text
stringlengths 2
2.82M
⌀ |
|---|
NMR methods for studying protein-protein interactions involved in translation initiation.
Translation in the cell is carried out by complex molecular machinery involving a dynamic network of protein-protein and protein-RNA interactions. Along the multiple steps of the translation pathway, individual interactions are constantly formed, remodeled, and broken, which presents special challenges when studying this sophisticated system. NMR is a still actively developing technology that has recently been used to solve the structures of several translation factors. However, NMR also has a number of other unique capabilities, of which the broader scientific community may not always be aware. In particular, when studying macromolecular interactions, NMR can be used for a wide range of tasks from testing unambiguously whether two molecules interact to solving the structure of the complex. NMR can also provide insights into the dynamics of the molecules, their folding/unfolding, as well as the effects of interactions with binding partners on these processes. In this chapter, we have tried to summarize, in a popular format, the various types of information about macromolecular interactions that can be obtained with NMR. Special attention is given to areas where the use of NMR provides unique information that is difficult to obtain with other approaches. Our intent was to help the general scientific audience become more familiar with the power of NMR, the current status of the technological limitations of individual NMR methods, as well as the numerous applications, in particular for studying protein-protein interactions in translation. |
Q:
Create RSS feed in asp.net core 1.0
I am working in Asp.net Core 1.0 MVC 6
I am trying to write a component to provide RSS feeds from my websites.
I found this post that suggests that System.ServiceModel.Syndication has yet to be ported to ASP.NET CORE.
I am unable to target the full .NET framework.
The suggestion is to write as an xml parser. I am however struggling to get my head around everything that might be required.
I have built the functionality to get my data into XML but now need to better understand how to allow this to be called from an IActionResult (or indeed how to generate a link that may be placed on my page).
I can provide samples of my code but am not sure it'll be helpful.
Is anyone able to point me in the right direction of examples achieving this?
I also found an answer on this post which points towards some ideas but I think is pre MVC6/Asp.net Core: RSS Feeds in ASP.NET MVC
A:
// action to return the feed
[Route("site/GetRssFeed/{type}")]
public IActionResult GetRssFeed(ArticleStatusTypes type)
{
var feed = _rss.BuildXmlFeed(type);
return Content(feed, "text/xml");
}
public string BuildXmlFeed(ArticleStatusTypes type)
{
var key = $"RssFeed{Convert.ToInt32(type)}{_appInfo.ApplicationId}";
var articles =
_cache.GetCachedData(key) ??
_cache.SetCache(key, _service.GetItems(Convert.ToInt32(type), _appInfo.CacheCount));
StringWriter parent = new StringWriter();
using (XmlTextWriter writer = new XmlTextWriter(parent))
{
writer.WriteProcessingInstruction("xml-stylesheet", "title=\"XSL_formatting\" type=\"text/xsl\" href=\"/skins/default/controls/rss.xsl\"");
writer.WriteStartElement("rss");
writer.WriteAttributeString("version", "2.0");
writer.WriteAttributeString("xmlns:atom", "http://www.w3.org/2005/Atom");
// write out
writer.WriteStartElement("channel");
// write out -level elements
writer.WriteElementString("title", $"{_appInfo.ApplicationName} {type}" );
writer.WriteElementString("link", _appInfo.WebsiteUrl);
//writer.WriteElementString("description", Description);
writer.WriteElementString("ttl", "60");
writer.WriteStartElement("atom:link");
//writer.WriteAttributeString("href", Link + Request.RawUrl.ToString());
writer.WriteAttributeString("rel", "self");
writer.WriteAttributeString("type", "application/rss+xml");
writer.WriteEndElement();
if (articles != null)
{
foreach (var article in articles)
{
writer.WriteStartElement("item");
writer.WriteElementString("title", article.Title);
writer.WriteElementString("link", _appInfo.WebsiteUrl); // todo build article path
writer.WriteElementString("description", article.Summary);
writer.WriteEndElement();
}
}
// write out
writer.WriteEndElement();
// write out
writer.WriteEndElement();
}
return parent.ToString();
}
A:
They've released a preview NuGet package for Microsoft.SyndicationFeed. On the dotnet/wcf repo, they've provided an example to get you up and running.
EDIT: I've posted a Repo and a NuGet package that serves as a Middleware around this.
|
FTIR spectroscopy of metalloproteins.
Absorption of infrared radiation by proteins gives important information about their structure and function. The most intense infrared bands correspond to the overlap of all the peptide bond absorption. Additionally, in many metalloproteins their prosthetic groups have intrinsic ligands or bind substrates/inhibitors that absorb intensively in the infrared. Here, we describe thoroughly several Fourier transform infrared methods for studying structure-function relationships in metalloproteins, using hydrogenases as an example. |
Q:
Raw Socket Help: Why UDP packets created by raw sockets are not being received by kernel UDP?
I am studying raw sockets. I used the IP_HDRINCL option to build my own IP headers. After the IP header, I am building a UDP header. Then I am sending the packet to my system's loopback address. I have another program running which will catch the UDP packets as they come. To check whether the packets are being correctly formed and received, I have another process running which is reading raw IP datagrams. My problem is that although the second process(reading raw datagrams) is working well(all the IP and UDP fields seem to be okay), but the first process(receiving UDP) is not receiving any of the packets that I created. The protocol field in the IP header is okay and the port also matches...
I am using Linux 2.6.35-22.
I want to know whether this is normal in new kernels? Please check the code below for any bugs. The UDP process which should receive the packets is listening on a socket bound to port 50000 on the same machine...
unsigned short in_cksum(unsigned short *addr, int len)
{
int nleft = len;
int sum = 0;
unsigned short *w = addr;
unsigned short answer = 0;
while (nleft > 1) {
sum += *w++;
nleft -= 2;
}
if (nleft == 1) {
*(unsigned char *) (&answer) = *(unsigned char *) w;
sum += answer;
}
sum = (sum >> 16) + (sum & 0xFFFF);
sum += (sum >> 16);
answer = ~sum;
return (answer);
}
main()
{
int fd=socket(AF_INET,SOCK_RAW,IPPROTO_UDP);
int val=1;
int ret=setsockopt(fd,IPPROTO_IP,IP_HDRINCL,&val,sizeof(val));
char buf[8192];
/* create a IP header */
struct iphdr* ip=(struct iphdr*)buf;//(struct iphdr*) malloc(sizeof(struct iphdr));
ip->version=4;
ip->ihl=5;
ip->tos=0;
ip->id=0;
ip->frag_off=0;
ip->ttl=255;
ip->protocol=IPPROTO_UDP;
ip->check=0;
ip->saddr=inet_addr("1.2.3.4");
ip->daddr=inet_addr("127.0.0.1");
struct udphdr* udp=(struct udphdr*)(buf+sizeof(struct iphdr));//(struct udphdr*) malloc(sizeof(struct udphdr));
udp->source=htons(40000);
udp->dest=htons(50000);
udp->check=0;
char* data=(char*)buf+sizeof(struct iphdr)+sizeof(struct udphdr);strcpy(data,"Harry Potter and the Philosopher's Stone");
udp->len=htons(sizeof(struct udphdr)+strlen(data));
udp->check=in_cksum((unsigned short*) udp,8+strlen(data));
ip->tot_len=htons(sizeof(struct iphdr)+sizeof(struct udphdr)+strlen(data));
struct sockaddr_in d;
bzero(&d,sizeof(d));
d.sin_family=AF_INET;
d.sin_port=htons(50000);
inet_pton(AF_INET,"localhost",&d.sin_addr.s_addr);
while(1)
sendto(fd,buf,sizeof(struct iphdr)+sizeof(struct udphdr)+strlen(data),0,(struct sockaddr*) &d,sizeof(d));
}
A:
There seems to be a problem with the calculation of the UDP check-sum.
udp->check=in_cksum((unsigned short*) udp,8+strlen(data));
UDP check-sum must include something called the "Pseudo-Header" before the UDP header. The code calculates checksum over only the UDP header and the payload. The UDP receiving process might not be receiving the packets because of the wrong check-sums.
Enable check-sum validation in Wireshark and check whether the check-sum fields of the UDP packets are correct or not.
See the following:
UDP: Checksum Computation
IETF: RFC 768
|
I think the real issue here is that most people don't understand /how/ to use MongoDB.
The best use case for MongoDB is as a document store. I can essentially cache numerous MySQL requests into a compiled set of useful information. Especially if the information changes somewhat infrequently, then instead of running MySQL requests for every page load I can pull the information from MongoDB. In most cases when I use MongoDB, its not as a persistent data store, but as a "compiled" data store.
MongoDB also has some useful set operations.
I for one don't believe that MongoDB is /directly/ competing with MySQL, Postgres, etc. but rather enhances these databases. |
import fetch from 'dva/fetch';
import { notification } from 'antd';
function checkStatus(response) {
if (response.status >= 200 && response.status < 300) {
return response;
}
notification.error({
message: `请求错误 ${response.status}: ${response.url}`,
description: response.statusText,
});
const error = new Error(response.statusText);
error.response = response;
throw error;
}
/**
* Requests a URL, returning a promise.
*
* @param {string} url The URL we want to request
* @param {object} [options] The options we want to pass to "fetch"
* @return {object} An object containing either "data" or "err"
*/
export default function request(url, options) {
const defaultOptions = {
credentials: 'include',
};
const newOptions = { ...defaultOptions, ...options };
if (newOptions.method === 'POST' || newOptions.method === 'PUT') {
newOptions.headers = {
Accept: 'application/json',
'Content-Type': 'application/json; charset=utf-8',
...newOptions.headers,
};
newOptions.body = JSON.stringify(newOptions.body);
}
return fetch(url, newOptions)
.then(checkStatus)
.then(response => response.json())
.catch((error) => {
if (error.code) {
notification.error({
message: error.name,
description: error.message,
});
}
if ('stack' in error && 'message' in error) {
notification.error({
message: `request error: ${url}`,
description: error.message,
});
}
return error;
});
}
|
Introduction
============
Diabetic cardiomyopathy contributes to increased cardiovascular mortality in diabetes mellitus (DM) patients and is characterized by a progressive alteration of left ventricular (LV) function. At a preclinical stage, a decrease in systolic myocardial strain has been suggested in echocardiographic studies.
MRI techniques remain the gold standard for quantification of myocardial deformation but only a single study suggested systolic abnormalities in type 2 DM patients with evidence of diastolic dysfunction.
MR-tagging is the most common technique for strain calculation using CMR but is intrinsically limited in measuring transmural variations. Cine-Displacement ENcoding Imaging with Stimulated Echoes(DENSE) has been recently proposed as an alternative that benefits from an increased spatial resolution.
Purpose
=======
To evaluate whether cine-DENSE and MR-tagging confirm the existence of a sub-clinical myocardial dysfunction in a population of type 2 DM patients with no sign or history of heart disease and normal conventional echo and MRI parameters.
Methods
=======
37 patients with type 2 DM (50.6±5.6 years, 8 females, HbA1c 7.6±1.2%) and 21 age-matched controls (49.7±8.0 years, 11 females) underwent a CMR study on a 1.5T scanner. Subjects were excluded if standard echocardiography showed significant abnormality. After a standard CMR study for conventional LV function assessment, two-dimensional cine-DENSE pulse sequence with short-echo train echo-planar imaging readout and cine-tagging with complementary spatial modulation of magnetization(CSPAMM) were acquired in short axis views at the same basal, mid and apical levels. LV volumes and ejection fraction were measured on cine-MRI images. Regional circumferential maximal systolic strain(ε~c~) was calculated from cine-DENSE and MR-tagging acquisitions on 16 LV segments. Average maximal systolic strain in each slice and a whole heart mean value(ε~c~mean) for each patient were calculated. Post-processing of cine-DENSE acquisitions included adaptive phase-unwrapping and spatial filtering. CSPAMM images were processed using *InTag* post-processing toolbox (Creatis, Lyon, France) implemented in OsiriX software (Geneva, Switzerland) with motion estimation based on the *Sine Wave Modeling* approach.
Results
=======
Standard cine-MRI LV function parameters were normal and comparable between groups (table [1](#T1){ref-type="table"}). Whereas LV ejection fraction was similar in the 2 groups, cine-DENSE showed a significant decrease in ε~c~ at basal, mid and apical LV level and in ε~c~mean in the DM group as compared to controls. MR-tagging confirmed a decrease in ε~c~ at the 3 LV levels and in ε~c~mean in DM patients as compared with controls.
######
Left ventricular function in type 2 diabetes mellitus patients and controls.
DM patients Controls P
----------------------- ---------------- ---------------- ---------
LVEDV (mL) 120 ± 26 129 ± 28 0.26
LVESV (mL) 41 ± 12 41 ± 12 0.90
LVEF (%) 66 ± 6 68 ± 6 0.30
ε~c~ base MR-tagging -0.173 ± 0.040 -0.200 ± 0.028 0.004
ε~c~ mid MR-tagging -0.177 ± 0.045 -0.220 ± 0.035 \<0.001
ε~c~ apex MR-tagging -0.189 ± 0.056 -0.232 ± 0.025 \<0.001
ε~c~ mean MR-tagging -0.179 ± 0.045 -0.216 ± 0.025 \<0.001
ε~c~ base cine-DENSE -0.134 ± 0.019 -0.155 ± 0.019 \<0.001
ε~c~ mid cine-DENSE -0.150 ± 0.021 -0.174 ± 0.020 \<0.001
ε~c~ apex cine- DENSE -0.153 ± 0.022 -0.193 ± 0.018 \<0.001
ε~c~ mean cine-DENSE -0.144 ± 0.016 -0.171 ± 0.016 \<0.001
LVEDV= left ventricular end-diastolic volume; LVESV= left ventricular end-systolic volume; LVEF= left ventricular ejection fraction; ε~c~ =Régional circumferential maximal systolic strain.
Conclusions
===========
Cine-DENSE and MR-tagging confirm subclinical myocardial dysfunction in asymptomatic patients with Type II DM.
|
Q:
Inequality between 2p-norm and p-norm for random variables
Recently I was studying something about random matrix theory, and class of sub-guassian / sub-exponential random variables is of interest. In the literature it gave an inequality as following:
$\sup_{p\geq 1} \frac{\|X^2\|_p}{p} \leq 2\sup_{p\geq 1} (\frac{\|X\|_p}{\sqrt{p}})^2$
which gives a sufficient condition such that:
$\|X\|_{2p} \leq \sqrt{2}\|X\|_p$
The proof of this inequality is not provided in the literature. Suppose the random variable $X\in\mathbb{L}^\infty(\mathbb{R})$ therefore the previous defined sub-gaussian norm and sub-exponential norm both exist, then how do we proof the sufficient condition?
Any comment is greatly appreciated :)
A:
This is a direct consequence of the general fact that $\|X^2\|_p=E[|X|^{2p}]^{1/p}=\left(\|X\|_{2p}\right)^2$ for every $p\gt0$ and every random variable $X$ in $L^{2p}$. Hence,
$$
\sup_{p\geqslant 1} \frac{\|X^2\|_p}{p}=2\,\sup_{p\geqslant 2} \left(\frac{\|X\|_p}{\sqrt{p}}\right)^2\leqslant 2\,\sup_{p\geqslant 1} \left(\frac{\|X\|_p}{\sqrt{p}}\right)^2.
$$
The rôle of the (not always true) inequality $\|X\|_{2p} \leqslant \sqrt{2}\,\|X\|_p$ is not clear.
|
Q:
Pascal to C converter
I'm writing program which translate Pascal to C and need some help. I started with scanner generator Flex. I defined some rules and created scanner which is working more or less ok. It breaks Pascal syntax into tokens, for now it's only printing what it found. But I have no idea what should I do next. Are there any articles or books covering this subject? What is the next step?
A:
You might want to take a look at "Translating Between Programming Languages Using A Canonical Representation And Attribute Grammar Inversion" and references therein.
A:
Why do you want to do such a Pascal to C converter?
If you just want to run some Pascal programs, it is simpler to use (or improve) existing compilers like gpc, or Pascal to C translators, like e.g. p2c
If you want to convert hand-written Pascal code to humanly-readable (and improvable) C code, the task is much more difficult; in particular, you probably want to convert the indentation, the comments, keep the same names as much as possible -but avoiding clashes with system names- etc!
You always want to parse some abstract syntax tree, but the precise nature of these trees is different. Perhaps flex + bison or even ANTLR may or not be adequate (you can always write a hand-written parser). Also, error recovery may or not be important to you (aborting on the first syntax error is very easy; trying to make sense of an ill-written syntactically-incorrect Pascal source is quite hard).
If you want to build a toy Pascal compiler, consider using LLVM (or perhaps even GCC middle-end and back-ends)
|
Catechins are bioavailable in men and women drinking black tea throughout the day.
Tea consumption has been associated with reduced risk of both cancer and cardiovascular disease in population studies, but clinical data demonstrating bioavailability of the individual catechins and other polyphenolic components of tea are limited. This study assessed the apparent bioavailability of the prominent catechins from black tea in humans drinking tea throughout the day. After 5 d of consuming a low flavonoid diet, subjects drank a black tea preparation containing 15.48, 36.54, 16.74, and 31.14 mg of (-)-epigallocatechin (EGC), (-)-epicatechin (EC), (-)-epigallocatechin gallate (EGCG) and (-)-epicatechin gallate (ECG), respectively, at four time points (0, 2, 4 and 6 h). Blood, urine and fecal specimens were collected over a 24- to 72-h period and catechins were quantified by HPLC with coularray detection. Plasma concentrations of EGC, EC and EGCG increased significantly relative to baseline (P < 0.05). Plasma EGC, EC and EGCG peaked after 5 h, whereas ECG peaked at 24 h. Urinary excretion of EGC and EC, which peaked at 5 h, was increased relative to baseline amounts (P < 0.05) and fecal excretion of all four catechins was increased relative to baseline (P < 0.05). Approximately 1.68% of ingested catechins were present in the plasma, urine and feces, and the apparent bioavailability of the gallated catechins was lower than the nongallated forms. Thus, catechins were bioavailable. However, unless they are rapidly metabolized or sequestered, the catechins appeared to be absorbed in amounts that were small relative to intake. |
Q:
how can I change month only in java date object?
I have java date object.
How can I change its month without changing the year.
e.g.
12/1/14
I want to change it to
12/3/14 and to 12/10/14
I basically want to change the month by +/- x month without changing the year.
Can it be done?
A:
Calendar cal = Calendar.getInstance();
cal.setTime(date); // your date (java.util.Date)
cal.add(Calendar.MONTH, x); // You can -/+ x months here to go back in history or move forward.
return cal.getTime(); // New date
ref : Java Calendar
A:
You can use the set method of the Calendar class to change the specific month you want
sample:
Calendar c = Calendar.getInstance();
System.out.println(c.getTime());
c.set(Calendar.MONTH, Calendar.JANUARY); //will change the month to JANUARY
System.out.println(c.getTime());
result:
Sun Aug 17 03:17:35 EDT 2014
Fri Jan 17 03:17:35 EST 2014
A:
java.time
LocalDate localDate = LocalDate.of ( 2017, Month.JANUARY, 23 );
LocalDate localDateFeb = localDate.withMonth ( 2 );
…or…
LocalDate localDateFeb = localDate.withMonth ( Month.FEBRUARY.getValue ( ) );
localDate.toString(): 2017-01-23
localDateFeb.toString(): 2017-02-23
The other Answers use the troublesome old date-time classes, now supplanted by the java.time classes.
About java.time
The java.time framework is built into Java 8 and later. These classes supplant the troublesome old legacy date-time classes such as java.util.Date, Calendar, & SimpleDateFormat.
The Joda-Time project, now in maintenance mode, advises migration to the java.time classes.
To learn more, see the Oracle Tutorial. And search Stack Overflow for many examples and explanations. Specification is JSR 310.
Where to obtain the java.time classes?
Java SE 8 and SE 9 and later
Built-in.
Part of the standard Java API with a bundled implementation.
Java 9 adds some minor features and fixes.
Java SE 6 and SE 7
Much of the java.time functionality is back-ported to Java 6 & 7 in ThreeTen-Backport.
Android
The ThreeTenABP project adapts ThreeTen-Backport (mentioned above) for Android specifically.
See How to use ThreeTenABP….
The ThreeTen-Extra project extends java.time with additional classes. This project is a proving ground for possible future additions to java.time. You may find some useful classes here such as Interval, YearWeek, YearQuarter, and more.
Joda-Time
Update: The Joda-Time project is now in maintenance mode, with the team advising migration to the java.time classes.
The Joda-Time library has a LocalDate class to represent a date-only without a time-of-day nor time zone.
You can arbitrarily set the month value. But beware of the issue that not all months have the same number of days, so having day-of-month values of 29, 30, and 31 are a problem.
LocalDate localDate = new LocalDate( 2014 , 12 , 31 ); // December.
LocalDate localDate_Feb = localDate.withMonthOfYear( 2 ); // February.
Dump to console.
System.out.println( "localDate: " + localDate );
System.out.println( "localDate_Feb: " + localDate_Feb );
When run.
localDate: 2014-12-31
localDate_Feb: 2014-02-28
|
November is flying by and that means the end of the semester will be here in a month or less. Ultimately, lots of exams and papers that need to be written. Methinks, however, I will write about that particular topic in another post…perhaps on summing up Fall 2010 semester at large. I think I’ll post something for the very end of the year as well. But I digress. Without further ado–may I present Richelle Mead’s Shadow Kiss.
“Suddenly, the burn of that black magic vanished from the bond, along with that sickening sensation. Something hit me like a blast of wind in the face, and I staggered backward I shuddered as a weird sensation twisted my stomach. It was like sparks, like a coil of electricity burning within me” (340).
Probably my favorite out of the series thus far. There was so much action in this particular novel–I can only imagine the coming action in the next novels-I am so excited! I guess you want an example of this action, yes? I figured–you shouldn’t want so many spoilers, my dear readers. 😉 But guess what–the above is as much as you’re getting. Anyway, Mead has done a wonderful job with Shadow Kiss as far as her descriptions and the plot is, as usual, fantastic!
To be ‘shadow kissed’ means to have been to the other side and come back; a second chance at life and forever bonded with whomever brought you back. Rose is shadow kissed and that is why she is bonded to Lissa Dragomir, a spirit user (keep in mind spirit is highly rare). It is one of the five elements the Moroi use as magic: Fire, Earth, Wind, Water, and Spirit. Adrian Ivashkov is actually another spirit user and fire belongs to Christian Ozera. Speaking of Christian, I really want him to become less insecure–he is such a sweet guy and Lissa loves him. That and he helps Rose kick some serious Strigoi ass. Sweet!!
I’ve come to the conclusion that Adrian is going to be another Mason. Sad day. Good guys who love Rose, but she doesn’t or didn’t want them. Not saying that Belikov isn’t *cough*wasn’t*cough* a good guy, but she can’t be exclusive with him and the really places burden on her shoulders that she shouldn’t have. However, if there is one thing I believe to be true–just because someone is good to you does not mean you will be happy. I’m hoping that Rose will be able to find someone who can be her equal in most, if not all facets of their lives. Or, I should say that Mead will hopefully write the story in that way.
So, anyway–lots of laughs, action, and a perfect amount of romance… and heartbreak. I leave you to read and discover what happens. I’m still rooting for Dimitri Belikov and Rose–but there’s a lot that needs to happen in order for that to happen. If you’ve read the books, you’ll know exactly what I’m talking about…
I loved Shadow Kiss! Completely fantastic and it is because it was so good I read it in one day–I want to say six hours. I’m giving Richelle Mead’s Shadow Kiss a 4/4.5 out of 5. Impressive and truly pulls you into their world.
“Unique and mesmerizing… this little gem is sure to be a hit… Readers will bite on this series for some time to come.”–VOYA
Hello Readers. Long time, no see. So far, October has been a busy month. And besides, since it is October, you would think I would try to get a theme for all the books I read and make them all supernatural–I already read that general genre, so I’m good and maybe slightly ahead of the game. 76 days (give or take a day or two) until a new year which means I will soon be compiling a new list of books that look interesting. This time I know to keep it looking reasonable. So, to the reason this entry is going up:Frostbite byRichelle Mead. If you haven’t already guessed, the title says it all.
“It had taken me several moments to grasp what she was talking about. Then it occurred to me that in decapitating two Strigoi, I’d earned two molnija tattoos. My first ones. The realization had stunned me. All my life, in considering my future career as a guardian, I’d looked forward to the marks. I’d seen them as badges of honor. But now? Mainly they were going to be reminders of something I wanted to forget” (Pg. 312).
In the sequel to Vampire Academy, our favorite dhampir is back and we meet her mother, Janine Hathaway. I won’t pretend to have immediately liked her character, but the more I read, the more I understood her. While part of me is going, “Yes! I understand the mind of a parent!” While at the same time, my mind is screaming at me, “What the hell!” In any case, based on Rose’s words in Vampire Academy, I’d assumed that her mother would not be in the picture at all. The way it had been worded made me think “working mom who puts her career before her child.” However, reading this novel made all the difference. So, that being said, you will like Janine.
Speaking of people you will like, I would like to bring up someone you will love. I would know, I fall in love with fictional characters–but that’s another blog, another time. Anyway! Guardian Dimitri Belikov. There is so much going on with him and Rose in Frostbite–intense as hell. I mean, you add another woman into the mix–not cool Belikov, not cool. Buuut, things are working out and reaaally going well. Things are amping up! I mean, stuff happened with Mason–he might have been what she needed, but he was not what she wanted.
Btw–RIP Mason. That’s all I’m saying.
Now, I’m very happy for Lissa and Christian. Interesting new character by the name of Adrian. Bad boy in every sense of the word–almost–he has a heart of gold. There are other characters that have been developed a great deal and I am really enjoying seeing them transform into the kind of character that is endearing. Granted, there are some that just need to go away. Permanently. Got to meet some Strigoi–they are nasty pieces of work.
So, overall, I really liked Frostbite. Richelle Mead is consistent in how she writes and she writes well. I am looking forward to reading the next novel and finding out where all this leads. Content was great, plot was fantastic, and of course, I love the characters. I am giving Frostbite a 3.5/4 out of 5.
“In a world that seems saturated with vampire books, Richelle Mead has created characters and a world that is both unique and believable.”– TeensReadToo.com
Five hours. Total time it took to read Richelle Mead’s Vampire Academy. Incredibly quick read, but an incredibly good book. I could not put it down. Okay, I put it down a couple of times so I could move around. This might sound familiar, but I have never read a novel like it. It is different from what I have read and definitely different than the Blue Bloods series. I’m not going to lie–I love the idea that Montana (of all places) has a hidden area where vampire teens and their companions go to school.
Mead takes a different approach to vampires and their companions. The main character’s name is Rose Hathaway–half-human, half-vampire–a dhampir. Her best friend is Lissa Dragomir–a Moroi princess–Moroi being mortal vampires. In Mead’s world, there are two kinds of vampires: Moroi, good; Strigoi, evil. A dhampir’s purpose is to protect a Moroi royal. Personally, I’ve never heard of mortal vampires and vampire guardians–but I think it is fantastic!
Character development is very high in this novel–and as such, I hope so in the rest of the series. I am all for the relationships that are forming: Lissa/Christian and Rose/Dimitri. I look forward to future novels, partly for these couples, and partly because I like the plots. Lissa and Christian understand each other because they are the last in their line, everyone else has passed on. Then there is Rose and Dimitri. Hmm… Dimitri Belikov. I am not sure what is to happen with this pair, but I love them together! Don’t know why–maybe it is the older guy thing–the maturity and knowledge that younger males seem to… lack. Ahm. Anyway, the romantic relationships are not nearly as complicated in Vampire Academy as in the Blue Bloods series. Don’t get me wrong–love them both and really love the complications as an outside looking in–that’s it. 🙂
”’That’s part of it, ‘ he said. ‘But also… well, you and I will both be Lissa’s guardians someday. I need to protect her at all costs. If a pack of Strigoi come, I need to throw my body between them and her.'” (324)
I think I will introduce this series to my sister. That is, if she hasn’t already discovered them. So–I like Mead’s storytelling and characters. I’m giving Vampire Academy a 3.4/4 out of 5. I really wish I had come across this series earlier than now. |
Development of crohn's disease following treatment for juvenile idiopathic arthritis in a nigerian child: Case report and review of literature.
Juvenile idiopathic arthritis (JIA) and Crohn's disease (CD) are diseases that are rarely seen in the black African child. CD has been reported to occur following therapy with etanercept in JIA patients. We report the case of a Nigerian child with JIA who developed CD following treatment for JIA. A 9-year-old male with JIA was referred to the pediatric gastroenterology unit of the Lagos University Teaching Hospital on the account of chronic diarrhea with occasional passage of bloody stools. He had been on prednisolone and methotrexate which had controlled the joint flares. Colonoscopy revealed extensive colitis, ulcers, abscesses, and ileocecal disease. Histology confirmed the CD. In view of the unavailability of the recommended treatment, namely biologics in the country and financial constraints; steroids; and sulfasalazine were added to his treatment regimen, and subsequently, he has made significant clinical improvement. |
IN THE SUPREME COURT OF MISSISSIPPI
NO. 97-IA-00275-SCT
STATE OF MISSISSIPPI AND ROBERT ISHEE
v.
JANET DAMPEER
CONSOLIDATED WITH
NO. 97-IA-00276-SCT
STATE OF MISSISSIPPI AND ROBERT ISHEE
v.
BRITTANY DAMPEER
DATE OF JUDGMENT: 12/31/96
TRIAL JUDGE: HON. ROBERT G. EVANS
COURT FROM WHICH APPEALED: SMITH COUNTY CIRCUIT COURT
ATTORNEY FOR APPELLANTS: OFFICE OF THE ATTORNEY GENERAL
BY: JIM FRAISER
ATTORNEY FOR APPELLEE: JOHN RAYMOND TULLOS
NATURE OF THE CASE: CIVIL - PERSONAL INJURY
DISPOSITION: REVERSED AND RENDERED - 06/24/1999
MOTION FOR REHEARING FILED:
MANDATE ISSUED: 7/15/99
BEFORE PRATHER, C.J., MILLS AND COBB, JJ.
MILLS, JUSTICE, FOR THE COURT:
STATEMENT OF THE CASE
¶1. On November 5, 1996, Janet Dampeer and her daughter, Brittany Dampeer, by and through her
mother, filed their separate complaints in the Circuit Court of Smith County against the State of Mississippi
and Robert Ishee, alleging negligence on the part of Robert Ishee while in the scope of his employment with
the State of Mississippi. Upon request of the Appellants, the two complaints were consolidated by an
Order of the Smith County Circuit Court dated March 3, 1997. On November 8, 1996, the State of
Mississippi and Ishee filed a MRCP 12(b)(6) motion to dismiss for failure to comply with the notice and
statute of limitations provisions of the Mississippi Tort Claims Act as set out in Miss. Code Ann. § 11-46-
11 (Supp.1998). Such motion was denied by the trial court. Aggrieved by the trial court's denial of the
Motion to Dismiss, the State of Mississippi and Robert Ishee appeal to this Court through interlocutory
appeal.
STATEMENT OF THE FACTS
¶2. On June 12, 1994, while Janet and Brittany Dampeer were parked in the Wal-Mart parking lot in
Magee, Mississippi, Robert Ishee backed a Boswell Retardation Center van into their automobile. The
Dampeers assert that, by reason of Ishee's negligence, both Janet and Brittany sustained serious physical
injuries and thereby did incur, and will continue to incur, substantial medical expenses. They note that Ishee
is an employee of the Boswell Retardation Center which is a facility owned by the State of Mississippi. In
their complaint they demand judgment of and from the Appellants in the amount of $25,000, plus costs of
Court.
¶3. In a letter dated June 15, 1994, the Dampeers' attorney notified the Boswell Retardation Center that he
represented Dampeer advising as follows:
This is to advise you that we represent Mrs. Janet Dampeer and her minor daughter, Brittany
Dampeer, for property damage and personal injuries sustained in a motor vehicle collision which
occurred on June 12, 1994 in the parking lot of Magee Wal-Mart, when your vehicle, being driven
by Robert H. Ishee, struck the rear of Mrs. Dampeer's 1990 Pontiac Grand Prix.
I shall appreciate you, or your liability insurance carrier, contacting me within the next fifteen days
concerning the contents of this letter.
¶4. Subsequently, in a letter dated June 21, 1994, and addressed to Ms. Dampeer, the Mississippi Tort
Claims Board wrote the following in regard to a notice of loss received from the Department of Mental
Health:
We have received notice of loss from the above agency. Please provide an estimate of repair to this
agency for consideration of your claim for damages.
If you have already sent estimates to a state agency or to the Tort Claims Board, please disregard this
notice.
¶5. On November 5, 1996, the Dampeers filed their separate complaints with the Smith County Circuit
Court. Subsequently, on November 8, 1996, the State of Mississippi and Robert Ishee filed their Motion to
Dismiss alleging that Dampeer violated the notice provisions and the statute of limitations provision of the
Mississippi Tort Claims Act. Such motion was denied on December 31, 1996. Following the denial of said
motion, the Appellants filed a Petition for Interlocutory Appeal on January 14, 1997. Such petition was
denied by the Circuit Court, but taken up on interlocutory appeal by this Court on February 6, 1998.
STANDARD OF REVIEW
¶6. This Court conducts a "de novo review of questions of law." Weeks v. Thomas, 662 So.2d 581, 583
(Miss. 1995). A motion to dismiss under MRCP 12(b)(6) "tests the legal sufficiency of the complaint." This
Court has held that "to grant this motion there must appear to a certainty that the plaintiff is entitled to no
relief under any set of facts that could be proved in support of the claim." Busching v. Griffin, 465 So.2d
1037, 1039 (Miss.1985) (citations omitted). Further, this Court stated in Weeks v. Thomas that in order to
survive a Rule 12(b)(6) motion, the complaint need only state a set of facts that will allow the plaintiff "some
relief in court." Weeks, 662 So.2d at 583.
ANALYSIS
WHETHER THE TRIAL COURT ERRED BY FAILING TO GRANT APPELLANT'S
MOTION TO DISMISS WHERE THE COMPLAINT WAS FILED SEVENTEEN
MONTHS AFTER THE TIME FOR FILING SUIT HAD LAPSED.
¶7. In their chief assignment of error, the State of Mississippi and Ishee assert that the Dampeers' suits are
barred by the one-year statute of limitations. This action is governed by the Mississippi Tort Claims Act.
The Act is set out in full in Miss. Code Ann. §§ 11-46-1, et seq. (Supp.1998). Section 11-46-11(3) reads
as follows:
(3) All actions brought under the provisions of this chapter shall be commenced within one (1) year
next after the date of the tortious, wrongful or otherwise actionable conduct on which the liability
phase of the action is based, and not after; provided, however, that the filing of a notice of claim as
required by subsection (1) of this section shall serve to toll the statute of limitations for a period of
ninety-five (95) days. The limitations period provided herein shall control and shall be exclusive in all
actions subject to and brought under the provisions of this chapter, notwithstanding the nature of the
claim, the label or other characterization the claimant may use to describe it, or the provisions of any
other statute of limitations which would otherwise govern the type of claim or legal theory if it were
not subject to or brought under the provisions of this chapter.
Miss. Code Ann. § 11-46-11 (Supp.1998).(1)
¶8. The Appellants correctly argue that section (3) of the governing statute laid out above demands that the
complaint be filed within one year of the actionable conduct. The statute also provides that the limitation
period be tolled for ninety-five days after the required notice of claim is filed with the chief executive officer
of the governmental agency. Therefore, when the proper requirements of bringing a claim for injury against a
governmental agency in the State of Mississippi are met, including the giving of the proper notice, the statute
of limitations allows one year, plus ninety-five days in which to bring the claim.
¶9. In the instant case the accident occurred on June 12, 1994. The complaint was filed November 5,
1996, nearly two years and five months after the accident. This claim is barred by the applicable one-year
statute of limitation. See Mississippi Dep't of Public Safety v. Stringer, No. 97-IA-00187-SCT, 1999
WL 353025 (Miss. June 3, 1999) (applying one-year Tort Claims Act statute of limitations to bar suit);
Marcum v. Hancock County Sch. Dist., No. 97-CA-00916-SCT, 1999 WL 353073 (Miss. June 3,
1999).
¶10. We do not discuss whether the notice of claim substantially complied with the notice of claim provision
under our recent authorities set forth in Reaves v. Randall, 729 So. 2d 1237 (Miss. 1998), and Carr v.
Town of Shubuta, No. 96-CT-01266-SCT, 1999 WL 62772 (Miss. Feb. 11, 1999). The Dampeers
failed to timely file their complaints under any set of facts before us. The trial court erred in denying the
motion to dismiss. We therefore reverse the judgment of the lower court and render judgment for the State
of Mississippi and Robert Ishee and finally dismiss with prejudice the complaints filed herein.
¶11. REVERSED AND RENDERED.
PRATHER, C.J., SULLIVAN AND PITTMAN, P.JJ., BANKS, McRAE, SMITH, WALLER
AND COBB, JJ., CONCUR.
1. Effective March 25, 1999, section 11-46-11 has been further amended by 1999 Miss. Laws Ch. 469 to
clarify the notice of claim requirements under the Tort Claims Act. This amendment is not pertinent to the
facts of this case.
|
Prevalence, incidence and distribution of erosion.
There is evidence that the presence of erosion is growing steadily. Due to different scoring systems, samples and examiners, it is difficult to compare the different studies. Preschool children from 2 to 5 years showed erosion on deciduous teeth in 1 to 79% of the subjects. Schoolchildren (aged from 5 to 9 years) already had erosive lesions on permanent teeth in 14% of the cases. In the adolescent group (aged between 9 and 20 years), 7 to 100% of the persons examined showed signs of erosion. Incidence data (the increase in the number of subjects presenting signs of dental erosion) was evaluated in four of these studies and presented average annual values between 3.5 and 18%, depending on the initial age of the examined sample. In adults (aged from 18 to 88 years) prevalence data ranged between 4 and 100%. Incidence data are scarce in this age group, and only one study was found analysing the increase of affected surfaces, showing an incidence of 5% for the younger and 18% for older age groups. In general, males present more erosive tooth wear than females. The distribution showed a predominance of affected occlusal surfaces (mandibular first molars) followed by facial surfaces (anterior maxillary teeth). Oral erosion was frequently found on maxillary incisors and canines. Overall, prevalence data are not homogeneous. Nevertheless, there is a trend towards a more pronounced rate of erosion in younger age groups. Furthermore, a tendency was found for more erosive lesions with increasing age and these erosions progressed with age. |
Assessment of hygiene habits and attitudes among removable partial denture wearers in a university hospital.
The aim of this study was conducting a survey of hygiene habits and use of removable partial dentures (RPDs) and correlate them with the social conditions of the interviewees. A total of 145 RPD wearers were interviewed by experienced clinical staff using a structured questionnaire. A Chi-squared test was performed to evaluate statistical significance between the variables, and the level of significance was P<0.05. A total of 72 (49%) patients reported that they had not been well informed by the dentists. Brushing was the most frequent cleaning method (57.6%). 77 (53.1%) patients did not take off their dentures at night. The frequency of cleaning dentures and using cleansing tablet was significantly higher in females than in males (P<0.05). The frequency of denture cleaning, cleaned parts of denture, use of cleansing tablet, removal of dentures at night, frequency of tooth brushing, does not show any significant difference according to age, educational status or duration of denture usage (P>0.05). RPD wearers did not clean their dentures and natural teeth satisfactorily and had limited knowledge of denture cleansing and oral hygiene maintenance. Hygiene habits and attitudes may be affected by gender, but education level and hygiene attitudes may not always present positive correlation. Dentists should thoroughly inform patients about the harmful effects of overnight wearing and motivate to clean metal parts of RPD's and cleansing tablet use in order to minimize the abrasive effect of widely preferred cleaning method of brushing with toothpaste. |
Error Codes)UE_ Top Loader
If the customer is calling regarding uE/UE displays after the recall you need to probe the issue a bit further to determine if service is necessary.Is your machine displaying a uE(lowercase"U") or UE(uppercase"U")?
A. ″uE″ or “UE” is informing customers that the sensor has detected unbalance of laundry. When the excessive unbalance of laundry occurs, a sensor detects unbalance of laundry. While the machine performs the process to rearrange and untangle unbalance of laundry. This display is appeared to inform the customer that “ When the excessive unbalance of laundry occurs, abnormal vibration can shorten the life of the washing machine, and even result in damage to the product. Please be careful to avoid the unbalance of laundry (Refer to the owner’s manual.)” (It occurs frequently when washing different kind of clothe, bulky items, such as waterproof sheet, shoes, mattresses, large dolls, etc.)
Q. What cycle was selected? Cotton/normal or heavy duty cycle?
Cotton/Normal or Heavy Duty cycle,If you use Cotton/Normal or Heavy duty cycle, it can happen easily. These two cycles are DOE cycles, meaning they provide energy savings according to the USA government requirement. As DOE Cycles, they use less water than other cycles. This requirement is same for all US energy star labeled washing machines.
* For models WT5860**/WT1701** : For this reason, we recommend “Power Cleanse" cycle * For models WT5******/WT4***CW : For this reason, we recommend "PermPress/Casual" cycle. * For models WT1****** : For this reason, we recommend "Pure color" cycle. (If customer want to use cotton or heavy duty, recommends water plus or fabric softener option)
This cycle uses more water and a deep tub rinse, so better washing and rinsing performance. The deep tub rinse will give less UE or unbalance.(Deep rinse compared to Jet spray Rinse)
If you decide to continue to use Cotton/Normal, Sanitary, and Heavy Duty cycles. Adding the Fabric Softener Option to the cycle will change the Jet Spray Rinse to a Deep Rinse. This increase in water will help to better distribute the load during the rinse cycle which may result in fewer vibrations.
Other cycle : Proceed to unbalanced load or Leveling.
Article Feedback
1. Overall, how satisfied were you with the usefulness of this article?
Very SatisfiedSatisfiedNeutralDissatisfiedVery Dissatisfied
1.1 Why did the article not resolve your issue?
I was disappointed with the product quality or performance.
My product requires repair service.
I followed the instructions but my issue was not resolved.
The article contain inaccurate information
The article is difficult to understand.
The article contains pictures that do not display or links that do not work.
LG SupportNeed information? Got a question? We can help.Whether you need to register your product, communicate with an LG Support Representative, or obtain repair service. Finding answers and information is easy with LG online service and support. Owner’s Manuals, requesting a repair, software updates and warranty information are all just a click away. |
Savoy, Texas -- Savoy ISD has named Mr. Danny Henderson as the new Principal of Savoy Elementary. Mr. Henderson was selected from over 80 applicants and was approved unanimously by the Savoy Board of Trustees.
Danny Henderson
Mr. Henderson has 13 years of administrative experience in Blue Ridge and in Pottsboro. Although his duties officially begin next school year, he will be visiting with staff at a get to know you meeting soon. |
Pharyngeal plexus (venous)
The pharyngeal plexus (venous) is a network of veins beginning in the pharyngeal plexus on the outer surface of the pharynx, and, after receiving some posterior meningeal veins and the vein of the pterygoid canal, end in the internal jugular.
See also
pterygoid venous plexus
References
External links
http://anatomy.uams.edu/AnatomyHTML/veins_head&neck.html
Category:Veins |
In 2006, biopharmaceuticals, including monoclonal antibodies (mAbs) and other recombinant proteins, accounted for nearly half of all drugs in the development phase and a quarter of drugs in preclinical and clinical trials (Walsh, 2006, Nat Biotechnol 24:769-776). As the demand for biopharmaceuticals continues to increase, there is a commensurate need for better bioproduction vehicles. Although non-mammalian production systems, such as cultured Escherichia coli, yeast, plant and insect cell lines, often result in high yields, cultured mammalian host cell lines are preferred for production of many humanized proteins that require post-translational modifications to preserve their bioactivity.
Culturing cells in vitro, especially in large bioreactors, has been the basis of the production of numerous biotechnology products, and involves the elaboration by these cells of protein products into the support medium, from which these products are isolated and further processed prior to use clinically. The quantity of protein production over time from the cells growing in culture depends on a number of factors, such as, for example, cell density, cell cycle phase, cellular biosynthesis rates of the proteins, condition of the medium used to support cell viability and growth, and the longevity of the cells in culture (i.e., how long before they succumb to programmed cell death, or apoptosis). Various methods of improving the viability and lifespan of the cells in culture have been developed, together with methods of increasing productivity of a desired protein by, for example, controlling nutrients, cell density, oxygen and carbon dioxide content, lactate dehydrogenase, pH, osmolarity, catabolites, etc. For example, increasing cell density can make the process more productive, but can also reduce the lifespan of the cells in culture. Therefore, it may be desirous to reduce the rate of proliferation of such cells in culture when the maximal density is achieved, so as to maintain the cell population in its most productive state as long as possible. This results in increasing or extending the bioreactor cycle at its production peak, elaborating the desired protein products for a longer period, and this results in a higher yield from the bioreactor cycle.
Many different approaches have been pursued to increase the bioreactor cycle time, such as adjusting the medium supporting cell proliferation, addition of certain growth-promoting factors, as well as inhibiting cell proliferation without affecting protein synthesis. One particular approach aims to increase the lifespan of cultured cells via controlling the cell cycle by use of genes or antisense oligonucleotides to affect cell cycle targets, whereby a cell is induced into a pseudo-senescence stage by transfecting, transforming, or infecting with a vector that prevents cell cycle progression and induces a so-called pseudo-senescent state that blocks further cell division and expands the protein synthesis capacity of the cells in culture; in other words, the pseudo-senescent state can be induced by transfecting the cells with a vector expressing a cell cycle inhibitor (Bucciarelli et al., U.S. Patent Appl. 2002/0160450 A1; WO 02/16590 A2). The latter method, by inhibiting cell duplication, seeks to force cells into a state that may have prolonged cell culture lifetimes, as described by Goldstein and Singal (Exp Cell Res 88, 359-64, 1974; Brenner et al., Oncogene 17:199-205, 1998), and may be resistant to apoptosis (Chang et al., Proc Natl Acad Sci USA 97, 4291-6, 2000; Javeland et al., Oncogene 19, 61-8, 2000).
Still another approach involves establishing primary, diploid human cells or their derivatives with unlimited proliferation following transfection with the adenovirus E1 genes. The new cell lines, one of which is PER.C6 (ECACC deposit number 96022940), which expresses functional Ad5 E1A and E1B gene products, can produce recombinant adenoviruses, as well as other viruses (e.g., influenza, herpes simplex, rotavirus, measles) designed for gene therapy and vaccines, as well as for the production of recombinant therapeutic proteins, such as human growth factors and human antibodies (Vogels et al., WO 02/40665 A2).
Other approaches have focused on the use of caspase inhibitors for preventing or delaying apoptosis in cells. See, for example, U.S. Pat. No. 6,586,206. Still other approaches have tried to use apoptosis inhibitors such as members of the Bcl-2 family for preventing or delaying apoptosis in cells. See Arden et al., Bioprocessing Journal, 3:23-28 (2004). These approaches have yielded unpredictable results. For example, in one study, expression of Bcl-2 increased cell viability but did not increase protein production. (See Tey et al., Biotechnol. Bioeng. 68:31-43, 2000.) Another example disclosed overexpression of Bcl-2 proteins to delay apoptosis in CHO cells, but Bcl-xL increased protein production whereas Bcl-2 decreased protein production (see WO03/083093). A further example disclosed experiments using expression of Bcl-2 proteins to prolong the survival of Sp2/0-Ag14 (ATCC # CRL-1581, hereafter referred to as Sp2/0) cells in cultures. However, the cell density of the Bcl-2 expressing clones were 20 to 50% lower than that of their parental cultures, raising concerns for their practical application in biopharmaceutical industry (see WO03/040374; U.S. Pat. No. 6,964,199).
It is apparent, therefore, that improved host cells for high level expression of recombinant proteins and methods for reliably increasing recombinant protein production, in particular the production of antibodies and antibody fragments, multispecific antibodies, fragments and single-chain constructs, peptides, enzymes, growth factors, hormones, interleukins, interferons, and vaccines, in host cells are needed in the art. A need also exists for cell lines that are pre-adapted to grow in serum-free or serum-depleted medium, that can be transfected with expression vectors under serum free conditions and used for protein production without going through a lengthy adaptation period before serum-free growth and protein production. |
Q:
How to get values from query string and pass it to new page using .htaccess file
currently I m using following code in my site in .htaccess file :
RewriteRule ^([^/\.]+).php?$ comman.php?cat=$1 [L]
This redirects user to comman.php page say, user requests
http://www.mysite.com/myfolder/page1.php
will redirects to
http://www.mysite.com/myfolder/comman.php?cat=page1
This works fine. My question is how can I achieve following
http://www.mysite.com/myfolder/page1.php?var1=123
to redirect
http://www.mysite.com/myfolder/comman.php?cat=page1¶m=123
i.e. whatever value passed to url using get method to add in my new url.
Thanks in Advance.....
A:
You should add the QSA flag:
RewriteRule ^([^/\.]+).php?$ comman.php?cat=$1 [L,QSA]
QSA stands for Query String Append. Anything after the ? in the original URL will be appended to the rewritten URL.
|
Firefighters encountered intense heat and cut several holes in the piping and ceiling to release the heat and prevent a possible explosion.
Sewert said emergency workers transported the firefighters to area hospitals for treatment of ‘heat-related problems’ but injuries are not believed to be life-threatening. All workers safely evacuated the building before firefighters arrived.
The cause of the blaze is unknown and is undergoing assessment by Cargill workers.
“The company said after making an initial assessment of what occurred here, they expected it to be a lot worse than what it was,” Sewert said. |
Q:
Why is this SML function returning a syntax error?
fun first_answer(my_f:('a -> 'b option)) : 'a list -> 'b =
let
fun help(_a:'a list) : 'a =
(((List.map valOf)o(List.filter isSome)o(List.map my_f)) _a)
in
help
end;
Error: syntax error: replacing WILD with SEMICOLON
Something with that _a is messing it up..... The error is linked to the last usage of _a
I am not getting very far, and I've rearranged the logic many ways already. As you can see the first_answer returns takes a function and returns a function. This is what I am doing here and I am following the types as far as I know. There is probably something simple that I am not seeing.
A:
It's simple indeed: an identifier cannot start with an underscore. So _a is parsed as if you had written _ a, in accordance with the usual maximal munch rule for lexical syntax.
Edit: Extra tip: Your function does not have the type 'a list -> 'b, because help returns a list of 'bs, not a single value of type 'b. Moreover, as written, it can be implemented more easily as
fun first_answer f xs = List.mapPartial f xs
or, in fact,
val first_answer = List.mapPartial
|
Q:
FFMPEG error with avformat_open_input returning -135
I have a DLL one of my applications uses to receive video from RTSP cameras. Under the hood, the DLL uses FFMPEG libs from this release zip :
ffmpeg-20141022-git-6dc99fd-win64-shared.7z
We have a wide variety of cameras in house and most of them work just fine. However, on one particular Pelco Model Number: IXE20DN-OCP, I am unable to connect. I tested the camera and rtsp connection string on VLC and it connects to the camera just fine.
I found the connection string here : http://www.ispyconnect.com/man.aspx?n=Pelco
rtsp://IPADDRESS:554/1/stream1
Oddly, even if I leave the port off of VLC, it connects, so I'm guessing its the default RTSP port or that VLC tries a variety of things based on your input.
In any case, when I attempt to connect, I get an error from av_format_open_input. It returns a code of -135. When I looked in the error code list I didn't see that listed. For good measure, I printed out all the errors in error.h just to see what their values were.
DumpErrorCodes - Error Code : AVERROR_BSF_NOT_FOUND = -1179861752
DumpErrorCodes - Error Code : AVERROR_BUG = -558323010
DumpErrorCodes - Error Code : AVERROR_BUFFER_TOO_SMALL = -1397118274
DumpErrorCodes - Error Code : AVERROR_DECODER_NOT_FOUND = -1128613112
DumpErrorCodes - Error Code : AVERROR_DEMUXER_NOT_FOUND = -1296385272
DumpErrorCodes - Error Code : AVERROR_ENCODER_NOT_FOUND = -1129203192
DumpErrorCodes - Error Code : AVERROR_EOF = -541478725
DumpErrorCodes - Error Code : AVERROR_EXIT = -1414092869
DumpErrorCodes - Error Code : AVERROR_EXTERNAL = -542398533
DumpErrorCodes - Error Code : AVERROR_FILTER_NOT_FOUND = -1279870712
DumpErrorCodes - Error Code : AVERROR_INVALIDDATA = -1094995529
DumpErrorCodes - Error Code : AVERROR_MUXER_NOT_FOUND = -1481985528
DumpErrorCodes - Error Code : AVERROR_OPTION_NOT_FOUND = -1414549496
DumpErrorCodes - Error Code : AVERROR_PATCHWELCOME = -1163346256
DumpErrorCodes - Error Code : AVERROR_PROTOCOL_NOT_FOUND = -1330794744
DumpErrorCodes - Error Code : AVERROR_STREAM_NOT_FOUND = -1381258232
DumpErrorCodes - Error Code : AVERROR_BUG2 = -541545794
DumpErrorCodes - Error Code : AVERROR_UNKNOWN = -1313558101
DumpErrorCodes - Error Code : AVERROR_EXPERIMENTAL = -733130664
DumpErrorCodes - Error Code : AVERROR_INPUT_CHANGED = -1668179713
DumpErrorCodes - Error Code : AVERROR_OUTPUT_CHANGED = -1668179714
DumpErrorCodes - Error Code : AVERROR_HTTP_BAD_REQUEST = -808465656
DumpErrorCodes - Error Code : AVERROR_HTTP_UNAUTHORIZED = -825242872
DumpErrorCodes - Error Code : AVERROR_HTTP_FORBIDDEN = -858797304
DumpErrorCodes - Error Code : AVERROR_HTTP_NOT_FOUND = -875574520
DumpErrorCodes - Error Code : AVERROR_HTTP_OTHER_4XX = -1482175736
DumpErrorCodes - Error Code : AVERROR_HTTP_SERVER_ERROR = -1482175992
Nothing even close to -135. I did find this error, sort of on stack overflow, here runtime error when linking ffmpeg libraries in qt creator where the author claims it is a DLL loading problem error. I'm not sure what led him to think that, but I followed the advice and used the dependency walker (http://www.dependencywalker.com/) to checkout what dependencies it thought my DLL needed. It listed a few, but they were already provided in my install package.
To make sure it was picking them up, I manually removed them from the install and observed a radical change in program behavior(that being my DLL didn't load and start to run at all).
So, I've got a bit of init code :
void FfmpegInitialize()
{
av_lockmgr_register(&LockManagerCb);
av_register_all();
LOG_DEBUG0("av_register_all returned\n");
}
Then I've got my main open connection routine ...
int RTSPConnect(const char *URL, int width, int height, frameReceived callbackFunction)
{
int errCode =0;
if ((errCode = avformat_network_init()) != 0)
{
LOG_ERROR1("avformat_network_init returned error code %d\n", errCode);
}
LOG_DEBUG0("avformat_network_init returned\n");
//Allocate space and setup the the object to be used for storing all info needed for this connection
fContextReadFrame = avformat_alloc_context(); // free'd in the Close method
if (fContextReadFrame == 0)
{
LOG_ERROR1("Unable to set rtsp_transport options. Error code = %d\n", errCode);
return FFMPEG_OPTION_SET_FAILURE;
}
LOG_DEBUG1("avformat_alloc_context returned %p\n", fContextReadFrame);
AVDictionary *opts = 0;
if ((errCode = av_dict_set(&opts, "rtsp_transport", "tcp", 0)) < 0)
{
LOG_ERROR1("Unable to set rtsp_transport options. Error code = %d\n", errCode);
return FFMPEG_OPTION_SET_FAILURE;
}
LOG_DEBUG1("av_dict_set returned %d\n", errCode);
//open rtsp
DumpErrorCodes();
if ((errCode = avformat_open_input(&fContextReadFrame, URL, NULL, &opts)) < 0)
{
LOG_ERROR2("Unable to open avFormat RF inputs. URL = %s, and Error code = %d\n", URL, errCode);
LOG_ERROR2("Error Code %d = %s\n", errCode, errMsg(errCode));
// NOTE context is free'd on failure.
return FFMPEG_FORMAT_OPEN_FAILURE;
}
...
To be sure I didn't misunderstand the error code I printed the error message from ffmpeg but the error isn't found and my canned error message is returned instead.
My next step was going to be hooking up wireshark on my connection attempt and on the VLC connection attempt and trying to figure out what differences(if any) are causing the problem and what I can do to ffmpeg to make it work. As I said, I've got a dozen other cameras in house that use RTSP and they work with my DLL. Some utilize usernames/passwords/etc as well(so I know that isn't the problem).
Also, my run logs :
FfmpegInitialize - av_register_all returned
Open - Open called. Pointers valid, passing control.
Rtsp::RtspInterface::Open - Rtsp::RtspInterface::Open called
Rtsp::RtspInterface::Open - VideoSourceString(35) = rtsp://192.168.14.60:554/1/stream1
Rtsp::RtspInterface::Open - Base URL = (192.168.14.60:554/1/stream1)
Rtsp::RtspInterface::Open - Attempting to open (rtsp://192.168.14.60:554/1/stream1) for WxH(320x240) video
RTSPSetFormatH264 - RTSPSetFormatH264
RTSPConnect - Called
LockManagerCb - LockManagerCb invoked for op 1
LockManagerCb - LockManagerCb invoked for op 2
RTSPConnect - avformat_network_init returned
RTSPConnect - avformat_alloc_context returned 019E6000
RTSPConnect - av_dict_set returned 0
DumpErrorCodes - Error Code : AVERROR_BSF_NOT_FOUND = -1179861752
...
DumpErrorCodes - Error Code : AVERROR_HTTP_SERVER_ERROR = -1482175992
RTSPConnect - Unable to open avFormat RF inputs. URL = rtsp://192.168.14.60:554/1/stream1, and Error code = -135
RTSPConnect - Error Code -135 = No Error Message Available
I'm going to move forward with wireshark but would like to know the origin of the -135 error code from ffmpeg. When I look at the code if 'ret' is getting set to -135, it must be happening as a result of the return code from a helper method and not directly in the avformat_open_input method.
https://www.ffmpeg.org/doxygen/2.5/libavformat_2utils_8c_source.html#l00398
After upgrading to the latest daily ffmpeg build, I get data on wireshark. Real Time Streaming Protocol :
Request: SETUP rtsp://192.168.14.60/stream1/track1 RTSP/1.0\r\n
Method: SETUP
URL: rtsp://192.168.14.60/stream1/track1
Transport: RTP/AVP/TCP;unicast;interleaved=0-1
CSeq: 3\r\n
User-Agent: Lavf56.31.100\r\n
\r\n
The response to that is the first 'error' that I can detect in the initiation.
Response: RTSP/1.0 461 Unsupported Transport\r\n
Status: 461
CSeq: 3\r\n
Date: Sun, Jan 04 1970 16:03:05 GMT\r\n
\r\n
I'm going to guess that... it means the transport we selected was unsupported. I quick check of the code reveals I picked 'tcp'. Looking through the reply to the DESCRIBE command, it appears :
Media Protocol: RTP/AVP
Further, when SETUP is issued by ffmpeg, it specifies :
Transport: RTP/AVP/TCP;unicast;interleaved=0-1
I'm going to try, on failure here to pick another transport type and see how that works. Still don't know where the -135 comes from.
A:
The solution turned out to be that this particular camera didn't support RTSP over TCP transport. It wanted UDP.
I updated to code to try TCP and if that failed, to use an alternate set of options for UDP and another call to try an open things up.
if ((errCode = av_dict_set(&opts, "rtsp_transport", "udp", 0)) < 0)
Works like a charm. Still concerned about the origin of the -135 and -22 error codes which don't appear in the error.h file. Maybe an ffmpeg bug where a stray error code is allowed through.
|
Treatment Protocol for Compromised Nasal Skin.
As the number of patients seeking surgical and nonsurgical rhinoplasty continues to increase, the risk of nasal skin compromise after surgery also has risen. Vascular insult to the nasal skin envelope can lead to permanent disfigurement that is nearly impossible to correct. Tissue loss often requires major reconstruction that yields suboptimal cosmetic results. This article discusses prevention, early recognition, and effective treatment that aim to mitigate skin necrosis and the resulting soft tissue destruction. |
[Reduced loading of one lower limb as a cause of local osteopenia].
An impact of diminished mechanical loading of lower extremity on bone densitometry has been quantitatively assessed with ultrasound. Seventy-three females with lower limb fracture history, coxarthrosis or scoliosis were evaluated. Both heels were submitted to measurements with Achilles densitometer (Lunar, USA). The following parameters were analyzed: Speed of Sound, Broadband Ultrasound Attenuation and Stiffness Index. Decreased values of all parameters were found in unloaded extremities. Speed of Sound was reduced most and in the group with fracture history. To avoid local bone loss short immobilization, early rehabilitation and pharmacotherapy is suggested. |
Like mother, like daughter
WHITSETT — There have been times Stanford Smith couldn’t tell his daughter’s cooking from his wife’s. And that’s a compliment, seeing as both women have been honored as Times-News’ Cooks of the Month.
Stanford’s wife, Hasseena Smith, was Cook of the Month in September 2012, and his daughter, Kaamilya Furman, is Cook of the Month for April.
Kaamilya graduated from Johnson & Wales University in Charlotte last May. It was through her studies there that she gained the confidence to experiment with ingredients and concentrate on presentation.
“That’s what I love — the presentation,” she said. “You do, after all, eat with your eyes.”
When Kaamilya was a senior at Eastern Guilford High School, Kathy Jo Mitchell came to speak to her class about Johnson & Wales University. Mitchell’s talk, Kaamilya said, inspired her to attend the school. The tips and tricks she learned at the university have encouraged her to pursue a career in food services and strengthened her ability as a chef.
“She doesn’t play around when she’s in the kitchen,” Hasseena said. “She does well with properly putting a menu together and making sure each dish complements the next. Kaamilya has learned and taught me how to make some salad dressings and sauces from scratch with items we have here in our kitchen cabinets.”
Kaamilya, along with her mother, are on the hospitality committee at Clapp’s Chapel AME Church in Whitsett and prepared a meal on Feb. 24 to celebrate Heritage Day. Those in attendance wore African attire and Kaamilya and Hasseena made Jamaican Jerk Chicken, potato croquettes, green beans and baked chicken.
“Everyone really seemed to enjoy the food and complimented us on it,” Hasseena said.
During a recent visit to their home, Kaamilya prepared two of her mother’s favorite dishes, Bourbon chicken with homemade bourbon sauce and potato croquettes.
“They are so delicious,” Hasseena said, observing the preparation of the potato croquettes, or as she referred to them — “potato cakes.”
Both Hasseena and Kaamilya also prepare healthier versions of drinks and dishes because some family members have suffered from high blood pressure, high cholesterol and heart disease. Kaamilya went to the cabinet and pulled out organic sugar, which she uses in recipes.
Kaamilya currently works at the Food Lion on Ramada Road in Burlington in the deli as a cashier and cake decorator; cake decorating was one of the skills she learned at Johnson & Wales.
When she’s not preparing food for others, though, Kaamilya described her food tastes as “plain Jane.” “I like simple foods, not fancy.”
Since she has such a passion for food, Kaamilya would like to be a caterer someday.
“I love watching others sample my food,” she said with a smile.
Page 2 of 3 - We’re looking for Cooks of the Month
Do you know someone worthy of being recognized as Cook of the Month? If so, contact Charity Apple at [email protected] or (336) 506-3057. We are looking for cooks for May, June and July at the moment.
Cook of the Month is published on the next to the last Wednesday of each month in Accent’s Food section.
COOK OF THE MONTH RECIPES
Sweet Bourbon Chicken
5 boneless, skinless chicken breasts, diced
¼ cup butter, melted
½ cup whiskey
1 medium onion
2 tablespoons parsley
½ cup lemon juice
¼ tablespoon brown sugar
¼ cup honey
Mix all ingredients well and marinate chicken for one to four hours. Melt butter in pan; add chicken until tender. Remove chicken when it begins to crisp up. Cook chicken in small batches.
For sauce, use the same marinade ingredients listed above, but with ½ cup heavy cream, and heat on stovetop until it begins to thicken. Top chicken with sauce and serve.
Orange-Filled Slices
3 oranges, sliced in half and remove pulp. Fill with strawberry Jell-O make for a beautiful presentation. You can also add Yogurt (plain) with diced strawberry chunks mixed and filled into oranges.
•n Cook’s note: You can make this either with Jell-O or yogurt.
Beer-battered Fried Shrimp
2 cups flour, seasoned with tablespoon of salt and pepper
3 cups beer (any, except dark)
3 cups all-purpose flour
3 teaspoons salt
2½ pounds shrimp, shelled and deveined
In a bowl, whisk beer into flour until smooth and stir in salt. Make several shallow cuts across each shrimp.
Dredge shrimp in seasoned flour first, then in batter to coat completely, letting excess drip off. Fry in a 350-degree F. fryer, working in batches and turning until golden brown, about 3 minutes. Drain excess oil and season with salt.
Remove from heat and cool. Add paste or Sriracha and season; blend until smooth.
Potato Croquettes
2 pounds russet potatoes
3 large eggs
1 tablespoon chopped parsley
¼ teaspoon chopped tarragon
2 tablespoons unsalted butter
Page 3 of 3 - 1/8 teaspoon black pepper
¾ cup flour (or as needed)
¾ cup breadcrumbs (or as needed)
Peel potatoes. Cut into 2-inch pieces and boil until tender; drain until potatoes are dry. Mash the potatoes and cool them. Lightly beat 1 egg into the cooled potatoes along with herbs, butter, salt and pepper and mix well. Now you can begin to roll potatoes to your desired size. Lightly beat remaining eggs into bowl and set aside. Spread flour and bread crumbs onto pan. Working in batches roll croquettes in flour to coat and gently shake off excess and then dip in egg. Let excess drip off then roll into bread crumbs and return to tray. Chill potatoes for about 30 minutes and you can begin to fry them. |
Modern electronic devices typically have user interfaces that include high-quality displays (e.g., color, greater than 300 ppi, and 800:1 contrast ratio). These electronic displays are found in numerous types of electronic devices such as include electronic book (“eBook”) readers, cellular telephones, smart phones, portable media players, tablet computers, wearable computers, laptop computers, netbooks, desktop computers, televisions, appliances, home electronics, automotive electronics, augmented reality devices, and so forth. Electronic displays may present various types of information, such as user interfaces, device operational status, digital content items, and the like, depending on the kind and purpose of the associated device. The appearance and quality of a display can affect the user's experience with the electronic device and the content presented thereon. Accordingly, finding ways to enhance user experience and satisfaction continues to be a priority.
Increased multimedia use imposes high demands on designs of display modules, as content available for mobile use becomes visually richer. In a liquid-crystal display (LCD), energy efficiency, among other things, can be determined by a backlight or frontlight design. Many conventional transmissive electronic displays use backlights that light up a display to enable a viewer to see content on the display that can otherwise be difficult to see without the backlights. In another example, conventional reflective displays use frontlights to improve visibility of content on displays, particularly in low light situations.
Electronic devices configured with backlights and/or frontlights can incorporate one or more light guides to direct light from a light source onto or through a display. In some applications, a light source can have a relatively small area, such as in the case of a light emitting diode (LED). |
Kowa Genesis-D / Genesis-Df Handheld Fundus Camera
The main unit incorporates all the optical system, but the main and power supply units are compact and lightweight.
2.5-inch large TFT liquid crystal display screen
ID input function
Forehead pad equipped in standard
You want a wider field of view with the ability to observe peripheral area in the indirect ophthalmoscopy.
Observation of peripheral sites, which was not possible until now, was made possible with the development of the Genesis Lens Holder. By simply mounting the device on the front of the camera, photographing the peripheral area is easy. |
Q:
Is there a way to state changes that will be applied to method parameters within Javadoc?
Imagine a method that applies changes to the parameterized objects. For example a map oder list passed.
If the developer decides not to create and return a copy of the parameter I guess it would be best to have a notice in the Javadoc of this method and the parameter which indicates these changes.
I could think of an alternate @param tag like @varparam or @refparam (Regarding pass-by-reference keywords of other programming languages).
The question is: Is there a common way to do those hints in Javadoc? How common is it to apply changes to parameters? I guess this could be a problem that appears often.
A:
There is no special tag that denotes this; the accepted practice is to clearly state that the method modifies the parameter object in the description section.
Although some don't like this style of code, there are some common methods in java core that do this. java.util.Arrays.sort (and a similar method in Collections) come to mind.
|
Panamanian Chess Championship
The Panamanian Chess Championship is the individual national chess championship of Panama. The first edition was played in 1945 and won by Rubén Darío Cabrera. It was originally a biennial event, and from 1945 to 1961 six championships were played, and from 1962 to 1971 eight championships. From 1972 to 1976, it was held annually, but the tournament of 1977 never finished because the beginning of a long schism in Panamanian chess. From 1978 to 1988, it was again held annually.
In 1982 and 1989, and from 1991 to 2004, two organizations held separate events, resulting in two champions, but in 1990 there was a single competition, and therefore one champion. In 2004 both federations made peace, and since 2005 then there has only been one championship each year. At the end of the 1970s, the first women's chess championship was started, and it became an annual event in 2002. Panama is the only country in the world where a father and daughter have been champions in the same year twice: 2004 and 2008. To show the rise of new isthmian chess, Panama took 2008 the Centroamerican Championship by the hand of Jorge Baúles, first IM of Panama. In the youth categories, the signal (abs) show a champion in one big tournament with various categories at same time.
In 2010 there was no play because of official budget trouble with "Pandeportes", the government sports entity (which had three chiefs in only eleven months), and the tournament was played in the firsts months of 2011. In the final round of the 2014 tournament, two players were tied in all playoffs and were proclaimed champions. One is a foreigner, but changed his country flag as Panamanian in ratings.fide.com in March 2015, and is the fourth to win the title. Usually the Panamanian common considered overseas with over five years of residence, as one of their own.
Champions
References
Federacion de Ajedrez de Panama
Federacion de Ajedrez de Panama previous website
Partial winners list from Ajedrez Ataque
Detailed results: 2003-2005 editions
AJEDREZ en Panamá www.bit.ly/ajedrezenpanama ..www.bit.ly/ajedrezpanama2..resultado www.bit.ly/ajedrezpanama coleccion # 7
chessresults.com - This website is for sale! - Chess Resources and Information.
"Finales y Problemas Elementales de Ajedrez" author "Luis Farrugia", recompiled by "Juan Ramon Martinez D'Ettore". copyright "Editora de la Nacion, Rep. de Panama, orden no. 1636, 1977.
Sánchez se imponen en el torneo nacional de ajedrez
Specific
<Sánchez se imponen en el torneo nacional de ajedrez />
Category:Chess national championships
Category:Women's chess national championships
Championship
Category:1945 in chess
Category:Recurring sporting events established in 1945 |
POWER tycoon Paul Massara sparked an outrage after claiming energy bills are sky-high because British households waste energy.
THE £600,000-a-year boss of energy giants npower was condemned by hard-up families last night after saying they were to blame for sky-high bills.
Chief executive Paul Massara, whose company’s average 10.4 per cent winter price hike was the highest of the Big Six suppliers, sparked a storm of outrage when he claimed: “Bills are high because British homes waste so much energy.”
And instead of apologising to customers for the rises, the millionaire with a three-storey 16th century mansion said ordinary households had to do more to cut costs.
Scots mum-of-one Alison Lindsay, 35, said Massara was “seriously out of touch”. And the civil servant from East Kilbride said she and husband Mark, 41, already do all they can to keep their astronomical bills down.
Alison, who has an 18-month-old son, Jake, said of Massara: “We can’t afford to be flippant with our money and I think he has been very flippant with his comments.
“These people are obviously completely out of touch with people such as myself.
“ I would love to know the last time they personally sat down and consulted single parents, young families and pensioners over their needs and struggles.
“They are misguided and he has obviously lost touch with the average person, on an average salary with an average life.”
Daily Record
Alison Lindsay with son Jake
Pensioner Cathy Leach, 70, a retired postal worker from Glasgow, said: “Energy companies are dodging and diving, and once again trying to take the onus off them and all the fantastic perks they get.
“How dare they treat people with such contempt when they are struggling?
“I go around my house switching everything off in a panic, like most people do, because they know their bills are going to be sky-high.
“For an energy boss to say people are being wasteful is absolute rubbish. What planet is he on? If I’m told to put another cardigan on or wear a woolly hat in my house, I’ll scream.”
Mark Todd, co-founder of energyhelpline.com, said: “For an energy supplier to blame customers for rocketing bills beggars belief. Suppliers have raised prices by 140 per cent in nine years while users have cut usage.
“Typical gas usage is down 34 per cent and electricity usage by three per cent, in part because many customers can no longer afford to heat their homes.
“To blame bill rises on wasteful customers is thus totally incorrect. It’s the suppliers who have put up the bills, not the customers.”
Massara said: “The actual unit price of energy in the UK is one of the lowest in Europe, but bills are high because British homes waste so much energy.
“If we can increase the efficiency of the UK’s old and draughty housing, we can ensure that annual energy bills are some of the lowest too.”
Adam Sorenson
The lights are on at npower boss Paul Massara's house
His comments come less than a week after our sister paper the Daily Mirror revealed that a fatcat who helped npower’s owners avoid millions in tax is now on the board of HM Revenue and Customs – advising the taxman.
Former npower boss Volker Beckers ran a tax avoidance operation in Malta which meant the firm paid no UK corporation tax for four years while bills rose by 55 per cent.
Caroline Flint MP, Labour’s Shadow Energy and Climate Change Secretary, said: “It’s hypocritical for energy companies like npower to blame households for ‘wasting’ energy and then lobby the Government to cut back on insulation schemes.
“If npower really want to help, they could always use some of their profits to improve the energy efficiency of their customers’ homes.
“If these companies want to win back customers’ trust they should admit they’ve been overcharging and back Labour’s price freeze, which will save money for 27million households and 2.4million businesses.”
And Gary Smith, national secretary for energy at the GMB union, said: “Npower are in crisis. They’re sacking thousands of workers across the UK, offshoring other jobs and their credit rating is going down the pan. Yet this company seem to think it is fine to use customers as a scapegoat for their problems.
“Some of the poorest people in this country live in private rented accommodation, yet there isn’t enough pressure on landlords to improve the energy efficiency of their homes.
“But instead of trying to improve their lot, npower seem happy to blame them. They are a disgrace.”
Massara’s “don’t blame us” message over rising bills has been touted repeatedly by his company.
Npower have claimed more than half of Britain’s homes are wasting money by “allowing expensive heat to escape through walls and roofs”.
They said they controlled less than 20 per cent of customers’ bills, made “no hidden profits” and had a profit margin of 3.2 per cent in the first nine months of 2013.
They also complained that Government regulations on energy would add £308 to bills by 2020.
Their report, Energy Explained, was slammed by regulator Ofgem, who said it contained “incorrect and misleading” figures on the cost of the UK’s energy supply network.
In October, Massara claimed on the npower website that 84 per cent of the retail price of energy was “outside our control”.
The firm were then accused of censoring comments on the site from angry customers, one of whom told Massara he was “full of it”.
Npower have increased gas prices by 39.6 per cent, and electricity prices by 34.3 per cent, since October 2010.
They announced a 2.6 per cent price cut this month after the Government reduced green levies on bills. They were the last of the Big Six to agree to pass on the cuts. |
Q:
Affected rows for stored procedure with node mssql object
I can't seem to get this working. I have an update procedure in Azure SQL.
CREATE PROCEDURE foobar
@a int
AS
update foo set bar=@a;
RETURN 0
I was returning the @@rowcount and trying to work with that but it means two resultsets and sloppy code on the client side. The client being a node.js Azure Custom API.
exports.post = function(request, response) {
var mssql = request.service.mssql;
var sqlParams = [request.body.a];
var sql = "foobar ?";
mssql.query(sql, sqlParams, {
success: function(results) {
response.send(statusCodes.OK, results); //return affected rows
}
})
};
I've tried using results.affectedRows. I've tried using additional parameters in the function to get a return value. I've queried the database directly and receive '1 Records Affected' as a response. Even when I returned the @@rowcount I had problems specifying it in the javascript. As in I was returning for results:
[{"affected":1}]
and attempting to access it with results[0].affected/results[0]["affected"] and various other permutations. I tried JSON.parse(results) and tried to access its properties then but still no go. It takes the Azure portal so long to update each time I'm just blindly trying different things at the minute.
Stephen
A:
Of course after all that I found the correct documentation that suggests using queryRaw instead of query and wouldn't you know it, that returns a RowCount.
Stephen
|
---
abstract: 'Isotropic Heisenberg exchange naturally appears as the main interaction in magnetism, usually favouring long-range spin-ordered phases. The anisotropic Dzyaloshinskii-Moriya interaction arises from relativistic corrections and is *a priori* much weaker, even though it may sufficiently compete with the isotropic one to yield new spin textures. Here, we challenge this well-established paradigm, and propose to explore a Heisenberg-exchange-free magnetic world. There, the Dzyaloshinskii-Moriya interaction induces magnetic frustration in two dimensions, from which the competition with an external magnetic field results in a new mechanism producing skyrmions of nanoscale size. The isolated nanoskyrmion can already be stabilized in a few-atom cluster, and may then be used as LEGO${\textregistered}$ block to build a large magnetic mosaic. The realization of such topological spin nanotextures in $sp$- and $p$-electron compounds or in ultracold atomic gases would open a new route toward robust and compact magnetic memories.'
author:
- 'E. A. Stepanov$^{1,2}$, S. A. Nikolaev$^{2}$, C. Dutreix$^{3}$, M. I. Katsnelson$^{1,2}$, V. V. Mazurenko$^{2}$'
title: 'Heisenberg-exchange-free nanoskyrmion mosaic'
---
The concept of spin was introduced by G. Uhlenbeck and S. Goudsmit in the 1920s in order to explain the emission spectrum of the hydrogen atom obtained by A. Sommerfeld [@Int2]. W. Heitler and F. London subsequently realized that the covalent bond of the hydrogen molecule involves two electrons of opposite spins, as a result of the fermionic exchange [@Int4]. This finding inspired W. Heisenberg to give an empirical description of ferromagnetism [@Int5; @Int6], before P. Dirac finally proposed a Hamiltonian description in terms of scalar products of spin operators [@Int7]. These pioneering works focused on the ferromagnetic exchange interaction that is realized through the direct overlap of two neighbouring electronic orbitals. Nonetheless, P. Anderson understood that the exchange interaction in transition metal oxides could also rely on an indirect antiferromagnetic coupling via intermediate orbitals [@PhysRev.115.2]. This so-called superexchange interaction, however, could not explain the weak ferromagnetism of some antiferromagnets. The latter has been found to arise from anisotropic interactions of much weaker strength, as addressed by I. Dzyaloshinskii and T. Moriya [@DZYALOSHINSKY1958241; @Moriya]. The competition between the isotropic exchange and anisotropic Dzyaloshinskii-Moriya interactions (DMI) leads to the formation of topologically protected magnetic phases, such as skyrmions [@NagaosaReview]. Nevertheless, the isotropic exchange mainly rules the competition, which only allows the formation of large magnetic structures, more difficult to stabilize and manipulate in experiments [@NagaosaReview; @PhysRevX.4.031045]. Finding a new route toward more compact robust spin textures then appears as a natural challenge.
As a promising direction, we investigate the existence of two-dimensional skyrmions in the absence of isotropic Heisenberg exchange. Indeed, recent theoretical works have revealed that antiferromagnetic superexchange may be compensated by strong ferromagnetic direct exchange interactions at the surfaces of $sp$- and $p$-electron nanostructures [@silicon; @graphene], whose experimental isolation has recently been achieved [@PbSn; @PhysRevLett.98.126401; @SurfMagn; @kashtiban2014atomically]. Moreover, Floquet engineering in such compounds also offers the possibility to dynamically switch off the isotropic Heisenberg exchange interaction under high-frequency-light irradiation, a unique situation that could not be met in transition metal oxides in equilibrium [@PhysRevLett.115.075301; @Control1; @Control2]. In particular, rapidly driving the strongly-correlated electrons may be used to tune the magnetic interactions, which can be described by in terms of spin operators $\hat{\bf S}_i$ by the following Hamiltonian $$\begin{aligned}
H_{\rm spin} = -\sum_{{\ensuremath{\left\langle ij \right\rangle}}} J_{ij} (A) \,\hat{\bf S}_{i}\,\hat{\bf S}_{j} +
\sum_{{\ensuremath{\left\langle ij \right\rangle}}}{\bf D}_{ij} (A)\,[\hat{\bf S}_{i}\times\hat{\bf S}_{j}],
\label{Hspin}\end{aligned}$$ where the strengths of isotropic Heisenberg exchange $J_{ij}(A)$ and anisotropic DMI ${\bf D}_{ij}(A)$ now depend on the light amplitude $A$. The summations are assumed to run over all nearest-neighbour sites $i$ and $j$. The isotropic Heisenberg exchange term describes a competition between ferromagnetic direct exchange and antiferromagnetic kinetic exchange [@PhysRev.115.2]. Importantly, it may be switched off dynamically by varying the intensity of the high-frequency light, while the anisotropic DMI remains non-zero [@Control2].
![Stable nanoskyrmion-designed DMI abbreviation resulting from the Monte Carlo simulation of the Heisenberg-exchange-free model on the non-regular square lattice with $B_{z} = 1.2$. Arrows and color depict the in- and out-of-plane spin projection, respectively.[]{data-label="Fig1"}](Fig1.pdf){width="0.67\linewidth"}
The study of Heisenberg-exchange-free magnetism may also be achieved in other classes of systems, such as optical lattices of ultracold atomic gases. Indeed, cold atoms have enabled the observation and control of superexchange interactions, which could be reversed between ferromagnetic and antiferromagnetic [@Trotzky], as well as strong DMI [@Gong], following the realization of the spin-orbit coupling in bosonic and fermionic gases [@SO_Lin; @SO_Wang].
Here, we show that such a control of the microscopic magnetic interactions offers an unprecedented opportunity to observe and manipulate nano-scale skyrmions. Heisenberg-exchange-free nanoskyrmions actually arise from the competition between anisotropic DMI and a constant magnetic field. The latter was essentially known to stabilize the spin textures [@PhysRevX.4.031045], whereas here it is a part of the substantially different and unexplored mechanism responsible for nanoskyrmions. Fig. \[Fig1\] immediately highlights that an arbitrary system of few-atom skyrmions can be stabilized and controlled on a non-regular lattice with open boundary conditions, which was not possible at all in the presence of isotropic Heisenberg exchange.
[*Heisenberg-exchange-free Hamiltonian*]{} — Motivated by the recent predictions and experiments discussed above, we consider the following spin Hamiltonian $$\begin{aligned}
&\hat H_{\rm Hef} =
\sum_{{\ensuremath{\left\langle ij \right\rangle}}}{\bf D}_{ij}\,[\hat{\bf S}_{i}\times\hat{\bf S}_{j}] - \sum_{i}{\bf B}\hat{\bf S}_{i},
\label{DMI}\end{aligned}$$ where the magnetic field is perpendicular to the two dimensional system and ${\bf B}=~(0,0,B_{z})$. The latter tends to align the spins in the $z$ direction, while DMI flavors their orthogonal orientations. At the quantum level this non-trivial competition provides a fundamental resource in quantum information processing [@QuantInf]. Here, we are interested in the semi-classical description of the Heisenberg-exchange-free magnetism.
![Magnetic frustration in elementary DMI clusters of the triangular ([**a**]{}) and square ([**b**]{}) lattices. Curving arrows denote clockwise direction of the bonds in each cluster. Big gray arrows correspond to the in-plane DMI vectors. Black arrows in circles denote the in-plane directions of the spin moments. Blue dashed and red dotted lines indicate the bonds with minimal and zero DMI energy, respectively. ([**c**]{}) and ([**d**]{}) illustrate the examples of the spin configurations corresponding to classical ground state of the DMI Hamiltonian.[]{data-label="Fig2"}](Fig2.pdf){width="1\linewidth"}
[*DMI-induced frustration*]{} — In the case of the two-dimensional materials with pure DMI between nearest neighbours, magnetic frustration is the intrinsic property of the system. To show this let us start off with the elementary plaquettes of the triangular and square lattices without external magnetic field (see Fig. \[Fig2\]). Keeping in mind real two-dimensional materials with the $C_{nv}$ symmetry [@graphene; @silicon] we consider the in-plane orientation of the DMI vector perpendicular to the corresponding bond. Taking three spins of a single square plaquette as shown in Fig. \[Fig2\] [**b**]{}, one can minimize their energy while discarding their coupling with the fourth spin. Then, the orientation of the remaining spin can not be uniquely defined, because the spin configuration regardless whether it points “up” or “down” has the same energy, which indicates frustration. Thus, Fig. \[Fig2\] [**d**]{} gives the example of the classical ground state of the square plaquette with the energy ${\rm E}_{\square} = - {\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}\,|\mathbf{D}_{ij}|\,S^2$ and magnetization ${\rm M}^z_{\square} = S/2$ (per spin). In turn, frustration of the triangular plaquette is expressed in Fig. \[Fig2\] [**b**]{}, while its magnetic ground state is characterized by the following spin configuration $\mathbf{S}_1 = (0, -\frac{1}{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}}, \frac{1}{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}})\,S$, $\mathbf{S}_2 = (\frac{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{3}}}{2{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}}, \frac{1}{2{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}}, \frac{1}{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}})\,S$ and $\mathbf{S}_3 = (-\frac{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{3}}}{2{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}}, \frac{1}{2{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}}, \frac{1}{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}})\,S$ shown in Fig. \[Fig2\] [**c**]{}. One can see that the in-plane spin components form $120^{\circ}$-Neel state similar to the isotropic Heisenberg model on the triangular lattice [@PhysRev.115.2]. The corresponding energy and magnetization are ${\rm E}_{\triangle} =- {\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{3}}\,|\mathbf{D}_{ij}|\,S^2$ and ${\rm M}^z_{\triangle} = S/{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}$, respectively.
Importantly, the ground state of the triangular and square plaquettes is degenerate due to the $C_{nv}$ and in-plane mirror symmetry. For instance, there is another state with the same energy ${\rm E'} = {\rm E}$, but opposite magnetization ${\rm M}'^z = - {\rm M}^z$. Therefore, such elementary magnetic units can be considered as the building blocks in order to realize [*spin spirals*]{} on lattices with periodic boundary conditions and zero magnetic field. The ensuing results are obtained via Monte Carlo simulations, as detailed in Supplemental Material [@SM].
![Fragments of the spin textures and spin structure factors obtained with the Heisenberg-exchange-free model on the square $20\times20$ ([**a**]{}) and triangular $21\times21$ ([**b**]{}) lattices. The values of the magnetic fields in these simulations were chosen $B_{z} = 3.0$ and $B_{z} = 3.2$ for the triangular and square lattices, respectively. The calculated skyrmion numbers for the triangular (blue triangles) and square (red squares) lattices ([**c**]{}). The magnetic field is in units of DMI. The temperature is equal to ${\rm T}=0.01\,|{\rm \bf D}|$.[]{data-label="Fig3"}](Fig3.pdf){width="1\linewidth"}
[*Nanoskyrmionic state*]{} — At finite magnetic field the spiral state can be transformed to a skyrmionic spin texture. Fig. \[Fig3\] gives some examples obtained from the Monte Carlo calculations for the triangular and square lattices. Remarkably, the radius of the obtained nanoskyrmions does not exceed a few lattice constants. The calculated spin structure factors $\chi_{\perp}({\mathbf{q}})$ and $\chi_{\parallel}({\mathbf{q}})$ [@SM] revealed a superposition of the two (square lattice) or three (triangular lattice) spin spirals with $\pm \mathbf{q}$, which is the first indication of the skyrmionic state (see Fig. \[Fig3\] [**a**]{}, [**b**]{}). For another confirmation one can calculate the skyrmionic number, which is related to the topological charge. In the discrete case, the result is extremely sensitive to the number of sites comprising a single skyrmion and to the way the spherical surface is approximated [@Rosales]. Here we used the approach of Berg and Lüscher [@Berg], which is based on the definition of the topological charge as the sum of the nonoverlapping spherical triangles areas [@Blugel2016; @SM]. According to our simulations, the topological charge of each object shown in Fig. \[Fig3\] [**a**]{} and Fig. \[Fig3\] [**b**]{} is equal to unity. The square and triangular lattice systems exhibit completely different dependence of the average skyrmion number on the magnetic field. As it is shown in Fig. \[Fig3\] [**c**]{}, the skyrmionic phase for the square lattice $2.7\leq B_{z} < 4.2$ is much narrower than the one of the triangular lattice $1.2 \leq B_{z} < 6$. Moreover, in the case of the square lattice we observe strong finite-size effects leading to a non-stable value of the average topological charge in the region of $0 < B_{z} < 2.7$. Since the value of the magnetic field is given in the units of DMI, the topological spin structures in the considered model require weak magnetic fields, which is very appealing for modern experiments.
We would like to stress that the underlying mechanism responsible for the skyrmions presented in this work is intrinsically different from those presented in other studies. Generally, skyrmions can be realized by means of the different mechanisms [@NagaosaReview]. For instance, in noncentrosymmetric systems these spin textures arise from the competition between isotropic and anisotropic exchange interactions. On the other hand, magnetic frustration induced by competing isotropic exchange interactions can also lead to a skyrmion crystal state, even in the absence of DMI and anisotropy. Moreover, following the results of [@Blugel] the nanoskyrmions are stabilized due to a four-spin interaction. Nevertheless, the nanoskyrmions have never been predicted and observed as the result of the interplay between DMI and a constant magnetic field.
![Catalogue of the DMI nanoskyrmion species stabilized on the small square (top figures) and triangular (bottom figures) clusters with open boundary conditions. The corresponding magnetic fields are (from top to bottom): on-site $B_{z}=3.0;~3.0$, off-site $B_{z}=1.2;~2.4$, bond-centered $B_{z}=2.5;~3.0$. []{data-label="Fig4"}](Fig4.pdf){width="0.64\linewidth"}
Full catalogue of nanoskyrmions obtained in this study is presented in Fig. \[Fig4\]. As one can see, they can be classified with respect to the position of the skyrmionic center on the discrete lattice. Thus, the on-site, off-site (center of an elementary triangle or square) and bond-centred configurations have been revealed. Importantly, these structures can be stabilized not only on the lattice, but also on the isolated plaquettes of 12-37 sites with open boundary conditions. It is worth mentioning that not all sites of the isolated plaquettes form the skyrmion. In some cases inclusion of the additional spins that describe the environment of the skyrmion is necessary for stabilization of the topological spin structure. As we discuss below, it can be used to construct a magnetic domain for data storage.
[*Nanoskyrmionic mosaic*]{} — By defining the local rules (interaction between nearest neighbours) and external parameters (such as the lattice size and magnetic field) one can obtain magnetic structures with different patterns by using Monte Carlo approach. As it follows from Fig. \[Fig5\], the pure off-site square skyrmion structures are realized on the lattices $6\times14$ with open boundary conditions at $B_{z} = 3.0$. Increasing the lattice size along the $x$ direction injects bond-centred skyrmions into the system. In turn, increasing the magnetic field leads to the compression of the nanoskyrmions and reduces their density. At $B_{z}=3.6$ we observed the on-site square skyrmion of the most compact size. Thus the particular pattern of the resulting nanoskyrmion mosaic respect the minimal size of individual nanoskyrmions and the tendency of the system to formation of close-packed structures to minimize the energy.
![(Top panel) Evolution of the nanoskyrmions on the lattice $6\times14$ with respect to the magnetic field. (Bottom panel) Examples of nanoskyrmion mosaics obtained from the Monte Carlo simulations of the DMI model on the square lattices with open boundary conditions at the magnetic field $B_{z}=3$.[]{data-label="Fig5"}](Fig5.pdf){width="1\linewidth"}
The solution of the Heisenberg-exchange-free Hamiltonian for the magnetic fields corresponding to the skyrmionic phase can be related to the famous geometrical NP-hard problem of bin packing [@Bin]. Let us imagine that there is a set of fixed-size and fixed-energy objects (nanoskyrmions) that should be packed on a lattice of $n \times m$ size in a more compact way. As one can see, such objects are weakly-coupled to each other. Indeed, the contact area of different skyrmions is nearly ferromagnetic, so the binding energy between two skyrmions is very small, since it is related to DMI. In addition, the energy difference between nanoskyrmions of different types is very small as can be seen from Fig. \[Fig5\]. Indeed, the energy difference between three off-site and bond-centered skyrmions realized on the $6\times14$ plaquette is about $0.2\,B_{z}$. Here, we sample spin orientation within the Monte Carlo simulations and do not manipulate the nanoskyrmions directly. Thus, the stabilization of a periodic and close-packed nanoskyrmionic structures on the square or triangular lattice with the length of more than $30$ sites becomes a challenging task. Therefore, the problem can be addressed to a LEGO$\textregistered$-type constructor, where one builds the mosaic pattern using the unit nanoskyrmionic bricks.
[*Size limit*]{} — For practical applications, it is of crucial importance to have skyrmions with the size of the nanometer range, for instance to achieve a high density memory [@Lin]. Previously the record density of the skyrmions was reported for the Fe/Ir(111) system [@Blugel] for which the size of the unit cell of the skyrmion lattice stabilized due to a four-spin interaction was found to be 1nm $\times$ 1nm. In our case the diameter of the triangular on-site skyrmion is found to be $4$ lattice constants (Fig. \[Fig4\]). Thus for prototype $sp$-electron materials the diameter is equal to 1.02 nm (semifluorinated graphene [@graphene]) and 2.64 nm (Si(111):{Sn,Pb} [@silicon]).
On the basis of the obtained results we predict the smallest diameter of $2$ lattice constants for the on-site square skyrmion. Our simulations for finite-sized systems with open boundary conditions show that such a nanoskyrmion can exist on the $5\times5$ cluster (Fig. \[Fig4\] top right plaquette), which is smaller than that previously reported in [@Keesman]. We believe that this is the ultimate limit of a skyrmion size on the square lattice.
[*Micromagnetic model*]{} — The analysis of the isolated skyrmion can also be fulfilled on the level of the micromagnetic model treating the magnetization as a continuous vector field [@SM]. Contrary to the case of nonzero exchange interaction, the Heisenberg-exchange-free Hamiltonian allows to obtain an analytical solution for the skyrmionic profile. In the particular case of the square lattice, the radius of the isolated skyrmion is equal to $R=4Da/B$, where $a$ is the lattice constant. Moreover, the skyrmionic solution is stable even in the presence of a small exchange interaction $J\ll{}D$ [@SM]. It is worth mentioning that the obtained result for the radius of the Heisenberg-exchange-free skyrmion is essentially different from the case of competing exchange interaction and DMI, where the radius is proportional to the ratio $J/D$. Although in the absence of DMI both, the exchange interaction and magnetic field, favour the collinear orientation of spins in the direction perpendicular to the surface, the presence of DMI changes the picture drastically. When the spins are tilted by the anisotropic interaction, the magnetic field still wants them to point in the $z$ direction, while the exchange interaction tries to keep two neighbouring spins parallel without any relation to the axes. Therefore, the stronger magnetic field decreases the radius of the skyrmion, while the larger value of exchange interaction broadens the structure [@ref].
![([**a**]{}) two possible states of the nanoskyrmionic bit. ([**b**]{}) the 24-bit nanoskyrmion memory block encoding DMI abbreviation as obtained from the Monte Carlo simulations with $B_{z} =1.2$.[]{data-label="Fig6"}](Fig6.pdf){width="0.9\linewidth"}
[*Memory prototype*]{} — Having analyzed individual nanoskyrmions we are now in a position to discuss technological applications of the nanoskyrmion mosaic. Fig. \[Fig6\] a visualizes a spin structure consisting of the elementary blocks of two types that we associated with the two possible states of a single bit, the “1” and “0”. According to our Monte Carlo simulations a side stacking of off-site square plaquette visualized in Fig. \[Fig4\] protects skyrmionic state in each plaquette. Thus we have a stable building block for design of the nano-scale memory or nanostructures presented in Fig. \[Fig1\]. Similar to the experimentally realized vacancy-based memory [@Memory], a specific filling of the lattice can be reached by means of the scanning tunnelling microscopy (STM) technique. In turn, the spin-polarized regime [@STM] of STM is to be used to read the nanoskyrmionic state. The density of the memory prototype we discuss can be estimated as 1/9 bits $a^{-2}$ ($a$ is the lattice constant), which is of the same order of magnitude as obtained for vacancy-based memory.
[*Conclusion*]{} — We have introduced a new class of the two-dimensional systems that are described with the Heisenberg-exchange-free Hamiltonian. The frustration of DMI on the triangular and square lattices leads to a non-trivial state of nanoskyrmionic mosaic that can be manipulated by varying the strength of the constant magnetic field and the size of the sample. Importantly, such a state appears as a result of competition between DMI and the constant magnetic field. This mechanism is unique and is reported for the first time. Being stable on non-regular lattices with open boundary conditions, nanoskyrmionic phase is shown to be promising for technological applications as a memory component. We also present the catalogue of nanoskyrmionic species that can be stabilized already on a tiny plaquettes of a few lattice sites. Characteristics of the isolated skyrmion were studied both, numerically and analytically, within the Monte Carlo simulations and in the framework of the micromagnetic model, respectively.
We thank Frederic Mila, Alexander Tsirlin and Alexey Kimel for fruitful discussions. The work of E.A.S. and V.V.M. was supported by the Russian Science Foundation, Grant 17-72-20041. The work of M.I.K. was supported by NWO via Spinoza Prize and by ERC Advanced Grant 338957 FEMTO/NANO. Also, the work was partially supported by the Stichting voor Fundamenteel Onderzoek der Materie (FOM), which is financially supported by the Nederlandse Organisatie voor Wetenschappelijk Onderzoek (NWO).
[42]{}
Uhlenbeck, G. E., Goudsmit, S. [*Die Naturwissenschaften*]{} [**13**]{}, 953 (1925). Uhlenbeck, G. E., Goudsmit, S. [*Nature*]{} [**117**]{}, 264 (1926).
Goudsmit, S., Uhlenbeck, G. E. [*Physica*]{} [**6**]{}, 273 (1926).
Heitler, W., London, F. [*Zeitschrift für Physik*]{} [**44**]{}, 455 (1927). Heisenberg, W. [*Zeitschrift für Physik*]{} [**43**]{}, 172 (1927). Heisenberg, W. [*Zeitschrift für Physik*]{} [**49**]{}, 619 (1928). Dirac, P. A. M. [*Proceedings of the Royal Society of London A: Mathematical, Physical and Engineering Sciences*]{} (The Royal Society, 1929).
Anderson, P. W. [*Phys. Rev.*]{} [**115**]{}, 2 (1959). Dzyaloshinsky, I. [*Journal of Physics and Chemistry of Solids*]{} [**4**]{}, 241 (1958). Moriya, T. [*Phys. Rev.*]{} [**120**]{}, 91 (1960). Skyrme, T. [*Nuclear Physics*]{} [**31**]{}, 556 (1962). Bogdanov, A., Yablonskii, D. [*Sov. Phys. JETP*]{} [**68**]{}, 101 (1989).
Mühlbauer, S., et al. [*Science*]{} [**323**]{}, 915 (2009). Münzer, W., et al. [*Phys. Rev.*]{} [**B 81**]{}, 041203(R) (2010). Yu, X., et al. [*Nature*]{} [**465**]{}, 901 (2010).
Nagaosa, N., Tokura, Y. [*Nature Nanotechnology*]{} [**8**]{}, 899 (2013).
Banerjee, S., Rowland, J., Erten, O., Randeria M. [*Phys. Rev.*]{} [**X 4**]{}, 031045 (2014). Badrtdinov, D. I., Nikolaev, S. A., Katsnelson, M. I., Mazurenko, V. V. [*Phys. Rev.*]{} [**B 94**]{}, 224418 (2016). Mazurenko, V. V., et al. [*Phys. Rev.*]{} [**B 94**]{}, 214411 (2016). Slezák, J., Mutombo, P., Cháb, V. [*Phys. Rev.*]{} [**B 60**]{}, 13328 (1999). Modesti, S., et al. [*Phys. Rev. Lett.*]{} [**98**]{}, 126401 (2007). Li, G., et al. [*Nature Communications*]{} [**4**]{}, 1620 (2013).
Kashtiban, R. J., et al. [*Nature Communications*]{} [**5**]{}, 4902 (2014).
Itin, A. P., Katsnelson, M. I. [*Phys. Rev. Lett.*]{} [**115**]{}, 075301 (2015). Dutreix, C., Stepanov, E. A., Katsnelson, M. I. [*Phys. Rev.*]{} [*B 93*]{}, 241404(R) (2016). Stepanov, E. A., Dutreix, C., Katsnelson, M. I. [*Phys. Rev. Lett.*]{} [**118**]{}, 157201 (2017). Trotzky, S., et al. [*Science*]{} [**319**]{}, 295 (2008). Gong, M., Qian, Y., Yan, M., Scarola, V. W., Zhang, C. [*Scientific Reports*]{} [**5**]{}, 10050 (2015).
Lin, Y. J., Jiménez-Garcia, K., Spielman, I. B. [*Nature*]{} [**471**]{}, 83 (2011).
Wang, P., et al. [*Phys. Rev. Lett.*]{} [**109**]{}, 095301 (2012). Da-Chuang, L., et al. [*Chinese Physics Letters*]{} [**32**]{}, 050302 (2015).
Supplemental Material for “Heisenberg-exchange-free nanoskyrmion mosaic”.
Rosales, H. D., Cabra, D. C., Pujol, P. [*Phys. Rev.*]{} [**B 92**]{}, 214439 (2015). Berg, B., Lüscher, M. [*Nuclear Physics*]{} [**B 190**]{}, 412 (1981). Heo, C., Kiselev, N. S., Nandy, A. K., Blügel, S., Rasing, T. [*Scientific reports*]{} [**6**]{}, 27146 (2016).
Heinze, S., et al. [*Nature Physics*]{} [**7**]{}, 713 (2011).
Johnson, D. S. [*Near-optimal bin packing algorithms*]{}, (Ph.D. thesis, Massachusetts Institute of Technology, 1973).
Lin, S. Z., Saxena, A. [*Phys. Rev.*]{} [**B 92**]{}, 180401(R) (2015). Keesman, R., Raaijmakers, M., Baerends, A. E., Barkema, G. T., Duine, R. A. [*Phys. Rev.*]{} [**B 94**]{}, 054402 (2016). Kalff, F. E., et al. [*Nature Nanotechnology*]{} [**11**]{}, 926 (2016).
Wiesendanger, R. [*Rev. Mod. Phys.*]{} [**81**]{}, 1495 (2009). Although the rich variety of nanoskyrmions on the discrete lattices obtained in the current study can not be described by the micromagnetic model, because the length scale on which the magnetic structure varies is of the order of the interatomic distance, the result for the radius matches very well our numerical simulations and can be considered as a limiting case of the micromagnetic solution when the applied magnetic filed is of the order of DMI. Nevertheless, the analytical solution for the isolated skyrmion might be helpful for the other set of system parameters, where the considered micromagnetic model is applicable.
Methods
=======
The DMI Hamiltonian with classical spins was solved by means of the Monte Carlo approach. The spin update scheme is based on the Metropolis algorithm. The systems in question are gradually (200 temperature steps) cooled down from high temperatures (${\rm T}\sim
|\mathbf{D}_{ij}|$) to ${\rm T}=~0.01|\mathbf{D}_{ij}|$. Each temperature step run consists of $1.5\times10^{6}$ Monte Carlo steps. The corresponding micromagnetic model was solved analytically.
Definition of the skyrmion number
=================================
Skyrmionic number is related to the topological charge. In the discrete case, the result is extremely sensitive to the number of sites comprising a single Skyrmion and to the way the spherical surface is approximated. Here we used the approach of Berg and Lüscher, which is based on the definition of the topological charge as the sum of the nonoverlapping spherical triangles areas. Solid angle subtended by the spins ${\bf S}_{1}$, ${\bf S}_{2}$ and ${\bf S}_{3}$ is defined as $$\begin{aligned}
A = 2 \arccos[\frac{1+ {\bf S}_{1} {\bf S}_{2} + {\bf S}_{2} {\bf S}_{3} + {\bf S}_{3} {\bf S}_{1}}{{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2(1+ {\bf S}_{1} {\bf S}_{2} )(1+ {\bf S}_{2} {\bf S}_{3})(1+ {\bf S}_{3} {\bf S}_{1})}}}].\end{aligned}$$ We do not consider the exceptional configurations for which $$\begin{aligned}
&{\bf S}_{1} [{\bf S}_{2} \times {\bf S}_{1}] = 0 \\
&1+ {\bf S}_{1} {\bf S}_{2} + {\bf S}_{2} {\bf S}_{3} + {\bf S}_{3} {\bf S}_{1} \le 0. \notag\end{aligned}$$ Then the topological charge $Q$ is equal to $
Q = \frac{1}{4\pi} \sum_{l} A_{l}.
$
Spin spiral state
=================
Our Monte Carlo simulations for the DMI Hamiltonian with classical spin $|\mathbf{S}| = 1$ have shown that the triangular and square lattice systems form [*spin spiral*]{} structures (see Fig. \[spinfactors\]). The obtained spin textures and the calculated spin structure factors are $$\begin{aligned}
\chi_{\perp}({\mathbf{q}})&=\frac{1}{N}{\ensuremath{\left\langle \left|\sum_{i} S_{i}^{x} \, e^{-i{\mathbf{q}}\cdot{\bf r}_{i}} \right|^{2}+\left|\sum_{i} S_{i}^{y} \, e^{-i{\mathbf{q}}\cdot{\bf r}_{i}} \right|^{2} \right\rangle}}\\
\chi_{\parallel}({\mathbf{q}})&=\frac{1}{N}{\ensuremath{\left\langle \left|\sum_{i} S_{i}^{z} e^{-i{\mathbf{q}}\cdot{\bf r}_{i}} \right|^{2} \right\rangle}}.\end{aligned}$$
![Fragments of the spin textures and spin structure factors obtained with the Heisenberg-exchange-free model on the square $20\times20$ [**A**]{} and triangular $21\times21$ [**B**]{} lattices in the absence of the magnetic field. The temperature is equal to ${\rm T}=0.01\,|{\rm \bf D}|$.[]{data-label="spinfactors"}](FigS1.pdf){width="0.55\linewidth"}
The pictures of intensities at zero magnetic field correspond to the spin spiral state with $|\mathbf{q}_{\square}| = \frac{1}{2{\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}} \times \frac{2\pi}{a}$ and $|\mathbf{q}_{\triangle}| \simeq 0.29 \times \frac{2\pi}{a}$ for the square and triangle lattices, respectively. Here $a$ is the lattice constant. The corresponding periods of the spin spirals are $\lambda_{\triangle} = 3.5\,a$ and $\lambda_{\square} = 2 {\mkern-6mu\mathop{}\oldsqrt[\mkern8mu]{2}}\,a$. The energies of the triangular and square systems at B$_{z}$ and low temperatures are scaled as energies of the elementary clusters, namely E$_{\triangle}$ and E$_{\square}$ (Fig. \[Fig2\] c and Fig. \[Fig2\] d), multiplied by the number of sites. In contrast to the previous considerations taking into account Heisenberg exchange interaction, we do not observe any long-wavelength spin excitations (${\mathbf{q}}=0$) in $\chi_{\parallel}(\boldsymbol{q})$.
Micromagnetics of isolated skyrmion
===================================
A qualitative description of a single skyrmion can be obtained within a micromagnetic model, when the quantum spin operators $\hat{\bf S}$ are replaced by the classical local magnetization ${\bf m}_{i}$ at every lattice site and later by a continuous and differentiable vector field ${\bf m}({\bf r})$ as $\hat{\bf S}_{i} \to S {\bf m}_{i} \to S{\bf m}({\bf r})$, where $S$ is the spin amplitude and $|{\bf m}|=1$. This approach is valid for large quantum spins when the length scale on which the magnetic structure varies is larger than the interatomic distance. Let us make the specified transformation explicitly and calculate the energy of the single spin localized at the lattice site $i$ that can be found as a sum of the initial DMI Hamiltonian over the nearest neighbor lattice sites $$\begin{aligned}
\label{mme1}
E_{i}&=-\sum_{j}J_{ij}\,\hat{\bf S}_{i}\,\hat{\bf S}_{j} +
\sum_{j}{\bf D}_{ij}\,[\hat{\bf S}_{i}\times\hat{\bf S}_{j}] -
{\bf B}\,\hat{\bf S}_{i} \\
&= -S^{2}\sum_{j}J_{ij}\,{\bf m}_{i}\,{\bf m}_{j} +
S^2\sum_{j}{\bf D}_{ij}\,[{\bf m}_{i}\times{\bf m}_{j}] -
S{\bf B}\,{\bf m}_{i} \notag\\
&=-S^{2}\sum_{j}J_{ij}\left(1-\frac{1}{2}({\bf m}_{j}-{\bf m}_{i})^{2}\right) +
S^2\sum_{j}{\bf D}_{ij}\left[{\bf m}_{i}\times\left({\bf m}_{j}-{\bf m}_{i}\right)\right] - S{\bf B}\,{\bf m}_{i} \notag\\
&\simeq-S^{2}\sum_{j}J_{ij}\left(1-\frac{1}{2}({\bf m}({\bf r}_{i}+\delta{\bf r}_{ij}) - {\bf m}({\bf r}_{i}))^{2}\right) + S^2\sum_{j}{\bf D}_{ij}\left[{\bf m}_{i}({\bf r}_{i})\times\left({\bf m}({\bf r}_{i}+\delta{\bf r}_{ij}) - {\bf m}({\bf r}_{i})\right)\right] - S{\bf B}\,{\bf m}({\bf r}_{i}) \notag\\
&\simeq\frac{S^{2}a^2}{2}\sum_{j}J_{ij}\left(({\bf e}_{ij}\nabla)\,{\bf m}({\bf r}_{i})\right)^{2} + S^2a\sum_{j}{\bf D}_{ij}\left[{\bf m}_{i}({\bf r}_{i})\times
(({\bf e}_{ij}\nabla)\,{\bf m}({\bf r}_{i}))\right] - S{\bf B}\,{\bf m}({\bf r}_{i}), \notag\end{aligned}$$ The DMI vector ${\bf D}_{ij} = D\left[{\bf e}_{z}\times{\bf e}_{ij}\right]$ is perpendicular to the vector ${\bf e}_{ij}$ that connects spins at the nearest-neighbor sites ${\ensuremath{\left\langle ij \right\rangle}}$ and favours their orthogonal alignment, while the exchange term tends to make the magnetization uniform. The above derivation was obtained for a particular case of a square lattice, but can be straightforwardly generalized to an arbitrary configuration of spins. Then, we obtain $$\begin{aligned}
\label{mme2}
E_{i}
&= \frac{S^{2}a^2}{2}\sum_{j}J_{ij}\left(({\bf e}_{ij}\nabla)\,{\bf m}({\bf r}_{i})\right)^{2} + S^2aD\sum_{j}\left[{\bf e}_{z}\times{\bf e}_{ij}\right]\left[{\bf m}_{i}\times
\Big(({\bf e}_{ij}\nabla)\,{\bf m}({\bf r}_{i})\Big)\right] - S{\bf B}_{z}\,{\bf m}_{z}({\bf r}_{i}) \\
&= \frac{J'}{2}\left[\Big(\partial_{x}\,{\bf m}({\bf r}_{i})\Big)^{2} + \Big(\partial_{y}\,{\bf m}({\bf r}_{i})\Big)^{2} \right] - S{\bf B}_{z}\,{\bf m}_{z}({\bf r}_{i}) \notag \\
&\,+ D'\,\left[{\bf m}_{z}({\bf r}_{i})\,\Big(\partial_{x}{\bf m}_{x}({\bf r}_{i})\Big) - \Big(\partial_{x}{\bf m}_{z}({\bf r}_{i})\Big)\,{\bf m}_{x}({\bf r}_{i})) + {\bf m}_{z}({\bf r}_{i})\,\Big(\partial_{y}{\bf m}_{y}({\bf r}_{i})\Big) - \Big(\partial_{y}{\bf m}_{z}({\bf r}_{i})\Big)\,{\bf m}_{y}({\bf r}_{i}))\right] \notag\end{aligned}$$ where $J'=2JS^{2}a^{2}$, $D'=2DS^{2}a$ and $B'=BS$. The unit vector of the magnetization at every point of the vector field can be parametrized by ${\bf m} = \sin\theta\cos\psi\,{\bf e}_{x} + \sin\theta\sin\psi\,{\bf e}_{y} + \cos\theta\,{\bf e}_{z}$ in the spherical coordinate basis. In order to describe axisymmetric skyrmions, we additionally introduce the cylindrical coordinates $\rho$ and $\varphi$, so that $\rho=0$ is associated to the center of a skyrmion $$\begin{aligned}
\partial_{x}{\bf m}({\bf r}_{i}) &=
\cos\varphi\,\partial_{\rho}{\bf m}({\bf r}_{i}) -
\frac{1}{\rho}\sin\varphi\,\partial_{\varphi}{\bf m}({\bf r}_{i})\,, \\
\partial_{y}{\bf m}({\bf r}_{i}) &=
\sin\varphi\,\partial_{\rho}{\bf m}({\bf r}_{i}) +
\frac{1}{\rho}\cos\varphi\,\partial_{\varphi}{\bf m}({\bf r}_{i})\,,\end{aligned}$$ from which follows $$\begin{aligned}
\Big(\partial_{x}{\bf m}({\bf r}_{i})\Big)^2 +
\Big(\partial_{y}{\bf m}({\bf r}_{i})\Big)^2 =
\Big(\partial_{\rho}{\bf m}({\bf r}_{i})\Big)^2 +
\frac{1}{\rho^2}\Big(\partial_{\varphi}{\bf m}({\bf r}_{i})\Big)^2.\end{aligned}$$ Assuming that $\theta=\theta(\rho,\varphi)$ and $\psi=\psi(\rho,\varphi)$, the derivatives of the magnetization can be expressed as $$\begin{aligned}
\partial_{\rho}{\bf m}({\bf r}_{i}) &=
\Big(\cos\theta\cos\psi\,\dot\theta_{\rho}-\sin\theta\sin\psi\,\dot\psi_{\rho}\Big)\,{\bf e}_{x} +
\Big(\cos\theta\sin\psi\,\dot\theta_{\rho}+\sin\theta\cos\psi\,\dot\psi_{\rho}\Big)\,{\bf e}_{y} -
\sin\theta\,\dot\theta_{\rho}\,{\bf e}_{z} \,, \\
\partial_{\varphi}{\bf m}({\bf r}_{i}) &=
\Big(\cos\theta\cos\psi\,\dot\theta_{\varphi}-\sin\theta\sin\psi\,\dot\psi_{\varphi}\Big)\,{\bf e}_{x} +
\Big(\cos\theta\sin\psi\,\dot\theta_{\varphi}+\sin\theta\cos\psi\,\dot\psi_{\varphi}\Big)\,{\bf e}_{y} -
\sin\theta\,\dot\theta_{\varphi}\,{\bf e}_{z} \,.\end{aligned}$$ The exchange and DMI energies then equal to $$\begin{aligned}
E^{J}_{i} &=
\frac{J'}{2}\left[\dot\theta^2_{\rho} + \sin^2\theta\,\dot\psi_{\rho}^2 + \frac{1}{\rho^2}\dot{\theta}^2_{\varphi} +
\frac{1}{\rho^2}\sin^2\theta\,\dot\psi^2_{\varphi} \right],\\
E^{D}_{i} &= D'\left(\cos(\psi-\varphi)\left[\dot\theta_{\rho}+\frac{1}{\rho}\sin\theta\cos\theta\,\dot\psi_{\varphi}\right] + \sin(\psi-\varphi)\left[\frac{1}{\rho}\dot\theta_{\varphi}-\sin\theta\cos\theta\,\dot\psi_{\rho}\right]\right).\end{aligned}$$ Finally, the micromagnetic energy can be written as follows $$\begin{aligned}
E(\theta,\psi) =\int_{0}^{\infty}{\cal E}(\theta,\psi,\rho,\varphi)\,d\rho\,d\varphi \,,\end{aligned}$$ where the skyrmionic energy density is $$\begin{aligned}
{\cal E}(\theta,\psi,\rho,\varphi)
&= \frac{J'}{2}\left[\rho\dot\theta^2_{\rho} + \rho\sin^2\theta\,\dot\psi_{\rho}^2 + \frac{1}{\rho}\dot{\theta}^2_{\varphi} +
\frac{1}{\rho}\sin^2\theta\,\dot\psi^2_{\varphi} \right] -
B'\rho\cos\theta \\
& + D'\left(\cos(\psi-\varphi)\left[\rho\dot\theta_{\rho}+\sin\theta\cos\theta\,\dot\psi_{\varphi}\right] + \sin(\psi-\varphi)\left[\dot\theta_{\varphi}-\rho\sin\theta\cos\theta\,\dot\psi_{\rho}\right]\right). \notag\end{aligned}$$ The set of the Euler-Lagrange equations for this energy density $$\begin{aligned}
\begin{cases}
\frac{\partial{\cal E}}{\partial\theta} - \frac{d}{d\rho}\frac{\partial{\cal E}}{\partial\dot\theta_{\rho}} - \frac{d}{d\varphi}\frac{\partial{\cal E}}{\partial\dot\theta_{\varphi}}=0,
\\
\frac{\partial{\cal E}}{\partial\psi} - \frac{d}{d\rho}\frac{\partial{\cal E}}{\partial\dot\psi_{\rho}} - \frac{d}{d\varphi}\frac{\partial{\cal E}}{\partial\dot\psi_{\varphi}}=0,
\end{cases}\end{aligned}$$ then reads $$\begin{aligned}
\left\{\hspace{-0.15cm}
\begin{matrix}
&J'\left[\rho\,\ddot\theta_{\rho} + \dot\theta_{\rho} + \frac{1}{\rho}\ddot\theta_{\varphi} - \frac{1}{\rho} \sin\theta\cos\theta\,\dot\psi^2_{\varphi} - \rho\sin\theta\cos\theta\,\dot\psi^2_{\rho} \right] + 2D'\left[\cos(\psi-\varphi)\sin^2\theta\,\dot\psi_{\varphi} - \rho\sin(\psi-\varphi)\sin^2\theta\,\dot\psi_{\rho}\right] - B'\rho\sin\theta=0 \,,\\
&J'\left[\rho\sin^2\theta\,\ddot\psi_{\rho} + \sin^2\theta\,\dot\psi_{\rho} + \rho\sin2\theta\,\dot\psi_{\rho}\dot\theta_{\rho} + \frac{1}{\rho}\sin^2\theta\,\ddot\psi_{\varphi} + \frac{1}{\rho}\sin2\theta\,\dot\theta_{\varphi}\,\dot\psi_{\varphi}\right] + 2D'\left[\rho\sin(\psi-\varphi)\sin^2\theta\,\dot\theta_{\rho} - \cos(\psi-\varphi)\sin^2\theta\,\dot\theta_{\varphi}\right] = 0 \,.
\end{matrix}
\right. \notag\end{aligned}$$ Here we restrict ourselves to the particular case of the $C_{nv}$ symmetry. Then, one can assume that $\dot\theta_{\varphi}=0$ and $\psi-\varphi=\pi{}n$ ($n\in{\mathbb Z}$), which leads to $$\begin{aligned}
\alpha \left[\rho^{2}\,\ddot\theta_{\rho} + \rho \dot\theta_{\rho} - \sin\theta\cos\theta \right] \pm 2\rho\sin^2\theta - \beta\rho^{2}\sin\theta=0 \,,\end{aligned}$$ where $\alpha=J'/D'$ and $\beta=B'/D'$. Although we are interested in the problem where the exchange interaction is absent, it is still necessary to keep $\alpha\ll1$ as a small parameter in order to investigate stability of the skyrmionic solution under small perturbations. Therefore, one can look for a solution of the following form $$\begin{aligned}
\theta = \theta_{0} + \alpha \theta_{1} + O(\alpha^2),\end{aligned}$$ which results in $$\begin{aligned}
\alpha \left[ \rho^{2}\,\ddot\theta_{0} + \rho \dot\theta_{0} - \sin\theta_{0}\cos\theta_{0} \right]
\pm 2\rho\sin^2\theta_{0} \pm 4 \alpha \rho\sin\theta_{0}\cos\theta_{0}\, \theta_{1}
- \beta\rho^{2}\sin\theta_{0} - \alpha \beta\rho^{2}\cos\theta_{0}\,\theta_{1}
=0 \,.\end{aligned}$$
Solution for $J'=0$
-------------------
When the exchange interaction is dynamically switched off ($J' = 0$), the zeroth order in the limit $\alpha\ll1$ leads to $$\begin{aligned}
\rho\,\sin\theta_{0} \left( \beta \rho \mp 2\sin\theta_{0} \right) =0 \,.\end{aligned}$$ This yields two solutions: $$\begin{aligned}
1)~\sin\theta_{0} &= 0,~\text{which corresponds to a FM ordered state}\\
2)~\sin\theta_{0} &= \pm \frac{\beta\rho}{2} = \pm \frac{B'\rho}{2D'},~\text{which describes a Skyrmion}.\label{eq:Skprofile}\end{aligned}$$ Then, the unit vector of the magnetization that describes a single skyrmion is equal to $$\begin{aligned}
{\bf m} = \sin\theta \cos(\psi-\phi)\,{\bf e}_{\rho} + \sin\theta\sin(\psi-\varphi)\,{\bf e}_{\varphi} + \cos\theta\,{\bf e}_{z} = \pm\sin\theta\,{\bf e}_{\rho} + \cos\theta\,{\bf e}_{z} =
\frac{\beta\rho}{2}\,{\bf e}_{\rho} + \cos\theta_0\,{\bf e}_{z},\end{aligned}$$ Importantly, the radial coordinate of the skyrmionic solution is limited by the condition $\rho\leq\frac{2D'}{B'}$. Moreover, the $z$ component of the magnetization, namely ${\bf m}_{z}=\cos\theta_0$, is not uniquely determined by the Euler-Lagrange equations. Indeed, the solution with the initial condition $\theta_0(\rho=0)=\pi$ for the center of the skyrmion describes only half of the skyrmion, because the magnetization at the boundary ${\bf m}(\rho=2D'/B')$ lies in-plane along ${\bf e}_{\rho}$, which can not be continuously matched with the FM environment of a single skyrmion. Moreover, the magnetization at the larger values of $\rho$ is undefined within this solution. Therefore, one has to make some efforts to obtain the solution for the whole skyrmionic structure.
Let us stick to the case, when the magnetization of the center of the skyrmion is points, i.e. $\theta_0(\rho=0)=\pi$, ${\bf m}_{z}(\rho=0)=-1$, and magnetic field is points. Then, Eq. \[eq:Skprofile\] provides the solution on the segment $\theta_0\in[\pi,\frac{\pi}{2}]$ and $\rho\in[0,\frac{2D'}{B'}]$, which for every given direction with the fixed angle $\varphi$ describes the quarter period of the spin spiral as shown in the left panel of Fig. \[fig:SkProf\]. As it is mentioned in the main text, in the case of the $C_{nv}$ symmetry, the single skyrmion is nothing more than a superposition of three and two spin spirals for the case of the triangular and square lattice respectively. Therefore, one has to restore the second quarter of the period of a spin spiral and the rest can be obtained via the symmetry operation $\rho\to-\rho$.
The second part of the spin spiral can be found by shifting the variable $\rho$ by $\rho_0$ in the skyrmionic solution as $\sin\theta_0 =~ B'(\rho-~\rho_0)/2D'$. In order to match this solution with the initial one, the constant has to be equal to $\rho_0=\frac{4D'}{B'}$. Since the magnetization is defined as a continuous and differentiable function, the angle $\theta_0$ can only vary on a segment $\theta\in[\frac{\pi}{2},0]$, otherwise either the ${\bf e}_{\rho}$, or ${\bf e}_{z}$ projections of the magnetization will not fulfil the mentioned requirement. The correct matching of the two spin spirals is shown in Fig. \[fig:SkProf\] a), while Fig. \[fig:SkProf\] c) shows the violation of differentiability of ${\bf m}_{z}$ and Figs. \[fig:SkProf\] b), d) give a wrong matching of ${\bf m}_{\rho}$. Thus, the magnetization at the boundary of the skyrmion at $\rho=R=\frac{4D'}{B'}$ that defines the radius $R$ points up, i.e. ${\bf m}_{z}(\rho_0)=1$, which perfectly matches with the FM environment that is collinear to a constant magnetic field ${\bf B}$.
![Possible matching of the two parts of the spin spiral.[]{data-label="fig:SkProf"}](FigS2.pdf){width="0.5\linewidth"}
![Skyrmionic radius for two different values of the magnetic field. The larger field favours more compact structures ($R_2<R_1$) as shown in the right panel. Red arrows depict the skyrmion, while the two black arrows are related to the ferromagnetic environment.[]{data-label="fig:SkR"}](FigS3.pdf){width="0.5\linewidth"}
It is worth mentioning that the obtained result for the radius of the skyrmion $R=\frac{4D'}{B'} = \frac{8DSa}{B}$ is fundamentally different from the case when the skyrmion appears due to a competition between the exchange interaction and DMI. The radius in the later case is proportional to the ratio $J/D$ and does not depend on the value of the spin $S$, while in the Hiesenberg-exchange-free case it does. Although in the absence of DMI both, the exchange interaction and magnetic field, favour the collinear orientation of spins along the $z$ axis, the presence of DMI changes the picture drastically. The spins are now tilted from site to site, but the magnetic field still wants them to point in the $z$ direction and the exchange interaction aligns neighboring spins parallel without any relation to the axes. This leads to the fact that the stronger magnetic field decreases the radius of the skyrmion, while the larger value of the exchange interaction broadens the structure. This is also clear from Fig. \[fig:SkR\] where in the case of zero exchange interaction the larger magnetic field favours the alignment with the smaller radius of the skyrmion $R_2<R_1$ shown in the right panel.
Finally, the obtained skyrmionic structure is shown in Fig. \[fig:Sk\]. It is worth mentioning that our numerical study corresponds to $B\sim{}D$, so the radius of the skyrmion is equal to $\rho_{0}\sim4Sa$, which is of the order of a few lattice sites. Although for these values of the magnetic field the micromagnetic model is not applicable, because the magnetization changes a lot from site to site, it provides a good qualitative understanding of the skyrmionic behavior and still matches with our numerical simulations.
The corresponding skyrmion number in a two-dimensional system is defined as $$\begin{aligned}
N=\frac{1}{4\pi} \int dx\,dy\,{\bf m} \left[ \partial_{x}{\bf m}\times\partial_{y}{\bf m}\right]\end{aligned}$$ and then equal to $$\begin{aligned}
N=\frac{1}{4\pi} \int dx\,dy\,\frac{1}{\rho}\sin\theta\,\dot\theta_{\rho} = \frac{1}{4\pi} \int d\rho\,d\varphi\,\sin\theta\,\dot\theta_{\rho} = \frac12\left(\cos\theta(0) - \cos\theta(\rho_{0})\right) = 1.\end{aligned}$$ One can also consider the case of zero magnetic field. Then, solution of the Euler-Lagrange equations $$\begin{aligned}
\left\{
\begin{matrix}
\dot\psi_{\varphi} = \rho\tan(\psi-\varphi)\,\dot\psi_{\rho},\\
\dot\theta_{\varphi} = \rho\tan(\psi-\varphi)\,\dot\theta_{\rho}
\end{matrix}
\right.\end{aligned}$$ describes a spiral state, as shown in Fig. \[spinfactors\].
![Spatial profile of the skyrmionic solution.[]{data-label="fig:Sk"}](FigS4.pdf){width="0.32\linewidth"}
Solution for small $J'$
-----------------------
Now, let us study stability of the skyrmionic solution and consider the case of a small exchange interaction with respect to DMI. The first order in the limit $\alpha\ll1$ implies $$\begin{aligned}
\left[ \rho^{2}\,\ddot\theta_{0} + \rho \dot\theta_{0} - \sin\theta_{0}\cos\theta_{0} \right]
\pm 4 \rho\sin\theta_{0}\cos\theta_{0}\, \theta_{1}
- \beta\rho^{2}\cos\theta_{0}\,\theta_{1}
=0 \,.\end{aligned}$$ The zeroth order solution leads to $$\begin{aligned}
\cos \theta_{0} \, \dot\theta_{0} = \pm \frac{\beta}{2} ~~~\text{and}~~~ \cos\theta_{0} \, \ddot\theta_{0} -\sin\theta_{0} \, \dot\theta_{0}^{2} = 0 \,.\end{aligned}$$ This results in $$\begin{aligned}
&\rho^{2}\frac{\sin\theta_{0}}{\cos\theta_{0}} \left(\frac{\beta}{2\cos\theta_{0}}\right)^{2} \pm \rho \frac{\beta}{2\cos\theta_{0}} - \sin\theta_{0}\cos\theta_{0} = - \beta \rho^{2} \cos\theta_{0} \, \theta_{1}
\notag\\
&\pm \left(\frac{\beta\rho}{2}\right)^{3}\frac{1}{\cos^{4}\theta_{0}} \pm \frac{\beta\rho}{2} \frac{1}{\cos^{2}\theta_{0}} \mp \frac{\beta\rho}{2} = - \beta \rho^{2} \, \theta_{1}
\notag\\
&\beta \rho^{2} \, \theta_{1} = \mp \left[ \left(\frac{\beta}{2} \rho \right)^{3} \frac{1}{\cos^{4}\theta_{0}} + \frac{\beta}{2} \rho \left( \frac{1}{\cos^{2}\theta_{0}} - 1 \right) \right] \notag\\
&\theta_{1} = - \frac{\beta}{4}\sin\theta_{0} \left[ \frac{1}{\cos^{4}\theta_{0}} + \frac{1}{\cos^{2}\theta_{0}} \right]
\,,\end{aligned}$$ provided $\cos\theta_{0}\neq0$. Therefore the total solution for the skyrmion $$\begin{aligned}
\theta = \theta_{0} - \frac{J'B'}{4D'^2}\sin\theta_{0} \left[ \frac{1}{\cos^{4}\theta_{0}} + \frac{1}{\cos^{2}\theta_{0}} \right]\end{aligned}$$ is stable in the two important regions when $\sin\theta_0=0$ – around the center of skyrmion and at the border. The divergency of the correction $\theta_1$ in the middle of the skyrmion when $\cos\theta_0=0$ comes from the fact that the magnetization is poorly defined here, as it was discussed above.
|
Q:
no default constructor exists
I'm having some trouble with a class that was working fine and now doesn't seem to want to work at all.
The error is "No appropriate default constructor available"
I am using the class in two places I'm making a list of them and initializing then adding them to the list.
Vertice3f.h
#pragma once
#include "Vector3f.h"
// Vertice3f hold 3 floats for an xyz position and 3 Vector3f's
// (which each contain 3 floats) for uv, normal and color
class Vertice3f{
private:
float x,y,z;
Vector3f uv, normal, color;
public:
// If you don't want to use a UV, Normal or Color
// just pass in a Verctor3f with 0,0,0 values
Vertice3f(float _x, float _y, float _z, Vector3f _uv,
Vector3f _normal, Vector3f _color);
~Vertice3f();
};
Vertice3f.cpp
#include "Vertice3f.h"
Vertice3f::Vertice3f(float _x, float _y, float _z,
Vector3f _uv, Vector3f _normal, Vector3f _color){
x = _x;
y = _y;
z = _z;
uv = _uv;
normal = _normal;
color = _color;
}
It is being using in my OBJModelLoader class as follows:
list<Vertice3f> vert3fList;
Vertice3f tvert = Vertice3f(
x = (float)atof(
vertList[i].substr(
vertList[i].find("v") + 1,
vertList[i].find(" ", vertList[i].find("v") + 2, 10)
).c_str()
),
y = (float)atof(
vertList[i].substr(
vertList[i].find(" ", vertList[i].find("v") + 4, 10) + 1,
vertList[i].find(" ", vertList[i].find("v") + 13, 10)
).c_str()
),
z = (float)atof(
vertList[i].substr(
vertList[i].find(" ", vertList[i].find("v") + 13, 10) + 1,
vertList[i].find(" ", vertList[i].find("v") + 23, 10)
).c_str()
),
::Vector3f(0.0f,0.0f,0.0f),::Vector3f(0.0f,0.0f,0.0f),::Vector3f(0.0f,0.0f,0.0f)
);
vert3fList.push_back(
tvert
);
I have tried defining a default constructor myself so in the .h I put
Vertice3f();
and in the cpp
Vertice3f::Vertice3f(){
x = 0.0f;
y = 0.0f;
z = 0.0f;
uv = Vector3f(0.0f,0.0f,0.0f);
normal = Vector3f(0.0f,0.0f,0.0f);
color = Vector3f(0.0f,0.0f,0.0f);
}
So, I'm not sure why it can't find a default constructor or how to appease the compiler. I'm sure it's user error because the compiler probably knows what it's doing.
Any help is greatly appreciated, I will answer any other questions you have, just ask.
A:
I'd guess that the missing default constructor is the default constructor of Vector3f class, not of Vertice3f class. Your constructor of Vertice3f attempts to default-construct its Vector3f members, which leads to the error.
This is why your attempts to provide default constructor for Vertice3f don't change anything. The problem lies, again, with Vector3f.
To fix it either provide all necessary default constructors (assuming it agrees with your design), or rewrite the constructor of Vertice3f by using initializer list instead of in-body assignment
Vertice3f::Vertice3f(float _x, float _y, float _z,
Vector3f _uv, Vector3f _normal, Vector3f _color) :
x(_x), y(_y), z(_z), uv(_uv), normal(_normal), color(_color)
{}
This version no longer attempts to default-construct anything. And using initializer list instead of in-body assignment is a good idea in any case.
|
OpenDoc in Microsoft Office a Reality
The OpenDocument Foundation has developed a plug-in for Microsoft Office that would provide transparent compatibility with ODF, allowing users to open and save like any other office document.
The group has apparently been working on the plug-in for quite some time, however only publicly acknowledged it after the state of Massachusetts put out a request on Wednesday.
The request asked for information on a plug-in that would "allow Microsoft Office to easily open, render, and save to ODF files, and also allow translation of documents between Microsoft's binary (.doc, .xls, .ppt) or XML formats and ODF."
According to the OpenDocument Foundation, the plug-in would work for any version of Office from Office 97. Testing of the plugin has been completed by the group and no issues have arisen.
The group is now in the process of submitting the plug-in to the state through the proper channels, it told Groklaw in an interview Thursday.
While some may find the organization's moves as somewhat contradictory to its stated premise, OpenDocument Foundation's Gary Edwards does not.
This isn't about Windows, Edwards told Groklaw. "It's about people, business units, existing workflows and business processes, and vested legacy information systems begging to be connected, coordinated, and re-engineered to reach new levels of productivity and service."
"It's also about the extraordinary value of ODF and it's importance to the next generation of collaborative computing," he continued.
It is not clear if the group plans to make the plug-in publicly available. |
Flóra Gondos
Flóra Gondos (born 11 April 1992) is a Hungarian diver. She competed in the 3 m springboard at the 2012 Summer Olympics.
References
External links
https://www.sports-reference.com/olympics/athletes/go/flora%2Dgondos%2D1.html
Category:1992 births
Category:Living people
Category:Divers at the 2012 Summer Olympics
Category:Olympic divers of Hungary
Category:Hungarian female divers |
Popular
March 25, 2009
Scientists Find New Way To Battle MRSA
by Sam Savage
Experts from Queen's University Belfast have developed new agents to fight MRSA and other hospital-acquired infections that are resistant to antibiotics. The fluids are a class of ionic liquids that not only kill colonies of these dangerous microbes, they also prevent their growth.
The development of these new antimicrobial agents was carried out by a team of eight researchers from the Queen's University Ionic Liquid Laboratories (QUILL) Research Centre. The team was led by Brendan Gilmore, Lecturer in Pharmaceutics at the School of Pharmacy, and Martyn Earle, Assistant Director of QUILL. The discovery is published in the scientific journal Green Chemistry.
Many types of bacteria, such as MRSA, exist in colonies that adhere to the surfaces of materials. The colonies often form coatings, known as biofilms, which protect them from antiseptics, disinfectants, and antibiotics.
Earle said: "We have shown that when pitted against the ionic liquids we developed and tested, biofilms offer little or no protection to MRSA, or to seven other infectious microorganisms."
Ionic liquids, just like the table salt sprinkled on food, are salts. They consist entirely of ions - electrically-charged atoms or groups of atoms. Unlike table salt, however, which has to be heated to over 800o C to become a liquid, the ionic liquid antibiofilm agents remain liquid at the ambient temperatures found in hospitals.
One of the attractions of ionic liquids is the opportunity to tailor their physical, chemical, and biological properties by building specific features into the chemical structures of the positively-charged ions (the cations), and/or the negatively-charged ions (the anions).
Earle said: "Our goal is to design ionic liquids with the lowest possible toxicity to humans while wiping out colonies of bacteria that cause hospital acquired infections."
Microbial biofilms are not only problematic in hospitals, but can also grow inside water pipes and cause pipe blockages in industrial processes.
Gilmore said: "Ionic liquid based antibiofilm agents could potentially be used for a multitude of medical and industrial applications. For example, they could be used to improve infection control and reduce patient morbidity in hospitals and therefore lighten the financial burden to healthcare providers. They could also be harnessed to improve industrial productivity by reducing biofouling and microbial-induced corrosion of processing systems." |
SA Promo
SA Promo is a magazine published monthly in the United Kingdom since 2006. It is printed in A5-size format and is targeted at the community of approximately 1,500, 000 expatriate South Africans living in the United Kingdom.
History
SA Promo was founded in November 2006 by J. C. Muller and Justin Lester, who saw an opportunity after South Africa rejoined the Commonwealth post-apartheid. This allowed South Africans to apply for a working holiday visa to live and work in the United Kingdom for a period of two years. The United Kingdom saw an influx from South Africa, many of whom have subsequently settled in the country. On the 27 November 2008 the UK working holiday visa was replaced by a Point Based Visa System. The South African government does not have a reciprocal agreement with the British government and therefore no longer qualify for this category of visa.
In 2014 the SA Promo changed focus to cater for all South Africans and not just South Africans abroad.
Circulation & Distribution
Internationally
With South Africans relocating all over the world the demand for media aimed at South Africans abroad has increased. SA Promo magazine is now available as an online magazine accessible from anywhere in the world.
Online
SA Promo magazine is available to read online, providing access to the magazine from anywhere in the world. The website also offers a comprehensive directory of South African businesses and organisations abroad.
References
External links
SA Promo
Category:British magazines
Category:Magazines established in 2006
Category:British monthly magazines |
Effects of transthoracic impedance and peak current flow on defibrillation success in a prehospital setting.
To assess whether transthoracic impedance and peak current are determinants of defibrillation success in patients with out-of-hospital ventricular fibrillation (VF). A retrospective cohort study was carried out in a suburban Canadian EMS system. Participants were patients who experienced out-of-hospital cardiac arrest in the regional municipality of Ottawa-Carleton, had VF rhythm at presentation, and received countershocks from the Laerdal Heartstart 2000 automated external defibrillator. A total of 310 patients met the inclusion criteria. Collectively they received 717 countershocks. The first shocks were successful in converting VF rhythm 25.5% of the time. The most important determinant of shock success was the interval from when the call was received until delivery of the first shock (P<.01). Length of time at scene, current, impedance, and patient age were not significant determinants of success of first shock. The time interval until first shock was also a determinant of survival (P<.01). EMS response time, whether the arrest was witnessed, initial impedance, and current were not determinants of survival. OHCA shock success and survival are associated with EMS system factors such as the interval from when the call was received until delivery of the first shock. The importance of impedance and peak current remain theoretic for out-of-hospital defibrillation success and did not influence defibrillation success in this study. |
Kruczynek
Kruczynek () is a village in the administrative district of Gmina Nowe Miasto nad Wartą, within Środa Wielkopolska County, Greater Poland Voivodeship, in west-central Poland. It lies approximately south of Środa Wielkopolska and south-east of the regional capital Poznań.
References
Kruczynek |
Interfaith
if you were in an interfaith relationship, how would you raise your children?
j(wh) and i have asked that question several times as we’ve discussed what the future may hold for us. and it will continue to be a topic of conversation, i’m sure. i have, from very early in our relationship, taken the stance that, if we were to marry and have children, our (hypothetical) children should be taught the beliefs and history of both of our faith traditions; that they should attend both quaker and mormon meetings regularly (not both every Sunday, but on some kind of split schedule); that they should have both quaker and mormon communities; and that ultimately they should decide for themselves (when they’re older than eight) which tradition works for them—or that neither works for them.
j(wh) sees the balance and fairness in such a suggestion, but he still has reservations about raising his children with any exposure to mormonism. primarily because he fears the ways in which mormonism could cause them pain—the pain and depression he’s seen me experience because of the church’s teachings about gender and marriage; the pain men and women close to us have felt as they’ve attempted to fit themselves into the mold the church prescribes; the pain some of our friends felt as they left the mormon community. he doesn’t want to expose his children to a belief system that can generate such deep psychological and spiritual hurt. and i do not blame him. in fact i agree with him. i don’t want my children exposed to such pain either.
while we haven’t resolved this particular problem, we both very much believe there is a middle ground—a way to teach our (hypothetical) children about both of our faith traditions while doing our best to control for teachings we believe are harmful. that middle ground is possible because j(wh) and i share deeply cherished values and we envision living those values in similar ways. in other words, while our formal faith traditions are different, our beliefs are very similar.
as we’ve discussed this question, j(wh) has asked me whether i know anyone who has raised their kids the way i’m suggesting we should raise our (hypothetical) children—half in the mormon church, half in another church. and i’ve had to say that, no—i don’t. so i went searching the bloggernacle for other people’s experiences, trusting i would find useful information. i was rather surprised at what i did find.
but i also found ideas that very much disturbed me. here’s a few, in brief:
that a woman will be ‘available’ to be sealed to a man in the next life, regardless of whether she stays single or marries a non-mormon. the implication being that were such a woman to marry a non-mormon, she would not be sealed to her non-mormon spouse.
that marriage to a non-mormon pre-supposes a ‘divorce-upon-death.’ again implying that it’s impossible for an interfaith marriage to be sanctioned in the next life.
that there should be a pre-nup understanding that the non-mormon spouse’s failure to actively support the LDS lifestyle would constitute sufficient grounds for divorce.
that a mormon marries a non-mormon out of desperation for sex and companionship.
that when a mormon marries a non-mormon, the mormon has settled for marrying someone who does not cherish the same values.
that marriage is about making babies, not about the spouses. that therefore, because marrying a non-mormon will jeopardize future children’s moral character, interfaith marriage should be avoided at all costs—even the cost of debilitating depression and loneliness.
that interfaith parents necessarily compete for control of their children’s moral training—because clearly they couldn’t have moral values in common.
that the children of interfaith marriages should, obviously, be raised exclusively mormon.
that marriage is teleological—about the ends achieved, rather than about the way life is lived now.
that mormons in interfaith marriages should be pitied, as if their marriages must be a daily burden instead of a source of joy and happiness.
that only mormons with serious testimony issues or rebellious natures marry outside the church.
that marrying a non-mormon constitutes a deliberate and active sin.
as i read these various posts and comments—literally hundreds of comments—i was stunned. and furious. and sad.
sad because essentially what i heard over and over was that interfaith marriage is inherently lacking; that it constituted sin; that it was begging for trouble. sad because of the lack of faith—faith that god will sanction any marriage built on love and equality and sound foundations, rather than just those begun with the proper ritual and form. i cannot understand the privileging of form (starting a marriage with a temple sealing) over principle (building a strong, loving, lasting marriage—a ‘celestial’ marriage, if you will). i cannot understand it in spite of my acceptance of the importance of saving ordinances.
my search for ideas about how to build interfaith marriages and families also took me to a couple of articles in dialogue. and it was there i found what felt right to me. in his short article “eternity with a dry-land mormon,”* levi peterson explains the rites of “baptism, confirmation, healing, and wedding” as ordained by god “for the comfort, not the condemnation, of human beings. a ritual is not a ticket allowing one to enter a certain door or gate. it is a reminder and a symbol; it concentrates meaning and rouses emotion” (113-4). this understanding of ordinances resonates with me. it makes sense to think of rites as focusing attention on living principled, examined lives while recognizing that they are not the only means of doing so.
peterson later concludes: “a wedding announces a marriage, celebrates it, establishes its hope and ideal, but doesn’t create it. the joy a couple has in one another’s presence creates their marriage. i therefore believe that, if god grants althea and me to participate in the miracle of the resurrection, he will also grant us the privilege of continuing our marriage. there will need be no other reason than that we have loved each other long and dearly” (115). i could not agree more fully. for me, love is the well-spring of the gospel. it is the power that should direct our daily lives. it is the hope i feel for myself and my world. love—not form—will lead to exaltation. form, ritual, ordinances can only help set expectations of love, focus attention on love; they cannot take love’s place.
because my own interfaith relationship is with a quaker, i read heidi hart’s article “householding: a quaker-mormon marriage”** with great interest. i appreciated her story of spiritually journeying away from mormonism into quakerism; of her and her husband’s efforts to not only preserve their marriage, but to use their divergent spiritual paths as an opportunity to strengthen their marriage. she speaks of a jewish creation story in which “god’s divinity is shattered into pieces at the beginning of the world. . . . that our job as human beings is to gather the pieces of goodness scattered all around us,” regardless of where they lay (142). i understand this vision because i see goodness everywhere in my world. i have no interest in making all of that goodness mormon, in redefining it so it fits neatly somewhere in the mormon cosmology. i am interested in exploring the goodness where it lays, in coming to understand how the goodness in mormonism and the goodness outside mormonism work together to make a beautiful world.
it is that desire, as much as any sense of fairness, that inspires my desire to raise (hypothetical) children with j(wh) as truly interfaith. i know it’s an unusual desire for a mormon. i know it will be a course with challenges. but i believe it can be done. because i believe that “it’s not our differences that divide us. it’s our judgments about each other that do” (150)**.
so why am i writing this post? i suppose i’m writing it in hopes that i’ll find some mormons who don’t agree with the crazy notions i encountered in the bloggernacle. more importantly i’m writing it hoping for thoughts about how to go about raising truly interfaith children. i don’t particularly want to repeat the extremely long, extremely hurtful discussion that happened at times & seasons a few years ago; which means that i’m not particularly interested in talking about whether a mormon should marry a non-mormon in the first place. the reality is that it happens. instead, i’m interested in ideas about how to go about building a strong, interfaith family (not just a mormon or a quaker family with one parent who believes differently).
Share this:
Related
Amelia has recently relocated to Salt Lake City for her new job selling college textbooks (a job she loves). She’s a 9th generation Mormon redefining her relationship with the church (the church she both loves and hates). She’s passionate about books, travel, beauty, and all things cheese.
In addition to her Dialogue article, you need to read Heidi Hart’s book, _Grace Notes_, about raising her family in an LDS/Quaker home (she’s Quaker, her husband is LDS, and their children are primarily LDS but also are a part of the Quaker community). She’s also done several Sunstone sessions on this topic that are available for download as mp3s.
2 things:
I am concerned about potential husband’s attitude towards your faith; if his primary reaction is fear of that faith because it causes pain, that seems to indicate a lack of support for you and your chosen religion.
Also, you seem a bit knocked off your feet with the idea that some LDS people (of course the vocal ones) will disapprove of your marriage. That is a fact, some people will. Why does it matter to you? It seems that if you were more at ease with the prospect, other people’s opinions would not matter.
I want to say that I think such an interfaith family could exist peacefully and happily, but I just don’t know if I have that much faith in the Mormon community. I wouldn’t trust them to not treat your kids as “the ones with the crazy parents”. Since my marriage is turning out to be a little more interfaith than I even expected, I would also like tips on how to handle it.
While at BYU, I took the missionary prep class taught by Randy Bott, and of all the many motivational things he said, the single thing I remember from that full semester is when he told the class that he would rather his daughters died than marry outside the temple. Such talk can be so damaging, where it creates the sense that non-temple marriage is evil and/or damning (in the sense that you will never be exalted). The conclusions in your bullet points are many times the result of such black and white declarations, which are, in the first place, only given as opinion.
I’m currently having a very hard time separating the important bits of doctrine from the actions of the church and its members, and the idea that my marriage is doomed for eternity if I don’t shape up and fix my beliefs doesn’t give me hope, it is heart wrenching. I would rather just concentrate on how much we love each other and are trying to make each others’ lives better while creating a loving family.
I agree with the poster who notes your husbands very negative view of the LDS faith; I would add that you also seem ambivalent at best about your religion. In light of your views, I do not agree with your idea of taking your children to both churches and “letting them choose”. Children need a spiritual foundation that they can build from, not competing ideas and mixed messages. I think you should raise them as Quakers if you truly believe that taking them to an LDS primary would cause them pain.
Amelia,
Thanks for this thoughtful post! I’m glad to have someone to share Mondays with 🙂
You hit the nail on the head when you asked about what an interfaith family would look like. It seems easy to talk about some kind of religious balance, but how that actually plays out can be much different. The devil’s in the details, I guess.
I’m not in the same situation, but I do think there are adjustments that families have to make as one of the parents becomes less (or non) believing in the LDS church. I think I’m on that path. Of course, starting out a marriage expecting the interfaith issue is a lot different than starting out in the temple and thinking you’ll both be on the same religious wavelength for the rest of your lives (and eternity).
I appreciate your research on this topic and it will be so helpful to refer people to this post in the future.
Best of luck in your journey.
Wow. I think some commenters are not focusing enough on how similar your beliefs are to j(wh). If you two believe in the same principles of kindness, charity, love, and equality, I think you can make it work.
Obviously there would be difficulties. It will get complicated when they learn in primary that only families that are sealed can be together forever. But like you, I think you can control for that. Tell them that that’s how some Mormon’s look at it, but others believe in God’s grace and love and that we’ll be with our loved ones in the hereafter. Give them the Quaker viewpoint on the subject. Ask them what’s the most compelling to them and why. I think this could lead to some wonderful discussions where the kids’ can learn to take the best from these two great religious traditions.
I also wanted to comment on how jaw droppingly awful it is to hear Mormon’s say they’d rather their children die than marry outside the church. Sarah, that was a horrific story. Also awful was that discussion on T&S that you linked too, Amy. I’m shocked that anyone could for a second think that no marriage is better than a great marriage to a non-Mormon. Absolutely ridiculous in my opinion. Would anyone really wish that on our friends and family? (Not that a single life can’t be great, but if someone has that chance to find a companion and have children, and that’s what he/she desires, good grief, how could you not see how potentially wonderful that marriage could be for them?)
I find it really sad that some Mo’s don’t have faith that God in all his infinite love won’t be completely compassionate and sympathetic towards those in interfaith marriages and ultimately ratify those marriages in the next life. Of courses, I am the product of an interfaith marriage, so maybe I’m biased.
Thank you for this thought provoking post, Amelia. It briefly reminded me of a conversation with my current home teacher. He knows that I am interested in women’s issues so he told me that he wrote his thesis on why Mormon women marry outside of the church. Unfortunately, most of his conclusions could be found in your bulleted points. He was none to pleased when I told him that I thought that his points did not fully explore the complexity of why many LDS women choose to marry non-members.
I am a firm believer that each couple must develop a theology that they will teach to their children. All couples do this regardless of whether they are interfaith or devout Mormons; we all pick and choose portions of the doctrine that are very important to us and overlook things that are not.
This is something that my husband and I are currently working on. There are several aspects of Mormon doctrine and culture that are profoundly hurtful to me and I must say that I have the same fears that j(wh) has expressed. In order to assuage some of my reservations, DH and I are working towards a theology of our own to give to our children. Personally, I think this is one of the greatest gifts you can give your children, a belief system that you have deeply explored and are committed to living and sharing.
Why does this conversation have to be limited to interfaith relationships? Parents will have their biases and, I would imagine, it would easier if they shared those biases, but let’s be honest: even in monofaith relationships, the individual parents are unlikely to have the exact same interpretations of the faith. If I were a parent, I would explore as many faiths, perspectives, and community as I could with my children, because not only would I want them to find their own truth, but I want to expose them to diversity–not only for the sake of being able to learn the impotency of discrimination, but also to find those golden areas that all faiths teach: compassion, love, respect, etc.
But of course faith is more than just values, right? It is also about community. I don’t have a good personal answer for how I would deal with this as a parent, but what I do know is that if I loved and chose to marry someone of a different faith-perspective than my own, there comes the implicit understanding that for any harm that the faith and faith community she comes from must be balanced with the fact that it also made her who she is–and I simply have to respect that to some level. Maybe it’s because the faith instilled good values; maybe it’s because the hurt and struggle made her learn good lessons; likely, it is both and more. But how does that translate to the children?
I have to go back to my original point, though: it may be magnified in an interfaith relationship, but these issues of values, faith, and community are something I believe all parents must struggle with.
I don’t know if this is way off base with the questions you’ve asked in your post and with the other comments here, but it occurred to me today as I was thinking of you and J(wh) and contemplating your relationship. What I’m wondering is do you, Amelia, have enough faith?
I mean, do you have enough faith in J(wh) as someone who will be a loving and righteous husband? Do you have enough faith in yourself to be the spouse that he deserves? Do you have enough faith that the two of you together can weather the challenges that will come when your kids come home from LDS church repeating some racist folklore? Do you have enough faith in a God who loves you and who wants you to be happy? Do you have enough faith to deal with the hurtful and pitying comments from LDS members about part-member families? Do you have enough faith to step into the unknown without the support of your family and your church community?
I know you have the gumption to do all of this–you are one of the most strong-willed people that I know. But having faith and having gumption are not necessarily the same thing.
i appreciate the concern ESO and E expressed, but i feel like i must not have communicated the nuances of my situation well. so a couple of things to clarify:
1. j(wh)’s fear regarding mormonism has to do with raising children mormon; not with my own involvement in it. he supports me in my chosen religion and my practice of it and i think he always will. he has no desire to change the way i believe because he recognizes that it’s not his place to change the way i believe.
2. i couldn’t care less what other random mormons think about my relationship with or my potential marriage to j(wh). what upset me about what i found on the bloggernacle was not anticipation of others responding to me in that way–i have a very thick skin and pretty often dismiss the stupid things i hear people say at church (and everywhere else). what shocked me was that people actually think these things. at all. they’re so clearly not in keeping with the peace and charity and compassion and mercy and love of christ’s gospel, that i have a hard time understanding how people can think them. such thoughts have never even occurred to me.
3. i’m not ambivalent about my religion. but i do believe that every individual has their own particular understanding of religion. i’m very passionate about my understanding of my religion and i live it fully. the thing is that my personal version of my religion very much aligns with many of j(wh)’s beliefs and values. so i don’t think our children will be without a foundation. quite to the contrary, i believe they’ll have an even more solid foundation than many traditionally raised mormon children. because i won’t simply trust that all the random mormons who teach my kids in primary, sunday school, YW/YM, and seminary think the same way i do. if anything, i think the difference in our religious beliefs will make j(wh) and i more involved and proactive about shaping our (hypothetical) children’s moral and spiritual foundation than the average mormon family.
and i’m not married to him yet. though i want to marry him someday. 🙂
sarah: i understand and share your concern about the openness of the mormon community. i would hope that a faith community would not be so petty in how it responds to others, but i know i can’t really expect that. i suppose i respond to the concern in a couple of ways. 1. trying to be in touch enough with my kids that i hear about such instances; and 2. making sure that my kids have a diverse enough community that when some freaky mormon makes them feel bad because they’re from a part-member family or because they’re black or whatever, they’ll realize that those individuals aren’t like the other people in their larger community.
and i think randy bott’s statement about his daughters being better off dead than married outside the temple is utterly unconscionable. what a truly awful thing to say.
as for your last concern–about separating the opinions/behavior of church members from doctrine, i think you should read levi peterson’s article i referenced. if you go here:
caroline: thanks for calling attention to the importance of shared values. i think it’s such a mistake to believe that if two people don’t share a religion, they therefore don’t share beliefs and values and morals. nothing could be further from the truth. why would two people get married if they didn’t share those things?
and i like your idea of talking to kids about beliefs. i realize that to a certain extent that’s an idealized vision of how things can be. but at the same time i think we far too often sell short our children and their ability to think and consider and understand truth.
mraynes and jessawhy: i appreciate your calling attention to the fact that any set of parents must navigate the differences between their beliefs. i really think it’s a mistake for a couple to assume they’re on the same wavelength in terms of spiritual and religious beliefs simply because they’re both mormon. no marriage is without its challenges in terms of reconciling different beliefs and understandings. while those differences may be more apparent in an interfaith marriage, i don’t think that necessarily means they’re insurmountable. it could, in fact, mean they’re more workable (as long as the two partners are willing to do the work) since they’re more visible.
okay, so after that long comment, a little more. do put up with me a bit longer. 🙂
isaac: i really appreciate your comment and completely agree with you about every marriage requiring a negotiation of differing beliefs. and i really like your suggestion about exposing children to a wide variety of religions. i’ve thought about that–going to visit another church every once in a while–as a means of removing some of the potential for competition between our two religions. you know–letting children know that there are many ways people experience the divine. and that many of them do have the kinds of commonalities you identify.
in addition to community, i think faith is also about history and heritage. maybe those things are caught up in ‘community.’ but i just keep coming back to the fact that even if i were to stop practicing mormonism (which i don’t envision ever happening), i’d still be mormon. it’s part of me.
jana: the simple answer is yes. i have the purest, strongest faith i’ve ever experienced in j(wh), in myself, and in god. i could not experience the peace and joy that i am experiencing in this relationship if i didn’t. even when j(wh) and i have had difficult conversations about this (and other topics), i continue to experience that peace and trust. it’s incredible. and beautiful.
I am in a very similar situation to you where I am LDS and the boyfriend (hopefully future husband) is not. Except for I very recently converted to my religion, while my boyfriend remains mainline/liberal Protestant. Like j(wh), J (my boyfriend) is concerned about exposed our (hypothetical) kids to mormonism. He’s afraid that some things that the church teaches are damaging – and I agree. But many of the things the church teaches are wonderful! The question is, can kids filter out the bad and embrace the good like I do as an adult? Not without guidance.
If I had the perfect interfaith family (though nothing ever goes to plan) I would teach them both my and J’s religions and treat them equally. I would be very careful to discuss what the kids heard in primary, and to modify any damaging ideas that they received. This should be repeated with J’s religion. J thinks that it’s best that a family is united in faith and only attends one church. I think that it’s perfectly fine to attend two church services and let the kids decide when they are old enough.
Most importantly, before I build an interfaith family, I and J must be a truly interfaith couple. He and I need to fully respect and accept each other’s religion. We must be able to say, “I love you and I want to be a part of anything that is important to you. Teach me about your beliefs. I’ll listen with an open heart and only ask questions to clarify things.” I would like J to take lessons from the missionaries, and if/when he joins a church in his new city, I’ll participate in the new member class. J and I aren’t to this point yet, but I believe that once we are, the issues around raising children in an interfaith marriage will diminish greatly.
So it’s a struggle and I know J is upset that I’ve joined a church without him – especially a church that he would not choose for himself. We talk talk talk about it, and I try not to get upset about it. It’s one thing to go into a relationship where you know that you’ll be an interfaith couple, and it’s quite another to make that change in the midst of it all.
ps – I know it’s hard, but ignore those crazy, hurtful things people write on the internet. Just look into your heart and you’ll know what’s right. 🙂
I find it ironic and sad that this post–calling for tolerance and love–has prompted a string of comments so critical and dismissive of Randy Bott and those who share his view on this topic.
Amelia, it sounds like you and j(wh) are working this through and are in a good place to build the type of family you envision. Certainly it is possible to build a loving, successful interfaith family–I know many such families!
On the other hand, an interfaith family is not what everyone wants–I know, because it’s not what I want. For me, my choice is to stay single until I have the opportunity for a temple marriage (and yes, I realize that’s no magic guarantee, that any type of marriage requires a huge amount of work, etc.). I feel so strongly about that for myself that I’m certain I will feel the same way about my children–isn’t it only natural that a parent wants the same things for their children that they want for themselves? Of course I can’t speak for Randy Bott, but I suspect that’s somewhere along the lines of where he is coming from–I think it is *because* he cares about his daughters that he says what he does, not because he wants to cause them pain. Can’t we give him a break? I think this church is big enough for all of us, and the Botts, too.
This is a hard one. That is why you cant find much. I think each individual marriage has to find for themselves how it works.
My husband decided he was done with the church on Sunday. It is hard on a marriage to not be on the same page. It is hard when each of you want to teach your kids different things. I was shocked when he asked if this meant I would leave him. I dont think it is that simple. I told he no way. I love him and we have a good marriage.
Where we go from here I am not sure. We both love our children and want the best for them. We both agree that Christ’s teaching are something they need and if they following those teaching it will help them in their lives. How this all comes about will happen one step at a time.
I will not force my children. So some of it is up to them and what they choose. I just want to encourage them to be good people who are kind to others and make choices that will keep them from many of the pains you can experience when choosing to sin.
It is hard because I know there will be have to be compromises on both sides. Compromises on things I thought I would never compromise on.
Good luck to you. I know the Lord loves all of us and in the end if we look for His direction on behalf of our children. He will guide us in what they will need.
sunlize: thanks for sharing your experience. i think you’re right that it’s important that each partner respect the other’s beliefs. without that, i doubt an interfaith marriage/family could work. the concern about making a change of religion after a relationship has begun reminds me of some of what i read about mormon couples in which one partner left the church. the situation is a little different, but some of the feelings are the same. it might be helpful to read some of what’s available about those experiences. good luck.
melanie2: i appreciate your comment, also. of course there’s room in the church for all kinds of perspectives, including yours–i.e., preferring to remain single until you have the opportunity to marry in the temple.
i want to be very clear that my comment about randy bott’s attitude has nothing to do with either 1. preferring to remain single oneself until one can marry in the temple; or 2. preferring temple marriage for one’s children.
my own parents prefer that i marry in the temple. that has caused some difficult conversations between them and me. but while my parents feel very strongly about how important it is that i marry in the temple, they also recognize that i am the only one who can receive revelation about who and how i marry. so they accept that i should be the one to make that choice, regardless of their view.
what i find unconscionable in randy bott’s reported statement is not his preference that his children marry in the temple–not hoping his children have the same blessing he have. what’s unconscionable, in my opinion, is that his expression of that desire (i’d rather they die than marry outside the temple) proscribes his children’s right to revelation for themselves about who to marry. it implies an inability to accept and love one’s own children regardless of whether they make the same decisions one made for oneself. and it reinforces all of the misinterpretations of the church’s teaching about marriage that i listed in my post.
i agree that we should tolerate all kinds of perspectives and ideas in the church. i especially think that on the issue of marriage. but i do not think we should tolerate hyperbolic statements that imply such violence to other people’s (even our own children’s) spiritual autonomy. i realize that what inspired his comment was likely a desire that his children have the same blessing he has had and a conviction that sealing is vital. but in my mind those feelings do not justify the mode of expression he chose. i’m a firm believer that language has power beyond the intent behind what’s spoken. and i believe we have a responsibility to use that power carefully. i don’t think we should tolerate careless use of langague.
gladtobeamom: thank you so much for sharing your own experience. i’ve watched friends navigate the situation you find yourself in and i know it can be difficult. but i also know it can be done.
i’m glad that, in spite of the difference of opinion over what church to participate in, you and your husband recognize where you have the same desires for your children–teaching them about christ and his gospel. in such situations i think recognizing that you still have common ground and similar hopes for your children must be a vital beginning point. i’m sure that, while your new course will present challenges, you’ll be able to maintain your good marriage and be good parents as long as you act in love, as it sounds like you have.
as for resources: you might take a look at faces east (i linked to it in my post). there was some good conversation there. and i really thought heidi hart’s article was a great look at a marriage in which one partner left mormonism. that article is not available online, but i could mail you a photocopy of it if you’d like. email me at whilikers at hotmail dot com if you’re interested. she also has a book which would be a bit easier to find–grace notes. jana mentioned it above.
Amelia – You make a great point about the power of language and our responsibility in using it carefully. But I don’t think Bott is advocating violence, spiritually or otherwise. I see a major difference between “I would rather my daughter die than do X” and “I will kill my daughter if she contemplates doing X.” Nor did his statement say anything about how he would actually treat a daughter who chose contrary to his wishes for her, or how he would respond to her if she told him that she felt prompted to do something he disagreed with.
I took Bott’s mission prep class years ago, and while I don’t remember the specifics (or if this particular marriage discussion ever came up that semester), I know that the class as a whole did focus on the importance of agency, personal revelation, etc. Putting myself in his shoes, teaching a roomful of prospective missionaries, my priority would be getting them to focus on worthy preparation–and I think it’s pretty clear that the temple is major part of that. It may well be that making such a dramatic statement about the value of the temple–suggesting that anything less would be unthinkable for his daughters–was the best way to grab the attention of a bunch of 18-year-old boys.
You make a great point about the power of language and our responsibility in using it carefully. But I don’t think Bott is advocating violence, spiritually or otherwise. I see a major difference between “I would rather my daughter die than do X” and “I will kill my daughter if she contemplates doing X.” Nor did his statement say anything about how he would actually treat a daughter who chose contrary to his wishes for her, or how he would respond to her if she told him that she felt prompted to do something he disagreed with.
I disagree with your view on the nuance of this wording. If I say, “I’d rather you die than make this choice,” it draws a clear line in the sand about my preferences. It says, quite clearly and dramatically, “this choice is more important to me than your life.”
j(wh), I would see that differently because that would be you addressing me directly. (As you said in your example, “I’d rather *you* die…”). As far as we know, he was actually talking to a classroom of students, not to the daughter(s) in the position of making the choice. To me that makes the statement more categorical–in the same vein as other general preferences about how people live their lives. I think it’s possible to have very strong views about religious beliefs, politics, values, etc., and express those, and yet still treat those who disagree with us with love and respect (for them and for their agency).
As far as tolerance of the intolerant goes–isn’t that what tolerance really is? It’s easy to deal with those with whom we agree; the difficulty is in tolerating those who annoy us. (Which I fully admit is one of my major faults!)
Amelia, I’m sorry I’ve taken us so far off-track…I’ll step aside from the threadjack now.
i don’t think bott is advocating violence; i think he’s committing violence against his daughters’–and others’–spiritual autonomy when he makes a statement like that. i understand that such statements are rhetorically powerful–that they will in fact gain and hold attention, so much that they will be remembered long after the moment in which they are spoken. which increases the amount of violence they commit.
why do i insist they commit violence against others’ spiritual autonomy? because those words–like most of the attitudes i encountered in the bloggernacle re: interfaith marriage–constitute an unjust and unwarranted exercise of force; because they do damage to others through distortion. (definitions of violence pulled from dictionary.com)
no matter how pure bott’s intent was when he uttered those words, the fact is that they distort gospel principles. and they exert power over others–because they become mental and spiritual barriers to an individual making their own choice regarding marriage.
why do i keep talking about bott’s statement? because i don’t think doing so is actually much of a threadjack. most of my bulleted points are, in spirit, very much like bott’s comment. and i believe that bott’s comment–as well as most of the bulleted points–violate tenets of the gospel.
is it really preferable that an individual’s mortal opportunity to grow through experience, to repent of previous problems, to make the most use possible of the time god has given us on earth be cut short rather than that she/he marry outside the temple? i just cannot reconcile that with my understanding of the gospel. how does the notion that it’s better to never experience the deep love and commitment of marriage and parenting than to marry outside the temple work given the gospel’s emphasis on love? is it really better to die young, having not had the many various opportunities life gives to love others, than to marry outside the temple?
the thought simply boggles my mind. i understand preferring to marry in the temple oneself; i understand preferring that one’s children marry in the temple; i do not understand preferring one’s children die rather than marry outside the temple.
i know some would justify that last preference by arguing that the next life is a drastic improvement on this life. but i stand by my first paragraph of questions here. i cannot understand why, if this life is necessary as a period in which we grow in ways necessary for our eternal progression, it’s ever preferable that someone die. the peace of the next life may be a means of reassuring ourselves about the inevitable loss of a loved one, but i cannot understand it as a justification for preferring that loved one die rather than _________ (insert whatever un-ideal, but still fulfilling choice you’d like there).
thus my astonishment and my anger when i read the various comments i listed in my post. i simply cannot understand the kinds of attitudes that cannot recognize that in the absence of the ideal, a situation that is still incredibly wonderful is a good thing.
and quite frankly, i don’t think temple marriage is the ideal. i think a strong, loving, growing marriage is the ideal. i think that starting a marriage with a temple sealing may help in the pursuit of that ideal. but i also believe that ideal can be pursued outside the bonds of temple sealing.
one more quick thing: i think this kind of comment (like bott’s)–so exclusive and thoughtless in the effort to drive home a point so thoroughly that the listeners would be manipulated into accepting it–is one of the kinds of things that causes j(wh) to fear raising his (hypothetical) children within mormonism. please do correct me if i’m wrong, j(wh).
it’s certainly one of the things i vehemently dislike about mormonism.
Amelia,
Yes, of course a strong, loving, growing marriage is possible outside of the temple. I agree, and I never meant to imply otherwise. That’s exactly the type of marriage I want, but I also want the temple aspect. I won’t move forward with a relationship unless both components are there–I hope it’s clear that I’m not advocating a temple marriage for its own sake if love, respect, growth, and so on are not also present.
My own decision (to remain single until that type of marriage, in the temple, is possible) is the result of very specific personal revelation. I would not deny anyone’s privilege to receive exactly the opposite prompting and to act on it.
On the other hand, as important as agency and personal revelation are, I don’t think it is inappropriate for the church (and thus, the body of members)to have an institutional preference for marriage to other members, in the temple. Indeed, I think it would be absurd to have the doctrine that we have about the temple, eternal families, and so on, and then not privilege those ordinances.
That type of preference can, I believe, extend to religion professors at BYU or to parents, and I simply disagree that having a general preference is problematic or manipulative. Hyperbolic statements expressing that opinion are just that: hyperbolic. In my mind, over-the-top is not necessarily manipulative.
Unfortunately, I’m afraid there will always be those in the church who do make ill-advised, rude, and judgmental comments about others’ choices. (By this point, you may think I’m one of them, though you’ll just have to trust me that that is not my intent at all.)
Certainly some of those bullet points you listed are incredibly hurtful and demeaning. Still, I do see how some of those points stem from real gospel principles (albeit with strong doses of zeal and judgment), so I don’t see them as having the same violent quality that you seem to see.
I get the sense–though please correct me if I’m wrong–that you and I disagree on the nature of Mormonism and what it encompasses. I think our differing perspectives have a lot to do with how we see comments such as Bott’s so differently.
I hesitate to start picking apart those bullet points, but to give one example: one point suggests that a member marrying a non-member has married someone who does not share the same values. Whether or not that might be true in a given case depends greatly on what we consider to be “values.” Values like love, charity, compassion, forgiveness, integrity, faith, humility, repentance, etc. obviously transcend Mormonism. But what of temple ordinances and eternal families? What about the church’s teachings about the nature of God, the authority of the priesthood, the divine origins of the Book of Mormon and latter-day revelation? Surely those principles/beliefs–which I include in my own definition of values–do not extend to most non-members. What that difference in beliefs means to any specific relationship will vary, but I think that distinction between “values” is real for a significant number of members. Thus, you can see your values as identical to j(wh)’s, while others might think–based on their different definition–that your values are different, or at least only partially aligned.
Given what I perceive as our conflicting views, what do you say we agree to disagree?
agreeing to disagree is often a wonderful thing. 🙂 and i don’t at all think you’ve made rude or inappropriate comments, melanie–you’ve maintained a perfectly appropriate tone throughout and i genuinely appreciate your perspective. what good are these conversations if they don’t include multiple perspectives?
i agree that the church as a whole, and its members as a body, should express a preference for mormons marrying in the temple. i have no problem with that. my problem is with the kinds of exclusionary and (in my opinion) unjustifiable extensions of that.
i completely understand your point about differing understandings of what constitutes “values.” i’m sure you’re right in surmising that a large part of our disagreement over some of these things stems from different understandings of what constitutes a “value” and of our different perspectives on mormonism. i readily admit that my perspective on mormonism is a little heterodox (though i don’t think it’s unorthodox).
what i would hope is that we all have charity when it comes to looking at other people and their choices. which, to my mind, means someone assumes, as a default, that two people who choose to marry each other do in fact have values in common, rather than assuming that such commonality is impossible simply because that person couldn’t imagine such a thing for him/herself (just one example).
i try very diligently to look at others’ choices with charity, assuming they act with integrity and good intent. heaven knows i don’t always succeed. but i do try. i would hope others would, too. but when i read an entire conversation of nearly 400 comments in which the kinds of attitudes i listed above are expressed ad infinitum ad nauseum–well i get a little discouraged. and a little angry.
Thanks for your response. I wish you the best in your relationship with this wonderful man. I think you have a very challenging situation; it’s hard for me to see a solution that doesn’t seem likely to cause conflict. I’ve certainly seen many successful interfaith marriages, but never one where one or both partners think the other person’s church is a threat they need to protect their children from. I would consider professional counseling to help the two of you come to specific agreement about exactly what you will teach your children, before you decide to have them. As it stands, it still seems to me that raising them as Quakers may be the way to go.
thanks for your good wishes, E. and i agree with you re: counseling. but then, i think pre-marriage counseling is a good idea for just about any couple. it’s something i think is too often overlooked in our church. i know couples go through a series of interviews with their bishop/stake president, but from what i understand i don’t think those interviews involve the kind of counseling one would get from a professional.
For some reason I feel compelled to add my support to amelia’s stance that a statement like “I’d rather my daughters were dead than married outside the temple.” I can only think how I would feel having that comment spoken by my own father in a public environment full of strangers. I think it is highly inappropriate. If he is comfortable saying that, he should be comfortable enough to say to my face, “I would rather you die than marry outside the temple.” I do not think passive threats like that belong anywhere in a father-daughter relationship.
Also, being in an interfaith relationship myself, I couldn’t help but go through the laundry list you posted, amelia, and I am saddened. I feel like I’m going to have to grow a thicker skin.
In personal experience, I remember the feeling of trying to squish myself into the image of what I thought the Mormon men I dated were looking for. In the last couple years, I’ve let go and decided to be myself. That allowed me to be open to relationships outside the church, and I’m happier than I’ve been in a long time.
I realized I didn’t finish this thought: For some reason I feel compelled to add my support to amelia’s stance that a statement like “I’d rather my daughters were dead than married outside the temple,” is nothing but harmful.
First, I apologize for using the name of the person who made the comment. That was completely irrelevant to the discussion, and is just the sort of thing I would normally find irritating, since it has the possibility of coloring people’s opinion of the speaker, religion classes at BYU, BYU itself, etc., etc. Perhaps Melanie2 had a great experience in that class, and perhaps the offending statement was not made during the time she took it. My bringing up who said it was construed as a criticism of the speaker, and his name just should have been left out. I guess I just wanted to emphasize that this sort of thing goes on in the mainstream church, even at “The Lord’s University”.
I also cannot help but disagree that the statement was made in a passive or hyperbolic sense. Every kid in that classroom heard it, and reacted some way. Maybe some nodded with agreement, knowing in their hearts that their parents also would rather see them dead that married outside the temple. Maybe some made the decision on the spot to only marry in the temple, only to ignore promptings later on to get involved with someone who was a good person, but not a member. Using the temple as a measuring stick, to me, can express doubt in the plan of salvation, which includes the ability for people to change, to repent, to accept the gospel, to be sealed in the temple after 20 years of happy marriage. In that way, the exclusionary view of the temple being the only viable option other than death can hurt both the people who have made that choice, and those who will never be touched by them because of the choice.
Which is not at all to say that I don’t respect people who do wish to be married there. I just wish people would see that it’s not the end of the world if they don’t. It’s not a sin, it won’t necessarily cause unhappiness, it’s not a sure road to divorce. I also wish that when someone makes the decision to marry elsewhere, their friends and family members and acquaintances from church would embrace the decision and the new family member, without recrimination at a choice that would not have been their own, or hurtful or pitying comments, or talking to others with that whispered emphasis “they didn’t get married in the temple… gasp!” as if it were somehow evil.
zenaida: i understand the frustration with trying to fit expectations when one is dating. i don’t think i did it very often. but it hurt that the expectations were there. which sounds odd. i k now that dating is always a process of finding someone who meets expectations on some level. but mormon dating feels more pressured than that–like people always come to dating with this preconceived notion of what a spouse should be and they immediately start measuring the other person against that ideal. i’m sure non-mormons do it, too. but in my experience dating non-mormons, it’s been so much more about exploring and discovering who the other person is, rather than measuring them against a checklist. which seems so much more healthy.
and you’re right. the peaceful assurance does come with time. i didn’t have it early on. and because i didn’t, j(wh) and i are lucky i made it to date 4. 🙂
and sarah–thank you for your comment. especially the last paragraph. a marriage should always be a time for celebration and joy. for family or friends to be more focused on their own disappointed expectations than on their loved one’s joy simply seems wrong on so many levels.
“interested in exploring the goodness where it lays, in coming to understand how the goodness in mormonism and the goodness outside mormonism work together to make a beautiful world.”
That seems like a great goal — drawing from the good in both traditions.
“i don’t particularly want to repeat the extremely long, extremely hurtful discussion that happened at times & seasons a few years ago; ”
I’m sorry that you found that thread hurtful, Amy. As someone who commented on that thread, I’m not sure what to make of that reaction. The thread essentially consisted of Julie saying that interfaith marriages are inherently bad, followed by every other bloggernacle regular who commented — Russell, Lisa, Melissa, me, even Adam Greenwood — telling her that she was wrong. She even called herself “the cheese standing alone” by the end of comments. It seemed pretty clear that Julie’s position (interfaith = bad) was the outlier.
“Amelia,
Thanks for this thoughtful post! I’m glad to have someone to share Mondays with :)”
Wait — you share Mondays? So I have to wait 2 weeks for Jess, and 2 weeks for Amy? Grumble.
“While at BYU, I took the missionary prep class taught by Randy Bott, and of all the many motivational things he said, the single thing I remember from that full semester is when he told the class that he would rather his daughters died than marry outside the temple. ”
A stupid, bullshit attitude that’s unfortunately not uncommon. Or at least, people say it. I don’t know if they’d _actually_ prefer a dead child. Either way, it’s an awful way to try to make a rhetorical point.
Kaimi,
I haven’t read the T&S thread Amy is referring to, but I’ve always found your comments to be very tolerant and supportive.
Thanks, btw, for looking forward to my posts, but I am running out of angst to blog about. (well, that’s not exactly true, running out of time is more like it)
You’ll be so delighted (as my 5 yo would say) to hear that MRaynes is sharing a spot on Mondays as well. (I think the schedule is MRaynes, Jess, Amy, Jess)
We’re really excited to have her blogging with us.
I do understand the real life constraints, though. My own blogging goes inevitably in cycles, depending on real life.
“You’ll be so delighted (as my 5 yo would say) to hear that MRaynes is sharing a spot on Mondays as well. (I think the schedule is MRaynes, Jess, Amy, Jess)
We’re really excited to have her blogging with us.”
Hey, that is good. I like MRaynes’s comments. And you women have a good track record at adding new bloggers.
Well, it may have started out kinda sketchy, what with the unipedal, camera-wielding maniac and “no flower unphotographed.” But it’s gone well enough since then, and . . . hey, stop hitting me!
i found it hurtful because even in the face of so much thoughtful, reasonable explanation why marrying outside the temple is not the end of the world, julie (and others) continued to hammer on the same point over and over. and to do so in an incredibly callous way that showed absolutely no consideration for anyone else’s experience. and i heard in that the voice of the mormon mainstream. and it’s hurtful to me that that mainstream could be so thoughtless about a person’s feelings. that they could dismiss a marriage as sinful or misguided or bound to destroy children when, for the two people (getting) married, it’s actually a source of great joy.
i very much appreciated all of the efforts at reasoned and thoughtful counterargument. but none of them made any difference to julie.
i don’t really care what other people think of my relationship. not in a way that would allow their thoughts to shape my choices. but, being a human being and therefore a social animal, i of course would like my family and community to recognize and celebrate the joy and happiness i’ve experienced in my relationship. to realize that instead that community will deem it sinful or misguided or destructive–well that hurts, even if it won’t affect my choices re: the relationship. though it may affect where i choose to find community.
it’s one of the reasons that, if i do marry outside the temple, i will not have a mormon bishop/stake president perform the ceremony.
One thing that I’ve never understood is why so many Mormons think that it’s like THE END if you marry a non-member, that you’re throwing away your eternal salvation, etc, etc. I’m married to a non-member. It hasn’t always been easy, but I don’t regret it because it was the right decision for ME. (You can find out why if you read the posting called “The Marriage Mission” on my blog.) We’re a church who actually believes in the opportunity of sorting out details in the hereafter through proxy during mortal life, whether through baptism for the dead or sealings. So the way I look at it, even if we both die being only civilly married, why can’t someone in this life do my husband’s temple work and have us sealed, including any children we may have someday? He might not accept it in this life, but maybe he will in the next. Who knows? Anyone who says that’s not a possibility is contradicting a fundamental Mormon belief. Or am I wrong?
amelia, I’ve never attended a wedding in which a member and a non-member were married. I tend to agree with you that I would not have a bishop perform a ceremony like that for me, but I’m not sure where that comes from. I have this sense that it would not be the joyful celebration I would want it to be.
i’ve attended a handful, zenaida. and the thing that always struck me was that there seemed to be this emphasis on the fact that the marriage ended at death. i’m not sure why it struck me that way. it could just be a factor of having been raised thinking about eternal marriages and knowing that the wedding i witnessed didn’t begin an eternal marriage–not in mormon terms. having been raised in the mormon church i am conditioned to feel that way, just like so many others. i’m sure that’s part of it.
but i’m sure it’s not the entirety of it. i’ve also always been struck by the absence of celebration during these ceremonies. they’re very short. the vows can’t be changed at all by any of the participants. i don’t know. they just don’t feel celebratory. in contrast to the weddings of non-members i’ve been to. i was at one last month and it was beautiful. a joyous celebration of these two people’s love for each other. and i think that it was that way in large part because they, as a couple, were able to shape the ceremony as they wanted it to be. which i like.
I think a lot depends on the individual bishop and his personality. My bishop at the time was actually a huge help in helping me make the decision to get married in the first place. I was very torn because I also was born and raised in the Church and although my parents didn’t raise me with the mindset that I had to get married in the temple, we all know that it’s everywhere in Mormon culture. So, I was actually very surprised when my bishop was nothing but encouraging, taking the time to fast and pray with me until I felt it was right, and then performing the ceremony. My husband and I were the ones who wanted it very minimal and simple, but the bishop gave a wonderful “sermon” on love, marriage, and although he talked about the possibility of temple marriage (which I didn’t object to), I never got the feeling he was looking down upon us for marrying outside the temple. Everyone who attended the wedding, including many non-members, were thoroughly impressed by him. I was also especially impressed that he didn’t use the line “until death do you part,” but rather “for as long as you both shall live.”
So I have no regrets about getting married in the chapel by the bishop. I wouldn’t have wanted to invite the whole ward, but that’s just the way I am. I only needed those around me who I knew cared about us and had our best interests at heart.
I’m a child of a part-member family, and currently a young single adult in the church. We were raised catholic (my father’s faith), but with a great deal of exposure to my the LDS church (the faith of my mother, who is incidentally one of two members of an RS stake presidency whose husbands are not members).
When I joined the church, as a 20-year old, despite years of obvious interest in the church, it was a problem. My Dad tried very hard to convince me not to. I know it caused a series of very difficult fights between my parents. My father now objects to my mom paying tithing on her income–something that was not true in the past–will no longer come to church with my mom on special occasions–which he did in the past–and often objects when there are ‘too many mormons’ coming to visit (not missionaries, vt’s or ht’s, just my mom’s friends). So long as we kids weren’t interested, he was fine with her participation, was fine with the church. Once I joined, everything changed. So, based on your representation of your boyfriend, and those of the person representing themselves as your boyfriend, you need to be sure that his acceptance of the church in your life will extend to the eventuality of your children’s enthusiastic membership; the representations of him give me pause that this would be the case.
More generally, do you care if your kids make gospel including the priesthood, part of their lives? Because the odds are that they won’t if you follow this course, just because this often happens in families where the are religious divides–it’s evident in my own family–I’m LDS, one sister is catholic, and the third is entirely uninterested in religion. Which has provided lots of heartache for both parents, as they have both sought for us to believe in things they deeply believe in. I don’t know you, but perhaps this is ok with you–the church does not seem to be the first place you look for your beliefs, so this might be fine with you. But you should be sure about your answers here before you proceed.
i just wanted to thank you for sharing your experience, TMD. i hope that the hard parts of that experience ease with time.
the eventuality of our (hypothetical) children joining the mormon church is something j(wh) and i have talked about. he believes that, so long as they make the choice as adults, he would be accepting of that. i think his biggest concern is the way a total immersion in mormonism could shape children before they’re old enough to make carefully considered decisions for themselves. which is something i can respect because religion is so important to me. i don’t think one’s religious beliefs should be anything but carefully considered.
i know him well enough that i trust he would accept his adult children’s decisions, even if they were choices he would not make for himself. and i believe i would do the same. for both of us the most important thing is the principles and values that inform our beliefs, rather than the form the beliefs take.
I would be accepting of my adult children’s choices as well, but it’s 18 years to adulthood, sometimes longer. I was tempted to ask a what if question here, but I think the point is that you can’t prepare for every single eventuality. The only thing you can do as a parent is the best you can.
I have a friend with a Catholic mother and a Jewish father. I think the parents decided to raise the kids with both religions and then let them choose. She is now 25 and while not a super devout Catholic, she definitely tends towards the Christian side. This partly has to do with the fact that he father didn’t put in much effort to teaching her and her brother about Judaism. When they moved to Canada when she was a child, her parents assumed they would need to put their kids in private school (evidently this was the case in Peru) and so they enrolled them in Catholic school. Anyway, apparently now the father seems slightly hurt that the kids didn’t “pick his side” but come on, man, you put them in Catholic school.
Anyway, I think it’s good that one of the big things being considered here is how to raise the children. I’m surprised that some people have a hard time understanding how being raised in a typical Mormon fashion could cause pain. Or maybe I shouldn’t be. I suppose this has to do with the fact that lately I have become acutely aware of how indoctrinated I am… I have really been pondering about whether I could feel good about really raising my future children in the church…
Stephanie, I think that at least for me, the idea that the mormon experience is uniquely painful is this issue. Unless someone is in a faith community that lacks any kind of community and interpersonal dynamics, and lacks any kind of coherent or strongly held beliefs, the same things will apply. There are no fewer “pain problems” being raised Catholic, Orthodox, Jewish (well, maybe not some of the reform varieties, which are almost UU anyways, but certainly conservative and orthodox).
And come to think of it, I want to explicate this term ‘interfaith’ here.
Before Christianity and its mythologies reached the Samoan islands, us native islanders had our own ideas and worshippings toward ‘god’/’gods’. The ancient pre-Christian beliefs are a part of me (gods ie, Nafanua, Pili, Salamasina, etc.) most notably in Samoan linguistics (I am fluent in my native tongue).
Reprising the pre-contact religions and ‘faiths’ in my life is my way of ‘faasolo le faaSamoa’, or further flourishing of my Samoan culture (part of the ‘twist’ I mentioned in my previous post).
In this regard, the ‘split’ between two camps of ‘faith’ (affiliated with this particular forum’s use of the term ‘interfaith’) is not so much between me & my nonmember husband Rob.
In this situation, my husband Rob being a nonmember is kind of an afterthought, really (to him, loving & following Jesus is his innate religion – add to that his newfounded disgust for Brigham, Joseph, McConkie and the other Mormon weirdos).
Hmmm…i’ll hafta think more upon this dilemma of mine: colonized, native Pacific Islander who hates and loves her LDS membership.
Subscribe to Magazine
Submit a Guest Post
Monthly Archive
Search This Site
Exponent II is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com. Exponent II participates in Google Adsense. |
1. Field of the Invention.
The present invention relates to a device for securing a game call securely in close proximity to the user's mouth both for convenience and safety. The game call holder is a band of resilient material, such as elastic, which is provided with at least two securing loops. The band is slid onto the upper arm of the user and a tubular game call is secured in the securing loops in a manner which places the mouthpiece of the call directly in front of the user's mouth when the user raises the arm, such as when sighting a gun or pulling back the string on a hunting bow.
2. Prior Art
The invention relates to the art of securing an air-operated game call in a safe and convenient position on a hunter's body. Game calls have long been used by hunters to attract particular animals into shooting range. Calls are also used by photographers, bird watchers and other sporting enthusiast. Of the several available game calls, air-powered calls of tube-like configuration are probably the easiest to use but do require the use of at least one hand to operate. This generally means that a hunter using a tube-like call will have not have both hands available to aim a gun or pull back a bow.
Safety is always a primary consideration when hunting. Generally, game calls are suspended by a lanyard about the hunter's neck. When the hunter desires to activate the call, the call is picked up and placed in the mouth. A safety problem occurs in this situation as the lanyard suspending the call is prone to snagging the hunter's gun or bow. Of particular concern is the entanglement of the lanyard with the string of a hunting bow immediately prior to release. Several documented hunting injuries have occurred when a game call lanyard has tangled with a hunter's rifle or bow.
A game call holder is disclosed in U.S. Pat. No. 5,111,981 which apparently allows a game call to be positioned on the user's shoulder thereby freeing up his or her hands. However, the referenced patent requires the user to turn his head to use the call. It is desirable to have a game call positioned so that the hunter can simultaneously sight her weapon and activate the game call. Further, the referenced patent has multiple components and will require the user to manipulate the holder into a comfortable and usable position. It is desirable to have a game call holder of simple design which is easy to use and which is durable and inexpensive.
Accordingly, it is the object of this invention to provide a game call holder which allows the game call to be positioned in close proximity to the user's mouth for simultaneous activation of the call and sighting of a weapon. The invention will allow hands-free operation of the call and will allow the user to focus on the animal and on aiming the weapon.
Another object of this invention is to provide a new and improved game call holder which allows safe and easy access to the game call while hunting by eliminating a lanyard, or other attachment means, and by positioning the call away from the weapon.
Yet another object of this invention is to provide a game call which is easy to use as it requires the user to place a resilient band over his or her upper arm and then fasten the game call in the securing loops provided. The invention eliminates any buckles, hook and loop fasteners, clips, snaps or buttons found in the prior art. Further, the invention will be durable and relatively inexpensive. |
Soviet prisoners of war in Finland
Soviet prisoners of war in Finland during World War II were captured in two Soviet-Finnish conflicts of that period: the Winter War and the Continuation War. The Finns took about 5,700 POWs during the Winter War, and due to the short length of the war they survived relatively well. However, during the Continuation War the Finns took 64,000 POWs, of whom almost 30 percent died.
Winter War
The number of Soviet prisoners of war during the Winter War (1939–1940) was 5,700, of whom 135 died. Most of them were captured in Finnish pockets (motti) north of Lake Ladoga. The war lasted only 105 days and most of the deceased POWs were either seriously wounded or sick. Some of the POWs, at least 152 men, enlisted in the so-called Russian Liberation Army in Finland. They were not allowed to take part in combat. After the war, some members of the Liberation Army managed to escape to a third country.
Continuation War
The number of Soviet prisoners of war during the Continuation War (1941–1944) was about 64,000. Most of them were captured in 1941 (56,000 persons). The first Soviet POWs were taken in June 1941 and were transferred to reserve prisons in Karvia, Köyliö, Huittinen and Pelso (a village in modern-day municipality of Vaala). Soon Finnish administration realized that the number of POWs was much greater than initially estimated, and established 32 new prison camps in 1941–1944. However, all of them were not used at the same time as POWs were used as a labour force in different projects around the country.
The Finns did not pay much attention to the living conditions of the Soviet POWs at the beginning of the war, as the war was expected to be of short duration. The quantity and quality of camp personnel was very low, as the more qualified men were at the front. It was not until the middle of 1942 that the quantity and quality of camp personnel was improved. There was a shortage of labour in Finland and authorities assigned POWs to forest and agricultural work, as well as the construction of fortification lines. Some Soviet officers cooperated with the Finnish authorities and were released from prison by the end of the war.
Finnic prisoners who were captured on the fronts or transferred by Germany were separated from other Soviet POWs. At the end of 1942 volunteers could join the Finnish battalion Heimopataljoona 3, which consisted of Baltic Finns such as Karelians, Ingrian Finns, Votes and Veps.
Prisoner exchange with Germany
About 2,600–2,800 Soviet prisoners of war were handed over to the Germans in exchange for roughly 2,200 Finnic prisoners of war held by the Germans. In November 2003, the Simon Wiesenthal Center submitted an official request to Finnish President Tarja Halonen for a full-scale investigation by the Finnish authorities of the prisoner exchange. In the subsequent study by Professor Heikki Ylikangas it turned out that about 2,000 of the exchanged prisoners joined the Russian Liberation Army. The rest, mostly army and political officers, (among them a name-based estimate of 74 Jews), most likely perished in Nazi concentration camps.
Deaths
Most of the deaths among Soviet POWs, 16,136, occurred in the ten-month period from December 1941 to September 1942. Prisoners died due to bad camp conditions and the poor supply of food, shelter, clothing, and health care. About a thousand POWs, 5 percent of total fatalities, were shot, primarily in escape attempts. Food was especially scarce in 1942 in Finland due to a bad harvest. Punishment for escape attempts or serious violations of camp rules included solitary confinement and execution. Out of 64,188 Soviet POWs, from 18,318 to 19,085 died in Finnish prisoner of war camps.
In 1942 the number of prisoner deaths had a negative effect on Finland's international reputation. The Finnish administration decided to improve living conditions and allowed prisoners to work outside their camps.
Hostilities between Finland and the Soviet Union ceased in September 1944, and the first Soviet POWs were handed over to the Soviet Union on 15 October 1944. The transfer was complete by the next month. Some of the POWs escaped during the transportation, and some of them were unwilling to return to the Soviet Union. Furthermore, Finland handed over 2,546 German POWs from the Lapland War to the Soviet Union.
Trials in Finland
According to the Moscow Armistice, signed by Finland and the victorious Allies, mainly the Soviet Union, the Finns were to try those who were responsible for the war and those who had committed war crimes. The Soviet Union allowed Finland to try its own war criminals, unlike other losing countries of the Second World War. The Finnish parliament had to create ex post facto laws for the trials, though in the case of war crimes the country had already signed the Hague IV Convention. In victorious Allied countries war-crime trials were exceptional, but Finland had to arrange full-scale investigations and trials, and report them for the Soviet Union.
Criminal charges were filed against 1,381 Finnish POW camp staff members, resulting in 723 convictions and 658 acquittals. They were accused of 42 murders and 342 other homicides. Nine persons were sentenced to life sentences, 17 to imprisonment for 10–15 years, 57 to imprisonment for five to ten years, and 447 to imprisonment varying from one month to five years. Fines or disciplinary corrections were levied out in 124 cases. Although the criminal charges were highly politicized, some war crime charges were filed already during the Continuation War. However, most of them were not processed during wartime.
Aftermath
Winter War POWs Returned to the Soviet Union
After the Winter War, the Soviet POWs were returned to the USSR in accordance with the Moscow Peace Treaty. They were transported under heavy guard by the NKVD to special camps as suspected traitors. Prisoners were interrogated by 50 person research teams. After lengthy investigations about 500 of the prisoners were found guilty of high treason and sentenced to death. Some prisoners were released, but most of them, 4,354 men, were sentenced to five to eight years in labour camps (gulag). This would lead to the later death of some of the prisoners due to harsh camp conditions.
Continuation War POWs Returned to the Soviet Union
After the Continuation War, Finland handed over all Soviet and German prisoners of war in accordance with the 10th article of the Moscow Armistice. Furthermore, the article also stipulated the return of all Soviet nationals who were deported to Finland during the Continuation War. This meant that Finland also had to hand over all those who moved to Finland voluntarily, as well as those who fought in the ranks of the Finnish army against the Soviet union, though some had Finnish citizenship. The return to the Soviet Union was in many cases fatal for these people, as some of them were executed as traitors at the Soviet train station at Vyborg and some died in harsh camp conditions in Siberia. After the collapse of the Soviet Union the survivors were allowed to return to Finland.
Some of the Soviet prisoners of war co-operated with the Finns during the war. Before the end of the war all related Finnish archives, including interrogation documents relating to co-operating prisoners, were destroyed; and these POWs' destinations after the war are uncertain. Some of them were secretly transported by Finnish army personnel to Sweden and some continued on as far as the United States. The highest ranking Soviet prisoner of war was Major General Vladimir Kirpichnikov, who returned to the Soviet Union. He was tried, convicted of high treason, and executed in 1950.
Legal position of Soviet POWs
Finland had signed the 1907 Hague IV Convention in 1922 that covered the treatment of prisoners of war in detail. However, Finland announced that it could not completely obey the convention as the Soviet Union had not signed the same convention. The convention required ratification by both parties to the hostilities before going into effect. Finland did not sign the updated 1929 Third Geneva Convention, because it conflicted with some clauses of Finnish criminal law. Although the Soviet Union had not signed the Hague IV Convention, the reality was unclear and ambiguous. Soviet law specified that a Soviet soldier's surrender constituted treason which was punishable by death or imprisonment and seizure of the soldier's property.
See also
Finnish prisoners of war in the Soviet Union
East Karelian concentration camps
War children § Soviet prisoners of war
Notes
References
Citations
Bibliography
Category:Military history of the Soviet Union during World War II
*
Category:Finland–Soviet Union relations
Category:Winter War
Category:Continuation War |
// Copyright Aleksey Gurtovoy 2000-2004
//
// Distributed under the Boost Software License, Version 1.0.
// (See accompanying file LICENSE_1_0.txt or copy at
// http://www.boost.org/LICENSE_1_0.txt)
//
// Preprocessed version of "boost/mpl/apply_wrap.hpp" header
// -- DO NOT modify by hand!
namespace boost { namespace mpl {
template<
typename F
, typename has_apply_ = typename aux::has_apply<F>::type
>
struct apply_wrap0
: F::template apply< >
{
};
template<
typename F, typename T1
>
struct apply_wrap1
: F::template apply<T1>
{
};
template<
typename F, typename T1, typename T2
>
struct apply_wrap2
: F::template apply< T1,T2 >
{
};
template<
typename F, typename T1, typename T2, typename T3
>
struct apply_wrap3
: F::template apply< T1,T2,T3 >
{
};
template<
typename F, typename T1, typename T2, typename T3, typename T4
>
struct apply_wrap4
: F::template apply< T1,T2,T3,T4 >
{
};
template<
typename F, typename T1, typename T2, typename T3, typename T4
, typename T5
>
struct apply_wrap5
: F::template apply< T1,T2,T3,T4,T5 >
{
};
}}
|
El Khasos
'Ain Shams El Sharkya () is a city in Cairo Governorate, Egypt.
Category:Populated places in Cairo Governorate |
The purpose of this contract is to provide support for a colony of rhesus macaques used in aging and diabetes research. The colony consists of both pre-diabetic and diabetic monkeys from the ages of 7 years to over 30 years. The colony is characterized extensively for parameters of aging and metabolism. These animals are made available to investigators outside of the University of Maryland through collaboration with or request to the P.I. Tissue and blood samples are also available through ODAAR's extensive tissue bank and prospective sampling. |
export type ModuleAddress =
ModuleAddress.GitHubRepo |
ModuleAddress.GitHubRawUrl |
ModuleAddress.DenoLandUrl
;
export namespace ModuleAddress {
/** e.g: "github:userOrOrg/repositoryName#branch" */
export type GitHubRepo = {
type: "GITHUB REPO";
userOrOrg: string;
repositoryName: string;
branch?: string;
};
export namespace GitHubRepo {
/**
* Input example
* KSXGitHub/simple-js-yaml-port-for-deno or
* github:KSXGitHub/simple-js-yaml-port-for-deno or
* KSXGitHub/simple-js-yaml-port-for-deno#3.12.1 or
* github:KSXGitHub/simple-js-yaml-port-for-deno#3.12.1 or
*/
export function parse(
raw: string
): GitHubRepo {
const match = raw.match(/^(?:github:\s*)?([^\/]*)\/([^\/]+)$/i)!;
const [repositoryName, branch] = match[2].split("#");
return {
"type": "GITHUB REPO",
"userOrOrg": match[1],
repositoryName,
branch
};
}
/** Match valid parse input */
export function match(raw: string): boolean {
return /^(?:github:)?[^\/\:]+\/[^\/]+$/.test(raw);
}
}
/** https://raw.githubusercontent.com/user/repo/branch/path/to/file.ts */
export type GitHubRawUrl = {
type: "GITHUB-RAW URL"
baseUrlWithoutBranch: string;
pathToIndex: string;
branch: string;
};
export namespace GitHubRawUrl {
export function parse(raw: string): GitHubRawUrl {
const match = raw.match(
/^(https?:\/\/raw\.github(?:usercontent)?\.com\/[^\/]+\/[^\/]+\/)([^\/]+)\/(.*)$/
)!;
return {
"type": "GITHUB-RAW URL",
"baseUrlWithoutBranch": match[1]
.replace(
/^https?:\/\/raw\.github(?:usercontent)?/,
"https://raw.githubusercontent"
)
.replace(/\/$/, "")
,
"branch": match[2],
"pathToIndex": match[3]
};
}
export function match(raw: string): boolean {
return /^https?:\/\/raw\.github(?:usercontent)?\.com/.test(raw);
}
}
/** e.g: https://deno.land/x/[email protected]/mod.js */
export type DenoLandUrl = {
type: "DENO.LAND URL"
isStd: boolean;
baseUrlWithoutBranch: string;
pathToIndex: string;
branch?: string;
};
export namespace DenoLandUrl {
export function parse(raw: string): DenoLandUrl {
const isStd = /^https?:\/\/deno\.land\/std/.test(raw);
const match = isStd ?
raw.match(/^(https?:\/\/deno\.land\/std)([@\/].*)$/)! :
raw.match(/^(https?:\/\/deno\.land\/x\/[^@\/]+)([@\/].*)$/)!
;
// https://deno.land/std@master/node/querystring.ts
// [1]: https://deno.land/std
// [2]: @master/node/querystring.ts
// https://deno.land/std/node/querystring.ts
// [1]: https://deno.land/std
// [2]: /node/querystring.ts
//https://deno.land/x/[email protected]/mod.js
// [1]: https://deno.land/x/foo
// [2]: @1.2.3/mod.js
//https://deno.land/x/foo/mod.js
// [1]: https://deno.land/x/foo
// [2]: /mod.js
const { branch, pathToIndex } = match[2].startsWith("@") ? (() => {
const [
, branch, // 1.2.3
pathToIndex // mod.js
] = match[2].match(/^@([^\/]+)\/(.*)$/)!;
return { branch, pathToIndex }
})() : ({
"branch": undefined,
"pathToIndex": match[2].replace(/^\//, "") // mod.js
});
return {
"type": "DENO.LAND URL",
isStd,
"baseUrlWithoutBranch": match[1],
"branch": branch,
pathToIndex
};
}
export function match(raw: string): boolean {
return /^https?:\/\/deno\.land\/(?:(?:std)|(?:x))[\/|@]/.test(raw);
}
}
export function parse(raw: string): ModuleAddress {
for (const ns of [GitHubRepo, GitHubRawUrl, DenoLandUrl]) {
if (!ns.match(raw)) {
continue;
}
return ns.parse(raw);
}
throw new Error(`${raw} is not a valid module address`);
}
}
|
afrol News, 28 October - With the signing of two large contracts last week between international oil companies and the Moroccan government to explore promising oil fields off the coast of Moroccan-occupied Western Sahara increases, international protests are being voiced. French and UK organisations yesterday called the agreements "scandalous".
The French association of friends of the Sahrawi Republic (AARASD) yesterday "strongly denounced" the "scandalous agreements" between international oil companies and the Moroccan state regarding the sale of exploration rights off the Western Sahara coast.
Also The Western Sahara Campaign UK yesterday condemned two oil contracts between TotalElfFina and Kerr McGee to exploit the oil resources of the territorial waters of Western Sahara. Under the contracts, TotalFinaElf may explore 115, 000 kilometre square area off the coast of Dakhla Western Sahara for a 12 month period. Kerr McGee signed a deal to explore 110, 000 kilometre square area of deep water off the northern coast of Western Sahara.
President of the Sahrawi Arab Democratic Republic, Mohamed Abdelaziz, said Wednesday that contracts signed by oil companies Kerr McGee and TotalFinaElf to explore the oil resources offshore Western Sahara were a "provocation." The President appealed to the United Nations to annul the contracts with Morocco because they violate international law.
Pro-Sahrawi pressure groups and President Abdelaziz claim this on behalf of the UN refusal to recognise the Moroccan occupation of Western Sahara and the territory's status as a colony. They refer to a 1991 UN resolution, stating that "the exploitation and plundering of colonial and non-self-governing territories by foreign economic interests, in violation of the relevant resolutions of the United Nations is a grave threat to the integrity and prosperity of those Territories."
According to the US Geological Survey of World Energy, year 2000, estimated oil and gas resources off the Saharan coast are substantial and the probability (including both geologic and accessibility probabilities) of finding lucrative oil and gas fields is very high. While it is assessed that Western Sahara has relative large and probable offshore oil resources, numbers for Morocco proper are low and insecure.
Richard Stanforth, spokesperson of the Western Sahara Campaign UK, however comments that in signing the contracts the companies are "trampling over the basic Human Rights of the Sahrawi people. The contracts are an attempt to legitimise the brutal Moroccan occupation of Western Sahara" "Most Sahrawi people from Western Sahara are languishing in refugee camps struggling to survive. They will not see a penny of this money. All this money will go to help Morocco build up its army in Western Sahara."
AARASD adds that "as the territory not is autonomous, one cannot accept these resources being alienated at the benefit of the occupying state." If the international community lets this happen, it would be "to accept the occupation of Western Sahara".
The Paris-based oil multi TotalFinaElf last week announced that it "has signed a reconnaissance contract with the Moroccan state oil company, Office National de Recherches et d'Exploitations Pétrolières (ONAREP), for the Dakhla Offshore zone. Located offshore the town of Dakhla, the zone covers an area of 115,000 km2." Dakhla was the capital of the Spanish Western Sahara colony before 1975.
According to a TotalFinaElf release, "the contract covers an initial period of 12 months, during which regional geological and geophysical studies will be undertaken in order to assess the petroleum potential of the zone. These studies will complement the knowledge base that TotalFinaElf has been building-up over several years along the length of the Atlantic coast of Africa.2
The American oil company Kerr-McGee is far more restrictive on its information. The company's website only informs that Kerr-McGee is involved in "focusing on international deepwater opportunities offshore ... Morocco, ... where it has lease positions". In November last year, the US company has acquired 33.33 percent interest in the 3 million-acre Cap Draa Haute Mer exploration license offshore Morocco.
Earlier operations abandoned
According to information gathered by UK Western Sahara Campaign, previous attempts to explore Western Sahara oil resources have all been abandoned due to the political risks. Gulf Oil, WB Grace, Texaco and Standard Oil were considering a joint venture with the Spanish authorities in the 1960s.
In the second half of the 1960's the US companies Pan American Hispano Oil, Caltex, Gulf Oil and Phillips undertook an exploration of 2443.192 hectares of Western Saharan desert which led to the discovery of a small layer of 100 km at Faim el Oued. In total 27 strata of oil were discovered in 1964.
In 1978, offshore blocks were awarded to Philips and BP but were quickly abandoned because of the war. In the basin between El Ayoun, Western Saharan capital and Tarfaya (Morocco) bituminous shale was discovered with reserves of 100 million barrels of crude but this can only profitably be extracted if oil prices rise to US$ 40 a barrel. Shell signed a contract to build a treatment works in 1981 but the work was never completed. |
/**
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* http://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
/**
*
*/
package org.activiti.designer.validation.bpmn20.bundle;
/**
* Plugin constants for the org.activiti.designer.validation.bpmn20 bundle.
*
* @author Tiese Barrell
* @version 1
* @since 5.6
*
*/
public final class PluginConstants {
public static final String VALIDATOR_ID = "com.atosorigin.esuite.editor.process.validation.ESuiteProcessValidator";
public static final String VALIDATOR_NAME = "E-Suite Process Validator";
public static final String FORMAT_NAME = "E-Suite ZaakType jPDL";
public static final String MARKER_MESSAGE_PATTERN = "[%s] %s";
public static final int WORK_CLEAR_MARKERS = 5;
public static final int WORK_EXTRACT_CONSTRUCTS = 20;
public static final int WORK_USER_TASK = 10;
public static final int WORK_SCRIPT_TASK = 10;
public static final int WORK_SERVICE_TASK = 10;
public static final int WORK_SEQUENCE_FLOW = 10;
public static final int WORK_SUB_PROCESS = 10;
public static final int WORK_TOTAL = WORK_CLEAR_MARKERS + WORK_EXTRACT_CONSTRUCTS + WORK_USER_TASK + WORK_SCRIPT_TASK + WORK_SERVICE_TASK
+ WORK_SEQUENCE_FLOW + WORK_SUB_PROCESS;
}
|
LATEST NEWS
Affordable Honda Full-Faired Bike Launch Soon
Honda is likely to launch a full-faired version of the CB Hornet 160R in India by late 2017. The new bike is expected to be priced between Rs 90,000 and Rs 95,000 (ex-showroom)
Honda is gearing up to launch 4 new products in the Indian two-wheeler market this year. The announcement was made by Minoru Kato, new president and CEO for Honda 2Wheelers India. Out of the new product line-up, one will be the Honda Africa Twin adventure tourer motorcycle. Honda officials announced that they have started trial assembly for the Africa Twin, which will be the second performance motorcycle by Honda to be assembled in India. Honda officials refused to divulge any details on the second motorcycle but just mentioned that it will be a “fun” motorcycle and something that would be part of the commuter segment.
In our opinion, the new motorcycle is question can be a fully-faired version of the Honda CB Hornet 160R. Honda currently has one full-faired bike in the 150cc segment as part of its product portfolio - the Honda CBR150R. A faired version of the CB Hornet 160R does make sense as Suzuki has achieved great success with the Gixxer SF, which is the faired version of the Gixxer 155cc motorcycle and currently holds the distinction of being the cheapest full-faired motorcycle on sale in India. The muscular styling of the CB Hornet 160R has played a key role in its success and we expect the new Honda motorcycle to get sharp and sporty styling.
It is likely to follow the Suzuki Gixxer SF’s footsteps of being a relaxed and easy to ride bike and will not have a committed riding posture like the CBR150R. The engine of the new motorcycle will be the same 162.7cc air-cooled motor that churns out 15.9PS of max power with peak torque rating of 14.8Nm. The frame and cycle parts will also be carried forward from the naked motorcycle. We expect the new Honda full-faired bike to be launched by late 2017 and likely to be priced between Rs 90,000and Rs 95,000 (ex-showroom). |
'use strict';
module.exports = function(Chart) {
var helpers = Chart.helpers;
function filterByPosition(array, position) {
return helpers.where(array, function(v) {
return v.position === position;
});
}
function sortByWeight(array, reverse) {
array.forEach(function(v, i) {
v._tmpIndex_ = i;
return v;
});
array.sort(function(a, b) {
var v0 = reverse ? b : a;
var v1 = reverse ? a : b;
return v0.weight === v1.weight ?
v0._tmpIndex_ - v1._tmpIndex_ :
v0.weight - v1.weight;
});
array.forEach(function(v) {
delete v._tmpIndex_;
});
}
/**
* @interface ILayoutItem
* @prop {String} position - The position of the item in the chart layout. Possible values are
* 'left', 'top', 'right', 'bottom', and 'chartArea'
* @prop {Number} weight - The weight used to sort the item. Higher weights are further away from the chart area
* @prop {Boolean} fullWidth - if true, and the item is horizontal, then push vertical boxes down
* @prop {Function} isHorizontal - returns true if the layout item is horizontal (ie. top or bottom)
* @prop {Function} update - Takes two parameters: width and height. Returns size of item
* @prop {Function} getPadding - Returns an object with padding on the edges
* @prop {Number} width - Width of item. Must be valid after update()
* @prop {Number} height - Height of item. Must be valid after update()
* @prop {Number} left - Left edge of the item. Set by layout system and cannot be used in update
* @prop {Number} top - Top edge of the item. Set by layout system and cannot be used in update
* @prop {Number} right - Right edge of the item. Set by layout system and cannot be used in update
* @prop {Number} bottom - Bottom edge of the item. Set by layout system and cannot be used in update
*/
// The layout service is very self explanatory. It's responsible for the layout within a chart.
// Scales, Legends and Plugins all rely on the layout service and can easily register to be placed anywhere they need
// It is this service's responsibility of carrying out that layout.
Chart.layoutService = {
defaults: {},
/**
* Register a box to a chart.
* A box is simply a reference to an object that requires layout. eg. Scales, Legend, Title.
* @param {Chart} chart - the chart to use
* @param {ILayoutItem} item - the item to add to be layed out
*/
addBox: function(chart, item) {
if (!chart.boxes) {
chart.boxes = [];
}
// initialize item with default values
item.fullWidth = item.fullWidth || false;
item.position = item.position || 'top';
item.weight = item.weight || 0;
chart.boxes.push(item);
},
/**
* Remove a layoutItem from a chart
* @param {Chart} chart - the chart to remove the box from
* @param {Object} layoutItem - the item to remove from the layout
*/
removeBox: function(chart, layoutItem) {
var index = chart.boxes? chart.boxes.indexOf(layoutItem) : -1;
if (index !== -1) {
chart.boxes.splice(index, 1);
}
},
/**
* Sets (or updates) options on the given `item`.
* @param {Chart} chart - the chart in which the item lives (or will be added to)
* @param {Object} item - the item to configure with the given options
* @param {Object} options - the new item options.
*/
configure: function(chart, item, options) {
var props = ['fullWidth', 'position', 'weight'];
var ilen = props.length;
var i = 0;
var prop;
for (; i<ilen; ++i) {
prop = props[i];
if (options.hasOwnProperty(prop)) {
item[prop] = options[prop];
}
}
},
/**
* Fits boxes of the given chart into the given size by having each box measure itself
* then running a fitting algorithm
* @param {Chart} chart - the chart
* @param {Number} width - the width to fit into
* @param {Number} height - the height to fit into
*/
update: function(chart, width, height) {
if (!chart) {
return;
}
var layoutOptions = chart.options.layout;
var padding = layoutOptions ? layoutOptions.padding : null;
var leftPadding = 0;
var rightPadding = 0;
var topPadding = 0;
var bottomPadding = 0;
if (!isNaN(padding)) {
// options.layout.padding is a number. assign to all
leftPadding = padding;
rightPadding = padding;
topPadding = padding;
bottomPadding = padding;
} else {
leftPadding = padding.left || 0;
rightPadding = padding.right || 0;
topPadding = padding.top || 0;
bottomPadding = padding.bottom || 0;
}
var leftBoxes = filterByPosition(chart.boxes, 'left');
var rightBoxes = filterByPosition(chart.boxes, 'right');
var topBoxes = filterByPosition(chart.boxes, 'top');
var bottomBoxes = filterByPosition(chart.boxes, 'bottom');
var chartAreaBoxes = filterByPosition(chart.boxes, 'chartArea');
// Sort boxes by weight. A higher weight is further away from the chart area
sortByWeight(leftBoxes, true);
sortByWeight(rightBoxes, false);
sortByWeight(topBoxes, true);
sortByWeight(bottomBoxes, false);
// Essentially we now have any number of boxes on each of the 4 sides.
// Our canvas looks like the following.
// The areas L1 and L2 are the left axes. R1 is the right axis, T1 is the top axis and
// B1 is the bottom axis
// There are also 4 quadrant-like locations (left to right instead of clockwise) reserved for chart overlays
// These locations are single-box locations only, when trying to register a chartArea location that is already taken,
// an error will be thrown.
//
// |----------------------------------------------------|
// | T1 (Full Width) |
// |----------------------------------------------------|
// | | | T2 | |
// | |----|-------------------------------------|----|
// | | | C1 | | C2 | |
// | | |----| |----| |
// | | | | |
// | L1 | L2 | ChartArea (C0) | R1 |
// | | | | |
// | | |----| |----| |
// | | | C3 | | C4 | |
// | |----|-------------------------------------|----|
// | | | B1 | |
// |----------------------------------------------------|
// | B2 (Full Width) |
// |----------------------------------------------------|
//
// What we do to find the best sizing, we do the following
// 1. Determine the minimum size of the chart area.
// 2. Split the remaining width equally between each vertical axis
// 3. Split the remaining height equally between each horizontal axis
// 4. Give each layout the maximum size it can be. The layout will return it's minimum size
// 5. Adjust the sizes of each axis based on it's minimum reported size.
// 6. Refit each axis
// 7. Position each axis in the final location
// 8. Tell the chart the final location of the chart area
// 9. Tell any axes that overlay the chart area the positions of the chart area
// Step 1
var chartWidth = width - leftPadding - rightPadding;
var chartHeight = height - topPadding - bottomPadding;
var chartAreaWidth = chartWidth / 2; // min 50%
var chartAreaHeight = chartHeight / 2; // min 50%
// Step 2
var verticalBoxWidth = (width - chartAreaWidth) / (leftBoxes.length + rightBoxes.length);
// Step 3
var horizontalBoxHeight = (height - chartAreaHeight) / (topBoxes.length + bottomBoxes.length);
// Step 4
var maxChartAreaWidth = chartWidth;
var maxChartAreaHeight = chartHeight;
var minBoxSizes = [];
function getMinimumBoxSize(box) {
var minSize;
var isHorizontal = box.isHorizontal();
if (isHorizontal) {
minSize = box.update(box.fullWidth ? chartWidth : maxChartAreaWidth, horizontalBoxHeight);
maxChartAreaHeight -= minSize.height;
} else {
minSize = box.update(verticalBoxWidth, chartAreaHeight);
maxChartAreaWidth -= minSize.width;
}
minBoxSizes.push({
horizontal: isHorizontal,
minSize: minSize,
box: box,
});
}
helpers.each(leftBoxes.concat(rightBoxes, topBoxes, bottomBoxes), getMinimumBoxSize);
// If a horizontal box has padding, we move the left boxes over to avoid ugly charts (see issue #2478)
var maxHorizontalLeftPadding = 0;
var maxHorizontalRightPadding = 0;
var maxVerticalTopPadding = 0;
var maxVerticalBottomPadding = 0;
helpers.each(topBoxes.concat(bottomBoxes), function(horizontalBox) {
if (horizontalBox.getPadding) {
var boxPadding = horizontalBox.getPadding();
maxHorizontalLeftPadding = Math.max(maxHorizontalLeftPadding, boxPadding.left);
maxHorizontalRightPadding = Math.max(maxHorizontalRightPadding, boxPadding.right);
}
});
helpers.each(leftBoxes.concat(rightBoxes), function(verticalBox) {
if (verticalBox.getPadding) {
var boxPadding = verticalBox.getPadding();
maxVerticalTopPadding = Math.max(maxVerticalTopPadding, boxPadding.top);
maxVerticalBottomPadding = Math.max(maxVerticalBottomPadding, boxPadding.bottom);
}
});
// At this point, maxChartAreaHeight and maxChartAreaWidth are the size the chart area could
// be if the axes are drawn at their minimum sizes.
// Steps 5 & 6
var totalLeftBoxesWidth = leftPadding;
var totalRightBoxesWidth = rightPadding;
var totalTopBoxesHeight = topPadding;
var totalBottomBoxesHeight = bottomPadding;
// Function to fit a box
function fitBox(box) {
var minBoxSize = helpers.findNextWhere(minBoxSizes, function(minBox) {
return minBox.box === box;
});
if (minBoxSize) {
if (box.isHorizontal()) {
var scaleMargin = {
left: Math.max(totalLeftBoxesWidth, maxHorizontalLeftPadding),
right: Math.max(totalRightBoxesWidth, maxHorizontalRightPadding),
top: 0,
bottom: 0
};
// Don't use min size here because of label rotation. When the labels are rotated, their rotation highly depends
// on the margin. Sometimes they need to increase in size slightly
box.update(box.fullWidth ? chartWidth : maxChartAreaWidth, chartHeight / 2, scaleMargin);
} else {
box.update(minBoxSize.minSize.width, maxChartAreaHeight);
}
}
}
// Update, and calculate the left and right margins for the horizontal boxes
helpers.each(leftBoxes.concat(rightBoxes), fitBox);
helpers.each(leftBoxes, function(box) {
totalLeftBoxesWidth += box.width;
});
helpers.each(rightBoxes, function(box) {
totalRightBoxesWidth += box.width;
});
// Set the Left and Right margins for the horizontal boxes
helpers.each(topBoxes.concat(bottomBoxes), fitBox);
// Figure out how much margin is on the top and bottom of the vertical boxes
helpers.each(topBoxes, function(box) {
totalTopBoxesHeight += box.height;
});
helpers.each(bottomBoxes, function(box) {
totalBottomBoxesHeight += box.height;
});
function finalFitVerticalBox(box) {
var minBoxSize = helpers.findNextWhere(minBoxSizes, function(minSize) {
return minSize.box === box;
});
var scaleMargin = {
left: 0,
right: 0,
top: totalTopBoxesHeight,
bottom: totalBottomBoxesHeight
};
if (minBoxSize) {
box.update(minBoxSize.minSize.width, maxChartAreaHeight, scaleMargin);
}
}
// Let the left layout know the final margin
helpers.each(leftBoxes.concat(rightBoxes), finalFitVerticalBox);
// Recalculate because the size of each layout might have changed slightly due to the margins (label rotation for instance)
totalLeftBoxesWidth = leftPadding;
totalRightBoxesWidth = rightPadding;
totalTopBoxesHeight = topPadding;
totalBottomBoxesHeight = bottomPadding;
helpers.each(leftBoxes, function(box) {
totalLeftBoxesWidth += box.width;
});
helpers.each(rightBoxes, function(box) {
totalRightBoxesWidth += box.width;
});
helpers.each(topBoxes, function(box) {
totalTopBoxesHeight += box.height;
});
helpers.each(bottomBoxes, function(box) {
totalBottomBoxesHeight += box.height;
});
// We may be adding some padding to account for rotated x axis labels
var leftPaddingAddition = Math.max(maxHorizontalLeftPadding - totalLeftBoxesWidth, 0);
totalLeftBoxesWidth += leftPaddingAddition;
totalRightBoxesWidth += Math.max(maxHorizontalRightPadding - totalRightBoxesWidth, 0);
var topPaddingAddition = Math.max(maxVerticalTopPadding - totalTopBoxesHeight, 0);
totalTopBoxesHeight += topPaddingAddition;
totalBottomBoxesHeight += Math.max(maxVerticalBottomPadding - totalBottomBoxesHeight, 0);
// Figure out if our chart area changed. This would occur if the dataset layout label rotation
// changed due to the application of the margins in step 6. Since we can only get bigger, this is safe to do
// without calling `fit` again
var newMaxChartAreaHeight = height - totalTopBoxesHeight - totalBottomBoxesHeight;
var newMaxChartAreaWidth = width - totalLeftBoxesWidth - totalRightBoxesWidth;
if (newMaxChartAreaWidth !== maxChartAreaWidth || newMaxChartAreaHeight !== maxChartAreaHeight) {
helpers.each(leftBoxes, function(box) {
box.height = newMaxChartAreaHeight;
});
helpers.each(rightBoxes, function(box) {
box.height = newMaxChartAreaHeight;
});
helpers.each(topBoxes, function(box) {
if (!box.fullWidth) {
box.width = newMaxChartAreaWidth;
}
});
helpers.each(bottomBoxes, function(box) {
if (!box.fullWidth) {
box.width = newMaxChartAreaWidth;
}
});
maxChartAreaHeight = newMaxChartAreaHeight;
maxChartAreaWidth = newMaxChartAreaWidth;
}
// Step 7 - Position the boxes
var left = leftPadding + leftPaddingAddition;
var top = topPadding + topPaddingAddition;
function placeBox(box) {
if (box.isHorizontal()) {
box.left = box.fullWidth ? leftPadding : totalLeftBoxesWidth;
box.right = box.fullWidth ? width - rightPadding : totalLeftBoxesWidth + maxChartAreaWidth;
box.top = top;
box.bottom = top + box.height;
// Move to next point
top = box.bottom;
} else {
box.left = left;
box.right = left + box.width;
box.top = totalTopBoxesHeight;
box.bottom = totalTopBoxesHeight + maxChartAreaHeight;
// Move to next point
left = box.right;
}
}
helpers.each(leftBoxes.concat(topBoxes), placeBox);
// Account for chart width and height
left += maxChartAreaWidth;
top += maxChartAreaHeight;
helpers.each(rightBoxes, placeBox);
helpers.each(bottomBoxes, placeBox);
// Step 8
chart.chartArea = {
left: totalLeftBoxesWidth,
top: totalTopBoxesHeight,
right: totalLeftBoxesWidth + maxChartAreaWidth,
bottom: totalTopBoxesHeight + maxChartAreaHeight
};
// Step 9
helpers.each(chartAreaBoxes, function(box) {
box.left = chart.chartArea.left;
box.top = chart.chartArea.top;
box.right = chart.chartArea.right;
box.bottom = chart.chartArea.bottom;
box.update(maxChartAreaWidth, maxChartAreaHeight);
});
}
};
};
|
Q:
printing a report in a navigation subform
I have built a database using MS Access 2010, everything is done except for one button that is not working.
I have a main navigation form, that has different tabs, one tab opens another navigation form (secondary nav. form - SNF) inside the main navigation form (MNF). in the SNF there are tabs which open reports that get their data from queries.
the reports, when opened separately, have a print button which works fine when the report are opened directly and not using the forms.
when the reports are opened through the SNF and the print button pressed the printed page has the SNF and the MNF headers and footers which isn't needed and the supposedly 1 page report would be divided to 4 pages. each containing a quarter of the view.
what I am trying to do is have the printing function using the button print only the report inside the SNF without anything outside that reports borders just as it does when the report is opened directly without using the forms.
NOTE:
* The printing button uses the defaut access print function which is implemented using the button wizard.
** Attached is a screenshot of what I get in both cases.
A:
I was having the same issues, where the entire form was being printed instead of the reports that were navigation subforms. I worked around it this way:
VBA:
DoCmd.OpenReport "MY REPORT", acViewPreview
DoCmd.RunCommand acCmdPrint
DoCmd.Close acReport, "MY REPORT"
It's clumsy, but it allows the user to use the print dialogue instead of just using
DoCmd.OpenReport, "MY REPORT", acPrint
and not being given the option choosing a printer, double sided etc.
|
Q:
Is there a new Midi API for Windows Vista/7/8?
I know the midiXxx API, but I saw it is currently listed under 'legacy' in msdn.
http://msdn.microsoft.com/en-us/library/windows/desktop/dd743619(v=vs.85).aspx
Is there some other API i should use to target the newer Windows versions?
Will the old API still work on Windows 7 and 8?
Thanx,
Marc
A:
For dektop applications (non metro) you can still use the legacy API safely.
Sadly for WinRT/Metro, there is no midi support at all (see this discussion on msdn).
Hope they will change that.
A:
Last Friday Microsoft released a preview Windows Runtime API for MIDI. Check out the //build/ session here:
http://channel9.msdn.com/Events/Build/2014/3-548
MSDN: http://msdn.microsoft.com/en-us/library/windows/apps/dn643522.aspx
Although a preview, apps can go live and be deployed to the Windows Store. Please let us know what you like or don't like. Happy app building!
|
Background {#Sec1}
==========
Hemangioblastomas (HB) are highly vascular tumors, which account for approximately 3 % of all tumors of the central nervous system (CNS) \[[@CR1]\]. It occurs in a subset of CNS locations, including the cerebellum (37 %), brainstem (10 %), and spinal cord (50 %) \[[@CR1]\]. They are classed as grade one tumors under the World Health Organization\'s classification system. While most of these tumors are low grade and benign, some hemangioblastomas can present aggressive and occasionally malignant behavior. Hemangioblastomas occur as sporadic tumors (75 %) or as a manifestation of an autosomal dominantly inherited disorder, von Hippel-Lindau (VHL) disease (25 %) \[[@CR2]\].
VHL hemangioblastomas are most commonly caused by germline exon deletions or truncating mutations \[[@CR3]\] of the Von Hippel-Lindau *(VHL*) tumor-suppressor gene. The VHL protein, which is the critical part of a ubiquitin ligase protein complex that binds to the hypoxia-inducing factors HIF-1 and HIF-2 transcription factors and targets them for ubiquitination and proteosomal degradation. Dysregulation of this VHL-associated function causes increased expression of a variety of growth factors, including erythropoietin, PDGF, VEGF and TGF. Upregulation of these factors may lead to angiogenesis and tumorigenesis. Additional mechanisms of tumorigenesis have been described outside of the HIF pathway, including alterations in microtubule binding and stabilization, abnormal extracellular matrix composition as well as apoptosis and transcription regulation \[[@CR4]\]. For most VHL disease related hemangioblastomas, the inactivation or loss of both alleles of the VHL gene is required. In addition to the phenotypic variability associated with allelic heterogeneity, genetic modifiers may influence the phenotypic expression of VHL disease. Allelic variants in the *CCND1, MMP1* and *MMP3* genes have been reported to influence hemangioblastoma development \[[@CR5]\]. This reiterates the need for elucidating other genetic alterations specific for hemangioblastoma beside the hits of *VHL* gene. Moreover, in a subset of tumors including mostly sporadic hemangioblastomas, the genetic pathways involved in tumorigenesis have not been defined yet \[[@CR6]\].
Copy number variants (CNVs) are alterations of DNA sections in result of genomic deletions (fewer than the normal number) or duplications (more than the normal number) on certain chromosomes and are common to many human cancers. Comparative genomic hybridization (CGH) by single nucleotide polymorphism (SNP) arrays is a cutting edge technology that allows characterization of CNVs. SNP array karyotyping provides genome-wide assessment of copy number and loss of heterozygosity (LOH) in one assay. SNP array platforms, such as Affymetrix SNP 6.0 (Affymetrix, Santa Clara, CA, USA), often identify amplifications/deletions at a single gene level, which could not have been accomplished by previous methods. Thus, modern SNP arrays offer a powerful method for the discovery of oncogene and tumor suppressor gene involvement in tumors, as well as for improved cancer classification \[[@CR7]\].
In contrast to surveillance of genome wide alterations by CGH arrays it is possible to directly quantify the absolute copy number of specific DNA loci by Droplet Digital PCR (ddPCR). In ddPCR, target sequences are amplified by PCR and the reaction products are partitioned into droplets and amplified to endpoint with TaqMan probes as in qPCR, then their concentrations are determined based on the number of fluorescently positive and negative droplets in a sample well. The absolute number of target and reference DNA molecules is calculated and provides the target copy number variation (CNV) \[[@CR8]\].
In the present study we used high-resolution SNP arrays for the first time to genome wide analysis of aberrations in hemangioblastomas aiming at the identification of novel pathogenetic mechanisms and possible targets for rational therapy. We validated the main reoccurring genetic changes by ddPCR highly precise quantification.
Methods {#Sec2}
=======
Study population {#Sec3}
----------------
A total of 44 hemangioblastoma samples were used for the present study. Thirteen frozen samples obtained from The Sourasky Medical Center, Tel Aviv, Israel were used for the CGH analysis. Additional 32 formalin fixed paraffin embedded (FFPE) samples from Sheba Medical Center, Tel Hashomer, Israel were used as validation group. The study was approved by the ethical review boards of both Sheba and Tel Aviv Sourasky Medical Centers and was consistent with the declaration of Helsinki including informed consents. Clinical parameters, such as sex, age at diagnosis, and pathologic classification were collected from patient records. Clinical information of the patient's cohort is outlined in Table [1](#Tab1){ref-type="table"}.Table 1Cohort characteristicsCharacteristicFrozenParaffinAverage age48.553.5Median age5153Spinal samples43Brain samples829Total number1232
CGH analysis {#Sec4}
------------
DNA was purified from frozen tissues using DNeasy (Qiagen Inc., Valencia, CA). One sample of pooled normal genomic DNA, provided by Affymetrix, was used as experimental positive control. 250 ng of genomic DNA was digested with *Nsp*I (New England Biolabs, Inc) and then ligated to Nsp adaptors. The adaptor-ligated DNA fragments were amplified, fragmented using DNase I, end labelled with a biotinylated nucleotide, and hybridized to a human cytoscan HD array (Affymetrix) at 50 °C for 17 h. After hybridization, the arrays were washed, stained, and finally scanned with a GeneChip scanner 3000 (Affymetrix). All procedures were performed according to the manufacturer's protocols. Array experiments were performed using the high-resolution Affymetrix CytoScan HD microarray (Affymetrix, Inc, Santa Clara, CA) containing 2,696,550 markers of which 1,953,246 are non-polymorphic markers and 750,000 SNPs with over 99 % accuracy to detect accurate breakpoint estimation as well as loss of heterozygosity (LOH) determination. This chip covers 340 International Standards for Cytogenomic Arrays (ISCA) constitutional genes, 526 cancer genes (99.6 %) and 36,121 RefSeq genes. The chip uses marker intervals of 25 markers / 100 kb. Analysis of CEL files from the Affymetrix CytoScan HD Array or Cytogenetics Whole-Genome 2.7 M Array was done with the Chromosome Analysis Suite (ChAS) software for cytogenetic analysis. Signal processing was done by Signal Covariate Adjustment, Fragment Correction, Dual Quantile Normalization and PLIER signal summarization. Dual Quantile Normalization was done to equalize each array's intensity distribution copy number and SNP probes separately. For SNP markers, multiple probes for each allele were summarized to single values. Copy number (CN) was calculated by hidden Markov model copy number segments after log2 calculation, high pass filter image correction, log2 ratio covariate adjustment and systematic residual variables removal. The baseline for CN = 2 (normal autosomal copy number state) was established and used by the analysis software by Affymetrix company using a set of 380 phenotypically normal individuals named as reference. The reference sample includes 186 females and 194 male. For chromosome X, only females were used and for chromosome Y only males were used. Log2 ratios for each marker are calculated relative to the reference signal profile. Results of the summarized Data (CYCHP files) were viewed as chromosomal aberrations in table and graphical formats. We also added visual inspection of probe performance for altered segments. Reference intensity intended to represent the copy normal state (typically 2). Log ratios above 0 mean CN gain, log ratios below 0 mean CN loss and log ratios around 0 represent no change. Abnormal DNA copy numbers are identified automatically using 25 markers for loss/50 markers for gains.
VHL sequencing {#Sec5}
--------------
To screen the *VHL* gene for mutations in our cohort, we performed direct sequencing of the coding region. Exons 1, 2 and 3 of the *VHL* gene and their immediately flanking sequences were amplified by PCR as described previously \[[@CR9]\]. The PCR amplification products were purified by using the QIAquick PCR Purification Kit (Qiagen), according to the manufacturer's instructions. The amplification primers were used as primers in the sequencing reactions, except for exon 1, for which we designed a new cycle sequencing primer (5′CGAAGATACGGAGGTCGA3′). Cycle sequencing was performed using the ABI PRISM Big Dye Terminator Cycle Sequencing Ready reaction kit (Applied Biosystems, Foster City, CA, USA), followed by isopropanol precipitation. The fragments were sequenced by automated sequencing analysis on an ABI Prism 377 sequencer (Applied Biosystems).
Droplet digital PCR {#Sec6}
-------------------
Copy Number validation was done on all samples, frozen and paraffin embedded, hemangioblastoma biopsies. Genomic DNA was purified using QIAamp DNA mini (Qiagen). Copy number variation (CNV) test was performed by droplet digital PCR (ddPCR) as previously described \[[@CR10]\]. In short, 16 ng of genomic DNA samples were added to 2xddPCR supermix (Bio-Rad) with final concentration of 500nM of each primer and 250nM probe in duplex of the tested gene and RNaseP. RNaseP served as a CNV = 2 reference gene. Probes for the tested genes contained a FAM reporter and RNaseP contained HEX. The genomic DNA and PCR reaction mixtures were partitioned into an emulsion of approximately 20,000 droplets using the QX100 droplet generator (Bio-Rad, USA). The droplets were transferred to a 96-well PCR plate, heat sealed, and placed in a conventional thermal cycler. Thermal cycling conditions were: 95oC for 10 min followed by 40 cycles of 94oC for 30 s, 60oC for 60 s and one cycle of 98oC for 10 min and finally 4oC hold. Following PCR, the plates were loaded into QX100 droplet reader (Bio-Rad) and the CNV value was calculated using Quantasoft software (Bio-Rad, USA). Primers and probes for selected areas enlisted in Table [2](#Tab2){ref-type="table"} were designed using Primer Express software (PE Corp, USA) and specificity was verified using NCBI BLAST online tool (National Library of Medicine, USA). RNaseP primers and probes were obtained from Bio-Rad.Table 2Digital PCR primers and probes for selected areasGeneOligonucleotidesSequence (5′-3′)reporter*PTPN11*Forward primerTTAGAGACAGGGTCCCACTCTTG-Reverse primerGCTTGAGGATGCAGTAAGCTATGA-ProbeCCTGGCTGGAGTGCAGTGGCGTFAM*CHECK2*Forward primerCATTTTTCTCTTAGTATCTTTCTGGGAAT-Reverse primerCATTTCTGAGCCCAGCAATACA-ProbeTCACAATCCAGGGCTACAGTAAGACCCATGFAM*PTCH1*Forward primerGCGTGCGAAGGTGGAGACT-Reverse primerTCATTGGCCTCCCACTTGA-ProbeTGTCTTCTCCCCCATGTCGGFAM*EGFR*Forward primerAGGAGGAACAACGTGGAGACA-Reverse primerGAGACACCGGAGCCACAGA-ProbeCCCAGAGGTGGAACGTTGGCCCFAM*RNaseP*Forward primerGATTTGGACCTGCGAGCG-Reverse primerGCGGCTGTCTCCACAAGT-ProbeCTGACCTGAAGGCTCTHex
Results {#Sec7}
=======
SNP array profiling identifies recurrent CNVs {#Sec8}
---------------------------------------------
The systematic genome-wide gain and loss segments based CNVs data detected by SNP profiling in hemagioblastoma is detailed in the karyoview (Fig. [1](#Fig1){ref-type="fig"}). We identified 94 CNVs with a median of 18 CNVs per sample. Twenty-three of them involved noncoding regions in centromeres that are known to harbor spurious CNVs, most of them were less than 100 Kb long, and 56 were found in at least two samples. The most frequently gained regions were on chromosomes 1 (p36.32) and 7 (p11.2). These regions contain the *PRDM16* and *EGFR* genes, respectively. Recurrent losses were located at chromosome 12 (q24.13) which includes the *PTPN11* gene. Pathway analysis revealed that *EGFR*, Notch and HedgeHog signaling were the most frequently altered pathways promoting angiogenesis and proliferation. *Mir 551a* (part of *PRDM16*) gain was detected in seven samples, *miR-196a-2* gain was observed in five samples and *miR-196b* gain was detected in four samples. The list of recurrent CNVs found in at least five specimens (Fisher exact test *p*-value \< 0.05), including type of alteration, involved chromosome, cytobands, and overlapping genes/miRNAs according to the RefSeq database is provided in Table [3](#Tab3){ref-type="table"}. Two samples had LOH affecting the *CHECK2* region (Fig. [2](#Fig2){ref-type="fig"}).Fig. 1Ideogram illustrating genome-wide distribution of DNA amplifications and deletions (copy number variation) on each chromosome. Each line next to the chromosome represents one sample. Gains in copy number are represented by triangles pointing upwards and losses in copy number are represented by triangles pointing downwards with indication of gene in that region. Chromosome numbers are indicated in boxesTable 3Frequent chromosome losses and gains involving single genesNumber of samplesTypeChromo someBandGenemiRNAGV7Gain7p11.2*EGFR*-7Gain1p36.32*PRDM16*hsa-mir-551ahsa-mir-551av7Loss12q24.13*PTPN11*-7Gain2q31.1*HOXD11, HOXD13 HOHOHOXD13 HOXD11HOXD13*v6Loss13q12.2*FLT3*-6Gain9q22.32*PTCH*v5Loss8p11.22*FGFR1*-5Loss3p13*FOXP1*-5GainXq26.2*GPC3*-5Gain12q13.13*HOXC13, HOXC11*hsa-mir-196a-2v5Loss22q13.1*MKL1*v5Loss22q12.1*CHEK2*vThe column "Number of samples" represents the number of patients with a particular genomic abnormality. For each variation the type of variation (gain or loss), location on chromosome and band, the gene located in this locus and miRNAs located in this locus are enlisted. Variants reported in the Database of Genomic Variants (DGV) database in genes are denoted as "v" and if none reported as "-" under the column DGVFig. 2*CHECK2* copy number state. *CHECK2* locus is labeled by centrally located data track with dashed line. The data point scores form a trinomial distribution about the values 2, 0 and −2, where values around 0 represent heterozygous SNPs, while homozygous SNPs have a value of approximately 2 or −2. LOH is located on genomic region with a scarcity of heterozygous SNP calls. **a** Sample 6 and (**b**) Sample 13 exhibit LOH of *CHECK2* region, (**c**) The control sample exhibits normal copy number state
VHL status {#Sec9}
----------
We determined the *VHL* mutation status of our discovery cohort by both DNA sequencing and results from the CGH arrays. In two of the thirteen frozen samples (samples 7 and 10) *VHL* deletions were detected by our CGH analyses. The deletion in sample 7 encompassed 332 kb with 564 markers. The deletion in sample 10 was shorter (135 kb) with 344 markers. Figure [3](#Fig3){ref-type="fig"} illustrates the smooth signal obtained in chromosome band 3p25.3 for these samples. Sequencing based mutational analysis of *VHL* did not reveal any additional mutations. Samples 7 and 10 incurred CNVs similarly to the other samples. The average number of CMVs in the other samples was seven. Sample 7 had 14 of the common CNVs thus had more than the average CNVs but sample 10 had less CNVs (six) which is similar to the average.Fig. 3VHL locus (Ch.3 p25.3) deletion data display. The smooth signal derived from the raw data is displayed. The smooth signal value is calculated using the intensity values of the flanking probes and the data is displayed by a continuous line which is filled down to the x axis. Focusing on VHL locus was done by selecting the specific region of the chromosome and zooming in such that this region spans the entire x-axis. The data points containing the probe values are overlaid on the graph. Smooth signal value can be between zero or four depending on the Log(2) ratio raw values of the surrounding probes. **a** Sample 7 and (**b**) Sample ten smooth signal is one exhibiting deletion in *VHL* locus (labeled with dashed line). Probes around the area are normal (around 2)
CNV validation by digital droplet PCR {#Sec10}
-------------------------------------
We validated our findings in a subset of four genes (*EGFR, CHECK2, PTCH1* and *PTPN11*) in the discovery cohort used for the array CGH and in an additional independent set of 32 FFPE specimens, using copy variation detection by digital droplet PCR (ddPCR) analysis. Samples were partitioned into thousands of nanoliter-sized droplets; single template molecules were amplified on a thermocycler, and counted for fluorescent signal. Absolute copy numbers of target and reference sequences were determined by Poisson algorithms \[[@CR8]\]. The RNase P (Ribonuclease P) amplicon maps within the single exon *RPPH1* gene on 14q11.2 was used as the standard reference assay for copy number analysis \[[@CR11]\]. Validation results were as follows: *EGFR* amplification was detected in 29 of 32 patient samples (Fig. [4](#Fig4){ref-type="fig"}), *PTCH1* was amplified in 18 of 32 patients (Fig. [5](#Fig5){ref-type="fig"}) and *CHEK2* was deleted in 27 of 32 (Fig. [6](#Fig6){ref-type="fig"}). Surprisingly, *PTPN11* was deleted in 7/32 whilst it was amplified in 17/32 specimens (Fig. [7](#Fig7){ref-type="fig"}).Fig. 4*EGFR* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 5*PTCH1* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 6*CHEK2* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that regionFig. 7*PTPN11* Copy number variation (CNV) values for clinical samples and one normal genomic DNA sample. Genomic DNA copy number alterations were assessed via ddPCR. The CNV is shown as the number of copies and the Poisson distribution at 95 % confidence interval. The copy number value of normal diploid sequence has a score of two. Copy number above two means amplification in that region and copy number below two means deletion in that region
It is important to note that in result of normal cell admixture within tumor samples a high CNV means either high fraction of tumor cells with relatively high copy number in each cell or low fraction of tumor cells with very high copy number in each cell. Likewise, low CNV means either high fraction of tumor cells with relatively low copy number in each cell or low fraction of tumor cells with relatively very low copy number in each cell. In short if the fraction of tumor cells is low then the relative copy number (both high and low CNV) is even higher than what is reported. In our cohort, histopathologic assessment by a pathologist determined that 47 percent of samples had more than 95 % tumor, 7 percent had more than 90 % tumor, 29 percent of samples had more than 70--80 % tumor, 14 percent of samples had between 50--70 % tumor and 3 percent had between 40--50 % tumor.
Discussion {#Sec11}
==========
We report here for the first time a genome-wide, high-resolution systematic analysis of chromosomal changes in hemangioblastoma. Using the SNP array 6 (Affymetrix) we analyzed 1.8 million genetic markers genome wide to identify amplifications/deletions up to single gene level. We identified a total of 94 CNVs, 23 of them involved noncoding regions. 56 (31 gains and 25 losses) were found in at least two specimens. The most frequently gained regions were on chromosomes 1 (p36.32) and 7 (p11.2). The most frequently deleted region was on chromosome 12 (q24.13).
Our findings provide the first high-resolution genome-wide view of chromosomal changes in hemangioblastoma and identify 23 common, ie found in 4 or more patients, candidate genes for hemangioblastoma pathogenesis (Table [3](#Tab3){ref-type="table"}): *EGFR, PRDM16, PTPN11, HOXD11, HOXD13, FLT3, PTCH, FGFR1, FOXP1, GPC3, HOXC13, HOXC11, MKL1, CHEK2, IRF4, GPHN, IKZF1, RB1, HOXA9, HOXA11* and several microRNA, including *hsa-mir-196a-2*. We note that some of these microalterations have been reported very rarely previously in tissue samples from healthy subjects (according to Database of Genome Variants (DGV), which are reported in Table [3](#Tab3){ref-type="table"}. However, in our tumor samples these alterations are significantly more common (p \< 0.00001).
Functional annotation analysis by David \[[@CR12]\] reviled that two pathways are prominently affected in the hemangioblastoma samples: the cell proliferation and angiogenesis promoting pathways. The cell proliferation pathway includes the following genes: *CHEK2, EGFR, FGFR, FLT3* and *PTCH1*. The angiogenesis pathway includes the genes *EGFR* and *FGFR*, which are significant because they are also involved in blood vessel formation. Importantly, three of these genes were verified by ddPCR: *EGFR, CHEK2* and *PTCH1*. Furthermore, *PTPN11* was selected for verification as it was lost strikingly often (Table [3](#Tab3){ref-type="table"}).
Epidermal growth factor receptor (*EGFR*) is a tyrosine kinase receptor that has been documented with increased expression in a variety of human cancers such as breast cancer, \[[@CR13]\], early stage non-small-cell lung cancers and gliomas \[[@CR14], [@CR15]\]. Our findings are in line with three prior immunohistochemical studies that found *EGFR* overexpression in hemangioblastomas \[[@CR16]\] \[[@CR17]\] \[[@CR18]\]. Fibroblast growth factor receptor 1 (*FGFR1*) micro deletions have been reported in myeloid and lymphoid neoplasms \[[@CR19]\]. Interestingly we discovered that the *FGFR1* deletion involves the FGFR1 2nd intron (chromosome 8, 38291333--38314367), which according to UCSC genome browser hg19 includes a regulatory site. Checkpoint kinase 2 (*CHEK2*) has been implicated in DNA repair, cell cycle arrest, and apoptosis in response to DNA double-strand breaks \[[@CR20]\]. Mutations in *CHEK2* have been reported to be possibly associated with breast cancer and liposarcoma development \[[@CR21], [@CR22]\]. The protein patched homolog 1 (*PTCH1*) is a sonic hedgehog receptor. Loss of function mutations in *PTCH1* are associated with development of various types of cancers, including medulloblastoma \[[@CR23], [@CR24]\], pancreatic cancer \[[@CR25]\] and colorectal cancer \[[@CR26]\]. In contrast to these observations, we find consistent *PTCH1* gains in our cohort of hemangioblastoma patients (Table [3](#Tab3){ref-type="table"}). In support of our findings there are reports of *PTCH1* also acting as an oncogene in a mouse model of skin basal cell carcinomas \[[@CR27]\].
FMS-like tyrosine kinase 3 (*FLT3*) plays a role in hematopoiesis including early hematologic differentiation and early B and T-cell development \[[@CR28]\] and dendritic cells differentiation \[[@CR29]\]. Activating *FLT3* mutations are some of the most common molecular abnormalities in acute myeloid leukemia (AML) \[[@CR30]\]. Interestingly, in our data, we find losses of *FLT3* (Table [3](#Tab3){ref-type="table"}). Consistent with our findings, others have reported deletions in *FLT3* in AML as well \[[@CR31]\] \[[@CR32]\]. Among the altered genes mapped in many of the recurrently gained regions we recognized several *HOX* genes (Table [3](#Tab3){ref-type="table"}) and microRNAs (miRNAs) residing in the same region. *HOX* genes encode master transcription factors important in development and have been reported to be commonly altered in human solid tumors \[[@CR33]\]. On the other hand, miRNAs are small regulatory RNAs that have recently been implicated in a variety of cancers \[[@CR34]\]. miR-196a-2 and miR-196b gain were the most common miRNA CNV in our patients. Interestingly, miR-196a-2 differs from miR-196b by one nucleotide \[[@CR35]\]. The miR-196 gene family is located in the regions of homeobox (*HOX*) transcription factors that are essential for embryogenesis. Up-regulation of miR-196a has been found in breast cancer, adenocarcinoma, leukemia and esophageal adenocarcinoma \[[@CR35]\]. Accordingly the relevant causative change may actually be altered miRNA expression rather than *HOX* gene expression. Other studies have reported a 12-fold increase in miR-9 and a 15-fold decrease of miR-200a in hemangioblastomas distinguishing hemangioblastomas from metastatic clear cell renal cell carcinomas in the CNS \[[@CR36]\]. *Prdm16* is preferentially expressed by stem cells throughout the nervous and haematopoietic systems and promotes stem cell maintenance \[[@CR37]\]. Megakaryoblastic leukemia protein-1 (*MKL1*), is a transcription factor that regulates many processes, including remodeling of neuronal networks and epithelial-mesenchymal transition \[[@CR38]\]. Moreover, deregulation by genetic alterations and/or altered *MKL1* transcription has been shown to have role in myeloproliferative neoplasms \[[@CR39]\]. Finally and most interestingly, protein tyrosine phosphatase, non-receptor type 11 *(PTPN11*) gene encodes the tyrosine phosphatase SHP2 protein required for RTK signaling and has a role in survival, proliferation and differentiation \[[@CR40]\]. The fact that we find the *PTPN11* gene is deleted in some hemangioblastoma patients and is amplified in others may suggest that these tumors actually originate from different cellular lineages. In fact, we found that spinal tumors were overwhelmingly deleted in the *PTPN11* region: 5 of 7 spinal tumors were deleted whilst 1 was amplified and 1 was chromosomally normal at this locus. In contrast, cerebellar hemangioblastomas were generally amplified: 16 out 37 were indeed amplified. However, 10 cerebellar tumors were deleted and 11 of 37 were normal in this genomic region. Interestingly, differential overexpression or deletion of *PTPN11* has been shown in other tumors. For example, mutations in *PTPN11* has been reported to be associated with development of Juvenile Myelomonocytic Leukemia (JMML) \[[@CR41]\], acute myeloblastic leukemia (AML) \[[@CR42]\], and acute lymphoblastic leukemia (ALL) \[[@CR43]\]. Overexpression in gastric carcinomas has been reported \[[@CR44]\]. In contrast, *PTPN11* has a tumor-suppressor function in liver \[[@CR45]\] and cartilage \[[@CR46]\]. Accordingly, decreased *PTPN11* expression was detected in a subfraction of human hepatocellular carcinoma specimens \[[@CR45]\]. Thus, in contrast to its common pro-oncogenic role in hematopoietic and epithelial cells, *PTPN11* may act as a tumor suppressor in cartilage. Accordingly, we hypothesize that the *PTPN11* gene may act in a cell-specific manner: as a tumor suppressor on one hand in the progenitor cells of spinal hemangioblastomas, whilst it acts as an oncogene in the cells of origin of cerebellar hemangioblastoma tumors.
Previous analysis of six VHL-related CNS hemangioblastomas showed loss of chromosome 3p or the whole of chromosome 3 to be the most common abnormality, which is detected in 70 % and loss of 1p11-p31 in 10 % \[[@CR47]\]. More relevant to our findings, published CGH studies on 10 sporadic cerebellar hemangioblastomas detected losses of chromosomes 3 (70 %), 6 (50 %), 9 (30 %), and 18q (30 %) and a gain of chromosome 19 (30 %) \[[@CR48]\]. We indeed detected losses and gains in these areas but they were not frequent (15-20 %). Chromosome 3 losses were more abundant, mostly on p13 (5 samples *FOXP1*) and p25 (3 samples showed *PPARG* loss and 2 samples showed *VHL* loss). Interestingly, *FOXP1* transcription factor, located on chromosome 3(p13), can function as a tumor suppressor gene. Low expression in glioma \[[@CR49]\] and Hodgkin lymphoma has been shown \[[@CR50]\]. Differences in methodology, sample size and definition of aberration inclusion criteria may account for some of the apparent inconsistencies between previous studies and our findings. For example, previous results were obtained from VHL-related hemangioblastomas using techniques that identify deletions that are larger than 2 Mb. In the current study we used modern CGH microarrays which scan the DNA every 1 kb and thus we were able to identify very subtle genomic changes. One of the most striking observations in our study is that many CNVs affected single genes (Table [3](#Tab3){ref-type="table"}) and revealed candidate genes, which have not been implicated in hemangioblastomas. This represents an important outcome of this study compared with previous investigations using CGH. Some of the new genes identified here as affected by CNVs in hemangioblastoma may serve as targets for future precisely targeted anti- cancer therapy. For example, antiangiogenic therapy can be given to patients with lesions that are not resectable.
Conclusions {#Sec12}
===========
In this study, we have demonstrated in two different tumor cohorts and using two different techniques for copy number alteration detection, SNP and digital PCR, that *Chek2* is deleted and *EGFR*, *PTPN11, Ptch1* amplified in majority of hemangioblastoma patients. EGFR is the only gene that has been previously reported as a candidate gene with hemangioblastoma. Independent of HB tumor location *PTPN11* may act as tumor suppressor or oncogene depending on the tumor cell of origin. These findings have potentially relevant clinical value, as this the first high resolution for chromosomal alteration in HB. Future research should be dedicated to the prospective validation of these alterations and further characterization of tumors that carry the deletions/amplifications, as well as of defining the role of these genes. This may offer insights into hemangioblastoma biology, provide DNA-based markers that can be analyzed by FISH suitable for routine clinical applications and eventually lead to the development of effective targeted therapies for HB.
CNVs
: Copy number variations
HB
: Hemangioblastomas
CNS
: Central nervous system
VHL
: von Hippel-Lindau
CGH
: Comparative genomic hybridization
SNP
: Single nucleotide polymorphism
LOH
: Loss of heterozygosity
ddPCR
: Droplet Digital PCR
CNV
: Copy number variation
FFPE
: Formalin Fixed Paraffin Embedded
RNase P
: Ribonuclease P
*EGFR*
: Epidermal growth factor receptor
*FGFR*
: Fibroblast growth factor receptor 1
*CHEK2*
: Checkpoint kinase 2
*PTCH1*
: Protein patched homolog 1
*FLT3*
: FMS-like tyrosine kinase 3
AML
: Acute myeloid leukemia
miRNA
: microRNA
*MKL1*
: Megakaryoblastic leukemia protein-1
PTPN11
: protein tyrosine phosphatase non-receptor type 11
Michal Yalon, Shlomi Constantini and Amos Toren contributed equally to this work.
**Competing interests**
The authors declare that they have no competing interest.
**Authors' contributions**
RMS conceived, designed and coordinated the study, performed the CGH analysis and drafted the manuscript, IM carried out the droplet digital PCR experiments, IB and DN participated in collecting the FFPE samples, JJ and CD carried out the CGH experiments, JR provided advice and revised the manuscript, MY, SC and AT participated in collecting the frozen samples, designing and coordinating of the study. All authors read and approved the final manuscript.
This research was funded by The Sheba Medical Research fund. We thank Sarah South, PhD, University of Utah, for insightful remarks on Affymetrix CGH analysis.
|
Card clampdown on gamblers
CREDIT card companies are clamping down on customers that use their cards to bet on online gambling sites.
A number of card issuers are changing their terms and conditions so that money placed in an online betting account from a credit card will be treated as cash advance and incur a higher rate of interest.
They will also be charged a 2% handling fee for cash advances, which starts at £2.
The interest charged on cash advances is usually much higher than normal card purchases. For example, Mint charges 14.9% APR on a normal card purchase, but 17.9% for cash advances.
Online gambling has proliferated over the past three years and many gambling sites are challenging the traditional High Street bookies. Punters enjoy the ease and anonymity of betting at home, and online sites also typically offer better odds.
Royal Bank of Scotland is introducing the change from May 1 for its 11m customers. A spokeswoman said: 'The gambling transactions are to be treated as advances as this is felt to be a more accurate means of reflecting that a gambling transaction is effectively a cash equivalent exchange.'
Egg, which has 3m customers, will introduce its own change from April 1. Spokesman Mark Maguire said: 'Essentially, using your card for gambling is quasi cash and we are changing our rules to reflect that. Basically, you are using your card to buy currency.'
A spokesman for PartyGaming, one of the largest online gambling sites on the web, said that very few of its customers are using credit cards to pay for their bets.
He said: 'There are 23 different ways to load your account. Most of our customers use 'e-wallet' services, such as those provided by Neteller or FireOne.'
Credit Card Reality Check Calculator
Your plastic debt
This calculator will show you just how long it's going to take you to clear your credit card balance if you don't wake up, face reality, stop paying the bare minimum and start clearing this punitive form of debt.
Your credit card balance:£
Interest rate:%
Monthly payment:£
Result
Number of monthly payments:
Clear your debt quickly
Now see how much you need to pay a month to clear your balance in the shortest possible time. |
THE Q ROCKS » bath salthttp://klaq.com
El Paso's Best RockTue, 31 Mar 2015 17:34:33 +0000en-UShourly1http://wordpress.org/?v=3.4.2http://klaq.com/files/2013/05/KLAQ_LOGO-resized2.pngTHE Q ROCKShttp://klaq.com
Some of Johnnie's Favorite Songs to Eat Brains To – A Zombie-pocalypse Tributehttp://klaq.com/some-of-johnnies-favorite-songs-to-eat-brains-to-a-zombie-pocalypse-tribute-2/
http://klaq.com/some-of-johnnies-favorite-songs-to-eat-brains-to-a-zombie-pocalypse-tribute-2/#commentsTue, 05 Jun 2012 03:49:42 +0000Johnnie Walkerhttp://klaq.com/?p=93152Continue reading…]]>Here I am, sitting in the control room at KLAQ, playing El Paso's Best Rock, and wondering where I can get me some bath salts. Do you think Bed Bath and Beyond has had a huge run on the stuff this past week? I seem to know a lot of people who wouldn't fight becoming a zombie. (Ask Stephanie the Corporate Computer Babe for her reasoning behind this.) |
Eleven dedicated educators who have been quietly changing the lives of city school kids for the better took center stage on Wednesday at the Daily News Hometown Heroes in Education awards.
Mayor de Blasio joined local luminaries and top education leaders for an emotional ceremony at the Edison Ballroom in Times Square and presented a special posthumous award to the daughter of Kevin O’Connor, the beloved 61-year-old Queens social studies teacher and dean who passed away in April.
“This kind of gathering puts things in a proper perspective and help us focus on what really matters,” de Blasio said. “We're going to take every opportunity to celebrate our educators and I'm so happy we're doing that today.”
The winners of the fourth annual awards included a big-hearted Brooklyn principal who makes sure homeless students and their families have everything they need to succeed in school, a Bronx teacher dedicated to improving communication between parents and teachers and a Queens school nurse who also teaches kids about good nutrition.
Stars from the world of music and television journalism shared the winners' inspirational stories and presented the awards, including hip-hop pioneer DMC and DJ Funkmaster Flex, and local news heavyweights Mary Calvi, David Ushery and Brenda Blackmon.
The educators were presented with Hometown Heroes in Education awards on Wednesday.
“To think about the tens of thousands of lives being shaped, guided and inspired every day in our city's schools is amazing,” said Daily News Editor-in-Chief Jim Rich. “Our educators are the most unsung heroes we have. Today's event is a well-deserved way of honoring them.”
The city’s public school system is the largest in the nation with 1.1 million students, over 76,000 teachers and 1,800 schools.
The News received more than 200 nominations from colleagues, students and others who wanted to recognize the hard work of teachers, principals and other school staffers.
A panel of judges comprised of education experts and parent advocates selected the winners in August.
Kevin O'Connor
Schools Chancellor Carmen Fariña, CUNY Chancellor James Milliken and United Federation of Teachers President Michael Mulgrew served as judges and presenters at the ceremony, emphasizing the importance of recognizing top-notch educators.
“What binds us together as educators is that we know we make a difference,” said Fariña, a 50-year veteran of city schools.
“The difference you make, you will sometimes never know,” she added. “It's not the award you get today— it's the fact that because of you, someone's life is transformed.”
Delfina Cheung and DMC.
“How do they show up every September with the enthusiasm they had their first September on the job? That to me is remarkable,” Kiernan said. “They're thinking, 'I've got another fresh class in here and this is a class that once again I'm going to make a difference in their world.' And they're special people because of that.”
The winners of the fourth annual awards included Tammy Katan-Brown, a big-hearted Brooklyn principal who makes sure homeless students and their families have everything they need to succeed in school; Adrian Brooks, a Bronx teacher dedicated to improving communication between parents and teachers; and Sherry Branch, a Queens school nurse who also teaches kids about good nutrition.
O’Connor, a veteran educator, worked at Francis Lewis High School in Fresh Meadows and Campus Magnet High School in Cambria Heights. He was popular for his ability to connect with his students.
His daughter, Kristen Rajak, travelled from Florida for the awards ceremony.
She said she plans to follow in her father’s footsteps and pursue a career in education.
“I can’t even really describe how proud I am of him,” Rajak said after accepting the honor for her father. “I knew that he was special. But this really solidified it that people recognize that and made note of it.” |
218 F.2d 148
Charles E. TOLIVER, Appellant,v.UNITED STATES of America, Appellee.
No. 14395.
United States Court of Appeals Ninth Circuit.
Dec. 7, 1954.
Leslie C. Gillen, Gregory Stout, San Francisco, Cal., for appellant.
Lloyd H. Burke, U.S. Atty., John H. Riordan, Asst. U.S. Atty., San Francisco, Cal., for appellee.
DENMAN, Chief Judge.
1
Attorney Gregory S. Stout moves for appellant an extension of time to January 9, 1955 to file an opening brief which he failed to file when due on November 20, 1954. The ground of his application is that the attorney has accepted an assignment by a District Court of Appeal of the State of California, an inferior state court, to write a report pertaining to an analysis of a provision of the California Constitution.
2
It further appears that Mr. Stout's client is, during his appeal, in the custody of this court in the San Francisco County Jail and that during such custody he is not serving time on the sentence from which his appeal is pending. That is to say, the wrong already done his client by not filing even now the brief due November 20, 1954, he seeks to extend by adding 30 days more to his client's imprisonment.
3
Whether such wrongful conduct by an officer of his court constitutes a contempt is not to be determined on this motion. However, unless the appellant's brief is filed within ten days hereof, the question of Mr. Stout's conduct is certain to be raised.
4
Time to file appellant's opening brief is extended to December 17, 1954.
|
1. Field of the Invention
The present invention relates to a microprocessor with a cache memory in which debugging operations are supported, and, in particular, to a microprocessor with a cache memory in which functions for implementing debugging operations are improved.
2. Description of the Background Art
Debugging operations are generally executed to debug in programming in a microprocessor applied system to develop the system.
In detail, a program stored in the system is actually executed before the debugging operations are executed. Thereafter, for example, pieces of data transmitted on an external bus connected to an external memory are monitored. The execution of the program is braked when arithmetic processing is advanced to a designated address or when designated conditions such as access to a piece of designated data are accomplished. After braking the execution of the program, contents of registers and memories are displayed. Also, instructions executed during the arithmetic processing are listed up. Therefore, an operator can debug the program stored in the program.
In this case, the system is generally provided with a plurality of microprocessors which are connected with a cache memory, an arithmetic unit and a control unit. In addition, the system is provided with an external memory connected with the microprocessors to store a large pieces of data, and external buses through which pieces of data, instructions or addresses are transmitted between the microprocessors and/or between the microprocessor and the external memory.
However, there are drawbacks to execute the debugging operations in cases where a program executed in a microprocessor with a cache memory is debugged.
That is, the debugging operations are initially executed according to normal operations.
In detail, in cases where a piece of data is stored at an address of the cache memory, an address hit occurs in the microprocessor when the address is accessed by the arithmetic unit during the execution of the program. Thereafter, under control of the control section, the data stored at the address is read out from the cache memory to utilize in the arithmetic unit or is rewritten to another piece of data which is made in the arithmetic unit. Therefore, an operation accessing to the external memory is not executed in the microprocessor. In other words, instructions or pieces of data transmitted between the cache memory and the arithmetic unit cannot be detected even though the operation accessed from the microprocessor to the external bus is monitored.
On the other hand, in cases where a piece of data is not stored at an address of the cache memory, a cache miss occurs in the microprocessor when the data is accessed by the arithmetic unit during the execution of the program. Thereafter, the data is fetched from the external memory through the external bus to store at the address of the cache memory.
The above debugging operations are executed in the same manner as the normal operations.
In this case, the data transmitted on the external bus is monitored by a data detector. Therefore, in cases where the arithmetic processing executed in the arithmetic unit is scheduled to be braked according to the debugging operations when a piece of data DA0 relating to the cache miss is fetched from the external memory, the data DA0 is detected when the data DA0 is transmitted on the external bus. This operation is one of the debugging operations and is not executed in the normal operation.
Accordingly, the arithmetic processing executed in the arithmetic unit can be braked to debug the program executed in the arithmetic unit.
However, it has been recently required to improve the speed of the arithmetic processing during the normal operation. Therefore, in cases where the cache miss occurs, a group of pieces of data is fetched in a block unit from the external memory to improve the speed of the arithmetic processing. The pieces of data fetched in a block unit are likely to be utilized in the arithmetic unit in serial order.
Therefore, as shown in FIG. 1, in cases where the arithmetic processing executed in the arithmetic unit is scheduled to be braked according to the debugging operations when a piece of data DA2 relating to the cache miss is fetched from the external memory, a data signal requiring a piece of data DA1 is, for example, transmitted to the external memory through an external bus when the data DA1 is accessed by the arithmetic unit in the microprocessor and a cache miss occurs. Thereafter, a group of sequential pieces of data DA1 to DA4 is fetched from the external memory into the cache memory in serial order. That is, the sequential pieces of data DA1 to DA4 are stored at addresses AD1 to AD4 of the cache memory. In this case, the data DA2 is not detected by a data detector because the data DA2 is not required by the data signal even though the data DA2 is fetched into the cache memory from the external memory.
Thereafter, the data DA1 stored at the address AD1 of the cache memory is read out from the cache memory to utilize for the arithmetic processing in the arithmetic unit. Thereafter, the data DA2 stored at the address AD2 of the cache memory is read out from the cache memory without the occurance of the cache miss.
Therefore, it is impossible to specify the data DA2 accessed by the arithmetic unit in the microprocessor even though data signals transmitted through the external bus are monitorred without monitorring a piece of data processed in the arithmetic unit.
Also, even though the data DA2 is detected by the data detector when the sequential pieces of data DA1 to DA4 are stored at addresses AD1 to AD4 of the cache memory, the data DA2 is not necessarily read out by the arithmetic unit after the data DA1 is read out by the arithmetic unit. Therefore, when the arithmetic processing is braked for the debugging operations, the program executed in the arithmetic unit is stopped at a step not relating to the data DA2.
As mentioned above, even though the arithmetic processing executed in the arithmetic unit is scheduled to be braked for the debugging operations when the data DA2 relating to the cache miss is read out from the cache memory to the arithmetic unit, it is impossible to specify the data DA2 because the sequential pieces of data including the data DA2 are fetched in a block unit.
Accordingly, the efficiency for specifying the data for the debugging operations deteriorates, and it is impossible to reliably specify which step is executed in the program.
Therefore, it is impossible to immediately brake the arithmetic processing according to an interruption operation of the debugging operations when the data DA2 relating to the cache miss is read out from the cache memory after the data DA2 is fetched from the external memory. That is, it is difficult to sufficiently execute the debugging operations.
On the other hand, there is another method that the microprocessor is operated according to simplified operations in which the cache memory is not used when the debugging operations are executed to prevent the efficiency for specifying the data DA2 from deteriorating.
However, the frequency that pieces of data are transmitted to the external bus according to the simplified operations is different from that in the normal operations in which the cache memory is used. In addition, the execution time of the program in the simplified operations is also different from that in the normal operations.
Therefore, there is a drawback that the debug operations cannot be efficiently executed while executing the normal operations. |
The Necessary Beggar
The Necessary Beggar is an adult science fiction novel written by Susan Palwick. Published on October 1, 2005 by Tor Books, it is the author's second novel. The book received the Alex Award in 2006 and was nominated for the Mythopoeic Fantasy Award in 2007.
Plot
The Necessary Beggar tells the story of alleged murderer Darroti and his family after he is exiled from the city of Lémabantunk in Gandiffri, a paradisaical land built on the central idea of community. Murder is the sole unforgivable crime in this world, and as Darroti is accused of murdering a mendicant (a holy beggar), his crimes are considered particularly egregious. Darroti's family follows him through the glowing doorway that leads to the randomly selected realm of his exile. They emerge at the entrance of an American refugee camp. Unable to speak the language or explain their origins, the family is prohibited from being officially admitted into the country but impossible to deport. The situation is made worse by the heightened xenophobia present in this year 2022 version of America.
Faced with the guilt of his family’s exile, Darroti commits suicide to relieve his loved ones of his burden. Rather than be reincarnated in a new form as he would have been in his homeland, he becomes a ghost. To his dismay, his death throws his father into depression and embitters his other family members. He attempts to provide explanation by entering his father’s dreams, but his communications are interpreted as nightmares.
Lisa and Stan, camp volunteers and evangelists, help the family adapt to the new culture. Zamatryna, one of Darroti’s nieces, is the quickest to adapt thanks to her high intelligence. When a bomb planted by an anti-immigration group explodes in the camp, Lisa helps the family escape under the guise of death. She allows them to live in the home inherited from her mother with the loose promise of payback at a later date.
Zamatryna continues to flourish in school, convinced that education is the only way to make her family’s life easier, while the adults acquire work. She meets a boy named Jerry who slowly convinces her to consider her own desires and open up to those who wish to know her. The final push is made by Darroti when he manipulates the dreams of the more susceptible Jerry. Through Jerry, the family discovers that Darroti didn't murder the mendicant; she was in fact his lover, and under the impression that Darroti had been unfaithful, killed herself. With the truth now known, Darroti’s spirit is returned to Lémabantunk. Zama and Jerry marry so that she may gain citizenship and sponsor her family.
Characters
Darroti - Timbor's youngest child. Restless and impulsive, he was never quite as comfortable with life in Lémabantunk as the other members of the family. His displeasure with his place in life was expressed by excessive spending and alcoholism. It is when he locks himself in a friend's apartment to detox for his lover that she misinterprets his act of love as infidelity.
Zamatryna - Eroloit and Harani's daughter. She arrives in the United States as a child and is unable to recall much of Lémabantunk. In addition to being highly intelligent, she assimilates to the new culture with the most ease. This results in the burden of the family's future being placed on her shoulders. Zama also carries a beetle into the U.S. which continually traces an X, the symbol of silence in Lémabantunk, which causes her to hide its existence. This beetle is the "murdered" mendicant in her reincarnated form.
Timbor - the family's patriarch and the father of Eroloit, Darroti, and Macsofo. Their mother, Frella, died before the events of the story took place. In his move from Lémabantunk to America, TImbor transitions from carpet merchant to taxi driver. He is the only character to form a bond with Stan.
Macsofo - the family member who harbors the most resentment towards Darroti and the situation that his alleged crime has put them in. He becomes short-tempered and verbally abusive to the point that his wife leaves the family home and takes the children with her.
Gallicina - the mendicant Darroti is accused of murdering. It is unusual that she decides to become a mendicant, because it's normally a rite of passage reserved for men. In addition to being part of a protected class as a mendicant, she comes from a prestigious family which makes for a large class discrepancy between her and Darroti.
Lisa's - Stan's wife. Her main occupation is helping Stan to grow the congregation of the small church that he operates from home. She is respectful of the family's culture and makes no overt attempts at converting them to Christianity. She served time in prison long ago.
Stan - the pastor of a small, struggling church. He makes a concentrated effort to convert the family and considers the expression of their religion to be blasphemous. His portrayal of Christianity frightens the family making his efforts unsuccessful.
Reception
Publishers Weekly called the novel "a sharp meditation on refugees and displaced persons and a tragicomedy of cultural differences."
References
Category:2005 science fiction novels
Category:American science fiction novels |
Q:
MongoDB find in array
I have a mongodb JSON array and I am having issues locating categories, eg.
{ name:"hoyts"}
I have tried {categories.name:"hoyts"} and a few others but nothing seems to work.
This is my JSON:
{
"_id": ObjectId("4f67da1538fc5d7347000000"),
"categories": {
"id": 1,
"name": "hoyts",
"product-logo": "http: \/\/www.incard.com.au\/newsite\/template\/images\/movieticket\/4cinemas\/hoytstop.png",
"products"▼: {
"0": {
"barcode": "25001",
"name": "GoldClass",
"Price": "12.00",
"CashBack": "2.00"
},
"1": {
"barcode": "25002",
"name": "Weekday",
"Price": "12.00",
"CashBack": "2.00"
},
"2": {
"barcode": "25003",
"name": "Weekend",
"Price": "24.00",
"CashBack": "4.00"
}
}
},
"store_name": "movies",
"1": {
"id": 2,
"name": "village",
"logo": "village.png",
"products": {
"0": {
"barcode": "26001",
"name": "GoldClass",
"Price": "12.00",
"CashBack": "2.00"
},
"1": {
"barcode": "26002",
"name": "Weekday",
"Price": "12.00",
"CashBack": "2.00"
},
"2": {
"barcode": "26003",
"name": "Weekend",
"Price": "24.00",
"CashBack": "4.00"
}
}
}
}
A:
In the JSON you posted categories is not an array, but object. If we assume that you have categories as array (inside []), you should use {"categories.name":"hoyts"} (with quotes for categories.name) for your criteria. The same thing will work if "categories" is not an array, but object (but I think that you wanted to have more categories, since name of the "property" is plural.
|
--- a/pppd/sha1.c
+++ b/pppd/sha1.c
@@ -18,7 +18,7 @@
#include <string.h>
#include <netinet/in.h> /* htonl() */
-#include <net/ppp_defs.h>
+#include "pppd.h"
#include "sha1.h"
static void
|
// SPDX-License-Identifier: GPL-2.0
#include <stdio.h>
#include <stdlib.h>
#include <unistd.h>
#include <fcntl.h>
#include <string.h>
#include <memory.h>
#include <malloc.h>
#include <time.h>
#include <ctype.h>
#include <sys/types.h>
#include <sys/wait.h>
#include <signal.h>
#include <errno.h>
#include <sys/time.h>
#include <linux/hpet.h>
extern void hpet_open_close(int, const char **);
extern void hpet_info(int, const char **);
extern void hpet_poll(int, const char **);
extern void hpet_fasync(int, const char **);
extern void hpet_read(int, const char **);
#include <sys/poll.h>
#include <sys/ioctl.h>
struct hpet_command {
char *command;
void (*func)(int argc, const char ** argv);
} hpet_command[] = {
{
"open-close",
hpet_open_close
},
{
"info",
hpet_info
},
{
"poll",
hpet_poll
},
{
"fasync",
hpet_fasync
},
};
int
main(int argc, const char ** argv)
{
unsigned int i;
argc--;
argv++;
if (!argc) {
fprintf(stderr, "-hpet: requires command\n");
return -1;
}
for (i = 0; i < (sizeof (hpet_command) / sizeof (hpet_command[0])); i++)
if (!strcmp(argv[0], hpet_command[i].command)) {
argc--;
argv++;
fprintf(stderr, "-hpet: executing %s\n",
hpet_command[i].command);
hpet_command[i].func(argc, argv);
return 0;
}
fprintf(stderr, "do_hpet: command %s not implemented\n", argv[0]);
return -1;
}
void
hpet_open_close(int argc, const char **argv)
{
int fd;
if (argc != 1) {
fprintf(stderr, "hpet_open_close: device-name\n");
return;
}
fd = open(argv[0], O_RDONLY);
if (fd < 0)
fprintf(stderr, "hpet_open_close: open failed\n");
else
close(fd);
return;
}
void
hpet_info(int argc, const char **argv)
{
struct hpet_info info;
int fd;
if (argc != 1) {
fprintf(stderr, "hpet_info: device-name\n");
return;
}
fd = open(argv[0], O_RDONLY);
if (fd < 0) {
fprintf(stderr, "hpet_info: open of %s failed\n", argv[0]);
return;
}
if (ioctl(fd, HPET_INFO, &info) < 0) {
fprintf(stderr, "hpet_info: failed to get info\n");
goto out;
}
fprintf(stderr, "hpet_info: hi_irqfreq 0x%lx hi_flags 0x%lx ",
info.hi_ireqfreq, info.hi_flags);
fprintf(stderr, "hi_hpet %d hi_timer %d\n",
info.hi_hpet, info.hi_timer);
out:
close(fd);
return;
}
void
hpet_poll(int argc, const char **argv)
{
unsigned long freq;
int iterations, i, fd;
struct pollfd pfd;
struct hpet_info info;
struct timeval stv, etv;
struct timezone tz;
long usec;
if (argc != 3) {
fprintf(stderr, "hpet_poll: device-name freq iterations\n");
return;
}
freq = atoi(argv[1]);
iterations = atoi(argv[2]);
fd = open(argv[0], O_RDONLY);
if (fd < 0) {
fprintf(stderr, "hpet_poll: open of %s failed\n", argv[0]);
return;
}
if (ioctl(fd, HPET_IRQFREQ, freq) < 0) {
fprintf(stderr, "hpet_poll: HPET_IRQFREQ failed\n");
goto out;
}
if (ioctl(fd, HPET_INFO, &info) < 0) {
fprintf(stderr, "hpet_poll: failed to get info\n");
goto out;
}
fprintf(stderr, "hpet_poll: info.hi_flags 0x%lx\n", info.hi_flags);
if (info.hi_flags && (ioctl(fd, HPET_EPI, 0) < 0)) {
fprintf(stderr, "hpet_poll: HPET_EPI failed\n");
goto out;
}
if (ioctl(fd, HPET_IE_ON, 0) < 0) {
fprintf(stderr, "hpet_poll, HPET_IE_ON failed\n");
goto out;
}
pfd.fd = fd;
pfd.events = POLLIN;
for (i = 0; i < iterations; i++) {
pfd.revents = 0;
gettimeofday(&stv, &tz);
if (poll(&pfd, 1, -1) < 0)
fprintf(stderr, "hpet_poll: poll failed\n");
else {
long data;
gettimeofday(&etv, &tz);
usec = stv.tv_sec * 1000000 + stv.tv_usec;
usec = (etv.tv_sec * 1000000 + etv.tv_usec) - usec;
fprintf(stderr,
"hpet_poll: expired time = 0x%lx\n", usec);
fprintf(stderr, "hpet_poll: revents = 0x%x\n",
pfd.revents);
if (read(fd, &data, sizeof(data)) != sizeof(data)) {
fprintf(stderr, "hpet_poll: read failed\n");
}
else
fprintf(stderr, "hpet_poll: data 0x%lx\n",
data);
}
}
out:
close(fd);
return;
}
static int hpet_sigio_count;
static void
hpet_sigio(int val)
{
fprintf(stderr, "hpet_sigio: called\n");
hpet_sigio_count++;
}
void
hpet_fasync(int argc, const char **argv)
{
unsigned long freq;
int iterations, i, fd, value;
sig_t oldsig;
struct hpet_info info;
hpet_sigio_count = 0;
fd = -1;
if ((oldsig = signal(SIGIO, hpet_sigio)) == SIG_ERR) {
fprintf(stderr, "hpet_fasync: failed to set signal handler\n");
return;
}
if (argc != 3) {
fprintf(stderr, "hpet_fasync: device-name freq iterations\n");
goto out;
}
fd = open(argv[0], O_RDONLY);
if (fd < 0) {
fprintf(stderr, "hpet_fasync: failed to open %s\n", argv[0]);
return;
}
if ((fcntl(fd, F_SETOWN, getpid()) == 1) ||
((value = fcntl(fd, F_GETFL)) == 1) ||
(fcntl(fd, F_SETFL, value | O_ASYNC) == 1)) {
fprintf(stderr, "hpet_fasync: fcntl failed\n");
goto out;
}
freq = atoi(argv[1]);
iterations = atoi(argv[2]);
if (ioctl(fd, HPET_IRQFREQ, freq) < 0) {
fprintf(stderr, "hpet_fasync: HPET_IRQFREQ failed\n");
goto out;
}
if (ioctl(fd, HPET_INFO, &info) < 0) {
fprintf(stderr, "hpet_fasync: failed to get info\n");
goto out;
}
fprintf(stderr, "hpet_fasync: info.hi_flags 0x%lx\n", info.hi_flags);
if (info.hi_flags && (ioctl(fd, HPET_EPI, 0) < 0)) {
fprintf(stderr, "hpet_fasync: HPET_EPI failed\n");
goto out;
}
if (ioctl(fd, HPET_IE_ON, 0) < 0) {
fprintf(stderr, "hpet_fasync, HPET_IE_ON failed\n");
goto out;
}
for (i = 0; i < iterations; i++) {
(void) pause();
fprintf(stderr, "hpet_fasync: count = %d\n", hpet_sigio_count);
}
out:
signal(SIGIO, oldsig);
if (fd >= 0)
close(fd);
return;
}
|
<?xml version='1.0' ?>
<xsl:transform xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="1.0">
<xsl:import href="include/StorageFunctions.xsl"/>
<xsl:output method="xml" omit-xml-declaration="yes"/>
<xsl:template match="/">
<xsl:element name="StorageObjects">
<xsl:apply-templates select="Strings"/>
<xsl:call-template name="TaskingInfo">
<xsl:with-param name="info" select="TaskingInfo"/>
</xsl:call-template>
</xsl:element>
</xsl:template>
<xsl:template match="Strings">
<xsl:element name="ObjectValue">
<xsl:attribute name="name">Strings</xsl:attribute>
<xsl:apply-templates select="String"/>
</xsl:element>
</xsl:template>
<xsl:template match="String">
<xsl:element name="ObjectValue">
<xsl:attribute name="name">String</xsl:attribute>
<xsl:element name="StringValue">
<xsl:attribute name="name">string</xsl:attribute>
<xsl:value-of select="."/>
</xsl:element>
<xsl:element name="IntValue">
<xsl:attribute name="name">offset</xsl:attribute>
<xsl:value-of select="@offset"/>
</xsl:element>
</xsl:element>
</xsl:template>
</xsl:transform> |
Q:
GLEW 1.9.0 builds a 64-bit .so even with m32 argument?
I've been trying to compile a 32-bit shared library of GLEW-1.9.0 under a 64-bit RedHat 4 machine, but it seems no matter what I try, the shared library it produces is 64-bit (this is determined using "file libGLEW*" in the output directory).
It seems GLEW has its own system for detecting the architecture. Ultimately, this comes down to "shell uname -m", which I've attempted to change using "setarch i386". The output of "uname -m" after that call is "i686", which isn't i386, but should still be 32-bit.
I've been setting CFLAGS.EXTRA before my 32-bit build to "-m32 -Wl,-rpath,$(APPDIR32)/lib -fPIC", where $(APPDIR32) is the directory I'm outputting to, as well as where I'm linking libraries from. This worked just fine for my 64-bit build (except with the '32's in the string replaced with '64's).
I've been using GLEW's Makefile as follows (after setting the variables mentioned above, among other less relevant ones): "make -f Makefile all"
Setting LDFLAGS to -m32 or melf_i386 has no effect on the format of the output file, which always ends up in ELF_64 (not ELF_32). The libraries being linked are all 32-bit, and that's one of the reasons it complains, as a describe below.
During the build I get repeated warnings like the following...
/usr/bin/ld: warning: i386 architecture of input file `tmp/linux/default/shared/glew.o' is incompatible with i386:x86-64 output
One question: Is i686 a 32-bit architecture? The wikipedia page is unclear on this. I found a point in that page where it says some i686 processors have support for 64-bit instruction sets.
Another question: I haven't been able to find any useful information on building 32-bit shared libraries for GLEW in a 64-bit environment. Can you give me any pointers?
And the ultimate question: Can you see where I'm going wrong, or do you know about an additional action I need to take to get this building a 32-bit shared library?
In response to request for information about the exact command line and its output for the warning mentioned above, it is as follows...
cc -shared -Wl,-soname=libGLEW.so.1.9 -o lib/libGLEW.so.1.9.0 tmp/linux/default/shared/glew.o -L/usr/X11R6/lib -L/usr/lib -lXmu -lXi -lGL -lXext -lX11
/usr/bin/ld: skipping incompatible /usr/lib/libXmu.so when searching for -lXmu
/usr/bin/ld: skipping incompatible /usr/lib/libXi.so when searching for -lXi
/usr/bin/ld: skipping incompatible /usr/lib/libGL.so when searching for -lGL
/usr/bin/ld: skipping incompatible /usr/lib/libXext.so when searching for -lXext
/usr/bin/ld: skipping incompatible /usr/lib/libX11.so when searching for -lX11
/usr/bin/ld: skipping incompatible /usr/lib/libc.so when searching for -lc
/usr/bin/ld: skipping incompatible /usr/lib/libc.a when searching for -lc
/usr/bin/ld: warning: i386 architecture of input file `tmp/linux/default/shared/glew.o' is incompatible with i386:x86-64 output
Here's my makefile, in case you get really excited and want more material. This makefile will work just fine if you put it in the same directory as GLEW-1.9.0's Makefile (that is until you try configure32). Just make sure to set TOPDIR. Use 'make -f clean', 'make -f configure32', 'make -f all', 'make -f install'.
APPLICATION = glew
VERSION = 1.9.0
FULLAPPLICATION = $(APPLICATION)-$(VERSION)
TOPDIR = /home/<username>/dev/project/third-party
APPDIRROOT = $(TOPDIR)/apps-miles
ARCH=$(shell uname | sed -e 's/-//g')
SHELL = /bin/csh
MACHTYPE32= i386
APPDIR32 = $(APPDIRROOT)/$(ARCH)_$(MACHTYPE32)
MACHTYPE64= x86_64
APPDIR64 = $(APPDIRROOT)/$(ARCH)_$(MACHTYPE64)
#
# Linux
#
ifeq ($(ARCH), Linux)
CC = gcc
CXX = g++
CFLAGS.EXTRA32 += -m32 -Wl,-rpath,$(APPDIR32)/lib -fPIC
CFLAGS.EXTRA64 += -m64 -Wl,-rpath,$(APPDIR64)/lib -fPIC
PATH = /sbin:/usr/sbin:/bin:/usr/bin:/usr/X11R6/bin
endif
#
# Darwin
#
ifeq ($(ARCH), Darwin)
CC = gcc
CXX = g++
CFLAGS.EXTRA32 += -m32 -mmacosx-version-min=10.5 -fPIC
CFLAGS.EXTRA64 += -m64 -mmacosx-version-min=10.5 -fPIC
PATH = /usr/bin:/bin:/usr/sbin:/sbin
endif
V_M_EXIST = $(shell test -e CONFIG.mk && echo 1)
ifeq ($(V_M_EXIST), 1)
include CONFIG.mk
endif
ECHO = echo
all::
make -f Makefile all
configure32::
@-/bin/rm CONFIG.mk; touch CONFIG.mk
@echo "GLEW_DEST = $(APPDIR32)" >> CONFIG.mk
@echo "export GLEW_DEST" >> CONFIG.mk
@echo "LIBDIR = $(APPDIR32)/lib" >> CONFIG.mk
@echo "export LIBDIR" >> CONFIG.mk
@echo "CFLAGS.EXTRA = $(CFLAGS.EXTRA32)" >> CONFIG.mk
@echo "export CFLAGS.EXTRA" >> CONFIG.mk
configure64::
@-/bin/rm VAPOR.mk; touch CONFIG.mk
@echo "GLEW_DEST = $(APPDIR64)" >> CONFIG.mk
@echo "export GLEW_DEST" >> CONFIG.mk
@echo "LIBDIR = $(APPDIR64)/lib" >> CONFIG.mk
@echo "export LIBDIR" >> CONFIG.mk
@echo "CFLAGS.EXTRA = $(CFLAGS.EXTRA64)" >> CONFIG.mk
@echo "export CFLAGS.EXTRA" >> CONFIG.mk
install::
make -f Makefile install
clean::
make -f Makefile clean
frog::
@$(ECHO) APPDIR = $(APPDIR32)
A:
EDIT: updated to reflect seemingly working workaround
First approach
As linking 32-bit code with 64-bit libs will not work on first sight the only problem seemed to be the following snippet of config/Makefile.linux starting on line 5:
M_ARCH ?= $(shell uname -m)
ifeq (x86_64,${M_ARCH})
LDFLAGS.EXTRA = -L/usr/X11R6/lib64 -L/usr/lib64
LIBDIR = $(GLEW_DEST)/lib64
else
LDFLAGS.EXTRA = -L/usr/X11R6/lib -L/usr/lib
LIBDIR = $(GLEW_DEST)/lib
endif
hardcoding the library search path to 64-bit libraries.
Second sight
As a first attempt trying something like:
make LDFLAGS=-m32 M_ARCH=anything_but_not_x86_64
still failed it turned out that in addition disregarding common conventions LDFLAGS will not be passed to the linker in the Makefile going with rules like the one on line 108:
lib/$(LIB.SHARED): $(LIB.SOBJS)
$(LD) $(LDFLAGS.SO) -o $@ $^ $(LIB.LDFLAGS) $(LIB.LIBS)
With LDFLAGS.whatever hardcoded to required switches.
Suggested workaround
While any of the workarounds like:
make LDFLAGS.SO="-L/usr/lib -L/usr/X11R6/lib -m32"
should work the most easy one to type seems to be the following one:
make LD="gcc -m32"
smuggling the -m32 switch into the LD macro.
|
//
// Created by Fabrice Aneche on 06/01/14.
// Copyright (c) 2014 Dailymotion. All rights reserved.
//
#import <Foundation/Foundation.h>
@interface NSData (ImageContentType)
/**
* Compute the content type for an image data
*
* @param data the input data
*
* @return the content type as string (i.e. image/jpeg, image/gif)
*/
+ (NSString *)sd_contentTypeForImageData:(NSData *)data;
@end
@interface NSData (ImageContentTypeDeprecated)
+ (NSString *)contentTypeForImageData:(NSData *)data __deprecated_msg("Use `sd_contentTypeForImageData:`");
@end
|
Q:
Dynamic input parameter instead of in Spring for a class
How can I get rid of the constructor-args in the spring-config.xml bean mapping and supply the value dynamically or from the String args[] parameter form the main method for the BattingStats class?
I have the following Player class
package com.scorer.game;
public class Player {
private BattingStats battingStats;
public BattingStats getBattingStats() {
return battingStats;
}
public void setBattingStats(BattingStats battingStats) {
this.battingStats = battingStats;
}
@Override
public String toString() {
return "Player{" +
"runs scored=" + battingStats.getRunsScored() +
" balls faced=" + battingStats.getBallsFaced() +
" strike rate=" + battingStats.getStrikeRate() +
'}';
}
}
and class BattingStats as follows:
package com.scorer.game;
public class BattingStats {
private Integer battingPosition;
private Integer ballsFaced;
private Integer runsScored;
private Integer fours;
private Integer sixes;
private Boolean isNotOut;
private Boolean isRightHand;
private Float strikeRate;
public BattingStats(Integer battingPosition,
Integer ballsFaced,
Integer runsScored,
Integer fours,
Integer sixes,
Boolean isNotOut,
Boolean isRightHand) {
this.battingPosition = battingPosition;
this.ballsFaced = ballsFaced;
this.runsScored = runsScored;
this.fours = fours;
this.sixes = sixes;
this.isNotOut = isNotOut;
this.isRightHand = isRightHand;
this.strikeRate = (float)(((float)runsScored/(float)ballsFaced)*100);
}
public static BattingStats getInstance(Integer battingPosition,
Integer ballsFaced,
Integer runsScored,
Integer fours,
Integer sixes,
Boolean isNotOut,
Boolean isRightHand) {
return new BattingStats(battingPosition, ballsFaced, runsScored, fours, sixes, isNotOut, isRightHand);
}
public Integer getBattingPosition() {
return battingPosition;
}
public Integer getBallsFaced() {
return ballsFaced;
}
public Integer getRunsScored() {
return runsScored;
}
public Integer getFours() {
return fours;
}
public Integer getSixes() {
return sixes;
}
public Boolean getIsNotOut() {
return isNotOut;
}
public Boolean getIsRightHand() {
return isRightHand;
}
public Float getStrikeRate() {
return strikeRate;
}
public void setBattingPosition(Integer battingPosition) {
this.battingPosition = battingPosition;
}
public void setBallsFaced(Integer ballsFaced) {
this.ballsFaced = ballsFaced;
}
public void setRunsScored(Integer runsScored) {
this.runsScored = runsScored;
}
public void setFours(Integer fours) {
this.fours = fours;
}
public void setSixes(Integer sixes) {
this.sixes = sixes;
}
public void setIsNotOut(Boolean isNotOut) {
this.isNotOut = isNotOut;
}
public void setIsRightHand(Boolean isRightHand) {
this.isRightHand = isRightHand;
}
public void setStrikeRate(Float strikeRate) {
this.strikeRate = strikeRate;
}
}
and the main class ass follows:
package com.scorer.app;
import com.scorer.game.BattingStats;
import com.scorer.game.Player;
import org.springframework.context.ApplicationContext;
import org.springframework.context.support.ClassPathXmlApplicationContext;
public class MainApp {
public static void main(String args[]) {
ApplicationContext context = new ClassPathXmlApplicationContext("spring-config.xml");
BattingStats battingStats = (BattingStats)context.getBean("battingStats");
Player player = (Player)context.getBean("player");
System.out.println(player.toString());
}
}
the spring-confix.xml is as follows
<?xml version="1.0" encoding="UTF-8"?>
<beans xmlns="http://www.springframework.org/schema/beans"
xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance"
xsi:schemaLocation="http://www.springframework.org/schema/beans http://www.springframework.org/schema/beans/spring-beans.xsd">
<bean id="player" class="com.scorer.game.Player" >
<property name="battingStats" ref="battingStats"></property>
</bean>
<bean id="battingStats" class="com.scorer.game.BattingStats">
<constructor-arg type="java.lang.Integer" name="battingPosition" value = "1"></constructor-arg>
<constructor-arg type="java.lang.Integer" name="ballsFaced" value = "101"></constructor-arg>
<constructor-arg name ="runsScored" value = "52"></constructor-arg>
<constructor-arg name ="fours" value = "100"></constructor-arg>
<constructor-arg name ="sixes" value = "100"></constructor-arg>
<constructor-arg name ="isNotOut" value = "true"></constructor-arg>
<constructor-arg name ="isRightHand" value = "true"></constructor-arg>
</bean>
</beans>
A:
You can use @Configuration annotation to construct your beans using Java instead of XML, enabling you to dynamically calculate whatever variables you need to pass into bean constructors.
package com.example;
import java.net.URI;
import java.net.URISyntaxException;
import org.apache.commons.dbcp.BasicDataSource;
import org.springframework.context.annotation.Bean;
import org.springframework.context.annotation.Configuration;
import com.scorer.game.BattingStats;
@Configuration
public abstract class DatabaseConfiguration {
@Bean
public BasicDataSource createDataSource() throws URISyntaxException {
URI dbUri = new URI(System.getenv("DATABASE_URL"));
String username = dbUri.getUserInfo().split(":")[0];
String password = dbUri.getUserInfo().split(":")[1];
String dbUrl = "jdbc:postgresql://" + dbUri.getHost() + ':' + dbUri.getPort() + dbUri.getPath();
BasicDataSource basicDataSource = new BasicDataSource();
basicDataSource.setUrl(dbUrl);
basicDataSource.setUsername(username);
basicDataSource.setPassword(password);
basicDataSource.setTestOnBorrow(true);
basicDataSource.setTestOnReturn(true);
basicDataSource.setTestWhileIdle(true);
basicDataSource.setTimeBetweenEvictionRunsMillis(1800000);
basicDataSource.setNumTestsPerEvictionRun(3);
basicDataSource.setMinEvictableIdleTimeMillis(1800000);
basicDataSource.setValidationQuery("SELECT version();");
return basicDataSource;
}
@Bean(name = "persistenceXmlLocation")
public String persistenceXmlLocation() {
return "classpath:META-INF/persistence.xml";
}
/* --------- UPDATE ---------------- */
@Bean
public BattingStats battingStats() {
Integer battingPosition = methodForDynamicallyCalculatingBattingPosition();
// call the rest of your "dynamic" methods here
return new BattingStats(battingPosition, /* the rest of your dynamic arguments go here */);
}
}
|
Clinical comparison of high-resolution with high-sensitivity collimators in low-count cardiac gated blood pool studies.
We compared high-sensitivity (HS) and high-resolution (HR) collimators for 2.5-minute low-count acquisitions in 13 patients undergoing cardiac gated blood pool studies. High-count acquisitions served as standards. Ejection fractions calculated from low-count acquisitions were plotted against high-count acquisitions for each collimator; the variance of the HS plot was lower, and HS images were superior. |
Comparison of hypothetical LNG and fuel oil fires on water.
Large spills of refined petroleum products have been an occasional occurrence over the past few decades. This has not been true for large spills of liquefied natural gas (LNG). This paper compares the likely similarities and differences between accidental releases from a ship of sizable quantities of these different hydrocarbon fuels, their subsequent spreading, and possible pool-fire behavior. Quantitative estimates are made of the spread rate and maximum slick size, burn rate, and duration; effective thermal radiation; and subsequent soot generation. |
Suboptimal use of pharmacological venous thromboembolism prophylaxis in cirrhotic patients.
Cirrhosis was previously perceived as a haemorrhagic disease state due to frequent associations with coagulopathy and bleeding. However, the coagulopathy of cirrhosis is complex with defects in both procoagulant and anticoagulant factors. Derangements in common laboratory indices of coagulation do not accurately reflect bleeding risk or protection from thrombotic events. To assess the rate of pharmacological prophylaxis for venous thromboembolism (VTE) among hospital inpatients with cirrhosis and analyse factors associated with prophylaxis being inappropriately withheld. A retrospective cohort study was performed in a tertiary teaching hospital. Patients included were admitted for greater than 48 h with discharge diagnosis codes corresponding to chronic liver disease and/or cirrhosis. The use of VTE chemoprophylaxis with enoxaparin was assessed in cirrhotic patients and non-cirrhotic controls. Patient data collected included contraindications to prophylaxis, known high-risk varices, international normalised ratio (INR), creatinine, bilirubin, haemoglobin and platelet count. Of 108 patients with cirrhosis eligible for VTE prophylaxis, 61 (56.5%) received prophylaxis compared to 104 (96.3%) non-cirrhotic patients. Platelets and INR were significantly different between those who did and did not receive VTE prophylaxis. On multivariate analysis, platelet count and INR were independent predictors for VTE not being administered. The administration of chemoprophylaxis in accordance with the hospital guidelines was suboptimal in patients with cirrhosis. Platelet count and INR were independent predictors of prophylaxis use. Our results suggest persistent misperceptions that prolonged INR and thrombocytopenia predict bleeding risk in cirrhosis. |
The content published in Cureus is the result of clinical experience and/or research by independent individuals or organizations. Cureus is not responsible for the scientific accuracy or reliability of data or conclusions published herein. All content published within Cureus is intended only for educational, research and reference purposes. Additionally, articles published within Cureus should not be deemed a suitable substitute for the advice of a qualified health care professional. Do not disregard or avoid professional medical advice due to content published within Cureus.
Introduction
============
Pulmonary sequestration was first described by Pryce in 1946 in the Journal of Pathology and Bacteriology \[[@REF1]\]. Pulmonary sequestration is a rare congenital malformation of the respiratory tract. It constitutes approximately 0.15%-6.4% of all congenital pulmonary malformations \[[@REF2]\]. It is defined as a non-functioning mass of parenchymal lung tissue that lacks communication with the tracheobronchial tree and is supplied by an anomalous systemic artery. Anatomically, it is classified as intralobar sequestration, where it is located within a normal lobe without its own visceral pleura, or extralobar sequestration, which is outside the normal lung with its own visceral pleura. Here, we present a case of a 45-year-old female who had a diagnosis of intrapulmonary sequestration \[[@REF3]\].
Case presentation
=================
A 45-year-old Caucasian female presented with a left-sided breast mass. An excisional biopsy showed a high-grade phyllodes tumor, which was treated by resection. Preoperatively, a chest radiograph was obtained, which revealed a left lower lobe shadow suspicious of consolidation. At the time, this was considered to be a community-acquired pneumonia though she had no symptoms. She was hemodynamically stable. Laboratory investigations were within normal limits. She was subsequently treated with a seven-day course of antibiotics. Follow-up chest radiograph showed persistence of the infiltrate which led to a non-contrast computed tomography (CT) scan of the chest. It revealed a moderate consolidation of the left lower lobe and hilar lymphadenopathy (Figure [1](#FIG1){ref-type="fig"}).
{#FIG1}
She, again, denied any signs of infection including sputum production, hemoptysis, shortness of breath or cough. She also denied a history of frequent pulmonary infections. She was a former smoker and had a 20-pack year history. A fiberoptic bronchoscopy was conducted for her unresolving left lower lobe infiltrate. Brushing of the area of infiltration was obtained along with the lymph node biopsy, which turned out to be non-malignant. At this juncture, a chest CT scan with contrast was obtained, which showed an artery from descending aorta feeding the area of infiltration highly suggestive of pulmonary sequestration (Figures [2](#FIG2){ref-type="fig"}, [3](#FIG3){ref-type="fig"}).
{#FIG2}
{#FIG3}
After discussion with the patient, it was decided to pursue a resection. She was referred to a cardiothoracic surgeon for a video-assisted thoracoscopic surgery (VATS) lobectomy procedure. The patient underwent left lower lobectomy. Pathology report after lobectomy confirmed the features consistent with an intralobar sequestration.
Discussion
==========
Pulmonary sequestration is a rare congenital malformation of dysplastic lung tissue. The sequestered lung does not communicate with the tracheobronchial tree and is supplied by an anomalous systemic arterial source, most commonly from the aorta \[[@REF4]\]. Intralobar sequestration is four times more common than the extralobar type \[[@REF5]\]. Diagnosis during adulthood is relatively uncommon as 60% of cases are diagnosed in the first decade of life and is a rarity in adults greater than 40 years of age \[[@REF6]\].
Most patients develop symptoms in infancy or early childhood. Symptoms may be non-specific, including cough, chest pain and shortness of breath. Some patients develop recurrent pneumonias and bronchiectasis \[[@REF7]\]. Approximately 15% of patients remain asymptomatic \[[@REF8]\]. Our patient was asymptomatic and had denied previous pulmonary infections.
As in our patient, sequestration occurs mostly in the left hemithorax, in the posterior basal segment of the left lower lobe \[[@REF8],[@REF9]\]. In 75% of the patients, the supply to the intralobar sequestration is from the descending thoracic aorta \[[@REF9]\].
CT angiography scan is the imaging test of choice as it can show the anomalous artery feeding into the pulmonary sequestration \[[@REF4],[@REF9]\]. Non-contrasted CT imaging is sometimes adequate to aid in the diagnosis of sequestration. However, in our case, the diagnosis was not clear until CT angiography was performed. Pulmonary angiography is considered to be the gold standard; however, it is not commonly used as the diagnosis is mostly clinched on CT scan imaging.
On cut section, the intralobar pulmonary sequestration represents mucus filled airways and small cysts which may be filled with purulent material. On histological examination, there is mucus stasis in the airways and a systemic artery accompanies the airways \[[@REF10]\].
Surgical resection is considered the treatment of choice for intralobar sequestration especially in symptomatic patients \[[@REF8],[@REF11],[@REF12]\]. Even in asymptomatic patients, surgical resection is often recommended due to the risk of serious future complications, including infections, massive hemoptysis and malignant transformation \[[@REF2],[@REF13]\]. The usual surgery is lobectomy either via VATS or standard thoracotomy. Our patient had a VATS lobectomy performed.
Conclusions
===========
Pulmonary sequestration is an uncommon finding especially in the adult population. Imaging modalities, especially contrast-enhanced CT scan, can aid in diagnosis by localizing the aberrant arterial blood supply to the sequestered lung parenchyma. Contrasted CT scan is also important for preoperative evaluation in these patients.
The authors have declared that no competing interests exist.
Consent was obtained by all participants in this study
We would like to acknowledge that we presented a poster presentation discussing the same case under the same heading at the Chest Conference 2019.
|
package io.quarkus.it.panache;
import java.io.Serializable;
import java.util.Objects;
import javax.persistence.Entity;
import javax.persistence.Id;
import javax.persistence.IdClass;
import io.quarkus.hibernate.orm.panache.PanacheEntityBase;
@Entity
@IdClass(ObjectWithCompositeId.ObjectKey.class)
public class ObjectWithCompositeId extends PanacheEntityBase {
@Id
public String part1;
@Id
public String part2;
public String description;
static class ObjectKey implements Serializable {
private String part1;
private String part2;
public ObjectKey() {
}
public ObjectKey(String part1, String part2) {
this.part1 = part1;
this.part2 = part2;
}
@Override
public boolean equals(Object o) {
if (this == o)
return true;
if (o == null || getClass() != o.getClass())
return false;
ObjectKey objectKey = (ObjectKey) o;
return part1.equals(objectKey.part1) &&
part2.equals(objectKey.part2);
}
@Override
public int hashCode() {
return Objects.hash(part1, part2);
}
}
}
|
Deadlock 0.4.8 - We need your feedback
Deadlock version 0.4.8 is online and available to all Spearheads and Frontliners. Remember that you can get access to Deadlock and help speed-up the development of Interstellar Marines by upgrading your profile to Spearhead or Frontliner in our store.
Summary
Since the last build we’ve moved into our new (and smaller) office in an effort to save money and keep developing on the game.
After the move we started migrating the project to Unity 4 (from previously running on Unity 3.5), which unfortunately took a lot longer than we had planned for. Basically there were some fundamental changes in the new engine which caused a lot of small problems with our old pipeline and code.
As a result almost all of the time for the last 3 weeks have been spent cleaning up and getting everything to work again in the new engine. So this build turned out to be mostly about maintenance. Fortunately there’s been some nice optimizations in our workflow, and we fixed a couple of vital bugs in the process that had been around for a while.
But most importantly we are now set-up in new offices and on the latest version of Unity, so we can get back to progressing the actual game from here on out!
When we actually get to play the game will we be able to customize our suit. including helmet color, flashlight color. Will we be able to change the suit's vision like night vision, EM Vision, Infrared Vision, Thermal Vision, Optic Vision.
Does our suit include an oxygen Tank to supply air when atmospheres are depressurizing and pressurizing. Add a few air Dispensers and maybe add an Air monitor on the hud just in case you want to know the level of oxygen. Maybe include hazardous areas that require an air filter.
What about a zero-g environment? floating through air and dodging attacks while firing back. I mean people don't always want to walk but maybe float to make it a more real-like environment.
I just bought this last week. I have only ever seen just a single person playing though, and he was new like me. What gives? With this new update I expected some more people to play.
it's mostly crowded. today was the only time I found the servers empty. Better luck next time.
Unity4 is vastly improved for performance. That being said, there is still much that can be done.
Shader 1 (SSAO):
Much improved from before, though it is highly sensitive to dynamic lights (the klaxons for instance). In more static lighting conditions, it is only a 20fps drop or so. With the klaxons, SSAO gives me a drop of about 30-40fps
Can we get settings for SSAO quality and samples?
Shader 2 (Brightness/Color Correct):
No appreciable impact on FPS. Awesome.
However, this does seem to wash the color out a bit too much (for my tastes)
Shader 3 (Bloom/Coronas):
About a 5fps impact for me. Almost negligible.
Shader 4 (HUD Blur):
This seems far too heavy. I'm getting about a 7fps drop. Would it not be simpler to just change to a different HUD overlay with the feathering baked in instead of using an apparently costly shader?
Shader 5 (Vignetting/Vaseline):
Another pricey shader, costs me about 7-8fps in most situations. Surely, vignetting could be accomplished with less impact by using semi-transparent texture overlays instead of a costly shader, yes?
Shader 6 (Edge Smoothing):
About a 18-20fps hit for me. I find it also muddies up the ground textures, etc. I keep it off honestly, takes away the crispness of the things you've created.
Some performance gotchas:
The lightning. Oh, the lightning.
I typically play with shaders 1,3,5 enabled for what I think "looks best". For what works best for competitive play, I use everything off except Shader 2.
ATTENTION LINUX USERS i am not sure if this works but this might help with the not being able to play deadlock problem http://answers.unity3d.com/questions/20888/what-ca
n-i-do-for-linux-support.html basically it says install google chrome due to it supporting native client
The facts is that despite the obvious maintenance overhead ... we have talked about combining all images effects into one script ... to make it 3-4x faster overall as we do not have to recalculate each shader pass pr. image effect. (Hope this makes sense) ... That's the challenge of doing pre-pre-alpha development ... it's not always logical to do performance optimizations all the time! :)
Regarding the image effects settings in general ... you know that we're going for ultra high sci-fi realism and not glowing, colorful, lens flared madness ... "cough" Battlefield 3 "cough" Halo 4 ... but this is a process and we're still a long way from the expression we want ... and at that point not all images effects will be toggleable (for competitive reasons) as gameplay will saturate every artistic choice we make! (Exhausted from sprinting will distort your vision via DOF, color correction, vignette etc.) and so forth!
But, rest assured I/we will listen and evaluate carefully in regard to everybody's shit-filter on look and feel!
No problem Hicks :) I just wanted to point out how each one behaves currently.
If I run native (1280x1024 @ 75fps) on Fastest with everything off, I'm typically getting about 125fps solid. If I turn it up to Fantastic and keep everything off, I'm usually around 79fps or so.
In the previous Deadlock builds on Unity 3.x, I'd be at about 25fps on Fantastic with everything off and about 50fps on Fastest at native.
This represents a HUGE step forward in playability for myself, and I'd imagine most other people.
I realize you're going for a realistic vision for the game, and I completely agree with doing that. However, I think the color correct filter is a bit TOO aggressive. I have a high density of cone cells in my retina, as I imagine most other people do, so I see the world as a fundamentally colorful and vibrant place.
The effect of the color-correct filter is most prominent in the sunset period on the outside level. With it off, the world looks rich and colorful, as it should during the setting of the sun. With it on, everything gets very washed out and the visual impact of the setting sun is lessened considerably.
I just want to caution you against making the mistake that many make in that "real" has to look like 50 shades of gray & brown everywhere.
I do like the idea that you'll present a consistent visual experience for competitive reasons, though I do think you (when you get there) should discuss with the community exactly what VFX they agree should be mandatory, and what ones should be optional. For instance, SSAO is not something that will render player shadows into the world, correct? So I would say this should be optional as it provides no tactical advantage, and can be quite heavy for some. Things like that need to be considered. I do think that using desaturation, vignetting, DOF changes, possibly image smearing, and other "stress" effects when fatigued/damaged/poisoned would serve to add depth to the gameplay, so I completely agree.
If you combined all the various effects into one script, what would happen? Would we still be able to toggle each effect, or would it simply be a ON/OFF for all 6 shaders?
I know it would be a massive bit of extra work, but would you ever consider making multiple scripts that are combinations of the various settings users could choose? So a script with everything off, a script with everything on, a script with just 1,3,5 on, etc? Again, I realize there are a large number of combinations of the various effects, but in this manner, each option would be fully optimized to run well, correct?
In any case, I look forward to continued testing and experience with IM. I've been... dis-involved for a long time and it was really exciting for me to get back in and to think critically about the game. |
Mellana
Mellana is a genus of skippers in the family Hesperiidae.
References
Natural History Museum Lepidoptera genus database
Category:Hesperiidae
Category:Hesperiidae genera |
The present invention generally relates to an interface for direct data transfers and, in particular, relates to such an interface for effecting direct data transfers between an intelligent switch and a microcomputer.
The direct data transfer from the random-access-memory (RAM) of one microcomputer to the RAM of another microcomputer is known. Characteristically, such transfers are effected by means of known handshake signal techniques. Basically, the initiating microcomputer accesses the other to request control of the other microcomputers local bus. When the accessed microcomputer yields control of its local bus, the initiating microcomputer, now controlling the local buses of both devices proceeds to read or write to the accessed RAM and, when the data transfer is complete, signals the completion of the transfer. The accessed device then regains control of its local bus.
Usually, such data transfers are executed to effect the transfer of large amounts of data. The direct data transfer, also referred to as "direct memory access" (DMA) results in a substantial savings of computing time compared to, for example, a first-in-first-out data transfer.
However, also characteristically, the accessed microcomputer, after religuishing its local bus, can only service the accessing microcomputer. For example, if a read is being performed on the accessed device, the accessed device must wait until the completion of that process before executing a read or write itself or participating in a data transfer with another device. It is for this reason that DMA transfers are conventionally restricted to large data transfers.
Further, when accessed, a device provides one address to the accessing device. This address represents a single starting address which the accessing device uses as a starting address from which it will read or to which it will write. That is, only a single starting address is generated by an accessed device for the transfer of substantial blocks of data. Hence, the transfer of a complete block of data must be completed before another starting address is supplied, i.e., before the device can be accessed again.
Still another characteristic of conventional DMA transfers is the requirement that the RAM of the accessing microcomputer must be linked, literally, directly, i.e., without intermediate storage devices, to the RAM of the accessed device. But for this characteristic, the use of DMA transfers would become disadvantageous due to the added read/write steps necessary to carry data through any storage medium.
These characteristics, however, place severe constraints on many potential implementations of such a technique. Hence, the direct transfer of data between a microcomputer and devices such as, for example, an intelligent switch, has, heretofore, been impractical. |
+ -306. What is the closest to 0.1 in 5, w, 0.2?
0.2
Let x = 0.568 + 0.242. Let r = x + -1.11. What is the closest to -2 in 13, r, -4?
r
Let s = 86 + -85.652. Let n = -0.1172 + 0.0692. Let g = n + s. What is the nearest to 1 in -2, -0.3, g?
g
Let m = -11.7 - -14.7. Let g = 24.9 - 24.6. Let j be (-6)/9 + (1 - 0). Which is the closest to -2/3? (a) j (b) g (c) m
b
Let t = 964 + -963.8. Let v = -5 - -7. Let y = -1.5 - -1.4. Which is the nearest to v? (a) -2/7 (b) t (c) y
b
Let s = -16490 - -16461. Which is the closest to -0.1? (a) -4 (b) s (c) -6 (d) 1/5
d
Let i(o) = -2*o**2 - 7*o - 14. Let j be i(-5). Let y = j - -29. Let h = 603/11 + -55. What is the nearest to y in -0.1, -3, h?
-0.1
Let t(u) = -u**3 - 22*u**2 + 76*u + 27. Let k be t(-25). Let q be k/(-7)*11/(-11). Which is the closest to 0.1? (a) q (b) -5 (c) 0 (d) -2/7
c
Let o = -0.0517 + 0.0917. Which is the nearest to -1? (a) 0.2 (b) o (c) -4/7 (d) -8
c
Let i be (-30)/675*(10 + (-232)/16). Let k = -24/5 - -91/20. What is the closest to k in i, -3, 0?
0
Let w = -0.2 + 0.1. Let k = -348 - -375.8. Let j = k - 28.8. What is the nearest to w in 2/13, -5, j?
2/13
Let l = -63811 + 63811. Suppose -2 = k - 1. Which is the closest to -1? (a) k (b) l (c) 0.01
a
Let p = -0.2 + -32.6. Let m = 32.4 + p. What is the nearest to 2 in 18, m, 3/5, -2?
3/5
Suppose 4*f + 1 = -5*o, -6*f + 3*f = 4*o. Suppose 0 = -m + 5*w, m - 9 = -7*w + o*w. Suppose 0 = -1338*u + 1334*u - 20. What is the nearest to 2/3 in 0.5, u, m?
0.5
Let r = -1.6261 - 59.8739. What is the nearest to r in 0, -0.2, 0.1?
-0.2
Let x = -38 + 56. Let w = 15 - x. Let m = -12.2 - -12. Which is the nearest to 0.1? (a) w (b) 0.08 (c) m
b
Let f = -5 - -2. Let l = -154.725 - 0.275. Let t = l + 158. What is the nearest to 1 in 1, t, f?
1
Let w(y) = y**2 + 42*y + 80. Let j be w(-31). Let z = j + 256. Which is the nearest to -6? (a) -2 (b) 0.4 (c) z
c
Let l = 3080.6 + -3081. Which is the nearest to -2/5? (a) 5 (b) l (c) -2/37 (d) 2/13
b
Let z = -2001 + 773. Let d = 1239 + z. Let l = -3.5 + -0.5. What is the closest to -1/2 in d, 2/5, l?
2/5
Let m = 18 - 13. Let a = 2.39311 + -2.56311. What is the nearest to a in 3, m, -9?
3
Let m = -2156 - -2159. What is the closest to m in -0.2, -0.07, -1?
-0.07
Let h = -1.7475 + 2.7475. Which is the closest to h? (a) -2/5 (b) -5 (c) 5 (d) -1/4
d
Let j = 291.2 - 302.2. What is the closest to 1 in j, 2, 6?
2
Let x = 249649 + -249652. Let w = -0.76 + 0.7. Which is the nearest to 2/7? (a) w (b) -1 (c) x
a
Let h = -0.041 + 34.641. Let k = h + -34.3. Let l = -2/885 - -2683/12390. Which is the nearest to 2/3? (a) 4 (b) k (c) l
b
Let l = -66.9 + 66.8. Let w = -16/5 + 53/15. What is the closest to l in -3, -2, w?
w
Let i = 0.2 - -16.8. Let g = -2.263798 - -0.263798. Which is the nearest to i? (a) -0.2 (b) -1/2 (c) g (d) 2/11
d
Let y(d) be the third derivative of -d**4/4 - 15*d**3/2 - 129*d**2. Let h be y(-8). Let n = -8/13 - -50/39. Which is the nearest to h? (a) n (b) -3 (c) 5
c
Let p = 22.35 + -22.95. Let k = -3.84 + -0.16. What is the closest to -0.1 in p, 2/11, k?
2/11
Let m = 69200.7 + -69201. Let f = 3/4 - 5/4. What is the closest to f in 0.19, -5, m?
m
Let f be 8/2 + (6 + -4)*-2. Let i = -15/454 + -503/12258. Which is the closest to i? (a) f (b) 4 (c) 3 (d) 1
a
Let g = -283 - 269. Let i = 552.4 + g. What is the closest to i in -0.5, 5, 7/4?
-0.5
Let i = -0.25 + 4.25. Let j = 26 - i. Let s = j - 21.9. What is the closest to s in 0.3, 2/7, -2?
2/7
Let n = -65.8 - -67.8. Suppose z = -4*z - 50. Let r = 21/2 + z. What is the nearest to 0 in r, 6, n?
r
Let g = 25570 - 281888/11. Let v = 56 + g. Which is the closest to v? (a) 3/2 (b) -1/4 (c) 4
b
Let u = 17 - 12. Let l = 2500 - 2501.986. Let z = 0.986 + l. Which is the closest to -2? (a) u (b) z (c) 4
b
Let m = 41.57 + -41.77. Which is the closest to 0.1? (a) -2/9 (b) -5 (c) 1/3 (d) m
c
Let t(y) = -2*y**2 - 4*y + 2. Let p be t(3). Let u be (-4)/(-14) + 22/p. Let z = -16.65 - -12.65. Which is the closest to u? (a) 2/9 (b) z (c) -0.5
c
Let j be (-2 + (-84)/(-49))*-1. Which is the nearest to 1? (a) j (b) -24 (c) -10
a
Let n = 195 - 195.36. Let x = n - -0.66. What is the closest to x in -0.2, -0.4, 0.4?
0.4
Let z = 1053 + -1052.5. Which is the nearest to 2/3? (a) z (b) 4 (c) 496
a
Let p = 434 - 392. Let q be p/(-70)*10/4. What is the closest to q in -2, 5, 1?
-2
Let q = 5515.13 - 5590. Let j = 75 + q. Let x = j - -0.87. Which is the closest to 1/3? (a) -1 (b) x (c) -15
b
Let k = 26.89 + -27. Let y = k + -0.31. Let i = y - -0.32. Which is the nearest to i? (a) -5 (b) 17 (c) -1
c
Let g = -0.05 + -1.75. Suppose 0 = s - 2*d + 15, -4*s - 137*d = -136*d - 12. What is the nearest to s in -3, g, 1, -1/3?
1
Let j = -2 - -1. Let n = -19995 - -19994.8. What is the nearest to 2 in -5, n, j?
n
Let m = 0.4 + -0.2. Let c = -639 - -673.3. Let j = -34.6 + c. What is the closest to 9/2 in m, -2/5, j?
m
Suppose -15 = -5*g, -g - 26 = 5*x - 3*g. Let r = -1982/5 + 1984/5. Which is the nearest to 3/2? (a) r (b) x (c) -1/6 (d) 0.3
a
Let h = -573 - -572.5. Let g = 351 + -320. Which is the closest to -0.3? (a) 0.1 (b) h (c) g
b
Let k be (10 - (-816)/(-80))*(0 + 3). What is the nearest to -2 in -5, k, -2?
-2
Let y = 0.9 - -0.1. Let d = 193 - 191.85. Let v = d - 1.45. What is the closest to y in v, 1/4, -2/13?
1/4
Let i = 221.426 + -0.426. Let y = i - 222. What is the closest to 2/3 in y, 1/5, 6?
1/5
Let k = 334 - 1001/3. Let f = -140.9 - -141. Which is the closest to k? (a) 0 (b) f (c) 5 (d) 2/7
d
Let c = 215/1122 + -1/102. Let i = 22 - 21.82. Let j = 15 + -12. What is the closest to -1/4 in c, j, i?
i
Let l = -16937/753986 + -93/20378. Let u = 7 - 25/4. Which is the closest to 0.1? (a) u (b) 4 (c) l
c
Let p = -0.8 + -0.2. Let o = 8.9576 - -0.0424. What is the closest to p in -1, -2, o?
-1
Let g = -0.07 + -0.03. Let a = -0.7 - 2.72. Let p = a - -2.42. What is the nearest to p in -6, g, 0.4?
g
Suppose 109*p - 113*p + 40 = 0. Suppose -13 = p*v - 3. Let i be (-6)/(-15)*(-6)/(-4). Which is the nearest to -1? (a) i (b) 2 (c) v
c
Let k = 8 - 12. Let c = 17.356 - 0.356. Let d = 20 - c. What is the closest to 0.1 in d, -0.04, k?
-0.04
Let t = -1.49 + 13.29. Let l = 16 - t. Let f = 4.7 - l. What is the nearest to 0 in 1, f, 5?
f
Let l = -500 - -313. Let n = 184 + l. Which is the nearest to 6/7? (a) 1 (b) 0 (c) n
a
Let r be (-22)/(-18) + 4/(-18). Let s = -189571 - -189598. What is the closest to s in 0, r, 2?
2
Let w be (0 - -1)/((-156)/51 + 3). Let b = 0.0392 + -0.0392. What is the nearest to b in 0.5, w, -1/5?
-1/5
Suppose -2*x - 30 = -36. Suppose 3*k = 4*y + 122 + 37, -123 = 3*y - x*k. Let h = y - -37. What is the closest to 0.1 in 0.4, 0.5, h?
0.4
Let u be 3*4/36 - 1210/(-15). Let c be ((-27)/u)/(8/6). What is the nearest to -2 in -5, -3/8, c?
-3/8
Let n = 0.8 + -0.44. Let u = n + -1.36. What is the closest to 2 in u, 1/7, -4/9?
1/7
Let h(j) = -j**2 - 7113*j - 21332. Let r be h(-3). Let k = -0.5 - 2.5. Which is the nearest to -0.1? (a) k (b) r (c) 3 (d) 4
b
Let r = -6 + 10. Suppose -16 = 94*y - 78*y. Let a be y/2 - (-27)/162. What is the nearest to a in -0.07, r, -2?
-0.07
Let x = -196 + 195.9. Let f be (-5 + 2)/(-3) - (-22)/(-20). Which is the closest to x? (a) f (b) 5 (c) -4 (d) -27/4
a
Let n = 94 - 58.3. Let c = n + -35. Let p = c - 3.7. What is the nearest to p in -0.4, -4, 0.3?
-4
Let t = 5692.9 + -5693. What is the closest to -2.51 in t, -1/3, -0.2?
-1/3
Let r = 0.1 - -0.1. Let l = 70045 + -70045.06. Which is the closest to -1? (a) 4 (b) r (c) l
c
Suppose -3*q + 8*l = 11*l + 483, q + 179 = -4*l. Which is the closest to 0? (a) 0 (b) q (c) -7
a
Let z = 0.02 - -0.98. Let p = 0.94197 + -0.44197. What is the closest to -1/3 in z, -0.2, p, 0.4?
-0.2
Let y = 5 - 9. Let r = 367 + -5129/14. Let l = -87/70 + r. What is the closest to 8 in y, l, 0?
0
Let m = -0.3 + 0.2. Let p = 0.5 + m. Let w = -28973 - -28970. Which is the nearest to -0.13? (a) -2 (b) w (c) p
c
Let u = -83.4 + -1.6. Let l = -93.5 - u. Let v = l - -10.5. Which is the nearest to 2/19? (a) 5 (b) -5 (c) v
c
Let f = -0.2 + 0.5. Let j = -5.7627 - 0.2373. Which is the closest to f? (a) j (b) -3/2 (c) 1
c
Let q = -2 - 1. Let m be q/(-20) + 2 |
Stroke risk of blood pressure indices determined by home blood pressure measurement: the Ohasama study.
The purpose of this prospective cohort study was to investigate associations between stroke and blood pressure (BP) indices (systolic BP [SBP], diastolic BP [DBP], mean BP, and pulse pressure [PP]) determined by home BP measurement. Associations between stroke and BP indices were examined in a rural Japanese population. Home BP data of 2369 subjects (40% men) > or =35 years of age (mean, 59 years) without a history of stroke were obtained. Associations between stroke and each index were determined using Cox proportional hazards regression and the likelihood ratio (LR) test. During follow-up (mean, 11.7 years), 238 strokes occurred. The LR test showed that SBP and mean BP were significantly more strongly associated with total and ischemic stroke than DBP and PP (LR chi2 > or =9.3, P<0.01 for SBP/mean BP, LR chi2 < or =3.8, P> or =0.05 for DBP/PP). SBP tended to be more strongly associated with total/ischemic stroke than mean BP (LR chi2=3.8, P=0.05 for SBP, LR chi2 < or =0.2, P>0.6 for mean BP). PP tended to be slightly more strongly associated with ischemic stroke than DBP (LR chi2=7.5, P<0.01 for DBP, LR chi(2)=9.3, P<0.01 for PP), whereas DBP was significantly more strongly associated with hemorrhagic stroke than PP (LR chi2=9.2, P<0.01 for DBP, LR chi2=2.5, P=0.01 for PP). PP obtained from home BP measurements was weakly associated with stroke, whereas SBP showed the strongest association. Additionally, DBP and PP may be associated with different stroke types. |
Q:
There is something wrong with my Python code involve the replace function
I was creating a function about replacing multiple part of a string with multiple number but for some reason, the output is not what i expected.
from pyprimes import isprime
def prime_replace(x, l = []):
lst = []
string = str(x)
for n in range(10):
for i in l:
string = string.replace(string[i], str(n))
lst.append(int(string))
return lst
print prime_replace(x = 56243, l = [2, 3])
The output of this function is a list [56003, 56113, 56223, 56333, 56444, 56555, 66666, 77777, 88888, 99999] but what i wanted is [56003, 56113, 56223, 56333, 56443, 56553, 56663, 56773, 56883, 56993] Can someone help me with this and tell me what went wrong, thank you.
A:
You're modifying the original string, and replace is replacing "all occurrences"
Here's part of a print out for how it's generating the output you see:
...
string is now 56333
replacing 3 with 3
string is now 56333
replacing 3 with 4
string is now 56444
...
You can see that we successfully got 56333 like you wanted, but then you wanted to replace str[2] (actual value: 3) with str(n) (actual value: 4), which replaced all occurrences of 3
One workaround for this specific scenario is to make a copy of your string:
def prime_replace(x, l = []):
lst = []
string = str(x)
for n in range(10):
newstr = string
for i in l:
newstr = newstr.replace(string[i], str(n))
lst.append(int(newstr))
return lst
print prime_replace(x = 56243, l = [2, 3])
Output:
[56003, 56113, 56223, 56333, 56443, 56553, 56663, 56773, 56883, 56993]
Demo (not recommended)
However, replace may not be the best choice since it will replace all occurrences of the "oldstring" with the "newstring". It looks like what you're really trying to do is to change string at indices in l to be the next value in range(10), we can do this through indexing and appending:
def prime_replace(x, l = []):
lst = []
string = str(x)
for n in range(10):
newstr = string
for i in l:
newstr = newstr[0:i]+str(n)+newstr[i+1:];
lst.append(int(newstr))
return lst
Demo (better)
|
The Case of the Missing Polygamists
The origins of our sexuality is the greatest mystery in human evolution. But could our prime suspect be a case of mistaken identity?
If reproductive success were applied to fiction the two billion copies of Agatha Christie's novels (only trailing behind Shakespeare and the Bible) would be considered a stunning example of evolutionary fitness. Her work, in such classics as Murder on the Orient Express, Death on the Nile, or Witness for the Prosecution represents a significant portion of our collective memory that is being passed on to future generations. However, researchers have recently uncovered evidence of a tragedy that befell the world's most popular mystery writer and, in so doing, provided a useful lesson when considering genetic evidence for the evolution of human sexuality.
Ian Lancashire and Graeme Hirst at the University of Toronto analyzed the vocabulary used throughout Christie's writing career and determined that the sophistication of her language underwent a significant decline in her final years. By looking at the number of different words used in her novels, as well as the number of repeated phrases, the researchers determined that her vocabulary dropped by almost 31% with the largest decline occurring in her last four books. This, in combination with her family's testimony about undiagnosed physical and mental decline, led the researchers to conclude that they were witnessing the effects of Alzheimer's disease on the world's best-selling author. As a result, Christie's final novels maintained echos of her former work, but they were of a substantially different character to most of her 54-year career as a writer.
Imagine for a moment that everything Agatha Christie had ever written was lost to history except for her last book. If you were to try and form conclusions about her work from this limited account it would result in significant distortions. It would represent the author after she had undergone a profound change and you would be hard pressed to understand why she had ever been so popular. But this kind of selection bias is essentially what we have when we look at the written record of our human past. All of written history, from the earliest accounts in 3,200 BCE to the present, is a mere fragment of human existence on this planet. It is the equivalent of only looking at Agatha Christie's final novel out of 85 published works during a long and distinguished career.
There is no greater mystery in human evolution than the origins of our sexuality. Following the trail of clues available researchers have independently concluded that humans evolved through systems of monogamy, polygamy, as well as polyamory. However, only one can be the culprit. Like a detective interrogating multiple suspects, the solution ultimately depends on which account you're willing to believe.
In 2009 Owen Lovejoy made the case for monogamy based on the fossil remains of the early human ancestor Ardipithecus ramidus. Meanwhile, Christopher Ryan and Cacilda Jethá have argued that polyamory (or, more precisely, a multimale-multifemale mating system) is the most likely scenario from an analysis that emphasized anthropology, behavioral biology, and physiology. To further complicate matters the third suspect in this mystery, polygamy, has been the conclusion from scientists conducting DNA analyses. These conflicting accounts therefore require careful detective work in order to determine which story is the most convincing.
Polygyny (the single male-multifemale version of polygamy) is most well known among primates such as baboons or gorillas. These are the species that have been (incorrectly) described as living in "harems," and are often easy to identify since the males can be up to twice the size of females. Many anthropological accounts, most famously George Murdock's Ethnographic Atlas, have suggested that the human species is "moderately polygynous" since the majority of studied societies practice polygynous marriage (982 out of 1157 according to Murdock's account).
To test whether these reports of polygyny are a local or species-wide phenomenon evolutionary biologist Michael F. Hammer and colleagues at the University of Arizona published their findings in the journal PLoS Genetics. By analyzing the clues left in our X-chromosomes and comparing their results to human autosomes (any of the additional 22 chromosome pairs that aren't sex-linked) the researchers sought to discover what they call male vs. female "effective population size," or the percentage of males compared to females who were effectively reproducing. If polygyny were indeed the norm it would mean that most men throughout human evolution never reproduced and, in strictly genetic terms, had mysteriously vanished without a trace.
Because women have two X-chromosomes they will always pass one of these to either their son or their daughter. Men, on the other hand, will either pass along an X-chromosome (in the case of a daughter) or a Y-chromosome (if they've had a son). But both men and women pass along the same number of autosomes. This means that by comparing the genetic differences between X-chromosomes and autosomes you can estimate the effective population size of men who successfully reproduced compared to women. In other words, the genetic evidence for effective population size is being used to determine the mating system. Skewed upwards and only a few men in any given population were having children with multiple women as in polygynous systems. However, if the ratio is closer to 1:1 it would be consistent with monogamy since an equal number of men as women were passing on their genes.
Mike Hammer and his team of genetic detectives therefore analyzed the chromosomes from six different societies: French Basque, Han Chinese, Melanesian islanders from Papua New Guinea, Biaka foragers from Central African Republic, Mandenka villagers from Senegal, and San hunter-gatherers from Namibia. The researchers found evidence that there was greater variability on the X-chromosome than would be expected if monogamy had been the standard practice. Instead, the evidence suggested a male-female ratio of relatively few men and multiple women as would be expected in polygyny (ranging from 2.4-to-1 among the San and 8.7-to-1 among the Basque). This genetic evidence by Hammer and colleagues would seem to support Murdock's data on marriage systems and confirm that polygyny was the dominant mating system during human evolution.
But like every good detective mystery, just when you think the case is closed you're treated to a twist ending. Primatologist Sarah Blaffer Hrdy (author of The Woman That Never Evolved, Mother Nature, as well as her latest book Mothers and Others) is one of the leading experts on polygynous mating systems in primates. As she explained to me in our recent correspondence there are several important considerations that have been left out of this story. The most important is the kind of sample bias I referred to earlier if we were to make conclusions about Agatha Christie's work based only on her final novel. The DNA evidence may be a record of the human past, but how far into the past does it actually go? As Hrdy explained:
Keep in mind that in terms of interpreting such genetic evidence we are of necessity confined to a fairly recent time depth (and remember, by "recent" someone like me means the last 10,000 years or so). For this time period multiple lines of evidence do indeed suggest that humans were moderately to extremely polygynous and that women were moving between groups more than men were.
There is also something very important to consider that dramatically influenced human behavior within the last 10,000 years: the invention of agriculture. Prior to about 12,000 years ago all humans were hunter-gatherers and lived a migratory existence. With the advent of farming some human societies began to remain sedentary for the first time in our history. This change had serious impacts on human life and behavior. Just as Alzheimer's dramatically altered the content of Agatha Christie's work, so agriculture radically transformed human society and, by consequence, sexual behavior.
Hrdy argues that there was a major disruption in human residence patterns as a result of this "agricultural revolution." In small bands of modern day hunter-gatherers there is a mixture of what anthropologists call matrilocal and patrilocal residence, the practice of women or men to stay within the community they're born into while the other migrates between communities. However, recent research has shown that hunter-gatherer societies today emphasize matrilocal (or bilocal) residence while fewer than 25% are considered patrilocal. This is in stark contrast to the larger scale agricultural societies where an estimated 70% are patrilocal.
According to Hrdy, pre-agricultural human societies would likely have been similar to modern day hunter-gatherers, but the rise of agriculture changed this pattern dramatically. Over the past 10,000 years or so, Hrdy explained, "matrilocal societies gave way to pressures from more expansionist patrilocal societies." This simple change had serious repercussions for both human life and the genetic record. Patrilocal societies typically show increased hierarchies, greater male control over women's sexual choices, and more competition among men compared to matrilocal societies. Patrilocal societies are also usually polygynous. Therefore, the larger numbers of patrilocal (and polygynous) societies today is likely the consequence of agriculture and not a true reflection of the human past. Like Agatha Christie's writing, many human societies underwent a dramatic transformation and basing our conclusions on this period would distort our understanding of what came before.
But there is an even more basic problem in assuming a polygynous human mating system. Modern day bonobos and chimpanzees have a male vs. female effective population size of between 2-to-1 and 4-to-1. If we were using the same argument presented by Hammer and colleagues, these two species should be considered "moderately polygynous" as well. Two independent genetic studies found both bonobos and chimpanzees to be similar to humans on identical criteria. As one study (Erickson et al., 2006) concluded, "the male effective population size in bonobos is small and similar to that suggested from comparable data in humans," while, in the second study (Langergraber et al., 2007), the "data indicate that the sex difference in effective population size is similar in chimpanzees and humans." It turns out that our would-be perpetrator has two reliable alibis.
Despite Pan's moderately polygynous genetics, the bonobo and chimpanzee mating system is most accurately described as multimale-multifemale because males and females each mate with multiple individuals. Of course, this isn't random or indiscriminate mating since females are making careful decisions about who they choose to mate with, and when. The effective population size in bonobos and chimps shows up looking genetically similar to humans because females choose to preferentially mate with high-ranking males during their peak of ovulation. Females still choose to mate with additional males at other times of their cycle, but since these don't produce offspring the end result is that relatively few males are passing on their genes. As Hrdy has demonstrated, something very similar has been shown among humans. This makes a multimale-multifemale mating system the prime suspect in our evolutionary whodunit.
In humans, bonobos, and many other primates, there is a great deal more non-conceptive sexual behavior going on than most people -- from Saint Augustine to contemporary biologists - realize. For example, in South American partible paternity societies, the woman's official mate or husband is still statistically more likely to be the progenitor of offspring she produces, even though other men can and do have some probability of paternity, or at the very least, perceive that they do.
Because of this, Hrdy notes, in a large number of human societies women may be having multiple sexual partners at any given time, but there will usually be a relatively small number of men who are the actual fathers of their children. In this way the missing persons in our evolutionary mystery would be the result of sample bias. It's not because our genes don't reveal the full story, it's because women have only chosen some men whose genetic tale they wanted future generations to remember. In the evolution of human sexuality, as it was in Agatha Christie's life and work, such stories can be subject to dramatic alterations depending on the circumstances and care must be taken lest we misinterpret and obscure the very mystery we're trying to solve.
Hrdy, S.B. (2005) Cooperative Breeders With an Ace in the Hold. In Voland, E., Chasiotis, A., and Schiefenhövel, W. (Eds.), Grandmotherhood: The Evolutionary Significance of the Second Half of Female Life. New York: Rutgers University Press.
Hrdy, S.B. (2000) The Optimal Number of Fathers. Evolution, demography, and history in the shaping of female mate preferences. Annals of the New York Academy of Sciences, 75-96. PMID: 10818622
The views expressed are those of the author(s) and are not necessarily those of Scientific American.
ABOUT THE AUTHOR(S)
Eric Michael Johnson
I grew up in an old house in Forest Ranch, California as the eldest of four boys. I would take all day hikes with my cat in the canyon just below our property, and the neighbor kids taught me to shoot a bow and arrow. I always loved reading and wrote short stories, poems, and screenplays that I would force my brothers to star in. A chance encounter with a filmmaker from Cameroon sent me to Paris as his assistant and I stayed on to hitchhike across Europe. Nearly a year later, I found myself outside a Greek Orthodox Church with thirty Albanian and Macedonian migrants as we looked for work picking potatoes.
After my next year of college I moved to Los Angeles to study screenwriting and film production. My love of international cinema deepened into larger questions about the origins of human societies and cultures. I entered graduate school with a background in anthropology and biology, joining the world-renowned department of Evolutionary Anthropology at Duke University to pursue a PhD in great ape behavioral ecology. But larger questions concerning the history and sociology of scientific ideas cut my empirical research short. I am now completing a dissertation at University of British Columbia on the intersection between evolutionary biology and politics in England, Europe, and Russia in the nineteenth century. In 2011 I met the economist and Nobel Laureate Amartya Sen whose work inspired my award-winning research.
My writing has always been a labor of love and a journey unto itself. I have written about the hilarity that ensues once electrodes are stuck into your medial ventral prefrontal cortex for Discover, the joy of penis-fencing with the endangered bonobo for Wildlife Conservation, and the "killer-ape" myth of human origins from Shakespeare's The Tempest to Kubrick's 2001: A Space Odyssey for Times Higher Education. My work has appeared online for Wired, PLoS Blogs, Psychology Today, Huffington Post, SEED, ScienceBlogs, Nature Network and a host of independent science related websites. I have appeared four times in The Open Laboratory collection of the year's best online science writing and was selected the same number as a finalist for the Quark Science Prize, though better writers have always prevailed. I am currently working on my first book.
If I am not engaged in a writing or research project I spend time with my young son, Sagan. Whenever I get the chance I go on backpacking trips in the mountains of British Columbia or catch the latest film from Zhang Yimou, the Coen Brothers, or Deepa Mehta. To this day one of my favorite passages ever written is from Henry David Thoreau's Walden where he describes an epic battle between ants in Concord, an injured soldier limping forward as the still living heads of his enemies cling to his legs and thorax "like ghastly trophies at his saddle-bow." Thoreau helped fugitive slaves to escape while he mused on the wonder and strange beauty of the natural world. Not a bad way to spend an afternoon.
Scientific American is part of Springer Nature, which owns or has commercial relations with thousands of scientific publications (many of them can be found at www.springernature.com/us). Scientific American maintains a strict policy of editorial independence in reporting developments in science to our readers. |
---
abstract: 'We use Stein’s method to bound the Wasserstein distance of order $2$ between a measure $\nu$ and the Gaussian measure using a stochastic process $(X_t)_{t \geq 0}$ such that $X_t$ is drawn from $\nu$ for any $t > 0$. If the stochastic process $(X_t)_{t \geq 0}$ satisfies an additional exchangeability assumption, we show it can also be used to obtain bounds on Wasserstein distances of any order $p \geq 1$. Using our results, we provide optimal convergence rates for the multi-dimensional Central Limit Theorem in terms of Wasserstein distances of any order $p \geq 2$ under simple moment assumptions.'
author:
- |
Thomas Bonis\
DataShape team, Inria Saclay, Université Paris-Saclay, Paris, France\
[email protected]
bibliography:
- 'Bibliography.bib'
title:
- 'Stein’s method for normal approximation in Wasserstein distances with application to the multivariate Central Limit Theorem [^1] '
- 'Stein’s method for normal approximation in Wasserstein distances with application to the multivariate Central Limit Theorem'
---
Acknowledgements {#acknowledgements .unnumbered}
================
The author would like to thank Michel Ledoux for his many comments and advice regarding the redaction of this paper as well as Jérôme Dedecker and Yvik Swan, Chi Tran and Frédéric Chazal for their multiple remarks.
[^1]: The author was supported by the French Délégation Générale de l’Armement (DGA) and by ANR project TopData ANR-13-BS01-0008.
|
Q:
Using querySelector exclude elements whose id's include a spesific string
I want to get results whose id does not include a string (let's say it's is "test")
<ul class="numberlist">
<li id="test1" style="display:none">
<div></div>
</li>
<li>
<a>one</a>
</li>
<li>
<a>two</a>
</li>
<li>
<a>three</a>
</li>
<li id="test2" style="display:none">
<div></div>
</li>
<li>
<a>four</a>
</li>
<li id="test" style="display:none">
</div></div>
</li>
</ul>
As I said I want to exclude which has id that includes string test. How can I achieve it?
I can get the list of <li>'s by writing
document.querySelectorAll('ul.numberList')
But I want to exclude some of them by their id's.
A:
You can use attribute contains selector with :not() pseudo-class selector
document.querySelectorAll('ul.numberlist li:not([id*="test"])')
console.log(document.querySelectorAll('ul.numberlist li:not([id*="test"])').length)
<ul class="numberlist">
<li id="test1" style="display:none">
<div></div>
</li>
<li>
<a>one</a>
</li>
<li>
<a>two</a>
</li>
<li>
<a>three</a>
</li>
<li id="test2" style="display:none">
<div></div>
</li>
<li>
<a>four</a>
</li>
<li id="test" style="display:none">
<div></div>
</li>
</ul>
FYI : document.querySelectorAll('ul.numberList') , doesn't get all li element, instead which gets all ul with class numberList. To get all li inside use selector as ul.numberList li. Also in your html class name is numberlist not numberList.
|
Olev Vinn
Olev Vinn (January 26, 1971) is Estonian paleobiologist and paleontologist.
Vinn graduated from the biology class of Tallinn 3. Secondary School in 1989. He studied geology at the University of Tartu from 1989 to 1993. Vinn holds an M.Sc.
degree in paleontology and stratigraphy from the University of Tartu in 1995 and a Ph.D. degree in geology from the same university in 2001. He is senior research fellow
in paleontology at the University of Tartu since 2007. He has published more than 100 peer reviewed papers in international scientific journals.
Taxonomic studies
Vinn has described new genera and species of brachiopods, cornulitids, microconchids, serpulid polychaetes and trace fossils. He is a specialist of extinct tubicolous fossils. A microconchid species Microconchus vinni is named in honour of his taxonomic studies of tentaculitoid tubeworms.
Biomineralization studies
Vinn has described majority of annelid skeletal ultrastructures.
Oriented tube structures are present in many serpulid species and cannot
be explained by the standard carbonate slurry model. Vinn
and his co-authors have hypothesized that oriented structures in serpulid tubes have been
secreted in the same way as in mollusc shells, based on their ultrastructural similarity.
Vinn and his co-authors proposed alternative ways to explain the calcified secretory
granules described by Neff in the lumen of the calcium-secreting glands in
serpulids. They proposed that worm actually produces calcium-saturated mucus in the glands. The mucus
is then deposited on the tube aperture, where crystallization of the structure is
controlled by an organic matrix, as in molluscs.The calcified granules in the glands may only
be an artifact of fixation and formed after the death of the worm.
Paleoecology studies
Vinn has studied evolution of symbiosis in several groups of early invertebrates such as cornulitids, microconchids, bryozoans, brachiopods, crinoids, stromatoporoids, tabulates and rugosans. He has described serpulid faunas of Mesozoic to Recent hydrocarbon seeps. A Late Devonian coral species ?Michelinia vinni is named in honour of his contribution to knowledge of ecology of Palaeozoic bioconstructing organisms. A crinoid species name Hiiumaacrinus vinni recognizes his
significant contributions to the Silurian paleontology of Estonia.
Publications
Some of Vinn's more important publications include:
Vinn, O. and Mõtus, M.-A. 2012. Diverse early endobiotic coral symbiont assemblage from the Katian (Late Ordovician) of Baltica. Palaeogeography, Palaeoclimatology, Palaeoecology 321–322, 137–141.
References
External links
Estonian Science Portal
ResearchGate
Olev Vinn's publications
Category:1971 births
Category:Estonian paleontologists
Category:Estonian geologists
Category:Estonian biologists
Category:People from Tallinn
Category:University of Tartu alumni
Category:Living people |
341 Mich. 495 (1954)
67 N.W.2d 718
ROBYNS
v.
CITY OF DEARBORN.
Docket No. 56, Calendar No. 46,289.
Supreme Court of Michigan.
Decided December 29, 1954.
John J. Fish, for plaintiffs.
Dale H. Fillmore, Corporation Counsel, and B. Ward Smith, Frederick G. Weideman and James A. Broderick, Assistants Corporation Counsel, for defendant.
DETHMERS, J.
Defendant appeals from decree enjoining enforcement of a zoning ordinance against plaintiffs' property because unreasonable and confiscatory as applied thereto.
Each of plaintiffs owns 1 of 8 lots on the south side of Ford road in the city of Dearborn across from the lots in Dearborn township involved in Ritenour v. Township of Dearborn, 326 Mich 242. Seven of the lots have a width of 20 feet and one 24.44 feet, fronting on Ford road, with depths varying from 100 to 110 feet. Some of plaintiffs purchased their lots prior to, and some after, the adoption of the original ordinance which zoned the lots for residence C use and some bought after adoption of an amendment changing the zoning to the present residence A classification. Original building restrictions, since expired, limited use of some of the lots to business purposes and others to business or residential. *498 Lots across the road in the township have been zoned light commercial since our holding in Ritenour and many are so used. Lots on the south side of Ford road, immediately west of the lots here involved, are zoned business B and those to the east, running for a considerable distance, are vacant. The ordinance in question provides "there shall be a minimum of 10 feet between residences."
Plaintiffs prayed that the ordinance be decreed to be unconstitutional and void as applied to their lots, that they be decreed to be business property, that defendant be enjoined from enforcing the ordinance with respect thereto, and that a building permit for nonresidential purposes be required to issue as relates to 1 of the lots.
Defendant says the bill is multifarious. This it predicates in part on the fact that some plaintiffs acquired lots before, and some after, the ordinance and its subsequent amendment, suggesting that, on the authority of Hammond v. Bloomfield Hills Building Inspector, 331 Mich 551, the rights of those who purchased before the ordinance differ, for that reason, from those who bought thereafter. Hammond does not so hold. Provisions of a zoning ordinance void as relates to a lot because unreasonable and confiscatory are not made valid with respect thereto by the transfer of title from the owner to another. Faucher v. Grosse Ile Township Building Inspector, 321 Mich 193. CL 1948, § 608.1 (Stat Ann § 27.591), permits joining a number of plaintiffs if sufficient grounds appear for uniting the causes of action in order to promote the convenient administration of justice. That is the consideration warranting joinder here, particularly because defendant is not thereby prejudiced. Gilmer v. Miller, 319 Mich 136. The fact that 1 plaintiff seeks, in addition to injunctive relief, a provision in the decree requiring issuance to him of a building permit, which might be *499 accomplished by mandamus, does not render the bill multifarious inasmuch as equity, having acquired jurisdiction to restrain defendant as prayed, may retain it to grant complete relief and finally dispose of the controversy even though some of the questions propounded could have been raised and some of the relief sought could have been obtained in a law action. City of Ecorse v. Peoples Community Hospital Authority, 336 Mich 490.
Defendant contends that plaintiffs had an adequate remedy at law for testing the validity of the ordinance, namely, mandamus to compel issuing of building permits of a character prohibited by the ordinance. As relates to 7 of the plaintiffs, it does not appear that they were ready to build or desired such permits. From the pleadings it does appear that defendant was about to institute condemnation proceedings against the lots in question and others for park and green-belt purposes. Defendant may not, through the device of zoning for a use to which property is not suited, depress its value preliminary to condemning it for public purpose. Grand Trunk Western R. Co. v. City of Detroit, 326 Mich 387; Long v. City of Highland Park, 329 Mich 146. Under such circumstances, equity alone could afford plaintiffs the necessary remedy. Resort was had to equity for the purpose of having zoning ordinances declared invalid and their enforcement enjoined in Ritenour v. Township of Dearborn, supra; Elizabeth Lake Estates v. Township of Waterford, 317 Mich 359; Faucher v. Grosse Ile Township Building Inspector, supra; Long v. City of Highland Park, supra; Hitchman v. Township of Oakland, 329 Mich 331.
Is the ordinance unreasonable and confiscatory as applied to plaintiffs' lots? It limits use to residences which, under its provisions, cannot be constructed on these lots at a width of more than 10 feet, comparable, *500 in this respect, to the situation in Ritenour. Other requirements of the ordinance with respect to area, minimum width of side yards, et cetera, cannot be complied with so as to permit construction of usable residences. Defendant's answer admits, in effect, plaintiffs' charge, that the provisions of the ordinance make use of the lots for residential purposes physically impossible, by alleging, in response thereto, that plaintiffs could comply by combining 2 or more lots for the building of residences thereon. We think the decision in Ritenour controlling here. Distinctions between that case and this in the respect that there the plaintiff acquired the property prior to enactment of the ordinance, that the property there involved had once been zoned for business purposes, and that the action there was brought by plaintiff within a year after adoption of the ordinance while here it was not brought until 22 years later, do not serve to alter the fact that the provisions of the ordinance would render plaintiffs' property here almost worthless. That the city may not do. Long v. City of Highland Park, supra. Transfer of title, or the lapse of 22 years, after adoption of the ordinance does not relieve the ordinance of its unreasonable and confiscatory character. It is invalid as applied to plaintiffs' lots.
Finally, defendant urges that plaintiffs have no standing in a court of equity because they did not first apply to the appeal board created under the ordinance. This point was not raised below nor in the statement of reasons and grounds for appeal and, accordingly, is not entitled to consideration here. At all events, it is without merit. The appeal board could not determine the validity of the ordinance nor afford plaintiffs the necessary relief under the circumstances of this case when building permits were not desired but redress against measures likely to depress value prior to condemnation *501 proceedings was sought. Austin v. Older, 278 Mich 518.
Affirmed, with costs to plaintiffs.
BUTZEL, C.J., and CARR, BUSHNELL, SHARPE, BOYLES, REID, and KELLY, JJ., concurred.
|
New contributor this month. He has written for Hakin9 Magazine and is now working on a few projects for us. This first article is a toe in the water for Maltego 3. Look for more articles in the future diving deeper into this great tool.
Maltego, developed by Roelof Temmingh, Andrew Macpherson and their team over at Paterva, is a premier information gathering tool that allows you to visualize and understand common trust relationships between entities of your choosing. Currently Maltego 3 is available for Windows and Linux. There is also an upcoming version for Apple users that has yet to be released.
Information gathering is a vital part of any penetration test or security audit, and it’s a process that demands patience, concentration and the right tool to be done correctly. In our case Maltego 3 is the tool for the job.
In this article we explore Maltego 3 and examine its fundamental features and a little hands-on with the newly designed version. If you haven’t already had a chance to upgrade to or pick up Maltego 3 you are missing out.
Let us know what you think as well as what you'd like to learn regarding Maltego. |
I need some help ladies! Bout my ex texting me how am I and what not?
so she texts me after a couple months of not talking asking how I've been so for me it was like oh shit cause i still have mad feelings for this girl right? but it just feels weird texting her now and even how we were texting just seemed like a friendly manner which kind of throws me off yet she was trying to keep a convo.. after bout a day or two of texting i said well i know you wanted to see how i was but im going to knock out and i dont know if you feel obligated to keep texting me but if not ill text you tomorrow or whenever and she replied that she nver felt obligated but was saying she was going to bed too cause she is exhausted and i never texted her back goodnight or the next day.. im lost what do you guys think this means? should i text her or see if she ever texts me again even tho i said i would? by the way she dumped me and is in college
What Girls Said 2
there's no need for you to feel obligated by replying her text messages. from my point of view. Once an EX is only an EX. no need to be friends with them. friends? for what? that'll be useless. You can still text them back or talk to them but only a respect not feel obliged with it. just ignore her or if she keeps on troubling you, you can change a contact number. :)
0
0|0
0|0
Asker
thank you! helps a lot but i told her i dont know if she feels obligated to text me and she said she isn't so she's wanting to but a question i have is should i wait and see if she ever texts me again or should i text her back? by the way you're amazing thank you for the help
for me.. when she said that she's not obligated, maybe i agree with but on the other side, it's the guilt that's holding her back. And NO, for me.. there's no point in waiting and no point texting her back. Just go forward.. it' s not easy at first but you'll get over it soon. You'll find someone whose much better than her. ^_^ |
This site is operated by a business or businesses owned by Informa PLC and all copyright resides with them. Informa PLC's registered office is 5 Howick Place, London SW1P 1WG. Registered in England and Wales. Number 8860726.
Source Control with Unity and Visual Studio
The following blog post, unless otherwise noted, was written by a member of Gamasutras community.
The thoughts and opinions expressed are those of the writer and not Gamasutra or its parent company.
DISCLAIMER: Because I am going to be recommending a Microsoft product, it behooves me - for several reasons - to inform you that I currently work for Microsoft. That said, all of the opinions on this blog, my Twitter, etc., are my own.
The Story So Far
It's unquestionable that Unity has become the go-to engine for indie developers. The ease with which you can add objects to your levels, script behaviors, and build to several different platforms makes it an obvious choice for everything from rapid prototyping to releasing a full AAA title.
When Psydra Games was ready to dive into our second game, after a short break following the release of Dark Scavenger, I was still a beginner with Unity, but its potential was already obvious. If nothing else, we could quickly get a prototype up and running of Lead Designer Alex Gold's crazy idea. The more we dove in, the clearer it was that this was definitely the engine for us.
And although Unity is for the most part a one-stop solution for game development, we were lacking in two areas:
Code Editor: While adequate for prototyping, as a long-term solution, MonoDevelop just isn't up to the standard of Unity's user-friendliness.
Version Control: This certainly isn't a failing on Unity's part, particularly for a free game development tool. Still, it's a necessity for having backups of your work, as well as collaborating with teammates.
As it turns out, both of these issues were solved with the same tool: Visual Studio.
Visual Studio has had its free Express version for a long time, but in November, Microsoft released the so-called "Community Edition", which has almost none of the restrictions that exist in Express. This was a great day particularly for Unity users, as the new Community Edition of Visual Studio even allows for plugins, such as UnityVS, which can be very useful for debugging your games.
Many developers are still unaware of the benefits to using Visual Studio, especially its source control, so I wanted to provide a little how-to (as well as a why-to) guide for Unity and Visual Studio, working in (near) perfect harmony.
Connecting Unity and Visual Studio
With that installed, you just need to set it as your code editor in Unity via Edit->Preferences->External Tools.
To be honest, I've had mixed results with this setting, and so by habit, I just open VS separately and open the solution directly. I've not found a great reason to constantly close and reopen VS, so opening it the same time as Unity and getting yourself set up should be a quick one-time process per development session.
That's really all there is to connecting VS with Unity. Again, UnityVS will further enhance this connection, allowing you to use the Visual Studio debugger, set breakpoints in your scripts, and many other handy features. The only important thing to note is that Unity will make edits to the solution file upon loading the project and upon adding or removing source files, which will prompt you to reload it in VS. This means that if you load up VS and your project's solution file before you load Unity, get ready to reload that solution right away, even if no changes have been made since you last loaded Unity.
Visual Studio Source Control
That brings us to the fun stuff: source control. If you are working alone, maybe you just need to backup your project and have versions to reference. If you're working on a team, source control can make all the difference in how quickly and smoothly your updates integrate with those of your colleagues. There are different settings that may apply to either scenario, so I'll include both options.
The first step in source control is the Unity set-up. By default, Unity has "hidden meta files". These meta files contain settings for the assets in your project, such as import settings and the GUIDs for those assets. This information is obviously vital to your project, and so your source control needs to be able to see them. Go to Edit->Project Settings->Editor, and under Version Control, Select "Visible Meta Files".
Also, while you're in these settings, if you set "Asset Serialization" to "Force Text", you can have multiple people working in the same scene, and merge the changes through your source control, as version control systems are often made to merge text files.
Next, you need to get set up with hosting for your source control. To use Visual Studio's Team Foundation Server, you can sign up for a free Microsoft account, providing you with version control hosting with no space or version limitations. The only limitation to the free service is a maximum of 5 users for your projects. If you are working with a larger team, you could either pay to upgrade, or work with another service (a Git source control plugin is also included with Visual Studio). Because our team fit perfectly in the 5-user limit, we went with Team Foundation Server hosting. As a bonus, TFS provides an agile task board, something else we had shopped around for a lot before settling on Visual Studio.
You'll want to create a new project through the website to contain your game. Then log into your account in Visual Studio, and under the "Team" menu, select, "Connect to Team Foundation Server...". The URL for your TFS hosting will show up in the server dropdown, which will contain your new project.
Here's where some options may change depending on your preferences and team setup.
Working with Workspaces
There are two options for workspaces in Visual Studio. One is Local (which for some reason is recommended), and the other is Server. A local workspace allows you to edit your files locally, and only connects with the server when you sync and submit files. A server workspace requires connection to the server when you check files out, and all server files are marked as read-only until they are checked out. Personally, the only way I can recommend using a local workspace is if you are working alone, and are only using the server to back up your project. I'm sure there are other scenarios, such as working from a laptop while traveling with no access to WiFi, but in general, I would stick with server workspaces for team projects.
And there are a few big reasons for that. First, because local workspaces don't connect to a server to check files out, your teammates cannot see what you are working on, which could mean duplicate work, incompatible edits, etc. Second, it means that you can't enforce exclusive checkouts, so that you don't have to worry about merging changes. And third, something I'm in favor of for everyone's awareness, it forces you to know what files you're editing, which also prevents you from editing files you didn't mean to, and submitting them to the source control.
For these reasons, I made the default workspace for our project a server workspace. To set this, go to Team->Team Project Collection Settings->Source Control
However, if you want, you can change your own workspace to be local. I changed the default because it makes it easier for everyone to get set up with the type of workspace I wanted them to use - and to be perfectly honest, if you want to "enforce" a workspace type, the less ambitiously curious members of your team will probably never dig deep enough to realize they can change it. So don't let them read this blog, because here's how you do that.
On the right side of Visual Studio, under the Team Explorer tab, click on your workspace name (probably your computer's name), and select "Manage Workspaces".
Click the "Edit..." button on the next screen, and then "Advanced >>>". The "Location:" dropdown determines whether your workspace is local or server.
With your workspace all set up, you can start synching and submitting files. First, map the server to a location on a local drive. Then right-click and click "Get Latest", which will download the temporary files that Visual Studio Online provided to get you started.
Now you're ready to get your project online and accessed by other team members. Put your existing project into the folder you mapped in source control, and grab the "Assets" and "Project Settings" folders. You don't need the "Library" folder, nor the solution files in your source control, as they are generated/edited by Unity when you load and make changes to the project.
If you go to the Team Explorer tab on the right and select "Pending Changes", you can see all of the files ready to be submitted to the server. You can submit these files by clicking the "Check In" button, and optionally (and certainly recommended) adding a comment about what you did.
Being Tricky
Now, if you're only adding a file/folder or two, this is pretty painless. However, once your project is on the server, you'll most likely start to add several different files in several different places. Adding these one by one can get tedious, so there is a shortcut.
First, do all of your work locally; add the files you need in your local version of the project, and make whatever changes you need (sometimes manually checking out server files is required, but Unity will force overwrite asset files you edit). When all of you work is done, go to your Source Control Explorer, and right-click the "Assets" folder (do not use the root project folder, as you don't need the library folder and its metadata), and click "Compare".
A list of your changes (and possibly file updates you didn't sync yet) will show up in a new tab. From here, you can select all, right-click, and select "Reconcile". This will provide you with some options such for resolving these differences. By default, it will add any files that aren't already on the sever and download updates you don't have from the server. It will not by default, however, open for edit the files you have changed but didn't already check out. This may be a good thing, as it will show you files you may have edited by mistake, and give you the opportunity to undo those changes rather then submitting them, or you may want to change that setting to check out all files that you have edited.
Another quick thing to note about Visual Studio source control is that any files you have checked out and submit with no changes will be automatically reverted. This means that you can check out an entire folder, edit one file, and when you check everything in, only that one file will be submitted, and the rest will simply have the server checkout undone. This minimizes the number of files everyone has to sync to without you having to explicitly undo files you didn't end up editing.
I could probably go on far longer, but this already feels too long for one post. Further posts on this topic may be added upon request. For any feedback/questions/hatemail, go to my about page. |
1. Technical Field
The present invention relates to a super-wide-angle lens and an imaging apparatus, and more particularly to a super-wide-angle lens which can be used for a digital camera, a broadcasting camera, a movie camera, and the like; and an imaging apparatus including the super-wide-angle lens.
2. Description of the Related Art
In recent years, there is great demand for cameras in the above fields to have a small F-number which enables photography in dark places and to have high performance which can be compatible with recent high-definition imaging elements. Moreover, for example, some movie cameras and the like are provided with a mechanism for driving power focus of a focusing group (a lens group which moves while focusing) such as an autofocus mechanism and the like. As there are many opportunities to photograph subjects which are moving, there is demand for a lightweight focusing group and suppression of fluctuations in aberrations and fluctuations in the angle of view in order to have superior responsiveness to focusing when the distance to a subject is changed. Taking these circumstances into consideration, the inner focus lens system is often adopted. Examples of the inner focus lens system include the lens systems disclosed in Japanese Unexamined Patent Publication No. 2011-186269 and Japanese Unexamined Patent Publication No. 2011-028009.
In contrast, many wide angle type lenses for movie cameras are conventionally of the fixed focus type from the viewpoint of optical performance, and are often used by changing a plurality of lenses according to the intended application. For example, the lens disclosed in Japanese Unexamined Patent Publication No. 2000-056217 of a retrofocus type in which a negative first lens group, a positive second lens group, and a positive third lens group are arranged in this order from the object side is known as a wide angle lens. |
Jianlin Cheng
Jianlin Jack Cheng is the William and Nancy Thompson Missouri Distinguished Professor in the Computer Science Department at the University of Missouri, Columbia. He earned his PhD from the University of California-Irvine in 2006, his MS degree from Utah State University in 2001, and his BS degree from Huazhong University of Science and Technology in 1994.
His research interests include bioinformatics, machine learning and data mining. His current research is focused on
protein structure and function prediction, 3D genome structure modeling, biological network construction, and deep learning with applications to big data in biomedical domains.
Dr. Cheng has more than 100 publications in the field of bioinformatics, computational biology, data mining and machine learning, which have been cited thousands of times according to Google Scholar statistics. His protein structure prediction methods (MULTICOM) supported by National Institute of Health were consistently ranked among the top methods during the last several rounds of the community-wide Critical Assessment of Techniques for Protein Structure Prediction (CASP). Dr. Cheng was a recipient of 2012 NSF CAREER award for his work on 3D genome structure modeling.
Bibliography (selected recent publications)
1. X. Deng, J. Cheng. Enhancing HMM-Based Protein Profile-Profile Alignment with Structural Features and Evolutionary Coupling Information. BMC Bioinformatics. 15:252, 2014. paper
2. T. Jo, J. Cheng. Improving Protein Fold Recognition by Random Forest. BMC Bioinformatics. 15(S11):S14, 2014. paper
3. R. Cao, Z. Wang, Y. Wang, J. Cheng. SMOQ: a tool for predicting the absolute residue-specific quality of a single protein model with support vector machines. BMC Bioinformatics, 15:120, 2014. paper
4. T. Trieu, J. Cheng. Large-scale reconstruction of 3D structures of human chromosomes from chromosomal contact data. Nucleic Acids Research. 42(7):e52, 2014. paper
5. L. Sun, A.F. Johnson, J. Li, A.S. Lambdin, J. Cheng, J.A. Birchler. Differential effect of aneuploidy on the X chromosome and genes with sex-biased expression in Drosophila. Proceeding of National Academy of Sciences (P.N.A.S), USA. 110(41):16514-9, 2013. paper
6. M. Zhu, J. Dahmen, G. Stacey, J. Cheng. Predicting gene regulatory networks of soybean nodulation from RNA-Seq transcriptome data. BMC Bioinformatics. 14:278, 2013. paper
7. J. Eickholt, J. Cheng. A Study and Extension of DNcon: a Method for Protein Residue-Residue Contact Prediction Using Deep Networks. BMC Bioinformatics. 14(Suppl 14):S12, 2013. paper
8. D. Bhattacharya, J. Cheng. i3Drefine Software for Protein 3D Structure Refinement and its Assessment in CASP10. PLoS ONE. 8(7):e69648, 2013. paper
9. J. Eickholt, J. Cheng. DNdisorder: Predicting Protein Disorder Using Boosting and Deep Networks. BMC Bioinformatics. 14:88, 2013. paper
10. J. Li, X. Deng, J. Eickholt, J. Cheng. Designing and Benchmarking the MULTICOM Protein Structure Prediction System. BMC Structural Biology. 13:2, 2013. paper
11. Z. Wang, R. Cao, K. Taylor, A. Briley, C. Caldwell, J. Cheng. The Properties of Genome Conformation and Spatial Gene Interaction and Regulation Networks of Normal and Malignant Human Cell Types. PLoS ONE. 8(3):e58793, 2013. paper
12. P. Radivojac, W. Clark, T.B. Oron, A.M. Schnoes, T. Wittkop, A. Sokolov, K. Graim, C. Funk, K. Verspoor, A. Ben-Hur, G. Pandey, J.M. Yunes, A.S. Talwakar, S. Repo, M.L. Souza, D. Piovesan, R. Casadio, Z. Wang, J. Cheng, H. Fang, J. Gough, P. Koskinen, P. Toronen, J. Nokso-Koivisto, L. Holm, D. Cozzetto, D.W. Buchan, K. Bryson, D.T. Jones, B. Limaye, H. Inamdar, A. Datta, S.K. Manjari, R. Joshi, M. Chitale, D. Kihara, A.M. Lisewski, S. Erdin, E. Venner, O. Lichtarge, R. Rentzsch, H. Yang, A.E. Romero, P. Bhat, A. Paccanaro, T. Hamp, R. Kassner, S. Seemayer, E. Vicedo, C. Schaefer, D. Achten, F. Auer, A. Bohm, T. Braun, M. Hecht, M. Heron, P. Honigschmid, T. Hopf, S. Kaufmann, M. Kiening, D. Krompass, C. Landerer, Y. Mahlich, M. Roos, J. Bjorne, T. Salakoski, A. Wong, H. Shatkay, M.N. Wass, M.J.E. Sternberg, N. Skunca, F. Supek, M. Bosnjak, P. Panov, S. Dzeroski, T. Smuc, Y.A.I. Kourmpetis, A.D.J. van Dijk, C.J.F. ter Braak, Y. Zhou, Q. Gong, X. Dong, W. Tian, M. Falda, P. Fontana, E. Lavezzo, B.D. Camillo, S. Toppo, L. Lan, N. Djuric, Y. Guo, S. Vucetic, A. Bairoch, M. Linial, P.C. Babbitt, S.E. Brenner, C. Orengo, B. Rost, S.D. Mooney, I. Friedberg. A Large-Scale Evaluation of Computational Protein Function Prediction. Nature Methods. 10(13):221-7, 2013. paper
13. D. Bhattacharya, J. Cheng. 3DRefine: Consistent Protein Structure Refinement by Optimizing Hydrogen Bonding Network and Atomic Level Energy Minimization. Proteins, 81(1):119-31, 2013. paper
14. J. Eickholt, J. Cheng. Predicting Protein Residue-Residue Contacts Using Deep Networks and Boosting. Bioinformatics. 28(23):3066-3072, 2012. paper
15. M. Zhu, X. Deng, T. Joshi, D. Xu, G. Stacey, J. Cheng. Reconstructing Differentially Co-expressed Gene Modules and Regulatory Networks of Soybean Cells. BMC Genomics, 13:434, 2012. paper
16. J. Cheng, J. Li, Z. Wang, J. Eickholt, X. Deng. The MULTICOM Toolbox for Protein Structure Prediction. BMC Bioinformatics, 13:65, 2012. paper
External links
Dr. Cheng's Laboratory homepage.
Category:American computer scientists
Category:Living people
Category:American scientists of Chinese descent
Category:Year of birth missing (living people) |
Q:
In cross validation, higher the value of k, lesser the training data for this formula?
Is it right to say that smaller the value of k in cross validation based on the following formula, more the number of records in test data/smaller the number of records in training data.
According to me, these are the proportions of train and test data depending on the value of k for the following formula.
x.train = x.shuffle[which(1:nrow(x.shuffle)%%folds != i%%folds), ]
x.test = x.shuffle[which(1:nrow(x.shuffle)%%folds == i%%folds), ]
Proportion of train and test data depending on the value of k
At k==10, train:test = 9:1, ie, traindata = 90%, testdata = 10%
At k== 9, train:test = 8:1
At k== 8, train:test = 7:1
At k== 7, train:test = 6:1
At k== 6, train:test = 5:1
At k== 5, train:test = 4:1, ie, traindata = 80%, testdata = 20%
At k== 4, train:test = 3:1
At k== 3, train:test = 2:1
At k== 2, train:test = 1:1, ie, traindata = 50%, testdata = 50%
At k== 1, train:test = 0:1, ie, traindata = 0%, testdata = 100%
A:
Yes, you can say that (and your train/test ratios are also correct).
Although, $k=1$ doesn't really make sense. The most common choice is $k=10$ (paper reference [PDF]).
|
Q:
Sending signals to PC over wifi
I need a microcontroller that would send statuses of it's input pins (around 5 of them, they can be 0 or 1) to a PC over wifi.
I thought of using arduino, but I don't know what would I need to make it able to send data over wifi? Some wifi module? And would that be a good combination?
This is a part of a device which is going to be on the hand, so it needs to be small and battery powered. (It should send statuses of it's pins at speed of around 15 times a second, and I'll need it to have one output pin set to 1, so I could send that signal to input pins) And since arduino is a bit bigger in size than I would like and it's made for much more advanced stuff I'm not sure if it would be the best choice.
So can anyone tell me what kind of microcontroller do I need and how to use wifi with it?
(I have some experience with arduino, but not with using wifi or other form of remote communication with electronics. If something about the question is unclear please ask in the comments. Thanks)
A:
For establishing a communication between a computer and an MCU I strongly suggest you to use Texas Instrument's CC3000 Wi-Fi chip with an Arduino (Easiest way to accomplish what you need). Adafruit and SparkFun introduced breakout* and shield** versions of the Wi-Fi chip. It is easy to use, just connect the wires and start communicating.
There is a strong library support of these products. Either of it can be found in relevant websites. You can send http requests to arduino or you can get http requests from arduino using these libraries.
There are a lot of examples, sketches of this product. One of them is Wi-Fi weather station. Check the video, I believe this is what you want to accomplish.
*Adafruit's breakout
*SparkFun's breakout
**Adafruit's shield
**SparkFun's shield
A:
Arduino is a good starting point. There is a WiFi Shield available.
Your question, "What kind of microcontroller do I need?" is too broad. There are literally hundreds if not thousands of microcontrollers that you could potentially use. So how do you go about selecting one?
First, there are many manufacturers such as Microchip (PIC), Freescale, Atmel (AVR), etc. Selecting one is largely preference, but also highly dependent on support, price, reputation, available tools/software, feature offerings, etc. PIC and AVR are, for example, very popular platforms for 8- to 32-bit microcontrollers. The Arduino Uno is based on the Atmel ATmega328 8-bit microcontroller.
Let's say you pick AVR after becoming familiar with Arduino as a starter platform. (This is what I did.) Atmel has a microcontroller selector which gives you a parametric selection matrix to help you narrow down choices. The available microcontrollers are quite numerous, and some are purpose-made with specific applications in mind, such as portable music players, automotive applications, touch-based devices, and so on.
Using the selector, you can filter by such properties as memory size, pin count, CPU speed and type, temperature range, included timers and interrupts, external oscillator support, etc.
From what you've explained of your application, you are simply reading the state of five input pins and need to send that to a PC over a wireless (presumably ethernet) network at a rate of 15 Hz. The minimum requirement for that would be, obviously, at least 5 I/O pins, plus a way to connect to another component to send the data. SPI and I2C are common interface types, requiring two to four pins, depending on configuration. The WiFi Shield for Arduino that I mentioned earlier uses SPI to connect to the Arduino.
In the case of the WiFi Shield, all of the processing required for handling TCP/IP, encryption, and so on, is built into the board. If you decide to design and build your own microcontroller-based device, you could potentially find WiFi modules designed to "plug and play" with a microcontroller via SPI, or select individual components and create your own WiFi implementation. Personally, that would be a daunting task, especially if you're not familiar with microcontroller basics.
This site is not suited for product recommendations, but I can at least tell you to look for "WLAN Modules" or "WiFi Modules" at your favorite electronics component vendor. You can use their search tools to find modules that suit your needs, including the connection type you intend to use with your microcontroller.
If you're doing a one-off, or just getting started in learning, I would definitely recommend picking up an Arduino and the WiFi Shield. There is a lot of support for it, most of the difficult work has already been done, and there's even an Arduino StackExchange site.
|
This is the first day of our official monitoring for Marine invasives. We put a 49' long rope off the top of the Stone Pier Wharf of which 27' would be always under water. The idea is that when we look for invasives on the float that we will pull this rope up and check it out each time. The rope will remain in this place as long as we do the studying. |
Previous work on muscarinic subsensitivity of the ciliary muscle in monkeys is continued. Previous work on axoplasmic flow against pressure gradients will be extended to the optic nerve in vitro. Changes in the carbonic anhydrase content in eyes and other organs of animals chronically treated with carbonic anhydrase inhibitors will be studied. Attempts will be made to develop a technique for measurement of aqueous humor flow in conscious monkeys. |
Synthesis of 3-substituted 4-aroylisoquinolines via Pd-catalyzed carbonylative cyclization of 2-(1-alkynyl)benzaldimines.
A number of 3-substituted 4-aroylisoquinolines have been prepared in good yields by treating N-tert-butyl-2-(1-alkynyl)benzaldimines with aryl halides in the presence of CO and a palladium catalyst. Synthetically the methodology provides a simple and convenient route to isoquinolines containing an aryl, alkyl, or vinylic group at C-3 and an aroyl group at C-4 of the isoquinoline ring. The reaction is believed to proceed via cyclization of the alkyne containing a proximate nucleophilic center promoted by an acylpalladium complex. |
# uncompyle6 version 2.9.10
# Python bytecode 2.7 (62211)
# Decompiled from: Python 3.6.0b2 (default, Oct 11 2016, 05:27:10)
# [GCC 6.2.0 20161005]
# Embedded file name: __init__.py
# Compiled at: 2012-05-08 15:43:06
pass |
Q:
Recurse for object if exists in JQ
I have the following structure:
{
"hits":
[
{
"_index": "main"
},
{
"_index": "main",
"accordions": [
{
"id": "1",
"accordionBody": "body1",
"accordionInnerButtonTexts": [
"button11",
"button12"
]
},
{
"id": "2",
"accordionBody": "body2",
"accordionInnerButtonTexts": [
"button21",
"button22"
]
}
]
}
]
}
I want to get to this structure:
{
"index": "main"
}
{
"index": "main",
"accordions":
[
{
"id": "1",
"accordionBody": "body1",
"accordionInnerButtonTexts": [
"button11",
"button12"
]
},
{
"id": "2",
"accordionBody": "body2",
"accordionInnerButtonTexts": [
"button21",
"button22"
]
}
]
}
Which means that I always want to include the _index-field as index, and I want to include the whole accordions-list IF IT EXISTS in the object. Here is my attempt:
.hits[] | {index: ._index, accordions: recurse(.accordions[]?)}
It does not produce what I want:
{
"index": "main",
"accordions": {
"_index": "main"
}
}
{
"index": "main",
"accordions": {
"_index": "main",
"accordions": [
{
"id": "1",
"accordionBody": "body1",
"accordionInnerButtonTexts": [
"button11",
"button12"
]
},
{
"id": "2",
"accordionBody": "body2",
"accordionInnerButtonTexts": [
"button21",
"button22"
]
}
]
}
}
{
"index": "main",
"accordions": {
"id": "1",
"accordionBody": "body1",
"accordionInnerButtonTexts": [
"button11",
"button12"
]
}
}
{
"index": "main",
"accordions": {
"id": "2",
"accordionBody": "body2",
"accordionInnerButtonTexts": [
"button21",
"button22"
]
}
}
It seems to create a list of all different permutations given by mixing the objects. This is not what I want. What is the correct jq command, and what is my mistake?
A:
The problem as stated does not require any recursion. Using your attempt as a model, one could in fact simply write:
.hits[]
| {index: ._index}
+ (if has("accordions") then {accordions} else {} end)
Or, with quite different semantics:
.hits[] | {index: ._index} + . | del(._index)
|
The Rub on Conjunctivitis (Pink Eye)
The Rub on Conjunctivitis (Pink Eye)
Conjunctivitis, or “pink eye” as it’s more commonly called, affects more than 3million Americans each year. While most commonly found in children ages 3-13, conjunctivitis can be contracted at any age. Itching, noticeable redness, and tearing in the affected eye are all symptoms, but conjunctivitis can be caused by several different factors.
In simple terms, pink eye is an irritation (or inflammation) of the conjunctiva – the thin, clear outer membrane that covers the whites of the eyes and the insides of the eyelids. Foreign bodies come into contact with the surface of the eye and this triggers inflammation in the conjunctiva, which causes the conjunctival blood vessels to dilate. This dilation of blood vessels is what causes the pink-red, bloodshot appearance of the eyes.
In each case of pink eye, it’s important to immediately remove contact lenses and wear only your glasses to lessen the risk of any possible complications. And though it sounds scary, conjunctivitis is typically easy to treat; and, with proper awareness and precautions, it can even be avoided. There are three primary types of conjunctivitis, and though there are some similarities, each type is very different from the other.
1. Allergic Conjunctivitis
This type of pink eye is caused by any number of different allergens making contact with the surface of the eyes. Depending upon the specific allergies, susceptible individuals could be at higher risk for allergic conjunctivitis either seasonally or year-round. For instance, those suffering from pollen allergies would be at a higher risk for pink eye during the season in which those plants are pollenating. While those suffering from dust, dander, or environmental allergies would be more susceptible to allergic pink eye year-round.
Allergic conjunctivitis is marked by itchy, burning, and watering in both eyes, never just one. Most allergies are multi-systemic, meaning the histamine releases associated with allergic reactions affect two or more of the body’s systems. For this reason, allergic conjunctivitis is often accompanied by a runny nose or sinus congestion. However, because allergies can’t be passed on from person to person, this type of pink eye isn’t contagious.
2. Bacterial Conjunctivitis
Though less common than the other two types, bacterial conjunctivitis can lead to infection and serious eye damage when left untreated. Bacteria are usually introduced to the eye from physical contact as opposed to contact from airborne bodies. For instance, bacteria could be present on a door handle or flat surface. After touching these surfaces and then touching or rubbing eyes, bacteria could be introduced to the conjunctiva and cause inflammation. Maintaining good hygiene and regular handwashing can help to limit infection and the colonization of harmful bacteria.
In addition to the typical redness associated with pink eye, bacterial conjunctivitis is marked by a thick, yellow or green discharge in the corner of the eye. In some cases, the discharge can be productive enough to cause the eyelids to become stuck together after sleeping or napping. Pink eye caused by bacteria can affect one or both eyes and is contagious, with bacteria usually being transmitted after direct contact with the infected eye, infected hands, or after handling instruments or objects that have touched the infected eye. Bacterial conjunctivitis can be a serious medical issue. Contact your optometrist immediately if you show any signs or symptoms of bacterial conjunctivitis.
3. Viral Conjunctivitis
The most common form of conjunctivitis is also, unfortunately, the most contagious. For this reason, an outbreak of viral conjunctivitis, say, in your child’s 5th grade class will spread like wildfire. Viruses are expert travelers, and in most cases, are transmitted through the air via sneezing or coughing from an infected individual. As with any viral infection, those with viral conjunctivitis should limit their exposure to non-infected people while experiencing symptoms.
Although it can affect both eyes, symptoms of viral conjunctivitis typically present themselves in just one eye. As with any virus, this type of pink eye will typically run its course and symptoms will subside with no medical treatment required. In addition to rest, applying a cold, damp washcloth to the eyes several times daily can help relived the itchiness and irritation associated with viral conjunctivitis. However, be sure not to share your washcloth, so as not to infect anyone else with viral pink eye.
Though each of the primary types of conjunctivitis are distinct from each other, it can often be difficult to determine which type of pink eye you may have by symptoms alone. Any time you develop red, irritated eyes, you should call an optometrist immediately to schedule an eye exam.
In the downtown Naples area, call Naples Optical Center at 239.263.6677. In the Pine Ridge/Vineyards area, call Naples Optical Too at 239.353.8794. In the North Naples/Immokalee area, call our sister store, Spectacles of Naples (located in Mercato) at 239.566.9307.
In addition to our incredible, independent Doctors of Optometry, our licensed opticians are ready to redefine your view with our hand-picked selection of designer frames and the latest in digital lens technology.
For more information on helping protect yourself from conjunctivitis, check out the CDC’s latest infographic by clicking here. |
Chino college boy physicals
His ass was nice and tight and I can feel pressure of how tight his ass really is. I then placed my fingers underneath the waistband of his undies feeling the base of his penis. Brooke hogan hard nipples Big cocks masturbating adult carmen film star Ipicture ru nudist girls Hot naked girls butts. Enjoy this hardcore gay site now. I was gettin super hard and horny and I had Zakk suck my cock for a while so I can test his throat muscles. It has come to our attention that the student that works part-time in our clinic doing some cleaning work, has been doing a bit more then just cleaning these days. I did the normal exam and Zakk was completely healthy.
College Boy Physicals - Chino
About the Doctors
I had him sit on the exam table as I went through his vital signs. I was out of the office and it was late. What I like about Mick is how his bulge looked inside those tighty whitie underwear and I can tell he was getting a semi-hard on which is common for boys his age. I was driving Rex crazy and I know he was dying to cum as I kept him on the edge of his climax. She is committed to providing compassionate, personalized medical care and well-being for all her patients. I then had him stand and had him remove his undies and check for hernias. Chino pushes Ashyton and makes his sit on the exam table.
Chino from College Boy Physicals at JustUsBoys - Gallery
Hot naked college girls anal. I left the exam room leaving the two boys alone so they decided to stay and jerk off. Jason then took the bottle away from him telling him not to sniff anymore of the aroma that it can be dangerous. MORE I left the exam room leaving the two boys alone so they decided to stay and jerk off. Mikey 2 - Shoot - The boys were very hesitant about undressing and getting nude in front of each other.
Martinez attended Northern College of Iowa for his undergraduate studies and earned his medical degree from the University of Iowa. Physical medical gay sex first time The next thing that we had to do was. If you are experiencing problems, this player can be turned off and replaced with Flowplayer. I then had him hope down on the exam table and had him bend over as I took his temperature with the anal thermometer. Provided you are under age of 18, or this content is insulting to you, or is it is illegal in your community to observe this kind of internet materials, please leave now. |
Conversations (Woman's Hour album)
Conversations is the debut album by London-based group Woman's Hour. This album is mixture of indie pop, alternative and electronic pop. Adding swooning synths, clipped rhythms, and muted guitars, "Conversations" is new wave with a twist of some nocturnal R&B and soft disco.
Track listing
"Unbroken Sequence" (3:33)
"Conversations" (3:20)
"To the End" (4:27)
"Darkest Place" (4:06)
"In Stillness We Remain" (3:38)
"Our Love Has No Rhythm" (4:27)
"Her Ghost" (3:13)
"Two Sides of You" (3:34)
"Devotion" (4:23)
"Reflections" (3:46)
"The Day That Needs Defending" (3:32)
References
Category:2014 albums |
Diverse activation and differentiation of multiple B-cell subsets in patients with atopic dermatitis but not in patients with psoriasis.
Atopic dermatitis (AD) and psoriasis pathogeneses involve skin barrier impairment and immune dysregulation; however, the contribution of B-cell imbalances to these diseases has not yet been determined. We sought to quantify B-cell populations and antibody-secreting cells in the blood of patients with AD, patients with psoriasis, and control subjects. We studied 34 adults with moderate-to-severe AD (mean SCORAD score, 65), 24 patients with psoriasis (mean Psoriasis Area and Severity Index score, 16), and 27 healthy subjects using an 11-color flow cytometric antibody panel. IgD/CD27 and CD24/CD38 core gating systems were used to determine frequencies of plasmablasts and naive, memory, transitional, and activated B cells. We measured increased CD19(+)CD20(+) B-cell counts in the skin and blood of patients with AD (P < .01). Significantly higher frequencies of chronically activated CD27(+) memory and nonswitched memory B cells were observed in patients with AD (P < .05), with lower values of double-negative populations (4% for patients with AD vs. 7% for patients with psoriasis [P = .001] and 6% for control subjects [P = .02]). CD23 expression was highest in patients with AD and correlated with IgE levels (P < .01) and disease severity (r = 0.6, P = .0002). Plasmablast frequencies and IgE expression were highest in all memory subsets of patients with AD (P < .01). Finally, CD19(+)CD24(++)CD38(++) transitional and CD19(+)CD24(-)CD38(-) new memory B-cell counts were higher in patients with AD versus those in patients with psoriasis (2.8% vs. 1.4% [P = .001] and 9.2% vs. 5.7% [P = .02], respectively). AD is accompanied by systemic expansion of transitional and chronically activated CD27(+) memory, plasmablast, and IgE-expressing memory subsets. These data create a critical basis for the future understanding of this debilitating skin disease. |