Datasets:

chemNLP

/

ncbi-text

like 0

Follow

chemNLP 5

Mycotoxins are fungal metabolites known to be harmful to human and animal health. To date, there are many reports of disorders caused by mycotoxins in the digestive, urinary, immune and reproduction systems, and the importance of oxidative stress through lipid peroxidation has been stressed as a trigger of mycotoxin-induced toxicity in these systems. Recently, Doi and Uetsuka reviewed the molecular mechanisms of neurotoxicity induced in rodent models by four kinds of mycotoxins, T-2 toxin, macrocyclic trichothecenes, fumonisin B1 (FB1) and ochratoxin A (OTA), from the viewpoint of oxidative stress-associated pathways. The FAO and WHO have highlighted the need for toxicological evaluation of mycotoxins through dermal exposure. This is important because the skin is the major interface between the body and surrounding environment, and there is a chance that the skin of grain handling workers as well as of domestic animals is exposed to mycotoxins. Concerning this point, it has been shown that such mycotoxins as aflatoxin B1 (AFB1) and T-2 toxin readily penetrate through human and animal skin and cause systemic toxic effects in their respective organs and also in the brain. Recently, Boonen examined the transdermal kinetics of seven kinds of mycotoxins, AFB1, OTA, FB1, citrinin (CTN), zearalenone (ZEN) and T-2 toxin, using human skin in an Franz diffusion cell setup, and they reported that except for FB1, all mycotoxins penetrate through the skin and that OTA shows the highest penetration. However, there have been few reports of toxic effects of mycotoxins on human skin. Except for skin lesions induced by T-2 toxin, only limited information on mycotoxin-induced dermal toxicity has been available even in animal models. However, during the last decade, several researchers have added more information on dermal toxicity and/or tumorigenesis induced in mice by topical application of AFB1, patulin (PAT), CTN and OTA. This paper reviews the molecular mechanisms of dermal toxicity and tumorigenesis experimentally induced in mice or rats by T-2 toxin, CTN, PAT, AFB1 and OTA especially from the viewpoint of oxidative stress-related pathways. T-2 toxin is a cytotoxic secondary fungal metabolite that belongs to the trichothecene mycotoxin family. It is produced by various species of ( and ), which can infect corn, wheat, barley and rice crops in the field or during storage. T-2 toxin is a well-known inhibitor of protein synthesis through its high binding affinity to peptidyl transferase. Subsequent inhibition of the peptidyl transferase reaction can trigger a ribotoxic stress response that activates c-Jun N-terminal kinase (JNK)/p38 mitogen-activated protein kinases (MAPKs). In addition, T-2 toxin inhibits the synthesis of DNA and RNA probably secondary to inhibition of protein synthesis, interferes with the metabolism of membrane phospholipids and increases liver lipid peroxides (LPOs). Moreover, oxidative stress is thought to be the main factor underlying the T-2 toxin-induced toxicity. As mentioned above, it has been reported that topical exposure to T-2 toxin could induce histopathological changes in the skin of several animal species, and Yarom suggested that T-2 toxin-induced epidermal degeneration might be secondary to ischemia brought about by microvessel degeneration in the dermis. In 1999, Albarenque started a series of studies to clarify the mechanisms of T-2 toxin-induced dermal toxicity using Wistar-derived hypotrichotic WBN/- rats focusing on the expression of apoptosis-related oncogenes and cytokines. In their first study, they clarified that after topical application of T-2 toxin, depression of proliferating activity starts at 3 h and that apoptosis of basal cells starts soon after and becomes prominent at 12 h in the epidermis, while capillary and small vessel endothelial degeneration develops at 6 h in the dermis; this suggests the direct toxic effect of T-2 toxin on the epidermis. This is the first report of mycotoxin-induced apoptosis in the skin. Thereafter, using the same experimental system, Albarenque . showed that the expression of oncogenes (c-jun and c-fos) as well as cytokines (TNF-α and IL-1β) mRNAs is significantly elevated prior to the peak time of apoptosis in keratinocytes after topical exposure to T-2 toxin. They also reported that the level of TGF-β1 mRNA of the whole skin tissue shows a slight elevation from 6 to 12 h and reaches a significantly higher level at 24 h and that the increase in signals of TGF-β1 mRNA detected by the hybridization method starts at 3 h in the epidermis and progresses thereafter both in the epidermis and dermis. Later, using rat keratinocyte primary cultures, they also showed that c-fos and c-jun and TNF-α and IL-1β play an important role in the development of T-2 toxin-induced apoptosis in keratinocytes. C-fos is a type of immediate-early response gene, and its activation with other factors such as c-jun occurs as an early response to cell injury, resulting in an increase in the sensitivity of keratinocytes to apoptosis, and the expression of c-fos is said to precede the initiation of apoptosis or to be concomitant with apoptosis in many systems. Keratinocytes can release pro-inflammatory cytokines such as TNF-α and IL-1β when they have been injured. There are many reports suggesting the possible role of TNF-α as an apoptosis-inducer in different kinds of cells including keratinocytes. TNF-α can interact with its receptors, and signals from the receptors are related to the induction of some genes and proteins such as c-myc, c-fos and caspase, resulting in the induction of apoptosis. TGF-β1 is a multifunctional cytokine and is known as a negative growth regulator of normal epithelial cells, and human keratinocytes can undergo apoptosis after initial growth arrest under the effect of TGF-β1. TGF-β1 may have a relation to the early depression of epidermal basal cell proliferating activity in rat skin following topical application of T-2 toxin. As mentioned above, trichothecenes mycotoxins trigger a ribotoxic stress response that activates JNK/p38, and JNK/p38 stimulates immediate-early genes, c-fos and c-jun, both of which encode components of transcription factor activator protein-1 (AP-1). In this regard, the c-fos gene plays an important role in the early phase of T-2 toxin-induced apoptosis in the lymphoid and hematopoietic tissues in mice and rats, and T-2 toxin increases expression of both oxidative stress-related genes and apoptosis-related genes (c-fos and c-jun), resulting in the induction of hepatocyte apoptosis in mice. Moreover, T-2 toxin is also reported to cause oxidative stress and subsequent activation of MAPK pathways in pregnant and fetal rat tissues, resulting in the induction of apoptosis in these tissues. To date, there have been no reports of T-2 toxin-induced skin tumorigenesis. In this regard, Lambert . reported that deoxynivalenol, one of the trichothecene mycotoxins, induces a mild diffuse squamous hyperplasia in the epidermis but shows no potential for initiation or promotion when topically applied as part of a two-stage skin tumorigenesis treatment regimen in Sencar mice. CTN is a secondary metabolite of several fungal species belonging to the genera and . It contaminates various commodities of plant origin, cereals in particular, and is usually found together with another nephrotoxic mycotoxin, OTA. CTN triggers nephropathy and hepatotoxicity as well as renal adenoma formation in various cellular and animal models. To date, the mechanisms of CTN-induced toxicity have not fully been understood, although several studies have shown the involvement of reactive oxygen species (ROS) in CTN-mediated toxicity characterized by apoptosis in certain models. Kumar were the first to investigate molecular mechanisms of CTN-induced dermal toxicity from the viewpoints of oxidative stress, DNA damage, cell cycle arrest, and apoptosis in mouse skin. They showed that CTN under condition has the ability to cause oxidative stress, which is indicated by significant depletion of glutathione (GSH) as well as inhibition of glutathione peroxidase (GPx) and catalase activities, along with an increase in LPOs and protein carbonyl content, and subsequent ROS-mediated DNA damage as evaluated by the comet assay in mouse skin upon topical exposure to CTN (25–100 μg/mouse for 12–72 h), as reported in the above-mentioned studies. ROS-mediated DNA damage in mouse skin leads to enhanced expression of p53 and p21 that causes cell cycle arrest at the G0/G1 and G2/M phases as reported by Abbas and Dutta in models, to enhanced Bax/Bcl2 ratio and cytochrome c release, and to activated caspase 9 and 3 but not caspase 8, which result in apoptosis through the mitochondria-mediated pathway. The p53 protein plays a key role in the DNA damage response pathway by transmitting a variety of stress signals associated with antiproliferative cellular responses that lead to apoptosis, and the lack of enhancement in caspase 8 activity indicates that the extrinsic or death receptor pathway of apoptosis is not activated by CTN in mouse skin. Moreover, Kumar clarified that topical treatment of bio-antioxidants such as butylated hydroxyanisole, quercetin and α-tocopherol abolishes CTN-induced oxidative stress, cell cycle arrest and apoptosis, confirming the direct involvement of ROS in CTN-induced toxicological manifestations in mouse skin. To summarize, CTN under conditions has the ability to cause oxidative stress and ROS-mediated DNA damage in mouse skin upon topical exposure, leading to enhanced expression of p53, p21 and BAX proteins that causes cell cycle arrest at the G0/G1 and G2/M phases and apoptosis in mouse keratinocytes through the mitochondria-mediated pathway. To date, there have been no reports of CTN-induced skin tumorigenesis. However, as mentioned above, CTN treatment causes prominent DNA damage, suggesting its genotoxic and mutagenic potential in the skin. Moreover, although the cell cycle arrest by CTN may permit DNA repair, if it is faulty, it may allow proliferation of mutated cells, which is generally observed in cases of tumorigenesis. PAT is a toxic chemical concomitantly produced by several species of mold, especially within and It is the most common mycotoxin found in apples and apple-derived products such as juice, cider, compotes and other food intended for young children. Exposure to this mycotoxin is associated with immunological, neurological and gastrointestinal outcome, and PAT has been classified as a group-3 carcinogen. To date, studies on the mechanisms of PAT-induced toxicity have been done using various cell lines, focusing on the immunotoxic and genotoxic effects of the toxin, and it has been reported that PAT has the potential for inducing formation of ROS, DNA damage, rapid activation of extracellular signal-regulated kinase (ERK)1/2 or of p38 and JNK and effects on cell cycle distribution responsible for overexpression of a functional p53 protein. Saxena were the first to study the mechanisms of PAT-induced dermal toxicity in mice, and they reported that dermal exposure of PAT in mice for 4 h results in a dose-dependent (40–160 μg/animal) and time-dependent (up to 6 h) enhancement of ornithine decarboxylase (ODC) activity and increase in biosynthesis of polyamines. Polyamines, cell proliferation, and apoptosis are tightly connected in a quite complex interplay, and polyamine levels within cells are regulated and modulated by the key enzymes that control polyamine biosynthesis, particularly ODC. Elevated ODC activity and increased biosynthesis of polyamines serve as a novel stimulus to induce the ataxia-telangiectasia mutated (ATM)-DNA damage signaling pathway and cell death in normal keratinocytes. Wei revealed the correlation of elevated ODC activity with apoptotic cell death in normal keratinocytes via the induced generation of reactive aldehydes and HO followed by subsequent activation of the ATM-DNA damage response pathway. Saxena also reported that topical application of PAT (160 μg/mouse) for 24–72 h causes DNA damage depicted by alkaline comet assay and significant G1- and S-phase arrest along with induction of apoptosis in skin cells. Moreover, they showed that PAT leads to overexpression of p21, Bax and p53 proteins and that PAT-induced apoptosis is mediated through the mitochondrial intrinsic pathway as revealed through the release of cytochrome c protein in cytosol, leading to enhancement of caspase 3 activity in mouse skin cells. Thus, the PAT (160 μg/mouse)-induced cascade of events in mouse skin is considered to occur as follows. Induction of ODC activity generates polyamines and HO, which cause DNA damage, resulting in enhancement of p53 expression and subsequent cell cycle arrest at the G0/G1 and S phases through enhanced p21 expression along with induction of apoptosis through enhanced BAX expression and caspase 3 activity. After that, Saxena also reported that a single topical application of PAT (400 nmol/mouse) resulted in enhanced cell proliferation as evaluated by H-thymidine uptake along with increased generation of ROS and activation of ERK, p38 and JNK MAPKs, in mouse skin. PAT exposure also results in activation of downstream target proteins, c-fos, c-jun and NF-κB transcription factors. They thought that the observed early activation of JNK and NF-κB appears to be a direct response to PAT, while later activation of ERK, p38, c-jun, c-fos and NF-κB may be due to enhanced generation of ROS as reported by Benhar . This suggests that PAT-induced ROS acts as second messengers in intracellular signaling cascades and may mediate cell proliferation by activating ERK and p38 along with activation of downstream targets, c-jun, c-fos and NF-κB. Moreover, Saxena reported that specific inhibitors of MAPK, especially p38 and JNK, pathways are able to significantly suppress H-thymidine uptake by keratinocytes in mouse skin following a single topical application of PAT (400 nmol/mouse), suggesting that p38 and JNK pathways may be involved in PAT-induced cell proliferation. In addition, as mentioned above, PAT enhances the activity of ODC in mouse skin following a single application. It is well known that ODC plays an important role in the regulation of cell proliferation, and it is stressed that ODC-related hyperproliferation and altered differentiation in skin keratinocytes have been linked with deregulation of MAPK signaling pathways. Regarding PAT-related skin tumorigenesis, Saxena have shown that a single topical application of PAT (400 nmol/mouse) followed by twice weekly application of 12-tetradecanoyl phorbol myristate acetate (TPA) results in tumor formation (squamouse cell carcinoma) after 14 weeks. In this PAT/TPA group, a significant increase in LPO activity and significant decreases in free sulfhydryls, catalase, superoxide dismutase (SOD) and glutathione reductase (GR) activities are observed. The DNA damaging ability of PAT in skin cells is in agreement with other findings in which PAT was shown to cause oxidative DNA damage in a few mammalian cells. On the other hand, Saxena described that no tumors were observed when PAT was used either as a complete carcinogen (80 nmol) or as a tumor promoter (20 nmol) (single dose of 7,12-dimethylbenz[a]anthracene (DMBA) followed by twice weekly application of PAT) for 25 weeks. However, it may be possible that prolonged exposure to PAT at a high dose may induce tumor promotion and cause further toxicological manifestations in the skin, since earlier reports have revealed that long-term exposure to PAT is tumorigenic in Wistar rats, leading to sarcoma at the injection site on subcutaneous administration, and causes benign tumors of the forestomach and glandular stomach in Sprague-Dawley rats after gavage treatment. Aflatoxins are secondary metabolites of the molds and . AFB1 is by far the most potent teratogen, mutagen and hepatocarcinogen of all aflatoxins. The carcinogenic potential of AFB1 following oral administration has been shown in several animal species, while limited knowledge is available regarding the epidermal carcinogenesis of AFB1, and therefore, the WHO has clearly highlighted the need for toxicological evaluation of aflatoxins through dermal exposure. and studies have shown that glutathione-S-transferase (GST) plays a crucial role in modulation of AFB1-DNA adduct formation, and AFB1 is said to mediate oxidative damage through generation of ROS including the hydroxyl ion. In addition, studies have also shown that AFB1 can stimulate the release of free radicals, which leads to chromosomal damage. Rastogi were the first to study the skin tumorigenic potential of AFB1 using a two-stage mouse skin tumor protocol. In their study, skin topical application of AFB1 (80 nmol) as a tumor initiator, followed by twice weekly application of TPA (4 nmol) for up to 24 weeks, resulted in tumor formation (squamous cell carcinoma) after 13 weeks, but no skin tumorigenic potential was observed when AFB1 was used either as a complete carcinogen (16 nmol) or as a tumor promoter (4 nmol). They also showed that weekly topical application of AFB1 causes significant induction of cutaneous CYP1A monooxygenases without any effect on hepatic levels, while GST activity, which detoxifies a number of LPO products, is induced more in the liver than skin; they further showed that topical application of AFB1 also results in increased hepatic and cutaneous LPO with concomitant depletion of GSH content, indicating the induction of oxidative damage. Later, Rastogi . reported the protective effect of an alcoholic extract of the leaves of on AFB1- and AFB1/TPA-induced skin tumorigenicity using the same experimental system used in their previous study. is a well-known medical plant widely distributed throughout India, and the aqueous and alcoholic extracts from the leaves of this plant have been shown to possess antioxidant, anticarcinogenic, hepatoprotective, and radioprotective properties. The skin of AFB1/TPA-treated animals demonstrated papillomatous growth comprising of proliferation of squamous cells, hyperkeratinization and keratin pearl formation while the skin of animals topically pretreated with leaf extract showed small papillomatous growth lacking pearl formation. In addition, pretreatment with leaf extract significantly decreased the number of skin tumors induced by AFB1/TPA. The expression of cutaneous γ-glutamyl transferase (GGT) and glutathione-S-transferase-P (GST-P) protein increased after AFB1 or AFB1/TPA treatment, but pretreatment with leaf extract led to a reduction in the expression of these proteins. GGT is considered to be a late marker of tumor progression, and its overexpression in hepatic and skin tumors has been well documented; GST-P expression is also said to increase in chemically induced hepatic tumors. Pretreatment with leaf extract led to the reduction of cutaneous phase I enzymes that had been elevated by AFB1 or AFB1/TPA treatment and to the elevation of cutaneous phase II enzymes, suggesting the possibility of impairment in reactive metabolites formation resulting in a reduction of skin carcinogenicity. Moreover, pretreatment with leaf extract increased the cutaneous GSH level and reduced cutaneous LPO levels that had been elevated by AFB1 or AFB1/TPA treatment. Enhanced levels of GSH resulting from treatment with leaf extract may reduce the rate of LPO as well as decrease the expression of heat shock protein (HSP) 70 protein, which has been reported to be altered during carcinogenesis. Since HSP70 is also involved in oxidative stress, it is quite likely that this protein may have a role in cancer, which is also associated with oxidative stress and inflammation. Thus, Rastogi concluded that leaf extract of provides protection against AFB1/TPA-induced skin carcinogenesis by acting as an antioxidant, by modulating phase I and II enzymes and/or by exhibiting antiproliferative activity. OTA is a fungal metabolite produced by and . OTA is found in a variety of plant food products such as cereals. Because of its long half-life, it accumulates in the food chain and is frequently detected in the human plasma at nanomolar concentrations. The main target organ for OTA toxicity is the kidney, and OTA also has immunotoxic, teratogenic, genotoxic and neurotoxic effects. In addition, there is sufficient evidence in experimental animals for the carcinogenicity of OTA, although there is still insufficient evidence in humans. Kumar were the first to investigate the OTA-induced toxicity and tumorigenesis in mouse skin. In their study, after a single topical application of OTA (20–80 μg/mouse for 12–72 h), significant DNA damage as assessed by alkaline comet assay along with an elevated γ-H2AX level, a sensitive marker of DNA damage, was detected in mouse skin. In addition, the level of nuclear factor erythroid 2-related factor (Nrf2), the master regulator for maintaining the balance of ROS, in the nucleus decreased after 24 h of OTA exposure, indicating an inhibitory effect of OTA on Nrf2 signaling. OTA-induced Nrf2 suppression may cause significant depletion of GSH content as well as inhibition of the activities of catalase, GST and GR along with enhanced production of LPOs and protein carbonyls dose- and time-dependently, and this indicates increased generation of ROS and subsequently enhanced oxidative stress in mouse skin. Kumar . also reported that OTA activates ERK1/2 in the early phase and then p38 and JNK in the later phase in mouse skin after topical exposure, and they suggested that the early activation of ERK1/2 is the result of a direct response to OTA but that later activation of p38 and JNK may be the result of OTA-induced ROS, which acts as secondary messengers in the intracellular signaling cascade in mouse skin. Moreover, they reported that exposure to OTA results in a significant increase in the proportion of cells in the G0/G1 phase with a concomitant decrease in S phase cells, followed by an increase in apoptosis through elevated expression of p53 and p21, enhancement of the Bax/Bcl-2 ratio and cytochrome c level, and increased activities of caspase 9 and 3 in mouse skin. On the other hand, Kumar . reported that a single topical application of OTA (100 nmol/mouse) causes significant enhancement of short-term markers of skin tumor promotion such as ODC activity, DNA synthesis and hyperplasia as well as expression of cyclin-G1 and cyclooxygenase-2 (COX-2) in mouse skin. The enhancement in ODC activity has been reported to occur in response to growth factors as well as promoters such as TPA, and the overexpression of cyclin-D1 and COX-2 proteins is said to play a role in cell proliferation and tumor promotion of various tissues including skin. In a two-stage mouse skin tumorigenesis protocol, Kumar reported that a a single topical application of OTA (80 μg/mouse) followed by twice weekly application of TPA for 24 weeks leads to tumor formation (squamous carcinoma with proliferation of epidermal layers). They suggested that some cells damaged by a single topical application of OTA may pass though a p53-mediated cell cycle checkpoint by faulty repair, which may introduce mutations in OTA-induced animals, and subsequent application of TPA, a tumor promoter, fixes the mutations and confers a selective advantage in those cells, which leads to tumorigenesis. They concluded that OTA has skin tumor-initiating properties under conditions, which may be related to oxidative stress, MAPK signaling and DNA damage in mouse skin. Kumar also reported that a single topical application of DMBA (120 nmol/mouse) followed by twice weekly application of OTA (50 nmol/mouse) for 24 weeks leads to tumor formation in mouse skin (squamous carcinoma with proliferation of epidermal layers), indicating the skin tumor promoting activity of OTA. Moreover, based on the results of study using primary murine keratinocytes exposed to a noncytotoxic dose of OTA (5.0 μM), they proposed that OTA-induced cell proliferation seems to be responsible for skin tumor promotion by activating epidermal growth factor receptor (EGFR), MAPKs and Akt signaling involving NF-κB, AP-1 transcription factors, cyclin-D1 and COX-2 genes. EGFR signaling leads to enhancement of phosphorylation of MAPKs as well as the activity of AP-1 and transcription factors and utilizes MAPK pathways to mediate its growth and stimulative effects, and MAPKs are said to play a crucial role in skin tumorigenesis. EGFR also acts through the Akt pathway, which plays a role in tumor promotion and progression. The transcription factor AP-1 mediates gene regulation in response to a variety of extracellular stimuli including growth factors, cytokines, oncogenes, tumor promoters and chemical carcinogens, and upon activation, both transcription factors NF-κB and AP-1 translocate to the nucleus, where they bind to promoter regions of various target genes including cyclin-D1 and COX-2. This paper reviewed the mechanisms of dermal toxicity and/or tumorigenesis induced in rodents by T-2 toxin, CTN, PAT, AFB1 and OTA. The T-2 toxin-induced cascade of events in rat skin is considered as follows. T-2 toxin brings about oxidative stress, which induces a ribotoxic stress response and subsequent activation of MAPK pathways. Then, this stimulates expression of c-fos and c-jun, resulting in keratinocyte apoptosis. In addition, TNF-α and IL-1β, which are released from keratinocytes primarily affected by ribotoxic stress, are also involved in T-2 toxin-induced keratinocyte apoptosis. CTN has the ability to cause oxidative stress and ROS-mediated DNA damage in mouse skin upon topical exposure, leading to enhanced expression of p53, p21 and Bax proteins that causes cell cycle arrest at the G0/G1 as well as G2/M phases and apoptosis in mouse keratinocytes through the mitochondria-mediated pathway. PAT (160 μg) has a potential to induce DNA damage leading to p53-mediated cell cycle arrest along with apoptosis through the mitochondria-mediated pathway in mouse skin that may also be correlated with enhanced polyamine production as shown by induction of ODC activity. On the other hand, topical application of PAT (400 nmol) to mice results in cell proliferation, which is mediated by ROS-induced MAPKs signaling pathway leading to transcriptional activation of downstream target proteins c-fos, c-jun and transcription factor NFκB, and this is related to the skin tumor-initiating ability of PAT. AFB1 acts as a skin tumor initiator through reactive metabolite formation, LPO-mediated oxidative stress, and GST-mediated AFB1-DNA adduct formation. AFB1 may also have skin tumorigenic potential as a promoter and/or a complete carcinogen in mouse skin after long-term and higher-dose application. OTA has skin tumor-initiating properties that may be related to oxidative stress, MAPKs signaling and DNA damage in mouse skin. OTA also has skin tumor-promoting properties that involve EGFR-mediated MAPKs and Akt pathways along with NF-κB and AP-1 transcription factors. Cyclin D1 and COX-2 are the target genes responsible for the tumor-promoting activity of OTA.

sub sup #text sup #text Pigs have an epitheliochorial and diffuse type of placenta (). Histologically, the surface of the allantochorion becomes complexly folded, producing ridges that fit into corresponding grooves or crypts in the endometrium (). In the interhemal area, the maternal vessels and fetal vessels are situated just below the basement membranes of the endometrium and trophectoderm without the destruction of endometrial tissue (). However, the endometrium and trophectoderm are thin and deeply indented by the blood vessels as pregnancy proceeds, resulting in shorter diffusion distances across the epitheliochorial placenta. The interhemal distance can be as little as 2 μm. The depths between the chorionic folds, the so-called areolus, are lined by tall, columnar trophoblasts (areolar trophectoderm) that are actively phagocytic (). Uteroferrin, an iron-containing glycoprotein, is released from the endometrial glands to the lumen, taken up by the areolar trophectoderm, and then transferred to the fetus, as an iron source. Many endometrial glands are observed under the endometrium (). Dogs have an endotheliochorial and zonary type of placenta (). Histologically, the placenta of dogs is composed of the labyrinth zone, the junctional zone and the glandular zone (). The labyrinth zone is composed of trophoblastic lamellae, in which cytotrophoblasts and syncytiotrophoblasts cover the maternal vessels (). The maternal vessels are surrounded by a noncellular layer, which is positive for periodic acid-Schiff (PAS) stain and Alcian blue stain. The fetal vessels deeply indent the trophoblasts. The junctional zone is an area of transition between the labyrinth zone and gland zone (). The trophoblasts, which show tall columnar cells in monolayers with microvilli on the free surface, invade into the endometrial gland cavity. Particularly, the deep part of the junctional zone is called the sponge zone (). The glandular zone is composed of the remnants of endometrial glands. These glands become distended by retained secreted function as the result of obstruction of their mouths by penetrating trophoblasts (). Marginal hemophagous zones filled with maternal blood develop at both edges of the placenta or in the middle of the placenta (). They are lined by high columnar trophectoderm showing active phagocytosis and digestion of erythrocytes, and are considered to have a relationship with placental iron transport. Rats and mice have a hemotrichorial and discoid type of placenta (). Histologically, the placenta of rats and mice is composed of the labyrinth zone, the basal zone, the decidua and the metrial glands (). In the labyrinth zone, there are three layers of trophoblasts, separating the maternal blood spaces from the fetal blood vessels (). The outer trophectoderm, which comes into direct contact with the maternal blood, is referred to as cytotrophoblasts with a microvillous surface. Under this trophectoderm, there are two layers of syncytiotrophoblasts. The basal zone is comprised of three types of differentiated cells: spongiotrophoblasts, trophoblastic giant cells and glycogen cells (). The spongiotrophoblasts are present immediately above the trophoblastic giant cell layer located at the materno-fetal placental interface. The glycogen cells form multiple small cell masses and develop into glycogen cell islands in midgestation, and then most of them disappear before parturition. The decidua is comprised of the mesometrial decidual cells ultimately, and plays essential roles in the development of the vascularized decidual-placental interface. The metrial gland is located in the mesometrial triangle of the pregnant uterus from early gestation and is fully developed in midgestation, leading to regression before parturition. It is composed of decidualized endometrial stromal cells, uterine natural killer cells, spinal-shaped arteries, trophoblasts originating from glycogen cells, and fibroblasts (). The yolk sac is composed of epithelial cells and mesodermal cells () and is divided into visceral and parietal parts. Because the parietal yolk sac ruptures in midgestation, the inside of the visceral yolk sac becomes exposed to the intrauterine cavity and is called a reversed yolk sac placenta, which functions throughout pregnancy. Rabbits have a hemodichorial and bidiscoid type of placenta (). Histologically, the placenta of rabbits is composed of the labyrinth zone, the junctional zone, the decidua·zone of necrosis, the decidua·zone of separation, and the mesometrium (). In the labyrinth zone, there are two layers of trophoblasts, an outer and inner layer separating the maternal blood spaces from the fetal blood vessels (). The outer trophectoderm, which comes into direct contact with the maternal blood, is comprised of the syncytiotrophoblasts, which are joined to the underlying cytotrophoblast layer by adhesion junctions. The inner trophectoderm is one layer of cytotrophoblasts overlying fetal blood vessels. The junctional zone is composed of glycogen cells containing PAS-positive substances (). These cells are transiently detected in midgestation, and disappear before parturition. The decidua originates from stromal cells of the mesometrial endometrium and is divided into the zone of necrosis and the zone of separation in midgestation. The zone of necrosis develops with dilated blood vessels as pregnancy advances. This zone is detected under the junctional zone and is composed of necrotic tissue. The zone of separation becomes thinner without necrosis as pregnancy advances (). The structure and functions of the yolk sac placenta are the same as those of rats and mice (). Cynomolgus monkeys have a hemomonochorial and bidiscoid type of placenta (). Histologically, the placenta of cynomolgus monkeys is composed of the placental villi, the chorionic plate, the basal plate and the decidua (). The placental villi protrude into the intervillous space and are bathed directly in maternal blood. The anchoring villi are peripheral ones that are connected to the basal zone. The placental villous surface is composed of an outer continuous layer of syncytiotrophoblasts in contact with maternal blood and an inner discontinuous layer of cytotrophoblasts (). The stroma of the placental villi is composed of fetal vessels and mesenchyme. The chorionic plate is populated with mesenchymal cells within a fibrous connective tissue, and represents the cover of the intervillous space. Tree-like arranged placental villi arise from the chorionic plate (). The basal plate is the bottom of the intervillous space and the junction of the endometrium with fetal tissues (). The basal plate is composed of extravillous cytotrophoblasts, endometrial stromal cells, decidual cells, etc. The placenta of cynomolgus monkeys is very similar to the human placenta. The fully formed placenta plays a major role in maintenance of nutrition for the fetus and in the secretory and essential regulatory functions for maintenance of pregnancy during the fetal period. As described in this brief review of the anatomical placentas in some experimental animals, the composition of intervening cells in the interhemal areas is different between animal species. Molecules cross the placenta either by diffusion or some form of active or facilitated transport. In the case of diffusion, the ability for molecules to cross the placenta in either direction is strongly influenced by the interhemal distance or the thickness of the cellular barrier between maternal and fetal blood. A small interhemal distance generally will increase the rate at which molecules can transfer between maternal and fetal blood, either by diffusion or active transport. Thus, the number of cell layers separating the maternal from the fetal blood is considered to be important in modifying the transfer of nutrients and forming the materno-fetal barrier. Actually, fatty acids and keto acids are readily transferred from dams to fetuses in the hemochorial placenta of rodents, rabbits and primates, whereas their uptake by ruminants, pigs and horses is very low. In addition, the pig is not suitable as an informative model for the study of antibody therapeutics in embryo-fetal toxicity studies, since the pig placenta is impermeable to the passage of macromolecules such as immunoglobulins. Also, it is known that there are at least three different mechanisms for iron transport, according to the structure of the maternal-fetal interface (hemochorial, penetration; endotheliochorial, phagocytosis; epitheliochorial, secretion). On the other hand, it is known that there are regions of the pig placenta where the six cell layers of the maternofetal barrier become sufficiently thinned to equal the minimal interhemal distance of the three cell layers in a human placenta, although the mean interhemal distance in the pig placenta is greater than the mean in the human placenta . There does not appear to be any difficulty in allowing for the passage of substances based simply on the number of layers separating the different blood supplies, even though there may be differences in transit times. In addition, the disadvantage of the greater difficulty in passage of materials between organisms is partially overcome by a variety of mechanisms. Therefore, it has been reported that the interspecies differences in the type of placenta do not play a dominant role in the placental transfer of most drugs, which is determined largely by placental blood flow. At any rate, it should be considered that the histological structure separating the maternal blood from the fetal blood modifies the transfer of nutrients, and that the placental structure is one of the important factors for its permeability between different animal species. In conclusion, the chorioallantoic placenta shows morphological diversity in experimental animals. In reproductive and developmental toxicity studies, careful attention should be paid to the histological structure of the interhemal area when extrapolating information concerning placental transfer characteristics to different animal species.

The standard amino acids are of the L-form, but their enantiomers, D-amino acids, are found in some proteins, such as peptidoglycan cell walls of bacteria. It has been reported that D-amino acids accumulated in different tissues, which might represent different physiological conditions. For example, accumulation of D-aspartate and D-hydroxyproline in dentin, tooth enamel and the crystalline lens can be used as aging index. Also, a large amount of D-serine accumulation was found in the frontal brain, cerebellum, cortex, hippocampus and microglia. These findings indicate that the distributions of D-amino acids are diverse and may have different physiological roles. D-serine is highly associated with neurodegenerative diseases such as schizophrenia and amyotrophic lateral sclerosis (ALS). Importantly, it was reported that D-serine could act as a potent activator of N-methyl-D-aspartate (NMDA)-type glutamate receptors, indicating that D-serine is an important neurotransmitter. In mammalians and zebrafish, blockage of NMDA receptors induces some neurological defects, such as seizures and impairment of learning and memory. This means that the biological roles of D-serine might be conserved between zebrafish and mammalians. In this regard, D-serine-induced toxicity is worthy of study. In rats, D-serine exposure resulted in changes in a number of pathways that may be associated with neuronal dysfunction. In addition, administration of D-serine induced oxidative stress and resulted in renal tubular necrosis and hyperaminoaciduria. These observations indicated that an excess of D-serine caused severe adverse effects such as neurotoxicity and nephrotoxicity in adult animals. However, the developmental toxicities of D-serine have not been fully clarified. Thus, development of an alternative model to study D-serine-induced developmental toxicities is essential. Zebrafish are a good model for toxicological experiments because they produce a large number of transparent embryos and have well-characterized developmental stages. To develop a zebrafish model for studying D-serine-induced developmental toxicities, we generated a series of time- and dose-dependent D-serine exposure experiments. By staining with specific monoclonal antibodies, subtle changes in neuronal axon formation and myofibril alignment can be easily observed. This strategy is efficient for studying D-serine-induced developmental toxicities. Mature zebrafish (AB strain) were raised at the zebrafish facility of the Life Sciences Development Center, Tamkang University. Embryos were produced using standard procedures and were staged according to standard criteria (hours post fertilization, hpf) or by days post fertilization (dpf). D-serine (Sigma) was dissolved in sterile distilled water to the desired concentrations (0, 100, 500, 1000 ppm), and was microinjected with a Nanoliter 2000 (World Precision Instruments, Sarasota, FL, USA) into the cytoplasm of one-cell stage embryos (2.3 nl/embryo). After microinjection, embryos were cultivated at 28.5°C, and survival rates were determined at 27 and 48 hpf. The spontaneous in-chorion contraction of zebrafish embryos was analyzed as previously described. Briefly, zebrafish embryos at 24 hpf without or with injection of different concentrations (100, 500 and 1000 ppm) of D-serine were collected and recorded. Spontaneous in-chorion contractions were defined based on the angle of the tail displacement relative to the body axis. Embryos with tail movements from one side to the other at any angles were classified as having in-chorion contraction. F59 monoclonal antibody (Hybridoma Bank; 1:10), Znp1 (Hybridoma Bank; 1:200) and Zn5 (Hybridoma Bank; 1:200) staining and acetylcholine receptor clustering were performed as previously described, except for the fact that 27- and 48-hpf zebrafish embryos were collected. After labeling, all embryos were observed at specific stages under a microscope (DM 2500, Leica) equipped with Nomarski differential interference contrast optics and a fluorescent module having a GFP or DsRed filter cube (Kramer Scientific). Photographs of embryos at specific stages were taken with a CCD (DFC490, Leica). All analyses in this study were carried out using the MATLAB software (version 7.7 R2008b). The two-way ANOVA (analysis of variance) was applied to test the effects of factors (exposure time, dosage level) on the mean of the outcome variable (survival rate or malformation rate). The P-value for each factor, reported by two-way ANOVA, was associated with the null hypothesis that samples at all levels of the factor are drawn from the same population. The Tukey-Kramer HSD (honestly significant difference) test was further used to compare the population marginal means for one factor, adjusted by removing the effect of other factors. The one-way ANOVA and Tukey-Kramer HSD test were employed to compare the average number of in-chorion contractions between dose groups. A significance level of 0.05 was used in all statistic analyses, and a familywise error rate of 0.05 was controlled for in the Tukey-Kramer HSD test. In order to study the exposure time and dosage effects of D-serine on zebrafish larvae, we injected zebrafish embryos with different dosages of D-serine (100, 500 and 1000 ppm) and calculated their survival rates at 27 hpf or 48 hpf. As shown in and , around 55.7–67.9% of the embryos injected with D-serine were alive at 27 hpf, and the survival rates decreased to 15.6–48.6% at 48 hpf. The two-way ANOVA revealed that the P-values for exposure time and dose effects on survival rate were 0.0754 and 0.0417, respectively. The former indicated the survival rates decreased as the time of exposure increased but not to a significant degree. The latter indicated a significant difference in survival rates between dosage groups. The Tukey-Kramer HSD test was thus used to pairwise compare the marginal mean survival rates for dosage level groups, adjusted by exposure time effect. The adjusted mean survival rates for the 0, 100, 500 and 1000 ppm dosage groups were 93.54%, 58.26%, 51.97% and 35.63% with a common standard error of 7.49%, and the difference in survival rate between the 1000 ppm D-serine-injected group and mock-treated group (0 ppm) was significant. Consequently, D-serine injection led to a reduction in the survival rates of zebrafish embryos. We further examined the phenotypic defects caused by D-serine. Compared with mock-treated embryos, D-serine-injected embryos (100–1000 ppm, 27 hpf) displayed some defective phenotypes (bent trunk phenotypes), such as a malformed somite boundary, twisted body axis and shorter body length ( vs. , , ). Similar results were also observed at 48 hpf ( vs. , , ). The D-serine-induced malformation rates were 59.9%–84.3% and 61.6–68.6% at 27 and 48 hpf, respectively ( and). Statistically, the two-way ANOVA indicated that the D-serine effect on the malformation rate was significant (P-value=0.0027). Furthermore, the Tukey-Kramer HSD test revealed that the mean malformed rates, adjusted by exposure time effect, for the 0, 100, 500 and 1000 ppm dosage groups were 0%, 60.90%, 66.00%, and 76.46% with a common standard error of 4.07% and identified that each of the D-serine injected groups (100, 500, and 1000 ppm) differed significantly from the control group (0 ppm) at a familywise error rate of 0.05, but no significant difference existed among the doses. We also noted that D-serine-injected embryos seemed to have less mobility at early larval stages. Thus, spontaneous in-chorion contractions in 27-hpf embryos were examined. The times of in-chorion contraction for each group were recorded for 3 min. As shown in , the average number (± standard error) of in-chorion contractions in the mock-treated control (0 ppm of D-serine) embryos was 21.7 ± 0.69 (3 min per embryo; n = 30). On the other hand, the average numbers of in-chorion contractions in the embryos injected with 100, 500 and 1000 ppm of D-serine were 18.3 ± 0.97, 12.7 ± 0.83 and 0.9 ± 0.23 (n = 30), respectively. The one way ANOVA test revealed a highly significant difference (P-value<0.0001) in the average number of in-chorion contractions between dose groups, and the Tukey-Kramer HSD test identified all pairwise differences as significant at a familywise error rate of 0.05. This demonstrated that D-serine treatment reduced significantly the motilities of zebrafish embryos. To further investigate the molecular mechanisms resulting in the reduced spontaneous in-chorion contraction of D-serine-injected embryos, the monoclonal antibody F59 was used to visualize the alignments of muscle fibers in mock-treated control and D-serine-injected zebrafish embryos. In the mock-treated control embryos (27 hpf), muscle fibers aligned well in the V-shaped somites (). In contrast, muscle fibers aligned disorderly after injection of 100–1000 ppm of D-serine (). Similar results were observed but were more severe at 48 hpf ( vs. ). These observations strongly indicate that injection of D-serine results in dose- and time-dependent defects of disorganized muscle fiber alignment. To address whether the projections of motor axons and the formation of neuromuscular junctions were affected by injection of D-serine, monoclonal antibody Znp1 and α-bungarotoxin labeling were carried out. The antibody Znp1 labeled the axonal bundles of primary motoneurons (pre-synapses) and revealed the common axonal path as well as the projections into ventral and dorsal somitic muscle blocks in mock-treated control embryos at 27 hpf (). In addition, α-bungarotoxin bound to acetylcholine receptors (AchRs; post-synapses) () and revealed clusters of AchRs. The merged signals suggested that axonal projections correlated well with the clusters of AchRs (C–D, yellow signals), indicating that the motor axons innerved to the muscle fiber functionally. Interestingly, we found that only 8.1% (5/61, numbers of defective embryos/total number of D-serine-injected embryos) of D-serine-injected zebrafish embryos displayed defective primary motoneuronal pre-synapses and clusters of AchRs (). These observations suggest that overdose of D-serine seems to have little effects on primary motor neuron projection. Axons of secondary motor neurons enter the common path set out by the primary neurons and complete migration as one nerve. When the development of primary motor neurons is impaired, the outgrowth of secondary motor axons is disrupted as well. We labeled secondary motor neurons with monoclonal Zn5, and the results revealed that secondary motor neurons completed their axonal migration along the common path and reached the trajectory point at 48 hpf (). However, secondary motor neuron axonal growth was impaired by injection of 100 ppm of D-serine (30.7%, 65/212; ). At higher concentrations (500 and 1000 ppm), secondary motor neuron axonal growth was nearly abandoned (C–D). Taken together, we suggest that overdose of D-serine can cause motor neuron defects, especially for secondary motor neuron axonal growth. D-serine is a coagonist of NMDA receptors and plays a significant role in neuronal activity, including learning, memory and cell-death signaling. As might be expected, increased levels of D-serine are associated with excitotoxicity of NMDA receptors. In adult rats, injection of 50–200 mg/kg D-serine induced oxidative stress, which was thought to be neurotoxic to the brain. Our data showed that zebrafish embryos injected with 100, 500 and 1000 ppm of D-serine displayed a significant decrease in in-chorion contraction () and few defects in primary motor neuron axonal growth but did not display severe impairment of secondary motor neuron projection ( and). Based on published information, we speculate that the D-serine-induced neural defects in zebrafish might be due to impairment of NMDA receptor function and that the injection concentrations described in this study are appropriate for exploration of D-serine-induced neurotoxicities. In addition to neuronal malformation, we also found that embryos injected with D-serine displayed severe muscle defects, especially myofibril misalignment (). Here, we propose two possible causes contributing to D-serine-induced muscle defects. One possibility is that such muscle malformation in D-serine-injected zebrafish embryos might result from D-serine affecting the NMDA receptors of the pre-synapse and disturbing the release of neurotransmitters from the axon terminals. Previous studies have shown that knockdown of neuronal activity led to impairment of muscle development. In this regard, D-serine-induced muscle defects might be the consequences of excitotoxicity of NMDA receptors. In other words, muscle defects are an indirect defect caused by D-serine-induced neuronal toxicity. The other possibility is that D-serine affects the muscle-type NMDA receptor or even an unknown muscle-specific receptor, and disturbs muscle development. In mouse C2C12 myoblasts, it has been demonstrated that NMDA receptors were expressed in myoblasts during muscle differentiation, and played a role in myoblasts fusion. In rats, NMDA receptors were found to be present at the neuromuscular junctions (NMJ) of the diaphragm. These observations suggested that NMDA receptors have direct effects on muscle development. Thus, whether or not NMDA receptors are present at the myoblasts of developing zebrafish embryos merits further study.

Busulfan, a bifunctional alkylating agent, has been used for the treatment of chronic myeloid leukemia and for myeloablative-conditioning regimens before stem cell transplantation. In children, there are several reports of diverse effects of busulfan treatment such as pulmonary fibrosis and acute clinical neurotoxicity (spasm). Busulfan has teratogenic and cytotoxic potentials, and it is reported that rat fetuses exposed to busulfan developed microencephaly and microphthalmia. Our previous studies clarified the systemic histopathological changes and the sequence of the central nervous system (CNS) lesions characterized by neural progenitor cell apoptosis in rat fetuses transplacentally exposed to busulfan on gestation day 13. It is also reported that busulfan induces histopathological changes in the lungs in adult humans and in gastrointestinal tissues, lymphoid tissues and gonadal tissues in adult rats. On the other hand, there are few reports of systemic histopathological changes in infant animals induced by busulfan except for our previous report of busulfan-induced CNS lesions in infant rats. In the present study, we examined the busulfan-induced systemic histopathological changes in infant rats mainly from the viewpoints of the distribution and sequence of pyknosis of component cells, except for brain and eye lesions, which will be described elsewhere in the near future. Male newborn rats were obtained in our laboratory by mating females with males of the same colony of specific pathogen-free rats of the Sprague-Dawley strain purchased from Charles River Laboratories Japan, Inc. (Kanagawa, Japan). One foster mother with 8 male newborns were housed together in plastic Econ cages (W 340 mm × D 450 mm × H 185 mm) with bedding (White flakes: Charles River Laboratories Japan, Inc.) in an environmentally controlled animal room (temperature, 23 ± 3ºC; relative humidity, 50 ± 20%; air ventilation rate, 10–15 times per hour; lighting, 12 h/12 h light/dark cycle) and fed an irradiation-sterilized pelleted diet (NMF, Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water . Finally, a total of fifty 6-day-old male rats were subjected to the experiment. The protocol of this study was reviewed and approved by the Animal Care and Use Committee of BoZo Research Center. No deaths occurred in any group until 7 DAT. Thereafter, one animal died with severe myelosuppression at 13 DAT in the busulfan group. In the control group, there were no histopathological changes observed in any tissues. On the other hand, in the busulfan group, histopathological changes mainly characterized by pyknosis of component cells were observed in many tissues as listed in . Histopathological changes other than pyknosis are shown in . Histopathological changes were also detected in the brain and eyes, but their data were excluded from the present paper as mentioned above. In the cardiopulmonary system, pyknosis was observed in a small number of cardiomyocytes () and alveolar and terminal bronchiolar epithelial cells at 2 and 4 DAT (). In the digestive system, pyknosis was found in a small number of hematopoietic cells in the liver at 2 DAT, glandular epithelial cells in the stomach () from 1 to 7 DAT, and crypt epithelial cells in the intestines from 1 to 4 DAT. Hematopoietic cells in the liver mildly decreased from 4 to 14 DAT, and glandular epithelial cells in the stomach showed vacuolation at 4 DAT. In the urogenital system, pyknosis was found in a small number of proximal and distal tubule epithelial cells in the kidneys () at 2 and 4 DAT. Pyknotic changes in spermatogonia started at 1 DAT and became moderate at 2 and 4 DAT in the testes (). Thereafter, seminiferous tubules showed atrophy with depletion of germ cells at 7 and 14 DAT, at which point only Sertoli cells were left in the germinal epithelium of markedly atrophied seminiferous tubules (). Pyknosis was also found in a small number of epithelial cells in the epididymides from 2 to 7 DAT. In the hematopoietic and lymphoid system, the thymus showed moderate cortical atrophy at 2 and 4 DAT following moderate or mild pyknotic changes in cortical lymphocytes at 1 and 2 DAT (). Similar but less severe changes were observed in mesenteric lymph nodes at 4 and 7 DAT. In the spleen, a minimal or mild decrease in the number of hematopoietic cells was detected from 2 to 14 DAT. In the bone marrow, mild or moderate pyknotic changes of hematopoietic cells were found from 1 to 7 DAT. A decrease in the number of hematopoietic cells with fat cell infiltration started at 2 DAT, progressed thereafter and became prominent at 14 DAT (). In the other tissues, pyknosis was found in a small number of hair follicle epithelial cells () in the dorsal skin and osteoblasts () in the femur at 2 and 4 DAT. Most of the pyknotic nuclei were immunohistochemically positive for cleaved caspase-3 (, inset), indicating that pyknotic cells were apoptotic. In the present study, we examined the nature and sequence of systemic histopathological changes observed in infant rats exposed to busulfan (20 mg/kg) at 6 days of age. As mentioned above, those in the CNS have been previously reported, and those in the eyes will be published elsewhere in the near future. Pyknosis of component cells was detected in many tissues (). Among them, the thymus was moderately affected by pyknosis at 1 DAT, and the bone marrow and testes were moderately affected by pyknosis at 2 and 4 DAT. Most of the pyknotic nuclei were immunohistochemically positive for cleaved caspase-3. This strongly indicates that pyknotic cells are apoptotic. In addition, moderate cortical atrophy was observed simultaneously with moderate pyknosis of cortical lymphocytes in the thymus, a moderate to marked decrease in the number of hematopoietic cells with infiltration of fat cells was found from 4 to 14 DAT in the bone marrow, and moderate or marked atrophy due to depletion of germ cells developed at 7 and 14 DAT in the testes. Thus, histopathological changes remained until 14 DAT in the bone marrow and testes, and whether or not the rats could recover from such lesions in the bone marrow and testes thereafter was not clear in the present study. On the other hand, histopathological changes observed in tissues other than the bone marrow and testes were considered to be transient in nature. Although there were no reports of cardiac lesions in fetal or adult rats following exposure to busulfan, apoptosis of cardiomyocytes was detected in infant rats in the present study, suggesting a susceptibility of the infant rat heart to busulfan. Regarding pulmonary lesions, it has been reported in humans that long-term and/or high-dose busulfan therapy brought about such pulmonary lesions as bronchopulmonary dysplasia and diffuse interstitial pulmonary fibrosis in adults and children. These lesions are known as “busulfan lungs.” In the lungs of fetal and infant rats, only transient apoptotic changes were detected in alveolar and terminal bronchiolar epithelial cells. With regard to histopathological changes in the gastrointestinal tissues, apoptotic changes were common in fetal and infant rats. Namely, they were milder in the intestine than in the stomach in fetal and infant rats, while they were reported to be milder in the stomach than in the intestine in adult rats. In humans, although there were no reports of histopathological changes in the gastrointestinal tissues, clinical signs of nonspecific gastroenteritis were reported. In the kidneys, although there were no reports of apoptosis in tubular epithelial cells in adult rats and humans, apoptosis of tubular epithelial cells was observed in fetal and infantile rats, suggesting that tubular epithelial cells of infant rats still remain susceptible to busulfan. The outline of the testicular lesions in infant rats was similar to those in adult rats, while there have been no reports of testicular lesions in humans. Histopathological changes in the thymus and mesenteric lymph nodes were similar between infant and adult rats. On the other hand, atrophy of the splenic white pulp, reported in adult rats, was not clear in infant rats. In the bone marrow of infant rats, as mentioned above, the number of hematopoietic cells decreased with time and became marked at 14 DAT with prominent infiltration of fat cells. This corresponded well to depressed bone marrow cellularity reported in adult rats. In our previous study on histopathological changes in fetal rats, we observed apoptosis of component cells in mesenchymal tissues such as craniofacial tissues, the mandible, limb buds and the tail bud. In the present study on histopathological changes in infant rats, apoptosis was found in hair follicle epithelial cells in the dorsal skin and osteoblasts in the femur, which were not reported in adult rats. In conclusion, the present study showed that busulfan-induced histopathological changes were characterized by apoptosis of component cells and that the distribution and sequence of apoptosis showed some differences, especially between infant and adult rats, probably reflecting the difference in susceptibility of component cells to busulfan between them.

AZD3783 is a potent and selective antagonist of the human 5-hydroxytryptamine 1B (serotonin, or 5-HT) receptor, with a Ki of 12.5 nM. that is involved in physiological functions including thermoregulation, modulation of neurotransmitter release, as well as anxiety and mood regulation. release of serotonin, thus 5-HT antagonists have been explored as an alternative therapy to selective serotonin re-uptake inhibitors (SSRIs) for treatment of depression. In guinea pig models, AZD3783 (0.6 µmol/kg. p.o.) was shown to increase extracellular serotonin in the brain, block hypothermia induced by 5-HT-agonists, and elicit effects indicative of anxiolytic and anti-depressant efficacy. emission tomography (PET) studies, AZD3783 was demonstrated to bind dose-dependently to brain 5-HT receptors in non-human primates and human subjects. K of 51 nM, which is approximately 4-fold lower than its affinity for the guinea pig or human 5-HT receptors. conducted with the dog receptors, however, given the receptor’s structural conservation, dogs would also be pharmacologically responsive. adrenergic α receptor and is an antagonist of the adrenergic α and α receptors in secondary pharmacology screens at 10 µM. amphiphilic drug (CAD). Many CADs have been shown to cause phospholipidosis (PLD) and in animals and man. PLD is considered an adaptive response rather than a manifestation of toxicity, questions remain as to the toxicological significance of PLD in affected tissues, since it is sometimes associated with concurrent toxicities clinically and preclinically. progresses to fibrosis, peripheral neuropathies from perhexiline, and corneal opacities from amidarone. PLD is regarded as a potential safety liability by regulatory agencies. maybe greater, because they are designed to cross the blood brain barrier, increasing the potential for PLD and associated toxicities in the brain, which are difficult to monitor. was developed to screen compounds with CAD structures for their ability to cause PLD. list of potential drug candidates based on a number of criteria - potency to cause PLD, repeat dose toxicity, and pharmacokinetic properties. clearance is moderate (18 mL/min/kg, after IV dosing), with a steady state volume of distribution of 4.3 L/kg. to be a p-glycoprotein substrate. (EC=164 µM) compared to reference compounds such as amiodarone, chloroquine, and perhexiline (EC<20 µM), and not a direct inhibitor of mitochondrial oxidative phosphorylation (unpublished data). number of tissues in a 14-day rat study, but at an incidence and severity less than the other comparison compounds (unpublished data). treatment-related pathology in a 14-day study in which limited tissues including dorsal root ganglion were examined (data not shown). pathologic changes in the nervous tissues after repeat dosing for 3 months. describe toxicologic findings in dogs after repeat dose exposure to AZD3783 for 1 or 3 months. been seen for other compounds that modulate the serotonin pharmacology. AZD3783, [(2R)-6-methoxy-8-(4-methylpiperazin-1-yl)--(4-morpholin-4-ylphenyl) chromane-2-carboxamide;MW=466.6 g/mol; for structure, see Reference ] was supplied by AstraZeneca’s Pharmaceutical Development Department in Macclesfield, UK. appearance), the identity was confirmed, and the storage condition was determined. purity of the micronized test substance was ≥ 99% in the two batches used in the studies. during the dosing period. The dosing volume was 5 mL/kg. ranged from 0.5 to 9.3 mg/mL. Control dogs received the vehicle, 0.1 M lactic acid in water (pH 3.0). used within the stability period. of AZD3783 was added to a pre-calibrated beaker. An appropriate volume of 0.1 M lactic acid (not adjusted for pH) was then added and the mixture was sonicated and stirred. mixture was then brought to volume using 0.1 M lactic acid (pH adjusted to 3), and stirred until a solution was obtained. were acceptable (± 2% of nominal). samples. pretest, end of dosing, and end of recovery in the 1-month toxicity study. toxicity study, ophthalmological examination was conducted during pretest, Weeks 6, and 13 of dosing period, as well as Weeks 3 and 5 of the recovery period. after application of a mydriatic agent (tropicamide solution, 1% Mydriacyl, Alcon), using an indirect ophthalmoscope and also a slit lamp (3 month study only). (t), maximum plasma concentration, C, area under the curve (AUC), half-life (t). No statistical analysis was performed in the 1-month toxicity study. toxicity study, numerical data were subjected to calculation of group means and standard deviations. test at the 0.05 significance level. found to be significant, a parametric two-sample -test was used to compare the group mean between the control and treated groups. Whenever Levene’s test indicated heterogeneous group variances (≤0.05), then the control group was compared to the treated group using the non-parametric Wilcoxon rank-sum test. Wilcoxon test, significance was reported at the 0.05, 0.01 and 0.001 levels. A summary of the toxicokinetic data is shown in . occurred between 0.5 and 3 h post-dose. appeared to increase with dose, especially after 3 months of dosing. longer on Day 28 than on Day 1. and t was longer on Day 91 than on Day 1 in the 15 and 30 mg/kg/day groups, while AUCs were similar between Day 1 and Day 91. saturation in absorption and a slowdown in elimination with repeat dosing. mechanisms behind these pharmacokinetic changes are not clear. t) in animals dosed at 47 mg/kg/day, but heart rate and blood pressure tended to be lower 24 h post dose in all dose groups. only consistent reductions in blood pressure were observed for systolic blood pressure in males dosed at 47 mg/kg/day and in females dosed at 14 and 47 mg/kg/day. treatment-related effect on ECG. 3-month toxicity study: Swelling and redness of the pinnas, periorbital region, cranium muzzle, lower jaw, abdominal area and/or limbs was noted in the 15 and 30 mg/kg/day groups during the first few weeks of dosing with the severity and incidences slightly higher in males than females. These clinical signs subsided as dosing continued. were observed in animals from the 15 and 30 mg/kg/day groups on most days during the study. adverse clinical signs. was slightly uncoordinated starting on Day 83. to termination revealed abnormal responses. findings from this dog is shown in . findings. No treatment-related ophthalmologic observations were recorded during Week 6 examination. findings including retinal hemorrhage (slight in one or both eyes), vitreous hemorrhage (moderate, 1 eye), or retinal detachment (both eyes, multifocal, small circular areas of retinal separation scattered throughout tapetal area). and retinal detachment improved and resolved while sequelae such as chorioretinal scar or tapetum hyperreflectivity or hyperpigmentation was observed. ophthalmologic findings is shown in . Pathological lesions in the liver and gallbladder were present prominently in those 4 dogs which had elevated liver biomarkers. inflammatory cell infiltration, degenerative and necrotic changes in the centrilobular region and moderate pigments in histiocytes (), which were confirmed as hemosiderin and lipofuscin. mucosa showed vacuolation and hypertrophy of the epithelium and inflammation ranging from minimal polymorphonuclear cell infiltration to frank cholecystitis. the liver and gallbladder tissues showed lamellar bodies consistent with PLD in hepatocytes (), intrahepatic bile duct epithelial cells and gallbladder epithelial cells. bile duct and gallbladder epithelial cells also had increased numbers and size of lipid droplets as compared to controls. 3-month toxicity study: Among dogs from the 15 and 30 mg/kg/day groups which were necropsied after 3 months of dosing, the major treatment-related microscopic findings were seen in the nervous system, including the eye, optic nerve, brain, spinal ganglia and sciatic nervous. marrow, GI tract, kidney, lung, lymph nodes, spleen, and thymus. from the decedant animal were similar in character and severity to those observed in other dogs dosed at 30 mg/kg/day. peripheral nervous tissues after 3 months of dosing is shown in . recovery evaluation but was killed preterminally on Day 86 are included in the summary with the 3 other females from the group that were necropsied on Day 91. cervical segment in 2 males and 1 female at 30 mg/kg/day. involving the thoracic and lumbar spinal cord segments was present in 2 males at 30 mg/kg/day. degeneration/necrosis, inflammation, ganglion cell vacuolation, and/or nerve fiber degeneration were present in at least one dog from all treatment groups (). male dog, which was normal in the neurologic examination. neuronal vacuolation (fine cytoplasmic vacuoles), nerve fiber degeneration, perivascular inflammation, and/or gliosis were present in all dogs dosed at 30 mg/kg/day, and in 2 females dosed at 15 mg/kg/day (). 15 mg/kg/day male had neuronal vacuolation and nerve fiber degeneration in the brain. brain regions that were typically affected with one or more microscopic findings included the visual/optical tracts/pathways (retina, optic nerve, optic tracts, and lateral geniculate body), brain stem (cochlear nuclei and superior olivary complex), and the CA2, CA3, and CA4 region of the hippocampus. dose-related and ranged from slight to moderate. dosed at 30 mg/kg/day (). eosinophilic inclusions were present in all animals dosed at 30 mg/kg/day (, insert). degeneration was present in animals dosed at 15 and 30 mg/kg/day (). still present after the 5-week recovery period. loss accompanied by marked astrogliosis in affected areas (). study. dogs dosed at 14 or 47 mg/kg/day, but not from dogs dosed at 2.3 mg/kg/day. appreciable concentrations of AZD3783 were detected in the brains of dogs from all groups, with greater than dose-proportional increases between 14 and 47 mg/kg (). the concentration detected at 2.3 mg/kg, a supra-proportional increase relative to dose. However, at each dose level, there was no difference in regional brain concentrations. brain/plasma concentration ratio appears to be constant (approximately 4) across the dose range, indicating that there is no saturation of clearance from the brain. effects on the serotonergic pathway. humans. (vacuolation) in tissues under light microscopy and by appearance of ultrastructural lamellar bodies under electron microscopy. some CADs only induce PLD in individual tissues, such as liver or lungs, others may induce generalized PLD in various tissues. be related to difference in tissue distribution, and compound lipophilicity or basicity. lamellar bodies in the liver and gallbladder of some treated dogs in the 1-month study. toxicity study, various tissues showed PLD-like vacuolation under examination by light microscopy. in the various tissues, including the nervous tissues are due to PLD. optic nerve were observed in dogs dosed at 30 mg/kg/day for 3 months. are also consistent with PLD, which with associated myeloid bodies or inclusion bodies are a common CAD-induced retinal change in the rat, and was seen in dogs administered fluoxetine. However, degeneration of optic nerve due to PLD has not been reported previously. example, amiodarone, which causes generalized PLD, did not cause any alteration in the retina or optic nerve in dogs after 11 weeks of dosing, although it did induce corneal microdeposits in 1 of 6 dogs after 6 weeks. severe than those previously reported with other CADs. not clear. the end of the dosing period. increase brain serotonin concentration, and serotonin toxicity has been reported in dogs after incidental ingestions of SSRI or hydroxytriptophan, a precursor of serotonin, we first considered whether the dog was experiencing serotonin toxicity. characterized by behavioral change (agitation, lethargy) accompanied by autonomic signs (e.g., vomiting, mydriasis, hypersalivation, hyperthermia, tachycardia), and neuromuscular signs (e.g., ataxia, tremors, myoclonus, hyperreflexia, nystagmus, and seizure). cases, coma, hyperpyrexia, and generalized seizure can be rapidly fatal. the reasons described here. the 1-month study, so as not to elicit severe liver toxicity and intolerable CNS effects. no seizure was ever noted. signs, such as emesis, hypertension, or hyperthermia. AZD3783, 17 µM, obtained prior to euthanasia on Day 86, was higher than C from other surviving females on Day 91 (which ranged from 11 to 15.7 µM), it was lower than C on Day 1 (which ranged from 23.7 to 33.7 µM). dosing progressed. adverse CNS signs were seen in any of the treated dogs during the early weeks of treatment, this suggests that the neurologic effects in the decedant developed over time with repeat dosing, and is most likely related to the pathological changes observed in the nervous tissues. dependent. dosing at 47 mg/kg/day, vacuolation plus degeneration or necrosis were seen after 3 months at 15 or 30 mg/kg/day, while only vacuolation in the spinal ganglia was observed at 7 mg/kg/day. leading event to the degeneration or necrosis. ganglia has not been reported with very many chemicals. has the highest potential to induce generalized PLD, few were reported to cause widespread PLD in the nervous system. Furthermore, most observations were made in rats. PLD in retina and DRG; citalopram (an SSRI) caused PLD in 1 sympathetic ganglion, none or very weak PLD in retinal and trigeminal ganglia, and hypothalamic neurosecretory perikarya; fluoxetine (an SSRI) caused PLD in retinas as well as PLD-like vacuolation in nerve cells in the thalamus, cerebellum, spinal cord and ganglion or rats. neuronal degeneration or neurological findings were observed. 1-year study included convulsions, tremors, transient nystagmus and slow/incomplete papillary responses. brain of dogs after chronic administration. degeneration or necrosis, nor was there any alteration in the amplitude, or latency of the auditory, visual, or somatosensory evoked potentials. between AZD3783 and these aforementioned CADs that contributed to the differences in the toxicity and pathologic findings in the nervous tissues. the study with posaconazole inflammatory changes were not observed in any tissues with PLD. In contrast, in our studies with AZD3783, inflammation and gliosis was present in the nervous tissue (eye, ganglion, and brain). on the work by Wada and assuming similarity in the pathogenesis of toxicity induced by PLD and lysosomal storage disease, one would hypothesize that the inflammatory response secondary to PLD was one of the trigger events to the neurodegeneration. Sandhoff’s disease, a lysosomal storage disorder characterized by storage of gangliosides in the CNS, showed that microglia activation and inflammation preceded the neurodegeneration. neurotoxic. apoptotic cell death was concentrated in the caudal region of the CNS, in spinal cord, brainstem, and thalamus, where microglia activation was indicated by overexpression of gene activation. exhibiting severe neuromuscular effects. in addition to neuronal vacuolation, also neuronal degeneration and necrosis accompanied by gliosis in the medulla oblongata. of dosing, and the degenerative changes in the brain tissues in this investigative study contrast with the minimum brain vacuolation observed in the 1-month toxicity study. differences between the two studies could be due to differences in dog sources and individual animal sensitivity. Nonetheless, the mean group plasma concentrations of AZD3783 after administration of various doses were comparable across studies. concentrations of AZD3783 relative to plasma were present in various brain regions. the plasma concentrations were generally dose-proportional (see ), the mean brain concentrations of AZD3783 were 38- and 460-fold higher at 14 and 47 mg/kg/day dose, respectively, relative to that at 2.3 mg/kg/day. Since CADs, e.g., amidarone, have been shown to accumulate in tissues in association with PLD, one may hypothesize that the high brain to plasma concentration ratio is due to PLD, following accumulation of AZD3783 in lysosomes. AZD3783 in the different brain regions were similar, i.e., there was no measureable preferential distribution of AZD3783 in select regions of the brain where dose-dependent PLD-like vacuolation was observed (e.g. was observed, relative to non-responding regions (e.g. frontal cortex; data not shown). cytotoxicity of AZD3783, do not rule out if it is due to differential sensitivity in different brain regions. visual/optical tracts/pathways, brain stem and the CA2, CA3, and CA4 regions of the hippocampus remain to be elucidated. vitreous hemorrhage, or retinal edema or detachment upon ophthalmologic examinations. findings are possibly related to the exaggerated pharmacologic effects of AZD3783 on serotonin and platelet function. spontaneous variant, is most frequently caused by trauma, or a systemic clotting disorder, and can occur secondary to retinal detachment, which is often associated with increased ocular pressure. the clotting mechanisms, e.g., coumarin anticoagulants and is the most common ocular lesion in dogs with systemic hypertension. serotonin and norepinephrine re-uptake inhibitors (SNRIs) drugs have effects on cardiovascular and coagulation mechanisms. been seen clinically with fluoxetine overdose. observed in the upper GI, and rare hemorrhage in retina or subjunctiva has been noted with fluoxetine, paroxetane, or venlafaxine (a SNRI) in man. ophthalmological findings have not been reported in preclinical studies with these aforementioned compounds. observed in fluoxetine dog studies, there was no change in coagulation parameters, nor was hemorrhage detected in any tissues after 13 weeks of dosing. study in dogs, AZD3783 causes modest tachycarda with decrease in blood pressure at 47 mg/kg, but no effect at 14 mg/kg/day. AZD3783 in dogs remain to be confirmed. in many visceral organs were similar to those seen in the dogs, the pathologic changes in the nervous tissues were limited and less severe. minimal neuronal vacuolation in the DRG and brain stem were observed. dosing at 100 mg/kg/day, minimal to slight neuronal vacuolation with eosinophilic deposits were seen in the DRG, brain stem, and additionally, spinal cord (unpublished results). were seen in the eyes, optic nerve, ventral root ganglion, sciatic nerve or in other brain regions. results). were 30 µM for C and 402 µM.h for AUC; the exposures at the NOEL for neuropathology, 25 mg/kg/day, were 11.4 µM for C and 84 µM.h for AUC (unpublished results). between rats and dogs, the rat had approximately 2-fold higher dose-normalized AZD3783 concentration in the brain stem or hippocampus. sensitivity and responses, e.g., inflammation or glia cell activation, to PLD may underlie some of the differences in neurotoxicity observed between dogs and rats after exposure to AZD3783. In AZD3783 Phase 1 trials in healthy volunteers, single ascending oral doses from 1 to 40 mg was well tolerated and did not elicit any severe adverse effects. 50% receptor occupancy in brain region, and is projected to be the efficacious dose, where the estimated C is 33 nM and AUC is 383 nM*h. predicted therapeutic concentration based on 50% receptor occupancy in the brain, the AUC exposure achieved in the 3-month study was 76-fold higher at 7 mg/kg/day, where only low incidences of vacuolation and inflammation were seen in the ganglion cell. where pathological changes were seen in brain, spinal ganglia, as well as sciatic and optic nerves, the exposure was 350-fold of the predicted therapeutic exposure. appeared to be large safety margins to the observed effects. findings from the 1- and 3-month studies with AZD3783 vs. raised these questions: 1) Are the more severe brain lesions (degeneration, necrosis, or inflammation) a direct or indirect consequence of PLD? 2) Is there an additional AZD3783-unique neurotoxic mechanism at play apart from PLD that lead to the severe lesions? 3) Will PLD and the neurotoxicity get progressively worse with chronic dosing, such that a NOEL will not be identified and thus no safety margin is attainable? And 4) Why and how is AZD3783 different from other SSRIs or SNRIs? These questions, together with the lack of recovery in effects in the 3-month study raised significant safety concerns and a decision to discontinue the project before multiple dose phase in man was initiated. various tissues in dogs after repeat dosing with AZD3783 from 1 to 3 months. of vacuolation in the various tissues suggests generalized PLD, which is consistent with the chemical structure of AZD3783. observed neuropathology are attributable to PLD or chemical toxicity unique to AZD3783.

Prostate cancer is the most common cancer and the second leading cause of death from cancer among men in the US. It has been estimated there will be approximately 238,590 new cases of prostate cancer and 29,720 deaths from prostate cancer in the US in 2013. In Japan, the prevalence and mortality of prostate cancer has also been increasing, along with in the so-called nutrition transition. Androgen ablation therapy is generally applied for prostate cancer because of hormone-dependent growth. However, outgrowth of androgen-independent and metastatic cancer cells is a frequent outcome, eventually leading to death of the patient. Therefore, understanding of the mechanisms of the acquisition of metastatic potential or the androgen-independent phenotype of cancer cells is urgently required. We have established a rat cancer model responding to the need for systems that adequately reproduce the spectrum of human prostate cancers. Administration of 3,2’-dimethyl-4-aminobiphenyl (DMAB) induces noninvasive and androgen-dependent adenocarcinomas in the ventral prostate, while additional long-term treatment with testosterone propionate (TP) causes development of invasive and metastasizing androgen-independent adenocarcinomas arising from the dorsolateral and anterior prostate and seminal vesicles. However, a long period of about 60 weeks is required to induce prostate cancers in both carcinogenesis models, and the incidence of lesion development is relatively low. Therefore, we have established transgenic rats bearing a probasin promoter/simian virus 40 (SV40) T antigen construct to resolve these problems. This model, the transgenic rat for adenocarcinoma of the prostate (TRAP), features development of high-grade prostatic intraepithelial neoplasia (HGPIN) from 4 weeks of age and androgen-dependent well-moderately differentiated adenocarcinomas with 100% incidences by the age of 15 weeks. These characteristics of the TRAP model have been shown to be very suitable for evaluation of strategies for chemoprevention and treatment. Microinvasive carcinomas characterized by a budding morphology from acini are observed in an age-dependent manner in TRAP rats, but these lesions are generally only 0.2–0.3 mm diameter in size and take over 35 weeks to develop. We speculated that testosterone administration might be of paramount importance in the induction of invasive carcinoma in our transgenic rats based on our experience with the DMAB combined with TP-induced prostate carcinogenesis model. In the present study, we therefore assessed whether testosterone exposure might result in a high-grade invasive phenotype or metastatic lesions in TRAP rats. TP was purchased from Sigma-Aldrich (St. Louis, MO, USA) and DMAB was obtained from Matsugaki Pharmaceutical Co. (Osaka, Japan). The purity of DMAB was >98%. Antibody for androgen receptor (AR) was obtained from Santa Cruz Biotechnology Inc (N-20, Santa Cruz, CA, USA). The antibody for Ki-67 was from Acris Antibodies GmbH (SP-6, Hiddenhausen, Germany). Male heterozygous TRAP rats with a Sprague–Dawley genetic background were obtained from Oriental BioService Inc. (Minamiyamashiro, Kyoto, Japan) and were housed in plastic cages with hardwood chips in an air-conditioned room with a 12 h light/dark cycle at 23 ± 2°C and 50 ± 10% humidity. Food (Oriental MF; Oriental Yeast Co., Ltd., Tokyo, Japan) and tap water were available . They were acclimatized for 1 week before use. Surgical treatments, such as orchiectomy and tube implantation, were carried out under deep isoflurane anesthesia. All animal experiments were performed under protocols approved by the Institutional Animal Care and Use Committee of the Nagoya City University Graduate School of Medical Sciences. Experiment 1: A total of 24 male TRAP rats aged 6 weeks were randomly divided into four groups. Rats in groups 1 and 2 were treated with bilateral orchiectomy at day 0 of the experiment. Those in groups 1–3 underwent subcutaneous implantation of 2-cm-long silicone rubber tubes (Silascon, inner diameter, 0.2 cm; outer diameter, 0.3 cm, Kaneka Medix Corporation, Osaka, Japan) containing 40 mg TP sealed at both ends with silicone rubber sealing compound (KE-42, Shin-Etsu Chemical Co., Ltd., Tokyo, Japan) into the interscapular region from weeks 1 to 4 and from weeks 6 to 16. The TP implants were replaced at 6-week intervals. Rats in groups 1 and 3 were subcutaneously given DMAB at a dose of 50 mg/kg body weight on the second day after TP tube implantation. No treatment was performed in rats of group 4, which served as controls. Animals were euthanized at weeks 16 and 22 after the beginning of the experiment (). Experiment 2: A total of 24 heterozygous male TRAP rats aged 6 weeks were randomly divided into three groups. All were given TP implants in the same manner as in experiment 1 at day 0. The duration of TP administration was different among the groups; that is, TP was administered in experimental weeks 0–3, 5–8 and 10–15 in group 1 and in experimental weeks 0–3 and 5–15 in group 2. Group 3 was continuously administered TP by implants throughout the experiment. The experiment was terminated at week 15 (). Deparaffinized sections were incubated with diluted antibodies for AR and Ki-67. The immunohistochemical analysis was performed with a Discovery XT System (Ventana Medical Systems, Tucson, AZ, USA). Incubation with primary antibodies was carried out for 3 hours followed by a one hour incubation with biotinylated anti-rabbit secondary antibody (Vectastain ABC Kit Rabbit IgG, Vector Laboratories, Burlingame, CA, USA) and a DAB detection kit (Ventana Medical Systems) according to the manufacturer’s instructions. Sections were counterstained with hematoxylin to facilitate orientation. Deparaffinized sections were autoclaved at 120°C for 20 min in antigen retrieval solution (Nichirei Biosciences Inc.) and then allowed to cool. Sections were incubated with 1% skim milk for 1 hour at room temperature. For double staining, anti-smooth muscle actin antibodies (1A4, dilution 1:1,000, mouse monoclonal, Dako) and anti-vimentin antibodies (EPR3776, dilution 1:400, rabbit monoclonal, Abcam) were simultaneously added to the slides and incubated for 1 hour at room temperature. After washing the slides with PBS, fluorescein-labeled goat anti mouse IgG (Life Technologies Corporation.) and tetramethylrhodamine-labeled goat anti-rabbit IgG (Life Technologies Corporation.) were added followed by incubation at room temperature for 1 hour. After washing the slides with PBS, the sections were mounted with Vectashield containing DAPI (Vector Laboratories) and subjected to fluorescence microscopy. At week 16, foci of invasive adenocarcinoma with abundant collagenous stroma were found in lateral, dorsal and anterior prostates of groups 1–3 (), along with minute ventral invasive carcinomas with minimal fibrous stroma. Cancer invasion into perineural spaces was also observed (). Almost all of infiltrating carcinoma cells expressed AR (). The incidences of invasive adenocarcinoma varied among the groups, tending to be higher in group 3 in all prostatic lobes (). Similarly, the number of invasive carcinoma foci was highest in group 3 (). There were no differences in histopathological characteristics of invasive adenocarcinomas among the groups. Development of small cell carcinomas of the prostate was sporadically noted, but there were no differences in incidence among the groups. No metastasis of cancer lesions to distant organs was found in any of the groups. Noninvasive adenocarcinomas in the ventral, lateral prostates were observed in all rats of groups 1–4. A significant increase of invasive adenocarcinoma development was observed in group 1, and this correlated well with the number of TP administration/withdrawal cycles in the lateral prostates (). Multicentric development of invasive adenocarcinoma foci with abundant collagenous stroma was found (), and invasive cancer cells were observed in the stroma () and were positive for AR protein (). Some invasive lesions consisted of cells with atrophic features, but more than 50% of these cells were labeled for Ki-67, suggesting that they were high-grade adenocarcinomas (). Reactive stromal cells surrounding invasive cancers expressed both smooth muscle actin and vimentin and were therefore revealed to be cancer-associated myofibroblasts (). Noninvasive adenocarcinomas in the ventral and lateral prostates were found in all rats of groups 1–3. The TRAP rat features sequential progression from prostatic intraepithelial neoplasias (PINs) to noninvasive adenocarcinomas through prostate epithelial cell-specific expression of the SV40 T antigen regulated by the androgen-dependent probasin promoter. We have applied the TRAP rat model to validate the chemopreventive effects of a variety of chemicals, and cancer development in TRAP rats is very sensitive to chemicals that modulate the AR axis, such as flutamide, finasteride, resveratrol or angiotensin II receptor blockers . These characteristics underly its acceptability to mimic early-stage hormone naïve human prostate cancer without an invasive phenotype. In the present study, we established a novel rat model for invasive adenocarcinoma of the prostate in TRAP rats by intermittent TP administration (group 1 in experiment 2, shown in ). The invasive carcinomas induced simulate human prostate cancer in several respects, such as perineural invasion and multicentric lesion development. To investigate mechanisms of prostate cancer progression, we previously combined administration of both DMAB and TP. While several experiments were conducted with the aim of increasing the incidence of invasive cancer and shortening the experimental period, none exceeded the DMAB + TP model in terms of the cancer incidence. The new prostate carcinogenesis model documented here is characterized by invasive adenocarcinoma development at a high incidence in a short period without carcinogen administration. This rat model should enable us to investigate candidate chemopreventive agents for therapeutic effects as well as chemopreventive properties against prostate cancer. We found that invasive adenocarcinoma incidences became greater as we increased the TP administration/withdrawal cycles for the TRAP rats. In our previous studies, testosterone induced invasive prostate adenocarcinomas in a dose- or duration-dependent manner after prostatic carcinogen treatment. However, continuous administration of testosterone alone earlier proved unable to cause development of invasive cancer with abundant reactive stromal tissue in the TRAP model. The present results thus lead us to speculate that physiological destruction of the normal acinar structure with stromal cell proliferation by androgen depletion plays an important role in the induction of invasive adenocarcinomas. The process of primary cancer invasion, which initiates metastasis, is multifactorial and multistep and requires alteration of cell adherence, proteolytic degradation of extracellular matrix elements and tumor cell migration through tissue. Accumulating evidence has shown that stromal-epithelial interactions play critical roles in cancer progression. The reactive tumor stroma mainly composed of cancer-associated fibroblasts (CAFs) including myofibroblasts, which are the predominant subpopulation of CAFs, is known to contribute to cancer development and progression. Growth of myofibroblasts is reported to be stimulated by androgen. TGFβ is one of the growth factors overexpressed in the prostate of rats after androgen ablation by orchiectomy. TGFβ1 induces reactive oxygen species production via enhancement of NOX4 expression and may underly fibroblast-to-myofibroblast differentiation in the prostatic stroma, while myofibroblasts per se contribute to the production and activation of TGFβ1 and stromal cell-derived factor-1 (SDF-1)/CXCL12 by autocrine signaling loops. Phosphoglycerate kinase-1 (PGK1), a downstream molecule of CXCL12-CXCR4 signaling, is upregulated in myofibroblasts, and this is involved in the enhanced proliferation and invasion of prostate cancer cells through activation of MMP, AKT and ERK pathways. In conclusion, TP administration/withdrawal cycles appear to be of paramount importance to induction of invasive adenocarcinomas in the TRAP rat prostate. Our new rat prostate carcinogenesis model for invasive adenocarcinoma should provide opportunities to investigate molecular mechanisms of prostate cancer progression and may serve as a useful preclinical model for evaluating efficacy of preventive and therapeutic agents in terms of the tumor microenvironment. The authors have no conflicts of interest.

Atrial dilatation and fibrillation are well-known risk factors for the development of thrombosis within the atrium. Thrombosis develops easily when blood pooling occurs in the left atrium, often leading to cardio-embolic stroke (CES). Since atrial thrombosis is strongly associated with CES, clarifying the mechanism responsible for thrombus formation in the left atrium would be valuable in the development of preventive measures and treatment strategies for CES. Thrombophilia is a disorder associated with excessive thrombosis; further, familial thromboembolism results from abnormal or deficient coagulation control factors, which leads to the development of idiopathic thrombophilia. Understanding the mechanisms responsible for thrombosis in such patients would improve current treatment options, and the availability of a suitable animal model is expected to contribute greatly to current research endeavors in thrombosis. Therefore, our study aimed to establish an animal model for left atrial thrombosis. In 1996, the male Spontaneously-Running-Tokushima-Shikoku (SPORTS) rat strain was identified in Wistar rats. SPORTS rats are able to spontaneously run long distances on an exercise wheel. These animals clock over 6,000 revolutions per day on an exercise wheel; they are considered valuable in research investigating the effects of training and exercise in healthy individuals or persons with lifestyle-related diseases. In an earlier study, we found that SPORTS rats had higher blood pressures than Wistar rats, although their blood pressures were not as high as those in spontaneous hypertensive rats (SHR) or stroke-prone spontaneous hypertensive rats (SHRSP). The SHR and SHRSP rats are well-known Wistar strains used in studies on hypertension and stroke, resepectively. A related strain —the SHHF/Mcc rat— is a model for spontaneous hypertension, progressive renal dysfunction and congestive heart failure (CHF); left atrial thrombosis has been reportedly observed on necropsy of these SHHF/Mcc rats. However, thus far, no reports have described a high incidence of atrial thrombosis in SHR, SHRSP or SHHF/Mcc rats. In this study, we examined the possibility of using the previously established Wistar strain of SPORTS rats, which develop spontaneous thrombi in the left atrium, as a model for atrial thrombosis. A male rat that spontaneously ran long distances, over 6,000 revolutions per day on an excise wheel, was discovered in an outbred strain of Wistar rats purchased from Charles River, Canada, in 1996. This strain was bred into a SPORTS rat strain at the Shikoku University (Tokushima, Japan). A colony of SPORTS rats was transferred to the University of Tokushima (Tokushima, Japan) and is currently being maintained there. In this study, 28 male and 45 female SPORTS rats were used; 15 male and 16 female Wistar rats were used as controls; and 5 male SHR rats were purchased from Japan SLC, Inc. (Shizuoka, Japan). All the rats were housed in individual cages and maintained under specific pathogen-free conditions at the Tokushima University Animal Study Facilities (room temperature, 23 ± 1°C; lighting, 08:00–20:00). Rats were fed a standard non-purified diet (Oriental Yeast, Tokyo, Japan) and had access to food and tap water. At the start of experimentation, all male and female SPORTS rats as well as all control rats were between 3 and 4 weeks of age, and they were housed in individual cages equipped with an exercise wheel (1.15 m/cycle). All the SPORTS rats clocked at least 6,000 revolutions per day on the exercise wheel. At the end of the experimentation, all rats were anesthetized with sodium pentobarbital (50 mg/kg) and then sacrificed by exsanguination. We performed electrocardiography and measured the blood pressures and heart rates of 7 male and 3 female SPORTS rats, 7 male control rats and 5 male SHR rats at 10 weeks of age. Electrocardiograms (ECG) were recorded using an ECG processor analyzing system (SRV-2W, SBP-2000; Sotron, Tokyo, Japan), and we used the tail-cuff method and a noninvasive rat-mouse manometer transfer (TK-370; Neuroscience, Tokyo, Japan) to record blood pressures and heart rates. We measured the levels of triiodothyronine (T3) and thyroxine (T4) levels to assess thyroid function and the levels of thyroid-stimulating hormone (TSH) to assess pituitary function in 6 male SPORTS rats and 6 male control rats at 16 weeks of age. Blood was collected from the abdominal aorta at the time of sacrifice, and the plasma T3, T4 and TSH levels were measured by radioimmunoassay (RIA; Immunotech Inc., Czech Republic). Necropsy was performed when SPORTS rats were found dead or euthanized and terminally sacrificed at 80 weeks of age in males and at 100 weeks of age in females. The thoracic and abdominal cavities were opened; the heart, lungs, liver, kidneys, and spleen were removed; and the weight of each organ was recorded. Thereafter, the heart and lungs were fixed in 10% neutral buffered formalin, trimmed, embedded in paraffin, sectioned at a thickness of 4 µm, stained with hematoxylin and eosin (H&E) and van Gieson’s stain for elastin and examined microscopically. Data are expressed as means ± SD. We used the two-tailed Student’s -test (Microsoft Excel, version 2007) to test for significance between groups. P < 0.05 was considered statistically significant. In the male rats, the average systolic blood pressure of the SPORTS, SHR and control rats were 134.3 ± 15.5, 197.9 ± 27.3 and 115.2 ± 10.8 mmHg, respectively (P < 0.05 for SPORTS vs. control rats, P < 0.01 for SHR vs. control rats, and P < 0.05 for SHR vs. SPORTS rats; ). In the female SPORTS rats, the average systolic blood pressure was 135.8 ± 5.6 mmHg. In the male rats, the average heart rates of the SPORTS, SHR and control rats were 458.8 ± 21.3, 388.6 ± 28.1 and 385.5 ± 44.3 beats/min, respectively (P < 0.01 for SPORTS vs. control rats and P < 0.01 for SPORTS vs. SHR rats, ). In the female SPORTS rats, the average heart rate was 446.0 ± 21.6 beats/min. The average levels of TSH and T4 in 16-week-old rats did not differ significantly between the SPORTS and control rats (). The average levels of T3 in 16-week-old SPORTS rats tended to be lower than those in the control rats; however, this difference was not statistically significant (P = 0.051). The average survival periods of the male and female SPORTS rats were 79.5 ± 26.7 and 102.3 ± 28.4 weeks, respectively (). The average survival periods in the male and female SPORTS rats that developed atrial thrombosis were 71.1 ± 26.0 and 98.6 ± 22.4 weeks, respectively; further, the shortest life spans in the male and female SPORTS rats with macroscopic atrial thrombosis were 33 and 50 weeks, respectively (data not shown). The body weights and relative organ weights in the male and female SPORTS and control rats were compared (). The body and organ weights of 80-week-old male and 100-week-old female Wistar rats were used as controls. The average body weight of the male SPORTS rats was considerably lower than that of the control rats. The relative weights of the heart and lungs to the body weight in the SPORTS rats were significantly higher than those in the control rats (P < 0.01, ). The relative weight of the liver to the body weight in the SPORTS rats was significantly higher than that in the control rats (P < 0.05, ). Atrial thrombosis occurred in 57.1% and 37.8% of male and female SPORTS rats, respectively (). Atrial thrombosis in the right atrium also occurred in 7.1% of male SPORTS rats; further, in one of these rats, thrombi developed in the hepatic veins. The necropsy results for the control rats did not show any evidence of macroscopic atrial thrombosis in any of the animals (). Further, necropsy of the 5 male SHR rats also did not show macroscopic atrial thrombosis (data not shown). Hard, white thrombi were observed in the left atria of the SPORTS rats on macroscopic examination (). shows the histological findings for the organized thrombi, with dense connective tissue in the left atrium stained with H&E (panel A) and van Gieson’s stain for elastin (panel B). The organization of thrombi was clearly observed in the left atrium. Many neutrophils accumulated around each thrombus, and some neutrophils and lymphocytes were observed to infiltrate the atrial wall. No signs of degeneration, necrosis or fibrosis was observed in the valves, atria, or ventricles. The histological findings for the lungs of the SPORTS rats are shown in ; many foam cells were observed in the pulmonary alveoli. Previous studies have investigated the characteristics of male and female SPORTS rats and reported the hyperactive wheel-running ability of these rats. In the present study, we observed that SPORTS rats were predisposed to the development of atrial thrombosis. Previous studies have reported that atrial thrombosis can occur following exposure to certain chemicals. For instance, the peroxisome proliferator-activated receptor-gamma agonist troglitazone is known to induce atrial thrombosis in Wistar rats. We could not find any evidence of macroscopic thrombosis in our control Wistar rats; further, the 2-year National Toxicology Program (NTP) for rodent studies reported the incidences of atrial thrombosis in male and female F344 rats to be 4.11% and 1.01%, respectively, and those in male and female B6C3F1 mice were reported to be 0.70% and 0.68%, respectively. Thus, the incidence of atrial thrombosis was clearly higher in the SPORTS rats than in other strains. SHR, SHRSP and SHHF/Mcc rats are derived from a single Wistar strain and are useful models for studies concerning the mechanisms and complications of high blood pressure, such as stroke and CHF. Compared with SHR and SHHF/Mcc rats, SPORTS rats have a lower systolic blood pressure and a considerably higher heart rate. Atrial fibrillation is considered a cause of thromboembolism; however, the absence of arrhythmias, including atrial fibrillation, in the SPORTS rats used in the present study suggests that atrial fibrillation was not a cause of atrial thrombi in these animals. Although SPORTS, SHR, and SHHF/Mcc rats belong to the same strain of Wistar rats, thus far, the underlying cause of the faster heart rate in the SPORTS rats remains unknown. In a previous study, we observed that SPORTS rats showed a slightly higher blood pressure than other strains, although this difference was not statistically significant. This lack of significance was possibly due to the small sample size used in the study and/or the decreased ejection fraction in SPORTS rats as compared with those in other strains (data is not shown). In the present study, the average TSH, T3 and T4 levels showed no significant differences between the SPORTS and control rats. Therefore, the higher systolic pressures and faster heart rates in the SPORTS rats could not have resulted from abnormal levels of thyroid hormone. We believe that SPORTS rats have sympathetic hypertonia, which could increase the activity of coagulation factors. Moreover, we observed that the lungs and hearts of SPORTS rats weighed more than the same organs in aged-matched control Wistar rats (). We hypothesize that cardiac enlargement and the presence of thrombi in the left atria of SPORTS rats caused these differences in cardiac weight. The differences in lung weights are thought to accompany the infiltration of foam cells in the alveoli. The mechanisms underlying the development of thrombosis in SPORTS rats may be relevant for studies investigating CHF. In addition, future studies should investigate the relationship between thrombosis and circulating norepinephrine levels. The contribution of inflammation in the atria of young SPORTS rats to the development of atrial thrombosis cannot be ruled out without further studies. In order to fully understand the causes underlying atrial thrombosis in SPORTS rats, further research, including genetic analyses for the identification of the genes responsible for atrial thrombosis, is necessary. Moreover, investigation of the hormones, cytokines and metabolic anomalies that may contribute to thrombosis is also essential. In conclusion, we have established that the SPORTS rat strain is predisposed to the development of atrial thrombi. SPORTS rats may thus be a useful new animal model for clarifying the causes of atrial thrombosis and familial thrombophilia in humans; further, this model could be utilized in the development of novel antithrombotic drugs.

Trichothecene mycotoxins produced by fungi are frequent contaminants in agricultural commodities such as rice, wheat, rye, barley, oats, corn, and other cereals produced in various countries around the world. Contamination with these mycotoxins, including mycotoxins, remains a major concern for human and animal health. Nivalenol (NIV), a trichothecene mycotoxin, is produced by strains of the genus including and . Toxicities of NIV have been reported that 50 and 100 mg/ml NIV damaged the nuclear DNA of cultured CHO cells in the absence of S9 mix, and oral (20 mg/kg) or intraperitoneal (3.7 mg/kg) administration of NIV to mice resulted in DNA damage in the kidneys, bone marrow, stomach, jejunum, and colon. A low level (0.1–0.5 μM) of NIV also induced DNA damage in differentiated human enterocyte-like Caco-2 cells. On the other hand, other results have shown a negative response to NIV in the Ames test and recombination-repair (rec)-assay. The oral LD of NIV in mice was determined to be 38.9 mg/kg body weight. Significant leukopenia and growth retardation were observed in a chronic toxicity study of female mice. In a two-year feeding study of female mice, NIV was not tumorigenic, although growth retardation and leucopenia were observed. Based on these toxicological data, the lowest-observed-adverse-effect level (LOAEL) was concluded to be 0.7 mg/kg body weight/day, and the temporary tolerable daily intake (t-TDI) of NIV was set to 0 to 0.7 μg/kg body weight by the Scientific Committee on Food of the European Union. Recently, a subchronic toxicity study of NIV using F344 rats was conducted, and the no-observed-adverse-effect level (NOAEL) of NIV was less than 6.25 ppm (0.4 mg/kg body weight/day for both male and female rats) based on hematological changes showing decreased white blood cell counts. In an extension of the subchronic study, natural killer (NK) activity against YAC-1 target cells by lymphocytes from the spleen derived from the subchronic toxicity study increased in males , indicating that orally administered NIV is immunotoxic. In young pigs, oral administration of NIV for 3 weeks showed toxicities in the gastrointestinal tract and kidneys and reduced the number of splenocytes. Additionally, the same study found that 2.5 mg/kg NIV caused a time-dependent increase in the plasma IgA concentration. The kidney is known to be a major target of NIV toxicity. Mice orally administered NIV for up to 8 weeks showed increased serum IgA concentrations and histopathological changes in the renal glomeruli such as mild mesangial expansion. In another study, 24 ppm NIV administered orally for up to 8 weeks increased serum IgA levels and glomerular deposition of IgA and IgG in a dose-dependent manner in female BALB/c mice and also increased the serum IgA level in a high IgA strain (HIGA) of mice, an animal model for human IgA nephropathy. According to the previous reports, oral administration of NIV or trichothecene vomitoxin to mice increased IgA(+) B cells or IgA production from Peyer’s patches or splenocyte cultures, respectively, which might cause elevation of the serum IgA concentration and IgA deposition in the glomeruli in mice. Although many studies have reported renal toxicities of NIV, there is limited toxicological data regarding renal toxicity in children with or without renal disease. Since there are reports that NIV increases the serum IgA concentration and deposition of IgA in the glomerular mesangial areas, there is a possibility that NIV would aggravate or modify developed glomerular lesions, especially in infant animals, which might be more sensitive to toxic chemicals. ICGN mice are an inbred strain with hereditary nephrotic syndrome and they are considered a good animal model of human idiopathic nephrotic syndrome. Since early onset of glomerular alteration and proteinuria were observed in the neonatal or infant period, 3-week-old ICGN mice were selected as a model of human infant patients with renal disease to clarify whether NIV aggravated the nephritic syndrome and renal lesions observed in infant ICGN mice. In addition, infant ICR mice, the genetic background of ICGN mice, were used as a model for healthy human infants. We focused on the effect of NIV on the renal glomeruli in 3-week-old ICGN and ICR mice, and changes in serum biochemistry, histopathology, and immunohistopathology of the kidneys were analyzed and compared with non-treated control animals or 8-week-old adult ICR mice. For purification of NIV, Fusarenon X was extracted and purified from the cultured media of (Fn-2B). Purified NIV was mixed with the basal diet (CRF-1; Oriental Yeast Co., Ltd., Tokyo, Japan) for animal studies, and NIV was extracted from the basal diet and analyzed. The identity and purity of NIV was determined by liquid chromatography/mass spectrometry (LC/MS; LCMS-2010A; Shimadzu Corp., Kyoto, Japan), with an atmospheric pressure chemical ionization interface and LC system (LC-2010CHT; Shimadzu Corp.), and the purity was estimated to be >90% from the area percentage of the chromatogram (data not shown). ICGN mice were bred in the National Institute of Health Sciences, Japan. Male and female ICGN/M mice showing proteinuria were mated at the age of 8 weeks old, and their 3-week-old male offspring were used in the present study. Neonatal ICGN mice were underdeveloped due to nephritic syndrome in their dams or their own renal problems. For comparison with ICR mice at the same age or with adults, 2-week-old and 7-week-old male Slc:ICR mice were purchased from Japan SLC, Inc. (Shizuoka, Japan), and infant ICR mice were maintained with their dams until being weaned. Mice were housed 5 or 6 per polycarbonate cage with sterilized softwood chips as bedding in a barrier-sustained animal room maintained at 23–25°C and 50–60% humidity with a 12 h light/dark cycle. ICGN and young and adult ICR mice were randomly divided into 4 groups. Each group consisted of 6 ICGN mice or 10 ICR mice. Due to the difficulty of obtaining neonatal ICGN mice, the number of ICGN mice used in the present study was lower than the number of ICR mice. Animals were administered 0 (control), 4, 8, or 16 ppm NIV mixed in powdered diet for 4 weeks. The diet and drinking water were given The animals were checked daily for clinical signs and mortality. Body weights were measured weekly, and all mice were checked weekly for proteinurea using test strips (Uropaper ΙΙΙ , Eiken Chemical Co., Ltd., Tochigi, Japan). Food intake was weighed weekly, and the NIV intake was calculated. At the end of the experiment, all of the animals were deeply anesthetized, blood samples were collected from the abdominal vein, and the animals were euthanized. The serum, obtained from centrifugation of the blood at 3,000 ppm, was stored until serum biochemical analysis. The left and right kidneys were removed, weighed and sectioned to provide central slices including the pelvis, and the slices were fixed with 10% neutral buffered formalin for histopathological and immunohistochemical examination. The remainder of the kidney tissue was fresh frozen with liquid nitrogen and stored at –80˚C until used for immunofluorescent assessment. The kidney slices fixed in 10% buffered formalin were routinely embedded in paraffin and were stained with hematoxylin and eosin and Periodic acid-Schiff (PAS) stains. To detect damage of mesangial areas by NIV, the number of glomeruli showing mesangial expansion was counted in the cross sections for bilateral kidneys using PAS sections, and the percentage of affected glomeruli per animal was calculated. Since mesangial expansion was observed in the glomeruli of ICGN mice, proliferative and activated mesangial cells were evaluated by immunohistochemical analysis. Formalin-fixed, paraffin-embedded renal sections were treated with 0.3% HO in absolute methanol after heating in instant antigen-retrieval agent H (neutral) (Mitsubishi Chemical Medience Corporation, Tokyo, Japan) at 90˚C for 10 minutes. The sections were incubated with a mouse anti-human smooth muscle actin (α-SMA) monoclonal antibody (clone 1A4, ×100 dilution; Dako Japan, Tokyo, Japan), a marker of activated mesangial cells, or anti-proliferating cell nuclear antigen (PCNA) monoclonal antibody (clone PC10, ×100 dilution; Dako Japan, Tokyo, Japan) at 4°C overnight. Immunodetection was carried out with Histofine® Simple Stain MAX PO (MULTI) (Nichirei Biosciences Inc., Tokyo, Japan) and was visualized with 3,3’-diaminobenzidine as the chromogen. To evaluate activated mesangial cells, the number of glomeruli showing α-SMA-positive mesangial areas was counted in the bilateral kidneys (81–124 glomeruli in ICGN mice and 130–231 glomeruli in 8-week-old ICR mice), and the ratios of glomeruli with α-SMA-positive mesangial areas to all glomeruli were analyzed. Variances in the data for body and kidney weight, serum biochemistry, serum IgA concentration, level of proteinuria, and percentage of glomeruli with α-SMA-positive mesangial cells were checked for homogeneity by Bartlett’s procedure. If the variance was homogeneous, the data were assessed by one-way analysis of variance. If not, the Kruskal-Wallis test was applied. When statistically significant differences were indicated, the Dunnett multiple comparison test was employed for comparison between the control and treatment groups. For histopathological changes, incidences were compared using the Fisher exact probability test, and severity was analyzed with the Mann-Whitney -test. Final body and kidney weights are shown in . ICGN mice had lower final body weights and absolute kidney weights than ICR mice at the same age. For ICGN mice, no significant differences in final body weight and kidney weight between control and treated groups were observed. In the 16 ppm NIV group of ICGN mice, a tendency towards a decreased final body weight was observed. For ICR mice, there was a significant decrease in final body weight in the infant 16 ppm NIV group, while there was no significant difference between controls and NIV-treated groups in adult ICR mice. Mean food consumption and intake of NIV are shown in . Mean daily food consumption decreased in the 16 ppm NIV groups for each strain and generation. Mean daily NIV intake almost doubled within strains and generations of mice as the dose increased. In the serum biochemistry, significant decreases in blood urea nitrogen (BUN) levels in the 16 ppm group of ICGN mice and in creatinine levels (CRN) in the 16 ppm group of infant ICR mice and 8 ppm group of adult ICR mice were observed compared with the corresponding controls (). The serum biochemical data of the ICGN mice did not show significant differences from controls or infant ICR mice. Other serum biochemistry parameters did not show any significant changes except for an increase in Alb in the 16 ppm NIV group of adult ICR mice. The concentration of IgA in the serum tended to increase, but there was no significant difference between controls and NIV-treated groups in ICGN mice (). In infant ICR mice, the serum IgA concentration in the 16 ppm group increased significantly, while there were no changes after NIV treatment in adult ICR mice. In all of the ICGN mice, the levels of proteinuria were higher than in age-matched ICR mice, indicating onset of proteinuria in infant ICGN mice (). However, the levels of proteinuria did not rise with NIV treatment in any strain or generation. Histopathologically, a thickened basement membrane, mesangial expansion, and microaneurysm were observed in the glomeruli of all ICGN mice groups including controls (). The thickened glomerular basement membrane was observed diffusely in the kidneys of ICGN mice. The number of glomeruli with mesangial expansion tended to increase in NIV-treated groups, but there was no statistically significant difference (). Microaneurysms in the glomeruli and urinary casts in the distal tubules were also observed, but NIV treatment did not enhance these lesions in ICGN mice (data not shown). In ICGN mice, mesangial cells of the expanded mesangial area were positive for α-SMA (), and the number of glomeruli with α-SMA-positive mesangial cells increased in the 16 ppm NIV group without statistical significance (). In the expanded mesangial area of ICGN mice, PCNA-positive mesangial cells were not observed in any of the glomeruli (). Mild to severe mesangial expansion was observed in 1.21% of the total glomeruli of the bilateral renal tissue sections in the 16 ppm NIV group of adult ICR mice () compared to 0.23% in the control group (). No change in the mesangium was observed in lower-dose adult groups or any treated infant ICR mouse groups (a, b, and c). A small amount of granular deposition of IgA in the glomeruli was detected at the glomerular basement membrane and mesangial area in all of the ICGN mouse groups including controls. The level and localization of IgA deposition did not show any differences between the control and NIV-treated groups (). In infant and adult ICR mice, IgA deposition was observed in the glomerular basement membrane and mesangial area in all groups including controls (). The level and localization of IgA deposition were almost the same regardless of age or NIV-treatment. Compared with ICGN mice, the level of glomerular IgA deposition was lower in infant ICR mice at the same age. In the present study, the effects of NIV on the kidneys of infant mice were evaluated, and some changes were detected in ICGN mice. In adult ICGN mice, genetic glomerular lesions including a thickened glomerular basement membrane, focal or diffuse mesangial expansion without mesangial cell proliferation and microaneurysm were observed. Since 12 ppm NIV is known to induce IgA deposition in the mesangial area in normal C3H/HeN and C3H/HeJ mice, it would be expected that IgA deposition by NIV might induce additional mesangial lesions such as mesangial damage/proliferation and progressive matrix production in the mesangial area of ICGN mice. However, such noticeable effects were not detected in the glomeruli of NIV-treated infant ICGN mice in the present study, except for an increased number of glomeruli with α-SMA-positive mesangial cells. Four weeks of treatment with 24 ppm NIV was reported to increase the serum IgA level and IgA deposition in the glomeruli of female BALB/c mice, yet the same treatment did not enhance immunoglobulin deposition in the glomeruli of high IgA strain (HIGA) mice. However, NIV did not induce or enhance glomerular lesions, such as mesangial expansion, in either BALB/c or HIGA mice in the reported study. It was also reported that deoxynivalenol, another trichothecene mycotoxin, increased levels of serum IgA, circulating IgA immune complexes, mesangial IgA deposition, and hematuria without significant mesangial lesions in mice. Based on the results of the present and reported studies, treatment with NIV for 4 weeks might be insufficient to induce aggravation of genetic glomerular lesions or obvious histopathological changes in the glomeruli and other renal components in ICGN mice. In particular, the highest dose of NIV was 16 ppm in the present study, which was lower than the 24 ppm dose used in previous studies. Therefore, the doses in the present study might be insufficient to induce or exacerbate glomerular lesions in ICGN mice. In the present study (), NIV treatment with ICR mice led to increases in the serum IgA concentration in infants and mesangial expansion in adults in the 16 ppm groups. Unexpectedly, no glomerular changes were observed in infant animals compared with adult animals. This result indicates that the histopathological sensitivity to NIV might be weaker in infant mice than in adult animals. However, in adults, the percentage of glomeruli with mesangial expansion was very low (1.21%). Similar to C3H/HeN and C3H/HeJ mice, the observed effects of NIV in adult ICR mice in the present study were mild. Therefore, the effect of NIV on the kidneys of adult ICR mice might be generally mild. In addition, it was reported that the sensitivity of kidneys to toxic chemicals shows strain differences. Treatment with 10 mg/kg body weight of Adriamycin (ADR) induced severe proteinuria in BALB/c mice, while the same dose of ADR did not induce proteinuria in C57BL/6 mice. Therefore, ICR mice could potentially be a resistant strain to the effect of NIV. A further factor regarding weak NIV effects in ICR mice may be the NIV concentration in the diet. Although the cause of the decreased concentration of NIV in the prepared diet could not be identified, the variation of NIV concentration in the diet might also be a cause for reduced NIV toxicity. In humans, IgA nephropathy (IgAN) is defined as chronic glomerulonephritis accompanied with mesangial proliferation, expansion of the extracellular matrix, and granular IgA deposition in the mesangial area. Recently, it was shown that circulating immune complexes containing aberrantly glycosylated IgA1 play a pivotal role in the pathogenesis of human IgAN. Although an increase in serum IgA concentration in infant mice and deposition of IgA in the glomeruli of all treated mice were observed in the present study, mesangial lesions were not prominent. Circulating IgA without aberrant glycosylation and insufficient deposition of IgA to the mesangial area might be related to the lower incidence and severity of mesangial lesions observed in NIV-treated mice. In conclusion, detailed analyses of the glomeruli did not provide clear evidence that diseased or healthy infant mice were toxicologically sensitive to NIV under the present experimental conditions. Human infants face a risk of exposure to nephrotoxins in their daily food intake, including mycotoxins. Further studies are needed to investigate the validity of the ICGN mouse model and to develop other suitable animal models for infant renal toxicity studies.

In general, hypoxia within tumor tissues plays a significant negative role in the treatment of malignant neoplasms, because the angiogenesis, evasion of apoptosis and increased glycolytic rate are all adaptations made by tumors in the hypoxic microenvironment. To improve therapeutic efficacy, recent efforts have been concentrated on the concept of eliminating the hypoxic state of tumors in order to remove the driving force behind these adaptations. Hyperbaric oxygen (HBO) therapy has been considered to control the hypoxia of the tumor microenvironment and possibly improve treatment outcome. HBO therapy refers to breathing pure (100%) oxygen under increased atmospheric pressure. This potential capacity is believed to reflect an increase O level in tumor cells and conquer hypoxic situation by increased amount of dissolved oxygen in the tissue. HBO may elevate blood levels of active oxygen, which would generate free radicals and cause cellular DNA damage in tissues. However, the effect of utilizing HBO for cancer treatments has not been clarified yet. HBO has been reported to increase tumor radiosensitivity both in basic and clinical studies. HBO has been used as combination treatment with chemotherapy and radiation therapy for malignant tumors. In our University Hospital, HBO therapy has been used for wound healing, recovery of radiation-injured tissues and cancer treatment in neurosurgery and radiation oncology. However, many clinicians and researchers do not yet recognize HBO therapy as an effective mechanism of cancer treatment. It still remains controversial in cancer treatment. Therefore, the role and modifying mode of HBO with regard to tumors need to be analyzed. In this study, we examined the modification effects on tumors developed under an HBO environment in skin two-stage chemical carcinogenesis using 7,12-dimethylbenz[a]anthracene (DMBA) and 12-O-tetradecanoylphorbol-13-acetate (TPA). A total of 51 six-week-old inbred CD-1 female mice (Japan SLC, Hamamatsu, Japan) were housed in cages with access freely to pelleted diet (CE-2, CLEA Japan, Inc., Japan) and drinking water and exposed to a 12-hour light-dark cycle during the experimental period. Mice were divided into the following five groups: group 1, normoxia and DMBA/TPA (n=19); group 2, HBO and DMBA/TPA (n=21); group 3, HBO and DMBA/acetone (n=3); group 4, normoxia and acetone (n=3); and group 5, non-treatment group (n=5) (). Animal care and experiments were approved by the University of the Ryukyus Animal Ethics Committee and carried out in accordance with the guidelines for animal experimentation of the University of the Ryukyus. For two-stage chemical carcinogenesis, the dorsal skin of mice was shaved using surgical clippers. After a 1-week quarantine period, 25 nmol DMBA (Sigma-Aldrich, St. Louis, MO, USA) dissolved in 0.2 ml acetone per mouse was topically applied to mice once except in group 5. After 2 weeks, we began twice-weekly applications of 8.5 nmol TPA (EMD Chemicals, San Diego, CA, USA) in 0.2 ml acetone per mouse in groups 1 and 2 (), and this was continued until the end of the experiment. Acetone was applied to mice in groups 3 and 4 instead of TPA. After DMBA was applied, mice in groups 2 and 3 were placed in a hyperbaric chamber (Barotec Hanyuda Co., Ltd., Tokyo, Japan) to be exposed to HBO. HBO was administered at a pressure of 2.2 ATA (atmospheres absolute) for 90 minutes. A minimum of 15 minutes of pressurization and depressurization was allowed for animals to adjust to the changes in pressure. HBO was administered 5 days a week. Mice were euthanized under deep anesthesia at 23 weeks from the start of the experiment (). =4/3π (a)(b), where (a) is the minor and (b) is the major axis (mm) of the tumor. Histopathologically, the skin tumors in groups 1 and 2 that were larger than 3.5 mm in diameter were examined by hematoxylin and eosin (HE) staining. According to the criteria of Conti , papillomas were judged based on two categories: low-grade papilloma, which is a well-differentiated hyperplastic lesion with no atypical cells or with very few atypical cells in the basal layer, and high-grade papilloma, which is a lesion with more than two-thirds of the thickness of the epithelium occupied by atypical cells. For inflammation, the induced inflammation state was divided into persistent and active; persistent: it appears almost lymphocyte infiltration in tumoral stroma with slightly edema; active: it appears predominantly neutrophil infiltration with lymphocytes in tumoral stroma, with increased and dilated vessels. In order to measure cell proliferation in the skin tumor, the Ki-67 labeling index (LI) was determined. Immunohistochemical staining was performed as described in our previous study. The embedded tissues were cut into 4-μm sections and then stained using anti-Ki-67 antibody (Dako, Carpinteria, CA, USA) and an LSAB Kit (Dako). Five hot spots within each tumor were selected, and the number of positive cells (dense brown precipitate restricted to the nuclei) in 500 cells for each tumor was counted to determine the Ki-67 LI, which was defined as the proportion of positive cells. The histopathological diagnosis and Ki-67 LI evaluation were confirmed by multiple pathologists. Data obtained in this study are presented as means ± SEM (standard error of the mean). We used InStat (GraphPad Software, La Jolla, CA, USA) for data analysis. Welch’s test or the -test was used to determine the significance of differences between groups. values of <0.05 were considered significant. All mice survived throughout the experimental period. There were no significant differences in the initial or final body weights between mice in all groups. The appearance of tumors in group 2 occurred at 8 weeks after the beginning of the experiment, whereas they began to appear in group 1 at 9 weeks. At 12 weeks, the incidences of tumors in groups 1 and 2 were 20% and 38%, respectively (). Ten of 19 mice in group 1 and 14 of 21 mice in group 2 had macroscopic tumors on the surface of dorsal skin at the end of the experiment ( and ). Final incidences of tumors in groups 1 and 2 were 53% and 67%, respectively (). The final multiplicities of tumors in groups 1 and 2 were 3.30 ± 0.87 and 3.35 ± 0.64, respectively (). There were no significant differences in tumor incidence and multiplicity between groups 1 and 2. Although the average volume (21.75 ± 9.03 mm) of tumors in group 2 was greater than that in group 1 (13.81 ± 4.63 mm), there was no significant difference between these groups (). No effects on the skin were observed in groups 3, 4 and 5. In addition, none of the other organs were affected by HBO in any group. Histopathologically, the skin tumors larger than 3.5 mm in diameter in group 1 included 11 low-grade papillomas, 1 high-grade papilloma and 1 basal cell carcinoma (BCC), while there were 6 low-grade papillomas, 12 high-grade papillomas, 4 squamous cell carcinomas (SCCs) and 1 keratoacanthoma (KA) in group 2 (). There was the difference in the occurrence of tumors showing low-grade and high-grade papillomas and SCCs between these groups according to the -test (<0.05, ). Compared with the stromal inflammation reactions of the tumors in group 1, those in group 2 tended to be more associated with leukocyte infiltration and edema in the stroma, without statistical significance (). Concerning the effect of HBO on cell proliferation, the Ki-67 LI was analyzed in groups 1 and 2. The Ki-67 LIs for low-grade papilloma, high-grade papilloma, SCC, BCC and KA are summarized in . The Ki-67 LIs for low-grade papilloma in groups 1 and 2 were 15.27 ± 2.54% and 29.67 ± 2.82%, respectively, and there was a significant difference in Ki-67 LI for low-grade papillomas between groups 1 and 2 according to the Welch’s test (<0.01). However, there was no significant difference in the Ki-67 LI for high-grade papillomas between these two groups. To the best of our knowledge, this study is the first report to examine an effect of HBO on a mouse skin two-stage chemical carcinogenesis model . We tried to compare the tumorigenesis and proliferative state in the chemical carcinogenesis model between HBO and normoxia groups. In the past, many similar experiments were performed to culture cells but there were a few studies . In the clinical study of advanced epithelial tumors of the head and neck, treatment with HBO markedly suppressed local tumor growth and significantly suppressed remote metastasis of a tumor to the lung. HBO has been applied to clinical practice; however, the effect of HBO on tumors has not been clarified. HBO therapy has been used in clinical medicine in combination with radiotherapy or chemotherapy for cancer treatment, but no obvious answer has been reported concerning the efficacy of HBO alone against tumors. In this study, the experiment was designed to examine the effect on tumor cells actually in an environment similar to a living body in a mouse chemical carcinogenesis model. The results showed that the tumor volume in group 2 was greatly increased compared with that of group 1; that is, HBO hastened the growth of tumors, although there was no statistical difference ( and ). Pande also reported a similar result, i.e., there was accelerated growth and progression of tumors after HBO therapy. Furthermore, McMillan . reported that HBO appears to have a stimulatory effect during the proliferative phase of carcinoma in hamster cheek pouch carcinogenesis. Histopathologically, the appearance of the tumors in group 2 was more progressive or aggressive than that in group 1 (). This suggested that the HBO treatment under the present conditions had a proliferative and aggressive affect on tumor cells. We also found that the cell proliferation of low-grade papillomas in group 2 with HBO was higher than that in group 1 without HBO, although there was no statistical difference in cell proliferation of high-grade papillomas between groups 1 and 2 ( and ). It seems that HBO influences cell growth. Generally, HBO is often used in combination with radiation therapy. The combination of HBO and radiation therapy is particularly effective for local tumor control according to the results of a trial of the British Medical Research Council. The effectiveness of the combination of chemotherapy and HBO has also been reported by Stuhr and Kalns .. The results of the present study, which showed that HBO increased the Ki-67 LI in tumor cells, confirm their conclusions concerning one of mechanisms of HBO effectiveness in the combination therapy by irradiation against cancers, because irradiation is much effective to mitotic cells (Ki-67-positive cells). Additionally, HBO is known to induce DNA damage in humans and experimental animals. In the present study, there is a possibility that the oxidative stress resulting from HBO therapy influenced the initiation phase in tumorigenesis, but it is complex to distinguish the DNA damage in lesions affected with HBO from those by DMBA and TPA used in this model. Further studies are needed. In conclusion, we found that the HBO accelerated tumor development and enhanced tumor growth in a mouse skin chemical carcinogenesis model. Since there are several inconsistent reports regarding the effect of HBO, further investigations about the combined effect of HBO with radiotherapy or chemotherapy on tumor development are necessary.

Ricin, a powerful cytotoxic protein derived from the seeds of the castor oil plant, consists of two polypeptide chains named ricin toxin A chain (RTA) and ricin toxin B chain (RTB) linked via a disulfide bridge. RTB mediates the binding to glycolipids or glycoproteins on the cell surface via its lectin receptors, followed by endocytic uptake into the cell. After endocytosis, ricin is transported retrogradely from endosomes to the Golgi and further on to the endoplasmic reticulum (ER), which is its unique trafficking pathway in the cell. As a potent toxin, ricin kills eukaryotic cells by inhibiting protein synthesis, inducing serious intoxication symptoms in poisoned people. Both antibodies and competitive ligands have been used to intervene in the binding of the toxin to cells. The morbidity and mortality of ricin is dependent upon the route of exposure. When ingested, ricin causes severe gastrointestinal symptoms followed by gastrointestinal hemorrhage with hepatic, splenic and renal necrosis. There is a latent period of more than 8 hours post ingestion after oral exposure before the symptoms of poisoning are observed in animal models. Research into antitoxins against ricin poisoning has attracted wide attention, including prophylactic and therapeutic strategies. More in-depth research on the trafficking and toxicity of ricin in animals is expected to shed light on its toxic mechanism and even contribute to prophylactic agent design and prediction of the therapeutic window for specific antidotes. In this paper, we aimed to investigate the absorption and distribution process of ricin and to analyze the pathologic injury to mice during toxic symptom latency. In order to evaluate the intestinal absorption process in mice after ingestion of ricin, Caco-2 cells were used to establish a monolayer cell model to determine the absorption and transformation. For a better understanding of ricin absorption, we also used the everted intestinal sac model to validate the uptake route of ricin from the gastrointestinal tract in Wistar rats. The cytotoxicity of ricin in Caco-2, HepG 2, H1299 and MDCK cells was determined to compare their sensitivity to ricin poisoning. The distribution of ricin in different tissues of mice intoxicated at different time points was determined by immunohistochemistry. So the monolayer cell model, the isolated and reverted intestine, and the mouse ingested model were used to analyze the absorption process of ricin. It will be helpful to explain the absorption, distribution and even intoxication of animals poisoned along the alimentary tract with reference to the results of pathological changes in the liver, kidney, lung, spleen and intestine induced by ricin. The ricin used in this study was supplied by the Laboratory of Toxicant Analysis, Beijing Institute of Pharmacology and Toxicology. Human non-small lung cancer cell line H1299, human colon carcinoma cell line Caco-2, human hepatocellular liver carcinoma cell line HepG 2 and Madin-Darby canine kidney (MDCK) cells were obtained from the American Type Culture Collection (ATCC). Mouse ascites containing monoclonal antibodies (Mab 4C13 and Mab 3D74) were produced in the Beijing Institute of Basic Medical Sciences. The antibodies were purified using protein G sepharose 4 Fast Flow (Amersham), and Mab 4C13 was labeled with horseradish peroxidase (HRP) in our laboratory. Female CD1 mice and Wistar rats were supplied by Vital River Laboratory Animal Technology Co., Ltd. (SCXK [Jing] 2012-0001). They were housed in a controlled environment (21 ± 2°C; 55 ± 5% humidity; 12 h dark and light cycle with light provided between 6 am and 6 pm). Food and water were given . All the animal experiments were carried out in the Beijing Center for Drug Safety Evaluation and in accordance with a protocol approved by the Institutional Animal Care and Use Committee of the Center,which is in compliance with the guidelines of the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC). Cells were cultured in a MEM/EBSS medium supplemented with fetal bovine serum (FBS, GIBCO, 20% for Caco-2 cells and 10% for HepG 2, H1299 and MDCK cells), 1% nonessential amino acids, 100 units/ml penicillin and 100 µg/ml streptomycin and incubated at 37°C in the presence of 5% CO. Cells were subcultured when they reached approximately 80% confluence. First of all, Caco-2, HepG 2, H1299 and MDCK cells were seeded in 96-well cell culture plates at a density of 1×10 cells/well in complete medium supplemented with 20% or 10% FBS. After incubation, the cells were washed with serum-free medium and cultured with different concentrations of ricin (1, 10, 100 and 1000 ng/ml) diluted with serum-free medium. Cells cultured with 0 ng/ml of ricin were used as the normal control. At the designated time point (0.5, 1, 3, 6, 24 and 48 h), 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was added to each well. After 4 hours of incubation at 37°C, 150 µL dimethyl sulfoxide (DMSO) was added to dissolve formazan crystals completely for about 15 minutes at room temperature after the medium was removed. Absorbance at 490 nm was measured with a micro-ELISA reader (Varioskan Flash version 2.4.3, Thermo Scientific, Waltham, MA, USA). The optical density of samples without ricin (cells only) was set at 100%. The viability ratio of cells treated with ricin was calculated as: Viability ratio = A490/A490. Caco-2 cells were seeded in polycarbonate inserts with a pore diameter of 0.4 μm (24-well Millicell® Hanging Cell Culture Inserts, Millipore, Darmstadt, Germany) at a density of 3×10 cells/well in complete medium supplemented with 20% FBS. The media volumes were 0.45 ml and 0.6 ml in the apical (AP) and basolateral (BL) compartments, respectively. The media on both sides was replaced every other day. The cells were cultured in an incubator at 37°C with 5% CO and allowed to differentiate for 21 days. The baseline transepithelial electrical resistance (TEER) value of the inserts was more than 550 Ω/cm, representing good monolayer integrity. Media on both sides of the compartments were aspirated, and the compartments were washed twice with Hanks balanced salt solution (HBSS, NaCl 136.9 mM; KCl 5.4 mM; NaHPO·HO 0.3 mM; Hepes Free Acid 25.2 mM; pH 7.2–7.4). The cells were incubated in HBSS at 37°C for 20 min in order to balance their internal environment, and 0.35 ml aliquots of 0, 1, 10, 100, 1000 and 10,000 ng/ml of ricin in HBSS were added to AP compartments; 1.4 ml HBSS aliquots were added to BL compartments. We also added 0, 100 and 10,000 ng/ml of ricin in HBSS into AP compartments without Caco-2 cell culturing to see whether ricin could permeate the well base directly. At different time points (15, 30, 60, 90, 120 and 180 min) after ricin administration, 120 µL samples from the BL compartment were transferred to conical centrifuge tubes, and the same volume of fresh HBSS buffer was added to the compartment. At the end of the experiment, all the remaining samples were removed. All samples collected were stored at –20°C until they were analyzed by sandwich enzyme-linked immunosorbent assay (ELISA). After 12 h of fasting, female rats weighing 200–250 g were anesthetized with an overdose of ether and euthanized. The duodenum, jejunum, ileum and colon segments were removed and washed with Kreb’s solution (118.0 mM NaCl, 4.7 mM KCl, 2.5 mM CaCl, 25.0 mM NaHCO, 1.2 mM KHPO, 1.2 mM MgSO, 11.1 mM glucose). The soft end of a homemade silicone casing tied around the end of a plastic cannula was put into the intestine with silk thread ligaturing, and the intestine was flipped carefully before the inside intestine was washed with the Kreb’s solution. The everted part was cut into 5 cm segments. The other end of the intestine was closed by ligature. The intestinal sac was then immersed into a Maxwell bath tube filled with 60 ml of 10 μg/ml ricin in Kreb’s solution at 37°C and supplied with mixed gas containing 95% O and 5% CO. Two milliliters of Kreb’s solution was injected into the intestine to balance for 5 min. Sample aliquots (22 μl) were removed from the intestinal sac at the time points of 15, 30, 45, 60, 90, 120, 150 and 180 min, respectively, and an equal volume of Kreb’s solution was replenished after each sampling. The removed samples were stored at –20°C until measurement by ELISA. ELISA was performed as described previously. Different epitopes could be recognized by Mab 3D74 and Mab 4C13. We used Mab 3D74 and Mab 4C13 labeled with HRP to establish the ELISA for ricin detection. Ricin could be captured by Mab 3D74 coated on enzyme immunoassay (EIA) plates (96-well, Costar) and then detected by HRP-labeled Mab 4C13 with the sensitivity limit of 2.5 ng/ml ricin in PBST, serum and water. Briefly, the plates (96-well, Costar) were coated with Mab 3D74 (400 ng/well) and then incubated with samples before HRP-labeled 4C13 was added. Ricin was detected by measuring the activity of HRP conjugated to 4C13 colorized with tetramethylbenzidine (TMB) substrate. Female CD1 mice (body weight 20 to 22 g) were used for the experiment. After 12 h of fasting, animals were intragastrically administered ricin at a dose of 0.1 mg/kg of body weight. The ricin was diluted with saline to a concentration of 0.01 mg/ml. The intoxicated mice received 0.1 ml of ricin/10 g body weight. Mice in the control group (n=4) were intragastrically administered saline. At the designated time points (1, 3 and 6 h) postexposure, the plasma samples were separated, and the nephrotoxicity and hepatotoxicity related to biochemical indicators were detected by a biochemical analyzer (Hitachi 7180) at the National Beijing Center for Drug Safety Evaluation and Research. Proximal small intestine, liver, spleen, lung, and kidney samples were dissected out and fixed in 10% formalin. The proximal small intestine, liver, spleen, lung and kidney were fixed in 10% formalin for 24 h prior to processing and paraffin embedding. Sections 3 μm thick were prepared and analyzed by immunohistochemistry. Monoclonal antibody 4C13 has been used to immunoprecipitate ricin or RTA in the tissues of poisoned mice and to analyze the toxin in detoxified meal of castor beans by Western blotting. For analysis of ricin, sections were prepared and analyzed by immunohistochemistry using Histostain-Plus Kits (Zymed Laboratories, San Francisco, CA, USA), Mab 4C13 (1 μg/ml) and the peroxidase-conjugated goat anti-mouse IgG (1/1000, Wuhan Boster Biological Technology, Ltd., Wuhan, China). Tissue processing, embedding, sectioning and staining were performed at SOONBIO Technology Corporation. Tissue samples of the proximal small intestine, liver, spleen, lungs and kidneys were dissected out and fixed in 10% formalin. Sections 3 μm thick were prepared and stained with hematoxylin and eosin. Microscopic observation was performed under a Leica DMI3000 B fluorescence microscope, and photographs were taken using Leica Application Suite V3. The cytotoxicity induced by ricin in Caco-2, HepG 2, H1299 and MDCK cells was determined by MTT assay (). Cells were treated with serial dilutions of ricin for different lengths of time. The results indicated that there was little change in the survival rate of Caco-2 cells when they were treated with ricin for 0.5 to 6 h. However, the survival rate decreased significantly when cells were treated with the toxin for 24 h and 48 h. The survival rate decreased to between 60% and 70% when cells were treated with 1 μg/ml of ricin for 24 h and 48 h. The cells treated with 1 to 1000 ng/ml of ricin exhibited almost the same survival levels, indicating that 1 ng/ml ricin could reach the highest level of cytotoxicity. Compared with Caco-2 cells, HepG 2, H1299 and MDCK cells exhibited high sensitivities to ricin. After treatment with 10 ng/ml of ricin for 48 h, 60% of Caco-2 cells, 50% of HepG 2 cells, 25% of H1299 cells and 13% of MDCK cells survived. Ricin can be taken up by endocytosis. It is unknown whether ricin can transfer through the intestinal epithelium via the paracellular route. We used Caco-2 monolayers to represent the intestinal epithelium and collected the samples from the BL compartments for ricin determination by ELISA. When 100 ng/ml of ricin was directly loaded into a cell-free insert, about 1 ng/ml of ricin, which was lower than the limit of detection, was detected in samples from the BL compartments. However, when 10 μg/ml of ricin was loaded, the signal of ricin transportation across the insert base was significantly increased (). These data indicated that ricin could be well absorbed by the polycarbonate insert, which would decrease the concentration of ricin in the BL compartment, especially when a low concentration of ricin was loaded. However, when we loaded 10 μg/ml of ricin on Caco-2 cell monolayers, no ricin was measured in the BL compartment even at 180 minutes postexposure (). The everted intestine sac model has been well used in the research of drug absorption and metabolism. We established an intestine sac model to determine the ricin in the internal sac after the everted intestine was immersed in a high concentration of ricin for different lengths of time. The results in showed that ricin could pass through the everted intestine within 1 h. The main sections were the jejunum and ileum. We have mentioned that ricin could not pass through monolayer Caco-2 cells even at the high concentration of 10 μg/ml (). In this experiment, when the intestine sac was immersed in the same concentration of ricin, the toxin could be detected in the opposite part of the intestine wall, indicating that the toxin could not be transferred through the intestine wall through cells directly but could be transferred through the blood vessels, which was not distributed in the monolayer cell model. When ricin is administrated intragastrically, it should be absorbed into the blood circulation and then distributed in different tissues of organs. The intestine must be the main tissue for its absorption along the alimentary tract, but what we need to find out is whether it is the main section for toxin distribution and how fast it accumulates in important organs. We gave mice a lethal dose of ricin and collected the lungs, liver, kidneys, spleen and proximal small intestine to examine the toxin with a specific antibody against ricin by immunohistochemistry (). The results showed that ricin could penetrate into the lung, liver, kidney and spleen quickly through the blood circulation. Ricin could be colorized in these tissues at even 1 h after intoxication. In the intestine samples of mice intoxicated for 1, 3 or 6 h, only slightly tinted brown spots were found, and at 24 h, a large number of dark brown spots appeared. It seems that ricin enters intestine cells slowly even if the intestine is the major tissue exposed to ricin via alimentary intoxication. As shown in , apparent injury to the liver and kidneys of poisoned mice was observed as early as 1 h after toxin treatment. The liver cells were considerably swollen, with their structures damaged and the density different from normal after poisoning for 1, 3, 6 or 24 h. The renal glomerulus showed hemorrhage, and some endothelial cells of vessels of the kidneys were absent. The renal pelvis was bleeding, and edema was observed in renal tubule cells. These symptoms deteriorated with the passage of time. In the spleen, widespread hemorrhage was found. However, there were few lesions in the proximal small intestine compared with the toxic changes in the kidneys. We have mentioned that kidney cells might be more sensitive to ricin than intestine cells. This result was also concordant with the distribution of ricin in different tissues of mice after ricin poisoning. At 24 h after poisoning, the mice developed a mild to moderate necrotizing pneumonia, with slight interstitial edema and diffuse perivascular inflammation. At 3 h after ricin intoxication, the serum samples of mice were examined to evaluate nephrotoxicity and hepatotoxicity. The results in summarize some of the related parameters in blood. At 3 h after ricin treatment, the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) were significantly higher than those of the control, being consistent with the results of rats poisoned with ricin reported by Balint. His results indicated that the serum ALT and AST values were significantly increased compared with the control after 24 h ricin exposure by the i.p. route. The elevated creatinine (CREA) level indicated the decline of the glomerular filtration rate, and the high creatine kinase activity (CK) suggested the possibility of myocardiolysis induced by ricin poisoning. A preliminary study of Kumar . revealed the same hepatotoxicity and nephrotoxicity in mice at 24 h post ricin via i.p. treatment. Whether the decreased level of BUN was related to the inhibition of protein synthesis and metabolism requires the further investigation. Ricin has the potential to be one of the most used toxins by terrorists. Basically, the clinical syndrome resulting from ricin poisoning is dependent on the route of exposure. It is generally believed that aerosolized ricin is the most lethal route of exposure. Certainly the oral and injection routes can also pose a significant risk to humans. The obvious symptoms of ricin poisoning do not appear for hours, but gastrointestinal bleeding, liver necrosis, diffuse nephritis and diffuse splenitis would be likely to emerge systemically after the latency period. In this study, we determined the cytotoxicity of ricin in Caco-2, HepG 2, H1299 and MDCK cells. The results indicated that MDCK and H1299 cells were more sensitive to ricin exposure, and this could be due to the glycoprotein or glycolipids on the surface of cells, which facilitate the entry of ricin, and the P-glycoprotein expression on the cell membrane, which could pump ricin out of cells. Our results showed that ricin could pass through the everted intestinal sac and be quickly transmitted to the liver, kidneys, spleen and lungs of mice intoxicated by gastric gavage . However, no ricin transmission was determined through Caco-2 cell monolayers. Previous research showed that the major disadvantage of Caco-2 cells was their low transportation rate. This research showed that Caco-2 cells were generally 20–40 times less permeable than cells of the normal human colon and 6–100 times less permeable than cells from the rat intestine. We presumed that the ricin transported through tight junctions and exocytosis from cells was absorbed by the basement membrane of the polycarbonate insert. Although the Caco-2 cell monolayer has been widely used to evaluate the transport of small molecules across the intestinal barrier, the absorption of compounds by the insert should be taken into consideration when bigger molecules, like proteins, are evaluated. Mantis . determined the effect of reducing RTA with IgA Mabs on the transepithelial transportation of ricin. In their research, MDCK II cells were used to establish monolayers, and the transport of biotinylated ricin was measured at 18 h after intoxication. In our research, we observed that after being cultured in serum-free medium for more than 4 h, the tight junction of Caco-2 cells became noncohesive, providing a pathway for ricin transport. In order to examine the ricin transportation through the normal intestine, the experiments were carried out within 3 h of ricin treatment. It was interesting that ricin could quickly pass through the everted intestinal sac, indicating that the internalized ricin could be secreted by exocytosis because the cell junctions are very tight and represent only 0.1% of the surface area of the intestine. The results of the test in vivo also exposed the slow accumulation of ricin in the intestine compared with the ricin distribution in the liver, lungs and kidneys. The pathological assay showed that the liver and kidney were most damaged in the initial period of intoxication. This result could be partly evaluated by their abundant blood supply and responsibilities for metabolism and excretion of ricin. The sensitivity of different cells to ricin exposure should be considered. Previous research showed that ricin exerts its toxicity on many different cell types, making it impossible to pinpoint the exact cause of death. Our experiment indicated that intestine cells were not as sensitive as other tissue cells to ricin poisoning even though they were treated with the same concentration of toxin. This was also found in the experiment . Although the intestine was the first tissue intoxicated with ricin, by gastric gavage, the kidney exhibited injury at 1 h after intoxication, which appeared much faster than the damage to the intestine. It was previously reported that it took at least 6 h to traffic a significant amount of ricin from the mouse stomach to the blood stream. Indeed, the absorption and distribution of ricin depend on many factors. Some physiological factors, such as gastric emptying and intestinal transit, also influence absorption. Our results of immunohistochemistry showed that ricin began to accumulate in the liver, spleen, kidneys and lungs at only 1 h post exposure in accordance with the pathological damage observed. This result indicated that although there were no significant toxic symptoms within several hours post intoxication, some important tissues were being injured and that the injuries were progressing; these injuries appeared much earlier than diarrhea induced by the injury to the intestine. Attention must be paid to the impairment of the liver and kidneys even in the initial stage of poisoning, and necessary symptomatic treatment needs to be provided to humans afflicted with ricin intoxication.

G-quadruplexes (GQs) are noncanonical secondary structures formed from G-rich sequences of nucleic acids, and play important roles in the regulation of gene transcription and translation. Formation of GQs in a telomere region causes inhibition of telomerase activity with subsequent obsolescence and cell death.[] GQ structures are found in some promoters of oncogenes, such as c-MYC,[] BCL-2,[] c-KIT,[] K-ras,[] VEGF.[] Therefore, GQs could be a key therapeutic target for anticancer drugs. Quarfloxin, a GQ-stabilizing drug for the treatment of neuroendocrine/carcinoid tumors has reached phase II clinical trials.[] Recently, a novel translation activation function of GQs in 3′-untranslated regions (3’-UTR) of messenger RNAs was also presented.[] While the idea of GQ-stabilizing/-destabilizing compounds looks promising for switching genes on and off, it is critical to measure kinetics of GQ folding in solution for efficient drug design and high-throughput screening of drug candidates. Finding kinetic parameters can relate the GQ folding time scale with biological processes like replication and transcription. Up to now, the most common techniques for studying of GQ conformations include circular dichroism (CD),[] UV absorption at 295/297 nm,[] non-denaturing gel electrophoresis,[] fluorescence-based single molecule methods,[] nuclear magnetic resonance (NMR),[] surface plasmon resonance (SPR)[] and X-ray crystallography (XRC).[] However, standalone CD studies the conformational changes in anisotropic molecules and chiral super assemblies in equilibrium, and for fast interactions it measures thermodynamic constants only. NMR shows the DNAs conformational dynamic in solution with atomic resolution. XRC provides a static picture of a DNA conformation. Alternatively, fluorescence resonance energy transfer (FRET)[], [] measures the relative distance between fluorescent residues or labels and requires fluorescent labeling that may interfere with DNA dynamics and ligand binding. The main disadvantages of NMR techniques are a requirement for the high concentration of a sample (around millimolar range) and difficulties in performing a multiplex study. Other solution-based techniques do not provide direct information about the structure of a GQ, making it challenging to interpret the data. The main methods for measuring kinetics of DNA folding and affinity binding are stopped-flow (SF)[] and SPR,[] both of which have the capability of calculating rate and thermodynamic constants of DNA binding to big biomolecules. They have restrictions due to mixing dead-time and re-dissociation of reagents for SF as well as mass transport to and heterogeneity of the surface of a SPR chip. In this article, we demonstrate the power of kinetic capillary electrophoresis coupled on-line with mass spectrometry (KCE-MS) to monitor individual DNA conformers and revealing rate and equilibrium constants of GQ DNA folding upon the binding to potassium ions. This represents an important step in deciphering fast kinetics of DNA folding, in addition to establishing KCE-MS as a real-time method for studying DNA dynamics and screening DNA binding ligands. Conceptually, KCE-MS is defined as an electrophoretic separation of compounds, which interact inside a capillary column during electrophoresis and are detected by mass spectrometry. Usually, separated analytes are detected by UV-VIS absorption or laser-induced fluorescence (LIF). These detection modes can be problematic for screening of complex mixtures with multiple targets and ligands. Therefore, the ability to acquire accurate molecular mass and structural information about the analytes is highly desirable. Capillary electrophoresis was coupled with mass spectrometry (CE-MS) over twenty years ago, which significantly advanced the field of nucleic acid and bioanalytical chemistry.[] Here, we connect KCE with MS on-line by electrospray ionization (ESI), a soft ionization technique, which keeps noncovalent complexes intact. It combines in one system the separation and kinetic capability of KCE together with molecular weight and structural elucidation of MS. The advantages of KCE-MS are that 1) DNA interacts with a ligand and folds at near physiological conditions, and all kinetic and thermodynamic parameters are measured in solution but not a gas phase; 2) DNA and ligands don′t need special labeling for the MS detection; and 3) interactions/foldings of several DNAs and ligands can be studied simultaneously in one capillary microreactor. KCE-MS implicates the benefits of both ion mobility, mass spectrometry and KCE-UV(LIF), where ion intensities, masses, electrophoretic mobilities and affinity of interacting compounds are determined. Ion mobility (IM) spectrometry separates ions on the basis of their collision cross section with a buffer gas. IM is fast and simple, and requires only a MS instrument with a drift cell. Nevertheless, the competitive binding, ion suppression during ionization and formation of nonspecific complexes in a gas phase could cause problems in interpretation of IM results. Fortunately, KCE can be coupled with IM directly, so that KCE separates interacting molecules based on their affinities and size-to-charge ratios in solution inside a capillary prior to the electrospray ionization (ESI), followed by IM separation in a gas phase and MS detection. KCE-based separation of GQ DNA involves two major processes. First, it includes the noncovalent interaction of an unfolded DNA (DNA) with a coordinating metal ion (M) leading to formation of a folded GQ complex (GQ-M) and dissociation of the complex regulated by a rate constant of complex formation () and a decay constant () []: Second, there is simultaneous separation of DNA, M, and GQ-M based on differences in their electrophoretic velocities in solution. These velocities are directly proportional to a size/charge ratio of DNA, M, and GQ-M. These two processes are described by the reaction scheme shown in and general system of partial differential : where [DNA], [M] and [GQ-M] are the concentrations of a unfolded DNA, metal ion, and a folded GQ–metal complex, respectively, , and are the migration velocities, , and are the diffusion coefficients, is the time, is the spatial coordinate along a capillary. Practically, a plug of an equilibrium mixture (EM) that consists of DNA, M, and GQ-M is injected into the capillary prefilled with the run buffer containing the metal ion with a total concentration identical to EM. Components of EM are separated by capillary electrophoresis while quasi-equilibrium is maintained between DNA, M and GQ-M complex inside the capillary (). This method is called equilibrium capillary electrophoresis of equilibrium mixtures (ECEEM).[] It is a mode of kinetic capillary electrophoresis (KCE), a platform for kinetic homogeneous affinity methods in which molecules interact with each other during electrophoretic separation.[] The unfolded DNA and folded GQ migrate with different velocities due to different shapes—GQ is more compact than unfolded DNA (), and thus migrates later than the unfolded DNA. There are three unique features of this separation: 1) DNA and GQ migrate as a single EM peak due to fast exchange between them, 2) the migration time of the EM peak depends on the concentration of M in the run buffer, so DNA sequences with different equilibrium folding constants, =/, migrate with different velocities and are separated from each other, and 3) EM peak broadening is dependent on the concentration of M, rate constants and characteristic separation time (). The characteristic separation time is the time required for DNA and GQ-M to separate from each other inside EM plug and is defined as []: where is the width of the initial EM peak. The general analytical solution of these nonlinear differential in partial derivatives is not known. In some cases like 1) the formation or decay rate constants are negligible or zero,[], [] 2) = or =, become linear directly or after the Cole–Hopf substitution.[], [] In our case, the molecular exchange between an unfolded DNA and a folded GQ-M complex is very fast. The relaxation time () to equilibrium for weak (>1 μ) and fast reactions depends on rate constants, DNA and M concentrations []: If >, the zones of DNA and GQ-M are separated before the re-equilibration in proceeds to a significant extent. Thus, unfolded DNA and folded GQ-M are moving as individual peaks. If ≈, re-equilibration in and separation proceed with comparable rates. Therefore, DNA and GQ-M are moving as two overlapping peaks. Finally, if <, the re-equilibration in occurs much faster than peak separation (our case), and, as a result, DNA and GQ-M will be moving as a single peak. The last case of fast molecular interactions is experimentally illustrated in . For the fast molecular exchange, when ≪ and [DNA]≪[M], the approximated is used: where is the velocity of the EM peak, is a physical diffusion coefficient for the EM peak and is a chemical induced coefficient of diffusion. They can be described as []: can be found from the expression: is well known in mathematics as Burgers’ equation and can be solved analytically if the injected EM plug is narrow (≪the length of capillary).[] The detailed mathematical solution is described in the Supporting Information. , , , are known, is found from . Afterward, is determined from , and =/. Interesting to note, ECEEM has a unique “accumulation” property. It accumulates the effect of molecular interactions in extra-long capillaries; it could reveal rates of extremely fast reactions, if >. We mixed 10 μ of GQ, forming a 15-nucleotide (nt) thrombin-binding aptamer (TBA) sequence (5′-d[GGTT GGTGTGGTTGG]-3′) with three mutated sequences (10 μ each, the flipped bases are italic), GM1 (d[GGTTGGTGTGGTG]), GM2 (d[GGTTGGTGGTGTG]), GM3 (d[GTGGGTG]) (equimolar mixture of GM1, GM2 and GM3 is labeled as GM), and separated in varying K concentrations from 10 μ to 2.5 m KCl in 12.5 m tris-acetate (TA) run buffer, pH 7.8. All DNA sequences have the same number of nucleotides and molecular mass (MW=4726.1 Da). As shown in , the GQ sequence is separated well from a mixture of mutated sequences upon increasing K concentration and visualized by UV () and MS detections (). Broadening of GQ peak has a bell-shaped curve, with a maximum width at approx. 150 μ of KCl, when fractions of unfolded DNA and GQ are equal (). Experiments carried out in the range of 15–450 μ of KCl, (0.1–3)×, provide the most confident results for finding rate and equilibrium constants. In this range, the EM contains both DNA and GQ in comparable amounts. Molecular diffusion can contribute to peak widening in a similar way as dynamic equilibrium between different DNA conformers. Moreover, in our case, the GQ peak became narrower with increasing migration time in experiments when [KCl]>500 μ—the phenomenon opposite to that could be caused by diffusion. Nevertheless, we found diffusion coefficients for GQ and GM by a CE method as described elsewhere.[] Briefly, we measured the change of GQ and GM peak widths with and without KCl. This was achieved by first moving an analyte in one direction to pass the UV detector and record the initial peak width. The analyte was then stopped to allow for its diffusion for 40 min. Finally, the analyte was moved back passing the detector for the second time and recording the final peak width. Diffusion coefficients for GQ and GM sequences were the same and equal to (1.4±0.1)×10 cm sec without KCl, and (4.5±0.2)×10 and (1.8±0.2)×10 cm sec in presence of 2 m KCl, respectively. The folding of DNA to a compact GQ structure decreases molecular cross section and a diffusion coefficient accordingly. The apparent folding constant () for GQ is (147±8) μ; is (1.70±0.41)×10 s ; for unfolding is (0.25±0.06) s. Half-life time of the complex is 2.8 s; relaxation time () equals 2.0 s in 150 μ KCl and 6.5 ms in 90 m KCl. To the best of our knowledge, this is the first report on kinetic parameters for fast DNA folding/unfolding in solution measured on-line by a separation technique and mass spectrometry. To confirm the value of measured by KCE-MS, we performed independent circular dichroism (CD) titration experiments and found equaled (126±4) μ for GQ–potassium complex (see the CD section in the Supporting Information). Our results are consistent as well with that reported by Zhang and Balasubramanian[] for the hTelo sequence (d[GGGTTAGGGTTAGGGTTAGGG]): =(120±20) μ, =(0.28±0.04)×10 s  and =40 ms in 90 m KCl using UV titration and stopped-flow techniques. The hTelo sequence is 21-nt long, has 3-quartet DNA G-quadruplexes and folds with a stronger positive cooperativity than TBA with 2 quartets only; therefore, hTelo has smaller and values and longer relaxation time. The challenge for MS detection is that molecular weights and / rations of all GM and GQ DNA sequences are the same due to the same nucleotide constitution. It makes these molecules unresolvable by means of MS only. Nevertheless, the differential affinity of DNA to K can be observed by direct injection mass spectrometry (DIMS). The main ions in DIMS are (GQ−4 H) for free GQ and (GM−4 H) for free GM (). Mixing with 2 m KCl eliminates free GQ as well as the Na adduct (), but brings several complexes of GQ with K where (GQ+K−5 H) and (GQ+2 K−6 H) are the main ions. The high concentration of KCl does not significantly change the amount of free GM (), which confirms the absence of specific affinity of GM to K. In DIMS experiments, the first and second dissociation constants for GQ–1 K and K for GQ–2 K have been previously found to be 119 μ and 556 μ, respectively.[] The apparent folding constant obtained in solution by KCE is inherently different from the consecutive dissociation constants and determined by mass spectrometry in a gas phase, because KCE does not resolve 1:1 and 1:2 GQ–metal complexes in solution. Complexation of GQ with two potassium ions causes GQ folding in a compact structure with smaller collision cross section (CCS) that is detectable by ion mobility spectrometry (IMS). GQ has shorter migration in CE and drift time in IMS experiments than GM sequences (). Addition of K ions to GM sequences increases a cross section and drift time as opposed to the GQ strand (). We also observed that Na and NH ions possessed weaker GQ stabilizing activity than K, as was previously shown.[] Important to note, NH-based buffers (popular in mass spectrometry) should be avoided in studying coordinating effects of nucleic acids with different ligands due to the fact that NH would compete with the ligands to bind to GQ making it harder to interpret experimental results. Balthasart et al.[] studied complexation of TBA (GQ sequence) with NH using IMS and found that the loss of NH from the complex does not change the CCS of nucleic acids, meaning that free TBA and TBA–NH complex have identical CCSs. These findings also support our conclusion that K is a stronger G-quadruplex stabilizing agent. Since GQ structures can regulate a broad spectrum of different biological processes and cancer development, it is of a great importance to search for compounds altering its stability. We tested a set of compounds that could possibly stabilize/destabilize GQ. These include nucleic acid binding dyes: SYTO, BOBO-1 iodide, BOBO-3 iodide. POPO-1 iodide, POPO-3 iodide, TOTO-1 iodide, TOTO-3 iodide, YOYO-1 iodide, YOYO-3 iodide; and an anticancer drug called cisplatin or -diamminedichloroplatinum(II). The dyes were supplemented into the run buffer as well as into samples of GQ, GM1, GM2, and GM3 sequences and were subjected to KCE-MS analysis. We did not observe any migration time shifts and peak widening in KCE, and did not detect GQ–dye complexes by MS in the range of dye concentrations from 50 n to 1.6 μ. We concluded that aforementioned DNA binding dyes did not possess any GQ stabilizing/destabilizing activity. Usually these dyes bind well to long double-stranded DNA. Unlike the dyes cisplatin demonstrated strong GQ destabilizing activity. Cisplatin coordinates to the N7 atoms of the purine (guanine and adenine) bases and forms a covalent adduct with two adjacent bases on the same strand of DNA. In this experiment, GM and GQ strands were derivatized with cisplatin with and without the presence of K ions (see Figure S1.2 in the Supporting Information). After derivatization, free DNA as well as monoderivatized strands were detected. Important to note, in cisplatin–DNA complexes both available bonds of cisplatin were used, which indicates intra-strand cross-linking. After cisplatin derivatization, DNA was no longer able to fold into GQ structure (see Figure S1.2 D in the Supporting Information). Therefore, cisplatin could be used as a strong and nonspecific GQ-destabilizing agent. Whitesides and co-authors were the first to apply CE for finding rate and equilibrium constants through a numerical approach of fitting reactant-propagation profiles.[], [] Most kinetic capillary electrophoresis (KCE) methods (non-equilibrium capillary electrophoresis of equilibrium mixtures (NECEEM), sweeping capillary electrophoresis (SweepCE), plug–plug KCE) cause irreversible perturbations in binding equilibrium and are not suitable for measuring reactions with fast re-equilibration (<). For example, in NECEEM, if the dissociation of a complex happens quickly, it is almost impossible to measure >0.1 s. In contrast, equilibrium capillary electrophoresis of equilibrium mixtures (ECEEM) considers both the forward and reverse process in the reaction. In this study, we coupled on-line kinetic capillary electrophoresis with mass spectrometry (KCE-MS) for the study of fast DNA conformations and dynamics in solution. We showed that peaks shift in CE and its widening can be used for the precise determination of rate and equilibrium constants for DNA–metal affinity interactions and DNA folding. We confirmed DNA folding by ion mobility (IM) spectroscopy and presented two-dimensional separation (KCE versus IM) of conformers in solution and a gas phase. In conclusion, KCE-MS establishes a new paradigm that separation methods together with MS detection can be used as comprehensive kinetic tools with mass and structure elucidation of nucleic acids. Most previous attempts to use chromatography and electrophoresis for studying nucleic acid interactions were restricted to assuming slow or no equilibrium between reactants. KCE shows that non-zero kinetics and structural dynamics must be taken into account when separation happens. KCE-MS could be a valuable supplement to IM-MS due to the separation of ions in solution according to their size-to-charge ratio. We believe that KCE-MS will be used in parallel with circular dichroism (CD), stopped-flow (SF), and surface plasmon resonance (SPR) techniques for studying nucleic acid structures and functions, screening DNA/RNA binding compounds and selecting aptamers. : All DNA sequences were purchased from IDT DNA Technologies (USA). For all experiments, 12.5 m tris-acetate, pH 7.85, was used as an incubation/run buffer. The buffer was prepared by dilution from 200 m tris-acetate stock buffer. The stock buffer was made by dissolving 12.11 g of tris-base (Bio Basic Inc., Canada, cat.# 77–86–1) and 2.86 mL of acetic acid (Bio Basic Inc., Canada, cat.# C1000) in 500 mL of ddHO. 100 m solutions of NHCl (Sigma–Aldrich, USA, cat.# 254134), NaCl (Sigma–Aldrich, USA, cat.# S7653) and KCl (Sigma–Aldrich, USA, cat.# P9541) were prepared in ddHO. 1 m 4,4′-(propane-1,3-diyl)dibenzoic acid (PDDA; Sigma–Aldrich, USA, cat.# S499455) was prepared in run buffer and used as internal standard in CE separation to normalize electrophoretic mobilities. Equilibrium mixtures of DNA and chlorides were prepared in the incubation buffer with 10 μ concentration of all DNA sequences. Concentrations of KCl were in the range of 10 μ–2.5 m. All solutions were filtered through 0.22 μm pore size nylon membrane filters (Millipore, Nepean, ON, Canada). The bare-silica capillary was purchased from Polymicro (Phoenix, AZ, USA). : The sample storage and capillary temperature was maintained at 25±0.5 °C. The electric field in KCE separation was 290 V cm with a positive electrode at the injection end. The run buffer was with one of the coordinating ions in the inlet reservoir. The concentration of the coordinating ions in the equilibrium mixture and the run buffer was the same for individual KCE experiments. For all experiments, the capillary was 89 cm long (30 cm in KCE-UV experiment, 20 cm to window) with an inner diameter of 50 μm and an outer diameter of 360 μm. The equilibrium mixture was injected into the capillary from the inlet end by a pressure pulse of 10 s×1 psi (0.3 psi for 3 sec in KCE-UV experiment). Before each experiment, the capillary was rinsed by 75 psi pressure with: 0.1  HCl for 3 min, 0.1  NaOH for 3 min, ddHO for 3 min, 12.5 m tris-acetate buffer for 5 min, and the incubation/run buffer with coordinating ions for 2 min. A Synapt G2 HDMS mass spectrometer from Waters (UK) was coupled with a PA800plus Pharmaceutical Analysis CE system having a PDA detector (Beckman Coulter, USA) through a CE-ESI sprayer from Micromass (UK) and used in all KCE-MS experiments. Electrospray ionization conditions were as follows: capillary voltage 3 kV, negative mode, sampling cone voltage 45 V, extraction cone voltage 3 V, source temperature 100 °C, cone gas 0 L h, nanoflow gas 0.5 Bar, purge gas 3 L h, mobility cell bias voltage 3 V. Sheath liquid (80:20 isopropanol/ddHO, 5 m triethanolamine) was delivered with a flow rate of 1.5 μL min.