signals readable by the power switch 1 . the current sense transformer 9 detects the current running through the system and sends a signal representing the current level to the amplifier 8 . the amplifier 8 sends an amplified signal to the μcontroller 3 , in which the processor is configured to recognize the signal representing the current level sent from the amplifier 8 . as discussed in more detail in fig1 - 5 , the μcontroller learns the dormant power signature of a battery charger by detecting the differential in energy consumed by a battery charger when a chargeable electronic device is coupled and decoupled from the battery charger . in addition to a processor , the μcontroller 3 also contains a memory , in which it stores the dormant power signature of battery chargers . when the μcontroller 3 recognizes the current level signal from the amplifier 8 as corresponding to a dormant power signature in its memory , the μcontroller 3 cuts off power to the switched line voltage output 11 by opening the power switch 1 . by doing so , the μcontroller 3 cuts off power to the batter charger plugged into the switched line voltage output 11 , thereby conserving energy . as described in fig3 , the energy - saving power supply system is also designed to recognize when a chargeable electronic device has been plugged back into the battery charger . after the processor in the μcontroller 3 has cut off power by opening the switch 1 , it closes the switch 1 intermittently , e . g ., briefly at regular intervals , to determine whether the energy consumed by the battery charger has increased . in one embodiment , the μcontroller 3 sends a signal every ten seconds to the switch 1 to close the switch 1 for half a second . during that half second , the μcontroller 3 identifies whether the energy detected by the sensing device 5 has increased significantly above the dormant power signature of the battery charger . if so , the μcontroller 3 determines that a chargeable electronic device has been plugged back into the battery charger and directs the switch 1 to send uninterrupted power to the battery charger again . the circuit protector 10 is a standard circuit protection device similar to those in most power strips designed to cut off power to the circuit when an overload or a short circuit would damage the elements in the energy - saving power supply system or in a battery charger or chargeable electronic device plugged into the switched line voltage output 11 . the voltage regulation 11 element is a standard voltage regulator which controls the voltage in the circuit so as to reduce voltage error . data logging can occur such that the controller logs when the power supply system has shut off the charger . the μcontroller can measure the time of the charger being shut off and multiply that time by the power saved by shutting off the charger to measure the kilowatt hours saved . this measure of power saved can be collected from the power supply system by connecting a computer or other device to the serial interface 4 . in one embodiment , the serial interface communicates this measure through data packets that can be transmitted as ip data packets over a network to a server . the server can execute an application that processes the measured savings to generate a number representative of the accumulated power savings achieved by using the power supply system . optionally , the server may also aggregate similar data from other users of power supply systems to generate a global , multi - user measure of how much energy has been collectively saved by users of the power supply systems . a web server coupled to this other server can generate web pages that display the measured global power savings . variations , modifications , and other implementations of what is described may be employed without departing from the spirit and scope of the disclosure . more specifically , any of the method , system , and device features described above or incorporated by reference may be combined with any other suitable method , system , or device features disclosed herein or incorporated by reference , and is within the scope of the contemplated systems and methods described herein . the systems and methods may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . the foregoing embodiments are therefore to be considered in all respects illustrative , rather than limiting of the systems and methods described herein . the teachings of all references cited herein are hereby incorporated by reference in their entirety .

US-201113022852-A

the diameter of an orbiting scroll plate is increased and the periphery of the plate is notched or scalloped to clear the bolt bosses or spacers located between the fixed scroll and crankcase . the bolt bosses act as guides for the notches in the orbiting scroll plate to thereby create an anti - rotation mechanism . because the anti - rotation structure is on the periphery of the plate , a greater thrust surface is available .

in fig1 the numeral 10 generally designates an orbiting scroll . orbiting scroll 10 has a wrap 11 extending axially from plate 12 . plate 12 has a plurality of equally spaced notches or scallops 14 formed in its periphery . referring now to fig2 crankcase 20 is located in shell 30 . a plurality of equally spaced threaded bolt holes 22 are formed in crankcase 20 and correspond in number to the notches 14 . the bolt holes 22 are shown as overlain by cylindrical bolt bosses 32 . although bolt bosses 32 are illustrated as cylindrical , only the portion defining the surface engaging notches 14 needs to be cylindrical . as best shown in fig3 fixed scroll 16 is secured to crankcase 20 by a plurality of equally spaced bolts 24 which serially extend through bolt bores 18 in fixed scroll 16 , hole 33 in bolt boss 32 into threaded bolt holes 22 in crankcase 20 . the diameter of plate 12 is equal to that of the bolt circle 25 , shown in fig4 - 6 , for bolts 24 . the orbit diameter of the orbiting scroll 10 is preferably , but not necessarily , the same as the diameter of bolt bosses 32 . orbiting scroll 10 is driven by crankshaft 26 through pin 13 by a motor ( not illustrated ). notches 14 are formed as portions of circles centered on the circumference of the plate 12 and of a radius equal to the combined radius of orbit of the orbiting scroll 10 and the radius of bolt boss 32 . thus , the centers of notches 14 and bolt holes 22 have the same angular spacing and are equal in number . from fig3 it is clear that there is a large annular thrust surface area 21 between plate 12 and crankcase 20 which is uncompromised due to any anti - rotation structure . fig4 - 6 represent the serial relationship between the notches 14 of the orbiting scroll and the bolt bosses 32 at - 30 ° crankangle intervals which repeat pictorially every 90 ° in the direction of orbiting and every 360 ° with respect to a specific bolt boss 32 . for the sake of clarity only four notches 14 and bolt bosses 32 have been illustrated in fig4 - 6 . the minimum number of uniformly spaced peripheral notches for smooth movement is four . circular orbit 40 is traced by the center of orbiting scroll 10 and the cross marks on the circular orbit 40 represent positions corresponding to fig4 - 6 or spacings in multiples of 90 ° therefrom . in fig4 orbiting scroll 10 which is orbiting in a clockwise direction , as illustrated , is in the middle of its contact with boss 32 - 1 , is just completing contact with boss 32 - 4 and is starting contact with boss 32 - 2 . in fig5 which represents 30 ° of clockwise orbit form the fig4 position , orbiting scroll 10 is just engaging bosses 32 - 1 and 2 with engagement with boss 32 - 1 well over half completed and engagement with boss 32 - 2 still in the early stages . fig6 represents another 30 ° of clockwise rotation and , again , only bosses 32 - 1 and 2 are engaged but engagement with boss 32 - 1 is nearing completion . another 30 ° of rotation would be the equivalent of rotating fig4 clockwise 90 ° except that it would be contact with boss 32 - 1 which was being completed . stated alternatively , the next sequence of - 90 ° for boss 32 - 1 with respect to scroll 10 , would be the same as that shown for boss 32 - 4 in fig4 - 6 and the following sequence of 90 ° would be the same as that shown for boss 32 - 3 in fig4 - 6 . the next sequence of 90 ° would be the same as that shown for boss 32 - 2 in fig4 - 6 . referring to fig1 - 3 , it will be noted that the contact surface of plate 12 with crankcase 20 defines a thrust surface which is an annular area with pin 13 and circular notches 14 formed therein . also , it will be noted that bolt bosses 32 are at the outer portion of crankcase 20 and the inner wall of shell 30 which places them at the greatest available radius . referring specifically to fig4 - 6 it will be noted that the notches 14 define the only loss of available thrust surface . however , because the centers of the portions of a circle defining notches 14 are on the periphery of the orbiting scroll 10 and have a radius equal to the combined radius of the circular orbit 40 and the radius of bosses 32 , the loss in thrust surface area is minimized and the available thrust surface is thereby maximized . although a preferred embodiment of the present invention has been illustrated and described , other changes will occur to those skilled in the art . for example , bosses 32 may be received in openings in the scroll plate rather than in notches or may be integral with the fixed scroll or crankcase or rollers on shoulder bolts . the spacing of the bosses and notches need not be uniform since the coaction of a boss is always with the same notch . so , the bosses may be non - uniformly spaced and have different curvatures so long as the corresponding notches have their radius changed accordingly since the radius of orbit would be the same . it is therefore intended that the scope of the present invention is to be limited only by the scope of the appended claims .

US-11532787-A

a lock for a motorcycle saddle bag container includes a key operated plug attached to a lock housing mounted on the inside wall of the container . the plug operates a pivotal and transversely movable shutter . the shutter , in turn , cooperates with a strike attached to the inside of the lid for the container . a rubber seal maintains the shutter and strike in a locked position until the lid is manually depressed to compress the seal and release the shutter from the strike .

the lock of the present invention is generally attached to the side wall 11 of a container 10 as shown in fig1 . container 10 may , for example , be a molded plastic container 10 with a molded plastic lid 14 and an elastomeric seal 18 where the lid 14 interfaces with top edge 20 of container 10 . the lock 12 in fig1 is inserted in the wall 11 of the container 10 along the top edge 20 of the wall 11 . the lid 14 includes a circumferential skirt 16 which fits over or covers the top edge 20 of the container 10 and prevents the moisture from entering the container 10 when the lid 14 and container 10 are in the closed position as shown in fig1 . attached to the inside of the skirt 16 is a circumferential seal 18 as shown in fig3 which cooperates with top edge 20 of container 10 to seal the lid 14 to the container 10 . fig2 further illustrates the manner in which the lid 14 and container 10 cooperate with the lock mechanism 12 . the container 10 includes an opening 22 which receives a fixed cylinder 24 . the opening 22 is flat sided to cooperate with flat sides 24a and 24b of cylinder 24 and thereby maintain the cylinder 24 aligned in opening 22 by preventing rotation thereof . a mounting plate 26 has a keyed opening 28 identical to opening 22 for receipt of cylinder 24 . mounting plate 26 fits flush against wall 11 . a shutter 30 is retained within a housing 32 . the shutter 30 is biased by spring 34 toward the plate 26 . housing 32 and shutter 30 each include openings 36 and 31 , respectively , for receipt of the cylinder 24 which projects through all the openings 22 , 28 , 31 , 36 . note that the opening 31 is elongated with respect to the body of the cylinder 24 so that the shutter 30 may be displaced in a vertical direction transverse to the axis of cylindrical plug 24 . a lock washer 38 fits over the end of cylinder 24 and a lock nut 40 retains the cylinder 24 and the assembly on the wall 11 of container 10 in the arranged sequence shown . a strike 42 is attached to the lid 14 for cooperation with shutter 30 . strike 42 projects downward and includes an opening 56 for cooperation with shutter 30 . turning now to the remaining figures and in particular fig3 the cylinder 24 includes a key actuated , rotatable , cylinder shaped plug 44 with an oval shaped drive cam 48 at the inside end and a head 50 at the opposite or outside end . plug 44 may be rotated about its longitudinal axis by a key 46 to a locked or unlocked position . in fig3 the key 46 is in the locked position . plug 44 is also translatable in an axial direction . thus , the plug 44 is both axially translatable and rotatable within the cylindrical passage 25 in cylinder 24 . axial translation inward is limited by the plug head 50 which fits within counterbore opening 27 of cylinder 24 . the inside end of plug 44 cooperates with shutter 30 , and more particularly a tab 33 of shutter 30 projects downward into opening 31 and through a longitudinal slot 29 in cylinder 24 where it cooperates with the cam 48 and the end of the plug 44 . the shutter 30 is normally biased by the spring 34 toward the plug 44 . shutter 30 thus pivots about its lower end 60 where it rests against a flange surface 62 . also , shutter 30 may be moved or slid in a direction transverse to the axis of plug 44 by actuation of cam 48 against tab 33 . the shutter 30 thus slides upward or downward in response to rotation of the oval shaped cam 48 . regardless of the direction of movement ( pivotal or transverse ), shutter 30 is maintained in alignment by cooperating tab 33 and slot 29 . fig3 and fig4 illustrate how the plug 44 may be rotated so that the oval shaped cam surface 48 drives the shutter 30 upwardly and into a locked position . in the position depicted in fig3 a lip or latch 54 of the shutter 30 cooperates with opening 56 in the strike 42 . the latch 54 thus holds the container lid 14 in a locked position . when in this position , the lid 14 is retained at a tolerance or position where the elastomeric or rubber seal 18 is compressed slightly and the shutter 30 is pulled upward in a transverse direction to a maximum limit of travel of shutter 30 . this limit is determined by the engagement of the bottom of opening 31 with the under surface of cylinder 24 . shutter 30 is thus moved beyond the extent of travel imparted by the plug 44 in response to actuation of key 46 . importantly in this position the shutter 30 is positioned to lie over a land or flange surface 58 which limits or prevents the pivotal motion of the shutter 30 and thus prevents unlatching of latch 54 . examining the configuration of fig3 when the plug 44 is in the locked position , of course the pushbutton head 50 cannot be depressed to pivot the shutter 30 about its lower end 60 against the surface 62 . assume , however , that the key 46 rotates the plug 44 by 90 ° to the unlocked position of fig6 . in this position , the shutter latch 54 will still be engaged with the strike opening 56 since the elastomeric or rubber seal 18 is compressed and maintains the shutter 30 in the position of fig3 . in order to release the latch 54 from the opening 56 of the strike 42 and disengage the latch 54 from the opening 56 , the shutter 30 must be moved downward in a vertical direction against the upward force imparted on it by the compressed seal 18 . this can be done by manually pushing downward on the lid 14 . a downward movement of lid 14 is illustrated in fig5 wherein the lid 14 has been depressed to cause the strike 42 to move down , engage to the shutter 30 and drive the shutter 30 downwardly in a sliding movement so that it reaches the position shown in fig5 . the shutter 30 is released from a position of engagement with the flange or land 58 . the pushbutton head 50 may then be depressed as shown in fig7 to move the plug 44 transversely against the shutter 30 . the shutter 30 pivots and the latch 54 then disengages from the opening 56 . the elastomeric characteristics of seal 18 then cause the lid 14 to pop up . with the latch mechanism of the present invention , therefore , the mechanism remains in the shut or closed position when the key operated lock is in the locked or unlocked position . accidental pushing of the pushbutton 50 , even when the latch is in the unlocked position , will not open the container 10 . in order to open the container 10 , it is necessary to push down on the lid 14 to compress seal 18 and simultaneously push in on the button 50 to pivot shutter 30 . the mechanism maintains the container 10 in a closed position and prevents unintentional opening of the container . thus , while there has been set forth a preferred embodiment of the invention , the invention is to be limited only by the following claims and their equivalents .

US-37618282-A

this invention concerns a method for forming ionomers by treatment with ammonium carbonate of copolymers having a substantially fluorinated , but not perfluorinated , polyethylene backbone having pendant groups of fluoroalkoxy sulfonyl fluoride . ionomers derived therefrom by ion exchange are useful in electrochemical applications such as batteries , fuel cells , electrolysis cells , ion exchange membranes , sensors , electrochemical capacitors , and modified electrodes .

for the purposes of description in the present invention , the generic term “ ionomer ” will be taken to encompass the ammonium sulfonate and the sulfonic acid forms of the polymer of the invention , as well as the alkali and alkaline earth salts thereof . for the purpose of the present invention , the term “ excess ” when applied to the ammonium carbonate solution of the present invention means that the solution contains more , preferably many fold , more than the amount of ammonium carbonate necessary to achieve complete hydrolysis of the sulfonyl fluoride to the sulfonate based upon reaction stoichiometry . that is , “ excess ” means beyond , preferably many fold beyond , the stoichiometric amount . the term “ substantially fluorinated ” means that at least 50 mole % of the hydrogens of the corresponding polyethylene backbone have been replaced by fluorines . in one aspect of the present invention the sulfonyl fluoride - containing precursor polymer is contacted with a many fold excess of ammonium carbonate solution , effecting the hydrolysis of the sulfonyl fluoride to the ammonium sulfonate without degradation of the polymer backbone . in another aspect of the present invention , the ammonium sulfonate ionomer may be melt processed , such as by thermal consolidation of ammonium sulfonate ionomer of the invention into a shaped article such as a polymer film , without the addition of any liquid to the polymer . means for forming the ammonium sulfonate ionomer into a film , sheet or other shaped article include melt pressing and extrusion using a screw extruder . other means include roll milling and such other means well - known in the art of plastics processing for forming shaped articles of thermoplastic polymers . the ammonium sulfonate ionomer of the invention can also be formed into shaped articles according to solution methods disclosed in the art such as by dissolution in a solvent followed by solution casting of a film or sheet upon a substrate . however melt processing is preferred . in an alternative embodiment of the present invention , the sulfonyl fluoride form of the polymer is first melt - formed into a sheet and then contacted with an excess of ammonium carbonate solution to effect hydrolysis to the ammonium sulfonate ionomer . in a further embodiment , the ammonium sulfonate ionomer is contacted with a mineral acid , preferably an aqueous mineral acid , such as nitric acid , to form the sulfonic acid ionomer which is useful in fuel cells . in yet a further embodiment of the invention , the sulfonic acid ionomer is contacted with a solution , preferably an aqueous solution , of an alkali metal salt , such as licl , to form the alkali sulfonate ionomer useful in various electrochemical cells such as lithium batteries . in a further embodiment , the ammonium ionomer may be contacted with a solution , preferably an aqueous solution , of an alkali metal salt such as licl to form the alkali metal ionomer by ion exchange . it is preferred , however , to first form the sulfonic acid followed by ion exchange to form the alkali metal , preferably the lithium , ionomer . in all said foregoing embodiments , it is preferred that the ionomer undergoing the ion exchange processes be in the form of a film or sheet . in the process of the invention vinylidene fluoride ( vdf ) is copolymerized with a non - ionic monomer ( i ) represented by the formula where r and r ′ are independently selected from f , cl or a fluorinated , preferably perfluorinated , alkyl group having 1 to 10 carbon atoms , a = 0 , 1 or 2 , b = 0 to 6 . preferably r is trifluoromethyl , r ′ is f , a = 1 and b = 1 . in the process of the invention , the copolymer so formed is contacted with an excess of a solution of ammonium carbonate to form an ionomer comprising monomer units of vdf and 0 . 5 - 50 mole %, preferably 0 . 5 - 36 mole %, of an ionic perfluoroalkenyl monomer having a pendant group of the formula —( o — cf 2 cfr ) a o — cf 2 ( cfr ′) b so 3 − nh 4 + where r and r ′ are independently selected from f , cl or a perfluorinated alkyl group having 1 to 10 carbon atoms , a = 0 , 1 or 2 , b = 0 to 6 . preferably , r is trifluoromethyl , r ′ is f , a = 0 or 1 , b = 1 . the ammonium carbonate solution suitable for use in the present invention is a solution formed by adding ammonium carbonate to water , alcohol , organic carbonate , or mixtures thereof . suitable alcohols include but are not limited to methanol , ethanol and butanol . suitable carbonates include but are not limited to ethylene carbonate and propylene carbonate . preferably the ammonium carbonate is dissolved in a mixture of methanol and water . a preferred hydrolysis process of the invention comprises contacting the sulfonyl fluoride - containing polymer with an excess of a solution of ammonium carbonate in methanol ( optionally containing another solvent such as water ), in the range of ca . 0 - 85 ° c ., preferably room temperature to 65 ° c . for a sufficient length of time to convert the desired percentage of sulfonyl fluoride to ammonium sulfonate . generally preferred are the mildest hydrolysis conditions possible consistent with timely conversion of the sulfonyl fluoride . the severe hydrolysis conditions taught in the art for hydrolyzing sulfonyl fluoride to sulfonate in the case of ionomers which do not include vdf , cause degradation of the vdf - containing copolymer in the present invention . the degree of conversion can be conveniently monitored by the disappearance of the characteristic infrared absorption band for the sulfonyl fluoride group at about 1462 cm − 1 . alternatively , 19 f nmr spectroscopy may be used as described in the examples . the ionomers prepared by the process of the invention include copolymer compositions in which the ionic monomer unit is present in the ionomer of the invention at concentrations ranging from 0 . 5 to 50 mole %, preferably 0 . 5 - 36 mole %. other cationic forms of the ion - exchange membrane can be achieved using ion - exchange procedures commonly known in the art and as outlined herein above ( see for example ion exchange by f . helfferich , mcgraw hill , new york 1962 ). for example , the protonic form of the membrane is preferably obtained by immersing the ammonium - ionomer into an aqueous acid . silver and copper sulfonate ionomers can be made by ion exchange with the ammonium sulfonate form of the polymer . for example , repeated treatment of the ammonium sulfonate ionomer with an aqueous solution of a silver salt such as silver fluoride or silver perchlorate would produce at least a partially cation exchanged silver sulfonate ionomer . in a similar fashion , the cuprous sulfonate ionomer can be produced by repeated treatment of the ammonium sulfonate ionomer with an aqueous acidic solution of a copper salt such as cuprous chloride . in many applications , the ionomer is preferably formed into a film or sheet . films of the ionomer may be formed according to processes known in the art . in one embodiment , the thermoplastic sulfonyl fluoride precursor is extrusion melt cast onto a cooled surface such as a rotating drum or roll , whence it is subject to hydrolysis according to the process of the invention . in a second embodiment , a sulfonyl fluoride - containing polymer is dissolved in a solvent , the solution cast onto a smooth surface such as a glass plate using a doctor knife or other device known in the art to assist in depositing films on a substrate , and the resultant film subject to hydrolysis according to the process of the invention . in a third embodiment , the sulfonyl fluoride copolymer resin is subject to hydrolysis by dissolution or suspension in a hydrolyzing medium , followed by optional addition of cosolvent , and filtration or centifugation of the resulting mixture , and finally solvent casting of the ionomer solution onto a substrate using a doctor knife or other device known in the art to assist in depositing films on a substrate . in an alternative embodiment , it is found in the practice of the present invention that the ammonium ionomer is particularly amenable to melt forming . thus , the ammonium ionomer may be isolated in the form of a powder , and the powder melt formed into a film or sheet which may then be subject to ion exchange according to the methods taught herein . the ionomers prepared according to the practice of the invention may be terpolymers . suitable third monomers include tetrafluoroethylene , chlorotrifluoroethylene , ethylene , hexafluoropropylene , trifluoroethylene , vinyl fluoride , vinyl chloride , vinylidene chloride , perfluoroalkylvinyl ethers of the formula cf 2 ═ cfor f where r f = cf 3 , c 2 f 5 or c 3 f 6 . preferred termonomers include tetrafluoroethylene , hexafluoropropylene , ethylene and the perfluoroalkylvinyl ethers . termonomers are preferably present in the polymer at a concentration of up to 30 mole %. the following terms and abbreviations are used in the examples . the abbreviation “ vf2 ” refers to the monomer 1 , 1 - difluoroethene . the abbreviation “ psepve ” refers to 2 -[ 1 -[ difluoro [( trifluoroethenyl ) oxy ] methyl ]- 1 , 2 , 2 , 2 - tetrafluoroethoxy ]- 1 , 1 , 2 , 2 - tetrafluroethanesulfonyl fluoride . the term “ meoh ” refers to methyl alcohol . differential scanning calorimetry ( dsc ) was performed according to astm d4591 , in a nitrogen atmosphere and at a heating rate of 20 ° c ./ minute , using a ta instruments model 2910 . 19 f nmr spectra were recorded using a bruker avance drx 400 spectrometer . the below examples were performed on polymer powder which can be pressed into good films . films can also be hydrolyzed directly by immersing them in an ammonium carbonate bath ( meoh / h 2 o ) using this method . a 4 liter horizontal , stainless - steel stirred polymerization reactor equipped with a 4 - bladed agitator was flushed with nitrogen and charged with 1 . 65 liter of demineralized water and 6 g of ammonium perfluorooctanoate . the reactor was sealed , pressurized with nitrogen to 100 psig and then vented to 0 psig . this pressure / venting cycle was repeated twice . the reactor was then evacuated to − 14 psig then purged with vinylidene difluoride ( vf2 ) to 0 psig . this evacuation / purge cycle was repeated two times . at 0 psig of vf2 in the reactor , 20 ml of an aqueous psepve emulsion ( containing 10 g psepve ) was injected into the reactor . the reactor contents were agitated at 200 rpm and heated to 60 ° c . the reactor was pressurized with vf2 to 300 psig at which time 0 . 9 g potassium persulfate dissolved in 20 ml demineralized water was injected at 10 ml / min . the polymerization initiated in 0 . 07 hr . a mixture of vf2 and psepve ( as psepve emulsion containing 0 . 5 g pspeve / ml ) in a 1 : 1 mole ratio was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor . the reaction was continued in this manner until about 215 g of psepve were fed to the reactor . the feeding of psepve was then discontinued and vf2 was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor , until an overall total of 334 g vf2 had been fed to the reactor . the reactor contents were cooled to ambient temperature , vented to 0 psig and discharged as a milky - white polymer emulsion containing 22 wt % polymer . the polymer emulsion was frozen to cause agglomeration of the polymer particles and their separation from the aqueous phase . the polymer agglomerates were filtered and washed vigorously 4 times with filtered tap water at about 50 ° c . then with demineralized water at ambient temperature . the washed polymer was dried at 100 ° c . under partial vacuum with a sweep of nitrogen to yield 520 g of white granular polymer . dsc analysis showed a glass transition temperature at − 24 ° c . ( at the inflection point ) and a well defined crystalline melting point at 166 ° c . ( δh f = 22 . 2 j / g ) on the second heat . elemental analysis found : c , 30 . 41 wt % from which an average composition of 8 . 1 mole % psepve and 91 . 9 mole % vf2 could be calculated . the polymer could be pressed into translucent white slabs and films at 200 ° c . that were clean and dense , free of voids or visible color . a 3 - necked 300 ml jacketed flask was equipped with a magnetic stir bar , condenser and nitrogen inlet . the flask was charged with 10 g (˜ 10 mmole — so 2 f ) of the psepve / vf2 copolymer prepared above , 3 . 85 g ( 40 mmole ) of ammonium carbonate and 100 ml of meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c . for 24 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to a white powder . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained 8 . 2 mole % psepve . the polymer could be pressed at 200 ° c . into a thin film ( 5 - 10 mil ) which was colorless , clear and tough . hydrolysis of psepve / vf2 copolymer film using excess ammonium carbonate in meoh / h2o and conversion to the sulfonic acid form a film , 0 . 005 in . to 0 . 007 in . thick , was prepared from the psepve / vf2 copolymer powder prepared in example 1 by melt pressing at 200 ° c . the film was supported between teflon ™ mesh to prevent it from folding on itself and immersed for 24 hr in a 1 - liter stirred bath containing a 0 . 4 molar ammonium carbonate solution in 1 : 1 methanol / water at 50 ° c . at the end of this period , the supported film assembly was removed from the ammonium carbonate solution , rinsed with several portions of demineralized water , then immersed for 18 hr in a second 1 - liter stirred bath containing 3 molar nitric acid at 70 ° c . at the end of this period , the supported film assembly was removed from the nitric acid solution , rinsed with several portions of demineralized water , then immersed in boiling demineralized water for 2 hr . the water was changed several times during the boiling to remove residual nitric acid . at the end of this period , the supported film assembly was removed from the boiling demineralized water and immediately immersed in fresh demineralized water at ambient temperature . a 1 . 0 by 1 . 5 cm 2 section of the film was blotted dry and assembled into a conductivity cell . proton ion conductivity was measured at ambient conditions according to the method of sone et al , j . electrochem . soc 143 , 1254 ( 1996 ), and determined to be equal to 81 × 10 − 3 s / cm . example 1 was repeated , but heating was at 60 ° c . for 24 hr for this example . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained 7 . 6 mole % psepve . a 4 liter horizontal , stainless - steel stirred polymerization reactor equipped with a 4 - bladed agitator , was flushed with nitrogen and charged with 1 . 65 liter of demineralized water and 6 g of ammonium perfluorooctanoate . the reactor was sealed , pressurized with nitrogen to 100 psig and then vented to 0 psig . this pressure / venting cycle was repeated twice . the reactor was evacuated to − 14 psig then purged with vinylidene difluoride ( vf2 ) to 0 psig . this evacuation / purge cycle was repeated twice . at 0 psig of vf2 in the reactor , 20 ml of an aqueous psepve emulsion ( containing 10 g psepve ) was injected into the reactor . the reactor contents were agitated at 200 rpm and heated to 60 ° c . the reactor was pressurized with vf2 to 300 psig at which time 0 . 9 g potassium persulfate dissolved in 20 ml demineralized water was injected at 10 ml / min . the polymerization initiated in 0 . 05 hr . a mixture of vf2 and psepve ( as psepve emulsion containing 0 . 5 g pspeve / ml ) in a 4 : 1 mole ratio was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor . the reaction was continued in this manner until about 215 g of psepve were fed to the reactor . the feeding of psepve was then discontinued and vf2 was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor , until an overall total of 334 g vf2 had been fed to the reactor . the reactor contents were cooled to ambient temperature , vented to 0 psig and discharged as a milky - white polymer emulsion containing 22 wt % polymer . the polymer emulsion was frozen to cause agglomeration of the polymer particles and their separation from the aqueous phase . the polymer agglomerates were filtered and washed vigorously 4 times with filtered tap water at about 50 ° c . then with demineralized water at ambient temperature . the washed polymer agglomerates were dried at 100 ° c . under partial vacuum with a sweep of nitrogen to yield 551 g of white granular polymer . dsc analysis showed a glass transition temperature at − 26 ° c . and a well defined crystalline melting point at 160 ° c . ( δh f = 15 . 9 j / g ) on the second heat . elemental analysis found : c , 30 . 28 wt % from which an average composition of 8 . 3 mole % psepve and 91 . 7 mole % vf2 could be calculated . the polymer could be pressed into translucent white slabs and films at 200 ° c . that were clean and dense , free of voids or visible color . a 3 - necked 3000 ml flask was equipped with an overhead stirrer , heating mantle , dropping funnel , distillation head and nitrogen inlet . the flask was charged with 50 g ( 44 mmole — so 2 f ) psepve / vf2 copolymer prepared above , 4 . 2 g ( 44 mmole ) of ammonium carbonate and 750 ml of meoh . the reaction mixture was stirred at 25 ° c . for 24 hr . the reaction mixture was heated to reflux to distill off the meoh . toluene was added through the dropping funnel to maintain the fluid level in the flask . the distillation was continued until the distillate contained & lt ; 1 % meoh by glc analysis at which time heating was discontinued and the reaction mixture was cooled to 25 ° c . with stirring . the polymer was collected by filtration and washed on the filter with 500 ml toluene . the collected polymer was dried at 25 ° c . under vacuum to a white powder . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained 9 . 5 mole % psepve . comparative examples show other alkali metal carbonates or tetraalkyl ammonium carbonates are either ineffective at — so 2 f hydrolysis or degrade the polymer by discoloration and loss of psepve . this example demonstrates that lithium carbonate is ineffective at complete hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 . a 3 - necked 300 ml jacketed flask was equipped with a magnetic stir bar , condenser and nitrogen inlet . the flask was charged with 5 g (˜ 5 mmole — so 2 f ) of the psepve / vf2 copolymer powder prepared in example 1 , 1 . 5 g ( 20 mmole ) lithium carbonate and 50 ml meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c . for 24 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to a white powder . by 19 fnmr analysis ( dmf - d7 ), only 17 % of the — so 2 f was converted and the polymer contained 8 . 2 mole % psepve . this example demonstrates that lithium carbonate is ineffective at complete hydrolysis of the sulfonyl fluoride moiety under the conditions of example 3 . comparative example a was repeated , but heated 60 ° c ./ 24 hr for this example . by 19 fnmr analysis ( dmf - d7 ), 28 % of the — so 2 f was converted and the polymer contained 7 . 9 mole % psepve . this example demonstrates that sodium carbonate hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 results in degradation of the starting polymer as evidenced by the substantial loss of functional comonomer . a 3 - necked 300 ml jacketed flask was equipped with a magnetic stir bar , condenser and nitrogen inlet . the flask was charged with 10 g (˜ 10 mmole — so 2 f ) of the psepve / vf2 copolymer powder prepared in example 1 , 4 . 25 g ( 40 mmole ) sodium carbonate and 100 ml meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c . for 24 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to a yellow powder . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained only 5 . 9 mole % psepve . the polymer could be pressed at 200 ° c . into a thin film ( 5 - 10 mil ) which was colored . this example demonstrates that sodium carbonate hydrolysis of the sulfonyl fluoride moiety under the conditions of example 3 results in degradation of the starting polymer as evidenced by the substantial loss of functional comonomer . comparative example c was repeated , but heated 60 ° c ./ 24 hr for this example . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained only 5 . 1 mole % psepve . this example demonstrates that potassium carbonate is ineffective at complete hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 . and further , this example demonstrates that potassium carbonate hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 results in degradation of the starting polymer as evidenced by the substantial loss of functional comonomer . a 3 - necked 300 ml jacketed flask was equipped with a magnetic stir bar , condenser and nitrogen inlet . the flask was charged with 25 g (˜ 25 mmole — so 2 f ) of the psepve / vf2 copolymer powder prepared in example 1 , 13 . 8 g ( 100 mmole ) potassium carbonate and 250 ml meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c ./ 22 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to a yellow powder . by 19 fnmr analysis ( dmf - d7 ), 87 % of the — so 2 f was converted and the polymer contained only 6 . 1 mole % psepve . the polymer could be pressed at 200 ° c . into a thin film ( 5 - 10 mil ) which was colored . this example demonstrates that potassium carbonate hydrolysis of the sulfonyl fluoride moiety under the conditions of example 3 results in degradation of the starting polymer as evidenced by the substantial loss of functional comonomer . comparative example e was repeated , but heated 60 ° c ./ 18 hr for this example . by 19 fnmr analysis ( dmf - d7 ), 100 % of the — so 2 f was converted and the polymer contained only 5 . 6 mole % psepve . hydrolysis of psepve / vf2 copolymer using excess tetramethylammonium carbonate in meoh / h 2 o this example demonstrates that tetramethylammonium carbonate is ineffective at complete hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 . and further , this example demonstrates that tetramethylammonium carbonate hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 results in degradation of the starting polymer as evidenced by the substantial loss of functional comonomer . a 4 - l horizontal , stainless - steel stirred polymerization reactor equipped with 4 - bladed agitator , was flushed with nitrogen and charged with 1 . 65 liter of demineralized water and 6 g of ammonium perfluorooctanoate . the reactor was sealed , pressurized with nitrogen to 100 psig and then vented to 0 psig . this pressure / venting cycle was repeated twice . the reactor was evacuated to − 14 psig then purged with vinylidene difluoride ( vf2 ) to 0 psig . this evacuation / purge cycle was repeated twice . at 0 psig of vf2 in the reactor , 20 ml of an aqueous psepve emulsion ( containing 10 g psepve ) was injected into the reactor . the reactor contents were agitated at 200 rpm and heated to 60 ° c . the reactor was pressurized with vf2 to 300 psig at which time 0 . 9 g potassium persulfate dissolved in 20 ml demineralized water was injected at 10 ml / min . the polymerization initiated in 0 . 06 hr . a mixture of vf2 and psepve ( as psepve emulsion containing 0 . 5 g pspeve / ml ) in a 2 : 1 mole ratio was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor . the reaction was continued in this manner until about 215 g of psepve were fed to the reactor . the feeding of psepve was then discontinued and vf2 was fed to the reactor at about the rate at which it was consumed maintaining about 300 psig pressure in the reactor , until an overall total of 332 g vf2 had been fed to the reactor . the reactor contents were cooled to ambient temperature , vented to 0 psig and discharged as a milky - white polymer emulsion containing 22 wt % polymer . the polymer emulsion was frozen to cause agglomeration of the polymer particles and their separation from the aqueous phase . the polymer agglomerates were filtered and washed vigorously 4 times with filtered tap water at about 50 ° c . then with demineralized water at ambient temperature . the washed polymer agglomerates were dried at 100 ° c . under partial vacuum with a sweep of nitrogen to yield 524 g of white granular polymer . dsc analysis showed a glass transition temperature at − 23 ° c . at inflection and a well defined crystalline melting point at 165 ° c . ( δh f = 20 . 0 j / g ) on the second heat . elemental analysis found : c , 30 . 33 wt % from which an average composition of 8 . 2 mole % psepve and 91 . 8 mole % vf2 could be calculated . the polymer could be pressed into translucent white slabs and films at 200 ° c . that were clean and dense , free of voids or visible color . a 100 ml flask was equipped with reflux condenser , magnetic stir bar and nitrogen inlet . the flask was charged with 5 . 0 g (˜ 5 mmole — so 2 f ) psepve / vf2 containing 8 . 4 mole % psepve by 19 fnmr , 4 . 25 g ( 20 mmole ) tetramethylammonium carbonate and 50 ml meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c . for 24 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to yield 4 . 12 g ( 17 . 6 % wt loss ) of a discolored , dark amber powder . by 19 fnmr analysis ( dmf - d7 ), 73 % of the — so 2 f was converted and the polymer contained only 5 . 0 mole % psepve . hydrolysis of psepve / vf2 copolymer using excess tetraethylammonium carbonate in meoh / h 2 o this example demonstrates that tetraethylammonium carbonate is ineffective at complete hydrolysis of the sulfonyl fluoride moiety under the conditions of example 1 . a 100 ml flask was equipped with reflux condenser , magnetic stir bar and nitrogen inlet . the flask was charged with 5 . 0 g (˜ 5 mmole — so 2 f ) of the psepve / vf2 copolymer powder prepared in comparative example g , 6 . 4 g ( 20 mmole ) tetraethylammonium carbonate and 50 ml meoh / h 2 o ( 50 v %). with gentle stirring , the reaction mixture was heated to 50 ° c . for 24 hr , then cooled to room temperature . the polymer was collected by filtration then washed 4 times by suspending in distilled water at 25 ° c . and filtering . the collected polymer was dried at 25 ° c . under vacuum to yield 4 . 78 g ( 4 . 8 % wt loss ) of a white powder . by 19 fnmr analysis ( dmf - d7 ), only 28 % of the — so 2 f was converted and the polymer contained 8 . 6 mole % psepve .

US-18750802-A

an actuator for reciprocating stem control valves having a linkage system affording variable force , reversible action , and adaptability to different valve strokes .

the actuator comprises a powerhead , generally indicated 9 , having an enclosing upper case 10 and lower case 11 provided with mated peripheral margins between which is sealed a flexible or rolling diaphram 12 , the left side of which is subject to plant air or positioner or controller output as supplied through upper case 10 . the controller air pressure is counter - balanced by a coil or other spring 13 compressed between lower case end wall 14 and plate or cup 15 to the opposite wall of which the diaphram 12 is face - engaged as shown . input thrust rod or stem 16 is screwed or otherwise fixed to plate 15 , and extends through the central opening in lower case end wall 14 within which it is shiftable and also rockable by the flexing of spring 13 and diaphram 12 subject to control fluid pressure , such as controller or positioner output pressure , or plant air pressure , on said diaphram . the powerhead 9 is bolted or otherwise secured at its end wall 14 to one side wall of a vertically elongate housing or yoke 17 , and for extension of the stem 16 laterally through a side wall opening into the yoke interior , to which access is given by the forming of another side wall thereof as a removable cover plate 18 . yoke 17 is fitted as conventionally for mounting on the body of a valve , such as a single port global valve , having a projecting , reciprocating plug stem , and in line with and so as to embrace or enclose said stem . the variable force linkage system of the actuator comprises within yoke 17 a support shaft 19 journalled in a yoke side wall , fig7 and in bearing plate 20 behind cover plate 18 . support shaft 19 defines the main pivot bearing for the actuator linkage , and is located on the valve stem axis . the linkage system or lever assembly further comprises a main lever 21 received on support shaft 19 , and which is plateformed to an angular width to encompass two sets of link pin holes 22 , 23 , 24 , and 25 , 26 , 27 , the said hole sets on radial lines from , and at the corresponding radial distances from , the main lever support shaft or pivot 19 . for controller input to the linkage system , lever 21 mounts a pivot pin 28 , located on a radial line from pivot 19 that bisects the angle included between the radial lines of hole sets 22 - 24 and 25 - 27 , and which is rotatively engaged in the end of stem 16 that projects within the yoke 17 . supported also on shaft 19 is an auxiliary or support level 29 that may be rotatively keyed to main lever 21 by a threaded bolt 30 by which the lever 29 is received and releasably retained against removal from shaft 19 , which removal is otherwise allowed by removal first of cover plate 18 and then of bearing plate 20 . the output side of the lever assembly comprises a link 32 pivoted at its upper end on a bearing pin 33 extending between main and support levers 21 , 29 for reception in any of lever 21 holes 22 - 24 and 25 - 27 , and in the corresponding hole of the lever 29 set 34 - 36 , lever 29 being rotatable , relative to lever 21 , to juxtapose its said hole set 34 - 36 to either of lever 21 hole sets 22 - 24 and 25 - 27 . link 32 extends within yoke 17 downwardly away from pivot 19 , and pivots , from its other or lower end , towards and away from the yoke or valve stem axis , with the pivoting of levers 21 , 29 by the actuator input shifting of stem 16 . the link 32 lower end is engaged by a pin 37 passed or threaded through ears 38 , 39 of a stem connector 40 for reciprocating of said connector 40 in axial , side - thrust bearing sleeve 41 removably seated , as behind expanding spring clip 42 , in internal shoulder or bridge portion 43 of yoke 17 . the stem connector or solid shaft 40 is threadedly or otherwise connected to the valve plug stem 44 for reciprocating that between downward and upward or extended and retracted , valve closing - opening limit positions , the valve closing position being schematically shown in fig1 - 14 5 as the lowering of plug p to engage against seat s . improved means are provided for manually or adjustably limiting overriding the pressure - responsive valve positioning by the actuator , comprising a hand wheel 45 turning a screw 46 journalled in the yoke 17 for travelling therealong a crosshead 47 . the crosshead 47 has a normal or neutral position in which it is not engaged by levers 48 , 49 received over shaft 19 and having openings 50 of suitably greater horizontal extent than the crosshead bearing stems 47a received therethrough , fig7 . providing said neutral , disengaged hand wheel 45 position , the levers 48 , 49 are oriented about shaft 19 such that their centerlines are on the line of centers of shaft 19 and pivot 28 . when midway of screw 46 , then , the crosshead 47 is in a neutral position of disengaement with the levers 48 , 49 as lever 21 , by its pivot 28 , rotates about shaft 19 between the limit or full close - open positions of the valve . thus when the crosshead 47 is moved in either direction from the neutral position by manipulation of the hand wheel 45 , it is brought into bearing or stopping engagement with one or the other opposite ends of the hand wheel lever openings 50 . the manual or hand wheel control hereof will be seen from the foregoing to be continuously connected or ready to use without the requirement of first actuating a clutching mechanism or the like . the hand wheel 45 is further distinguished by low required rim force , or easy operation , in that it is coupled as described to the input side of the actuator linkage , and hence requires , for its driving of levers 48 , 49 to rotate shaft 19 , only the same low force as is required of stem 16 to rotate shaft 19 . the hand wheel has been further shown to be bi - directional in operation , from its aforementioned neutral position , and in that to be capable , by virtue of its described input side connecting , of manual manipulation with ease or low force to override whatever plug force , in shifting the valve stem in either direction and including to the full open or full closed position . from the foregoing it will also be seen that the hand wheel is operable manually or adjustably to limit stop the valve stroke , as well as to override or replace the actuator input . for their described orienting about shaft 19 , and torquing of the actuator linkage , the hand wheel levers 48 , 49 are rotatively interlocked with main lever 21 , by being made commonly rigid with shaft 19 through their mating interfitting respectively with shaft splines 51 , about which support lever 29 has a loose fit , fig8 as do spacer rings or collars 52 . the actuator produces , for the same , relatively long , constant input stroke of the control - pressure - responsive actuator powerhead 9 , and by the described linkage , a variable output stroke and force adapted to the stroke of the particular valve with which the actuator is to be used , this by pinning the link 32 to the main lever 21 at the appropriate radius , of whichever is selected of the same - radius mounting or opening pairs 22 - 24 or 25 - 27 , and 34 - 36 . the main lever end support and link pivot openings or bearings may of course be provided in the number and radii from the lever pivot 19 that are dictated by application requirements . the hole or lever - link bearing locations may be such , for example , that the actuator output strokes for the hole pairs 22 , 25 and 23 , 26 may be one half and three fourths respectively of the output stroke for the hole pair 24 , 27 . thus , fig5 a , wherein the link 32 is connected at 24 - 36 , indicates a valve stroke twice that of fig5 b , wherein the link 32 is connected at 22 - 34 . as herein before explained , change of the setup from air - to - close , fig1 and 2 , to air - to - open , fig3 and 4 , or vice - versa , merely requires shifting the link 32 attachment from one to the other of the hole sets 22 - 23 - 24 and 25 - 26 - 27 . in accordance with the invention , the maximum actuator output force is developed when the stem 40 is fully extended , whether in the air - to - close or air - to - open setup . for the same input force , of whatever control pressure is applied to diaphram 12 , the output force increases as the link 32 is swung from the fig1 toward the fig2 and from the fig4 towards the fig3 position . maximum output force is thus developed when it is most needed , that is , when the stem 40 is extended for advancing a down - seating valve plug to the seated position . said maximum force is suitably limited by attaching the link 32 to main lever 21 at , or spacing the holes 22 - 24 and 25 - 27 from the line of centers 19 - 28 by , an angle such that the link 32 is swung close to but does not reach , congruence with the valve stem axis , upon the full open or close input stroke of the actuator . the variable stroke of the actuator , or rate of change of output stroke with respect to input stroke thereof , is thus minimum when the stem is fully extended , and increases to a maximum as the stem is moved to its fully retracted position . this invention thereby affords a valve trim flow characteristic which is an equal percentage ( as opposed to linear ) characteristic , and hence counteracts the undesirable effects of system flow resistance , which latter has the opposite tendency of flow characteristic modification towards quick opening , when a valve is installed in series therewith . the actuator is additionally characterized by variable stiffness , the maximum output stiffness being developed when the stem is fully extended , the powerhead 9 stiffness being then increased at the output stem 40 by the square of the mechanical advantage , disregarding frictional losses . the advantage of actuator stiffness increase with stem extension is of course that the maximum rate of change of fluid forces acting on the valve plug generally occurs in the movement thereof which is closest to the valve seat . the input or powerhead stroke is , again , a constant of , say , 21 / 2 inches , that being readily attainable with conventional constructions of the diaphram 12 , and reasonable or practical dimensions of the compression spring 13 . the mechanical advantage being expressed by the instantaneous input - output stroke relation , the maximum force of an output stroke of , say , one inch is , then , typically a five times multiplication of the actuator input stroke force when the stem is fully extended . thus for an air - to - retract stem action , and an initial actuator spring compression of 500 pounds , the maximum output force , or thrust on the valve stem 44 , would be 2 , 500 pounds ( neglecting friction ). the relative radii , or distances from the shaft 9 , of the stem 16 and link 32 connections to the main lever 21 , can be such as variously produce , with the same actuator design and parts , mechanical advantages of up to 10 to 1 . with its actuator output forces far exceeding valve forces even at high pressure drops , tighter shutoffs are obtained by the invention , and with exceptional plug stability , especially near the seat , while maintaining precise control . it will be seen that the invention actuator may be employed with a linear - flow - characterized valve plug , because the actuator linkage converts that linear plug characteristic always to an equal percentage characteristic , or a characteristic in the range from linear to , say , 50 : 1 equal percentage , or greater if desired . thus , the actuator hereof , in general purpose applications as aforementioned , achieves superior response and precise positioning at low flows , and compensates for changes in pressure drop because of line loss in series with the control valve . θ = the angle from the stem axis of input thrust rod connection 28 φ = the angle from the stem axis of output thrust link connection 33 α = the angle from the stem axis of the link - stem connection 37 θ o , φ o , α o = the angles when the stem is fully extended y p = l l cosα o + l a cosφ o - l l cosα - l a cos

US-65545376-A

a method of cleaving a substrate is disclosed . a species , such as hydrogen or helium , is implanted into a substrate to form a layer of microbubbles . the substrate is then annealed a pressure greater than atmosphere . this annealing may be performed in the presence of the species that was implanted . this diffuses the species into the substrate . the substrate is then cleaved along the layer of microbubbles . other steps to form an oxide layer or to bond to a handle also may be included .

fig2 is a simplified block diagram of a beam - line ion implanter . those skilled in the art will recognize that the beamline ion implanter 200 is only one of many examples of differing beamline ion implanters . in general , the beamline ion implanter 200 includes an ion source 280 to generate ions that are extracted to form an ion beam 281 , which may be , for example , a ribbon beam or a spot beam . the ion beam 281 may be mass analyzed and converted from a diverging ion beam to a ribbon ion beam with substantially parallel ion trajectories in one instance . the beamline ion implanter 200 may further include an acceleration or deceleration unit 290 in some embodiments . an end station 211 supports one or more workpieces , such as the substrate 138 , in the path of the ion beam 281 such that ions of the desired species are implanted into substrate 138 . in one instance , the substrate 138 may be a semiconductor wafer having a disk shape , such as , in one embodiment , a 300 mm diameter silicon wafer . however , the substrate 138 is not limited to a silicon wafer . the substrate 138 also could be , for example , a flat panel , solar , or polymer substrate . the end station 211 may include a platen 295 to support the substrate 138 . the end station 211 also may include a scanner ( not shown ) for moving the substrate 138 perpendicular to the long dimension of the ion beam 281 cross - section , thereby distributing ions over the entire surface of substrate 138 . the ion implanter 200 may include additional components known to those skilled in the art such as automated workpiece handling equipment , faraday sensors , or an electron flood gun . it will be understood to those skilled in the art that the entire path traversed by the ion beam is evacuated during ion implantation . the beamline ion implanter 200 may incorporate hot or cold implantation of ions in some embodiments . one skilled in the art will recognize other systems and processes involved in semiconductor manufacturing , other systems and processes involved in plasma treatment , or other systems and processes that use accelerated ions that may perform the process described herein . some examples of this , for example , are a plasma doping tool , an ion shower , or a plasma immersion tool . other semiconductor processing equipment known to those skilled in the art that can accelerate species and implant species into a substrate also may be used . thus , this process is not limited solely to beam - line ion implanters . fig3 is an embodiment of an implanted substrate with a layer of microbubbles . a species 300 , which may be at least one chemical element in this particular embodiment , is implanted into the substrate 138 . in some embodiments , hydrogen may be implanted at approximately 6e16 cm − 2 or helium and hydrogen co - implants may be implanted at approximately 1e16 cm − 2 to produce a layer of microbubbles 301 below the surface of the substrate 138 . the substrate is later cleaved along this layer of microbubbles 301 . in other embodiments , oxygen , nitrogen , other rare or noble gases , or a combination of gases are used to form the layer of microbubbles 301 . this may be performed in one implant or a series of implants . other species known to those skilled in the art also may be used to form the layer of microbubbles 301 . greater implant energy of the species 300 generally will result in a greater implant depth of microbubbles 301 . greater implant dose of the species 300 generally will result in a greater concentration of the species 300 that form the microbubbles 301 . fig4 a - 4e are cross - sectional views of an embodiment of cleaving with diffusion . embodiments of this process may be applied to , for example , silicon - on - insulator ( soi ) or 3d integrated circuit ( ic ) or stacked chip configurations . this process also may be applicable to the fabrication of substrates that are used in , for example , flat panels , thin films , solar cells , leds , other thin metal sheets , or other devices . the substrate that is cleaved using this process may be , for example , si , sic , gan , gap , gaas , polysilicon , ge , quartz , or other materials . in fabricating a cleaved workpiece , a substrate 138 is provided ( a ). the substrate 138 may be referred to as a donor substrate . at least one species 300 , such as hydrogen , helium , or hydrogen and helium , for example , is implanted ( b ) into the substrate 138 to form a layer of microbubbles 301 ( as illustrated by the dotted line in fig4 b ). forming the microbubbles 301 with the species 300 also may include creating damage sites where the microbubbles 301 grow either during implant or a later processing step . other species such as oxygen , nitrogen , other rare or noble gases , or a combination of gases also may be implanted . this may be a low - dose implant of approximately 1e14 cm − 2 to approximately 2e15 cm − 2 in one instance . the layer of microbubbles 301 are a distance ( rp ) below the surface of the substrate 138 . the layer of microbubbles 301 initiates a defect plane at the desired depth , which depends on the implant energy . compared to a dose previously used to cleave a substrate 138 without further implant or diffusion steps , this particular implant to form the microbubbles 301 may use a lower implant dose . in one particular embodiment , the temperature of the substrate 138 is increased during the implant . this may be from about 100 ° c . to about 400 ° c . if the dose of the species 300 is above the amorphizing threshold , the end - of - range defect density ( defect slip lines ) tends to be higher . this may remove the need for an annealing step ( c ) in one instance . the substrate 138 may be heated with lamps or using the platen 295 as seen in fig2 - 3 . the substrate 138 may be heated during implant or pre - heated prior to implant . following formation of the microbubbles 301 , the defect planes are formed during an anneal ( c ) of , for example , between approximately 400 ° c . and approximately 600 ° c . the annealing will grow the microbubbles 301 using ostwald ripening . in one instance , the anneal is for approximately 500 - 600 ° c . for about 5 - 10 minutes . the temperature and duration of the anneal is optimized for the type of the substrate 138 . following the anneal ( c ), the substrate 138 is annealed in a low - temperature , high - pressure ambient of species 500 that is diffused into the substrate 138 ( d ). the species 500 may be , for example , hydrogen , helium , or hydrogen and helium . the species 500 may be mixed with a dilutant gas , such as nitrogen . the temperature during diffusion may be , for example , between approximately 200 ° c . and approximately 400 ° c ., though other temperatures are possible . the high - pressure process provides an abundant source of the species 500 at the surface of the substrate 138 . this forces the species 500 to diffuse into the substrate 138 and to decorate the defects in the substrate 138 caused by the microbubbles 301 . thus , the dose of the species that forms the microbubbles 301 increases from the initial implanted dose to a second , higher dose . in one embodiment , the second , higher dose is approximately 7e16 cm − 2 for hydrogen in a silicon substrate 138 . the second , higher dose may be an order of magnitude greater for a gan substrate 138 . in one instance , the species 500 matches the species 300 , though the species 500 and species 300 also may be different . in one embodiment , the species 300 and species 500 may both be hydrogen . this enables growth of the microbubbles 301 without any interactions . in another embodiment , the species 300 and species 500 may both be a combination of hydrogen and helium . in yet another embodiment , the species 300 is hydrogen or nitrogen and the species 500 is helium or neon . if the substrate 138 is silicon , the species 300 may be chemically - reactive to assist in stabilizing the wall of the individual microbubbles 301 while the species 500 may diffuse through silicon . the species 500 and species 300 may be selected to stabilize and fill the microbubbles 301 . this higher pressure in step d may be , for example , approximately 2 × to several 100 × greater than atmospheric pressure because at a lower pressure , the species 500 tends to diffuse to the ambient rather than into the substrate 138 . in one particular embodiment , the pressure is approximately 10 × to 20 × greater than atmospheric pressure . the temperature during step d is configured to increase the diffusion of the species 500 into the substrate 138 and increase the solubility of the species 500 in the substrate 138 . in one particular instance , this temperature is between 400 ° c . and 800 ° c . the duration of this step d is determined by the type of substrate 138 and the amount of species 500 that is needed for cleaving . this species 500 will cause ostwald ripening of the largest microbubbles 301 . the species 300 formed nucleus cavities that hold the species 500 during the anneal . these nucleus cavities caused by species 300 may be damage to the substrate 138 . crystalline silicon , for example , has all its bonds satisfied . if the bonds are broken , the hydrogen , for example , will preferentially attach to the dangling bonds and form the nucleus cavities . helium is a noble gas and not as reactive as hydrogen , but may in one instance “ stuff ” a nucleus cavity formed by hydrogen . other species may do the same . during the thermal diffusion , an anneal , or another thermal process , the substrate 138 fractures or cleaves along the layer of microbubbles 301 ( e ). in another embodiment , a mechanical , chemical , or fluid force is used to fracture or cleave the substrate 138 along the layer of microbubbles 301 . the remaining substrate 138 that is cleaved off may be reused in some embodiments . in another particular embodiment , the substrate 138 is bonded to another workpiece , such as a handle , prior to fracturing or cleaving the substrate 138 along the layer of microbubbles 301 . the substrate 138 may require polishing in one instance . the diffusion of species 500 into the substrate 138 reduces the dose of the species 300 required to cleave the substrate 138 . this significantly reduces the cost of the cleaving process because the entire dose of the species 300 does not need to be implanted into the substrate 138 . in an alternate embodiment , the anneal ( c ) and the diffusion ( d ) are performed at least partially simultaneously . this combined anneal ( c ) and diffusion ( d ) is a high - pressure , high - temperature process . in yet another embodiment , the species 500 is diffused into the substrate 138 during a plasma - enhanced chemical vapor deposition ( pecvd ) process . fig5 a - 5h are cross - sectional views of an embodiment of soi substrate fabrication that uses substrate cleaving with diffusion . embodiments of this process are not solely limited to soi substrates . embodiments of this process are applicable to other cleaving implants such as 3d ic or stacked chip configurations . this process also may be applicable to the fabrication of substrates that are used in , for example , flat panels , thin films , solar cells , leds , other thin metal sheets , or other devices . the substrate that is cleaved using this process may be , for example , si , sic , gan , gap , gaas , polysilicon , ge , quartz , or other materials known to those skilled in the art . in fabricating an soi substrate , a substrate 138 is provided ( a ). the substrate 138 may be referred to as a donor substrate . the substrate 138 has a thermal oxide layer 400 formed on at least one surface ( b ). at least one species 300 , such as hydrogen or helium , for example , is then implanted ( c ) into the silicon of the substrate 138 to form a layer of microbubbles 301 ( as illustrated by the dotted line in fig5 c ). other species such as oxygen , nitrogen , other rare or noble gases , or a combination of gases also may be implanted . the substrate is subject to an anneal ( d ) similar to step c in fig4 . a species 500 is then diffused into the substrate 138 ( e ) similar to step d of fig4 . the species 500 may be , for example , hydrogen , helium , or hydrogen and helium . in one instance , the species 500 matches the species 300 , though the species 500 and species 300 also may be different . this species 500 will cause ostwald ripening of the largest microbubbles 301 . of course , the anneal ( d ) is optional and may be removed if the implant ( c ) is performed at about 100 ° c . to about 400 ° c . this substrate 138 is then flipped over , bonded to a handle 401 , and annealed ( f ). in some embodiments , the substrate 138 is cleaned prior to bonding it to the handle 401 . during the anneal or another thermal process , the substrate 138 fractures or cleaves along the layer of microbubbles 301 ( g ). the formed soi substrate 402 , including the thermal oxide layer 400 and silicon overlayer 403 , may require polishing to make the surface smooth enough for device manufacture ( h ). in another embodiment , a mechanical , chemical , or fluid force is used to fracture or cleave the substrate 138 along the layer of microbubbles 301 . the remaining substrate 138 may be reused in some embodiments . for any of the embodiments of fig5 a - 5h , the dose of species 300 during ion implantation is lowered compared to a dose of a species 300 implant without diffusion of species 500 , leading to cost savings . in an alternate embodiment , the anneal ( d ) and the diffusion ( e ) are performed at least partially simultaneously . this combined anneal ( d ) and diffusion ( e ) is a high - pressure , high - temperature process . in yet another embodiment , the species 500 is diffused into the substrate 138 during a pecvd process . the surface roughness of the soi substrate 402 and the silicon overlayer 403 after cleaving depends on the size of the microbubbles in the layer of microbubbles 301 . smaller microbubbles in the layer of microbubbles 301 will lead to a smoother surface of the soi substrate 402 and the silicon overlayer 403 after cleaving . this may eliminate or limit the polishing step in some embodiments . the present disclosure is not to be limited in scope by the specific embodiments described herein . indeed , other various embodiments of and modifications to the present disclosure , in addition to those described herein , will be apparent to those of ordinary skill in the art from the foregoing description and accompanying drawings . thus , such other embodiments and modifications are intended to fall within the scope of the present disclosure . furthermore , although the present disclosure has been described herein in the context of a particular implementation in a particular environment for a particular purpose , those of ordinary skill in the art will recognize that its usefulness is not limited thereto and that the present disclosure may be beneficially implemented in any number of environments for any number of purposes . accordingly , the claims set forth below should be construed in view of the full breadth and spirit of the present disclosure as described herein .

US-85116810-A

a method of controlling several clocked loads controllable individually and independently of each other , more particularly heating loads of an electric oven , for minimizing the demand on an alternating current mains due to switching transients . more particularly , the loads are energized in sequence to prevent flickering when the loads are coupled to a common phase of the alternating current mains are switched on each time at the beginning of their clock period . the clock periods of the various loads are of equal length . all loads neither switched off nor switched to full power in a switching cycle are connected to the mains so as to be interlinked in time in a manner such that , when the preceding load is switched off , the next load is switched on . such a switching cycle is started again each time at the beginning of a common clock period independently of the length of the switching cycle .

fig1 shows a block circuit diagram of a circuit arrangement designed for the method of controlling several electrical loads controllable independently of each other with respect to their power consumption . the microprocessor 1 fulfils central control functions . it is connected on the one hand to a key - board 2 , which serves to record data and thus has the function of a control panel . through this key - board 2 , the required data , such as , for example , the desired powers of the individual loads , are supplied to the microprocessor 1 . moreover , the microprocessor is connected through a connection 3 to an electrical load relay 4 . this load relay 4 is switched by ttl signals on the lead 3 . the load relay 4 is moreover connected on the one hand to a mains phase l 1 and on the other hand to a load 5 . the load relay changes over , when a corresponding ttl signal is applied to the lead 3 , in the next voltage passage of the mains phase l 1 . this load 5 , which represents , for example , an oven plate , is moreover connected to the zero conductor n of the alternating current mains . in the same manner , further loads 6 , 7 and 8 can be connected by means of electrical load relays 9 , 10 and 11 to the same phase of the alternating current mains . the loads 5 , 6 , 7 and 8 are therefore not connected directly through the key - board 2 to the alternating current mains l 1 , n . it supplies only the desired data to the microprocessor 1 , which then switches the loads 5 , 6 , 7 and 8 in accordance with the method . the number of loads is then determined by the kind of application . fig2 shows symbolically the variation in time of several clock periods and of the switching cycles proceeding therein . at the beginning of the clock period i ( ti ), the load 5 is switched on for a time determined by the desired power , which is indicated symbolically in fig2 by the arrow 15 . immediately after the load 5 has been switched off , the load 6 is switched on , which is indicated by the arrow 16 . the load 6 remains switched on for a shorter time than the load 5 . after it has been switched off , the load 7 is switched on ( indicated symbolically by the arrow 17 ) and , after the latter has been switched off , the load 8 is switched on ( indicated symbolically by the arrow 18 ). in this example , the sum of the switching - on times of the four loads , i . e . of a switching cycle , is smaller than a clock period . at the beginning of the clock period ii ( tii ), the four loads are again connected in the same manner in a switching cycle to the mains , it being assumed in this example and in the following examples that the adjusted powers of the individual loads are not varied . the time diagram in fig3 shows symbolically the switching - on times of the same four loads , but in this example they are switched to higher powers . at the beginning of the clock period i , again the load 5 is switched on ( arrow 21 ), after which the load 6 is switched on ( arrow 23 ), then the load 7 is switched on ( arrow 25 ) and subsequently the load 8 is switched on ( arrow 27 ). during the switching - on period of the load 7 , a new clock period ii begins at this instant , a new switching - on cycle is started in that first the load 5 is switched on , indicated by the arrow 29 . at the same time , however , the first switching - on chain proceeds , which in this example means that the load 7 also remains switched on , which is indicated by the arrow 25 . in the second switching cycle , after the load 5 has been switched off , the load 6 is switched on ( arrow 31 ). during the switching - on period of this load in the switching cycle ii , the switching cycle i is terminated in that the load 8 is switched off . meanwhile the second switching cycle proceeds : after the load 6 has been switched off , the load 7 is switched on ( arrow 33 ), after which the load 8 is switched on ( arrow 35 ). in this example , a switching cycle therefore each time has a length of about 11 / 2 clock periods . at the beginning of each new clock period , a new switching cycle is started without the already proceeding switching cycle being interrupted . thus , in this example , during approximately the first half of each clock period two switching cycles proceed parallel to eachother . if , at the beginning of the clock period i , the switching - on and switching - off instants of the electrical loads in the following switching cycles are already calculated , the loads may be switched according to this &# 34 ; stationary &# 34 ; condition so that the case marked by the arrows 41 and 43 in the form of broken lines arises . already at the beginning of the clock period i , the stable switching condition is calculated by the microprocessor 1 , as it is adjusted in this example normally only at the beginning of the clock period ii . this means that already at the beginning of the clock period i the load 7 is switched on for a residual time , which is indicated in the figure by the arrow 41 . this switching cycle is started effectively in the middle and is then normally brought to an end , which means that , after the load 7 has been switched off , the load 8 is switched on ( arrow 43 ). fig4 shows symbolically the switching - on cycles in the case of four equal loads , in this example the individual loads 5 to 8 being switched to substantially full power . correspondingly , the switching - on duration of the load 5 during the clock period i ( arrow 51 ) is substantially equal to the length of the first clock period . as in the example shown in fig2 and 3 , the loads 6 , 7 and 8 ae then interlinked in a time sequence which is indicated in the figure by the arrows 53 , 55 and 57 . due to the long switching - on periods , the first switching - on cycle terminates in this example only approximately in the middle of the clock period iv ( tiv ). at the beginning of the clock period ii , a further switching cycle is started , which is indicated by the arrows 59 , 61 , 63 and 65 . during the procedure of the first switching cycle , at the beginning of the clock period iii ( tiii ) the third switching cycle is started , which is indicated by the arrows 67 , 69 , 71 etc . although the load 8 within the first switching cycle is still switched on ( arrow 57 ) at the beginning of the clock period iv , the load 5 is switched on already for the fourth time , which is indicated by the arrow 75 . due to the comparatively long switching - on times of the loads in this example and since at the beginning of each clock period a new switching cycle is started , three or four loads are always switched on simultaneously from the beginning of the clock period iv . also in this example , again the case is represented in which already at the beginning of the first clock period the switching - on and switching - off times of all loads , which are adjusted in the stationary condition , are calculated and the loads are switched correspondingly . this means that the stationary condition , as adjusted in this example only with the clock period iv , is determined already at the beginning of the clock period i and the loads are switched correspondingly . thus , at this instant a switching cycle indicated by the arrows 79 , 81 and 83 begins already with the load 6 , while a further switching cycle indicated by the arrows 85 and 87 begins with the load 7 and a further switching cycle indicated by the arrow 89 begins with the load 8 . in fig2 and 4 , three examples for the same four loads are shown in which the loads are switched to powers of different height . if in the present examples it is assumed that all four loads have the same current consumption , it holds , for example , for the example shown in fig2 that at the beginning of the clock period i a switching - on edge occurs and a short time before the end of the first clock period a switching - off edge occurs . the same holds for each further clock period . this means a very favourable load variation behaviour because in each clock period a variation of the current consumption occurs only two times . the same holds for the examples shown in fig3 and 4 . for example , in the stationary condition during the clock period iii in fig3 a switching - on edge occurs at the beginning of the clock period and a switching - off edge occurs approximately in the middle of the clock period . also in this example , the same holds for the further following clock periods . the same holds for the example shown in fig4 . the demand on the alternating current mains due to the load variations obtained by the switching - on and switching - off edges consequently remains constant , that is to say that it is independent of the power adjustment chosen for the various loads . if the four loads have different power consumptions , it is favourable to arrange these loads within a switching cycle in such a manner that the small loads are switched on at the beginning and at the end and the larger loads are switched on in the middle of the switching cycle . this means in the present examples that the loads 5 and 8 are smaller loads and the loads 6 and 7 are larger loads . since this current consumption is determined by the physical properties , for example of the heater coils , the most favourable order of succession is consequently fixedly defined and must not be calculated again in accordance with the switching conditions of the loads . fig5 shows a diagram from the existing flickering standard ( iec publication 533 ), in which it is defined how large the demand on the mains is allowed to be due to load variations by a user . by means of the diagram in fig5 in dependence upon the occurring ohmic load variation δp l at a phase ( 220 v ) the associated recovery time δt can be determined . for example , for a load variation of 500 w the recovery time is about 0 . 1 sec and for a load variation of 1000 w this time is about 1 . 2 sec . if therefore , for example , loads of 1000 w have to be switched , during a time interval of 5 to 15 minutes a switching - on or switching - off edge is allowed to occur only every 1 . 2 sec . if in a given time interval different loads having different powers are switched , for each individual load edge the recovery time is to be determined . the sum of the recovery times of all the load variations occurring in this time interval must not be larger than the time interval itself . fig6 shows a few switching constellations of loads and the sum of the recovery times each time obtained , n 1 being the number of the large load jumps ( 1000 w ) and n 2 being the number of the small load jumps ( 500 w ). in the first example , only one load having a power consumption of 1000 w is switched . consequently , two load jumps each of 1000 w occur so that the sum of the recovery times ( σδt ) is 2 . 4 sec ., which means that the switching cycle shown for this load is allowed to be repeated only every 2 . 4 sec . in the switching example b further shown in fig6 two loads each having a power consumption of 1000 w and two loads each having a power consumption of 500 w are switched in such a manner that each time the 1000 w loads are arranged at the beginning and at the end of the switching cycle and the two loads of 500 w are arranged in the middle . within such a switching cycle , two load jumps 1000 w and two load jumps 500 w occur . according to the diagram shown in fig5 a sum of the recovery times of 2 . 6 sec . is obtained . in the example c also shown in fig6 the same loads as in example b are switched , but they are now arranged so that alternately a load having a higher power and a load having a lower power are switched . per switching cycle , a large load jump and four small load jumps ae then obtained . this results in a sum of the recovery times of 1 . 6 sec . in the examples d and e , again the same four loads are arranged in a more favourable manner , that is to say that in the example d the loads are arranged in accordance with decreasing and increasing powers , respectively , which leads to a sum of the recovery times of 1 . 4 sec . in the example e , the loads having a higher power are arranged in the middle and the loads having a smaller power are arranged at the beginning and at the end . this leads not to a large variation jump , but only to four small load jumps . according to the flickering standard , this results in a sum of the recovery times of only 0 . 4 sec . it appears from the examples b to e , in which each time the same four loads are switched , that an arrangement of the loads within a switching cycle in accordance with example e distinctly yields the miost favourable result . this means that in this example the shortest possible clock period is only 0 . 4 sec . also , the arrangement of the loads within a switching cycle shown in the example d is still comparatively favourable . in this case , a possible clock period of 1 . 4 sec . is obtained . in the method of controlling several electrical loads according to the invention , in the simplest case there can consequently be started from the largest individual load . in the examples b to e shown in fig6 this would mean that only the largest individual load ( 1000 w ) is taken into account and a clock period of 2 . 4 sec . is chosen . if the clock period should become as short as possible , for example in order to obtain a more favourable control behaviour , with , for example , two loads of each 1000 w and two loads of each 500 w the loads are switched in accordance with the example e shown in fig6 in which the sum of the recovery toimes is smallest . in this example , the clock period can then be shortened to only 0 . 4 sec . the circuit arrangement shown in fig1 which operates according to the method of controlling several electrical loads , can be used in a simple manner in an electrical heating apparatus , for example , an electric oven . in an electric oven , the loads 5 , 6 , 7 and 8 represent the heater windings of the hot plates of the oven etc . the key - board 2 in this case corresponds to the operating panel of the electric oven , by means of which the desired heating powers or temperature values of the hot plates of the oven etc . are supplied to the microprocessor 1 incorporated in the apparatus .

US-92778886-A

a vehicle with a retractable and extensible roof assembly including a ceiling for the vehicle having an opening formed at one end thereof , a load - supporting horizontally slidable closure member adapted to cover the opening in the ceiling , a vertically movable roof portion over the ceiling , movable between a fully extended portion and a retractable portion having flexible sidewalls between the movable roof portion and the ceiling , and utilizing both tension and compression spring biasing for aiding in the elevation of the roof to the fully extended position , and the lowering of the roof to the fully retracted position thereof .

referring to the drawings and to fig1 and 2 , in particular , there is shown a vehicle , generally designated by reference numeral 10 , on which the present roof 12 is mounted . the vehicle illustrated in the drawings is a small bus or van which does not have sufficient height between the floor and the ceiling for an adult to stand erect therein . the roof 12 is typically formed of a fiber glass reinforced plastic or similar material which is light in weight , sturdy in construction , resistant to weather , and easy to maintain . the contour of the roof 12 , when it is in the retracted or lower position , as illustrated in fig1 presents a low silhouette which is pleasing in appearance and is of acceptable aerodynamic configuration . the type of vehicle on which the roof installation is made is not considered critical so long as the vehicle top construction is such that the present retractable and extensible roof can be mounted thereon . however , it should be noted that the roof of the present invention is particularly adapted to small vehicles which require additional head room for passengers or occupants . these vehicles generally include a body portion 14 , a ceiling portion 16 , doors 18 , a plurality of windows 20 , and front and rear ground - engaging wheels not shown . the retractable and extensible roof 12 consists of a top panel 22 , side panels 24 , and end panels 26 . at the free marginal edges of the side and end panels 24 and 26 , respectively , there is provided a molding strip 28 typically formed of an elastomeric material such as rubber , for example , which will effectively create a cushioned seal between the roof 12 and the ceiling portion 16 of the vehicle 10 . it will be appreciated that in the retracted position illustrated in fig1 the strip 28 effectively militates against the passage of water , dirt , grit , and other foreign materials into the interior of the vehicle 10 through the top 12 . in order to assist with the raising of the roof 12 from the retracted position of fig1 to the extended position of fig2 there is provided a mechanism which includes a pair of crossarms 30 and 32 which are pivotally interconnected as at 34 . the crossarms 30 and 32 are formed as u - shaped members so that the relationship to each crossarm on one side of the vehicle 10 is the same as the relationship on the other side of the vehicle . because the relationship of each component on one side of the vehicle 10 is substantially identical to like components on the other side of the vehicle 10 , it is only necessary that one side of the vehicle 10 be discussed in the preferred embodiment and shown in the illustrated drawings . the lower end of crossarm 32 is pivotally connected to the channel member 36 at 37 while the center of the crossarm 32 is free to slide forward and backward in a pair of guides 38 mounted on the underside of roof 12 . the channel members 36 are fixedly attached to the ceiling portion 16 of the vehicle 10 . the lower end of the crossarm 30 is slidably engaged in a slot 40 of the channel member 36 by a stud 42 . as can be seen in fig6 the stud 42 includes an enlarged head portion 43 and extends through the slot 40 where it attaches to the lower end of crossarm 30 . as illustrated in fig1 and 2 , the center of the crossarm 30 passes through a pivot and anchor block 44 which is mounted on the underside of the roof 12 . thus , as the end of the crossarm 30 slides forward and backward in the slot 40 , the center of the crossarm pivots in the anchor block 44 . at the lower end of the crossarm 30 , on the side corresponding to the front of the vehicle , a helical tension spring 48 , which operates in tension , has one end thereof secured to the end of the crossarm 30 and the opposite end secured to a turnbuckle 50 which is fastened to the channel member 36 . a corresponding helical tension spring 48 and turnbuckle 50 are attached to the opposite end of the crossarm 30 on the opposite side of the vehicle . the turnbuckle 50 is used to adjust the spring tension to the desired level . as shown in fig1 , 3 , 5 , and 6 , a helical compression spring 52 is utilized which operates under compression . similarly , a corresponding helical compression spring 52 is utilized on the opposite side of the vehicle . fig5 and 6 show the compression helical spring 52 as it relates to the extensible roof 12 when the extensible roof is in its fully extended position . the compression helical spring 52 is retained within the channel member 36 by a cover plate 53 typically maintained in fixed relation by means of threaded fasteners . when the roof 12 is situated in or relatively near to its retracted position , one end of the helical compression spring 52 engages the crossarm 30 while the other end of the helical compression spring 52 is retained by a stop plate 54 , which is attached to the channel member 36 . as the crossarm 30 moves backward in slot 40 towards the helical compression spring , the compression spring 52 will be compressed between the crossarm 30 and the stop plate 54 , thereby increasing the amount of potential energy stored by the compression spring 52 . consequently , when the roof 12 is in the retracted position as shown in fig1 the tension spring 48 is in tension and the compression spring 52 is in compression . therefore , when the roof 12 is in the retracted position , both the tension spring 48 and the compression spring 52 are storing potential energy . during the elevation of the roof 12 , the potential energy is converted to kinetic energy , which is utilized to assist in elevating the roof 12 to its fully extended position , as illustrated in fig2 . upon initiating the process to elevate the roof 12 , the two springs 48 and 52 work in conjunction with one another to impart a relatively strong initial force upon the crossarms 30 and 32 to quickly initiate the upward movement of the roof 12 towards its fully extended position . the helical compression spring 52 converts the potential energy to kinetic energy while the roof 12 is being elevated in the initial upward movement thereof . after the roof 12 has been elevated approximately twelve inches , the compression spring 52 ceases to make contact with the crossarm 30 . consequently , the helical tension spring 48 effectively supplies all of the kinetic energy exerted for the remainder of the elevation process , and as a result the roof 12 is elevated to the fully extended position . once the roof 12 is in the fully extended position , the bias of the respective helical tension spring 48 is sufficient to maintain the roof 12 in place . in a fashion similar to the extension process explained above , the tension spring means 48 and the compression spring means 52 function together to assist in the lowering of the roof 12 to the fully retracted position , as illustrated in fig1 . consequently , the roof 12 will lower more slowly and softly into the fully retracted position than possible with previous designs of extensible roof assemblies . as shown in fig7 spacers 56 may be utilized between the stop plate 54 and compression spring 52 to adjust the spring compression to a desired level , either to cause extension of the roof to be more easily accomplished , or to aid in balancing the roof . alternatively , the compression helical spring means 52 could be replaced by other means to assist with the elevating and lowering of the roof , such as a lead screw device , hydraulic means , or the like . as illustrated in fig2 when the roof 12 is in the extended position , the side and end flaps 58 and 60 are unfolded and effectively enclose the space between the undersurface of the roof 12 and the upper surface of the ceiling 16 of the vehicle 10 . the side and end flaps 58 and 60 are comprised of flexible water repellant material such as canvas , for example , having openings therein covered by a flexible screening material to permit the transmission of both air and light therethrough . the upper marginal edges of the side and end flaps 58 and 60 are typically secured to the inner surface of the roof 12 and the lower edges are suitably secured to the upper surface of the ceiling 16 of the vehicle 10 . thereby , when the roof 12 is lowered to its retracted position , the flexible material of the side and end flaps 58 and 60 fold to a concealed position under the roof 12 . with reference to fig3 and 4 , there is shown an opening 62 formed in the ceiling portion 16 of the vehicle 10 completely covered by the roof 12 . the opening 60 is typically formed in the ceiling of the vehicle 10 after manufacture thereof , and at a location remote from where the vehicle was manufactured . the opening 62 provides access from the interior of the vehicle 10 into the space encompassed by the roof 12 and the side and end flaps 58 and 60 , respectively , when the roof 12 is in the extended position of fig2 . it is through the opening 62 that occupants or passengers of the vehicle 10 may extend the upper portions of their body to obtain full head room in the vehicle to assume an erect position . partially covering opening 62 is a slidably disposed mattress support panel 64 comprising three sections connected by hinges . the panel 64 is adapted to be supported on the upper surface of the ceiling portion 16 of the vehicle 10 within the zone defined by the side flaps 58 and the end flaps 60 and is further employed to support a mattress 66 ( shown in folded position of nonuse in fig4 ). when the panel 64 is in the unfolded position illustrated in fig3 the space there above would typically have a composite length adequate to house and support adults . when not in use , the panel 64 and the mattress 66 are folded as shown in fig4 to a storage position such that the uncovered portion of opening 62 is effectively increased . the extensible roof 12 is typically installed on a conventional small bus type vehicle by cutting an aperture or hole in the ceiling portion of the vehicle of the desired size . the marginal edges of the formed aperture may then be covered by appropriate molding strips to provide a finished appearance thereto . when the channel members 36 are secured in place it will be understood that the crossarms 30 and 32 are simultaneously positioned . it will be apparent that the installation is made by the utilization of conventional fastener means such as screws , or nuts and bolts , and that no special tools are required . after the extensible roof structure has been installed on the vehicle 10 , the roof 12 can be conveniently extended from the inside of the vehicle by merely pushing upward at the center of crossarm 30 on pivot and anchor block 44 . normally , when the roof 12 is in its retracted position , the side and end flaps 58 and 60 are in a folded position . as the roof 12 elevates , the side and end flaps 58 and 60 are brought under some tension until they are completely unfolded . the roof 12 may be retracted by manually grasping the center of crossarm 30 at pivot and anchor block 44 and pulling down as the roof 12 is retracting , the side and end panels 52 and 54 are folded to be completely concealed within the interior of the roof 12 in a protected position . it will be appreciated from the foregoing that the assembly illustrated and described has produced a relatively simple means for raising and lowering the retractable and extensible roof from only a single location . a particular advantage of the assembly resides in the requirement for only a single latching or locking mechanism in the region of the front end panel 26 of roof 12 to lock the same , in its lowered position , to the vehicle 10 . the linkage mechanism is such that when the front panel is suitably locked , the rear end of the roof , although not specifically locked , cannot be raised . another particular advantage of the assembly is that very little physical effort is needed to move the roof 12 from its retracted position , to its fully extended position , or vice versa . the description has pointed out the structural and functional aspects of the crossarm 30 for purposes of roof support and its use in the raising and lowering of the roof , but it must also be realized that the crossarm 30 provides a member which may be grasped to effectively manipulate the assembly . in accordance with the provisions of the patent statutes , i have explained the principle and mode of operation of my invention and have illustrated and described what i now consider to represent its best embodiment . however , it is to be understood that within the spirit and scope of the appended claims the invention may be practiced otherwise than as specifically illustrated and described .

US-58806590-A

to enable a high speed operation and to increase the current gain , the disclosed a method of manufacturing a semiconductor device , comprising the steps of : forming a first semiconductor layer with a first - conductivity type in a semiconductor substrate ; forming a second semiconductor layer with a second - conductivity type different from the first - conductivity type on the first semiconductor layer ; insulation separating the formed second semiconductor layer into a first semiconductor region and a second semiconductor region by an insulating film ; changing the second semiconductor region to the first - conductivity type ; forming a pattern of an insulating film or a photoresist film having a hole at a partial area of the first semiconductor region of the semiconductor substrate ; and implanting first - conductivity type impurities and second - conductivity type impurities at the first semiconductor region , respectively by use of the formed pattern as a mask , to form a first - conductivity type impurity region contacting with the first semiconductor layer and a second - conductivity type impurity region .

the first embodiment of the semiconductor device according to the present invention will be described with reference to fig1 . in this embodiment , the semiconductor device is a lateral pnp bipolar transistor , in which the major current flows in the horizontal direction . an n - type impurity layer 2 having an impurity concentration of 1 × 10 19 cm - 3 or higher is formed on a silicon substrate 1 . further , on the impurity layer 2 , a p - type epitaxial layer 3 and an n - type epitaxial layer 3a are formed being separated by a separation insulating layer 4 . further , a p - type emitter region 7 is formed in a region near the surface of the p - type epitaxial layer 3 . further , an n - type base region 11 is formed in the p - type epitaxial layer 3 in such a way as to cover the emitter region 7 and reach the n - type buried layer 2 . further , the p - type epitaxial layer 3 is a collector region , and the n - type epitaxial layer 3a is a base leading region . further , an interlayer insulating film 13 is formed on the semiconductor substrate 1 on which the collector region 3 , the emitter region 7 and the base region 11 have been all formed . in the interlayer insulating film 13 , contact holes contacting with the collector region 3 , the base leading region 3a , and the emitter region 7 are formed . these contact holes are buried with a metal film and then patterned so as to form a collector electrode 41 , a base electrode 42 and an emitter electrode 43 , respectively . the second embodiment of the method of manufacturing the semiconductor device according to the present invention will be described with reference to fig2 a to 2c and fig3 a and 3b . as shown in fig2 a , after the n - type buried layer 2 with a high concentration ( e . g ., 1 × 10 19 cm - 3 or higher ) has been formed in the silicon substrate 1 , the p - type epitaxial layer 3 with a concentration of 1 × 10 15 to 1 × 10 17 cm - 3 is formed on the n - type buried layer 2 . further , as shown in fig2 b , after the p - type epitaxial layer 3 has been patterned to remove the epitaxial layer 3 from regions where element separating regions are to be formed , an insulating film 4 formed of sio 2 , for instance is buried at the removed regions . successively , after a region except a region where a base leading layer is to be formed has been covered with a mask ( not shown ), n - type impurity ions such as as are implanted , to form the n - type base leading region 3a . further , as shown in fig2 c , after a photoresist has been applied all over the substrate 1 , a resist pattern 5 having a hole 6 is formed in the p - type epitaxial layer 3 at a region where the collector region is to be formed by exposure and development . further , p - type impurity ions b or bf 2 are implanted shallow with the resist pattern 5 as a mask , to form the emitter region 7 . in this case , it is possible to increase the impurity concentration at the emitter region 7 than that at the collector region 3 , by controlling the dose of the impurities to be implanted to the emitter region 7 . further , as shown in fig3 a , the inner periphery of the hole 6 of the resist pattern 5 is etched by oxygen plasma , to widen the aperture width of the hole by about 0 . 05 to 0 . 15 μm , that is , to form an opening portion 10 . successively , the n - type impurity ions ( e . g ., p ) are implanted with the resist pattern as a mask , to form the base region 11 with a predetermined concentration so as to reach the n - type buried layer 2 . further , as shown in fig3 b , after the resist pattern has been removed , the interlayer insulating film 13 formed of sio 2 , for instance is deposited all over the substrate 1 by use of cvd ( chemical vapor deposition ) method . further , the contact holes contacting with the collector region 3 , the base leading region 3a and the emitter region 7 , respectively are formed in the interlayer insulating film 13 by the photolithography and anisotropic etching . further , the formed contact holes are buried by a metal film , and then patterned to form the collector electrode 41 , the base electrode 42 and the emitter electrode 43 , respectively . as described above , in the semiconductor device according to the present invention , since the base width can be reduced markedly by controlling the aperture width of the hole 6 , it is possible to operate the formed device at a high speed . in addition , since the base region 11 can be formed in the collector region 3 and further since the emitter region 7 can be formed in the base region 11 , the proportion of the minority carriers injected from the lower surface of the emitter region 7 to the collector region 3 can be increased , so that it is possible to increase the current gain thereof . in addition , since the impurity concentration of the emitter region 7 and that of the collector region 3 can be both changed , the breakdown voltage between the emitter and the collector can be increased , so that it is possible to increase the reliability of the element . further , since the base region 11 can be formed by the ion implantation , it is possible to uniformalize the impurity concentration of the base in the direction from the emitter to the collector . in addition , since the number of the photolithography process can be reduced , as compared with that of the prior art manufacturing method , it is possible to reduce the manufacturing cost of the semiconductor device . further , in the above - mentioned embodiment , although the semiconductor device having a lateral pnp bipolar transistor has been explained , it is of course possible to obtain the same effect as above , when the semiconductor device has a lateral npn bipolar transistor . the third embodiment of the semiconductor device according to the present invention will be described with reference to fig6 . in this embodiment , the semiconductor device is a bi - cmos transistor , in which a lateral bipolar transistor and a cmos transistor are both formed on the same semiconductor substrate 51 . as shown in fig6 an n - type buried layer 52 is formed in the surface region of a silicon substrate 51 , and a p - type collector region 53a is formed at a predetermined region on the buried layer 52 . further , an n - type base leading region 53 is formed at another region on the buried layer 52 . the base leading region 53 is insulated electrically from the collector region 53a by an element separation insulating film 54 . further , an n - type base region 64 is formed in horizontal contact with the collector region 53a and in vertical contact with the buried layer 52 . further , a p - type emitter region 67 is formed in the surface of the base region 64 . on the other hand , a p well 55 and an n well 56 are formed at a predetermined region on the buried layer 52 , at which a cmos transistor is to be formed . the p well 55 and the n well 56 are insulated electrically from each other by the element separation insulating film 54 . in the same way , the n well 56 and the collector region 53a are insulated electrically from each other by the element separation insulating film 54b . a gate electrode is formed on the p well 55 . an n type source region 61a and a drain region 61b are formed in the surface of the p well 55 so as to sandwich the gate electrode . in the same way , a gate electrode is formed on the n well 56 . a p type source region 68a and a drain region 68b are formed in the surface of the n well 56 so as to sandwich the gate electrode . further , an interlayer insulating film 70 is formed on the semiconductor substrate 51 on which the above - mentioned semiconductor regions are formed . further , the contact holes contacting with the collector region 53a , the base leading region 53 , the emitter region 67 , the source regions 61a and 68a , and the drain regions 61b and 68b are all formed in the interlayer insulating film 70 . the formed contact holes are buried by a metal film , and then patterned to form various electrodes 72 . in the semiconductor device constructed as described above , since the base width of the bipolar portion can be reduced , it is possible to operate the formed device at a high speed . in addition , since almost all of the minority carriers emitted from the emitter region 67 can reach the collector region 53a , it is possible to increase the current gain thereof . in addition , since the impurity concentrations at the emitter region 67 and the collector region 53a can be adjusted , it is possible to improve the breakdown voltage between the emitter and collector regions . the fourth embodiment of the method of manufacturing the semiconductor device according to the present invention will be described with reference to fig7 a to 7c and fig8 a and 8b . first , as shown in fig7 a , after the n - type buried layer 52 of high concentration has been formed in the surface region of the silicon substrate 51 , the n - type epitaxial layer 53 is grown on the silicon substrate 51 . further , as shown in fig7 b , after the n - type epitaxial layer 53 has been patterned to remove the epitaxial layer 53 from regions where the element separating regions are to be formed , an insulating film 54 , 54b formed of sio 2 , for instance is buried at the regions from which the epitaxial layer has been removed . successively , p - type impurity ions ( e . g ., b or bf 2 ) are implanted at the regions where the collector region of the bipolar portion and the well region of an nmos transistor are to be formed , to form the collector region 53a and the p well 55 of the nmos transistor . further , impurity ions are implanted in the p well 55 and the n well 56 , to form a channel region , respectively . successively , a gate oxide film 57 , a poly crystal silicon film 58 , and a metal silicide film 59 are formed in sequence all over the surface of a predetermined cmos forming region , and then patterned to form the gate electrodes . further , after a side wall 60 formed of sio 2 , for instance has been formed at the side portion of the gate electrode of the nmos transistor , n - type impurity ions are implanted to form the source region 61a and the drain region 61b of the nmos transistor . further , as shown in fig7 c , after an insulating film 62 formed of sio 2 , for instance has been deposited all over the substrate , metal electrodes are formed to open a hole 63 at the collector region 53a of the bipolar portion . successively , n - type impurity ions ( e . g ., as ) are implanted to form the base region 64 . further , as shown in fig8 a , after the insulating film 62 has been further patterned to open a hole 65 , so as to expose a predetermined region where the pmos transistor is to be formed , an insulating film formed of silicon nitride , for instance is formed all over the substrate . successively , the formed silicon nitride film is etched by anisotropic etching method , to form two side walls 66 of silicon nitride on the side surfaces of the holes 63 and 65 and additionally a side wall 66a of silicon nitride on the side surface of the gate electrode of the pmos transistor . further , p - type impurity ions are implanted with these side walls 66 and 66a as masks , to form the emitter region 67 of the bipolar transistor , and the source region 68a and the drain region 68b of the pmos transistor . further , as shown in fig8 b , an insulating film formed of sio 2 , for instance is deposited all over the substrate , to form an interlayer insulating film 70 . further , the contact holes are formed in the interlayer insulating film 70 by use of the photolithography and anisotropic etching . the formed contact holes are buried by a metal film and then patterned to form the various electrodes 72 . in the method of manufacturing the semiconductor device , since the aperture width of the hole 63 can be controlled by forming the side wall 66 , it is possible to reduce the base width markedly , so that the high speed operation is enabled . further , since the base region 64 is formed in the collector region 53a and additionally since the emitter region 67 is formed in the base region 64 , the proportion of the minority carriers injected from the lower surface of the emitter region 67 to the collector region 53a can be increased , so that it is possible to increase the current gain thereof . in addition , since the impurity concentration at the emitter region 67 and that at the collector region 53a can be both changed , the breakdown voltage between the emitter and the collector can be increased , so that it is possible to increase the reliability of the element . further , since the base region 64 can be formed by the ion implantation , it is possible to uniformalize the impurity concentration of the base in the direction from the emitter to the collector . further , in the above - mentioned embodiment , although the semiconductor device having a lateral pnp bipolar transistor has been explained , it is of course possible to obtain the same effect as above , when the semiconductor device has a lateral npn bipolar transistor . further , in the above - mentioned embodiment , although the n - type epitaxial layer 53 is grown on the n - type well buried layer 52 , instead even if the p - type epitaxial layer is grown in the same way as with the case of the second embodiment , it is of course possible to manufacture the semiconductor device having the lateral bipolar transistor . the fifth embodiment of the method of manufacturing the semiconductor device according to the present invention will be described with reference to fig9 a to 9d , fig1 a to 10c , fig1 a to 11c , fig1 a to 12c , and fig1 a and 13b . in this embodiment , a vertical and lateral bipolar transistors are both formed on the same substrate . first , as shown in fig9 a , after an n - type buried layer 82 of high concentration has been formed in the surface region of a silicon substrate 81 , an n - type epitaxial layer 83 is grown on the silicon substrate 81 . further , as shown in fig9 b , after the n - type epitaxial layer 83 has been patterned to remove the epitaxial layer 83 from regions at which the element separating regions are to be formed , an insulating film formed of sio 2 , for instance is buried at the regions from which the epitaxial layer has been removed , to form element separating regions 84a and 84b . therefore , the epitaxial layer 83 is separated into semiconductor layers 83a , 83b , 83c and 83d , respectively by the formed element separating regions 84a and 84b . further , a vertical bipolar transistor and a lateral bipolar transistor are electrically separated from each other by the element separation insulating film 84b . successively , as shown in fig9 c , after a photoresist has been applied all over the substrate , the formed photoresist is patterned to form a resist pattern 85 . in this resist pattern 85 , only a predetermined region where a collector of the lateral bipolar transistor is to be formed is exposed . further , p - type impurity ions are implanted with the resist pattern as a mask , to change the collector forming region 83b of the lateral bipolar transistor into an n - type semiconductor layer ( a collector region ) 86 . further , as shown in fig9 d , after the above resist pattern 85 has been removed , a poly crystal silicon film is deposited all over the substrate and then patterned , to leave a poly crystal silicon film 88 only on the semiconductor layer 83a . further , as shown in fig1 a , an insulating film formed of sio 2 , for instance is deposited all over the substrate and then patterned , to expose a semiconductor layer 83c used as a collector leading region of the vertical bipolar transistor , a semiconductor layer 83d used as a base leading region of the lateral bipolar transistor , and a hole 90 for forming a base region of the lateral bipolar transistor . after that , n - type impurity ions are implanted , to form a high concentration collector leading region 91 of the vertical bipolar transistor and a high concentration base leading region 92 of the lateral bipolar transistor , and a base region 93 of the lateral bipolar transistor . further , as shown in fig1 b , an insulating film 95 formed of silicon nitride , for instance is deposited all over the substrate . further , as shown in fig1 c , after a photoresist is applied all over the substrate and then patterned , to form a resist pattern 97 for covering the collector leading region 91 of the vertical bipolar transistor and the base leading region 92 of the lateral bipolar transistor . further , as shown in fig1 a , the silicon nitride film 95 is etched by the anisotropic etching method with the formed resist pattern 97 as a mask , to leave the silicon nitride film 95a on the side surface of the hole 90 in such a way that the base region 93 can be exposed at the bottom of the hole 90 and further to expose the surface of the poly crystal silicon film 88 . further , as shown in fig1 b , after the resist pattern 97 has been removed , p - type impurity ions are implanted , to form an emitter region 98 of the lateral bipolar transistor and further to change the poly crystal silicon film 88 to a base leading electrode 88a . further , as shown in fig1 c , an insulating film 100 formed of sio 2 , for instance is formed all over the surface of the substrate . successively , as shown in fig1 a , the insulating film 100 and the base leading electrode 88a are patterned , to open a hole 101 for forming the emitter and base of the vertical bipolar transistor . further , as shown in fig1 b , an insulating film formed of silicon nitride , for instance is deposited all over the substrate , and then patterned by the anisotropic etching , to form a side wall 102 of the insulating film on the side wall of the hole 101 . after that , the p - type impurities are diffused from the base leading electrode 88a to the epitaxial layer 83a by thermal process , to form an external base region 103 . successively , p - type impurity ions are implanted , to form an internal base region 104 of the vertical bipolar transistor . successively , as shown in fig1 c , a poly crystal silicon film is deposited all over the substrate to bury the hole 101 . further , n - type impurity ions are implanted in the poly crystal silicon film . further , the poly crystal silicon film is patterned to form an emitter leading electrode 106 . after that , the n - type impurities are diffused from the emitter leading electrode 106 to the internal base region 104 by thermal process , to form an emitter region 107 . further , as shown in fig1 a , an insulating film 109 formed of sio 2 , for instance is formed all over the surface of the substrate . further , as shown in fig1 b , contact holes are formed , and then these formed contact holes are buried by a metal film . the formed metal film is patterned to form a base electrode 110a , a collector electrode 110b and an emitter electrode 110c of the lateral bipolar transistor , and further a base electrode 111a , a collector electrode 111b and an emitter electrode 111c of the vertical bipolar transistor , respectively . in this embodiment of the method of manufacturing the semiconductor device , the operation speed and the current gain can be both increased as high as possible , in the same way as with the case of the fourth embodiment . further , since it is possible to change the impurity concentration between the emitter region 98 and the collector region 86 , it is possible to increase the breakdown voltage between the emitter and collector . further , in the fourth and fifth embodiments , since the process of photolithography can be reduced , as compared with the case of the conventional method , it is possible to reduce the manufacturing cost of the semiconductor device . further , when the side wall is formed on the side surface of the hole , it is preferable to deposit the insulating film by lpcvd ( low pressure chemical vapor deposition ) method . this is because the lpcvd method is excellent in the controllability of the film thickness of the side wall , as compared with the case of the normal pressure cvd method , with the result that it is possible to obtain a side wall of a precise film thickness even when a hole of a high aspect ratio is to be formed . further , in the fifth embodiment , when the poly crystal silicon film 88 is formed ( as shown in fig9 d ), it is possible to form this film 88 by depositing a poly crystal silicon film containing p - type impurities and by patterning the deposited film . in this case , in the process as shown in fig1 c , it is preferable to form the resist pattern 97 so as to cover the poly crystal silicon film 88 . as described above , in the method of manufacturing the semiconductor device according to the present invention , it is possible to enable high speed operation , to increase the current gain as high as possible , and further to decrease the manufacturing cost thereof . in addition , the breakdown voltage between the emitter and collector can be increased , with the result that the element reliability can be improved .

US-81603797-A

a process is described for making semiconductor devices with highly controlled doping profiles . the process involves minimizing or eliminating segregation effects caused by surface electric fields created by fermi - level pinning . these electric fields act on dopant ions and cause migration from the original deposition site of the doplant ions . dopant ions are effectively shielded from the surface electric fields by illumination of the growth surfaces and by background doping . also , certain crystallographic directions in certain semiconductors do not show fermi - level pinning and lower growth temperatures retard or eliminate segregation effects . devices are described which exhibit enhanced characteristics with highly accurate and other very narrow doping profiles .

the invention is based on the discovery that segregation effects are due to dopants being pulled along the growth direction by electric fields induced by fermi - level pining at the semiconductor surface and that segregation effects can be minimized or eliminated by a variety of procedures aimed at reducing the effect of these electric fields on dopant ions . typical procedures are illumination of the growth surface during crystal growth , background doping to screen the induced electric field from the dopant ions , growth orientations which have no fermi - level pinning and low growth temperatures where the effect of the induced electric field is minimized . the procedure applies to both n - type and p - type doping . by this procedure , devices can be made with very narrow doping profiles , often with half widths less than 400 or even 100 angstroms . under very stringent control conditions , semiconductor devices with doping half widths less than 50 or even 25 angstroms are obtainable . minimum half widths of 2 or even 10 angstroms are generally contemplated . the procedure can be applied to a large variety of semiconductors including ii - vi semiconductor compounds ( e . g . znse , cdte , cdhgte ), iii - v semiconductor compounds ( e . g . gaas , inp , gap , and various ternary and quaternary compounds such as algaas , ingaas , ingaasp ) and single - element semiconductors such as si and ge . the invention applies to any dopant ion useful for the semiconductor device being made . typical donor dopants for silicon and germanium are phosphorus , arsenic , antimony and bismuth ; for iii - v semiconductor compounds are silicon , germanium , tin and tellurium ; and for ii - vi semiconductor compounds are chlorine , aluminum and gallium . typical acceptor dopants for silicon and germanium are boron , aluminum , gallium and indium ; for iii - v semiconductor compounds are beryllium and zinc ; and for ii - vi semiconductor compounds are lithium , nitrogen and arsenic . the procedure is applicable to a variety of crystal growth techniques where doping profile is of importance . it is especially useful in the growth of semiconductor layers , particularly thin layers by various techniques such as molecular beam epitaxy ( mbe ), liquid phase epitaxy ( lpe ), vapor phase epitaxy ( vpe ) and metal organic chemical vapor deposition ( mocvd ). the procedure is most useful in the growth of thin layers ( e . g . thickness less than 2 μm or 1 μm or even 1 / 2μm ) where precise control of doping profile is required . particularly significant are quantum well devices where very thin layers are used and sharp segregation between doped and undoped regions are highly desirable . the practice of the invention involves minimizing or eliminating the effects of electric fields induced by fermi - level pinning at the semiconductor growth surface . illumination of the growth surface with radiation so as to increase free carrier density is one convenient procedure for minimizing the effect of electric fields on dopant redistribution . here , for best results , radiation intensity on the growth surface should be high to insure maximum free carrier density . also , for most efficient production of free carriers , the frequency of at least a portion of the radiation should correspond to an energy greater than the band gap of the semiconductor . illumination should preferably be maintained during the growth process and until the temperature of the semiconductor is reduced to a temperature range where redistribution effects are negligible . the radiation procedure for minimizing segregation effects is advantageous because no unwanted dopants are introduced to the semiconductor , crystal growth conditions such as temperature , crystal orientation can be optimized for the best crystal growth and device performance rather than minimizing segregation effects and the procedure is relatively simple and easily carried out . the procedure can be carried out with any of the epitaxial growth procedures described above and with either donor or acceptor ions . the illumination procedure is particularly useful with mbe grown layers since this growth procedure is particularly suitable for very thin layers where close control of doping profile is highly advantageous . the effects of the surface electric field may also be minimized or eliminated by use of background doping during the crystal growth . here , the primary doping profile is shielded from the surface electric field by introducing background ( secondary ) doping of the opposite type from the primary doping between the primary doping species and the growth surface . for example , for a p - type primary doping profile ( e . g ., a thin p - type semiconductor layer ), a layer of n - type semiconductor material would be put down to shield the p - type primary doping layer from surface electric fields . equally useful is the use of p - type background doping to shield an n - type primary doping profile . although the concentration of background doping may vary over large limits , typically a concentration within a factor of 10 of the primary doping profile concentration yields satisfactory results . a concentration within a factor of two of the primary doping profile concentration is preferred . segregation effects are also minimized or eliminated by choosing a crystallographic growth direction where there is no fermi - level pinning . although such growth directions are highly specific , useful devices are made in accordance with this procedure . for example , with iii - v semiconductor compounds such as gallium arsenide and indium phosphide , the & lt ; 011 & gt ; crystallographic surface does not have fermi - level pinning and no surface electric fields are developed to cause segregation effects . similarly , ternary and quaternary iii - v semiconductor compounds such as algaas , ingaas and ingaasp do not have fermi - level pinning on the & lt ; 011 & gt ; crystallographic surface . the doping profiles of iii - v semiconductor compounds grown on this & lt ; 011 & gt ; surface are extremely sharp and well defined . indeed , doping profiles with half - widths ( the width of the doping profile at half the maximum doping concentration ) of 100 or even 50 or 20 or 10 angstroms are made conveniently in accordance with the invention . another procedure for reducing or eliminating segregation effects is to carry out the growth procedure at an unusually low growth temperature . in this procedure , the rate at which dopant ions move under the influence of the surface electric field is considerably reduced by the lower growth temperature , generally a temperature below 500 or even 450 degrees c . or even 400 degrees c . under these conditions , growth rates are often reduced to insure high quality crystal growth with low defect densities . for example , with mbe crystal growth , growth rates of less than 0 . 2 μm / hr or even 0 . 1 μm / hr are often used to insure high crystal quality . a number of devices are usefully made in accordance with the invention . shown here are a representative number of devices where precise doping profile is critical to optimum device performance . fig1 shows a diagram of a selectively doped hetreostructure transistor ( sdht ) ( an fet type device ) where precise doping profile is of importance . the transistor structure 10 is made up of a substrate 11 made of gallium arsenide and successive layers of al x ga 1 - x as . the aluminum gallium arsenide typically contain from 10 to 40 mole percent aluminum ( 25 to 35 preferred ) and the successive layers are made up of a first layer 12 without doping , a next layer 13 with doping and a top layer 14 without doping . the first layer 12 is a buffer layer , without doping and may vary over large limits in thickness but usually has a thickness of 1000 to 2000 angstroms . the next layer 13 ( called here the doped layer ) is doped n - type , typically with silicon or tin in the concentration range from 10 17 to 10 20 carriers per cubic centimeters and has a thickness typically from 2 to 400 angstroms . preferred are doped layer thicknesses between 2 and 100 or 2 and 50 or 2 and 20 angstroms depending on various factors such as device application . the top layer 14 is undoped and generally quite thin ( e . g ., 10 to 200 angstroms ). on top of this top layer 14 is a layer of gallium arsenide 15 with source electrode 16 , gate electrode 17 and drain electrode 18 . a portion 19 of the gallium arsenide layer 15 near the aluminum gallium arsenide layer 14 is undoped but the portion of this layer close to the source 16 and drain 17 is doped n - type to facilitate good ohmic contact . this structure may be part of the array of similar structures or may be integrated with other structures on the same semiconductor chip . an important aspect of this structure is the doped layer 13 . this layer has a high doping concentration with a very sharp doping profile , often with doping profile half widths less than 50 or even 20 angstroms . this is highly advantageous since dopant ions that migrate into the undoped portion of the gallium arsenide layer 15 become scattering centers and reduce electron mobility . this structure is conveniently made by illumination of the growth surface so as to reduce or eliminate segregation effects that cause redistribution of dopant ions during semiconductor layer growth . other procedures to reduce or eliminate effects of segregation may be used including background doping , low growth temperature and use of a crystallographic growth surface where fermi - level pinning does not occur . fig2 shows a diagram of a selectively doped quantum well structure 30 with a gallium arsenide substrate 31 , an undoped layer of aluminum gallium arsenide 32 , a doped layer of aluminum gallium arsenide 33 and another undoped layer of aluminum gallium arsenide 34 . typically , the aluminum content of the aluminum gallium arsenide may vary between 10 and 40 mole percent with 25 to 35 mole percent preferred . the doped layer 33 is doped with either silicon or tin in carrier concentrations typically between 10 17 and 10 20 per cubic centimeter . typically , the first undoped layer 32 of aluminum gallium arsenide has thickness of about 1000 to 2000 angstroms , the doped layer 33 between 2 and 400 angstroms with 2 to 50 or 2 to 20 preferred and the top undoped layer 34 with thickness between 10 and 200 angstroms . on top of the undoped aluminum gallium arsenide layer 34 is the channel layer 35 made of undoped gallium arsenide , a thin layer 36 of undoped aluminum gallium arsenide , then a doped ( n - type ) layer of aluminum gallium arsenide 37 . this layer 31 is doped as the doped layer 33 . next is a doped gallium arsenide layer 38 , doped typically with silicon in the concentration range of 10 18 to 10 20 per cubic centimeter to facilitate fabrication of ohmic contacts at the drain 39 , source 40 and gate 41 . in order to obtain devices with superior electronic properties , it is critical to have a sharp doping profile so a minimum of the dopant ions migrate into the channel region 35 where they would create scattering centers and degrade the mobility of the electrons in the channel region . these devices are typically made by illuminating the growth surfaces so as to reduce or eliminate migration of the dopant ions and produce extremely sharp doping profiles . reduced growth temperature as well as growth on a crystal plane surface where there is no fermi - level pinning may also be used to produce these sharp doping profiles . also useful is background doping to prevent segregation effects or a combination of these procedures . fig3 shows a diagram of a heterobipolar transistor 50 made in accordance with the invention . the device is made up of a collector 51 , which is either part of a gallium arsenide substrate or epitaxial layer of gallium arsenide on top of a substrate . the collector 51 is doped n - type typically with silicon to a concentration of 10 17 to 10 18 carriers per cubic centimeters . on top of the collector 51 is the base 52 , made of gallium arsenide and doped p - type typically with beryllium or carbon as high a concentration as possible but typically in the 10 19 to 10 21 / cubic centimeter range . on top of the base 52 is the emitter 53 , made of aluminum gallium arsenide and doped n - type typically with silicon in the concentration range from 10 17 to 10 19 ions per cubic centimeter . sharp doping profiles are critical to optimum operation of the device . other substances may also be used to make these devices including , for example , indium phosphide and indium gallium arsenide , etc .

US-37433689-A

the method for operating a radio communications system , which provides for the routing of data of connections via subscriber stations , which occasionally perform the function of routing nodes , provides that one of the subscriber stations indicates , to a routing unit of the radio communications system , its readiness to take on the function of a routing node .

reference will now be made in detail to the preferred embodiments , examples of which are illustrated in the accompanying drawing , wherein like reference numerals refer to like elements throughout . all signaling between the subscriber stations ms 1 to ms 5 of said radio cell and said routing unit ru is relayed via the base station bs . the fourth subscriber station ms 4 has an input option for a user n of said subscriber station by which the user can manually communicate to the routing unit his / her wish that the subscriber station ms 4 shall act as a routing node . after a corresponding key has been pressed by the user n , corresponding signaling s 4 is conveyed to the base station bs , which relays said signaling to the routing unit . up to the time at which the connection c is to be set up between the first subscriber station ms 1 and the fifth subscriber station ms 5 , only the third subscriber station ms 3 has not signaled any readiness to be available as a routing node . this can be due , for example , to the fact that the charge condition of its battery has fallen below the limit value of 50 %. by the signaling s 2 , s 4 of the second subscriber station ms 2 and the fourth subscriber station ms 4 it is also simultaneously signaled to the base station bs or , as the case may be , to the routing unit ru that a position finding or , as the case may be , location determination of said subscriber stations is to be performed . appropriate methods for determining the location of mobile subscriber stations ( for example , eo tda = enhanced observed time differences of arrival or a - gps = assisted global positioning system ) are sufficiently known to the person skilled in the art and are not described any further here . the mobile radio system also has a localization unit l which is likewise connected to the base station bs and receives the signaling s 2 , s 4 of the two subscriber stations ms 2 , ms 4 and which recognizes on the basis of said signaling that a location determination is to be performed for the subscriber stations in question . the location determination is performed in one of the ways known to the person skilled in the art . the results of the location determination are subsequently made available to the routing unit ru by the localization unit l . the routing unit ru is now able to take into account , for the purpose of routing the connection c , all subscriber stations ms 2 , ms 4 which have previously signaled , via corresponding signaling s 2 , s 4 , their readiness to assume a relaying function . for said routing the routing unit ru takes into account the previously determined location of the available routing nodes ms 2 , ms 4 and establishes a route on the basis of a routing method known to the person skilled in the art . in this case criteria such as minimum number of routing nodes or minimization of the overall transmission power or minimization of the maximum transmission power per routing node can be taken into account . it is beneficial , though not essential , that the routing unit ru requests , via a corresponding request d to those subscriber stations ms 2 , ms 4 which are available as routing nodes , further information i that is accessible to said subscriber station ms 2 , ms 4 for example on account of measurements that are to be performed . in this case the information can relate for example to distances from other subscriber stations . with the information i the subscriber stations ms 2 , ms 4 can also transmit to the routing unit ru further details about their individual properties that are useful for the routing function . this can be , for example , the maximum data rate available for a relaying operation , the possible modulation types , or maximum or , as the case may be , minimum values for the transmission power . in the present exemplary embodiment the routing unit ru determines a route for the connection c which goes from the first subscriber station ms 1 via the fourth subscriber station ms 4 and the second subscriber station ms 2 to the fifth subscriber station ms 5 . the routing unit ru notifies this route to the subscriber stations involved , whereupon the corresponding connection c is set up . if one of the subscriber stations acting as routing nodes for a connection wishes to cease exercising this function any further , it likewise communicates this to the routing unit ru via corresponding signaling s 2 , s 4 . if , for example , the charge condition of the power supply of the fourth subscriber station ms 4 falls below the limit value of 50 %, the routing unit ru is notified by corresponding signaling s 4 . the connection c is then re - routed by the routing unit ru , with only those subscriber stations being considered as routing nodes which have previously signaled their readiness to act as such and have not revoked such readiness . in the present case this is only the second subscriber station ms 2 . with other exemplary embodiments it is also possible that the routing unit ru only preferably , rather than exclusively , determines those subscriber stations as routing nodes which have previously signaled their corresponding readiness . this means that initially as far as possible only those subscriber stations are factored in as routing nodes by the routing unit which have signaled their readiness therefor . however , if no favorable route for a connection can be determined by the routing unit in so far as it only includes routing nodes which have previously declared themselves ready for this , in the case of such exemplary embodiments the routing unit ru can also include one or more of the remaining subscriber stations ( in the figure this would be the third subscriber station ms 3 ) in the routing scheme . the routing unit ru is a network - side device of the mobile radio system which can perform the routing for a plurality of connections . in the exemplary embodiment considered here , all the subscriber stations ms 1 to ms 5 are active before the start of the routing , that is to say they are switched on and therefore operational . of these active subscriber stations , however , only the second and the fourth subscriber station ms 2 , ms 4 signal their readiness to act as routing nodes . in order to increase the incentive for users of the subscriber station to make their own subscriber station available as a routing node , a more favorable charging arrangement could be provided for said subscribers or the possibility could be provided that such users may upgrade their terminal device free of charge , as a result of which at the same time the latest technology would also always be available for the ad hoc component of the radio communication system . if the user , as in the case of the fourth subscriber station ms 4 , for example , has the possibility to inhibit or actively control the transmission of the signaling of the relaying readiness , he / she is able to prevent the corresponding location determination of his / her subscriber station ms 4 . his / her subscriber station is also available for setting up his / her own connections and radiation emissions are avoided in that the corresponding subscriber station ms 4 does not act as a routing node . the method enables centralized planning of optimal and reliable routing in ad hoc networks . the result is increased reliability and consequently greater acceptance of ad hoc networks than was previously the case . a description has been provided with particular reference to preferred embodiments thereof and examples , but it will be understood that variations and modifications can be effected within the spirit and scope of the claims which may include the phrase “ at least one of a , b and c ” as an alternative expression that means one or more of a , b and c may be used , contrary to the holding in superguide v . directv , 358 f3d 870 , 69 uspq2d 1865 ( fed . cir . 2004 ).

US-63015305-A

a unitary connector made from thin sheet metal is provided that forms a substantially concealed connection between a held member at the end face thereof to a holding member . the connector has a first flange to be applied against the end face of the held member to be connected and a second flange extending away therefrom and which is applied against the holding member , wherein these flanges or fastening flanges cam each be provided with fastener openings , through which fasteners , such as nails , dowel pins , screws or bolts , can be driven into the members to be joined to one another . the second flange is folded over itself to give it strength . a third flange can extend from the second flange over the held member to strengthen the connection .

fig1 through 3 show a connector 1 comprising thin sheet metal having a wall thickness s of 2 mm for connecting a held member 2 at the end thereof to a holding member 3 disposed crosswise thereto . connector 1 has a first flange 4 to be disposed against the end face 2 ′ of held member 2 to be connected , and a second flange 6 extending away therefrom and to be disposed against an upper side surface 3 ′ of holding member 3 . the first flange 4 is provided with fastener openings 7 and 8 and second fastener opening 9 . second flange 6 is provided with fastener openings 10 ′ and first fastener opening 10 . fasteners 11 ( see fig4 ) can be driven through the openings to join members 2 and 3 . fastener openings 7 of first flange 4 are formed as round holes oriented obliquely relative to its contact surface 4 ′, which holes are provided with an oblique forced guide for the respective fasteners 11 to be driven in . the central axis 11 ′ ( see fig4 ) of the fastener 11 is oriented such that it is not perpendicular to first flange 4 or its contact surface 4 ′, in order to achieve the advantageous effects desired and achieved in german utility model de 29610381 . 0 u1 for the connector according to the present invention as well . as is evident from fig1 thickness d of second flange 6 is doubled by folding the edge of the corresponding sheet - metal blank over along the rim of second flange 6 facing away from the held member 2 , thus acquiring a value of 2 s , since the two plies of second flange 6 are in surface contact with one another . as is further evident from fig1 and 3 of the drawing , upper ply 6 ′ of second flange 6 is elongated in the direction of the held member 2 to be connected , beyond first flange 4 , to a third flange 12 . under these conditions , in a version illustrated with dot - dash lines in fig1 third flange 12 adjacent first flange 4 is offset in the direction of first flange 4 by bending or by folding up its edge such that its underside 12 ′ is aligned with the underside of second flange 6 , thus ensuring that underside 12 ′ of third flange 12 , acting as a contact surface , is horizontally aligned with the underside of lower ply 6 ″ of second flange 6 and does not have to be hammered into shape for the first time during installation . fig1 a shows detail 1 a enclosed with a dot - dash circle in fig1 ( in other words the angle region between first and second flanges 4 and 6 respectively as well as third flange 12 if applicable ) in a further version of a connector 1 without third flange 12 . in this case — and in this respect differing from the embodiment according to fig1 — the free end portion of upper ply 6 ′ of second flange 6 is formed such that it is parallel to the angle region between the first and second flanges 4 and 6 , so that the resisting torque of second flange 6 is correspondingly increased . in order to improve the strength characteristics still further , the free rim portion of upper ply 6 ′ of second flange 6 oriented parallel to first flange 4 is joined by a spot weld 13 to first flange 4 . it must be pointed out here that the two mutually parallel , mutually contacting plies 6 ′ and 6 ″ of second flange 6 can also be joined permanently to one another by spot weld 13 or adhesive bonding . fig3 a shows an embodiment which resembles the connector according to fig1 through 3 , which also comprises a thin steel sheet of 2 mm thickness , but which is not provided with a third flange 12 , wherein here again the thickness of first flange 4 is 2 mm and thickness d of second flange is twice as large , or in other words is 4 mm . in this embodiment also the free rim of upper ply 6 ′ of second flange 6 facing first flange 4 is joined by spot weld 13 to lower ply 6 ″ of the second flange or to first flange 4 . fig3 a also shows a further version ( illustrated with dot - dash lines ) in which the one half of the first flange is swung up by 90 ° relative to the other half , and during installation is guided into a corresponding slot of held member 2 and held there with dowel pins . fig3 b shows ( only ) in a top view according to fig3 a further version in which width b of third flange 12 is considerably larger than width b of second flange 6 and of first flange 4 . in this case third flange 12 can form a right - angled surface , as in the embodiment according to fig1 to 3 ( see fig3 ). if necessary , however , it can also be recessed , especially in its middle region 14 , as is indicated by dotted lines in fig3 b . fig5 through 8 show another version of a connector 1 , wherein the diagram according to fig5 corresponds to fig1 that of fig6 to fig2 and that of fig7 to fig3 . the connector according to fig5 through 8 differs from the version described in the foregoing substantially in that all surface portions have two - ply structure and in that the second flange 6 and the third flange 12 are aligned with one another are provided with two creases 15 , which are stamped in such a way in upper plies 6 ′ and 12 ″ respectively of third flange 12 that they protrude upwardly , so that the two plies 6 ′ and 6 ″ or 12 ″ and 12 ′″ can nevertheless be in contact with one another . as regards the embodiment of connector 1 according to fig5 through 8 depicted in the foregoing , the corresponding sheet - metal blank — as in connector 1 according to fig1 through 4 — ends at the lower rim of first flange 4 at its ply 4 ″ facing holding member 3 , but at its other rim does not end at the free end of third flange 12 , which in this embodiment also has two - ply structure . instead , the second free rim is also disposed at the lower end portion of first flange 4 , albeit not beside the free rim of ply 4 ″ in the embodiment illustrated in fig5 since the second ply of first flange 4 is bent one additional time around the free rim of ply 4 ″, so that the first flange has three - ply structure at its lower end portion . fig9 through 12 show a further version of a connector 1 according to the present invention , wherein parts or portions which are similar or have similar action or correspond to one another once again have the same reference symbols as in the embodiment according to fig1 to 4 . in connector 1 according to fig9 through 11 , it is obvious that third flange 12 has one - ply , first flange 4 two - ply and second flange 6 three - ply structure , wherein the rim of second flange 6 facing away from third flange 12 is rounded off as in the embodiments described hereinabove , since the third ply of second flange 6 extends into the upper and lower plies . the version according to fig1 through 16 differs from this embodiment substantially only ( see in particular fig1 in comparison with fig9 ) in that the two upper plies of the second flange are rounded off by appropriately folding the edges over , and in that thereunder there is disposed the third ply of second flange 6 , which ends in truncated form at the rim of second flange 6 facing away from third flange 12 . fig1 , 18 and 19 show a connector 1 of sheet metal , having a thickness s of 3 mm . in some places , the connector 1 shown in fig1 , 18 and 19 is shaped or machined ( by chip - removing methods if necessary ) in a certain way . in the version according to fig1 , 18 and 19 , first flange 4 is provided with three mutually parallel rows of fastener openings 7 and 8 , the longitudinal axis of which is disposed obliquely relative to the plane of first flange 4 ( as far as outer fastener openings 7 adjacent the rim are concerned ), so that fasteners 11 , which are to be driven through outer fastener openings 7 during assembly , and which in fig1 are indicated merely by dashed lines , are oriented correspondingly obliquely relative to end face 2 ′ of held member 2 or to the plane of first flange 4 when in installed condition . in contrast , the two fastener openings 8 in first flange 4 are formed therein in such a way that their longitudinal axes are oriented perpendicular to the plane of first flange 4 . in addition , first flange 4 is also provided in its upper portion with ( at least ) one second fastener opening 9 , which is obtained by appropriate shaping of first flange 4 and which is formed by an appropriately shaped projection 9 ′, which is obtained by a type of deep - drawing process . as can be seen in particular from fig1 and 19 , the longitudinal central line 5 of this second fastener opening 9 is also oriented obliquely relative to the plane of first flange 4 and thus — in the installed condition — relative to connection end face 2 ′ of held member 2 as well . it is aligned with longitudinal central line 5 ′ of a first fastener opening 10 adjacent the free end portion of second flange 6 and formed therein . as shown in fig1 , a second fastener opening 9 can also be aligned with longitudinal central line 5 ′ of a first fastener opening 10 adjacent the free end portion of third flange 12 and formed therein . second and first fastener openings 9 and 10 associated with one another are used to accommodate a fastener 11 ″, which has a longitudinal axis 11 ′″, ( preferably a nail or screw ), which during installation is driven or screwed in obliquely from above in the direction of arrow 16 , after connector 1 has first been fixed to held member 2 by proper placement with fasteners 11 , which are driven in via through fastener openings 7 and 8 , and held member 2 has been braced and placed properly at the intended position by lowering second flange 6 onto upper side 3 ′ of holding member 3 . for this purpose the second and first fastener openings 9 and 10 associated with one another as a pair are dimensioned and arranged such that , in the installed condition , they bear interlockingly on fastener 11 ″, while at the same time the “ angle element ” formed by the first and second flanges 4 and 6 is endowed with stiffness by means of the said fastener 11 ″ driven through them and traversing them after installation , the portion a of the said fastener extending between the second and first fastener openings 9 and 10 in the installed condition then forming , in the side view according to fig1 and 19 , the hypotenuse of a right - angled triangle with legs c and d , which triangle correspondingly stiffens connector 1 under load l ( see arrow in fig3 ) against relative bending and / or twisting of its first and second flanges 4 and 6 . this stiffening effect , which is the main objective of the connector of the present invention , can obviously be further enhanced if there are provided in first and second flanges 4 and 6 of connector 1 several pairs of second and first fastener openings 9 and 10 associated with one another , each for accommodation of one rod - like fastener 11 ″ ( preferably a nail or screw ) and , in another embodiment , which obviously can also be additionally provided , by the fact that there is chosen as the rod - like fastener not a nail 11 ″ but in each case a screw , wherein at least one fastener opening 9 and / or 10 is then provided with an appropriate female thread , which corresponds to the male thread of the screw , so that this — if necessary after a pilot hole has first been formed — can be screwed in obliquely from above in the direction of arrow 16 , and wherein the stiffening effect can be enhanced still further if necessary by forming both second and first fastener openings 9 and 10 of a pair of fastener openings associated with one another as threaded holes if necessary . given this information , it is immediately obvious to the person skilled in the art that a corresponding feature can also be provided ( separately or additionally ) if necessary with regard to third flange 12 . in other words , this can also be provided if necessary with a first fastener opening 10 , which is oriented obliquely relative to the flange plane and the longitudinal central axis 5 ′ of which is aligned with a further second fastener opening 9 in the first flange 4 , which further second fastener opening 9 is also formed by appropriate shaping of a projection 9 ′, albeit obviously in mirror - image relationship , as it were , relative to the plane of first flange 4 , whereby there can obviously be achieved further considerable stiffening of connector 1 it is immediately obvious that , within the scope of the present invention , still further diverse embodiments are possible without leaving the scope of the invention , and that the embodiments illustrated in the drawing therefore represent merely examples intended to contribute to explanation of the present invention .

US-51901100-A

a method and system for providing a realistic environment for a traffic report is disclosed . the traffic report includes a 3d view of current traffic conditions for one or more roadways in and around a metropolitan area . the 3d view includes a background that reflects the current time of day and / or weather conditions . for example , a traffic report shown by a television station as part of the evening news may depict the background as having a dark sky and nighttime lighting , such as vehicle , building , and street lights . as another example , a traffic report shown by a television station as part of the noon news may depict the background as having overcast skies .

fig1 is a block diagram of a system 100 for providing a traffic report . the system 100 includes a traffic data collection center 102 and a traffic report application 104 . the traffic data collection center 102 receives data regarding traffic conditions from a variety of sources and provides a traffic data output to the traffic report application 104 . the traffic report application 104 uses the traffic data output along with user inputs to generate a video output for a traffic report that can be used by a television station 106 or other end user , such as a web - based or cellular - based application , to present information regarding current traffic conditions to viewers . the traffic data collection center 102 receives sensor data 108 , probe data 110 , and / or event data 112 . the sensor data 108 is data collected from roadway sensors . the sensors may use radar , acoustics , video , and embedded loops in the roadway to collect data that can be used to characterize traffic conditions . for example , the sensor data 108 may include speed , volume ( number of vehicles passing the sensor per period of time ), and density ( percentage of the roadway that is occupied by vehicles ). the sensor data 108 may include other data types as well , such as vehicle classification ( e . g ., car , truck , motorcycle ). the sensor data 108 is generally collected in real time ( i . e ., as it occurs ) or at near real time . the probe data 110 is point data collected from a moving vehicle having a device that can identify vehicle position as a vehicle travels along a road network . for example , the device may use cellular technology or global positioning satellite ( gps ) technology to monitor the vehicle &# 39 ; s position on the road network . by monitoring the vehicle &# 39 ; s movement , the probe data 110 can be used to determine travel time , which can then be used to calculate speed of the vehicle . the probe data 110 is generally collected in real time or at near real time . the event data 112 is traffic data regarding a traffic event . a traffic event is an occurrence on a road system that may impact the flow of traffic . traffic events include incidents and weather . an incident is a traffic event that obstructs the flow of traffic on the road system or is otherwise noteworthy in reference to traffic . example incidents include accidents , congestion , construction , disabled vehicles , and vehicle fires . a traffic operator may enter the event data 112 into a traffic incident management system ( tims ), such as the tims described in u . s . patent publication no . 2004 / 0143385 , which is assigned to the same assignee as the current application . u . s . patent publication no . 2004 / 0143385 is hereby incorporated by reference in its entirety . a traffic operator is a person who gathers traffic information from a variety of sources , such as by monitoring emergency scanner frequencies , by viewing images from cameras located adjacent to a roadway , and by calling government departments of transportation , police , and emergency services . in addition , the traffic operator may obtain traffic data from aircraft flying over the road network . the traffic operator may enter event data 112 using tims edit screens , which present the traffic operator with a menu to select the type of information entered for a particular type of incident . the tims uses a series of forms to prompt the traffic operator for relevant information to be entered . the forms and fields used depend on the type of traffic information to be entered and what type of information is available . for example , the traffic information entered by the traffic operator may be related to weather , an accident , construction , or other traffic incident information . the traffic data collection center 102 may also have access to historical traffic data 114 . the historical traffic data 114 may include travel time , delay time , speed , and congestion data for various times of the day and days of the week . the traffic data collection center 102 may use the historical traffic data 114 to predict clearance time for a traffic event , to predict traffic conditions when sensor data 108 , probe data 110 , and / or event data 112 is unavailable for a particular roadway , or for any other suitable purpose . the traffic data collection center 102 includes a combination of hardware , software , and / or firmware that collects the received sensor , probe , event , and historical traffic data 108 - 114 , analyzes the data 108 - 114 , and provides a traffic data output to applications that use traffic data . for example , the traffic data collection center 102 may be a virtual geo - spatial traffic network ( vgstn ) as described in u . s . patent publication no . 2004 / 0143385 . other systems for collecting , analyzing , and providing traffic data in a format that can be used by applications may also be used . the traffic data collection center 102 analyzes sensor data 108 and probe data 110 to determine whether congestion is building , steady , or receding on a roadway . additionally , the traffic data collection center 102 integrates the sensor data 108 and probe data 110 with the collected event data 112 . the integrated data is mapped using a geographic database to produce a virtual traffic network representing traffic conditions on a road network . in one embodiment , the geographic database is a geographic database published by navteq north america , llc of chicago , ill . the traffic data collection center 102 provides a traffic data output to the traffic report application 104 . the traffic data output may be a traffic feed , such as an rss or xml feed . the traffic report application 104 uses the traffic data output and inputs from a user to create a video output for a traffic report that can be used by the television station 106 . for example , the traffic report application 104 may be the nexgen television traffic reporting application as described in u . s . patent publication no . 2006 / 0247850 , which is assigned to the same assignee as the current application . u . s . patent publication no . 2006 / 0247850 is hereby incorporated by reference in its entirety . other applications that can create a traffic report using traffic data may also be used . the nexgen application uses the traffic data output to create data - driven maps and informational graphics of traffic conditions on a road system for display on a video device . with the nexgen application , traffic maps and informational graphics do not need to be pre - rendered into movies , thus providing a dynamic view of traffic data on a road system . specifically , two - dimensional ( 2d ) and three - dimensional ( 3d ) traffic maps and informational graphics change as traffic data changes in real or near real time . also , with the nexgen application , the traffic report is dynamically created to illustrate the traffic data that the user selects . while the traffic report application 104 is depicted in fig1 as a stand - alone entity , it is understood that the traffic report application 104 may be co - located with either the traffic data collection center 102 or the television station 106 . additionally , the output from the traffic report application 104 may be provided to end users other than the television station 106 . for example , the traffic report application 104 may provide the traffic report to a web - based application or a cellular application . fig2 is a screen shot 200 depicting a 3d view of traffic conditions in a city during the day . fig3 is a screen shot 300 depicting a 3d view of traffic conditions in a city at night . the screen shots 200 , 300 are examples of a single image from a traffic report that may be generated by the traffic report application 104 and presented by the television station 106 . the screen shot 200 includes a sky area 202 and the screen shot 300 includes a sky area 302 , each of which surround the buildings , roads , vehicles , and other objects in the image of the city . in reality , the sky &# 39 ; s lighting and color changes according to viewing direction , the position of the sun , and conditions of the atmosphere . to provide a realistic traffic report environment , the traffic report application 104 adjusts the sky areas 202 , 302 to more closely match the how the lighting and color of the sky changes over time . the traffic report application 104 may adjust the sky areas 202 , 302 based on time of day . for example , the time of day may be segmented into dawn , daytime , dusk , and nighttime . the traffic report application 104 may adjust the light intensity and color of the sky area 202 , 302 for each of these time segments based on lighting and sky color conditions expected in the real world at that time . the daytime scene may have full lighting with a sky color of light blue . the nighttime scene may have minimal lighting with a dark sky color , such as black , dark blue , or dark purple . the dawn and dusk scenes may have lighting that ranges between the full lighting of the daytime scene and the minimal lighting of the nighttime scene . the color of the sky area 202 , 302 in the dawn or dusk scenes may vary based on the colors expected at that time . for example , the dawn scene may have a sky color with a pinkish hue , while the dusk scene may have sky color with an orange hue . additionally or alternatively , the traffic report application 104 may adjust the sky areas 202 , 302 based on weather conditions . the traffic report application 104 may adjust the sky areas 202 , 302 based on cloud cover , rain , snow , fog , and other weather conditions that can change the color and lighting of the sky in the real world . for example , if the weather is currently stormy , the light intensity and color of the sky areas 202 , 302 may be adjusted to be darker than if the weather is clear . other adjustments to the sky areas 202 , 302 may also be made based on weather conditions . prior to the traffic report application 104 adjusting the sky areas 202 , 302 , an artist may use a graphics application , such as commercially available autodesk ® 3ds max ® ( formerly 3d studio max ), to generate the sky areas 202 , 302 . another application , such as gamebryo , may be used to create a runtime graphics data file ( e . g ., a . nif file ) used by the traffic report application 104 to create the video output sent to the television station 106 or other end user . the artist may create the sky areas 202 , 302 using a dome . the artist selects a light source to illuminate the sky dome . the artist varies the lighting intensity and color of the light source to change the environment color reflecting the expected real world color and light intensity of the sky at different times of the day . the light source reflects off objects in the scene , such as buildings , bridges , and vehicles . in this manner , the light source affects objects in the scene much like sunlight in the real world . the artist may also change environment colors by changing texture of the objects in the scene . the textures are the images applied to objects to make 3d geometry ( e . g ., boxes and rectangles ) look like buildings . in this example , the light source provides a consistent light , typically a bright white light . the textured images are altered to receive the color hues , such as the orange hues used in the dusk scene . the artist may use an image editing program , such as photoshop , to alter the textures of the objects . as another example , the artist may change the environment color by changing the underlying material colors of each object in a scene . in this example , the light source and textures are not altered . instead , the material color of each object is altered . the material is a set of properties that affect the appearance of an object . the material contains the main texture image and allows for setting other textures and properties . for example , other texture images can be used to add reflectivity , areas of transparency , and / or the appearance of a bumpy surface . the materials can also contain several color properties , such as diffuse color , specular color , and emittance color . the diffuse color is the object &# 39 ; s base color . when a texture is applied to an object , the diffuse color affects how the texture is displayed . the specular color is the color of highlights . usually , the specular color is white , but can be other colors as well . when light shines on a glossy object , certain areas have brighter spots . the specular color alters the color of these brighter spots . the emittance color is the “ glow ” color that makes an object look like its being illuminated from inside the object . changing these underlying colors may affect the appearance of the objects in the scene without adjusting the lights or the texture images . for example , changing the environment color for a dusk scene may include changing the diffuse , specular , and emittance colors to an orange hue , making the object appear to have an orange glow . other methods may be used to change the environment color . for example , the graphics application may allow an artist to import actual weather data to simulate outdoor lighting . the artist may also add clouds 204 and / or stars 304 to the sky dome . the traffic report application 104 may add graphics 206 , 306 to the sky areas 202 , 302 based on time and / or weather conditions . prior to the traffic report application 104 adding graphics 206 , 306 to the sky areas 202 , 302 , the artist may use the graphics application to generate the graphics 206 , 306 . for example , the sun , the moon , clouds , fog , lightening bolts , rain drops , rainbows , tornadoes , and other objects that may be seen in the real sky may be added to the sky areas 202 , 302 . as described , two types of clouds may be added to the virtual world . the clouds 204 are added to the background of the sky dome , while the clouds 206 are added as 3d objects in a scene . in a similar manner , stars can be added to the background of the sky dome and / or as 3d objects in a scene . the added objects may also be adjusted as conditions change . for example , as a storm approaches , the cloud objects may increase in size and darken in color . as another example , to simulate fog , a cloud object may be adjusted to create one big cloud producing low visibility in the scene . the added graphics may be positioned in the image at a location that represents the location of the objects in the actual sky ( e . g ., sun located in the east in the dawn view ). additionally , the added graphics may reflect the actual size , shape , and / or color of the objects in the actual sky ( e . g ., full moon , cumulus clouds , stratus clouds ). the traffic report application 104 may also add graphics to the objects in the city and alter graphics added to the city objects as conditions change . for example , as seen in the nighttime scene depicted in fig3 , lights may be added to or altered on a vehicle graphic to simulate headlights , tail lights , and dome lights . as another example , the traffic report application 104 may add or alter graphics depicting street lights , bridge lights , and building lights to the city objects in the nighttime or stormy view . the color of the lights may be selected to match the color of the actual lights . additionally , the traffic report application 104 may add audio to the background of the traffic report to reflect the time of day or current weather conditions . for example , the background of the traffic report may include the sound of raindrops or thunder . as another example , while presenting the dawn scene , the background of the traffic report may include the sound of birds chirping . the traffic report application 104 creates the traffic report using the sky areas and graphics created by the artist . the traffic report application 104 may adjust the sky areas 202 , 302 or add graphics 206 , 306 automatically or based on user input . in an automatic mode , the traffic report application 104 may use a clock to determine the time of day and / or a weather feed to determine weather conditions . the weather feed may be an rss , xml , or other type of feed provided by a weather service provider , such as the national weather service . based on the time and / or weather , the traffic report application 104 selects the appropriate environment to display during the traffic report . in a manual mode , the user selects which environment to display during the traffic report . the user may be a television producer or any other person . the traffic report application 104 may provide the television station 106 with a list of options to select , such as dawn , sunny , dusk , overcast , stormy , and night . based on the user selection , the traffic report application 104 selects the associated environment to display during the traffic report . fig4 is a flow chart of a method 400 for providing a traffic report depicting a realistic environment . at block 402 , the method 400 obtains data regarding current traffic conditions for one or more roadways in a road network . sensors along the roadway and / or probes in vehicles traveling along the roadway collect current traffic conditions . additionally or alternatively , traffic operators obtain traffic data from traffic cameras , scanners , and from other people who are aware of traffic incidents . the traffic data received from the various sources are organized and compiled into a form that can be used to provide a traffic data output ( e . g ., a traffic feed ) that can be used by the traffic report application 104 . at block 404 , the method 400 selects a background to be used in a traffic report based on time of day and / or weather conditions . preferably , the background includes sky color and light intensity that simulates current real world sky conditions . the background also includes graphics that represents objects found in the real sky or objects that appear in certain lighting conditions , such as car headlights that a driver activates at night or during stormy conditions . the background may be selected automatically using a clock and / or a weather feed or manually by receiving user input . at block 406 , the method 400 creates a traffic report that includes the current traffic conditions and the selected background . the traffic report includes a traffic flow map that shows current traffic conditions , preferably using a color - coded animation of vehicles moving along a roadway . the animation is representative of the current speed , volume , and density of the current traffic conditions along the roadway . for example , cars depicted on a segment of the traffic flow map may move at a rate representative of the actual roadway speed for the segment . additionally , the number of cars may represent the actual volume of cars on the segment and the color of the cars may represent the actual density of the segment . the traffic report may include a series of images depicting 2d and / or 3d views of the area surrounding the roadway . when the traffic report depicts a 3d view , the corresponding images may include an area representing the sky . the traffic report depicts the sky area in a manner that reflects real world sky conditions by using the selected background . the traffic report is provided to the television station 106 , to web - based applications , to cellular applications , and so on . viewers of the traffic report see a more realistic representation of the area depicted in the report . as a result , the viewers may have a better sense of connection to the real world , making the traffic reports easier to understand . moreover , a user has the ability to present the same traffic data in many different ways providing a more interesting and topical report . it is intended that the foregoing detailed description be regarded as illustrative rather than limiting and that it is understood that the following claims including all equivalents are intended to define the scope of the invention . the claims should not be read as limited to the described order or elements unless stated to that effect . therefore , all embodiments that come within the scope and spirit of the following claims and equivalents thereto are claimed as the invention .

US-21033608-A

hbv surface antigen particles , prepared by recombinant dna technology are described , said particles being composed of epitopes from the group of surface peptides and / or core peptide of non - a , non - b hepatitis virus , hepatitis virus a and / or hepatitis virus b . respective particles are especially characterized by a composition of different epitopes selected from pre - s and s peptides . there are also described dna - sequences , plasmids and cell lines coding for respective hbv surface antigen particles as well as a new vaccine containing the same .

preferred dna constructs of the present invention are characterized by the presence of a selection marker selected from the group consisting of dhfr ( dihydrofolate reductase ), mt - neo ( a neomycin resistance sequence coupled to a methallothionein and mt - ecogpt ( a resistance sequence coupled to a methallothionein promoter ). the expression rate may be further enhanced by adding to the constructs a dhfr gene as an amplification gene . hbv nucleotide sequences used in certain constructs of the present invention can be formed or isolated by any means including isolation and ligation of restriction fragments and synthetic oligonucleotides . constructs specifically described herein were formed by the ligation of synthetic oligonucleotides to a 5 &# 39 ; xbai - bglii 3 &# 39 ; fragment from the s region of the hbv genome shown in fig . ix ( hereinafter the &# 34 ; xbai - bglii fragment &# 34 ;) which is derived from a bglii - bglii hbv fragment including the entire pre - s 1 - pre - s 2 - s regions ( the &# 34 ; bglii - bglii fragment &# 34 ;). the pre - s 1 - pre - s 2 - s region of the hbv genome is shown in fig . ix . oligonucleotides used in making such constructs are summarized in table i . table i__________________________________________________________________________oligonucleotide duplexes for vector constructionrestriction sites and sequence ( 5 &# 39 ;- 3 &# 39 ;) oligo . no . schematic structure function ( sticky ends are underlined ) __________________________________________________________________________1 mstii - atg - s1 - xbai s1 ( exchanged tcaggaaatggagaacatatcagga flanking ttcctaggaccccttctcgtgttacag sequence gcggggtttttcttgttgacaagaatc atg ) ctcacaataccgcagagt13 mstii - ata - s1 - xbal s1 ( exchanged tcaggaaatagagaacatatcagga flanking ttcctaggaccccttctcgtgttacagg sequence cggggtttttcttgttgacaagaatcct ata ) cacaataccgcagagt17 bglii - atg - s2 - ecori s2 ( exchanged gatctacctgaacatggagtgg flanking sequence atg ) 19 mstii - atg ( s )- s2 - s2 ( 20 amino ) tcaggcgctgaacatggagaacatctccxhoi acids ; with s agttcaggaacagtaaaccctgttctga atg ) ctactgcctctcccttatcgtcaatcttc23 bglii - atg ( s )- s1 - s1 ( 28 amino gatctttaacatggagaacaatcctctgxbai acids ; with s ggattctttcccgatcaccagttggatcc atg ) agccttcagagcaaacaccgcaaatcc agattgggacttcaatcccagt29 bglii - atg ( s )- s2 - s2 ( 26 amino gatctttaacatggagaaccagtggaatxbal acids ; with s tccacaaccttccaccaaactctgcaag atg ) atcccagagtgagaggcctgtatttccct gctggtggctccagt33 xbai - ata ( s )- styi s 5 &# 39 ; with ata ctagaccctgcgctgaacatagagaaca tcacatcaggattcctaggaccccttctc gtgttacaggcggggtttttcttgttgaca agaatcctcacaataccgcagagc35 xbai - ata ( s )- hpai - s 5 &# 39 ; with ata ctagaccctgtggttaacatagagaacastyi tcacatcaggattcctaggaccccttctc gtgttacaggcggggtttttcttgttgaca agaatcctcacaataccgcagagc37 bglii - s1 - hpai s1 gatctttaacatggagaacaatcctctg ggattctttcccgatcaccagttggatcc agccttcagagcaaacaccgcaaatcc agattgggacttcaatgtt39 ecori - xbai - xhoi - s 5 &# 39 ; with ata aattctagactcgagtctgaacatagagata ( s )- styi aacatcacatcaggattcctaggacccc ttctcgtgttacaggcggggtttttcttgt tgacaagaatcctcacaataccgcaga gc43 styi - s2 - xhol s 3 &# 39 ; ctaggaacagtaaaccctgttctgacta ctgcctctcccttatcgtcaatcttctcta ggattggggac45 bglii - atg ( s )- s1 - s1 ( 17 amino gatctttaacatggagaacgatcaccagpoly alanine - xbai acids ; with s ttggatccagcctccagagcaaacaccg atg ); poly cagccgccgccgccgccgccgccgccgccg alanine sequence ccgccgccgccgccaat49 xbai - s2 - styi s 3 &# 39 ; ctagacacagtaaaccctgttctgacta ctgcctctcccttatcgtcaatcttctcga cgattggggac55 bglii - s1 - xbai s1 ( 28 amino gatctttaacatggagaccaatcctctg acids ) ggattctttcccgatcaccagttggatcc agccttcagagcaaacaccgcaaatcc agattgggacttcaat__________________________________________________________________________ the oligonucleotides in table i were combined with the xbai - bglii fragment to produce constructs with desired features . in certain constructs adapter oligonucleotide sequences ( table ii ) were used to create proper matching sticky ends on the oligonucleotides and other construct components . table ii__________________________________________________________________________oligonucleotide duplexes ( adapter sequences ) restriction sites andoligo no . schematic structure sequence ( 5 &# 39 ;- 3 &# 39 ;) __________________________________________________________________________2 apai - bglii - hindiii cttagatcttta ccgggaatctagaaattcga4 mstii - xhoi tcaggac cctgagct7 ecori - hindiii - bglii aattcaagctta gttcgaatctag9 sali - bglii - bamhi tcgacagatatg gtctagacctac15 ecori - bglii aattccccggga ggggccctctag27 ecori - bglii - bamhi - aattcagatctggatccgagctcahindiii gtctagacctaggctcgagttcga31 bamhi - hindiii gatcctta gaattcga41 apai - bglii - xhoi caaaagatct ttc ccgggt tt tctagaaaagagct47 xbai - polyalanine - xhoi ctagac ( 20h gcc ) gac tg ( 20h cgg ) ctgagct53 ecori - bglii - xbai - xhoi aat tcatccagatctaattctc tagattac gtaggtctagattaagagatctaatgagct57 xhoi - xbai tcgaggagtcgacctagt cctcagctggatcagatc61 bglii - ecori - bglii gatctaattgaattcaatta attaacttaagttaatctag63 ecori - sali - ecori aattatgtcgacta tacagctgatttaa__________________________________________________________________________ other adapter sequences may be used to combine desired oligonucleotides from table i with the xbai - bglii fragment , other restriction fragments , oligonucleotides and other construct components . the necessary sequences of such other adapter sequences will be readily apparent to those skilled in the art from consideration of tables of restriction sites [ e . g ., that found at pages 121 - 128 of methods in enzymology , volume 152 , &# 34 ; guide to molecular cloning techniques ,&# 34 ; ed . berger and kimmel ( academic press 1987 ) which is incorporated herein in its entirety by reference ) and the sequences of the various nucleotides to be combined . adapter sequences can also be used to introduce additional restriction sites into constructs of the present invention . it should be noted that adapter sequences must be selected or designed so that the proper reading frame is maintained throughout the hbv sequence . preferred gene constructs which were used to transfect host cells were prepared by recombinant dna techniques in accordance with the present invention . preferred embodiments of constructs with an enhanced expression rate are shown in figs . i - viii and are schematically represented by the following : each of the constructs shown in figs . i - viii contain , in addition to a hbv sequence , a neomycin selection marker with the mt promoter , an ampicillin selection marker , a dhfr selection / amplification gene and a promoter for the hbv sequence . the promoter for the hbv sequence is preferably the u2 promoter , the mt promoter or the h2k promoter . isolation of fragments containing the various promoters , the selection markers and amplification gene is described below . the hbv sequences in the constructs of figs . i - viii are schematically represented by a rectangular bar in each figure which indicates the oligonucleotides and / or adapter sequences from tables i and ii which were combined with the xbai - bglii fragment . shaded areas within the bar indicate generally regions of the entire pre - s 1 - pre - s 2 - s region which are not found in the specific construct . oligonucleotides from table i which can be used to construct each type of hbv sequence are indicated in the figures . fig . x depicts two additional constructs for expression of peptides including sequence from the pre - s2 region under the control of the mt promoter . constructs have also been made which include the entire bglii - bglii fragment from the hbv genome under the control of the us promoter . these constructs have produced peptides which include a deletion in the s region as indicated by western blot analysis . the above - cited promoters are specially preferable when their use is coupled with a modulation method using the dhfr gene and methotrexate to enhance the expression . this is achieved when in addition to the selection marker the dhfr minigene is also introduced into the plasmid sequence . it is essential that the dhfr gene is located on the same plasmid together with the structural gene to be expressed . an enhancement of the expression rate of the structural gene can then be obtained by adding methotrexate in the micromolar concentration range . thereby a manyfold enhancement of the expression rate is achieved . suitable cells are e . g . vero cells ( monkey kidney cell line ), 3t3 - cells ( murine fibroblast line ), c127 - cells ( murine fibroblast line ), l - cells and cho - cells ( chinese hamster cells , which are either positive or negative in dehydrofolate reductase ). as a stop signal it is preferred to use a stop signal from a eukaryotic cell . preferably the stop signal of the caseine dna - sequence is used . as used throughout the following examples , &# 34 ; hbv protein &# 34 ; refers generically to any protein produced in accordance with the present invention which corresponds to hbsag sequences . the supernatant of hbv protein producing cultures was collected and split into portions of 2 , 400 ml . to each portion 144 g of peg 6000 ( serva ) were added and dissolved by stirring at room temperature for 20 minutes and was stirred for another 6 hours at 4 ° c . the precipitate was separated by centrifugation in 500 ml bottles un a gs 3 rotor at 9 , 000 rpm ( 15 , 000 × g ) for 30 minutes at 10 c . the supernatant was collected and 144 g of peg 6000 were added and dissolved as described above . the solution was stirred at 4 c for 3 hours . the precipitate from this solution was harvested as described above except that centrifugation was continued for 60 minutes . the material obtained after peg precipitation was redissolved in 20 ml pbs and submitted to gel chromatography on a - 5 m ( biorad ). column dimensions were 25 × 1000 mm and 480 ml bed volume . in a typical fractionation run 1 , 000 ug of peg precipitated hbv protein in 10 to 15 ml was loaded and eluted with pbs at a speed of 6 drops / min ( 18 ml / h ) 3 ml fractions were collected . hbv protein eluted with the first peak . collected fractions were submitted to a cscl gradient . about 30 fractions covering the first peak in column chromatography on a - 5m and containing prepurified hbv protein were collected to approximately 100 ml . this solution was adjusted to a density of 1 . 30 g / cc with cscl and subsequently transferred to a nitrocellulose tube fitting into a sw 27 / 28 rotor ( beckman ). a gradient was set by underlaying 4 ml of a cscl solution of 1 . 35 g / cc and by overlaying 4 ml of 1 . 25 g / cc followed by 4 ml of 1 . 20 g / cc density . this gradient had been run at 28 , 000 rpm for 50 hours at 10 c . thereafter the gradient was fractionated and purified hbv protein floating in the 1 . 20 g / cc density layer was collected . the solution was desalted by three cycles of dialysis in bags against water . in the ausria ii - 125 &# 34 ; sandwich &# 34 ; radioimmunoassay ( commercially available from abbot ), beads coated with guinea pig antibody to hepatitis b surface antigen ( anti - hbs ) were incubated with serum or plasma or purified protein and appropriate controls . any hbsag present was bound to the solid phase antibody . after aspiration of the unbound material and washing of the bead , human 125t - anti - hbs was allowed to react with the antibody - antigen complex on the bead . the beads were then washed to remove unbound 125 i - anti - hbs . the radioactivity remaining on the beads was counted in a gamma scintillation counter . in the enzygnost hbsag micro &# 34 ; sandwich &# 34 ; assay ( commercially available from behring ), wells were coated with anti - hbs . serum plasma or purified protein and appropriate controls were added to the wells and incubated . after washing , peroxidase - labelled antibodies to hbsag were reacted with the remaining antigenic determinants . the unbound enzyme - linked antibodies are removed by washing and the enzyme activity on the solid phase is determined . the enzymatically catalyzed reaction of hydrogen peroxide and chromogen was stopped by adding diluted sulfuric acid . the colour intensity was proportional to the hbsag concentration of the sample and was obtained by photometric comparison of the colour intensity of the unknown samples with the colour intensities of the accompanying negative and positive control sera . the plasmid pbpv - 342 - 12 ( commercially available from atcc ) was digested with the endonucleases bglii and bamhi . three dna molecules were generated . the fragment of interest contains the methallothionein promoter and a pbr322 sequence comprising 4 . 5 kb and is easily detectable from the other fragments ( 2 . 0 kb and 7 . 6 kb ). the reaction was performed in a total volume of 200 ul of reaction buffer at a final concentration of 0 . 5 ug / ul dna including 100 units of each restriction enzyme . the completion of the digestion was checked after incubation at 37 ° c . for three hours by agarose gel electrophoresis at a 0 . 8 % agarose gel . the reaction was stopped by adding 4 ul 0 . 5 m edta . the 4 . 5 kb fragment was separated from the other fragments by preparative 1 . 2 % agarose gel electrophoresis . the dna was eluted from the agarose gel on de - 81 whatman filter paper from which the dna was removed in a high salt buffer . the dna was purified by a phenol / chloroform extraction and two ethanol precipitations . a 2 . 3 kb bglii - bglii fragment containing the hbv pre - s 1 , pre - s 2 and s coding regions was isolated from hbv - containing dna . the 2 - 3kb fragment was ligated together with the 4 . 5 kb fragment ( obtained as described in c1 ) containing the methallothionein promoter . 2 ul of the 2 . 3 kb fragment were mixed with 3 ul of the 4 . 5 kb fragment and ligated together in a total volume of 10 ul ligation buffer , containing 2 units t 4 - dna ligase and a atp at 14 ° c . overnight . the ligation mixture was added to 150 ul competent bacterial cell suspension for dna up - take . after the dna up - date the bacterial cells were spread on lb agar plate containing 50 ug / ml ampicillin at volumes of 50 to 300 ul cell suspension per plate . the agar plates were incubated at 37 ° c . overnight . single isolated bacterial colonies were screened for the presence of a plasmid containing the desired fragments . single colonies were picked with a toothpick and transferred to a lb - ampicillin media containing tube ( 5 ml ). the tubes were incubated overnight at 37 ° c . by shaking rapidly . a mini - plasmid preparation of each grown bacterial suspension was made . the different resulting dnas were proved by digestion with the restriction endonuclease ecori . two molecules were expected , a 2 . 2 kb fragment and a 4 . 6 kb fragment . the digestion was analysed by agarose gel electrophoresis . plasmid dna was isolated from the bacterial cells . the plasmid resulting from ( 3 ) above was digested with the endonucleases bglii and xbai . two molecules were expected , one 550 bp fragment and one 6 . 250 kb fragment which was isolated after agarose gel electrophoresis . the 6 . 250 kb fragment was ligated together with oligomecleotide no . 55 from table i . the ligation mixture was added to 150 ul competent bacterial cell suspension for dna up - take . single isolated bacterial colonies were screened for the presence of the desired plasmid . the new plasmid was proved by a digestion with the endonucleases ecori and bglii . two molecules were expected , one 1 . 9 kb and one 4 . 450 kb . the plasmid resulting from ( 4 ) above was linearized by digestion with the restriction enzyme ecori . the reaction was performed in a total volume of 50 ul and a final concentration of l ug / ul plasmid dna . 50 units of ecori were added and the digestion was proved after incubation at 37 ° c . for three hours by agarose gel electrophoresis . the reaction was stopped by adding 1 ul of 0 . 5 m edta and the dna was precipitated with a final concentration of 0 . 3 m sodium acetate and 3 - 4 volumes of ethanol at - 80 ° c . for 30 minutes . the precipitated dna was dissolved in 50 ul distilled water . 2 ul of the linearized plasmid were mixed with 3 ul of the dna fragment containing the methallothionein promoter and the neomycin selection gene ( isolated from the plasmid pmt - neo - e ( available from atcc ) by digestion with the endonuclease ecori as a 4 kb fragment ], and ligated together . single bacterial colonies were screened for the presence of the desired plasmid . the plasmid pdhfr3 . 2 ( available from atcc ) was digested with the restriction endonuclease hindiii . two molecules were generated , one of 3 , 000 bp containing the dhfr gene sequence and one of 3 , 400 bp . the 3 , 000 bp fragment was isolated and ligated into the plasmid resulting from ( 5 ) above which was previously opened by digestion with hindiii . the resulting plasmid is represented by fig . i - 2 . the plasmid puc - 8 - 42 ( available from exogene ) was digested with the restriction endonucleases ecori and apai . two dna molecules were generated . the fragment of interest contains the u2 - promoter comprising 340 bp and is easily detectable from the other fragment ( 3160 bp ). the digestion was performed in a total volume of 200 ul of reaction buffer at a final concentration of 0 . 5 ug / ul dna including 100 units of each restriction enzyme . the completion of the digest was checked after incubation at 37 ° c . for three hours by agarose gel electrophoresis in a 0 . 7 % agarose gel . the reaction was stopped by adding 4 ul 0 . 5 m edta . the 340 bp fragment was separated from the plasmid dna by preparative 1 . 2 % agarose gel electrophoresis . the dna was eluted from the agarose gel on de - 81 whatman filter paper from which the dna was removed in a high salt buffer . the dna was purified by a phenol / chloroform extraction and two ethanol precipitations . 2 ) insertion of the fragment containing the promoter sequence into a polylinker plasmid . the plasmid psp165 ( commercially available from promega biotec ) containing a polylinker sequence ( containing the following restriction sites : ecori , saci , smai , avai , bamhi , bglii , sali , psti , hindiii ) was linearized with the restriction enzyme ecori . the reaction was performed in a total volume of 50 ul and a final concentration of 1 ug / ul plasmid dna . 50 units of ecori were added an the digestion was proved after incubation at 37 ° c . for three hours by agarose gel electrophores . the reaction was stopped by adding 1 ul of 0 . 5 m edta and the dna was precipitated with a final concentration of 0 . 3 m sidium acetate and 3 - 4 volumes of ethanol at - 80 ° c . for 30 minutes . the precipitated dna was dissolved in 50 ul distilled water . 2 ul of plasmid dna were mixed with 10 ul of the fragment dna containing the v2 promoter sequence , and ligated together in a total volume of 25 ul of ligation buffer containing 2 units t4 - dna ligase and 2 mm atp at 14 ° c . overnight . thereafter the dna was purified by phenol / chloroform extractions followed by two ethanol precipitations and dissolved in 10 ul distilled water . the resulting sticky ends of ecori and apai had to be converted into blunt ends and ligated . the blunt ends were converted by a removing reaction with the mung bean nuclease as follows : to 25 ul dna ( 1 ug / ul concentration ) reaction buffer , 20 units of enzyme and a final concentration of 1 % glycerol to the reaction volume of 35 ul were added . after an incubation for 30 minutes at 30 c the dna was purified by phenol / chloroform extractions followed by two ethanol precipitations . the dna was dissolved again in 5 ul distilled water . the resulting blunt ends were ligated together in 15 ul reaction volume containing 10 × more t4 ligase then used above and 2 mm atp at 14 ° c . overnight . the ligation mixture was added to 150 ul competent bacterial cell suspension for dna up - take . after the dna up - take the bacterial cells were spread on lb agar plates containing 50 ug / ml ampicillin at volumes of 50 to 300 ul cell suspension per plate . the agar plates were incubated at 37 ° c . overnight . single isolated bacterial colonies were screened for the presence of a plasmid containing the desired u2 - promoter fragment . single colonies were picked with a toothpick and transferred to a lb - ampicillin containing tube ( 5 ml ). the tubes were incubated overnight at 37 ° c . by shaking rapidly . a mini plasmid preparation of each grown bacterial suspension was made . the different resulting plasmid was proved by digestion with both restriction endonucleases ecori and hindiii . two molecules were found , a 400 bp fragment containing the u2 promoter sequence and the plasmid of 2 , 700 bp . the digestion was analysed by agarose gel electrophoresis . the resulting plasmid was isolated from the bacterial cells . the plasmid pbpv - 342 - 12 ( commercially available from atcc ) was digested with the endonucleases ecori and bamhi . two molecules were isolated , one containing the mt promoter together with the neomycin selection gene of 4 , 000 bp and the plasmid of 10 , 000 bp . the plasmid resulting from ( 3 ) above was linearized with ecori and ligated together with the 4 , 000 bp fragment containing the mt - promoter together with the neomycin selection gene . the resulting sticky ends were also converted into blunt ends and ligated together as described above . after bacterial transformation , colony selection and mini plasmid preparation , the resulting plasmids were analysed by a digestion with the restriction enzymes ecori and hindiii . two dna molecules were isolated , a 400 bp fragment and a 6 , 700 bp fragment . the plasmid resulting from ( 4 ) above was linearized with bglii . the 2 . 3 kb - bglii - bglii fragment was ligated together with the linearized plasmid . bacterial colonies were analysed to find the resulting plasmid . the plasmid - dna was digested with ecori and two resulting fragments were obtained , a 700 bp fragment ( containing the promoter and a part of the hbv - sequence ) and a 8 , 700 bp fragment ( containing the rest of the hbv - sequence , mt - neo and plasmid ). the plasmid resulting from ( 5 ) above was digested with the endonucleases bglii and mstii . two molecules were generated , one of 300 bp containing part of the pre - s sequence and the other ( 9 , 100 bp ) which was eluted as described above . this 9 , 100 bp fragment was ligated to another bglii / mstii 216 bp fragment the desired plasmid was digested with ecori and two resulting fragments were isolated , a 616 bp fragment and a 8 , 700 bp fragment . the h2k promoter was isolated as an ecori / bglii fragment ( 2kb ) from psp65h2 ( available from exogene ). the fragment containing the methallothionein promoter and the egpt - selection gene was isolated by digestion of the plasmid pmsg ( available from pharmacia ) with the restriction enzyme ecori as a 3 . 6 kb fragment . all other plasmid constructions were made in similar ways by combining fragments containing the necessary components and employing desired oligonucleotides and adapter sequences ( where necessary ). in order to achieve secretion of substantial amounts of the hbv peptides encoded by constructs of the present invention , mammalian cells must be transfected with both the construct of the present invention and a construct which will express entire s protein . the cotransfection was performed in two steps ( i . e ., a separate transfection for each construct ) or in a single step ( i . e ., one transfection using preparation of both constructs ). cotransfection was confirmed either by use of different selection markers on the two constructs or by detection of secretion of expression products of both constructs by immunoassay . alternatively , a sequence encoding the hbv peptide sequence of the present invention and a separate sequence encoding the entire s protein could be combined in a single construct . general procedures useful in practicing the present invention may be found in ( 1 ) methods of enzymology , volume 152 , &# 34 ; guide to molecular cloning techniques ,&# 34 ; ed . berger and kimmel ( academic press 1987 ), and ( 2 ) maniatis et al ., &# 34 ; molecular cloning : a laboratory manual ,&# 34 ; ( cold spring harber laboratory 1982 ), both of which are incorporated herein in their antirety by reference . specific techniques employed are described below . the restriction endonucleases used were : bglii , bamhi , hindiii , ecori , xbai , mstii , xhoi , pflmi , commercially available from gibco / brl with their respective restriction buffers ( 10z ). unless otherwire indicated , restriction digests were performed and fragments were isolated as follows . reactions typically contained 1 - 5 ug dna . distilled water was added to the dna in an eppendorf tube to a final volume of 8 ul 1 ul ( containing 5 - 10 u ) restriction enzyme was added and mixed carefully the reaction tube was incubated for 1 hour at 37 ° c . digestion was stopped by adding 0 . 5 m edta ( ph 8 . 0 ) to a final concentration of 10 mm if the dna was analysed directly on a gel , 1 ul of gel - loading dye iii ( maniatis ) was added , mixed and the sample was loaded into the slots of a 0 . 8 % agarose gel . the agarose gel normally contains 0 . 8 % agarose 1 × running buffer ( tbe , maniatis ). where a fragment ( about 100 - 1000 bp ) was isolated from an agarose gel the agarose was increased to 1 . 2 to 1 . 4 %. from a dense overnight culture , 1 ml of the bacterial cell suspension was added to 100 ml fresh growth medium ( l - broth ). the cells were grown at 37 ° c . to a density of od 600 = 0 . 7 which was reachad within 2 hours with vigorous shaking in a 500 ml erlenmeyer flask . growth was stopped by chilling the culture on ice for 10 minutes . from this culture , 3 ml were taken for harvesting the exponential bacterial cells at 3 , 000 rpm for 5 minutes . the cells were resuspended in 1 . 5 ml of 50 mm cacl 2 in 10 mm tris , ph 8 . 0 , and incubated on ice for another 15 minutes . the cells were harvested once more by centrifugation at 3 , 000 rpm for 5 minutes and resuspended in 200 ul of 50 mm cacl 2 in 10 mm tris , ph 8 . 0 , and used directly . the dna to be transformed was suspended in 10 mm tris , ph 7 . 5 , 1 mm edt 70 ul and added to the 200 ul bacterial cell suspension for dna take - up . the mixture was incubated on ice for 30 minutes and then 1 ml l - broth was added . the mixture was incubated at 42 ° c . for 2 minutes and at 37 ° c . for 40 minutes . after the incubation , the cells were spread on agar plates containing 50 ug ampicillin / ml agar at volumes of 50 - 300 ul cell suspension per plate . the agar plates were incubated at 37 ° c . overnight . after this incubation period , single isolated bacterial colonies were formed . 1 liter of plasmid - bearing cells was grown to 0 . 5 od 600 in l - broth and amplified for 20 hours with 200 ug / ml chloramphenicol . the culture was then centrifuged at 4 , 000 rpm for 20 minutes in ja - 10 rotor , 4 ° c . the pellet was resuspended in 18 ml cold 25 % sucrose , 50 mm tris , ph 8 . 0 , transferred to a 250 ml erlenmeyer flask and kept on ice . 6 ml 5 mg / ml lysozyme in 250 mm tris , ph 8 . 0 was added and the mixture was left to stand 10 - 15 minutes . 6 ml 250 mm edta , ph 8 . 0 , was added , mixed gently and incubated for 15 minutes on ice . 30 ml detergent ( 0 . 01 % triton x - 100 ; 60 mm edta , ph 8 . 0 ; 50 mm tris , ph 8 . 0 ) was added and the mixture was incubated for 30 minutes on ice . after incubation , the mixture was centrifuged at 25 , 000 rpm 90 minutes in sw28 rotor , 4 ° c . pronase was added to supernatant fluid to 250 ug / ml and incubated 30 minutes , 37 ° c . the solution was extracted with phenol once with 1 / 2 volume phenol equilibrated with 10 mm tris , ph 8 . 0 , 1 mm edta . the aqueous layer was removed . sodium acetate was then added to a final concentration of 300 mm , followed by the addition of 3 volumes cold 100 % ethanol and thorough mixing . the mixture was stored at - 20 ° c . overnight . the mixture was thawed and centrifuged . the pellet was resuspended in 6 ml 10 mm tris , 10 mm edta , ph 8 . 0 . 9 . 4 g cscl and 0 . 65 ml of 6 mg / ml ethidium bromide were added and the volume was brought up to 10 ml with sterile double - distilled water . the 10 ml alignots were put into beckman heat - sealable gradient tubes and centrifuged , 50 , 000 rpm , 48 hours in ti70 . 1 beckman rotor . plasmid bands were visualized with uv and removed with syringe and 18 gauge needle by piercing the side of the tube . ethidium bromide was removed from the plasmid fractions by 3 successive extractions with equal volumes of isobutanol . fractions were then ( 1 ) dialyzed against one 2 - liter lot of 10 mm tris , ph 7 . 4 , 1 mm edta , ph 7 . 5 , 5 mm nacl for 2 hours or more at 4 ° c . ; and ( 2 ) phenol extracted once with 1 / 3 volume phenol equilibrated as above . sodium acetate was then added to a final concentration of 300 mm , followed by addition of two volumes of 100 % ethanol . precipitate formed at - 20 ° c . overnight , or at - 70 ° c . for 30 minutes . 1 ml of an overnight bacteria culture was put into an eppendorf tube and centrifugated for 20 minutes . the supernatant was removed . 100 ul of 50 mm glucose , 25 mm tris ( ph 8 . 0 ), 10 mm edta ( ph 8 . 0 ) was added to the pellet , mixed by vortex and incubated for 5 minutes at room temperature . 200 ul of 0 . 2 n naoh , 1 % sds was added , mixed by vortex and incubated for 5 minutes on ice . 150 ul 3 m sodium acetate ( ph 4 . 8 ) was added , mixed by vortex and incubated for 5 minutes on ice . after centrifugation for minutes at 13 , 000 rpm the supernatant was decanted into a fresh eppendorf tube . 3 volumes of 100 % ethanol were supplemented , mixed well and incubated for 30 minutes at - 80 ° c ., than centrifuged for 10 minutes at 13 , 000 rpm . the ethanol was removed , the pellet washed with 70 % ethanol , lyophilized and dissolved in 20 ul distilled water . 5 ul of this plasmid dna solution were used directly for restriction analysis . nick translation was performed according to rigby et al ., j . mol . biol ., vol . 113 , pp . 237 - 251 , 1977 , which is incorporated herein by reference . the reaction mixture for 32 p - labeling of dna contained 0 . 5 ug of a hbv fragment , in a total volume of 30 ul with 50 mm tris , ph 7 . 8 , 5 mm mgcl 2 , 10 mm mercaptoethanol , 0 . 1 mm datp , 0 . 1 mm dgtp , 0 . 1 mm dttp , 50 uci 32 p - dctp , 10 units dna polymerase i , 3 ul of a 2 × 10 - 5 fold dilution of 1 mg / ml dnase i and is incubated for 90 minutes at 15 ° c ., yielding 3 × 10 6 to 12 × 10 6 total cpm , i . e . 1 × 10 to 5 × 10 7 cpm / ug dna . to characterize the organization within the host cell genome of the vectors of this invention , chromosomal dna from cell lines producing particles of this invention - were isolated and digested with the appropriate restriction enzyme ( s ) and analysed by the method of southern ( j . mol . biol ., vol . 98 , pp . 503 - 517 , 1975 ), which is incorporated herein by reference , using a 32 p - labeled dna probe . following digestion of the chromosomal dna ( 20 ug ) with the restriction enzyme bglii , the resulting fragments were separated by 0 . 7 % agarose gel electrophoresis , thereafter , the dna was denatured by exposing to 366 nm uv light for 10 minutes and by incubation in a solution of 0 . 5 m naoh and 1 m nacl for 45 minutes . the gels were neutralized by incubation in 0 . 5 m tris , 1 . 5 m nacl , ph 7 . 5 for 60 minutes . the dna was transferred to a nitrocellulose filter by soaking in 3 m nacl , 0 . 3 m sodiumcitrate ( 20 × ssc ) for 20 hours through the gel by covering the top of the nitrocellulose filter with a staple of dry paper towels . the nitrocellulose filter was kept for 2 hours in a vacuum oven at 80 c . a radioactive dna probe from the bglii fragment of the phbv ( 2 . 3 kb ) was prepared by nick translation . for hybridization with the dna probe , the nitrocellulose filter was sealed in a plastic bag containing 10 ml of prehybridization mixture : 50 % formamide , 5 × ssc , 50 mm sodiumphosphate , ph 7 . 0 , 5 × denhardt &# 39 ; s solution , 250 ug / ml denatured salmon sperm dna . the filter was incubated in this mixture for 4 hours at 45 ° c ., after which the pre - hybridization mixture was replaced by the hybridization mixture : 50 % formamide , 5 × ssc , 20 mm sodiumphosphate , ph 7 . 0 , 1 × denhardt &# 39 ; s solution , 100 ug / ml denatured salmon sperm dna , 5 × 10 cmp / ml 32 p - probe . the filter , after incubating in the hybridization mix for 13 hours at 45 ° c ., was washed three times , 5 minutes each , in 0 . 1 × ssc , 0 . 1 % sds at 50 ° c . the filter was dried at 60 ° c . for 10 minutes and exposed to two x - ray films ( xar - 5 , kodak ) between two intensifying screens and kept at - 80 ° c . the first x - ray film is developed after 3 days &# 39 ; exposure ; the second film after 7 days , exposure . the recipient cells ( c127 or cho - cells available from atcc ) were seeded in normal growth medium ( dmem + 10 % fetal calf serum , glycose and glutamin ) into petri - dishes ( 1 - 2 × 10 6 cells per dish , ¢ 10 cm ) at day 1 . the next day the medium was removed ( 4 hours before the dna precipitate was added onto the cells ), and the cells were washed twice with 1 × pbs . then 8 ml dmem without fcs were added . 4 hours later the dna precipitate ( prepared as described billow ) was added to the cells . again after 4 hours the medium was removed , 3 ml of glycerol - mix ( 50 ml 2 × tbs buffer , 30 ml glycerol , 120 ml distilled water ) were added . the glycerol - mix was immediately removed after an incubation at 37 ° c . for 3 minutes and the cells were washed with 1 × pbs . the cells were cultivated overnight with 8 ml of dmem with 10 % fcs . after 48 hours , the calls were recovered from the dish by treating with trypsin - edta - solution ( 0 . 025 % trypsin + 1 mm edta ). afterwards , to remove the trypsin - edta the cells were washed with 1 × pbs , suspended in dmem with 10 % fcs and distributed into 24 costar - well - plates ( cells from one dish into four 24 - well - plates ). when the cells had grown wall , selection medium was added ( concentration 0 . 5 - 1 mg / ml of neomycin , or xanthine : 250 μg / ml , hypoxanthine : 15 μg / ml ( or adenine : 25 μg / ml ), thymidine : 10 μg / ml , aminopterine 2 μg / ml mycophenolic acid : 25 μg / ml for eco - gpt , for example ). the medium was changed every week . the first growing cell colonies were seen after 2 weeks . to 10 ug of plasmid dna and 20 ug of carrier - dna ( salmon - sperm dna , calf - thymus dna ) te - buffer ( 10 mm trix - hcl , 1 mm edta , ph 7 . 05 ) was added to a final volume of 440 ul and mixed together with 60 ul 2 m cacl 2 . then the same amount of 2 × tbs ( hepes 50 mm , nacl 280 mm , na 2 hpo 4 1 . 5 mm , ph 7 . 05 ) was added and mixed well . the precipitation solution was incubated for 30 minutes at 37 ° c . and added directly to the cells which should be transfected . the selected cells are treated for further cultivation in normal growth medium as described in section 8 . to the desired concentration of antigen particles suspended in sterile saline , 1 : 10 , 000 volume thimerosol , 1 / 10 volume of filter - sterilized 0 . 2 m al k ( so4 ) 2 : 12 h 2 o were added . the ph was adjusted to 5 . 0 with sterile 1 n naoh and the suspension was stirred at room temperature for 3 hours . the alum - precipitated antigen was recovered by centrifugation for 10 minutes at 2 , 000 rpm , resuspended in sterile normal saline containing 1 : 10 , 000 thimerosol and aliquoted under sterile conditions . tables iii - x give some of the results of elisa analysis of immunogenic particles of the present invention as described below : table iii : shows the elisa data of the purified hbs antigen particle produced from any hbv sequence construct of the present invention including the pre - s 1 region with total deletion of pre - s 2 and deletions upstream of the pre - s 2 atg and the s region with deletion of the s atg and downstream the s atg through the xbai site ( e . g . the construct of fig . i - 1 ) with the anti - pre - s 1 monoclonal antibody ma 18 / 7 . the fractions 9 - 15 ( fig . xi ) were pooled after cscl sedimentation . table iv : shows the elisa data of the purified hbs antigen particle produced from any hbv sequence construct of the present invention including the pre - s 1 region with total deletion of pre - s 2 and deletions upstream of the pre - s 2 atg and the s region with deletion of the s atg and downstream the s atg through the xbai site ( e . g ., the construct of fig . i - 1 ) with the anti - pre - s 2 monoclonal antibody mq 19 / 10 . the fractions 9 - 15 ( fig . xi ) were pooled after cscl sedimentation . table v : shows the elisa data of the purified hbs antigen particle produced from an hbv sequence construct of the present invention including the pre - s 2 region with none of the pre - s 1 region and deletions upstream of the s atg and downstream of the s atg through the xbai site , and the s region with deletion of the s atg ( e . g . the construct of fig . ii - 1 ). with the anti - pre - s 1 monoclonal antibody ma 18 / 7 . the fractions 9 - 15 ( fig . xii ) were pooled after cscl sedimentation . table vi : shows the elisa data of the purified has antigen particle produced from an hbv sequence construct of the present invention including the pre - s 2 region with none of the pre - s 1 region and deletions upstream of the s atg and downstream of the s atg through the xbai site , and the s region with deletion of the s atg ( e . g . the construct of fig . ii - 1 ) with the anti - pre - s 2 monoclonal antibody mq 19 / 10 . the fractions 9 - 15 ( fig . xii ) were pooled after cscl sedimentation . table iii______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 18 / 7______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 839______________________________________ table iv______________________________________ elisa meaaurementcscl - gradient monoclonal antibody mq 19 / 10______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 000______________________________________ table v______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 18 / 7______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 000______________________________________ table vi______________________________________ elisa measurementcscl - gradient monoclonal antibody mq 19 / 10______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 1 . 028______________________________________ table vii : shows the elisa data of the purified hbs antigen particle produced from any hbv sequence construct of the present invention including the pre - s 1 region with total deletion of pre - s 2 and deletions upstream of the pre - s 2 atg and the s region with deletion of the s atg ( e . g ., the construct of fig . vi - 2 ) with the anti - pre - s 1 monoclonal antibody ma 18 / 7 . the fractions 9 - 15 ( fig . xi ) were pooled after cscl sedimentation . table viii : shows the elisa data of the purified hbs antigen particle produced from any hbv sequence construct of the present invention including the pre - s 1 region with deletions upstream of the pre - s 2 atg with deletion of the s atg ( e . g ., the construct of fig . vi - 4 ) with the anti - pre - s 2 monoclonal antibody mq 19 / 10 . the fractions 9 - 15 ( fig . xi ) were pooled after cscl sedimentation . table ix : shows the elisa data of the purified hbs antigen particle produced from an hbv sequence construct of the present invention including the pre - s 2 region with none of the pre - s 1 region and deletions upstream of the s atg and the s region with deletion of the s atg ( e . g ., the construct of fig . vii - 2 ) with the anti - pre - s 1 monoclonal antibody ma 18 / 7 . the fractions 9 - 15 ( fig . xii ) were pooled after cscl sedimentation . table x : shows the elisa data of the purified hbs antigen particle produced from an hbv sequence construct of the present invention including the pre - s 2 region with deletions upstream of the s atg with deletion of the s atg ( e . g ., the construct of fig . vii - 4 ) with the anti - pre - s 2 monoclonal antibody mq 19 / 10 . the fractions 9 - 15 ( fig . xii ) were pooled after cscl sedimentation . table vii______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 18 / 7______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 1 . 273______________________________________ table viii______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 19 / 10______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 000______________________________________ table ix______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 18 / 7______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 000______________________________________ table x______________________________________ elisa measurementcscl - gradient monoclonal antibody mq 19 / 10______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 985______________________________________ table xi shows the elisa data of purified hbs antigen particles produced by construct including the entire pre - s 1 - pre - s 2 - s region under control of the ltr region of rous sarcoma virus after stimulation with stimulating substances ( e . g . pma ) and the additional cotransfection with s ( fig . xiii ). table xi______________________________________ elisa measurementcscl - gradient monoclonal antibody ma 18 / 7______________________________________fraction no . 9 - 15 ( pooled ) e . sub . 492 = 0 . 125______________________________________ fig . xiv shows the characterisation of the particles derived from gene constructs according to table iii ( fig . i - 1 ) and table v ( fig . ii - 1 ) cotransfected in c127 after purification in the cscl gradient . the fraction collected had a smaller volume . table xii shows the serotyping of particles according to fig . i - 1 having the s sequence done in the pettenkofer institute . from the foregoing , it will be obvious to those skilled in the art that various modifications in the above - described compositions and methods can be made without departing from the spirit and scope of the invention . accordingly , the invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof . present embodiments , therefore , are to be considered in all respects as illustrative and not restrictive , the scope of the invention being indicated by the appended claims rather than by the foregoing description , and all changes which come within the meaning and range of equivalency of the claims are therefore intended to be embraced therein .

US-25854994-A

aspects of the present disclosure are directed to providing flexible and efficient communication by dynamically adjusting a transmit data rate in response to data status feedback . such feedback may include information regarding data errors and / or latency . a first communication node communicates with a second communication node and sends data at an initial data rate . the transmit data rate is then selectively adjusted based on data status feedback received from the second communication node or other destination .

fig1 is a functional block diagram of two illustrative communication nodes 100 , 112 coupled via a network 106 . the first communication node 100 as shown includes a transmitter 104 , a receiver 103 , a processor 102 , and a memory 101 . the second communication node 100 as shown includes a transmitter 114 , a receiver 115 , a processor 113 , and a memory 111 . the first communication node 100 may stand alone or be part of a device such as a personal computer , video game unit , video player , audio player , digital consumer electronics device , cellular phone or other type of telephone , and / or personal digital assistant ( pda ). the first communication node 100 may be implemented as hardware , software in the form of computer - executable instructions stored on one or more computer - readable media , and / or firmware , in the form of one or more separate modules . one or more additional communication nodes ( not shown ) may also be coupled to the network 106 . the description of the first communication node 100 above and throughout this specification may , depending upon the particular embodiment , apply to any or all of the other communication nodes , including the second communication node 112 . the network 106 may be configured in any fashion that allows bi - directional communication between the first communication node 100 and the second communication node 112 , including , but not limited to , an internet protocol ( ip ) network such as the internet , a wired network , a wireless network , a telephone landline network , a cellular phone network , a local area network ( lan ), a wide area network ( wan ), a satellite network , and / or a proprietary network . in addition to being coupled together via the network 106 , the first communication node 100 and the second communication node 112 may also have a direct connection between them . like the first communication node 100 and the second communication node 112 , any or all of the nodes coupled to the network 106 may be configured to communicate with any or all of the other nodes coupled to the network 106 , as desired . as also shown in fig1 , data 107 is transmitted from the first communication node 100 and received as data 108 by the second communication node 112 , and data 110 is transmitted from the second communication node 112 and received as data 109 by the first communication node 100 . data 107 , 108 , 109 , and 110 may each be any type of data , including , but not limited to , ascii data , html data , binary data , picture data , audio data , and / or video data . additionally , the data may or may not be real - time data . fig2 shows an example of data 107 being a real - time video data transmission . in this example , data 107 may be organized in a conventional manner as a time series of video frames 205 a - 205 f that are transmitted from transmitter 104 of communication node 100 . data 108 also includes a time series of video frames 206 a , b , c , e , f that each correspond to a different one of the video frames 205 a , b , c , e , f . displaying the video and / or audio corresponding to the data making up each frame 205 or 206 in sequence creates an audiovisual presentation . ideally , data 107 and data 108 contain the same data content ( e . g ., the same video data content ). however , due to various errors and / or delays that may occur , this may not always be the case . it should be noted that video data may be in a variety of known formats that are not necessarily organized in the manner illustratively shown ; any data format may be used herein . fig2 shows a few problems that may cause video frames 205 to differ from video frames 206 : missing video frames 203 , corrupted video frames 202 , and high latency 204 . in the present example , a missing frame 203 occurs when data corresponding to an entire video frame ( in this case , video frame 206 c ) fails to arrive at the receiver 115 in a timely fashion . this includes video frames that never arrive at the destination , or highly latent video frames as discussed below . missing video frames may be caused by , for example , the network 106 reaching a maximum bandwidth such that there is simply no more room for a particular video frame or other piece of data to be sent over the network 106 . a data error 202 in this example occurs when a portion of a particular video frame is missing or corrupted . for example , a video frame may be transmitted in the form of a plurality of network packets containing video data and one or more error - checking packets containing data that is the exclusive - or of the video data . in this case , since there is some data redundancy built in , when one or more of the video data packets is missing or corrupted , the video frame can correct the missing data or corrupted data from the other packets . data errors may result from , e . g ., such as noise and / or intermittent bandwidth limitations . another type of problem that may occur in transmitting data 108 is high latency 204 . latency between a source and a destination is the delay between the time when a given piece of data leaves a source and when it arrives at the destination . in this example , latency may be measured such that the destination is the network 106 ( or some point within the network 106 ) or the second communication node 112 . latency may be measured at any data level , such as on a frame - by - frame , packet - by - packet , or byte - by - byte basis . there is always some latency that occurs in any normal transmission . for example , it may be expected that there is a normal latency 200 that occurs when one of the video frames 205 is transmitted through the network 106 until it arrives as one of the video frames 206 at the second communication node 112 . high latency occurs when the delay exceeds than the normal latency 200 . the normal latency may be considered a single threshold value or a range of normal values . for example , a high latency 204 is shown in fig2 , where the amount of time that it takes for transmitted video frame 205 f to arrive at the second communication node 112 as received video frame 206 f is higher than normal . unexpectedly high latency may cause substantial problems , especially in real - time communications scenarios . sufficiently high latency may cause data to be dropped even though it may be eventually received , because the late data may no longer considered relevant by the time it reaches its destination . even where latency is high , yet not high enough to trigger actual problems such as dropped video frames , such high latency is often a good predictor of whether data errors are imminent . although the previous example was directed to a video frame scenario , similar problems may occur in connection with any type of data transmission . in general , data errors may occur , which include missing and / or corrupted data , and high latency may occur . either of these problems may be caused by the transmission being sent at such a data rate that more bandwidth is required than is available or advisable . this often occurs where the available bandwidth that the network 106 allocates at any given time to the transmission of data 107 is close to , or even less than , the actual bandwidth used by the transmission . the available bandwidth may depend upon a variety of factors , such as a service level agreement between the provider of the network 106 ( or the provider of access to the network 106 ), the current usage level of the network 106 , and / or noise on the network 106 and / or any connections to the network 106 . for example , assume that data 107 is being transmitted into network 106 at a transmission data rate , and network 106 is able to transfer data 107 across the network 106 at up to a higher network data rate . if the network data rate is substantially higher than the transmission data rate , then very few data problems should be expected . however , if the network data rate is only slightly higher than the transmission data rate , then occasional data errors and / or high latency may become more likely . if the network data rate is lower than the transmission data rate , then data errors and / or high latency become much more likely . because the network data rate ( i . e ., the maximum bandwidth that the network 106 is presently able to provide for the transmission of data 107 through the network 106 ) may change over time and / or is unknown , it may be desirable to adjust the transmission data rate . adjustment of the transmission data rate may depend upon the network data rate . however , since the network data rate is not necessarily known to the first communication node 100 , it may be desirable to provide information about whether the transmission of data 107 is successful , contains an error , or is excessively latent . in other words , it would be useful to provide feedback regarding the status of the transmission of data 107 into and / or through the network 106 and / or of the data 108 as received by the second communication node 100 . such data status may be provided by the second communication node 112 . for instance , the receiver 109 of the second communication node 112 may receive data 108 , and the processor 113 would analyze the received data 108 for latency and / or data errors . based on this analysis , the processor 113 would control the transmitter 114 to transmit data 110 , which would contain the data status that is received in data 109 by the receiver 103 of the first communication node 100 . there are various known ways of measuring data errors and latency of received data , and any of these methodologies may be used . referring to the flowchart of fig3 , the first communication node 100 relies on data status that is fed back to the first communication node 100 , to control the transmission rate of data 107 . the data status includes information about data errors and / or latency . fig3 is a flow chart showing illustrative steps that may be taken to adjust the data rate of video data 107 being transmitted from the first communication node 100 to the second communication node 112 based on the data status . fig3 may apply to a data transmission from any communication node to any one or more other communication nodes . the data rate may be adjusted in order to maximize the data rate , to maximize stability of the transmission , or for any other reason . initially , in step 300 , the processor 102 controls the transmitter 104 to begin transmission of the video data at a first data rate . the first data rate may be a predetermined minimum data rate , or the first data rate may be a predetermined data rate greater than the minimum possible data rate . the first data rate may be set exclusively by the first communication node 100 or in accordance with an agreement protocol between the first communication node 100 , the network 106 , and / or the second communication node 112 . for example , the first data rate may be set to 100 kbps . next , in step 301 , the transmitter 104 maintains the first data rate for a certain period of time , which will be referred to hereinafter as the “ monitoring period .” during the monitoring period , the processor 102 monitors the data status contained in feedback data 109 received by the receiver 103 . referring to the example of fig2 , the data status may include information regarding missing frames 203 , corrupted video frames 202 , latency 200 , 204 , and / or any other type of information regarding the success and / or failure of transmitting the data 107 and receiving the corresponding data 108 at the other side of the network 106 . the data status may be generated by the second communication node 112 , by the network 106 , or by some other data / network monitoring device . the data status is sent to the first communication node 100 through the network 106 or via some other path . in the shown example , the data status is sent as data 110 from the transmitter 114 of the second communication node 112 and received as data 109 at the receiver 103 of the first communication node 100 . the duration of each monitoring period may always be the same or it may vary based on the data status . for example , the monitoring period may initially be about twenty seconds in length and then about five seconds in length for each subsequent monitoring period . where the monitoring period is variable , the monitoring period may be shorter during the initial phase in order to raise the data rate to a more desirable rate relatively quickly . the monitoring period may later become longer responsive to the data rate having reached a threshold rate or depending upon the particular data status . during the monitoring period , the processor 102 listens to the data status that is fed back to the receiver 103 to determine whether a data error and / or high latency has occurred . a data error may be considered to have occurred if any amount of data error occurs at all , or alternatively only if at least a threshold amount of error has occurred . high latency may be considered to have been experienced if at least a threshold amount of latency is experienced . responsive to determining that a data error and / or high latency has occurred , in step 303 the processor 102 controls the transmitter 104 to decrease the transmission data rate of data 107 . the transmission data rate may be decreased to the most recent transmission data rate used previously or by a predetermined decrement to a transmission data rate that may or may not necessarily result in the previous transmission data rate . the amount of the predetermined decrement may be a fixed amount , calculated based on the particular data status , and / or calculated based on some other factor . after a decrease in the transmission data rate , the first communication node 100 starts a new monitoring period where it again monitors the data status . if , however , during the monitoring period , no data errors are detected and the latency remains below a certain threshold , then in step 302 , the processor 102 controls the transmitter 104 to increase the transmission data rate . the transmission data rate may be increased each time by any amount . for example , the transmission data rate may be increased by a fixed increment , by a predetermined amount based on the current transmission data rate , by a predetermined increment based on whether a data error and / or high latency has previously occurred , by an amount based on data from the network 106 and / or the second communication node 112 , and / or by any other amount . after an increase in the transmission data rate , the first communication node 100 again continues the monitoring period , for example every fifth second , in step 301 , where it again monitors the data status . although the method shown in fig3 has been discussed with regard to a specific series of monitoring periods , alternatively the first communication node 100 may always be continuously monitoring the data status . for example , the processor 102 may continuously and simultaneously monitor the data status and adjust the transmit data rate accordingly . as previously mentioned , adjustments of other properties of data 107 may also be made along with adjustments to the transmission rate of data 107 . for instance , where data 107 is video data , the transmitted video quality ( e . g ., resolution , number of colors , video frame rate , and / or any other video quality parameter ) may be based on the data transmission rate . fig4 shows an illustrative lookup table that may be used by the processor 102 to choose a video quality based on the data transmission rate . video quality may be defined using one or more parameters . for example , video quality may be defined by a particular encoding bit rate , video resolution ( e . g ., number of pixels ), video frame rate , and / or color depth ( e . g ., bits per pixel ). any particular data transmission rate 400 or range of data transmission rates may correspond to a particular video quality 401 . in this example , when the data transmission rate is higher , a higher video quality is used , and when data rates are lower , a lower video quality is used . for example , when the data transmission rate is at 100 kbps , the corresponding video quality may be set at 106 . times . 80 pixels per video frame with a video frame rate of 10 frames per second ( fps ). this feature may improve optimization of the video data communication . the lookup table may be used with each change in the data rate or less frequently . alternatively , the processor 102 may choose the video quality or other data property based directly on the data status as received by the receiver 103 . the above - mentioned functionality may be implemented as computer - executable instructions that are part of one or more software applications and / or in the operating system itself , and / or as hardware , and / or as firmware . the computer - executable instructions , in the examples given , may be stored in the memories 101 and / or 111 and may be executed by the processors 102 and / or 113 , as appropriate . for instance , computer - executable instructions for performing the steps described in connection with fig3 may be stored in the memory 101 and executed by the processor 102 . thus , a way to dynamically adjust the data transmission rate of a communication node has been described , based on monitoring the status of the data that has been transmitted . such status may be provided as feedback to the communication node , from the network itself or from the ultimate recipient of the transmitted data . it is also noted that , while the transmission function has been described with reference to the first communication node 100 and the feedback function has been described with reference to the second communication node 112 , both such functions may be performed by both communication nodes 100 , 112 , in a symmetrical communication scenario such as an audio / video chat session . for example , both the first communication node 100 and the second communication node 112 may be transmitting video to each other and receiving video from each other , simultaneously . in this case , each of the communication nodes 100 , 112 would dynamically adjust their respective data transmission rates in response to data status as reported by the other communication node .

US-75882610-A

apparatus including transportation structure for generating elliptically polarized shear waves in soft earth medium . a suitable carrier includes a jack assembly for transporting shear wave apparatus that includes a telescoping tube for earth engagement . the shear wave apparatus , including a major or lower reaction mass and a passive top reaction mass , is raised and lowered by the jack assembly into operative position while the energy - coupling telescoping tube is extendably forced into an earth medium so that , during shear wave generation , the vibration source or reaction mass is continually imparting shear wave energy into the progressively extending telescoping tube to effect continual energy coupling into the surrounding earth medium . the reaction mass is driven by a plural hydraulic actuator system that imparts elliptically polarized vibration to the telescopic tube which , in turn , imparts elliptically polarized shear waves into the surrounding earth medium .

fig1 illustrates in idealized form the manner in which omni - directional vibrator 10 might be mounted on a suitable carrier vehicle 12 , in this case a specialized vehicle such as is commercially available from crane carrier corp . it is preferable that the vibrator 10 be center counted on vehicle 12 so that better weight control is enabled in applying hold - down force . thus , the vibrator 10 is primarily supported on a dual longitudinal frame 14 as the centrally located vibrator 10 couples to the earth through vertical movement of the telescoping tube 16 . the telescoping tube 16 is elongatable to force a generally conical coupling head 18 down through the earth &# 39 ; s surface into energy - coupling relationship with the subsurface earth medium . a jack assembly consists of left and right guide cylinders 20 , 22 as connected by left and right longitudinal support tubes 24 . left and right foot members 26 are connected to left and right guide posts 28 , 30 which are vertically movable to place vibrator reaction mass 32 close to the earth &# 39 ; s surface with tube head 18 inserted therein and elongated into firm earth coupling . fig2 and 4 illustrate the carriage and jack assembly structure in greater detail . thus , the longitudinal dual truck frame 14 consists of opposite side frame members 34 , 36 which support fore and aft transverse tube members 38 and 40 in welded affixure . the front guide cylinders 20 l and 20 r are then secured as by welding to opposite sides of lateral tube 38 , and the rear guide cylinders 22 l and 22 r are secured on opposite sides of rear lateral tube 40 . a quadrature array of guide rods 28 , 30 on the lefthand side and 41 , 42 on the righthand side provide a vertically positionable frame for supporting the vibrator relative to vehicle 12 . positioning of the forward guide rods relative to the guide cylinders is effected by a hydraulic actuator 44 l and 44 r , and each of the rear guide rods 30 and 42 is controlled by a respective hydraulic actuator 46 l and 46 r . the upper end of the respective guide rods receives a cap 48 , 50 , 52 and 54 which form corners for weld affixure to a rectangular frame consisting of structural members 56 , 58 , 60 and 62 ( see fig4 ). a quadrature array of post support beam brackets 64 , 66 , 68 and 70 are secured as by welding to the upper corner surfaces of a top or passive reaction mass 72 in such manner as to allow spaced disposition of the support brackets outward over the top frame and corner caps 48 , 50 , 52 and 54 . as shown in fig2 this may be done as by welding with spacer beams 74 provided at each corner . the top reaction mass 72 is then supported by a quadrature array of vertical posts 76 , left and right , and 78 , left and right , as they are connected top and bottom by upper u - joints 80 l and 80 r and lower u - joints 82 l and 82 r to connect the respective support brackets to the foot members . thus , support brackets 64 - 70 are connected universally to foot member 26 l and post support brackets 66 - 68 are connected to foot member 26 r . further vertical support is connected by means of vertical support rods 83 , l and r , and 85 , l and r . the supports rods 83 and 85 connect between opposite forward and rearward lateral sides of the main vibrator reaction mass 32 and opposite - side frame members 56 and 60 of the top frame . each of the vertical support rods 83 and 85 is connected top and bottom by a suitable universal joint connection to the respective top frame member and bottom reaction mass . the purpose of universal joint connections to the vertical support rods is to allow the reaction masses to translate , but not rotate in horizontal planes . the top reaction mass 72 is further laterally positioned by opposite side air mounts 84 and 86 as secured between first air mount brackets 88 , 90 welded to the underside of reaction mass 72 and air mount brackets 92 , 94 as welded mid - section to respective opposite side frame tubes 56 and 60 . the central area of reaction mass 72 includes an opening 96 over which a cylindrical housing 98 is formed to provide an anchor position for a u - joint 100 that is connected via a cap plate 102 to support the telescoping tube 16 . as shown particularly in fig3 the telescoping tube 16 consists of an outer pivot tube 104 and an inner , concentric telescoping tube 106 which terminates in a conical head 108 . conical head 108 may be reinforced or formed of hardened steel as necessitated by usage , and such as a quadrature array of blades 110 may be employed to enhance earth engagement . the conical sidewall of head 108 subtends an angle of about 25 ° relative to the vertical axis of tube 106 . an upper bronze bearing 112 may be secured around the top collar of telescoping tube 106 for slidable engagement with the inner surface of pivot tube 104 and , in similar manner , a lower bronze bearing 114 may be secured about the inner surface of the lower collar of pivot tube 104 to bear in sliding contact with the outer surface of telescoping tube 106 . the lower portion of pivot tube 104 is inserted through a collar 116 connected to a drive yoke , as will be further described below . a hydraulic actuator 118 is secured axially within pivot tube 104 as at pivot connection 103 to extend an actuator arm 120 into affixure with a securing block 122 secured at a selected point within telescoping tube 106 . thus , operation of hydarulic actuator 118 serves to extend and retract the telescoping tube 106 along its vertical axis . the main reaction mass 32 is further maintained in lateral alignment by means of a quadrature array of air mounts 124 , 126 , 128 and 130 ( see also fig5 ). the air mounts 124 - 130 are arranged generally in opposite side lateral pairs tending to center the reaction mass 32 relative to the support apparatus , i . e ., the jack assemblies consisting of the opposite - side guide cylinder and rod support structures . thus , suitable bracket structures 132 , two per side , are secured as by welding to the foot members 26 , l and r , to extend horizontally inward into connection with respective air mounts 124 - 130 . four inner air mount brackets 134 are welded about the inner periphery of reaction mass 32 for connection to the inner side of the air mounts 124 - 130 . the reaction mass 32 is formed with a snowflake - type , centrally disposed opening 136 which serves to adapt the vibratory energy source for horizontal vibration within the same plane as reaction mass 32 . the opening 136 is formed as a central portion 137 extending into quadrature - spaced diagonal openings 139 , 140 , 142 and 144 in respective corners of the reaction mass 32 . the diagonal openings 139 - 144 provide for disposition of respective electrohydraulic actuators 146 , 148 , 150 and 152 therein . the collar 116 riding around pivot tube 104 is adapted to include a quadrature array of drive flanges 154 , 156 , 158 and 160 which are pivotally connected to respective pivot ends 162 , 164 , 166 and 168 of the respective actuators 146 - 152 . the outer pivot ends 170 , 172 , 174 and 176 are each further pivotally secured to respective corner flanges 178 , 180 , 182 and 184 . the servo valves 186 , 188 , 190 and 192 control the coordinated drive function of the respective actuators 146 - 152 , as will be further described below . fig6 provides an enlarged showing of the actuator 148 , with parts shown in section . thus , actuator 148 consists of a double rod end piston 194 having an outer rod end 196 and the inner rod end 164 as pivotally connected to drive flange 156 . a cylinder 198 having opposite - end cylindrical bearings or packing sleeves 200 and 202 define the central cylinder chamber 204 . ports ( not shown ) provide fluid communication between the associated servo valve 188 and the chamber 204 on opposite sides of piston 194 . an annular insert with seal 206 retains sleeve 202 in sealed , operative position at rod end 164 , and a seal 208 is seated around outer rod end 196 adjacent sleeve 200 . the pivot end 172 is of cylindrical formation and includes a flange 210 that is secured as by bolts to actuator housing 198 around outer seal 208 . actuator position feedback is generated by an lvdt having an axial stem 212 extending into coil bore 214 . each of the quadrature array of linear actuators 146 - 152 is of identical construction . while any of a number of electrohydraulic control systems might be utilized to control operation of the vibrator 10 , a preferred form of circuit is indicated in fig7 . operator control may be input at a digital computer 220 , e . g ., a standard control microprocessor circuit functioning with a suitable memory 222 and keyboard and display 224 . to control the multidirectional vibrator , it is required to correctly switch the combination of drives for the mode selected . thus , the computer 220 produces a digital voltage sweep signal online 226 to d / a converter 228 which provides an analog output signal on lead 230 to an amplifier 232 . the analog signal as amplified in output on lead 234 is an operation control voltage of designated frequency , sweep length , duration and the like . the generated voltage on lead 234 is then applied as input to each of control circuits 1 - 4 which function to control the individual electrohydraulic actuators 146 - 152 in well - known manner . the computer 220 also outputs two digital pulse trains at selected phases φ 1 and φ 2 which feed through a phase switch 236 . the phase switch 236 under control of computer 220 via line 238 , switches selected phase signal trains via leads 240 , 242 , 244 and 246 for input to the phase inputs of each of the respective control circuits 1 - 4 . phase φ 1 signal will go to one pair of control circuits while phase φ 2 signal goes to the other pair of control circuits , depending upon the mode of operations selected by the phase switch control . the computer 220 may also be utilized before the start of any sweep to initialize all drives , i . e ., to synchronize drives at pre - sweep displacements and phase angles . such a control system as that of fig7 would be easily contained at one operator station in a single operator vehicle . also , multiple vibrators may be tied together for synchronous operation in a manner similar to that presently used for synchronizing multiples of conventional vibrators . fig8 illustrates an alternative form of coupling head 250 and telescoping bearing arrangement . thus , a pivot tube 252 terminates at its lower edge by affixure to a circular plate 254 , e . g ., welded using a plurality of gussets 256 . a cylindrical plate 258 is then secured as by welding beneath circular plate 254 and spaced to retain a bronze bearing sleeve 260 in sliding position against a telescoping tube 262 . a bottom circular plate 264 is then secured about the lower end of cylindrical sleeve 258 which defines on its outer surface a race upon which the actuator drive collar 116 may be positioned . the lower end of telescoping tube 262 is secured to a circular flange plate 265 which , in turn , is secured as by a circumfery of fasteners to a base plate 266 , a circular plate forming the upper part of the conical coupling head 250 . the conical coupling head 250 is further formed of a hardened steel conical point 268 secured on conical side wall plate 270 which , in turn , is secured as by welding about the outer circumphery of plate 266 . side wall plate 270 subtends an angle of 45 ° relative to the axis of tube 262 . interior reinforcement to the cone structure is provided by an interior cylinder 272 of lesser radius and securely coupled through a cylinder 274 and disk 276 welded in reinforcing attitude between concial side walls 270 and cylinder 272 . the interior cylinders 272 and 274 act as stiffening tubes within the conical structure . fig9 illustrates yet another alternative form of coupling head 280 . the coupling head 280 is a welded spherical assembly that consists of a sperically formed outer skin 282 . interior stiffeners are provided to spherical skin 282 in the form of a ring plate 284 welded in bi - section of the partial sphere and generally parallel to a base plate 286 as welded to an upper sector of the partial sphere for attachment to flange plate 365 by means of a plurality of fasteners . still other transverse stiffener plates such as circular plate 288 may be utilized as required to achieve the necessary rigidity of the spherical surface of skin 282 . while the foregoing vibrator embodiment functions with a reaction mass employing a quadrature array of four linear actuators driving the telescoping tube , it should be understood that multiples of two actuators are all that are required so long as their strokes are properly coordinated . fig1 illustrates a two actuator elliptical shear wave generator 290 for driving a telescoping tube . in this case , it may also be noted that a particular offset configuration is utilized as evidenced by the irregular configuration of the bottom reaction mass assembly 292 and the off - center relationship to the pivot tube 294 and the telescoping tube 296 . also , while the pivot and telescoping tubes have been previously referred to as concentric cylindrical tubes , they may well be concentric square tubing as tubes 294 and 296 . the present more radical design of fig1 has been necessitated for mounting on a support vehicle within limited space ; however , it should be understood that the dual actuator telescopic drive can also be readily constructed in a geometrically balanced design . the bottom reaction mass assembly 292 is configured for a particular support vehicle application as formed on a generally rectangular mass bottom plate 298 having a mass side wall 300 welded therearound , and including a forward cutout or irregular portion 302 as well as an octagonal central cutout portion 304 through which the pivot tube 294 and telescoping tube 296 pass . the reaction mass bottom plate 298 further includes heavy mass members 306 , 308 secured thereon and , in all , the rection mass assembly totals about 8500 pounds in the fig1 design . two forward , diagonal voids 309 and 310 of generally elongated , cubic form receive respective linear actuators 312 and 314 therein , as will be further described . respective cover plates 315 , l and r , are welded beneath voids 309 , 310 to provide continuity to bottom plate 298 and to guard the respective cylinders against contact with ground irregularities . a pair of diagonal voids 316 and 318 are formed through the rearside of reaction mass plate 298 , and these receive respective snubber assemblies 320 and 322 , also to be further described . the vertical centerline of octagonal central cutout portion 304 passes through the center of gravity of reaction mass assembly 292 . also , the center of gravity of reaction mass assembly 292 lies in a horizontal plane containing the horizontal centerlines of actuators 312 and 314 and snubber assemblies 320 and 322 . these constraints on the center of gravity location of reaction mass assembly 292 prevent unwanted torsional disturbances during vibrator operation . the base configuration of pivot tube 294 is similar to that of fig8 and 9 except that we are dealing with a square tube assembly . thus , the bottom edge of pivot tube 294 receives in welded affixure a square peripheral plate 324 as welded on a short section of square tube 326 as seated on a lower peripheral plate 328 . the upper and lower plates 324 and 328 then provide a seating point for the quadrature arrayed connector plates 330 , 332 , 334 and 336 as they are welded securely therebetween . respective rod end / clevis pivotal connections 338 , 340 , 342 and 344 then provide spherically pivotal connection to the respective actuators 312 , 314 and snubbers 320 , 322 . referring to fig1 , each of the hydraulic actuators 312 , 314 consists of a cylindrical actuator body 350 receiving a double rod end piston 352 therethrough . each piston 352 includes an inner rod end 354 which is securely connected to the respective pivotal connection 338 , 340 . an outer rod end 356 is reciprocally disposed within an end cap 358 which is secured by means of a respective rod end / clevis pivot connector 360 to the respective corners 362 and 364 of the reaction mass assembly 292 . piston 352 is disposed for reciprocal movement within actuator body 350 as opposite - end bronze insert sleeves 364 and 366 define a cylinder chamber 368 . ports ( not shown ) provide fluid communication between the electrohydraulic servo valve 369 and the opposite sides of piston 352 within cylinder chamber 368 . the inner end of the actuator is terminated around inner rod end 354 by means of a seal and retainer plate 370 and the outer rod end 356 terminates in a chamber 372 of end cap 358 with a bronze bumper 374 resiliently secured on an elastomer cylinder 376 secured within end bore 378 . the bumper elastomer 376 may be formed of such as uniroyal vibrathane ® material or other similar substance as the bumper assembly guards against damaging over - travel of the rod end 356 . tracking of piston travel is effected by an lvdt assembly that is supported by a clamp 380 secured around inner rod end 354 , a guide rod bearing 382 secured on actuator body 312 and a mounting clamp 384 also secured on actuator body 312 . a guide rod 386 is secured by guide rod bearing 382 and clamp 380 to position an lvdt stem 388 within an lvdt coil mounting structure 390 supported by mounting clamp 384 . positioning of the coil structure 390 is adjusted by manual sliding of coil structure 390 within mounting clamp 384 with mounting screws ( not shown ) loosened . connector 392 provides an electrical connection of coil structure 390 to vibrator control electronics . the rear side of reaction mass assembly 292 is characterized by reaction structure int he form of balanceing snubbers 320 and 322 . each of the snubbers consists of a cylinder 394 having a self - lubricating liner or sleeve bearing 395 for receiving a respective bumper rod 396 for reciprocal movement therein . the bumper cylinder 394 includes an end plate 398 with an axial hole for bumper clearance , plate 398 being secured to the pivotal connections 342 , 344 . the outer end of bumper rod 396 is secured through a rod end / clevis pivot connection 400 to a brace plate 402 as welded upright on each of mounting plates 316 , 318 and other parts of reaction mass 292 . the inner end of bumper rod 396 includes a counterbore 404 for receiving an elatomer bumper 406 and bronze outer bumper 408 as secured therein by an axial bolt . balancing snubbers 320 and 322 guard against damaging over extensions of rod ends 354 . balancing snubbers 320 and 324 are also sized such as to dynamically balance torsional forces about the vertical centerline of tubes 294 and 296 . without such balancing , unwanted dynamic torquing of tubes 294 and 296 would occur during vibrator operation . referring to fig1 , actuator 312 is shown in greater detail , each end of the actuator is supported by a clevis / pivot connector ( 360 , 338 ) of similar construction which includes a pivot pin 410 connection while also including a ball surface 412 theron for sliding spherical engagement with a yoke 414 as securely affixed to the reaction mass corner plate 362 . all of the interconnections of actuator and snubber ends are of similar spherical / pivot construction to allow maximum freedom of contact during vibration . the bronze sleeves 364 , 366 are retained in place by respective sleeve retainers 416 and 418 with suitable ring sealing members included . the end cap 370 maintains a wiper seal 420 in annular engagement against sleeve retainer 416 . at the opposite end , a retainer plate 422 is secured by bolting in retention of sleeve retainer 418 . an upper part 424 of cylinder 350 contains separated fluid flow passages 430 and 432 . passages 430 , 432 are then in communication with fluid ports 434 , 436 providing fluid communication with cylinder 368 on opposite sides of piston 352 . the hydraulic servo valve 369 is secured on actuator upper part 424 in communication with the opposite side flow passages 430 and 432 . plugs 450 serve to seal opposite side ports , used for access in forming ports 434 and 436 . referring to fig1 , 13 and 14 , an alternative form of support structure 452 is directed to a different form of connection between the passive or top reaction mass 454 and the guide rods . some similar structure , as seen at left side view in fig2 would consist of frame member 56 extending between left - side corner caps 48 and 52 on respective guide posts 28 and 30 . guide posts 28 and 30 reciprocate relative to guide cylinders 20 and 22 during raising and lowering of the vibrator apparatus . the telescoping tube 16 is secured through a suitable u - joint assembly 456 to a cylinder frame 458 secured as by welding within the quadrature arrayed stiffening beams 460 and 462 , l and r . the hydraulic actuation cylinder for extension of telescoping tube 16 is contained within tube 16 and pivotally connected to u - joint 456 in connection similar to that shown in fig3 . the lower reaction mass , e . g ., vibrator reaction mass 32 of fig2 is supported by means of suspension arms 464 and 466 , left and right , as each is connected at both top and bottom ends by u - joints 468 between the upper support frame members 56 , 58 , 60 and 62 ( see also fig4 ) and the reaction mass suspended therebelow . support posts 470 and 472 , left and right , are also connected at top and bottom ends by respective u - joints 474 between the respective four corners of top reaction mass 454 and the support assembly foot members 26 , left and right , ( see fig2 ). each corner of the passive or top reaction mass 454 is resiliently supported on respective corner caps 48 , 50 , 52 and 54 ( fig4 ) by means of elastomer disk assemblies 480 and 482 , left and right . fig1 and 14 illustrate the disk assemblies in greater detail as each consists of a suitable bushing 484 secured upward through a hole 486 in the corner to top reaction mass 454 . an elastomer disk 488 unitarily formed to include an axial sleeve or bumper 490 is inserted over a securing post 492 extending axially from corner cap 48 - 54 . elastomer disk 488 is clamped between retaining ring 496 and top reaction mass 454 by a plurality of bolts passing through holes in ring 496 , disk 488 , and bushing 484 . in operation , the present vibrator 10 in any of several forms is effective to maintain firm energy - coupling engagement with an earth medium throughout a vibration sequence when operating in relatively soft earth surface areas such as loose soil , snow , marshes , water - covered bottom , and similar surface situations . the telescoping tube 16 is controlled to continually depress within the engaged earth medium during the vibratory sequence so that it continually seeks firm engagement for transmission of the seismic energy . the seismic energy is generated with a phase and amplitude - controlled , multi - directional vibration technique that enable simultaneous generation of elliptically polarized shear waves and compressional waves in the receiving earth medium . compression waves are effectively obtained by sequentially generating two mirror image , circularly polarized sweeps and then summing the recorded results . thus , when using an azimuthally oriented array of two or more actuators in force application to the telescoping tube , proper phase control of the individual actuator contributions enables propagation of any of elliptically , linearly or circularly polarized shear waves , as is more specifically discussed in co - pending u . s . patent application ser . no . 897 , 434 . the actual earth engaging surface of telescoping tube 16 includes a head structure 18 that may take any of several forms . as shown in fig2 the head 18 may consist of a conical side wall 108 that is formed at about 25 °- 30 ° from the vertical axis of telescoping tube 16 , and it includes a plurality of radial blades 110 disposed therearound , e . g ., in quadrature array . fig8 illustrates another form of coupling head 18 that consists of a cone structure having a conical side wall extending at 45 ° from the vertical axis telescoping tube 16 . the fig9 illustration shows yet another type of coupling head 18 wherein a spherical or ball - type head 280 is formed with reinforcing structure to impart vibratory energy from telescoping tube 262 into the earth medium therearound . thus , it can be seen that any of several coupling heads 18 might be utilized , this depending largely upon the type of soil or water bottom wherein the exploration is taking place . still another alternative , not specifically shown , consists of a narrower conical head inclined at 24 . 5 ° from the vertical axis of the telescoping tube and terminating in a hardened steel conical point having a 30 ° inclined side wall . many special forms of head and / or coupling blade structure may be developed for specific applications . the foregoing discloses a novel , soft earth vibrator of a type capable of being transported on a support vehicle or craft , that includes a type of source that generated elliptically polarized shear waves for continual propagation into an earth medium . control and generation structure is disclosed for generating such elliptically polarized shear waves using either two , or four , or more hydraulic actuators as controlled in phase related operation . various support and handling structure is also disclosed for enabling utilization of the shear wave generator as deployed from vehicles or marine structures best capable of carrying and positioning such sources over soft earth areas . changes may be made in combination and arrangement of elements as heretofore set forth in the specification and shown in the drawings ; it being understood that changes may be made in the embodiments disclosed without departing from the spirit and scope of the invention as defined in the following claims .

US-998987-A

a gas spring is provided in an illustrational example between a framework and a trunk cover of a motor vehicle for compensating for the weight of the trunk cover during movement of said trunk cover . the gas spring is hinged to the framework and to the trunk cover . for eliminating the spring force action on the hinge between the trunk cover and the gas spring in the closed position of the trunk cover , the part of the gas spring hinged to the trunk cover is supported on the framework , when the trunk cover is in its closed position . alternately , the gas spring is locked when the trunk cover is in its closed position .

in fig1 a gas spring 1 is at 7 hingedly connected to a basic construction unit , namely the framework 4 of a motor vehicle . at 8 , the gas spring is hingedly oonnected to a movable construction element , namely a construction element 5 . the gas spring 1 comprises a cylinder 2 and a piston rod 3 . the cylinder 2 is filled with pressurized gas so that an outwardly directed spring force is exerted on the piston rod 3 . the trunk cover 5 is pivotally connected to the framework 4 by hinges 6 . the connections at 7 and 8 may be ball - and - socket connections as illustrated in german offenlegungsschrift no . 29 42 800 , corresponding to u . s . pat . no . specification re . 31 , 635 . the ballsockets are in such case fixed to the bottom of cylinder 2 and the outer end of the piston rod 3 , respectively , while the ballheads are fixed to the framework 4 and the construction element 5 , respectively . fig1 shows the closed position of the construction element in full lines and the fully opened position of the construction element in dotted lines . in the fully opened position , the piston rod 3 is in its outermost position with respect to cylinder 2 , which outermost position is defined by internal abutments of the gas spring . in this position , only the weight of the trunk cover 5 is transmitted into connection 8 . in fig2 reaction force control means are generally designated by 9 . these reaction force control means are designed as reaction force support means . they comprise a first abutment member 10 which is fixed to the framework 4 by a flange 11 . the abutment member 10 has the u - shape as indicated in fig3 with a slot 9a to receive the piston rod 3 in the fully closed position of the trunk cover 5 . the abutment member 10 and its flange 11 are preferably a unitary stamped metal part . a further abutment member 12 is slidably mounted on the piston rod 3 . a helical spring 13 urges the abutment member 12 against a spacer sleeve 15 . the spring 13 is supported by an annular member 14 , axially supported by piston rod 3 . fig2 shows in the left - hand illustration ( solid lines ) the position of the gas spring shortly before the construction element arrives at its closed position , and in the right - hand illustration ( dotted lines ) the position of the gas spring when the construction element 5 has arrived at its fully closed position . the abutment members 10 and 12 carry respective engagement faces 10a and 12 a which extend generally transversely of the gas spring axis . during transition from the left - hand position of fig2 to the right - hand position of fig2 the abutment member 12 engages abutment member 10 , so that abutment member 12 is moved upwards in fig2 and the spring 13 is compressed . the engagement faces 12a and 10a are sloped such as to effect a progressive compression of spring 13 when the gas spring 1 is moved from the left - hand position of fig2 towards the right - hand position . the spring force of spring 13 in the right - hand position of fig2 is directed against the spring force to which the piston rod 3 is subjected to by the pressurized gas within cylinder 2 . so the reaction force acting on the connection means 8 is equal to the difference of the spring force of the gas spring and the spring force of the compressed spring 13 . by suitable dimensioning of the spring 13 and positioning of the abutment member 10 , it may be achieved that the above - mentioned difference is zero and no reaction force occurs at 8 when the construction element is in the right - hand position of fig2 . the slot 9a receives the spacer sleeve 15 in the right - hand position of fig2 . according to fig4 the abutment member 21 is axially fixed on the piston rod 3 . the abutment member 20 is slidably mounted on a pin 17 which is fixed to a support member 19 , welded to framework 4 . a helical compression spring 18 is provided between the abutment member 20 and the support member 19 . the abutment member 20 is carried by a cage member 16 adapted to receive the connection means 8 in the fully closed position of the trunk cover 5 . when the construction element 5 moves from the left - hand position in fig4 to the fully closed right - hand position , the abutment members 21 and 20 engage each other so that the spring 18 is compressed . the spring force of spring 18 acts in opposite direction as compared with the spring force acting on piston rod 3 , so that the resulting reaction force acting on connection 8 is reduced , possibly , zero . in the embodiment of fig5 the connection between piston rod 3 and construction element 5 comprises a mounting bracket 24 rigidly secured to trunk cover 5 and a lever 26 pivotally mounted on the mounting bracket 24 . the piston rod 3 is pivotally connected at 25 to the lever 26 . in an intermediate position of the trunk cover 5 , as shown in fig5 the lever 26 is held in a terminal position by engagement of stop members 26a and 26b . the stop member 26a is fixed to lever 26 , whereas stop member 26b is fixed to the mounting bracket 24 . so the spring force of gas spring 1 is transmitted to the trunk cover 5 by stop members 26a , 26b and the weight of the trunk cover 5 is compensated for . a support roller 22a is fixed to the framework 4 by a carrier 22 . a cam 26c is provided on lever 26 . when the construction element 5 approaches the closed position as shown in fig6 the cam 26c engages the support roller 22a and lever 26 is rotated counterclockwise . so the stop members 26a , 26b are disengaged and the spring force of gas spring 1 is substantially transmitted to the support roller 22a by cam 26c . no substantial reaction force is transmitted to the trunk cover 5 if the support roller 22a and the pivot axis 25 are aligned along the axis of the piston rod as shown in fig6 . in the embodiment of fig7 a gas spring , ( as shown in fig8 ) is used . this gas spring comprises a cylinder 2 and a piston rod 3 . a damping piston 30 is fixed to piston rod 3 within cylinder 2 . the cylinder 2 is partially filled with a liquid 31 and partially with a volume of gas 32 . the volume of gas 32 exerts an outwardly directed expelling force on the piston rod 3 . piston rod 3 is provided with a piston rod extension 34 . this piston rod extension 34 enters into a chamber 35 at the bottom of cylinder 2 when the piston rod 3 reaches its innermost position corresponding to the closed position of trunk cover 5 in fig1 . when the extension 34 enters into chamber 35 , the liquid present in chamber 35 is expelled out of chamber 35 through a non - return valve 36 and a conduit 37 towards the working space of cylinder 2 . the chamber 35 is sealed against extension 34 by a sealing ring 38 . as soon as the piston rod 3 moves for a short way out of chamber 35 , the pressure within chamber 35 is decreased and the expelling force acting on piston rod 3 is reduced and becomes zero . for returning piston rod 3 towards its outermost position , a certain withdrawing force must be exerted on piston rod 3 . in fig7 the piston rod 3 is again pivotally connected at 125 with a lever 126 which is pivotally connected to mounting bracket 124 . the stop means 126a , 126b delimit again the pivot - movement of lever 126 , so that in the partially opened position of the trunk cover 5 the spring force of the gas spring is transmited from the piston rod 3 to the trunk cover 5 , and the weight thereof is compensated for . when the trunk cover 5 approaches its closed position , the cam 126c rides over a control roller 122a which is carried on the framework by a carrier 122 . so the piston rod 3 is moved upwards in fig7 . this upward movement causes the extension 34 of fig8 to enter into chamber 35 of fig8 . as soon as the cam 126c has overridden the support roller 122a , namely in the closed position according to fig7 the lever 126 is rotated in clockwise direction by the spring force of the gas spring . so the extension 34 of fig8 can move upwards ( as shown in fig8 ) again and the pressure within chamber 35 is descreased , so that the expelling force of the piston rod 3 becomes zero . this means that in the position of fig7 no reaction force at all is transmitted to the trunk cover 5 , and simultaneously no reaction force is transmitted at 7 ( fig1 ) to the framework 4 . when the trunk cover 5 is to be opened again , a manual force is to be exerted on trunk cover 5 , such that the cam 126c rides again beyond the control roller 122a , and even after the cam 126c has overridden the control roller 122a , the manual force must be further exerted on the trunk cover 5 until the extension 34 of fig8 has fully left the chamber 35 . other systems for locking the piston rod 3 within the cylinder 2 may be used , particularly such locking systems which become locking after a predetermined inward movement of the piston rod and a subsequent short outward movement of the piston rod . while specific embodiments of the invention have been shown and described in detail to illustrate the application of the inventive principles , it will be understood that the invention may be embodied otherwise without departing from such principles . the reference numerals in the claims are only used for facilitating the understanding and are by no means restrictive .

US-32456889-A

devices for concentrating radiant energy and having reflective anticlastic surfaces , produced by processes involving shrinking an elastic reflective film onto a rigid frame representing one or a series of twisted squares , or by twisting a semi - rigid elastic reflective panel .

the device 10 of fig1 comprises a rigid closed frame 11 , initially a flat rectangle which has been twisted or skewed , e . g ., by lifting the corner a from the plane of the three remaining corners , b , c , d . to the frame is affixed a thin elastic heat - shrinkable web 12 having a specularly reflective surface and which has been heated so as to be constricted to a condition of minimum surface area , thereby assuming an anticlastic configuration as repesented by the diagonals ac and bd and by lines ef , fg , gh and he generally parallel thereto . radiation directed parallel to a central perpendicular against the reflective hyperbolic paraboloidal surface 12 of the device as shown in fig1 is reflected and brought to a focus along a line 13 as indicated in fig2 and 3 . fig2 shows the position of the focus with respect to the concave curvature of diagonal ac , whereas fig3 illustrates the focus , ( with the width dimension indicated as viewed from the direction of the source ) obtained along the convex curvature bd , in this case for two or more juxtaposed modules 10 , 10 &# 39 ;. the length of the narrow linear focus 13 may be shown to be greater by one diagonal than the sum of the diagonals of the several square modules . the energy reflected from adjacent modules overlaps between their midpoints ( 14 15 ) to provide increased intensity along all but the terminal portions of the focal area 13 . the same anticlastic surface characteristics are obtainable by affixing the reflective film over a rigid framework 40 which may be supported on a base 45 as illustrated in fig4 and wherein the exposed edges of the four frame members 41 - 44 are initially curved to match the curvature of lines ef , fg , gh and he of fig1 . these curved exposed edges thus may be considered to represent the twisted rigid closed frame 11 of fig1 frames of other shapes but with edges following the contours of the surface 12 may analogously be developed . the linear focus of the concentrators 10 and 10 &# 39 ; of fig2 and 3 may , as illustrated , be disposed along a linearly extended receptor 16 , as shown in black diagram form , for an energy converting medium which will absorb the concentrated radiant energy . instead of affixing the film to a previously twisted rigid frame and then heat - shrinking , it is alternatively possible to twist and rigidify the frame after first stretching and applying the suitably elastic film . minimum surface area and an anticlastic configuration are achieved during twisting of the frame , by virtue of the elasticity of the film . most effective concentration of incident radiation is accomplished with arrays of substantially square panels , aligned such that their overlapping foci are collinear ; but panels of other shapes , including rectangular and multi - lateral or circular , may also be used . rectangular panels having a length to width ratio of two are substantially as effective in such arrays as are square panels , but the effectiveness , as determined in terms of concentration of solar energy , diminishes rapidly as the ratio is increased to or beyond three . for solar concentrators having an initially rectangular shape , the maximum useful length to width ratio may be estimated from the formula ( 90 / t ) wherein t signifies the specific twist angle , i . e ., the twist angle in degrees between the opposing edges of a twisted square segment of the panel . for a rectangle of length l and width w , specific twist angle is therefore the relative angle between the two ends , divided by the factor ( l / w ). reflectivity is nost conveniently attained by metallizing or otherwise treating the film prior to affixing it to the frame , but reflective coatings may alternatively be applied to the final curved surface providing the conditions required do not cause distortion of the film . the structure and method just described make possible the formation of anticlastic surfaces having desirably short focal lengths and with relatively inexpensive thin films . another structure requires much thicker semirigid webs and results primarily in longer focal lengths , but makes possible structures with which the focal length may be easily varied , and others with which the reflected rays may be brought to substantially a point focus . the thick semi - rigid web or panel of elastic material is supported between rigid support members analogous to frame elements ad and bc of fig1 which are then uniformly oppositely angularly offset by twisting about their common axis and rigidly retained in the twist position . the degree of twist imparted is not greater than that required to produce a specific twist deformation of approximately twice the thickness of the panel and in any event is less than that amount which would cause localized folding or creasing of the panel rather than development of a smooth anticlastic surface . within the indicated limitation , the rigidity of the panel is sufficient to maintain full panel width between the unsupported side edges , the panel edges defining substantially straight lines connecting the corresponding ends of the rigid support members . specific twist deformation is here defined as the deflection at each corner of the twisted square panel or segment from the original plane of the flat untwisted panel . for the usual small twist angles , deformation may be determined more easily and substantially as accurately by measuring the vertical distance to any given corner of the square from the plane of the other three corners , the value thus obtained being approximately four times the specific twist deformation . the focal lengths of continuous hyperbolic paraboloidal reflectors made from smooth - surface semi - rigid elastic panels may be altered if desired , by simply altering , within the specified limits , the amount of relative twist or angular offsetting given the rigid end supports . fig5 illustrates a cross - section , taken along a convex parabolic diagonal corresponding to line bd of fig1 of a modified semi - rigid anticlastic concentrator with which the incident radiation is brought to substantially a point focus . the irradiated forward surface of the panel 50 is illustrated as being provided with an incremental reflector pattern of linear elements 52 . these elements are linearly each perpendicular to the diagonal bd of fig1 and when disposed in the convex parabolic shape illustrated are sloped to reflect the parallel incoming rays 54 toward a focus 53 . the combination of the slope of the elements and the over - all curvature of the panel results in the focusing of the incident rays at or very near a focal point 53 . the linear incremental reflector elements are conveniently formed in the initially flat panel 51 , e . g ., by gouging or molding followed by metallizing . the slope of the elements may be formed so as to focus radiation incident on said flat panel at a selected focal length f ; the focal length of the same panel when twisted sufficiently to obtain minimum image area at the focal point 53 is then found to be 2f . the following specific examples will further illustrate , without limiting , the practice of the invention : biaxially oriented ethylene glycol terephthalate polyester film of nominal thickness of 0 . 81 mm . is reflectorized over one surface by vacuum deposition of aluminum . the reflective metallized film is smoothly applied over a rigid twisted square framework of 12 . 7 mm . aluminum angle stock 31 . 8 cm . on each side and which is twisted to an angle of 20 . 9 ° between opposing end frame members ; i . e ., each corner is 11 . 1 cm . from the plane of the other three . the film is rigidly affixed to the frame using high strength heat - resistant adhesive tape . the assembly is placed in an oven maintained at 200 - 230 ° c . and held there for 15 seconds . the film contracts to minimum surface area and assumes an anticlastic configuration . the assembly is supported in such a position that a beam of sunlight is incident on the reflective surface . the reflected beam focuses as a narrow line on a transparency held at a distance of 45 . 7 cm . in front of the reflective surface . the concentration at the focus , determined as the ratio of the reflector area to the area of the concentrated beam at the focus as determined visually is approximately 20 . the assembly may alternatively be used to reflect light , from a line source placed at the focus , in a directed beam . another reflector prepared as described under example 1 but with a framework 63 . 5 cm . on each side and twisted at an angle of 22 . 1 degrees between opposing frame members , i . e ., with each corner deflected a distance of 23 . 5 cm . from the plane of the other three , exhibits a focal length of 81 . 2 cm . by visual inspection , the area of the reflected beam at the focus is found to measure 180 × 0 . 8 cm ., indicating a concentration of 28 . a series of four reflectors each as described under example 1 , except that the reflective surface of each measures 10 . 2 cm . along each side and each frame has a twist angle of 7 . 6 ° between opposite sides , is assembled with the corners at the ends of their convex diagonals along a common line , the total length of the array being 58 . 4 cm . the assembly is exposed to sunlight parallel to the central perpendiculars . the focal length is 38 . 1 cm . the concentrated beam at the focus covers an area of 0 . 32 × 72 . 8 cm ., providing a concentration factor of approximately 18 . semi - rigid rectangular flat plates of various elastic materials are reflectorized or polished . they are supported across their ends between parallel rigid clamps and are then twisted by opposite rotation of the clamps about their common axis and with minimal axial tension applied , to a point at which axial contraction first becomes apparent . the angle of twist between the clamps is measured and the specific twist angle determined . specific twist deformation is calculated from the specific twist angle and is found to be not significantly greater than twice the thickness of the plate in each instance . results are as tabulated : __________________________________________________________________________ focal sp . twist sp . twist lengthmaterial dimensions , cm . angle , deg . deform ., cm . cm . __________________________________________________________________________ &# 34 ; plexiglass &# 34 ; 47 . 1 × 15 . 2 × . 159 4 . 67 . 31 93 . 5 &# 34 ; plexiglass &# 34 ; 47 . 1 × 10 . 2 × . 159 7 . 33 . 325 39 . 6 &# 34 ; plexiglass &# 34 ; 47 . 1 × 15 . 2 × . 265 8 . 53 55 . 1aluminum 6 . 66 × 5 . 1 × . 089 8 . 1 . 18 18 . 0__________________________________________________________________________ a strip of &# 34 ; plexiglass &# 34 ; polymethylmethacrylate paneling of 1 . 59 mm . thickness is reflectorized over one surface and supported between rigid clamps , rotatable about the axis of the strip , to provide a reflective rectangular segment measuring 47 . 1 × 10 . 2 cm . the clamps are rotated in opposite directions to indicated angular displacement between the two , and the focal length , i . e ., the distance from the center of the surface at which sunlight incident on the surface is brought to a linear focus , is determined for each position . the area of the focused beam is determined by estimation of its length and width at the focus and the concentration determined as the inverse ratio of such area to the area of the reflective strip , with the following tabulated results . ______________________________________angular focal imagerotation length widthdegrees cm . cm . concentration______________________________________15 83 . 8 . 79 7 . 920 63 . 5 . 64 9 . 825 50 . 8 . 48 12 . 630 41 . 9 . 40 14 . 9______________________________________ a flat plexiglass panel is provided over one surface with a series of parallel liner ridges extending from side to side . the panel is 27 . 9 cm . on each side and 0 . 06 cm . in thickness . there are 20 ridges per cm . and the surfaces of the ridges are angled to reflect sunlight incident on the panel to a focal line in front of the central ridge and at a distance of 25 cm . the ridged surface is reflectorized by vapor coating with aluminum . two opposite corner segments of the panel are removed , leaving a central doubly pointed segment 15 cm . in width and almost 40 cm . in length , and with the grooves at an angle of 45 ° to the longitudinal axis . the segment is adherently bonded onto a plexiglass support strip measuring 55 × 15 × 0 . 265 cm . which is held between rotatable rigid clamps mounted 46 cm . from each other . the clamps are rotated to an angular displacement of 25 ° to convert the initially flat ridged surface into an anticlastic or hyperbolic paraboloidal surface configuration and with the ridges aligned perpendicularly to the convex diagonal . sunlight incident on the anticlastic surface is found to be focused at a central spot measuring 1 . 6 × 3 . 2 cm . and at a distance of 50 . 8 cm . in front of the panel .

US-56054175-A

a gel system comprising propylene glycol alginate and basic aluminum acetate salt . also , disclosed is a personal care formulation comprising a room deodorant gel employing said gel system .

in this invention , the combination of propylene glycol alginate and an aluminum salt , preferably a sparingly soluble aluminum salt , such as basic aluminum acetate , al ( oh )( c 2 h 3 o 2 ) 2 , provides a useful range of gels , whose characteristics will depend upon the degree of esterification of the alginate and the amount of aluminum salt used . gel textures ranging from soft and elastic to firm and rigid can be made herein as the components are varied . for example , propylene glycol alginates with a high degree of esterification generally will produce soft , elastic gels while a lower degree of esterification will provide firm , brittle gels . advantageously , in this invention , gelation does not occur immediately so that a sequestrant is not needed to slow down the rate of reaction , as in previous alginate gel systems . actually , the aluminum salt may be added to the alginate in an aqueous medium and the resulting solution filled into a container before gelation occurs . reaction of the propylene glycol alginate with the sparingly soluble aluminum salt is slowed down herein by the presence of the ester group in the alginate so that some period of time is required to build - up the gel structure . in this manner , a very desirable uniform gel is obtained . in the preferred forms of the invention , the propylene glycol alginate is esterified to about 40 - 90 %; its concentration in the aqueous gel system is about 0 . 5 - 5 . 0 wt . %, most preferably 1 - 2 . 5 wt . %; and the aluminum salt concentration will provide 20 - 100 % of complete reaction with the carboxyl groups of the alginate , most preferably 35 - 75 %. the invention will be described in more detail with reference to the following examples . 4 . 0 g of kelcoloid lvf , a low viscosity , 50 - 59 % esterified , propylene glycol alginate ( isp alginates , san diego , calif .) was dissolved in 190 g of deionized water . then a slurry of 0 . 27 g of basic aluminum acetate about 50 % of theoretical for complete reaction with free carboxyl groups present in the alginate in deionized water was then added and mixed thoroughly . the amount of added basic aluminum acetate was a soft elastic gel formed after an hour ; which , upon standing over a period of 24 hours gradually changed into a firm , brittle gel . example 1 was repeated using manucol ester m , a medium viscosity propylene glycol alginate , having a degree of esterification of 52 - 56 %. a gradual gelation to a firm , stable gel occurred in like manner . example 1 was repeated using kelcoloid s , a low viscosity , highly esterified ( 82 - 85 %) propylene glycol alginate . a very soft , elastic gel was formed . example 1 was repeated using kelcoloid hvf , a high viscosity product with a degree of esterification of abut 45 - 50 %. a very firm stable gel gradually formed which showed no syneresis or bleeding even after several days . example 1 was repeated with 4 . 0 g of kelcoloid lvf was dissolved in 190 g of deionized water to which a slurry of 0 . 54 g of basic aluminum acetate ( 100 % of theoretical ) in 6 . 0 g of water was added . a soft gel formed in about 45 minutes which gradually changed into a very firm , brittle gel which showed gel syneresis , indicating gel instability . example 1 was repeated with 4 . 0 g of kelcoloid lvf was dissolved in 190 g of deionized water to which a slurry of 0 . 11 g of basic aluminum acetate in 6 . 0 g of water was added , ( 20 % of theoretical ). a soft elastic gel was formed . a stable , room deodorant gel was prepared according to the following formulation : the propylene glycol alginate was dissolved in 184 g water containing tween 80 and mint oil . after complete dissolution , the aluminum salt was added as a slurry in the remaining water and mixed thoroughly . the formulation was then poured into containers where gelation occurred . the gel was stable and released the mint oil fragrance in the same manner as present commercially available products made with carrageenan or gellan gum . alternatively , a dry blend of propylene glycol alginate and the aluminum salt admixture may be used for subsequent , dispersion in aqueous media with rapid agitation to provide the desired gel system . to improve syneresis control of the gel system herein , e . g . in situations where an excess of aluminum ions may be present therein , the addition of a nonionic polymeric viscosifier to the mixture is advantageous . suitable polymers include guar gum , hydroxypropyl methylcellulose and hydroxyethylcelulose . guar gum is a preferred polymer , e . g . present in an amount of about 0 . 25 - 1 . 0 % by weight of the system . while the invention has been described with particular reference to certain embodiments thereof , it will be understood that changes and modifications may be made which are within the skill of the art . accordingly , it is intended to be bound only by the following claims , in which .

US-94127501-A

the invention is a means for removing an often noisy and troublesome upper spin tube bearing used in a speed queen washer and comprises an elongated rigid sheath configured to fit over the spin tube bearing housing , the sheath having a central threaded shaft extending therethrough to extend into the bearing housing and through the annular spin tube bearing , the bearing being removed by means of a pressure disc threaded on the shaft beneath the bearing and drawn upwardly by rotating a nut on an upper portion of the shaft .

the bearing puller of the present invention was designed for use specifically with speed queen brand washers , this brand comprising the majority of the machines used in laundromat facilities and thus being frequently in need of having their upper spin tube bearings replaced . the drawings illustrate the bearing puller as it operates on a few essential parts of the machine , the machine itself and the great majority of the parts used in the machine having been omitted for simplicity . the structure of the washer which is shown includes a frame member 10 having a pivot yoke 12 which supports a mounting plate 14 to which is mounted a spin tube bearing housing 16 which is cylindrical in form and is mounted by means of a pair of angulated legs 18 to the mounting plate . the following structure has already been removed from the bearing housing which is shown in the drawings . first , the inner wash tub , which is provided with an upwardly and centrally extending spindle which is hollow and coaxially mounted on the bearing housing is removed , this spindle having a shaft that is called a spin tube which extends downward through the cylindrical bearing housing 16 to support the rotational wash tub . a pair of bearings are needed in the housing to rotationally support the spin tube , the lower bearing having been removed from the spin tube shown in the drawings and the upper bearing being the subject of this invention and is shown at 20 . the spin tube of the wash tube extends downwardly through the bearing housing and is provided with a retainer and a drive pulley which have been removed prior to the stage of assembly which is illustrated . the mounting plate 14 has a central opening such that the bottom of the bearing housing is accessible by hand from beneath the mounting plate , the area beneath the mounting plate also being accessible by hand through the remaining portions of the washer . for reasons that are not apparent from the drawings and will not be detailed herein , it is the removal of the spin tube bearing housing 16 that is responsible for hours of labor and requires the dismantling of a large portion of the washer so that the spin tube bearing housing may be freed and the upper spin tube bearing 20 pounded out with a wooden block and mallet . the upper spin tube bearing rests in a shoulder 22 on the inside of the housing and , especially with age , becomes seated so securely that a tremendous force is needed to remove it . turning now to the structure of the invention , an elongated sheath is generally designated at 24 and in the preferred embodiment comprises upper and lower tube portions 26 and 28 , respectively . the lower tube portion has cut away areas 30 such that the lower tube portion may straddle the angulated legs 18 as it encloses the bearing housing . the lower tube is braced against the mounting plate 14 and , together with the upper tube , is composed of a tough plastic or the like having strength sufficient to withstand considerable compressive forces . in view of the strength necessary in the sheath , the upper tube rests directly on a metallic platform 32 which rests atop the lower tube and ideally would be glued thereto , although conceivably the platform could be maintained in place by means of an external fairing 34 , which is preferably composed of the same tough material from which the tubes are made and is adhered securely to the tubes so that a one - piece housing is defined . note however that the straight cylindrical upper tube rests directly on the platform so that the fairing 34 need not endure forces which it might not be able to withstand due to its flared shape . the upper end of the upper tube 26 has an end plate 36 attached thereto in a fashion similar to that of the platform 32 and above this end plate is a bearing washer 38 which is free to rotate in sliding fashion against the end plate 36 , and is retained by a retainer cap 40 which is adhered to the upper tube and also serves as a fairing similar to that at 34 to provide the overall apparatus with a smooth appearance , and to eliminate the possibility of the grease or grime prevalent in areas which the tool will be used from lodging in crevices of the tool which would otherwise be exposed . centrally extended through the sheath is a threaded shaft 42 preferably having an orthognally extended handle 44 mounted to the top end . a nut 46 is engaged on the shaft beneath the handle and rests on the bearing washer 38 and it can be seen as this nut is rotated such as by means of an open end wrench , the shaft will be raised or lowered provided it is maintained non - rotational by means of the handle , a position being shown in phantom in fig2 indicating the raised shaft . the shaft extends through openings in the end plate 36 and lower platform 32 and passes generally coaxially through the cylindrical portion of the bearing housing 16 so that the lower end is exposed beneath the housing . as previously mentioned , there is an opening in the mounting plate 14 which permits access to the lower end portion of the housing from beneath this mounting plate , and it is through this access route that , once the shaft has been extended through the bearing housing and through the bearing itself , a pressure disc 48 is slipped onto the end of the shaft and retained there by means of a modified wing nut 50 . the purpose of the pressure disc , which is of diameter greater than the inner diameter of the annular bearing 20 , is to draw the bearing upwardly as the shaft is raised and free it from its housing , and thus the wing nut 50 is provided with finger pieces 52 which are heavy enough to provide additional angular momentum to the nut so that it may be spun on and by its own momentum will raise the pressure disc into contact with the upper bearing prior to its removal . thus in summary of the operation of the device , after the washer has been dismantled to the extent that only those parts illustrated remain in the sphere of operation , the elongated sheath with the shaft in the raised position and having the wing nut and pressure disc removed is inserted over the bearing housing such that the cut - away portions of the lower tube aligned with the angulated legs 18 . when the sheath is firmly resting on the mounting plate , the shaft is lowered through the upper spin tube bearing 20 and through the bearing housing so that the end projects beneath the housing and the upper nut 46 rests on the bearing washer 38 . at this point , the pressure disc is engaged on the bottom end of the shaft , which is done by reaching through the hole in the mounting plate , and in the same fashion the weighted wing nut is attached to the shaft and twirled upwardly until it brings the pressure disc against the bearing . the apparatus is now ready for the actual removal of the bearing , and this is accomplished by holding the handle 44 in one hand and with an open end or crescent wrench rotating the nut 46 such that the shaft moves into the position illustrated in phantom in fig2 and the bearing pops free , also indicated in phantom in fig2 . the bearing puller is no longer attached to the washing machine structure and can be simply lifted out of place and a new bearing inserted in the shoulder area 22 , and the machine is ready for reassembly .

US-71268876-A

provider are a method , system , and program for maintaining data in a distributed computing environment . data is stored at a primary storage site . a data structure is processed indicating an association of data sets in the stored data , secondary storage sites , and update frequencies . in response to processing the data structure , a determination is made of one of a plurality of secondary storage sites and a determination is made of at least one data set to transmit to the determined secondary storage site at an update frequency . the determined data set is transmitted to the determined secondary storage site according to the update frequency .

in the following description , reference is made to the accompanying drawings which form a part hereof , and which illustrate several embodiments of the present invention . it is understood that other embodiments may be utilized and structural and operational changes may be made without departing from the scope of the present invention . [ 0022 ] fig1 illustrates a distributed computing environment in which aspects of the invention are implemented . a primary server 2 maintains a hypertext transfer protocol ( http ) server 4 to respond to http requests from clients 6 a , 6 b . . . 6 n in geographical location a ( 8 ) and clients 10 a , 10 b . . . 10 n in geographical location b ( 12 ) over a network 14 . the primary server 2 further includes transaction code 5 to process transaction requests as described below . the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n may include http clients , such as hypertext markup language ( html ) browsers ( not shown ) to transmit http requests for information to the http server 4 . the network 14 may comprise any type of network known in the art , such as a wide area network , the internet , an intranet , a local area network ( lan ), etc . the geographical locations a ( 8 ) and b ( 12 ) may be separated by a significant geographical distance from geographical location c ( 16 ), which includes the primary server 2 . for instance , the location c ( 14 ) may be separated by a distance of thousands of miles from locations a ( 8 ) and b ( 12 ), or on separate continents , different states , etc . the primary server 2 is capable of accessing data from primary storage 18 , which includes database data 20 , such as database tables , and content 22 , such as textual information , multimedia content ( e . g ., audio files , movie files , images , etc .). the primary server 2 includes a data copy program 24 capable of propagating data from the primary storage 18 to secondary servers 30 a and 30 b at locations a ( 8 ) and b ( 12 ) to store in secondary storages 32 a and 32 b , respectively . the secondary servers 30 a and 30 b further include data copy programs 34 a and 34 b , respectively , to receive data from the primary server data copy program 24 and store received data in the secondary storages 32 a and 32 b . in certain implementations , the data copy program 24 , 30 a , and 30 b may comprise the international business machines corporation ( ibm ) extended remote copy ( xrc ) or peer - to - peer remote copy ( pprc ) products that ensure that updates to a primary location are applied to a secondary location in real time . alternatively , the data copy programs 24 a , 30 a , and 30 b may comprise any program capable of replicating data and data updates at a primary location to mirror sites . although two secondary sites at locations a ( 8 ) and b ( 12 ) are shown , additional sites , including additional secondary servers and storages , may be incorporated into the distributed computing environment of the described implementations . the secondary servers 30 a and 30 b further include http servers 36 a and 36 b , respectively , to respond to http requests from the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n . the secondary servers also include transaction code 37 a and 37 b to process client requests in the manner described below . the secondary storages 32 a and 32 b include location specific database data 38 a and 38 b and location specific content 40 a and 40 b . the location specific data 38 a , 38 b , 40 a , and 40 b are subsets of the data 20 and 22 maintained in the primary storage 20 and 22 . for instance , the primary storage 18 includes database data 20 and content 22 for all geographical locations . the data routing map 42 provides information on how data in the primary storage database data 20 and content 22 maps to the location sites a ( 8 ) and b ( 12 ). the data copy program 24 would access the data routing map 42 to determine which secondary server site to send data so that location a specific data is sent to secondary server 30 a and location b specific data is sent to secondary server 30 b . in certain implementations , the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n would submit http requests for data in the primary storage 18 to the primary server 2 over network 14 . the http server 4 may then redirect requests from the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n to the secondary server 30 a and 30 b at the location that is the situs of the originating client , i . e ., requests from clients 6 a , 6 b . . . 6 n would be redirected to the secondary server 30 a at location a ( 8 ) and requests from clients 10 a , 10 b . . . 10 n would be redirected to secondary server 30 b at location b ( 12 ). in certain implementations , because the secondary storages 32 a and 32 b maintain location specific data , the secondary servers 30 a and 30 b can service requests from the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n from location specific data . in certain of the implementations , a portion of the data in the secondary storages 32 a and 32 b may be common data maintained at all remote locations a and b , and other of the data at the remote sites may be specific to the particular location . for instance , in implementations where the primary server comprises a retailer e - commerce web site , the database 20 may maintain customer account information , such as address and payment information , and inventory information . the content 22 may maintain information on products and services provided by the retailer . the retailer would further maintain the secondary sites at the locations a and b to service client requests from the secondary storages systems within their geographic proximity . in this way , network related delays resulting from the processing of commercial communications between the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n and the server processing the transaction are minimized because the distance of the network transaction is reduced . the content 40 a and 40 b may include the same data on the retailer products and services , and thus not differ between geographical sites . however , the location specific database data 38 a and 38 b may include information on only those clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n within the geographical location of the secondary server 30 a and 30 b , such that location a database data 38 a would include customer information for clients 6 a , 6 b . . . 6 n , and not clients 10 a , 10 b . . . 10 n , and database data 38 b would include customer information for clients 10 a , 10 b . . . 10 n and not clients 6 a , 6 b . . . 6 n . in the implementation shown in fig1 the clients 6 a , 6 b . . . 6 n and 10 a , 10 b . . . 10 n , secondary servers 30 a and 30 b , and primary server 2 communicate over a common network 14 , such as the internet or any other network known in the art . fig2 a and 2 b illustrate an additional implementation where , as shown in fig2 a , the primary server 102 and secondary servers 130 a and 130 b communicate over a private network 114 , which may comprise any network limited to authorized members of the organization , i . e ., employees etc . the private network 114 , may comprise a wide area network ( wan ), storage area network ( san ), intranet , local area network ( lan ), virtual private network ( vpn ), etc . separately , as shown in fig2 b , the clients 106 a , 106 b . . . 106 n and 110 a , 110 b . . . 110 n , primary server 102 , and secondary servers 130 a and 130 b may communicate over a separate network 116 , such as the internet . in this way , the primary server 102 propagates data to the secondary servers 130 a and 130 b through a private network separate from the network the clients 106 a , 106 b . . . 106 n and 110 a , 110 b . . . 110 n use to access the data . still further alternative distributed computing environments are possible . for instance , in certain implementations , a separate network may exist between the clients 106 a , 106 b . . . 106 n and 110 a , 110 b . . . 10 n and the secondary servers 130 a and 103 b in a particular geographical location , such as a storage area network ( san ), local area network ( lan ), etc . yet further , the clients may communicate with the secondary server within their geographical location through a common subnet of the internet , such that each geographical location comprises a separate subnet . any other network architecture or arrangement known in the art may also be used to connect the clients , primary server and secondary servers . as discussed , when propagating data to the remote secondary servers 30 a and 30 b , the primary server 2 , and data copy program 24 therein may use a data routing map 42 , or any other data structure , to determine how to route data to the secondary sites . fig3 illustrates an example in one implementation of the information the data routing map 42 would maintain for each data set to be mirrored at a remote secondary site . the data routing map 42 maintains an entry 200 for each data set to be separately mirrored to one or more of the remote secondary servers 30 a and 30 b . each entry 200 includes a data set information 202 indicating the data sets to be mirrored . the data set information 202 may indicate specific files , a directory , a database table , records in a database , etc . in certain instances , the data set information 202 may indicate a query , such that all data in the database data 20 and / or content 22 satisfying the query is part of the data set to mirror . for instance , the query may indicate a particular location , such that all database records having the location value , i . e ., all customers within a particular geographic region , form a data set to mirror to a particular server 30 a , 30 b . each entry 200 further indicates an update frequency 204 that specifies how frequently data from a particular data set 202 is mirrored to the remote site . for instance , critical data , such as payment and address information , inventory information , etc ., may be immediately mirrored to the remote sites , such that any updates to such critical data are immediately copied to the remote site in real time . in this way , the secondary storages 32 a and 32 b maintain the most recent updates for such critical data . in certain implementations , the data copy program 24 may transfer updates to critical data immediately to the secondary servers 30 a and 30 b when such updates are applied to the primary storage 18 , such that the update does not complete until the secondary server 30 a and 30 b acknowledges receiving the update . however , less critical data may be updated at less frequent intervals , such as once a day , etc . for instance , the retailer product advertising and pricing information may be mirrored only once a day as such data does not frequently change . the target server information 206 indicates the one or more secondary servers 30 a , 30 b to receive the data sets . for instance , data that is common among the geographical locations , such as certain advertising and pricing information , may be propagated to all secondary servers 30 a and 30 b , whereas geographical specific data may be propagated to the one or more servers within that specific region . [ 0031 ] fig4 illustrates logic implemented in the data copy program 24 at the primary server 2 to propagate updated data to the secondary servers 30 a and 30 b . at block 250 , the data copy program 24 begins the process to schedule data mirroring operations . for each entry 200 ( fig3 ) in the data routing map 42 that does not require real - time updates , the data copy program 24 schedules ( at block 252 ) a mirroring operation to occur at an interval equivalent to the specified update frequency 204 for the entry 200 . the scheduled mirroring operation would indicate the data set entries 200 to include in the mirroring operation and the target secondary site ( s ). at block 260 , the data copy program 24 processes a scheduled mirroring operation . a loop is performed at blocks 262 through 268 for each data set entry 200 specified for the scheduled mirroring operation . the data specified in the data set 202 for the entry 200 , which may comprise database data 20 , content 22 or data satisfying a query defined for the mirroring operation , is accessed ( at bock 264 ) from primary storage 18 and sent ( at block 266 ) to each secondary server 30 a , 30 b specified in the target server information 206 . at block 270 , in response to receiving an update to data that is a member of a data set 202 specified in an entry 200 as having an high update frequency 204 , such as “ real - time ”, control proceeds to block 272 to determine the one or more secondary servers 30 a and 30 b specified in the target server information 206 . the updates are then sent ( at block 274 ) to the determined secondary server ( s ) to apply to the attached secondary storage 32 a , 32 b . with the logic of fig4 updated data to the primary storage 18 is propagated to the secondary storages according to an update frequency specified for the data . this allows updates to more critical data to be updated immediately at the secondary storage , whereas less critical data that does not change frequently may be updated with less frequency . further , the data copy programs 34 a and 34 b at the secondary servers 30 a and 30 b , respectively , would send any updates to the data at the secondary storage 32 a , 32 b to the primary server 2 . this allows the clients to update data at the secondary server to which they were redirected . in the logic of fig4 the update frequency indicated a time interval at which to propagate non - critical data to the secondary servers 30 a and 30 b . in alternative implementations , the update frequency may comprise one or more threshold triggers other than a time interval . for instance , the update frequency may indicate a threshold percentage of non - critical data that has been modified , e . g ., 10 %, such that after modification of such threshold percentage of the non - critical data , the updated non - critical data is propagated to the secondary servers 30 a and 30 b . still further , the update frequency criteria may also indicate a threshold count of the number of updates to non - critical data , such that upon reaching the threshold count value , the modified non - critical data is propagated to the secondary servers 30 a and 30 b . alternative update frequency criteria may be applied in lieu of the time interval frequency described with respect to fig4 or in addition to fig4 such that the non - critical data is propagated to secondary sites upon the occurrence of one or more triggering events , e . g ., expiration of a specified time interval , updating a threshold percentage of non - critical data , performing a threshold number of updates to non - critical data , etc . different criteria may be maintained for different groups of the non - critical data , i . e ., different data sets 202 indicated in different entries 200 ( fig3 ). [ 0035 ] fig5 illustrates logic implemented in the data copy program 24 to propagate non - critical data when the update frequency 204 indicates a time interval , threshold percentage of updated non - critical data , and / or a threshold absolute number of updates to non - critical data . in the logic of fig5 each of these checks are described as being considered together . however , in additional implementations , only one of these checks may be performed to determine when to propagate non - critical data , or any combination of the different checks may be used . control begins at block 280 after propagating updates to non - critical data to the target server ( s ) 206 . in response , a timer is cleared ( at block 282 ) that is used to determine when a time interval specified in the update frequency 204 ( fig3 ) has expired , an update percentage count is cleared ( at block 284 ) indicating the percentage of non - critical data that has been updated , and an update count is cleared ( at block 286 ) indicating the number of updates to non - critical data that have been performed . upon the occurrence of any one of the above thresholds being satisfied at blocks 288 , 290 or 292 , the updated non - critical data is then propagated ( at block 294 ) to the one or more target servers 30 a and 30 b indicated in the target server field 206 . [ 0036 ] fig6 illustrates logic implemented in the primary 2 and secondary 30 a , 30 b servers to handle data requests from clients . control begins at block 300 with the primary http server 4 receiving a request for data from a client 6 a , 6 b . . . 6 n , 10 a , 10 b . . . 10 n and determining ( at block 302 ) a redirect secondary server 30 a , 30 b , and redirecting the requesting client to that redirect secondary server . the http server 4 may use any criteria known in the art for selecting a secondary server 30 a , 30 b as the redirect server . in certain implementations , the http server 4 may select the secondary server 30 a , 30 b that is within the defined location of the client , e . g ., client 6 a , 6 n . . . 6 n requests are redirected to secondary server 30 a . additionally , the http server 4 may perform load balancing to redirect the request to the secondary server with the lowest current load , thereby minimizing server load delays . still further , the http server 4 may apply a combination of factors , or any other redirection selection factors known in the art . at block 310 in fig6 one secondary server 30 a , 30 b receives the redirected client request . fig1 shows how client requests 50 a and 50 b are redirected at path 52 a and 52 b to one secondary server 30 a and 30 b , respectively . after redirection , the client may communicate directly with the secondary server 30 a and 30 b , as shown on paths 54 a and 54 b . if ( at block 312 ) the requested data is not within the secondary storage 32 a , 32 b , then the secondary server 30 a , 30 b requests ( at block 314 ) the requested data from the primary server 2 and stores the returned data in the secondary storage 32 a , 32 b . from block 314 or the yes branch of block 312 , the requested data is returned ( at block 316 ) to the client initiating the request . [ 0038 ] fig7 illustrates logic implemented in the transaction code 37 a and 37 b in the secondary servers 30 a , 30 b to process a redirected transaction request from a client 6 a , 6 n . . . 6 n , 10 a , 10 b . . . 10 n . control begins at block 320 upon the http server 36 a , 36 b in one secondary server 30 a , 30 b receiving a redirected transaction request from the client , such as a request to purchase or procure goods or services . if ( at block 322 ) the location database data 38 a , 38 b indicates that the requesting client is not registered , then the transaction code 37 a , 37 b transmits ( at block 324 ) a registration page to the client 6 a , 6 b . . . 6 n , 10 a , 10 b . . . 10 n requesting the client to register . upon receiving the returned client registration information , the transaction code 37 a , 37 b updates ( at block 326 ) the location database data 38 a , 38 b with the new client registration information and then sends the new client registration information to the primary server 2 . the primary server 2 would then propagate the received client registration information to the other secondary servers so all remote sites maintain consistent information . the location database data 38 a , 38 b may include different database tables , such as a customer registration table including information on a registered customer , such as address , billing , and credit card information , tables including information on product pricing and inventory . as discussed , the information in the location database data 38 a , 38 b may be specific to the location , such as all customers within the defined location . if ( at block 322 ) the requesting client is registered , then the transaction code 37 a , 37 b generates ( at block 328 ) a transaction object and assigns a unique identifier ( id ) to the transaction . the transaction object may comprise a record in a database table providing information on a client transaction prior to finalization or some data structure maintaining information on a client initiated transaction . additionally , in workflow processing environments , such as the ibm mqseries ** workflow environment , the transaction may comprise a piece of workflow that is processed at different nodes in a workflow management scheme . at block 330 , the transaction code 37 a , 37 b receives selection of items for the transaction from the client , e . g ., selected goods and services . if ( at block 332 ) the location database data 38 a , 38 b indicates that the selected items are not available , i . e ., not in current inventory or unable to be provided , then the transaction code 37 a , 37 b returns ( at block 334 ) a message to the requesting client that the requested items are unavailable . at this time , the requesting client may be provided the option to backorder the items . if ( at block 332 ) the requested items are available , then indication of the items are added ( at block 336 ) to the transaction , i . e ., transaction object or database record . the transaction code 37 a , 37 b then accesses ( at block 338 ) client customer information and accesses ( at block 340 ) pricing information for the selected product from the location database data 38 a , 38 b or content 40 a , 40 b and then generates ( at block 342 ) a transaction approval page for the client including the unique transaction id , customer information , selected transaction items , cost of selected items , and a request for selection of a payment method . the transaction approval page is returned to the client 6 a , 6 b . . . 6 n , 10 a , 10 b . . . 10 n . in alternative implementations , different types of information may be included in the pages transmitted to the application to accomplish the transaction . [ 0041 ] fig8 illustrates logic implemented in the secondary and primary server transaction code 5 , 37 a , 37 b to process a client approval of a transaction . control begins at block 350 with the secondary server transaction code 37 a , 37 b receiving acceptance from a transaction approval form sent to a requesting client . the transaction code 37 a , 37 b then begins ( at block 352 ) a process to approve the transaction by verifying data from the location database data 38 a , 38 b and obtain approval from the credit card issuer for the transaction . as mentioned , the processing may be implemented by a workflow model . if ( at block 354 ) the transaction is not approved , then a disapproved message is returned to the client , perhaps stating the reason for the disapproval , e . g ., failure of credit card authorization . if the transaction is approved , then the secondary server transaction code 37 a , 37 b sends ( at block 358 ) the transaction information to the primary server 2 to finally approve of the transaction . at block 360 , the primary server transaction code 5 receives the request to approve the transaction and transaction information from the secondary server 30 a , 30 b . in response , the primary server transaction code 5 processes ( at block 362 ) the primary database data 20 to verify the availability of the items included in the transaction and the customer information . in certain implementations , the payment or credit card approval may be performed at the primary server and not the secondary server as shown in fig8 . if ( at block 364 ) all transaction information is consistent with the information maintained in the primary database data 20 , then the primary server transaction code 5 initiates ( at block 366 ) a process to carry out the transaction , such as starting a workflow to execute the transaction , gather the transacted items , ship the items , and bill the customer &# 39 ; s credit card . the primary server transaction code 5 returns ( at block 368 ) approval to the secondary server 30 a , 30 b submitting the approval request . in response to the received approval , the secondary server transaction code 37 a , 37 b returns ( at block 380 ) a page or message to the requesting client that the transaction was approved . if ( at block 364 ) the primary server transaction code 5 determined that some of the received transaction information is not consistent with the data in the primary storage 18 , then the transaction code 5 would generate and transmit ( at block 380 ) a message to the secondary server 30 a , 30 b that the data was not verified and include the data from the primary site that is inconsistent with the data gathered from the secondary storage 32 a , 32 b . in response to receiving the message , the secondary server transaction code 37 a , 37 b would update ( at block 382 ) the location database data 38 a , 38 b and / or content 40 a , 40 b with the data received from the primary server 2 . the transaction code 37 a , 37 b would then generate and transmit ( at block 384 ) a revised transaction approval page to the client 6 a , 6 b . . . 6 n , 10 a , 10 b . . . 10 n including previous transaction data updated with new information from the primary storage 18 that was inconsistent with the data previously included in the transaction , for instance any price change information or customer billing or contact information , product information , etc . control would then return to block 350 to await the client &# 39 ; s acceptance of the revised transaction . with the described implementations , most of the parts of a transaction and most data verification and gathering occurs at a remote secondary server from data mirrored for that location in the secondary storage . ths architecture improves response times to client requests by reducing the transmission distance of the requests because the client is redirected to communicate with a more geographically proximate server and by redistributing the load from the primary server to remote secondary servers . moreover , in certain implementations , data is propagated to the secondary servers in a manner that provides the secondary sites with data in a timely manner and conserves network bandwidth . this is accomplished by propagating updates to critical data , such as customer information , payment information , inventory information , etc ., at a high frequency , such as real time , and propagating updates to data that changes less frequently at greater intervals . still further , with the described implementations , data and transaction consistency is maintained because final approval of the transaction is obtained from a primary storage site , which includes the most recent version of data and ensures that a transaction processed at a secondary site is not based on stale or inconsistent data . the described data mirroring and transaction techniques may be implemented as a method , apparatus or article of manufacture using standard programming and / or engineering techniques to produce software , firmware , hardware , or any combination thereof . the term “ article of manufacture ” as used herein refers to code or logic implemented in hardware logic ( e . g ., an integrated circuit chip , programmable gate array ( pga ), application specific integrated circuit ( asic ), etc .) or a computer readable medium ( e . g ., magnetic storage medium ( e . g ., hard disk drives , floppy disks ,, tape , etc . ), optical storage ( cd - roms , optical disks , etc . ), volatile and non - volatile memory devices ( e . g ., eeproms , roms , proms , rams , drams , srams , firmware , programmable logic , etc .). code in the computer readable medium is accessed and executed by a processor . the code in which preferred embodiments are implemented may further be accessible through a transmission media or from a file server over a network . in such cases , the article of manufacture in which the code is implemented may comprise a transmission media , such as a network transmission line , wireless transmission media , signals propagating through space , radio waves , infrared signals , etc . of course , those skilled in the art will recognize that many modifications may be made to this configuration without departing from the scope of the present invention , and that the article of manufacture may comprise any information bearing medium known in the art . the messages and information returned to the clients in response to transaction related requests may comprise pages , such as html or xml pages transmitted using the http protocol or comprise e - mail messages or instant messaging messages . in the described implementations one instance of a primary server and primary storage is shown . in further implementations , the primary site may comprise multiple primary servers and primary storages . in certain implementations , two secondary storage sites are shown each including one secondary server and secondary storage . in further implementations , there may be more than two secondary storage sites at different geographical locations and each site may include multiple secondary servers and / or secondary storages . the preferred logic of fig4 - 8 described specific operations occurring in a particular order . further , the steps may be performed in parallel as well as sequentially . in alternative embodiments , certain of the logic operations may be performed in a different order , modified or removed and still implement preferred embodiments of the present invention . morever , steps may be added to the above described logic and still conform to the preferred embodiments . yet further , steps may be performed by a single processing unit or by distributed processing units . in the described implementations , the transaction initiated by the client comprised a transaction to purchase goods or services from a commercial retailer e - commerce web site . in alternative implementations , the transactions processed in the manner described above may comprise any type of transaction requesting resources or interactions that a client would transmit across a network . thus , the described implementations are not limited to commercial e - commerce type operations and may encompass any network transaction known in the art that is serviced from a server . in certain implementations , the distributed systems communicated across the networks using the http protocol for transmitting documents between computers within a network . however , those skilled in the art will appreciate that any communication protocol may be used to transmit information in accordance with implementations of the invention . in certain implementations , the secondary servers transmitted pages of data to the clients in the html or xml file format . however , any document or data format known in the art may be used to transmit information between the systems . the foregoing description of the described implementations has been presented for the purposes of illustration and description . it is not intended to be exhaustive or to limit the invention to the precise form disclosed . many modifications and variations are possible in light of the above teaching . it is intended that the scope of the invention be limited not by this detailed description , but rather by the claims appended hereto . the above specification , examples and data provide a complete description of the manufacture and use of the composition of the invention . since many embodiments of the invention can be made without departing from the spirit and scope of the invention , the invention resides in the claims hereinafter appended .

US-9642302-A

a securing and locking device for transporting bicycles is presented which may be easily and universally attached to the front rail of a truck bed . the device has an outer inverted l - shaped bracket which is secured to the front rail of a truck bed by means of an inner l - shaped tightening mechanism . nuts attached to the vertical and horizontal legs of the tightening mechanism tighten the entire device to the front rail of a truck by means of horizontal and vertical normal forces exerted against the truck rail and outer bracket . a quick - attach skewer device is provided on the horizontal leg of the outer l - shaped bracket so that the front fork of the bicycle may be quickly and securedly attached to the bracket which is attached to the truck bed rail . a securing cable may be placed around the bicycle frame and through a slot in the outer bracket and locked . due to the configuration of the cable slot and the location of the lock when in place , it is virtually impossible to loosen the tightening nuts . the outer bracket is constructed so that it may be universally adapted to any type of truck rail in common use in the united states .

bicycles are frequently transported in the back of a truck bed 1 . the truck bed has side rails and a front rail 2 near the front end cab section of the truck . a standard bicycle 3 may be attached to the truck bed by means of this new device . in order to effect the attachment , the front wheel 4 ( as best shown on fig1 ) is first detached from the front fork 5 of the bicycle . the front wheel 4 is then secured according to the method of this invention to the frame of the bicycle by means cf velcro strips 6a and 6b . the bicycle is then ready to be attached to the securing carrier device 9 . a perspective view of the securing carrier is shown at fig2 . various embodiments of the securing carrier which may be attached to different types of truck rails , are shown on fig4 a , 4b , 4c and 4d . the locking carrier device comprises an outer inverted l - shaped bracket 10 . this outer inverted l - shaped bracket 10 has an upper horizontal leg 15 and a lower vertical leg 16 . the upper horizontal leg 15 has a horizontal slot 17 , as shown on fig2 . the lower vertical leg of the outer bracket has a vertical slot 18 . the upper vertical leg of the outer bracket also has an outer bracket horizontal flange 12 at the end opposite the horizontal leg 16 . in order to attach the outer inverted l - shaped bracket 10 to the truck bed front rail 2 , an inner l - shaped tightening mechanism 11 is utilized . this inner l - shaped tightening mechanism comprises a vertical tightening leg 22 and a horizontal tightening leg 23 . slidably attached to the vertical tightening leg 22 is a pressure plate 13 . this pressure plate 13 slides up or down the vertical tightening leg 22 depending on the size and type of truck rail 2 encountered . the tightening mechanism 11 is tightened by means of a vertical tightening nut 24 and a horizontal tightening nut 25 . with the outer bracket flange 12 positioned over the front rail as shown in fig2 and 4a through 4d , the tightening nuts 24 and 25 are turned so as to attach the outer bracket 10 to the truck rail 2 . a pair of axle flanges 20 are permanently affixed to the upper portion of the vertical leg of the outer bracket , as shown on fig2 and 4a through 4d . a quick - connect skewer 21 is then positioned onto the axle flanges 20 as shown on fig2 . the skewer has a horizontal axle 26 similar to the axle of a bicycle wheel . the front forks 5 of a bicycle may then be easily attached to the axle 26 by means of the quick - attach skewer 21 . as best shown on fig2 the carrier device is attached to the front rail of the truck bed 2 by means of the tightening mechanism 11 . the horizontal slot 17 allows the device to be adjusted according to the width of the rail . various widths of truck bed front rails 27 are shown on drawing fig4 a through 4d . the vertical slot 18 on the outer bracket allows for vertical adjustment to the height of the truck bed rail . a horizontal cable slot 19 , which is on the vertical leg and perpendicular to the vertical slot 18 , is used for attaching the locking cable 7 and bicycle to the locking carrier device . an alternate embodiment of this device has a v - shaped cable slot instead of the horizontal cable slot as shown . this v - shaped cable slot is formed beneath the lower terminating portion of the vertical slot 18 . use of the v - shaped slot causes a shield to be formed for the tightening nut or nuts when the bicycle is locked by the cable and lock . when using one of the pressure pads shown in drawing fig6 a through 6c , a v - slot renders it nearly impossible to remove any of the tightening nuts . this , of course , prevents the bracket from being moved out of position or being detached from the truck bed . in attaching the carrier device to the front rail of a truck bed , the outer bracket flange 12 is first placed over the front edge 28 of the truck rail . the vertical tightening nut 24 is then adjusted so that the pressure plate 13 is in contact with the lower angled portion of the front rail of the truck . the horizontal tightening nut is then adjusted so that the entire device is secured to the front rail of the truck as shown in fig4 a through 4d . the pressure plate 13 may have a soft pad 29 so as to prevent damage to the painted surface of the truck front rail . similarly , the outer bracket flange 12 may be padded along with the bottom surface of the upper horizontal leg of the outer bracket to prevent paint damage . such a bracket flange pad 30 is shown in fig4 b . in the alternate embodiment for the outer inverted l - shaped bracket , as shown in fig8 these pads 29 and 30 may be omitted . because the alternate embodiment is made of plastic , it is unlikely that any paint damage would occur and the cushioning pads are not required . as demonstrated on fig2 and 3 , tightening the nuts 24 and 25 secures the locking carrier device to the truck bed . tightening nut 24 applies a vertical force to the device and tightening nut 25 provides a horizontal force to the outer l - shaped bracket . these forces prevent the outer bracket from rotating about the rail . in the preferred embodiment , the inner l - shaped tightening mechanism consists of an l - shaped screw which is threaded in both its horizontal and vertical legs . however , this l - shaped screw is not required to be a one - piece unit as long as the relation between the horizontal threaded member and the vertical threaded member is held substantially perpendicular to one another . a one - piece l - shaped threaded member will work well when used with the lanced loop 14 of the pressure plate 13 , as shown in fig4 a through 4d . another method of securing the outer l - shaped bracket to the truck bed rail is shown in fig5 a and 5b . fig5 a shows a hinged pressure pad which is capable of adjusting to any rail configuration and hence is universal in its application . the angle shown on pressure pad 13 is not fixed in this embodiment but may vary according to the configuration of the truck bed rail encountered . ( fig5 a and 5b form an alternate embodiment to the inner l - shaped tightening mechanism 11 shown on fig4 a through 4d .) the variable angle of the alternate tightening mechanism , best shown on fig5 is accomplished by simply tightening the angle bolt 31 . tightening the angle bolt 31 on the vertical threaded member 32 of the variable pressure plate 33 varies the angle between the horizontal leg 34 of the variable pressure plate and the oblique leg 35 . fig5 a shows the variable pressure plate 33 fully open with both the horizontal and oblique legs parallel to the vertical threaded member 32 . fig5 b shows the variable pressure plate in a partially closed position creating an oblique angle between legs 34 and 35 . both fig5 a and 5b are shown without the outer inverted l - shaped bracket attached . this alternate embodiment for the inner tightening mechanism is attached to the outer inverted l - shaped bracket by placing the horizontal attaching leg 36 through the vertical slot 18 on the outer l - shaped bracket and by placing the top of the vertical threaded member 37 through the horizontal slot on the horizontal leg of the outer inverted l - shaped bracket . a variable pressure plate attaching nut 38 is used in place of the vertical tightening nut 24 of fig4 a in practicing this embodiment . fig6 a through 6c show alternate constructions for the pressure pad and inner l - shaped tightening mechanism . fig6 a shows the vertical leg 22 &# 39 ; connected to the horizontal leg 23 &# 39 ; by means of a lanced loop 39 . the lanced loop forms a slidable collar about the vertical leg of the tightening mechanism . the horizontal leg 23 &# 39 ; of the tightening mechanism is then welded to the collar to form the perpendicular l - shaped tightening mechanism . as before , the pressure plate 13 is slidably attached about the vertical leg 22 &# 39 ; by means of a lanced loop 14 . another embodiment for the inner l - shaped tightening mechanism is shown at fig6 b . in this embodiment , the lanced loops 39 and 14 shown on fig6 a are combined . a cylindrical hollow collar 40 has attached to it a pressure pad 13 and a horizontal tightening leg 23 &# 39 ;. in this embodiment , the horizontal tightening leg and the pressure pad slide vertically about the vertical leg 22 &# 39 ; of the tightening mechanism as shown . the alternate embodiments shown in fig6 a and 6b allow the slotted holes 17 and 18 to remain centered . yet another variation for the inner l - shaped tightening mechanism is shown on fig6 c . in this embodiment , the pressure pad may be adjusted to any angle . according to the embodiment taught by the variation as shown in fig6 c , the pressure pad 13 &# 39 ; is rotatably attached to a separate horizontal tightening leg 23 &# 39 ; by means of a pin 41 . in this embodiment , an additional nut 42 is added to the separate horizontal leg of the inner tightening mechanism to hold the block against the rails . the holes in the block 43 are substantially at ninety degrees to each other , and are offset as shown in fig6 d . as shown in fig6 d , one way to adjust the angle of the plate involves offset holes 44 and 45 . in this embodiment , the vertical hole 44 for the vertical leg of the tightening mechanism is offset from the horizontal hole 45 . the separate horizontal leg 23 &# 39 ; of the tightening mechanism extends through the block 43 . the outer end of the separate horizontal leg has the rotatably attached pressure plate 13 &# 39 ; attached about pin 41 . yet another method of attaching a variable pressure plate to the vertical leg of the tightening mechanism is shown in fig6 e and 6f . in place of the two adjusting plates 33 and 35 shown on fig5 b , there is used the hollow cylindrical collar 40 &# 39 ; having threaded arms 46 . the hinged plate 47 shown in fig6 f is then attached about the threaded arm 46 by means of the radiused slotted holes 48 . the top of the hinged plate 47 is pivotably attached to the bottom of the horizontal leg of the variable pressure plate 34 . in this embodiment , the cylindrical collar 40 &# 39 ; would slide up the vertical threaded member 32 to adjust to the height of the truck rail . hinged plate 47 would rotate according to the angle of the rail encountered and the tightening nut 31 would be adjusted to hold the height of the collar 40 &# 39 ; at the proper position to secure the outer inverted l - shaped bracket in place . fig7 shows one embodiment of the outer inverted l - shaped bracket which is of unitary construction and made of metal . the outer flanged bracket 12 may alternatively be secured to the outer l - shaped bracket by means of welding and reinforcements as shown on fig7 . the slots , flanges and other aspects of the outer inverted l - shaped bracket remain essentially the same . fig8 shows a plastic embodiment of the outer inverted l - shaped bracket showing the various points of reinforcement . reinforcing ridges 49 help to strengthen this particular embodiment . in place of the axle 26 , there is a plastic axle 26 &# 39 ; as best shown on fig8 . fig9 shows a front view of the device . in fig9 the horizontal cable slot 19 is present for securing the bicycle to the carrier device and thence to the truck bed . the quick - attached skewer 21 is shown . once the carrier device has been attached to the truck rail , the front forks 5 of the bicycle frame 3 are inserted into fork slots 49 . the quick - attach skewer handle 50 is then tightened so that the front forks 5 are firmly attached in the fork slots 49 . to complete the attachment of the bicycle frame to the truck , a securing cable 7 is attached about the bicycle frame . the ends of the securing cable 7 are both looped and are placed through the cable slot 19 . the loops are then securely fastened by means of a padlock 8 , as best shown on fig1 . if the cable slot 19 is arranged so that it is in a v - shape with the bottom of the &# 34 ; v &# 34 ; near the bottom of the horizontal slot 17 , the two loops , when attached by the padlock 8 , make it nearly impossible for a person to loosen the carrier device 9 without first unlocking the padlock 8 and removing the cable and cable ends . the pressure plate lanced loops may be constructed as shown in fig1 a through 10c . as shown in fig1 b , a rectangular shaped piece of metal is cut so that loop 51 may be raised from the metal . when loop 51 is raised from the metal it forms the collar 14 as shown at fig1 a . another variation for the inner l - shaped mechanism is shown on fig1 and 12 on the preferred embodiment . a vertical plate 51 is formed having a vertical cylinder 52 and a horizontal cylinder 53 . these cylinders receive the vertical threaded member 32 and the horizontal attaching leg 36 , shown in fig5 b . the vertical plate 51 has a horizontal hinged flange 54 which adjusts to the proper angle when the entire device is secured in place on the truck . the mechanism shown in fig1 and 12 replaces pieces 33 , 34 and 35 shown in fig5 b . this part could be made of plastic , in which case the hinged flange comprises a living hinge or the part could be of metal . in constructing this part from metal the hinged flange and vertical plate would be two pieces , pivotably attached by a hinge . the device as shown and described is capable of being attached to any type of truck rail as shown in fig4 a through 4d . the different types of pressure plates and methods of attachment to the inner l - shaped tightening mechanism may be used interchangeably .

US-51219090-A

diagnostic strips of the kind which are exposed to biological fluids such as blood or urine to detect or monitor medical conditions are cut sequentially from elongated cards by a reciprocating shear blade . the cards may be ones which exhibit defective areas that should not be included in the finished strips . blade motion seats each newly cut strip on a movable strip carrier which abuts the blade during the cutting operation . the carrier then travels a nondefective strip to a pickup location where it is precisely positioned and picked off of the carrier for emplacement in a housing . a strip with a defective area is carried further to a discharge location where it is released into a waste receptacle . this enables more economical manufacture of diagnostic strips by efficiently making use of nondefective areas of cards that have defective areas .

referring initially to fig1 of the drawings , strip cutting and sorting apparatus 11 embodying the invention is designed to cut transverse strips 12 from elongated rectangular cards 13 in a sequential manner . the cards 13 may be of the known diagnostic form which are coated with reagents that change color upon exposure to specific substances in biological fluids . the reagents are typically contained in laminated ribbons 14 of thin tissue like material that extend along opposite boundary regions of one surface of a backing material 16 . the apparatus 11 may also be used to cut transverse strips from other types of card . cards 13 may on occasion exhibit visible defective areas 17 which can arise during manufacture or from exposure of the card to foreign substances . strips containing such areas 17 or portions of such areas may not function properly and should not be present in the finished product . cutting and sorting apparatus 11 enables efficient sorting of defective strips 12 a from the nondefective strips 12 . each card 13 is fed end wise into a cutter unit 18 which cuts the strips 12 , 12 a from the card in a sequential manner . a movable strip transporting carrier 19 separately carries each newly cut nondefective strip 12 from a first location 21 at which the cutting operation takes place to a second location 22 at which the strip is picked off of the carrier by pickup mechanism 101 which will hereinafter be described . defective strips 12 a are carried further by the carrier 19 to a third location 23 at which the strip is released from the carrier into a waste receptacle 24 . in this example of the invention , pickup mechanism 101 emplaces each non - defective strip 12 in one of a series of flat plastic housings 15 which are brought to a housing loading location 25 by a conveyer belt 108 . the housings 15 are subsequently provided with covers 25 to form test kits such as pregancy test kits , for example . the kits may be of the known form in which covers 25 have openings through which fluid may be admitted and for observing the central region of the strips . the strip 12 is emplaced in a recess 20 within housing 15 that has a rectangular configuration conforming with the outline of the strip . the strip 12 fits tightly into the recess 20 in order to prevent it from shifting position . this requires that the strip 12 be in precise register with recess 20 as it is being entered into the recess . that in turn requires that the strip 12 be precisely positioned and oriented at the pickup location 22 . referring jointly to fig2 and 3 , the cutter unit 18 of this particular example of the invention includes a vertically extending rectangular die member 26 and a reciprocating rectangular shear blade 27 disposed against the back surface of the die member in parallel relation ship with the die member . track members 28 of right angled cross section extend from each side of die member 26 and along edge regions of the back of shear blade 27 to hold the blade against the die member . referring to fig1 and 2 , die member 26 is supported by a downward extending portion 29 of the framing of the apparatus 11 which also supports an electrical servomotor 31 . servomotor 31 turns a crank wheel 32 within framing portion 29 through a speed reducing gearbox 33 . the lower end of a crank arm 34 is pivoted to wheel 32 , at an off center location on the wheel , by a pivot pin 36 . the upper , end of crank arm 34 is coupled to shear blade 27 through another pivot pin 37 . thus operation of servomotor 31 causes vertical reciprocation of shear blade 27 relative to die member 26 . referring to fig3 and 4 in conjunction , the shear zone at which successive strips are cut from the cards 13 is defined by the lower edge of a horizontal slot 38 in die member 26 into which the cards are fed . the upper edge 39 of a trapezoidal opening 41 in shear blade 27 is a cutting edge of the blade and is sloped so that each cutting of a strip proceeds progressively along a transverse cut line on the card . the shear blade 27 has a surface 42 immediately above the cutting edge 39 which is inclined to extend outward from die member 26 . the inclined surface 42 urges cut portions of the strip outward from the die member 26 as cutting of the strip progresses in a manner which will hereinafter be further described . three spaced apart vertical grooves 43 in the back surface of shear blade 27 extend upward from the inclined surface 42 to enable entry of strip transporting components into the blade as will also hereinafter be further described . the die member 26 , including slot 38 , and shear blade 27 of this example of the apparatus are considerably broader than the particular cards 13 which are being cut . this facilitates adaptation of the apparatus for cutting cards of different widths . referring jointly to fig3 and 5 , the strip transporting carrier 19 of this example of the invention has a platen 44 which is traveled towards the strip cutter 18 and away from the strip cutter along a strip travel path 46 which extends horizontally from the shear zone 38 at die member 26 . the platen 44 rides on a pair of spaced apart rails 48 which are engaged by sliding shoes 49 at the underside of the platen . rails 48 are secured to a horizontal portion 51 of the framing of the apparatus 11 . referring jointly to fig3 and 6 , parallel thin slots 52 in platen 44 extend from the front end 53 of the platen 44 to a location near the back end of the platen . platen 44 is formed to have raised ribs 54 which extend along each side of the top of each slot 52 and which also extend outward towards die member 26 at the front of the platen . another raised rib 56 extends along the top of the platen 44 at a location which is midway between the pairs of ribs 54 . newly cut strips 12 which are being traveled by the carrier 19 rest on the ribs 54 and 56 . a pivot arm 57 extending along each slot 52 has an upwardly directed strip containment finger 58 at its front end , the finger being immediately in front of the ribs 54 which bound the slot . arms 57 are coupled to the platen 44 by a pivot axle 59 which extends transversely within the platen thereby enabling fingers 58 to be moved in a vertical direction by pivoting of the arms . a cross link rod 61 extends between the arms 57 at a location forward from pivot axle 59 to enable joint raising and lowering of the fingers 58 by a single actuator 62 of the type having an extensible and retractable rod 63 . actuator 62 , which may be any of the pneumatic , hydraulic or electrical type , is pivoted to a bracket 64 which extends down from platen 44 and the extensible and retractable rod 63 engages cross link rod 61 . as best seen in fig6 fingers 58 are proportioned to be flush with the tops of ribs 54 and 56 when in the lowered position and to extend above the ribs when in the raised position . in conjunction with other structure to be described , fingers 58 assure that a newly cut strip is precisely positioned on the platen 44 in a transverse orientation and remains at that position during travel towards the strip pickup location 22 . as may be seen in fig9 the fingers 58 are within the shear blade 27 when cutting of a new strip begins . the fingers 58 are in the lowered position and are within shear blade opening 41 at that time . the previously described vertical grooves 43 in the shear blade 27 allow fingers 58 to remain in the blade as the blade descends and the cutting operation continues . descent of the inclined surface 42 of the blade 27 moves the newly cut strip out of the blade and on to platen 44 . fingers 58 are then raised to contact the adjacent edge of the newly cut strip and thereby maintain it in a transverse orientation as it is traveled away from the blade by the carrier 19 . in the absence of preventive measures , the shear blade 27 would tend to wedge strips downward between fingers 58 and die member 26 as cutting of the strip progresses . this is avoided by a series of spaced apart retractable strip supports 66 at the front end 67 of carrier 19 , there being four such strip supports in this example of the invention . referring jointly to fig3 and 7 , the strip supports 66 extend outward from platen 44 except when cutting of a strip is progress . during a cutting operation , the descending inclined surface 42 of the shear blade 27 forces the strip supports 66 into notches 68 in platen 44 . this moves newly cut portions of the strip on to platen 44 without the wedging effect discussed above . the strip supports 66 are retractable as the supports have stems 69 which extend into openings 71 in the front of platen 44 . compression springs 72 in openings 71 act against steps 73 on the stems 69 to urge the supports in an outward direction . stops 74 at the inner ends of the stems 69 limit the outward movement . movement of the strip transporting carrier 19 can be effected with a motor or actuator of any various kinds . in this example , with reference to fig1 an arm 76 extends downward from the carrier 19 to an internally threaded sleeve 77 . sleeve 77 engages on a horizontally extending lead screw 78 which is turned by an electrical servomotor 79 to travel the carrier 19 between the above described locations of the carrier . referring jointly to . fig2 and 9 , precise positioning of each strip 12 on the carrier 19 is further provided for by a top containment plate 81 which extends horizontally between the cutting unit 18 and the strip pickup location 22 . spacing of the bottom surface of top containment plate 81 from the top of carrier 19 is just slightly greater than the thickness of the strips 12 . longitudinal grooves 82 in the bottom surface of top containment plate 81 are entered by the tops of the strip containment fingers 58 of carrier 19 when the fingers are in the raised position . movement of strips 12 at right angles to the direction of travel is blocked by strip end guides 83 and 84 which extend along opposite sides of the strip travel path . end guides 83 and 84 extend down from top containment plate 81 to a level which is slightly below the level of the tops the platen ribs 54 on which the strips rest . end guide 83 is a fixed end guide fastened directly to the top containment plate 81 . the other end guide 84 is a retractable end guide which is movable towards the fixed end guide 83 and away from the fixed end guide within a small range of travel in order to accommodate to slight variations in the length of strips 12 . retractable end guide 84 has a tab 86 which extends up to a location which adjacent to a spring housing 87 situated at the top of containment plate 81 , and is secured to a horizontal rod 88 which extends into the housing at right angles to the path of travel of carrier 19 . a spring 89 within housing 87 urges rod 88 and thus retractable end guide 84 in the direction of the fixed end guide 83 . the retractable end guide 84 is positioned to be urge slightly away from the fixed end guide 83 by strips 12 entering the region between the end guides and thus exerts a light pressure against the strip which acts to hold the other end of the strip in abutment against the fixed end guide 83 . this assures precise positioning of the ends of strips 12 on carrier 19 . referring to fig2 and 3 in conjunction , positioning of nondefective strips 12 at the pickup location 22 is completed by transversely extending front edges of a pair of spaced apart registration guides 91 which are components of a lift gate assembly 92 . assembly 92 has a vertically oriented rectangular fixed frame 93 , secured to the previously described framing portion 51 of the apparatus , which extends around the path of travel of carrier 19 . a lift gate 94 which is also a vertically oriented rectangular frame , is disposed against fixed frame 93 . the lift gate 94 has vertically extending rails 96 of angled cross section which are entered into conforming grooves 97 in the fixed frame 93 . this enables vertical movement of the lift gate 94 relative to the fixed frame 93 and relative to the strip transporting carrier 19 . referring to fig1 vertical movement of the lift gate 94 is effected by another actuator or cylinder 98 of the form having an extensible and retractable rod 99 and which may be of the pneumatic , hydraulic or electrical type . referring again to fig2 and 3 , registration guides 91 are integral portions of the lift gate 94 that extend down to carrier ribs 54 when the gate is at the lowered position . the lowered guides 91 are abutted by nondefective strips 12 as the strips arrive at the pickup location 22 along the strip travel path . referring to fig8 nondefective strips 12 are lifted away from the pickup location 22 by the pickup mechanism 101 . in this example of the invention the pickup mechanism 101 has a pair of vertically oriented suction tubes 102 which extend downward from a vacuum housing 103 . housing 103 and tubes 102 are movable in a vertical direction to bring the bottom ends of the tubes 102 into contact with nondefective strips 12 which have arrived at the pickup location 22 . a flexible conduit 106 is connected between housing 103 and a vacuum source 107 through a valve 104 . valve 104 is opened when the tubes 102 arrive at the pickup location 22 to create suction which causes the strip 12 to cling to the bottoms of the tubes 102 . housing 103 and tubes 102 are then traveled upward and then horizontally and then downward to emplace the strip 12 in a housing 15 in the previously described manner . the housings 15 are brought to the loading position 25 by conveyor belt 108 which is driven by another servomotor 110 . closure of valve 104 at that time releases the strip 12 from the suction tubes 102 . the pickup mechanism 101 includes a horizontal rail 109 which extends in the direction of travel of housing 103 and a support block 111 is slidable along the rail . housing 103 is secured to an arm 112 which extends in parallel relationship with rail 109 below the rail . spaced apart vertical rods 113 extend up from arm 112 through vertical passages 114 in block 111 . the above described vertical motion of housing 103 and suction tubes 102 is effected by another extensible and contractible actuator 116 connected between arm 112 and slidable block 111 . the block 111 is traveled along rail 109 to provide the horizontal movement by a leadscrew 117 driven by another servomotor 118 . referring jointly to fig1 and 2 , cards 13 which are to be cut into strips 12 are fed into the cutter unit 18 along a card guide 119 having a floor 121 and upward extending side walls 122 . in this example a ram member 123 abuts the end of the card 13 within guide 119 and is traveled along the guide to force the card into the cutter unit 18 . ram member 123 is traveled by another lead screw 124 driven by another servomotor 126 . the card 13 is preferably traveled in a stepped manner with each increment of movement having a length equal to the desired width of the strips 12 . servomotor 126 is preferably of the programable type to enable selective changing of the length of the stepping movements of ram member 123 in order to change the width of the strips 12 which are being produced . the herein described operations of the servomotors 31 , 79 , 110 , 118 and 126 , valve 104 and actuators 62 , 98 and 116 can be preprogrammed and sequenced by automatic controls if desired . incipient entry of a defective area 17 of a card 13 into cutter unit 18 can be detected by an optical sensor 127 situated above guide 119 at the entrance to the cutter unit . a lamp 128 illuminates the region of the card 13 that is passing under sensor 127 . when an optical sensor 127 is used , the cards 13 are preferably manually inspected prior to being fed into the cutting and sorting apparatus 11 and defective areas 17 are emphasized by marks 129 made with a marking pen or the like , the markings being black or of some other color that contrasts with the color of the card . upon entry of a defective area 17 into the cutter unit 18 , with reference jointly to fig1 and 10 , actuator 98 is operated to shift lift gate 94 including registration guide 91 to the raised position . preferably , the next cutting operation at the cutter unit 18 is then delayed until the entire defective area 17 has passed through die member 26 . the strip transport carrier 19 is then traveled beyond the pickup location 22 to the third location 23 as depicted in fig1 . this locates the defective portion 12 a of the card , which is being transported by carrier 19 , beyond the registration guide 91 . referring again to fig1 and 10 , the lift gate 94 including registration guide 91 is then lowered by operation of actuator 98 to reposition the registration guide against ribs 54 of the carrier 19 . strip containment fingers 58 are lowered by operation of actuator 62 . servomotor 79 is then operated to return the carrier 19 to cutter unit 18 in preparation for receipt of another strip . during the return motion of the carrier 19 the defective portion 12 a of the card is scraped off of the back end of the carrier by the back surface of the lowered registration guide 91 . a chute 131 extends outward and downward from the back of carrier 19 to guide the rejected portion 12 a of the card into waste receptacle 24 . while the invention has been described with reference to a single preferred embodiment for purposes of example many modifications and variations are possible and it is not intended to limit the invention except as defined in the following claims .

US-81643201-A

an emissions recycling system is used on a vehicle towing an agricultural implement to enrich the fertility of the soil . the system includes an exhaust collector for collecting exhaust emissions from the internal combustion engine of the towing vehicle and an exhaust distribution system for injecting at least a portion of the exhaust emissions collected by the exhaust collector into the ground worked by the ground working tools of the agricultural implement . fertility of the soil is enriched by bioactivity within the soil &# 39 ; s micro flora which consumes the greenhouse gas and emissions .

referring to the accompanying drawings , there is illustrated an emissions recycling system generally indicated by reference numeral 10 . the recycling system is designed to condition emissions in the emissions conditioning chamber 14 . internal combustion engine emissions and green house gases such as co 2 , no x , and so x can be chemically and catalytically conditioned and cooled to match the plant soil micro flora and micro fauna needs . the system 10 includes an agricultural tractor or the like with an internal combustion engine 12 operating at optimum stoichiometric ratio to break the n 2 bonds and achieve complete combustion . as a result , all hydrocarbons are burned , releasing all the energy of the fuel to provide kinetic energy to till , seed or rotor till the soil or implement of the like 54 that fractures the soil . this allows the emissions to be buried or well mixed into the soil structure , becoming bioactive with the micro flora 64 bacteria , fungi , and micro - organisms that in return release nutrients from the soil organic matter and minerals . free living bacteria 64 bio - activate 20 co 2 and fix n 2 from the air to make plant usable nitrogen . the catalyst that makes this happen is molybdenum that may need to be applied with emissions if the fuel source 22 does not contain sulphur , molybdenum as a lubricant . two types of fuel could be used and chosen to best suit the soil as sulphur lowers ph and helps salt resistance , but on low ph soil , a low sulphur fuel would be burnt as determined by the agronomic computer 66 to avoid further acidification of the soil . the bioactive emissions recycling system 10 includes an emissions conditioning chamber 14 that is connected to the exhaust manifold . as the exhaust gasses pass through the chamber , various chemical reactions can be controlled to alter emissions to best suit the plant &# 39 ; s soil type , ph and micro flora that bio - activate 20 the emissions hydrogen conditioning 30 and oxygen conditioning 40 . the n molecules will combine with hydrogen or oxygen making a cat ion (+) or an anion (−). multiple compartment water tanks 24 and 26 store and reuse water at lower ph levels to aid in chemical reactions . the water makes steam in the boiler chamber 34 to be injected at various locations in the chamber . hydrogen conditioning 30 starts at the exhaust manifold 32 , which is the hottest location to oxidize metals with steam injection . at the point of glowing hot metals , the oxygen oxidizes the metals , breaking the h 2 o bond , thus freeing hydrogen to combine with the n molecules as nh 4 . the replaceable metal pipes 33 will oxidize away as the micronutrients including copper , zinc , nickel , and iron are beneficial to the soil . if lacking , the steam chamber 34 removes the heat from the conditioning chamber that creates steam pressure to inject steam into the chamber 14 . hydrogen can be released by electrolysis of acidic water 36 , or recirculation of condensate within the chamber or from a distribution fan 52 . a water return line 58 to the return storage tank 26 is used as the biological culture growing tank . as condensate is added the reproducing culture consumes the elements from the emissions producing amino acids , enzymes , bacteria and fungi . this culture is applied to the soil on the go as it reproduces . heat exchanger 38 and cooling fins can cool the chamber 14 . oxygen conditioning can start in the exhaust manifold 32 to burn unburned hydrocarbons or within a three stage catalytic converter 46 . air injection 42 of o 3 , may be produced from an alternator or a generator high voltage arc . catalysts 46 are located in various locations to speed up reactions in the chamber 14 . the inside of the combustion chamber is impregnated with a ceramic parts coating that helps the engine 12 withstand hotter exhaust temperatures . electromagnetic fields , a cathode and an anode in the water tank make water favour hydrogen at the cathode outlet 28 connected to the negative terminal of the battery 27 or oxygen at the anode outlet 29 connected to the positive terminal of the battery 27 . a distribution system 50 is retrofitted to tillage equipment 54 or the like by distribution hoses 56 which withstand up to 450 degrees f . or 230 degrees celsius of steam . otherwise a heat exchanger 38 , or any other form of cooling mechanism , is used to remove heat from the hoses 56 which are connected to the tillage points to incorporate all the emissions into the soil structure . in other embodiments , the emissions are distributed into a rotor tiller hood or a lawn mower deck to be well mixed into the soil or grass mulch . the distribution fan 52 maintains air flow in the system is to avoid back pressure on the engine . soil 60 can vary in ph , and have excessive or lacking elements . the plants 62 adapt to the soil chemistry . micro - organisms 64 bio - activate the emissions . certain micro - organisms live off of the emissions and feed back the nutrients that they have bio - activated 20 back to the plants 62 when they die . to manage the many variable requirements of the soil 60 , the plants 62 and the micro - organisms 64 , an agronomic computer 66 alters the emissions to best meet the soil micro - organisms and crop needs . as described herein , a bioactive recycling system uses the micro flora such as bacteria , fungi and organisms that are naturally with in the soil of a typical agricultural landscape . this bioactivity within the soil structure consumes the greenhouse gases and emissions from the hydrocarbons that are burnt at optimum stoichiometric ratio combustion in an agricultural tractor that is tilling or incorporating seed into the soil . limited availability of co 2 , no 2 and so 2 can be a limiting factor of bioactivity with in the soil structure . plants and micro flora use these emissions as an energy source to assist in the cycle of plant nutrients . for example , free - living - nitrogen - fixing organism &# 39 ; s ability to fix n 2 from air within the soil structure is limited by the demand on co 2 as plants and their root &# 39 ; s associated micro flora get first chance at the co 2 from photosynthesis . this shortage is greater when applied fertilizer &# 39 ; s ammonium is taken up by the roots as co 2 has to combine with the ammonia as urea is transported to the shoots . this co 2 consumption takes energy from the plant which causes a co 2 shortage at the roots instead of co 2 which exudates . hydrogen from the roots has to be secreted causing problems with ph balance , nutrient uptake and root growth . no x emissions recycled into the soil are consumed by nitrobacteria in various oxidations to no 3 as an energy source . uptake by the roots of no 3 allows the plant to secrete co 2 for its roots to feed associated root bacteria . in return , the bacteria feeds back photo hormones cyt , iaa and ga back to the plant . less hydrogen has to be secreted from the roots , thus balancing ph , increasing efficiency of nitrogen use , and improving nutrient extraction by fungi to root associations . any leftover co 2 goes to free - living bacteria that fix n 2 from the air in the soil . so 2 emissions are useful to balance ph as it is oxidized by bacteria for plant uptake and salt tolerance . the complexities of the soil and plant requirements can be matched by the chemistry altering methods with in the exhaust conditioning system . these methods include selecting a type of fuel which has either a high or low sulphur content , varying fuel combustion temperature , varying catalytic chemistry , providing electrolysis to oxidize micro nutrients , producing hydrogen from glowing hot cast iron with steam circulation in the conditioning chamber , or providing air with ozone rich oxygen from an alternator , generator or high voltage arc injected for oxidation . the method has no need to scrub out the emissions or add binders that tie up or store them for disposal . the complete exhaust stream is placed below the soil surface as the tractor and equipment are tilling the soil or incorporating seed within the soil , so as to release minimal emissions to the atmosphere as conditioned emissions are altered to be chemically bioactive within the soil profile to maximize plant growth and shorten the co 2 , no 2 , so 2 emissions cycle . the bioactive emissions recycling process incorporates the emissions from an internal combustion engine into the topsoil while the agricultural tractor is pulling the tillage or seeding equipment . the emissions become bioactive by the micro flora of the soil as co 2 , no x , so x and other emissions are consumed as an energy source while releasing plant usable nutrients or fixing nitrogen from the air . the system includes an emissions conditioning chamber for collecting and receiving the exhaust gas from the internal combustion engine of the tractor . emissions from the internal combustion engine flow through the chamber , which conditions and alters the chemistry of the emissions to best suit the plant genetics , soil ph , salinity and the bioactive soil micro flora . steam is injected into the chamber at various locations within the chamber to release hydrogen . the steam can be directed near glowing hot iron or a combination of metals connected to the exhaust manifold . the oxygen oxidizes the metal , releasing the hydrogen to react with the emissions . the oxidized metal is carried by the steam and emissions to mix with the soil . steam is created in a heat transfer chamber around the conditioning chamber . the water is injected into the chamber and the heat that boils the water is removed from the emissions gases to cool the exhaust flow before oxygen or air is injected . hydrogen and oxygen can be formed by electrolysis of water using a cathode and anode or alternatively by passing protons through a member . alternatively a catalyst or an electromagnetic field can be used to enhance conditioning of the emissions . air is injected into the chamber at various locations and can oxidize the emissions to desirable forms of chemical reactions . atmospheric air , oxygen enriched air from electrolysis , or o 3 enriched air from an electronic device , including an alternator or generator , may be used for injection . air injection is performed at high heat locations or within the catalytic converter to burn unburned hydrocarbons and produce more co 2 emissions . an after burner 50 with a controlled air fuel ratio can raise the temperature above 2000 k as temp goes up no x levels go up . air injection in the cooler locations unable to support combustion will aid in chemical reactions . water injection into the chamber is performed at various locations as a carrier of dissolved elements to aid in conditioning the emissions and assist in the bioactivity in the soil . nickel can be added to enhance nh 4 metabolism , molybdenum can be added to aid in no 3 metabolism and bacteria assist in n 2 fixation . water recirculation or recovery at the point of incorporation can conserve water use and aid in chemical reactions within the chamber . low ph water will release more hydrogen to make nh 4 . high ph water has less hydrogen and more oxygen to make no 3 . electromagnetic high voltage fields , high voltage carbon electrode arcs , cathodes , anodes , electro negativity of elements and catalytic aid of metals can be used to speed up chemical reactions and can be located from the combustion chamber to the point of emission incorporation into the soil . the emissions distribution system is mounted on the tillage or seeding equipment via flex hoses from the emissions conditioning chamber . the flex hoses comprise a network of heat resistant steam hoses that can withstand a maximum temperature of 450 f or 230 c . a distributor fan maintains air flow and lower back pressure on the exhaust system . the flex hoses are connected to the tillage points under the soil . as the soil is tilled and fractured , the steam and conditioned emissions fill the air spaces in the soil to become bioactive . when incorporating emissions through a conventional air seeder , the exhaust temperature has to be cooled with a heat exchanger to prevent heat damage to the air distribution system when incorporating emissions . when using a rotor tiller , the emissions are injected evenly inside the tiller hood . the emissions become well mixed into the soil . lawn mower decks work well to incorporate the emissions into the lawn and clippings . as the steam from the emissions conditioning chamber contacts the clippings , bioactivity is sped up to decay the clippings , thus recycling the nutrients and emission back to the lawn . grain harvesters can apply emissions at a straw chopper to speed up straw breakdown . steam injection air to air cooler prevents fire . forage choppers burning bio - diesel can use cooled emissions that form urea as a protein booster to improve feed value . compost turning equipment will speed the compost by stimulating aerobic activity fuel additive and co 2 will increase aerobic to anaerobic ratio in closed or open compost systems . liquid manure lagoon agitation motors emissions can be incorporated at agitation time to raise carbon to nitrogen ratio and lower ammonia and sulphur smell . internal combustion engine modifications and adjustments to aid in n 2 conversion to no x include adjustments to ignition timing the maximum advanced and grade of fuel to support advanced ignition timing . diesel injection spray pattern split injection timing can be altered to increase no x . a cooling system thermostat needs to maintain maximum operating temperature . antifreeze that boils at a higher temperature should be used . higher compression ratio or use of a turbo booster to raise combustion flame temperature is desirable . to protect engine internal parts to withstand the extreme heat , the parts can be protected with a coating of ceramic with a catalyst impregnation to speed up no x production internally in the engine . exhaust gas recirculation no x control equipment needs to be disabled or removed as the no x produced by internal combustion is now capturing the energy released by the internal combustion . the no x is bio - activated by the soil bacteria converting the no x into plant usable nitrogen . as described herein the growth characteristics in soil which assist in how well plants grow can be improved by various means when exhaust emissions from an internal combustion engine is incorporated into the soil by tillage equipment . the growth characteristics can be improved by increasing the aerobic bacteria content in the soil by adding an oxidizing agent to the fuel of the engine or by providing a culturing tank in which micro organisms which feed on exhaust emissions can be cultured for subsequent distribution or incorporation into the soil as well . the growth characteristics can also be improved by increasing no x content in the soil either by adding a catalyst to the soil with the exhaust emissions or by passing the exhaust emissions through an afterburner which elevates the temperature of combustion to increase the no x content in the exhaust emissions which are subsequently incorporated into the soil . the oxidizing agent which is added to the fuel as described herein may comprise any form of chemical compound that readily gives up oxygen or a substance that gains electrons in a redox chemical reaction . in doing so the oxidizing agent becomes reduced in the process . when adding an oxidizing agent , the computer 66 is arranged to control an amount of the oxidizing agent being added to the fuel responsive to measured growth characteristic of a sample of the soil which measures characteristics such as ph level and the like . when adding a catalyst to increase the no x content in the soil , the catalyst may be added to seed which is to be planted into the soil or alternatively the catalyst maybe added to the soil by adding to the fuel of the internal combustion engine prior to combustion . the catalyst is selected from the group including nickel , cobalt , molybdenum , chromium or iron and is characterized in that it can withstand the elevated temperatures of greater than 1900 degrees kelvin in the afterburner while still having some useful effect as a catalyst when injected into the ground with the exhaust emissions after combustion . in addition to catalysts added to the fuel , ph level of the exhaust emissions can be adjusted by adding sulphur to the fuel of the internal combustion engine . the computer 66 in this instance is arranged to control the amount of catalyst or sulphur which is added responsive to measured growth characteristics of a sample of the soil or in response to measured conditions of the exhaust during operation . the afterburner 50 can be used to increase the no x content in the soil by passing the exhaust emissions therethrough at an operating temperature at greater than 1900 degrees kelvin prior to incorporating the exhaust emissions into the soil . at these temperatures additional reactions are encouraged which would not normally take place in a normally operating internal combustion engine . the afterburner receives both the exhaust emissions therethrough along with some additional fuel and air to optimize the elevated operating temperature of the afterburner . the fuel may comprise the same fuel as the tractor or other equipment with which the internal combustion engine is associated , or may comprise an alternative fuel , for example oils having more carbon in the form of longer chain carbon molecules which are heavier to increase carbon dioxide production and to promote oxidizing metals . desirable bacteria in the soil use oxidized metals produced as a result of the heavier carbon fuels as an energy source so that feeding the aerobic bacteria produces more plant nutrients resulting in more fertile soil . the computer 66 in this instance is arranged to vary composition of the exhaust emissions by varying operating temperature of either one of the internal combustion engine or the afterburner . the computer is further arranged to control the amount of fuel or air added to the exhaust emissions at the afterburner and the ratio thereof prior to passing the exhaust emissions through the afterburner in response to measuring both characteristics of the soil to determine what additional nutrients are most effective to be incorporated into the soil . to be used either in combination with catalysts added to the fuel , oxidizers added to the fuel , and an afterburner for elevating the operating temperature of combustion of the exhaust emissions , the condensate tank 26 further improves the growth characteristics of the soil by increasing the aerobic bacteria content in the soil by culturing these bacteria along with any other beneficial micro organisms including various fungi and the like . the bacteria or other micro organisms cultured in the tank are typically not indigenous to the soil being improved to further enhance the benefits thereof . the computer 66 in this instance controls operation of the tank by maintaining the tank at a desired operating temperature to most encourage production of bacteria or other micro organisms while also being arranged to control the rates at which condensate is added and removed from the tank so that an equal amount of cultured bacteria and micro organisms is solution is removed and incorporated into the soil as the amount of new condensate with exhaust emissions incorporated therein is introduced into the tank . to further enhance the benefits noted above , the system includes a suitable blower which draws exhaust emissions from the internal combustion engine into a suction side of the blower and distributes the exhaust emissions under pressure from the pressure side of the blower to optimize efficiency and to provide some control as to the rate at which exhaust emissions are incorporated into the soil . the computer 66 in this instance controls the rate of the blower responsive to the speed of internal combustion being displaced over the ground in the instance of agricultural equipment including tillage or seeding equipment for example . the rate of the blower accordingly is controlled responsive to demands for exhaust emissions incorporated into the soil . when using an afterburner in particular or simply when feeding exhaust emissions directly from internal combustion engine to a network of distribution hoses for incorporation to the ground , for example the plastic distribution hoses of an agricultural seeding implement , a cooler , comprising is provided in series with the exhaust emissions to cool the exhaust emissions prior to distributing them through the plastic hoses so that no modification to the distribution equipment is required while still protecting any plastic parts from damage of excessive heat . the system as described herein may also be used for other organic matter other than simply incorporating the emissions into the soil , for decomposing the organic matter so it can then be used as an additive to soil . to encourage decomposition of organic matter the internal combustion engine is again operated to produce exhaust emissions which are then in turn mixed into the organic matter . when the internal combustion engine comprises part of a grain harvester having a straw chopper , the method includes mixing the exhaust emissions with the straw in the straw chopper to assist in the decomposition of the straw . alternatively when the organic matter comprises grass which is cut by a mulching deck of a lawn mower , exhaust emissions from the internal combustion engine of the mower can be mixed with the grass in the mulching deck to assist in its decomposition . emissions from an internal combustion engine associated with compost mixing equipment can be mixed with the compost using the compost mixing equipment . in liquid waste management equipment , exhaust emissions from any internal combustion engines associated therewith can be mixed into the liquid organic waste managed by the equipment , for example equipment used to manage waste in a lagoon or the like . yet a further example exhaust emissions from the internal combustion engine from a forage chopper may be mixed in with the forage being chopped to assist in the decomposition thereof . since various modifications can be made in my invention as herein above described , and many apparently widely different embodiments of same made within the spirit and scope of the claims without department from such spirit and scope , it is intended that all matter contained in the accompanying specification shall be interpreted as illustrative only and not in a limiting sense .

US-201314034023-A

a hinge includes first and second holders , which are fixedly inserted in a doorframe and a door plank respectively , and a hinge pivoting the holders together ; the hinge includes several first and second bent arms , which have first and second holes on two tail ends , and an intermediate hole ; a pivotal pin is passed through the intermediate holes ; another pin is passed through the first holes of the first arms to pivot the first arms to the first holder ; yet another pin is passed through the first holes of the second arms to pivot the second arms to the second holder ; a sliding pin is passed through the second holes of the first arms and passed into opposing upper and lower slots of the second holder ; a second sliding pin is passed through the second holes of the second arms and passed into opposing slots of the first holder .

shown in fig1 , 2 , and 3 is a preferred embodiment of a hidden type of hinge structure of the present invention , which is used to pivot a door plank 2 to a doorframe 1 . the hidden hinge structure includes : ( a ) a first holding member 3 joined to the doorframe 1 , the first holding member 3 comprises a connecting panel 31 secured on the doorframe 1 , and several hollow holding portions 32 , which are arranged one on top of another next to one side of the connecting panel 31 , and which are inserted in a space in the doorframe 1 ; each of the hollow holding portions 32 has a receiving room 33 therein ; the connecting panel 31 has several holes 36 thereon , which are faced and in open communication with the receiving rooms 33 of the hollow holding portions 32 respectively ; each of the hollow holding portions 32 has two slots 34 , which are formed on a top and a bottom of the hollow holding portion 32 respectively so as to face each other , and which are faced and in open communication with a corresponding said receiving room 33 ; the first holding member 3 further comprises connecting plate members 35 , which are arranged on the top and the bottom of each of the hollow holding portions 32 ; ( b ) a second holding member 4 joined to the door plank 2 , the second holding member 4 has the same shape as the first one 3 , comprising a connecting panel 41 secured on the door plank 2 , and several hollow holding portions 42 , which are arranged one on top of another next to one side of the connecting panel 41 , and which are inserted in a space in the door plank 2 ; each of the hollow holding portions 42 has a receiving room 43 therein ; the connecting panel 41 has several holes 46 thereon , which are faced and in open communication with the receiving rooms 43 of the hollow holding portions 42 respectively ; each of the hollow holding portions 42 has a slot 44 on each of a top and a bottom thereof , which is faced and in open communication with a corresponding said receiving room 43 ; the second holding member 4 further comprises connecting plate members 45 , which are arranged on the top and the bottom of each of the hollow holding portions 42 ; and ( c ) several hinges 5 pivoting the first and the second holding members 3 and 4 together ; the hinges 5 are each partly received in one of the hollow holding portions 32 , and partly received in one of the hollow holding portions 42 ; each of the hinges 5 includes : several first swinging bent arms 51 ; each of the first swinging bent arms 51 has a short section 511 , a long section 512 , a first receiving hole 514 on a tail end of the short section 511 , and a second receiving hole 515 on a tail end of the long section 512 thereof ; several second swinging bent arms 52 ; each of the second swinging bent arms 52 has a short section 521 , a long section 522 , a third receiving hole 524 on a tail end of the short section 521 , and a fourth receiving hole 525 on a tail end of the long section 522 ; in addition , each of the first and the second swinging bent arms 51 , 52 has a connecting hole 513 , 523 , which is formed on a joint between the short section 511 , 521 and the long section 512 , 522 ; the first swinging bent arms 51 are overlapped with and intersect the second swinging bent arms 52 such that all of the connecting holes 513 and 523 are on a straight line ; in addition , the first swinging bent arms 51 are arranged such that every two close ones of the connecting holes 513 of the first swinging bent arms 51 , which are close to each other , have one said connecting hole 523 intervening between them ; furthermore , the first receiving holes 514 of the first swinging bent arms 51 are on a straight line , the second receiving holes 515 are on a straight line , the third receiving holes 524 of the second swinging bent arms 52 are on a straight line , and the fourth receiving holes 525 are on a straight line ; a connecting pin 53 passed through the connecting holes 513 and 523 of the first and the second swinging bent arms 51 and 52 to pivot the first and the second swinging bent arms 51 and 52 together ; the connecting pin 53 is securely joined to threaded elements 532 at two ends thereof ; there are several first ringed pads 531 positioned around the connecting pin 53 , which are each interposed between two said connecting holes 513 , 523 of the first and the second swinging bent arms 51 and 52 , and passed into one of the corresponding connecting holes 513 and 523 at a small - diameter section thereof ; a first pivotal pin 54 pivoting the first swinging bent arms 51 to the first holding member 3 ; the first pivotal pin 54 is passed through the first receiving holes 514 of the first swinging bent arms 51 , and securely joined at two ends thereof to the top and the bottom of one said hollow holding portion 32 of the first holding member 3 by means of threaded elements 542 ; there are several second ringed pads 541 positioned around the first pivotal pin 54 , which are each interposed between two adjacent ones of the first receiving holes 514 of the first swinging bent arms 51 , and passed into one of said corresponding first receiving holes 514 at a small - diameter section thereof ; a first sliding pin 55 , the first sliding pin 55 is passed at two ends thereof into the slots 44 of the top and the bottom of one corresponding said hollow holding portion 42 of the second holding member 4 , and passed through the second receiving holes 515 of the first swinging bent arms 51 so as to serve as a pivot of the first swinging bent arms 51 ; there are several third ringed pads 551 positioned around the first sliding pin 55 , which are each interposed between two adjacent ones of the second receiving holes 515 of the first swinging bent arms 51 , and passed into one of said corresponding second receiving holes 515 at a small - diameter section thereof ; furthermore , there are two sliding sleeves 552 provided to the present structure , which are positioned around two ends of the first sliding pin 55 respectively , and received in the slots 44 in a movable manner in order for allowing the long sections 512 of the first swinging bent arms 51 to be moved on the slots 44 together with the first sliding pin 55 ; a second pivotal pin 56 pivoting the second swinging bent arms 52 to the second holding member 4 ; the second pivotal pin 56 is passed through the third receiving holes 524 of the second swinging bent arms 52 , and securely joined at two ends thereof to the top and the bottom of a corresponding said hollow holding portion 42 of the second holding member 4 by means of threaded elements 562 ; there are several fourth ringed pads 561 positioned around the second pivotal pin 56 , which are each interposed between two adjacent ones of the third receiving holes 524 , and passed into one of said corresponding third receiving holes 524 at a small - diameter section thereof ; a second sliding pin 57 , the second sliding pin 57 is passed at two ends thereof into the slots 34 of the top and the bottom of one corresponding said hollow holding portion 32 of the first holding member 3 , and passed through the fourth receiving holes 525 of the second swinging bent arms 52 so as to serve as a pivot of the second swinging bent arms 52 ; there are several fifth ringed pads 571 positioned around the second sliding pin 57 , which are each interposed between two adjacent ones of the fourth receiving holes 525 , and passed into one of said corresponding fourth receiving holes 525 at a small - diameter section thereof ; in addition , two sliding sleeves 572 are provided , which are positioned around two ends of the second sliding pin 57 respectively , and received in the slots 34 in a movable manner in order for allowing the long sections 522 of the second swinging bent arms 52 to be moved on the slots 34 together with the second sliding pin 57 . therefore , the door plank 2 is allowed to pivot between an opened position and a closed one , with the first and the second sliding pins 55 and 57 moving on the slots 34 and 44 respectively ; shown in fig4 is a horizontal section of the door plank 2 in an opened position , wherein the first sliding pin 55 is located in front ends of the slots 34 of the corresponding hollow holding portion 32 of the first holding member 3 , which are nearer to the corresponding hole 36 of the connecting panel 31 than rear ends of the slots 34 , and the second sliding pin 57 is located in front ends of the slots 44 of the corresponding hollow holding portion 42 of the second holding member 4 , which are nearer to the corresponding hole 46 of the connecting panel 41 than rear ends of the slots 44 . and , shown in fig5 is a horizontal section of the door plank 2 in a closed position , wherein the first sliding pin 55 is located in the rear ends of the slots 34 , and the second sliding pin 57 is located in the rear ends of the slots 44 instead ; thus , the hinges 5 are hidden within the door plank 2 and the doorframe 1 . from the above description , it can be seen that the present invention has the following advantages : 1 . the first and the second pivotal pins are parallel with upright edges of the connecting panels of the first and the second holding members therefore the hinges will be in the correct position for use as soon as the first and the second holding members are inserted in the doorframe and the door plank respectively from the hollow holding portions thereof . in other words , it takes less time and labor to accurately install the hidden type of hinge of the present invention than it does to install the prior art . 2 . the hinge structure is equipped with the ringed pads , which are positioned around the connecting pin , the sliding pins , and the pivotal pins to interpose between the swinging bent arms so as to reduce friction between the swinging bent arms . therefore , the swinging bent arms of the hinge structure will move relatively smoothly when the door plank is being opened / closed .

US-80226907-A

for manufacturing a superconducting device , a first c - axis orientated oxide superconductor thin film having a very thin thickness is formed on a principal surface of a substrate , and a stacked structure of a gate insulator and a gate electrode is formed on a portion of the first oxide superconductor thin film . an a - axis orientated oxide superconductor thin film is grown , using the gate electrode as a mask , so that second and third superconducting regions having a relatively thick thickness are formed at both sides of the gate electrode , electrically isolated from the gate electrode . the superconducting device thus formed can functions as a super - fet .

referring to fig1 a to 1i , the process in accordance with the present invention for manufacturing the super - fet will be described . as shown in fig1 a , a substrate 5 having a substantially planar principal surface is prepared . this substrate 5 is formed of for example , an insulator substrate such as a mgo ( 100 ) substrate , a srtio 3 ( 100 ) substrate , a cdndalo 4 ( 001 ) substrate or others , or a semiconductor substrate such as a silicon substrate having a principal surface coated with a buffer layer composed of an insulating film . in the case of the silicon substrate , the principal surface of the silicon is preferably coated with mgalo 4 by a cvd ( chemical vapor deposition ) and also with batio 3 by a sequential sputtering process . as shown in fig1 b , an extremely thin c - axis orientated y 1 ba 2 cu 3 o 7 - δ oxide superconductor thin film 11 having a thickness on the order of about 5 nanometers is deposited on the principal surface of the substrate 5 , by for example an off - axis sputtering , a reactive evaporation , an mbe ( molecular beam epitaxy ), a cvd , etc . this extremely thin oxide superconductor thin film 11 forms a superconducting channel 10 when the super - fet is completed . the superconducting channel is preferably formed of c - axis orientated thin film , since the c - axis orientated thin film has a large critical current density in the direction in parallel to the substrate surface . a condition of forming the c - axis orientated y 1 ba 2 cu 3 o 7 - δ oxide superconductor thin film 11 by off - axis sputtering is as follows : ______________________________________sputtering gasar : 90 % o . sub . 2 : 10 % pressure 10 patemperature of the substrate 700 ° c . ______________________________________ the oxide superconductor thin film is preferably formed of , for example , a bi -- sr -- ca -- cu -- o type compound oxide superconductor material , or a tl -- ba -- ca -- cu -- o type compound oxide superconductor material other than y -- ba -- cu -- o type compound oxide superconductor material . then , as shown in fig1 c , an insulating layer 16 is deposited on the oxide superconductor thin film 11 . the insulating layer 16 is deposited to have a thickness of not less than 10 nanometers which is sufficient to prevent a tunnel current . in addition , the insulating layer 16 is foraged of an insulating material such as mgo , which does not form a large density of energy levels between the superconductor thin film 11 and the insulating layer 16 . furthermore , from the viewpoint of a mechanical stress , it is preferred to form on the oxide superconductor thin film 11 an insulating layer having a composition similar or analogous to that of the oxide superconductor thin film 11 , without taking out the substrate 5 from a film deposition apparatus or chamber after the oxide superconductor thin film 11 is deposited on the substrate 5 . thereafter , as shown in fig1 d , a normal conducting layer 17 is deposited on the insulating layer 16 and a refractory layer 9 is deposited on the normal conducting layer 17 . the normal conducting layer 17 can be deposited by a vacuum evaporation or any other suitable process , so as to have a thickness of about 200 nanometers . the normal conducting layer 17 can be formed of au , or a refractory metal such as ti , w or a silicide thereof . the insulating layer 16 and the normal conducting layer 17 are preferably deposited continuously on the oxide superconductor thin film 11 , without taking out the substrate 5 from a film deposition apparatus or chamber . the refractory layer 9 is formed of a refractory metal such as mo etc ., a refractory resist , an insulating layer and can be deposited by a vacuum evaporation etc . the refractory layer 9 is selectively etched so as to remove all of the refractory layer excluding a portion 91 which is above the super conducting channel and to form a gate electrode pattern , as shown in fig1 e . thereafter , as shown in fig1 f , the stacked layer of the oxide superconductor thin film 11 , the insulating layer 16 and the normal conducting layer 17 is selectively removed so as to form a superconducting channel 10 , a gate insulator 6 and a gate electrode 4 . for this purpose , the normal conducting layer 17 , the insulating layer 16 and the oxide superconductor thin film 11 are selectively etched in a self alignment to the patterned refractory mask 91 , so as to remove all of the metal layer excluding a portion which becomes the gate electrode on the superconducting channel 10 , so that the gate electrode 4 is formed , and a gate insulator 6 is left on the oxide superconductor thin film 11 and only under the patterned gate electrode 4 , and a superconducting channel 10 is left on the substrate 5 , and the substrate 5 is exposed excluding a portion under the superconducting channel 10 . in this connection , it is desired that the gate electrode 4 and the gate insulator 6 are side - etched in comparison with the superconducting channel 10 , so that the gate electrode 4 has a length shorter than that of the superconducting channel 10 and the gate insulator 6 has a length shorter than that of the gate electrode 4 . thereafter , as shown in fig1 g , normal conductor members 12 and 13 are formed on the both ends of the superconducting channel 10 . these normal conductor members 12 and 13 can be formed by depositing an au layer covering the superconducting channel 10 and exposing portion of the substrate 5 , and etching back the deposited au layer by means of an anisotropic etching so that the au layer remains only on the side surfaces of the superconducting channel 10 . then , as shown in fig1 h , a superconducting source region 2 and a superconducting drain region 3 of an a - axis orientated y 1 ba 2 cu 3 o 7 - δ oxide superconductor thin film are formed on the substrate 5 at both sides of the superconducting channel 10 , respectively . an a - axis orientated y 1 ba 2 cu 3 o 7 - δ oxide superconductor thin film can be formed by an off - axis sputtering process which is carried out under a condition that the substrate temperature is not higher than 650 ° c . a sputtering condition under which the superconducting source region 2 and the superconducting drain region 3 are formed is as follows : ______________________________________sputtering gasar : 90 % o2 : 10 % pressure 10 patemperature of the substrate 640 ° c . ______________________________________ at the same time , an a - axis orientated oxide superconductor thin film 20 is deposited on the refractory mask 91 , however , the refractory mask 91 which is formed of mo sublimates while the oxide superconductor thin film is deposited . with this , the super - fet in accordance with the present invention is completed , as shown in fig1 i . the oxide superconductor thin film 20 can be left above the gate electrode 4 , in the case of using an insulator as the refractory mask 91 . as explained above , if the super - fet is manufactured in accordance with the first embodiment of the method of the present invention , the limitation in the fine processing technique required for manufacturing the super - fet is relaxed . since the flatness of the upper surface of the superconducting device can be improved , it become easy to form conductor wirings in a later process . accordingly , it is easy to manufacture the super - fet with good repeatability , and the manufactured super - fet has a stable performance . referring to fig2 a to 2g , a second embodiment of the process for manufacturing the superconducting device will be described . in this second embodiment , the same processings as those shown in fig1 a to 1b are performed except that the c - axis oxide superconductor thin film 11 is formed having a thickness on the order of 20 nanometers . after the c - axis orientated oxide superconductor thin film 11 is deposited , as shown in fig2 a , a normal conducting layer 17 is deposited on the oxide superconductor thin film 11 by a cvd , a sputtering , etc . the normal conducting layer 17 can be formed of au , or a refractory metal such as ti , w or a silicide thereof . as shown in fig2 b , the normal conducting layer 17 is selectively etched so as to remove all of the normal conducting layer excluding a portion which becomes the gate electrode on the superconducting channel 10 , so that the gate electrode 4 is formed . then , the oxide superconductor thin film 11 is selectively etched more than 10 nanometers in a self alignment to the patterned gate electrode 4 , so that a portion under the patterned gate electrode 4 projects from the etched portion of the oxide superconductor thin film 11 . thereafter , the substrate 5 is heated to more than 400 ° c . under a pressure of 10 - 5 pa . then , as shown in fig2 c , oxygen of the crystals of the portion of the oxide superconductor thin film 11 under the patterned gate electrode 4 escapes through side surfaces 18 and 19 so that the portion changes to the gate insulator 6 . the portion of the oxide superconductor thin film 11 under the gate insulator 6 becomes superconducting channel 10 . an oxide superconductor loses its superconductivity when it lacks oxygen of its crystals . therefore , after the process , the oxide which forms gate insulator 6 becomes an oxide insulator for lack of oxygen . in above process the oxygen of the crystals of the oxide superconductor escapes only through sides 18 and 19 , since the oxide superconductor has larger diffusion coefficients of oxygen along the a - axis and the b - axis of the crystal than along the c - axis . after the process , as shown in fig2 d , an insulating layer 16 which covers the extremely thin oxide superconductor thin film 11 and the gate electrode 4 is deposited . the insulating layer 16 is formed of an insulating material such as mgo by a sputtering etc . then as shown in fig2 e , the insulating layer 16 is etched by an anisotropic etching so that the insulating layer remains only on the side surfaces of the gate electrode 4 to form the gate insulating side - walls 14 and 15 . finally , as shown in fig2 f , a superconducting source region 2 and a superconducting drain region 3 of an a - axis orientated oxide superconductor thin film are formed on the oxide superconductor thin film 11 at both sides of the gate electrode 4 and of gate insulator 6 , respectively . in the process , in order to planarize an upper surface of the deposited a - axis orientated oxide superconductor thin film and to shape the superconducting source region 2 and the superconducting drain region 3 , a photoresist layer ( not shown ) is deposited on the a - axis orientated oxide superconductor thin film in such a manner that the deposited photoresist layer has a flat upper surface , and then , the deposited photoresist layer and the deposited a - axis orientated oxide superconductor thin film are etched back , until the upper surface of the a - axis orientated oxide superconductor thin film is planarized and the gate electrode 4 is exposed at the planarized upper surface of the a - axis orientated oxide superconductor thin film as shown in fig2 f . with this , the super - fet in accordance with the present invention is completed . as explained above , if the super - fet is manufactured in accordance with the second embodiment of the method of the present invention , the limitation in the fine processing technique required for manufacturing the super - fet is relaxed , similarly to the first embodiment . in addition , since the upper surface of the superconductor thin film is planarized , it become easy to form conductor wirings in a later process . accordingly , it is easy to manufacture the super - fet with good repeatability , and the manufactured super - fet has a stable performance . the super - fet manufactured in accordance with the method of the present invention comprises the superconducting channel 10 formed on the substrate 5 and the gate electrode 4 arranged on the superconducting channel 10 . the superconducting channel 10 is formed of a c - axis orientated oxide superconductor thin film which is as extremely thin as about 5 nanometers . both sides of the superconducting channel 10 , the superconducting source region 2 and the superconducting drain region 3 are located , respectively . the superconducting source region 2 and the superconducting drain region 3 are formed of a - axis orientated oxide superconductor thin films , which are directly formed on the substrate 5 in the embodiment shown in fig1 i or formed on the c - axis orientated super conductor thin film 11 in the embodiment shown in fig2 f . on the other hand , the gate electrode 4 is located on the gate insulator 6 foraged directly on the superconducting channel 10 . the invention has thus been shown and described with reference to the specific embodiments . however , it should be noted that the present invention is in no way limited to the details of the illustrated structures but changes and modifications may be made within the scope of the appended claims .

US-28012394-A

a process utilizing pet as a reactive constituent to manufacture other polymers containing the pre - condensed moieties by the rapid transesterification of the condensation polymer with a pre - made modifying polymer containing the desired mix of other monomers . the process involves as a first step the manufacture of a modifying polymer containing the desired mix of acids and alcohols to a specific molecular weight such molecular weight dependent on the desired final level of utilized condensation polymer and the finished molecular weight . the second step of the process involves the rapid buildup of molecular weight and / or polymer uniformity by the rapid transesterification of the condensation polymer with the modifying polymer . the second step can be performed in any suitable vessel including an extrusion line . the process has the advantage of greatly reduced cycle times over other condensation polymer utilization processes such as the recycling of pet into other materials .

the term “ modifying polymer ” for purposes of this patent is defined as a polymer , not necessarily a polyester polymer , used to modify through transesterification a pet , pen , or other polymer of commerce to achieve a new polymer with new desired properties . in the process disclosed herein two steps are used . the first step is the manufacture of a modifying polymer containing the desired ingredients not derived from the commercially available condensation polymer itself . this differs substantially from the other techniques described that utilize pet in that the first step itself does not involve the pet or the monomers that make up pet . this first step of the reaction of the present invention to achieve a modifying polymer reduces the condensation or esterification reactions to only those that are different from the condensation polymer of the second step thereby having lower energy requirements and lower toxic waste stream condensation products . also , where less crystalline aromatic polymers are desired , the condensation of other aromatic acids to form the modifying polymer is much less energy consumptive than the condensation of terephthalic acid as in the case of pet . in addition , if the goal is to produce a pdlyol or alkyd , then the modifying polymer reaction proceeds extremely rapidly on the order of a few hours due to the excess of hydroxyl components to acid components . this is in itself a much more rapid condensation than a polymer whose carboxyl and hydroxyl functions are more closely equal , which could take more than 24 hours . where aliphatic acids for the polymer constituents are used at a temperature range from 150 to 250 degrees centigrade , the reaction is further shortened due to the higher reaction rates , sometimes double that of aromatics . with the use of terephthalic acid at a temperature of 190 to 270 degrees centigrade , a reasonable reaction rate can also be obtained . the second step of the present process is the rapid transesterification of a commercially available condensation polymer with the modifying polymer produced in the first step . careful monitoring of temperatures and reaction rates are not necessary with the only requirement being enough heat to transesterify the two polymers in a given length of time because if heating is a , problem , the reaction time can be increased . higher temperatures will greatly reduce the time required . reaction rates are dependent on several factors including ( 1 ) time , ( 2 ) temperature , ( 3 ) modifying poloymer molecular weight , ( 4 ) hydrophilicity of modifying polymer , ( 5 ) number and type of hydroxyl functionality on modifying polymer , and ( 6 ) transesterification catalyst . therefore , good transesterification of terephthalates starts around 200 degrees centigrade , greatly accelerates around 240 degrees centigrade , and is very rapid around 260 degrees centigrade . reaction time at 200 degrees centigrade is about ten hours to transesterify pet with a glycol . reaction rate is reduced to about one hour at 240 degrees centigrade and only fifteen minutes at 260 degrees centigrade . in an extruder , heating is not an issue so one can heat to 300 degrees centigrade and transesterify even quicker . with a more hydrophobic modifying polymer and secondary hydroxyl groups , these times would be longer . thus , a rapid reaction rate can be achieved in the first step if the modifying polymer is lower molecular weight than the commercially available condensation polymer or if it contains monomers whose reaction temperatures are lower than that of the condensation polymer . in this regard it becomes easier to consider the transesterification step as the molecular weight building step for the lower molecular weight polymers . even if the objective is higher molecular weights it is still far easier to esterify a smaller batch given the charging , heat up cycles , etc . than any of the current processes or techniques currently utilizing condensation polymers of commerce such as pet . transesterification is a reaction that takes place when a group such as an alcohol or amine becomes a nucleophile and exchanges take places at the ester linkage . this group can come from any molecule and is not limited to a simple molecule such as a carbon chained alcohol with 6 to 12 carbons , a glycol with 6 to 20 carbon atoms or an amine with 2 to 20 carbon atoms . indeed a polymer containing these groups can be made to react by first transesterifying ester groups contained on a premanufactured polyester such as pet or pen . however , since transesterification continuously occurs above the polymers tg ( glass transition temperature ), the alcohol generated from the nucleophile displacement itself becomes a nucleophile that can further react . in this way at some point equilibrium is reached where no further change in the polymer mixture occurs and the mixture becomes a homogeneous new polymer . if the mixture contains polymer segments that for some reason do not participate in the transesferification reactions , then the new polymer becomes a copolymer of the two beginning polymers . if the mixture contains segments that participate more or less equally in the tranesterification process , then the product becomes more or less a homogeneous polymer with completely new properties . one of the parameters important to control in polymer synthesis is molecular weight . with the manufacture of esters , the molecular build up is rapid initially and slows down considerably as the molecular weight increases . with the present process the final molecular weight is controlled by the molecular weight of the modifying polymer and the percentage of that modifying polymer reacted with the commercially available condensation polymer . for instance , if pet is used as the commercially available condensation polymer and its quantity is held constant , then the molecular weight of the finished polymer is solely dependent on the molecular weight of the modifying polymer . in this way polymers of lower molecular weight than the commercially available condensation polymer , especially in the range of less than 15 , 000 , become extremely quick to manufacture compared to other techniques ( approximately one - half the time as other techniques ). the second step of the present process can be done in the same manufacturing vessel or any suitable closed vessel separate from the vessel used to manufacture the modifying polymer . in some instances the second step does not require the condensers or condensation receivers that are required in the first step and so less expensive equipment can be used . in fact it is possible to do the second step in an extruder set up for the needed dwell times and agitation required . if no condensate is removed from the second step reaction , no venting or condensers are required . in this way once transesterification has reached an equilibrium , the molecular weight achieved is the average of the mole content of the reactants in the beginning mixture of the second step . by first calculating the desired final molecular weight , the final weight can be achieved without further esterification which is the major time consuming step in high molecular weight polyester synthesis . advantages of this present process are therefore lower reaction times ( approximately one - half of current processes ), lower waste streams , higher utilization of the commercially available condensation polymer , and higher finished molecular weights with less energy and time . the process of this invention eliminates many of the problems associated with the prior art . for instance as stated in much of the prior art the digestion of pet to reconstitute the original starting materials is in many cases more expensive than the cost of manufacturing the starting materials . once digested , the materials have to be re - condensed which is inherently energy inefficient and produces toxic levels of glycol and dioxane in the waste stream . thus , only small amounts of pet are reprocessed in this manner . the present process eliminates these problems since it preserves the ester linkages already formed in the commercially available condensation polymer so that re - condensation of precursor materials is unnecessary . the high heat and duration of esterification make the manufacturing of unsaturated resins using pet , as mentioned in the prior art , a very sensitive process . in many instances a polyester precursor is made first and maleic anhydride is added , reacted in , and brought up to temperatures that over time allow some isomerization of the maleic ester groups to fumaric ester groups to occur . the process described in the present application allows for the rapid transesterification of pet and isomerization of maleic groups to occur simultaneously . water soluble or dispersible resins are used in a wide variety of applications such as coatings and ink carrier vehicles . water dispersible polyesters have become popular in recent years . these resins are solublized using a number of techniques . generally an end group , such as a carboxylic acid , that can be subsequently neutralized is used . there are certain monomers that can also afford water dispersibility , such as sodium sulfoisophthalic acid ( sip ). in the following examples we compare current techniques of reacting sip into polyesters with the process of the present application . the following example is taken from the section of preferred embodiment for u . s . pat . no . 5 , 820 , 982 entitled “ sulfoaryl modified water - soluble or water - dispersible resins from polyethylene terephthalate of terephthalates ” issued to salsman in october of 1998 : ingredient % weight g sipeg ( a ) 30 135 ethox 2988 5 22 . 5 na - acetate 0 . 5 2 . 25 fascat ™ 2001 0 . 1 0 . 45 pet 23 . 11 104 pa 41 . 29 185 . 8 total 100 % 450 . 00 g . all ingredients except pa are charged into a reactor and heated to 205 degrees centigrade . the resulting mixture is heated to 220 degrees centigrade , then cooled to 190 degrees centigrade and tested on clear peel test . pa is charged into the reactor and the mixture continued to cool down . next day the mixture is heated up to 200 degrees centigrade for about 8 hours . when av reaches 14 . 3 the mixture is dilated to 30 % to good particle size . in this example pet is used in the reaction and broken down by the initial charge of hydroxyl - terminated materials . the sipeg is a grade of sip from dupont where the sulfoisophthalic is pre - reacted with ethylene glycol resulting in two hydroxyl terminations . the pa or phthalic anhydride is used to build back the molecular weight to suitable size for film formation . the total reaction time in the flask is about 2 work days or 16 hours .” for comparison the same ingredients are used in present disclosure where a modifying polymer is first made and then reacted rapidly with the pet : ingredient percent amt ( in grams ) modifying polymer sipeg 30 . 00 63 . 00 ethox 2988 5 . 00 10 . 50 na - acetate 0 . 50 1 . 05 phthalic anhydride 41 . 29 86 . 71 fascat ™ 2001 0 . 10 0 . 21 tyzor ™ tpt 0 . 02 0 . 04 a small amount of tyzor ™ tpt was added at the end of the modifying polymer stage in order to insure that enough tranesterification catalyst was present for the process of this disclosure . all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . temp time (° c .) observations 8 : 16 a rt all ingredients charged except tpt and pet , 80 % 8 : 40 a 146 clearing , used agitation and inert blanket 9 : 00 a 160 water coming over , cut back to 45 % 11 : 08 a 182 water slowing , up to 60 % 11 : 31 a 198 water still slowing 11 : 50 a 220 water almost stopped , added tpt and pet , 80 % 12 : 15 p 250 all pet in , cut to 70 % 12 : 30 p 250 cooled , a . v . & lt ; 5 . 0 in this case because the mixture contains ethylene glycol the reaction was slowed down to prevent the ethylene glycol from coming over with the water . the finished resin was a clear tough solid that was readily dispersible in hot water . the total time for this process was 4 hours and 15 minutes . much less than the 16 hours of the example of u . s . pat . no . 5 , 820 , 982 . in the manufacture of adhesives the greatly reduced cycle times become even more of an issue since the rate determining step of high molecular weights that are needed for good bond strength require long reaction times . using the approach in the present process and even with a required slightly higher molecular weight modifying polymer a range of high equivalent ratios of hydroxyl component polymers can be made . the second step of the present process , the transesterification step , is only slightly longer ( in the range of minutes instead of hours ) than for lower molecular weight polymers . three hot melt adhesive compositions were prepared , two by prior art methods and one using the process disclosed in this patent application . the main purpose is to show the significant difference in processing times with the herein disclosed process over the prior art processes . a small 250 ml round bottomed flask was used in all cooks . sample 1 ( prior art method ): all virgin raw material were used and straight esterification was performed to condense all the raw materials . the following reaction was performed . ingredient percent amt ( in grams ) peg 400 9 . 69 20 . 35 diethylene glycol 23 . 90 50 . 19 trimethylol propane 14 . 62 30 . 70 phthalic anhydride ( pa ) 46 . 60 97 . 86 adipic acid 5 . 11 10 . 73 fascat ™ 4100 0 . 08 0 . 17 total 100 210 . 00 all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . at a later step vacuum was applied using a suitable vacuum pump with connecting hose . note : fascat ™ 4100 is a monobutyl stannoic acid catalyst for esterifications made by atofina ™. phthalic anhydride was used in this cook due to its lower cost and ease of reaction over terephthalic acid ; however , in terms of performance for the end product application terephthalic acid is preferred . temp time (° c .) observations 8 : 35 a rt all ingredients charged . heater set at 80 %. 8 : 55 a 98 ingredients melted . began agitation and inert blanket . set control on 44 % to control reaction . 9 : 35 a 160 distillate began coming over . 12 : 05 p 180 distillate slowing down . set control to 50 % 1 : 35 p 220 set control to 60 %. began inert gas sparge . 3 : 38 p 240 began vacuum . pulled 25 inch vacuum for one hour . 4 : 44 p 240 vacuum cut and product tested . total cook time : 8 hrs . 9 min . the product was suitably tacky and had the resilience of a higher molecular weight polymer . the gardner holdt viscosity was t at 60 %. the adhesion was very good . sample 2 ( prior art method ): the process was used where some pet is broken down into oligomer segments and used to replace some of the aromatic acids . next , the polymer is built back up using esterification . the following reaction was performed : ingredient percent amt ( in grams ) peg 400 9 . 13 19 . 17 trimethylol propane 30 . 70 64 . 47 pet pellets 45 . 57 95 . 70 tyzor ™ tpt 0 . 02 0 . 04 terephthalic acid 14 . 50 30 . 45 fascat ™ 4100 0 . 08 0 . 17 total 100 210 . 00 all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . at a later step vacuum was applied using a suitable vacuum pump with connecting hose . note : tyzor ™ tpt is a dupont tetrapropyltitanate catalyst that is known to be effective in transesterification reactions . temp time (° c .) observations 8 : 26 a rt peg 400 , and tmp charged . control set at 80 %. 8 : 50 a 80 ingredients melted . began agitation and inert blanket . 9 : 41 a 200 added tpt and a third , 15 grams , of pet . 10 : 01 a 240 added a third , 15 grams , of pet . 10 : 20 a 240 added last third , 15 . 57 grams , of pet . 10 : 43 a 250 hold for thirty minutes at 250 centigrade . 11 : 15 a 250 turned off heat and allow to cool down . 12 : 30 p 200 added terephthalic acid and fascat ™ 4100 . set control to 50 %. 1 : 30 p 190 water coming over . 6 : 25 p 220 set up vacuum at 25 inches for 1 hour , set control at 55 %. 7 : 25 p 240 finished total cook time : 10 hrs . 59 min . some of the additional reaction time over the first example was due to the use of terephthalic acid . if phthalic anhydride were used instead , based on previous work , the reaction should run 3 to 4 hours less . the product was suitably tacky and had the resilience of a higher molecular weight polymer . the gardner holdt viscosity was u + at 60 %. the adhesion was very good . sample 3 ( present method ): all other ingredients of a final polymer were reacted together to form a modifying polymer through esterification , except pet . next , transesterification of pet was used to build molecular weight to form a final polymer . ingredient percent amt ( in grams ) modifying polymer : peg 400 3 . 63 7 . 62 diethylene glycol 1 . 82 3 . 82 trimethylol propane 17 . 20 36 . 12 adipic acid 12 . 29 25 . 81 fascat ™ 4100 0 . 08 0 . 17 tyzor ™ tpt 0 . 02 0 . 02 all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . no vacuum step was needed to increase the molecular weight . note : in this process the fascat ™ 4100 is used first for esterification of the modifying polymer and then the tpt is used for transesterification of the modifying polymer with the commercially available condensation polymer . temp time (° c .) observations 8 : 29 a rt peg 400 , deg , tmp , adipic acid , and fascat ™ 4100 charged , control set at 80 %. 8 : 45 a 90 ingredients melted . began agitation and inert blanket . 9 : 05 a 170 condensate coming over . 10 : 10 a 220 condensate almost stopped . a . v . of less than 3 . 0 10 : 20 a 240 added tyzor ™ tpt and first third , 45 grams , of pet . 10 : 43 a 250 all clear and liquid . added second third , 45 grams , of pet . 11 : 03 a 250 all clear and liquid . added last third , 46 . 42 grams , of pet . 11 : 50 a 250 held thirty minutes after reaching 250 degrees centigrade . cooled . tyzor ™ tpt added . total cook time : 3 hrs . 19 min . the product was suitably tacky and had even more resilience , as indicated by its recovery rate after manually stretching , than either of the two previous cooks indicating an even higher molecular weight polymer than the prior samples . the gardner holdt viscosity was x + at 60 % again indicating a higher molecular weight than either of the previous processes . the adhesion to a paper substrate was very good and required more force to tear apart as evident by the large amount of fiber tear observed over the previous examples . in the production of films it is essential that the viscosity , resiliency , or other properties of the molten resin be high enough to hold a sheet through a drop zone when forming or laminating . with many films a certain degree of cross - link density is incorporated into the polymer to achieve this . it becomes necessary at times to approach the gellation point of the polymer in order to achieve these running properties . with the disclosed procedure one can approach the gellation point by selecting the right cross - link density in the modifying polymer achieving unheard of properties with great accuracy . in fact in many cases gellation is a necessary property to achieve high strengths and cohesive properties . with this process and the proper choice of beginning multifunctional alcohols or acids , gellation can be achieved with large quantities of the commercially available condensation polymer . pen is a relatively new polymer that has come into being in the last few years . prior to the construction of a manufacturing site by amoco specifically for the manufacture of ndc , or dimethyl - 2 , 6 - naphthalenedicarboxylate the intermediate for pen , the cost was prohibitive for all but the most demanding applications . now however many items of commerce are using pen . there are advantages of using pen over pet for packaging of certain articles . for example the barrier properties of pet are not good enough for certain applications where barrier are necessary . pet has been used for bottling beer but because of the high permeability of oxygen it causes the flavor to deteriorate rapidly . there have been several products where pet is laminated with a high oxygen barrier film to try to compensate for this . pen has the needed barrier properties . this and the fact that it can take higher temperatures that are used to pasteurize some liquids , it is expected that the use of pen will increase over the next decade . the process of the present invention can use pen as the commercially available condensation polymer . the required temperatures to produce this polymer are slightly greater on the order of 250 to 270 degrees centigrade . ingredient percent amt ( in grams ) modifying polymer peg 400 53 . 46 112 . 27 diethylene glycol 16 . 28 34 . 19 adipic acid 30 . 11 63 . 23 fascat ™ 4100 0 . 12 0 . 25 tyzor ™ tpt 0 . 03 0 . 06 total 100 210 all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . temp time (° c .) observations 8 : 33 a rt all above ingredients except tyzor ™ tpt , 80 % 8 : 58 a 100 all melted , agitate and inert gas 9 : 31 a 170 condensate over , set at 65 % 11 : 15 a 225 condensate slowed almost to stop , a . v . & lt ; 3 . 0 , removed all but 42 grams from flask , added tpt , 80 % ingredient percent amt ( in grams ) modifying polymer 20 42 pen 80 168 finished product was a clear , stretchy material . when poured out onto a teflon ™ sheet the material had the characteristics of the shrink wrap used in the packaging industry . considering the content of pen , this film should have superior barrier properties . it has been shown in the prior art that pet can be broken down through glycolysis with various types of glycols to a polyol that is then further reacted with propylene or ethylene oxide to make these polyols pet - containing less crystalline and aid in the handling by lowering the viscosity of the resulting liquid . the liquid polyols are usually used to make more pliable or flexible types of finished materials such as foam for backing various substrates , foam for furniture cushions , automotive seats , etc . but there are some liquid polyols that create rigid foams as well . the need for non - crystallizing material to make polyols requires further processing with ethylene oxide or propylene oxide units to achieve the desired end product . harder more crystalline polyols can be made that are suitable for further reaction with diisocyanate prepolymers or epoxy containing polymers to make hard coatings for appliances , automotive finishes and the like that are formed by heating up or baking the polyol powder until it fuses and becomes a coating . in the process , there are many environmental aspects of having materials with low voc &# 39 ; s and containing no solvents that need to be removed . these are collectively referred to as powder coatings because they are normally in the form of powders ready for use . in the prior art , several types of polyester polyols have been made using pet as a raw material . polyols are useful components of a number of different compounds . these include , but are not limited to , surfactants , different types of polyurethanes from foam to thermoplastic elastomers , and adhesives or coatings . the present process is especially useful for the preparation of polyols with a wide variety of properties . furthermore , when using an extruder for the second step , the rapid transesterification step , the procedure is especially useful as a means of making and utilizing polymers of high viscosity or high crystallinity which are impossible to utilize with other manufacturing technologies that require isolation prior to use , such as high molecular weight polyurethanes . to make high molecular weight polyurethanes liquid polyols are mixed with close to stoicheiometric equivalents of diisocyanate compounds and allowed to react . the isocyanate groups react with the alcohol groups of - the polyols and extend the chain with the resulting urethane linkages . due to the relatively low molecular weights of the starting polyols often the mixtures contain 30 to 50 percent of the isocyanate compound . in contrast , with the present process , it is possible to create high molecular weight polyols with wide ranges of amorphous and crystalline segments . with the polyol component at higher molecular weights , the isocyanate component can be reduced to very low levels , often less than 1 % of the total . three different polyols were made using the present procedure with varying molecular weights and degrees of crystallinity . a small 250 ml round bottomed flask was used in all cooks . ingredient percent amt ( in grams ) modifying polymer : peg 400 39 . 80 83 . 58 diethylene glycol 10 . 60 22 . 26 adipic acid 14 . 60 30 . 66 fascat ™ 4100 0 . 08 0 . 17 tyzor ™ tpt 0 . 02 0 . 04 all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . no vacuum step was used . note : in these examples , the fascat ™ 4100 is used first for esterification of the modifying polymer . next , the tpt is used for transesterification of the modifying polymer with the commercially available condensation polymer of commerce . temp time (° c .) observations 8 : 14 a rt peg 400 , deg , adipic acid , and fascat ™ 4100 charged , control set at 80 %. 8 : 35 a 100 ingredients melted . began agitation and inert blanket . 9 : 01 a 170 condensate coming over . 9 : 15 a 190 condensate over too fast , cut back to 60 % 10 : 20 a 220 condensate almost stopped . a . v . less than 5 10 : 32 a 240 added tpt and all of pet 10 . 48 a 250 all clear and liquid . clear pill of 30 minutes total time 2 hours and 34 minutes the product was a clear , slightly viscous liquid at room temperature . polyol sample 2 : in this example only the amounts of peg 400 and adipic acid were changed . however , this represented a change in the modifying polymer from an equilvalent excess of hydroxyls of 0 . 995 to 0 . 39 . this shifts the molecular weight up considerably , as indicated by the increase in viscosity from 15 poise at 175 degrees centigrade to 35 poise at 175 degrees centigrade , while reducing the hydroxyl content of the finished polyol . ingredient percent amt ( in grams ) modifying polymer : peg 400 34 . 80 73 . 08 diethylene glycol 10 . 60 22 . 26 adipic acid 19 . 60 41 . 16 fascat ™ 4100 0 . 08 0 . 17 tyzor ™ tpt 0 . 02 0 . 04 all the ingredients were combined in a 250 milliliter flask fitted with a ii condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . temp time (° c .) observations 12 : 35 p rt peg 400 , deg , adipic acid , and fascat ™ 4100 charged . heater set at 80 %. 12 : 55 p 100 ingredients melted . began agitation and inert blanket . 1 : 26 p 170 distillate began coming over . set heater to 60 %. 3 : 20 p 220 condensate almost stopped . a . v . & lt ; 3 . 0 3 : 35 p 230 added all tpt and pet . set control to 80 % 4 : 16 p 250 all clear . total cook time : 3 hrs . 41 min . this polyol was clear and much more viscus than polyol sample 1 . this is due to the higher molecular weight . in this example the same percentage of ingredients are used to make the modifying polymer as in polyol sample 2 . however , the amount of the commercially available condensation polymer , i . e . pet , is changed so that the finished polyol contains 50 %, and not 34 . 90 % of the pet . since the pet is of higher molecular weight than that of the modifying polymer , the molecular weight is increased substantially from the pet upon reaction with subsequent changes in properties expected of higher molecular weight polymers . ingredient percent amt ( in grams ) modifying polymer : peg 400 26 . 70 56 . 07 * diethylene glycol 8 . 14 17 . 09 adipic acid 15 . 06 31 . 63 fascat ™ 4100 0 . 08 0 . 17 tyzor ™ tpt 0 . 02 0 . 04 * note : in order to allow the catalysts , fascat ™ 4100 and tyzor ™ tpt , to remain constant a slight adjustment was made in the quantity of peg 400 used . all the ingredients were combined in a 250 milliliter flask fitted with a condenser , a thermometer , a pipet for the introduction of an inert gas , an agitator , and a heating mantel with a scale controlled rheostat . temp time (° c .) observations 8 : 21 p rt peg 400 , deg , adipic acid , and 4100 charged . heat set at 80 %. 8 : 40 p 100 ingredients melted . began agitation and inert blanket . 9 : 08 p 170 condensate coming over , back to 60 %. 10 : 31 p 222 condensate stopped . a . v . & lt ; 3 . 0 , back to 80 % 10 : 45 p 250 added 50 . 0 grams of pet . 11 : 05 p 250 added 55 . 0 grams of pet . 11 : 30 p 250 clear melt . 11 : 45 p 250 finished and cooled . total cook time : 3 hours 24 minutes at this point the product was cooled and was a tacky solid at room temperature indicative of a much higher molecular weight . also it crystallized overnight so the crystallinity with this much pet is high . in production of high pet content urethanes as in the following examples it would not be necessary to isolate this material . as presented in polyol samples 1 - 3 , polyols are reacted with near stoichiometric amounts of diisocyanate compounds to yield polyurethanes that can be used for foam , adhesives , or other elastomeric compounds . the polyols of the present process are especially suitable to rapid modification of polyurethanes to suit a wide range of finished properties . in addition , the higher molecular weights that can be easily obtained can produce rare properties with very small amounts of diisocyanate compounds because of the higher ratio of polymer to isocyanate components the finished polyurethanes can take on properties more like the polyester and less like the isocyanates . these properties could include crystalline and non - crystalline phases within the same polymer structure resulting in a combination of properties such as rigidity and impact strength that have not been achieved with past polyurethane systems . in the following examples polymethylene polyphenyl isocyanate ( papi ) was used as the diisocyanate compound . it has low volatility and is therefore safer to use than standard methylene phenyl diisocyanate ( mdi ) one of the more common isocyanates used . the isocyanate index of papi 27 from dow ™ is stated to be 300 . this value is used to establish combining weights with other reactive groups . it is common practice to use a slight theoretical excess of isocyanate , usually 3 - 5 % for flexible foams . also , water is commonly used as a foaming agent in these types of mixes . the isocyanate reacts with the water creating carbon dioxide that then expands and creates the foam . the quantity of isocyanate compound used for this purpose must also be taken into account . using polyol sample 1 since the equivalents of diethylene glycol and adipic acid are equal the equivalents of peg 400 can be used to calculate the equivalents of hydroxyl components and the hydroxyl number . the hydroxyl number for this polyol is 111 . 6 . this value is calculated by either 1 ) calculating the hydroxyl value of the beginning mixture and subtracting the calculated beginning acid value and then adding back the measured final acid value , or 2 ) using conventional techniques with anhydrides and back calculations by titration of remaining acid values . once this value is obtained , it is divided by the isocyanate index to obtain the combining ratio . using 1 gram of water for the foaming agent an amount of 14 . 4 grams of papi was added for conversion to carbon dioxide to create the foam . so the following ratio amounts were combined in a cup and allow to react : polyol sample 1 100 grams papi 38 . 7 grams water 1 . 0 grams papi for water 14 . 4 grams dbtl 0 . 1 grams the di - butyl tin laurate ( dbtl ) is added to help catalyze the reaction . other catalysts such as amines are commonly used to speed up the reaction . this produced a nice foam that expanded and became slightly rigid and very tough after curing . using polyol sample 2 , since the equivalents of diethylene glycol and adipic acid are equal the equivalents of peg 400 can be used to calculate the equivalents of hydroxyl components and the hydroxyl number . the hydroxyl number for this polyol is 97 . 6 . this value is calculated by either 1 ) calculating the hydroxyl value of the beginning mixture and subtracting the calculated beginning acid value and then adding back the measured final acid value , or 2 ) using conventional techniques with anhydrides and back calculations by titration of remaining acid values . once this value is obtained , it is divided by the isocyanate index to obtain the combining ratio . using 1 gram of water for the foaming agent an amount of 14 . 4 grams of papi was added for conversion to carbon dioxide to create the foam . so the following ratio amounts were combined in a cup and allow to react : polyol sample 2 100 grams papi 33 . 8 grams water 1 . 0 grams papi for water 14 . 4 grams dbtl 0 . 1 grams this produced a nice foam that was tough and more rigid than polyurethane example 1 . using polyol sample 3 , since the equivalents of diethylene glycol and adipic acid are equal the equivalents of peg 400 can be used to calculate the equivalents of hydroxyl components and the hydroxyl number . the hydroxyl number for this polyol is 74 . 9 . this value is calculated by calculating the equivalents supplied by the peg 400 . the hydroxyl number is based on the molecular weight of potassium hydroxide , which is 56 . 1 and is defined as being millequivalents of potassium hydroxide per gram of sample . once this value is obtained , it is divided by the isocyanate index to obtain the ratio . using 1 gram of water for the foaming agent an amount of 14 . 4 grams of papi was added for conversion to carbon dioxide to create the foam . so the following ratio amounts were combined in a cup and allow to react : polyol sample 3 100 grams papi 26 grams water . 82 grams papi for water 8 . 5 grams dbtl 0 . 1 grams in this example less water is used because the total amount of sample is less . because the polyol of this example was a solid at room temperature it was necessary to first warm it in order to melt it to a liquid form before adding all of the ingredients . this produced dense cell structured foam that expanded and became very rigid and tough after curing . in all of the above polyurethane examples , foam was generated by mixing liquids at temperatures close to room temperature . it is easy to see that the trend is as the hydroxyl content is lowered , the molecular weight goes up , and the amount of papi required to produce a foam is less . however we rapidly approach the point where the polyol becomes a solid and cannot be reacted easily with the isocyanate in a cup or mixing container . the next examples are performed in an extruder . in this example the modifying polymer is prepared and then reacted with the pet in the same reactor . the resulting product is then transferred to an extruder where it is reacted to make the polyurethane . papi is injected in a zone downstream from the feed throat . because of the high temperatures , reaction takes place rapidly and as the polymer exits it expands as foam . the raw materials of the modifying polymer in this example have been changed to reflect the diversity of alcohols and acids that can be used . ingredient amount actual percent peg 600 52 . 20 56 . 80 peg 200 20 . 00 21 . 76 phthalic anhydride 19 . 60 21 . 33 fascat ™ 4100 0 . 08 0 . 09 tyzor ™ tpt 0 . 02 0 . 02 total 91 . 9 100 . 00 ingredient percent modifying polymer 19 . 6 pet 78 . 4 5 - phenyl tetrazole 2 . 0 in this example the modifying polymer was prepared in advance in a small reactor . pet was later added in stages and the reaction was heated to 250 degrees centigrade until no change in viscosity was noticed . the resulting material was cooled to about 100 degrees centigrade and the 5 - phenyl tetrazole was added . this is a common foaming agent used in high temperature polymers . however , since extremely high temperatures are not needed , other suitable foaming agents will work such as , but not limited to , hydrocarbons , such as hexane or heptane , inert gases such as nitrogen , carbon dioxide , or any of the noble gases . at this point the polyol polymer was transferred to a twin screw extruder using a nordstrom ™ hot melt pump . the processing temperatures had to be high enough at the end to effect the decomposition of the 5 - phenyl tetrazole to nitrogen gas in the range of 230 to 265c . papi was injected into the polyol polymer at about 100 degrees centigrade and the barrel was brought up to 250 degrees centigrade to effect decomposition of the 5pt prior to exiting the dye . the following ratios of polyol polymer to papi were used : ingredient parts percent polyol polymer from above 100 90 . 58 papi ( stoichiometric plus 4 %) 10 . 4 9 . 42 total 110 . 4 100 . 00 the foam created was very rigid and tough and suitable as structural foam . in this example the modifying polymer was added with the pet in a twin screw extruder and the transesterification reaction was performed in the barrel of the extruder . papi was reacted in a further downstream injection and the subsequent foam was generated with a hydrocarbon gas former . this example shows the lower quantities of isocyanate that can be used with higher molecular weights . ingredient parts percent pet 100 . 00 95 . 90 modifying polymer of polyol sample 2 1 . 50 1 . 44 papi 0 . 78 0 . 74 heptane 2 . 00 1 . 92 total 104 . 28 100 . 00 the foam created was extremely rigid and tough and suitable for many kinds of structural uses . it is in the actual comparison of reaction rates and times for the present process that one becomes aware of the novelty in the present process since the present process is not only faster but much easier to control than those of the prior art . another substantial benefit of the present process relates to the time for research and development of new polymer types . instead of being limited to only the beginning mixture of ingredients one can vary the commercially available condensation polymer ratio in the second step of the process and extract research samples along the way thereby producing a wide range of polymer species for property comparisons . although the invention has been described with reference to specific embodiments , this description is not meant to be construed in a limited sense . various modifications of the disclosed embodiments , as well as alternative embodiments of the inventions will become apparent to persons skilled in the art upon the reference to the description of the invention . it is , therefore , contemplated that the appended claims will cover such modifications that fall within the scope of the invention .

US-82702804-A

a fish screen is presented having a porous surface made of two or more corrugations having an at least partially porous surface . the incorporation of a porous area on the corrugations allows increasing the total porous surface area compared to an underlying diversion area . the porous area is a magnification of an underlying diversion area , which reduces the fluid pressure acting on the porous area of the screen . the valley between each pair of corrugations is solid , not porous . the solid valley provide two important functions ; they provide multiple small solid surface flow channels over the screen surface . these solid channels protect small or weak swimming aquatic organisms from impingement on the screen . that is , once organisms reach the solid channel , they may move along the solid channel free of impingement until they reach the edge of the screen .

reference will now be made to the accompanying drawings , which at least assist in illustrating the various pertinent features of the presented inventions . the following description is presented for purposes of illustration and description and is not intended to limit the inventions to the forms disclosed herein . consequently , variations and modifications commensurate with the following teachings , and skill and knowledge of the relevant art , are within the scope of the presented inventions . the embodiments described herein are further intended to explain the best modes known of practicing the inventions and to enable others skilled in the art to utilize the inventions in such , or other embodiments and with various modifications required by the particular application ( s ) or use ( s ) of the presented inventions . fish screens are often used to cover water diversions / flow diversions to prevent entry of debris and / or aquatic species into the diversion . when placed over a diversion , the flow of the water though the fish screen can impinge debris and aquatic species against the surface of the screen . provided herein is a fish screen that reduces the impingement forces present at the surface of the screen and provides escape routes from the interior of the screen to edges of the screen . such escape routes may have little or no impingement forces allowing aquatic species to readily move from an interior of the screen to an edge of the screen and back to their native waters . fig1 and 2 show isometric and plan views of one embodiment of a fish screen 10 in accordance with various aspects of the presented inventions . as shown , the screen 10 includes a plurality of aligned corrugations 20 that , in the illustrated embodiment extend along a majority of the length of the screen from a forward end 32 ( e . g ., upstream end ) toward a rearward end 34 ( e . g ., downstream end ). the corrugations 20 are designed to be substantially aligned with a flow direction 50 , when the screen 10 is in use . further , each corrugation includes a porous surface 22 that is sized to allow water to filter through the corrugations while preventing debris and / or aquatic species from passing there through . fig3 illustrates the fish screen 10 as applied to water diversion 100 . in the illustrated embodiment , the fish screen 10 is applied over the diversion 100 at the bottom of a water flow 50 . in this illustration , the fish screen 10 is utilized in a horizontal configuration on the bottom of the flow 50 . however , this is not a requirement and it will be appreciated that fish screen 10 may be applied in other orientations ( e . g ., angled etc .). as shown , the fish screen covers the diversion 100 such that a frame 30 of the fish screen 10 is supported about a periphery of the diversion 100 . when so positioned , the porous surfaces of the corrugations 20 are disposed above the diversion 100 . as water flows past the screen 10 , the water is able to pass into the porous surfaces 22 of the corrugations 20 and into the flow diversion 100 while preventing debris and aquatic species from entering into the diversion 100 . fig4 illustrate one embodiment of a portion of a corrugation 20 removed from the fish screen for purposes of illustration . as shown , the corrugation 20 is at least partially formed of a porous surface 22 . any porous surface may be unitized and may include , without limitation , woven wire surfaces ( e . g ., detail a ) and solid surfaces with a plurality of apertures / holes formed ( e . g ., drilled , punched ) through the surface ( detail b ). in any arrangement , the size of the pores ( e . g ., spacing between wires , aperture diameter etc .) are selected to permit water to pass through the surface while preventing aquatic species above a predetermined size from passing through . as shown , each corrugation 20 is an elongated convex surface that , when disposed on the frame 30 raises , a reference plane of the screen 10 as generally defined by screen frame 30 . see , e . g . fig1 . to reduce the impingement forces experienced by the porous surfaces of the screen 10 , each corrugation has a total surface area that is a multiple of the projection area / diversion covered by the corrugation . that is , the convex three - dimensional surface formed by the porous areas of each corrugation is larger than the projected diversion area covered by the corrugation . referring again to fig4 a , the porous surface area of the exemplary angled corrugation is larger than the diversion area 60 covered by the corrugation 20 . stated otherwise , the porous surface area of the convex corrugation is larger than the area defined by the open end of the convex corrugation . in the illustrated embodiment , the porous surface area is calculated as twice the porous width ( pw ) of the corrugation times the porous length ( l ) of the corrugation . in contrast , the projection area 60 of the porous surface is equal to the width ( w ) times the porous length of the corrugation ( l ). that is : though illustrated with an angled corrugation , will be appreciated that similar calculations can be made for any convex corrugation ( e . g ., in cross - section ) including , without limitation , half - circular , trapezoidal etc . in any arrangement , the porous screen area is a magnification of the flow diversion area covered by the corrugation 20 . in one embodiment , the porous screen area is at least 1 . 25 times the projection area . in further embodiments , the porous screen area is at least 1 . 5 times the projection area . in a yet further embodiment , the porous screen area is at least 2 . 0 times the projection area . magnification of porous screen area compared to the diversion area covered by the corrugation allows flow passing through the smaller diversion area to pass through a larger porous area . this reduces the impingement force ( e . g ., fluid pressure ) on the porous screen per unit area . lower impingement forces entrap less debris and aquatic species . to further reduce the impingement forces experienced by debris and aquatic species contacting the screen , the valleys 24 between adjacent corrugations 20 are solid . this is best illustrated in the plan view of fig2 , the cross - sectional view of fig5 and the detail view of fig6 . as shown , each solid valley 24 extends between the porous surfaces 22 of two adjacent corrugations 20 . in the illustrated embodiment , the solid valley 24 is generally u - shaped or trapezoidal . that is , the solid valley 24 includes a bottom surface 26 ( e . g ., flat ) and two upwardly extending legs 28 a and 28 b . such a configuration provides a recessed channel , which further provides a refuge for aquatic species to move toward the edge of the screen . though the solid valley is illustrated with a recessed channel , it will be appreciated that other configurations are possible . in any embodiment , the solid valley 24 provides a flow channel across the screen from the forward end 32 to the rearward end 34 with no impingement forces that may trap debris or aquatic species against the screen . rather , when the corrugations 20 and valleys 24 are aligned with a flow direction , the resulting flow through the valleys is directed toward the edge of the screen 10 , which provide an escape route for aquatic species across the screen and helps remove debris from the surface of the screen 10 . in use , young life stages of aquatic species will naturally navigate to the deeper valleys where solid continuous passage is available . diverted flow will pass through the screen in the porous surfaces 22 of each corrugation 20 . see fig3 . the forward end and / or rearward end of the corrugations 20 may further include optional flow guidance structures . referring to fig1 , the forward ends of the corrugations abut against and angled accelerator plate 40 . as shown , the accelerator plate 40 is an angled surface that extends from the forward end of the frame 30 and extends to the peak surfaces of the aligned corrugations 20 . as shown , the accelerator plate covers the open forward ends of the corrugations preventing objects from entering into these open ends . when utilized , the accelerator plate 40 also diverts the flow upward as it passes over the screen 10 . this reduces the fluid pressure on the forward ends of the porous corrugations 20 . that is , the accelerator plate 40 diverts the flow upward as it contacts the screen 10 . this allows the water to drain through the porous surfaces rather than flowing directly into the porous surfaces . again , this further reduces the impingement force on the porous surface . the embodiment of the screen illustrated in fig1 also includes a plurality of individual flow guides 42 disposed on the rearward end of the corrugations 20 . these flow guides enclose the rearward open ends of the corrugations 20 . in other embodiments , such flow guides may be disposed on the forward ends of the corrugations ( not shown ). in such an arrangement , the flow guides direct flow along the screen . as illustrated in the side view of fig3 , the screen may optionally include a number of flow baffles 44 disposed behind / below the screen 10 , which allow for a more equal distribution of fluid flow through the screen . that is , the flow baffles provide resistance to water passing through the screen such that the forward end does not experience significantly higher flow velocities relative to downstream portions of the screen . the number spacing and physical configuration of the baffles may be varied based on expected conditions ( e . g ., expected flow velocity , etc .). the fish screen may be constructed of any appropriate materials . typically the fish screen is form of corrosion resistant metals . in one embodiment , the corrugations their porous surfaces and the solid valleys between the corrugations are integrally formed from a common sheet of metal . in such an arrangement , the metal sheet may be perforated ( e . g ., drilled , punched , laser cut , etc .) to for the porous surfaces . at this time , the sheet may be shaped ( e . g ., bent ) to form the corrugations having the solid valleys there between . however , other methods of manufacture are possible and within the scope of the presented inventions . for instances , metal screens ( e . g ., woven ) may be shaped to form the convex corrugations and the lateral edges of the metal screens may be attached ( e . g ., riveted , spot welded etc .) to , for example , lateral edges of solid channels . the porous corrugations and solid channels may then be attached to a frame . alternatively , the frame may be integrally formed with the corrugations and solid valleys . the width and length of the screen may be sized based on its intended use . that is , the screen may be manufactured to the dimensions of a particular diversion . in summary , the fish screen can be placed in any orientation from vertical , a porous wall which flow passes through , to horizontal , a porous floor with flow passing over and down through the screen . most typically , the screen corrugations run parallel to the major direction of flow . water passes through the screen and fish and debris travel along the screen face returning to native water . the three - dimensional screen surface formed by corrugating the screen provides a magnification of screen area compared to a flat screen surface / diversion area of the same area . this allows more flow to be passed through the screen per unit area . a portion of the valleys formed between the corrugations are preferably a solid material such that the screen contains multiple parallel rows of porous screen and solid valley channels . weak swimming fish and other aquatic organisms will naturally seek the screen valleys where they are protected from impingement as they pass the entire length of the screen . the solid valleys further serve a benefit by passing debris and fine sediment the length of the screen . this reduces cleaning requirements of the screen compared to a similar continuous flat surface screen . the foregoing description has been presented for purposes of illustration and description . furthermore , the description is not intended to limit the inventions and / or aspects of the inventions to the forms disclosed herein . consequently , variations and modifications commensurate with the above teachings , and skill and knowledge of the relevant art , are within the scope of the presented inventions . the embodiments described hereinabove are further intended to explain best modes known of practicing the inventions and to enable others skilled in the art to utilize the inventions in such , or other embodiments and with various modifications required by the particular application ( s ) or use ( s ) of the presented inventions . it is intended that the appended claims be construed to include alternative embodiments to the extent permitted by the prior art .

US-201514851522-A

a sealing device effects a seal between a first member and a second member of a hermetic chamber . the sealing device includes a body having an elongated shape forming a closed loop . the body of the sealing device includes magnetic material and further includes a ) a first and a second sealing portions , and b ) at least one internal compartment formed by walls undulatingly extending between the first and second sealing portions . a sealing apparatus includes a first member of a hermetic chamber , a second member of the hermetic chamber , and the above sealing device .

as shown in fig3 , an exemplary embodiment of a sealing apparatus is a hermetic chamber 300 comprising a container 310 which is a first member of the hermetic chamber , a lid 320 which is a second member of the hermetic chamber , and an embodiment of a sealing device 330 which is disposed between the lid 320 and the container 310 . the container 310 can be a chamber portion of a wet bench spin dryer used in semiconductor manufacturing , or of any container or enclosure of a hermetic type which needs to be airtight . the lid 320 can be a lid or cover portion of the wet bench spin dryer , or of any hermetic type container or enclosure which needs to be airtight . the sealing device 330 has a body with an elongated shape forming a closed loop . for example , fig7 shows the bottom view of the sealing device 330 and the lid 320 in fig3 . in this embodiment , the sealing device 330 forms a round loop . ordinary people in the art will understand that a sealing device can form a loop of other shapes such as a rectangular loop . the sealing device 330 comprises silicone , a fluoroelastomer such as viton , or a flour seal plastic , which is a soft , pliable , or tender seal plastic . many other elastic materials can be used . in addition , the sealing device 330 comprises magnetic material to increase a sealing effect . as shown in cross section in fig4 a , the sealing device 330 comprises a first sealing portion 430 , a second sealing portion 450 , and an internal compartment 410 formed by walls undulatingly extending between the first and second sealing portions . the outer surfaces of the first sealing portion 430 form an approximately 90 degrees angle 435 with a lower sealing surface 460 of the lid 320 . the second sealing portion 450 has a flat surface 480 to contact with an upper sealing surface 470 of the container 310 . the internal compartment 410 contains compressible material , such as air . the outer surfaces 440 extending between the first and second sealing portions form an undulating shape with a crest 442 and a trough 444 . an internal magnetic compartment 420 disposed in the second sealing portion 450 contains a magnetic material such as ndfeb . in this embodiment , the first sealing portion 430 of the sealing device 330 is attached to the lid 320 by using glue , screws and other means known to those skilled in the art . when the container 310 is in sealing engagement with the lid 320 with the sealing device 330 disposed therebetween , the second sealing portion 450 contacts the container 310 which comprises metal . as a result , the attractive force between the magnetic material in the internal magnetic compartment 420 and the metal in the container 310 improves the sealing effect . besides , the internal compartment 410 of the sealing device 330 is compressed to certain extent in the sealing engagement . if the internal compartment 410 is strongly compressed , in order to release some compressive material such as air from the internal compartment 410 into the outside of the sealed container such as a spin dryer , there may be some small holes 485 disposed on the walls forming the internal compartment 410 . fig4 b demonstrates another embodiment of the sealing device 490 of the present invention . the sealing device 490 does not have an internal magnetic compartment . powders of magnetic material such as ndfeb can be blended together with silicone and / or a fluoroelastomer while manufacturing the sealing device 490 to make the resultant sealing ring magnetic . according , a sealing effect can be increased by the attractive force between the sealing device 490 and the container 310 which comprises metal and / or by the attractive force between the sealing device 490 and the lid 320 which comprises metal . in another embodiment of a sealing apparatus illustrated in fig5 , a lid 510 , which is the first member of a sealing apparatus , can be a cover portion of a wet bench spin dryer used in semiconductor manufacturing , or of any hermetic container or enclosure which needs to be airtight . a container 520 , which is the second member of the sealing apparatus , can be a chamber portion of the wet bench spin dryer , or any hermetic enclosure which needs to be airtight . a sealing device 530 is disposed between the lid 510 and the container 520 . in this embodiment , the sealing device 530 is fastened to the container 520 by using glue , screws and other means known to those skilled in the art . the sealing device 530 comprises a first sealing portion 540 , a second sealing portion 550 , and an internal compartment 570 formed by walls undulatingly extending between the first and second sealing portions . the outer surfaces of the first sealing portion 540 form an approximately 90 degrees angle 555 with an upper sealing surface 525 of the container 520 . the second sealing portion 550 has a flat surface 545 to contact with a lower sealing surface 515 of the lid 510 . an internal compartment 570 contains compressible material , such as air . the outer surfaces 560 extending between the first and second sealing portions form an undulating shape with a crest 562 and a trough 564 . an internal magnetic compartment 575 disposed in the second sealing portion 550 contains a magnetic material such as ndfeb . the lid 510 comprises metal . as a result , the attractive force between the magnetic material in the internal magnetic compartment 575 and the metal in the lid 510 improves the sealing effect . in fig6 , another embodiment of a sealing device 600 disposes between the lid 510 and the container 520 . the sealing device 600 comprises a first sealing portion 610 , a second sealing portion 620 , and an internal compartment 640 formed by walls undulatingly extending between the first and second sealing portions . the second sealing portion 620 has a flat surface 627 to contact with a lower sealing surface 515 of the lid 510 . in addition , the outer surfaces of the second sealing portion 620 form an approximately 90 degrees angle 625 with the lower sealing surface 515 of the lid 510 when the container 520 is in sealing engagement with the lid 510 . the outer surfaces 630 extending between the first and second sealing portions form an undulating shape with a crest 634 and two troughs 632 and 636 . an internal magnetic compartment 650 disposed in the second sealing portion 620 contains a magnetic material . in fig8 , another embodiment of a sealing apparatus comprises a first member 810 , a second member 820 with an opening 840 , and a sealing device 830 fastened to the second member 820 . the body of the sealing device 830 can be an elongated loop in a rectangular shape . the second member 820 may enclose a fairly large space where machines , such as a process chamber and a metrology device , can be installed inside . the first member 810 can be a window or a door to the second member 820 . by a screw , a spring , and / or a compressor , the first member 820 can be in sealing engagement with the second member 820 with the sealing device 830 disposed therebetween . although the invention has been described in terms of exemplary embodiments , it is not limited thereto . rather , the appended claims should be construed broadly , to include other variants and embodiments of the invention , which may be made by those skilled in the art without departing from the scope and range of equivalents of the invention .

US-83655204-A