Datasets:
ManuelAlv
/
Cancer

Dataset card Data Studio Files Community
1
input
stringlengths
600
32.7k
label
stringclasses
3 values
"In most of these studies miR-182 which contains two putative Sp1 binding sites within its upstream region was upregulated in lung cancer. When we examined miR-182 expression we found that miR-182 was decreased in Sp1-knockdown cells but increased in IMR-90 cells that overexpressed GFP-Sp1 (A and 1B) suggesting that Sp1 positively regulates miR-182 expression. Luciferase activity driven by the miR-182 promoter increased in H1299 cells overexpressing GFP-Sp1 (C) whereas luciferase activity decrease in cells treated with an Sp1 inhibitor mithramycin A (D). These results suggested that Sp1 is involved in miR-182 transcriptional activation. Using the TFSEARCH software we analyzed the miR-182 promoter and identified two putative Sp1 binding elements. Consequently recruitment of Sp1 to the miR-182 promoter was examined (E and 1F). Acetyl-histone3 was recruited to the Sp1 binding elements indicating that the region could recruit TFs (E panel b). Sp1 was also recruited to the miR-182 promoter (E panel c and panel d and 1F). When the Sp1 binding element at site 1 was mutated luciferase activity driven by the miR-182 promoter was abolished but no change was observed when the other Sp1 binding site was mutated indicating that the Sp1 binding element at site 1 is important for the Sp1-mediated expression of miR-182 (G). Sp1 regulates miR-182 expression (A) Scramble (shScr) and different doses of Sp1 shRNAs (shSp1) were transfected into A549 for 48 h. The miR-182 level was determined by stem-loop RT-PCR. U6 served as the internal control (panel a). Data were quantified after three independent experiments (panel b). (B) Different titer of adeno-GFP-Sp1 virus was infected IMR-90 cells for 48 h. The miR-182 level was determined by stem-loop RT-PCR (panel a). Data were quantified after three independent experiments (panel b). (C) Plasmids pGL2 or pGL2-miR-182 (-1000/+50) and GFP or GFP-Sp1 were co-transfected into H1299 cells for 24h. Cells were harvested to study the luciferase activity. Data were quantified after three independent experiments. (D) The plasmids pGL2 or pGL2-miR-182 were transfected into H1299 cells with mithramycin A treatment for 24 h. Cells were harvested for luciferase activity assays. (E) Schematic diagram indicates the location of putative Sp1 binding sites on miR-182 promoter region (panel a). ChIP assays were performed with anti-acetyl-H3 (panel b) and anti-Sp1 antibodies (panel c). DNA was extracted for PCR with miR-182 and p21 primers. Data were quantified after three independent experiments (panel d). (F) A549 cells were harvested for DAPA with a biotin-conjugated p21 and miR-182 promoter probes and samples were analyzed by Western blotting using anti-Sp1 antibodies (panel a). Data were quantified after three independent experiments (panel b). (G) Plasmids GFP or GFP-Sp1 were co-transfected with pGL2 pGL2-miR-182 WT or mutation plasmids into H1299 cells for 24 h and then cells were harvested for luciferase activity assays. Data are representative of three independent experiments each of which was performed in triplicate and presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01). Because Sp1 is highly expressed in lung cancer we studied the expression of Sp1 and miR-182 in various lung cancer cell lines and patient samples (). Compared with normal human lung cells (BEAS-2B) lung cancer cell lines expressed higher levels of miR-182 (A). We also assessed the correlation between the miR-182 and Sp1 expression patterns. Sp1 levels in clinical lung tissue samples were highly elevated in the tumorous sections of the lung accompanied by increased expression of miR-182 (B). To confirm this result Sp1 and miR-182 levels were measured in 32 lung cancer patients. Sp1 and miR-182 were upregulated by more than 1.3-fold in 59.4% of the lung adenocarcinoma specimens when compared to expression in normal tissue (C). These results indicate that Sp1 expression positively correlates with miR-182 expression (D). The miR-182 level correlates to Sp1 level Total RNA and cell lysates were prepared from indicated cell lines (A) or from clinical lung tissues of lung cancer patients (B). The miR-182 level was determined by stem-loop RT-PCR and Sp1 level was studied by Western blotting with anti-Sp1 antibodies. U6 and tubulin served as the internal control. (C) Total RNA and cell lysates were prepared from 32 paired normal lung tissues and lung adenocarcinoma samples. The miR-182 level was studied by stem-loop RT-PCR and Sp1 levels were studied by RT-PCR. (D) The relationship between Sp1 and the miR-182 level in the 32 lung cancer samples was statistically analyzed using Fisher's exact test. miR-182 increases lung tumor growth The data shown in indicated that Sp1 regulated miR-182 expression during lung tumorigenesis. To identify the specific gene targets of miR-182 we searched public miRNA target prediction databases (miRDB miRWalk and TargetScanHuman) for candidate target genes. By combining the data from these three databases we identified 161 genes potentially regulated by miR-182 (Supplementary Figure S1A). Moreover pathway analysis using Ingenuity software indicated that the cellular growth and proliferation pathway had the highest score when the association of these 161 genes with biological pathways was examined. This suggests that miR-182 may play a functional role in cancer-associated processes (Supplementary Figure S1B). Indeed when miR-182 was knocked down with miRZip-182 shRNA the percentage of cells in G2/M and sub-G1 phases increased suggesting that miR-182 positively regulated cell cycle progression in the lung cancer cells (A). To further elucidate miR-182's effect on the cell cycle cells were synchronized at prometaphase using nocodazole treatment. After removing nocodazole more miRZip-182 than miRZip cells remained in G2/M phase providing further evidence that miR-182 positively regulates cell cycle progression (B). Consistently knockdown of miR-182 expression inhibited cell growth (C). miR-182 increases cancer cell proliferation (A) The miRZip and miRZip-182 stably expressed H1299 cells were fixed with 70% ethanol and stained with propidium iodide for cell cycle analysis by FACS. (B) Mitotic cells were released into growth by removing nocodazole then fixed at indicated time points for cell cycle progression assay by FACS. (C) The growth rates of miRZip and miRZip-182 stably expressed H1299 cells were calculated by cell counting within 5 days. Data are representative of six independent experiments and presented as the mean ± SEM. (D) Bioluminescent imaging was performed on 10 severe combined immunodeficient (SCID) mice implanted with miRZip and miRZip-182 stable expression H1299 cells (106 cells/mouse) at day 14 (panel a) then image signal was analyzed using Living Image software and presented as total flux measurements in photons/second (panel b). (E) Tumors from SCID mice implanted with miRZip and miRZip-182 stable expression H1299 cells for 4 weeks are shown (panel a) and tumor weights were analyzed (panel b). Data are representative of ten independent experiments and are presented as the mean ± SEM. The level of statistical significance determined by t-test (* p<0.05; ** p<0.01; *** p<0.001). To confirm the effect of miR-182 on tumor formation cells stably expressing with miRZip or miRZip-182 were implanted into SCID mice and tumor growth was monitored in vivo (D). The miRZip lentivector contains a copGFP gene and the GFP signal in miRZip-182-expressing cells was lower than that in miRZip control cells (D). Furthermore tumor volume and tumor weight were also lower in miRZip-182-implanted mice than in miRZip-implanted mice (N = 10 per group) (E). These results suggest that miR-182 overexpression facilitates lung tumor growth in vivo. Sp1 inhibits FOXO3 expression by inducing miR-182 expression To investigate the molecular mechanism underlying miR-182-mediated cancer cell proliferation we studied an important miR-182 target gene FOXO3. FOXO3 expression was higher in cells stably expressing miRZip-182 than in control cells (A). Knockdown of miR-182 expression enhanced the luciferase activity of a pGL3 vector containing the 3?-UTR of FOXO3 (B) indicating that miR-182 downregulated FOXO3 expression. Further to determine whether Sp1 downregulated FOXO3 expression through miR-182 GFP-Sp1 was expressed in cells stably expressing miRZip-182 (C). Overexpression of GFP-Sp1 reduced FOXO3 protein expression in miRZip stable cells but increased FOXO3 levels in miRZip-182-expressing cells implying that different effect of Sp1 is existed on the regulation of FOXO3 expression. Regulation of FOXO3 by miR-182 and Sp1 (A) Lenti-miRZip and lenti-miRZip-182 viruses were infected into H1299 for 96 h individually. FOXO3 level was studied by Western blotting with anti-FOXO3 antibodies and miR-182 level was studied by stem-loop RT-PCR. (B) Plasmids pGL3 and pGL3-FOXO3-3'UTR were transfected into miRZip and miRZip-182 stably expressed H1299 cells for 24 h and then cells were harvested for luciferase activity assays. (C) Different doses of GFP-Sp1 adenovirus were infected into the miRZip and miRZip-182 stably expressed H1299 cells for 48 h. FOXO3 level was studied by Western blotting using anti-FOXO3 antibodies (panel a). Quantitative results from three independent experiments are shown (panel b). The level of statistical significance was determined by t-test (* p<0.05; *** p<0.001). Therefore we further investigated the relationship between Sp1 and miR-182 in the context of FOXO3 regulation. The expression of Sp1 and FOXO3 in patients with lung cancer was examined (Figure 5A). In normal tissue samples Sp1 levels were low and FOXO3 levels were high. In tumor tissue samples two Sp1 expression patterns i.e. high and low Sp1 expression were identified. Samples with higher Sp1 levels exhibited lower FOXO3 levels whereas samples with lower Sp1 levels exhibited higher FOXO3 levels suggesting that there is an inverse correlation between Sp1 and FOXO3 levels in lung specimen (Figure 5A). The levels of FOXO3 and Sp1 in the lung cancer cell lines A549 H1299 CL 1-0 and CL 1-5 were studied (Figure 5B). Higher levels of Sp1 expression were accompanied by lower levels of FOXO3 expression in A549 and CL 1-0 cells and lower levels of Sp1 expression were accompanied by higher levels of FOXO3 expression in H1299 and CL 1-5 cells suggesting that there is an inverse correlation between Sp1 and FOXO3 expression in lung tumorigenesis."
Lung_Cancer
" The median time to distant metastases was 18.4 ± 10.7 months in HCRT group and 16.7 ± 7.7 months in 3DCRT group (p?=?0.7). In the HCRT group distant metastases involved only the contralateral chest in three patients (30%) and only the abdominal cavity in three patients (30%). Both sites were affected by distant metastases in four further patients (40%). Discussion We demonstrate in a retrospective analysis of patients with MPM and treated at our institution with trimodality therapy that the use of postoperative highly conformal radiation techniques (HCRT) reduces local recurrence in comparison to 3DCRT. A recurrence analysis showed that in the case of 3DCRT 4 of 25 patients (16%) had a local recurrence in regions that were clearly underdosed according to current radiation protocols (doses???45 Gy are recommended e.g. SAKK 17/04) in contrast to 0% of patients treated with HCRT. This supports the hypothesis that HCRT should improve local control in comparison to 3DCRT by improving target volume coverage. In our study patients treated with HCRT showed a tendency for improved progression free survival and local relapse free survival but did not benefit in terms of overall survival due to the high rates of distant relapses. Local control is important in patients with MPM for symptom control but also because some patients might benefit in terms of improved overall survival. Better local control after HCRT did not translate into improved overall survival in our patient series. Remarkably the rate of death due to intercurrent disease most often cardiac events was higher after HCRT (29%) in comparison to 3DCRT (4%). Since cardiac sparing is rather improved with HCRT the most likely explanation for this difference is patient selection. The urgent research question if postoperative radiotherapy impacts on overall survival after EPP is addressed by a randomized study currently conducted in Switzerland SAKK 1704. Patient accrual for this study was terminated in 2012 and the results are awaited. Even after trimodality treatment local recurrence remains high in some patient series. In a retrospective series of 49 patients treated with 3D-conformal RT after EPP and chemotherapy 67% of all recurrences included the ipsilateral hemithorax and 25% of all recurrences were local only [12]. Therefore improvement of radiotherapy is mandatory. In recent years radiotherapy has made enormous technical advances. More sophisticated highly conformal radiation techniques (HCRT) such as IMRT or rotational RT (VMAT) have become available and substituted for the older 3DCRT technique. The use of HCRT enables improvement in the dose distribution and target volume coverage. This is because with HCRT even complex target volumes such as the tumor bed of the costodiaphragmatic recess or the pericardium can be treated without or with little dose compromise and at the same time with optimal sparing of the normal tissue due to a steeper dose fall-off. Thus the use of HCRT should intuitively improve treatment outcome in terms of local tumor control. Our data suggest indeed that the use of HCRT bears considerable potential to improve on hemi-thoracic tumor control rates most likely due to improved target volume coverage. The poor local control rates and high rates of in-field recurrences following 3DCRT in our cohort may be due to suboptimal dose coverage or the restriction of the target volume to avoid critical ans both limitations inherent to the technique. After 3DCRT 4/24 (16.6%) in-field recurrences occurred in regions covered with only 30“43 Gy. In the case of 3DCRT mixed beams of photons and electrons were used to optimize dose coverage. The match of these beams often causes cold and hot spots of dose coverage. Poor matching during daily treatment can result in >20% dose inhomogeneity in the junction area [7]. In addition as the spinal cord is blocked when the tolerance dose of 45 Gy is reached insufficient dose delivery to parts of the mediastinum has been observed resulting in underdosage to the tumor bed [7]. Favorable tumor control after IMRT as part of a trimodality therapy has previously been reported by Rice et al. [13]. The median overall survival of their 61 patients treated was 14.2 months with a locoregional recurrence rate of 13% and only 5% local in-field recurrences reported. The median dose prescribed was only 45 Gy and half of all patients received doses even less than 45 Gy. The reason for the comparatively higher local control rate reported by Rice et al. in comparison to our study remains unclear. It may be explained by patient selection and the comparatively short median overall survival of 14.2 months in comparison to 20.8 months in the present series and by the retrospective study design. The shorter median overall survival reported by Rice et al. could be caused by more advanced tumor stages (40 T3 8 T4 26 N2) more aggressive subtypes (14 biphasic 4 sarcomatoid) and the fact that neoadjuvant chemotherapy was not routinely administered. With regard to toxicity the major dose limiting an for postoperative radiotherapy of MPM is the contralateral lung. Lung complications such as radiation pneumonitis are likely to be higher with multi-field techniques such as IMRT or VMAT in comparison to 3DCRT where opposed beams from 0 and 180 degrees are usually used thereby optimally sparing the contralateral lung. With regard to dose escalation and lung sparing surgery protons might prove superior to IMRT/VMAT. Severe complications of the lung with grade 4 and 5 pneumonitis after IMRT have been reported [712]. Since then special attention to the contralateral lung dose has been given during the treatment planning process and pneumonitis rates should be lower today. Intuitively the use of HCRT should reduce toxicity and complication probabilities of esophagus heart liver and kidney however no data with regard to these toxicity endpoints comparing both treatment techniques are available. In recent years the need for extensive surgery has been questioned and less radical surgery has been advocated such as pleurectomy/decortication. In the context of reduced surgery the anatomical situation makes it difficult for RT to be applied to the entire pleural space however it can still be considered as a targeted local postoperative option in case of incomplete resection. Future clinical studies are required to define the role of radiotherapy in combination with lung sparing surgery. Conclusions In summary the use of HCRT for treatment of patients with MPM after EPP is likely to improve local control rates. The local control improvement did not improve the overall survival due to the high rates of distant relapses in this series. Further improvement of trimodal or systemic therapy is required to tackle the high risk of distant recurrences. "
Lung_Cancer
"We observed PTEN loss of CAFs in CRC patients and it was more frequently observed in the corresponding distant metastases. It is suggested that CAFs not only cancer cells have altered gene expression. Moreover loss of PTEN expression of CAFs in distant metastases was significantly correlated with the survival of patients. To our knowledge these are the first results showing PTEN loss in CAFs in CRC patients. Although more research is required we expect that it might be a prognostic factor in CRC patients. In our large cohort of advanced CRC patients with synchronous and metachronous distant metastasis we demonstrated the regional heterogeneity of stromal microenvironment factors according to the tumor location. The amount of microvasculature measured by LVD and MVD was also heterogeneous in relation to the metastatic an examined. By Cox regression analysis center LVD and MVD periphery LVD and CAFs in distant metastasis were independently associated with patients' prognosis in addition to synchronous distant metastasis age and perineural invasion. Heterogeneity of microenvironment not only of cancer cells is suggested to contribute to tumor heterogeneity and biologic complexity thus it should be considered in managing CRC patients. In addition our results showed that PTEN expression was altered in CAFs of CRCs suggesting that CAFs might have altered gene expression and play an active role in cancer progression. Supporting Information Figure S1 The prognostic association of stromal characteristics as it relates to tumor location. The analysis was performed by using cut-off values obtained by maximal chi-squared methods. (TIF) Click here for additional data file. Figure S2 Representative PTEN antibody stainings of stromal cells and the prognostic association of PTEN expression. (A) Intact expression of PTEN in CAFs (—400) and (B) loss of PTEN expression in CAFs (—400). (C“F) Kaplan-Meier survival curves for the center (C) and periphery (D) of the primary tumor lymph node metastases (E) and distant metastases (F) according to CAF PTEN expression status. (TIF) Click here for additional data file. Table S1 Pearson's correlation coefficients among center periphery lymph node metastasis and distant metastasis. (DOCX) Click here for additional data file. Table S2 Correlation coefficients between CAFs and LVD or MVD. (DOCX) Click here for additional data file. Table S3 PTEN expression in CAFs and clinicopathologic factors. (DOCX) Click here for additional data file. References 1 JemalA SiegelR XuJ WardE (2010) Cancer statistics 2010. CA Cancer J Clin60: 277“30020610543 2 Edge SB American Joint Committee on C American Cancer S (2010) AJCC cancer staging handbook: from the AJCC cancer staging manual 7th ed. New York: Springer. 3 KnijnN TolJ PuntCJ (2010) Current issues in the targeted therapy of advanced colorectal cancer. Discov Med9: 328“33620423677 4 Van CutsemE (2007) Optimizing administration of epidermal growth factor receptor-targeted agents in the treatment of colorectal cancer. Clin Colorectal Cancer6 Suppl 2S60“6518021489 5 AlbaneseI ScibettaAG MigliavaccaM RussoA BazanV et al (2004) Heterogeneity within and between primary colorectal carcinomas and matched metastases as revealed by analysis of Ki-ras and p53 mutations. Biochem Biophys Res Commun325: 784“79115541358 6 ParkJH HanSW OhDY ImSA JeongSY et al (2011) Analysis of KRAS BRAF PTEN IGF1R EGFR intron 1 CA status in both primary tumors and paired metastases in determining benefit from cetuximab therapy in colon cancer. Cancer Chemother Pharmacol68: 1045“105521340604 7 BaldusSE SchaeferKL EngersR HartlebD StoeckleinNH et al (2010) Prevalence and heterogeneity of KRAS BRAF and PIK3CA mutations in primary colorectal adenocarcinomas and their corresponding metastases. Clin Cancer Res16: 790“79920103678 8 PagetS (1989) The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev8: 98“1012673568 9 CampbellI QiuW HavivI (2011) Genetic changes in tumour microenvironments. J Pathol223: 450“45821294119 10 LohelaM BryM TammelaT AlitaloK (2009) VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol21: 154“16519230644 11 Muller-HubenthalB AzemarM LorenzenD HuberM FreudenbergMA et al (2009) Tumour Biology: tumour-associated inflammation versus antitumor immunity. Anticancer Res29: 4795“480520032438 12 RasanenK VaheriA (2010) Activation of fibroblasts in cancer stroma. Exp Cell Res316: 2713“272220451516 13 Des GuetzG UzzanB NicolasP CucheratM MorereJF et al (2006) Microvessel density and VEGF expression are prognostic factors in colorectal cancer. Meta-analysis of the literature. Br J Cancer94: 1823“183216773076 14 WeidnerN SempleJP WelchWR FolkmanJ (1991) Tumor angiogenesis and metastasis”correlation in invasive breast carcinoma. N Engl J Med324: 1“81701519 15 LindmarkG GerdinB SundbergC PahlmanL BergstromR et al (1996) Prognostic significance of the microvascular count in colorectal cancer. J Clin Oncol14: 461“4668636758 16 VermeulenPB VerhoevenD FierensH HubensG GoovaertsG et al (1995) Microvessel quantification in primary colorectal carcinoma: an immunohistochemical study. Br J Cancer71: 340“3437530985 17 GombosZ XuX ChuCS ZhangPJ AcsG (2005) Peritumoral lymphatic vessel density and vascular endothelial growth factor C expression in early-stage squamous cell carcinoma of the uterine cervix. Clin Cancer Res11: 8364“837116322297 18 KitadaiY KodamaM ChoS KurodaT OchiumiT et al (2005) Quantitative analysis of lymphangiogenic markers for predicting metastasis of human gastric carcinoma to lymph nodes. Int J Cancer115: 388“39215688374 19 JainRK FentonBT (2002) Intratumoral lymphatic vessels: a case of mistaken identity or malfunction?J Natl Cancer Inst94: 417“42111904313 20 TroskoJE RuchRJ (1998) Cell-cell communication in carcinogenesis. Front Biosci3: d208“2369458335 21 BarskySH GopalakrishnaR (1987) Increased invasion and spontaneous metastasis of BL6 melanoma with inhibition of the desmoplastic response in C57 BL/6 mice. Cancer Res47: 1663“16673815362 22 SkobeM FusenigNE (1998) Tumorigenic conversion of immortal human keratinocytes through stromal cell activation. Proc Natl Acad Sci U S A95: 1050“10559448283 23 OrimoA GuptaPB SgroiDC Arenzana-SeisdedosF DelaunayT et al (2005) Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell121: 335“34815882617 24 OlumiAF GrossfeldGD HaywardSW CarrollPR TlstyTD et al (1999) Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res59: 5002“501110519415 25 TsujinoT SeshimoI YamamotoH NganCY EzumiK et al (2007) Stromal myofibroblasts predict disease recurrence for colorectal cancer. Clin Cancer Res13: 2082“209017404090 26 MatsumotoN YoshidaT YamashitaK NumataY OkayasuI (2003) Possible alternative carcinogenesis pathway featuring microsatellite instability in colorectal cancer stroma. Br J Cancer89: 707“71212915883 27 KuroseK GilleyK MatsumotoS WatsonPH ZhouXP et al (2002) Frequent somatic mutations in PTEN and TP53 are mutually exclusive in the stroma of breast carcinomas. Nat Genet32: 355“35712379854 28 TrimboliAJ Cantemir-StoneCZ LiF WallaceJA MerchantA et al (2009) Pten in stromal fibroblasts suppresses mammary epithelial tumours. Nature461: 1084“109119847259 29 MekenkampLJ KoopmanM TeerenstraS van KriekenJH MolL et al (2010) Clinicopathological features and outcome in advanced colorectal cancer patients with synchronous vs metachronous metastases. Br J Cancer103: 159“16420551951 30 Bosman FT (2010) WHO classification of tumours of the digestive system/edited by Fred T. Bosman et al; anization WH Cancer IAfRo editors. France: Lyon: IARC Press. 31 LeeHS KimWH (2006) Tissue array methods for high-throughput clinicopathologic research. Cancer Res Treat38: 1“619771251 32 SpadernaS SchmalhoferO HlubekF BerxG EgerA et al (2006) A transient EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology131: 830“84016952552 33 RyuHS Park doJ KimHH KimWH LeeHS (2012) Combination of epithelial-mesenchymal transition and cancer stem cell-like phenotypes has independent prognostic value in gastric cancer. Hum Pathol43: 520“52822018628 34 JunttilaMR de SauvageFJ (2013) Influence of tumour micro-environment heterogeneity on therapeutic response. Nature501: 346“35424048067 35 KimMJ LeeHS KimJH KimYJ KwonJH et al (2012) Different metastatic pattern according to the KRAS mutational status and site-specific discordance of KRAS status in patients with colorectal cancer. BMC Cancer12: 34722876814 36 BarresiV Di GregorioC Regiani-BonettiL Ponz-De LeonM BarresiG et al (2010) Stage I colorectal carcinoma: VEGF immunohistochemical expression microvessel density and their correlation with clinical outcome. Virchows Arch457: 11“1920532559 37 MoreiraLR SchenkaAA Latuf-FilhoP PennaAL LimaCS et al (2011) Immunohistochemical analysis of vascular density and area in colorectal carcinoma using different markers and comparison with clinicopathologic prognostic factors. Tumour Biol32: 527“53421222066 38 ChenY YanJ WangZ YuS YuanZ et al (2013) A meta-analysis of the relationship between lymphatic microvessel density and the survival of patient with colorectal cancer. Lymphology46: 42“5123930440 39 DuffSE JeziorskaM KumarS HaboubiN SherlockD et al (2007) Lymphatic vessel density microvessel density and lymphangiogenic growth factor expression in colorectal cancer. Colorectal Dis9: 793“80017931169 40 PrallF GringmuthU NizzeH BartenM (2003) Microvessel densities and microvascular architecture in colorectal carcinomas and their liver metastases: significant correlation of high microvessel densities with better survival. Histopathology42: 482“49112713626 41 OstmanA AugstenM (2009) Cancer-associated fibroblasts and tumor growth”bystanders turning into key players. Curr Opin Genet Dev19: 67“7319211240 J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 25381398 4271082 10.1093/jnci/dju350 Response Response Gu Fangyi Wacholder Sholom Freedman Neal D. Panagiotou Orestis A. Reyes-Guzman Carolyn Bertazzi Pier Alberto Caporaso Neil E. Affiliation of authors:Division of Cancer Epidemiology and Genetics National Cancer Institute National Institutes of Health Bethesda MD; Universita™ degli Studi di Milano Milan Italy (PAB). Correspondence to: Neil E. Caporaso MD Division of Cancer Epidemiology and Genetics National Cancer Institute Room 6E410 9609 Medical Center Drive Bethesda MD 20850 (e-mail: [email protected]). 12 2014 6 11 2014 106 12 dju350 Published by Oxford University Press 2014. 2014 Proc Natl Acad Sci U S A Proc. Natl. Acad. Sci. U.S.A pnas pnas PNAS Proceedings of the National Academy of Sciences of the United States of America 0027-8424 1091-6490 National Academy of Sciences 24367082 3890787 201320383 10.1073/pnas.1320383110 Biological Sciences Cell Biology Identification of cancer initiating cells in K-Ras driven lung adenocarcinoma Cancer initiating cells of lung adenocarcinoma Mainardi Sara a 1 Mijimolle Nieves a 2 Francoz Sarah a Vicente-Due±as Carolina b c S¡nchez-Garc­a Isidro b c Barbacid Mariano a 3 aMolecular Oncology Programme Centro Nacional de Investigaciones Oncol³gicas 28029 Madrid Spain; bExperimental Therapeutics and Translational Oncology Program Instituto de Biolog­a Molecular y Celular del C¡ncer Consejo Superior de Investigaciones Cientificas/Universidad de Salamanca 37007 Salamanca Spain; and cInstitute of Biomedical Research of Salamanca 37007 Salamanca Spain 3To whom correspondence should be addressed. E-mail: [email protected]. Contributed by Mariano Barbacid October 30 2013 (sent for review August 18 2013) Author contributions: M.B. designed research; S.M. and N.M. performed research; C.V.-D. and I.S.-G. contributed new reagents/analytic tools; S.F. analyzed data; and S.M. and M.B. wrote the paper. 1Present address: Division of Molecular Carcinogenesis Center for Biomedical Genetics and Cancer Genomics The Netherlands Cancer Institute 1066 CX Amsterdam The Netherlands. 2Present address: Asociaci³n Espa±ola contra el C¡ncer Amador de los R­os 5 28010 Madrid Spain. 7 1 2014 23 12 2013 111 1 255 260 Significance K-RAS oncogene-driven lung adenocarcinomas is one of the most malignant human tumors for which there are no efficacious therapeutic strategies. Here we have used a mouse tumor model that closely recapitulates this human disease to illustrate that adult lung cells are uniquely sensitive to transformation by this oncogene. Monitoring lung cells at the single-cell level revealed that they respond differently to K-Ras oncogenic signals. Whereas K-Ras“expressing Clara cells required an inflammatory response to yield hyperplasias and adenomas alveolar type II cells or their committed precursors led to the generation of malignant adenocarcinoma regardless of their surrounding microenvironment. Ubiquitous expression of a resident K-RasG12V oncogene in adult mice revealed that most tissues are resistant to K-Ras oncogenic signals. Indeed K-RasG12V expression only induced overt tumors in lungs. To identify these transformation-permissive cells we induced K-RasG12V expression in a very limited number of adult lung cells (0.2%) and monitored their fate by X-Gal staining a surrogate marker coexpressed with the K-RasG12V oncoprotein. Four weeks later 30% of these cells had proliferated to form small clusters. However only SPC+ alveolar type II (ATII) cells were able to form hyperplastic lesions some of which progressed to adenomas and adenocarcinomas. In contrast induction of K-RasG12V expression in lung cells by intratracheal infection with adenoviral-Cre particles generated hyperplasias in all regions except the proximal airways. Bronchiolar and bronchioalveolar duct junction hyperplasias were primarily made of CC10+ Clara cells. Some of them progressed to form benign adenomas. However only alveolar hyperplasias exclusively made up of SPC+ ATII cells progressed to yield malignant adenocarcinomas. Adenoviral infection induced inflammatory infiltrates primarily made of T and B cells. This inflammatory response was essential for the development of K-RasG12V“driven bronchiolar hyperplasias and adenomas but not for the generation of SPC+ ATII lesions. Finally activation of K-RasG12V during embryonic development under the control of a Sca1 promoter yielded CC10+ but not SPC+ hyperplasias and adenomas. These results taken together illustrate that different types of lung cells can generate benign lesions in response to K-Ras oncogenic signals. However in adult mice only SPC+ ATII cells were able to yield malignant adenocarcinomas. inflammation genetically engineered mouse model non-small cell lung cancer lung "
Lung_Cancer
"The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in .The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases"
Lung_Cancer
"In the present study however a subset of pure GGNs were pathologically diagnosed as invasive adenocarcinoma. This discrepancy between radiological and pathological findings could be explained by a partial volume effect which means that when the slice thickness is relatively high (2“2.5 mm) detection of small nonaerated components may be difficult because of inadequate spatial resolution [9] [10] [11]. Although all CT images were acquired by using high resolution CT at a 1.25-mm slice thickness in the present study a much higher resolution may be needed to detect small nonaerated invasion. Meanwhile in some invasive adenocarcinomas sparsely proliferated areas are histologically recognized in papillary or acinar lesions and these sparsely invasive lesions could be aerated and thus depicted as nonsolid portions on CT images. Recently limited resection for early-stage lung cancers has been advocated for preserving lung function [12]. However there are currently no established criteria for the indication of limited resection. Suzuki et al. demonstrated the prognostic importance of the extent of central fibrosis. In their study the 5-year survival rate was reported to be 100% if the region of central fibrosis was ?5 mm 72% if the region was between 5 and 15 mm and 40% if the region was >15 mm [13]. In the new adenocarcinoma classification proposed by IASLC/ATS/ERS in 2011 a new concept of minimally invasive adenocarcinoma for lepidic predominant tumors with ?5-mm invasion was recommended in order to distinguish these tumors from invasive adenocarcinomas in which invasion is >5 mm [8]. Yoshizawa et al. reported in their analysis of 514 stage I adenocarcinoma cases that AIS and MIA were associated with a 100% 5-year disease-free survival rate after complete resection [14]. These findings suggest that limited resection might be indicated for adenocarcinoma cases classified as AIS/MIA. For feasibility in clinical practice accurate preoperative differentiation of AIS/MIA from invasive adenocarcinoma is important. In the present study upon ROC curve analyses for predicting invasive adenocarcinoma tumor size and mean CT attenuation yielded AUC values of 0.75 and 0.77 respectively. AUC values between 0.7 and 0.9 are thought to indicate a moderately accurate test [15] suggesting that these two parameters may represent useful predictors of invasive adenocarcinoma in cases of pulmonary pure GGNs. Moreover ROC curve analysis of the combination of the two factors resulted in an AUC of 0.82 suggesting that the use of this combination may facilitate more accurate prediction of invasive adenocarcinoma than the use of these factors individually. However the usefulness of tumor size and CT attenuation as predictive factors for the invasiveness of pure GGNs should be confirmed in further large-scale studies and additional accurate tests should be established in order to facilitate preoperative decision making regarding surgical procedures for pulmonary pure GGNs. This present study has a number of limitations. First the small number of patients analyzed and the retrospective nature of the analysis may have affected our results. A second limitation of our study was that the mean CT attenuation value of pure GGNs was evaluated only in the slice containing the part of the lesion with its maximum diameter and thus this value could potentially be quite different from that of the entire tumor. Conclusions A subset of pulmonary pure GGNs have histological invasive areas that cannot be recognized as solid components on CT and in this study we found that tumor size and CT attenuation in cases of pure GGNs could successfully predict pathological invasiveness. The combination of tumor size and CT attenuation might enable a more accurate prediction of invasive adenocarcinoma than the two factors individually and further large-scale studies should be conducted to confirm these results. References 1 KondoR YoshidaK KawakamiS ShiinaT KuraiM et al (2011) Efficacy of CT screening for lung cancer in never-smokers: "
Lung_Cancer
"The patient had received two successive courses of first-line chemotherapy without tumor response. Tumor cells were negative for wild-type of epidermal growth factor receptor/K-RAS variants; thus she was not eligible for tyrosine kinase inhibitor therapy. Unfortunately increased levels of interleukin-6 and carcinoembryonic antigen and computed tomography scan results indicated cancer progression. Once crizotinib was approved by the China Food and Drug Administration and the ALK gene translocation was identified in tumor cells by fluorescent in situ hybridization the patient commenced treatment with crizotinib. Remarkably the tumor response to crizotinib was classified as partial response after only 26 days of treatment commencement. The partial response status has been maintained to date (23 weeks). Conclusion Considering this remarkable response to crizotinib we can safely conclude that patients with squamous cell lung cancer should have the option of undergoing ALK testing to determine if there is indication for crizotinib treatment even after they have failed chemotherapy. ALK Crizotinib Squamous cell lung cancer Chemotherapy Background Treatment of EML4-ALK fusion-positive non-small-cell lung cancer (NSCLC) with the anaplastic lymphoma kinase (ALK)-targeted agent crizotinib offers significant improvement of clinical outcomes [1]. Herein we report the successful case of a patient with squamous cell lung cancer and ALK gene translocation that experienced a remarkable response to crizotinib treatment after two courses of failed chemotherapy. Case presentation A 55-year-old woman presented in May 2013 with cough sputum and annihilation after activities of daily living for more than 20 days. She had no history of smoking or alcoholism but had undergone total hysterectomy because of hysteromyoma in 2010. She was diagnosed with hypertension three years earlier. On physical examination an enlarged right cervical lymph node was palpated. Chest computed tomography (CT) scan (Figure 1A) indicated the presence of a mass in the lower lobe of the right lung and mediastinal lymph node enlargement. The patient was then accepted and treated by the Department of Respiration for lung cancer stage IV with cervical lymph node metastasis (T4N3M1). Chest computed tomography (CT) scans. Before the first chemotherapy treatment (May 2013) (A). After the second course of chemotherapy (B). After 26 days (C) and 11 weeks (D) of crizotinib treatment. The whole enlarged right cervical lymph node was resected and followed by biopsy and histologic examination. Hematoxylin and eosin (H & E) staining showed the typical morphology of squamous cell carcinoma cells (Figure 2A and B). Immunohistochemistry (IHC) analysis demonstrated that tumor cells were positive for cytokeratin (CK) 5/6 (Figure 2C) and P63 (Figure 2D) and negative for CK7 CK20 TTF-1 and Napsin A. The positive rate of Ki-67 was 30%. Altogether these results confirmed the diagnosis of metastatic squamous cell carcinoma. The patient requested treatment with epidermal growth factor receptor (EGFR)-tyrosine kinase inhibitors (TKIs) because dozens of patients with squamous cell carcinoma and EGFR mutations responded well to TKIs at our institute. Amplification refractory mutation system (ARMS) was used to assess EGFR and K-RAS gene profiles to determine the presence of mutated variants. However evidence of a normal genotype excluded the patient from receiving EGFR-TKI treatment. Right cervical lymph node analysis. H & E staining (A and B). IHC staining of CK5/6 (C) P63 (D) and ALK (1A4) (E). ALK gene translocation (FISH arrows: split-apart signals for ALK gene translocation) (F). As first-line chemotherapy the patient was initially administered 135 mg/m2 (210 mg) of paclitaxel and 80 mg/m2 (120 mg) of nedaplatin. During treatment the patient™s condition did not seem to improve; thus after a 20-day treatment a second round of chemotherapy was administered with 75 mg/m2 (120 mg) of docetaxel and 80 mg/m2 (120 mg) of nedaplatin. Unfortunately increasing levels of interleukin-6 (IL-6) (25.41 vs 16.03 pg/mL) and carcinoembryonic antigen (CEA) (23.43 vs 7.13 ng/mL) indicated cancer progression which was confirmed by the presence of multiple metastases in both lungs on CT scan images (Figure 1B). Although not initially indicated the patient was then administered oral treatment with the EGFR-TKI erlotinib (1-month trial). However this treatment showed no efficacy. After the use of crizotinib was approved by the China Food and Drug Administration (CFDA) in July 2013 the patient underwent ALK testing. IHC staining (Clone 1A4 Origene 1:200) showed tumor cell positivity for ALK protein (Figure 2E). Then ALK break-apart fluorescent in situ hybridization (FISH) was performed on 4-?m formalin-fixed paraffin-embedded tissue sections. Slides were hybridized with the LSI ALK Break Apart Rearrangement Probe (Vysis Abbott Molecular Des Plaines IL USA) and read on an epifluorescence microscope (BX41 Olympus Tokyo Japan). The lung cancer cell line NCI-H2228 (American Type Culture Collection-ATCC) was used as positive control. At least 50 tumor cell nuclei were analyzed and at least 15% of interpretable tumor cells harboring break-apart signals were used as the cutoff value [2]. As a result the presence of ALK gene translocation was confirmed (Figure 2F). The patient underwent crizotinib treatment (250 mg/bid orally) for 26 days. After this period symptoms including neck constriction and cough were improved. Chest CT scan images demonstrated decrease in tumor size and metastases. According to the Response Evaluation Criteria in Solid Tumors (RECIST) guidelines (version 1.1) such tumor response to crizotinib was classified as partial response (PR) (Figure 1C). Follow-up chest CT scan performed 11 weeks after the beginning of the treatment revealed a dramatic reduction in tumor size and mediastinal lymph node with nearly no presence of metastases in both lungs (Figure 1D). IL-6 (3.34 vs 25.41 pg/mL) and CEA (1.84 vs 23.43 ng/mL) levels were also reduced 23 weeks after the beginning of the therapy which demonstrated continuous partial response. Discussion According to the National Comprehensive Cancer Network guidelines ALK testing is not routinely performed in patients with squamous cell lung cancer. Therefore this patient was not tested for ALK until crizotinib was approved for marketing by the CFDA (June 23 2013). Unfortunately neither chemotherapy nor EGFR-TKI treatment produced effective tumor response in this patient. ALK gene translocations have been previously detected in patients with lung adenocarcinoma and light or non smoking history [34]. To date two studies have previously reported cases of patients with mixed carcinoma and squamous cell component harboring ALK rearrangements [56] but these studies did not describe specific therapy or diagnostic procedures. Another report showed that a patient with squamous cell lung cancer harboring c-MET amplification had partially responded to crizotinib [7]. Herein we report the case of a non-smoking woman with squamous cell lung cancer and ALK gene rearrangement who experienced remarkable response to crizotinib treatment after failed chemotherapy. In concordance with other studies on patients with lung adenocarcinoma treated with crizotinib [89] this patient has remained in remission (PR). Most importantly such remarkable response was obtained after two courses of failed chemotherapy. Conclusion Despite the low reconstruction rate of ALK gene if applicable patients with squamous cell lung cancer should have the option of undergoing ALK testing and receiving crizotinib treatment. ALK testing and subsequent targeted therapy could be an effective option for patients with non-small cell lung cancer who present progression following chemotherapy radiotherapy or any other treatment. Consent The patient provided written consent for publication of this case report. Abbreviations EML4: Echinodermmicro tubule associated protein like 4; ALK: Anaplastic lymphoma kinase; NSCLC: Non-small-cell lung cancer; CT"
Lung_Cancer
"However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(). .0098621.g002 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans were a fraction of those needed for the photon plans (). This translates to a beam on time per field of between 5 and 10 seconds for the PT-SABR plans compared to 75 to 90 seconds for photon plan. This 5 to 10 second time estimate is based on a conservative 1 nC/sec dose rate however new proton centers may be able to achieve greater than 2 nC/sec thereby reducing this time by a factor of 2. By decreasing the treatment time to less than 10 seconds per field breath-hold techniques may be better tolerated in greater number of lung cancer patients with suboptimal lung function. Breath-hold technique would minimize tumor motion (i.e. ITV) leading to a smaller overall irradiation volume and interplay would not be a significant issue [8]. Spot scanning proton therapy that utilizes the Bragg peak would require a larger planning volume due to the various uncertainties that need to be taken into account; and it would require a longer treatment time due to the use of multiple proton energies. Each change in energy requires several seconds (2 to 7) and at least 5 to 10 energies would be required for these treatments. Volumetric modulated arc therapy (VMAT) with photons may decrease treatment times compared to multiple static-gantry beams. However VMAT comes at the cost of larger volumes of normal tissue receiving low doses of radiation since the beam is continuously on as it rotates about the patient. The use of four to five proton transmission beams achieves both shorter treatment times as well as a lower integral dose to the body. The dosimetric data of the normal tissues in the photons plans met the constraints of RTOG 0915. The dosimetric gains of protons over these plans may be considered modest and the statistical analysis comparing plans is limited by the small sample size. However in some plans the dose to particular critical ans can be avoided completely without compromising target coverage by choosing beam arrangements appropriately. This may be beneficial in treating patients with tumors in challenging locations [9] or recurrent tumors that have had prior radiotherapy. The interim analysis of RTOG 0617 reported local failure rates of 25% and 34% in the standard and high dose RT arms [10] and therefore re-irradiation may play a role in this subset of patients who fail after definitive chemoradiotherapy. For these patients keeping dose at or near zero to the spinal cord heart lungs or other critical structures is feasible with protons. Planning with PT-SABR using only transmission beams without the Bragg peak is feasible. This proof of principle as described in our study eliminates the uncertainty of proton dose distribution in lung tumors which has the potential to underdose the target and overdose surrounding normal tissues. Proton therapy planning with this technique also demonstrates better sparing of normal tissues and fast treatment times than photon plans. Further study of this novel approach to proton SABR is warranted. The authors thank Katy Nelson for maintaining the SABR database. References 1 GeD HillbrandM StockM DieckmannK PotterR (2008) Can protons improve SBRT for lung lesions? Dosimetric considerations. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology88: 368“37518405986 2 HoppeBS HuhS FlampouriS NicholsRC OliverKR et al (2010) Double-scattered proton-based stereotactic body radiotherapy for stage I lung cancer: a dosimetric comparison with photon-based stereotactic body radiotherapy. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology97: 425“43020934768 3 MacdonaldOK KruseJJ MillerJM GarcesYI BrownPD et al (2009) Proton beam radiotherapy versus three-dimensional conformal stereotactic body radiotherapy in primary peripheral early-stage non-small-cell lung carcinoma: a comparative dosimetric analysis. International journal of radiation oncology biology physics75: 950“958 4 WestoverKD SecoJ AdamsJA LanutiM ChoiNC et al (2012) Proton SBRT for medically inoperable stage I NSCLC. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer7: 1021“1025 5 PaganettiH (2012) Range uncertainties in proton therapy and the role of Monte Carlo simulations. Physics in medicine and biology57: R99“11722571913 6 SecoJ PanahandehHR WestoverK AdamsJ WillersH (2012) Treatment of non-small cell lung cancer patients with proton beam-based stereotactic body radiotherapy: dosimetric comparison with photon plans highlights importance of range uncertainty. International journal of radiation oncology biology physics83: 354“361 7 VideticGM HuC SinghA ChangJY ParkerW et al (2013) Radiation Therapy Oncology Group (RTOG) Protocol 0915: A Randomized Phase 2 Study Comparing 2 Stereotactic Body Radiation Therapy (SBRT) Schedules for Medically Inoperable Patients With Stage I Peripheral Non-Small Cell Lung Cancer. International journal of radiation oncology biology physics87: S3 8 KeallPJ MagerasGS BalterJM EmeryRS ForsterKM et al (2006) The management of respiratory motion in radiation oncology report of AAPM Task Group 76. Medical physics33: 3874“390017089851 9 RegisterSP ZhangX MohanR ChangJY (2011) Proton stereotactic body radiation therapy for clinically challenging cases of centrally and superiorly located stage I non-small-cell lung cancer. International journal of radiation oncology biology physics80: 1015“1022 10 BradleyJD PaulusR KomakiR MastersGA ForsterK et al (2013) A randomized phase III comparison of standard-dose (60 Gy) versus high-dose (74 Gy) conformal chemoradiotherapy with or without cetuximab for stage III non-small cell lung cancer: Results on radiation dose in RTOG 0617. Journal of Clinical Oncology31: 7501 Cancer Cancer cncr Cancer 0008-543X 1097-0142 BlackWell Publishing Ltd Oxford UK 24752945 4140446 10.1002/cncr.28714 Original Articles A phase 2 cooperative group adjuvant trial using a biomarker-based decision algorithm in patients with stage I non-small cell lung cancer (SWOG-0720 NCT00792701) Bepler Gerold MD PhD 1 Zinner Ralph G MD 2 Moon James MS 3 Calhoun Royce MD 4 Kernstine Kemp MD 5 Williams Charles C MD 6 Mack Philip C PhD 4 Oliveira Vasco PhD 1 Zheng Zhong MD PhD 6 Stella Philip J MD 7 Redman Mary W PhD 2 Gandara David R MD 4 1 Karmanos Cancer Institute Detroit Michigan 2 The University of Texas MD Anderson Cancer Center Houston Texas 3 SWOG Statistical Center Seattle Washington 4 University of California at Davis Sacramento California 5 City of Hope Duarte California 6 H. Lee Moffitt Cancer Center Tampa Florida 7 Michigan Cancer Research Consortium Community Clinical Oncology Program Ann Arbor Michigan Corresponding author: Gerold Bepler MD PhD Karmanos Cancer Institute 4100 John R Detroit MI 48201; Fax: (313) 576-8628; beplerg@karmanos. 01 8 2014 18 4 2014 120 15 2343 2351 10 2 2014 17 3 2014 18 3 2014 © 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society 2014 This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non-commercial and no modifications or adaptations are made. BACKGROUND This cooperative group adjuvant phase 2 trial in patients with completely resected stage I non-small cell lung cancer with tumor diameters measuring ??2 cm was designed to assess the feasibility and preliminary efficacy of assigning patients to therapy or observation using a molecularly based decision algorithm. METHODS At least a lobectomy and sampling of recommended mediastinal lymph node stations good Zubrod performance status adequate an function and a formalin-fixed and paraffin-embedded tumor specimen were required. Excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) were analyzed using immunofluorescence-based in situ automated quantitative image analysis and categorized as high or low using prespecified cutoff values. Patients with high ERCC1 and RRM1 were assigned to observation and all others to 4 cycles of cisplatin and gemcitabine. Feasibility was defined as treatment assignment within 84 days from surgery in >?85% of patients. Secondary objectives were to estimate the 2-year survival. RESULTS Treatment assignment met the feasibility criteria in 88% of eligible patients (71 of 81 patients). The collective 2-year disease-free and overall survival rates were 80% and 96% respectively. Protein levels for RRM1 fell within the previously established range ERCC1 levels were slightly lower than expected and they were significantly correlated (correlation coefficient 0.4). The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. CONCLUSIONS Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. To assess DFS the disease status was monitored every 2 months for the first 6 months and subsequently every 3 months by computed tomography after enrollment and according to good medical practice. Toxicities related to the administration of chemotherapy were assessed according to the National Cancer Institute Common Terminology Criteria for Adverse Events (version 3.0; ctep.cancer.gov). DFS was defined as the time from the date of enrollment to disease recurrence or death due to any cause and estimated according to the Kaplan-Meier method. A Cox regression model was fit with the time from surgery to enrollment as a covariate to evaluate its effect on DFS. A natural log transformation was applied to the raw protein measurement data and the Pearson correlation coefficient was used to test associations. Bivariate comparison of baseline characteristics between the assigned treatment groups was performed using the Fisher exact test for categorical variables or the Student t test or Wilcoxon rank sum test for continuous variables. A multivariable logistic model to evaluate baseline factors and treatment assignment was fit using backwards selection. Median ERCC1 and RRM1 expression levels were compared with historical medians using the 1-sample Wilcoxon signed rank test. The percentage of patients with both ERCC1 ??65 and RRM1 ??40 was compared with the historical rate using a chi-square test. All statistical analyses and graphics were performed using SAS statistical software (version 9.2; SAS Institute Inc Cary NC). A significance level of 5% was used for all analyses. RESULTS Patient and Trial Characteristics To ensure an adequate sample size of eligible patients and biomarker-specific subgroups a total of 85 patients was registered between April 2 2009 and April 1 2011 from 27 participating sites. Four patients were ineligible; 3 had inadequate lymph node sampling and 1 did not have a tumor measuring ??2 cm. provides the characteristics of the 81 eligible patients. Patient Demographics and Disease Characteristics Variablesa All Patients Assigned to Chemotherapy Assigned to Observation P Refused Assignment Accepted Assignment P N = 81 N = 63 N = 18 N = 20 N = 61 Age y .37 .39 ?Median 64 63.3 68.8 67.2 63.3 ?Mean 63.5 62.9 65.5 65.2 62.9 ?Range 41.6“84.2 41.6“84.2 41.6“81.7 44.2“82.9 41.6“84.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African American 8 (10%) 8 (13%) 0 (0%) 2 (10%) 6 (10%) ?Asian 3 (4%) 2 (3%) 1 (6%) 0 (0%) 3 (5%) ?Pacific Islander 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) ?White 66 (81%) 52 (83%) 14 (78%) 17 (85%) 49 (80%) ?Unspecified 2 (2%) 0 (0%) 2 (11%) 1 (5%) 1 (2%) Histology .06c .60c ?Adeno 52 (64%) 44 (70%) 8 (44%) 14 (70%) 38 (62%) ?Squamous 25 (31%) 17 (27%) 8 (44%) 6 (30%) 19 (31%) ?Large 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Bronchioloalveolar 1 (1%) 0 (0%) 1 (6%) 0 (0%) 1 (2%) ?Other 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) Stage of disease .16 .27 ?IA (<3 cm) 25 (31%) 22 (35%) 3 (17%) 4 (20%) 21 (34%) ?IB (?3 cm) 56 (69%) 41 (65%) 15 (83%) 16 (80%) 40 (66%) Zubrod performance status .11 1.00 ?0 44 (54%) 31 (49%) 13 (72%) 11 (55%) 33 (54%) ?1 37 (46%) 32 (51%) 5 (28%) 9 (45%) 28 (46%) Weight loss (6 mo) 1.00d .31d ?<5% 64 (79%) 49 (78%) 15 (83%) 14 (70%) 50 (82%) ?5-<10% 9 (11%) 7 (11%) 2 (11%) 3 (15%) 6 (10%) ?10“20% 4 (5%) 3 (5%) 1 (6%) 2 (10%) 2 (3%) ?>20% 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Unknown 3 (4%) 3 (5%) 0 (0%) 1 (5%) 2 (3%) Smoking status ?Current 33 (41%) 26 (41%) 7 (39%) 8 (40%) 25 (41%) ?"
Lung_Cancer
"Additional information is provided in the Section B of the supporting information. The functions f(x) and w(?) composing sx(xt) for the model candidates are selected a priori among linear constant piecewise constant functions and quadratic B-splines with 36 models in total. Specifically the three cut-offs of a piecewise constant function and combinations of 01 or 2 knots for B-splines are placed at quartiles for the dimension of x corresponding to 26.760.2 and 122.2 WLM/year and at 13.320 or 26.6 lags for the dimension of ?. Also in alternative parameterizations of w(?) the intercept is excluded in the B-spline bases left-constraining the smooth lag“response curve to start from a null risk at lag 2. This a priori assumption reasonably follows the hypothesis that the risk associated with past exposures smoothly increases from zero starting from lag 2. Model selection is based on AIC and BIC adapted to survival analysis given by the following: (12) where is the log-likelihood of the fitted model k is the number of total df and d is the number of uncensored events. The best-fitting model (11) is chosen by minimizing AIC or BIC in (12). Both criteria apply a multiplicative constant to the number of parameters for penalizing more complex models. In particular the penalty of BIC (equal to log(d)) is usually higher and tends to select simpler models. 3.3. Results for distributed lag models Results for simple DLMs assuming a linear radon“mortality relationship on the log scale are illustrated first. Table II presents models with different functions w(?) as defined in (3). Specifically model 1 is specified by a constant (intercept only) function producing a lag-basis identical to the traditional index of unweighted cumulative exposure; model 2 is an example of a DLM with a piecewise constant function; the best-fitting B-spline models with and without intercept specified by a single knot at 13.3 lags are reported as models 3 and 4 respectively. The fit of the various options is expressed by AIC and BIC with the best performance achieved by model 1 for both criteria. This model assigns the same importance to the exposures experienced ? lags earlier in defining the risk for a given time. The specification of more flexible functions with more df does not seem to improve the fit. Table II Functions f(x) and w(?) total degrees of freedom (df) associated with the cross-basis and values for the AIC and BIC for alternative models for the exposure“lag“response association between radon and mortality. Data from the Colorado Plateau uranium miners cohort DLMs f(x) w(?) df AIC BIC Model 1 Linear Constant 1 2236.0 2257.3 Model 2 Linear Piecewise constant  4 2238.6 2270.6 Model 3 Linear Quadratic B-Spline? 4 2238.8 2270.8 Model 4 Linear Quadratic B-Spline§ 3 2238.9 2267.3 DLNMs f(x) w(?) df AIC BIC Model 5 Quadratic B-Spline* Constant 3 2181.4 2209.8 Model 6 Piecewise constant¡ Piecewise constant  12 2171.6 2232.0 Model 7 Quadratic B-Spline* Quadratic B-Spline? 12 2155.3 2215.7 Model 8 Quadratic B-Spline* Quadratic B-Spline§ 9 2153.2 2202.9 ¡ Cut-offs at 26.760.2 and 122.2 WLM/years.   Cut-offs at 1020 and 30 lag. * Knot at 60.2 WLM/years. ? Knot at 13.3 lag. § Knot at 13.3 lag no intercept. DLM distributed lag models; DLNMs distributed lag non-linear models. shows the lag“response curves estimated from models 12 and 4. The curves are composed of a series of estimated contributions to the risk of mortality for lung cancer at each lag ? associated with an increase of 100 WLM/year in radon exposure with defined in (8). The results can be interpreted following the scheme described in Section 2.3. By using a forward perspective represents the HR contribution from a unit increase in exposure experienced at t to the subsequent risk at t + ? with ? = 2 ¦ 40 years. Alternatively adopting a backward perspective the same summary is interpreted as the HR contribution from a unit increase in exposure experienced at t ? ? to the overall risk at t. Model 4 predicts a maximum increase in risk at lag 11 with a HR of 1.042 (95%CI: 1.031“1.052) compared with the constant HR of 1.031 (95%CI: 1.025“1.036) estimated from model 1. Hazard ratio (HR) of lung cancer mortality associated with radon exposure to 100 WLM/year in the lag period of 0“40 years. The figure shows the lag“response curves estimated from models 4 (with 95%CI)2 and 1 as specified in Table II. Data from the Colorado Plateau uranium miners cohort. The better performance of model 1 seems to indicate that the hypothesis of constant risk H0 : w(?) = c is supported by the data. Also the lag“response curve from model 4 in does not suggest a decrease in risk at longer lags although the confidence intervals are relatively wide in this part of the lag period. 3.4. Results for distributed lag non-linear models The results illustrated in Section 3.3 are dependent on the strong assumption of a log-linear relationship between radon exposure and lung cancer mortality. The analysis can be repeated with more flexible DLNMs which can describe simultaneously nonlinear exposure“response relationships and lag structures through the specification of a cross-basis in (5)“(7). The definition of DLNMs involves a higher number of potential models obtained by different combinations of bases for the functions f(x) and w(?). The second part of Table II only reports models with the same choices for w(?) used in DLM and with f(x) specified as another piecewise constant function and the B-spline providing the best fit with one knot at 60.2 WLM/year. Overall the best-fitting option for both AIC and BIC is model 8 with a B-spline for both f(x) and w(?). This model uses 9 df in total for expressing the bidimensional association. The hypothesis H0 : f(x) = x of a linear radon-mortality dependency is not supported by the data as all the DLNMs show a substantial decrease in both AIC and BIC when compared with simpler DLMs. In particular the comparison of the best-fitting model 8 representing f · w(x?) with model 4 representing x · w(x?) indicates that the 6 additional df substantially improve the fit. Similarly the hypothesis H0 : w(?) = c of a constant risk along lags previously suggested when evaluating DLMs is not supported either. The comparison of model 8 with model 5 representing f(x) · c indicates a better fit of the former. Interestingly this result is the opposite of what was suggested in Section 3.3 revealing how imposing a wrong assumption about the relationship in one dimension induces spurious results in the other space compromising the analysis of the association. The interpretation of results from DLNMs relies on a bidimensional representation of the exposure“lag“response association. This is achieved by computing the risk contributions over a grid defined in the range of the exposure x and the lag ? applying (9). This bidimensional dependency is depicted in the two top panels of showing the predicted HR surfaces from models 8 and 6 in the range 0“250 WLM and 0“40 lags. The graphs show an initial increase in risk along lags peaking at approximately 10 years after the exposure and then decreasing and apparently disappearing after about 30 years independent of the exposure levels. The inspection of the panels along the dimension of x reveals the nonlinear radon-mortality dependency with the risk increasing steadily up to 50 WLM/year and then flattening out. The shape of the HR surfaces unveils the different assumptions underlying the choices of bases for functions f(x) and w(?) namely B-splines and piecewise constant functions. Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0“250 WLM/year and lag period 0“40 years. The figure shows 3-D graphs of the exposure“lag“response association on a grid of exposure — lag values (from model 8 top left and model 6 top right) lag“response curves for radon exposure of 100 WLM/year (from models 8 with 95%CI and model 6 bottom left) and exposure“response curves at lag 15 (from models 8 with 95%CI and models 6 and 4 bottom right). The models are described in Table II. Data from the Colorado Plateau uranium miners cohort. Although the 3-D representation offered by the top panels in provides an overview of the bidimensional association it is still limited for inferential purposes as the uncertainty in the estimate is not reported. In order to extend the interpretation the analysis can focus on the risk along ? predicted for specific exposure intensities or alternatively the risk along x for specific lags namely the vectors and from Section 2.3. These dependencies are represented by slices cut on the bidimensional risk surface along the appropriate dimension. The bottom panels of report the lag“response curve corresponding to an exposure level of 100 WLM/year and the exposure“response curve for lag 15 from both Models 8 and 6 together with 95% confidence intervals for the former. These curves correspond to the two bold lines in the 3-D plots. The bottom-left panel is interpreted similarly to the DLM in as the specific risk contributions composing the lag“response curve but this time associated with a specific exposure xp = 100 WLM/year. The curve estimated from model 8 peaks at lag 11 with an HR of 1.21 (95%CI: 1.16“1.26) and both models 8 and 6 suggest that the risk disappears after 30“35 years. The B-spline for w(?) in model 8 is left-constrained by the lack of an intercept forcing the smoothed lag“response curve to start from a null risk at lag 2. The best fit of Model 8 if compared with model 7 which includes the intercept seems to support this hypothesis. The bottom-right panel shows instead the risk contributions at ?p = 15 for different exposure intensities and is interpreted as the exposure“response at t from exposures experienced at t ? 15 (backward perspective) or the exposure“response contributions at t + 15 from exposures experienced at year t (forward perspective). Although models 8 and 6 adopt different bases for functions f(x) and w(?) the estimates of the predicted risk along x and ? are consistent showing a radon-mortality relationship that is markedly nonlinear and nonconstant in time. These measures of risk are extended in Figure 3 reporting estimates from model 8 for different exposure and lag values. A right-constrained version of Model 8 is discussed in Section D.1 and illustrated in Figure S2 of the supporting information. Figure 3 Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0“250 WLM/year and lag period 0“40 years. The figure shows lag“response curves for radon exposure of 2050100 and 200 WLM/year (left) and exposure“response curves at lag 51015 and 20 (right) estimated from model 8 as specified in Table II. Data from the Colorado Plateau uranium miners cohort. Interestingly even though model 8 is produced from the flexible definition in (5)“(7) Figures 2 and 3 suggest that the assumption of independency holds here with shapes of the exposure-response and lag-response curves at different values of ?p and xp respectively being proportional and the maximum HR constantly experienced at lag 11. This result reinforces the fact that the cross-basis representation based on a truly bivariate exposure“lag“response function f · w(x?) may appropriately describe the specific independency case defined by the simpler representation f(x) · w(?) in (4). 3.5. Prediction for specific exposure histories The flexible modeling approach described here can be applied to predict the overall cumulative risk from (10) for a specific exposure history qh as outlined in Section 2.3. Table III illustrates the predicted HR from four different models in five alternative exposure scenarios. This approach previously proposed 17 provides clear and interpretable risk summaries from complex models in the presence of varying exposure patterns. The first two scenarios refer to a constant radon exposure of 20 and 100 WLM/year respectively in the past 10 years. As expected simple DLMs (models 1 and 4) predict a similar risk but substantially lower than the two DLNMs with a B-spline for f(x). In particular model 5 extends model 1 by allowing a nonlinear dependency for the unweighted cumulative exposure estimating a slightly lower risk when compared with the more flexible model 8 already described. The third scenario extends the exposure to 20 WLM/year in the previous 20 years while the fourth one assumes that a 10-year exposure to the same intensity ceased 10 years before. The comparative assessment of the four models is similar to the first two examples. The last scenario considers the risk of more remote exposures occurring 30“39 years ago. Interestingly models 1 and 5 provide identical estimates to the fourth scenario as the risk of past exposures is assumed constant along the whole lag period. Model 8 instead predicts no excess in lung cancer in the last scenario given at least 30 years passed from the last exposure to radon a lag period for which the lag“response curve in (bottom-left panel) displays a null risk. Table III Overall cumulative hazard ratio (with 95%CI) of lung cancer mortality associated with alternative scenarios of exposure histories to radon as predicted from models 145 and 8 described in Table II Model 1 Model 4 Model 5 Model 8 Exposure scenario x · c x · w(x?) f(x) · c f · w(x?) 20 WLM/year in the last 10 years 1.05 (1.04“1.06) 1.04 (1.03“1.05) 1.33 (1.22“1.46) 1.52 (1.31“1.76) 100 WLM/year in the last 10 years 1.27 (1.22“1.33) 1.20 (1.13“1.27) 1.96 (1.73“2.22) 2.37 (1.87“2.99) 20 WLM/year in the last 20 years 1.11 (1.09“1.14) 1.11 (1.09“1.14) 1.92 (1.56“2.35) 3.12 (2.29“4.24) 20 WLM/year 10“19 years ago 1.06 (1.05“1.07) 1.07 (1.06“1.09) 1.43 (1.28“1.61) 2.05 (1.70“2.48) 20 WLM/year 30“39 years ago 1.06 (1.05“1.07) 1.05 (1.00“1.11) 1.43 (1.28“1.61) 1.04 (0.64“1.70) WLM working-level months. The summaries illustrated in this section can be extended to predict how the risk evolves dynamically in time in association with time-varying exposures. Adopting a forward perspective the risk changes along an exposure profile with specific exposures events referring to different lags and producing a different exposure history. As an example Figure 4 displays the overall cumulative mortality risk within years 0“60 for an exposure to 20 WLM/year experienced in the first 15 years. Here model 8 predicts an HR peak of 2.94 (95%CI: 2.20“3.93) at around 20 years 5 years after the end of the exposure. The plot also suggests that model 4 assuming a log-linear exposure“response relationship seriously underestimates the risk of lung cancer for four decades predicting an HR at year 20 of 1.11 (95%CI: 1.09“1.13). Also the assumption of a constant risk along lags of a nonlinear relationship adopted in model 5 produces an underestimation of the predicted HR in the first part of the period followed by a clear overestimation in the last years. Figure 4 Trend of hazard ratio (HR) of lung cancer mortality in the period 1“60 years associated with radon exposure of 20 WLM/year experienced in years 1“15 predicted from models 8 (with 95%CI)5 and 4 as specified in Table II. 3.6. On linearity and the ™nonspecial™ case of log transformation The bottom-right panel of reports the exposure“response for the simple DLM in model 4 which predicts a substantially lower risk than the two DLNMs. This difference is also evident when comparing the HR range in Figures 1 and 2 (bottom-left panel). This discrepancy is related to the wrong assumption of a linear radon-mortality dependency with the fit of model 4 highly dependent on a few of very high exposure occurrences. A sensitivity analysis performed on the subset of subjects with a maximum yearly exposure to radon of less than 300 WLM/year (81.6% of the total) is illustrated in Section D.2 of the supporting information. The highly skewed distribution of exposure events to radon and the shape of the estimated exposure“response curve suggest a log transformation of the exposure. In fact this model can be still described as a DLNM in (5)“(7) characterized by a basis with dimension vx = 1 corresponding to f(x) = log(x + 1). A new model is defined by replacing the spline in model 8 with the log function. The comparison is presented in details in Section D.3 of the supporting information. Although this more parsimonious model slightly improves the fit with an AIC of 2148.6 it is worth noting that results are very similar as illustrated in Figure S4 (supporting information) suggesting that the spline function is flexible enough to recover the association. More generally different functions than those presented here can be used to define the exposure“response or lag structure. 4. Simulation study The performance of the extended DLNM framework is validated through simulations under different scenarios of exposure“lag“response associations. Specifically the framework is evaluated by estimating the relative bias coverage and relative root mean square error (RMSE) of the estimators derived from AIC and BIC selection and the empirical rejection rates for the hypotheses H0 : f(x) = x and H0 : w(?) = c of linearity and constant effects respectively. 4.1. Simulation design and data generation The simulation setting involves the generation of exposure profiles for a set of ns subjects the definition of scenarios with known bidimensional exposure“lag“response associations and the random generation of time-to-event occurrences from such scenarios. These steps are briefly summarized here with more detailed information provided in Section E of the supporting information. The time-varying exposure profiles for ns subjects are represented as series of occurrences xt at time t = 1 ¦100 generated by random exposure events with an intensity in the range 0“10. The exposure“lag“response associations are defined by the function fs(x) · ws(?) in (4) which is simpler to simulate if compared with the truly bivariate alternative in (5) for each value of exposure x and lag ?. Different scenarios explore alternative choices for the exposure“response function fs(x) and the lag“response function ws(?). These are obtained by simple mathematical functions involving logarithms or exponentials. Specifically fs(x) is specified as linear plateau and exponential while ws(?) as constant decay and peak (see Figure S7 in the supporting information). Three scenarios out of the nine possible combinations are shown in the top panels of Figure 5 the others in Figure S8 (supporting information). Figure 5 Results of the simulation study for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). The graphs illustrate the true simulated 3-D exposure“lag“response association (first row) and the lag“response (second“third rows) and exposure“response curves (fourth“fifth rows) from AIC and BIC-selected models corresponding to the bold lines in the 3-D plots. These last panels compare the true simulated associations with the average of the estimated associations together with a sample of estimated curves corresponding to the first 25 simulations (in grey). Results from m = 500 simulated data sets with ns = 400 subjects. Time-to-event data are simulated conditional on the cumulative contribution of the simulated exposure using a permutational algorithm previously proposed for time-varying exposures 29. The cumulative effect is calculated in the form of a function defined in (4) given the exposure history of each subject at time t over a lag period 0“L with L = 40. Censoring events are included and represent approximately 25% of the total. For each of the nine scenarios m = 500 data sets are simulated with a number of subjects ns equal to 200400 or 800. 4.2. Evaluation of performance For each data set i = 1 ¦500 the exposure“lag“response association is estimated by Cox regression models with a cross-basis as defined in (5)“(7). The Efron method is used for tie handling. Similarly to the example in the exposure“response function fe(x) is specified as a simple linear term or quadratic B-splines with 01 or 2 knots placed at 3.35 or 6.7. The lag“response function we(?) is specified as a simple constant term with 1 df or quadratic B-splines with intercept and 01 or 2 knots placed at 13.320 or 26.7 lags. The total number of df for the cross-basis function se(xt) ranges from 1 — 1 = 1 to 4 — 5 = 20 in the 36 models. For each simulated data set the best-fitting models are selected as those minimizing AIC and BIC in (12) respectively. Performance is formally evaluated using a synthetic risk summary ?c from (10) corresponding to an overall cumulative effect and then visually assessed on the whole exposure“lag“response association. "
Lung_Cancer
"(P>10?7 10?7>P>10?10 10?10>P>10?15 10?15>P>10?20 P<10?20). A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2 ? 0.8) resides in the ChIP-Seq peaks of the regulatory regions. Regulatory elements include CTCF binding sites DNaseI hypersensitive sites and histone marks from small airway epithelial cells (SAEC) from ENCODE and human alveolar epithelial cells (hAEC) from our laboratory. For each p-value category we calculated the proportions of cis-meQTL SNPs related with regulatory regions. The figures show that the proportions of cis-meQTL SNPs related with regulatory regions increase with the significance of meQTL associations except for the repressive mark H3K27me3. DNA methylation regional associations for lung cancer GWAS SNPs in subjects of European ancestry (a b f and g) Symbols represent the association between established lung cancer GWAS genetic loci in four regions and methylation levels in nearby CpG probes. Y-coordinate P-value for association; x-coordinate genomic location. For each SNP the red solid circle or square represents the methylation probe with the strongest association whereas other methylation probes are colored on the basis of their correlation (measured as r2) to the most-associated probe. For the most-associated probes the P-values in EAGLE discovery set (n=210) and TCGA lung replication data (n=65) are shown. SNP locations are marked by a blue triangle. (c“e and h“j) show the associations between genotypes and methylation levels of the most associated CpG probes. The box plots show the distribution of the methylation levels in each genotype category with error bars representing the 25% and 75% quantiles. Enrichment of cis-meQTL SNPs for lung cancer risk Analysis based on NCI lung cancer GWAS data (5739 cases and 5848 controls). P-values were produced based on 10000 permutations. AD SQ and SC represent adenocarcinoma squamous cell carcinoma and small cell carcinoma. (a) Enrichment was tested using all cis-meQTL SNPs after LD pruning. (b and c) Strong enrichments were observed for cis-meQTL SNP associated with CpG probes annotated to north shores (b) and gene body (c) regions for SQ. (d) The enrichment in (c) was driven by the cis-meQTLs SNPs impacting CpG probes in non-CpG islands. (e) The enrichment in (d) is driven by the SNPs (or their LD SNPs with r2 > 0.95) overlapping with CTCF binding sites or H3K27me3 mark regions. Replication of EAGLE lung meQTLs in TCGA histologically normal tissue samples. Tissue N All cis associations in EAGLE(34304 associations P<4.0—10?5) Strong cis associations in EAGLE(12083 associations P<1.0—10?10) All trans associations in EAGLE(585 associations P<2.5—10?10) Consistentdirection FDR<0.05 Consistentdirection FDR<0.05 Consistentdirection FDR<0.05 Lung 65 32128 (93.7%) 22441 (65.4%) 11250 (99.3%) 11229 (92.9%) 556 (95.2%) 467 (79.8%) Breast 87 30391 (88.6%) 18762 (54.7%) 11640 (96.3%) 9987 (82.7%) 561 (96.1%) 488 (83.4%) Kidney 142 30975 (90.3%) 23984 (70.0%) 11634 (96.3%) 10783 (89.2%) 558 (95.5%) 506 (86.4%) N is the sample size in replication studies. FDR was calculated based on single-sided p-values. Chromatin marks are enriched on meQTL SNPs. control cis only trans only cis + trans cell line mark proportion proportion fold change proportion fold change proportion fold change SAEC CTCF 11.8% 35.3% 3.0 29.6% 2.5 45.4% 3.8 DnaseI 25.4% 54.0% 2.1 45.8% 1.8 59.6% 2.3 H3K27me3 20.4% 34.1% 1.7 25.4% 1.2 42.9% 2.1 H3K4me3 4.8% 29.7% 6.2 18.0% 3.8 39.9% 8.3 H3K36m3 13.4% 36.8% 2.7 22.8% 1.7 45.4% 3.4 HAEC H3K27me3 17.5% 25.3% 1.4 15.6% 0.9 33.2% 1.9 H3K4me3 7.6% 37.0% 4.9 25.0% 3.3 54.9% 7.2 H3K9-14Ac 17.3% 47.6% 2.8 32.3% 1.9 65.3% 3.8 meQTL SNPs were enriched in chromatin marks including CTCF binding sites DNaseI hypersensitive sites and histone marks from small airway epithelial cells (SAEC) from ENCODE and human alveolar epithelial cells (hAEC) from our laboratory. "
Lung_Cancer
"Sulindac is a Food and Drug Administration (FDA)-approved non-steroidal anti-inflammatory drug (NSAID) for the treatment of osteoarthritis ankylosing spondylitis gout or rheumatoid arthritis [20]“[23]. Its anti-inflammatory activity is due to its inhibition of the synthesis of prostaglandins [24] which cause inflammation and pain in the body. Sulindac has also been found to block cyclic guanosine monophosphate-phosphodiesterase an enzyme that inhibits the normal apoptosis signaling pathway and this inhibitory effect allows the apoptotic signaling pathway to proceed unopposed resulting in apoptotic cell death and reducing the incidence of various tumors including breast esophageal stomach prostate bladder ovary and lung cancers [25] [26]. In humans sulindac is reduced to the active anti-inflammatory metabolite sulindac sulfide undergoes a 2-step reoxidation to sulindac sulfone [27] [28]. All three compounds have been shown to have chemoprotective effects. In colon cancer sulindac has been used to increase the anticancer effects of some reagents or stresses including bortezomib [4] hydrogen peroxide [29] and oxidative stress [30]. Importantly sulindac and its metabolites modulate the expression of multioxidative enzymes including glutathione S-transferases and NQO1 the latter being the key regulator of ?-lapachone-induced cell death in cancer cells [28] [31] [32] and sulindac might therefore have a synergistic anti-tumor effect with ?-lapachone. Lung cancer the major cancer worldwide is now the leading cause of cancer-related deaths [33]“[35]. According to a report of the Department of Health Executive Yuan ROC (Taiwan) published in 2010 the mortality rate for lung cancer is 20% topping the list of all cancer-related deaths. The cost of health care for treatment of lung disease is increasing tremendously each year and threatens to overwhelm public health services [36]. In order to get a better target therapy researchers have tried to identify key differences between lung cancer cells and normal lung cells such as mutation or overexpression of genes including EGFR ras and VEGF [37]“[39]. Unfortunately current chemotherapies for lung cancer lack adequate specificity efficacy and treatment heterogeneity is also a big issue [40]. There is therefore an urgent need for new therapeutic drugs or new combinations of drugs to provide more efficient lung cancer therapy. Since NQO1 overexpression has been noted in both non-small cell lung cancer (NSCLC) cell line [41] [42] ?-lapachone could be a potential therapeutic drug for lung cancers. However some lung cancer cells show lower NQO1 expression or activity and might therefore be resistant to ?-lapachone toxicity. In this study we first investigated the relationship between ?-lapachone toxicity and NQO1 levels in NSCLC cell lines then determined the signaling pathway involved in the cell death caused by high concentrations of ?-lapachone. We also used lower concentrations of ?-lapachone to explore whether sulindac and its metabolites could facilitate the anticancer effect of ?-lapachone by increasing NQO1 expression or activity in lung cancer cell lines with low NQO1 levels and checked the importance of NQO1 in this combination therapy. We found that the toxicity of ?-lapachone was related to the level of NQO1 expression or activity in lung cancer cells and that high concentrations of ?-lapachone killed cells by decreasing phosphorylation of PI3K AKT and ERK and activating JNK. In addition the cytotoxicity of low concentrations of ?-lapachone was increased by combination with sulindac and its metabolites a process involving upregulation of expression or activity of NQO1. Materials and Methods Cell Culture The human lung cancer cell lines CL1-1 CL1-5 and A549 were cultured in 5% CO2 at 37°C in RPMI 1640 medium containing 10% fetal calf serum 100 Units/ml of penicillin and 100 mg/ml of streptomycin (all from Gibco). The cell lines were gifts from Dr. PC Yang National Taiwan University Hospital [43] in whose laboratory CL1-5 cells were selected from parental CL1-1 cells for greater metastatic potential using a transwell system. Cell Viability Assays CL1-1 CL1-5 or A549 cells (1x104) were seeded for 24 h at 37°C in a 96-well culture plate then were subjected to starvation for 14 h in RPMI 1640 medium containing 2% fetal calf serum 100 Units/ml of penicillin and 100 mg/ml of streptomycin. Following 6 h pretreatment with medium or the indicated concentration of sulindac or its metabolites (all from Sigma) the cells were incubated for 12 h with or without the indicated concentration of ?-lapachone in the continued presence of sulindac or its metabolites and then cell viability was evaluated. Two cell viability assays were used. In the crystal violet staining assay the cells were fixed with 4% paraformaldehyde for 15 min stained with 0.4% crystal violet for 15 min and washed with H2O then 50% acid alcohol was used to dissolve the bound crystal violet and the OD at 550 nm measured on an ELISA reader. In the MTT assay 10 µl of MTT (0.5 mg/ml) (Sigma) was added to each well and the plates incubated at 37°C for 4 h then the formazan product was dissolved in 100 µl of DMSO at 37°C for 30 min and the OD at 570 nm measured on a microplate reader. Acridine Orange (AO) Staining Cells (5x104) cultured on cover-slides in 24-well plates were incubated for 14 h in RPMI 1640 medium containing 2% fetal calf serum preincubated with sulindac sulfide for 6h and then treated with or without ?-lapachone for 24 h then were immediately fixed in 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature (RT) and stained for 10 min with 0.5 ml of AO (10 mg/ml in PBS) (Sigma). After several PBS washes the cells were examined on an Olympus BH-2 inverted microscope equipped with a fluorescence attachment. Detection of Apoptosis and Measurement of Intracellular Calcium Levels To detect apoptosis cells (1x106) were treated for 36 or 9 h with 5 µM ?-lapachone then were washed with ice-cold PBS trypsinized with 0.05% trypsin-0.02% EDTA stained for 15 min at 37°C with Annexin V-FITC (10 µg/ml) (Strong Biotech Corporation AVK050 Taipei Taiwan) and analyzed by flow cytometry on a FACScan flow cytometer (Becton Dickinson). To measure intracellular calcium levels the cells were incubated for 10 min at 37°C with 2 mM Fluo-4/AM (Molecular Probes) washed with PBS trypsinized and analyzed by FACSan flow cytometry using the FL1H parameter. Western Blot Analyses Treated cells were lysed with RIPA buffer containing 10 µg/ml of protease inhibitor (Sigma) and then the lysate was centrifuged at 10000—g for 15 min at 4°C and the supernatant collected for immunoblotting. The protein concentration was measured by the Bradford assay and samples containing 20 µg of protein were separated by 10 or 12% SDS“PAGE and then transferred to Immobilon-P membranes for 2 h at 200 V (Millipore) in a Trans-Blot Electrophoretic Transfer cell. The membranes were blocked for 1 h at RT with 5% skim milk in PBS-0.2% Tween 20 (PBS-T) then incubated for 2 h at RT with antibodies against NQO1 (Cell Signaling) PI3 kinase or p-PI3 kinase (Millipore) AKT or p-AKT (Epitomics) ERK p-ERK JNK or p-JNK (Cell Signalling)GAPDH (Genetex) or ?-actin (Abcam) diluted 1?1000 in 1% BSA. After washing for 30 min at RT with PBST the membranes were incubated for 1 h at RT with horseradish peroxidase-conjugated secondary antibody (Perkin-Elmer Boston MA; 1?5000 dilution in PBST) then bound antibody was detected using the ECL Western blotting reagent (Amersham) chemiluminescence being detected using a Fuji Medical X-ray film (Tokyo Japan) and quantified by gel image analyses with Image Pro software. The intensity of the band of interest was divided by that for ?-actin or GAPDH (loading controls) and this value normalized to that seen with no treatment. "
Lung_Cancer
"confidence. If you choose not to take part in this survey it will not affect the care you receive from the NHS in any way. Please do not write your name and address anywhere on the questionnaire as this information is not required. No information you give in this questionnaire will be shared in a way that allows you to be identified. How to complete the survey and how long it will take. The questionnaire is short and will take 5“10?min to complete. Please try to answer every question. Please return your questionnaire even if you have not answered every question. If English is not your first language or if you if you have difficulty understanding the questions then please ask a relative or carer to help you complete the questionnaire. Questions or help? If you have any questions please contact your local lung clinical nurse specialist team. Please select one answer to each question by placing a in the appropriate box. There is space at the end of the survey for you to write any comments. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Abdel-Rahman M Stockton D Rachet B Hakulinen T Coleman MP 2009 What if cancer survival in Britain were the same as in Europe: how many deaths are avoidable Br J Cancer 101 (Suppl 2 S115 S124 19956155 Aveling EL Martin G Jimnez Garc­a S Martin L Herbert G Armstrong N Dixon-Woods M Woolhouse I 2012 Reciprocal peer review for quality improvement: an ethnographic case study of the Improving Lung Cancer Outcomes Project BMJ Qual Saf 21 1034 1041 Beckett P Woolhouse I Stanley R Peake MD 2012 Exploring variations in lung cancer care across the UK-the ˜story so far' for the National Lung Cancer Audit Clin Med 12 14 18 22372213 Department of Health2012National Cancer Patients' Experience Survey Programme 2012/13. England. Health And Social Care Information Centre2012National Lung Cancer Audit Report. Institute for Healthcare Improvement2003The Breakthrough Series: IHI's Collaborative Model for Achieving Breakthrough Improvement. Boston. Khakwani A Rich AL Powell HA Tata LJ Stanley RA Baldwin DR Duffy JP Hubbard RB 2013 Lung cancer survival in England: trends in non-small-cell lung cancer survival over the duration of the National Lung Cancer Audit Br J Cancer 109 (8 2058 2065 24052044 Kwon S Florence M Grigas P Horton M Horvath K Johnson M Jurkovich G Klamp W Peterson K Quigley T Raum W Rogers T Thirlby R Farrokhi E Flum D 2012 Creating a learning healthcare system in surgery: Washington State's Surgical Care and Outcomes Assessment Program (SCOAP) at 5 years Surgery 151 146 152 22129638 National Institute for Health and Care Excellence 2011 The Diagnosis And Treatment Of Lung Cancer (Update Of Nice Clinical Guideline 24) Clinical guidelines CG121 London UK Pronovost P Needham D Berenholtz S Sinopoli D Chu H Cosgrove S Sexton B Hyzy R Welsh R Roth G Bander J Kepros J Goeschel C 2006 An intervention to decrease catheter-related bloodstream infections in the ICU N Engl J Med 355 2725 2732 17192537 Roberts CM Stone RA Buckingham RJ Pursey NA Lowe D Potter JM 2012 A randomized trial of peer review: the UK National Chronic Obstructive Pulmonary Disease Resources and Outcomes Project: three-year evaluation J Eval Clin Pract 18 (3 599 605 21332611 Walters S Maringe C Coleman MP Peake MD Butler J Young N Bergstr¶m S Hanna L Jakobsen E K¶lbeck K Sundstr¸m S Engholm G Gavin A Gjerstorff ML Hatcher J Johannesen TB Linklater KM McGahan CE Steward J Tracey E Turner D Richards MA Rachet B ICBP Module 1 Working Group 2013 Lung cancer survival and stage at diagnosis in Australia Canada Denmark Norway Sweden and the UK: a population-based study 2004-2007 Thorax 68 551 564 23399908 Wise J 2010 Health atlas shows large variations in care in England BMJ 341 c6809 c6809 Study timelines. Consort diagram disposal of eligible trusts including screening randomisation and follow-up. Run chart showing the waiting times from the multidisciplinary team meeting to the first treatment for 10 consecutive small-cell lung cancer patients following the implementation of the quality improvement plan at one trust in the intervention group. Mean change in national lung cancer audit metrics from baseline (2009) to 2011. P=0.055 active treatment”intervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer. Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekensradboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurkradboudumc.nl Prins Judith B 3 Judith.Prinsradboudumc.nl Molema Johan 2 Johan.Molemaradboudumc.nl Donders A Rogier T 4 Rogier.Dondersradboudumc.nl Woertman Willem H 4 Willem.Woertmanradboudumc.nl van der Drift Miep A 2 Miep.vanderDriftradboudumc.nl Speckens Anne EM 1 Anne.Speckensradboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]. MBSR is an 8-week group-based training consisting of meditation practices such as the bodyscan gentle yoga sitting and walking meditation. By repeatedly bringing attention back to the current experience participants gradually learn to disengage from dysfunctional thoughts and directly experience the emotions and bodily sensations of the present moment. MBSR aims to provide participants with the ability to step back from ruminating about the past or worrying about the future and simply allow experiences to unfold [2829]. A recent meta-analysis [30] of 13 nonrandomized studies and 9 randomized controlled trials (RCT) concluded there is positive evidence for the use of mindfulness-based interventions in reducing psychological distress in cancer patients. Among the RCT™s a reduction in symptom severity was found for both anxiety and depression corresponding to moderate pooled controlled effect sizes (Hedges™s g = 0.37 and Hedges™s g = 0.44 respectively) [30]. Though mindfulness-based interventions seem to be effective the authors note that across studies the majority of participants were women (85%) and diagnosed with breast cancer (77%). Compared to breast cancer patients patients with lung cancer are more often male older and have a poorer prognosis. Furthermore of these 22 studies only one study included the partners of the patients showing that partners also benefit from the MBSR training [31]. This is quite surprising since partners of cancer patients also report high levels of distress [32]. Aims The aim of the Mindfulness for Lung Oncology Nijmegen (MILON) study is to examine the effectiveness of MBSR compared to TAU in reducing psychological distress in patients with lung cancer and their partners. We hypothesize that patients in the MBSR group will report a lower level of psychological distress (i.e. anxiety and depressive symptoms) higher levels of quality of life quality of relationship and spirituality than those in the TAU group. Medical and societal costs will be lower in the MBSR versus TAU group. We expect partners in the MBSR group to report a lower level of psychological distress and higher levels of caregiver appraisal relationship quality and spirituality than their counterparts in the TAU group. With regard to the working mechanisms of the MBSR programme we will examine changes in mindfulness skills self-compassion rumination intrusion avoidance and adherence to MBSR. Methods/Design Study design The design of the ˜MILON™ study is a parallel group randomized controlled trial with an embedded process study. Participants are randomized between MBSR and TAU. The study protocol has been approved by our ethical review board (CMO Arnhem-Nijmegen) and registered under number 2011“519. Participants and procedure Patients and partners are recruited at the outpatient "
Lung_Cancer
"Radon is the exposure of interest and is modeled with different combinations of bases for f(x) and w(?) in the cross-basis sx(xt). Given the limited information on smoking histories in this analysis the cross-basis sz(zt) is a priori defined with a natural cubic B-spline with one knot at the median of 2.5 yearly packs — 100 for the exposure“response and a step function with a single cut-off at lag 20 for the lag structure with lag period 2“40 years. However different cross-basis functions can be applied. The model spends 5 df controlling for confounders and a different amount for modeling the effect of radon depending on the chosen cross-basis sx(xt). Modeling exposure“lag“response associations in time-to-event data assumes the definition of an extended version of continuous time-varying predictors namely the varying exposure history for each subject at the ages he contributes to different risk sets 28. The lag scale is chosen as years with lag 0 identifying the exposure during the last year. The lag period is fixed at 2“40 assuming no effect of exposure after 40 years and in the last 2 years consistently with previous analyses. Multiple exposure histories are computed for each subject at the ages he contributed to each risk set given his exposure profile reconstructed from the 5-year periods. This step produced matrices of exposure histories Qx and Qz for radon and smoking respectively as defined in (2). These matrices are used to specify the lag-bases or cross-bases matrices Wx and Wz from (3)“(7) included in the design matrix of the Cox model. Additional information is provided in the Section B of the supporting information. The functions f(x) and w(?) composing sx(xt) for the model candidates are selected a priori among linear constant piecewise constant functions and quadratic B-splines with 36 models in total. Specifically the three cut-offs of a piecewise constant function and combinations of 01 or 2 knots for B-splines are placed at quartiles for the dimension of x corresponding to 26.760.2 and 122.2 WLM/year and at 13.320 or 26.6 lags for the dimension of ?. Also in alternative parameterizations of w(?) the intercept is excluded in the B-spline bases left-constraining the smooth lag“response curve to start from a null risk at lag 2. This a priori assumption reasonably follows the hypothesis that the risk associated with past exposures smoothly increases from zero starting from lag 2. Model selection is based on AIC and BIC adapted to survival analysis given by the following: (12) where is the log-likelihood of the fitted model k is the number of total df and d is the number of uncensored events. The best-fitting model (11) is chosen by minimizing AIC or BIC in (12). Both criteria apply a multiplicative constant to the number of parameters for penalizing more complex models. In particular the penalty of BIC (equal to log(d)) is usually higher and tends to select simpler models. 3.3. Results for distributed lag models Results for simple DLMs assuming a linear radon“mortality relationship on the log scale are illustrated first. Table II presents models with different functions w(?) as defined in (3). Specifically model 1 is specified by a constant (intercept only) function producing a lag-basis identical to the traditional index of unweighted cumulative exposure; model 2 is an example of a DLM with a piecewise constant function; the best-fitting B-spline models with and without intercept specified by a single knot at 13.3 lags are reported as models 3 and 4 respectively. The fit of the various options is expressed by AIC and BIC with the best performance achieved by model 1 for both criteria. This model assigns the same importance to the exposures experienced ? lags earlier in defining the risk for a given time. The specification of more flexible functions with more df does not seem to improve the fit. Table II Functions f(x) and w(?) total degrees of freedom (df) associated with the cross-basis and values for the AIC and BIC for alternative models for the exposure“lag“response association between radon and mortality. Data from the Colorado Plateau uranium miners cohort DLMs f(x) w(?) df AIC BIC Model 1 Linear Constant 1 2236.0 2257.3 Model 2 Linear Piecewise constant  4 2238.6 2270.6 Model 3 Linear Quadratic B-Spline? 4 2238.8 2270.8 Model 4 Linear Quadratic B-Spline§ 3 2238.9 2267.3 DLNMs f(x) w(?) df AIC BIC Model 5 Quadratic B-Spline* Constant 3 2181.4 2209.8 Model 6 Piecewise constant¡ Piecewise constant  12 2171.6 2232.0 Model 7 Quadratic B-Spline* Quadratic B-Spline? 12 2155.3 2215.7 Model 8 Quadratic B-Spline* Quadratic B-Spline§ 9 2153.2 2202.9 ¡ Cut-offs at 26.760.2 and 122.2 WLM/years.   Cut-offs at 1020 and 30 lag. * Knot at 60.2 WLM/years. ? Knot at 13.3 lag. § Knot at 13.3 lag no intercept. DLM distributed lag models; DLNMs distributed lag non-linear models. shows the lag“response curves estimated from models 12 and 4. The curves are composed of a series of estimated contributions to the risk of mortality for lung cancer at each lag ? associated with an increase of 100 WLM/year in radon exposure with defined in (8). The results can be interpreted following the scheme described in Section 2.3. By using a forward perspective represents the HR contribution from a unit increase in exposure experienced at t to the subsequent risk at t + ? with ? = 2 ¦ 40 years. Alternatively adopting a backward perspective the same summary is interpreted as the HR contribution from a unit increase in exposure experienced at t ? ? to the overall risk at t. Model 4 predicts a maximum increase in risk at lag 11 with a HR of 1.042 (95%CI: 1.031“1.052) compared with the constant HR of 1.031 (95%CI: 1.025“1.036) estimated from model 1. Hazard ratio (HR) of lung cancer mortality associated with radon exposure to 100 WLM/year in the lag period of 0“40 years. The figure shows the lag“response curves estimated from models 4 (with 95%CI)2 and 1 as specified in Table II. Data from the Colorado Plateau uranium miners cohort. The better performance of model 1 seems to indicate that the hypothesis of constant risk H0 : w(?) = c is supported by the data. Also the lag“response curve from model 4 in does not suggest a decrease in risk at longer lags although the confidence intervals are relatively wide in this part of the lag period. 3.4. Results for distributed lag non-linear models The results illustrated in Section 3.3 are dependent on the strong assumption of a log-linear relationship between radon exposure and lung cancer mortality. The analysis can be repeated with more flexible DLNMs which can describe simultaneously nonlinear exposure“response relationships and lag structures through the specification of a cross-basis in (5)“(7). The definition of DLNMs involves a higher number of potential models obtained by different combinations of bases for the functions f(x) and w(?). The second part of Table II only reports models with the same choices for w(?) used in DLM and with f(x) specified as another piecewise constant function and the B-spline providing the best fit with one knot at 60.2 WLM/year. Overall the best-fitting option for both AIC and BIC is model 8 with a B-spline for both f(x) and w(?). This model uses 9 df in total for expressing the bidimensional association. The hypothesis H0 : f(x) = x of a linear radon-mortality dependency is not supported by the data as all the DLNMs show a substantial decrease in both AIC and BIC when compared with simpler DLMs. In particular the comparison of the best-fitting model 8 representing f · w(x?) with model 4 representing x · w(x?) indicates that the 6 additional df substantially improve the fit. Similarly the hypothesis H0 : w(?) = c of a constant risk along lags previously suggested when evaluating DLMs is not supported either. The comparison of model 8 with model 5 representing f(x) · c indicates a better fit of the former. Interestingly this result is the opposite of what was suggested in Section 3.3 revealing how imposing a wrong assumption about the relationship in one dimension induces spurious results in the other space compromising the analysis of the association. The interpretation of results from DLNMs relies on a bidimensional representation of the exposure“lag“response association. This is achieved by computing the risk contributions over a grid defined in the range of the exposure x and the lag ? applying (9). This bidimensional dependency is depicted in the two top panels of Figure 2 showing the predicted HR surfaces from models 8 and 6 in the range 0“250 WLM and 0“40 lags. The graphs show an initial increase in risk along lags peaking at approximately 10 years after the exposure and then decreasing and apparently disappearing after about 30 years independent of the exposure levels. The inspection of the panels along the dimension of x reveals the nonlinear radon-mortality dependency with the risk increasing steadily up to 50 WLM/year and then flattening out. The shape of the HR surfaces unveils the different assumptions underlying the choices of bases for functions f(x) and w(?) namely B-splines and piecewise constant functions. Figure 2 Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0“250 WLM/year and lag period 0“40 years. The figure shows 3-D graphs of the exposure“lag“response association on a grid of exposure — lag values (from model 8 top left and model 6 top right) lag“response curves for radon exposure of 100 WLM/year (from models 8 with 95%CI and model 6 bottom left) and exposure“response curves at lag 15 (from models 8 with 95%CI and models 6 and 4 bottom right). The models are described in Table II. Data from the Colorado Plateau uranium miners cohort. Although the 3-D representation offered by the top panels in Figure 2 provides an overview of the bidimensional association it is still limited for inferential purposes as the uncertainty in the estimate is not reported. In order to extend the interpretation the analysis can focus on the risk along ? predicted for specific exposure intensities or alternatively the risk along x for specific lags namely the vectors and from Section 2.3. These dependencies are represented by slices cut on the bidimensional risk surface along the appropriate dimension. The bottom panels of Figure 2 report the lag“response curve corresponding to an exposure level of 100 WLM/year and the exposure“response curve for lag 15 from both Models 8 and 6 together with 95% confidence intervals for the former. These curves correspond to the two bold lines in the 3-D plots. The bottom-left panel is interpreted similarly to the DLM in as the specific risk contributions composing the lag“response curve but this time associated with a specific exposure xp = 100 WLM/year. The curve estimated from model 8 peaks at lag 11 with an HR of 1.21 (95%CI: 1.16“1.26) and both models 8 and 6 suggest that the risk disappears after 30“35 years. The B-spline for w(?) in model 8 is left-constrained by the lack of an intercept forcing the smoothed lag“response curve to start from a null risk at lag 2. The best fit of Model 8 if compared with model 7 which includes the intercept seems to support this hypothesis. The bottom-right panel shows instead the risk contributions at ?p = 15 for different exposure intensities and is interpreted as the exposure“response at t from exposures experienced at t ? 15 (backward perspective) or the exposure“response contributions at t + 15 from exposures experienced at year t (forward perspective). Although models 8 and 6 adopt different bases for functions f(x) and w(?) the estimates of the predicted risk along x and ? are consistent showing a radon-mortality relationship that is markedly nonlinear and nonconstant in time. These measures of risk are extended in Figure 3 reporting estimates from model 8 for different exposure and lag values. A right-constrained version of Model 8 is discussed in Section D.1 and illustrated in Figure S2 of the supporting information. Figure 3 Hazard ratio (HR) of lung cancer mortality associated with radon exposure in the range 0“250 WLM/year and lag period 0“40 years. The figure shows lag“response curves for radon exposure of 2050100 and 200 WLM/year (left) and exposure“response curves at lag 51015 and 20 (right) estimated from model 8 as specified in Table II. "
Lung_Cancer
"inhibitors by causing immediate and nearly complete intracellular and extracellular thiamine deprivation [6]. In previous studies we have shown that thiaminase has both in vitro and in vivo cytotoxicity activity further supporting the concept that TDEs could represent new targets for novel therapies [6] [7] [8]. We have also previously reported that rapamycin has antagonistic effect on thiaminase-mediated growth inhibition of leukemia cells [7] a surprising finding since rapamycin generally acts as a sensitizing agent in combination with cytotoxic drugs. We now present metabolic and metabolomic observations regarding the anticancer activities and metabolic effects of thiaminase in leukemia and breast cancer cells. We chose to focus on breast and leukemia models because these were the models in which we observed the most promising activity of thiaminase in xenografts. These studies help define thiaminase metabolic effects that may be responsible for its cytotoxic activity. These studies also further elucidate the role of mTOR as an inhibitor of thiaminase-mediated alterations in cellular metabolism and demonstrate the role of mTOR in regulating expression of enzymes involved in thiamine-dependent metabolism. Methods Ethics statement All animal studies were approved by the University of Kentucky Institutional Animal Care and Use Committee. Cell Lines The human breast cancer cell line MCF-7 and the non-malignant breast cell line MCF-10A were obtained from ATCC; human leukemia cell lines Reh and RS4 were originally obtained from ATCC and generously provided by Dr. Terzah Horton Baylor College of Medicine. Cell line authentication was performed by PCR amplification of nine short tandem repeat (STR) loci (Research Animal Diagnostic Laboratory St. Louis MO) and comparing the profile to the ATCC STR database. The STR profile of MCF-7 and RS4 cell lines were identical to the ATCC profile. The Reh cell line matched all alleles in the ATCC Reh profile plus one extra allele at two loci. Cytotoxicity assays Human leukemia cell lines Reh or RS4 were plated in triplicate in 96-well microtiter plates in RPMI-1640 (with 25 mM HEPES) medium containing 10% fetal bovine serum at final densities of 8—104 cells/well. MCF-7 cells were plated in the same medium at the final density of 1000cells/well. Medium containing native thiaminase at a concentration range of 1—10?6 to 4 units/ml was added to cells and incubated for four days. Following incubation an MTT Cell Proliferation Assay (ATCC) was performed according to the ATCC protocol. The IC50 was calculated from the dose response curve as the concentration of drug producing a 50% decrease in the mean absorbance compared to the untreated wells using Prism GraphPad software. The cytotoxicity experiments were repeated a minimum of three times in triplicate. Analysis of primary human ALL specimens was performed by plating cells at a density of 1—106/ml and treating for 24 hours with the indicated concentration of thiaminase. Viability was evaluated by dead cell exclusion labeling with trypan blue dye as well as flow cytometric analyses using Annexin-V labeling as previously described [9]. Xenograft studies RS4 tumor xenografts were established by subcutaneously inoculating 1—107 cells into the right flank of five-week-old female Crl:NU-Foxn1 nude mice (Charles River Laboratories Wilmington MA). For the establishment of MCF-7 xenograft a 17?-estradiol pellet (0.72 mg 60 days release; Innovative Research of America Sarasota FL) was implanted subcutaneously into the neck to facilitate optimal tumor growth for the estrogen receptor“positive MCF-7 cells. The xenografts were initiated by subcutaneously injecting 5—106 MCF-7 cells into the right flank of five-week-old female Crl:NU-Foxn1 nude mice. When palpable tumors had formed mice were treated with native thiaminase at its MTD (2000 units/kg body weight) twice a week at a site distant from the formed tumor for three weeks. Mice were treated with a single dose of thiaminase enzyme conjugated with 1k linear chain PEG (1K-LCPTE) at its MTD (50 U/kg) at a site distant from the formed tumor. Mice treated with N3-pyridyl thiamine (N3PT) received an intraperitoneal (i.p.) dosage of 80 mg/kg daily for five days. Mice treated with both 1K-LCPTE and N3PT received a single dose of 1K-LCPTE at 50 U/kg first then after 5five days mice received N3PT at 80 mg/kg daily for five days. Tumors were measured twice a week in a blinded manner by measuring perpendicular diameters with a digital caliper and tumor volumes (mm3) were calculated using the following formula: volume ?=? width — width — length — ?/6. The predetermined endpoint was a tumor volume of 1500 mm3. The control mice were injected with MCF-7 or RS4 cells and left untreated and results combined with a previous control group of the same xenograft [7]. Kaplan-Meier survival curves and statistical analysis was performed with GraphPad Prism software. Primary lymphoblastic leukemia xenograft methods A primary lymphoblastic leukemia specimen was transplanted by IV injection into sub-lethally irradiated immune deficient NOD/SCID/IL2Rg mice. When the tumor burden was established in the bone marrow (day 17) animals received treatment with thiaminase 2000 units/kg on days 17 20 and 24 administered by subcutaneous injection (the longer interval between treatments in these mice in comparison to the Crl:NU-Foxn1 nude mice was due to tolerability). The animals were sacrificed on day 33 and marrow cells were isolated and examined by flow cytometry using human-specific antibodies for CD45 and CD19 to determine the level of human leukemia cell engraftment as previously described [9]. Mitochondrial bioenergetics measurements Oxygen consumption was determined using the Seahorse Extracellular Flux (XF-96) analyzer (Seahorse Bioscience Chicopee MA). The XF-96 measures the concentration of oxygen and free protons in the medium above a monolayer of cells in real-time. Thus the rates of oxygen consumption and proton production can be measured across several samples at a time. To allow comparison between experiments data are presented as oxygen consumption rate (OCR) in pMoles/min/104 cells and the extracellular acidification rate (ECAR) in mpH/min/104 cells. RS4 and Reh leukemia cells were seeded at 125000 cells/well into gelatin-coated Seahorse Bioscience XF microplates cultured in the presence or absence of 2 g/L D-glucose and then centrifuged to adhere to the bottom of the wells while for the MCF-7 and MCF-10A about 45000 cells were plated and allowed to adhere overnight. OCR was measured four times and plotted as a function of cells under the basal condition followed by the sequential addition of oligomycin (1 µg/ml) FCCP (1 µM) and rotonone (1 µM). The ATP-linked OCR was calculated as the basal OCR minus the OCR measured after the addition of oligomycin. The OCR maximal capacity was the direct rate measured after the addition of FCCP. The reserve capacity is the FCCP OCR minus the basal OCR. For the ECAR measurements cells were washed following overnight incubation and changed to assay media lacking glucose. Basal ECAR were measured four times and plotted as a function of cells under the basal condition followed by the sequential addition of glucose (25 mM) oligomycin (1 µg/ml) and 2-deoxyglucose (25 mM). The rate of glycolysis was determined by subtracting the basal ECAR from the ECAR after the addition of glucose. Glycolytic reserve was determined by subtracting the ECAR following the addition of oligomycin from the ECAR following the addition of glucose. Differences between treatment groups were calculated using the Kruskal Wallis test. Metabolomic studies RS4 leukemia cells and MCF-7 breast cancer cells were analyzed under six conditions: control for 24 hrs (C-24); incubation in thiaminase for 24 hrs (T-24); control for 48 hours (C-48); thiaminase for 48 hrs (T-48); rapamycin for 48 hrs (R-48); and both rapamycin and thiaminase for 48 hrs (R+T-48). Four independent samples were produced for each time point for each cell line and cell pellets were stored at ?80°C until the separate experiments were all completed. Metabolomic studies were performed at Metabolon Inc. (Durham NC). The non-targeted metabolic profiling platform consisted of three independent instrumental methods: ultrahigh performance liquid chromatography/tandem mass spectrometry (UHPLC/MS/MS2) optimized for basic species; UHPLC/MS/MS2 optimized for acidic species; and gas chromatography/mass spectrometry (GC/MS). The detailed process of the platform; including sample processing instrument configuration data acquisition as well as metabolite identification and quantitation were published previously [10] [11]. Three hundred and forty two metabolites were identified by automated comparison of the ion features in the experimental samples to a reference library of chemical standard entries that included retention time molecular weight (m/z) preferred adducts in-source fragments and associated MS spectra [12]. Instrument variability was determined by calculating the median relative standard deviation (RSD) for the internal standards that were added to each sample prior to injection into the mass spectrometers. Overall process variability was determined by calculating the median RSD for all endogenous metabolites (i.e. non-instrument standards) present in 100% of a set of technical replicates of pooled samples. Values for instrument and process variability meet Metabolon™s acceptance criteria with instrument variability of 3% and overall process variability of 12%. Following normalization to total protein (Bradford assay) log transformation and imputation with minimum observed values for each compound Welch™s two-sample t-tests were used to identify biochemicals that differed significantly between experimental groups. The entire metabolomic data sets for RS4 and MCF-7 cells with statistical results are included in data tables (Table S1). Immunoblot analysis Cells were treated with thiaminase (0.001 U/ml) and/or rapamycin (0.1 µM) for 96 hours. Cells were lysed with a triple-detergent lysis buffer (50 mM Tris pH8.0 150 mM NaCl 1% NP-40 0.5% DOC 0.1% SDS 0.02% sodium azide 100 µg/ml PMSF protease inhibitors (Roche) and phosphatase inhibitors (Thermo Scientific)). Equal amounts of protein were loaded into each well and separated by SDS-PAGE gel followed by transfer onto nitrocellulose membranes. The membranes were blocked incubated with the indicated primary antibodies at 4°C overnight and the appropriate horseradish peroxidase“conjugated secondary antibody was added for 1 hour at room temperature. Immunoblots were developed by use of SuperSignal West Pico chemiluminescent substrate (Thermo Scientific) according to the manufacturer™s protocol and analyzed by FujiFilm LAS-4000 luminescent image analyzer (Multigauge software). The primary and secondary antibodies used in this study are listed as follows. Anti- PKM1; anti-BCAT2; anti-TPK1 and anti-THTPA antibodies were purchased from Proteintech Group Inc. (Chicago IL). Anti- PKM2 and anti-CPT1A antibodies were from Cell Signaling Technology (Danvers MA). Anti-BCKDE1 and anti-phospho-BCKDE1 antibodies were obtained from Bethyl laboratories (Montgomery TX). Anti-BCAT1 anti-?-actin and all secondary antibodies were obtained from Sigma-Aldrich (St. Louis MO). Results Evidence of antitumor activity of thiaminase in leukemia and breast cancer tumor models is shown in Figure 1. Figure 1A is a Kaplan-Meier plot of MCF-7 subcutaneous xenografts treated with thiaminase showing a prolongation in the time to endpoint (pre-defined tumor volume) (TTE) from 41 days in the mock treated cohort to 59 days in the treated cohort (p?=?0.03). In Figure 1B RS4 subcutaneous xenografts show an increase in median TTE from 16.5 days from the start of treatment to undefined TTE after 60 days (p<0.001). We have also previously shown evidence of thiaminase activity against MDA231 breast cancer [8]. In Figure 1C the activity of thiaminase is shown against primary human leukemia cells. The most sensitive primary leukemia specimens appear to be lymphoblastic specimens with MLL-gene re-arrangements. This was of interest as the RS4 cell line is also an MLL-rearranged cell line. Figure 1D shows flow cytometric analysis of bone marrow of a primary MLL-rearranged leukemia cell xenograft treated with thiaminase demonstrating a decrease in leukemia cell proportion after treatment. These studies along with previous studies [7] [8] provided the rationale for performing further detailed examination of the metabolic effects of thiaminase in the breast cancer cell line MCF-7 and in the RS4 leukemia cell line. In addition for further points of comparison we included selected studies in two additional cell lines Reh leukemia cells another lymphoblastic leukemia cell line and MCF-10A a non-malignant breast cell line. 10.1371/journal.pone.0085702.g001 Figure 1 In vivo evidence of thiaminase anticancer activity. A. A Kaplan-Meyer plot of time to pre-defined tumor volume endpoint for subcutaneous MCF-7 breast cancer xenografts treated with thiaminase 2000 units SC QOD or buffer control. The median time to endpoint was 41 "
Lung_Cancer
"Mesothelin; MTB: Mycobacterium tuberculosis; Hsp: Heat shock protein; i.p.: Intraperitoneal; i.d.: Intradermal; BMDCs: Bone marrow-derived dendritic cells; APCs: Antigen-presenting cells; PBMCs: Peripheral blood mononuclear cells; PBLs: Peripheral blood leukocytes; LPS: Lipopolysaccharide; H&E: Haematoxylin and eosin; PFA: Paraformaldehyde; DAB: Diaminobenzidine; mAb: monoclonal antibody. Competing interests The authors declare that they have no competing interests. Authors™ contributions JY played a role in the design of the experiments acquisition analysis and interpretation of the data and writing the manuscript. PR JN YY NHA MN GJ-M XT SK HC PU BF TC and PL participated in the performance of experiments. SK and TB were involved in design of the experiments. RB was involved in data analysis. ER was involved in setting up murine ovarian cancer model. SO provided the murine ovarian cancer model. NS provided the plasmid that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein. GD NS and SO gave constructive input on experimental design and data analysis. JG played a role in conception and design of the fusion protein. MP and JG were involved in the conceptualization and design of the study analysis and interpretation of datasets and in writing the manuscript. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Figure S1 scFvMTBHsp70 binds to 40L mesothelioma cells. 40L cells were stained with scFvMTBHsp70 or MTBHsp70 followed by mouse anti-MTBHsp70 and Donkey anti-mouse Alexa Fluor 594. Cells were observed using a Nikon Eclipse TiE fluorescence microscope. A Representative pictures from three independent experiments. Scale bar 10 ?m. B Images were analyzed using the NIS-Elements AR Microscope Imaging Software. Mean Fluorescence Intensity was analyzed using ImageJ. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. ****p?<?0.0001. Click here for file Additional file 2: Figure S2 scFvMTBHsp70 or MTBHsp70 plus P4 scFv treatment does not lead to infiltration of inflammatory cells into abdominal or intestinal mesothelial tissues. Samples of abdominal wall and intestine were prepared from C57BL/6 mice that had previously received multiple i.p. injections of scFvMTBHsp70 MTBHsp70 plus P4 scFv or saline as described in the Methods section. Sections of these tissues were stained with H&E and images were acquired on a Zeiss Axio A1 microscope. Representative images from 3 animals per treatment group are shown. No detectable level of mononuclear cell or granulocyte infiltrate within mesothelial tissues was seen in any sampled tissues. Scale bar 20 ?m. Click here for file Additional file 3: Figure S3 scFvMTBHsp70 treatment does not affect numbers of tumor-infiltrating CD8+ or Foxp3+ T cells. (A) Representative images of intratumoral CD8+ and Foxp3+ T cells from saline (n?=?3) scFvMTBHsp70 (n?=?3) or MTBHsp70 plus P4 scFv (n?=?3) -treated mice. Mouse spleen sections were used as positive controls: CD8+ and Foxp3+ T cells are clearly evident in the sections. Scale bar 20 ?m. (B) Numbers of CD8+ and Foxp3+ cells were quantified from 3“5 randomized fields. Click here for file Additional file 4: Figure S4 Validation of in vivo depletion of CD8+ cells in FVB/NJ mice. Mice were injected i.p. with 200 ?g of anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a as described in Methods. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. (A) Representative results of flow analyses on 10 mice per group and reported as the percentage of CD8+ cells in lymphocytes. (B) CD8+ cells in the mice treated with isotype IgG2a or anti-CD8 mAb were compared. ***p< 0.001. Click here for file Acknowledgments This manuscript is dedicated to the memory of Janet Gelfand a victim of ovarian cancer. The authors gratefully acknowledge the continuing support for this work from the Edmund C. Lynch Jr. Cancer Fund Arthur Luxenberg Esq. Perry Weitz Esq. and the VIC Mesothelioma Research and Resource Program at MGH and the Friends of VIC Fund. PU and NHA were supported by the Prof. Dulcie V. Coleman Studentship at Imperial College London. We thank Oliver Mitchell John Cao Lujia Zhou Rumbidzai Mushavi and Sayinthen Vivekanantham for their technical assistances Dr. Yuhui Huang for his useful comments Michael Waring Dr. Michael Santuosuosso and Dr. Ravi Mylvaganam for their technical advice Dr. Musie Ghebremichael for his advice in statistical analysis and Mahnoor Valibhoy for her assistance with the schematic figure. Banchereau J Palucka AK Dendritic cells as therapeutic vaccines against cancer Nature reviews Immunology 2005 5 296 306 10.1038/nri1592 15803149 Mellman I Coukos G Dranoff G Cancer immunotherapy comes of age Nature 2011 480 480 489 10.1038/nature10673 22193102 Topalian SL Weiner GJ Pardoll DM Cancer immunotherapy comes of age J Clin Oncol 2011 29 4828 4836 10.1200/JCO.2011.38.0899 22042955 Kantoff PW Higano CS Shore ND Berger ER Small EJ Penson DF Redfern CH Ferrari AC Dreicer R Sims RB Xu Y Frohlich MW Schellhammer PF IMPACT Study Investigators Sipuleucel-T immunotherapy for castration-resistant prostate cancer The New England journal of medicine 2010 363 411 422 10.1056/NEJMoa1001294 20818862 Chambers JD Neumann PJ Listening to provenge“what a costly cancer treatment says about future medicare policy The New England journal of medicine 2011 364 1687 1689 10.1056/NEJMp1103057 21470004 Chang K Pastan I Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers Proc Natl Acad Sci USA 1996 93 136 140 10.1073/pnas.93.1.136 8552591 Argani P Iacobuzio-Donahue C Ryu B Rosty C Goggins M Wilentz RE Murugesan SR Leach SD Jaffee E Yeo CJ Cameron JL Kern SE Hruban RH Mesothelin is overexpressed in the vast majority of ductal adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by serial analysis of gene expression (SAGE) Clinical cancer research: an official journal of the American Association for Cancer Research 2001 7 3862 3868 11751476 Ho M Bera TK Willingham MC Onda M Hassan R FitzGerald D Pastan I Mesothelin expression in human lung cancer Clinical cancer research: an official journal of the American Association for Cancer Research 2007 13 1571 1575 10.1158/1078-0432.CCR-06-2161 17332303 Tang Z Qian M Ho M The role of mesothelin in tumor progression and targeted therapy Anti-cancer agents in medicinal chemistry 2013 13 276 280 10.2174/1871520611313020014 22721387 Hassan R Bullock S Premkumar A Kreitman RJ Kindler H Willingham MC Pastan I Phase I study of SS1P a recombinant anti-mesothelin immunotoxin given as a bolus I.V. infusion to patients with mesothelin-expressing mesothelioma ovarian and pancreatic cancers Clinical cancer research: an official journal of the American Association for Cancer Research 2007 13 5144 5149 10.1158/1078-0432.CCR-07-0869 17785569 Kreitman RJ Hassan R Fitzgerald DJ Pastan I Phase I trial of continuous infusion anti-mesothelin recombinant immunotoxin SS1P Clinical cancer research: an official journal of the American Association for Cancer Research 2009 15 5274 5279 10.1158/1078-0432.CCR-09-0062 19671873 Feldhaus MJ Siegel RW Opresko LK Coleman JR Feldhaus JM Yeung YA Cochran JR Heinzelman P Colby D Swers J Graff C Wiley HS Wittrup KD Flow-cytometric isolation of human antibodies from a nonimmune Saccharomyces cerevisiae surface display library Nature biotechnology 2003 21 163 170 10.1038/nbt785 12536217 Bergan L Gross JA Nevin B Urban N Scholler N Development and in vitro validation of anti-mesothelin biobodies that prevent CA125/Mesothelin-dependent cell attachment Cancer"
Lung_Cancer
"These results indicate that FTSJ2 is involved in the inhibition of cancer cell migration and invasion. .0090818.g006 Inhibition of cell migration and invasion upon the over-expression of hFTSJ2 in TE671 cancer cells. (A) The wound healing assay showing that the TE671-hFTSJ2 cells had a reduced migration compared with the untransfected TE671 cells at 12 hours after wounding. (B) Cell migration area at 12 hours after wounding ([healing area/wounding area]—100%). (C) Invasion assay showing that the TE671-hFTSJ2 cells had a reduced invasion compared with the untransfected TE671 cells. The cells that penetrated the Trans-well membrane are shown in purple. (D) Quantity of the cells that invaded the Trans-well membrane ([Giemsa positive area/total area]—100%). The values are equal to?=?the means±SE; n?=?3; *P<0.05 vs. untransfected TE671 cells. Discussion In this study we characterized the mammalian FTSJ2 protein which we presumed to be an ortholog of E. coli RrmJ. RrmJ is known as a 2?-O-ribose MTase which methylates U2552 in the A-loop of the peptidyl transferase center in the 23S rRNA [5]. Um2552 is one of the four 2?-O-methylated nucleotides in rRNA [6]. In a previous study a lack of U2552 methylation has been found to influence the tertiary interactions of U2552 U2555 and C2556; to reduce the conformational dynamics of the A-loop [8]; and to subsequently decrease the ribosome stability and translation efficiency [7] [9] [37]. These results indicate the importance of RrmJ and the methylation of U2552. In our phylogenetic analysis in this study the RrmJ homologs clustered into the following three groups in Eukaryota: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). In a comparison of the divergent distance between RrmJ and the ancestral roots of each group FTSJ2/Mrm2p showed the closest relation to RrmJ. In the FTSJ2/Mrm2p protein group S. cerevisiae Mrm2p has been studied extensively. In the mitochondrial rRNA of S. cerevisiae only three nucleotides are modified including the U2791 of the 21S rRNA which is 2?-O-ribose-methylated by Mrm2p. It has been proposed that Mrm2p is the mitochondrial RrmJ ortholog in S. cerevisiae according to the equivalent catalytic positions of Um2791 in the S. cerevisiae mitochondrial 21S rRNA and Um2552 in the E. coli 23S rRNA [6] [12]. However mammalian FTSJ2 remains uncharacterized. Thus we performed a sequence alignment of human FTSJ2 with RrmJ Mrm2p and FtsJ2 in M. jannaschii and three typological invertebrate species () and we compared the 3D structures of RrmJ human FTSJ2 and porcine FTSJ2 (Figure S1). A previous study showed the highly conserved catalytic tetrad K-D-K-E in site-specific 2?-O-ribose MTases [10] and this catalytic tetrad was also present in our sequence alignment. Furthermore a sequence alignment revealed the highly conserved amino acids involved in SAM binding. However interestingly the 3D structure of human FTSJ2 showed a different orientation for the first residue of the catalytic tetrad (lysine) compared with RrmJ. This difference may indicate a different A-loop structure of the rRNA substrate or a different catalytic mechanism of the FTSJ2/Mrm2p protein in mammals. Because S. cerevisiae Mrm2p is localized in the mitochondria [12] we hypothesized that hFTSJ2 is a mitochondrial protein. We used immunofluorescence and Western blot analysis to verify that hFTSJ2 was predominantly located in the mitochondria but not in the nucleus or cytoplasm (Figures 3C and 3D). In addition E. coli RrmJ is well known as a heat shock protein. The rrmJ mRNA expression increases over 20-fold after heat shock [3] and the rrmJ deletion strain fails to adapt to heat shock temperatures [7]. In S. cerevisiae the growth of the mrm2 deletion strain at 37°C is slightly reduced on glucose-containing medium and severely reduced on glycerol-containing medium [12]. Thus to evaluate the heat shock response of the RrmJ ortholog in mammals we tested the heat shock response of piglets at 30°C or 35°C. The large intestine lung and bladder showed an up-regulated expression of Ftsj2 mRNA at temperatures of 30°C and 35°C but only the lung tissue demonstrated a simultaneous heat shock response with the up-regulation of Hsp70.2 mRNA (). This finding in the lung may have been caused by the direct exposure of this tissue to the increased temperature through the inhalation of hot air. However under these heat shock treatments for the piglets only 5 (small intestine muscle lung kidney and liver) of the 11 tissues showed an up-regulation tendency of Hsp70.2 expression possibly because of the systemic effect of the response of the warm-blooded piglets to the heat shock stress. Furthermore to eliminate this systemic effect and to confirm the FTSJ2 mRNA up-regulation in the lung a human lung adenocarcinoma cell line (A549) was subjected to heat shock for 1 hour and allowed to recover at 37°C. The results of this experiment showed a 1.5-fold increase in the hFTSJ2 expression at both 42°C and 45°C and then a gradual return to its normal level after the recovery period (). Although the exact role of FTSJ2 in the heat shock response in mammals is unknown these results indicate that FTSJ2 inherited the HSP characteristics of its orthologs in E. coli and S. cerevisiae. In the previous studies of HSPs such as HSP70 and HSP90 it has been demonstrated that the heat shock responses are highly conserved during evolution. From Prokaryota to Eukaryota and Protozoa to Metazoa the HSPs represented the universal protein structures and similar physiological functions and following evolution the HSPs diverged and translocated into different anelles [1] [2] [38]“[40]. These characteristics are in alignment with the results of the RrmJ phylogenic analysis and the conservation of the heat shock response properties in mammals. In addition to certain small HSPs (i.e. HSP32 HSP25 and HSP22) most of the HSPs are expressed in all types of tissues [2] [41] and our results showed that Ftsj2 was expressed in all of the 13 normal piglet tissues (Figure S2). These results indicated that FTSJ2 was not only involved in the heat shock response but also might be necessary for mitochondrial functions under normal condition according to the mitochondrial localization of FTSJ2. In addition previous functional studies have shown that the HSPs (i.e. HSP70 and HSP90) are involved in tumorigenesis and the inhibition of apoptosis in cancer cells [40] [42]“[44]. Similarly the amplification of the genetic locus of FTSJ2 has been discovered in several NSCLC clinical samples and was considered as a novel oncogenic locus [20]. In our study the expression of FTSJ2 was also shown in different cancer cells (hepatocarcinoma lung adenocarcinoma and rhabdomyosarcoma cells). However in the human lung adenocarcinoma cell sublines CL1-0 and CL1-5 [45] we found that hFTSJ2 mRNA was decreased in the more invasive CL1-5 cells compared with the less invasive CL1-0 cells. Moreover the TE671-hFTSJ2 cells which over-expressed the hFTSJ2 protein showed a decrease in cell migration and invasion (). These results indicate that the mitochondrial hFTSJ2 protein exhibits an additional function to suppress cancer cell metastasis. Previous reports have suggested that hFTSJ2 functions in the mitochondria. Thus it is reasonable that FTSJ2 is required for extensive ATP production through respiration in the mitochondria of proliferating cancer cells [46]“[48]. In contrast according to recent studies a mitochondrial complex I and NAD+/NADH imbalance enhances the metastasis of breast cancer cell lines [49] and the dynamics of mitochondrial fusion or fission also regulates cell migration and invasion [50] [51]. These results indicate that the invasiveness of cells is affected by the condition and state of their mitochondria. In we characterized FTSJ2 as an ortholog of the E. coli 23S rRNA 2?-O-ribose MTase and showed that it functions in the mitochondria. We also provided evidence that FTSJ2 is a novel heat shock protein that is over-expressed after heat shock treatment in both piglet lung and lung adenocarcinoma cells. Surprisingly FTSJ2 may also be involved in the inhibition of cancer cell migration and invasion by influencing the mitochondrial functions. Accession Numbers The GenBank accession numbers of the protein sequences which were used in the phylogenetic tree construction and the protein sequences alignment are labeled in and . The protein coding regions of the porcine Ftsj1 and Ftsj2 mRNA were first sequenced in this study and the GenBank accession numbers of the corresponding porcine Ftsj1 and Ftsj2 mRNA are EU694401 and EU694400 respectively and the porcine FTSJ1 and FTSJ2 proteins are ACH57153 and ACH57152 respectively. Supporting Information Figure S1 Three-dimensional protein structures of E. coli RrmJ human FTSJ2 and porcine FTSJ2. (A) The protein structure of E. coli RrmJ which was resolved by B¼gl et al. (2000) (PDB ID: 1EIZ) [7]. (B) The protein structure of human FTSJ2 which was resolved by Wu et al. (2009) (PDB ID: 2NYU) [36]. (C) The protein structure of porcine FTSJ2 which was predicted using the SWISS-MODEL website with human FTSJ2 as a template. The ?-helices and ?-strands are shown in green and yellow respectively. The SAM residues and the K-D-K-E catalytic center are shown in the ball and stick representations respectively. (TIF) Click here for additional data file. Figure S2 Porcine Ftsj2 mRNA expression in porcine tissues. (A) Expression of porcine Ftsj2 mRNA as measured by semi-quantitative RT-PCR. Porcine ?-actin mRNA was used as a loading control. (B) Quantification of the porcine Ftsj2 mRNA expression which normalized to the ?-actin mRNA expression. The values are equal to?=?the means of duplicate experiments. (TIF) Click here for additional data file. The authors would like to thank Dr. Jeremy J.W. Chen for providing the CL1-0 and CL1-5 cell lines. We also like to thank our colleagues (Drs. Tung-Chou Tsai Yu-Tang Tung and Zi-Lun Lai) in the Molecular Embryology and DNA Methylation Laboratory for their help with discussions and technical issues. References 1 AngM LiberekK SkowyraD ZyliczM GeopoulosC (1991) Biological role and regulation of the universally conserved heat shock proteins. J Biol Chem266: 24233“242361761528 2 BenjaminIJ McMillanDR (1998) Stress (heat shock) proteins: molecular chaperones in cardiovascular biology and disease. Circ Res83: 117“1329686751 3 RichmondCS GlasnerJD MauR JinH BlattnerFR (1999) Genome-wide expression profiling in Escherichia coli K-12. Nucleic Acids Res27: 3821“383510481021 4 OguraT TomoyasuT YukiT MorimuraS BeggKJ et al (1991) Structure and function of the ftsH gene in Escherichia coli. Res Microbiol142: 279“2821925026 5 CaldasT BinetE BoulocP CostaA DesgresJ et al (2000) The FtsJ/RrmJ heat shock protein of Escherichia coli is a 23 S ribosomal RNA methyltransferase. J Biol Chem275: 16414“1641910748051 6 LapeyreB (2004) Conserved ribosomal RNA modification and their putative roles in ribosome biogenesis and translation. Curr Genet12: 263“284 7 B¼glH FaumanEB StakerBL ZhengF KushnerSR et al (2000) RNA methylation under heat shock control. Mol Cell6: 349“36010983982 8 BlanchardSC PuglisiJD (2001) Solution structure of the A loop of 23S ribosomal RNA. Proc Natl Acad Sci USA98: 3720“372511259644 9 CaldasT BinetE BoulocP RicharmeG (2000) Translational defects of Escherichia coli mutants deficient in the Um(2552) 23S ribosomal RNA methyltransferase RrmJ/FTSJ. Biochem Biophys Res Commun271: 714“71810814528 10 FederM PasJ WyrwiczLS BujnickiJM (2003) Molecular phylogenetics of the RrmJ/fibrillarin superfamily of ribose 2?-O-methyltransferases. Gene302: 129“13812527203 11 PintardL LecointeF BujnickiJM BonnerotC GrosjeanH et al (2002) Trm7p catalyses the formation of two 2?-O-methylriboses in yeast tRNA anticodon loop. EMBO J21: 1811“182011927565 12 PintardL BujnickiJM LapeyreB BonnerotC (2002) MRM2 encodes a novel yeast mitochondrial 21S rRNA methyltransferase. EMBO J21: 1139“114711867542 13 BonnerotC PintardL LutfallaG (2003) Functional redundancy of Spb1p and a snR52-dependent mechanism for the 2?-O-ribose methylation of a conserved rRNA position in yeast. Mol Cell12: 1309“131514636587 14 KresslerD RojoM LinderP CruzJ (1999) Spb1p is a putative methyltransferase required for 60S ribosomal subunit biogenesis in Saccharomyces cerevisiae. Nucleic Acids Res27: 4598“460810556316 15 LapeyreB PurushothamanSK (2004) Spb1p-directed formation of Gm2922 in the ribosome catalytic center occurs at a late processing stage. Mol Cell16: 663“66915546625 16 PintardL KresslerD LapeyreB (2000) Spb1p is a yeast nucleolar protein associated with Nop1p and Nop58p that is able to bind S-adenosyl-L-methionine in vitro. Mol Cell Biol20: 1370“138110648622 17 HagerJ StakerBL B¼glH JakobU (2002) Active site in RrmJ a heat shock-induced methyltransferase. J Biol Chem277: 41978“4198612181314 18 YangD OyaizuY OyaizuH OlsenGJ WoeseCR (1985) Mitochondrial origins. Proc Natl Acad Sci USA82: 4443“44473892535 19 FreudeK HoffmannK JensenLR DelatyckiMB des PortesV et al (2004) Mutations in the FTSJ1 gene coding for a novel S-adenosylmethionine-binding protein cause nonsyndromic X-linked mental retardation. Am J Hum Genet75: 305“30915162322 20 CampbellJM LockwoodWW BuysTP ChariR CoeBP (2008) Integrative genomic and gene expression analysis of chromosome 7 identified novel oncogene loci in non-small cell lung cancer. Genome51: 1032“103919088816 21 MorelloLG ColtriPP QuaresmaAJ SimabucoFM SilvaTC (2011) The human nucleolar protein FTSJ3 associates with NIP7 and functions in pre-rRNA processing. PLoS One6: e2917422195017 22 SimabucoFM MorelloLG Arag£oAZ Paes LemeAF ZanchinNI (2012) Proteomic characterization of the human FTSJ3 preribosomal complexes. J Proteome Res11: 3112“312622540864 23 WangH BoisvertD KimKK KimR KimSH (2000) Crystal structure of a fibrillarin homologue from Methanococcus jannaschii a hyperthermophile at 1.6 A resolution. EMBO J19: 317“32310654930 24 HodelAE GershonPD QuiochoFA (1998) Structural basis for sequence-nonspecific recognition of 5?-capped mRNA by a cap-modifying enzyme. Mol Cell1: 443“4479660928 25 VidgrenJ SvenssonLA LiljasA (1994) Crystal structure of catechol O- methyltransferase. Nature368: 354“3588127373 26 TamuraK PetersonD PetersonN StecherG NeiM et al (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood evolutionary distance and maximum parsimony methods. Mol Biol Evol28: 2731“273921546353 27 PollastriG McLysaghtA (2005) Porter: a new accurate server for protein secondary structure prediction. Bioinformatics21: 1719“172015585524 28 LiuFC ChenHL ChongKY HsuAL ChenCM (2008) Production of recombinant porcine colipase secreted by Pichia pastoris and its application to improve dietary fat digestion and growth of postweaning piglets. Biotechnol Prog24: 1333“134119194948 29 LiuFC ChenHL LinW TungYT LaiCW et al (2010) Application of porcine lipase secreted by Pichia pastoris to improve fat digestion and growth performance of postweaning piglets. J Agric Food Chem58: 3322“332920166658 30 ChangTP YuSL LinSY HsiaoYJ ChangGC et al (2010) Tumor suppressor HLJ1 binds and functionally alters nucleophosmin via activating enhancer binding protein 2alpha complex formation. Cancer Res70: 1656“166720145123 31 HuangJT TsengCP LiaoMH LuSC YehWZ et al (2013) Hepatitis C virus replication is modulated by the interaction of nonstructural protein NS5B and fatty acid synthase. J Virol87: 4994“500423427160 32 TungYT ChenHL LeeCY ChouYC LeePY et al (2013) Active component of danshen (Salvia miltiorrhiza Bunge) Tanshinone I attenuates lung tumorigenesis via inhibitions of VEGF Cyclin A and Cyclin B expressions. Evid Based Complement Alternat Med2013: e319247 33 ChenHL LaiYW ChenCS ChuTW LinW et al (2008) Probiotic Lactobacillus casei expressing human lactoferrin elevates antibacterial activity in the gastrointestinal tract. Biometals23: 543“55420148305 34 TungYT ChenHL YenCC LeePY TsaiHC et al (2013) Bovine lactoferrin inhibits lung cancer growth through suppression of both inflammation and expression of vascular endothelial growth factor. J Dairy Sci96: 2095“210623462173 35 TsaiSW TungYT ChenHL ShenCJ ChuangCH et al (2013) Treadmill running upregulates the expression of acetylcholine receptor in rat gastrocnemius following botulinum toxin A injection. J Orthop Res31: 125“13122733692 36 Wu H Dong A Zeng H Loppnau P Weigelt J et al. (2009) PDB ID: 2NYU. 37 WiderakM KernR MalkiA RicharmeG (2005) U2552 methylation at the ribosomal A-site is a negative modulator of translational accuracy. Gene347: 109“11415715963 38 LindquistS (1986) The heat-shock response. Annu Rev Biochem55: 1151“11912427013 39 Radosevic-StasicB JakovacH GrebicD TrobonjacaZ Mrakovcic-SuticI et al (2012) Heat shock protein Gp96 as potential regulator of morphostasis after partial hepatectomy in mice. Curr Aging Sci5: 254“26223387888 40 SiegelinMD (2013) Inhibition of the mitochondrial Hsp90 chaperone network: a novel efficient treatment strategy for cancer?Cancer Lett333: 133“14623376257 41 VerschuureP TatardC BoelensWC GrongnetJF DavidJC (2003) Expression of small heat shock proteins HspB2 HspB8 Hsp20 and cvHsp in different tissues of the perinatal developing pig. Eur J Cell Biol82: 523“53014629120 42 MosserDD MorimotoRI (2004) Molecular chaperones and the stress of oncogenesis. Oncogene23: 2907“291815077153 43 LeeHW LeeEH KimSH RohMS JungSB et al (2013) Heat shock protein 70 (HSP70) expression is associated with poor prognosis in intestinal type gastric cancer. Virchows Arch463: 489“49523913168 44 YangX WangJ ZhouY WangY WangS et al (2012) Hsp70 promotes chemoresistance by blocking Bax mitochondrial translocation in ovarian cancer cells. Cancer Lett321: 137“14322281241 45 ChuYW YangPC YangSC ShyuYC HendrixMJ et al (1997) Selection of invasive and metastatic subpopulations from a human lung adenocarcinoma cell line. Am J Respir Cell Mol Biol17: 353“3609308922 46 ChengZ RistowM (2013) Mitochondria and metabolic homeostasis. Antioxid Redox Signal19: 240“24223432475 47 ChoiI KimJ JeongHK KimB JouI et al (2013) PINK1 deficiency attenuates astrocyte proliferation through mitochondrial dysfunction reduced AKT and increased p38 MAPK activation and downregulation of EGFR. Glia61: 800“81223440919 48 KangR TangD SchapiroNE LouxT LiveseyKM et al (2013) The HMGB1/RA GE inflammatory pathway promotes pancreatic tumor growth by regulating mitochondrial bioenergetics. Oncogene33: 567“57723318458 49 SantidrianAF Matsuno-YagiA RitlandM SeoBB LeBoeufSE et al (2013) Mitochondrial complex I activity and NAD+/NADH balance regulate breast cancer progression. J Clin Invest123: 1068“108123426180 50 LinCS LeeHT LeeSY ShenYA WangLS et al (2012) High mitochondrial DNA copy number and bioenergetic function are associated with tumor invasion of esophageal squamous cell carcinoma cell lines. Int J Mol Sci13: 11228“1124623109849 51 ZhaoJ ZhangJ YuM XieY HuangY et al (2013) Mitochondrial dynamics regulates migration and invasion of breast cancer cells. Oncogene32: 4814“482423128392 J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24419415 4132025 00009 10.1097/JTO.0000000000000048 Original Articles Non-Small Cell Lung Cancer Effectiveness of Gefitinib against Non“Small-Cell Lung Cancer with the Uncommon EGFR Mutations G719X and L861Q Watanabe Satoshi MD PhD * Minegishi Yuji MD PhD   Yoshizawa Hirohisa MD PhD * Maemondo Makoto MD PhD ¡ Inoue Akira MD PhD § Sugawara Shunichi MD PhD ? Isobe Hiroshi MD PhD ¶ Harada Masao MD PhD # Ishii Yoshiki MD PhD ** Gemma Akihiko MD PhD   Hagiwara Koichi MD PhD    Kobayashi Kunihiko MD PhD ¡¡ *Bioscience Medical Research Center Niigata University Medical and Dental Hospital Niigata Japan;  Department of Internal Medicine Division of Pulmonary Medicine Infections Disease and Oncology Nippon Medical School Tokyo Japan; ¡Department of Respiratory Medicine Miyagi Cancer Center Miyagi Japan; §Department of Respiratory Medicine Tohoku University Sendai Japan; ?Department of Pulmonary Medicine Sendai Kousei Hospital Sendai Japan; ¶Department of Medical Oncology KKR Sapporo Medical Center Sapporo Japan; #Department of Respiratory Medicine National Hospital anization Hokkaido Cancer Center Sapporo Japan; **Department of Pulmonary Medicine and Clinical Immunology Dokkyo Medical University School of Medicine Mibu Japan;   Department of Respiratory Medicine Saitama Medical University Saitama Japan; and ¡¡Department of Respiratory Medicine Saitama International Medical Center Saitama Japan. Address for correspondence: Hirohisa Yoshizawa MD PhD Bioscience Medical Research Center Niigata University Medical and Dental Hospital 1“754 Asahimachi-dori Niigata 951“8510 Japan. E-mail: [email protected] 2 2014 23 1 2014 9 2 189 194 Copyright © 2013 by the International Association for the Study of Lung Cancer 2013 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: In non“small-cell lung cancer an exon 19 deletion and an L858R point mutation in the epidermal growth factor receptor (EGFR) are predictors of a response to EGFR-tyrosine kinase inhibitors. However it is uncertain whether other uncommon EGFR mutations are associated with sensitivity to EGFR-tyrosine kinase inhibitors. Methods: A post-hoc analysis to assess prognostic factors was performed with the use of patients with EGFR mutations (exon 19 deletion L858R G719X and L861Q) who were treated with gefitinib in the NEJ002 study which compared gefitinib with carboplatin-paclitaxel as the first-line therapy. Results: In the NEJ002 study 225 patients with EGFR mutations received gefitinib at any treatment line. The Cox proportional hazards model indicated that performance status response to chemotherapy response to gefitinib and mutation types were significant prognostic factors. Overall survival (OS) was significantly shorter among patients with uncommon EGFR mutations (G719X or L861Q) compared with OS of those with common EGFR mutations (12 versus 28.4 months; p = 0.002). In the gefitinib group (n = 114) patients with uncommon EGFR mutations had a significantly shorter OS (11.9 versus 29.3 months; p < 0.001). By contrast OS was similar between patients with uncommon mutations and those with common mutations in the carboplatin-paclitaxel group (n = 111; 22.8 versus 28 months; p = 0.358). Conclusions: The post-hoc analyses clearly demonstrated shorter survival for gefitinib-treated patients with uncommon EGFR mutations compared with the survival of those with common mutations and suggest that the first-line chemotherapy may be relatively effective for non“small-cell lung cancer with uncommon EGFR mutations. Gefitinib G719X L861Q NEJ002 Uncommon epidermal growth factor receptor mutations OPEN-ACCESS TRUE The clinical efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) such as gefitinib and erlotinib has been demonstrated in non“small-cell lung cancer (NSCLC) patients in whom standard chemotherapy has failed.12 Further studies have revealed that the presence of activating mutations in the EGFR kinase domain is strongly associated with the therapeutic efficacy of EGFR-TKIs.34 Randomized phase 3 trials have demonstrated that EGFR-TKIs significantly improve median progression-free survival (PFS) compared with platinum-doublet therapy in EGFR-mutated patients.5“8 However not all mutations in the EGFR kinase domain are responsive to EGFR-TKI treatment. These phase 3 trials have shown that EGFR-TKIs are effective for patients with common EGFR mutations such as an exon 19 deletion or the L858R point mutation which account for more than 90% of EGFR mutations. Retrospective studies and case reports suggest that some uncommon mutations are associated with sensitivity to EGFR-TKIs.9“20 These mutations include G719X in exon 18 which accounts for approximately 3% of EGFR mutations and L861Q in exon 21 which represents approximately 2% of EGFR mutations. However these uncommon EGFR mutations have not been clearly shown to be predictive markers for the efficacy of EGFR-TKIs because of their low frequency. To investigate the efficacy of gefitinib in patients with uncommon mutations we conducted a post-hoc analysis of the NEJ002 which compared gefitinib and carboplatin-paclitaxel as first-line therapies for advanced NSCLC with activating EGFR mutations. PATIENTS AND METHODS Patient Population We retrospectively analyzed the data of 225 patients who received gefitinib treatment at any point in the NEJ002 study.6 The eligibility criteria of the NEJ002 study included the presence of advanced NSCLC harboring an EGFR mutation (exon 19 deletion or L858R G719X or L861Q point mutation) without the resistant EGFR mutation T790M (identified using the peptide nucleic acid“locked nucleic acid polymerase chain reaction clamp method) no history of chemotherapy an age of 75 years or younger a performance status of 0 to 1 and appropriate an function.2122 Patients provided a written informed consent. The study was conducted in accordance with the Helsinki Declaration of the World Medical Association. The protocol was approved by the institutional review board of each participating institution. Treatment Eligible patients were randomly assigned to receive either gefitinib (250 mg/day)"
Lung_Cancer
" Replication of these findings supports the robustness of these markers for CMH and suggests that they are useful in defining a subset of subjects with CMH who could benefit from computed tomography (CT) screening for lung cancer [46]. Indeed low cost gene-specific methylation screening assays could be incorporated into clinical practices for patients suspected to be at risk for lung cancer. Conclusions Especially male former smokers with persistent chronic mucous hypersecretion have markedly increased promoter methylation of lung cancer risk genes in cell obtained by sputum collection. These smokers may be at increased risk of lung cancer and may benefit from further tests for lung cancer such as CT screening. Competing interests The authors declare that they have no competing interests. Authors™ contributions YT SB and HP made substantial contributions to conception and design; SB JW JS HP SB and MP made substantial contributions to acquisition of data or analysis and interpretation of data. All authors made substantial contributions to drafting the or revising it critically for important intellectual content and final approval of the version to be published. Supplementary Material Additional file 1: Table S1 Select variables by CMH status in the combined cohorts. Table S2. Select variables by high and low methylation tertile in combined cohorts. Table S3. Select variables by CMH in males from the LSC and PLuSS. Table S4. Select variables by CMH in females from the LSC and PLuSS. Figure S1. ROC curves comparing the sensitivity and specificity of the 3-gene methylation panels for classifying CMH. ROC curves were generated by applying logistic regression models to male former smokers independently in the PLuSS (n?=?52) and LSC (n?=?87). The covariates included age pack years education and COPD. AUC is indicated in parentheses. "
Lung_Cancer
"In addition at concentrations of 12 or 5 µM the JNK inhibitor SP600125 partially rescued cells from toxicity induced by 24 h incubation with ?-lapachone (C) showing that JNK plays an important role in lung cancer cell death induced by ?-lapachone. .0088122.g003 Signaling pathway components involved in ?-lapachone-induced apoptosis. (A) CL1-1 cells (left) or CL1-5 cells (right) were incubated with 5 µM ?-lapachone for the indicated time then levels of p-ERK ERK p-JNK and JNK were measured by Western blotting. (B) CL1-1 cells (left) or CL1-5 cells (right) were incubated with 5 µM ?-lapachone for 036 or 9 h then levels of p-PI3K and p-AKT were examined by Western blotting. (C) CL1-1 cells (left) or CL1-5 cells (right) were pretreated with the indicated concentrations of the JNK inhibitor sp600125 for 6 h and then treated with or without 5 µM ?-lapachone for 24 h.Cell survival was measured by the MTT assay and expressed as percentage survival compared to the untreated cells.* p<0.05 (D) CL1-1 cells (left) or CL1-5 cells (right) were left untreated or were preincubated for 1 h with 10 µM dicoumarol then medium or 5 µM ?-lapachone was added and the cells incubated for 9 h and levels of p-PI3K and p-AKT were measured by Western blotting. In order to determine whether NQO1 was a key regulator in ?-lapachone-mediated lung cancer cell death cells were incubated for 6 h with 10 µM dicoumarol a specific NQO1 inhibitor and this resulted in about a 67% and 77% reduction in NQO1 activity in CL1-1 and CL1-5 cells respectively (Figure S3A). Dicoumarol treatment significantly inhibited the decrease in phosphorylation of p-PI3K and p-AKT caused by 9 h of ?-lapachone treatment (D) blocked the increase in intracellular calcium levels induced by 1 h of ?-lapachone treatment (Figure S3B) and markedly inhibited the apoptotic cell death caused by 6 h incubation with ?-lapachone as shown by Annexin V staining (A) and acridine orange (AO) staining (B). .0088122.g004 Dicoumarol an NQO1 inhibitor blocks the apoptotic effects of ?-lapachone. (A) CL1-1 cells (top) or CL1-5 cells (bottom) were left untreated or were incubated for 6 h with 5 µM ?-lapachone and/or 10 µM dicoumarol then stained with Annexin V-FITC and the Annexin V fluorescence measured by flow cytometry. (B) Morphological changes after drug treatment. CL1-1 or CL1-5 cells were left untreated (CTL) or were incubated for 24 h with 5 µM ?-lapachone with or without 10 µM dicoumarol then stained with acridine orange to observe the morphology of the cell nucleus. The scale bar represents 50 µm. Sulindac and its Metabolites Increase the Cytotoxic Effect of ?-lapachone through Activation of NQO1 The NSAID sulindac and its metabolites sulindac sulfide (the reduced form) and sulindac sulfone (the oxidized form) are known to modulate the expression of some multioxidative enzymes including NQO1 [31] [32]. Since NQO1 levels and activity were negatively associated with the cytotoxicity of ?-lapachone we next investigated whether sulindac and its metabolites could increase the cytotoxicity of ?-lapachone for cells with low NQO1 expression and lower ?-lapachone sensitivity such as CL1-1 and CL1-5 cells. To determine whether sulindac and its metabolites could modulate NQO1 expression in lung cancer cell lines they were used at concentrations of 100 and 250 µM to treat CL1-1 and CL1-5 cells for 612 or 24 h. As shown in A in CL1-1 cells both concentrations of sulindac or metabolite upregulated NQO1 protein levels at all 3 time points while in CL1-5 cells the results were more complex an increase being seen after incubation for 12 or 24 h with 100 µM but not 250 µM sulindac at all three time points with both concentrations of sulindac sulfone or 100 µM sulindac sulfide and with 250 µM sulindac sulfide for 6 h (12 and 24 h not tested) (A). NQO1 enzyme activity was also increased by all three chemicals (B). As shown in Figure S4 at 100 and 250 µM the three drugs had no significant effect on the percentage survival of CL1-1 and CL1-5 cells after incubation with sulindac or sulindac sulfone for 54 h or with sulindac sulfide for 12 h. In order to examine the synergistic effect of sulindac or its metabolites and ?-lapachone in lung cancer cells CL1-1 and CL1-5 cells were incubated with 050100 or 250 µM sulindac or the metabolites for 6 h then with 2 µM ?-lapachone in the continued presence of sulindac or metabolite for 12 h and the percentage survival was measured using crystal violet staining. Compared to cells treated with ?-lapachone alone the survival of both cell lines was decreased by 10-40% when cotreated with ?-lapachone plus sulindac 20-40% with ?-lapachone plus sulindac sulfone and 30-60% with ?-lapachone plus sulindac sulfide (A). The cotreatment-induced decrease was greater with CL1-5 cells than with CL1-1 cells i.e. it was greater with the cells expressing lower NQO1 levels (A); in addition no additional effect of combined treatment compared to ?-lapachone alone was seen with A549 cells (Figure S5) which express the highest NQC1 levels. These data show that sulindac can increase the sensitivity of cells with low NQO1 levels to ?-lapachone cytotoxicity. Using AO staining and fluorescence microscopy 6 h pretreatment with 100 or 250 µM sulindac sulfide followed by addition of 2 µM ?-lapachone for 12 h resulted in a decrease in CL1-1 and CL1-5 cell density compared to ?-lapachone alone (B) and similar results were obtained with the combination of ?-lapachone and either sulindac or sulindac sulfone (data not shown). .0088122.g005 Sulindac and its metabolites increase NQO1 expression and activity. (A) CL1-1 cells (left) or CL1-5 cells (right) were left untreated or were incubated with 100 or 250 µM sulindac sulindac sulfone or sulindac sulfide for 612 or 24 h then protein levels were measured by Western blotting. (B“D) CL1-1 cells (left) or CL1-5 cells (right) were left untreated (Ctl) or were incubated with the indicated concentration of sulindac (B) sulindac sulfone (C) or sulindac sulfide (D) for the indicated time then NQO1 activity was measured. * : p<0.05 **: p<0.01 ***: p<0.001 compared to the control. .0088122.g006 The cytotoxicity of ?-lapachone for CL1-1 and CL1-5 cells is enhanced by sulindac and its metabolites. (A) CL1-1 cells (left) or CL1-5 cells (right) were left untreated or were pretreated for 6 h with the indicated concentration of sulindac sulindac sulfone and sulindac sulfide then 2 µM ?-lapachone was added for 12 h then cell survival was measured using crystal violet staining and expressed as percentage survival compared to the untreated cells. * : p<0.05 compared to ?-lapachone alone. (B) Two sets of each cell type were left untreated or were incubated for 6 h with 100 or 250 µM sulindac sulfide then 2 µM B-lapachone was added to one set and incubation continued for 12 h then the morphology was examined by acridine orange staining. The scale bar represents 100 µm. NQO1 Plays a Key Role in the Sulindac-induced Increase in ?-lapachone Cytotoxicity for Lung Cancer Cells Although NQO1 expression and activity were increased by sulindac and its metabolites whether NQO1 was a major contributor to the sulindac-induced increase in ?-lapachone cytotoxicity still required investigation. "
Lung_Cancer
"Methods Tissue collection We obtained 113 paired NSCLC and adjacent non-tumor lung tissues from patients who underwent surgery at Jiangsu Province Hospital between 2008 and 2010 and were diagnosed with NSCLC (stages I II and III) based on histopathological evaluation. Clinicopathological characteristics including tumor-node-metastasis (TNM) staging were recorded. No local or systemic treatment was conducted in these patients before surgery. All collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at “80°C until required. Our study was approved by the Research Ethics Committee of Nanjing Medical University China. Written informed consent was obtained from all patients. Cell lines Five NSCLC adenocarcinoma cell lines (A549 SPC-A1 NCI-H1975 NCI-H1299 and NCI-H1650) a NSCLC squamous carcinomas cell line (SK-MES-1) and a normal human bronchial epithelial cell line (16HBE) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai China). A549 SK-MES-1 NCI-H1975 NCI-H1299 NCI-H1650 and 16HBE cells were cultured in RPMI 1640; SPC-A1 cells were cultured in DMEM (GIBCO-BRL) medium supplemented with 10% fetal bovine serum (FBS) 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Carlsbad CA USA) at 37ºC/5% CO2. RNA extraction and qPCR assays Total RNA was isolated with TRIzol reagent (Invitrogen) according to the manufacturer™s instructions. Total RNA (500 ng) was reverse transcribed in a final volume of 10 ?l using random primers under standard conditions for the PrimeScript RT reagent Kit (TaKaRa Dalian China). We used the SYBR Premix Ex Taq (TaKaRa Dalian China) to determine BANCR expression levels following the manufacturer™s instructions. Results were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The specific primers used are presented in Additional file 3: Table S2. The qPCR assays were conducted on an ABI 7500 and data collected with this instrument. Our qPCR results were analyzed and expressed relative to threshold cycle (CT) values and then converted to fold changes. Plasmid generation The BANCR sequence was synthesized and subcloned into the pCDNA3.1 (Invitrogen Shanghai China) vector. Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hilden Germany) and transfected into SPC-A1 or A549 cells. The siRNAs si-HDAC1 si-HDAC3 si-BANCR or si-NC were transfected into SPC-A1 or A549 cells (Additional file 3: Table S2). A549 and SPC-A1 cells were grown on six-well plates to confluency and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer™s instructions. At 48 h post-transfection cells were harvested for qPCR or western blot analysis. Cell viability assays Cell viability was monitored using a Cell Proliferation Reagent Kit I (MTT) (Roche Applied Science). The A549 cells transfected with si-BANCR (3000 cells/well) and A549 or SPC-A1 cells transfected with pCDNA-BANCR were grown in 96-well plates. Cell viability was assessed every 24 h following the manufacturer™s protocol. All experiments were performed in quadruplicate. For colony formation assays pCDNA-BANCR-transfected SPC-A1 or A549 cells (n?=?500) were placed in a 6-well plates and maintained in media containing 10% FBS. The medium was replaced every 4 days; after 14 days cells were fixed with methanol and stained with 0.1% crystal violet (Sigma-Aldrich). Visible colonies were then counted. For each treatment group wells were assessed in triplicate. Flow cytometry analysis of apoptosis SPC-A1 and A549 cells were harvested at 48 h post-transfection by trypsinization. After staining with FITC-Annexin V and propidium iodide cells were analyzed by flow cytometry (FACScan; BD Biosciences) using CellQuest software (BD Biosciences). Cells were discriminated into viable cells dead cells early apoptotic cells and apoptotic cells. The ratio of early apoptotic cells was compared to that for controls from each experiment. All samples were assayed in triplicate. Wound-healing assay For the wound-healing assay 3?—?105 cells were seeded in 6-well plates cultured overnight and transfected with pCDNA-BANCR or the control vector. Once cultures reached 85% confluency the cell layer was scratched with a sterile plastic tip and washed with culture medium then cultured for 48 h with medium containing 1% FBS. At different time points images of the plates were acquired using a microscope. The distance between the two edges of the scratch was measured using Digimizer software system. Cell migration and invasion assays For the migration assays at 48 h post-transfection 5?—?104 cells in serum-free media were placed into the upper chamber of an insert (8-?m pore size; Millipore). For the invasion assays 1?—?105 cells in serum-free medium were placed into the upper chamber of an insert coated with Matrigel (Sigma-Aldrich). Medium containing 10% FBS was added to the lower chamber. After incubation for 24 h the cells remaining on the upper membrane were removed with cotton wool. Cells that had migrated or invaded through the membrane were stained with methanol and 0.1% crystal violet imaged and counted using an IX71 inverted microscope (Olympus Tokyo Japan). Experiments were independently repeated three times. Tail vein injections into athymic mice Athymic male mice (4-weeks-old) were purchased from the Animal Center of the Chinese Academy of Science (Shanghai China) and maintained in laminar flow cabinets under specific pathogen-free conditions. SPC-A1 cells transfected with pCDNA-BANCR or the empty vector were harvested from 6-well plates washed with phosphate-buffered saline (PBS) and resuspended at 2?—?107 cells/ml. Suspended cells (0.1 ml) were injected into the tail veins of 9 mice which were sacrificed 7 weeks after injection. The lungs were removed and photographed and visible tumors on the lung surface were counted. "
Lung_Cancer
"Non-Small-Cell Lung Cancer J Exp Clin Cancer Res 2012 31 77 22992338 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24887068 4041776 PONE-D-14-02596 .0098621 Research Medicine and Health Sciences Oncology Cancer Treatment Radiation Therapy Feasibility of Proton Transmission-Beam Stereotactic Ablative Radiotherapy versus Photon Stereotactic Ablative Radiotherapy for Lung Tumors: A Dosimetric and Feasibility Study Lung SABR Using Transmission Proton Beams Mou Benjamin Beltran Chris J. * Park Sean S. Olivier Kenneth R. Furutani Keith M. Department of Radiation Oncology Mayo Clinic Rochester Minnesota United States of America Deutsch Eric Editor Institut Gustave Roussy France * E-mail: Beltran.Chrismayo.edu Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: BM KMF SSP KRO CJB. Analyzed the data: BM KMF SSP KRO CJB. Contributed reagents/materials/analysis tools: BM KMF SSP KRO CJB. Wrote the paper: BM KMF SSP KRO CJB. 2014 2 6 2014 9 6 e98621 21 1 2014 6 5 2014 2014 Mou et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Stereotactic ablative radiotherapy is being increasingly adopted in the treatment of lung tumors. The use of proton beam therapy can further reduce dose to normal structures. However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (Figure 2). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(Table 2). .0098621.g002 Figure 2 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Table 2 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans"
Lung_Cancer
"These observations clearly demonstrate that acetylation of peptide's N-terminus is an efficient way to reduce the nonspecific kidney accumulation and optimize the in vivo kinetics of peptide-based imaging probes. To our surprise the apparent stability profile of all three divalent probes (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) measured in rat serum out to 24 h were almost identical. This indicates that the in vivo properties of the divalent probe were improved as the result of its positive charge reduction. However we cannot rule out the possibility that acetylation improves the in vivo stability in mice. It is important to note that the previous PET studies with A20FMDV2 also used a capped N-terminus and the kidney uptake varied greatly. Similarly the ?v?6-binding cysteine knot probes showed persistent kidney retention. Therefore simple capping of the N-terminus does not abrogate kidney retention for all ?v?6 PET probes. Additionally it should be noted that multimerization of other peptidic ligands has also lead to a significant increase in kidney accumulation 30 48. Kidney retention of peptidic probes is a complicated multifactorial issue and involves numerous factors including peptide stability charge hydrophobicity choice of radiolabel peptide sequence and chemical modifications of the peptide 50-52. Due to their size peptides are filtered by glomeruli and excreted; however a small percentage of the peptide or peptide fragments are reabsorbed by the proximal tubules and retained. Although unlikely to induce substantial renal toxicity within the context of imaging retention of the radiolabel can affect detection of tumors within or around the kidneys. However kidney accumulation can be problematic for therapeutic applications in which the peptide is used to deliver radiopharmaceuticals or chemotherapeutics. As such efforts to reduce peptidic retention in the kidneys is of key importance. Minor changes in the charge and/or chemical structure of a peptide have been shown to dramatically affect renal uptake. Pre-dosing animals with polycationic species or Gelofusine prior to administering radiolabeled peptides has been observed to reduce kidney retention. PEGylation of peptides has also been shown to improve tumor-to-kidney uptake ratio. Although we have shown significant reduction of kidney retention by acetylating the peptide we are performing further empirical studies to minimize kidney accumulation of the radiolabeled peptidic probes. Integrins are commonly found in tumor cells as well as in angiogenic tumor vasculature. As previously mentioned the H2009.1-10mer peptide sequence contains an RGD moiety which is an overlapping ligand for various integrins such as ?v?3 integrin. Although in vitro data support the specificity of the H2009-10mer peptide for ?v?6 one may question whether our imaging results indeed reflect the ?v?6 expression in tumor. To answer this question we performed an imaging study in the same tumor models using our recently reported conjugate (64Cu-CB-TE2A-(c(RGDyK))2) built on the same BFCS which specifically targets the ?v?3 integrin. The cRGDyX peptide is widely used as an ?v?3-specific ligand for both molecular imaging of angiogenic tumor vasculature and anti-angiogenic therapies 53. Unlike H2009.1-10mer conjugates the 64Cu-CB-TE2A-(c(RGDyK))2 showed virtually identical uptake in H2009 and H460 tumors out to 24 h p.i. (1.8 %ID/g at 1h p.i.; 0.7 %ID/g at 24 h p.i.). Lack of specificity of 64Cu-CB-TE2A-(c(RGDyK))2 can be attributed to ubiquitous expression of ?v?3 integrin in angiogenic vessels as well as in tumor cells. Unlike 64Cu-CB-TE2A-(c(RGDyK))2 the specific imaging of H2009 tumor by 64Cu-(M10)2 64Cu-D10 or 64Cu-AcD10 is primarily due to the restrictive expression of ?v?6 integrin in H2009 tumor. These results clearly demonstrate the potential use of our designed probes for molecular profiling of ?v?6+ NSCLC. Conclusions Imparting multivalency is an effective way to improve biopotency of a phage selected peptide. The designed multivalent probes showed enhanced binding affinity which was utilized for PET signal enhancement in ?v?6+ tumor imaging. Significantly multivalent probes maintained the desired specificity to image ?v?6+ H2009 tumor while low signal was observed in ?v?6- H460 tumor. We showed that N-terminus acetylated probe (64Cu- AcD10) provided drastic uptake reduction in kidney and other non-target ans while maintaining tumor uptake. Further evaluation of this methodology is under way to realize its full potential in imaging probe design by utilizing existing ligands selected from combinatorial library screening. Overall the selective tumor uptake of 64Cu-AcD10 along with its favorable distribution in major ans makes it an ideal candidate to be developed for specific imaging of ?v?6+ expression. Additionally 67Cu can be used for radiotherapy opening the possibility of using this probe as a therapeutic as well. This work was partially supported by a small animal imaging research program grant (SAIRP) from the National Institute of Cancer (U24 CA126608 XS) the Welch Foundation (I-1622 KCB) and the National Institute of Biomedical Imaging and Bioengineering (1R01EB014244-01 XS and KCB). "
Lung_Cancer
"Thus novel approaches to effectively managing this disease at the molecular level could identify patients who have a higher or lower risk of relapse following surgery and provide biomarkers for the prediction of patient survival. In this regard the use of serum miRNAs as potential biomarkers for diagnosing and predicting prognosis of lung cancers has been reported [7] [10]. Indeed several studies have identified miRNA signatures that differ between normal and cancerous tissues for the classification of cancer types and for tumor diagnosis and prognosis. It may also be possible to use miRNA expression as a biomarker to monitor treatment efficacy or predict cancer progression [11]“[12]. However to date most studies have focused on tumor tissue and changes in circulating serum miRNAs levels and the relationship between these changes and the tissue at disease onset remain controversial [7]. Moreover the usefulness of many circulating miRNAs has been demonstrated in the diagnosis of NSCLC but few circulating miRNAs showed diagnostic value for early stage NSCLC [13] [14]. However further verification in different populations is needed. Thus in this study we analyzed levels of three miRNAs (miR-29c miR-93 and miR-429) in non-small cell lung cancer (NSCLC) tissues and compared them to those in serum samples of NSCLC patients and healthy controls particularly their expression levels in early stage NSCLC patients. Meanwhile we analyzed the data by comparison with carcinoma embryonic antigen (CEA) which is a widely used marker in the diagnosis of NSCLC [15]. We then investigated associations between their expression and clinicopathological and survival data from NSCLC patients. Materials and Methods Ethics Statement This study was approved by the Ethical Review Committee of Zhoushan Municipal Government of China and all biological samples were obtained with patients' written informed consent. Patient samples In this study we recruited 70 patients with surgically resected NSCLC and matched distant noncancerous tissues from Zhoushan Hospital Zhejiang China between January 2008 and May 2009. There were 56 male and 14 female patients with NSCLC including 34 patients younger than 60 years and 36 older than 60 years. Meanwhile sera from all NSCLC patients and 48 healthy volunteers matched according to sex and age were also collected. None of the patients enrolled in this study had received any chemotherapy or radiotherapy before surgery. For tissue sample collection upon removal of the surgical specimens the tissues were immediately transported to the Pathology Laboratory and the samples were placed in a cryovial snap-frozen in liquid nitrogen for 30 min and stored at ?80°C until use. All tissue samples were reviewed by two pathologists and the diagnosis was made according to the National Comprehensive Cancer Network (NCCN) criteria. There were 34 lung adenocarcinomas and 36 lung squamous cell carcinomas and 46 tumors were moderately to highly differentiated whereas 24 were poorly differentiated. Moreover 18 NSCLC patients had a tumor less than 3 cm in size whereas 52 patients with a tumor larger than 3 cm. Lymph node metastasis was found in 32 patients and 36 patients had stage I NSCLC and 34 patients had stage II III or IV NSCLC (). In addition serum levels of CEA were measured using chemiluminescence as part of routine clinical tests and reference value was acquired from the clinical database at Zhoushan Hospital. .0087780.t001 Clinicopathological features of 70 NSCLC patients. Clinical features n Mean age (years) 59 <60 34 ?60 36 Gender Male 56 Female 14 Tumor size 0“3 cm 18 >3 cm 52 Histological classification Adenocarcinoma 34 SCC 36 Differentiation Moderate“well 46 Poor 24 Lymph node Negative 38 Positive 32 Stage classification Stage I 36 Stage II III and IV 34 RNA isolation and quantitative RT-PCR Total cellular RNA was isolated from 100 mg lung tissue or 600 µl serum samples using a miRNAs isolation kit or mirVana PARIS RNA isolation kit (Applied Biosystems Foster City CA USA) according to the manufacturer's protocol. RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Wilmington DE USA) and RNA quality was measured using a denaturing 15% polyacrylamide gel. The reverse transcription reaction was carried out using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions in a total reaction volume of 7.5 µl. qPCR was performed in triplicate using TaqMan 2— Universal PCR Master Mix without AmpErase UNG (Applied Biosystems) in an ABI 7500 Real-Time PCR system (Applied Biosystems) with the following conditions: 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The cycle threshold (Ct) values were calculated using SDS 2.0.1 software (Applied Biosystems). Template-free controls for both RT and PCR were included in each experiment to ensure target-specific amplification. The average levels of miRNA expression in tissues and sera were normalized relative to the average amounts of U6 snRNA and U48 snRNA using the 2???Ct method [16]“[17]. "
Lung_Cancer
"Biological Sciences Cell Biology Analysis of the tumor-initiating and metastatic capacity of PDX1-positive cells from the adult pancreas PDX1-positive cells from adult pancreas Ischenko Irene a Petrenko Oleksi b 1 Hayman Michael J. a 1 Departments of aMolecular Genetics and Microbiology and bPathology Stony Brook University Stony Brook NY 11794 1To whom correspondence may be addressed. E-mail: alexei.petrenkostonybrook.edu or michael.haymanstonybrook.edu. Edited by Douglas R. Lowy National Cancer Institute Bethesda MD and approved January 22 2014 (received for review October 22 2013) Author contributions: O.P. and M.J.H. designed research; I.I. and O.P. performed research; I.I. and O.P. contributed new reagents/analytic tools; O.P. and M.J.H. analyzed data; and O.P. and M.J.H. wrote the paper. 4 3 2014 18 2 2014 111 9 3466 3471 Significance Pancreatic cancer is characterized by aggressive growth and a high propensity for metastatic spread. Despite growing understanding of the genetic causes of pancreatic cancer the mechanism and timing of cancer metastasis the main cause of deaths in pancreatic cancer patients remain relatively unexplored. In this study we used experimental mouse models of pancreatic carcinogenesis to show that hyperactivation of the Ras/MAPK/ERK pathway and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization. Several studies have suggested that Hsp70 functions upstream of the mitochondria by preventing the release of cytochrome c instead of inhibiting the apoptosome or other downstream points in the caspase cascade.16 17 Some of this confusion may be due to different experimental systems used to evaluate apoptosis or reflects the variability of apoptotic pathways among different cell lines. In this study we found that the inhibition of Hsp70 by ibuprofen facilitates the activation of Bax induced by cisplatin and its translocation to the mitochondria in A549 cells. This finding is consistent with the previous observation of blockade of Bax activation being one of the upstream sites of action of Hsp70. On the other hand the role played by Hsp70 in the A549 cellular mitochondrial apoptotic pathway is likely to be more complex than described earlier because in cisplatin-treated cells the "
Lung_Cancer
"Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter and/or higher CRP levels. Abbreviations RCC: Renal cell carcinoma; TKI: Tyrosine kinase inhibitor; RECIST: Response evaluation criteria in solid tumors; CCRCC: Clear cell RCC; CTC-AE: Common Terminology criteria for Adverse Events; ROC: Receiver-operator curve; AUC: Area under the curve; CRP: C-reactive protein. Competing interests Norihiko Tsuchiya and Tomonori Habuchi received honoraria from Pfizer Japan Inc. Authors™ contributions NT TY JY and TH were involved in the conception and design of the study. TY KN MS and SM were involved in the provision of patients™ clinical data. NT and TH drafted the manuscript. SN TI SS supported the manuscript writing. All authors have read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2490/14/26/prepub Acknowledgements There were no external sources of funding. Akaza H Kawai K Tsukamoto T Fujioka T Tomita Y Kitamura T Ozono S Miki T Naito S Zembutsu H Successful outcomes using combination therapy of interleukin-2 and interferon-alpha for renal cell carcinoma patients with lung metastasis Jpn J Clin Oncol 2010 40 7 684 689 10.1093/jjco/hyq027 20382632 Flanigan RC Salmon SE Blumenstein BA Bearman SI Roy V McGrath PC Caton JR Jr Munshi N Crawford ED Nephrectomy followed by interferon alfa-2b compared with interferon alfa-2b alone for metastatic renal-cell cancer N Engl J Med 2001 345 23 1655 1659 10.1056/NEJMoa003013 11759643 Albiges L Oudard S Negrier S Caty A Gravis G Joly F Duclos B Geoffrois L Rolland F Guillot A Laguerre B Legouffe E Kohser F Dietrich PY Theodore CA Escudier B Complete remission with tyrosine kinase inhibitors in renal cell carcinoma J Clin Oncol 2012 30 5 482 487 10.1200/JCO.2011.37.2516 22231040 Staehler M Haseke N Zilinberg E Stadler T Karl A Siebels M Durr HR Siegert S Jauch KW Bruns CJ Stief CG Complete remission achieved with angiogenic therapy in metastatic renal cell carcinoma including surgical intervention Urol Oncol 2010 28 2 139 144 10.1016/j.urolonc.2009.03.033 19576802 Krajewski KM Guo M Van den Abbeele AD Yap J Ramaiya N Jagannathan J Heng DY Atkins MB McDermott DF Schutz FA Pedrosa I Choueiri TK Comparison of four early posttherapy imaging changes (EPTIC; RECIST 1.0 tumor shrinkage computed tomography tumor density Choi criteria) in assessing outcome to vascular endothelial growth factor-targeted therapy in patients with advanced renal cell carcinoma Eur Urol 2011 59 5 856 862 10.1016/j.eururo.2011.01.038 21306819 Yuasa T Urakami S Yamamoto S Yonese J Nakano K Kodaira M Takahashi S Hatake K Inamura K Ishikwa Y Fukui I Tumor size is a potential predictor of response to tyrosine kinase inhibitors in renal cell cancer Urology 2011 77 4 831 835 10.1016/j.urology.2010.12.008 21316083 Motzer RJ Hutson TE Tomczak P Michaelson MD Bukowski RM Rixe O Oudard S Negrier S Szczylik C Kim ST Chen I Bycott PW Baum CM Figlin RA Sunitinib versus interferon alfa in metastatic renal-cell carcinoma N Engl J Med 2007 356 2 115 124 10.1056/NEJMoa065044 17215529 Escudier B Eisen T Stadler WM Szczylik C Oudard S Siebels M Negrier S Chevreau C Solska E Desai AA Rolland F Demkow T Hutson TE Gore M Freeman S Schwartz B Shan M Simantov R Bukowski RM Sorafenib in advanced clear-cell renal-cell carcinoma N Engl J Med 2007 356 2 125 134 10.1056/NEJMoa060655 17215530 Rini BI Escudier B Tomczak P Kaprin A Szczylik C Hutson TE Michaelson MD Gorbunova VA Gore ME Rusakov IG Negrier S Ou YC Castellano D Lim HY Uemura H Tarazi J Cella D Chen C Roosbrook B Kim S Motzer RJ Comparative effectiveness of axitinib versus sorafenib in advanced renal cell carcinoma (AXIS): a randomised phase 3 trial Lancet 2011 378 9807 1931 1939 10.1016/S0140-6736(11)61613-9 22056247 Tannir NM Plimack E Ng C Tamboli P Bekele NB Xiao L Smith L Lim Z Pagliaro L Araujo J Aparicio A Matin S Wood CG Jonasch E A phase 2 trial of sunitinib in patients with advanced Non-clear cell renal cell carcinoma Eur Urol 2012 62 6 1013 1019 10.1016/j.eururo.2012.06.043 22771265 Chin AI Lam JS Figlin RA Belldegrun AS Surveillance strategies for renal cell carcinoma patients following nephrectomy Rev Urol 2006 8 1 1 7 16985554 Fujioka T Obara W Evidence-based clinical practice guideline for renal cell carcinoma: the Japanese Urological Association 2011 update Int J Urol 2012 19 6 496 503 10.1111/j.1442-2042.2012.03031.x 22621218 van der Veldt AA Meijerink MR van den Eertwegh AJ Bex A de Gast G Haanen JB Boven E Sunitinib for treatment of advanced renal cell cancer: primary tumor response Clin Cancer Res 2008 14 8 2431 2436 10.1158/1078-0432.CCR-07-4089 18413834 Kroon BK de Bruijn R Prevoo W Horenblas S Powles T Bex A Probability of downsizing primary tumors of renal cell carcinoma by targeted therapies is related to size at presentation Urology 2012 81 1 111 115 23153934 Abel EJ Culp SH Tannir NM Tamboli P Matin SF Wood CG Early primary tumor size reduction is an independent predictor of improved overall survival in metastatic renal cell carcinoma patients treated with sunitinib Eur Urol 2011 60 6 1273 1279 10.1016/j.eururo.2011.07.008 21784574 Gabay C Kushner I Acute-phase proteins and other systemic responses to inflammation N Engl J Med 1999 340 6 448 454 10.1056/NEJM199902113400607 9971870 Bromwich E McMillan DC Lamb GW Vasey PA Aitchison M The systemic inflammatory response performance status and survival in patients undergoing alpha-interferon treatment for advanced renal cancer Br J Cancer 2004 91 7 1236 1238 10.1038/sj.bjc.6602152 15354220 Casamassima A Picciariello M Quaranta M Berardino R Ranieri C Paradiso A Lorusso V Guida M C-reactive protein: a biomarker of survival in patients with metastatic renal cell carcinoma treated with subcutaneous interleukin-2 based immunotherapy J Urol 2005 173 1 52 55 10.1097/01.ju.0000146713.50673.e5 15592024 Ramsey S Lamb GW Aitchison M Graham J McMillan DC Evaluation of an inflammation-based prognostic score in patients with metastatic renal cancer Cancer 2007 109 2 205 212 10.1002/cncr.22400 17149754 Yasuda Y Saito K Yuasa T Kitsukawa S Urakami S Yamamoto S Yonese J Takahashi S Fukui I Prognostic impact of pretreatment C-reactive protein for patients with metastatic renal cell carcinoma treated with tyrosine kinase inhibitors Int J Clin Oncol 2012 18 5 884 889 22886358 Slaviero KA Clarke SJ Rivory LP Inflammatory response: an unrecognised source of variability in the pharmacokinetics and pharmacodynamics of cancer chemotherapy Lancet Oncol 2003 4 4 224 232 10.1016/S1470-2045(03)01034-9 12681266 Eisenhauer EA Therasse P Bogaerts J Schwartz LH Sargent D Ford R Dancey J Arbuck S Gwyther S Mooney M Rubinstein L Shankar L Dodd L Kaplan R Lacombe D Verweij J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1) Eur J Cancer 2009 45 2 228 247 10.1016/j.ejca.2008.10.026 19097774 Han KS Jung DC Choi HJ Jeong MS Cho KS Joung JY Seo HK Lee KH Chung J Pretreatment assessment of tumor enhancement on contrast-enhanced computed tomography as a potential predictor of treatment outcome in metastatic renal cell carcinoma patients receiving antiangiogenic therapy Cancer 2010 116 10 2332 2342 20225226 Nathan PD Vinayan A Stott D Juttla J Goh V CT response assessment combining reduction in both size and arterial phase density correlates with time to progression in metastatic renal cancer patients treated with targeted therapies Cancer Biol Ther 2010 9 1 15 19 10.4161/cbt.9.1.10340 20009542 Hittinger M Staehler M Schramm N Ubleis C Becker C Reiser M Berger F Course of size and density of metastatic renal cell carcinoma lesions in the early follow-up of molecular targeted therapy Urol Oncol 2012 30 5 695 703 10.1016/j.urolonc.2010.10.011 21865061 Choi H Charnsangavej C Faria SC Macapinlac HA Burgess MA Patel SR Chen LL Podoloff DA Benjamin RS Correlation of computed tomography and positron emission tomography in patients with metastatic gastrointestinal stromal tumor treated at a single institution with imatinib mesylate: proposal of new computed tomography response criteria J Clin Oncol 2007 25 13 1753 1759 10.1200/JCO.2006.07.3049 17470865 Oncol Rep Oncol. Rep Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 24842630 4067423 10.3892/or.2014.3198 or-32-01-0033 Articles Identification of a novel HLA-A*02:01-restricted cytotoxic T lymphocyte epitope derived from the EML4-ALK fusion gene YOSHIMURA MAYUKO 1 2 TADA YOSHITAKA 1 3 OFUZI KAZUYA 1 YAMAMOTO MASAKAZU 2 NAKATSURA TETSUYA 1 3 1Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center Kashiwa Chiba 277-8577 Japan 2Department of Gastroenterological Surgery Tokyo Women™s Medical University Shinzyukuku Tokyo 162-8666 Japan 3Research Institute for Biomedical Sciences Tokyo University of Science Chiba 278-0022 Japan Correspondence to: Dr Tetsuya Nakatsura Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center 6-5-1 Kashiwanoha Kashiwa Chiba 277-8577 Japan E-mail: [email protected] 7 2014 19 5 2014 19 5 2014 32 1 33 39 21 3 2014 23 4 2014 Copyright © 2014 Spandidos Publications 2014 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed reproduced and reused for non-commercial purposes provided the original source is properly cited. Cancer immunotherapy is a promising new approach to cancer treatment. It has been demonstrated that a high number of tumor-specific cytotoxic T cells (CTLs) is associated with increased disease-specific survival in lung cancer patients. Identification of superior CTL epitopes from tumor antigens is essential for the development of immunotherapy for malignant tumors. The EML4-ALK fusion gene was recently identified in a subset of non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK"
Lung_Cancer
"These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization."
Lung_Cancer
"adenocarcinoma in Chinese female non-smokers has not been well addressed. ATM rs189037 was a common polymorphism in the promoter of ATM gene. Studies have shown that this site possibly may regulate ATM protein activity due to regulation function of promoter as shown in most genes. And specific genotypes or haplotypes of ATM may play an important role in carcinogenesis through expression regulation or alternative splicing of the ATM gene [31]. We searched through NCBI (National Center for Biotechnology Information) dbSNP database to get the allele frequency of this polymorphism. The data indicated that the frequency of wild-type allele G was 61.1% and the frequency of variant allele A was 38.9% in Chinese Han population (http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=rs189037). In this study our results was in accordance with the data from NCBI. In 2006 Kim et al.[25] evaluated the role of ATM rs189037 in lung cancer development In Korean population for the first time. No significant association was found between this polymorphism and lung cancer risk (P>0.05). They recruited 616 lung cancer patients in which 78.4% were male and 79.6% were cigarette smokers. As cigarette smoking might modulate the risk of lung cancer in turn it could be a confounder in the association between ATM rs189037 and lung cancer risk. Besides there was no gene-environment interactions be considered in their research. In 2010 Lo et al.[23] suggested that ATM rs189037 was associated with lung cancer risk among never smokers (AA vs GG: OR?=?1.61 95%CI 1.10“2.35) and this association might be modified by passive smoking. Although they have eliminated the cofounding effect of cigarette smoking by conducting their study in non-smokers the risk of lung cancer among different histological types still needed to be clarified. Recently Hsia et al.[24] put their attention on the association of ATM rs189037 with lung cancer susceptibility among ever smokers. No genotype frequency difference was found between lung cancer cases and controls among ever smokers (P>0.05). After summing up the omissions of their studies and combining with the current situation that Chinese non-smoking female lung adenocarcinoma incidence and fatality rate was increasingly rising up we performed this case-control study to elucidate the association between ATM rs189037 and lung adenocarcinoma risk. To the best of our knowledge this is the first study that has investigated whether ATM rs189037 was associated with lung adenocarcinoma risk in non-smoking Han-Chinese females. Our results have shown that individuals with exposure to cooking oil fume had a 1.63-fold increased risk of developing lung adenocarcinoma (P?=?0.011). Similar significant associations were observed in our previous studies of Chinese non-smoking females. Experimental studies have presented that fumes from cooking oils could be genotoxic because of the potential carcinogenic components such as polycyclic aromatic hydrocarbons (PAHs) and benzo[a]pyrene 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer."
Lung_Cancer
"Both FDR values for discovered pairwise and triplet combinations were zero therefore all of the discovered logic pairwise and triplet combinations were not generated by chance and all of them might represent real associations. In addition we calculated the recurrence rate of discovered logic pairwise and triplet combinations among all random trials. The logic relationships with the recurrence rate larger than were considered as the relationships which were independent of the specimens selected. Finally we derived probe-AC lower logic relationships and probe-AC higher logic relationships (Table A and B in Table S1). Note that the AC profile data and SCC profile data were binary complementary vectors. If a probe (or a probe pair) is related with AC by the th type of lower (higher) logic relationships then the probe (the probe pair) is related with SCC by the th type of lower (higher) logic relationships where the uncertainty coefficient of the probe-SCC lower (higher) logic relationship is equal to that of the probe-AC lower (higher) logic relationship but . Therefore the probe which has a close relationship with AC is also closely related with SCC. Finally we obtained probe-AC/SCC lower logic relationships and probe-AC/SCC higher logic relationships. Identification of gene-subtype lower and higher logic relationships Each probe which was focused on in this paper is mapped to a single gene. Conversely a gene may be detected by more than one probe. For example the CLCA2 gene was detected by four different probes: 206164_at 206165_s_at 206166_s_at and 217528_at. All of the above four probes were related with AC by the second type of lower logic relationships. Moreover and were the mean uncertainty coefficients for each of the four probes related with AC in both directions respectively. A probe-AC logic relationship set comprised several probe-AC logic relationships where probes were associated to the same gene. In a probe-AC logic relationship set the probe-AC/SCC logic relationship with the largest mean uncertainty coefficients in both directions was used to generate a gene-AC/SCC logic relationship as described in Section Materials and Methods. Thus CLCA2 was related with AC by the second type of lower logic relationships and the coefficient of the CLCA2-AC/SCC relationship was . According to the above method gene-AC/SCC lower logic relationships were generated from probe-AC/SCC lower logic relationships (Table A in Table S2). Each of the rest probe-AC/SCC lower logic relationships generated a gene-AC/SCC lower logic relationship. Finally we obtained gene-AC/SCC lower logic relationships (Table A in Table S3). We found that if a gene was detected by more than one probe and the probes were related with subtypes by lower logic relationships then the types of the probe-AC/SCC lower logic relationships were the same. It is suggested that the probes which are associated to the same gene may be related with subtypes by the same way. We obtained six gene-AC/SCC higher logic relationships from probe-AC/SCC higher logic relationships (Table B in Table S2). Each of the rest probe-AC/SCC higher logic relationships generated a gene-AC/SCC higher logic relationship. Finally we obtained gene-AC/SCC higher logic relationships (Table B in Table S3). In what follows we discussed examples of logic relationships which may be inferred from phenomenons previously described in the literature. Examples of gene-subtype lower logic relationships If each of the genes DSG3 CLCA2 DSC3 and PKP1 was expressed then SCC was present while AC was absent. In addition if each of above genes was not expressed then SCC was absent and AC was present. That is the expression of each of above genes was a sufficient and necessary condition of the presence of SCC as well as the absence of AC. Our results suggested that genes (DSG3 CLCA2 DSC3 and PKP1) may distinguish subtype AC from SCC. Given that intracellular bridges are one of the most characteristic of SCC but not of AC proteins involved in these bridges may be up-regulated in SCC only such as desmosome proteins and intercellular junctional proteins [25]. Desmoglein 3 is the protein encoded by DSG3. This protein is a calcium-binding transmembrane glycoprotein component of desmosome in vertebrate epithelial cells."
Lung_Cancer
" Patient characteristics in the thoracic surgery and non-thoracic surgery groups All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Cases 100 (185) 27.0 (50) 73.0 (135) 0.0001 # Age years a 70.3 (39“88) 74.6 (62“80) 68.7 (39“86) 0.0001 # Sex male 72.4 (134) 76.0 (38) 71.1 (96) 0.581 History of smoking 78.9 (213) 82.0 (41) 77.0 (104) 0.549 COPD diagnosed b 49.7 (92) 66.0 (33) 43.7 (59) 0.012 # COPD managed c 9.2 (17) 20.0 (10) 5.2 (7) 0.004 # COPD-related systemic comorbidities 57.3 (106) 60.0 (30) 56.3 (76) 0.739 Diabetes 20.0 (37) 30.0 (15) 16.3 (22) 0.061 Ischemic disease 7.6 (14) 10.0 (5) 6.7 (9) 0.532 Hypertension 40.5 (75) 40.0 (20) 40.7 (55) 1.000 Hyperlipidemia 11.4 (21) 10.0 (5) 11.8 (16) 0.799 n indicates number. aData are shown as mean (range). bindicates the patients who were firstly diagnosed as COPD at bronchoscopy. cindicates the patients who had been diagnosed as COPD before bronchoscopy. All other data are shown as% (numbers). #p?<?0.05. COPD: chronic obstructive pulmonary disease. Physical assessment variables among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value BMI (kg/m 2 ) a 22.2 (3.0) 22.3 (2.4) 22.1 (3.2) 0.760 Spirometric variables %VC a 108.8 (20.6) 104.5 (20.4) 110.4 (19.6) 0.031 FEV1 (ml) a 2126 (612) 1810 (591) 2242 (580) 0.0001 # FEV1/FVC a 67.6 (13.0) 62.7 (17.0) 69.5 (10.7) 0.01 # %FEV1 predicted a 101.4 (25.5) 93.7 (28.7) 104.3 (23.7) 0.020 # %IC a 87.8 (18.9) 85.3 (19.7) 88.7 (18.6) 0.314 Severity of airway obstruction 0.002 # Non-COPD 50.2 (93) 34.0 (17) 56.3 (76) ## GOLD grade 1 34.6 (64) 44.0 (22) 31.1 (42) GOLD grade 2 10.8 (20) 10.0 (5) 11.1 (15) GOLD grade 3 4.3 (8) 12.0 (6) 1.5 (2) ## GOLD grade 4 0 (0) 0 (0) 0 (0) Chest CT finding Emphysema 30.8 (57) 36.0 (18) 28.9 (39) 0.374 n indicates number. aData are shown as mean (SD). All other data are shown as% (numbers). #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. BMI: body mass index; VC: vital capacity; FEV1: forced expiratory volume in 1 second; FVC: forced vital capacity; IC: inspiratory capacity; GOLD: the Global Initiative for Chronic Obstructive Lung Disease. Characteristics of lung cancer among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Lung cancer histology 0.028 # Adenocarcinoma 58.4 (108) 44.0 (22) 63.7 (86) ## Sq 30.8 (57) 38.0 (19) 28.1 (38) NSCLC 5.4 (10) 10.0 (5) 7.4 (10) SCLC 3.2 (6) 8.0 (4) 1.5 (2) ## Large 2.2 (4) 0 (0) 3.0 (4) Clinical stage 0.0001 # 1A 37.3 (69) 26.0 (13) 41.5 (56) 1B 19.4 (36) 14.0 (7) 21.5 (29) 2A 14.6 (27) 10.0 (5) 16.3(22) 2B 11.4 (21) 8.0 (4) 12.6 (17) 3A 17.3 (32) 42.0 (21) 8.1 (11) ## EGFR status 0.0001 # Yes 16.2 (30) 8.0 (4) 19.3 (26) No 61.6 (114) 28.0 (14) 74.1 (100) ## ND 22.2 (41) 64.0 (32) 6.7 (9) ## n indicates number. aData are shown as mean (range). bData are shown as mean (SD). All other data are shown as% (numbers). ND indicates œnot determined. #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. Sq: squamous cell carcinoma; NSCLC: non-small cell lung carcinoma; SCLC: small cell lung carcinoma; Large: large cell carcinoma; EGFR: epidermal growth factor receptor. Multivariate analysis of independent factors in decision-making process for proposing thoracic surgery with curative intent Variables Odds ratio 95% CI p value Severity of airflow obstruction 0.002 # Non-COPD versus GOLD grade 1 0.920 0.370“2.289 0.858 Non-COPD versus GOLD grade 2 1.085 0.268“4.386 0.909 Non-COPD versus GOLD grade 3 0.025 0.004“0.167 <0.0001 # Clinical staging <0.0001 # Stage 1A versus stage 1B 1.084 0.326“3.602 0.895 Stage 1A versus stage 2A 0.679 0.185“2.491 0.559 Stage 1A versus stage 2B 0.705 0.172“2.895 0.628 Stage 1A versus stage 3A 0.062 0.019“0.202 <0.0001 # Age (per one year) 0.858 0.802“0.917 <0.0001 # #p?<?0.05. Discussion This is the first study to evaluate the clinical impact of the prevalence and severity of COPD on a large cohort of Japanese patients with lung cancer who underwent bronchoscopy. Mounting evidence suggests that there is a close association between COPD and lung cancer [91013]. For example a case-control study by Young et al. demonstrated a high prevalence of COPD in patients with newly diagnosed lung cancer [10]; however their study population comprised only Caucasian ancestry and nonsmokers with lung cancer were also excluded [10]. Although many lines of evidence suggest that EGFR mutations are more common among women never-smokers patients with adenocarcinoma-type lung cancer and patients of East Asian ethnicity including Japanese [1119] the association of COPD prevalence with EGFR mutations has not been fully evaluated. Indeed 21.1% of our Japanese study population was non-smokers 42.1% of whom had adenocarcinoma with EGFR mutation. Compatible with the distribution of pathological findings there was significantly higher rate of EGFR mutation in the non-COPD group than in the COPD group (). Although a recent study by Loganathan et al. also showed that 67% of 436 patients with newly diagnosed lung cancer had undergone spirometry prior to receiving treatment [9] our study analyzed the prevalence of COPD and its severity in 84.4% of patients with newly diagnosed lung cancer mainly by performing spirometry at bronchoscopy. Furthermore almost 50% of Loganathan et al.™s population were women [9] whereas only 26.7% of our population were women. Epidemiologic surveys of cancers in Japan and the United States of America might support the different proportion of women patients with lung cancer between our study and their studies [2021]. Although we previously demonstrated that 43.2% of the patients undergoing major lung resection had COPD (178/412 cases) [14] here the prevalence of COPD was found to be 54.4% in Japanese patients with lung cancer who underwent bronchoscopy. In the present population 61.3% of men had COPD (122/199 cases) whereas only 35.2% of women had COPD (25/71 cases). In addition 95.5% of men had a history of smoking in our population whereas 67.6% of women were non-smokers. In contrast the percentage of non-smokers among women with lung cancer was only 10.5% in the study of Loganathan et al. Thus the lower prevalence of COPD in women with lung cancer might be explained by the high rate of non-smokers among women in our Japanese population [1322]."
Lung_Cancer
"TTP and 1-year survival were not different between the two dose groups indicating the dose-to-rash strategy failed to increase clinical benefit. Observed low incidence of toxicity and low erlotinib exposure suggest standardized and maximum allowable dosing may be suboptimal in African Americans. EGFR Erlotinib African American Pharmacokinetics Pharmacogenetics PLoS One one 1932-6203 Public Library of Science San Francisco USA 24647522 3960222 PONE-D-13-47730 .0092320 Research Biology and Life Sciences Biochemistry Biomarkers Cell Biology Molecular Cell Biology Genetics Gene Expression Medicine and Health Sciences Clinical Medicine Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Cancer Treatment Research and Analysis Methods Research Design Clinical Research Design Retrospective Studies Response to First-Line Chemotherapy in Patients with Non-Small Cell Lung Cancer According to RRM1 Expression Chemotherapy According to RRM1 Expression Dong Xiaopeng 1 Hao Yingtao 1 Wei Yucheng 2 Yin Qiuwei 3 Du Jiajun 4 Zhao Xiaogang 1 * 1 Department of Thoracic Surgery Second Hospital of Shandong University Jinan China 2 Department of Thoracic Surgery Affiliated Hospital of Qingdao University Medical College Qingdao China 3 Department of Thoracic Surgery Qilu Hospital of Shandong University Jinan China 4 Department of Thoracic Surgery Shandong Provincial Hospital Jinan China de Mello Ramon Andrade Editor University of Algarve Portugal * E-mail: dxp3260sohu.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: XZ XD. Performed the experiments: YH YW QY JD. Analyzed the data: XZ XD. Contributed reagents/materials/analysis tools: YW QY JD. Wrote the paper: XD. 2014 19 3 2014 9 3 e92320 23 11 2013 7 2 2014 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The response to cytotoxic chemotherapy varies greatly in patients with advanced non-small cell lung cancer (NSCLC) and molecular markers may be useful in determining a preferable therapeutic approach for individual patients. This retrospective study was performed to evaluate the predictive value of ribonucleotide reductase regulatory subunit M1 (RRM1) on the therapeutic efficacy of platinum-based chemotherapy in patients with NSCLC. Methods Patients with advanced NSCLC who received platinum doublet chemotherapy (n?=?229) were included in this retrospective study and their clinical outcomes were analyzed according to RRM1 expression. Results In patients receiving gemcitabine-based therapy the disease control rate (DCR) and progression-free survival (PFS) of patients with RRM1-negative tumors were significantly higher than in patients with RRMI-positive tumors (P?=?0.041 and P?=?0.01 respectively) and multivariate analysis showed that RRM1 expression was an independent prognostic factor (P?=?0.013). No similar differences were found in patients receiving docetaxel- or vinorelbine-based therapy. In RRM1-positive patients the DCRs for docetaxel and vinorelbine were higher than for gemcitabine (P?=?0.047 and P?=?0.047 respectively) and docetaxel and vinorelbine showed a longer PFS than gemcitabine-based chemotherapy (P?=?0.012 and P?=?0.007). No similar differences were found among patients with RRM1-negative tumors. Conclusions Negative RRM1 expression in advanced NSCLC is associated with a higher response rate to gemcitabine-based chemotherapy. In patients with RRM1-positive tumors docetaxel and vinorelbine showed a higher therapeutic efficacy than gemcitabine-based therapy. Additional prospective studies are needed to investigate the predictive meaning of RRM1 in the response to chemotherapy. These authors have no support or funding to report. Introduction Platinum-based chemotherapy is considered the main therapeutic approach for advanced non-small cell lung cancer (NSCLC) [1] 2. However the selection of chemotherapeutic agents is primarily based on the clinician™s experience and preference and studies have shown a great deal of variability with respect to their therapeutic efficacy and toxicity. Even with newly developed chemotherapy regimens the prognosis of patients with advanced NSCLC remains dismal [3]“[5]. At present promising results on the utility of molecular markers in predicting efficacy of cytotoxic therapy in NSCLC have been reported. Excision repair cross-complementation group 1 (ERCC1) was shown to be associated with the response to platinum-based chemotherapy [6]“[8] and in another recent study taxane-based therapies showed a higher disease control rate (DCR) and longer progression-free survival (PFS) than gemcitabine in patients with epidermal growth factor receptor (EGFR) mutations [9]. These studies suggest that the tumor biology and the response to cytotoxic chemotherapy vary greatly among NSCLC patients and individualized therapies may help reduce the resistance to chemotherapeutic agents. Ribonucleotide reductase regulatory subunit M1 (RRM1) is a molecule involved in DNA synthesis and damage repair. Preclinical studies have shown that RRM1 is involved in sensitivity to gemcitabine in NSCLC [10] [11]. Lower RRM1 expression was associated with a high response rate to platinum agents and gemcitabine and patients with high expression of RRM1 showed a decreased response to gemcitabine therapy [12]“[15]. However in other reports RRM1 was either not associated or was inversely associated with the survival of NSCLC patients receiving gemcitabine-containing regimens [16] [17]. Therefore the correlation between RRM1 expression and the response to chemotherapy is still uncertain. In the present study we reviewed 229 patients with advanced NSCLC who had received platinum-based doublet chemotherapy as a first-line therapy and evaluated their clinical outcomes according to RRM1 expression. Patients and Methods Ethics Statement This retrospective study was approved by the ethics committee of second hospital of Shandong university. And all patient records were anonymized and de-identified prior to analysis. Patients In this retrospective analysis 680 patients diagnosed with advanced NSCLC between 2007 and 2010 were screened 325 of whom had received carboplatin-based doublet chemotherapy as a first-line treatment. A cohort of 229 patients for whom clinical records and computed tomography (CT) scans were complete and tumor specimens were available to screen for RRM1 expression was selected. Histological type was determined according to the World Health anization criteria. During the treatment period a chest CT scan was taken every 6“8 weeks and independent reviews of these CT scans were performed in this retrospective study to confirm the response to therapy and to assess disease progression. The treatment response was classified as progressive disease (PD) stable disease (SD) partial response (PR) or complete response (CR) according to RECIST (Response Evaluation Criteria in Solid Tumors). Patients showing a CR or PR were regarded as responders. The DCR included patients with CR PR and SD lasting longer than three months. PFS was the time between the first day of treatment and the first sign of disease progression or death. RRM1 Expression Analysis Immunohistochemistry was performed using 5 ?m-thick sections from paraffin-embedded tissue blocks and a Bond Polymer Intense Detection System (VisionBioSystems Vic Australia) according to the manufacturer™s instructions. As a negative control the same immunohistochemical staining protocol was used except the specific primary antibody (ProteinTech Group Chicago USA) was replaced with distilled water. Formalin-fixed paraffin-embedded human colonic adenocarcinoma tissue was used as a positive control. Five fields at 400— magnification were selected for each section to assess immunoreactivity. RRM1 immunoreactivity was evaluated semi-quantitatively based on the staining intensity and the proportion of positively staining cells by two independent observers blinded to patient status. The proportion of staining was scored from 0 to 3 as follows: diffuse ?50% positive (score 3); regional 10“49% positive (score 2); focal 1“9% positive (score 1); and negative <1% positive (score 0). The intensity of staining was also scored from 0 to 3 (0 absent; 1 weak; 2 moderate; 3 intense). The immunoreactive score for each sample was determined by multiplying the two individual scores. A score of ?9 was defined as a positive/high expression and a score of <9 was considered a negative/low expression. Statistical Analysis Statistical analyses of categorical variables including response rate (RR) and DCR were performed using Fisher™s exact test. Comparisons of the mean between different groups were calculated using the Student™s t-test. The median duration of PFS was calculated using the Kaplan-Meier method. Multivariate analyses were performed using Cox regression analysis for PFS to identify independent factors. Two-sided P-values of less than 0.05 were considered significant. All analyses were performed using SPSS 17.0 for Windows. Results Patient Characteristics and RRM1 Expression A total of 229 NSCLC patients were included in the study. The ages ranged from 39 to 75 years (median age 61 years) and 127 patients (55.5%) were male. The majority of the tumors were adenocarcinoma (112 patients 48.9%) and 123 patients had stage IV disease (53.7%). All patients received carboplatin-based doublet chemotherapy as a first-line treatment. Gemcitabine docetaxel and vinorelbine regimens were administered in 81 (35.4%) 77 (33.6%) and 71 (31.0%) cases respectively and the choice of regimen was made by the responsible clinician (Table 1). Of the 229 tumors 146 (63.8%) were negative for RRM1 expression and 83 (36.2%) were positive for RRM1 (Table 1). .0092320.t001 Table 1 Basic characteristics of NSCLC patients. Characteristics No % No. of patients 229 Age (median years) 61 Range 39“75 Gender Male 127 55.5 Female 102 44.5 History of smoking Never smoker 130 56.8 Smoker 99 43.2 Histology Adenocarcinoma 112 48.9 Squamous cell carcinoma 67 29.3 Others 50 21.8 Stage IIIB 106 46.3 IV 123 53.7 RRM1 Negative 146 63.8 Positive 83 36.2 Chemotherapeutic regimen Gemcitabine and carboplatin 81 35.4 Docetaxel and carboplatin 77 33.6 Vinorelbine and carboplatin 71 31.0 The relationship between patient characteristics and chemotherapy regimens according to RRM1 expression was analyzed. The patient characteristics were similar among patients receiving gemcitabine- docetaxel- and vinorelbine-based therapies (Table 2). .0092320.t002 Table 2 Characteristics of patients receiving chemotherapeutic regimens according to RRM1 expression. Characteristics RRM1-negative P-value RRM1-positive P-value Gemcitabine Docetaxel Vinorelbine Gemcitabine Docetaxel Vinorelbine No. of patients 52 50 44 29 27 27 Age (years) 58 62 61 >0.05# 60 58 63 >0.05# Gender Male 29 (55.8%) 28 (56.0%) 25 (56.8%) >0.05* 16 (55.2%) 15 (55.6%) 14 (51.2%) >0.05* Female 23 (44.2%) 22 (44.0%) 19 (43.2%) 13 (44.8%) 12 (44.4%) 13 (48.8%) Smoking history Never smoker 30 (57.7%) 31 (62.0%) 25 (56.8%) >0.05* 15 (51.7%) 15 (55.6%) 14 (51.9%) >0.05* Smoker 22 (42.3%) 19 (38.0%) 19 (43.2%) >0.05* 14 (48.3%) 12 (44.4%) 13 (48.1%) >0.05* Histology Adenocarcinoma 24 (46.2%) 25 (50.0%) 22 (50.0%) >0.05* 14 (48.3%) 14 (51.9%) 13 (48.2%) >0.05* Squamous cell carcinoma 17 (32.7%) 15 (30.0%) 12 (27.3%) 8 (27.6%) 8 (29.6%) 7 (25.9%) others 11 (21.1%) 10 (20.0%) 10 (22.7%) 7 (24.1%) 5 (18.5%) 7 (25.9%) Stage IIIB 24 (46.2%) 22 (44.0%) 20 (45.5%) >0.05* 14 (48.3%) 12 (44.4%) 14 (51.9%) >0.05* IV 28 (53.8%) 28 (56.0%) 24 (54.5%) 15 (51.7%) 15 (55.6%) 13 (48.1%) *Based on Fisher™s exact test. # Based on Student™s t-test. Tumor Response and PFS According to RRM1 Expression In the 229 patients 3 CRs 77 PRs 101 SDs and 48 PDs were observed for an overall RR and DCR of 34.9% and 79.0% respectively. There were no differences in the RR and DCR between patients with RRM1-negative tumors and those with RRM1-positive tumors. However in patients receiving gemcitabine-based therapy the DCR of RRM1-negative patients was significantly higher than that of RRM1-positive cases (78.8% vs. 55.2% P?=?0.041). No similar difference was found in patients receiving docetaxel- or vinorelbine-based therapy (Table 3). .0092320.t003 Table 3 Response to chemotherapy according to RRM1 expression. Gemcitabine and carboplatin Docetaxel and carboplatin Vinorelbine and carboplatin CR PR SD PD RR DCR CR PR SD PD RR DCR CR PR SD PD RR DCR RRM1 Negative 1 18 22 11 19 41* 1 17 26 6 18 44 1 14 21 8 15 36 Positive 0 7 9 13 7 16*# 0 10 12 5 10 22# 0 11 11 5 11 22# *Based on Fisher™s exact test. In patients receiving gemcitabine-based therapy the DCR of RRM1-negative patients was higher than RRM1-positive patients (P?=?0.041). # Based on Fisher™s exact test. In patients with RRM1-positive tumors the DCRs for docetaxel and vinorelbine were higher than for gemcitabine-based therapy (P?=?0.047 and P?=?0.047 respectively). The median PFS was 8.7 months (95% confidence interval (CI): 8.5“9.0 months) in all patients. No difference in PFS was found between patients with RRM1-negative tumors and those with RRM1-positive tumors (8.9 months vs. 8.5 months P?=?0.316) (Fig. 1A). However in patients receiving gemcitabine-based therapy the PFS of RRM1-negative patients was significantly higher than that of RRM1-positive patients (8.8 months vs. 7.6 months P?=?0.01) (Fig. 1B). No similar difference was observed in patients receiving docetaxel- or vinorelbine-based therapy (Figs. 1C and 1D). .0092320.g001 Figure 1 Kaplan-Meier curve of progression-free survival (PFS) according to ribonucleotide reductase M1 (RRM1) expression. (A) PFS for all patients with negative or positive RRM1 expression. (B) PFS for patients receiving gemcitabine-based therapy. (C) PFS for patients receiving docetaxel-based therapy. (D) PFS for patients receiving vinorelbine-based therapy. In multivariate analysis adjusted for gender smoking history and stage of disease RRM1 expression emerged as an independent predictive factor for PFS in patients receiving gemcitabine-based therapy (95% CI: 1.135“2.907 P?=?0.013). Tumor Response and PFS According to Chemotherapy Regimen In patients with RRM1-negative tumors no differences were observed in terms of RR DCR or PFS among patients that received gemcitabine- docetaxel- or vinorelbine-based therapies. However in patients with RRM1-positive tumors the DCR of patients receiving docetaxel or vinorelbine was higher than that of patients receiving gemcitabine (81.5% and 81.5% vs. 55.2% respectively; P?=?0.047 and P?=?0.047) (Table 3). In addition docetaxel and vinorelbine showed a longer PFS than gemcitabine-based chemotherapy (8.9 months and 9.1 months vs. 7.6 months respectively; P?=?0.012 and P?=?0.007) (Figs. 2A and 2B). .0092320.g002 Figure 2 Kaplan-Meier curve of progression-free survival (PFS) according to chemotherapy regimen. (A) PFS for patients with RRM1-negative tumors. (B) PFS for patients with RRM1-positive tumors. Discussion In the present study we analyzed 229 patients with NSCLC who had received carboplatin-based doublet chemotherapy. In patients receiving gemcitabine-based therapy the DCR and PFS in patients with RRM1-negative tumors was significantly higher than in RRM1-positive cases and multivariate analysis showed that RRM1 expression was an independent predictive factor for outcome. RRM1 overexpression in tumor tissue may induce resistance to gemcitabine-based therapy. Ribonucleotide reductase (RR) is an essential enzyme for DNA synthesis and is inhibited by the active metabolite of gemcitabine difluorideosycytidine 5-diphosphate. RRM1 depletes difluorideosycytidine 5-diphosphate and promotes DNA synthesis thereby enabling tumor survival. In studies with lung cancer cell lines RRM1 overexpression is associated with resistance to gemcitabine therapy [13] [18]. Consistently clinical studies have also suggested that overexpression of RRM1 correlates with resistance to gemcitabine-based therapy [19] [20]. Conversely low RRM1 mRNA expression was associated with a high response rate [21]"
Lung_Cancer
"FISH analysis was performed on the 297 cases to evaluate ALK gene rearrangement status. Two hundred and eighty-six out of 297 cases were informative for FISH analysis and 33 cases were identified with ALK+?(E). Thirty of the 33 ALK+?cases showed strong ALK expression and the other 3 showed weak ALK expression. Therefore there were 11 cases that showed ALK expression but were ALK-. We re-reviewed the FISH slides of the 11 discordant cases (2 cases with strong and 9 cases with weak ALK expression) and 3 cases (1 with strong and 2 with weak ALK expression) were identified as ALK+?while 8 (1 case with strong and 7 with weak ALK expression) were still ALK- ( F). Regarding the 3 ALK+?cases which were not identified by the original FISH analysis a case-by-case analysis revealed the following: Case 1 The dominant FISH signal pattern in this case was more than one copy of a single green signal without a corresponding orange signal in addition to fused signals (D). According to the ALK signal enumeration guide this indicated a deletion of the orange portion of the ALK probe which targeted the drug targeting area. Therefore we initially considered this case as negative. After re-reviewing the FISH analysis we found there were some areas containing scattered ALK+?cells with one or more copies of single green signals in addition to fused signals and a single red signal. The first 50 cells counted revealed 8 ALK+?cells. The second and third cell count in another 100 cells by different readers revealed 6 and 7 ALK+?cells respectively. If the first and third 50-cell count was considered the average percentage of positive cells reached 15%. Therefore this sample should be considered positive. Case 1 and 3 For these two cases originally constructed on TMA and IHC analysis showed strongly positive staining in one core and weakly positive staining in the other. After re-reviewing the FISH slides we found that there was indeed a small area of each core with a few cells containing subtle break-apart signals. As cell counts were difficult to perform in small areas containing not many cancer cells we cut the tissue sections. The IHC analysis still demonstrated strongly and weakly positive ALK expression respectively. The FISH analysis in the tissue sections showed ALK+. According to the final result of FISH analysis 36 out of the 286 lung adenocarcinoma cases were identified with ALK+. None of IHC negative cases were ALK+ demonstrating 100% sensitivity. Eight IHC-positive cases (1 strongly and 7 weakly positive cases) did not show ALK gene rearrangement resulting in 81.8% specificity. The concordance rate of IHC and FISH is 97.2% (). qRT-PCR and VENTANA ALK IHC analysis of discordant cases To further identify whether eight discordant cases of IHC and FISH carried ALK fusion at the RNA level a qRT-PCR analysis was applied. Positive qRT-PCR results were observed in 5 cases (1 strongly and 4 weakly positive cases) (). Among the 5 cases 3 (1 strongly and 2 weakly positive cases) were shown to have ALK expression using VENTANA ALK IHC analysis (G). The ALK fusion in these 3 cases was detected at around 14 of 30 qRT-PCR cycles (J). Regarding the other two cases although weak staining in cancer cells could be observed (H) they were considered negative according to the manufacturer™s scoring algorithm (details in Materials and Method section). The ALK fusion in these 2 cases was detected at around 28 of 30 qRT-PCR cycles (K). The remaining 3 of the 8 discordant cases showed neither VENTANA ALK staining nor ALK fusion (Figures 1I and 1L). VENTANA IHC and qRT-PCR analysis of all weakly positive and discordant cases detected by CST ALK (D5F3) Sample ID FISH IHC (CST) IHC (VENTANA) qRT-PCR Variant type 9 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 37 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 67 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 94 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 98 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 28 Negative 2+ Positive EML4-ALK variant 1/2/3a/3b 171 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 203 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 21 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 36 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 41 Negative 1+ Negative Negative 39 Negative 1+ Negative Negative 74 Negative 1+ Negative Negative VENTANA ALK IHC and qRT-PCR assays were also applied to the remaining 5 of the 12 ALK weakly expressed cases which were concordant with FISH analysis. These 5 cases were shown to have ALK expression detected by VENTANA ALK IHC and ALK fusion revealed by qRT-PCR analysis (). Clinicopathological characteristics of patients with ALK+ Using FISH analysis as a standard detection method the clinicopathological characteristics of the ALK+?and ALK- patients were compared and the results are shown in . As the median ages of the positive and negative groups were 48 and 58 years respectively the ALK+ patients were significantly younger (p <0.001). Patients with ALK+ were more likely to have lymph node metastasis compared to ALK- patients (p = 0.002). No correlation was observed between ALK+ and ALK- cases in terms of sex smoking habit tumor size pT M factors or pathologic TNM stage."
Lung_Cancer
"The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. "
Lung_Cancer
"We used a total of 10 samples for each round of the scheme as has been suggested as the adequate number of cases for proficiency testing in this area of pathology (Thunnissen et al 2011). Overall the results of the EQA suggest that there is more work to be done if laboratories are to ensure that the quality of their EGFR mutation testing meets an acceptable standard as only 72 out of 91 (72%) of the laboratories passed the EQA and is in line with the findings of other similar EQA schemes (Deans et al 2013). The threshold that was used (?18 points) is comparable with that of the majority of other EQA schemes in this field (van Krieken et al 2013). We weighted the marking of the errors' type differently depending on its implications for the patient. Errors resulting in no diagnosis (analytical failures) or no change in diagnosis (different mutation) were marked more leniently (deduction of 1.00 mark) when compared with those that resulted in the wrong diagnosis for the patient (false-negative or false-positive results; deduction of 2.00 marks). Given the potentially significant clinical consequences for the patient of any error we propose to change the threshold criteria to >18 points (Normanno et al 2013) in future schemes to ensure that any significant errors are picked up in the performance data. The materials we used in the scheme allowed us to control for some of the causes of variation seen in other EQA schemes such as influence of fixative on DNA quality (Bellon et al 2011). However our results show that not all laboratories are able to produce EGFR mutation test results to a high standard. At least 1 in 10 samples is genotyped incorrectly in >19% of laboratories (round 2) although there is evidence to show that this does improve with continued participation (round 3). In the first round proof of principle EQA we identified five laboratories that made systematic errors in their pre or post-analytical processes. The way the sample blocks were labelled may have contributed to these errors but it is impossible to identify the true root cause from our data. However the outcome of these errors was that the correct results were reported for the wrong patients indicating a failure of their quality management system. False-negative and false-positive results were the main sources of genotyping error in the scheme. Both these results are extremely harmful for NSCLC patients. In fact a negative result will lead to treatment of an EGFR-mutant patient with chemotherapy as first line of therapy which is less effective as compared with EGFR TKIs in this subgroup of patients (Mok et al 2009). On the other hand false-positive findings will lead to treatment of EGFR wild-type patients with EGFR TKIs that have been shown to be detrimental as first-line treatment in this subgroup of patients who benefit more from first-line chemotherapy (Mok et al 2009; Fukuoka et al 2011). False-negative results accounted for 85% of all the genotype errors made in the scheme and might be due to the low sensitivity of the method used for mutational analysis. PCR/sequencing was the most common method used in the scheme for scanning to detect point mutations. The major disadvantage of sequencing is that it is not very sensitive (Angulo et al 2010) especially in samples with low tumour cell content. Real-time allele-specific tests such as Qiagen's Therascreen EGFR kits are much more sensitive and specific but only test for a subset of common mutations (Lopez-Rios et al 2013). However it is difficult for us to draw strong s from this scheme about the errors made using the different technologies due to the lack of detailed data provided by the labs on exactly which methods were used for each sample except for samples B2/C3 and B8/C10 that gave a disproportionately high error rate compared with the other samples used. We hypothesised that our estimates of mutational allelic frequency in the samples used in rounds 2 and 3 were inaccurate possibly due to EGFR gene copy number variation. We therefore undertook further quantitative validation on these samples using ddPCR to establish the true allelic frequency (Hindson et al 2011). This innovative approach enabled us to establish that in three of the samples the true value was higher than expected and for the other two samples lower than expected. However crucially for two samples (B2/C3 and B8/C10) the value established by ddPCR is very close to the expected minimum level of methodological sensitivity (for example 15% for Sanger sequencing and 5.43% for the p.(G719S) mutation as defined in version 1 of the Qiagen Therascreen kit packaging insert). We speculate that latent problems with the pre-analytical processes used by these labs (for example poor recovery of DNA inaccurate DNA quantification) resulted in false-negative results due to suboptimal analytical conditions. These include insufficient method validation misinterpretation of raw data lack of awareness of assay limitations sample contamination and poor in-house assay design. Nevertheless all of the mutations were identified by the validating laboratories using a range of different methodologies used by the participant laboratories. These findings confirm that every laboratory should be undertaking an appropriate test validation or verification to define the limits of detection and measurement uncertainty of the techniques they are using. This is a requirement for all labs that are accredited to the ISO 15189:2012 standard (International anisation for Standardization (ISO) 2010). A fundamental aspect of all diagnostic testing is the accurate reporting of the results. The quality of reports submitted was acceptable with a large proportion being comprehensive stand-alone documents containing most of the basic core elements. However the report is meaningless if the referring clinician cannot easily extract the relevant information. Therefore it is essential that that the report is clear concise and easy to read. Many of the reports obscured the take home message and there was often a lack of clarity and balance between the test information and the clinical context. Standardisation of the reporting and naming of mutations is also important and we assessed labs against the nomenclature guidelines from the Human Genome"
Lung_Cancer
"The mean Ct values for these five miRNAs were calculated excluding outliers (i.e. replicates with Ct values differing by more than one cycle from the median). In addition if CtU6ave and CtU48ave each did not occur within 32 cycles the assay was repeated. Samples with low U6 or U48 snRNA levels were not excluded from data analyses. Statistical analysis All statistical analyses were performed using GraphPad Prism 5.0 software (GraphPad Software Inc. San Diego CA USA). The data were analyzed using homogeneity of variance. One-way ANOVA or Wilcoxon two-sample tests were used to test for associations between miRNA expression levels and clinicopathological features of the patients. A paired sample t-test was used to compare differences in miRNA expression between lung tissue and serum samples. Receiver operating characteristic (ROC) curves were generated to assess the diagnostic accuracy of each parameter. Patient survival was estimated by the Kaplan-Meier method and the log-rank test was used to compare the survival between groups. The Cox hazard regression model was used to analyze the risk factors for NSCLC. All statistical tests were two-sided and a P value of 0.05 was considered statistically significant. Results Differential expression of three miRNAs in NSCLC tissue and patient sera Based on our miRNA array (Agilent) and validation data we selected three miRNAs (miR-29c miR-93 and miR-429) for further study in NSCLC samples. We performed qRT-PCR analysis for these three miRNAs in 70 pairs of NSCLC and corresponding noncancerous lung tissues. Our data showed that levels of miR-29c and miR-93 expression were upregulated in NSCLC tissues compared to the corresponding noncancerous lung tissues (P?=?0.0408 and P?=?0.0444 respectively) whereas miR-429 levels were not significantly different between NSCLC and noncancerous lung tissues (P?=?0.3903 A). .0087780.g001 Differential expression of miRNAs in NSCLC. A qRT-PCR detection of three miRNAs in 70 NSCLC tumors and the corresponding normal lung tissues. P-values for miR-29c miR-93 and miR-429 were 0.04080.0444 and 0.3903 respectively using a paired sample t-test. B qRT-PCR analysis of serum miRNA levels in serum samples of 70 NSCLC patients vs. 48 healthy controls. P-values of serum miR-29c miR-93 and miR-429 were 0.00120.9291 and 0.0001 respectively using an unpaired sample t-test. C D E Association of these miRNA levels between NSCLC tissue and serum samples. Pearson correlation test showed that miR-429 expression in serum was significantly associated with that in NSCLC tissues (r?=?0.3578 P?=?0.0024) whereas serum levels of miR-29c and miR-93 were not associated with those in NSCLC tissues (r?=??0.07877 P?=?0.5169 and r?=?0.1515 P?=?0.2105 respectively). *P<0.05 between groups. We then investigated whether these differences in miRNA expression were present in serum samples from these patients. We found that serum miR-93 expression did not differ between NSCLC patients and healthy controls (P?=?0.3530). However miR-29c expression was significantly increased serum from NSCLC patients (P?=?0.0012) and miR-429 expression was significantly decreased (P?=?0.0001 B). The serum level of miR-429 expression was significantly correlated with that in NSCLC tissues (r?=?0.3578 P?=?0.0024 E) whereas serum levels of miR-29c and miR-93 expression were not associated with those in NSCLC tissues (r?=??0.07877 P?=?0.5169 and r?=?0.1515 P?=?0.2105 respectively C and D). Associations between altered miRNA expression and clinical characteristics of NSCLC We next investigated associations between the altered miRNA expression levels (miR-29c and miR-93 in NSCLC and miR-29c and miR-429 in serum) with the clinicopathological characteristics of the NSCLC patients. We found that increased miR-93 expression was strongly associated with NSCLC histology (P?=?0.031 ) whereas serum miR-29c expression was associated with abnormal CEA levels (P?=?0.030 ). In contrast no other associations were detected between the expression levels of these miRNAs. Furthermore we plotted expression data for miR-29c and miR-429 using ROC curves to identify a cut-off value that could distinguish lung cancer patients from healthy controls. ROC curve analysis showed that at the optimal cut-off serum levels of miR-29c had a sensitivity of 65.7% and a specificity of 74.1% for distinguishing NSCLC patients from healthy controls with an area under the curve (AUC) of 0.676 (P?=?0.0004 95% confidence interval [CI]: 0.584“0.759 A). In addition serum levels of miR-429 had a sensitivity of 54.3% and a specificity of 81.2% for distinguishing NSCLC patients from healthy controls with an AUC of 0.713 (P<0.0001 95% CI: 0.623“0.793 B)."
Lung_Cancer
"Hispanic black and 130598 white participants ages 49“78 at enrollment in the Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial. BMI at baseline BMI at age 20 and BMI change were calculated using self-reported and recalled height and weight. Relative risks were stratified by race and sex and adjusted for age education marital status and smoking. Results 1495 black and 18236 white participants died during follow-up (mean=13 years). Clear J-shaped associations between BMI and mortality were observed among white men and women. Among black men and women the bottoms of these curves were flatter and increasing risks of death with greater BMI were observed only at higher BMI levels (?35.0). Associations for BMI at age 20 and BMI change also appeared to be stronger in magnitude in whites versus blacks and these racial differences appeared to be more pronounced among women. Conclusion Our results suggest that BMI may be more weakly associated with mortality in blacks particularly black women than in whites. National Cancer Institute : NCI Z99 CA999999 || CA Introduction In the U.S. there are substantial disparities in obesity prevalence across racial and ethnic groups. In 2009“2010 it was estimated that 38.8% of black men and 58.5% of black women as compared with 36.2% of white men and 32.2% of white women were obese 1. Evidence suggests that differences in obesity between black and white populations has increased in the past decade2“3 and is likely to continue to increase in the future4. It is of great public health importance to understand how racial and ethnic differences in the burden of obesity might contribute to health disparities. In the white population it has been well-established that there is a J-shaped relation between body mass index (BMI) and all-cause mortality with recent studies showing that mortality is the lowest at BMI 22.5“25.0 kg/m2 and increases monotonically with increasing levels of BMI above 25.0 5“6. However the shape of relation between BMI and mortality in the black population is less clear. Several early studies have suggested that the association for higher BMI values may be weaker among blacks than whites especially for black women 7“10. However in a recent study conducted within a large U.S. cohort of black women 6 Boggs et al. found a J-shaped association between BMI and mortality that was largely similar to that in the white population 11. This and other studies have suggested that the racial difference in the BMI-mortality association may differ according to factors such as sex age and education 10“11. BMI in young adulthood and subsequent weight changes may additionally affect health later in life. Previous studies conducted in predominantly white populations have linked excess body weight at young ages to elevated mortality 12“14. Recent results from the Atherosclerosis Risk in Communities (ARIC) study showed a positive association between BMI at age 25 and all-cause mortality in African-American women although the authors did not examine the association of BMI change 15. More studies are needed to explore the health effects of weight at young adulthood and long-term weight change in the black population and compare these effects to those in the white population. To further clarify the BMI-mortality association in the black population we investigated the relationship of BMI at baseline and at age 20 as well as BMI change during this period with total and cause-specific mortality among black men and women in a large U.S. cohort. To investigate racial differences in these associations we directly compared the results among blacks to those among whites in this population. Methods Study population The Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial is a randomized controlled multi-center trial designed to evaluate selected methods for the early detection of prostate lung colorectal and ovarian cancers16“17. Briefly between November 1993 and June 2001 over 150000 men and women aged 49“78 were enrolled from 10 study sites and were randomly assigned to receive either specific cancer screening regime or standard care. Of the 149980 study participants who completed the self-administered baseline risk factor questionnaire we excluded those who reported to be neither non- Hispanic black nor non-Hispanic White (n=9696) did not provide information on height or weight (n=1723) were not followed up for mortality (n=8) or reported extremely low or high BMI values (below 15 or above 50 kg/m2 n=509). The analytic cohort consisted of 3278 non-Hispanic black men4168 non-Hispanic black women64162 non-Hispanic white men and 66436 non-Hispanic white women. The study protocol was approved by the Institutional Review Board of the National Cancer Institute and the participating centers. All participants provided written information consent upon enrollment. Exposure assessment In the baseline risk factor questionnaire participants were asked to report their current height (in feet and inches) current weight (in pounds) and weight at age 20 (in pounds). We calculated BMI at baseline and at age 20 as the weight at these respective ages in kilograms (kg) divided by current height in meters (m) squared. We additionally calculated the change in BMI between age 20 and baseline for each participant. Other information ascertained from the baseline questionnaire included demographic characteristics; lifestyle factors such as physical activity alcohol intake and smoking history; and medical history including diabetes hypertension heart attack stroke and cancer. Mortality ascertainment Information on deaths and cause of deaths were obtained through periodic linkage of the study population to the National Death Index. We used the International Classification of Diseases Ninth Revision [ICD-9] to define death due to cardiovascular diseases (ICD-9 codes 390“459) or cancer (ICD-9 codes 140“208). Study staff retrieved death certificates and relevant medical records to confirm deaths occurring during follow-up and to verify the underlying cause of death in a uniform and unbiased manner 17. Statistical analysis Age-standardized mortality rates (number of deaths/1000 person-years) were calculated by direct standardization using five-year age categories. Multivariable-adjusted hazard ratios (HRs) and two-sided 95% confidence intervals (CIs) were calculated using Cox proportional hazards models via the SAS PROC PHREG procedure (SAS 9.3; SAS Institute Cary North Carolina). Person-years were calculated from the date of completion of the baseline questionnaire until the date of death the last date of follow-up the 13th anniversary of randomization or December 312009 whichever occurred first. In multivariable-adjusted models we included age at baseline (continuous) education (less than high school high school post-high school some college college graduate and postgraduate) marital status (married widowed divorced separated and never married) smoking status (never former and current smoker) pack-years (>0“10 >10“20 >20“30 and >30) and years since quitting (<5 5“<10 10“<20 20“<30 and 30+). For each covariate missing values (generally <5%) were put into a separate group. Because further adjustment for physical activity alcohol drinking and intervention status had little influence on the results (i.e. <5% change in the HRs for BMI) these variables were not included in the final models. In the main analysis BMI at baseline was categorized into 7 groups: 15.0“<22.5 22.5“<25.0 25.0“<27.5 27.5“<30.0 30.0“<35.0 35.0“<40.0 and 40.0“50.0. In analyses of cause-specific mortality and subgroup analyses we used consolidated categories and continuous values of BMI to preserve statistical power and participants with BMI values less than 20 were excluded to account for the elevated risks of death observed in this group. Due to the generally lower values of BMI at age 20 we used the following 5 categories for analyses: 15.0“<20 20“<22.5 22.5“<25.0 25.0“<27.5 27.5“50. BMI change between age 20 and baseline was categorized into 4 groups (<0 0“<5 5“<10 and 10+). In multivariable-adjusted models of BMI change we additionally adjusted for BMI at age 20. Tests for linear trend across BMI categories were performed by modeling median values in each category as a continuous variable. Tests for interaction were performed using the likelihood-ratio test comparing the fit of models having a cross-product term between BMI and the covariate of interest to that of models without this term. Tests for heterogeneity were performed using the Mantel-Haenszel test. To assess the impact of reporting error in self-reported BMI on our results we used race- and sex-specific regression models to calculate adjusted BMI using the self-reported BMI for each participant (BMI adjusted=?2.03+1.07 BMI self-reported + 0.0062 age for black men BMI adjusted=?0.88+1.00 BMI self-reported + 0.0273 age for white men BMI adjusted=? 1.10+1.02 BMI self-reported + 0.0174 age for black women and BMI adjusted=?0.51+1.02 BMI self-reported + 0.0117 age for white women). We generated these equations using data from participants ages 49 years and older in the U.S. National Health and Nutrition Evaluation Survey (NHANES) 1999“200618 by regressing BMI calculated from measured height and weight on BMI calculated from self-reported height and weight adjusting for age. Results During an average of 13 years of follow up we identified 1495 deaths in blacks and 18236 in whites. Table 1 describes study characteristics of black and white men and women. The mean age at baseline was 62 for all race and sex groups. Compared with whites both black men and women were less likely to be college educated and married and more likely to be current smokers and have a history of diabetes hypertension heart attack and/or stroke. The mean baseline BMI was higher in blacks than in whites and this race difference was more pronounced in women than in men. The distribution of BMI at age 20 was similar across categories of race and sex. Age-standardized mortality rates were lowest between 27.5 and 29.9 in black men and 25.0 and 27.4 in black women whereas the lowest mortality rates among white participants were generally found between 22.5 and 24.9. Black men and women had higher age-standardized mortality rates in all BMI categories when compared with their white counterparts (Table 2). In multivariable-adjusted models using 22.5“<25.0 as the reference category of BMI we observed J-shaped associations between BMI and mortality in both blacks and whites. Additional exclusion of current smokers recent quitters (<5 years) and subjects with a history of cancer heart attack or stroke at baseline generally yielded slightly weaker associations for the lowest BMI category and slightly stronger positive associations at the higher range of BMI (Table 2 Figure 1). "
Lung_Cancer
"Introduction Lung cancer is the leading cause of cancer-related deaths worldwide [1] whereas non-small cell lung cancer (NSCLC) represents the most frequent type of lung cancer [2]. NSCLC accounts for approximately 80% of all lung cancer cases and has a 5-year overall survival rate of less than 15% [3 4]. Approximately 40% of patients diagnosed with NSCLC have unresectable stage III disease or medically inoperable disease [5]. Radiation therapy has been regarded as the main treatment strategy for NSCLC for a long time. However radioresistance is the key issue limiting the effects of radiotherapy [2 6]. It is possibly due to tumor heterogeneity in terms of cell of origin pathology etiology and molecular/genetic pathogenesis [7]. NSCLC cells are often resistant to radiotherapy [8] which in turn induces the local recurrence of NSCLC [9 10]. Therefore the development of novel approaches for the treatment of NSCLC including targeted gene treatment as a radiosensitizer to treat this lethal disease is urgently needed to enhance the survival rate in patients. microRNAs (miRNAs) [11] are a class of short noncoding RNAs that function as a regulation for gene expression via targeting mRNA for degradation or inhibition of translation [12]. miRNAs are new factors implicated in regulating the expression of genes involved in tumorigenic processes such as inflammation cell cycle regulation stress response differentiation apoptosis and invasion and over the past decade they have been found to have key roles in cancers [13“15] including lung cancer [16]. Moreover recent studies have suggested a link between expression of some miRNAs and radiotherapy particularly in lung cancer [17“19]. microRNA-21 (miR-21) is a miRNA which has been reported to be overexpressed in many human malignancies including NSCLC [20“22]. Interestingly miR-21 was found to be upregulated in radiotherapy resistant NSCLC cells relative to radiosensitive counterparts [18]. In addition Wang et al. also reported that comparing with radiotherapy resistant NSCLC patients miR-21 was greatly downregulated in radiotherapy sensitive group [23]. Considering miR-21 as a putative regulator of NSCLC radiotherapy resistance we explore the role of miR-21 in radiotherapy resistance of NSCLC A549 cells and the potential molecular mechanism in the present study. 2. Materials and Methods 2.1. Cell Culture The NSCLC cell line A549 was cultured in Dulbecco's modified Eagle's medium (Invitrogen Carlsbad CA) supplemented with 10% fetal bovine serum 100?U/mL penicillin and 100??g/mL streptomycin. Cell cultures were incubated in a humidified atmosphere of 5% CO2 at 37°C. 2.2. Transfection Anti-miR-21 (5?-UCAACAUCA-GUCUGAUAAGCUA-3?) and the negative control oligonucleotides (NC 5?-CAGUACUUUUG-UGUAGUACAA-3?) were obtained from Ambion Inc. (Austin TX USA). The transfection was performed using LipofectamineTM 2000 (Invitrogen USA) according to the instructions provided by the manufacturer. The transfected cells were resuspended and cultured in regular culture medium for 48?h before analysis. 2.3. Detection of miR-21 by TaqMan Real-Time PCR PCR-based detection of miR-21 was performed by the TaqMan miRNA assays (ABI Forest City CA) as described previously [24 25]. The real-time PCR results recorded as threshold cycle numbers (Ct) were normalized against an internal control (U6 RNA) and then expressed as fold changes [25]. 2.4. Ionizing Radiation 48?h after anti-miR-21 or anti-miR-NC transfection subconfluent cell monolayers were treated with ?-ray ionizing radiation (IR) from a 60Co source (PLA General Hospital Beijing China) at a rate of 2.4?Gy/min. 2.5. Clonogenic Survival Analysis After exposure to various doses of IR cells were trypsinized washed and replated at 200 cells per 10-cm dishes. Cells were grown for 14 days fixed with ethanol and stained with Giemsa to detect colonies. The number of colonies containing at least 50 cells was determined and surviving fractions were calculated. 2.6. MTT Assay Twenty-four hours before IR 200??L cells were seeded to 96-well microtiter plate at 5 — 104 cells/mL. Three days after IR 10??L MTT reagent was added to each well followed by incubation for 4?h at 37°C. The supernatants were aspirated and the reaction was terminated by adding 100??L DMSO. The contents of the plates were mixed for 10?min and the absorbance was read at 490?nm. All experiments were performed three times and the average results were calculated. 2.7. Flow Cytometry Attached cells were harvested at 48?h after IR for apoptosis detection using the annexin V-FITC apoptosis detection kit (Sigma Louis MO). Briefly the cells were washed twice with DPBS and then were resuspended in 1— binding buffer at a concentration of 1 — 106 cells/mL. 5??L of annexin V-FITC conjugate and 10??L of propidium iodide solution were added to 500??L of each cell suspension in a plastic 12?mm — 75?mm test tube followed by incubation at room temperature for 15?min and protection from light. The fluorescence of the cells was determined immediately with a flow cytometer. 10?ng/mL of PI3K activator IGF-1 (Prospec-Tany Rehovot Israel) was used in the apoptosis assay. 2.8. Western Blot Analysis Cells were lysed in lysis buffer (20?mM Tris-HCl pH 7.4 150?mM?NaCl 1% Triton X-100 0.1?mM?EDTA 1?mM?EGTA 2?mM sodium orthovanadate 2?mM?NaF and Complete TM Protease Inhibitor Mix [Roche Applied Science Mannheim Germany]) for 20?min on ice and cleared by centrifugation at 12000?rpm and 4°C. Proteins were resolved on a 10% SDS PAGE gel transferred onto nitrocellulose membranes and blocked with 5% nonfat dry milk in TBST (10?mM Tris-HCl pH 7.5 100?mM?NaCl and 0.05% Tween 20) followed by incubation with a primary antibody [total and anti-phosphorylated-Akt (Ser473) antibody (Cell Signaling Biotechnology Beverly MA USA)]. Blots were washed and incubated with horseradish peroxidase-conjugated secondary antibody. Antibody complexes were visualized using an enhanced chemiluminescence-Western blotting detection system (Thermo Fisher Scientific Inc. Rockford IL USA). 2.9. Statistical Analysis Statistical analysis was performed using SPSS 13.0. The results from three independent experiments were presented as the means ± standard deviation. Statistical analyses were done by Student's t-test. P value < 0.05 was considered statistically significant. 3. Results 3.1. miR-21 Expression Was Knocked down in A549 Cells by Anti-miR-21 Transfection To confirm knockdown efficiency of anti-miR-21 transfection the relative of miR-21 expression level was detected by real-time quantitative RT-PCR. Compared with anti-miR-NC-transfected A549 cells the level of miR-21 expression in anti-miR-21-transfected cells was significantly decreased by about 64% (). 3.2. Downregulation of miR-21 Inhibited Survival Capacity of A549 Cells after IR To assess whether miR-21 downregulation could sensitize NSCLC A549 cells to IR the A549 cells transfected with either anti-miR-NC or anti-miR-21 were irradiated and their response was analysed. In clonogenic survival analysis we observed the expected decreased survival capacity of A549 cells transfected with anti-miR-21 14 days after IR (). Forty-eight hours after transfection A549 cells were treated with various doses of IR (0246 or 8?Gy) and the survival fractions upon IR were detected. As shown in after IR at 46 or 8?Gy the survival fraction of A549 cells in anti-miR-21-transfected group (0.61 ± 0.06 0.43 ± 0.08 and 0.27 ± 0.07 resp.) was significantly lower than that in anti-miR-NC-transfected group (0.83 ± 0.08 0.76 ± 0.11 and 0.65 ± 0.10 resp.) indicating that downregulation of miR-21 could significantly enhance the sensitivity of A549 cells to IR. 3.3. Downregulation of miR-21 Suppressed Proliferation of A549 Cells after IR To confirm the increased IR sensitivity of A549 cells the effect of miR-21 on cell proliferation was further analysed at 72?h after IR (). Downregulation of miR-21 expression was found to reduce cell proliferation as demonstrated by the decreased proliferation index of cells transfected with anti-miR-21 compared with anti-miR-NC (75.6 ± 18.96% versus 100% P < 0.05). Importantly a more pronounced growth inhibition of A549 cells was found when miR-21 was knocked down in combination with IR. This inhibition of cell growth in the combined treatment (anti-miR-21 + IR) was found to be significantly higher compared with that in the sole IR treatment group (proliferation index: 36.1 ± 8.48% versus 73.2 ± 21.37% P < 0.05 ). This indicates that knockdown of miR-21 sensitizes radioresistant NSCLC A549 cells to radiation. 3.4. Downregulation of miR-21 Enhanced Apoptosis of A549 Cells Induced by IR We next explored the role of miR-21 in the apoptosis of NSCLC A549 cells induced by IR. Anti-miR-21 or anti-miR-NC was transfected into A549 cells and was exposed (or sham exposed) to 8?Gy of IR. As shown in Figure 4 the percentage of apoptosis cells in miR-21 knockdown group (anti-miR-21) was significantly higher than that of negative control group (anti-miRNA-NC) at the dose 8?Gy (61.5 ± 15.62 versus 21.2 ± 5.35 P < 0.05) indicating that miR-21 knockdown may enhance radiosensitivity of A549 cells by promoting apoptosis and thus confirm a role for miR-21 in the regulation of radiotherapy response of NSCLC. 3.5. Downregulation of miR-21 Inactivated PI3K/Akt Signaling Pathway Induced by IR Because the PI3K/Akt signaling pathway is associated with apoptosis we subsequently examined the potential effects of miR-21 on the activation of PI3K/Akt pathways by IR to explore the potential molecular mechanisms. The activation of PI3K/Akt signaling pathways was measured by Akt phosphorylation on Ser473. By Western blot we found that the endogenous level of phospho-Akt expression (Ser473) in anti-miR-21-transfected A549 cells was downregulated compared to that in anti-miR-NC-transfected A549 cells after IR (Figure 5). Interestingly phospho-Akt (Ser473) expression was significantly increased in the case of being treated with IGF-1 a PI3K activator in anti-miR-NC-transfected A549 cells and even in anti-miR-21-transfected A549 cells after IR (Figure 5). This suggested that activation of PI3K/Akt signaling pathway by IR in A549 cells was suppressed by knockdown of miR-21 and the suppression was reversed by PI3K activator IGF-1. 3.6. miR-21 Knockdown Caused Promotion on Apoptosis Induced by IR Was Mediated by PI3K/Akt Signaling Pathway To further confirm the molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we next treated the cells with or without PI3K activator IGF-1 and then examined the effects of miR-21 downregulation on cell apoptosis induced by IR. As shown in Figure 6 without IGF-1 treatment the cell apoptosis induced by IR was significantly increased in anti-miR-21-transfected A549 cells (61.5 ± 15.62%) compared with that in anti-miR-NC-transfected A549 cells (21.2 ± 5.35% P < 0.05). However after activation of PI3K/Akt signaling pathway the cell apoptosis induced by IR was inhibited in either anti-miR-21-transfected or anti-miR-NC-transfected A549 cells. The percentage of cell apoptosis was not significantly different between these two groups (18.1 ± 5.55% versus 18.3 ± 5.15% P > 0.05). These data showed that in the condition of PI3K/Akt activation knockdown of miR-21 did not promote the apoptosis of A549 cells induced by IR suggesting that PI3K/Akt signaling pathway was the downstream target of miR-21 and the promotive effects of miR-21 knockdown on apoptosis induced by IR were mediated by PI3K/Akt signaling pathway. 4. Discussion It is well known that the acquisition of resistance to radiotherapy which greatly increases patient morbidity and mortality is a significant problem in the treatment of NSCLC. Effective treatment which can sensitize the radioresistant NSCLC to radiotherapy is always being sought. Recently some miRNAs were found to be related to radioresistance. Among them miR-21 is reported to play a role in radioresistance of cancer including glioblastoma [26 27] breast cancer [28] and rectal cancer [29]. But up to now few researches have studied the correlations between miR-21 expression and radiotherapy sensitivity of NSCLC. Liu et al. reported that miR-21 expression promotes radioresistance in NSCLC but the related molecular mechanisms were not revealed [30]. The roles of miR-21 in the radiotherapy response of NSCLC are not fully understood and remain to be elucidated. Thus in the current study we investigated whether miR-21 could affect the radiosensitivity of NSCLC A549 cells and found that downregulation of miR-21 significantly enhanced the sensitivity of A549 cells to radiotherapy through inhibition of PI3K/Akt signaling pathway. Our data showed that following the transfection of anti-miR-21 into A549 cells the inhibition of survival fraction caused by various doses of IR was enhanced compared with radiotherapy alone. This result suggests that miR-21 is closely associated with the therapeutic efficiency of IR on radioresistant A549 cells and downregulation of miR-21 may sensitize A549 cells to IR. It is reported that miR-21 could stimulate growth in NSCLC [30 31]. Accordingly we also found that the proliferation of A549 cells was inhibited after miR-21 knockdown. Moreover the inhibition of cell proliferation induced by combination of miR-21 knockdown and IR was more pronounced compared with either miR-21 knockdown or IR treatment indicating that miR-21 knockdown plays a crucial role in the combined inhibition of cell proliferation and silencing miR-21 may increase the sensitivity of A549 cells to IR. Cell apoptosis induced by IR is one of the most important effects of tumor radiotherapy. Furthermore miR-21 is reported to be an antiapoptotic factor in lung cancer [32 33]. So we hypothesized that it is possible that miR-21 could affect the apoptosis of NSCLC induced by IR. Our current results demonstrated that miR-21 knockdown promoted apoptosis of A549 cells induced by IR indicating that the expression of miR-21 could affect radiosensitivity of NSCLC cells which might be associated with inhibition of apoptosis. This is also in agreement with the previous report [30]. To explore the potential molecular mechanisms of radiosensitization by miR-21 knockdown in NSCLC A549 cells we focused on analysis of PI3K/Akt signaling pathway because the influence of PI3K/Akt signaling pathway on IR-induced apoptotic propensity is well documented [34 35]. We examined whether downregulation of miR-21 could affect Akt phosphorylation at Ser473 and/or its total expression and found that miR-21 knockdown suppressed the activation of PI3K/Akt signaling pathway by IR in A549 cells. In addition the apoptosis induced by IR was enhanced in A549 cells after miR-21 knockdown. This data indicates that the stimulative effects of miR-21 knockdown on A549 cell apoptosis induced by IR are related to the inactivation of PI3K/Akt signaling pathway. Furthermore with the treatment of PI3K activator IGF-1 we found that the apoptosis of A549 cells induced by IR was not promoted even if miR-21 was downregulated. Our results suggest that the promotive effects of miR-21 knockdown on A549 cell apoptosis induced by IR depend on the inactivation of PI3K/Akt signaling pathway."
Lung_Cancer
"progression-free survival (PFS) compared with placebo in patients from eastern Asian with locally advanced/metastatic non-small-cell lung cancer (NSCLC) after four chemotherapeutic cycles (21 days per cycle) of first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the cost-effectiveness of maintenance gefitinib therapy after four chemotherapeutic cycle™s stand first-line platinum-based chemotherapy for patients with locally advanced or metastatic NSCLC with unknown EGFR mutations from a Chinese health care system perspective. Methods and Findings A semi-Markov model was designed to evaluate cost-effectiveness of the maintenance gefitinib treatment. Two-parametric Weibull and Log-logistic distribution were fitted to PFS and overall survival curves independently. One-way and probabilistic sensitivity analyses were conducted to assess the stability of the model designed. The model base-case analysis suggested that maintenance gefitinib would increase benefits in a 13 6 or 10-year time horizon with incremental $184829 $19214 $19328 and $21308 per quality-adjusted life-year (QALY) gained respectively. The most sensitive influential variable in the cost-effectiveness analysis was utility of PFS plus rash followed by utility of PFS plus diarrhoea utility of progressed disease price of gefitinib cost of follow-up treatment in progressed survival state and utility of PFS on oral therapy. The price of gefitinib is the most significant parameter that could reduce the incremental cost per QALY. Probabilistic sensitivity analysis indicated that the cost-effective probability of maintenance gefitinib was zero under the willingness-to-pay (WTP) threshold of $16349 (3—per-capita gross domestic product of China). The sensitivity analyses all suggested that the model was robust. Conclusions Maintenance gefitinib following first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations is not cost-effective. Decreasing the price of gefitinib may be a preferential choice for meeting widely treatment demands in China. This study was funded by National Natural Science Foundation of China (No.81173028) (URL: http://www.nsfc.gov.cn/Portal0/default152.htm). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer the most commonly diagnosed form of cancer is also the leading mortality cause of cancer in males [1]. Non-small-cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancer cases and the majority of patients with NSCLC have locally advanced/metastatic disease when they are diagnosed with carcinoma [2] [3]. Platinum-based combination therapies are recommended as first-line chemotherapy for unselected patients with locally advanced/metastatic NSCLC [4] [5]. However the duration of them (4“6 chemotherapeutic cycles 21 days per cycle) are limited by cumulative toxicities and response rates (20%“35%) and median overall survival (7“12 months) are modest [6] [7]. On the basis of previous investigations efforts to improve treatment outcome have focused on the specific goal of prolonging tumour response progression-free survival (PFS) and overall survival (OS) with well tolerated maintenance treatment in patients who have attained tumor control during first-line treatment [8]“[12]. Because of these trials and other findings both erlotinib and pemetrexed (for patients with histologies other than squamous cell carcinoma) have been approved by clinical guidelines as a category 2A recommendation for switch maintenance therapy and also been approved by FDA in patients without disease progression after 4“6 chemotherapeutic cycles of first-line therapy [4] [13] [14]. In The Lancet Oncology recently Li Zhang et al based on a double-blind randomised phase 3 trial reported that maintenance gefitinib significantly prolonged PFS compared with placebo in patients from 27 centres across China with locally/metastatic NSCLC which indicates that gefitinib should be considered as a maintenance treatment choice in eastern Asian patients [15]. Several economic studies were conducted of maintenance therapy [16]“[23]. Two analyses concluded that maintenance erlotinib is cost-effective versus best supportive care for locally advanced/metastatic NSCLC [16] [17]. Except for the study by Greenhalgh et al [18] the 4 other studies of maintenance pemetrexed indicated that the new therapy was not cost-effective [19]“[22]. The evaluation from Zhu J et al on the basis of the clinical trial suggested that the maintenance gefitinib therapy was cost-effective for locally advanced/metastatic NSCLC patients with activating EGFR mutations [23]. However it is unclear whether the new therapy is cost-effective in patients with unknown EGFR mutations after first-line platinum-based combination chemotherapy without disease progression. The objective of the current study was to evaluate the long-term cost-effectiveness (10 year time horizon) of maintenance gefitinib therapy after four chemotherapeutic cycles of stand first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC patients with unknown EGFR mutations from a Chinese health care system perspective. Materials and Methods A previously constructed semi-Markov model was used to compare the long-tern impact of maintenance gefitinib treatment versus placebo after 4 chemotherapeutic cycles of first-line platinum-based chemotherapy for patients with locally advanced/metastatic NSCLC [22] on the basis of the double-blind randomised phase III trial from China by Li Zhang et al [15]. The model along with two-parametric Weibull and Log-logistic distribution were used for calculating the direct medical costs life-years gained (LYGs) and quality-adjusted life-years (QALYs) gained of the practice presented in the trial [15]. Due to the perspective of the Chinese health care system only direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment for progressive disease and terminal-phase cost. Costs in this study were estimated in US dollars (USD) corresponding to the 2011 consumer price index and assuming an average exchange rate of 1 USD to 6.45 Chinese Yuan (RMB). Utilities for the model were derived from the literature. The future costs and outcomes were discounted at 3% annually in compliance with the request of China Guidelines for Pharmacoeconomic Evaluations (version 8) [24]. Effectiveness data were stemmed from the multicentre double-blind randomised clinical trial [15] which is the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search. In brief 296 patients with histological or cytological NSCLC in stage IIIb or IV between September 28 2008 and August 112009 who were 18 years or older and had a WHO performance status of 0“2 and more than 12 weeks life expectancy after completion of four chemotherapeutic cycle™s first-line platinum-based chemotherapy without disease progression were eligible for the maintenance gefitinib or placebo treatment (1?1 randomization ratio). Eligible patients continued to take either gefitinib (250 mg per day) or placebo orally until disease progression intolerable toxicity withdrawal of consent serious non-compliance with protocol or dose delay or interruption >14 days. In this report there were 40 and 39 patients were deemed know EGFR mutation status in gefitinib group and placebo group respectively. Therefore there were 108 patients and 109 patients with unknown EGFR mutation received maintenance gefitinib and placebo treatment separately. The primary endpoint of the trial was progression-free survival and the survival analysis revealed that median PFS for patients with unknown EGFR mutation was 6.0 months in gefitinib group and 2.7 months in placebo group (HR 0.40 [95% CI 0.29“0.54]; p<0.0001). Median OS was not significantly different between the two groups (HR 0.84 [95% CI 0.62“1.14]; p?=?0.26; median OS 18.7 months vs 16.9 months). The incidence of adverse events in gefitinib group was more frequent than that in placebo group (80% vs. 53%). The cumulative probabilities of serious adverse events were 7% and 3% in the maintenance gefitinib and placebo groups respectively. The model outcomes were presented as costs LYGs and QALYs from the perspective of the Chinese health care system. Sensitivity analyses of input parameters with the high/low values and various distributions were conducted to assess the stability of the model at a value of recommended willingness-to-pay (WTP) threshold of $16349 (3—per-capita gross domestic product GDP) based on the cost-effectiveness guidelines of Word Health Organization (WHO) [25]. Model Structure The simplified model structure was shown in Figure 1 which comprised 3 mutually exclusive health states: PFS (entry state); progressed survival (PS state) and death. Patients move from one state to another during each Markov cycle length of 3 weeks (short enough to detect all clinically relevant events) until time horizon termination of 10-year (>95% patients died). Two-parametric Weibull survival and Log-logistic distribution analyses using R for Statistical Computing version 2.15.2 (R Foundation Wien Austria) were fitted to the PFS and OS curves respectively on the basis of survival data extracted from the published Kaplan-Meier curves [15] by using GetData Graph Digitizer software (version 2.24). Table 1 shows the Weibull and Log-logistic distribution parameters of model estimated. The estimated Weibull parameters are used to measure the time-dependency transition probabilities from PFS to PS state according to the following formula:where the ? defines the scale of the distribution the ? gives the shape the u is the Markov cycle and tu indicates that t is calculated as integer multiples of the cycle length of the model. The transition probabilities of death at current t due to the following formula:where the ? and ? are the theta and kappa from the estimated Log-logistic parameters indications of the u and the tu are the same as above. 10.1371/journal.pone.0088881.g001 Figure 1 Markov model of locally advanced/metastatic non-small-cell lung cancer. 10.1371/journal.pone.0088881.t001 Table 1 Weibull and Log-logistic parameters of model estimated for progression-free and overall survival curves respectively. Progression-free survivala Scale Mean (Range) Shape Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm 0.10443 (0.04509/0.16377) 1.29221 (0.99662/1.58780) 0.9729 ?0.995165 Gefitinib arm 0.10231 (0.06622/0.13840) 0.83852 (0.71474/0.96230) 0.9782 ?0.998386 Overall survival b Theta Mean (Range) Kappa Mean (Range) Adjusted R2 Correlation Coefficient Placebo arm ?6.54311 (?7.16112/?5.92510) 2.09373 (1.89823/2.28923) 0.9855 ?0.999986 Gefitinib arm ?5.04069 (?5.53622/?4.54516) 1.54139 (1.38359/1.69919) 0.9801 ?0.999852 a R output for Weibull regression fitted to progression-free curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. b R output for Log-logistic regression fitted to overall curves of locally advanced/metastatic non-small-cell lung cancer patients derived from the Phase III trial [15]. Medical Costs and Utilities Medical costs for each strategy (Table 2) from the perspective of Chinese health care system were based on outlining current practice [15] which reflected the effectiveness of maintenance gefitinib treatment in Chinese patients with locally advanced/metastatic NSCLC. Direct medical costs related to the practice were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Prices of gefitinib follow-up treatment cost in PS state and terminal-phase cost were obtained from our previous study in which we have calculated healthcare costs associated with the time- and health status-related treatment resources that advanced NSCLC may anticipate based on health expenditure data for 253 cases of advanced NSCLC registered at the Second Xiangya Hospital of Central South University in China between 2006 and 2010 [26]. The aggregate annual medical costs for patients in either PFS or PS state and monthly healthcare costs accumulated during the terminal 3 months were estimated and evaluated using 95% confidence intervals through bootstrapping with the R software (version 2.14.0; R Foundation Vienna Austria) [26]. According to Gefitinib Patients Assistance Program of the pharmaceutical producer in China NSCLC patients receive donations of gefitinib after six months treatment [23]. Therefore six months was applied to calculate the total cost of the maintenance drug. Routine follow-up treatment cost for patients without progression including computed tomography scan physician visit and other examinations and drugs was derived from the literature by Wu B et al [27]. Based on expert opinion only diarrhoea and other grade 3/4 adverse events were considered to estimate the costs of treatment-associated toxicity. Therefore the unit costs of diarrhoea treated and liver protected were multiplied by published rates of corresponding events to populate the model analysis (we assumed patients with grade 3/4 alanine aminotransferase aspartate aminotransferase or aminotransferases increased should receive treatment of liver protected). The unit costs of diarrhoea and liver protected were estimated according to local charges in China."
Lung_Cancer
"The amount of microvasculature measured by LVD and MVD was also heterogeneous in relation to the metastatic an examined. By Cox regression analysis center LVD and MVD periphery LVD and CAFs in distant metastasis were independently associated with patients' prognosis in addition to synchronous distant metastasis age and perineural invasion. Heterogeneity of microenvironment not only of cancer cells is suggested to contribute to tumor heterogeneity and biologic complexity thus it should be considered in managing CRC patients. In addition our results showed that PTEN expression was altered in CAFs of CRCs suggesting that CAFs might have altered gene expression and play an active role in cancer progression. Supporting Information Figure S1 The prognostic association of stromal characteristics as it relates to tumor location. The analysis was performed by using cut-off values obtained by maximal chi-squared methods. (TIF) Click here for additional data file. Figure S2 Representative PTEN antibody stainings of stromal cells and the prognostic association of PTEN expression. (A) Intact expression of PTEN in CAFs (—400) and (B) loss of PTEN expression in CAFs (—400). (C“F) Kaplan-Meier survival curves for the center (C) and periphery (D) of the primary tumor lymph node metastases (E) and distant metastases (F) according to CAF PTEN expression status. (TIF) Click here for additional data file. Table S1 Pearson's correlation coefficients among center periphery lymph node metastasis and distant metastasis. (DOCX) Click here for additional data file. Table S2 Correlation coefficients between CAFs and LVD or MVD. (DOCX) Click here for additional data file. Table S3 PTEN expression in CAFs and clinicopathologic factors. (DOCX) Click here for additional data file. References 1 JemalA SiegelR XuJ WardE (2010) Cancer statistics 2010. CA Cancer J Clin60: 277“30020610543 2 Edge SB American Joint Committee on C American Cancer S (2010) AJCC cancer staging handbook: from the AJCC cancer staging manual 7th ed. New York: Springer. 3 KnijnN TolJ PuntCJ (2010) Current issues in the targeted therapy of advanced colorectal cancer. Discov Med9: 328“33620423677 4 Van CutsemE (2007) Optimizing administration of epidermal growth factor receptor-targeted agents in the treatment of colorectal cancer. Clin Colorectal Cancer6 Suppl 2S60“6518021489 5 AlbaneseI ScibettaAG MigliavaccaM RussoA BazanV et al (2004) Heterogeneity within and between primary colorectal carcinomas and matched metastases as revealed by analysis of Ki-ras and p53 mutations. Biochem Biophys Res Commun325: 784“79115541358 6 ParkJH HanSW OhDY ImSA JeongSY et al (2011) Analysis of KRAS BRAF PTEN IGF1R EGFR intron 1 CA status in both primary tumors and paired metastases in determining benefit from cetuximab therapy in colon cancer. Cancer Chemother Pharmacol68: 1045“105521340604 7 BaldusSE SchaeferKL EngersR HartlebD StoeckleinNH et al (2010) Prevalence and heterogeneity of KRAS BRAF and PIK3CA mutations in primary colorectal adenocarcinomas and their corresponding metastases. Clin Cancer Res16: 790“79920103678 8 PagetS (1989) The distribution of secondary growths in cancer of the breast. 1889. Cancer Metastasis Rev8: 98“1012673568 9 CampbellI QiuW HavivI (2011) Genetic changes in tumour microenvironments. J Pathol223: 450“45821294119 10 LohelaM BryM TammelaT AlitaloK (2009) VEGFs and receptors involved in angiogenesis versus lymphangiogenesis. Curr Opin Cell Biol21: 154“16519230644 11 Muller-HubenthalB AzemarM LorenzenD HuberM FreudenbergMA et al (2009) Tumour Biology: tumour-associated inflammation versus antitumor immunity. Anticancer Res29: 4795“480520032438 12 RasanenK VaheriA (2010) Activation of fibroblasts in cancer stroma. Exp Cell Res316: 2713“272220451516 13 Des GuetzG UzzanB NicolasP CucheratM MorereJF et al (2006) Microvessel density and VEGF expression are prognostic factors in colorectal cancer. Meta-analysis of the literature. Br J Cancer94: 1823“183216773076 14 WeidnerN SempleJP WelchWR FolkmanJ (1991) Tumor angiogenesis and metastasis”correlation in invasive breast carcinoma. N Engl J Med324: 1“81701519 15 LindmarkG GerdinB SundbergC PahlmanL BergstromR et al (1996) Prognostic significance of the microvascular count in colorectal cancer. J Clin Oncol14: 461“4668636758 16 VermeulenPB VerhoevenD FierensH HubensG GoovaertsG et al (1995) Microvessel quantification in primary colorectal carcinoma: an immunohistochemical study. Br J Cancer71: 340“3437530985 17 GombosZ XuX ChuCS ZhangPJ AcsG (2005) Peritumoral lymphatic vessel density and vascular endothelial growth factor C expression in early-stage squamous cell carcinoma of the uterine cervix. Clin Cancer Res11: 8364“837116322297 18 KitadaiY KodamaM ChoS KurodaT OchiumiT et al (2005) Quantitative analysis of lymphangiogenic markers for predicting metastasis of human gastric carcinoma to lymph nodes. Int J Cancer115: 388“39215688374 19 JainRK FentonBT (2002) Intratumoral lymphatic vessels: a case of mistaken identity or malfunction?J Natl Cancer Inst94: 417“42111904313 20 TroskoJE RuchRJ (1998) Cell-cell communication in carcinogenesis. Front Biosci3: d208“2369458335 21 BarskySH GopalakrishnaR (1987) Increased invasion and spontaneous metastasis of BL6 melanoma with inhibition of the desmoplastic response in C57 BL/6 mice. Cancer Res47: 1663“16673815362 22 SkobeM FusenigNE (1998) Tumorigenic conversion of immortal human keratinocytes through stromal cell activation. Proc Natl Acad Sci U S A95: 1050“10559448283 23 OrimoA GuptaPB SgroiDC Arenzana-SeisdedosF DelaunayT et al (2005) Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion. Cell121: 335“34815882617 24 OlumiAF GrossfeldGD HaywardSW CarrollPR TlstyTD et al (1999) Carcinoma-associated fibroblasts direct tumor progression of initiated human prostatic epithelium. Cancer Res59: 5002“501110519415 25 TsujinoT SeshimoI YamamotoH NganCY EzumiK et al (2007) Stromal myofibroblasts predict disease recurrence for colorectal cancer. Clin Cancer Res13: 2082“209017404090 26 MatsumotoN YoshidaT YamashitaK NumataY OkayasuI (2003) Possible alternative carcinogenesis pathway featuring microsatellite instability in colorectal cancer stroma. Br J Cancer89: 707“71212915883 27 KuroseK GilleyK MatsumotoS WatsonPH ZhouXP et al (2002) Frequent somatic mutations in PTEN and TP53 are mutually exclusive in the stroma of breast carcinomas. Nat Genet32: 355“35712379854 28 TrimboliAJ Cantemir-StoneCZ LiF WallaceJA MerchantA et al (2009) Pten in stromal fibroblasts suppresses mammary epithelial tumours. Nature461: 1084“109119847259 29 MekenkampLJ KoopmanM TeerenstraS van KriekenJH MolL et al (2010) Clinicopathological features and outcome in advanced colorectal cancer patients with synchronous vs metachronous metastases. Br J Cancer103: 159“16420551951 30 Bosman FT (2010) WHO classification of tumours of the digestive system/edited by Fred T. Bosman et al; anization WH Cancer IAfRo editors. France: Lyon: IARC Press. 31 LeeHS KimWH (2006) Tissue array methods for high-throughput clinicopathologic research. Cancer Res Treat38: 1“619771251 32 SpadernaS SchmalhoferO HlubekF BerxG EgerA et al (2006) A transient EMT-linked loss of basement membranes indicates metastasis and poor survival in colorectal cancer. Gastroenterology131: 830“84016952552 33 RyuHS Park doJ KimHH KimWH LeeHS (2012) Combination of epithelial-mesenchymal transition and cancer stem cell-like phenotypes has independent prognostic value in gastric cancer. Hum Pathol43: 520“52822018628 34 JunttilaMR de SauvageFJ (2013) Influence of tumour micro-environment heterogeneity on therapeutic response. Nature501: 346“35424048067 35 KimMJ LeeHS KimJH KimYJ KwonJH et al (2012) Different metastatic pattern according to the KRAS mutational status and site-specific discordance of KRAS status in patients with colorectal cancer. BMC Cancer12: 34722876814 36 BarresiV Di GregorioC Regiani-BonettiL Ponz-De LeonM BarresiG et al (2010) Stage I colorectal carcinoma: VEGF immunohistochemical expression microvessel density and their correlation with clinical outcome. Virchows Arch457: 11“1920532559 37 MoreiraLR SchenkaAA Latuf-FilhoP PennaAL LimaCS et al (2011) Immunohistochemical analysis of vascular density and area in colorectal carcinoma using different markers and comparison with clinicopathologic prognostic factors. Tumour Biol32: 527“53421222066 38 ChenY YanJ WangZ YuS YuanZ et al (2013) A meta-analysis of the relationship between lymphatic microvessel density and the survival of patient with colorectal cancer. Lymphology46: 42“5123930440 39 DuffSE JeziorskaM KumarS HaboubiN SherlockD et al (2007) Lymphatic vessel density microvessel density and lymphangiogenic growth factor expression in colorectal cancer. Colorectal Dis9: 793“80017931169 40 PrallF GringmuthU NizzeH BartenM (2003) Microvessel densities and microvascular architecture in colorectal carcinomas and their liver metastases: "
Lung_Cancer
"ssed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life “ cancer; QLQ-LC13: Quality of life “ lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment “ care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale “ extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors™ contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe d™HuZes and the Dutch Cancer Society (Grant number KUN 2011“5077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease J Hosp Palliat Nurs 2009 11 2 82 90 10.1097/NJH.0b013e31819974f9 Pinquart M Duberstein PR Optimism pessimism and depressive symptoms in spouses of lung cancer patients Psychol Health 2005 20 5 565 578 10.1080/08870440412331337101 Kim Y Duberstein PR Sorensen S Larson MR Levels of depressive symptoms in spouses of people with lung cancer: effects of personality social support and caregiving burden Psychosomatics 2005 46 2 123 130 10.1176/appi.psy.46.2.123 15774950 Mosher CE Jaynes HA Hanna N Ostroff JS Distressed family caregivers of lung cancer patients: an examination of psychosocial and practical challenges Support Care Cancer 2013 21 2 431 437 10.1007/s00520-012-1532-6 22797839 Mosher CE Bakas T Champion VL Physical health mental health and life changes among family caregivers of patients with lung cancer Oncol Nurs Forum 2013 40 1 53 61 10.1188/13.ONF.53-61 23269770 Ostlund U Wennman-Larsen A Persson C Gustavsson P Wengstrom Y Mental health in significant others of patients dying from lung cancer Psychooncology 2010 19 1 29 37 10.1002/pon.1433 19253315 Wennman-Larsen A Persson C Ostlund U Wengstrom Y Gustavsson JP Development in quality of relationship between the significant other and the lung cancer patient as perceived by the significant other Eur J Oncol Nurs 2008 12 5 430 435 10.1016/j.ejon.2008.07.004 18845476 Siminoff LA Wilson-Genderson M Baker S Jr Depressive symptoms in lung cancer patients and their family caregivers and the influence of family environment Psychooncology 2010 19 12 1285 1293 10.1002/pon.1696 20119935 Manne S Badr H Intimacy processes and psychological distress among couples coping with head and neck or lung cancers Psychooncology 2010 19 9 941 954 10.1002/pon.1645 19885852 Badr H Taylor CLC Effects of relationship maintenance on psychological distress and dyadic adjustment among couples coping with lung cancer Health Psychol 2008 27 5 616 627 18823188 Buccheri G Depressive reactions to lung cancer are common and often followed by a poor outcome Eur Respir J 1998 11 1 173 178 10.1183/09031936.98.11010173 9543289 Walker J Sawhney A Hansen CH Symeonides S Martin P Murray G Sharpe M Treatment of depression in people with lung cancer: a systematic review Lung Cancer 2013 79 1 46 53 10.1016/j.lungcan.2012.09.014 23102652 Follwell M Burman D Le LW Wakimoto K Seccareccia D Bryson J Rodin G Zimmermann C Phase II study of an outpatient palliative care intervention in patients with metastatic cancer J Clin Oncol 2009 27 2 206 213 10.1200/JCO.2008.17.7568 19064979 Jordhoy MS Fayers P Loge JH Ahlner-Elmqvist M Kaasa S Quality of life in palliative cancer care: results from a cluster randomized trial J Clin Oncol 2001 19 18 3884 3894 11559726 Gustafson DH DuBenske LL Namkoong K Hawkins R Chih M-Y Atwood AK Johnson R Bhattacharya A Carmack CL Traynor AM An eHealth system supporting palliative care for patients with non“small cell lung cancer Cancer 2013 119 9 1744 1751 10.1002/cncr.27939 23355273 Greer JA Pirl WF Jackson VA Muzikansky A Lennes IT Heist RS Gallagher ER Temel JS Effect of early palliative care on chemotherapy use and end-of-life care in patients with metastatic non-small-cell lung cancer J Clin Oncol 2012 30 4 394 400 10.1200/JCO.2011.35.7996 22203758 Kabat-zinn J Full catastrophe living: using the wisdom of your body and mind to face stress pain and illness 1990 New York: Delacourt Segal ZV Williams JMG Teasdale JD Mindfulness-Based Cognitive Therapy for depression: a new approach to preventing relapse 2002 New York: Guilford Press Piet J Wurtzen H Zachariae R The effect of Mindfulness-Based Therapy on symptomps of anxiety and depression in adult cancer patients and survivors: a systematic review and meta-analysis J Consult Clin Psychol 2012 80 6 1007 1020 22563637 Birnie K Garland SN Carlson LE Psychological benefits for cancer patients and their partners participating in Mindfulness-Based Stress Reduction (MBSR) Psychooncology 2010 19 9 1004 1009 10.1002/pon.1651 19918956 Hagedoorn M Sanderman R Bolks HN Tuinstra J Coyne JC Distress in couples coping with cancer: a meta-analysis and critical review of role and gender effects Psychol Bull 2008 134 1 1 30 18193993 Folstein MF Folstein SE McHugh PR Mini-mental state: practical method for grading cognitive state of patiens for clinician J Psychiatr Res 1975 12 3 189 198 10.1016/0022-3956(75)90026-6 1202204 Roth AJ Kornblith AB Batel-Copel L Peabody E Scher HI Holland JC Rapid screening for psychologic distress in men with prostate carcinoma Cancer 1998 82 10 1904 1908 10.1002/(SICI)1097-0142(19980515)82:10<1904::AID-CNCR13>3.0.CO;2-X 9587123 Tuinman MA Gazendam-Donofrio SM Hoekstra-Weebers JE Screening and referral for psychosocial distress in oncologic practice Cancer 2008 113 4 870 878 10.1002/cncr.23622 18618581 Kübler-Ross E On death and dying 1969 New York: Macmillan MBSR teacher certification pathway: complete checklist http://www.umassmed.edu/uploadedFiles/cfm2/training/MBSR%20Teacher%20Certification%20Pathway%20Complete%20Checklist[1].pdf Crane RS Kuyken W Williams JMG Hastings RP Cooper L Fennell MJV Competence in teaching mindfulness-based courses: concepts development and assessment Mindfulness 2012 3 76 84 10.1007/s12671-011-0073-2 23293683 Zigmond AS Snaith RP The H"
Lung_Cancer
"The proband™s father (II-5) and sister (III-5) were both unaffected and peripheral blood samples were obtained from these individuals. Some family members who were not considered as critical for this study were excluded from the pedigree chart to preserve confidentiality. Whole-exome sequencing was performed for individuals II-4 II-5 III-4 and III-5. After obtaining permission from the Institutional Review Board at Okayama University Hospital and informed consent from the patients and other family members we performed a whole-exome sequencing study. Tumor DNA samples from II-4 tumor and peripheral blood DNA samples from III-4 and peripheral blood DNA samples from two unaffected family members (II-5 and III-5) were used for the analysis. The candidate germline alterations were restricted to 29 variants by comparing the whole-exome sequencing results between the patients and the unaffected family members. Among them we focused on a point mutation in the human epidermal growth factor receptor 2 (HER2/neu) gene (NM_004448 G660D GGC to GAC) which was located in exon 17 encoding the transmembrane domain of HER2 (Supplementary Tables 1“3). This alteration was confirmed by direct sequencing (A). We also confirmed that there was no copy number gain of HER2 in the examined tumors based on the degree of read-depth in the whole-exome sequencing results. Of note no mutations in genes known to cause lung cancers were detected for tumors from III-4 and II-4. . DNA and amino acid sequences in the transmembrane domain of HER2. A) Direct Sanger sequencing of the proband (III-4) her affected mother (II-4) and her unaffected sister (III-5). The results indicated that G660D was a germline mutation. B) Direct sequencing of a sporadic lung adenocarcinoma with a HER2 V659E mutation. V659E was found to be of somatic origin based on the sequencing results of the peritumoral lung tissue from the same specimen. All the sequence variants were confirmed by independent polymerase chain reaction amplifications and were sequenced in both directions. C) Interspecies conservation of the transmembrane domain of HER2 (UCSC Genome Browser http://genome.ucsc.edu accessed September 12 2013). The yellow highlight indicates the N-terminal glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of a GG4-like motif of human HER2. Codons 659 and 660 in human HER2 are highly conserved among the listed vertebrate species (shown in red). X. tropicalis = Xenopus tropicalis. We considered that somatic mutations in the HER2 transmembrane domain might act as driver mutations in lung cancer. Hence we sequenced exon 17 of the HER2 in the tumor samples of 315 sporadic non“small cell lung cancer patients of which 253 were adenocarcinomas. Although the HER2 G660D mutation was not detected a novel nonsynonymous mutation V659E (GTT to GAA) next to codon 660 was identified in one of these patients. This patient was histologically diagnosed as nonmucinous adenocarcinoma in situ and the patient had neither smoking history nor apparent family history of lung cancer. This V659E mutation was certainly a somatic mutation because it was not identified in the peritumoral lung tissue of the same patient (B). The alignment of HER2 amino acid sequences showed high conservation of valine 659 and glycine 660 among vertebrates (C). HER2 somatic mutations have been reported in 2% to 4% of lung adenocarcinomas (5“7). However all reported mutations were restricted to its tyrosine kinase domain (67). According to the cBioPortal for Cancer Genomics (http://www.cbioportal./public-portal/ accessed September 12 2013) the same genetic mutation in the HER2 has not been reported in any type of cancer. Interestingly a previous study reported that a mutation in the transmembrane domain (V664E) of the rat neu gene which corresponds to V659E in its human homolog HER2 induced oncogenic transformation (8). In addition in vivo experiments showed that the HER2 V659E mutation contributed to the stability of HER2 dimers resulting in the dysregulated receptor activation and subsequent cell transformation (910). Furthermore the novel mutations were located within the glycine zipper motif Thr652-X3-Ser656-X3-Gly660 a tandem variant of the GG4-like motif at the N-terminal portion of the transmembrane domain which was critically related to the dimerization of HER2 (C) (911). Accordingly we performed a functional analysis of the mutant HER2 proteins. We found that the degradation of HER2 protein after the administration of cycloheximide was slower in G660D and V659E mutants as compared with wild-type (Supplementary A) indicating the higher stability of the mutant proteins than wild-type protein. In addition results of a phospho-mitogen“activated protein kinase array indicated the activation of Akt and p38? (data not shown). Indeed Akt is known to be activated by HER2 by phosphatidylinositol 3-kinase and leads to increased cell growth and survival (1213). Also the activation of p38 was shown to contribute to the viability of lung adenocarcinoma cells derived from never or light smokers (1415). A western blot analysis for Akt and p38 successfully confirmed the upregulation of both phospho-Akt and phospho-p38 expression in the mutant HER2 transfectants (Supplementary B). Because the G660D alteration in HER2 might have been the cause of the lung cancer in the pedigree studied we investigated whether familial aggregation of cancer in other ans could be seen in this pedigree. We found that II-1 and II-6 developed renal and gastric cancers respectively; however both of them also had lung cancer. The reason why other types of clinically apparent malignances were rarely found in this pedigree is unclear. The G660D germline mutation may be tolerated in ans other than the lung. This study had some limitations. First the carcinogenic potential of the HER2 mutation at the transmembrane domain should be confirmed in other models such as transgenic mice. Second the rarity of these mutations in sporadic lung cancers may be the limitation for generalizability to other cases even if targeting therapies for similar types of HER2 mutation were developed. In we identified a novel germline mutation in the transmembrane domain of the HER2 in familial lung adenocarcinomas. Somatic mutation in the HER2 transmembrane domain may be a possible cause of sporadic lung adenocarcinomas. Funding This study was supported by a Grant-in Aid for Scientific Research from the Ministry of Education Culture Sports Science and Technology of Japan (25293302 to ST). H. Yamamoto J. Soh S. Miyoshi and S. Toyooka conceived the project. K. Higasa M. Sakaguchi K. Shien and K. Ichimura performed the experiments. H. Yamamoto J. Soh M. Furukawa S. Hashida N. Takigawa K. Kiura K. Tsukuda and S. Toyooka collected the samples and assisted with the experiments. H. Yamamoto K. Higasa K. Shien and K. Matsuo analyzed the data. H. Yamamoto K. Higasa M. Sakaguchi F. Matsuda and S. Toyooka prepared the manuscript with input from the other authors. S. Miyoshi F. Matsuda and S. Toyooka supervised the project. The authors declared no conflicts of interest. References 1. BellDWGoreIOkimotoRA Inherited susceptibility to lung cancer may be associated with the T790M drug resistance mutation in EGFR. Nat Genet. 2005;37(12):1315“131616258541 2. IkedaKNomoriHMoriTSasakiJKobayashiT Novel germline mutation: EGFR V843I in patient with multiple lung adenocarcinomas and family members with lung cancer. Ann Thorac Surg. 2008;85(4):1430“143218355544 3. OhtsukaKOhnishiHKuraiD Familial lung adenocarcinoma caused by the EGFR V843I germ-line mutation. J Clin Oncol. 2011;29(8):e191“e19221172876 4. van NoeselJvan der VenWHvan OsTA Activating germline R776H mutation in the epidermal growth factor receptor associated with lung cancer with squamous differentiation. J Clin Oncol. 2013;31(10):e161“e16423358982 5. PaoWGirardN New driver mutations in non-small-cell lung cancer. Lancet Oncol. 2011;12(2):175“18021277552 6. ShigematsuHTakahashiTNomuraM Somatic mutations of the HER2 kinase domain in lung adenocarcinomas. Cancer Res. 2005;65(5):1642“164615753357 7. StephensPHunterCBignellG Lung cancer: intragenic ERBB2 kinase mutations in tumours. Nature. 2004;431(7008):525“52615457249 8. BargmannCIHungMCWeinbergRA Multiple independent activations of the neu oncogene by a point mutation altering the transmembrane domain of p185. Cell. 1986;45(5):649“6572871941 9. BocharovEVMineevKSVolynskyPE Spatial structure of the dimeric transmembrane domain of the growth factor receptor ErbB2 presumably corresponding to the receptor active state. J Biol Chem. 2008;283(11):6950“695618178548 10. FleishmanSJSchlessingerJBen-TalN A putative molecular-activation switch in the transmembrane domain of erbB2. Proc Natl Acad Sci U S A. 2002;99(25):15937“1594012461170 11. MineevKSBocharovEVPustovalovaYEBocharovaOVChupinVVArsenievAS Spatial structure of the transmembrane domain heterodimer of ErbB1 and ErbB2 receptor tyrosine kinases. J Mol Biol. 2010;400(2):231“24320471394 12. BaselgaJSwainSM Novel anticancer targets: revisiting ERBB2 and discovering ERBB3. Nat Rev Cancer. 2009;9(7):463“47519536107 13. EngelmanJA Targeting PI3K signalling in cancer: opportunities challenges and limitations. Nat Rev Cancer. 2009;9(8):550“56219629070 14. MountziosGPlanchardDBesseB Mitogen-activated protein kinase activation in lung adenocarcinoma: a comparative study between ever smokers and never smokers. Clin Cancer Res. 2008;14(13):4096“410218593986 15. PlanchardDCamara-ClayetteVDorvaultNSoriaJCFouretP p38 Mitogen-activated protein kinase signaling ERCC1 expression and viability of lung cancer cells from never or light smoker patients. Cancer. 2012;118(20):5015“502522415779 Oncotarget Oncotarget ImpactJ Oncotarget 1949-2553 Impact Journals LLC 24519909 3996653 Research Paper Sp1-mediated microRNA-182 expression regulates lung cancer progression Yang Wen-Bin 1 Chen Ping-Hsin 2 Hsu Tsung-I 3 Fu Tzu-Fun 4 Su Wu-Chou 5 Liaw Hungjiun 6 Chang Wen-Chang 7 Hung Jan-Jong 1 2 3 7 1 Institute of Bioinformatics and Biosignal Transduction College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 2 Department of Pharmacology College of Medicine National Cheng Kung University Tainan 701 Taiwan 3 Center for Infectious Disease and Signal Transduction Research National Cheng Kung University Tainan 701 Taiwan 4 Department of Medical Laboratory Science and Biotechnology College of Medicine National Cheng Kung University Tainan 701 Taiwan 5 Department of Internal Medicine College of Medicine and Hospital National Cheng Kung University Tainan 701 Taiwan 6 Department of Life Sciences College of Bioscience in Biotechnology National Cheng Kung University Tainan 701 Taiwan 7 Graduate Institute of Medical Sciences College of Medicine and Center for Neurotrauma and Neuroregeneration Taipei Medical University Taipei 110 Taiwan Correspondence to:petehung [email protected] 2 2014 25 1 2014 5 3 740 753 18 11 2013 24 11 2014 Copyright: © 2014 Yang et al. 2014 This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Our recent study indicated that overexpression of Sp1 enhances the proliferation of lung cancer cells while represses metastasis. In this study we found that the transcriptional activity of FOXO3 was increased but its protein levels decreased following Sp1 expression. Sp1 increased expression of miR-182 which was then recruited to the 3'-untranslated region of FOXO3 mRNA to silence its translational activity. Knockdown of miR-182 inhibited lung cancer cells growth but enhanced the invasive and migratory abilities of these cells through increased N-cadherin expression. Repression of FOXO3 expression in the miR-182 knockdown cells partially reversed this effect suggesting that miR-182 promotes cancer cell growth and inhibits cancer metastatic activity by regulating the expression of FOXO3. The expression of several cancer metastasis-related genes such as ADAM9 CDH9 and CD44 was increased following miR-182 knockdown. In in the early stages of lung cancer progression Sp1 stimulates miR-182 expression which in turn decreases FOXO3 expression. This stimulates proliferation and tumor growth. In the late stages Sp1 and miR-182 decline thus increasing FOXO3 expression which leads to lung metastasis. Sp1 miR-182 FOXO3 Lung cancer INTRODUCTION Post-transcriptional regulation plays an important role in diverse cellular processes such as development neurogenesis and cancer progression [1-3]. MicroRNAs (miRNAs) have emerged as important post-transcriptional regulators that inhibit mRNA translation or induce mRNA cleavage by base pairing with a seed region in the 3'-untranslated region (3'-UTR) of target genes [4 5]. Recent studies have shown that dysregulation of miRNAs contributes to the initiation progression metastasis and drug resistance of cancer [6 7]. For example miR-200c targets Kras to regulate Kras expression during tumorigenesis [8]. Furthermore several upregulated and downregulated miRNAs have been identified in lung cancer the most frequently diagnosed cancer and the most common cause of cancer-related death worldwide [9-11]. Identification of early-detection biomarkers and precise diagnosis are necessary if lung cancer patients are to receive efficacious therapeutic treatment quickly. Several factors such as USP17 have been identified as potential biomarkers for lung cancer [12 13]. Circulating miRNAs could also serve as useful clinical biomarkers for the screening of high-risk populations and the detection solid tumors in the early stages of cancer progression [14 15]. miRNAs offer new targets for cancer therapy [16 17]. Therefore a detailed understanding of the mechanisms underlying miRNA production and function is important. Identification of miRNA target genes and the use of gene set enrichment analysis have clarified the function role of miRNAs. However the molecular mechanisms that regulate of miRNA biogenesis are still largely unknown. Recent studies have shown that transcription factors (TFs) regulate not only the expression of protein-encoding genes but also miRNA biogenesis through RNA polymerase II-dependent transcription [18]. Several TFs including p53 c-myc and HIF1? that directly recognize miRNA promoters and regulate miRNA transcription have been reported [19-21]. Specificity protein 1 (Sp1) which belongs to the specificity protein/ Krüppel-like family was the first TF identified in mammalian cells. Sp1 contains three Cys2His2-type zinc finger DNA binding motifs that recognize GC-rich promoter sequences [22]. Sp1 regulates thousands of coding genes such as those encoding cyclin A2 p21cip1/waf1 E-cadherin and Sp1 itself. These genes are involved in a variety of physiological processes including cell cycle progression and cell migration [23-26]. Sp1 also regulates the expression of noncoding genes. Sp1 forms a complex with NF-?B to downregulate miR-29b expression through the recruitment of histone deacetylase (HDAC) 1 and HDAC3 in leukemia and thereby contributes to the growth of leukemia cells [27]. Sp1 also forms a complex with HDAC4 to downregulate miR-200a expression in hepatocellular carcinoma and contributes to cell proliferation and migration [28]. In addition Sp1 is an activator of miR-34c miR-132 and miR-365 expression [29-31]. However no studies have assessed whether Sp1 regulates the expression of miRNAs involved in lung tumorigenesis. Because the accumulation of Sp1 is required for lung tumor growth further investigation of Sp1-mediated miRNA regulation is needed. In this study we showed that Sp1 suppressed FOXO3 expression via post-transcriptional regulation. To elucidate whether miRNAs were involved in this process we used a systematic screening approach to identify Sp1-regulated miRNAs. We identified a novel Sp1-regulated miRNA miR-182 in lung cancer cells and demonstrated that Sp1 downregulated FOXO3 expression by upregulating miR-182 expression. Our results show that miR-182 functions as an oncomiR to enhance cancer cell proliferation and acts as a tumor suppressor to inhibit cancer metastasis. RESULTS Sp1 regulates miR-182 expression Our previous studies demonstrated that Sp1 is involved in KrasG12D-induced lung tumorigenesis [23 32]. Using cDNA microarray analysis we found that Sp1 increased oncogene expression and decreased tumor suppressor gene expression. In the present study we initially used software to analyze the promoters of all identified miRNAs. According to the miRBase database the human genome contains 1600 miRNA genes. We investigated whether Sp1 participates in the regulation of intergenic miRNAs. First we screened the upstream (-1 kb) flanking sequences of intergenic miRNAs. Using the TFSEARCH program we identified 205 intergenic miRNAs that contained potential binding sites for Sp1. Because Sp1 is upregulated in lung cancer and the expression of its target genes is altered we next examined the expression of these miRNAs in lung cancer. According to previous studies the expression patterns of 22 miRNAs differed significantly in lung cancer tissue and normal lung tissue (Supplementary Table S1). In most of these studies miR-182 which contains two putative Sp1 binding sites within its upstream region was upregulated in lung cancer. When we examined miR-182 expression we found that miR-182 was decreased in Sp1-knockdown cells but increased in IMR-90 cells that overexpressed GFP-Sp1 (Figure 1A and 1B) suggesting that Sp1 positively regulates miR-182 expression."
Lung_Cancer
" Based on the above analysis we speculated that there may be some interaction between p120ctn isoform 3A and snail which plays a role in suppressing EMT in lung cancer cells expressing cytoplasmic E-cadherin but this hypothesis requires further study. Importantly we also found that knockdown of p120ctn-1A in SPC cells with cytoplasmic E-cadherin resulted in decreased twist expression (B). Meanwhile transfection of LK2 cells which also showed cytoplasmic localization of E-cadherin with the p120ctn isoform 1A plasmid resulted in increased twist expression (B). However no changes in twist expression were observed in the rest of the experiments (A 4A). As a transcription factor and master gene regulator of EMT [39] [40] twist can downregulate E-cadherin expression [41] and upregulate N-cadherin and other mesenchymal biomarkers [42]. Increased twist expression in LK2 cells transfected with the p120ctn isoform 1A plasmid indicated that transcriptional activation took place and further suggested that the p120ctn isoform 1A may have translocated into the nucleus upon binding of E-cad/CTF2 in the cytoplasm consequently activating the Wnt signaling pathway to promote EMT. Decreased twist expression in SPC cells transfected with p120ctn-1A-siRNA indicated that transcriptional activity was downregulated and suggested that ablation of p120ctn isoform 1A resulted in the inhibtion of EMT by removing the stimulatory effect of the Wnt signaling activity by p120ctn isoform 1A. In the H460 and H1299 cells with E-cadherin localized in the membrane the unchanged twist expression confirmed that p120ctn isoforms 1A and 3A could bind to E-cadherin and maintain effective cell-cell adhesion in order to suppress EMT instead of affecting the Wnt/twist pathway. Intriguingly overexpression of p120ctn isoform 3A did not change twist expression in LK2 cells expressing cytoplasmic E-cadherin indicating that p120ctn isoform 3A did not activate transcription. Therefore we firmly believe in the above hypothesis that p120ctn isoform 3A may interact with snail in some manner to influence E-cadherin expression and suppress EMT in lung cancer cells carrying cytoplasmic E-cadherin. Previous studies have observed that p120ctn-1A restored the cytoplasmic expression of E-cadherin whereas p120ctn-3A could not [20] which seems to be contradictory with the results of this study. However the method in previous studies of knocking down p120ctn expression and then transfecting p120ctn isoforms 1A and 3A plasmids into cells is different from that in the current study in which cells were only transiently transfected with p120ctn isoforms 1A and 3A plasmids. Therefore the different research methods may have led to different effects on E-cadherin. We also noted that in previous studies decreased and almost undetectable levels of E-cadherin by ablation of p120ctn resulted in the failure of exogenous p120ctn-1A to translocate into the nucleus to activate the Wnt/b-catenin pathway and decrease E-cadherin expression due to the deletion of the binding partner E-cad/CTF2. However the LK2 and H1299 cell lines used in these experiments expressed E-cadherin in the present study. E-cadherin binds primarily to unphosphorylated p120ctn isoform 3A whereas tyrosine-phosphorylated p120ctn isoform 1A interacts exclusively with N-cadherin [23]. In the previous studies exogenous p120ctn isoform 3A was prevented from binding and stabilizing E-cadherin after its ablation while in the present study the exogenous p120ctn isoform 3A could stabilize E-cadherin expression directly on the membrane or indirectly by increasing its cytoplasmic expression via regulation of snail expression. Of course all of these findings will need to be further investigated. In we for the first time found that p120ctn isoforms 1A and 3A to have different functions in EMT of lung cancer cells with E-cadherin expressed in different subcellular locations. When E-cadherin was localized on the cell membrane p120ctn isoforms 1A and 3A both could inhibit EMT and reduce the cell invasiveness phenotype. When E-cadherin was localized in the cytoplasm p120ctn isoform 1A promoted EMT and enhanced cell invasion while p120ctn isoform 3A inhibited EMT and reduced cell invasiveness. We thank Dr. Albert B. Reynolds (Department of Cancer Biology Vanderbilt University School of Medicine TN USA) for kindly providing p120ctn isoforms 1A and 3A cDNA plasmids. References 1 ThieryJP SleemanJP (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol7: 131“14216493418 2 ShookD KellerR (2003) Mechanisms mechanics and function of epithelial-mesenchymal transitions in early development. Mech Dev120: 1351“138314623443 3 StockingerA EgerA WolfJ BeugH FoisnerR (2001) E-cadherin regulates cell growth by modulating proliferation-dependent beta-catenin transcriptional activity. J Cell Biol154: 1185“119611564756 4 ValdesF AlvarezAM LocascioA VegaS HerreraB et al (2002) The epithelial mesenchymal transition confers resistance to the apoptotic effects of transforming growth factor Beta in fetal rat hepatocytes. Mol Cancer Res1: 68“7812496370 5 HuberMA KrautN BeugH (2005) Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol17: 548“55816098727 6 WheelockMJ ShintaniY MaedaM FukumotoY JohnsonKR (2008) Cadherin switching. J Cell Sci121: 727“73518322269 7 PeinadoH OlmedaD CanoA (2007) Snail Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype?Nat Rev Cancer7: 415“42817508028 8 PeinadoH PortilloF CanoA (2004) Transcriptional regulation of cadherins during development and carcinogenesis. Int J Dev Biol48: 365“37515349812 9 VandewalleC ComijnJ De CraeneB VermassenP BruyneelE et al (2005) SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res33: 6566“657816314317 10 WarzechaCC SatoTK NabetB HogeneschJB CarstensRP (2009) ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell33: 591“60119285943 11 SlorachEM ChouJ WerbZ (2011) Zeppo1 is a novel metastasis promoter that represses E-cadherin expression and regulates p120-catenin isoform expression and localization. Genes Dev25: 471“48421317240 12 IshiyamaN LeeSH LiuS LiGY SmithMJ et al (2010) Dynamic and static interactions between p120 catenin and E-cadherin regulate the stability of cell-cell adhesion. Cell141: 117“12820371349 13 WangEH LiuY XuHT DaiSD LiuN et al (2006) Abnormal expression and clinicopathologic significance of p120-catenin in lung cancer. Histol Histopathol21: 841“84716691536 14 BellovinDI BatesRC MuzikanskyA RimmDL MercurioAM (2005) Altered localization of p120 catenin during epithelial to mesenchymal transition of colon carcinoma is prognostic for aggressive disease. Cancer Res65: 10938“1094516322241 15 JiangG WangY DaiS LiuY StoeckerM et al (2012) P120-catenin isoforms 1 and 3 regulate proliferation and cell cycle of lung cancer cells via beta-catenin and Kaiso respectively. PLoS One7: e3030322276175 16 LiuY DongQZ ZhaoY DongXJ MiaoY et al (2009) P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells. Exp Cell Res315: 890“89819150613 17 AhoS LevansuoL MontonenO KariC RodeckU et al (2002) Specific sequences in p120ctn determine subcellular distribution of its multiple isoforms involved in cellular adhesion of normal and malignant epithelial cells. J Cell Sci115: 1391“140211896187 18 SotoE YanagisawaM MarlowLA CoplandJA PerezEA et al (2008) p120 catenin induces opposing effects on tumor cell growth depending on E-cadherin expression. J Cell Biol183: 737“74919015320 19 YanagisawaM AnastasiadisPZ (2006) p120 catenin is essential for mesenchymal cadherin-mediated regulation of cell motility and invasiveness. J Cell Biol174: 1087“109616982802 20 YuJ MiaoY XuH LiuY JiangG et al (2012) N-terminal 1-54 amino acid sequence and Armadillo repeat domain are indispensable for P120-catenin isoform 1A in regulating E-cadherin. PLoS One7: e3700822615871 21 Travis WD Brambilla E Muller-Hermelink HK (2004) Pathology and Genetics: Tumours of the Lung Pleura Thymus and Heart. Lyon: IARC. 22 GoldstrawP (2011) Updated staging system for lung cancer. Surg Oncol Clin N Am20: 655“66621986263 23 SeidelB BraegS AdlerG WedlichD MenkeA (2004) E- and N-cadherin differ with respect to their associated p120ctn isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene23: 5532“554215107817 24 KeirsebilckA BonneS StaesK van HengelJ NolletF et al (1998) Molecular cloning of the human p120ctn catenin gene (CTNND1): expression of multiple alternatively spliced isoforms. Genomics50: 129“1469653641 25 AhoS RothenbergerK UittoJ (1999) Human p120ctn catenin: tissue-specific expression of isoforms and molecular interactions with BP180/type XVII collagen. J Cell Biochem73: 390“39910321838 26 ReynoldsAB CarnahanRH (2004) Regulation of cadherin stability and turnover by p120ctn: implications in disease and cancer. Semin Cell Dev Biol15: 657“66315561585 27 CheungLW LeungPC WongAS (2010) Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene29: 2427“244020118984 28 ThoresonMA AnastasiadisPZ DanielJM IretonRC WheelockMJ et al (2000) Selective uncoupling of p120(ctn) from E-cadherin disrupts strong adhesion. J Cell Biol148: 189“20210629228 29 BukholmIK NeslandJM Borresen-DaleAL (2000) Re-expression of E-cadherin alpha-catenin and beta-catenin but not of gamma-catenin in metastatic tissue from breast cancer patients [seecomments]. J Pathol190: 15“1910640987 30 PeiferM YapAS (2003) Traffic control: p120-catenin acts as a gatekeeper to control the fate of classical cadherins in mammalian cells. J Cell Biol163: 437“44014610049 31 DavisMA IretonRC ReynoldsAB (2003) A core function for p120-catenin in cadherin turnover. J Cell Biol163: 525“53414610055 32 MirandaKC JosephSR YapAS TeasdaleRD StowJL (2003) Contextual binding of p120ctn to E-cadherin at the basolateral plasma membrane in polarized epithelia. J Biol Chem278: 43480“4348812923199 33 teinhusenU WeiskeJ BadockV TauberR BommertK et al (2001) Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol Chem276: 4972“498011076937 34 SpringCM KellyKF O'KellyI GrahamM CrawfordHC et al (2005) The catenin p120ctn inhibits Kaiso-mediated transcriptional repression of the beta-catenin/TCF target gene matrilysin. Exp Cell Res305: 253“26515817151 35 FerberEC KajitaM WadlowA TobianskyL NiessenC et al (2008) A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem283: 12691“1270018356166 36 DiMeoTA AndersonK PhadkeP FanC PerouCM et al (2009) A novel lung metastasis signature links Wnt signaling with cancer cell self-renewal and epithelial-mesenchymal transition in basal-like breast cancer. Cancer Res69: 5364“537319549913 37 MiaoY LiuN ZhangY LiuY YuJH et al (2010) p120ctn isoform 1 expression significantly correlates with abnormal expression of E-cadherin and poor survival of lung cancer patients. Med Oncol27: 880“88619763914 38 YangJ ManiSA DonaherJL RamaswamyS ItzyksonRA et al (2004) Twist a master regulator of morphogenesis plays an essential role in tumor metastasis. Cell117: 927“93915210113 39 BerxG RaspeE ChristoforiG ThieryJP SleemanJP (2007) Pre-EMTing metastasis? Recapitulation of morphogenetic processes in cancer. Clin Exp Metastasis24: 587“59717978854 40 VernonAE LaBonneC (2004) Tumor metastasis: a new twist on epithelial-mesenchymal transitions. Curr Biol14: R719“72115341765 41 VesunaF van DiestP ChenJH RamanV (2008) Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem Biophys Res Commun367: 235“24118062917 42 AlexanderNR TranNL RekapallyH SummersCE GlackinC et al (2006) N-cadherin gene expression in prostate carcinoma is modulated by integrin-dependent nuclear translocation of Twist1. Cancer Res66: 3365“336916585154 43 AndreolasC KalogeropoulouM VoulgariA PintzasA (2008) Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells. Int J Cancer122: 1745“175618098284 44 KnirshR Ben-DrorI SpanglerB MatthewsGD KuphalS et al (2009) Loss of E-cadherin-mediated cell-cell contacts activates a novel mechanism for up-regulation of the proto-oncogene c-Jun. Mol Biol Cell20: 2121“212919193763 Stat Med Stat Med sim Statistics in Medicine 0277-6715 1097-0258 BlackWell Publishing Ltd Oxford UK 24027094 4098103 10.1002/sim.5963 Research Articles Modeling exposure“lag“response associations with distributed lag non-linear models Gasparrini Antonio *   Medical Statistics Department London School of Hygiene and Tropical Medicine London U.K. *Correspondence to: Antonio Gasparrini London School of Hygiene and Tropical Medicine Keppel Street London WC1E 7HT U.K.  E-mail: [email protected] 28 2 2014 12 9 2013 33 5 881 899 29 3 2012 10 8 2013 © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. 2013 This is an open access article under the terms of the Creative Commons Attribution License which permits use distribution and reproduction in any medium provided the original work is properly cited. In biomedical research a health effect is frequently associated with protracted exposures of varying intensity sustained in the past. The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposure“lag“response association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposure“lag“response delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposure“response relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposure“lag“response associations. In particular this issue has been debated in cancer epidemiology 7“9. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 14“16 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposure“response relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposure“lag“response associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposure“response relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposure“response relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lag“response function models the lag“response curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ¦ L. A statistical model for (1) can be defined by expressing the lag“response function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) × v? matrix C is obtained from the transformation of the lag vector ? = [?0 ¦ ? ¦ L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lag“basis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)“(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lag“basis functions for representing s(xt) are derived through different lag“response functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1."
Lung_Cancer
"However uncertainty exists in proton-based treatment plans including range uncertainties large sensitivity to position uncertainty and calculation of dose deposition in heterogeneous areas. This study investigated the feasibility of proton transmission beams i.e. without the Bragg peak to treat lung tumors with stereotactic ablative radiotherapy. We compared three representative treatment plans using proton transmission beams versus conformal static-gantry photon beams. It was found that proton treatment plans using transmission beams passing through the patient were feasible and demonstrated lower dose to normal structures and markedly reduced treatment times than photon plans. This is the first study to demonstrate the feasibility of proton-based stereotactic ablative radiotherapy planning for lung tumors using proton transmission beams alone. Further research using this novel approach for proton-based planning is warranted. The authors have no support or funding to report. Introduction Stereotactic ablative radiotherapy (SABR) plays an essential role in the treatment of patients with medically inoperable early stage lung cancer and oligometastasis. The use of protons for lung SABR is emerging as an appealing treatment option because of its potential to deliver higher doses of conformal radiotherapy and spare normal tissues better than traditional photons [1] [2] [3] [4]. This can be achieved because of the natural characteristics of proton beams that deposit its dose at depth with no exit dose referred to as a Bragg peak. However conventional dosimetric models fail to accurately model how protons scatter and deposit dose in highly heterogeneous areas which leads to uncertainties in proton treatment plans [5]. In addition the uncertainties in the stopping power of the various tissues in the body and the interplay effect between spot scanning proton therapy and the target motion leads to large uncertainties in the treatment of lung tumors [5] [6]. In this study we report on the feasibility of proton transmission-beam SABR (PT-SABR) for lung tumors which uses the transmission portion of a spot scanning proton beam i.e. without the Bragg peak. This technique eliminates the major uncertainties of proton therapy mentioned above by having the proton beams pass through the patient. In addition the use of the transmission beam allows an entire field to be treated in one breath hold. This quick treatment and decreased uncertainties lead to smaller planning volumes. To the best of the authors™ knowledge this is the first report on the use of this novel approach to plan SABR with protons without using the Bragg peak which may have dosimetric advantages over photon treatments. Materials and Methods Ethics Statement Written informed consent was obtained from all patients registered in the SABR database. This study including the consent procedure was approved by the Mayo Clinic institutional review board. Patient Cohort Patients were identified from a prospectively collected institutional database of patients treated with SABR. Patients with lung tumors less than one centimetre in maximum dimension were included. The radiation treatment plans of three patients were extracted from the treatment planning system. All patients were treated using three-dimensional conformal multiple static-gantry photon beams. Plans were normalized so that 95% of the planning target volume (PTV) received at least 95% of the prescription dose. The prescription doses for these plans were adjusted to 34 Gy in one fraction based on the recently reported results of Radiation Therapy Oncology Group (RTOG) 0915 which established this dose fractionation regimen as a possible standard dose to be used in future trials [7]. Dose calculations for photon plans used the anisotropic analytical algorithm. Proton Treatment Planning A machine was commissioned in Eclipse v.10 (Varian Medical Systems Palo Alto CA) which allowed for planning and calculating transmission dose plans. The spot size (sigma) of the transmission beam which had an energy of 229 MeV was 2.2 mm. A proton plan that only used the transmission portion of the beam was created for each patient. Proton beam arrangements were selected so that no beams entered through the heart or spinal cord and allowed up to two non-coplanar beams. Four to five beams were used to keep the skin dose comparable to photon plans. The energy of the protons for each spot of a field was 229 MeV; this ensured the Bragg peak was not located within the patient. Dose calculations for the transmission portion of the proton beam were verified with Monte Carlo (Geant4). The proton plans were normalized so that the internal target volume (ITV) receives at least 95% of prescription dose including when range and position errors were included (3.5% and 2 mm) which is standard for spot scanning proton therapy. ITVs were created based on motion of the gross tumor volume in three dimensions using four-dimensional computed tomography image data. The dose constraints from RTOG 0915 were compared for the photon and proton plans as well as the total time that would be required to deliver the treatment. The radiotherapy delivery time per beam was estimated at 1 nC per second for proton therapy which is readily achievable by most spot scanning proton centers and 600 MU per minute for the photon plans. Differences in dosimetric and treatment planning parameters between photon and proton plans were analyzed with two-sided paired t-tests using SAS version 9.2 (SAS Institute Inc. Cary NC). Results The ITVs of the three tumors measured 0.220.42 and 0.99 cubic centimeters. All three proton plans had excellent coverage of the ITV. For all ITVs over 99.4% of the volume received at least 95% of the prescription dose including when uncertainties were examined. This was comparable with the photon plans where 100% of the ITVs received at least 95% of the prescription dose. For most normal tissues lower doses to these ans were achieved with the proton plans compared to the photon plans (). In fact (near) complete sparing of the spinal cord heart and esophagus was possible with protons through careful selection of beam angles (). .0098621.g001 Dose-volume histogram comparison of ans at risk. .0098621.t001 Dosimetric comparison of photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Internal target volume (cc) 0.54 0.22“0.99 0.54 0.22“0.99 N/A Spinal cord Maximum dose (Gy) 5.66 2.39“8.07 1.97 0.00“3.06 0.04 Lungs (bilateral) Mean lung dose (Gy) 1.35 0.95“1.92 0.69 0.03“1.36 0.12 V20 (%) 0.66 0.39“1.20 0.49 0.16“1.01 0.06 V5 (%) 7.32 5.4“11.30 6.65 2.96“11.70 0.56 Heart Mean dose (Gy) 8.36 6.27“12.51 0.00 0.00“0.00 0.13 Skin Maximum dose (Gy) 11.75 9.86“13.28 11.40 7.37“16.23 0.89 Esophagus Maximum dose (Gy) 6.49 2.98“9.43 3.40 0.00“7.51 0.05 Homogeneity Index 1.25 1.21“1.29 1.07 1.03“1.11 0.06 Conformity Index 17.14 8.23“30.05 3.47 2.17“4.64 0.15 Proton plans used four to five non-coplanar beams compared to nine to ten beams for photon plans (). The average number of monitor units per field was 818 (range 758“871) with photons and only 38 (range 31“59) with protons. This would translate to an average beam-on time per field of 82 seconds versus 6 seconds for photon and proton plans respectively. These differences in monitor units and beam-on time were statistically significant with P<0.01(). .0098621.g002 Comparison of isodose distributions. Proton (left) and photon (right) treatment plans. .0098621.t002 Comparison of treatment time between photon and proton plans. Parameter Photon Proton P-value Mean Range Mean Range Total monitor units (MU) 7929 6820“8713 178 122“235 <0.01 Fields 9.7 9“10 4.7 4“5 N/A Average MU/field 818 758“871 38 30.5“46.9 <0.01 Beam on time per field (seconds) 81.8 75.6“87.1 5.8 4.7“7.2 <0.01 Discussion Exploiting the transmission beam in proton therapy planning has significant potentials for dose escalation and re-irradiation in lung tumors and eliminates the concern over the uncertainty of the stopping power and its impact on the Bragg peak location. PT-SABR planning requires fewer beams than photons and careful selection of optimal beam angles allows for minimal dose to adjacent normal tissues and tumor dose escalation which may translate to improved local control rates. RTOG 0915 showed that 34 Gy in a single fraction was comparable to 48 Gy in four fractions [7] and the dosimetric constraints from the protocol were easily achieved using both proton and photon plans for patients in this study. Further optimization with proton therapy can allow even higher doses to be delivered while still respecting established dosimetric constraints for normal tissues. This may translate to better tumor control but requires more investigation in a clinical setting. Patients planned with PT-SABR required fewer beams (5 vs. 10) which reduce the total treatment time and the low dose outside the tumor. The average monitor units per field for PT-SABR plans were a fraction of those needed for the photon plans (). This translates to a beam on time per field of between 5 and 10 seconds for the PT-SABR plans compared to 75 to 90 seconds for photon plan. This 5 to 10 second time estimate is based on a conservative 1 nC/sec dose rate however new proton centers may be able to achieve greater than 2 nC/sec thereby reducing this time by a factor of 2. By decreasing the treatment time to less than 10 seconds per field breath-hold techniques may be better tolerated in greater number of lung cancer patients with suboptimal lung function. Breath-hold technique would minimize tumor motion (i.e. ITV) leading to a smaller overall irradiation volume and interplay would not be a significant issue [8]. Spot scanning proton therapy that utilizes the Bragg peak would require a larger planning volume due to the various uncertainties that need to be taken into account; and it would require a longer treatment time due to the use of multiple proton energies. Each change in energy requires several seconds (2 to 7) and at least 5 to 10 energies would be required for these treatments. Volumetric modulated arc therapy (VMAT) with photons may decrease treatment times compared to multiple static-gantry beams. However VMAT comes at the cost of larger volumes of normal tissue receiving low doses of radiation since the beam is continuously on as it rotates about the patient. The use of four to five proton transmission beams achieves both shorter treatment times as well as a lower integral dose to the body. The dosimetric data of the normal tissues in the photons plans met the constraints of RTOG 0915. The dosimetric gains of protons over these plans may be considered modest and the statistical analysis comparing plans is limited by the small sample size. However in some plans the dose to particular critical ans can be avoided completely without compromising target coverage by choosing beam arrangements appropriately. This may be beneficial in treating patients with tumors in challenging locations [9] or recurrent tumors that have had prior radiotherapy. The interim analysis of RTOG 0617 reported local failure rates of 25% and 34% in the standard and high dose RT arms [10] and therefore re-irradiation may play a role in this subset of patients who fail after definitive chemoradiotherapy. For these patients keeping dose at or near zero to the spinal cord heart lungs or other critical structures is feasible with protons. Planning with PT-SABR using only transmission beams without the Bragg peak is feasible. This proof of principle as described in our study eliminates the uncertainty of proton dose distribution in lung tumors which has the potential to underdose the target and overdose surrounding normal tissues. Proton therapy planning with this technique also demonstrates better sparing of normal tissues and fast treatment times than photon plans. Further study of this novel approach to proton SABR is warranted. The authors thank Katy Nelson for maintaining the SABR database. References 1 GeD HillbrandM StockM DieckmannK PotterR (2008) Can protons improve SBRT for lung lesions? Dosimetric considerations. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology88: 368“37518405986 2 HoppeBS HuhS FlampouriS NicholsRC OliverKR et al (2010) Double-scattered proton-based stereotactic body radiotherapy for stage I lung cancer: a dosimetric comparison with photon-based stereotactic body radiotherapy. Radiotherapy and oncology: journal of the European Society for Therapeutic Radiology and Oncology97: 425“43020934768 3 MacdonaldOK KruseJJ MillerJM GarcesYI BrownPD et al (2009) Proton beam radiotherapy versus three-dimensional conformal stereotactic body radiotherapy in primary peripheral early-stage non-small-cell lung carcinoma: a comparative dosimetric analysis. International journal of radiation oncology biology physics75: 950“958 4 WestoverKD SecoJ AdamsJA LanutiM ChoiNC et al (2012) Proton SBRT for medically inoperable stage I NSCLC. Journal of thoracic oncology: official publication of the International Association for the Study of Lung Cancer7: 1021“1025 5 PaganettiH (2012) Range uncertainties in proton therapy and the role of Monte Carlo simulations. Physics in medicine and biology57: R99“11722571913 6 SecoJ PanahandehHR WestoverK AdamsJ WillersH (2012) Treatment of non-small cell lung cancer patients with proton beam-based stereotactic body radiotherapy: dosimetric comparison with photon plans highlights importance of range uncertainty. International journal of radiation oncology biology physics83: 354“361 7 VideticGM HuC SinghA ChangJY ParkerW et al (2013) Radiation Therapy Oncology Group (RTOG) Protocol 0915: A Randomized Phase 2 Study Comparing 2 Stereotactic Body Radiation Therapy (SBRT) Schedules for Medically Inoperable Patients With Stage I Peripheral Non-Small Cell Lung Cancer. International journal of radiation oncology biology physics87: S3 8 KeallPJ MagerasGS BalterJM EmeryRS ForsterKM et al (2006) The management of respiratory motion in radiation oncology report of AAPM Task Group 76. Medical physics33: 3874“390017089851 9 RegisterSP ZhangX MohanR ChangJY (2011) Proton stereotactic body radiation therapy for clinically challenging cases of centrally and superiorly located stage I non-small-cell lung cancer. International journal of radiation oncology biology physics80: 1015“1022 10 BradleyJD PaulusR KomakiR MastersGA ForsterK et al (2013) A randomized phase III comparison of standard-dose (60 Gy) versus high-dose (74 Gy) conformal chemoradiotherapy with or without cetuximab for stage III non-small cell lung cancer: Results on radiation dose in RTOG 0617. Journal of Clinical Oncology31: 7501 Cancer Cancer cncr Cancer 0008-543X 1097-0142 BlackWell Publishing Ltd Oxford UK 24752945 4140446 10.1002/cncr.28714 Original Articles A phase 2 cooperative group adjuvant trial using a biomarker-based decision algorithm in patients with stage I non-small cell lung cancer (SWOG-0720 NCT00792701) Bepler Gerold MD PhD 1 Zinner Ralph G MD 2 Moon James MS 3 Calhoun Royce MD 4 Kernstine Kemp MD 5 Williams Charles C MD 6 Mack Philip C PhD 4 Oliveira Vasco PhD 1 Zheng Zhong MD PhD 6 Stella Philip J MD 7 Redman Mary W PhD 2 Gandara David R MD 4 1 Karmanos Cancer Institute Detroit Michigan 2 The University of Texas MD Anderson Cancer Center Houston Texas 3 SWOG Statistical Center Seattle Washington 4 University of California at Davis Sacramento California 5 City of Hope Duarte California 6 H. Lee Moffitt Cancer Center Tampa Florida 7 Michigan Cancer Research Consortium Community Clinical Oncology Program Ann Arbor Michigan Corresponding author: Gerold Bepler MD PhD Karmanos Cancer Institute 4100 John R Detroit MI 48201; Fax: (313) 576-8628; beplerg@karmanos. 01 8 2014 18 4 2014 120 15 2343 2351 10 2 2014 17 3 2014 18 3 2014 © 2014 The Authors. Cancer published by Wiley Periodicals Inc. on behalf of American Cancer Society 2014 This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License which permits use and distribution in any medium provided the original work is properly cited the use is non-commercial and no modifications or adaptations are made. BACKGROUND This cooperative group adjuvant phase 2 trial in patients with completely resected stage I non-small cell lung cancer with tumor diameters measuring ??2 cm was designed to assess the feasibility and preliminary efficacy of assigning patients to therapy or observation using a molecularly based decision algorithm. METHODS At least a lobectomy and sampling of recommended mediastinal lymph node stations good Zubrod performance status adequate an function and a formalin-fixed and paraffin-embedded tumor specimen were required. Excision repair cross-complementing group 1 (ERCC1) and ribonucleotide reductase M1 (RRM1) were analyzed using immunofluorescence-based in situ automated quantitative image analysis and categorized as high or low using prespecified cutoff values. Patients with high ERCC1 and RRM1 were assigned to observation and all others to 4 cycles of cisplatin and gemcitabine. Feasibility was defined as treatment assignment within 84 days from surgery in >?85% of patients. Secondary objectives were to estimate the 2-year survival. RESULTS Treatment assignment met the feasibility criteria in 88% of eligible patients (71 of 81 patients). The collective 2-year disease-free and overall survival rates were 80% and 96% respectively. Protein levels for RRM1 fell within the previously established range ERCC1 levels were slightly lower than expected and they were significantly correlated (correlation coefficient 0.4). The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. CONCLUSIONS Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. To assess DFS the disease status was monitored every 2 months for the first 6 months and subsequently every 3 months by computed tomography after enrollment and according to good medical practice. Toxicities related to the administration of chemotherapy were assessed according to the National Cancer Institute Common Terminology Criteria for Adverse Events (version 3.0; ctep.cancer.gov). DFS was defined as the time from the date of enrollment to disease recurrence or death due to any cause and estimated according to the Kaplan-Meier method. A Cox regression model was fit with the time from surgery to enrollment as a covariate to evaluate its effect on DFS. A natural log transformation was applied to the raw protein measurement data and the Pearson correlation coefficient was used to test associations. Bivariate comparison of baseline characteristics between the assigned treatment groups was performed using the Fisher exact test for categorical variables or the Student t test or Wilcoxon rank sum test for continuous variables. A multivariable logistic model to evaluate baseline factors and treatment assignment was fit using backwards selection. Median ERCC1 and RRM1 expression levels were compared with historical medians using the 1-sample Wilcoxon signed rank test. The percentage of patients with both ERCC1 ??65 and RRM1 ??40 was compared with the historical rate using a chi-square test. All statistical analyses and graphics were performed using SAS statistical software (version 9.2; SAS Institute Inc Cary NC). A significance level of 5% was used for all analyses. RESULTS Patient and Trial Characteristics To ensure an adequate sample size of eligible patients and biomarker-specific subgroups a total of 85 patients was registered between April 2 2009 and April 1 2011 from 27 participating sites. Four patients were ineligible; 3 had inadequate lymph node sampling and 1 did not have a tumor measuring ??2 cm. provides the characteristics of the 81 eligible patients. Patient Demographics and Disease Characteristics Variablesa All Patients Assigned to Chemotherapy Assigned to Observation P Refused Assignment Accepted Assignment P N = 81 N = 63 N = 18 N = 20 N = 61 Age y .37 .39 ?Median 64 63.3 68.8 67.2 63.3 ?Mean 63.5 62.9 65.5 65.2 62.9 ?Range 41.6“84.2 41.6“84.2 41.6“81.7 44.2“82.9 41.6“84.2 Sex .18 .61 ?Female 44 (54%) 37 (59%) 7 (39%) 12 (60%) 32 (52%) ?Male 37 (46%) 26 (41%) 11 (61%) 8 (40%) 29 (48%) Ethnicity .65 .18 ?Unknown 7 (8%) 5 (8%) 2 (11%) 0 (0%) 7 (11%) ?Non-Hispanic 74 (91%) 58 (92%) 16 (89%) 20 (100%) 54 (89%) Race .73b .75b ?African American 8 (10%) 8 (13%) 0 (0%) 2 (10%) 6 (10%) ?Asian 3 (4%) 2 (3%) 1 (6%) 0 (0%) 3 (5%) ?Pacific Islander 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) ?White 66 (81%) 52 (83%) 14 (78%) 17 (85%) 49 (80%) ?Unspecified 2 (2%) 0 (0%) 2 (11%) 1 (5%) 1 (2%) Histology .06c .60c ?Adeno 52 (64%) 44 (70%) 8 (44%) 14 (70%) 38 (62%) ?Squamous 25 (31%) 17 (27%) 8 (44%) 6 (30%) 19 (31%) ?Large 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Bronchioloalveolar 1 (1%) 0 (0%) 1 (6%) 0 (0%) 1 (2%) ?Other 2 (2%) 1 (2%) 1 (6%) 0 (0%) 2 (3%) Stage of disease .16 .27 ?IA (<3 cm) 25 (31%) 22 (35%) 3 (17%) 4 (20%) 21 (34%) ?IB (?3 cm) 56 (69%) 41 (65%) 15 (83%) 16 (80%) 40 (66%) Zubrod performance status .11 1.00 ?0 44 (54%) 31 (49%) 13 (72%) 11 (55%) 33 (54%) ?1 37 (46%) 32 (51%) 5 (28%) 9 (45%) 28 (46%) Weight loss (6 mo) 1.00d .31d ?<5% 64 (79%) 49 (78%) 15 (83%) 14 (70%) 50 (82%) ?5-<10% 9 (11%) 7 (11%) 2 (11%) 3 (15%) 6 (10%) ?10“20% 4 (5%) 3 (5%) 1 (6%) 2 (10%) 2 (3%) ?>20% 1 (1%) 1 (2%) 0 (0%) 0 (0%) 1 (2%) ?Unknown 3 (4%) 3 (5%) 0 (0%) 1 (5%) 2 (3%) Smoking status ?Current 33 (41%) 26 (41%) 7 (39%) 8 (40%) 25 (41%) ?"
Lung_Cancer
" The blue nodes represent biomarkers identified in this work. The yellow nodes represent six genes which are not related with NSCLC on the NSCLC and normal specimens. The red nodes represent subtypes i.e. AC and SCC. Key gene pairs inferred by gene-subtype higher logic relationships We grouped together the gene-subtype higher logic relationships with the same logic function. Because the two logic functions AND (Type 1) and XOR (Type 8) have more intuitive biological interpretations than other logic functions we restricted our analysis to these two logic functions. The key gene pairs were defined as the gene pairs involved in the gene-subtype higher logic relationships with logic function AND or XOR. We obtained key gene pairs in total where and gene pairs were related with AC/SCC through the logic functions AND and XOR respectively (Table S6). This result may be explained by the strict parameters we chose. Gene Ontology analysis The Gene Ontology (GO) is a structured and controlled vocabularies and classifications about the annotations of genes gene products and sequences [40]. GO includes three categories of terms: biological processes molecular functions and cell components. We were focused on the biological processes enriching the genes involved in lower logic relationships. So in what follows when we say GO terms it means the GO terms in the ˜biological process™ category. According to probe-AC/SCC pairwise associations and their uncertainty coefficients we obtained a gene set containing genes without overlap and each gene attached a coefficient. A total of genes were ranked in descending order by coefficients and given as input to the Gorilla. The Gorilla gave significant GO terms like ˜tissue development™ (GO: 0009888) ˜epidermis development™ (GO: 0008544) and ˜epithelial cell differentiation™ (GO: 0030855) (Part A in Appendix S1). Given that the significant GO terms were retrieved based on the subtypes of NSCLC data it has to be checked whether the significant GO terms are also significant on NSCLC and normal specimens. The same procedure was applied to the ranked genes based on the NSCLC and normal data. The test revealed significant GO terms with significant value (Part B in Appendix S1). In total seven out of GO terms on the subtypes of NSCLC data were also significant on the NSCLC and normal specimens (). It indicates that the following seven biological processes are important for tumorigenesis of NSCLC: tissue development epidermis development epithelial cell differentiation anatomical structure development developmental process cell adhesion and biological adhesion. .0094644.t002 Significant GO terms. GO terms Description P-value1 P-value2 E1 E2 GO:0009888 tissue development GO:0008544 epidermis development GO:0030855 epithelial cell differentiation GO:0048856 anatomical structure development GO:0032502 developmental process GO:0007155 cell adhesion GO:0022610 biological adhesion ˜P-value1™ and ˜P-value2™ denote the p-value scores of GO terms based on the subtypes of NSCLC data and NSCLC and normal data respectively. ˜E1™ and ˜E2™ are the enrichment values of GO terms based on the subtypes of NSCLC data and NSCLC and normal data respectively. Further we grouped the genes closely related with the subtypes of NSCLC into two groups by the types of gene-SCC lower logic relationships. We mapped the genes which were related with SCC (AC) by Type () lower logic relationships to GO terms. Gene ontology analysis revealed GO terms with the p-value scores smaller than and the enrichment scores larger than . Among significant GO terms epithelial cell differentiation (GO: 0030855) and cell adhesion (GO: 0007155) were also involved in the seven significant GO terms which may be important for tumorigenesis of NSCLC. It indicates that dysfunction of epithelial cell differentiation and cell adhesion is important for both of the tumorigenesis of AC and SCC. In addition we mapped the identified biomarkers to GO terms. The resulted significant GO terms were cell adhesion (GO: 0007155) and epidermis development (GO: 0008544) with the p-value scores smaller than and the enrichment scores larger than . It indicates that genes annotated to epidermis development and cell adhesion may be differently regulated between AC and SCC. By mapping the higher logic relationships to GO terms we obtained pairs of GO terms with different GO terms. Among all pairs of GO terms pairs of GO terms involving GO terms were significant with the p-value scores smaller than enrichment score larger than one and the number of gene pairs larger than two. These combination of biological processes may be pivotal for differentiating AC and SCC including a combination of ˜transport™ (GO: 0006979) and ˜regulation of transcription DNA-dependent™ (GO: 0006355) a combination of ˜oxidation-reduction process™ (GO: 0055114) and ˜nervous system development™ (GO: 0007399) and a combination of ˜negative regulation of cell proliferation™ (GO: 0008285) and ˜muscle contraction™ (GO: 0006936). Discussion In this paper we improved the logic analysis method to infer sufficient and necessary conditions for the presence states (presence or absence) of a phenotype. The current method omits the integration of networks and identifies not only gene-phenotype pairwise combinations (i.e. lower logic relationships) but also triplets combinations (i.e. higher logic relationships). On one hand it avoids the incompleteness of data sources and the noise from the integration of data; on the other hand the triplets combinations reflect the combination effect of gene pairs on phenotypes other than an individual effect. Some examples of lower and higher logic relationships demonstrated the biological relevance of our results. However the accuracy of all discovered logic relationships cannot be verified because of the current limited knowledge of the relationships between genes and phenotypes. The statistics analysis strengthened the reliability of discovered logic relationships. In addition the current method was compared with the two earlier methods (the NMF method and the RA method). The current method was superior to the two earlier methods because of its ability of mining gene pairs which are closely related with phenotypes. Moreover the current method gained the higher recall rate and classification accuracy than the two earlier methods. Our results display the advantage of the current method in mining genes closely related with phenotypes. The discovered gene-subtypes logic relationships in this paper are equivalent relationships between the expression patterns (expression or no-expression) of genes and the presence states (presence or absence) of phenotypes. That is both a expression pattern of a gene and a presence state of a phenotype must be either simultaneously true or simultaneously false. For example DSC3 is expressed if and only if the specimen is SCC as DSC3 is related with SCC by the first type of lower logic relationship. If a gene is related with a phenotype by a logic relationship then either the expression pattern of a gene or the presence state of a phenotype may be determined by the underlying logic relationship. Concretely given a phenotype the expression pattern of genes in a phenotype could be determined by the logic relationship. For example the expression pattern of DSC3 in SCC depends on the type of DSC3-SCC lower logic relationship. Conversely given a expression pattern of a gene the presence state of a phenotype could also be determined by the underlying logic relationships. The type of a discovered gene-AC lower logic relationship was totally different from that of the gene-SCC lower logic relationship where the genes involved in two relationships are the same. It indicates that the totally different types of lower logic relationships between genes and phenotypes may be the intrinsic reason for the different expression patterns of genes in distinct phenotypes. A total of genes identified in our work were regarded as the biomarkers for distinguishing AC from SCC as well as novel molecular targets for targeted therapeutic agents. Besides the genes identified in the literature (DST CLCA2 KRT5 DSG3 GJB5 SERPINB13 TRIM29 PKP1 KRT6B DSC3 NKX2-1 TP63 and NTRK2) most of the rest genes (BNC1 FAT2 LASS3 and PVRL1) are likely to be the novel biomarkers to distinguish AC from SCC. The BNC1 gene is thought to play a regulatory role in ˜keratinocyte proliferation™ and the LASS3 gene is participated in ˜keratinocyte differentiation™. Both of the biological process ˜keratinocyte proliferation™ and ˜keratinocyte differentiation™ are children of ˜keratinization process™. Because the genes involved in ˜keratinization process™ are higher expressed in SCC as compared with AC [26] BNC1 and PVRL1 which are either a upstream regulatory factor or a member of these high expressed genes may be able to differentiate AC and SCC. FAT2 functions as a cell adhesion molecular and it controls cell proliferation. As ˜cell adhesion™ is one of the significantly important biological processes for tumorigenesis of NSCLC the cell adhesion molecular (FAT2) is deserved to be a biomarker to distinguish AC from SCC. Until recently the function of LOC642587 and GOLT1A has been unknown. Further experimental validation is needed to confirm the differentiating ability of these two genes. In addition the NKX2-1 gene has been considered as a novel oncogene [35] and it opens new windows for novel targeted therapies [41]. "
Lung_Cancer
"The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling. PLoS One8: e7099423923041 24 QuY WangJ RayPS GuoH HuangJ et al (2011) Thioredoxin-like 2 regulates human cancer cell growth and metastasis via redox homeostasis and NF-?B signaling. J Clin Invest121: 212“22521123948 25 YaoJ LiangL HuangS DingJ TanN et al (2010) MicroRNA-30d promotes tumor invasion and metastasis by targeting Galphai2 in hepatocellular carcinoma. Hepatology51: 846“85620054866 26 AiJ TangQ WuY XuY FengT et al (2011) The role of polymeric immunoglobulin receptor in inflammation-induced tumor metastasis of human hepatocellular carcinoma. J Natl Cancer Inst103: 1696“171222025622 27 MiraccoC CeveniniG FranchiA LuziP CosciE et al (2010) Beclin 1 and LC3 autophagic gene expression in cutaneous melanocytic lesions. Hum Pathol41: 503“51220004946 28 LeeYJ HaYJ KangKJ HwangJS ChungWJ et al (2013) The Autophagy-Related Marker LC3 Can Predict Prognosis in Human Hepatocellular Carcinoma. PLoS One8: e8154024282606 29 SchumackerPT (2006) Reactive oxygen species in cancer cells: live by the sword die by the sword. Cancer Cell10: 175“17616959608 30 QiuF LiZ HeL WangD (2013) HPLC-ESI-MS/MS analysis and pharmacokinetics of luteoloside a potential anticarcinogenic component isolated from Lonicera japonica in beagle dogs. Biomed Chromatogr27: 311“31722865633 31 TangH CaoW KasturiSP RavindranR NakayaHI et al (2010) The T helper type 2 response to cysteine proteases requires dendritic cell-basophil cooperation via ROS-mediated signaling. Nat Immunol11: 608“61720495560 32 BruchardM MignotG Derang¨reV ChalminF ChevriauxA et al (2013) Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nat Med19: 57“6423202296 33 ZhouR TardivelA ThorensB ChoiI TschoppJ (2010) Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat Immunol11: 136“14020023662 34 ChenK ZhangS JiY LiJ AnP et al (2013) Baicalein inhibits the invasion and metastatic capabilities of hepatocellular carcinoma cells via down-regulation of the ERK pathway. PLoS One8: e7292724039823 35 DaiZJ WangBF LuWF WangZD MaXB et al (2013) Total flavonoids of Scutellaria barbata inhibit invasion of hepatocarcinoma via MMP/TIMP in vitro. Molecules18: 934“95023344202 36 GhasemiR GhaffariSH MomenyM PirouzpanahS YousefiM et al (2013) Multitargeting and antimetastatic potentials of silibinin in human HepG-2 and PLC/PRF/5 hepatoma cells. Nutr Cancer65: 590“59923659451 37 MenonSG SarsourEH KalenAL VenkataramanS HitchlerMJ et al (2007) Superoxide signaling mediates N-acetyl-L-cysteine-induced G1 arrest: regulatory role of cyclin D1 and manganese superoxide dismutase. Cancer Res67: 6392“639917616699 38 DeNicolaGM KarrethFA HumptonTJ GopinathanA WeiC et al (2011) Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature475: 106“10921734707 39 TschoppJ SchroderK (2010) NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production?Nat Rev Immunol10: 210“21520168318 40 SorbaraMT GirardinSE (2011) Mitochondrial ROS fuel the inflammasome. Cell Res21: 558“56021283134 41 WenH GrisD LeiY JhaS ZhangL et al (2011) Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat Immunol12: 408“41521478880 42 ChowMT SceneayJ PagetC WongCS DuretH et al (2012) NLRP3 suppresses NK cell-mediated responses to carcinogen-induced tumors and metastases. Cancer Res72: 5721“573222986739 43 WangC PanY ZhangQY WangFM KongLD (2012) Quercetin and allopurinol ameliorate kidney injury in STZ-treated rats with regulation of renal NLRP3 inflammasome activation and lipid accumulation. PLoS One7: e3828522701621 44 HuQH ZhangX PanY LiYC KongLD (2012) Allopurinol quercetin and rutin ameliorate renal NLRP3 inflammasome activation and lipid accumulation in fructose-fed rats. Biochem Pharmacol84: 113“12522426011 45 ChuangSY YangCH ChouCC ChiangYP ChuangTH et al (2013) TLR-induced PAI-2 expression suppresses IL-1? processing via increasing autophagy and NLRP3 degradation. Proc Natl Acad Sci U S A110: 16079“1608424043792 46 GalluzziL VitaleI AbramsJM AlnemriES BaehreckeEH et al (2012) Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ19: 107“12021760595 47 WenS NiuY LeeSO ChangC (2014) Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis anoikis entosis necrosis and autophagic cell death. Cancer Treat Rev40: 31“4023993415 48 ZhangY ZhaoL LiX WangY YaoJ et al (2014) V8 a newly synthetic flavonoid induces apoptosis through ROS-mediated ER stress pathway in hepatocellular carcinoma. Arch Toxicol88: 97“10723835921 49 FengR WangSY ShiYH FanJ YinXM (2010) Delphinidin induces necrosis in hepatocellular carcinoma cells in the presence of 3-methyladenine an autophagy inhibitor. J Agric Food Chem58: 3957“396420025272 50 LongoL PlatiniF ScardinoA AlabisoO VasapolloG et al (2008) Autophagy inhibition enhances anthocyanin-induced apoptosis in hepatocellular carcinoma. Mol Cancer Ther7: 2476“248518723493 51 HuH LiZ ChenJ WangD MaJ et al (2011) P16 reactivation induces anoikis and exhibits antitumour potency by downregulating Akt/survivin signaling in hepatocellular carcinoma cells. Gut60: 710“72120971978 52 J¸rgensenHG AllanEK JordanidesNE MountfordJC HolyoakeTL (2007) Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells. Blood109: 4016“401917213283 53 PapeleuP LoyerP VanhaeckeT ElautG GeertsA et al (2003) Trichostatin A induces differential cell cycle arrests but does not induce apoptosis in primary cultures of mitogen-stimulated rat hepatocytes. J Hepatol39: 374“38212927923 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505400 3914905 PONE-D-13-19136 .0088122 Research Medicine Drugs and Devices Non-Clinical Medicine Oncology Sulindac Compounds Facilitate the Cytotoxicity of ?-Lapachone by Up-Regulation of NAD(P)H Quinone Oxidoreductase in Human Lung Cancer Cells Sulindac Assists the Effect of ?-Lap through NQO1 Kung Hsiu-Ni 1 * Weng Tsai-Yun 2 Liu Yu-Lin 2 Lu Kuo-Shyan 1 * Chau Yat-Pang 2 3 * 1 Department of Anatomy and Cell Biology College of Medicine National Taiwan University Taipei Taiwan 2 Institute of Anatomy and Cell Biology School of Medicine National Yang-Ming University Taipei Taiwan 3 Department of Medicine Mackay Medical College New Taipei City Taiwan Szakacs Gergely Editor Hungarian Academy of Sciences Hungary * E-mail: kunghsiunigmail.com (HK); leonchaummc.edu.tw (YC); lksntu.edu.tw (KL) Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HK YC. Performed the experiments: TW YL. Analyzed the data: HK TW YL. Wrote the paper: HK KL YC. 2014 5 2 2014 9 2 e88122 2 4 2013 5 1 2014 2014 Kung et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. ?-lapachone a major component in an ethanol extract of Tabebuia avellanedae bark is a promising potential therapeutic drug for various tumors including lung cancer the leading cause of cancer-related deaths worldwide. In the first part of this study we found that apoptotic cell death induced in lung cancer cells by high concentrations of ?-lapachone was mediated by increased activation of the pro-apoptotic factor JNK and decreased activation of the cell survival/proliferation factors PI3K AKT and ERK. In addition ?-lapachone toxicity was positively correlated with the expression and activity of NAD(P)H quinone oxidoreductase 1 (NQO1) in the tumor cells. In the second part we found that the FDA-approved non-steroidal anti-inflammatory drug sulindac and its metabolites sulindac sulfide and sulindac sulfone increased NQO1 expression and activity in the lung adenocarcinoma cell lines CL1-1 and CL1-5 which have lower NQO1 levels and lower sensitivity to ?-lapachone treatment than the A549 cell lines and that inhibition of NQO1 by either dicoumarol treatment or NQO1 siRNA knockdown inhibited this sulindac-induced increase in ?-lapachone cytotoxicity. In conclusion sulindac and its metabolites synergistically increase the anticancer effects of ?-lapachone primarily by increasing NQO1 activity and expression and these two drugs may provide a novel combination therapy for lung cancers. This work was supported by grants (NSC 101-2320-B-002-020-MY3 NSC 98-2320-B-715-001-MY3 (YPC) and NSC 101-2320-B-002-008) from the National Science Council Taiwan. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction ?-Lapachone a natural o-naphthoquinone originally obtained from lapacho trees in South America has promising anti-tumor activity on various tumor cells [1]-[6] and has been tested as an anti-tumor candidate drug in phase I/II/III clinical trials in combination with other chemotherapy drugs [1] [7]. Its anti-cancer activity is thought to be due to the two-electron reduction of ?-lapachone catalyzed by NAD(P)H : quinone oxidoreductase (NQO1 DT-diaphorase) using NAD(P)H or NADH as electron source [1] [8] [9]. In the presence of NQO1 ?-lapachone undergoes reduction to an unstable hydroquinone which rapidly undergoes a two-step oxidation back to the parent compound perpetuating a futile redox cycle and resulting in the generation of reactive oxygen species (ROS) including superoxides [8] [10]“[12]. These reactive species can oxidize thiol groups of the mitochondrial potential transition pore complex leading to increased mitochondrial inner membrane permeability reduced mitochondrial membrane depolarization and release of cytochrome c resulting in cell death [13] [14]. Because NQO1 is more highly expressed in various solid cancers than in normal tissues [15] ?-lapachone can selectively kill these cancer cells. In addition higher NQO1 expression or activity in cancer cells may make them more sensitive to ?-lapachone. In order to increase the clinical efficacy of ?-lapachone many methods have been examined to increase NQO1 expression or activity in cancer cells [3] [5] [16]“[19]. "
Lung_Cancer
"In this model the lymphangiogenesis induced by PDGF-BB could not be restricted by blocking interaction of VEGF-C with VEGFR-3 suggesting that PDGF-BB exerts its effect via an independent pathway that may involve PDGF receptors on lymphatic vessels [34]. Another study showed that VEGF-C is an essential regulator determining PDGF-BB expression for vascular stabilization via a paracrine mode of action [22]. The stimulation of proliferation of lymphatic endothelial cells by platelets seems to be induced in a time and dose dependent manner mainly by VEGF-C and PDGF-BB which are secreted by platelets. Blocking the experiments indicate a predominant role of VEGF-C in this process [35]. All those results suggested that both factors play complicated roles in tumor lymphangiogenesis. However the overlapping biological effects of these two factors have not been clarified clearly in human cancers. In this study overexpression of both PDGF-BB and VEGF-C significantly correlated. LMVD. Those cases were also younger and had larger tumor size more likely lymph node metastasis worse histological differentiation and poorer OS. In addition a significant association between VEGF-C overexpression alone and worse histological differentiation was found. For the rest however PDGF-BB or VEGF-C alone was not linked to any other clinical feature including LMVD. The results indicated NSCLC patients who had overexpression of both PDGF-BB and VEGF-C might present with more rapid growth and higher potential for invasion due to their lymphangiogenesis. Thereby these patients had poorer OS which was consistent with the results in patients with esophageal squamous cell carcinoma those with positive expressions of PDGF-BB and VEGF-C have been shown to possess a worse prognosis compared to those with negative expressions [23]. Also those results suggested that poorly differentiated cancer cells might be more capable to secrete VEGF-C and PDGF-BB which induced lymphangiogenesis thereby promoting disease progression in NSCLC. The secretion of VEGF-C or PDGF-BB by tumor could induce the activation of their receptors on the vascular endothelium and thereby inducing the formation of new lymphatic vessels [36]. However little is currently known about the interplay among these lymphangiogenic factors. In this study a significant positive correlation between PDGF-BB and VEGF-C protein expression of tumor cells was seen in NSCLC suggesting a lymphangiogenesis pathway that one factor (PDGF-BB or VEGF-C alone) may up-regulate the other factor expression in the same cells. Therefore we suspected that PDGF-BB and VEGF-C could synergistically promote NSCLC lymphangiogenesis and enhance the tumor growth and lymph node metastasis. Combined targeting both PDGF-BB and VEGF-C may become a promising strategy for the treatment of NSCLC. Conclusions We found for the first time that compared with the overexpression of PDGF-BB or VEGF-C alone both PDGF-BB and VEGF-C overexpression in primary human NSCLC was significantly associated with lymphangiogensis and poor outcome. Furthermore our data suggested that PDGF-BB and VEGF-C expression might have a correlative dependence and interplay not only in NSCLC lymphangiogenesis but also in cancer progression. Based on the expression of PDGF-BB and VEGF-C we speculated the therapy targeting VEGF-C expression in combination with targeting PDGF-BB might be an important approach for control the cancer growth in patients with NSCLC having high expression of both PDGF-BB and VEGF-C. Competing interests All authors declare they have no actual or potential competing financial interests. Authors™ contributions All authors read and approved the final manuscript"
Lung_Cancer
"colon cancer Clin. Cancer Res. 2009 15 7451 7452 19996205 Landi MT Gene expression signature of cigarette smoking and its role in lung adenocarcinoma development and survival PLoS One 2008 3 e1651 18297132 Lee ES Prediction of recurrence-free survival in postoperative non-small cell lung cancer patients by using an integrated model of clinical information and gene expression Clin. Cancer Res. 2008 14 7397 7404 19010856 Lin YH Multiple gene expression classifiers from different array platforms predict poor prognosis of colorectal cancer Clin. Cancer Res. 2007 13 498 507 17255271 Lu TP Integrated analyses of copy number variations and gene expression in lung adenocarcinoma PLoS One 2011 6 e24829 21935476 Marisa L Gene expression classification of colon cancer into molecular subtypes: characterization validation and prognostic value PLoS Med. 2013 10 e1001453 23700391 Munoz-Pinedo C Cancer metabolism: current perspectives and future directions Cell Death Dis. 2012 3 e248 22237205 Smith JJ Experimentally derived metastasis gene expression profile predicts recurrence and death in patients with colon cancer Gastroenterology 2010 138 958 968 19914252 Su LJ Selection of DDX5 as a novel internal control for Q-RT-PCR from microarray data using a block bootstrap re-sampling scheme BMC Genomics 2007 8 140 17540040 Subramanian A Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles Proc. Natl Acad. Sci. USA 2005 102 15545 15550 16199517 Tian L Discovering statistically significant pathways in expression profiling studies Proc. Natl Acad. Sci. USA 2005 102 13544 13549 16174746 Vaske CJ Inference of patient-specific pathway activities from multi-dimensional cancer genomics data using PARADIGM Bioinformatics 2010 26 i237 i245 20529912 Wang Y Gene expression profiles and molecular markers to predict recurrence of Dukes' B colon cancer J. Clin. Oncol. 2004 22 1564 1571 15051756 Am J Respir Cell Mol Biol Am. J. Respir. Cell Mol. Biol ajrcmb American Journal of Respiratory Cell and Molecular Biology 1044-1549 1535-4989 American Thoracic Society 23980547 3930939 2013-0314TR 10.1165/rcmb.2013-0314TR Translational Review The Role of Vimentin Intermediate Filaments in the Progression of Lung Cancer Kidd Martha E. 1 2 Shumaker Dale K. 2 Ridge Karen M. 2 1Department of Biomedical Engineering Northwestern University Evanston Illinois; and 2Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine Chicago Illinois Correspondence and requests for reprints should be addressed to Karen M. Ridge Ph.D. Division of Pulmonary and Critical Care Medicine Northwestern University Feinberg School of Medicine 240 East Huron Street McGaw M328 Chicago IL 60611. E-mail: kridgenorthwestern.edu 1 2014 1 2014 50 1 1 6 08 7 2013 30 7 2013 Copyright 2014 by the American Thoracic Society 2014 There is an accumulation of evidence in the literature demonstrating the integral role of vimentin intermediate filaments (IFs) in the progression of lung cancers. Vimentin IF proteins have been implicated in many aspects of cancer initiation and progression including tumorigenesis epithelial-to-mesenchymal transition (EMT) and the metastatic spread of cancer. Specifically vimentin IFs have been recognized as an essential component regulating EMT major signal transduction pathways involved in EMT and tumor progression cell migration and invasion the positioning and anchorage of anelles such as mitochondria and cell“cell and cell“substrate adhesion. In tumenesis vimentin forms a complex with 14-3-3 and beclin 1 to inhibit autophagy via an AKT-dependent mechanism. Vimentin is a canonical marker of EMT and recent evidence has shown it to be an important regulator of cellular motility. Transcriptional regulation of vimentin through hypoxia-inducible factor-1 may be a potential driver of EMT. Finally vimentin regulates 14-3-3 complexes and controls various intracellular signaling and cell cycle control pathways by depleting the availability of free 14-3-3. There are many exciting advances in our understanding of the complex role of vimentin IFs in cancer pointing to the key role vimentin IFs may play in tumor progression. Keywords epithelial-to-mesenchymal transition invadopodia lung cancer metastatic cascade vimentin 8711562 6325 Oncogene Oncogene Oncogene 0950-9232 1476-5594 23752194 3839253 10.1038/onc.2013.208 NIHMS490151 ARF Inhibits the Growth and Malignant Progression of Non-Small Cell Lung Carcinoma Busch Stephanie E 1 2 Moser Russell D 1 Gurley Kay E 1 Kelly-Spratt Karen S 1 Liggitt H Denny 3 Kemp Christopher J 1 1Division of Human Biology Fred Hutchinson Cancer Research Center Seattle Washington 98109 2Molecular and Cellular Biology Graduate Program University of Washington Seattle Washington 98195 3Department of Comparative Medicine University of Washington Seattle Washington 98195 Corresponding author: Christopher J. Kemp Ph.D. Fred Hutchinson Cancer Research Center 1100 Fairview Ave N Mail Stop C1-015 Seattle WA 98109. cjkempfhcrc.. Phone: (206) 667-4252. Fax: (206) 667-5815 11 7 2013 10 6 2013 15 5 2014 15 5 2015 33 20 2665 2673 Non-small cell lung carcinoma (NSCLC) is among the deadliest of human cancers. The CDKN2A locus which houses the INK4a and ARF tumor suppressor genes is frequently altered in NSCLC. However the specific role of ARF in pulmonary tumorigenesis remains unclear. KRAS and other oncogenes induce the expression of ARF thus stabilizing p53 activity and arresting cell proliferation. To address the role of ARF in Kras-driven NSCLC we compared the susceptibility of NIH/Ola strain wild-type and Arf knockout mice to urethane-induced lung carcinogenesis. Lung tumor size malignancy and associated morbidity were significantly increased in Arf?/? compared to Arf+/+ animals at 25 weeks post-induction. Pulmonary tumors from Arf knockout mice exhibited increased cell proliferation and DNA damage compared to wild-type. A subgroup of tumors in Arf?/? animals presented as dedifferentiated and metastatic with many characteristics of pulmonary sarcomatoid carcinoma a neoplasm previously undocumented in mouse models. Our finding of a role for ARF in NSCLC is consistent with the observation that benign adenomas from Arf+/+ mice robustly expressed ARF while ARF expression was markedly reduced in malignant adenocarcinomas. ARF expression also frequently co-localized with expression of p21CIP1 a transcriptional target of p53 arguing that ARF induces the p53 checkpoint to arrest cell proliferation in vivo. Together these findings demonstrate that induction of ARF is an early response in lung tumorigenesis that mounts a strong barrier against tumor growth and malignant progression. p19Arf p14ARF ethyl carbamate metastasis J Transl Med J Transl Med Journal of Translational Medicine 1479-5876 BioMed Central 24726028 3996904 1479-5876-12-98 10.1186/1479-5876-12-98 Research Thymidylate synthase polymorphisms in genomic DNA as clinical outcome predictors in a European population of advanced non-small cell lung cancer patients receiving pemetrexed Arvalo Estefan­a 1 e.arevalo-vazquezhotmail.com Casta±n Eduardo 1 ecastanonunav.es Lpez Ins 2 milopezunav.es Salgado Josefa 3 jsalgadogunav.es Collado V­ctor 2 v.d.colladogmail.com Santisteban Marta 1 msantistebunav.es Rodr­guez-Ruiz Mar­a 4 mrruizunav.es Mart­n Patricia 1 pmromanounav.es Zubiri Leire 4 lzubiriunav.es Pati±o-Garc­a Ana 3 apatigarunav.es Rolfo Christian 5 christian.rolfouza.be Gil-Bazo Ignacio 1 2 igbazounav.es 1Department of Oncology Cl­nica Universidad de Navarra 31008 Pamplona Spain 2Division of Oncology Center for Applied Medical Research (CIMA) 31008 Pamplona Spain 3Laboratory of Clinical Genetics Cl­nica Universidad de Navarra 31008 Pamplona Spain 4Department of Radiation Oncology Cl­nica Universidad de Navarra 31008 Pamplona Spain 5Oncology Department Antwerp University Hospital UZA 2650 Edegem Belgium 2014 14 4 2014 12 98 98 3 11 2013 7 4 2014 Copyright 2014 Arvalo et al.; licensee BioMed Central Ltd. 2014 Arvalo et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background We studied whether thymidylate synthase (TS) genotype has an independent prognostic/predictive impact on a European population of advanced non-small cell lung cancer (NSCLC) patients receiving pemetrexed. Methods Twenty-five patients treated with pemetrexed-based regimens were included. Genomic DNA was isolated prior to treatment. The variable number of tandem repeat (VNTR) polymorphisms the G >?C single nucleotide polymorphisms (SNP) and the TS 6-bp insertion/deletion (6/6) in the 3? untranslated region (UTR) polymorphisms were analyzed and correlated with overall response rate (ORR) progression-free survival (PFS) overall-survival (OS) and toxicity. Results The genotype +6/+6 predicted a higher ORR among active/former smokers compared to +6/-6 genotype (100% vs. 50%; p =?0.085). Overall the 3R/3R genotype predicted a higher ORR (100%) over the rest VNTR polymorphisms (p =?0.055). The presence of 3R/3R genotype significantly correlated with a superior ORR in patients without EGFR activating mutations (100%) compared to 2R/2R 2R/3R and 3R/4R genotype (77.8% 33.3% and 0% respectively; p =?0.017). After a median follow-up of 21 months a trend towards a better PFS although not significant was found among subjects showing 3R/3R polymorphisms (p =?0.089). A significantly superior OS was found in patients showing 3R/3R genotype rather than other VNTR polymorphisms (p =?0.019). No significant correlation with the toxicity was observed. Conclusion In our series 3R/3R polymorphism correlated with a superior OS. Also this polymorphism when associated to wild type EGFR was related to a higher ORR to pemetrexed. "
Lung_Cancer
"630±60?nm band pass filter) and green (?excitation: 470±40?nm band pass filter ?detection: 535±50?nm band pass filter) fluorescence channels. Flow cytometric analysis was assayed with the JC-1 Mitochondrial Membrane Potential Kit (AAT Bioquest Sunnyvale CA USA) according to the manufacturer's directions using a FACSCalibur and the results were analyzed by CellQuest software. In vitro casapse-9 activity determination Caspase-9 activity was measured by a fluorometric assay in whole-cell lysates using Ac-Leu-Glu-His-Asp-MCA substrate (Peptide International Inc. Louisville KY USA). A549 cell extracts were mixed with Ac-LEHD-MCA in ICE standard buffer (100?mM HEPES pH 7.5 10% sucrose 0.1% CHAPS 10?mM DTT 1?mM PMSF) and cleavage of the fluorogenic peptide substrate was monitored at 37?°C for 30?min by a SPECTRA max GEMINI EM (Molecular Device Sunnyvale CA USA) fluorometer with excitation at 370?nm and emission at 460?nm. This work was supported in part by a Grant-in-Aid (23591477) from the Ministry of Education Culture Sports Science and Technology of Japan. Apaf-1 apoptotic protease-activating factor 1 COX cyclooxygenase HSF-1 heat shock factor 1 MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide NSAID nonsteroidal anti-inflammatory drug NSCLC non-small cell lung cancer PCR polymerase chain reaction RNAi RNA interference RT reverse transcriptase TUNEL terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling Edited by G Raschell  The authors declare no conflict of interest. Tavaria M Gabriele T Kola I Anderson RL A hitchhiker's guide to the human Hsp70 family Cell Stress Chaperones 1996 1 23 28 9222585 Jaattela M Escaping cell death: survival proteins in cancer Exp Cell Res 1999 248 30 43 10094811 Aghdassi A Phillips P Dudeja V Dhaulakhandi D Sharif R Dawra R Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreas adenocarcinoma Cancer Res 2007 67 616 625 17234771 Ciocca DR Clark GM Tandon AK Fuqua SA Welch WJ McGuire WL Heat shock protein hsp70 in patients with axillary lymph node-negative breast cancer J Natl Cancer Inst 1993 85 570 574 8455204 Cornford PA Dodson AR Parsons KF Desmond AD Woolfenden A Fordham M Heat shock protein expression independently predicts clinical outcome in prostate cancer Cancer Res 2000 60 7099 7105 11156417 Vargas-Roig LM Gago FE Tello O Aznar JC Ciocca DR Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy Int J Cancer 1998 79 468 475 9761114 Igney FH Krammer PH Death and anti-death: tumor resistance to apoptosis"
Lung_Cancer
"The recurrence rate Q is used to evaluate the reliability of logic relationships as follows:(5)where represents the number of recurrance times of a logic relationship in all random trials and is the number of all random trials. Mapping probe-phenotype relationships to gene-phenotype relationships On the basis of lower and higher probe-phenotype logic relationships lower and higher gene-phenotype logic relationships are generated as follows. Suppose all the probes detecting genes and form a set and where and are the size of the set and and respectively. 1. If () is the unique probe of that is related with a phenotype then the gene relates with in the same way as . Moreover the coefficient of the - lower logic relationship is equal to the mean uncertainty coefficient of the - lower logic relationship in both directions. If ( and ) is the unique probe pair related with a phenotype then the gene pair is related with in the same way as the probe pair . Moreover the coefficient of the - higher logic relationship is the mean uncertainty coefficient of the - higher logic relationship in both directions. 2. Suppose is a probe set of gene where is the size of the set and . Every probe in the above set is related with a phenotype by a lower logic relationship. We define as the mean of and where and are real numbers. If is the largest element in then is related with the phenotype in the same way as the probe and its coefficient is equal to . Similarly suppose is the probe pair set of gene pairwise where is the size of the set. Every probe pair in the above probe pair set is related with a phenotype by a higher logic relationship. If is the maximum mean uncertainty coefficient in then the gene pair is related with the phenotype in the same way as the probe pair and the coefficient of - higher logic relationship is equal to . Earlier relationship-inference methods We adapt the two earlier methods suitable for mining gene-phenotype relationships. These methods are described as follows: The non-negative matrix factorization (NMF) method is a model selection method. Given a positive matrix of size the NMF algorithm iteratively computes an approximation where and are nonnegative matrics with size and respectively [18]. Each column of represents a metagene and the number of columns () is typically equal to the number of phenotypes. Entry denotes the expression level of metagene in cluster . Entry represents the coefficient of gene in metagene . Genes which are more active in the genome have higher coefficient values. When the coefficient values are sorted in descending order the first one represents the most active gene while the last one represents the least active. That is the larger coefficient of a gene in a metagene the closer relationship between the gene and a phenotype. In this work we chose the alternate least squares as the algorithm to factorize into because of the algorithm's speed and robustness. The NMF method is implemented in Matlab using the NMF:DTU toolbox (http://cogsys.imm.dtu.dk/toolbox/nmf/index.html). The relevance analysis (RA) method identifies a potential biological association between a gene and a phenotype by a mutual information value [20]. The mutual information for two discrete random variables and is calculated as:(6)where is the probability that is the joint probability that and represents a probe profile and denotes a phenotype profile. The classification ability of probes We evaluate the discriminating ability of probes by constructing a classification model. Given that the competitive neural network (CNN) has produced promising classification accuracy we apply CNN to build the classification model in this work. Next we calculate the classification accuracy which is used as the measure of the probes' classification ability. The competitive neural network consists of three layers which are the input layer the competitive layer and output layer respectively. An input vector consists of the binary probe data of the evaluated probes in a specimen. During the learning process for each input vector the neurons in the competitive layer compete with each other and the one with the weight vector closest to the input vector is chosen as the winner. The wining neuron is picked up by the output layer and the output layer classifies the input vector to that class. The classification accuracy is the ratio of the number of specimens which are correctly classified to the total number of specimens. Gene ontology analysis To check how significant the GO term (a pair of GO terms) related with phenotypes the p-value score and enrichment value are used for gene ontology analysis. The Gorilla is a web tool to calculate both the p-value score and the enrichment value of a GO term at the top of a ranked list of all genes [46]. We use the Gorilla to compute an exact p-value score and enrichment value for a GO term's significance as follows. Firstly we rank all the genes by the coefficients of gene-phenotype pairwise combinations. Then all the gene are uploaded into the Gorilla. Finally the Gorilla exports the exact p-value score and enrichment value for a GO term's significance. In addition we pay attention to the GO terms which are associated with the genes or gene pairs selected. We map the genes (gene pairs) into GO terms and obtain the GO terms (a pair of GO terms) which are related with phenotypes. The p-value score is defined as the probability of obtaining no less number of the same number of gene (genes pairs) by chance by the hypergeometric distribution. It is calculated as follows:(7)where represents the total number of gene (gene pairs) is the number of gene (gene pairs) involved in lower (higher) logic relationships represents the total number of gene (gene pairs) associated with pairs of GO terms and represents the number of the discovered gene (gene pairs) which are associated with the given GO term (a pair of GO terms). The enrichment value of a GO term (a pair of GO terms) is calculated as follows:(8)where and are the same with those in the e.q (7). In the analysis the significance of a GO term (a pair of GO terms) mainly depends on the p-value scores as it describes well from a biological point of view. Supporting Information Appendix S1 Significant GO terms obtained by Gorilla. (PDF) Click here for additional data file. Appendix S2 The phenotype data and the probe data. (ZIP) Click here for additional data file. Appendix S3 Matlab codes of the current relationship-inference method. (ZIP) Click here for additional data file. Table S1 List of probe-AC lower and higher logic relationships identified. (PDF) Click here for additional data file. Table S2 List of gene-AC lower and higher logic relationships each of which is generated from more than one probe-AC lower and higher logic relationship. (PDF) Click here for additional data file. Table S3 List of gene-AC/SCC lower and higher logic relationships identified in this paper. (PDF) Click here for additional data file. Table S4 Probes sorted by the non-negative matrix factorization method. (XLSX) Click here for additional data file. Table S5 Two datasets involved the genes which are related with NSCLC. One dataset includes high frequency genes and the other contains the genes which are down or up regulated in NSCLC compared to the normal tissue. (XLSX) Click here for additional data file. Table S6 Gene pairs related with AC or SCC through the logic function AND or XOR. (PDF) Click here for additional data file. Table S7 The genes and probes included in GPL570. (ZIP) Click here for additional data file. "
Lung_Cancer
"Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting s. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in . .0085329.g001 Identification of studies for inclusion. .0085329.t001 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g004 Figure 4 5-year survival rate. Forest plot of the Odds Ratio(OR) of the 5-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Four studies compared the 1-year disease free survival rate (OR?=?1.31; 95% CI 0.79“2.19; p?=?0.30)finding no significant heterogeneity among these studies (x2?=?1.82P?=?0.61I2?=?0%) (Fig 5) and four studies compared the 3-year disease free survival rate (OR?=?0.59; 95% CI0.38“0.91; p?=?0.02) finding no significant heterogeneity (x2?=?1.82P?=?0.61I2?=?0%) between the patients who underwent VATS and those who underwent open thoracotomy (Fig 6). Because of the heterogeneity in the sample size sensitivity analyses were conducted using larger sample size studies; however there was no difference between the two surgical methods with an OR of 1.71 (95% CI1.02“2.89) and with heterogeneity (?2?=? 3.07P ?=?0.22 I2?=?35%). There were significant 3-year disease free survival rate benefits with open thoracotomy. We attempted to evaluate the 5-year disease free survival rate.Only two studies reported these ratesand the published data were not sufficient for the combined analysis. .0085329.g005 Figure 5 1-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 1-year disease free survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g006 Figure 6 3-year disease-free survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. Publication bias Publication bias might exist when nonsignificant findings remain unpublishedthus artificially inflating the apparent magnitude of an effect.The funnel plots of the study are shown in Figure 7.The funnel plots of the 1-year survival rate following VATS and thoracotomy for the treatment of metastatic lung cancer showed asymmetry which suggested that there was some publication bias. .0085329.g007 Figure 7 Funnel plot of the outcome of 1-year survival rate. Discussion Many tumors can metastasize to the lungand colorectal and breast tumors are the most common primary tumors[9].Pulmonary resection has been shown to be beneficial for patients with resectable and isolated pulmonary metastases[10]. Traditional open thoracotomy and VATS are two principally different surgical methods for pulmonary metastasectomy.The selection of an approach depends more on the theoretical knowledge and personal experience of the surgeon than on the evidence. Over the past two decades several studies have demonstrated the benefits of VATS that included less postoperative pain shorter hospital stays a smaller degree of immunosuppression and enhanced recovery and the ability to tolerate adjuvant therapy[11]“[13]. Whether the long-term advantages are comparable to those of open thoracotomy is not well documented. The major deficiency of the VATS approach is that nodules might be undetected by VATS that might be detected by manual palpation during thoracotomy; such missing nodules are not imaged on a preoperative CT scan. The VATS approach has long been controversial because VATS does not consistently detect all the metastases and it is recognized that complete resection remains a major determining factor of survival [14].The detection rate of HRCT for pulmonary metastases is 78“84%[15]“[17].Kayton[18]found that 35% of the pathologically verified metastases were missed by CT. In the International Registry of Lung Metastases study of 5206 patients the 5-year survival rate was 36% for complete resection compared with 13% incomplete resectoin[19]. It is not certain whether the nodule imaged on a CT scan and resected by VATS is the correct one [14]. Those who disagree with the use of VATS hypothesize that VATS-related recurrence is commonly observed including port-site recurrence and resection stump recurrence[20]. Johnstone reported 23 cases of port-site chest wall recurrence related to VATS[21]. They hypothesized that the thoracoscopic approach should only be used in patients with a solitary lesion and when resection is requried for diagnostic purposes. The surgeons who favor the VATS approach advocate that VATS minimizes pain and trauma to the patients and that the VATS group might have an improved tolerance of chemotherapy which would likely ensure delivery of planned post-resection adjuvant therapy without a reduction in dosage or delay. The standard surgical procedure for pulmonary metastases is wedge resection that usually does not require manipulation of the pulmonary hilum which is appropriate for the VATS approach.They hypothesiezd that a lesion overlooked by CT but detected by palpation might not result in a survival gain[22] [23] and may be partially compensated for by carefully follow-up.Flores[24] hypothesized that the VATS group might demonstrate a great number of metachronous tumors over time;however the metachronous lesions in each group was similar. Our work suggests that thoracoscopic resection of metastatic lung cancer is a safe and curative procedure with 13 and 5-year survival rates comparable to those of thoracotomy. Patients with metastatic lung cancer are likely to relapse in the lung and after lung metastasectomy by VATS patients might benefit from a second metastasectomy. We hypothesize that earlier chemotherapy and radiation are essential to maximizing survival. Our study might be subject to pretreatment selection bias because most of the patients selected for open thoracotomy had multiple lesions and high risk and were not suitable for treatment with VATS.The missing lesions perhaps skewed the data more toward VATS as an equivalent procedure. We were also interested in the recurrence of cancerand the disease-free survival rates were evaluated. This study demonstrates a similar 1-year disease-free survival rate;however the 3-year disease-free survival rate is inferior for three reasons. First unrelated cancer deaths were included in our analysis of the 13 and 5-year overall survival which might account for VATS having a comparable overall survival rate but an inferior disease-free survival rate. Secondthe patients in the VATS group might have lesions that are missed and there are more likely to relapse in the lung leading to the inferior 3-year disease-free survival rate.Third some of our included studies were in the early period of VATS development when the technology was immature and some of the complications can now be prevented with more experience. Schaeff[25] reported 23 cases of port-site recurrence associated with VATS that occurred before 1998.The number of cases studied was small and the observation period was limitied. Spiral computed tomography has a far higher detection rate today than it did 20 years ago;so small lesions can be accurately localized before surgery[26] which ensures the success of VATS. With advances in imaging technology palpaiton during open thoracotomy is becoming less important.The latest VATS technology has a high-definition resolution and the flexible-tip thoracoscope enables complete inspection of the pleural cavity.These advancements ensure that VATS is an ideal method for patients with a solitary and relatively small peripheral lesions.Tamas[27] hypothesizes that palpation is necessary in a therapeutic metastasectomy as opposed to a diagnostic procedure.Whether patients with multiple lesions should be treated with open thoracotomy or VATS is controversial. This study is the first meta-analysis of the oncological outcome of thoracoscopic surgery for the treatment of metastatic lung cancer. In our work we observed that VATS might be a promising treatment for metastatic lung cancer. No randomized trials existing to guide doctors in the field of metastatic lung cancer currently. A prospective randomized study of the different surgical strategies is needed. Limitation No randomized controlled trials existing to comparing VATS with thoracotomy have been conducted. Heterogeneity was observed between the sample size and the years covered. Most studies are limited to small observational studies and single-institution case series. For these reasonsthere are only a total of 546 patients were included in the two groups for a study period spans more than a decade. Two of the studies comprise almost 65% of the patients and one study has only 20 patients; there are potential sources of bias in our work.Additional randomized controlled trials in the studies we accessed would have increased the strength of our results.There is a bias for the English language. Conclusion In our meta-analysis we found that for patients with metastatic lung cancer comparing VATS with thoracotomy showed almost equivalent survival rates. The VATS can not replace open thoracotomy completely. Further study is neededand a large multicenter randomized trial comparing VATS and thoracotomy would be ideal. Supporting Information Checklist S1 PRISMA Checklist. (DOC) Click here for additional data file. References 1 RuschVW (2010) Pulmonary metastasectomy: a moving target. J Thorac Oncol5: S130“13120502246 2 CassonAG PutnamJB NatarajanG JohnstonDA MountainC et al (1992) Five-year survival after pulmonary metastasectomy for adult soft tissue sarcoma. Cancer69: 662“6681730117 3 van HalterenHK van GeelAN HartAA ZoetmulderFA (1995) Pulmonary resection for metastases of colorectal origin. Chest107: 1526“15317781341 4 KandiolerD KromerE TuchlerH EndA MullerMR et al (1998) Long-term results after repeated surgical removal of pulmonary metastases. Ann Thorac Surg65: 909“9129564899 5 McCormackPM BainsMS BeggCB BurtME DowneyRJ et al (1996) Role of video-assisted thoracic surgery in the treatment of pulmonary metastases: results of a prospective trial. Ann Thorac Surg62: 213“216 discussion 216“217.8678645 6 SaishoS NakataM SawadaS YamashitaM SaekiH et al (2009) Evaluation of video-assisted thoracoscopic surgery for pulmonary metastases: 11-years of experience. Surg Endosc23: 55“6118437482 7 CerfolioRJ BryantAS McCartyTP MinnichDJ (2011) A prospective study to determine the incidence of non-imaged malignant pulmonary nodules in patients who undergo metastasectomy by thoracotomy with lung palpation. Ann Thorac Surg91: 1696“1700 discussion 1700“1691.21619965 8 DownsSH BlackN (1998) The feasibility of creating a checklist for the assessment of the methodological quality both of randomised and non-randomised studies of health care interventions. J Epidemiol Community Health52: 377“3849764259 9 KondoH OkumuraT OhdeY NakagawaK (2005) Surgical treatment for metastatic malignancies. Pulmonary metastasis: indications and outcomes. Int J Clin Oncol10: 81“8515864692 10 PorterGA CantorSB WalshGL RuschVW LeungDH et al (2004) Cost-effectiveness of pulmonary resection and systemic chemotherapy in the management of metastatic soft tissue sarcoma: a combined analysis from the University of Texas M. D. Anderson and Memorial Sloan-Kettering Cancer Centers. J Thorac Cardiovasc Surg127: 1366“137215115994 11 PetersenRP PhamD BurfeindWR HanishSI TolozaEM et al (2007) Thoracoscopic lobectomy facilitates the delivery of chemotherapy after resection for lung cancer. Ann Thorac Surg83: 1245“1249 discussion 1250.17383320 12 PaulS AltorkiNK ShengS LeePC HarpoleDH et al (2010) Thoracoscopic lobectomy is associated with lower morbidity than open lobectomy: a propensity-matched analysis from the STS database. J Thorac Cardiovasc Surg139: 366“37820106398 13 WhitsonBA GrothSS DuvalSJ SwansonSJ MaddausMA (2008) Surgery for early-stage non-small cell lung cancer: a systematic review of the video-assisted thoracoscopic surgery versus thoracotomy approaches to lobectomy. Ann Thorac Surg86: 2008“2016 discussion 2016“2008.19022040 14 EckardtJ LichtPB (2012) Thoracoscopic versus open pulmonary metastasectomy: a prospective sequentially controlled study. Chest142: 1598“160222677347 15 AmbrogiV PaciM PompeoE MineoTC (2000) Transxiphoid video-assisted pulmonary metastasectomy: relevance of helical computed tomography occult lesions. Ann Thorac Surg70: 1847“185211156082 16 MargaritoraS PorziellaV D'AndrilliA CesarioA GalettaD et al (2002) Pulmonary metastases: can accurate radiological evaluation avoid thoracotomic approach? Eur J Cardiothorac Surg21: 1111“111412048094 17 ParsonsAM DetterbeckFC ParkerLA (2004) Accuracy of helical CT in the detection of pulmonary metastases: is intraoperative palpation still necessary? Ann Thorac Surg78: 1910“1916 discussion 1916“1918.15561000 18 KaytonML HuvosAG CasherJ AbramsonSJ RosenNS et al (2006) Computed tomographic scan of the chest underestimates the number of metastatic lesions in osteosarcoma. J Pediatr Surg41: 200“206 discussion 200“206.16410133 19 Long-term results of lung metastasectomy: prognostic analyses based on 5206 cases. The International Registry of Lung Metastases. J Thorac Cardiovasc Surg113: 37“499011700 20 MutsaertsEL ZoetmulderFA RutgersEJ (2001) Port site metastasis as a complication of thoracoscopic metastatectomy. Eur J Surg Oncol27: 327“32811373113 21 JohnstonePA RohdeDC SwartzSE FetterJE WexnerSD (1996) Port site recurrences after laparoscopic and thoracoscopic procedures in malignancy. J Clin Oncol14: 1950“19568656265 22 TreasureT (2007) Pulmonary metastasectomy: a common practice based on weak evidence. Ann R Coll Surg Engl89: 744“74817999813 23 RothJA PassHI WesleyMN WhiteD PutnamJB et al (1986) Comparison of median sternotomy and thoracotomy for resection of pulmonary metastases in patients with adult soft-tissue sarcomas. Ann Thorac Surg42: 134“1383741009 24 FloresRM IhekweazuUN RizkN DycocoJ BainsMS et al (2011) Patterns of recurrence and incidence of second primary tumors after lobectomy by means of video-assisted thoracoscopic surgery (VATS) versus thoracotomy for lung cancer. J Thorac Cardiovasc Surg141: 59“6421055770 25 SchaeffB PaolucciV ThomopoulosJ (1998) Port site recurrences after laparoscopic surgery. A review. Dig Surg15: 124“1349845574 26 ChenYR YeowKM LeeJY SuIH ChuSY et al (2007) CT-guided hook wire localization of subpleural lung lesions for video-assisted thoracoscopic surgery (VATS). J Formos Med Assoc106: 911“91818063512 27 MolnarTF GebitekinC TurnaA (2010) What are the considerations in the surgical approach in pulmonary metastasectomy? J Thorac Oncol5: S140“14420502249 28 NakajimaJ TakamotoS TanakaM TakeuchiE MurakawaT et al (2001) Thoracoscopic surgery and conventional open thoracotomy in metastatic lung cancer. Surg Endosc15: 849“85311443456 29 MutsaertsEL ZoetmulderFA MeijerS BaasP HartAA et al (2002) Long term survival of thoracoscopic metastasectomy vs metastasectomy by thoracotomy in patients with a solitary pulmonary lesion. Eur J Surg Oncol28: 864“86812477479 30 NakasA KlimatsidasMN EntwisleJ Martin-UcarAE WallerDA (2009) Video-assisted versus open pulmonary metastasectomy: the surgeon's finger or the radiologist's eye? Eur J Cardiothorac Surg36: 469“47419464921 31 CarballoM MaishMS JaroszewskiDE HolmesCE (2009) Video-assisted thoracic surgery (VATS) as a safe alternative for the resection of pulmonary metastases: a retrospective cohort study. J Cardiothorac Surg4: 1319239710 32 GossotD RaduC GirardP Le CesneA BonvalotS et al (2009) Resection of pulmonary metastases from sarcoma: can some patients benefit from a less invasive approach? Ann Thorac Surg87:"
Lung_Cancer
"A mean reduction of 20% was observed in average percentage changes over time in tumour burden (sum of largest diameters of target lesions) from baseline. Of the 38 patients evaluable for efficacy 22 (58%) developed hypertension as AE during the study. Seven (7 out of 22=32%) had a PR compared with only three with no hypertension (3 out of 16=18%) suggesting that patients who developed hypertension may have had a higher likelihood of response to this treatment. Correlative studies Participation in the correlative studies was optional. Erythropoietin levels were obtained from 16 patients. No trend towards increase in haemoglobin or change in erythropoietin level was seen over time. Pharmacokinetic and antibody evaluation Twenty-three patients participated in blood sampling for PK analysis. Mean observed noncompartmental PK parameters for free ziv-aflibercept are presented in . The concentration“time profiles and PK of free ziv-aflibercept and adjusted bound ziv-aflibercept: VEGF were consistent with results in the phase I study (Diaz-Padilla et al 2012). Mean trough concentrations after the second ziv-aflibercept dose plateaued and remained at ?10?mg?l?1. The mean adjusted bound ziv-aflibercept:VEGF complex Cmax was 7.81?mg?l?1. Trough concentrations plateaued after day 42 and remained constant for the remainder of the study. Two patients had one sample each that was positive in the anti-drug antibody (ADA) assay. One was positive at baseline but did not have an antibody titre drawn at the end of treatment (EOT) visit. This patient completed all six cycles of combination treatment without dose delay/reduction or grade 3/4 AEs and had stable disease. The other one was negative at baseline but positive at the EOT visit. This patient experienced anaphylaxis 20?minutes after start of the ziv-aflibercept infusion on day 1 of the second cycle. Study drug was permanently withdrawn. This patient had PK parameters and a concentration“time profile different from ADA-negative patients probably because of the ADA formation. Discussion Ziv-aflibercept has been tested as a single agent and in combination with chemotherapy in the treatment of NSCLC (Leighl et al 2010; Ramlau et al 2012). On the basis of activity and safety profile we conducted the current phase II study to explore the efficacy of ziv-aflibercept in the first-line setting. Similar to ECOG 4599 AVAiL and PointBreak trials (Sandler et al 2006; Patel et al 2009a; Reck et al 2009) this study was designed to test a three-drug regimen including an anti-angiogenesis agent in this case ziv-aflibercept/cisplatin/pemetrexed. In addition maintenance therapy with single-agent ziv-aflibercept was intended to prolong the benefits and delay the development of resistance. This approach was first tested in a phase I dose-escalation study that used the same regimen of ziv-aflibercept/cisplatin/pemetrexed in 18 patients with advanced solid tumours (Diaz-Padilla et al 2012). Our study population was representative of patients with advanced NSCLC. Overall the median ziv-aflibercept dose intensity was similar to the planned intensity. The delivered dose intensities of pemetrexed/cisplatin in this study were over 98% higher than those in the pemetrexed/cisplatin arm (94.8% and 95.0% respectively) of the phase III trial (Scagliotti et al 2008). The PK of ziv-aflibercept in this study was characterised as nonlinear and similar to that observed in the phase I study. The mean observed terminal t1/2 was independent of ziv-aflibercept dose. Administration of ziv-aflibercept did not alter pemetrexed PK. Development of ADA was a rare event leading to reduced drug concentration in one patient who experienced anaphylaxis. As with all therapeutic proteins there is a potential for immunogenicity; however severe hypersensitivity reactions are rare. Although this study was terminated early the two co-primary end points ORR of 26% and median PFS of 5 months were in accordance with most historical first-line NSCLC studies (Schiller et al 2002; Scagliotti et al 2008) and slightly less than triplet regimens incorporating another anti-VEGF agent (Sandler et al 2006; Reck et al 2009). However there was no statistical power to test the primary hypothesis that ziv-aflibercept would enhance the efficacy of standard chemotherapy in NSCLC. Biomarkers that can reliably predict the degree of VEGF blockade in vivo are currently not available. Preclinical studies identified increased erythropoietin production and erythropoiesis as a possible surrogate marker of VEGF inhibition as animal data indicate that stringent VEGF inhibition including by ziv-aflibercept modulates erythropoiesis via increased hepatic erythropoietin synthesis (Tam et al 2006). Bevacizumab has also been associated with increased haemoglobin in NSCLC (Riess et al 2012) and reduced anaemia (Sher and Wu 2011). Therefore this study explored whether the increase in haemoglobin observed previously could be reproduced in the presence of chemotherapy and would correlate with anti-angiogenic activity. No trend towards increase in haemoglobin or change in erythropoietin level was found in a small subset of patients. However as in the phase I study a stabilisation of median haemoglobin values for multiple cycles as well as low rate of all-grade anaemia was observed. The result provides some support for the hypothesis that VEGF is a negative regulator of erythropoiesis and its inhibitors may have a role in the management of anaemia. The toxicity profile of this trial was consistent with published data on cisplatin plus pemetrexed and with the known effects of ziv-aflibercept with the exception of a higher than anticipated rate of RPLS (Gadgeel 2012). Hypertension was the third most frequent TEAE and is a known adverse effect of anti-VEGF therapies. However higher response rate was observed among patients who developed hypertension during the treatment than among those who did not in a post hoc analysis. This observation is consistent with data from ECOG 4599 that suggested improved outcomes associated with bevacizumab in patients developing hypertension on therapy (Dahlberg et al 2010). Although cases of RPLS have been observed in other ziv-aflibercept studies the 7% rate observed in this study was much higher. It should be noted that the dose and schedule of ziv-aflibercept in this study at 6?mg?kg?1 every 21 days is different from the one approved in colorectal cancer at 4?mg?kg?1 every 14 days (Van Cutsem et al 2012) although the dose intensity is the same at 2?mg?kg?1 per week. At the recommended phase II dose of 6?mg?kg?1 for ziv-aflibercept no RPLS was reported in the phase I study that used the same regimen (N=7 at that dose level; Diaz-Padilla et al 2012) or in another phase I study of ziv-aflibercept/cisplatin/docetaxel (N=17 at that dose level; Freyer et al 2012) nor in combination with docetaxel in the VITAL study (N=456 in the combination arm; Ramlau et al 2012). A meta-analysis of safety data from three large placebo-controlled studies reported no RPLS among 1333 patients treated with ziv-aflibercept in combination with standard chemotherapy (Allegra et al 2012). It is likely that the development of RPLS may be regimen dependent rather than dose or schedule dependent. Reversible posterior leukoencephalopathy syndrome is described as a brain-capillary leak syndrome frequently related to hypertension fluid retention and possibly the cytotoxic effects of immunosuppressive agents on the vascular endothelium (Hinchey et al 1996). Risk factors include female sex hypertension and renal dysfunction (Vaughn et al 2008) as well as anticancer agents: 75% were diagnosed in women and 71% were associated with combination regimens (Marinella and Markert 2009). Bevacizumab and gemcitabine have been most commonly associated with RPLS. Treatment including cisplatin without concomitant anti-VEGF therapy has been associated with RPLS (Ito et al 1998) whereas pemetrexed before this study was not. Consistent with the literature the three cases of RPLS were all diagnosed in women which may be related to an anticancer drug“oestrogen interaction inducing altered cerebral vasoreactivity and endothelial dysfunction. Agents that decrease VEGF signalling increases the risk of RPLS (including bevacizumab sunitinib sorafenib and ziv-aflibercept) suggesting a class effect toxicity (Glusker et al 2006). Clinical features of RPLS are neurological symptoms characterized by headaches altered mental status visual disturbances or seizures and systemic signs such as hypertension. Onset is variable ranging from hours to 1 month after completing therapy (Lee et al 2008). Characteristic findings in brain MRI demonstrate bilateral symmetric parieto-occipital subcortical and cortical vasogenic oedema (Bartynski 2008). Removal of the causative agent and treatment of hypertension and renal insufficiency are indicated for RPLS which is usually but not always reversible clinically. In conclusion this phase II study was designed to evaluate ziv-aflibercept in combination with cisplatin and pemetrexed in patients with untreated advanced/metastatic non-squamous NSCLC. However three confirmed and two suspected but unconfirmed cases of RPLS led to the early termination of the trial. The reason for the increased incidence of RPLS might be related to declining CrCL and/or increased BP. Although ORR and median PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further pursued in NSCLC. Future efforts to identify predictive biomarkers of anti-VEGF agents are warranted. This study was supported by Sanofi and Regeneron Pharmaceuticals. We thank all the patients who participated in this study. We also thank all the participating study sites and the investigators and research staff. This work is published under the standard license to publish agreement. After 12 months the work will become freely available and the license terms will switch to a Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. Drs Liu Gao and DiCioccio are employees of Regeneron Pharmaceuticals Inc. The remaining authors declare no conflict of interest. Allegra CJ Tabernero J Rougier P Scagliotti GV Philip PA Lakomy R Ramlau R Assadourian S Chevalier S Van Cutsem E 2012 Meta-analysis of anti-VEGF class adverse events from three double-blind (Db) placebo (Pbo)-controlled phase III trials with IV aflibercept (Afl) J Clin Oncol 30 (Suppl 4 abstract 561 Bartynski WS 2008 Posterior reversible encephalopathy syndrome part 1: fundamental imaging and clinical features AJNR Am J Neuroradiol 29 1036 1042 18356474 Dahlberg SE Sandler AB Brahmer JR Schiller JH Johnson DH 2010 Clinical course of advanced non-small-cell lung cancer patients experiencing hypertension during treatment with bevacizumab in combination with carboplatin and paclitaxel on ECOG 4599 J Clin Oncol 28 949 954 20085937 de Groot JF Lamborn KR Chang SM Gilbert MR Cloughesy TF Aldape K Yao J Jackson EF Lieberman F Robins HI Mehta MP Lassman AB DeAngelis LM Yung WKA Chen A Prados MD Wen PY 2011 Phase II study of aflibercept in recurrent malignant glioma: A North American Brain Tumor Consortium Study J Clin Oncol 29 2689 2695 21606416 Diaz-Padilla I Siu LL San Pedro-Salcedo M Razak ARA Colevas AD Shepherd FA Leighl NB Neal JW Thibault A Liu L Lisano J Gao B Lawson EB Wakelee HA 2012 A phase I dose-escalation study of aflibercept administered in combination with pemetrexed and cisplatin in patients with advanced solid tumours Br J Cancer 107 604 611 22805331 Dowlati A 2010 Hunting and trapping the vascular endothelial growth factor J Clin Oncol 28 185 187 19949005 Ferrara N Davis-Smyth T 1997 The biology of vascular endothelial growth factor Endocr Rev 18 4 25 9034784 Folkman J 1995 Clinical applications of research on angiogenesis N Engl J Med 333 1757 1763 7491141 Freyer G Isambert N You B Zanetta S Falandry C Favier L Trillet-Lenoir V Assadourian S Soussan-Lazard K Ziti-Ljajic S Fumoleau P 2012 Phase I dose-escalation study of aflibercept in combination with docetaxel and cisplatin in patients with advanced solid tumours Br J Cancer 107 598 603 22790797 Gadgeel SM 2012 Safety profile and tolerability of antiangiogenic agents in non-small-cell lung cancer Clin Lung Cancer 13 96 106 22056889 Gaya A Tse V 2012 A preclinical and clinical review of aflibercept for the management of cancer Cancer Treat Rev 38 484 493 22264850 Glusker P Recht L Lane B 2006 Reversible posterior leukoencephalopathy syndrome and bevacizumab N Engl J Med 354 980 982 16510760 Hinchey J Chaves C Appignani B Breen J Pao L Wang A Pessin MS Lamy C Mas J-L Caplan LR 1996 A reversible posterior leukoencephalopathy syndrome N Engl J Med 334 494 500 8559202 Isambert N Freyer G Zanetta S You B Fumoleau P Falandry C Favier L Assadourian S Soussan-Lazard K Ziti-Ljajic S Trillet-Lenoir V 2012 Phase I dose-escalation study of intravenous aflibercept in combination with docetaxel in patients with advanced solid tumors Clin Cancer Res 18 1743 1750 22261804 Ito Y Arahata Y Goto Y Hirayama M Nagamutsu M Yasuda T Yanagi T Sobue G 1998 Cisplatin neurotoxicity presenting as reversible posterior leukoencephalopathy syndrome AJNR Am J Neuroradiol 19 415 417 9541291 Jain RK 2001 Normalizing tumor vasculature with anti-angiogenic therapy: A new paradigm for combination therapy Nat Med 7 987 989 11533692 Korpanty G Smyth E Sullivan LA Brekken RA Carney DN 2010 Antiangiogenic therapy in lung cancer: focus on vascular endothelial growth factor pathway Exp Biol Med 235 3 9 Lassoued W Murphy D Tsai J Oueslati R Thurston G Lee WMF 2010 Effect of VEGF and VEGF Trap on vascular endothelial cell signaling in tumors Cancer Biol Ther 10 1326 1333 21079419 Lee VH Wijdicks EFM Manno EM Rabinstein AA 2008 Clinical spectrum of reversible posterior leukoencephalopathy syndrome Arch Neurol 65 205 210 18268188 Leighl NB Raez LE Besse B Rosen PJ Barlesi F Massarelli E Gabrail N Hart LL Albain KS Berkowitz L Melnyk O Shepherd FA Sternas L Ackerman J Shun Z Miller VA Herbst RS 2010 A multicenter phase 2 study of vascular endothelial growth factor trap (aflibercept) in platinum- and erlotinib-resistant adenocarcinoma of the lung J Thorac Oncol 5 1054 1059 20593550 Lockhart AC Rothenberg ML Dupont J Cooper W Chevalier P Sternas L Buzenet G Koehler E Sosman JA Schwartz LH Gultekin DH Koutcher JA Donnelly EF Andal R Dancy I Spriggs DR Tew WP 2010 Phase I study of intravenous vascular endothelial growth factor trap aflibercept in patients with advanced solid tumors J Clin Oncol 28 207 214 19949018 Marinella MA Markert RJ 2009 Reversible posterior leucoencephalopathy syndrome associated with anticancer drugs Intern Med J 39 826 834 19220526 National Cancer Institute2006Common Terminology Criteria for Adverse Events Version 3.0. Available from http://ctep.cancer.gov (accessed 28 August 2013). Patel JD Bonomi P Socinski MA Govindan R Hong S Obasaju C Pennella EJ Girvan AC Guba SC 2009 Treatment rationale and study design for the PointBreak study: A randomized open-label phase III study of pemetrexed/carboplatin/bevacizumab followed by maintenance pemetrexed/bevacizumab versus paclitaxel/carboplatin/bevacizumab followed by maintenance bevacizumab in patients with stage IIIB or IV nonsquamous non“small-cell lung cancer Clin Lung Cancer 10 252 256 19632943 Patel JD Hensing TA Rademaker A Hart EM Blum MG Milton DT Bonomi PD 2009 Phase II study of pemetrexed and carboplatin plus bevacizumab with maintenance pemetrexed and bevacizumab as first-line therapy for nonsquamous non“small-cell lung cancer J Clin Oncol 27 3284 3289 19433684 Ramlau R Gorbunova V Ciuleanu TE Novello S Ozguroglu M Goksel T Baldotto C Bennouna J Shepherd FA Le-Guennec S Rey A Miller VA Thatcher N Scagliotti GV 2012 Aflibercept and docetaxel versus docetaxel alone after platinum failure in patients with advanced or metastatic non-small-cell lung cancer: a randomized controlled phase III trial J Clin Oncol 30 3640 3647 22965962 Reck M von Pawel J Zatloukal P Ramlau R Gorbounova V Hirsh V Leighl N Mezger J Archer V Moore N Manegold C 2009 Phase III trial of cisplatin plus gemcitabine with either placebo or bevacizumab as first-line therapy for nonsquamous non-small-cell lung cancer: AVAiL J Clin Oncol 27 1227 1234 19188680 Riess JW Logan AC Krupitskaya Y Padda S Clement-Duchene C Ganjoo K Colevas AD Pedro-Salcedo MS Kuo CJ Wakelee HA 2012 Maintenance bevacizumab is associated with increased hemoglobin in patients with advanced nonsquamous non-small cell lung cancer Cancer Invest 30 231 235 22360362 Sandler AB Gray R Perry MC Brahmer J Schiller JH Dowlati A Lilenbaum R Johnson DH 2006 Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer N Engl J Med 355 2542 2550 17167137 Scagliotti GV Parikh P von Pawel J Biesma B Vansteenkiste J Manegold C Serwatowski P Gatzemeier U Digumarti R Zukin M Lee JS Mellemgaard A Park K Patil S Rolski J Goksel T de Marinis F Simms L Sugarman KP Gandara D 2008 Phase III study comparing cisplatin plus gemcitabine with cisplatin plus pemetrexed in chemotherapy-naive patients with advanced-stage non-small-cell lung cancer J Clin Oncol 26 3543 3551 18506025 Schiller JH Harrington DP Belani CP Langer CJ Sandler AB Krook JE Zhu J Johnson DH the Eastern Cooperative Oncology Group 2002 Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer N Engl J Med 346 92 98 11784875 Sher A Wu S 2011 Anti-vascular endothelial growth factor antibody bevacizumab reduced the risk of anemia associated with chemotherapy“A meta-analysis Acta Oncol 50 997 1005 21554028 Sitohy B Nagy JA Jaminet S-CS Dvorak HF 2011 Tumor-surrogate blood vessel subtypes exhibit differential susceptibility to anti-VEGF therapy Cancer Res 71 7021 7028 21937680 Tam BYY Wei K Rudge JS Hoffman J Holash J Park S Yuan J Hefner C Chartier C Lee J-S Jiang S Nayak NR Kuypers FA Ma L Sundram U Wu G Garcia JA Schrier SL Maher JJ Johnson RS Yancopoulos GD Mulligan RC Kuo CJ 2006 VEGF modulates erythropoiesis through regulation of adult hepatic erythropoietin synthesis Nat Med 12 793 800 16799557 Tew WP Gordon M Murren J Dupont J Pezzulli S Aghajanian C Sabbatini P Mendelson D Schwartz L Gettinger S Psyrri A Cedarbaum JM Spriggs DR 2010 Phase 1 study of aflibercept administered subcutaneously to patients with advanced solid tumors Clin Cancer Res 16 358 366 20028764 Therasse P Arbuck SG Eisenhauer EA Wanders J Kaplan RS Rubinstein L Verweij J Van Glabbeke M van Oosterom AT Christian MC Gwyther SG 2000 New guidelines to evaluate the response to treatment in solid tumors (RECIST Guidelines) J Natl Cancer Inst 92 205 216 10655437 Van Cutsem E Tabernero J Lakomy R Prenen H Prausova J Macarulla T Ruff P van Hazel GA Moiseyenko V Ferry D McKendrick J Polikoff J Tellier A Castan R Allegra C 2012 Addition of aflibercept to fluorouracil leucovorin and irinotecan improves survival in a phase III randomized trial in patients with metastatic colorectal cancer previously treated with an oxaliplatin-based regimen J Clin Oncol 30 3499 3506 22949147 Vaughn C Zhang L Schiff D 2008 Reversible posterior leukoencephalopathy syndrome in cancer Curr Oncol Rep 10 86 91 18366965 Figure 1 (A) The Kaplan“Meier curve of PFS (N=38). Median PFS: 5 months (95% CI 4.3“7.1). (B) Brain MRI of a patient diagnosed with RPLS. Extensive increased T2 signal of a few scattered areas of restricted diffusion and vasogenic oedema in the frontal cortex/subcortical regions near the vertex and the parietal and occipital regions bilaterally (arrows). No focal enhancing lesions to suggest metastatic disease. Table 1 Baseline demographics (N=42) Age (years) Median 61.5 Range (years)"
Lung_Cancer
"The second patient with EGFR mutation achieved the longest PFS and OS (727 and 1249 days respectively). .0087629.g007 Kaplan-Meier estimates of PFS and OS. No statistically significant difference (P?=?0.007) in PFS was observed between metabolic non-progressive (mNP) patients (median PFS 292 days ; range 190“727) and metabolic (mP) progressive patients (median PFS 64 days ; range: 37“216). Improved PFS in non-progressive patients was associated with prolonged OS (mNP; n?=?4; median OS: 1031 days ; 296 to 1249 days versus mP; n?=?8 ; 337 5 days ; 71 to 734 days) (HR 0.34; 95% CI 0.06 to 0.84; P?=?0.03). Discussion Despite the widespread use of [18F]FDG-PET/CT in NSCLC staging a large-scale study recently failed to confirm an overall survival gain in NSCLC patients.[17] This result highlights the value of [18F]FDG-PET/CT in unmet clinical needs such as prediction of residual NSCLC after surgery[18] neoadjuvant therapy[19] or antineoplastic therapy.[20] Prediction of response to antineoplastic therapies would appear to be particularly adapted to targeted therapies that do not induce rapid tumor shrinkage. NSCLC preclinical models have validated this hypothesis with both gefitinib[21] and erlotinib.[22] This original method could compensate for the weakness of RECIST criteria and has led to the proposal of evaluation of new criteria by addition metabolic evaluation by FDG-PET to CT scan.[23] The value of PET in evaluation of response to new targeted therapies emerged in the early 2000 s with the first reports on the efficacy of imatinib mesylate in Gastro Intestinal Stromal Tumor (GIST). Subsequently many studies have confirmed that PET is able to identify very early (i.e. only 24 hours after initiation of treatment) a decrease in glucose metabolism which is correlated with overall survival and progression-free survival of patients with GIST.[24] [25] In the present exploratory study a decrease in SUVmax of at least 21.6% soon after starting therapy (9±3 days) was able to discriminate progressive from non-progressive patients and was associated with improved PFS and OS. This result confirms the results of Mileshkin et al. who showed in a series of 51 patients receiving second- or third-line treatment with erlotinib that an early (14 days) [18F]FDG-PET partial metabolic response was associated with improved PFS and OS even in the absence of subsequent RECIST response.[26] Evaluation of response by [18F]FDG-PET can be performed semi-quantitatively for instance by establishing a SUV cut-off to discriminate metabolic progressive patients from non-metabolic progressive patients. This patient classification (mP/mNP) seems to be more appropriate to assess response to cytostatic therapy that is designed to stabilize disease rather than achieve complete response. The main difficulty of this approach is the overlap of SUV changes between mP and mNP patients. Furthermore different cut-off variations can be expected depending on the types of SUV measured the types of drugs used and the types of tumors which increase the difficulty of establishing a reliable SUV cut-off. However despite the absence of consensus on the most appropriate cut-off value it is generally admitted that the rationale for metabolic response or non-progression of tumor is decreased [18F]FDG tumor uptake or at least stability of tumor uptake over time respectively. Another limitation of semi-quantitative analysis of FDG-PET is that it does not take into account the development of new lesions. However PET detection of new lesions early in the course of therapy has been reported to be a strong independent predictive factor of OS in NSCLC patients treated by EGFR inhibitor.[27] Our findings are consistent with this observation as new lesions occurred in 2/8 patients correctly classified as progressive on PET2 and in 4/5 patients correctly classified as progressive on PET3. One patient (patient #7) was reclassified as mP on PET3 due to the appearance of a new lesion despite a decrease of SUVmax to below the cut-off value. As in our study previous studies failed to demonstrate any difference between SUVmax and SUVpeak.[22] [28] However SUVmax remains the standard for semi-quantitative [18F]FDG-PET assessment probably because is a parameter that can be reliably reproduced by independent operators. It is noteworthy that in our study no significant difference in mean SUV values was observed between PET1 PET2 and PET3 which can be explained by the nature of the cytostatic therapy. 11/12 patients were correctly classified (P versus NP) by PET2 and 10/10 were correctly classified by PET3 by applying the SUV cut-off determined by ROC analysis. In 9/10 patients PET3 revealed response information concordant with PET2. The only patient with discordant [18F]FDG-PET findings was classified by SUV analysis as progressive on PET2 and non-progressive on PET3. Blood glucose injected dose or uptake time were normal and/or not significantly different between PET2 and PET3 (1.16 and 1.4 g/l; 261 and 262 MBq; 60 and 75 min respectively) excluding any to methodology-related error. A flare-up phenomenon could be proposed as described on several occasions on [18F]FDG-PET during cytotoxic treatments for squamous cell carcinoma in prostate cancer patients with bone metastases[29]“[33] and particularly NSCLC patients treated with erlotinib presenting an osteoblastic bone flare-up response mimicking disease progression.[34] Benz et al also described a case of flare-up on early PET in a NSCLC patient treated by erlotinib.[27] Another explanation is that the P/NP classification probably increases mismatches of response assessments related to a discordant outcome of patients with stable disease.[27] Our results suggest that therapeutic efficacy PFS and OS of erlotinib therapy can be predicted 2 weeks after starting erlotinib. These data are consistent with the data of a retrospective study recently published by Kobe et al.[26] [35] At the present time anticancer therapy is currently monitored in the context of hormone-sensitive cancers by regular assay of tumor markers (such as prostate-specific antigen in prostate cancer). The efficacy of hormonal therapy is reflected by a decrease in blood levels of the marker. When the marker remains elevated hormonal therapy is considered to be ineffective and is therefore stopped. Repeated PET imaging can be considered to be a promising approach to evaluate cancer therapy such as targeted therapies that do not induce tumor shrinkage. This new approach appears to be supported by the results of recent clinical trials. The ˜Tarceva Versus Docetaxel or Pemetrexed for Second Line Chemotherapy of Advanced Stage NSCLC™ (TITAN) trial failed to demonstrate an improvement in OS with erlotinib compared to chemotherapy in unselected NSCLC patients receiving second-line treatment (HR?=?0.96; 95% CI 0.78“1.19; p?=?0.73).[36] In a similar group of NSCLC patients the results of the TAILOR trial indicated a highly significant increase of PFS in favor of docetaxel (HR?=?0.71; 95% CI 0.53“0.95; p?=?0.02) versus erlotinib.[37] We consider that evaluation of the metabolic response to erlotinib could provide useful information to rapidly identify patients in whom erlotinib therapy is ineffective especially in EGFR patients without EGFR-activating mutations or unknown status. [18F]FDG-PET could also become a theranostic tool for clinicians. By stopping ineffective therapy earlier physicians can rapidly propose other drugs to a larger proportion of patients with better performance status. This approach could increase the number of patients included in early trials and accelerate drug development. However no medico-economic study has been conducted to determine whether the additional costs induced by [18F]FDG-PET are compensated by the decreased costs of drug (erlotinib) and medical care induced by side effects. Our study highlights the need for more prospective and randomized studies to evaluate the theranostic use of [18F]FDG-PET for management of erlotinib therapy in NSCLC including medico-economic considerations. Conclusion [18F]FDG-PET performed within two weeks of starting erlotinib therapy (9±3 days) appears to be able to predict morphologic response at 2 months according to RECIST criteria. [18]FDG-PET may be clinically useful for early evaluation of targeted therapies as a theranostic tool. Nathalie BAIZE MD Université d'Angers CHU Angers Pôle des Spécialités Médicales et Chirurgicales Intégrées Département de Pneumologie Angers France References 1 FerlayJ ParkinDM Steliarova-FoucherE (2010) Estimates of cancer incidence and mortality in Europe in 2008. Eur J Cancer46: 765“78120116997 2 JemalA BrayF CenterMM FerlayJ WardE et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 3 Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials. Non-small Cell Lung Cancer Collaborative Group. BMJ311: 899“909 4 SchillerJH HarringtonD BelaniCP LangerC SandlerA et al (2002) Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med346: 92“9811784875 5 LynchTJ BellDW SordellaR GurubhagavatulaS OkimotoRA et al (2004) Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med350: 2129“213915118073 6 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 7 RosellR CarcerenyE GervaisR VergnenegreA MassutiB et al (2012) Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial. Lancet Oncol13: 239“24622285168 8 ShepherdFA Rodrigues PereiraJ CiuleanuT TanEH HirshV et al (2005) Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med353: 123“13216014882 9 CappuzzoF CiuleanuT StelmakhL CicenasS SzczesnaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 521“52920493771 10 MillerAB HoogstratenB StaquetM WinklerA (1981) Reporting results of cancer treatment. Cancer47: 207“2147459811 11 TherasseP ArbuckSG EisenhauerEA WandersJ KaplanRS et al (2000) New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst92: 205“21610655437 12 EisenhauerEA TherasseP BogaertsJ SchwartzLH SargentD et al (2009) New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer45: 228“24719097774 13 FischerBM MortensenJ HojgaardL (2001) Positron emission tomography in the diagnosis and staging of lung cancer: a systematic quantitative review. Lancet Oncol2: 659“66611902536 14 LardinoisD WederW HanyTF KamelEM KoromS et al (2003) Staging of non-small-cell lung cancer with integrated positron-emission tomography and computed tomography. N Engl J Med348: 2500“250712815135 15 VansteenkisteJF StroobantsSG DupontPJ De LeynPR VerbekenEK et al (1999) Prognostic importance of the standardized uptake value on (18)F-fluoro-2-deoxy-glucose-positron emission tomography scan in non-small-cell lung cancer: An analysis of 125 cases. Leuven Lung Cancer Group. J Clin Oncol17: 3201“320610506619 16 BerghmansT DusartM PaesmansM Hossein-FoucherC BuvatI et al (2008) Primary tumor standardized uptake value (SUVmax) measured on fluorodeoxyglucose positron emission tomography (FDG-PET) is of prognostic value for survival in non-small cell lung cancer (NSCLC): a systematic review and meta-analysis (MA) by the European Lung Cancer Working Party for the IASLC Lung Cancer Staging Project. J Thorac Oncol3: 6“1218166834 17 DinanMA CurtisLH CarpenterWR BiddleAK AbernethyAP et al (2012) Stage migration selection bias and survival associated with the adoption of positron emission tomography among medicare beneficiaries with non-small-cell lung cancer 1998-2003. J Clin Oncol30: 2725“273022753917 18 VelazquezER AertsHJ OberijeC De RuysscherD LambinP (2010) Prediction of residual metabolic activity after treatment in NSCLC patients. Acta Oncol49: 1033“103920831492 19 AukemaTS KappersI OlmosRA CodringtonHE van TinterenH et al (2010) Is 18F-FDG PET/CT useful for the early prediction of histopathologic response to neoadjuvant erlotinib in patients with non-small cell lung cancer? J Nucl Med51: 1344“134820720059 20 plannedT SchefflerM NogovaL KobeC Engel-RiedelW et al (2011) Early prediction of nonprogression in advanced non-small-cell lung cancer treated with erlotinib by using [(18)F]fluorodeoxyglucose and [(18)F]fluorothymidine positron emission tomography. J Clin Oncol29: 1701“170821422426 21 SuH BodensteinC DumontRA SeimbilleY DubinettS et al (2006) Monitoring tumor glucose utilization by positron emission tomography for the prediction of treatment response to epidermal growth factor receptor kinase inhibitors. Clin Cancer Res12: 5659“566717020967 22 UllrichRT ZanderT NeumaierB KokerM ShimamuraT et al (2008) Early detection of erlotinib treatment response in NSCLC by 3?-deoxy-3?-[F]-fluoro-L-thymidine ([F]FLT) positron emission tomography (PET). PLoS One3: e390819079597 23 WahlRL JaceneH KasamonY LodgeMA (2009) From RECIST to PERCIST: Evolving Considerations for PET response criteria in solid tumors. J Nucl Med50 Suppl 1122S“150S19403881 24 StroobantsS GoeminneJ SeegersM DimitrijevicS DupontP et al (2003) 18FDG-Positron emission tomography for the early prediction of response in advanced soft tissue sarcoma treated with imatinib mesylate (Glivec). Eur J Cancer39: 2012“202012957455 25 Van den AbbeeleAD (2008) The lessons of GIST“PET and PET/CT: a new paradigm for imaging. Oncologist13 Suppl 28“1318434632 26 MileshkinL HicksRJ HughesBG MitchellPL CharuV et al (2011) Changes in 18F-fluorodeoxyglucose and 18F-fluorodeoxythymidine positron emission tomography imaging in patients with non-small cell lung cancer treated with erlotinib. Clin Cancer Res17: 3304“331521364032 27 BenzMR HerrmannK WalterF GaronEB ReckampKL et al (2011) (18)F-FDG PET/CT for monitoring treatment responses to the epidermal growth factor receptor inhibitor erlotinib. J Nucl Med52: 1684“168922045706 28 KahramanD SchefflerM ZanderT NogovaL LammertsmaAA et al (2011) Quantitative analysis of response to treatment with erlotinib in advanced non-small cell lung cancer using 18F-FDG and 3?-deoxy-3?-18F-fluorothymidine PET. J Nucl Med52: 1871“187722065872 29 BjurbergM HenrikssonE BrunE EkbladL OhlssonT et al (2009) Early changes in 2-deoxy-2-[18F]fluoro-D-glucose metabolism in squamous-cell carcinoma during chemotherapy in vivo and in vitro. Cancer Biother Radiopharm24: 327“33219538055 30 MessiouC CookG ReidAH AttardG DearnaleyD et al (2011) The CT flare response of metastatic bone disease in prostate cancer. Acta Radiol52: 557“56121498309 31 KrupitskayaY EslamyHK NguyenDD KumarA WakeleeHA (2009) Osteoblastic bone flare on F18-FDG PET in non-small cell lung cancer (NSCLC) patients receiving bevacizumab in addition to standard chemotherapy. J Thorac Oncol4: 429“43119247091 32 BiersackHJ BenderH PalmedoH (2004) FDG-PET in monitoring therapy of breast cancer. Eur J Nucl Med Mol Imaging31 Suppl 1S112“11715112111 33 MortimerJE DehdashtiF SiegelBA TrinkausK KatzenellenbogenJA et al (2001) Metabolic flare: indicator of hormone responsiveness in advanced breast cancer. J Clin Oncol19: 2797“280311387350 34 LindJS PostmusPE SmitEF (2010) Osteoblastic bone lesions developing during treatment with erlotinib indicate major response in patients with non-small cell lung cancer: a brief report. J Thorac Oncol5: 554“55720357621 35 KobeC SchefflerM HolsteinA ZanderT NogovaL et al (2012) Predictive value of early and late residual 18F-fluorodeoxyglucose and 18F-fluorothymidine uptake using different SUV measurements in patients with non-small-cell lung cancer treated with erlotinib. Eur J Nucl Med Mol Imaging39: 1117“112722526960 36 CiuleanuT StelmakhL CicenasS MiliauskasS GrigorescuAC et al (2012) Efficacy and safety of erlotinib versus chemotherapy in second-line treatment of patients with advanced non-small-cell lung cancer with poor prognosis (TITAN): a randomised multicentre open-label phase 3 study. Lancet Oncol13: 300“30822277837 37 GarassinoMC MartelliO BrogginiM FarinaG VeroneseS et al (2013) Erlotinib versus docetaxel as second-line treatment of patients with advanced non-small-cell lung cancer and wild-type EGFR tumours (TAILOR): a randomised controlled trial. Lancet Oncol14: 981“98823883922 Nucleic Acids Res Nucleic Acids Res nar nar Nucleic Acids Research 0305-1048 1362-4962 Oxford University Press 24970867 4117748 10.1093/nar/gku489 15 Methods Online Integrated RNA and DNA sequencing improves mutation detection in low purity tumors Wilkerson Matthew D. 1 2 * Cabanski Christopher R. 1 3 Sun Wei 2 4 Hoadley Katherine A. 1 2 Walter Vonn 1 Mose Lisle E. 1 Troester Melissa A. 1 5 Hammerman Peter S. 6 7 Parker Joel S. 1 2 Perou Charles M. 1 2 Hayes D. Neil 1 8 * 1Lineberger Comprehensive Cancer Center University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 2Department of Genetics University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 3The Genome Institute at Washington University St. Louis MO 63108 USA 4Department of Biostatistics University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 5Department of Epidemiology University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA 6Department of Medical Oncology Dana-Farber Cancer Institute Boston MA 02215 USA 7Broad Institute of Harvard and MIT Cambridge MA 02142 USA 8Department of Internal Medicine Division of Medical Oncology Multidisciplinary Thoracic Oncology Program University of North Carolina at Chapel Hill Chapel Hill NC 27599 USA *To whom correspondence should be addressed. Tel: +1 919 966 3098; Fax: +1 919 966 1587; Email: [email protected] Correspondence may also be addressed to D. Neil Hayes. Tel: +1 919 966 3786; Fax: +1 919 966 1587; Email: [email protected] 01 9 2014 26 6 2014 26 6 2014 42 13 e107 e107 15 5 2014 22 4 2014 14 10 2013 © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted reuse distribution and reproduction in any medium provided the original work is properly cited. Identifying somatic mutations is critical for cancer genome characterization and for prioritizing patient treatment. DNA whole exome sequencing (DNA-WES) is currently the most popular technology; however this yields low sensitivity in low purity tumors. RNA sequencing (RNA-seq) covers the expressed exome with depth proportional to expression. We hypothesized that integrating DNA-WES and RNA-seq would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method called UNCeqR that detects somatic mutations by integrating patient-matched RNA-seq and DNA-WES. In simulation the integrated DNA and RNA model outperformed the DNA-WES only model. Validation by patient-matched whole genome sequencing demonstrated superior performance of the integrated model over DNA-WES only models including a published method and published mutation profiles. Genome-wide mutational analysis of breast and lung cancer cohorts (n = 871) revealed remarkable tumor genomics properties. Low purity tumors experienced the largest gains in mutation detection by integrating RNA-seq and DNA-WES. RNA provided greater mutation signal than DNA in expressed mutations. Compared to earlier studies on this cohort UNCeqR increased mutation rates of driver and therapeutically targeted genes (e.g. PIK3CA ERBB2 and FGFR2). In summary integrating RNA-seq with DNA-WES increases mutation detection performance especially for low purity tumors. cover-date 2014 INTRODUCTION Somatically acquired sequence mutations (nucleotide substitutions insertions and deletions) fuel the initiation and progression of cancer (1). Knowledge of mutations in patient specimens informs therapeutic management (23) and in large patient cohorts provides the basis to assess recurrently altered genes that may drive molecular pathogenesis (14“5). DNA whole exome sequencing (DNA-WES) is currently the popular technology to sequence cancer genomes and has led to an abundance of discoveries in many cancer types (46“8). However detecting somatic mutations by DNA-WES with high sensitivity and specificity remains a challenge (79“10) as evidenced by validation rates of 73% in repeated sequencing and by large inter-rater disagreement among different groups analyzing the same sequencing data (710). The biggest challenge is high quality mutation detection in low purity tumors "
Lung_Cancer
"As differential LysoTracker retention may reflect differences in basal lysosomal mass and/or lysosomal pH we therefore next examined phenothiazine-induced changes in LysoTracker retention (?LysoTracker) as an indicator of perturbation in lysosomal pH. Exposure to TFP for 24?h was associated with varying degrees of loss in LysoTracker retention in almost all of the LC cell lines tested (b). Furthermore there was a highly significant positive correlation between the extent of TFP-induced loss in LysoTracker retention and the magnitude of cytotoxicity (b left). Importantly the loss of LysoTracker retention became irreversible in SCLC at lower TFP concentrations than in NSCLC cells (10??M in H82 and 20??M in U-1810) (c) and the afflicted cells underwent clear mitochondrial depolarization (d). By contrast cells exposed to non-cytotoxic concentrations of TFP recovered LysoTracker Green staining to various degrees over time (c). These data showed that prolonged disruption of lysosomal functions was detrimental to LC cell viability and that SCLC were more sensitive to phenothiazines as result of lower intrinsic lysosomal buffer capacity. In line with these results TFP-induced cell death was significantly antagonized by the protease inhibitor E-64d (e). Moreover preventing the accumulation of TFP within lysosomes by BafA1 pre-treatment also largely abolished its negative impact on cell viability (f). Thus our data suggest that the more prominent cytotoxic effect of phenothiazines in SCLC is related to a higher degree of lysosomal pH neutralization (?LysoTracker) that is more persistent in SCLC than in NSCLC. Moreover although phenothiazines initially induced LC3-II in both NSCLC and SCLC only SCLC failed to adapt to phenothiazine-induced lysosomal dysfunction and this led to increased cell death preferentially in SCLC. Together these data reinforce the notion that persistent lysosomal perturbation induced upon single-agent phenothiazine treatment is a major mediator of cytotoxicity in SCLC cells. SCLC cells show increased sensitivity toward lysosome-disrupting agents On the basis of the findings presented above we reasoned that the increased susceptibility of SCLC cells to phenothiazines may be due to lower basal lysosomal mass and/or lysosomal pH buffer capacity leading to intrinsically lower tolerance toward compounds that disrupt lysosomal functions. Consistent with this idea we found that SCLC cells were typically more sensitive than NSCLC counterparts toward a number of lysosomotropic agents (Supplementary Figure S3) including the clinically approved drugs tamoxifen (TMX) and chloroquine (CQ) in addition to the phenothiazine compounds TFP and CPZ. Notably TFP CPZ TMX and CQ all dissipated LysoTracker staining to a larger extent in SCLC (H69 H82 H592 and U-1285) than in NSCLC (A549 and U-1810) cell lines (Figures 6a and b). Moreover the increased sensitivity of SCLC cells toward lysosomotropic agents was not recapitulated with the CaM antagonist W7 suggesting that phenothiazine-induced lysosomal perturbation does not involve modulation of Ca2+/CaM signaling a well-known process inhibited by phenothiazines (c Supplementary Figure S3A). Overall our findings highlight not only the potential for treating SCLC with FDA-approved drugs that target lysosomal acidification in general but also the use of phenothiazines against this tumor type in particular. Discussion Phenothiazines are most well-known for their dopamine antagonistic activity in the central nervous system (CNS) which has been utilized clinically for the management of psychiatric disorders such as schizophrenia.1 2 In addition these compounds affect the fate of non-CNS cells in a variety of ways and depending on the experimental context may result in cellular differentiation cell death or protection from toxic injuries.34 9 One well-recognized property of phenothiazines is their ability to induce apoptosis in certain cell types.34 9 The mechanism(s) behind this is not clearly understood although inhibition of CaM-regulated processes and increases in membrane fluidity/permeability are thought to be at least partially responsible. However the cell-intrinsic determinants that govern which of these effects that will be elicited in a particular model system are not known and the underlining molecular pathways remain poorly defined. Elucidating the contextual utilities of phenothiazines in in vitro system response in tumor xenografts and animal models will enable them to be harnessed appropriately for treating different human ailments including tumors as illustrated here with SCLC. Although targeted agents have been introduced for the clinical management of LC cases the majority of SCLC and NSCLC patients with advanced disseminated diseases are still treated with conventional CT agents such as cisplatin. For SCLC the initial response is often good but most cases relapse and present high degrees of chemoresistance while for NSCLC a less CT-sensitive phenotype is usually found already at start of treatment.14 Consequently there is an urgent need for the development of new treatment regimen to combat both subtypes of LC. In this study we evaluated a novel strategy involving the use of phenothiazines as single treatment agents in LC. Our data demonstrate that phenothiazines are generally more cytotoxic in SCLC than in NSCLC cell lines despite comparable responses to cisplatin etoposide and gemcitabine which are standard chemotherapeutic agents for the treatment of LC. Importantly we show that normal lung fibroblasts are less affected by phenothiazines at concentrations which were toxic for SCLC indicating a favorable therapeutic window that would allow its use in SCLC without incurring significant adverse effects on healthy tissues. Although it needs to be confirmed by further in vivo toxicity analysis; several earlier reports have shown that phenothiazines are in general well-tolerated by cancer patients.10 15 To uncover responsible mechanisms for the preferential susceptibility of SCLC to phenothiazines we dissected the molecular details of phenothiazine-induced cell death using multiple SCLC and NSCLC cell lines and with TFP as a model compound. We found that TFP treatment led to a rapid neutralization of lysosomal pH as judged by decreased retention of the lysosomotropic dye LysoTracker Green accompanied by accumulation of LC3-II in SCLC cells. Our data thus corroborated a previous study that identified TFP as an inducer of autophagy at low doses in H4 human neuroglioma cells.16 However we found that TFP at cytotoxic concentrations irreversibly disrupted lysosomal homeostasis especially in SCLC cells driving LC3 conversion while blocking its degradation through autophagy. This was logical given that protonation of the weakly basic phenothiazines within lysosomes is expected to increase lumenal pH and could thereby adversely affect the activities of acid hydrolases.13 17 Prolonged exposure to cytotoxic concentrations of TFP (10??M in H82 and 20??M in U-1810) was associated with lysosomal membrane permeabilization followed by mitochondrial depolarization."
Lung_Cancer
"The associations between BMI and total mortality appeared to be stronger with increasing HRs beginning at lower BMI values in whites compared to blacks and the racial difference was more pronounced in women ( ). For the highest compared to the reference category of BMI the magnitudes of the HRs were similar between white (HR=2.62 95% CI: 2.12 3.23) and black (HR=2.42 95% CI: 1.25 4.68) men but appeared to be stronger for white (HR=2.68 95% CI: 2.27 3.17) versus black (HR=1.83 95% CI: 1.28 2.61) women ( ). After adjusting for reporting error using NHANES data associations between BMI and mortality generally became slightly more negative with the exception of the highest category of BMI in black men and the lowest category of BMI in black women which became more strongly positive. Nonetheless the shapes of the BMI curves remained largely similar ( ). In a sensitivity analysis we further excluded all former smokers which reduced somewhat the excess risk of death observed among those with a low BMI but otherwise results were similar (data not shown). We also excluded those who died within the first year of follow-up but found that the results were largely unchanged (data not shown). We also examined associations between BMI and cardiovascular disease and cancer mortality among blacks and whites ( Supplementary ). Among white men and women a high BMI was associated with an increased risk of cancer and to a greater extent cardiovascular disease mortality. Among black men and women BMI was positively associated with cardiovascular mortality but not with cancer mortality; however the number of cancer deaths in these populations was small. We further examined BMI and all-cause mortality for men and women by age education and marital status ( Supplementary and 3). In all subgroups of white men and women there was a positive and significant association between BMI and risk of death. The association differed according to age in women and education in men with stronger relationships observed among younger white women (P-interaction <0.001) and more educated white men (P-interaction=0.002). Among blacks the association was slightly stronger in those who were 65 years or younger at baseline but the interaction with age was not significant. Education did not modify the BMI-mortality association in black men or women. However a strong positive association between BMI and mortality was observed among married but not unmarried black men (P-interaction=0.001). Finally we examined BMI at age 20 and BMI change between age 20 and baseline in relation to total mortality (). We found that compared to the reference group (22.5“<25.0) higher categories of BMI at age 20 were associated with increased total mortality in white men and women but this association appeared to be weaker in blacks possibly due to smaller numbers of deaths. Compared to gaining less than five units of BMI between age 20 and baseline gaining more than 10 units was associated with a significantly elevated risk of death in whites and in black men; however no association was observed among black women. Discussion In this large prospective U.S. cohort we found a positive association between BMI and mortality which appeared to be weaker in blacks particularly black women compared to whites. When compared with the reference group of a BMI of 22.5“<25.0 mortality increased monotonically with greater BMI in healthy non-smoking white men and women which largely confirmed previous findings 5“6. Among healthy non-smoking black men and women the bottoms of these curves were flatter and increasing risks of death with greater BMI were observed only at higher BMI levels (?35.0). Similarly associations of BMI at age 20 and BMI change with mortality appeared to be weaker in blacks than in whites. Our findings for BMI and all-cause mortality may be evaluated against those of several other large prospective studies conducted in the U.S. including the NIH-AARP Diet and Health Study 10 the Cancer Prevention Study-II 9 the Southern Community Cohort Study 19 and the Reasons for Geographic and Racial Differences in Stroke study 20 in which the shape of BMI-mortality curves among black and white men and women were also directly compared within the same cohort. The first three studies used the same reference BMI category that was used in our study and similarly found a weaker association between higher BMI categories and mortality in black women than in white women; among black women the BMI-mortality association was relatively flat until BMI?40. For men the NIH-AARP study found a similar BMI-mortality relationship between blacks and whites while the Southern Community Cohort Study showed an elevated mortality with higher BMI only among whites. Results from the Cancer Prevention Study were inconclusive due to limited numbers of black men in the extreme BMI categories. In the Reasons for Geographic and Racial Differences in Stroke study increased mortality was associated with higher BMI in white men and women; however there was no significant elevation in mortality among overweight and obese black men and women. Our results differed with those of the Black Women™s Health Study which reported an association that was largely similar to that found in white women11. This discrepancy may be partly due to the fact that our study included an older population (49“78 years) while the participants in the Black Women™s Health Study were somewhat younger (21“69 years). As shown in our study and others the association between BMI and mortality tended to be stronger in younger populations than in older populations 6 9“10. Nevertheless like the Black Women™s Health Study the Multiethnic Cohort Study observed similar BMI-mortality associations across racial/ethnic groups 21 and similar to our study included participants who were middle-to-older aged (45“75 years). Thus there may be other differences across studies such as socioeconomic or demographic factors that could account for these inconsistencies. Our findings confirmed those from previous studies showing a positive association of BMI with cancer and cardiovascular mortality in whites 6 9. We observed a positive association between BMI and cardiovascular but not cancer mortality in both black men and women. The results were consistent with those from the Black Women™s Health Study 11. Because only a subset of cancers are obesity-related 22“24 differences in site-specific cancer mortality rates between blacks and whites may partially account for the differences in the BMI-cancer mortality association. However the relatively small number of cancer deaths in our study precluded us from examining the relationship between BMI and death from specific cancers. Consistent with previous studies we found that higher BMI at age 20 was linked to higher mortality in whites; however this association appeared to be weaker among blacks. Moreover excess weight gain since age 20 was also associated with higher mortality in whites and in black men but not in black women. Although results from the ARIC Study showed significantly elevated mortality among black men and women who had a young-adulthood BMI of over 30 15 we were unable to examine risks of death at higher values of young-adulthood BMI among blacks in this cohort due to the small number of deaths. However both the ARIC study and our study found possible racial difference across lower values of BMI with weaker associations found in blacks."
Lung_Cancer
"Moreover niclosamide could enhance antitumor immunity and inhibit lung metastasis by reducing the number of Gr1+/CD11b+ (MDSCs) in tumors. Therefore our studies provided strong evidence that niclosamide as a candidate of antibreast cancer drug is worth being further investigated. References 1 SiegelR NaishadhamD JemalA (2013) Cancer statistics 2013. CA Cancer J Clin63: 11“3023335087 2 DeSantisC SiegelR BandiP JemalA (2011) Breast cancer statistics 2011. CA Cancer J Clin61: 408“418 3 WiebeJP ZhangG WelchI Cadieux-PitreHAT (2013) Progesterone metabolites regulate induction growth and suppression of estrogen-and progesterone receptor-negative human breast cell tumors. Breast Cancer Res15: R3823663549 4 AndersonBO YipCH RamseySD BengoaR BraunS et al (2006) Breast cancer in limited-resource countries: health care systems and public policy. Breast J. 12: S54“S69 5 LiuMR CasimiroMC WangCG ShirleyLA JiaoXM et al (2009) p21CIP1 attenuates Ras-and c-Myc-dependent breast tumor epithelial mesenchymal transition and cancer stem cell-like gene expression in vivo. Proc Natl Acad Sci U S A106: 19035“1903919858489 6 Ottenhoff-KalffAE RijksenG Van BeurdenE HennipmanA MichelsA et al (1992) Characterization of protein tyrosine kinases from human breast cancer: involvement of the c-src oncogene product. Cancer Res52: 4773“47781380891 7 BrennanK BrownAM (2003) Is there a role for Notch signalling in human breast cancer? Breast Cancer Res5: 69“7512631384 8 CaiJC GuanHY FangLS YangY ZhuX et al (2013) MicroRNA-374a activates Wnt/?-catenin signaling to promote breast cancer metastasis. J Clin Invest123: 566“57923321667 9 HarrisonH SimµesBM RogersonL HowellSJ LandbergG et al (2013) Oestrogen increases the activity of oestrogen receptor negative breast cancer stem cells through paracrine EGFR and Notch signaling. Breast Cancer Res15: R2123497505 10 ZhangXL YuePB PageBD LiTS ZhaoW et al (2012) Orally bioavailable small-molecule inhibitor of transcription factor Stat3 regresses human breast and lung cancer xenografts. Proc Natl Acad Sci U S A109: 9623“962822623533 11 PageC HuangM JinX ChoK LiljaJ et al (2000) Elevated phosphorylation of AKT and Stat3 in prostate breast and cervical cancer cells. Int J Oncol17: 23“3110853013 12 CataldoL ChenNY YuanQ LiW RamamoorthyP et al (2000) Inhibition of oncogene STAT3 phosphorylation by a prolactin antagonist hPRL-G129R in T-47D human breast cancer cells. Int J Oncol17: 1179“126411078803 13 YuH JoveR (2004) The STATs of cancer-new molecular targets come of age. Nat Rev Cancer4: 97“10514964307 14 RenXM DuanL HeQ ZhangZ ZhouY et al (2010) Identification of Niclosamide as a New Small-Molecule Inhibitor of the STAT3 Signaling Pathway. ACS Med Chem Lett1: 454“459 15 HiranoT IshiharaK HibiM (2000) Roles of STAT3 in mediating the cell growth differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene19: 2548“255610851053 16 SrivastavaK Kundumani-SridharanV ZhangBL BajpaiAK RaoGN (2007) 15 (S)-hydroxyeicosatetraenoic acid-induced angiogenesis requires STAT3-dependent expression of VEGF. Cancer Res67: 4328“433617483346 17 BollrathJ PhesseTJ von BurstinVA PutoczkiT BenneckeM et al (2009) gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer cell15: 91“10219185844 18 XinH HerrmannA ReckampK ZhangW PalS et al (2011) Antiangiogenic and antimetastatic activity of JAK inhibitor AZD1480. Cancer Res. 71: 6601“6610 19 LiR YouS HuZL ChenZG SicaGL et al (2013) Inhibition of STAT3 by niclosamide synergizes with erlotinib against head and neck cancer. PloS One8: e7467024019973 20 GarinJ DespeignesJ BillerauM (1964) Present treatment of taeniasis with niclosamide."
Lung_Cancer
"was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under protocols that were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care (SRAC). Treatment of na¯ve mice with experimental or control protein 6-week-old male C57BL/6 mice were injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. Seven days post the administration of the final treatment mice were sacrificed and abdominal wall and intestine were retrieved for histopathological studies of mesothelial tissues. Ex vivo assessment of tumor specific T-cell functions Single cell suspensions were prepared from spleens. Cells were plated in round-bottomed 96-well plates pulsed with a validated CD8+ T-cell Her2/neu peptide (PDSLRDLSVF 1 ?g/ml; EZBiolab) [2543] an in-house designed H2d-restricted MSLN Ld1 peptide (IPLSYLCDF 1 ?g/ml; EZBiolab) that did not induce ovarian cancer specific T-cell response in H-2q FVB mice or medium alone for 72 hours when Golgi Plug (BD Bioscience) was added for the last 5 hours as previously described [44] and then stained with fluorophore-conjugated anti-CD3 anti-CD4 anti-CD8 anti-IFN? (BD Pharmingen) and anti-Granzyme B (eBioscience) antibodies. Cells were then analyzed on a LSRII 4 laser (BD Biosciences). Depletion of CD8+ T cells in vivo FVB/NJ mice were injected i.p. with 200 ?g of anti-CD8 monoclonal antibody (mAb)(53“6.72 Bio X Cell) or an isotype-matched irrelevant rat IgG2a (2A3 Bio X Cell) 2 days before 1 day before and 1 day after i.p. inoculation with BR5FVB1 ovarian tumor cells. Depletion was continued once every week until 29 days after tumor inoculation. The mice were treated with scFvMTBHsp70 or saline as described above. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. Generation and purification of bone marrow-derived DCs (BMDCs) CD11c+ DCs were generated from bone marrow cells of FVB/NJ mice as described [45-47] with minor modifications. Briefly erythrocyte-depleted mouse bone marrow cells from flushed marrow cavities were cultured in complete RPMI 1640 with 10 ng/ml GM-CSF and 1 ng/ml IL-4 at 1 — 106 cells/ml. Medium was changed on day 3. On day 7 DCs were harvested by gentle pipetting and purified with magnetic microbeads conjugated to a monoclonal antibody against CD11c (MiltenyiBiotec) as described [4648] according to the manufacturer™s recommended protocol. In vitro activation of BMDCs CD11c+ BMDCs were plated in a 24-well plate at a density of 2?—?106 cells/ml and incubated with 2 ?g/ml scFvMTBHsp70 (105 kDa) 1.3 ?g/ml MTBHsp70 (70 kDa) 1 ?g/ml LPS equivalent to 103 EU/ml endotoxin (InvivoGen San Diego CA) or 0.1 ng/ml (0.1 EU/ml) LPS equivalent to endotoxin found in 2 ?g/ml of proteins (since LPS level is less than 50 EU per mg of protein) for 24 h at 37°C in humidified atmosphere with 5% CO2. Cells were then placed on ice collected by vigorous pipetting washed and stained with the following fluorophore-conjugated antibodies: anti-CD11c and anti-CD40 (eBioscience) anti-CD80 (BD Horizon) anti-CD86 and anti-MHC class II (I-Aq) (BD Pharmingen). Afterwards the cells were analyzed on an LSRII 4 laser (BD Biosciences). In vitro tumor antigen presentation assay BR5FVB1 cells were harvested and treated with mitomycin C and plated in a 96-well round-bottomed plate with 20 ?g/ml scFvMTBHsp70 or 13 ?g/ml MTBHsp70. After pre-incubation at 4°C for 1 h CD11c+ BMDCs (ratio of tumor cells: DCs = 3: 1) were added to the wells and the plate was incubated at 37°C for 24 h. For generation of BR5FVB1 cell-primed T cells we inoculated FVB/NJ mice by i.p. injection with 107mitomycin C-treated BR5FVB1 cells and sacrificed the mice 60 days after the immunization according to the approved animal protocol. Splenocytes were then harvested and T cells were isolated using the Pan T-Cell Isolation Kit II (MiltenyiBiotec). BR5FVB1 cell-primed T cells were then added to the wells at a DC/T-cell ratio of 1:20. After a 24-hour co-culture of BR5FVB1 cell-pulsed DCs with BR5FVB1 cell-primed T cells the cells were harvested washed and resuspended in PBS with 5% FBS stained for CD3 CD4 CD8 and IFN? and analyzed on a LSRII 4 laser (BD Biosciences). In vivo immunization with mitomycin C-treated ovarian tumor cells BR5FVB1 ovarian tumor cells were harvested with enzyme-free cell-dissociation buffer and treated with mitomycin C as described above. Cells were then pre-incubated with scFvMTBHsp70 (10 ?g/106 cells) MTBHsp70 (6.5 ?g/106 cells) or PBS alone at 4°C for 1 h. 6-week-old FVB mice were shaved and depilated on both left and right flanks and then injected i.d. with 50 ?l of PBS or 1?—?106 tumor cells in 50 ?l of PBS with or without a pre-incubation with scFvMTBHsp70 or MTBHsp70 at both flanks. Histopathology Abdominal walls and intestines from mice were fixed for at least 24 h in PBS-buffered 10% formalin. Tissues were routinely embedded in paraffin. 5 ?m thick sections were stained routinely with H&E. For staining tumor-infiltrating T cells mice were perfused with 4% paraformaldehyde (PFA) in PBS and tumor nodules were fixed in 4% PFA/PBS for additional 2 hours washed and infiltrated with 30% sucrose/PBS at 4°C. 6 ?m thick frozen sections were stained with rat anti-mouse CD8 (BD Biosciences 1:100 dilution) or rat anti-mouse Foxp3 (eBioscience 1:12 dilution) followed by polyclonal rabbit anti-rat immunoglobulin/HRP (Dako 1:750 dilution). Signal was developed with diaminobenzidine (DAB Dako). Images were acquired on a Zeiss Axio A1 microscope. All histopathological and immunohistochemical samples were reviewed and the quantitation of the cellular infiltrate was performed in a blinded manner to the observer. Statistical analysis Statistical differences between three or more experimental groups were analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests when mean of each group is compared with that of every other group or followed by Dunnett™s multiple comparison tests when mean of each group is compared with that of a control group. Statistical differences between two experimental groups were analyzed using Student™s t-test. Survival was analyzed with the Log-rank test. Prism 6.0 software (GraphPad Software) was used for all the statistical analysis. Abbreviations DC: Dendritic cell; scFv: Single-chain antibody variable fragment; MSLN: "
Lung_Cancer
"We choose this system as it is successfully applied by others (Zhu et al 2009; Yilmaz et al 2012) allows for transgene induction in multiple somatic cell types (Carey et al 2010) and is compatible with a vector system for doxycycline-regulated fluorescence-linked shRNAs (McJunkin et al 2011; Premsrirut et al 2011; Dow et al 2012). Targetings were performed under the new 2i culture conditions; colonies were screened by PCR and correctly targeted clones were confirmed by Southern blotting (supplementary Fig S4A and B). For all three genotypes i.e. Rb1F/F ;Trp53F/F Nf2F/F ;Trp53F/F ;Cdkn2a*/* and KrasLSL-G12D similar targeting efficiencies of ˜35% were achieved (supplementary Table S2). These efficiencies were comparable to that of the wild-type 129/Ola ESC clone IB10 (36% under 2i culture conditions). The Col1a1-frt targeted GEMM-ESC clones were subsequently injected into morulae or blastocysts to produce chimeric mice. Out of 11 clones injected three failed to produce chimeras. All other clones produced germline-competent chimeras (Fig 3A supplementary Fig S5A and B Table S1). Genomic stability of targeted GEMM-ESC clones. Comparison of chimeric contribution between the parental Rb1F/F ;Trp53F/F ESC clone 1.5 and three Col1a1-frt targeted derivatives. Correct targeting was confirmed by Southern blot analysis using a 3? probe in the Col1a1 locus (supplementary Fig S4A and B). Two Col1a1-frt targeted clones i.e. 1.5_1A10 and 1.5_1B1 provided good and germline-competent chimeras (supplementary Table S1). One chimera from the Rb1F/F ;Trp53F/F ESC clone 1.5_1B1 was backcrossed twice to the original strain and ESC were re-derived i.e. clone 1.5_1B1 re-derived 4 (). This ESC clone resulted in improved chimeras compared to the parental clones. male female n.d. Parts of whole representation of genetic aberrations observed in GEMM-ESCs cultured in 2i medium and subjected to either gene targeting Flp-in integration and subcloning (supplementary Table S4). Last box represent the genetic aberrations observed in ESCs cultured under classic culture conditions as reported by Liang et al 2008. Summary of CNVs observed in Rb1F/F ;Trp53F/F ESC clones as detected by aCGH. Two Col1a1-frt targeted clones acquired four independent CNVs. Some CNVs can be transmitted via the germ line as CNV-4.1 was maintained after backcrossing twice to the original strain see ESC clone 1.5_1B1 re-derived 4. A detailed description of all CNVs is provided in supplementary Table S3. Assessment of the genomic integrity of these targeted clones by array comparative genomic hybridization (aCGH) revealed three types of genomic aberrations either small copy number variations (CNVs) in the 0.2“1.0 megabase (Mb) range loss of the Y-chromosome or trisomy of entire chromosomes (supplementary Fig S5C and D Tables S3 and S4). These types of aberrations have also been reported by others with similar frequencies in targeted wild-type ESC clones cultured under classic culture conditions (Fig 3B; Liang et al 2008). All CNVs showed a single copy gain and were non-recurrent neither in our tested GEMM-ESC clones nor in the published dataset (Liang et al 2008) indicating that there is no strong biological selection for specific amplifications or deletions. For future experiments we selected targeted GEMM-ESC clones with no or few CNVs of <1 Mb each. Note that there is an option to ˜clean-up™ a targeted GEMM-ESC clone with several CNVs by re-deriving ESC clones from decedents of chimeras backcrossed to the original GEMM. For example re-derivation of ESC clones from second-generation descendants of the Col1a1-frt targeted Rb1F/F ;Trp53F/F ESC clone 1B1 resulted in loss of two of the three CNVs present in the original clone (Fig 3C). This clone was used to generate chimeras and outperformed the original targeted clone 1B1 based on the number of chimeras and percentage of coat-color chimerism (Fig 3A). Efficient introduction of reporter constructs via Flp recombinase mediated integration The third and final step in the GEMM-ESC approach is the introduction of a transgenic construct in the Col1a1-frt locus using the Flp recombinase. As proof-of-principle we generated two genetic inversion reporter constructs called frt-invCAG-Luc or frt-invEF1-Luc containing a codon-optimized firefly Luciferase 2 ( Luc) gene that”following Cre-mediated inversion”is expressed from a constitutive CAG or EF1a promoter respectively (supplementary Fig S4C). These vectors were introduced into a Col1a1-frt targeted Nf2F/F ;Trp53F/F ;Cdkn2a*/* GEMM-ESC clone with 100% efficiency. The same efficiency was achieved for Flp-in of the frt-invCAG-Luc construct into the Col1a1-frt;Rb1F/F ;Trp53F/F GEMM-ESC clone (supplementary Table S2 Fig S4D). Five out of seven ESC clones used for injections into pre-implantation embryos performed well and gave chimeric animals that showed in most cases >50% coat-color chimerism (supplementary Fig S5E and F). PCR screening of offspring from crosses of male chimeras with the original GEMM revealed that all tested chimeras gave GLT of the Luciferase allele (supplementary Table S1). In vivo imaging of tumor growth in chimeric reporter mice The chimeric animals with the new Luciferase reporter constructs were treated with Ad5-Cre to induce tumor formation. The majority of the invCAG-Luc;Rb1F/F ;Trp53F/F chimeras developed SCLC with similar latency as presented earlier (Figs 4A“C and 2E). One mouse with the lowest coat-color chimerism failed to develop a tumor after 375 days possibly reflecting insufficient contribution of GEMM-ESCs to lung epithelium for reliable use in experimental cohorts (Fig 4B). Bioluminescence imaging of luciferase activity revealed tumor initiation at variable time points ranging between 140 and 320 days after which the majority of tumors displayed exponential growth until animals had to be sacrificed because of respiratory distress. In the mesothelioma model the results were less pronounced. Here all but one chimera developed mesothelioma with thoracic Luciferase expression; however the increase in Luciferase expression over time was limited and in some cases leveled off after an initial increase (supplementary Fig S6). This occurred for both reporter constructs but was most often observed for the reporter construct carrying the EF1a promoter. The underlying cause for this behavior remains speculative and could have multiple reasons. It might be due to quenching of the luminescence signal by pleural effusion i.e. accumulated liquid in the pleural cavity. Also the immunogenicity of the Luciferase protein might trigger an immune response against Luciferase-expressing tumor cells leading to selective outgrowth of tumor cells with low or no luciferase expression (Jeon et al 2007). Thirdly the CAG and EF1a promoters might be silenced by methylation. We have indications that at least the latter event occurs as treatment of cultured primary mesothelioma cells derived from a chimeric animal with the demethylating agent 5-aza-2dC resulted in a marked increase in Luciferase expression (supplementary Fig S6E). Promoter silencing is likely due to the presence of bacterial DNA of the plasmid integrated in the Col1A1 locus (Tasic et al 2011). Still the promoter silencing appears to be model or cell type dependent as tumors in the SCLC model showed robust Luciferase expression judged by the exponential increase in luminescence signals measured in the majority of the invCAG-Luc;Rb1F/F ;Trp53F/F chimeras (Fig 4B). In the few cases where no Luciferase expression was observed in SCLC tumors the invCag-Luc transgene had failed to recombine after Cre expression (supplementary Fig S7). Luciferase imaging of SCLC in chimeras. In vivo imaging of a invCAG-Luc;Rb1F/F ;Trp53F/F chimeric mouse injected intrathoracically with Ad5-Cre. Tumor growth was monitored weekly by bioluminescence imaging. Luciferase activity emitted from the thorax of 10 chimeric invCAG-Luc;Rb1F/F ;Trp53F/F mice. Each line represents measurements of an individual mouse. The chimeric mouse with the lowest coat-color chimerism (? 20%) did not develop a tumor while the second lowest chimera (? 35%) did develop SCLC though with a long latency. One chimera (? 962975) failed to show any Luciferase activity but did develop SCLC. Analysis of the tumor revealed a lack of Cre-mediated switching of the invCag-Luc transgene (supplementary Fig S7). "
Lung_Cancer
"Low magnification image of the tumor (HE staining) revealed a subpleural tumor consisting predominantly of lepidic growth with a small (<5 mm) focus of invasion. (iv) Middle magnification image of the invasive area of the tumor (HE staining) revealed acinar-type growth pattern. (c) A 74-year-old female patient with lepidic-predominant invasive adenocarcinoma. (i) Lung window CT showed a pure GGN 19.7 mm in size. The mean CT attenuation was ?618 HU. (ii) Mediastinal window CT showed no tumor components except for vessels. (iii) Low magnification image (HE staining) revealed a tumor consisting mostly of lepidic growth with a smaller area (8 mm) of acinar invasion. (iv) Middle magnification image of the invasion area of the tumor (HE staining) revealed acinar gland proliferation in the fibrous stroma. (d) A 76-year-old male patient with papillary-predominant invasive adenocarcinoma. (i) Lung window CT image showed a pure GGN 10.7 mm in size. The mean CT attenuation was ?509 HU. (ii) Mediastinal window CT showed no tumor components. (iii) Low magnification image of the tumor (HE staining) revealed that the tumor predominantly consisted of papillary proliferation. (iv) Middle magnification image of the tumor (HE staining) revealed cuboidal tumor cells growing along fibrovascular cores in a papillary configuration. Comparison of Demographic and Clinicopathological Characteristics The patient characteristics and tumor properties for all patients and for patients in each group are shown in . When comparing the 3 groups the tumor size and mean CT attenuation significantly differed between the groups (p?=?0.0005 and p<0.0001 respectively). Tumor size was significantly larger in the MIA and I-ADC groups than in the AIS group (p?=?0.0100 and 0.0025 respectively). Mean CT attenuation was significantly higher in the I-ADC group than in the AIS and MIA groups (p?=?0.0001 and 0.0129 respectively). Pearson™s Correlation Analyses between the Pathological Invasion Diameter and the Tumor Size/CT Attenuation The correlation coefficients for the pathological invasion diameter with tumor size and CT attenuation were 0.3740 and 0.4072 (p?=?0.0001 and p<0.0001 respectively). ROC Curve Analyses of Tumor Size and CT Attenuation for Predicting Invasive Adenocarcinoma With regard to tumor size as a predictor of invasive adenocarcinoma the highest odds ratio (20.2) was obtained at a cutoff value of 11.0 mm and the sensitivity and specificity were 95.8% and 46.8% respectively with an area under the curve (AUC) of 0.75 (). With regard to CT attenuation the highest odds ratio (12.4) was obtained at a cutoff value of “680 HU and the sensitivity and specificity were 95.8% and 35.1% respectively with an AUC of 0.77 (). A combined variable was constructed using these 2 cutoff values: .0097867.g002 Receiver operating characteristic curve analysis for invasive adenocarcinoma prediction: tumor size and computed tomography attenuation. The sensitivity and specificity of tumor size for predicting invasive adenocarcinoma were 95.8% and 46.8% respectively at a cutoff value of 11.0 mm with an area under the curve (AUC) of 0.75 (green curve). The sensitivity and specificity of the mean computed tomography (CT) attenuation were 95.8% and 35.1% respectively at a cutoff value of “680 HU with an AUC of 0.77 (yellow curve). The sensitivity and specificity of the combined variable (tumor size and mean CT attenuation) were 91.7% and 71.4% respectively at cutoff values of 11 mm and ?680 HU with an AUC of 0.82 (blue curve). Group A: Neither tumor size nor mean CT attenuation indicated invasive adenocarcinoma (i.e. tumor size ?11 mm and mean CT attenuation ?“680 HU) Group B: Either tumor size or mean CT attenuation indicated invasive adenocarcinoma (i.e. tumor size >11 mm or mean CT attenuation >“680 HU) Group C: Both tumor size and mean CT attenuation indicated invasive adenocarcinoma (i.e. tumor size >11 mm and mean CT attenuation >“680 HU) The sensitivity and specificity of the combined variable for predicting invasive adenocarcinoma at the cutoff values were 100% and 10.4% for group B and 91.7% and 71.4% for group C respectively with an AUC of 0.82 (). Discussion In this present study we showed that approximately half of all resected pulmonary pure GGNs displayed a pathological invasive area. Moreover approximately a quarter of the resected pure GGNs were diagnosed as invasive adenocarcinomas and we found that tumor size and mean CT attenuation were useful in predicting pathological invasiveness. We have previously reported a strong negative association between CT attenuation and retained air space in tumors in a study of small peripheral lung adenocarcinomas detected by CT screening [7]. We moreover found that the retained air space was larger in non-invasive adenocarcinomas than in invasive adenocarcinomas and that this was largely due to an increased tumor tissue component and thickening of the alveolar septa in invasive adenocarcinomas resulting in reduced air space. These findings suggested that the high CT attenuation of pure GGNs reflects the large number of tumor cells that grow along alveolar septa and in terms of a stepwise progression of adenocarcinoma indicates that the lesion is progressing to invasive adenocarcinoma [4]. In general an invasive area is thought to be nonaerated and is theoretically thought to appear as a solid component on high-resolution CT. "
Lung_Cancer
"Methods Tissue collection We obtained 113 paired NSCLC and adjacent non-tumor lung tissues from patients who underwent surgery at Jiangsu Province Hospital between 2008 and 2010 and were diagnosed with NSCLC (stages I II and III) based on histopathological evaluation. Clinicopathological characteristics including tumor-node-metastasis (TNM) staging were recorded. No local or systemic treatment was conducted in these patients before surgery. All collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at “80°C until required. Our study was approved by the Research Ethics Committee of Nanjing Medical University China. Written informed consent was obtained from all patients. Cell lines Five NSCLC adenocarcinoma cell lines (A549 SPC-A1 NCI-H1975 NCI-H1299 and NCI-H1650) a NSCLC squamous carcinomas cell line (SK-MES-1) and a normal human bronchial epithelial cell line (16HBE) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai China). A549 SK-MES-1 NCI-H1975 NCI-H1299 NCI-H1650 and 16HBE cells were cultured in RPMI 1640; SPC-A1 cells were cultured in DMEM (GIBCO-BRL) medium supplemented with 10% fetal bovine serum (FBS) 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Carlsbad CA USA) at 37ºC/5% CO2. RNA extraction and qPCR assays Total RNA was isolated with TRIzol reagent (Invitrogen) according to the manufacturer™s instructions. Total RNA (500 ng) was reverse transcribed in a final volume of 10 ?l using random primers under standard conditions for the PrimeScript RT reagent Kit (TaKaRa Dalian China). We used the SYBR Premix Ex Taq (TaKaRa Dalian China) to determine BANCR expression levels following the manufacturer™s instructions. Results were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The specific primers used are presented in Additional file 3: Table S2. The qPCR assays were conducted on an ABI 7500 and data collected with this instrument. Our qPCR results were analyzed and expressed relative to threshold cycle (CT) values and then converted to fold changes. Plasmid generation The BANCR sequence was synthesized and subcloned into the pCDNA3.1 (Invitrogen Shanghai China) vector. Ectopic expression of BANCR was achieved through pCDNA-BANCR transfection with an empty pCDNA3.1 vector used as a control. The expression levels of BANCR were detected by qPCR. Cell transfection Plasmid vectors (pCDNA3.1-BANCR and pCDNA3.1) for transfection were prepared using DNA Midiprep or Midiprep kits (Qiagen Hilden Germany) and transfected into SPC-A1 or A549 cells. The siRNAs si-HDAC1 si-HDAC3 si-BANCR or si-NC were transfected into SPC-A1 or A549 cells (Additional file 3: Table S2). A549 and SPC-A1 cells were grown on six-well plates to confluency and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer™s instructions. At 48 h post-transfection cells were harvested for qPCR or western blot analysis. Cell viability assays Cell viability was monitored using a Cell Proliferation Reagent Kit I (MTT) (Roche Applied Science). The A549 cells transfected with si-BANCR (3000 cells/well) and A549 or SPC-A1 cells transfected with pCDNA-BANCR were grown in 96-well plates. Cell viability was assessed every 24 h following the manufacturer™s protocol. All experiments were performed in quadruplicate. For colony formation assays pCDNA-BANCR-transfected SPC-A1 or A549 cells (n?=?500) were placed in a 6-well plates and maintained in media containing 10% FBS. The medium was replaced every 4 days; after 14 days cells were fixed with methanol and stained with 0.1% crystal violet (Sigma-Aldrich). Visible colonies were then counted. For each treatment group wells were assessed in triplicate. Flow cytometry analysis of apoptosis SPC-A1 and A549 cells were harvested at 48 h post-transfection by trypsinization. After staining with FITC-Annexin V and propidium iodide cells were analyzed by flow cytometry (FACScan; BD Biosciences) using CellQuest software (BD Biosciences). Cells were discriminated into viable cells dead cells early apoptotic cells and apoptotic cells. The ratio of early apoptotic cells was compared to that for controls from each experiment. All samples were assayed in triplicate. Wound-healing assay For the wound-healing assay 3?—?105 cells were seeded in 6-well plates cultured overnight and transfected with pCDNA-BANCR or the control vector. Once cultures reached 85% confluency the cell layer was scratched with a sterile plastic tip and washed with culture medium then cultured for 48 h with medium containing 1% FBS. At different time points images of the plates were acquired using a microscope. The distance between the two edges of the scratch was measured using Digimizer software system. Cell migration and invasion assays For the migration assays at 48 h post-transfection 5?—?104 cells in serum-free media were placed into the upper chamber of an insert (8-?m pore size; Millipore). For the invasion assays 1?—?105 cells in serum-free medium were placed into the upper chamber of an insert coated with Matrigel (Sigma-Aldrich). Medium containing 10% FBS was added to the lower chamber. After incubation for 24 h the cells remaining on the upper membrane were removed with cotton wool. Cells that had migrated or invaded through the membrane were stained with methanol and 0.1% crystal violet imaged and counted using an IX71 inverted microscope (Olympus Tokyo Japan). Experiments were independently repeated three times. Tail vein injections into athymic mice Athymic male mice (4-weeks-old) were purchased from the Animal Center of the Chinese Academy of Science (Shanghai China) and maintained in laminar flow cabinets under specific pathogen-free conditions. SPC-A1 cells transfected with pCDNA-BANCR or the empty vector were harvested from 6-well plates washed with phosphate-buffered saline (PBS) and resuspended at 2?—?107 cells/ml. Suspended cells (0.1 ml) were injected into the tail veins of 9 mice which were sacrificed 7 weeks after injection. The lungs were removed and photographed and visible tumors on the lung surface were counted. "
Lung_Cancer
" This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestos“cancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestos“cancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant non“small cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant non“small cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Post“solid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j D™Amico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 79“85) and specificity was 31% (95% CI: 23%“40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). Kaplan“Meier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 45“68 years). The clinical features of the patients are summarized in Table 1. Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 3“80 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Table 1Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patient™s presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500×g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the Mann“Whitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the Kaplan“Meier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.841“0.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were "
Lung_Cancer
" Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The results will inform as to whether the gene-based test is both effective as motivator and acceptable to subjects recruited from primary care. Trial registration Registered with Clinical Trials.gov Registration number: NCT01176383. Smoking cessation Genetic test Lung cancer Background Gene testing in primary care is no longer limited by their exorbitant cost. The prices of genetic tests are dropping faster than Moore™s law for computing costs [1]. This leads the focus to shift from cost of genetic testing to the clinical value of individual gene tests. The recent development of gene-based tests that predicts the risk of lung cancer in smokers is an important example [2]. Despite the well accepted 10-15% probability of lung cancer in smokers 50% of smokers do not believe they are at significantly increased risk [3]. However over 80% of smokers would like to know their personal risk of lung cancer [4]. There is a plausible three way link between biomarkers for chronic obstructive pulmonary disease (COPD) a set of 20 single nucleotide polymorphisms (SNPs) associated with cancer risk and lung cancer [5-8] (). Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics (Figure 3) only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Figure 3 Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up). Subsequently the principal investigator will report back to clinic A patients with estimated lung cancer risks (session 3). To ensure balance in the control clinic the principal investigator will also attend Clinic B sessions 2 and 3 (see Figure 5 flow charts). ¢At the eight week clinic and the 6-month follow-up clinic smoking cessation status and carbon monoxide breath test score will be recorded and a feedback questionnaire used to assess efficacy of various components will be administered. Mailing 4. Telephone calls followed by letters to patients with invitation to 6-month follow-up session with NHS Smoking Cessation Practitioners and the principal investigator when cessation rate will be assessed and verified by repeating the carbon monoxide breath and salivary cotinine tests. “ for further details see Figure 5: flow charts Figure 4 Timeline of project. Figure 5 Flow chart for the duration of the trial. a. Flow chart of project from start to week 12. b. Flow chart of project to week 36. We anticipate good attendance at the eight week free smoking cessation clinic as would be expected if it were a regular NHS smoking cessation clinic but the attendance at the 6-month follow-up clinic may be more challenging. We consider this attendance essential and as attendance will take up an evening of their time study participants should be paid for their travel expenses (£20) and will receive up to three reminders. Group B subjects attending at the 6-month follow up who have been unable to quit will be offered the gene-based test at this stage. Technique for taking the respiragene test The test requires a Buccal swab and the subjects should not eat or drink within 15 minutes prior to supplying a sample (if has eaten or taken a drink within 15 minutes then rinse mouth with tap water). The nurse taking the sample should wear latex or plastic gloves and take care to avoid contact with the buccal swab collection tip to avoid DNA (deoxyribonucleic acid) contamination. Then: 1. Open buccal swab package at the handle end and carefully remove the swab. 2. Holding handle end of swab stick scrape the collection tip firmly against the inside of the cheek 5-6 times (about 10 seconds) being careful not to press the plunger that ejects the tip. 3. After taking the sample eject the swab tip into a labelled 2 ml microcentrifuge tube by firmly pressing the plunger at the end of the handle. 4. Complete and affix the sample tube label onto the microtube. The sample label requires the anonymised trial code for the subject. Storage of the respiragene test After sample collection tips can be kept at room temperature if they are posted immediately. If storage is necessary freeze the tubes containing the tips at -20°C. Packaging instructions for return of samples to Lab21 Ltd 1. Place absorbent material around the tube and then place tube in the plastic bag provided with the kit. Seal the plastic back as per the instructions on the bag 2. Place the plastic bag containing the sample tube into the shipping box. 3. Seal the box with the security seal supplied. 4. Using the Freepost service provided send the samples to: Lab 21 184 Cambridge Science Park Cambridge CB4 0GA. Patients will be asked to sign a disclaimer form that explains clearly that this test can only give an estimation of cancer risk and is a test that is still under development (one copy of form for investigators and one for patient). Interpretation of result of respiragene test Lung cancer susceptibility is calculated using the Respiragene test Auckland formula [7]: Lung cancer score?=?(number of susceptible genotypes) - (number of protective genotypes)?+?3 (for positive family history)?+?4 (for past history of COPD)?+?4 (for age?>?60 years old). The laboratory reports include the scores with an explanation of how the scores relate to a risk category (see ). When the subject is aged <60 years the report will also include the score and risk category that would apply if the subject is still a smoker at age 60 years or over. Follow-up questionnaires The questionnaires will be slightly different for groups A (questionnaire 2a) and B (questionnaire 2b) as only 2a will contain a direct reference to the gene-based test. Patients who fail to attend at eight weeks and six months will be contacted by telephone to remind them to complete their questionnaires and hand them in to the practice manager. They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (Table 2). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Table 2 Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: œHow do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting). This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors™ contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors™ information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia.org/wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC O™Neill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants PLoS ONE [Electronic Resource] 2009 4 4 e5302 10.1371/journal.pone.0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) “ Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details"
Lung_Cancer
"These alleles always augmented germline genotype in UNCeqR thus preventing somatic mutation detections with these alleles even if unobserved in a given germline sequencing. Mutation annotation and analysis Sequence mutations were annotated with a gene a predicted transcript and protein alteration using Annovar (version 8/23/13) (42) and RefSeq gene models. Non-silent mutations referred to non-silent substitution insertion and deletion mutations within translated regions and splice-site mutations. MAFs were compared by one-sided Fisher's exact tests on mutant versus germline read counts with significant results having false discovery rate < 5%. Sequence alignments were visualized using the Integrative Genomics Viewer (43). Germline variant analysis Patient germline variants relative to the reference genome were detected in germline DNA-WES and patient-matched germline RNA-seq using UNCeqRMETA without population polymorphism or mapping artifact allele augmentation P ? 1.1e?9. Germline variant allele fractions were defined and compared between DNA and RNA using the procedure described for somatic mutations. Simulation analysis A novel simulation strategy was followed (diagrammed in Supplementary Figure S2). Using chromosome 2 simulated tumor genomes were generated by randomly sampling 500 sites from exons to define positive mutation sites while the remainder of exon sites served as negative mutations. For the positive sites mutant alleles (substitution insertion or deletion) were randomly sampled at rates 90 5 and 5%. For insertion and deletion alleles allele lengths of 1“6 were randomly sampled at rates 602095 5 and 1%. Positive mutations were spiked into germline DNA-WES and RNA-seq sequencing by editing a specified MAF of read alignments overlapping the site producing simulated tumor alignments. ˜V™ characters were used for substitutions and insertions to avoid overlap with germline genotype. Simulated tumor alignments contained a subset of the total positive mutations because the alignment may have minimal or zero depth at some positive sites reflecting reality that a sequencing technology does not cover every site in the genome at high depth and enabling simulated mutations to occur at RNA-seq and DNA-WES uniquely covered sites. Original tumor sequencing served as simulated germline sequencing. Simulated germline sequencing contained the original somatic mutations which had the effects of expanding germline genotype with additional alleles and not triggering variant detection. UNCeqR models were applied to these simulated data. Limiting to sites with at least a germline depth of 10 model detections were compared to the truth to define receiver operating characteristic (ROC) curves (44). A pair of models was compared by their difference in area under the curve over the false positive rate range of 0 to 1 — 10?5. A P-value was defined using a distribution of differences in area under the curve calculated from 100 permuted models in which the rank of the discrimination threshold (i.e. P-value) between the models at each genomic site was randomly shuffled. Mutation detection by other programs Strelka v2.0.8 (17) was executed on tumor and germline DNA-WES using recommended settings for BWA alignments (strelka_config_bwa_default.ini) DNA-WES (isSkipDepthFilter = 1) and filtering (passed). SNVMix2 (13) was executed upon RNA-seq using default settings. Validation analysis Within exonic regions true positive and false positive mutation detections were defined using patient-matched DNA-WGS alignments based on a published procedure for exome mutation validation (4). Tumor and germline DNA-WGS BAM files were downloaded from ://cghub.ucsc.edu. Specifically tumor and germline DNA-WGS were interrogated at each predicted mutation using samtools (31) with no filtering. True positive mutation predictions met one of two conditions: (1) germline depth ? 10 and read count of predicted mutant allele ?1 in tumor and zero in germline; or (2) germline depth ?10 proportion of mutant allele in germline sequencing not significantly > 2% (proportions test P > 0.25) and proportion of mutant allele in tumor significantly greater than in germline (proportions test P < 0.05). Otherwise false positive mutation predictions had germline DNA-WGS depth ?10 and had depth in tumor DNA-WGS providing ?80% power to detect the mutant allele based the predicted MAF. Power was estimated by a binomial distribution a null probability of 3 — 10?3 an alpha of 0.05 the observed depth in DNA-WGS and an alternate probability of the predicted DNA MAF. The number of true positives and false positives were tabulated at each model discrimination threshold i.e. P-value or score. The step function of these points (number of false positives versus number of true positives) generated a performance curve in absolute counts that is equivalent to a ROC curve without the denominators of total positives and negatives which were constant and unknown for the validation cohort. Between models performance curves were compared by area under the curve from 0 to 3000 false positives and by the number of true positives (proportional to sensitivity) at fixed numbers of false positives (proportional to 1 ? specificities) of 250 500 and 1000). P-values were calculated to provide evidence for the change in area under the curve and sensitivity estimates using permutation (see ˜Simulation analysis™ methods). RESULTS Mutation detection models Existing methods to detect somatic mutations are based on either DNA sequencing alone or on RNA sequencing alone and do not integrate more than one type of sequencing (913“17). In order to test whether integrating DNA-WES and RNA-seq enables superior somatic mutation detection versus the current standard of DNA-WES alone a new method was developed called UNCeqR. UNCeqR contains different models for detecting somatic mutations based on different sequencing input and statistical modeling. Briefly UNCeqRMETA integrates tumor DNA-WES and RNA-seq UNCeqRDNA uses tumor DNA-WES and UNCeqRRNA uses tumor RNA-seq. UNCeqR software is available at http://lbg.med.unc.edu/tools/unceqr. Evaluation in simulated tumor sequencing To test our hypothesis that somatic mutation detection based on integrated RNA-seq and DNA-WES is superior to that based on DNA-WES alone simulated tumor genomes were generated so that the entire genome space is a completely defined truth of positive and negative somatic mutations. In brief for each patient's sequencing 500 mutant sites were sampled for each site a mutant allele was randomly sampled and then aligned reads in the real RNA-seq and DNA-WES were edited to have the mutant allele at a rate of a fixed MAF (Supplementary Figure S2). By using real sequencing as the basis of the simulation authentic sequencing depths random errors (sequencing and alignment) and patients™ germline variants were preserved. Sequencing from the lung cancer quadruplet cohort was used for simulation. Patients™ DNA-WES and RNA-seq had large and similar numbers of sequenced nucleotides (DNA-WES median: 10.6 billion RNA-seq median: 10.2 billion; Kruskal-Wallis P = 0.54) indicating no significant imbalance in total sequencing. UNCeqR models were applied to the simulated tumor sequencing and detected mutations were compared against the truth by receiver operating characteristic curves. In simulations with a 10% MAF (A) the UNCeqRMETA model had significantly superior performance over UNCeqRDNA (difference in area under the curve P < 0.01); in other words UNCeqRMETA achieved a greater true positive rate (greater sensitivity) at the same false positive rate (same specificity) than UNCeqRDNA. In simulations with a 20% MAF (B) UNCeqRMETA continued to be superior to UNCeqRDNA (difference in area under the curve P < 0.01) although the gain in 20% MAF simulations was less (roughly 50% less) than the gain in 10% MAF simulations. This demonstrates that adding RNA-seq improved sensitivity particularly when the mutation signal that is MAF was low. UNCeqRMETA and UNCeqRDNA had large and clear superior performance to UNCeqRRNA which incurred false positives at a higher rate. Alternative ways to integrate RNA and DNA (taking the union or intersection of UNCeqRDNA and UNCeqRRNA) were both inferior to UNCeqRMETA (Supplementary Figure S3). Therefore in simulation UNCeqRMETA achieved superior performance over UNCeqRDNA with the largest gains occurring in mutations with low MAF. . Mutation detection performance in simulated tumor genomes. Model performance is displayed as receiver operating characteristic curves. Sensitivity plateaus below 1 because simulated mutations include sites with zero tumor sequencing depth in DNA and/or RNA (see ˜Simulation analysis™ methods). Validation by whole genome sequencing To validate the superior performance of integrated DNA-WES and RNA-seq mutation detection (UNCeqRMETA) over DNA-WES only detection (UNCeqRDNA) tumor and germline whole genome DNA sequencing (DNA-WGS) was used as an independent measure of truth for evaluating DNA-WES and RNA-seq mutation detections. Following a published validation procedure (4) mutation detections were interrogated in patient-matched DNA-WGS to determine if a mutation detection was a true positive that is present in the tumor specimen and absent from the germline specimen or false positive that is absent from the tumor specimen or present in the germline specimen. For each mutation model true positives and false positives were summed at each discrimination threshold (e.g. P-value) to generate a performance curve by which true positive rates could be compared at the same false positive rates (see methods for further description). These curves demonstrated that UNCeqRMETA achieved overall superior performance than UNCeqRDNA (difference in area under the curve P < 0.01) and at fixed false positive thresholds (250 500 and 1000) thus validating the result from simulated tumor genomes (Figure 2). Therefore in real tumor sequencing integrated DNA and RNA mutation detection by UNCeqRMETA outperformed DNA-only mutation detection. Figure 2. Validation of mutation detection by whole genome sequencing. The number of true positives and false positives of mutation detection models are plotted as step functions. At fixed false positive totals (250 500 or 1000) each pair of models was compared for differences in number of true positives (*). The published mutation set (46) did not include mutation rankings and was not amenable to rank-based statistical analysis. Other models displayed overall reduced performance relative to UNCeqRMETA and UNCeqRDNA. As another DNA-only control a leading (45) DNA-WES mutation caller from Illumina Strelka (17) was run on the same DNA-WES. Strelka exhibited inferior performance overall smaller true positive rates at fixed false positive rates and never achieved the sensitivity of UNCeqRMETA or UNCeqRDNA (Figure 2). Strelka had greater sensitivity than UNCeqRMETA or UNCeqRDNA at the highest extreme of specificity; however at UNCeqR's minimum false positive rate Strelka's sensitivity was only ?70% of either UNCeqR model. Providing another DNA-only control previously published mutations of this cohort made by heterogeneous pipelines (46915“16) had reduced sensitivity than UNCeqRMETA and UNCeqRDNA at the same false positive rate (256 false positives). At this false positive rate indel mutation detections were rare in all models (maximum 1.7%) with UNCeqRMETA and UNCeqRDNA having no significant difference in indel precision (number of true positives divided by the sum of false positives and true positives 92 and 96% respectively) but both having greater indel precision than Strelka (83%) and previously published mutations (82%) (proportions test P < 0.001). Taking the union or intersection of UNCeqRDNA and UNCeqRRNA had higher false positive rates and inferior performance than UNCeqRMETA or UNCeqRDNA (Supplementary Figure S4A). Integrating Strelka with an RNA-seq mutation detector SNVmix did not result in superior performance versus Strelka UNCeqRDNA or UNCeqRMETA (Supplementary Figure S4A). Providing a separate source of validation UNCeqRMETA detected nearly all mutations that were published as validated by targeted resequencing within this cohort (up to 97% depending on the model threshold; Supplementary Figure S5). Repeating this analysis with a slightly increased true positivity definition minimum two confirming tumor WGS DNA reads maintained all findings listed above (Supplementary Figure S4B). Increased mutation signal in RNA-seq To analyze integrated mutation detection across larger cohorts UNCeqR was applied to the lung and breast triplet cohorts (n = 871) and using model thresholds with the same empirically estimated specificity (500 false positives in DNA-WGS validation sequencing marked as triangle point in Figure 2 UNCeqRMETA P-value ? 1.1 — 10?9 UNCeqRDNA P-value ? 9.3 — 10?9)."
Lung_Cancer
"non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK peptide vaccine CTL clone lung cancer Introduction Lung cancer is one of the main causes of cancer-related mortality. Approximately 85% of lung cancers are diagnosed as non-small cell lung cancer (NSCLC) and the overall survival (OS) rate for advanced NSCLC is poor. The 5-year survival rate is 5% for stage IIIb NSCLC and <1% for stage IV NSCLC (1). Treatment for NCSLC is determined by the patient™s clinical and tumor characteristics performance status (PS) the histological subtype and tumor genotype/phenotype. Recently there have been many studies concerning agents that target molecular changes such as mutations in the epidermal growth factor receptor (EGFR) and the fusion oncogene EML4-ALK in which the echinoderm microtubule-associated protein-like 4 (EML4) is fused with the intracellular domain of anaplastic kinase (ALK) (2“4). Although significant advances have been made in the treatment of NSCLC using molecular targeted therapies such as erlotinib and crizotinib the median OS for patients with advanced NSCLC remains low (56) and acquired resistance to target agents is a major clinical problem. Therefore the development of novel therapies is needed (7). Immunotherapy manipulates the immune system to control and eradicate cancer. Many recent studies provide evidence suggesting that immunotherapeutic manipulations are viable in many tumor types including lung cancer. Numerous trials of peptide vaccines autologous cellular therapy T cell-directed antibody therapy and monoclonal antibody therapy for lung cancer have been carried out around the world (8“10) and some of them have shown favorable results (11“13). The EML4-ALK fusion gene was identified in NSCLC patients by a team led by Professor H. Mano. This fusion gene was formed as the result of a small inversion within the short arm of chromosome 2 that joins differing portions of the EML4 gene with a portion of the ALK gene (1415). As a result of this fusion constant dimerization of the kinase domain of ALK is induced and its catalytic activity increases consequently. The EML4-ALK fusion gene is mainly identified in young never/former light smokers with NSCLC (16). It is estimated that approximately 5% of all NSCLC cases have this fusion gene. A few reports have also identified EML4-ALK in other cancers namely breast cancer and colorectal cancer (1718). For the most part the EML4-ALK fusion gene and other mutations such as those in EGFR and KRAS are mutually exclusive (19). The chromosomal inversion does not always occur in the same location and multiple EML4-ALK variants have been identified (19). At least 11 variants have been reported. The most common variants are E13;A20 (variant 1) and E6a/b;A20 (variant 3a/b) which have been detected in 33% and 29% of NSCLC patients respectively (14). PF-02341066 (crizotinib) is an ALK inhibitor currently under clinical development. Kwak et al conducted an open-label multi-center two-part phase I trial and found a remarkable 57% overall response rate and a 72% 6-month progression-free survival rate (20). In spite of the marked antitumor activity of crizotinib ALK-positive cancers invariably gain resistance to crizotinib. In the case of ALK-positive cancers as well as EGFR-mutant lung cancer resistance develops on average within the first 2 years of therapy (21). The main resistance mutations are L1196M a gatekeeper mutation and C1156M. In addition to ALK mutations other known mechanisms for acquired resistance include ALK amplification (2122) and EGFR activation (2324). To overcome resistance new ALK inhibitors are currently in early phase studies (25). Novel combinatorial strategies to overcome crizotinib resistance and further improve the clinical outcome are needed. We focused on this new fusion array as a novel target of immunotherapy. There are several methods to detect EML4-ALK NSCLC including polymerase chain reaction (PCR) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) (19). These methods detect high-level EML4-ALK fusion gene expression. Passoni et al identified two HLA-A*02:01-restricted ALK-derived peptides that induce peptide-specific CTL lines (26). We focused on the EML4 array as a novel epitope of immunotherapy. We identified a candidate 9- or 10-amino acid array of novel epitopes using the Bioinformatics and Molecular Analysis Section (BIMAS) software and analyzed its potential as a new immunotherapy epitope with respect to its ability to induce anticancer activity. We then induced and generated a peptide-specific CTL clone from peripheral blood lymphocytes of HLA-A*02:01-positive healthy donors. We report here that an EML4-ALK-derived peptide-specific human CTL clone recognized peptide-pulsed T2 cells and HLA-A*02:01-positive and EML4-ALK-positive tumor cells pretreated with IFN-?. Furthermore we showed that immunotherapy with this novel epitope peptide has potential for treatment of EML4-ALK-positive NSCLC. Materials and methods Peptides Human EML4-ALK-derived peptides carrying binding motifs for HLA-A*02:01-/HLA-A*24:02-encoded molecules were identified by HLA-peptide binding predictions using the BIMAS program (http://bimas.dcrt.nih.gov/molbio/hla_bind/index.html). We purchased a total of seven EML4-ALK-derived peptides carrying HLA-A*02:01 binding motifs and two peptides carrying HLA-A*24:02 binding motifs from Geneworld (Tokyo Japan). Cell lines The H2228 human lung adenocarcinoma cell line and EML4-ALK fusion protein variant 3 (E6; A20) were kindly provided by Professor S. Yano (Kanazawa University). T2 is a lymphoblastoid cell line that lacks TAP function and has HLA-A*02:01 molecules that can easily be loaded with exogenous peptides. T2A24 is the same cell line but with HLA-A*24:02 instead. T2 and T2A24 cells were cultured in RPMI medium supplemented with 10% heat-inactivated FBS. HLA-A*02:01/HLA-A*24:02 binding assay In order to determine the binding ability of the predicted peptides to HLA-A*02:01/HLA-A*24:02 molecules an in vitro cellular binding assay was performed as reported previously (27). Briefly after incubation of the T2/T2A24 cells in culture medium at 26°C for 18 h cells were washed with PBS and suspended in 1 ml Opti-MEM (Invitrogen Carlsbad CA USA) with or without 100 ?g peptide and then incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS HLA-A*02:01/HLA-A*24:02 expression was measured by flow cytometry using a FITC-conjugated and HLA-A*02:01-/HLA-A*24:02-specific monoclonal antibody (mAb) and the mean fluorescence intensity was recorded. Generation of dendritic cells CD14+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using human CD14 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). Immature dendritic cells (DCs) were generated from CD14+ cells using interleukin (IL)-4 (10 ng/ml; PeproTech Inc. Rocky Hill NJ USA) and granulocyte-macrophage colony-stimulating factor (GM-CSF; 10 ng/ml; PeproTech) in RPMI-1640 medium supplemented with 10% FBS. Maturation of DCs was induced by prostaglandin E2 (PGE2; 1 ?g/ml; Sigma St. Louis MO USA) and tumor necrosis factor (TNF-)-? (10 ng/ml; PeproTech). Induction of EML4-ALK-derived peptide-specific CTLs from PBMCs CD8+ cells were isolated from PBMCs using human CD8 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). CD8+ cells (2×106) were stimulated by peptide-pulsed irradiated autologous mature DCs (1×105). Autologous DCs were prepared from a limited supply; artificial antigen presenting cells (aAPCs) (K562/A2 or A24/CD80/CD83) were alternatively used for further examination. After 1 week these cells were stimulated twice per week by peptide-pulsed irradiated artificial APC-A2 or artificial APC-A24 cells (1×105). Supplementation with 10 IU/ml IL-2 (Proleukin; Novartis Pharmaceuticals Basel Switzerland) and 10 ng/ml IL-15 (PeproTech) was performed every 3 to 4 days between stimulations (28). IFN-? ELISPOT assay Specific secretion of IFN-? from human CTLs in response to stimulator cells was assayed using the IFN-? ELISPOT kit (BD Biosciences) according to the manufacturer™s instructions. Stimulator cells were pulsed with peptide for 2 h at room temperature and then washed. Responder cells were incubated with stimulator cells for 20 h. The resulting spots were counted using an ELIPHOTO counter (Minerva Tech Tokyo Japan). HIV-gag (77“85) (SLYNTYATL) was used as an irrelevant peptide in the CTL assay. Generation of CTL clones Cultured cells were incubated with peptide-pulsed T2/T2A24 cells at a ratio of 2:1 for 3.5 h at 37°C. CD107a-specific antibodies (BioLegend San Diego CA USA) were included in the mixture during the incubation period. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter (BD Biosciences). Sorted CTLs were stimulated and the CTL clones were established as described previously (29). Flow cytometry H2228 cells with or without pretreatment with 100 U/ml IFN-? (PeproTech) for 48 h were harvested and stained with anti-HLA-A2 Ab-FITC (MBL Japan) and analyzed using a FACSCanto II flow cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo software. Cytotoxicity assay The cytotoxic capacity was analyzed using the Terascan VPC system (Minerva Tech Tokyo). The CTL clone was used as the effector cell type. Target cells treated with 100 U/ml IFN-? (PeproTech) 42 h previously were labeled through incubation in calcein-AM solution for 30 min at 37°C. The labeled cells (1×104) were then co-cultured with the effector cells for 4“6 h. Fluorescence intensity was measured before and after the culture period and specific cytotoxic activity was calculated as described previously (29). HLA-A*02:01 blocking of T-cell activity was tested by pre-incubating the target cells with anti-HLA-A -B -C mAb (W6/32) or an isotype control mAb (mIgG2a?; BioLegend San Diego CA USA). Results Identification of HLA-A*02:01-/HLA-A*24:02-restricted EML4-ALK-derived peptides As candidate EML4-ALK- derived and HLA-A*02:01-/HLA-A*24:02-restricted CTL epitopes we selected nine peptides with highly predicted scores for HLA-A*02:01/HLA-A*24:02 binding calculated using BIMAS software (Tables I and II) and evaluated their ability to bind to HLA-A*02:01/HLA-A*24:02 molecules. All nine peptides were able to bind HLA-A*02:01/HLA-A*24:02 molecules (Fig. 1). Generation of an EML4-ALK-derived peptide-specific CTL clone from human PBMCs We next assessed the capacity of EML4-ALK-derived peptides to generate peptide-specific CTLs in vitro from human PBMCs of HLA-A*02:01/HLA-A*24:02 healthy donors. CTLs were induced by three stimulations with DCs or artificial APCs loaded with the EML4-ALK-derived peptides. CTLs were tested for specificity for each peptide using the IFN-? ELISPOT assay. Peptides A B and C could induce peptide-specific CTLs that were able to specifically recognize T2 cells pulsed with each peptide but not T2 cells without peptides (Fig. 2). Peptides B and C were able to induce CTLs from only one donor (healthy donor 3 for peptide B and healthy donor 4 for peptide C) but peptide A was able to induce CTLs in three of four donors (healthy donors 2 3 and 4). Based on this result we used peptide A for further examinations. Next we obtained one CTL clone from peptide A-specific CTLs that was able to specifically recognize T2 cells pulsed with peptide A but not T2 cells pulsed with an irrelevant HIV-gag peptide using single cell sorting with a CD107a antibody. The population of CD8+CD107a+ cells represented 0.984% of all stimulated cells (Fig. 3A). These cells were sorted as single cells in each well of a 96-well plate. "
Lung_Cancer
"To further functionally validate this point we show two promoters where the NME2 target site was not occupied by NME2 and had positioned nucleosomes in A549 cells and NME2-depleted A549 cells but were available for NME2 binding following NME2 induction (Supplementary Figure S3). In case of 53 genes we found positioned nucleosomes on or near NME2 target sites on NME2 depletion relative to control A549 cells. Together this suggests that in contrast to the nucleosomal changes following increase in NME2 expression NME2 target sites remain nucleosome-occupied in most cases on depletion of NME2. Binding site occupancy is transcriptionally active when associated with nucleosome repositioning We found that occupancy of about a fifth (870 of 3956 NME2 target sites ?22%) of the transcription target sites was concurrent with repositioning of nucleosomes in the NME2-induced condition. Interestingly these repositioning events resulted in altered expression of all the 791 genes (D). In contrast we found 1175 genes where the NME2 binding site (unique to the induced condition) was co-occupied with nucleosomes”only 130 (11%) of these genes showed altered expression. As a third possibility we found 1990 genes with NME2 occupancy in the induced condition though no nucleosomes were present in the vicinity of the NME2 site either before or after induction”i.e. target sites appeared to be independent of nucleosome repositioning. Again out of 1990 only 179 (8.9%) genes were differentially expressed. On mapping the NFR between the ?1 and +1 nucleosome positions in each of the three situations described above we found repositioning of the ?1 nucleosome by ?40 bp in the first case when repositioning was linked to binding site occupancy whereas in the other two situations the NFR was minimally altered on inducing NME2 (). DISCUSSION Our findings suggest that TF binding when closely associated with nucleosome repositioning results in altered gene expression changes. Interestingly in most cases when TF binding did not impact local nucleosome reanization it was not associated with altered transcriptional state of target gene. As we used human cancer cells that are metastatic and expression of the TF NME2 decreased their metastatic potential these findings also help in understanding how TF binding-induced nucleosome level changes influence the transcriptome during metastasis. TF binding and transcriptional activity are linked through local nucleosome repositioning It was recently reported that repositioning of the +1 nucleosome resulted in changes to NFR in genes that were differentially regulated during meiotic development in yeast (9). Though this was noted as a result of change in possibly multiple regulatory factors involved in meiotic development it is consistent with our results. Furthermore our findings indicate that assignment of transcriptional function to genome-wide target site binding would require information on nucleosome reanization to be more precise. This helps explain the noted discrepancy in high throughput DNA binding studies where low overlap between experimentally determined binding sites and gene expression has been observed (3435). A recent study noted chromatin accessibility before and after binding of the receptors (androgen (AR) or estrogen (ESR1)) were significantly altered (19) and suggested that both AR and ESR1 binding are associated with changes in local nucleosome occupancy. This is in line with our findings and suggests a model that integrates factor binding and transcriptional activity of genes with local nucleosomal changes. Non-specific binding of NME2 in the induced condition could be a confounding factor. To address this first we checked and found that in NME2-depleted cells a large number of genes were oppositely expressed with respect to their status in NME2-induced cells; it is unlikely that non-specifically activated/repressed genes as a result of NME2 induction would be differentially expressed on depleting NME2 (Supplementary Figure S4). Second the differentially expressed genes in NME2-induced cells correlate significantly with transcriptome changes that are clinically relevant (Supplementary Figure S5). Therefore though all NME2 binding events do not lead to increase/decrease in transcription it is unlikely to be due to spurious binding”it is possible that many of these associations are required for functions other than transcription. Overall chromatin landscape in promoters is largely constant site-specific changes are associated with transcription We found only 11.4% of nucleosomes to be repositioned in promoter proximal regions as a result of NME2 induction. Therefore it is interesting to consider that overall chromatin level changes may be relatively small. On the other hand and perhaps more interestingly there may be shift in nucleosome occupancy on TF binding leading to site-specific ˜open™ or ˜closed™ regions that facilitate regulatory events. Our findings (discussed above) further support this: nucleosomes repositioning along with engagement of TF at specific sites were in almost all cases associated with transcriptional change in the corresponding gene. In addition in both cases before and after NME2 induction enriched promoter nucleosome occupancy correlated with decreased expression of genes. Together these support a model where nucleosome occupancy generally determines the suppressed state of the transcriptome and reanization induced by DNA binding factors (themselves or when associated with chromatin modifiers) results in transcriptional activation at specific loci. Although further studies using other TFs will be required to substantiate this it appears to be consistent with an earlier study which observed decreased presence of nucleosomes in promoters of genes that were expressed during heat shock in yeast (16). However others have also noted either unchanged nucleosome occupancy (yeast grown in different carbon sources (3637)) or found nucleosome positioning to correlate with the state of transcription (active or silent) and not the extent of gene expression (18). Epigenetic signaling directs the location of TFs to cognate sites in given chromatin territories. Following this TFs are believed to be one of the key recruiters of chromatin modification and remodeling machineries (38“40). Recent evidence suggests that even the general TFs such as subunit of TFIID (Transcription Factor II D) complexes may be functional component of these machineries (41). In agreement with this basic understanding of transcription through chromatin our results demonstrate TF binding to be transcriptionally competent when coupled with locally altered nucleosome positioning. Furthermore our findings for the first time underline the importance of these aspects of chromatin biology in suppression of cancer spread mediated by NME2."
Lung_Cancer
"versus gemcitabine/carboplatin in advanced non-small-cell lung cancer J Clin Oncol 2013 31 2404 2412 23690416 19 Chemotherapy in non-small cell lung cancer: a meta-analysis using updated data on individual patients from 52 randomised clinical trials Non-Small Cell Lung Cancer Collaborative Group BMJ 1995 311 899 909 7580546 20 Scagliotti GV Fossati R Torri V Randomized study of adjuvant chemotherapy for completely resected stage I II or IIIA non-small-cell lung cancer J Natl Cancer Inst 2003 95 1453 1461 14519751 21 Waller D Peake MD Stephens RJ Chemotherapy for patients with non-small cell lung cancer: the surgical setting of the Big Lung Trial Eur J Cardiothorac Surg 2004 26 173 182 15200998 22 Douillard JY Rosell R De Lena M Adjuvant vinorelbine plus cisplatin versus observation in patients with completely resected stage IB-IIIA non-small-cell lung cancer (Adjuvant Navelbine International Trialist Association [ANITA]): a randomised controlled trial Lancet Oncol 2006 7 719 727 16945766 23 Pignon JP Tribodet H Scagliotti GV LACE Collaborative Group Lung adjuvant cisplatin evaluation: a pooled analysis by the LACE Collaborative Group J Clin Oncol 2008 26 3552 3559 18506026 24 Waller D Fairlamb DJ Gower N The Big Lung Trial (BLT): determining the value of cisplatin-based chemotherapy for all patients with non-small cell lung cancer. Preliminary results in the surgical setting Lung Cancer 2003 41 54 25 Chansky K Sculier JP Crowley JJ Giroux D Van Meerbeeck J Goldstraw P International Staging Committee and Participating Institutions The International Association for the Study of Lung Cancer Staging Project: prognostic factors and pathologic TNM stage in surgically managed non-small cell lung cancer J Thorac Oncol 2009 4 792 801 19458556 26 Bepler G Olaussen KA Vataire AL ERCC1 and RRM1 in the International Adjuvant Lung Trial by automated quantitative in situ analysis Am J Pathol 2011 179 69 78 21224045 27 Friboulet L Olaussen KA Pignon JP ERCC1 isoform expression and DNA repair in non-small-cell lung cancer N Engl J Med 2013 369 1101 1110 23514287 28 Bhagwat NR Roginskaya VY Acquafondata MB Dhir R Wood RD Niedernhofer LJ Immunodetection of DNA repair endonuclease ERCC1-XPF in human tissue Cancer Res 2009 69 6831 6838 19723666 29 Ma D Baruch D Shu Y Using protein microarray technology to screen anti-ERCC1 monoclonal antibodies for specificity and applications in pathology BMC Biotechnol 2012 12 88 23171216 30 Vaezi A Bepler G Bhagwat N CCT? is a novel antigen detected by the anti-ERCC1 antibody 8F1 with biomarker value in lung and head and neck squamous cell carcinomas Cancer 31 Reed E Platinum-DNA adduct nucleotide excision repair and platinum based anti-cancer chemotherapy Cancer Treat Rev 1998 24 331 344 9861196 32 Chen Z Zhou J Zhang Y Bepler G Modulation of the ribonucleotide reductase M1-gemcitabine interaction in vivo by N-ethylmaleimide Biochem Biophys Res Commun 2011 413 383 388 21893046 World J Surg Oncol World J Surg Oncol World Journal of Surgical Oncology 1477-7819 BioMed Central 24755441 3999735 1477-7819-12-108 10.1186/1477-7819-12-108 Case Report Surgical treatment of a solitary pulmonary metastasis from eyelid sebaceous carcinoma: report of a case Kaseda Kaoru 1 kasedawb4.so-net.ne.jp Ohtsuka Takashi 1 t-ohremus.dti.ne.jp Hayashi Yuichiro 2 yuichirohayashi72gmail.com Emoto Katsura 2 emotoa7.keio.jp Asakura Keisuke 1 asakurakeisukegmail.com Kamiyama Ikuo 1 i_kamirc4.so-net.ne.jp Goto Taichiro 1 taichirogj9.so-net.ne.jp Kohno Mitsutomo 1 kohnoa3.keio.jp 1Department of Surgery Section of General Thoracic Surgery Keio University 35 Shinanomachi Shinjuku-ku Tokyo 160-8582 Japan 2Department of Pathology School of Medicine Keio University Tokyo Japan 2014 23 4 2014 12 108 108 19 2 2014 7 4 2014 Copyright 2014 Kaseda et al.; licensee BioMed Central Ltd. 2014 Kaseda et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/4.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Ocular sebaceous carcinoma is an uncommon aggressive ocular neoplasm with potential for regional and distant metastasis. Case presentation A 77-year-old woman was found to have a solitary pulmonary lesion 6 years after the initial treatment of sebaceous carcinoma of the eyelid. Video-assisted lung wedge resection of an undetermined pulmonary nodule was carried out successfully. Microscopically the tumor showed foamy cytoplasm and atypical nuclei consistent with metastasis of eyelid sebaceous carcinoma. Conclusion This is the first case report of resected solitary pulmonary metastasis of eyelid sebaceous carcinoma. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Sebaceous carcinoma Lung metastasis Solitary metastasis Background Sebaceous carcinoma of the eyelid is a relatively rare malignant tumor and accounts for less than 1% of all eyelid tumors [1]. As well as being a rare tumor sebaceous carcinoma can mimic other benign inflammatory and malignant processes thus errors or delays in diagnosis are not unusual [2-5]. Although local management strategies for this tumor have previously been described [6-10] very few reports have focused on the patterns of metastasis of this tumor and the treatment strategies for such metastases [78]. Here we report a case of solitary lung metastasis of eyelid sebaceous carcinoma and discuss the clinical implication of surgery for a solitary pulmonary metastasis from sebaceous carcinoma. Case presentation A 77-year-old woman underwent left upper lid resection in April 2006 for sebaceous carcinoma of the eyelid. The surgical margin was negative for cancer cells. In January 2008 she had developed a recurrence in the left upper eyelid and underwent radiotherapy with a total dose of 57.6 Gy of proton beam therapy followed by orbital exenteration of the left eye [1112]. In July 2012 positron emission tomography“computed tomography (PET-CT) revealed a solitary pulmonary nodule 0.5 cm in size in the right upper lobe of the patient™s lung which had increased to 1.1 cm by September 2013 (A). PET-CT revealed a focus of increased uptake in that nodule with a standardized uptake value of 3.7 (B). There was no evidence of other metastatic disease on PET-CT scans. In September 2013 the patient underwent video-assisted thoracoscopic wedge resection of the pulmonary nodule. Frozen sections using oil red O stain revealed accentuation of lipid and presences of foamy cytoplasm in tumor cells which was positive for lipid staining (). Permanent histology demonstrated tumor cells with foamy cytoplasm and atypical nuclei accompanying numerous lipid globules within the cytoplasm () consistent with metastasis of eyelid sebaceous carcinoma. At the last follow-up 7 months after resection there was no loco-regional recurrence or distant metastasis of the tumor after surgery. Computed tomography (CT) and positron emission tomography of the tumors. (A) Chest CT showed a 1.1 cm nodule in the anterior segment of the right upper lobe (arrow). (B) PET-CT showed fluorodeoxyglucose accumulation with a Standardized uptake value (SUV) of 3.7 (arrowhead). Accentuation of lipid by staining. The lipid globules have a red color (frozen sections oil red O magnification?—?100). Sebaceous carcinoma cells. Foamy and frothy cytoplasm and atypical nuclei occurred with numerous lipid globules within the cytoplasm of the tumors cells seen as clear spaces (hematoxylin and eosin magnification?—?100). Discussion Sebaceous carcinoma of the eyelid refers to a group of carcinomas derived from sebaceous gland cells that occur in the ocular adnexa. It can be invasive in the eyelid and conjunctiva and can metastasize to regional lymph nodes and distant ans [81314]. Treatment strategies for primary eyelid sebaceous carcinoma are surgery radiotherapy and chemotherapy [15-17]. Distant hematogenous metastases to the lung liver and brain have a mortality rate as high as 30% [1618]. However few reports demonstrated the surgical treatment of metastatic eyelid sebaceous carcinoma. Standard treatment strategy for pulmonary metastatic sebaceous carcinoma has not yet been established because of the limited number of cases. Chemotherapy regimens in existing reports are largely based on the combination regimens commonly used in the treatment of other forms of poorly differentiated carcinomas of the head and neck region [1920]. Husain et al. reported combined chemotherapy of carboplatin and docetaxel for the patient who had multiple lung and lymph node metastases which resulted in a 30% decrease in tumor size but the efficacy of this regimen for sebaceous carcinoma has not yet been fully evaluated [21]. Radiotherapy for primary eyelid sebaceous carcinoma was described in several reports; however there have been no reports describing radiotherapy for pulmonary metastatic eyelid sebaceous carcinoma [2223]. Resection of pulmonary metastases in patients with sebaceous carcinoma is controversial. However our case suggests that a surgical approach to lung metastasis of eyelid sebaceous carcinoma could prolong survival in certain subgroups of patients namely those with a limited number of metastatic nodules or a significant disease-free interval. The possibility of metastasis from eyelid sebaceous carcinoma or primary lung cancer cannot be predicted only on the basis of radiologic findings or disease-free interval. In the present case we could successfully differentiate solitary lung metastasis of eyelid sebaceous carcinoma from primary lung cancer using oil red O stain which stains lipid has a red color on frozen sections. Conclusion We report a rare case of solitary lung metastasis of eyelid sebaceous carcinoma which was successfully resected and differentiated from primary lung cancer using oil red O stain on frozen sections. Pulmonary resection is a good option for the treatment and diagnosis of metastatic eyelid sebaceous carcinoma. Consent Written informed consent was obtained from the patient for the publication of this case presentation and accompanying images. A copy of the written consent is available for the review by the Editor-in-Chief of this journal. Abbreviations CT: Computed tomography; FDG: Fluorodeoxyglucose; PET: Positron emission tomography. Competing interests The authors declare that they have no competing interests. Authors™ contributions KK and TO wrote the manuscript. KK TO KA and IK performed surgery. YH and KE carried out the pathological examination. MK and TG were involved in the final editing. All authors approved the final manuscript. Cook BE Jr Bartley GB Cook BE Jr Bartley GB Treatment options and future prospects for the management of eyelid malignancies: an evidence-based update Ophthalmology 2001 108 2088 2209 quiz 2099“2100 2121 10.1016/S0161-6420(01)00796-5 11713084 Lai TF Huilgol SC Selva D James CL Eyelid sebaceous carcinoma masquerading as in situ squamous cell carcinoma Dermatol Surg 2004 30 222 225 10.1111/j.1524-4725.2004.30069.x 14756656 Leibovitch I Selva D Huilgol S Davis G Dodd T James CL Intraepithelial sebaceous carcinoma of the eyelid misdiagnosed as Bowen™s disease J Cutan Pathol 2006 33 303 308 10.1111/j.0303-6987.2006.00423.x 16630181 Pereira PR Odashiro AN Rodrigues-Reyes AA Correa ZM de Souza Filho JP Burnier MN Jr Histopathological review of sebaceous carcinoma of the eyelid J Cutan Pathol 2005 32 496 501 10.1111/j.0303-6987.2005.00371.x 16008694 Sinard JH Immunohistochemical distinction of ocular sebaceous carcinoma from basal cell and squamous cell carcinoma Arch Ophthalmol 1999 117 776 783 10.1001/archopht.117.6.776 10369589 Chao AN Shields CL Krema H Shields JA Outcome of patients with periocular sebaceous gland carcinoma with and without conjunctival intraepithelial invasion Ophthalmology 2001 108 1877 1883 10.1016/S0161-6420(01)00719-9 11581065 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the eyelids: personal experience with 60 cases Ophthalmology 2004 111 2151 2157 10.1016/j.ophtha.2004.07.031 15582067 Shields JA Demirci H Marr BP Eagle RC Jr Shields CL Sebaceous carcinoma of the ocular region: a review Surv Ophthalmol 2005 50 103 122 10.1016/j.survophthal.2004.12.008 15749305 Yen MT Tse DT Wu X Wolfson AH Radiation therapy for local control of eyelid sebaceous cell carcinoma: report of two cases and review of the literature Ophthal Plast Reconstr Surg 2000 16 211 215 10.1097/00002341-200005000-00008 10826762 Wang JK Liao SL Jou JR Lai PC Kao SC Hou PK Chen MS Malignant eyelid tumours in Taiwan Eye (Lond) 2003 17 216 220 10.1038/sj.eye.6700231 12640409 Zenda S Kawashima M Nishio T Kohno R Nihei K Onozawa M Arahira S Ogino T Proton beam therapy as a nonsurgical approach to mucosal melanoma of the head and neck: a pilot study Int J Radiat Oncol Biol Phys 2011 81 135 139 10.1016/j.ijrobp.2010.04.071 20950948 Zenda S Kohno R Kawashima M Arahira S Nishio T Tahara M Hayashi R Kishimoto S Ogino T Proton beam therapy for unresectable malignancies of the nasal cavity and paranasal sinuses Int J Radiat Oncol Biol Phys 2011 81 1473 1478 10.1016/j.ijrobp.2010.08.009 20961697 Ginsberg J Present Status of Meibomian gland carcinoma Arch Ophthalmol 1965 73 271 277 10.1001/archopht.1965.00970030273022 14237799 Rao NA Hidayat AA McLean IW Zimmerman LE Sebaceous carcinomas of the ocular adnexa: a clinicopathologic study of 104 cases with five-year follow-up data Hum Pathol 1982 13 113 122 10.1016/S0046-8177(82)80115-9 7076199 Gardetto A Rainer C Ensinger C Baldissera I Piza-Katzer H Sebaceous carcinoma of the eyelid: a rarity worth considering Br J Ophthalmol 2002 86 243 244 10.1136/bjo.86.2.243 11815355 Kass LG Hornblass A Sebaceous carcinoma of the ocular adnexa Surv Ophthalmol 1989 33 477 490 10.1016/0039-6257(89)90049-0 2658172 Lan MC Lan MY Lin CZ Ho DM Ho CY Sebaceous carcinoma of the eyelid with neck metastasis Otolaryngol Head Neck Surg 2007 136 670 671 10.1016/j.otohns.2006.08.019 17418274 Boniuk M Zimmerman LE Sebaceous carcinoma of the eyelid eyebrow caruncle and orbit Trans Am Acad Ophthalmol Otolaryngol 1968 72 619 642 5706692 Midena E Angeli CD Valenti M de Belvis V Boccato P Treatment of conjunctival squamous cell carcinoma with topical 5-fluorouracil Br J Ophthalmol 2000 84 268 272 10.1136/bjo.84.3.268 10684836 Yeatts RP Engelbrecht NE Curry CD Ford JG Walter KA 5-Fluorouracil for the treatment of intraepithelial neoplasia of the conjunctiva and cornea Ophthalmology 2000 107 2190 2195 10.1016/S0161-6420(00)00389-4 11097594 Husain A Blumenschein G Esmaeli B Treatment and outcomes for metastatic sebaceous cell carcinoma of the eyelid Int J Dermatol 2008 47 276 279 10.1111/j.1365-4632.2008.03496.x 18289332 Hata M Koike I Omura M Maegawa J Ogino I Inoue T Noninvasive and curative radiation therapy for sebaceous carcinoma of the eyelid Int J Radiat Oncol Biol Phys 2012 82 605 611 10.1016/j.ijrobp.2010.12.006 21300468 Howrey RP Lipham WJ Schultz WH Buckley EG Dutton JJ Klintworth GK Rosoff PM Sebaceous gland carcinoma: a subtle second malignancy following radiation therapy in patients with bilateral retinoblastoma Cancer 1998 83 767 771 10.1002/(SICI)1097-0142(19980815)83:4<767::AID-CNCR20>3.0.CO;2-P 9708943 101274235 33311 J Thorac Oncol J Thorac Oncol Journal of thoracic oncology : official publication of the International Association for the Study of Lung Cancer 1556-0864 1556-1380 24736085 4271824 10.1097/JTO.0000000000000082 NIHMS648380 A Randomized Placebo-Controlled Multicenter Biomarker-Selected Phase 2 Study of Apricoxib in Combination with Erlotinib in Patients with Advanced Non“Small-Cell Lung Cancer Gitlitz Barbara J. MD * Bernstein Eric MD   Santos Edgardo S. MD ¡ Otterson Greg A. MD § Milne Ginger PhD ? Syto Mary MS ¶ Burrows Francis PhD ¶ Zaknoen Sara MD ¶ *University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center Los Angeles California  Providence Cancer Center Portland Oregon ¡University of Miami Sylvester Comprehensive Cancer Center Miami Florida §Ohio State University Columbus Ohio ?Vanderbilt University Nashville Tennessee ¶Tragara Pharmaceuticals San Diego California Address for correspondence: Barbara Gitlitz MD University of Southern California Keck School of Medicine Norris Comprehensive Cancer Center 1441 Eastlake Avenue Suite 3400 Los Angeles CA 90089. gitlitzusc.edu 13 12 2014 4 2014 19 12 2014 9 4 577 582 Copyright 2013 by the International Association for the Study of Lung Cancer 2013 Cyclooxygenase-2 (COX-2) overexpression is associated with a poor prognosis in non“small-cell lung cancer (NSCLC) and may promote resistance to epidermal growth factor receptor inhibitors. This randomized phase 2 trial evaluated apricoxib a novel COX-2 inhibitor in combination with erlotinib in biomarker-selected patients. Patients with stage IIIB/IV NSCLC previously treated with platinum-based chemotherapy were randomized (2:1) to 400 mg/day apricoxib plus 150 mg/day erlotinib (AP/E) or placebo plus erlotinib (P/E) in 21-day cycles until disease progression or unacceptable toxicity. The primary endpoint was time to progression (TTP). A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetzbroadinstitute. (G.G.) tjacksmit.edu (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor "
Lung_Cancer
"We also evaluated chest CT findings to determine the involvement of emphysema. The percentage of the COPD group with involvement of emphysema in the chest CT findings was almost twice as high as that of the non-COPD group (38.8% vs 20.3% respectively). Patient characteristics among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value Cases 100 (270) 45.6 (123) 54.4 (147) 0.0001 # Age years a 70.1 (39“88) 67.9 (39“82) 71.9 (51“87) 0.0001 # Sex male 73.7 (199) 62.6 (77) 83.0 (122) 0.0001 # History of smoking 78.9 (213) 65.9 (81) 89.8 (132) 0.0001 # COPD managed b 8.5 (23) 1.6 (2) 14.3 (21) 0.0001 # COPD-related systemic comorbidities 55.9 (151) 52.8 (65) 58.5 (86) 0.390 Diabetes 19.3 (52) 16.3 (20) 21.8 (32) 0.280 Ischemic cardiac disease 7.4 (20) 2.4 (3) 11.6 (17) 0.004 # Hypertension 38.1 (103) 37.4 (46) 38.8 (57) 0.900 Hyperlipidemia 11.9 (32) 8.1 (10) 15.0 (22) 0.092 n indicates number. aData are shown as mean (range). bindicates the patients who had been diagnosed as COPD before bronchoscopy. All other data are shown as% (numbers). #p?<?0.05. COPD: chronic obstructive pulmonary disease. Population of non-COPD and COPD in Japanese patients with lung cancer. Schematic presentation of the percentage of non-COPD (n?=?123) and COPD (n?=?147) among Japanese patients with lung cancer. Patients with COPD were classified by GOLD grade that is grade 1 (n?=?95) grade 2 (n?=?41) grade 3 (n?=?11) and grade 4 (n?=?0). Physical assessment variables among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value BMI (kg/m 2 ) a 22.1 (2.8) 22.0 (2.8) 22.2 (2.9) 0.749 spirometric variables %VC a 105.9 (20.6) 104.8 (20.8) 106.7 (20.5) 0.520 FEV1 (ml) a 2062 (610) 2302 (555) 1861 (583) 0.0001 # FEV1/FVC a 67.3 (12.6) 77.8 (6.3) 58.9 (10.3) 0.0001 # %FEV1 predicted a 98.2 (25.7) 109.4 (21.1) 88.9 (25.4) 0.0001 # %IC a 85.9 (19.5) 83.6 (17.8) 87.9 (20.6) 0.111 chest CT finding emphysema 30.4 (82) 20.3 (25) 38.8 (57) 0.001 # n indicates number. aData are shown as mean (SD). All other data are shown as% (numbers). #p?<?0.05. BMI: body mass index; VC: vital capacity; FEV1: forced expiratory volume in 1 second; FVC: forced vital capacity; IC: inspiratory capacity; GOLD: the Global Initiative for Chronic Obstructive Lung Disease. Association of COPD prevalence with lung cancer characteristics in Japanese patients undergoing bronchoscopy To evaluate the association of COPD with characteristics of lung cancer the pathological findings EGFR mutation status clinical staging and decision for thoracic surgery were compared between the COPD group and the non-COPD group (). Characteristics of lung cancer status among non-COPD and COPD patients All cases (n?=?270) Non-COPD (n?=?123) COPD (n?=?147) p value Pathology 0.0001 # Adenocarcinoma 53.7 (145) 69.9 (86) 40.1 (59) ## Sq 27.0 (73) 17.9 (22) 34.7 (52) ## NSCLC 10.4 (28) 4.9 (6) 15.0 (21) ## SCLC 6.7 (18) 5.7 (7) 7.5 (11) Large 2.2 (6) 1.6 (2) 2.7 (4) Clinical stage 0.046 # 1A 25.6 (69) 30.8 (38) 21.1 (31) 1B 13.7 (37) 13.0 (16) 13.6 (20) 2A 9.6 (26) 13.0 (16) 7.5 (11) 2B 7.8 (21) 9.8 (12) 6.1 (9) 3A 11.9 (32) 8.9 (11) 14.3 (21) 3B 5.6 (15) 4.1 (5) 6.8 (10) 4 17.0 (46) 16.3 (20) 17.7 (26) ND 8.9 (24) 4.1 (5) 12.9 (19) ## Thoracic surgery 0.0001 # Yes 138 (51.1) 64.2 (79) 40.1 (59) EGFR mutation status 0.001 # Yes 14.8 (40) 21.1 (26) 9.5 (14) ## No 55.2 (149) 59.3 (73) 51.7 (76) ND 30.0 (81) 19.5 (24) 38.8 (57) ## n indicates number. All data are shown as% (numbers). ND indicates œnot determined. #p?<?0.05. ##indicates a significant difference compared with the non-COPD group. COPD: chronic obstructive pulmonary disease; Sq: squamous cell carcinoma; NSCLC: non-small cell lung carcinoma; SCLC: small cell lung carcinoma; Large: large cell carcinoma; EGFR: epidermal growth factor receptor. Regarding pathologic findings the incidence of adenocarcinoma was significantly lower in the COPD group than in the non-COPD group. In the present study EGFR mutation was observed only in the patients with adenocarcinoma (40/145 cases; 27.6%). In contrast the number of cases in which EGFR mutation status was not determined was significantly higher in the COPD group than in the non-COPD group. Although determination of the clinical stage should be essential in order to propose the therapeutic options for lung cancer some cases in which clinical staging had not been completed were observed in the study population. The number of these cases was significantly higher in the COPD group than in the non-COPD group. In contrast the proportion of patients with each classification in the clinical staging did not differ between the two groups besides the cases in which the clinical staging was not determined. Among the total study population the number of thoracic surgeries performed was significantly lower in the COPD group than in the non-COPD group. Critical impact of the severity of airflow obstruction on the decision to propose thoracic surgery with curative intent To explore whether or not the severity of airflow obstruction might affect the decision to propose thoracic surgery with curative intent patients at stage 3B and 4 were excluded from the analysis because they were not eligible for thoracic surgery. In addition patients for whom the clinical staging had not been completed were also excluded. As a result we evaluated data from 185 patients with lung cancer at stage 1A to 3A who underwent spirometry and bronchoscopy. These patients were subdivided into those who underwent thoracic surgery (135 cases) and those who did not (50 cases). The characteristics and spirometric data for the patients with or without thoracic surgery are summarized in Tables 4 and 5. The characteristics of lung cancer among these groups are also shown in . Univariate analysis identified a significantly lower frequency of thoracic surgery among the patients of greater age and with more severe airway obstruction and advanced clinical staging. Univariate analysis also identified a significantly higher frequency of thoracic surgery among patients with adenocarcinoma. Finally all of the factors with a significant association in the univariate analysis were applied to the multivariate model to identify variables independently associated with the decision for thoracic surgery. Multivariate analysis identified more severe airway obstruction advanced clinical stagings and higher age as independent factors affecting the decision on thoracic surgery ()."
Lung_Cancer
"This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCT™s treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress"
Lung_Cancer
" <0.001* Ia + Ib 25(47.2) 9(15.0) IIa + IIb 17(32.1) 21(35.0) IIIa 11(20.7) 30(50.0) Tumor size 0.001* ?5cm 35(66.0) 21(35.0) >5cm 18(34.0) 39(65.0) Lymph node metastasis 0.001* Negative 34(64.2) 20(33.3) Positive 19(35.8) 40(66.7) Smoking History 0.127 Smokers 39(64.2) 36(60.0) Never Smokers 14(35.8) 24(40.0) * Overall P?<?0.05. Association of BANCR expression with patients™ survival Kaplan-Meier survival analysis was conducted to investigate the correlation between BANCR expression and NSCLC patient prognosis. According to relative BANCR expression in tumor tissues the 113 NSCLC patients were classified into two groups: the high BANCR group (n?=?53 fold-change???4); and the low BANCR group (n?=?60 fold-change ?4) (B). With respect to progression-free survival (PFS) this was 35.3% for the high BANCR group and 17.2% for the low BANCR group. Median survival time for the high BANCR group was 31 months and 16 months for the low BANCR group (C). The overall survival rate over 3 years for the high BANCR group was 46% and 27.5% for the low BANCR group. Median survival time for the high BANCR group was 32 months and 18 months for the low BANCR group (D). Univariate analysis identified three prognostic factors: lymph node metastasis; TNM stage; and BANCR expression level. Other clinicopathological features such as gender and age were not statistically significant prognosis factors (). Multivariate analysis of the three prognosis factors confirmed that a low BANCR expression level was an independent predictor of poor survival for NSCLC (p?=?0.031) in addition to TNM stage (p?=?0.038) (). Univariate and multivariate analysis of overall survival in NSCLC patients (n?=?113) Variables Univariate analysis Multivariate analysis HR 95% CI p value HR 95% CI p value Age 1.257 0.712-2.219 0.431 Gender 1.185 0.670-2.098 0.559 Smoker 1.120 0.842-1.491 0.436 Histological subtype 0.982 0.738-1.307 0.902 Chemotherapy 0.787 0.587-1.055 0.110 Tumor size 1.233 0.926-1.640 0.151 Lymph node metastasis 0.424 0.235-0.764 0.004* 0.577 0.311-1.071 0.081 TNM stage (I vs. II or IIIa) 0.320 0.149-0.685 0. 003* 0.431 0.195-0.954 0.038* BANCR expression 0.367 0.201-0.669 0. 001* 0.496 0.262-0.938 0.031* HR hazard ratio; 95 % CI 95 % confidence interval * Overall P?<?0.05. Histone deacetylation is involved in the downregulation of BANCR Expression levels of BANCR in NSCLC cell lines were determined by qPCR. Compared with that in 16HBE cells relative expression levels of BANCR were reduced in NSCLC cells (A). Because of the different expression patterns for BANCR in NSCLC and melanomas we investigated the mechanisms controlling tissue-specific expression of BANCR. We analyzed the promoter region of BANCR and found there were no CpG islands (data not shown). Histone protein modification was thought to play an important role in the transcription of lncRNAs; however knockdown of two core subunits of polycomb repressive complex 2 (SUZ12 and EZH2) had no influence on BANCR expression (Additional file 2: Figure S1A). Histone deacetylation is involved in BANCR downregulation. (A) BANCR expression levels of NSCLC cell lines (A549 SPC-A1 H1299 H1650 H1975 and SK-MES-1) compared with that in normal human bronchial epithelial cells (16HBE). (B) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with TSA. (C) qPCR analysis of HDAC2 and HDAC3 expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC2 or si-HDAC3.(D E) qPCR analysis of BANCR expression levels following the treatment of SPC-A1 and A549 cells with si-HDAC1 and si-HDAC3. We observed that BANCR expression was upregulated in SPC-A1 and A549 cells following treatment with the histone deacetylase (HDAC) inhibitor trichostatin A (TSA) (B). We sought to determine whether repression of BANCR was mediated by HDACs. Specific anti-HDAC1 and HDAC3 siRNAs were transfected into NSCLC cells and HDAC1 and HDAC3 expression was significantly decreased (C). Expression levels of BANCR were significantly upregulated in cells transfected with si-HDAC3. Transfection with the scrambled siRNA or si-HDAC1 did not induce BANCR expression (D and E). Moreover the HDAC3 expression was upregulated in NSCLC cells and negatively correlated with BANCR expression (Additional file 2: Figure S1B). Furthermore NSCLC cells were treated with RGFP966 which is an seletive inhibitor for HDAC3 with an IC50 of 0.08?M and no effective inhibition of other HDACs at concentrations up to 15?M. The results of qPCR showed that the expression of BANCR was upregulated in NSCLC cells after treated with RGFP966 when compared with control cells (Additional file 2: Figure S1C). These data indicate that HDAC3 knockdown induced BANCR increase may be due to the inhibition of HDAC3 enzymatic activity. BANCR inhibits NSCLC cell viability and induces apoptosis To assess the biological role of BANCR in NSCLC we investigated the effects of BANCR over-expression on the viability and apoptosis of SPCA1 or A549 cells. Our qPCR results revealed that BANCR expression was significantly upregulated compared with that in control cells (A). MTT assay results showed that the growth of SPC-A1 and A549 cells transfected with pCDNA-BANCR was impaired compared with that for control cells (B and C). Colony formation assay results revealed that clonogenic survival was inhibited following overexpression of BANCR in SPC-A1 and A549 cells (D). Flow cytometry analysis of SPC-A1 and A549 cells showed that upregulation of BANCR expression promoted apoptosis in comparison with that in control cells (E). Effects of BANCR on NSCLC cell viability and apoptosis in vitro. (A) SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (B C) MTT assays were used to determine the cell viability for pCDNA-BANCR-transfected SPC-A1 and A549 cells. Values represented the mean?±?s.d. from three independent experiments. (D) Colony-forming assays were conducted to determine the proliferation of pCDNA-BANCR-transfected SPC-A1 and A549 cells. (E) Apoptosis was determined by flow cytometry. UL necrotic cells; UR terminal apoptotic cells; LR early apoptotic cells. *P?<?0.05 and **P?<?0.01. BANCR inhibits migration and invasion of NSCLC cells The wound healing assay results showed that cells transfected with pCDNA-BANCR resulted in a slower closing of scratch wounds compared with that for control cells (A and B). We evaluated cancer cell invasion through matrigel and migration through transwells. Increased BANCR expression levels impeded the migration of SPC-A1 and A549 cells by approximately 64% compared with controls (C and D). Similarly invasion of SPC-A1 and A549 cells was also reduced by 59% following upregulation of BANCR expression. Effects of BANCR on NSCLC migration and invasion in vitro. SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (A B) Wound-healing assays were used to investigate the migratory ability of NSCLC cells. (C D) Transwell assays were used to investigate the changes in migratory and invasive abilities of NSCLC cells. *P?<?0.05 and **P?<?0.01. Knockdown of BANCR expression promotes NSCLC cells invasion To determine whether inhibition of BANCR expression could promote NSCLC cells viability and invasion we performed targeted knockdown of BANCR expression using RNA interference (RNAi) in A549 cells (A). MTT assays revealed that downregulation of BANCR expression did not affect cell viability (data not shown). However decreased BANCR expression levels promoted A549 cell migration and invasion in vitro (B). Effects of BANCR overexpression on tumor metastasis in vivo. (A) BANCR expression levels were determined by qPCR following the treatment of A549 cells with si-BANCR. (B) Transwell assays were conducted to determine the migratory and invasive abilities of si-BANCR-transfected A549 cells. Analysis of an experimental metastasis animal model was performed by injecting BANCR-overexpressing SPC-A1 cells into nude mice. (C) Lungs from mice in each experimental group with the numbers of tumor nodules on lung surfaces were shown. (D) Visualization of the entire lung and HE-stained lung sections. **P?<?0.01. BANCR suppresses NSCLC cell metastasis in vivo To validate the effects of BANCR on the metastasis of NSCLC cells in vivo SPCA1 cells stably transfected with pCDNA-BANCR were injected into nude mice. Metastatic nodules on the surface of lungs were counted after 7 weeks. Ectopic overexpression of BANCR resulted in a reduction of the number of metastatic nodules compared with those in the control group (C). This difference was further confirmed following examination of the entire lungs and through hematoxylin and eosin (HE) staining of lung sections (D). Our in vivo data complemented the results of functional in vitro studies involving BANCR. BANCR influences NSCLC cell EMT We conducted qPCR and western blotting assays to detect the expression of EMT-induced markers (E-cadherin N-cadherin and Vimentin) in cells over-expressing BANCR. Our findings showed that increased BANCR expression levels induced E-cadherin expression while decreased N-cadherin Vimentin and MMP-2 expression (Figure 6A). Simultaneously upregulation of BANCR expression led to decreased SNAIL1 SNAIL2 and SIP1 expression (Figure 6B). Western blotting and immunofluorescence analysis also revealed that enhanced BANCR expression stimulated E-cadherin expression and reduced Vimentin expression in NSCLC cells (Figure 6B and C). Figure 6 BANCR overexpression suppresses NSCLC cell invasion and metastasis by affecting EMT. (A B) Analysis of E-cadherin N-cadherin Vimentin MMP-2 MMP-9 SNAIL1 SNAIL2 TWIST and SIP1 expression in A549 cells treated with pCDNA-BANCR. (CD) Analysis of E-cadherin and Vimentin expression in A549 cells treated with pCDNA-BANCR by western blot and immunofluorescence. All experiments were performed in triplicate with three technical replicates. *P < 0.05 **P < 0.01. Discussion Recent evidence has shown that ncRNAs play an important role in cancer pathogenesis and could provide new insights into the biology of this disease [2122]. Over the past decade microRNAs (miRNAs) have moved to the forefront of ncRNA research in NSCLC. However lncRNAs in NSCLC are still an emerging field with only a handful of lncRNAs involved in NSCLC tumorigenesis. One of these lncRNAs is metastasis-associated lung adenocarcinoma transcript 1 (MALAT1). MALAT1 also known as NEAT2 (nuclear-enriched abundant transcript 2) is a highly conserved nuclear lncRNA and a predictive marker for metastasis development in lung cancer [23]. In this study we found that the expression of another lncRNA BANCR was significantly downregulated in NSCLC tissues. Specifically BANCR expression was significantly lower at the later stages of tumor development and in tumors that had undergone extensive metastasis. Moreover the overall survival time of patients with lower BANCR expression levels was significantly shorter than that for patients with higher BANCR expression levels. Our results indicate that BANCR expression provided a significant independent predictive value for TNM stage (P?=?0.038). We demonstrated that upregulation of BANCR expression led to the significant inhibition of cell viability migration invasion and promotion of apoptosis. Knockdown of BANCR expression promoted cell migration and invasion. BANCR induced cell apoptosis may be partly via P53 which could contribute to the less cells in migration and invasion; however the impaired migration and invasion ability is the main reason which could be supported by wound-healing assay. Moreover increased BANCR expression levels resulted in a significant reduction in the number of metastatic nodules on the lungs in vivo. These findings suggest that BANCR plays a direct role in the modulation of cell metastasis and NSCLC progression and may be useful as a novel prognostic or progression marker for NSCLC. Tumor development and progression is precisely regulated by several subsets of genes that act by either silencing tumor suppressor genes or activating oncogenes [24]. Tumor suppressor genes can negatively regulate cell proliferation by inducing growth arrest and inhibiting cell invasion. In cancer cells tumor suppressor genes are usually silenced by genetic or epigenetic alterations [25]. Whether epigenetic regulatory factors such as histone acetylation or DNA methylation manipulate the expression of lncRNAs remains unclear. Hypermethylation of the promoter or the intergenic differentially methylated region has been found to contribute to reduced lncRNA MEG3 expression in tumors indicating that epigenetic regulation is also involved in the expression of these genes [2627]. Our findings highlight that histone acetylation is a key factor in controlling lncRNA BANCR expression. These results along with those from a recent study [28] highlight the role of epigenetics in regulating lncRNA transcription. To explore the molecular mechanism through which BANCR contributes to the invasion and metastasis of NSCLC we investigated potential target proteins involved in cell motility and matrix invasion. Hallmarks of EMT are the loss of E-cadherin expression and aberrant expression of N-cadherin and Vimentin [29-32]. Therefore we determined the protein levels of these EMT-induced markers following BANCR overexpression. Our results indicated that inhibitory effects on cell migration and invasion were associated with EMT. Matrix metalloproteases (MMPs) are also important to many aspects of biology ranging from cell proliferation differentiation and remodeling of the extracellular matrix (ECM) to vascularization and cell migration. Upregulation of BANCR expression in NSCLC cells led to a significant decrease in MMP2 protein levels. Our findings demonstrated that BANCR mediated NSCLC cell migration invasion and metastasis suppression which possibly also affected EMT. As a central differentiation process EMT allows for remodeling of tissues during the early stages of embryogenesis and is implicated in the promotion of tumor cell invasion and metastasis [733]. It has been proposed and supported by many studies that EMT could be a potent mechanism for promoting the detachment of cancer cells from primary tumors. A characteristic of cells that undergo EMT is increased expression levels of N-cadherin and Vimentin and a loss of E-cadherin expression. Importantly EMT has been reported to be associated with poor clinical outcome in NSCLC [3435]. Therefore lncRNAs as regulators of EMT might be suitable candidates for intervention in the treatment of cancer. Although only a small number of functional lncRNAs have been well characterized to date they have been shown to regulate gene expression at various levels including chromatin modification transcription and post-transcriptional processing. Hox transcript antisense intergenic RNA (HOTAIR) is one of the most studied lncRNAs involved in chromatin modification which can target PRC2 genome-wide to alter H3K27 methylation and gene expression patterns [22]. A muscle-specific lncRNA linc-MD1 may function as competing endogenous RNAs (ceRNAs) to sponge miRNAs thereby modulating the derepression of miRNA targets and impose an additional level of post-transcriptional regulation [36]. Here although we observed BANCR overexpression induced NSCLC cells apoptosis and regulate EMT phenotype the possible mechanisms that underlie such regulatory behaviors still remain to be fully understood. Further investigation of BANCR molecular and biological functions in controlling EMT will undoubtedly be important in understanding the molecular biology of NSCLC metastasis and progression. Conclusions The expression of BANCR was significantly decreased in NSCLC tissues suggesting that its downregulation may be a negative prognostic factor for NSCLC patients and indicative of poor survival rates and a higher risk for cancer metastasis. We showed that BANCR possibly regulates the invasive and metastatic ability of NSCLC cells partially through regulation of EMT. Our findings further the understanding of NSCLC pathogenesis and development and facilitate the development of lncRNA-directed diagnostics and therapeutics against cancers. However the molecular mechanisms through which BACNR regulates EMT requires further investigation. Methods Tissue collection We obtained 113 paired NSCLC and adjacent non-tumor lung tissues from patients who underwent surgery at Jiangsu Province Hospital between 2008 and 2010 and were diagnosed with NSCLC (stages I II and III) based on histopathological evaluation. Clinicopathological characteristics including tumor-node-metastasis (TNM) staging were recorded. No local or systemic treatment was conducted in these patients before surgery. All collected tissue samples were immediately snap-frozen in liquid nitrogen and stored at “80°C until required. Our study was approved by the Research Ethics Committee of Nanjing Medical University China. Written informed consent was obtained from all patients. Cell lines Five NSCLC adenocarcinoma cell lines (A549 SPC-A1 NCI-H1975 NCI-H1299 and NCI-H1650) a NSCLC squamous carcinomas cell line (SK-MES-1) and a normal human bronchial epithelial cell line (16HBE) were purchased from the Institute of Biochemistry and Cell Biology of the Chinese Academy of Sciences (Shanghai China). A549 SK-MES-1 NCI-H1975 NCI-H1299 NCI-H1650 and 16HBE cells were cultured in RPMI 1640; SPC-A1 cells were cultured in DMEM (GIBCO-BRL) medium supplemented with 10% fetal bovine serum (FBS) 100 U/ml penicillin and 100 mg/ml streptomycin (Invitrogen Carlsbad CA USA) at 37ºC/5% CO2. RNA extraction and qPCR assays Total RNA was isolated with TRIzol reagent (Invitrogen) according to the manufacturer™s instructions. Total RNA (500 ng) was reverse transcribed in a final volume of 10 ?l using random primers under standard conditions for the PrimeScript RT reagent Kit (TaKaRa Dalian China). We used the SYBR Premix Ex Taq (TaKaRa Dalian China) to determine BANCR expression levels following the manufacturer™s instructions. Results were normalized to the expression of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The specific primers used are presented in Additional file 3: Table S2. The qPCR assays were conducted on an ABI 7500 and data collected with this instrument. Our qPCR results were analyzed and expressed relative to threshold cycle (CT) values and then converted to fold changes. Plasmid generation The BANCR sequence was synthesized and subcloned into the pCDNA3.1 (Invitrogen Shanghai China) vector. "
Lung_Cancer
"We concluded that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor was effective in suppressing the growth of gefitinib-resistant tumors caused by EGFR T790M mutation MET amplification and KRAS/PIK3CA mutation. These findings represent a promising strategy for the treatment of gefitinib-resistant NSCLC and provide a strong basis for the design of clinical trials for this purpose. Competing interests The authors declare that they have no competing interests. Authors™ contributions YQQ conceived and designed the experiments. XXW YHY YY and HL performed the experiments. XXW YHY and DDM analyzed the data. XXW YHY and HL wrote the paper. YQQ supervised the whole experimental work and revised the manuscript. All authors read and approved the manuscript. She J Yang P Hong Q Bai C Lung cancer in China: challenges and interventions Chest 2013 143 1117 1126 23546484 Weir HK Thun MJ Hankey BF Ries LA Howe HL Wingo PA Jemal A Ward E Anderson RN Edwards BK Annual report to the nation on the status of cancer "
Lung_Cancer
"This study was supported by grants from National Basic Research Program of China (973 Program No. 2012CB967003 to S. Shao) Natural Science Foundation of China (NO. 20935004 81071784 to S. Shao and 81172028 to Z. Hou). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Squamous cell carcinoma (SCC) is the second most common type of lung cancer accounting for about 30% of all lung cancers [1]. When diagnosed early lung SCC (LSCC) is well curable by surgical excision. However most of LSCC patients encounter high rate of recurrence for metastasis and resistance to existing chemotherapeutic agents after resection. Therefore in order to reduce mortality of LSCC it is necessary to identify molecular markers for early diagnosis and elucidate the biochemical mechanism governing the processes of recurrence and metastasis as well as therapeutic resistance. A proteomic approach using fluorescent dye-labeled proteins coupled with two-dimensional gel electrophoresis (2-DIGE) and mass spectrometric (MS) analysis has been widely applied to identify differentially expressed proteins between normal and tumor specimens [2]. These differentially expressed proteins could either serve as molecular markers for diagnosis or lead to understanding the molecular mechanisms of metastasis and therapeutic resistance. By employing the 2-DIGE and MS approaches we compared the protein profiles between clinical metastatic non-metastastic LSCC tissues and adjacent normal lung tissues and identified a number of differentially expressed proteins participating in many biological functions such as cell signaling regulation carbohydrate metabolism molecular chaperones and protein synthesis. Among these protein candidates we were particularly interested in fructose-bisphosphate aldolase A (ALDOA) an key enzyme in glycolysis responsible for catalyzing the reversible conversion of fructose-16-bisphosphate to glyceraldehydes-3-phosphate and dihydroxyacetone phosphate [3]. ALDOA is one of the three aldolase isozymes (A B and C) encoded by three different genes. These aldolases are differentially expressed during development. ALDOA is highly expressed in the developing embryo and in adult muscle [3]. ALDOA contributes to various cellular functions and biological process related to muscle maintenance regulation of cell shape and mobility striated muscle contraction actin filament anization and ATP biosynthetic process [4]“[13]. ALDOA deficiency is associated with myopathy and hemolytic anemia [14]“[16]. Notably ALDOA has been found highly expressed in a variety of malignant cancers including human lung squamous [17]“[18] renal cell [19] and hepatocellular carcinomas [20]. However none of these reports examined the involvement of ALDOA in LSCC progression and metastasis. In this study we reported that ALDOA is highly expressed in LSCC and its expression level is correlated with LSCC metastasis. Further we demonstrated that depletion of ALDOA in lung cancer cells reduces its tumorigenicity and capability of migration. These observations suggest that ALDOA is a potential biomarker of LSCC metastasis and play important role in LSCC progression and metastasis. Materials and Methods Samples Preparation and Proteomic Analysis Seven pairs of matched primary LSCC samples (6 male and 1 female aging from 36 to 67 years old with an average age of 55 years old) were obtained from the Department of Thoracic Surgery of the First Affiliated Hospital of Dalian Medical University China. Three pairs are non-metastatic and 4 pairs are metastatic. No patients received preoperative radiotherapy and chemotherapy. The study was approved by the Ethic and Research Committees of Dalian Medical University and was conducted in accordance with the Declaration of Helsinki Principles. The patients thoroughly understood the collecting process and purpose of using the specimens and signed œinformed consents-specimen collection. The fresh samples from tumor and normal tissues (>5 cm away from the lesion) were snap-frozen and stored at ?80°C. The pathological diagnosis was done to confirm that tumor specimens were real SCC tissues. Surgery follow-ups were conducted to each patient at an interval of 12 months for 3 years. To prepare protein extracts the tissues were homogenized in buffer containing 7 M urea 2 M thiourea 4% CHAPS 30 mM Tris and a cocktail of protease inhibitors (GE Healthcare) and the supernatants were collected by centrifugation at 12000 g for 15 min at 4°C. 50 ug of pooled protein extracts was labeled with Cy2 as the internal standard control Cy3 and Cy5 were used to label experimental samples. The resulting samples were resolved bi-dimensionally on 12.5% SDS-PAGE gels. Images were acquired using the fluorescence scanner (GE Healthcare) at excitation wavelengths of 488/520 nm 532/580 nm or 633/670 nm respectively. The image analysis was processed using DeCyder 6.5 (GE Healthcare). BVA software module was used for matching spots between gels and average abundance and statistics calculation. The protein abundance was represented by the volume ratio of samples versus standards and the proteins of interest with an average ratio more than 1.50 or less than ?1.50 were selected for mass spectrometry analysis. Western Blot immunofluorecence and LSCC tissue microarrays Protein extracts (50 µg) were resolved on 12% SDS-PAGE gels transferred to nitrocellulose membranes (0.45 µm) and immunoblotted with rabbit anti-human ALDOA antibody (HPA004177 Sigma; 1?1500) or mouse anti-human ?-actin monoclonal antibody (1?4000)."
Lung_Cancer
"Rabbit anti-MOR antibody was purchased from GeneTex (San Antonio TX). Rabbit anti-EGFR rabbit anti-phosphotyrosine-EGFR (pY845 pY992 pY1045 pY1068) rabbit anti-Grb-2 rabbit anti-Gab-1 rabbit anti-phosphotyrosine-Gab-1 (pY307 pY627) rabbit anti-Src rabbit anti-phosphotyrosine-Src (pY416) rabbit anti-p85 PI3 kinase rabbit anti-p55 PI3 kinase rabbit anti-phosphotyrosine-p85/p55 PI3 kinase (pY458 pY199) rabbit anti-STAT3 rabbit anti-phosphotyrosine-STAT3 (pY705) rabbit anti-vimentin rabbit anti-ZO-1 rabbit anti-claudin-1 rabbit anti-Snail and rabbit anti-Slug antibodies were purchased from Cell Signaling Technologies (Danvers MA). Mouse anti-?-actin antibody was purchased from Sigma (St. Louis MO). Secondary horseradish peroxidase-labeled antibodies were purchased from Amersham Biosciences (Piscataway NJ). N-methylnaltrexone bromide or methylnaltrexone was purchased from Mallinckrodt Specialty Chemicals (Phillipsburg NJ). The PI3 kinase inhibitor LY294002 Akt Inhibitor X the Src family kinase inhibitor PP2 and the STAT3 inhibitor Stattic were purchased from EMD Biosciences (Billerica MA). Immunoblotting Immunoblotting was performed as we have previously described. Cellular materials from treated or untreated human NSCLC cells were incubated with lysis buffer (50 mM HEPES (pH 7.5) 150 mM NaCl 20 mM MgCl2 1% Triton X-100 0.1% SDS 0.4 mM Na3VO4 40 mM NaF 50 µM okadaic acid 0.2 mM phenylmethylsulfonyl fluoride 1?250 dilution of Calbiochem protease inhibitor mixture 3). The samples were then run on SDS-PAGE in 4“15% polyacrylamide gels transferred onto Immobilon„¢ membranes and developed with specific primary and secondary antibodies. Visualization of immunoreactive bands was achieved using enhanced chemiluminescence (Amersham Biosciences Piscataway NJ). In some instances immunoreactive bands were quantitated using computer-assisted densitometry. Small Interfering RNA Transfection in Human NSCLC Cells Stable Control and either MOR Gab-1 or Src siRNA (Santa Cruz Biotechnology Santa Cruz CA) were transfected into H358 cells as we have previously described [12]. Cells (?40% confluent) were serum-starved for 1 hour followed by incubated with siRNA for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours. Inhibition of protein expression was confirmed by immunoblot analysis with specific antibodies. Stable Control and MOR Small Hairpin RNA Transfection in Human NSCLC Cells Stable Control and MOR shRNA (Santa Cruz Biotechnology Santa Cruz CA) were stably transfected into H358 cells as we have previously described [12]. Cells (?40% confluent) were serum-starved for 1 hour followed by incubated with shRNA for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours and puromycin selection reagent was added. Inhibition of protein expression was confirmed by immunoblot analysis with anti-MOR antibody (GeneTex San Antonio TX). Stable Vector Control and MOR1 Overexpression in Human NSCLC Cells Myc-DDK-tagged ORF clone of Homo sapiens opioid receptor mu 1 (OPRM1) transcript variant MOR-1 (OriGene Technologies Inc MD) was amplified using Platinum Taq DNA polymerase high fidelity enzyme (Invitrogen CA) and subsequently cloned into a pCR8/GW/Topo entry vector (Invitrogen CA) according to manufacturer's instructions. Plasmid DNA was extracted from selected clones by QIAquick Plasmid Mini kit (Qiagen CA). ORF integrity and fragment orientation were confirmed by sequencing. The MOR1-Myc fusion product was then transferred to pcDNA3.2/v5 DEST vector (Invitrogen CA) by LR reaction. The resulting construct (pcDNA3.2-MOR1-Myc) was transfected into H358 cells using FuGENE HD„¢ as the transfection reagent (Roche Applied Sciences) according to the protocol provided by Roche as we have previously described. Cells (?40% confluent) were serum-starved for 1 hour followed by incubation with pcDNA3.2-MOR1-Myc for 6 hours in serum-free media. Serum-containing media was then added (10% serum final concentration) for 42 hours and neomycin selection reagent was added. Overexpression was confirmed by immunoblot analysis with anti-MOR antibody (GeneTex San Antonio TX). Human NSCLC Cell Proliferation Assay Measurement of in vitro NSCLC cell growth was performed as we have previously described. Control or siRNA pretreated H358 cells (5—103 cells/well) were incubated with 0.2 ml of serum-free media containing either vehicle (control) methylnaltrexone (MNTX 100 nM) the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM) for 72 h at 37°C in 5%CO2/95% air in 96-well culture plates. The in vitro cell proliferation assay was analyzed by measuring increases in cell number using the CellTiter96„¢ MTS assay (Promega Madison WI) and read at 492 nm. Each assay was set up in triplicate and repeated at least five times. Human NSCLC Cell Migration Assay Measurement of in vitro NSCLC cell migration was performed as we have previously described. Twenty-four transwell units with 8 µM pore size (Millipore Billerica MA) were used for monitoring in vitro cell migration as we have previously described [12]. Control or siRNA pretreated H358 cells (5—103 cells/well) were incubated with 0.2 ml of serum-free media containing either vehicle (control) methylnaltrexone (MNTX 100 nM) the PI3 kinase inhibitor LY294002 (10 uM) Akt Inhibitor X (5 uM) the Src family kinase inhibitor PP2 (100 nM) or the STAT3 inhibitor Stattic (10 uM) were plated on the upper chamber and media with serum was added to the lower chamber. Cells were allowed to migrate through the pores for 18 hours. Cells from the upper and lower chamber were quantitated using the CellTiter96„¢ MTS assay (Promega San Luis Obispo CA) and read at 492 nm. % migration was defined as the # of cells in the lower chamber divided by the number of cells in both the upper and lower chamber. Each assay was set up in triplicate and repeated at least five times. Statistical Analysis Results are expressed as mean ± standard deviation of three independent experiments. For data analysis experimental samples were compared to controls by unpaired Student's t-test. For multiple-group comparisons a one-way variance analysis (ANOVA) and post hoc multiple comparisons tests were used. Differences between groups were considered statistically significant when P value was less than 0.05. All statistical analyses were performed using the GraphPad Prism program (GraphPad Software Inc. USA). Results Our results in indicate that inhibiting MOR with the peripheral MOR antagonist MNTX attenuates EGF-induced proliferation (-A) and migration (-B) of human H358 NSCLC cells in a dose-dependent manner. These data suggest a link between MOR and the EGFR in H358 cells. To mechanistically evaluate the role of MOR on EGF-induced EGFR dynamics we treated H358 cells with EGF at various times and immunoprecipitated the EGFR to determine potential MOR association. -A demonstrates that EGF induces a complex formation between the EGFR and MOR which peaks at 5 to 15 minutes after EFG challenge. Based on our results that a MOR/EGFR complex can occur with EGF stimulation of H358 cells we next examined whether MOR can regulate EGFR phosphorylation. Utilizing a panel of anti-phospho-EGFR antibodies -B demonstrates that pretreatment of H358 human NSCLC cells with the peripheral MOR antagonist MNTX failed to attenuate EGF-induced EGFR tyrosine phosphorylation. .0091577.g001 The peripheral mu opioid receptor antagonist methylnaltrexone (MNTX) inhibits epidermal growth factor (EGF)-induced proliferation and migration of human lung cancer cells in a dose-dependent manner. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for methylnaltrexone (MNTX) inhibition of EGF-mediated proliferation using a MTS proliferation assay. Cells were growth in the presence of 100 ng/ml EGF and/or 0“250 nM MNTX for 72 hours. MNTX There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and MNTX (1050100 250 nM) treatment with n?=?3 per condition and error bars?=?standard deviation. See the Methods section for experimental details. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were analyzed for methylnaltrexone (MNTX) inhibition of EGF-mediated migration using a transwell assay (8 uM pore size). Cells were allowed to migrate in the presence of 100 ng/ml EGF and/or 0“250 nM MNTX for 18 hours. There is a statistically significant difference (p<0.05 indicated by an asterisks) between control and MNTX (50100 250 nM) treatment with n?=?3 per condition and error bars?=?standard deviation. See the Methods section for experimental details. .0091577.g002 The mu opioid receptor (MOR) is recruited to the EGF receptor with EGF stimulation but does not regulate EGF receptor phosphorylation. Panel A: Human H358 non-small cell lung cancer (NSCLC) cells were treated with no (control) or 100 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoprecipitated with anti-EGFR antibody. Immunoblots were performed on total cell lysates (left) and immunoprecipitated material (right) using anti-MOR (a) and anti-EGFR (b) antibodies. The mu opioid receptor is recruited to the EGFR with EGF stimulation. Panel B: Human H358 non-small cell lung cancer (NSCLC) cells were either untreated (control) or treated with 100 nM MNTX alone 10 ng/ml EGF for 5 15 or 30 minutes or 100 nM MNTX and 10 ng/ml EGF for 515 or 30 minutes. Cell lysates were obtained and immunoblotted using anti-pY845 EGFR (a) anti-pY992 EGFR (b) anti-pY1045 EGFR (c) anti-pY1068 EGFR (d) anti-EGFR (e) and anti-actin (e) antibodies. MNTX does not inhibit EGF-induced EGFR tyrosine phosphorylation. We next examined whether MOR can regulate EGFR downstream signaling molecules. We first examined the adaptor protein Growth factor receptor-bound protein 2 (Grb-2)"
Lung_Cancer
"PDGF-BB and VEGF-C expression were detected in 109 primary NSCLC tissues while the lymphatic micro-vessel density (LMVD) was counted. Results Of 109 cases PDGF-BB and VEGF-C overexpression was 66.97% (73/109) and 65.14% (71/109) respectively. 52 (47.7%) had overexpression of both PDGF-BB and VEGF-C (P?+?V+) 21 (19.3%) overexpression of PDGF-BB but low expression of VEGF-C (P?+?V-) 19(17.4%) overexpression of VEGF-C but low expression of PDGF-BB (P-V+) and 17(15.6%) low expression of both PDGF-BB and VEGF-C (P-V-). PDGF-BB expression was positively related to that of VEGF-C (r?=?0.451 p?=?0.034). LMVD in cases with P?+?V?+?was much higher than those with P-V- (p?=?0.004). In addition the patients with P?+?V?+?were younger and also had larger tumor size more likely lymph node metastasis and worse histological differentiation than those with P-V-. Moreover the overall survival (OS) of patients with P?+?V?+?was shorter than those with P-V- (p?=?0.015). Conclusion Coexpression of both PDGF-BB and VEGF-C was associated with lymphangiogenesis and poor prognosis in NSCLC and might play a critical role in NSCLC progression. Virtual Slides The virtual slide(s) for this can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/2261801312571320 Platelet-derived growth factor-BB Vascular endothelial growth factor-C Lymphatic micro-vessel density Non-small cell lung cancer Background Lung cancer is the leading cause of tumor-related mortality throughout the world of which 80% are non-small cell lung cancer (NSCLC). In 2008 lung cancer replaced liver cancer as the first cause of death among people with malignant tumors in China [1]. Despite all efforts in the field of early diagnosis and adjuvant therapy the morbidity and mortality of NSCLC trend to ascend straightly [2]. One of the most important factors with direct impact on prognosis and therapeutic strategy in NSCLC is lymphatic metastasis [34]. Lymphangiogenesis the formation of new lymphatic vessels is considered to be an important process in the development of lymphatic metastasis [5]. The status of lymphangiogenesis and lymphatic vessel remodeling has been estimated by lymphatic micro-vessel density (LMVD) [6]. D2-40 is the preferred lymphatic endothelium-specific monoclonal antibody (mAb) for investigating intra-tumoral and peri-tumoral lymphatic micro-vessels [7]. Increased amount of LMVD provides more opportunities for tumor cells to disseminate to the lymph nodes. The correlation between LMVD and prognosis was confirmed in a variety of human cancer including breast cancer melanoma and NSCLC [8-11]. The family of VEGFs is composed of VEGF-A VEGF-B VEGF-C VEGF-D VEGF-E VEGF-F and placental growth factor (PlGF). VEGF-A is directly linked to angiogenesis while VEGF-C is considered as a prime mediator of lymphangiogenesis and has been implicated in carcinogenesis and metastasis. VEGF-C is a ligand for the VEGF receptor (VEGFR)-3 a tyrosine kinase receptor that is expressed predominantly on lymphatic endothelial cells (LECs) [1213]. It is demonstrated that VEGF-C induces lymphangiogenesis by VEGFR-3 signaling [14]. Studies showed that VEGF-C expression is associated with lymphatic invasion LMVD lymph node metastasis and prognosis in some human tumors such as breast cancer gastric cancer and NSCLC [15-18]. Recent studies show that platelet-derived growth factors (PDGFs) also enable the process of functional lymphangiogenesis. They can connect the receptors on LECs to promote LECs™ proliferation migration and the formation of tubular structures which induce lymphangiogenesis [19]. PDGF family consists of five isoforms -AA -AB -BB -CC and “DD [20]. PDGF-BB is a direct lymphangiogenic factor [21]. Emerging evidences indicate that the tight communication between vascular endothelial cells and mural cells by platelet-derived growth factor (PDGF)-BB is essential for capillary stabilization during the angiogenic process [22]. It was reported that the expression of PDGF-BB was correlated with tumor growth lymph node metastasis and lymphatic invasion in human esophageal squmaous cell carcinomas and NSCLC [2324]. Based on these data PDGF-BB and VEGF-C may play an important role in the process of tumor growth and lymphangiogenesis. However it is still unknown about the significance of combination of PDGF-BB and VEGF-C i.e. expression of both PDGF-BB and VEGF-C compared with only PDGF-BB or VEGF-C expression in NSCLC. In this study we examined the expression of PDGF-BB and VEGF-C in primary NSCLC tissues and investigated the clinicopathological significance of their coexpression and association with lymphangiogenesis. Methods Patients™ characteristics Tumor specimens were obtained from 109 patients with primary NSCLC who underwent surgery at the Jinan Central Hospital Affiliated to Shandong University China during the period from October 2008 to September 2010. They did not receive radiation therapy or chemotherapy before biopsy or surgical resection. There were 78 men (72%) and 31 women (28%) with median age of 58 years (interquartile range: 50?~?65 years) at the time of diagnosis. We determined the cell differentiation degree according to the classification amended in 1999 [25] and found 81 cases of well and moderately differentiated cells and 28 cases of poorly differentiated cells. The tumors were staged according to the USA Cancer Union Guidelines [26]. 38 patients were diagnosed with early NSCLC (I-IIa) and 71 with advanced NSCLC (IIb-III). Other clinical features are summarized in Table 1. All patients were followed up for at least 3 years after surgery. The median follow-up period was 47 months (interquartile range: 42?~?50 months). Overall survival (OS) was calculated from the date of surgery to the last follow up. The work was conducted in accordance with the Declaration of Helsinki. Informed consent was obtained from all the patients in this study. All patients signed the informed consent for use of specimens and the study was approved by the Institutional Review Board (Medical Ethics Committee of Jinan Central Hospital). Correlations of both PDGF-BB and VEGF-C coexpression with clinicopathological factors in primary human NSCLC Factors P?+?V+ P-V- P1 P?+?V - P2 P-V+ P3 Gender Male 35 13 0.476 16 0.716 14 0.847 Female 17 4 5 5 Age >60 years 23 11 0.047 13 0.859 11 0.676 ?60 years 29 6 8 8 Histology SQC 28 6 0.184 6 0.539 5 0.559 ADC 24 11 15 14 Tumor size >5 cm 24 3 0.037 5 0.950 6 0.563 ?5 cm 28 14 16 13 differentiation WD MD 35 17 0.017 17 0.757 12 0.027 PD 17 0 4 7 TNM stage I-IIa 12 8 0.113 10 0.973 8 0.765 IIb-III 40 9 11 11 Nodal status Positive 29 3 0.006 5 0.471 7 0.362 Negative 23 14 14 12 Note: P1 P value between P?+?V?+?and P-V-; P2 P value between P?+?V- and P-V-; P3 P value between P-V?+?and P-V-. Abbreviations: WD well differentiated MD moderately differentiated PD poorly differentiated ADC adenocarcinoma SQC squamous cell carcinoma. Main reagents The main reagents were anti-podoplanin mouse monoclonal antibody D2-40 (Dako Co. Denmark) anti-PDGF-BB rabbit polyclonal antibody (abcam Cambridge UK) Anti-VEGF-C rabbit monoclonal antibody (Beijing Zhongshan Goldenbrige Biotechnology China) immunohistochemical SP reagent box and DAB colour reagent (Fuzhou Maixin Co. China.P.R). Immunohistochemistry Immunohistochemical staining was carried out using the DAKO Envision detection kit (Dako Carpinteria CA USA). In brief paraffin-embedded tissue blocks were sectioned (4 ?m-thick) dried deparaffinized and rehydrated. Antigen retrieval was performed in a microwave oven for 15 min in 10 mM citrate buffer (pH 6.0). For all samples endogenous peroxidase activity was blocked with a 3% H2O2-methanol solution. The slides were blocked with 10% normal goat serum for 10 min and incubated with an appropriately diluted primary antibody mouse monoclonal antibody D2-40 (diluted 1:50) anti-PDGF-BB rabbit polyclonal antibody (diluted 1:200) or anti-VEGF-C rabbit polyclonal antibody (diluted 1:100) overnight at 4°C. The slides were then probed with an HRP-labeled polymer conjugated to an appropriate secondary antibody for 30 min. Each step was followed by washing with PBS. Each batch of staining was accompanied by positive and negative control slides. Primary human NSCLC tissues which are demonstrated to exhibit high levels of PDGF-BB and VEGF-C protein were used as positive controls. Normal mouse IgG substituted for primary antibody was a negative control. Quantitation of immunohistochemistry Clinicopathological findings were evaluated simultaneously using a double-headed light microscope by two independent examiners in a blinded fashion and mean values were calculated. The percentage of stained cells was recorded in at least 5 fields at 400-fold magnification in randomly selected tumor areas. In tumor specimens analysis of staining was exclusively restricted to the NSCLC cell reactions. Staining of stromal cells was not considered. Because cancer cells showed heterogeneous staining the dominant pattern was used for scoring. A combined scoring method that accounts for the intensity of staining as well as the percentage of cells stained was used as described previously [27]. The intensity of staining was graded from 0 to 3 with strong moderate weak and negative staining intensities as grade 321 and 0 respectively. The scores indicating percentage of positive cancer cells and staining intensity were multiplied to get a weighted score for each sample. For example a sample with 10% weak staining 10% moderate staining and 80% strong staining would be assigned a score of 270 (10?×?1?+?10?×?2?+?80?×?3?=?270) out of a possible score of 300. For statistical analyses samples with weighted scores 0“100 were defined as negative otherwise as positive. LMVD was performed according to a modification of Weidner™s method [28]. The immunostained sections were scanned by light-microscopy at low magnification (40×) and the areas of tissue with the greatest number of distinctly highlighted microvessels (hot spots) were selected. LMVD was then determined by counting all immunostained vessels at a total magnification of (200×) from five areas for each case. Determination of the staining reaction was strictly confined to the hot spots and the mean number of the vessels in each case was evaluated. Statistical analysis Data were analyzed according to the Statistical Package for Social Sciences (SPSS. 18.0 Chicago IL USA). Spearman™s coefficient of correlation Chi-squared test and two-tailed Student t test were used as appropriate. "
Lung_Cancer
"Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells. (a) Upregulation of Hsp70 in lung cancer cell lines. Each cell extract was separated by SDS-PAGE and immunoblotted with an anti-Hsp70 or actin antibody (upper panel). The quantity of each protein was estimated by densitometric analysis using Scion Image (Scion Frederick MD USA). The Hsp70/actin ratios are shown in the lower panel. (b) Effect of ibuprofen on the expression of Hsp70 protein and mRNA in A549 cells. Top: expression of Hsp70 and Hsc70 proteins in A549 cells treated with ibuprofen at the specified concentrations for 48?h examined as described in a (left panel). Bottom: densitometric analysis of each protein level in arbitrary unit (arb-u). The alternation of each mRNA expression after ibuprofen treatment was analyzed by semiquantitative RT-PCR (top right panel). These results are representative of three separate experiments. (c) Effect of ibuprofen on the expression of Hsp70 protein in H358 cells. Expression of Hsp70 proteins in H358 cells treated with ibuprofen at the specified concentrations for 48?h (upper panel). The quantity of each protein was estimated by densitometric analysis (lower panel) Ibuprofen increased the antitumoural activity of cisplatin by suppressing Hsp70. (a) The viability of A549 (upper panel) and H358 (lower panel) cells treated with ibuprofen for 48?h was analyzed by MTT assay. The value is represented as the percentage of cell viability without ibuprofen set at 100%. (b) Synergistic effect of ibuprofen on cisplatin-induced apoptosis in A549 (upper panel) or H358 (lower panel) cells. The cells were treated with the specified concentrations of cisplatin in absence or presence of 400??M ibuprofen for 48?h and the cell viability was assessed by MTT assay. The results are shown as means±S.D. from triplicated experiments. The results shown are representative of three separate experiments. *P<0.05; **P<0.01 (by Student's t-test). (c) Time course of cisplatin-mediated cell death with ibuprofen. A549 cells were treated with 400??M ibuprofen alone or A549 cells with 10??M cisplatin were cultured in absence or presence of 400??M ibuprofen and the cell viability was analyzed by TUNEL staining. The results shown as means±S.D. **P<0.01 (by Student's t-test). (d) The silencing efficiency of Hsp70 determined by immunoblotting. (e) Effect of Hsp70 RNAi on the cisplatin-mediated death of A549 cells. The cells exposed to siRNA targeting Hsp70 or control siRNA were treated with 10??M cisplatin for 48?h and MTT assay was used to determine the cell viability. Data are presented as means±S.D. from triplicated experiments. The results shown are representative of three separate experiments. *P<0.05; **P<0.01 (by Student's t-test). (f) Cytofluorimetric dot plot analysis of the CF488A-Annexin V versus propidium iodide (PI) staining performed in 10??M cisplatin-treated or -untreated A549 cells in absence or presence of 400??M ibuprofen for 48?h. A representative experiment out of three performed with similar results is shown. (g) Effect of cisplatin on the expression of Hsp70. The data are representative of three separate experiments Ibuprofen inhibits the expression of Hsp70 by transcriptional inactivation. (a) ChIP assay for the association of HSF-1 with Hsp70 gene in A549 cells treated with or without ibuprofen. The DNA in the product immunoprecipitated by anti-HSF-1 or non-immune IgG was followed by PCR with a primer specific to the Hsp70 promoter. The immunoprecipitates with antibody against HSF-1 were confirmed by immunoblotting (bottom left). The actin signal is a control of DNA input (bottom right). (b) Effect of ibuprofen on the expression of HSF-1. Cell extracts from A549 cells with ibuprofen for 48?h were separated by SDS-PAGE and immunoblotted with a HSF-1-specific antibody (upper panel). The quantity of each protein was estimated by densitometric analysis (middle panel). The data are representative of three separate experiments. The effect of ibuprofen on the mRNA level of HSF-1 was confirmed by RT-PCR (lower panel). (c) HSF1-mediated inhibition of Hsp70 expression. A549 cells were treated with 10?nM siRNAs against HSF-1 or non-code siRNA. The HSF-1 silencing efficiency and its effect on the expression of Hsp70 were examined by immunoblotting using appropriate antibodies. Three separate siRNAs oligo against HSF-1 were used for its knock-down. The results shown are representative of three separate experiments Ibuprofen exposure enhanced the cisplatin-dependent mitochondrial membrane depolarization and cytochrome c release. (a) A549 cells were treated for 48?h with 10??M cisplatin 400??M ibuprofen or both and subjected to JC-1 staining to study the changes in mitochondrial membrane potential. The percentages indicate the green fluorescence intensity of JC-1 measuring with FACSCalibur. A representative experiment out of three performed with similar results is shown. (b) A549 cells treated as described earlier were fractionated into cytosol and the release of cytochrome c was analyzed by western blot using anti-cytochrome c antibody. The expression of Erk was monitored as an internal control of cytosol protein. The quantity of each protein was estimated by densitometric analysis. The results are means of three separate experiments from cells in different cultures The downregulation of Hsp70 increased the cisplatin-mediated activation of Bax and its translocation to the mitochondria. (a) Detection of active Bax. A549 cells were treated with cisplatin (10??M) and/or ibuprofen (400??M) for 48?h. Active Bax was immunoprecipitated with an active conformation-specific monoclonal antibody and revealed by immunoblotting with an anti-Bax polyclonal antibody. The quantity of active Bax was estimated by densitometric analysis. (b) A549 cells treated as described earlier were lysed and fractionated by differential centrifugation to separate the mitochondria from the cytosol. The translocation of Bax to the mitochondria was visualized by the immunoblot of mitochondrial fractions using an anti-Bax antibody. VDAC-1 was used as a loading control to ensure the use of equal amounts of mitochondria. (c) A decrease in Hsp70 by RNAi promoted cisplatin-dependent activation of Bax. A549 cells treated with Hsp70 or control siRNA were incubated in presence or absence of cisplatin; each cell extract was immunoprecipitated with an anti-active Bax antibody followed by immunoblotting with anti-Bax antibody. The data are representative of three separate experiments Synergistic effect of Hsp70 suppression on the cisplatin-mediated activation of caspase-9. (a) A549 cells were treated with cisplatin and/or ibuprofen and cell extracts were immunoblotted with active caspase-9 antibody. The lower panel shows the measurement of each caspase-9. (b) A549 cells exposed to siRNA targeting Hsp70 or control siRNA were incubated with or without cisplatin and the active caspase-9 was detected by western blot using an anti-caspase-9 antibody. The quantity of each protein was estimated by densitometric analysis (lower panels). (c and d). Assay for enzymatic activity of caspase-9 using a fluorogenic substrate. (c) After the incubation of the A549 cells with cisplatin (10??M) and/or ibuprofen (400??M) the caspase-9 activity of each cell extract was measured as described in Materials and methods section. (d) A549 cells transfected with Hsp70 siRNA or control siRNA were exposed to cisplatin for 48?h. The caspase-9 activity was then assessed using an enzymatic assay as described earlier. The value of caspase-9 activity was presented relative to the activity in untreated cells set at 1.0. The data represent mean values of three separate experiments. Significances were determined by Student's t-test (*P<0.05) Effects of nonsteroidal anti-inflammatory drugs on the expression of Hsp70 in A549 cells NSAIDs Hsp70 expression (%) Ibuprofen (400??M) 22.7±2.8 Aspirin (2500??M) 95.1±7.8 Diclofenac (200??M) 97.2±5.6 Sulindac (15??M) 98.9±2.9 Piroxicam (60??M) 96.6±6.2 Indometacin (10??M) 95.0±15.1 Mefenamic acid (25??M) 100.5±6.0 Values are shown as means±S.D. The expression of Hsp70 was measured by immunoblotting with an anti-Hsp70 antibody. The quantity of Hsp70 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each NSAID on the A549 cells for 48?h Table 2 Effects of nonsteroidal anti-inflammatory drugs on the expression of HSF-1 in A549 cells NSAIDs HSF-1 expression (%) Ibuprofen (400??M) 16.2±3.9 Aspirin (2500??M) 93.5±2.9 Diclofenac (200??M) 96.7±6.6 Sulindac (15??M) 99.8±3.6 Piroxicam (60??M) 96.3±4.7 Indometacin (10??M) 98.1±1.6 Mefenamic acid (25??M) 98.5±1.1 Values are shown as means±S.D. The expression of HSF-1 was measured by immunoblotting with anti-HSF-1 antibody. The quantity of HSF-1 protein was estimated by densitometric analysis using Scion Image. The values in parentheses are the highest non-toxic concentrations (approximately 90% viability) used for each of the NSAID on the A549 cells"
Lung_Cancer
"materials and marking with radio-opaque materials. Examples of directly visible materials are hook wire methylene blue and indocyanine green. Ethiodized oil (lipiodol) barium and iodine contrast agents are used for radio-opaque markers. Each marking method has strong and weak points. Localization with a hook wire is easy to perform but carries a high risk of pneumothorax and a propensity to dislodge during transport and surgical preparation (6 7). Methylene blue and indigo carmine have a tendency to diffuse over a large area by the time the operation is done and render localization features inadequate (8 9). The use of a radio-opaque marker (such as barium or lipiodol) requires an intraoperative fluoroscopy to confirm an adequate excision as well as lead to increased radiation exposure (10-13). The use of mixture has been reported to make up for the weakness of marking materials. For example the problem of dye diffusion has led to attempts to use a mixture of dye with various materials such as cyanoacrylate adhesive or collagen or autologous blood (14-16). However they have not been widely used for localization due to difficulties in making and manipulation. Lipiodol and methylene blue are commonly used materials for localization (17-20). We hypothesized that lipiodol reduces the spread of methylene blue and provides additional localization opportunities by its radio-opacity. The use of a mixture of lipidol and methylene blue (MLM) for a percutaneous injection material requires a high success rate for appropriate localization and a low complication rate. To our knowledge there have been no reports that evaluate the availability of MLM as a percutaneous injection material in human lungs. This study compared MLM with methylene blue as a percutaneous injection material for pulmonary localization in rabbit lungs. MATERIALS AND METHODS Animal preparation This study was performed after approval by the Institutional Animal Care and Use Committee (IACUC) in Seoul National University Hospital biomedical research institute (IACUC approval No. 11-0356). Twenty-four adult New Zealand White rabbits were used. We recorded their weight before the procedures. The animals were randomly divided into two groups: Group A (n=12) and Group B (n=12) each sacrificed at about 6 hr and 24 hr after percutaneous injections respectively (Fig. 1). Six hours after percutaneous injections were same day operations of the preoperative localization; and 24 hr after percutaneous injections were next day operations of the preoperative localization. The injection of each material was done in all 24 subjects because we injected methylene blue and MLM at two different lung sites for each subject. Percutaneous injection materials: mixture of lipiodol and methylene blue versus methylene blue A pilot study was performed to decide the optimal amount of materials for percutaneous injections. Methylene blue (1% 100 mg/mL TERA Pharmaceuticals Buena Park CA USA) of 0.3 to 0.9 mL was used for human lung localization in previous studies by Wicky et al. (18) and Vandoni et al. (19). In the pilot study with rabbit lungs we injected 0.1 mL and 0.05 mL of methylene blue and MLM in four subjects. We found that staining was extensive (more than half height of one lobe) with 0.1 mL and localized (about 1 cm of staining diameter) with 0.05 mL for both methylene blue and MLM. Extensive dispersion made it difficult to find exact injecting sites; subsequently 0.05 mL of methylene blue was administered. We made variable mix ratios of lipiodol and methylene blue in vitro; 1:1 1:2 1:3 1:4 and 1:5 in order to find an appropriate mixing ratio of lipiodol (480 mg Iodine/mL Andre Guerbet Aulnay-sous-Bois France) and methylene blue. The separation of two materials occurred instantly after mechanical blending to the fat-soluble character of lipiodol and the water-soluble character of methylene blue. A higher concentration of lipiodol in MLM resulted in increased uneven blending and rapid separation. A mixture with a 1:6 (or lower) mixing ratio contained a minimal amount of lipiodol and it might make it difficult to be detected on the fluoroscopy; subsequently we decided that 1:5 was an appropriate mixing ratio for injection. A total of 0.06 mL of MLM (0.01 mL of lipiodol plus 0.05 mL of methylene blue) was administrated in each subject to avoid the effect of different volumes of methylene blue to the diffusion extent of the materials. CT guided percutaneous injections Percutaneous injection was performed with computed tomography (CT) guidance (Discovery CT750 HD; GE Healthcare Waukesha WI USA). We performed pre-procedural CT scans in order to determine an appropriate skin entry site for the successful placement of a needle in the desired location. The desired location was the basal portion of both caudal lobes around the mid-scapula line. We tried to situate the needle tip at 5 mm depth from the visceral pleura and avoid passing through the pulmonary vessels. We placed the needle of 20 gauze and 3.5 cm length in the lung parenchyma after marking the appropriate skin entry site. The parameters of CT used in our study were: tube voltage of 120 kV tube current of 25 mA slice thickness of 2 mm thickness and gantry rotation speed of 350 milliseconds. We connected 1 mL syringe to the needle hub and retracted the syringe piston to confirm that no blood was aspirated after the needle tip was accurately located within the desired location. We then injected the materials and immediately removed the needle. On the procedural CT scan we measured the distance from the skin-entry to the needle tip and the depth from visceral pleura to the needle tip. A post-procedural CT scan identified procedure-related complications that included the leakage of injecting materials and pneumothorax; in addition we recorded the extent shape and density of radio-opacity of MLM after injection. The extent of MLM was defined as a maximum diameter of the radio-opacities. The shape of radio-opacity was categorized into 3 groups (small faint nodular scattered nodular and discrete compact nodular). We recorded the injection time to measure the time interval between injection and sacrifice. Fluoroscopic examinations A successful localization of lipiodol was determined by fluoroscopic examination; subsequently we evaluated the radio-opacity of MLM using the fluoroscopy X-ray unit (BV Pulsera; Philips Medical Systems Best The Netherlands) at the immediate post-procedure session and the follow up session at 6 hr in Group A and 24 hr in Group B. The parameters of fluoroscopy were: tube voltage of 59 kV and tube current of 946 mA. We obtained anteroposterior fluoroscopic images of the thorax of the rabbit with a 17 cm of field of view. A radio-opaque ruler of 5 cm was located near the rabbit in order to estimate the exact size of lipiodol opacity. We recorded the time of the fluoroscopic examinations and the radiographic findings of MLM (size and shape of the radio-opacity). Evaluation of the staining and radio-opacity We assessed the directly visible staining on the freshly excised lung surface and radio-opacity of MLM on the fluoroscopic examinations using 4-point scoring in order to compare the localization ability of MLM and methylene blue as a percutaneous injection material. A blind reviewer who was unaware of the injection materials assessed the staining ability. In order to evaluate the staining ability the blind reader reviewed the photographic images of the freshly excised lung specimens obtained before formalin fixations and rated the staining by 4-point scores: 0=non-visualization of staining 1=inappropriate; extensive dispersion made it difficult to find accurate injecting locations 2=acceptable; available to estimate injecting locations in spite of the dispersion and 3=excellent definitely localized staining (Fig. 2). The maximum diameter of the staining extent on the lung surface was measured. We calculated and compared scores and extent of staining between two materials. For the fluoroscopic findings the radio-opacity of MLM was evaluated using 4-point scoring: 0=no detectable radio-opacity 1=inappropriate minimally increased opacity 2=acceptable low density of increased opacity 3=excellent compact nodular increased opacity (Fig. 3). We compared the average scores of initial and follow up fluoroscopic examinations. We considered a score of 0 or 1 as inappropriate and a score of 2 or 3 as appropriate for localization for both staining and radio-opacity. We compared the number of appropriate or excellent localization between MLM and methylene blue. Sacrifice and histopathologic examinations Both freshly excised entire lungs were used as final specimens. The lung tissues were fixed in 10% neutral formalin embedded in paraffin and cut into 5 µm thick slices after we took photographs to record staining on the lung surface. We made 4 axial slices that covered the center of the staining. The slices were subjected to hematoxylin-eosin (H-E) stain to the evaluate lung parenchymal change. We evaluated the presence or absence of neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus. The extent of each histopathologic finding was estimated using visual grading scores as 0 (no) 1 (focal) or 2 (diffuse). Localized parenchymal change (<50% of total area) surrounded by normal lung was defined as focal. Extensive lung parenchymal change (?50% of total area) that replaced normal lung was defined as diffuse. An experienced pathologist with eight years of experience reviewed all slices. The overall severity of the lung parenchymal change was defined as a total score by adding visual grading scores for each histopathologic finding. We compared the overall severity score between MLM and methylene blue as well as between Group A and Group B. Statistical analysis All data are expressed as mean±standard deviation (SD) unless otherwise stated. Comparisons of the average scores were performed by two-tailed unpaired Student's t-test or Mann-Whitney test. We used a Fisher's exact test to compare the number of subjects in the subgroups. Linear by linear association evaluated the association of the extent of lung parenchymal change and materials or groups. Null hypotheses of no difference were rejected if the P values were less than 0.05. The statistical analysis was performed with commercially available statistical software IBM SPSS Statistics version 20.0 (IBM Corp. in Armonk NY USA). RESULTS Subject characteristics procedural records time interval of injection and examinations Among the 24 subjects included in our study successful CT-guided percutaneous injections into the desired location of the lung were achieved in 21 subjects (11 in Group A and 10 in Group B). Three subjects died during anesthesia. Mean weight was 3.2±0.2 kg for Group A and 3.3±0.2 kg for Group B. Injection depth from visceral pleura to needle tip was 0.4±0.1 cm (range: 0.3-0.6 cm) for MLM and 0.4±0.1 cm (range: 0.3-0.7 cm) for methylene blue (P=0.43). Distance from skin to needle tip was 2.8±0.6 cm (range: 2.1-5.0 cm) for MLM and 2.8±0.3 cm (range: 2.2-3.5 cm) for methylene blue (P=0.83). Of 42 CT-guided percutaneous injections total number of procedure related complications was 10 (24%) including 7 leakage (all in MLM) and 3 pneumothorax (2 in MLM 1 in methylene blue). The complication rate in MLM was significantly higher than methylene blue (43% vs 5%) (P=0.004). On post-procedural CT images the extent of the radio-opacity of MLM was 1.3±0.4 cm (range: 0.7-2.0 cm) for Group A and 0.6±0.3 cm (range: 0.3-1.1 cm) for Group B. Discrete compact nodular opacity was achieved in 15 subjects (72%) scattered nodular opacities in 3 (14%) and small faint opacity in 3 (14%) (Fig. 4). The average value of radio-opacity of MLM was 1415±856 HU (range: 307-2768 HU). The interval between injection and sacrifice was 7.9±0.1 hr (range: 7.8-8.0 hr) for Group A and 23.5±0.1 hr (range: 23.4-23.7 hr) for Group B. Time from injection to initial and follow up fluoroscopy was 3.4±0.5 hr (range: 2.5-4.2 hr) and 6.8±0.4 hr (range: 6.3-7.7 hr) for Group A and 1.5±0.4 hr (range: 0.9-2.1 hr) and 22.6±0.4 hr (range: 21.9-23.2 hr) for Group B respectively. Scores and extent of staining and radio-opacity Table 1 demonstrates the staining extent and localization ability of MLM and methylene blue. In total groups the staining extent of MLM was significant smaller than methylene blue (0.6 cm vs 1.0 cm P<0.001). MLM showed a significantly higher staining ability score than methylene blue (2.8 vs 2.2 P=0.010). Radio-opacity in the initial fluoroscopy was not significantly different from the follow up (2.0 vs 1.9 P=0.49). Table 2 showed the number of subjects in each score of localization ability of staining or radio-opacity. In Group A appropriate staining was 100% for both MLM and methylene blue. In Group B appropriate staining was 90% for MLM and 70% for methylene blue. Appropriate staining of MLM was not significantly different from that of methylene blue (95% vs 86% P=0.61); however excellent staining in MLM was significantly higher than methylene blue (81% vs 38% P=0.011) (Table 3). Table 4 shows the localization ability of MLM regarding both staining ability and radio-opacity. There was no subject with a score of 0 or 1 in both radio-opacity and staining. MLM achieved appropriate staining or radio-opacity in 21 subjects (100%) with a dual localization feature. Histopathologic findings Table 5 demonstrates the results of the histopathologic findings. In all lung specimens both methylene blue and MLM showed acute lung parenchymal change that included neutrophil infiltration hemorrhage and foam cell in alveolus (Fig. 4). Comparing the two materials the number of specimen having neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus was similar in each extent. In terms of all features the number of specimen that showed diffuse extent was more in Group B than Group A for both MLM and methylene blue. The extent of the histopathologic findings was not significantly associated with the materials for all histopathologic features (Table 5). Among the histopathologic findings the extent of vasculitis was significantly associated with Group for both MLM and methylene blue (P=0.002 for both MLM and methylene blue). Focal or diffuse extent of vasculitis was more frequently found in Group A than Group B (P=0.001 for both MLM and methylene blue). The overall severity of lung parenchymal change was not different between MLM and methylene blue (5.6±1.6 vs 5.7±1.5 P=0.839); in addition Group B showed a significantly higher overall severity score of lung parenchymal change than Group A (6.6±1.6 vs 4.7±0.9 P=0.005). DISCUSSION The results of this study show that MLM is a useful percutaneous injection material for a successful localization in the lung. The average staining score of MLM was significantly higher than methylene blue (2.8±0.5 vs 2.2±0.7 P=0.010). In terms of staining the appropriate localization rate (acceptable or excellent staining) in our study was 95% using MLM. The result was in close agreement with previous studies that showed a high success performance rate of lipiodol localization (99%-100%) (21-23). An appropriate localization rate (acceptable or excellent staining) of methylene blue injection was 86% in our study. This is lower than the results found in previous studies where the success rate of methylene blue injection was 96%-100% (18 20). We found that an acceptable (or excellent staining rate) of MLM and methylene blue was not significantly different (95% vs 86% P=0.610). However MLM showed excellent staining for localization in 17 (81%) of 21 subjects and was significantly higher than methylene blue (38%) (P=0.011). The results indicate that lipiodol reduced the spread of methylene blue. This is the first study to indicate that MLM is an available percutaneous injection material for localization with superior staining ability compared to methylene blue. The complication rate was 43% in MLM and 5% in the methylene blue (P=0.004). Possible complications after percutaneous injection for pulmonary localization include pneumothorax leakage hemorrhage pain hemoptysis hemothorax and embolism. Previous studies reported that the complication rate was 17-29% for lipiodol and 33% for methylene blue (2023 24). The complication rate of MLM in the current study was higher than the results of previous studies mainly due to the leakage of MLM into the pleural cavity (n=9). This difference was probably because the distance from the pleura to the injecting needle tip (0.4±0.1 cm for MLM) was inadequate to avoid leakage into the pleural cavity. In the previous studies of lipiodol marking for localization the mean distance from the pleura to the target nodule was 1.0-1.9 cm (22-24) more than twice our study. The results indicate that the high complication rate of our study is associated with the inserting procedure of the needle rather than MLM itself. The dispersion of methylene blue throughout the lung parenchyma may lead to unnecessarily large wedge resections; in addition some have reported instances of the dispersion of methylene blue throughout the entire pleural surface or intraoperative identification failure due to severe anthracosis of the visceral pleura. The failure rate was reported to be 0%-13% with the use of methylene blue (1819 25). The results are similar to our study and indicate that inappropriate staining on the lung surface was 14% in methylene blue. In this study we found that the dispersion of methylene blue in MLM through the lung parenchyma was significantly smaller than methylene blue (0.6±0.3 cm vs 1.0±0.4 cm P<0.05). The result implies that lipiodol reduces the spread of methylene blue in lung parenchyma. Regarding the score of radio-opacity 38% of MLM showed non-visualization or minimally increased opacity on the fluoroscopic examinations. It means the proportion of lipiodol in MLM at the time of the percutaneous injection was too small to be detected. Post-procedural CT images also revealed that 3 subjects had small faint radio-opacity after the injection of MLM. It suggests that the uneven blending of lipiodol and methylene blue occurred during the preparation of MLM. Water-insolubility of lipiodol would result in the uneven mixing of water soluble methylene blue after mechanical blending of the two materials. Further research is required to reduce non-homogeneity of MLM at the time of injection. Previous studies reported the availability of a mixture of methylene blue with other materials such as collagen or autologous blood (15 16). They performed VATS resection on the same day as localization. In our study we evaluated the localization ability of MLM on the same day of localization (6 hr) as well as 24 hr after injection. Localization is usually performed on the day of surgery. This requires the simultaneous use of the CT and the operating room which is not always available. Surgeries on the next day of localization were reported in several published articles (26 27). MLM shows a prolonged localization ability of up to 24 hr in terms of staining ability and radio-opacity. Stable localization ability is the advantage of MLM in our study. Due to uneven blending of MLM one subject (10%) showed inappropriate staining and appropriate radio-opacity and required an intraoperative fluoroscopic examination to detect MLM. Possible radiation exposure is a drawback of MLM. We would like to justify the use of intraoperative fluoroscopy because the operator can avoid radiation exposure with a lead apron. In regards to the risk-benefit for patients lowering the risk of detection failure is thought to be more important than radiation exposure. Histopathologic examinations showed lung parenchymal changes in all specimens. Both methylene blue and MLM induced acute lung injury that included neutrophil infiltration vasculitis necrosis hemorrhage and foam cell in alveolus (Table 5). The results of our study are similar to those of a previous study by Kwon et al. (28) that showed that lipiodol led to acute lung injury. They described that lipiodol creates the histopathologic feature of acute lung injury such as peripheral endothelial cell damage neutrophil infiltration necrosis hemorrhage alveolar wall destruction vasculitis emboli (or thrombi in arteriole) and macrophages in the alveolar space (28). In our results the extent of lung parenchymal change was not associated with the materials for all histopathologic features. In addition the overall severity score of lung parenchymal change in MLM was not different from methylene blue (5.6 and 5.7 P=0.839). This suggests that MLM shows similar histopathologic effects in the lung parenchyma to methylene blue. The overall severity score of parenchymal change was higher in Group B (follow up interval of 24 hr) than Group A (follow up interval of 6 hr) (6.6 vs 4.7 P=0.005). The extent of lung parenchymal change depends on the time interval. Acute lung injury after the percutaneous injection of lipiodol or methylene blue was reported in animal studies (28 29); however there are no clinical results that show the adverse effect of acute lung injury in human lungs. Injection material (such as barium) can potentially complicate the pathologic diagnosis of the target lesion due to acute inflammation (29 30). To our knowledge no study has indicated that lipiodol or methylene blue hinders the histopathologic diagnosis of target lesions in human lungs. The small amount of material injection in human lungs might not create a significant parenchymal change or disrupt underlying lung disease. It is necessary to avoid directly injecting materials into the target lesion in human lungs in order to avoid the adverse effect of injection materials on underlying lung disease (especially ground glass opacity nodule or potential benign lesion). There were several limitations in our study. First we included only a small number of subjects. Second the overall localization success rate was low and the complication rate was high (compared to the results of previous studies) due to the difficulty in an accurate percutaneous injection at the desired location and depth in the small sized rabbit lung. Third we used a 1 mL syringe with manual administration to inject materials in the lung parenchyma and there were possible individual difference in the administering volume of materials. Fourth we could not evaluate complications such as intractable pain material related anaphylaxis or embolism. Fifth we could not evaluate if the histopathologic changes had any effect on underlying lung disease because the lung parenchyma of the experimental rabbits were normal. Finally we did not evaluate a successful localization for the true target lesion in lung parenchyma. The criteria for appropriate staining and radio-opacity were subjective. We expect that further clinical studies might provide an answer to if MLM can be a useful percutaneous injection material for localization in the human lung. In conclusion MLM is available for percutaneous injection for the pulmonary localization. The results of this study showed that MLM provides superior ability for appropriate localization than that of methylene blue. Further research on human lungs can clarify the availability of MLM as a CT guided percutaneous injection material. This study was supported by grant from the Seoul National University College of Medicine Research Fund 2012 (800-20120036). We have no potential conflicts of interest or commercial "
Lung_Cancer
"Hispanic black and 130598 white participants ages 49“78 at enrollment in the Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial. BMI at baseline BMI at age 20 and BMI change were calculated using self-reported and recalled height and weight. Relative risks were stratified by race and sex and adjusted for age education marital status and smoking. Results 1495 black and 18236 white participants died during follow-up (mean=13 years). Clear J-shaped associations between BMI and mortality were observed among white men and women. Among black men and women the bottoms of these curves were flatter and increasing risks of death with greater BMI were observed only at higher BMI levels (?35.0). Associations for BMI at age 20 and BMI change also appeared to be stronger in magnitude in whites versus blacks and these racial differences appeared to be more pronounced among women. Conclusion Our results suggest that BMI may be more weakly associated with mortality in blacks particularly black women than in whites. National Cancer Institute : NCI Z99 CA999999 || CA Introduction In the U.S. there are substantial disparities in obesity prevalence across racial and ethnic groups. In 2009“2010 it was estimated that 38.8% of black men and 58.5% of black women as compared with 36.2% of white men and 32.2% of white women were obese 1. Evidence suggests that differences in obesity between black and white populations has increased in the past decade2“3 and is likely to continue to increase in the future4. It is of great public health importance to understand how racial and ethnic differences in the burden of obesity might contribute to health disparities. In the white population it has been well-established that there is a J-shaped relation between body mass index (BMI) and all-cause mortality with recent studies showing that mortality is the lowest at BMI 22.5“25.0 kg/m2 and increases monotonically with increasing levels of BMI above 25.0 5“6. However the shape of relation between BMI and mortality in the black population is less clear. Several early studies have suggested that the association for higher BMI values may be weaker among blacks than whites especially for black women 7“10. However in a recent study conducted within a large U.S. cohort of black women 6 Boggs et al. found a J-shaped association between BMI and mortality that was largely similar to that in the white population 11. This and other studies have suggested that the racial difference in the BMI-mortality association may differ according to factors such as sex age and education 10“11. BMI in young adulthood and subsequent weight changes may additionally affect health later in life. Previous studies conducted in predominantly white populations have linked excess body weight at young ages to elevated mortality 12“14. Recent results from the Atherosclerosis Risk in Communities (ARIC) study showed a positive association between BMI at age 25 and all-cause mortality in African-American women although the authors did not examine the association of BMI change 15. More studies are needed to explore the health effects of weight at young adulthood and long-term weight change in the black population and compare these effects to those in the white population. To further clarify the BMI-mortality association in the black population we investigated the relationship of BMI at baseline and at age 20 as well as BMI change during this period with total and cause-specific mortality among black men and women in a large U.S. cohort. To investigate racial differences in these associations we directly compared the results among blacks to those among whites in this population. Methods Study population The Prostate Lung Colorectal and Ovarian (PLCO) Cancer Screening Trial is a randomized controlled multi-center trial designed to evaluate selected methods for the early detection of prostate lung colorectal and ovarian cancers16“17. Briefly between November 1993 and June 2001 over 150000 men and women aged 49“78 were enrolled from 10 study sites and were randomly assigned to receive either specific cancer screening regime or standard care. Of the 149980 study participants who completed the self-administered baseline risk factor questionnaire we excluded those who reported to be neither non- Hispanic black nor non-Hispanic White (n=9696) did not provide information on height or weight (n=1723) were not followed up for mortality (n=8) or reported extremely low or high BMI values (below 15 or above 50 kg/m2 n=509). The analytic cohort consisted of 3278 non-Hispanic black men4168 non-Hispanic black women64162 non-Hispanic white men and 66436 non-Hispanic white women. The study protocol was approved by the Institutional Review Board of the National Cancer Institute and the participating centers. All participants provided written information consent upon enrollment. Exposure assessment In the baseline risk factor questionnaire participants were asked to report their current height (in feet and inches) current weight (in pounds) and weight at age 20 (in pounds). We calculated BMI at baseline and at age 20 as the weight at these respective ages in kilograms (kg) divided by current height in meters (m) squared. We additionally calculated the change in BMI between age 20 and baseline for each participant. Other information ascertained from the baseline questionnaire included demographic characteristics; lifestyle factors such as physical activity alcohol intake and smoking history; and medical history including diabetes hypertension heart attack stroke and cancer. Mortality ascertainment Information on deaths and cause of deaths were obtained through periodic linkage of the study population to the National Death Index. We used the International Classification of Diseases Ninth Revision [ICD-9] to define death due to cardiovascular diseases (ICD-9 codes 390“459) or cancer (ICD-9 codes 140“208). Study staff retrieved death certificates and relevant medical records to confirm deaths occurring during follow-up and to verify the underlying cause of death in a uniform and unbiased manner 17. Statistical analysis Age-standardized mortality rates (number of deaths/1000 person-years) were calculated by direct standardization using five-year age categories. Multivariable-adjusted hazard ratios (HRs) and two-sided 95% confidence intervals (CIs) were calculated using Cox proportional hazards models via the SAS PROC PHREG procedure (SAS 9.3; SAS Institute Cary North Carolina). Person-years were calculated from the date of completion of the baseline questionnaire until the date of death the last date of follow-up the 13th anniversary of randomization or December 312009 whichever occurred first. In multivariable-adjusted models we included age at baseline (continuous) education (less than high school high school post-high school some college college graduate and postgraduate) marital status (married widowed divorced separated and never married) smoking status (never former and current smoker) pack-years (>0“10 >10“20 >20“30 and >30) and years since quitting (<5 5“<10 10“<20 20“<30 and 30+). For each covariate missing values (generally <5%) were put into a separate group. Because further adjustment for physical activity alcohol drinking and intervention status had little influence on the results (i.e. <5% change in the HRs for BMI) these variables were not included in the final models. In the main analysis BMI at baseline was categorized into 7 groups: 15.0“<22.5 22.5“<25.0 25.0“<27.5 27.5“<30.0 30.0“<35.0 35.0“<40.0 and 40.0“50.0. In analyses of cause-specific mortality and subgroup analyses we used consolidated categories and continuous values of BMI to preserve statistical power and participants with BMI values less than 20 were excluded to account for the elevated risks of death observed in this group. Due to the generally lower values of BMI at age 20 we used the following 5 categories for analyses: 15.0“<20 20“<22.5 22.5“<25.0 25.0“<27.5 27.5“50. BMI change between age 20 and baseline was categorized into 4 groups (<0 0“<5 5“<10 and 10+). In multivariable-adjusted models of BMI change we additionally adjusted for BMI at age 20. Tests for linear trend across BMI categories were performed by modeling median values in each category as a continuous variable. Tests for interaction were performed using the likelihood-ratio test comparing the fit of models having a cross-product term between BMI and the covariate of interest to that of models without this term. Tests for heterogeneity were performed using the Mantel-Haenszel test. To assess the impact of reporting error in self-reported BMI on our results we used race- and sex-specific regression models to calculate adjusted BMI using the self-reported BMI for each participant (BMI adjusted=?2.03+1.07 BMI self-reported + 0.0062 age for black men BMI adjusted=?0.88+1.00 BMI self-reported + 0.0273 age for white men BMI adjusted=? 1.10+1.02 BMI self-reported + 0.0174 age for black women and BMI adjusted=?0.51+1.02 BMI self-reported + 0.0117 age for white women). We generated these equations using data from participants ages 49 years and older in the U.S. National Health and Nutrition Evaluation Survey (NHANES) 1999“200618 by regressing BMI calculated from measured height and weight on BMI calculated from self-reported height and weight adjusting for age. Results During an average of 13 years of follow up we identified 1495 deaths in blacks and 18236 in whites. Table 1 describes study characteristics of black and white men and women. The mean age at baseline was 62 for all race and sex groups. Compared with whites both black men and women were less likely to be college educated and married and more likely to be current smokers and have a history of diabetes hypertension heart attack and/or stroke. The mean baseline BMI was higher in blacks than in whites and this race difference was more pronounced in women than in men. The distribution of BMI at age 20 was similar across categories of race and sex. Age-standardized mortality rates were lowest between 27.5 and 29.9 in black men and 25.0 and 27.4 in black women whereas the lowest mortality rates among white participants were generally found between 22.5 and 24.9. Black men and women had higher age-standardized mortality rates in all BMI categories when compared with their white counterparts (Table 2). In multivariable-adjusted models using 22.5“<25.0 as the reference category of BMI we observed J-shaped associations between BMI and mortality in both blacks and whites. Additional exclusion of current smokers recent quitters (<5 years) and subjects with a history of cancer heart attack or stroke at baseline generally yielded slightly weaker associations for the lowest BMI category and slightly stronger positive associations at the higher range of BMI (Table 2 Figure 1). "
Lung_Cancer
"We also studied the oncogenic potential of SETDB1 by evaluating its ability to enhance cell invasion in a lung carcinoma cell line without SETDB1 gene amplification (A549; a). To this end we transfected the plasmids driving the expression of SETDB1 and performed a matrigel invasion assay. We observed a significant increase in the number of invasive cells upon SETDB1 transfection in comparison with empty vector-transfected cells (a). We also wondered about gene targets in the amplified lung cancer cells whose expression could be regulated by SETDB1-mediated H3-K9 promoter methylation and that could further explain the above observed impact in cell growth and invasiveness. To find downstream targets of SETDB1 in the amplified lung cancer cell lines DMS-273 and NCI-H1437 we have developed expression microarray analyses (Agilent G4851B 60K Santa Clara CA USA) of both SETDB1 shRNA-depleted cell lines in comparison with their corresponding shRNA-scrambled control cell lines. The microarray expression data obtained are freely available at the Gene Expression Omnibus database: http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=tdexdacygiayejy&acc=GSE45175. Using this approach we have identified eighteen common genes repressed in both SETDB1-amplified lung cancer cell lines that become upregulated upon SETDB1 shRNA-mediated downregulation (Supplementary Table S2 and Supplementary Figure S4). We have also confirmed the expression changes of the candidate genes by quantitative reverse transcription“PCR and the shift in H3-K9 methylation status in their respective promoters by quantitative chromatin immunoprecitation (Supplementary Figure S4). Related to function gene ontology analysis of these genes determined ˜regulation of cell proliferation' as the most significantly enriched biological process (false discovery rate=0.0006). Representative examples included the tumor suppressor roles of delta/notch-like epidermal growth factor-related receptor34 and insulin-like growth factor-binding protein 7.35 The observation that the presence of the SETDB1 gene amplification with associated overexpression was critical for the tumorigenesis of these lung cancer cells prompted us to examine whether drugs targeting this pathway might find a therapeutic ˜niche' for their use in the described subset of cases with extra copies of this gene. Similar scenarios have been described for inhibitors of another histone methyltransferase DOT1L36 and the BET family of acetyl-lysine-recognizing chromatin ˜adaptor' proteins3738 39 in which hematological malignancies carrying gene-activating events involving targets of these pathways are more sensitive to these drugs. No highly specific inhibitor for SETDB1 has been described in the publicly available literature but to the best of our knowledge one agent ”mithramycin” could be important in targeting SETDB1.40 Mithramycin is a clinically approved antitumor antibiotic that binds to DNA by interacting with the minor groove and displacing transcriptional activators that bind to GC-rich binding sites.41 Most importantly it has been shown to suppress basal SETDB1 promoter activity in a dose-dependent manner by inhibiting the binding of Sp transcription factors.40 Thus we tested whether a putative growth inhibitory effect of this drug in lung cancer cells was dependent on SETDB1 expression. First we developed western blot analyses for the SETDB1 protein in the SETDB1-amplified lung cancer cell lines DMS-273 NCI-H1437 and NCI-H1395 upon the use of the drug. We found that mithramycin was able to inhibit SETDB1 expression in the three cell lines (Supplementary Figure S5). Using the small lung cancer cell line DMS-273 harboring the previously identified SETDB1 gene amplification in comparison with three stable short hairpin SETDB1-depleted clones we observed that the scramble shRNA DMS-273 cells were significantly more sensitive to the growth inhibitory effect mediated by mithramycin than any of the depleted clones (A30 A31 and B32-63; and Supplementary Figure S5). Experiments for each clone were performed in triplicate. Furthermore we extended the cell viability experiments using the MTT assay to the other two SETDB1-amplified lung cancer cell lines (NCI-H1437 and NCI-H1395) and to three SETDB1 non-amplified lung cancer cell lines (DMS-114 A549 and NCI-H1299). The determination of the corresponding EC50 values further confirmed that SETDB1-amplified cell lines (EC50=13.6?nM for NCI-H1437 and EC50=14.7?nM for NCI-H1395) are more sensitive to the drug than the non-amplified cell lines (EC50=347.5?nM for DMS-114 EC50=122?nM for A549 and EC50=32?nM for NCI-H1299; analysis of variance P<0.001). Thus at least in vitro the presence of SETDB1 gene amplification could ˜mark' lung cancer cells that are more sensitive to the inhibition of cell viability associated with the use of mithramycin for which previous data also suggested SETDB1 as a likely candidate target gene of the drug.40 Finally we sought to demonstrate that the presence of SETDB1 gene amplification was not a specific feature of in vitro grown lung cancer cell lines and that it also occurred in primary tumors of lung cancer patients. In this regard the 1q chromosome arm undergoes gains (trisomic or tetrasomic) in lung cancer4243 44 that are also associated with overrepresentation of the 1q21 region.4546 47 Recent genomic data48 49 using single-nucleotide polymorphism microarrays confirm the gain of the SETDB1-1q21 chromosomic region in primary lung tumors. Herein we performed fluorescence in situ hybridization analyses for the SETDB1 locus using a collection of 59 primary lung tumors corresponding to 40 non-small cell lung tumors (20 squamous cell carcinoma and 20 adenocarcinomas) and 19 small cell carcinomas (a). We identified SETDB1 gene amplification in nine tumors corresponding to 20% (4 of 20) 20% (4 of 20) and 5% (1 of 19) of adenocarcinoma squamous and small cell lung cancer cases respectively. Most importantly we also demonstrated that the presence of extra copies of SETDB1 in these nine primary tumors was associated with overexpression of the SETDB1 protein as determined by immunohistochemistry in all cases (b). "
Lung_Cancer
"Methods: We updated a case“cohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 1989“2006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We applied Cox proportional hazards modelling to estimate exposure“response trends adjusted for age and smoking for cumulative exposures lagged by 010 and 20 years and separately for time windows of ?15 and >15 years since first exposure. Results: We observed no associations between cumulative exposure and lung cancer irrespective of lag interval. In contrast analyses by exposure time windows revealed modestly elevated but not statistically significant relative risks (?1.27) at the highest three exposure quintiles for exposures that occurred >15 years since first exposure. Conclusions: The findings do not support a protective effect of endotoxin but are suggestive of possible lung cancer promotion with increasing time since first exposure. endotoxin lipopolysaccharide lung cancer epidemiology textile industry occupational health Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24651386 3992504 bjc2014146 10.1038/bjc.2014.146 Clinical Study A multicentre randomised controlled trial of reciprocal lung cancer peer review and supported quality improvement: results from the improving lung cancer outcomes project Improving lung cancer outcomes project results Russell G K 1 Jimenez S 1 Martin L 1 Stanley R 2 Peake M D 1 3 Woolhouse I 1 4 * 1Clinical Standards Department Royal College of Physicians London NW14LE UK 2Clinical Audit Support Unit NHS Information Centre for Health and Social Care Leeds LS16AE UK 3Department of Respiratory Medicine Glenfield Hospital Leicester LE39QP UK 4Department of Respiratory Medicine Queen Elizabeth Hospital Birmingham Birmingham B152WB UK *E-mail: ian.woolhouseuhb.nhs.uk 15 04 2014 20 03 2014 110 8 1936 1942 19 12 2013 11 02 2014 24 02 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Results from the National Lung Cancer Audit demonstrate unexplained variation in outcomes. Peer review with supported quality improvement has been shown to reduce variation in other areas of health care but has not been formally tested in cancer multidisciplinary teams. The aim of the current study is to assess the impact of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working on lung cancer process and outcome measures. Methods: English lung cancer teams were randomised to usual care or facilitated reciprocal peer review visits followed by 12 months of supported quality improvement. The primary outcome was change in the following national audit indicators; mulitdisciplinary team discussion histological confirmation active treatment surgical resection small-cell chemotherapy and specialist nurse review. Patient experience was measured using a new lung cancer patient questionnaire in the intervention group. Results: Thirty teams (31 trusts) entered the intervention group and 29 of these submitted a total of 67 quality improvement plans. Active treatment increased in the intervention group (n=31) by 5.2% compared with 1.2% in the control group (n=48 mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining audit indicators improved similarly in all groups. Mean patient experience scores in the intervention group did not change significantly during the study but a significant improvement was seen in the scores for the five teams with the worst baseline scores (0.86 to 0.22 P<0.001). Conclusions: Reciprocal peer review with supported quality improvement was feasible and effective in stimulating quality improvement activity but resulted in only modest improvements in lung cancer treatment rates and patient experience. lung cancer multidisciplinary quality improvement peer Lung cancer is the commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 1“15 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in Figure 1. Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the Shapiro“Wilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 0“11 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a ˜Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (0“1.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%“100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.22“0.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. "
Lung_Cancer
"As this was designed to ascertain proof of principle we did not apply a measure of successful laboratory performance. The pilot established that the scheme design and methods used were acceptable for use in a larger scheme. Second round One hundred and seventeen laboratories from 30 countries registered and 101 participated in the second round (due to customs issues we were not able to get samples to 16 labs) run in the second quarter of 2012. Ninety-one laboratories submitted results within the 8-week time frame “ the remaining 10 labs gave no reason why they did not submit results. A different set of samples from those used in the pilot first round were sent to the laboratories with the emphasis being on the inclusion of mutations at allelic frequencies that would challenge the analytical sensitivity of all the commonly used technologies (; samples B1“B10). A code number different from the one assigned in the first round was given to the samples. In addition to the genotype results all participating laboratories were also required to submit for assessment copies of their clinical reports for three samples (B1 B4 and B9). The main methodology used by the participants was PCR/sequencing (n=35 laboratories; 39%) and real-time PCR (n=17; 18.6% ). It was common for labs to use a combination of different methodologies in their testing process (). A variety of different errors were detected by the second scheme round including 74 (8.1%) genotype errors (false-positive (n=13; 1.5%) false-negative (n=61; 82.4%) and a combination of false-negative and -positive results (n=1; 1.4%)) as well as analytical test failures (n=31; 3.4%) mispositioning of the genotype (n=7; 0.8%) and significant errors in the mutation nomenclature (n=36; 3.9%). Two samples (B2 and B8) gave a disproportionately high error rate compared with the other samples used in this round () with 94.1% of errors for B2 made by labs using PCR/sequencing vs 40.7% of errors for sample B8 made by labs using a version of the Therascreen EGFR kit (Qiagen). Laboratories did not lose marks if the declared limitations of their assay meant that they would not detect a particular mutation at the given frequency used in the EQA materials. Eighteen laboratories (19.8%) from 13 countries with a total score below 18 did not pass the second round and were thus classified as poor performers “ 72.2% of these labs used PCR/Sequencing as their main diagnostic test for EGFR mutation status. The interpretation of the test result relative to the clinical referral was reviewed with laboratories receiving comments on their performance but no marks assigned. Overall 46 (50.5%) of the laboratories had a score ?18 in the second round and passed the EQA. All laboratories received a certificate of participation that displayed their performance in the scheme. Third round The 18 laboratories that did not pass the second round were given the opportunity to participate in a third round. One laboratory was unable to participate due to problems with customs sample import permissions. The same set of samples used in the second round was sent to the laboratories in the third quarter of 2012 (; samples C1“C10). To obscure the sample identity from the labs a different code number from the one assigned in the second round was given to the samples. Only the genotyping result was assessed for each of the 17 laboratories that returned results. A total of 18 (10.6%) genotyping errors (reported false-positive (n=1; 5.5%) and false-negative results (n=13; 94.4%)) were made as well as analytical test failures (n=3; 1.8%). Eight laboratories (47.1%) missed the same mutation in identical samples in rounds 2 and 3 (for example B3/C9 n=1; B9/C5 n=2; B8/C10 n=5) indicating a failure of their assay for a particular mutation. Three laboratories (17.6%) had a pattern of errors indicating a more general assay validation problem. Four laboratories (23.5%) did not pass the third round and scored <18. Overall all 17 laboratories (100%) improved their performance compared with the second round with 6 (35.3%) labs getting the correct result for all 10 samples. Discussion The clinical significance of somatic aberrations in oncology has seen rapid progression in the last couple of years with the correlation of treatment-related outcomes to gene alterations (Normanno et al 2013). The rapid development and approval for use of therapeutic drugs based on mutational tests has represented a significant innovation for medical oncology but also a major challenge for oncologists pathologists and clinical scientists. Companion diagnostics and related guidelines have traditionally lagged behind such clinical indications for a variety of reasons. Although EQA schemes are running for the KRAS (sporadic colorectal cancer) and BRAF (malignant melanoma) genes such schemes for EGFR are further complicated by the diverse spectrum of mutations tumour heterogeneity and issues pertaining to the availability of appropriate biological material for use as EQA samples. For this reason ESMO ETOP ESP and other stakeholders collaborated with the EMQN to develop an integrated approach to offer EQA for EGFR mutation testing in NSCLC to laboratories around the world. The purpose of the scheme is the provision of accurate and reliable EGFR testing for patients by assuring parity of test outcomes among participating laboratories from around the world. Different types of samples can be used for this type of EQA (van Krieken et al 2013). In the majority of existing schemes FFPE patient biopsy samples have been used (Bellon et al 2011; Deans et al 2011; Thunnissen et al 2011; Normanno et al 2013). Although this type of sample enables the complete analytical pathway to be assessed ensuring a closer relationship between the EQA and routine clinical activity it is limited by the amount of human tissue that is available and issues related to transport of samples across national borders. For this scheme we developed a different approach and used artificial materials composed of FFPE cell lines to allow us to provide exactly the same sample to all the participating laboratories even when these were numerous. In addition it was possible to generate homogenous samples with variable content of mutant alleles by mixing wild-type and mutant cells and to use them to uncover hidden weaknesses in test performance (sensitivity specificity). This EQA scheme assessed both the genotyping and the interpretation of the clinical significance of the results. Other EQA schemes that employed tumour samples have also addressed the pre-analytical phase with laboratories being required to assess the percentage of neoplastic cells and to perform dissection if needed. However scoring of this phase is not easy as no consensus on the estimation of tumour cell content has been reached and a huge variability has been reported in previous EQA schemes (Thunnissen et al 2011; van Krieken et al 2013). Our approach is similar to that described by Normanno et al (2013) as it reduces the inter-laboratory variability related to the type of technique used for the dissection and allows a comparative evaluation of the sensitivity and specificity of the methods used for the mutational analysis."
Lung_Cancer
"Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C ACGTTGGATGTACATGTGCACAACGTGCAG ACGTTGGATGAAGGACGAGTTAATGGGTGC GGGAACGTCGCACATGTAT rs4844600 G/A ACGTTGGATGGAATGGCTTCCATTTGCCAG ACGTTGGATGGGGCGGCATTCATAGTTCAG CCCAATGGGAAACTCAAA rs3818361 C/T ACGTTGGATGTGGAAAGGACAGTTCCAGAG ACGTTGGATGTTTTAAGCCCTCTGGTAAGC TAATCCCTCTGGTAAGCATAAGATATA rs17048010 T/C ACGTTGGATGTTTCAAGGCTGCTCCTTGTT"
Lung_Cancer
"in xenograft models. Mechanistically NEDD9 localized to invasive pseudopods and was required for local matrix degradation. Depletion of NEDD9 impaired invasion of cancer cells through inactivation of membrane-bound matrix metalloproteinase MMP14 by excess TIMP2 on the cell surface. Inactivation of MMP14 is accompanied by reduced collagenolytic activity of soluble metalloproteinases MMP2 and MMP9. Re-expression of NEDD9 is sufficient to restore the activity of MMP14 and the invasive properties of BCa cells in vitro and in vivo. Collectively these findings uncover critical steps in NEDD9-dependent invasion of BCa cells. Implications This study provides a mechanistic basis for potential therapeutic interventions to prevent metastasis. NEDD9 invasion metastasis breast cancer MMP14 Int J Occup Environ Health Int J Occup Environ Health OEH International Journal of Occupational and Environmental health 1077-3525 2049-3967 Maney Publishing Suite 1C Joseph's Well Hanover Walk Leeds LS3 1AB UK 24999846 4090870 2014_1 10.1179/1077352514Z.000000000104 Original Dust diseases and the legacy of corporate manipulation of science and law Dust diseases Egilman David 1 Bird Tess 2 Lee Caroline 2 1 Department of Community Health Brown University Attleboro MA USA 2 Never Again Consulting Attleboro MA USA Correspondence to: David Egilman 8 North Main Street Suite 404 Attleboro MA 02703 USA. Email: degilmanegilman.com 4 2014 20 2 115 125 W. S. Maney & Son Ltd 2014 2014 Background: The dust diseases silicosis and asbestosis were the first occupational diseases to have widespread impact on workers. Knowledge that asbestos and silica were hazardous to health became public several decades after the industry knew of the health concerns. This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestos“cancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestos“cancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant non“small cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant non“small cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Post“solid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j D™Amico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 79“85) and specificity was 31% (95% CI: 23%“40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). Kaplan“Meier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. "
Lung_Cancer
"A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetzbroadinstitute. (G.G.) tjacksmit.edu (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: toyookamd.okayama-u.ac.jp). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 The Author 2013. Published by Oxford University Press. 2013 This is an Open Access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact journals.permissionsoup.com We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). "
Lung_Cancer
"Among biomarkers genes have been used to distinguish AC from SCC in practice and other six genes were newly discovered biomarkers for distinguishing subtypes. Furthermore NKX2-1 has been considered as a molecular target for the targeted therapy of AC and other genes may be novel molecular targets. By gene ontology analysis we found that two biological processes (˜epidermis development™ and ˜cell adhesion™) were closely related with the tumorigenesis of subtypes of NSCLC. More generally the current method could be extended to other complex diseases for distinguishing subtypes and detecting the molecular targets for targeted therapy. The authors' work is supported by the National Natural Science Foundation of China (Grant Nos. 61100145 61033003 and 91130034). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Lung cancer is the leading cause of cancer-related deaths in the world [1]. It has been divided into two classes by the World Health anization (WHO): non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC) [2]. NSCLC which has two major subtypes: adenocarcinoma (AC) and squamous cell carcinoma (SCC) accounts for more than a half of all lung cancer cases [2]. However less than of NSCLC patients survive beyond five years [3]. The limited effectiveness of the diagnosis and treatment of NSCLC is mainly caused by the difficulty to distinguish the subtypes and the limited knowledge about the pathogenesis mechanisms of subtypes of NSCLC. NSCLC is a system disease and the difference of AC and SCC may be reflected on the cellular and molecular level. Traditional methods rely on visual cell morphology (e.g. size of tumor and histological features) to distinguish subtypes which are based on cellular level [4]“[6]. It has been proposed that traditional methods could effectively distinguish SCLC from NSCLC because of the clear distinction between the morphology of SCLC cells and that of NSCLC cells [7]. However the morphological difference among the subtypes of NSCLC remains unclear [8]. Multiple molecular level data (mRNA microRNA and methylation data) between NSCLC and normal have been used for analyzing dysfunctions of NSCLC [9]. It was suggested that the discriminating ability of genes obtained by mRNA data was significant greater than those by microRNA and methylation data. Therefore it is reasonable to retrieve valuable genes and biological processes that have great discriminating ability between AC and SCC on the mRNA level. A targeted therapeutic agent is designed to interfere with a specific molecular target which plays a crucial role for tumor growth and progression [10]. For example which is a targeted therapeutic agent for the targeted therapy of NSCLC is a monoclonal antibody for VEGF. The gene VEGF is crucial because it is higher expressed in lung cancer than in normal lung [11]. Hence the molecules which play distinct roles between cancer and normal may be important for selecting therapeutic agents. Although targeted therapy shows clinical benefits targeted agents have not enabled targeted therapies to change clinical outcome dramatically. Moreover existing targeted therapeutic schedules may be suitable for the prognostic of a special subtype of NSCLC. For example only patients with non-SCC are better to use [12]. Therefore it is necessary to research the molecular mechanisms that are related with the subtypes of NSCLC to develop effective methods to distinguish AC from SCC and novel therapeutic agents special for the subtypes of NSCLC. The expression patterns of several genes are found to be special for the subtypes of diseases. For example the NKX2-1 gene is expressed in lung AC [13]. The knockdown of NKX2-1 results growth inhibition in lung AC cell. Therefore the presence of lung AC depends on the expression of NKX2-1 [14]. Another example is involved in the research of esophageal cancer the combination of the genes GATA6 and SPRR3 may discriminate among normal epithelium Barrett's dysplasia and Barrett's esophagus associated AC [15]. Some special relationships exist between the gene pair (GATA6 and SPRR3) and the phenotypes of esophageal cancer. Such examples suggest the existence of relationships between genes and the subtypes of diseases. The methods that indirectly identify gene-phenotype relationships can be roughly divided into three common steps: construct a gene-gene (or protein-protein) network and a phenotype-phenotype network by pooling interaction data from several databases; connect the gene-gene (or protein-protein) network with the phenotype-phenotype network; use an algorithm (e.g. random walk with restart on heterogeneous network algorithm) to infer pairwise gene-phenotype relationships [16] [17]. However the noise from the integration of data limits the effectiveness of the detection of gene-phenotype relationships. Many methods have been developed to directly associate single molecules to phenotypes. The nonnegative matrix factorization (NMF) method is a dimensionality-reducing algorithm to obtain a set of metagenes and associated coefficients [18]. Each phenotype corresponds to a metagene. The coefficient of a gene in a metagene represents the closeness of the relationship between the gene and the phenotype corresponding to the metagene. This method requires to filter several data to ensure the nonnegative condition which may loss some useful information. Linear correlation coefficients were used to measure genotype-phenotype associations between single proteins in a microbe and the microbe's phenotypes [19]. Slonim et al. used the relevance analysis method (RA) to infer gene-phenotype relationships by estimating mutual information [20]. However phenotype traits are often influenced not by a single gene but by combinations of genes. Association rule mining (ARM) is a data mining technique to extract if-then rules with the general form [21]. Bowers et al. designed the logic analysis method to obtain if-then rules from an item or a combination of items to another one. Previous studies have been done to infer logic relationships among genes or proteins using pairwise and triplet logic analysis on expression data or phylogenetic profiles [22]. However if-then rules may not have many biological cases unless the converse relation holds as well [23]. In this paper we improve the logic analysis method to mine the necessary and sufficient conditions for the presence states (presence or absence) of phenotypes [22]. The current method takes into consideration both a single gene and a gene pair which may influence phenotypes. We apply the method to infer gene-subtype relationships based on AC and SCC specimens. It is suggested that the expression patterns (expression or no-expression) of identified genes are necessary and sufficient conditions for the presence states of AC or SCC. The effectiveness of the current method is demonstrated on NSCLC and normal specimens. Our results show that the current method outperforms the two existing methods (the NMF method and the RA method) in recall rate and classification accuracy. This work could help to find the biomarkers to distinguish the subtypes of diseases and to design novel targeted therapeutic agents for diseases as well as reveal the biological processes which are closely related with diseases. Results We applied our method to identify relationships between genes and two major subtypes of NSCLC (AC and SCC). Further the performance comparison of our method with those of the two earlier methods (the NMF method and the RA method) was made by comparing two measures (the recall rate and classification accuracy) on the data of GSE18842 which contains similar numbers of NSCLC and normal specimens. The biomarkers as well as biological processes which were closely related with the subtypes of NSCLC could be obtained from several interesting relationships between genes and subtypes of NSCLC. Identification of gene-subtype lower and higher logic relationships Given that the number of AC specimens () was much larger than that of SCC specimens () () we randomly selected the fixed number (i.e.) of AC specimens to ensure the similar number of specimens for different phenotypes. We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the selected AC specimens and all of the SCC specimens. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The new binary probe data had size where the first columns corresponded to AC specimens and the last columns refered to SCC specimens. The new phenotype profile data had size where the first row represented AC and the second one represented SCC. For convenience we defined the first and second row of the new phenotype profile data as AC profile data and SCC profile data respectively. The subtypes of NSCLC data comprised the new binary probe data and the new phenotype profile data. We applied our method to the subtypes of NSCLC data to mine gene-subtype logic relationships. 10.1371/journal.pone.0094644.t001 Data source. Subtype No.(n) AC GSE10245(40) GSE37745(106) GSE18842(14) GSE28571 (50) SCC GSE10245(18) GSE37745(66) GSE18842(32) GSE28571 (28) Normal ” ” GSE18842(45) ” ˜No.™ is the accession number from the Gene Expression Omnibus (GEO) database in NCBI; ˜n™ is the number of specimens; ˜”™ means there are no specimens from the corresponding data set. Identification of probe-subtype lower and higher logic relationships Based on the subtypes of NSCLC data we calculated the uncertainty coefficient for a subtype of NSCLC predicted by a probe (or a probe pair) as well as the uncertainty coefficient for a probe (or a probe pair) predicted by the subtype in the reverse direction. The same procedure was applied to random binary probe data and phenotype profile data. The maximum random uncertainty coefficients for logic pairwise and triplet combinations were used as the thresholds for lower and higher logic relationships respectively. That is the association of a probe or a probe pair with a subtype was considered significant if and only if its uncertainty coefficients in both directions were found to be greater than the maximal value obtained from the random data. Let and be the thresholds of lower and higher logic relationships respectively. We obtained logic pairwise combinations and logic triplet combinations with uncertainty coefficients higher than and respectively. Because the significance of the discovered logic pairwise and triplet combinations cannot be exactly verified by the limited knowledge of gene-subtype interactions a statistical analysis is deserved to be estimated [24]. Suppose the significance level was . The p-values were all zeros for the discovered logic pairwise and triplet combinations which were smaller than the significance level. The results of the statistical analysis showed that the discovered logic pairwise and triplet combinations did not interact randomly. Next we evaluated the false discovery rate (FDR) to control the global significance of the discovered logic pairwise and triplet combinations."
Lung_Cancer
"Median PFS in patients with EGFR mutation?positive tumors was 18 weeks based on 26 patients with 21 (81%) achieving PFS events; this median was longer than that seen in the overall population. The 6 patients with documented T790M had a median PFS of 7 weeks which was similar to that of patients with EGFR wild?type tumors (8 weeks). Kaplan?Meier curves show (A) progression?free survival and (B) overall survival by arm (all patients). CI indicates confidence interval. image Overall Survival At the time of data cutoff 47 patients (71%) had died and median OS was 37 weeks in the overall population 45 weeks in patients with adenocarcinoma and 27 weeks in patients with nonadenocarcinoma (Fig. 3B). Of the 26 patients with EGFR mutation?positive tumors (both arms) median OS was 57 weeks OS6M was 81% and OS12M was 59%. Safety and Tolerability The majority of treatment?related AEs were of grade 1 or 2 severity () and were manageable with standard supportive care. Common events included diarrhea (85%) dermatitis acneiform (68%) dry skin (38%) fatigue (38%) exfoliative rash (24%) stomatitis (24%) decreased appetite (23%) and pruritus (23%). One patient experienced treatment?related grade 4 AEs of dyspnea and pulmonary embolism considered by the investigator to be possibly related to study drug; 18 patients (27%) experienced treatment?related AEs with a maximum severity of grade 3. The majority of patients (n?=?44 67%) did not require a dose reduction and interruption of daily dosing was seen in 33% for evaluation and management of AEs. Of the 22 patients who did require dose reduction 17 patients had 1 dose reduction and 5 had 2 dose reductions. AEs resulting in dose modification were predominantly dermatologic or gastrointestinal. Six patients permanently discontinued dacomitinib due to treatment?related AEs which included grade 4 dyspnea (day 8) and grade 4 pulmonary embolism (day 9) (both in a single patient); grade 3 fatigue (day 14); grade 3 exfoliative rash (day 134); grade 2 allergic dermatitis (day 3); grade 2 fatigue (day 85); and grade 1 fatigue (day 43). Twelve deaths occurred within 28 days following the last dose of dacomitinib and were reported as serious AEs; none was considered to be treatment?related. Treatment?Related Adverse Events Occurring in ?10% of Patients in the Overall Population (N?=?66) and Hematologic Laboratory Values by Maximum CTCAE Grade (All Cycles; N?=?66) Adverse Event Grade 1/2n (%) Grade 3n (%) Total n (%) Any adverse events 46 (69.7) 18 (27.3)a 65 (98.5) Diarrhea 48 (72.7) 8 (12.1) 56 (84.8) Dermatitis acneiform 41 (62.1) 4 (6.1) 45 (68.2) Dry skin 25 (37.9) 0 25 (37.9) Fatigue 23 (34.8) 2 (3.0) 25 (37.9) Exfoliative rash 14 (21.2) 2 (3.0) 16 (24.2) Stomatitis 15 (22.7) 1 (1.5) 16 (24.2) Decreased appetite 15 (22.7) 0 15 (22.7) Pruritus 12 (18.2) 3 (4.5) 15 (22.7) Nausea 13 (19.7) 0 13 (19.7) Vomiting 8 (12.1) 1 (1.5) 9 (13.6) Aspartate aminotransferase increased 8 (12.1) 0 8 (12.1) Mucosal inflammation 7 (10.6) 0 7 (10.6) Hematologic Laboratory Values Grade 1/2n (%) Grade 3n (%) Total n (%) Hemoglobin 36 (54.5) 1 (1.5) 50 (75.8) Lymphopenia 10 (15.2) 12 (18.2)b 40 (60.6) Neutropenia 2 (3.0) 1 (1.5) 4 (6.1) Thrombocytopenia 4 (6.1) 1 (1.5)c 5 (7.6) Leukopenia 10 (15.2) 0 11 (16.7) a Includes two grade 4 events (dyspnea and pulmonary embolism) both experienced by the same patient. b Includes 2 patients with grade 4 events. c Grade 4. Patient?Reported Outcomes Completion rates for the EORTC QLQ?C30/?LC13 and DLQI questionnaires were high throughout the study (generally?>90% of patients answered at least one question). Patients with radiographic disease control reported improvement in lung cancer symptoms of dyspnea cough pain in chest and pain in arm/shoulder relative to baseline scores first observed after 3 weeks on therapy (Supporting Fig. 1A). Diarrhea was the most commonly reported class?related AE; diarrhea peaked at cycle 3 day 1 (week 6) and remained stable over time (Supporting Fig. 1B). With a score of 0?=?no symptoms and 100?=?most symptoms patients on dacomitinib reported scores that were at the midpoint in the range at their worst. The impact of dacomitinib on PRO for NSCLC symptoms and dermatologic toxicity has been previously presented and will be subsequently reported in full (Campbell AK et al; unpublished data). Pharmacokinetics PK parameters (overall and by histology) following a single dose (cycle 1 day 1) and mean Ctrough values after multiple doses for dose?compliant patients (Supporting ) were consistent with those previously reported.5 Pharmacodynamics Soluble HER2 and EGFR levels were slightly decreased on day 1 of most cycles compared with baseline for most patients. One patient with nonadenocarcinoma demonstrating HER2 amplification had elevated baseline soluble HER2 that significantly declined to population normal baseline levels upon treatment with dacomitinib. This patient's tumor also demonstrated a PR.16 Discussion In this phase 2 trial dacomitinib demonstrated an overall response rate of 5% but the primary endpoint of this study was not met. Three PRs were observed 2 in patients with EGFR mutation?positive tumors and 1 in a patient whose tumor was EGFR wild?type with HER2 amplification.16 In contrast patients with known EGFR T790M did not respond to dacomitinib therapy despite efficacy in preclinical models. These observations could be due to the presence of concurrent drug resistance mechanisms (such as MET amplification)18 or to the inability of dacomitinib to fully inhibit EGFR in tumors harboring EGFR T790M at the doses currently under clinical investigation.5 Strategies to improve EGFR inhibition in EGFR T790M cancers include the combination of irreversible EGFR inhibitors with the EGFR?directed antibody cetuximab (as reported for afatinib plus cetuximab)19; the development of more potent and specific inhibitors of EGFR T790M2021; and the use of intermittent but high doses of existing irreversible EGFR inhibitors.18 In contrast where resistance is mediated by compensatory signaling pathways or tumors harbor more than one concomitant drug resistance mechanism combination strategies with targeted agents in appropriately selected patients will be necessary to treat such cancers (eg inhibition of the MET pathway). In the absence of a known oncogene addiction patients with wild?type EGFR may still benefit from EGFR?directed therapy in the absence of a RECIST?defined radiographic response; endpoints such as PFS and patient report of HRQoL and symptom relief have become increasingly important in a noncurative setting.22 This is demonstrated in the BR21 trial of erlotinib versus placebo where the ORR was low and yet was associated with improvements versus placebo in OS and NSCLC symptoms.10 In the current study in refractory NSCLC 10 of 36 patients with SD as BOR derived prolonged clinical benefit (SD???6 months) with dacomitinib; patients also reported a rapid onset of improvement in key lung cancer symptoms with symptomatic improvements remaining durable over the course of therapy. Common AEs were typically gastrointestinal or dermatologic and consistent with targeting EGFR.24 By patient report both gastrointestinal and dermatologic symptoms peaked early in treatment and stabilized or improved over time (Campbell AK et al; unpublished data). The benefits seen in this study may reflect dacomitinib's broader mode of action in targeting all kinase?active HER family members irreversible binding to the tyrosine kinase domain retreatment in some of those patients with an EGFR?driven tumor following a period off treatment after a prior selective EGFR TKI or other as yet to be determined factors. Data from this and other phase 1 and 2 studies in post?EGFR TKI settings5 and from a head?to?head trial comparing dacomitinib with erlotinib in the second?line setting8 suggest that dacomitinib has clinically relevant activity in patients with NSCLC who do not harbor KRAS mutations. However in the absence of a control arm it remains unclear if this degree of benefit seen here could be due to patient selection or favorable prognostic factors. A phase 3 trial is underway to determine the efficacy and safety of dacomitinib compared with erlotinib in patients with KRAS wild?type NSCLC for whom first?line chemotherapy has failed (ARCHER 1009; ClinicalTrials.gov identifier NCT01360554). FUNDING SUPPORT This study was sponsored by Pfizer Inc. CONFLICT OF INTEREST DISCLOSURE Drs. Ruiz?Garcia Liang Taylor Gernhardt and O'Connell are employees of Pfizer and own Pfizer stock. Stephen Letrent and an immediate family member are employees of Pfizer and own Pfizer stock. Dr. Reckamp received research funding from Pfizer. Dr. Camidge served Pfizer in an advisory role. Dr. Engelman received honoraria from Genentech/Roche and received research funding from Novartis. He also received remuneration from Pfizer for use of cell lines for which he is a coinventor and has an EGFR/MET patent that has been licensed by Ventana and owned by Roche (no compensation to date). Dr. Koczywas received honoraria from Pfizer and Genentech. Dr. Gadgeel received honoraria from Pfizer. Alicyn K. Campbell and an immediate family member were previously employed by Pfizer (neither hold current employment with Pfizer). Dr. Campbell is currently employed by Genentech a member of the Roche Group. Dr. Jänne has been a consultant for Boehringer?Ingelheim Genentech/Roche AstraZeneca and Pfizer. Drs. Giaccone Khuri and Rajan have no conflicts of interest to disclose. Supplementary Material Additional Supporting Information may be found in the online version of this article. Supplementary information Click here for additional data file. Supplementary information Figure 1. Click here for additional data file. Supplementary information Table 1. Click here for additional data file. REFERENCES 1 Hynes NE Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 2005;5:341?354 15864276 2 Roberts PJ Stinchcombe TE Der CJ Socinski MA. Personalized medicine in non?small?cell lung cancer: is KRAS a useful marker in selecting patients for epidermal growth factor receptor?targeted therapy?J Clin Oncol. 2010;28:4769?4777 20921461 3 Engelman JA Zejnullahu K Gale CM et al. PF00299804 an irreversible pan?ERBB inhibitor is effective in lung cancer models with EGFR and ERBB2 mutations that are resistant to gefitinib. Cancer Res. 2007;67:11924?11932 18089823 4 Gonzales AJ Hook KE Althaus IW et al. Antitumor activity and pharmacokinetic properties of PF?00299804 a second?generation irreversible pan?erbB receptor tyrosine kinase inhibitor. Mol Cancer Ther. 2008;7:1880?1889 18606718 5 Jänne PA Boss DS Camidge DR et al. Phase I dose?escalation study of the pan?HER inhibitor PF299804 in patients with advanced malignant solid tumors. Clin Cancer Res. 2011;17:1131?1139 21220471 6 Takahashi T Boku N Murakami H. Phase I and pharmacokinetic study of dacomitinib (PF?00299804) an oral irreversible small molecule inhibitor of human epidermal growth factor receptor?1 ?2 and ?4 tyrosine kinases in Japanese patients with advanced solid tumors. Invest New Drugs. 2012;30:2352?2363 22249430 7 Park K Heo DS Cho BC et al. Updated safety and efficacy results of a phase 1/2 study of PF?00299804 in Korean patients with NSCLC who experienced disease progression on platinum?based chemotherapy plus gefitinib or erlotinib. Presented at the 4th Asia Pacific Lung Cancer Conference (APLCC) Seoul Korea December 2?4 2010. J Thorac Oncol. 2010;5:S371?S423 Abstract O?018. 8 Ramalingam SS Blackhall F Krzakowski M et al. Randomized phase II study of dacomitinib (PF?00299804) an irreversible pan?human epidermal growth factor receptor inhibitor versus erlotinib in patients with advanced non?small?cell lung cancer. J Clin Oncol. 2012;30:3337?3344 22753918 9 Mok T Spigel DR Park K et al. Efficacy and safety of PF?00299804 as first?line treatment of patients with advanced NSCLC selected for activating mutation of epidermal growth factor receptor (EGFR). Ann Oncol. 2010;21(suppl 8): Abstract LBA18 10 Shepherd FA Rodrigues PJ Ciuleanu T et al. Erlotinib in previously treated non?small?cell lung cancer. N Engl J Med. 2005;353:123?132 16014882 11 Thatcher N Chang A Parikh P et al. Gefitinib plus best supportive care in previously treated patients with refractory advanced non?small?cell lung cancer: results from a randomised placebo?controlled multicentre study (Iressa Survival Evaluation in Lung Cancer). Lancet. 2005;366:1527?1537 16257339 12 Therasse P Arbuck SG Eisenhauer EA et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst. 2000;92:205?216 10655437 13 Aaronson NK Ahmedzai S Bergman B et al. The European Organization for Research and Treatment of Cancer QLQ?C30: a quality?of?life instrument for use in international clinical trials in oncology. J Natl Cancer Inst"
Lung_Cancer
"When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (a lane 3) over untreated cells (a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (c) or siRNA against Hsp70 (d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization. Several studies have suggested that Hsp70 functions upstream of the mitochondria by preventing the release of cytochrome c instead of inhibiting the apoptosome or other downstream points in the caspase cascade.16 17 Some of this confusion may be due to different experimental systems used to evaluate apoptosis or reflects the variability of apoptotic pathways among different cell lines. In this study we found that the inhibition of Hsp70 by ibuprofen facilitates the activation of Bax induced by cisplatin and its translocation to the mitochondria in A549 cells. This finding is consistent with the previous observation of blockade of Bax activation being one of the upstream sites of action of Hsp70. On the other hand the role played by Hsp70 in the A549 cellular mitochondrial apoptotic pathway is likely to be more complex than described earlier because in cisplatin-treated cells the decreased expression of Hsp70 caused by ibuprofen amplified the activation of caspase-9 significantly compared with that of Bax. Furthermore the similar increase in the activation of cisplatin-dependent Bax and release of cytochrome c by ibuprofen suggests that Hsp70 also inhibits the post mitochondrial steps between the release of cytochrome c and the activation of caspase-9. If Hsp70 were acting downstream of the mitochondria one would predict that it interferes with the activation of caspase-9 in response to cytochrome c either by inhibiting the formation of the apoptosome or by preventing the binding of pro-caspase-9 to this complex. When we studied the effects of Hsp70 on the formation of and recruitment of pro-caspase-9 to the apoptosome the cell lysates were immunoprecipitated although Hsp70 failed to migrate with Apaf-1 cytochrome c or caspase-9 (data not shown). These results may be supported by previous report that no association between Hsp70 and Apaf-1 or apoptosome complex was observed even under in vitro activation of caspase by the addition of cytochrome c and dATP.44 Furthermore we were unable to identify a new target for Hsp70 in the process of caspase-9 activation indicating that its inhibitory activity is attributable to another indirect effect instead of a direct one as previously reported. Altogether the data presented here are the first evidence of cell death inhibition by Hsp70 by its targeting of both upstream and downstream mitochondrial processes while the precise mechanisms by which it interferes with the activation of caspase-9 remains to be clarified. In conclusion ibuprofen potentiated the antitumoural properties of cisplatin in the cells of lung adenocarcinoma via a mechanism of action mediated by the suppression of Hsp70. These findings may promote the development of a new strategy to increase the effectiveness of cisplatin in the treatment of NSCLCs as well as highlight the putative merits of developing anticancer treatments targeting Hsp70. Materials and Methods Materials The mouse monoclonal anti-Hsp70 the rat monoclonal anti-Hsc70 and rabbit polyclonal HSF-1 antibodies purchased from Stressgen – Enzo Life Sciences Inc. Plymouth Meeting PA USA. Anti-Bax rabbit polyclonal (N-20) and anti-VDAC-1 goat polyclonal (N-18) antibodies were purchased from Santa Cruz Biotechnology Inc. Santa Cruz CA USA. Anti-cytochrome c mouse monoclonal antibody (556433) was obtained from BD Pharmingen Inc. San Diego CA USA. Anti-caspase 9 and -ERK antibodies were acquired from Cell Signaling Technology Inc. Danvers MA USA. The mouse monoclonal antibody against actin was obtained from Chemicon International Inc. Temecula CA USA. Anti-Bax 6A7 monoclonal antibody and other reagents were purchased from Sigma-Aldrich St. Louis MO USA. Cell culture and viability assay A549 and H358 lung cancer cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% foetal bovine serum at 37?°C. BEAS-2B cells were grown in bronchial epithelial basal medium. All NSAID and cisplatin were dissolved in dimethyl sulphoxide and added to the medium at indicated concentrations. The activity of mitochondrial dehydrogenase 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide (MTT) assay was used to measure cell death/survival. The reaction product was measured at A570 and the relative viability of cells treated with reagents versus untreated cells was calculated. TUNEL staining The TUNEL assay was performed using an in situ cell death detection kit (F Hoffmann-La Roche Basel Switzerland) according to the manufacturer's instructions. The ratio of TUNEL-positive cells to the total number of cells was calculated. Immunoprecipitation and cell fractionation A549 cells were lysed in RIPA buffer (50?mM Tris-HCl pH 7.5 150?mM NaCl 1?mM sodium orthovanadate 1?mM EDTA 0.1% NP-40 10?mM NaF) containing the Calbiochem Protease Inhibitor Cocktail Set III (Merck KGaA Darmstadt Germany). The cell lysates and immunoprecipitates were resolved in Laemmli sample buffer. The samples underwent sodium dodecyl sulphate-polyacrylamide gel electrophoresis were transferred to a polyvinylidene difluoride membrane reacted with the respective antibodies and detected with an ECL chemiluminescence detection kit (GE Healthcare Fairfield CT USA). For the immunoprecipitation the cell lysates were incubated with the indicated antibodies for 1?h at 4?°C. Protein G-sepharose beads were added to collect the immunocomplexes for an additional 1?h of incubation. The pellets were washed three times with lysis buffer. The mitochondria and cytosol fractions were prepared as described previously.45 Chromatin immunoprecipitation (ChIP) assay ChIP assays were performed as described previously46 using an EZ ChIP kit (Upstate Biotechnology Inc. Waltham MA USA). Briefly after adding formaldehyde A549 cells were suspended in SDS lysis buffer and the chromatin DNA was disrupted by sonication. For the immunoprecipitation the lysate was incubated with anti-HSF-1 antibody followed by immobilization on salmon sperm DNA/Protein G agarose. The protein/DNA complexes extracted with elution buffer were heated to 65?°C for 6?h to reverse cross-links then digested with proteinase K. DNA fragments were amplified in PCR with the ChIP assay primers containing the heat shock element sites in human Hsp70 promoter. PCR primers for the ChIP assay were as follows: Hsp70 (?103/+7) (F) 5?-TGATTGGTCCAAGGAAGGCT-3? and (R) 5?-AAAAAGGTAGTGGACTGTCGC-3?. Reverse transcriptase-PCR RT-PCR was carried out using a Qiagen (Valencia CA USA) One-Step RT-PCR Kit. We used the following primer pairs to amplify. Hsp70 (F) 5?-ATGAAGCACTGGCCTTTCCA-3? (R) 5?-TTGTTCTGGCTGATGTCCTT-3? Hsc70 (F) 5?-TGGAACTATTGCTGGTCTCAA3? (R) 5?-AGAACCACCAACCAGGACAAT-3? HSF-1 (F) 5?-TTCGACCAGGGCCAGTTT-3? (R) 5?-AGAGCTGGCCACAGCATCA-3? actin (F) 5?-AGAGGCATCCTCACCCTGA-3? (R) 5?-CATCTCTTGCTCGAAGTCCA-3?. The products were examined by agarose gel electrophoresis after 23 cycles. RNA interference The sequences of the sense strands used to generate specific siRNA were obtained as follows: HSF-1 5?-AAGTACTTCAAGCACAACAA-3? 5?-AAGAGTGAAGACATAAAGAT-3? 5?-AAGTCGTCAACAAGCTCATT-3?. The siRNAs were synthesized using the Silencer siRNA construction kit (Ambion; Applied Biosystems Inc. Carlsbad CA USA). Double-stranded Hsp70 and control siRNA duplex were synthesized as followed by Qiagen: Hsp70-specific sequence 5?-CCAUUGAGGAGGUAGAUUAdTdT-3?. A549 cells were transfected with each siRNA (10?nmol/l) using the Lipofectamine 2000 (Invitrogen; Applied Biosystems Inc.) and grown for 72?h to allow an effective decrease in the expression of the respective target molecules. Quantification of apoptosis by flow cytometry A549 cells were washed with Annexin V staining buffer (10?mM HEPES pH 7.4 150?mM NaCl 5?mM KCl 1?mM MgCl2 1.8?mM CaCl2) and incubated with CF488A-Annexin V and propidium iodide (Biotium Inc. Hayward CA USA) in staining buffer for 30?min at 37?°C in the dark. Fluorescence was measured using a FACSCalibur (BD Biosciences San Jose CA USA) and the data were analyzed with CellQuest software (BD Biosciences). JC-1 staining and quantification A549 cells were cultured at 37?°C for 48?h on glass chamber slides and treated with ibuprofen and cisplatin at the specified concentrations for 48?h. Mitochondrial permeability transition was determined by staining the cells with 55?66?-tetrachloro-1133?-tetraethyl- benzimidazolylcarbocyanin iodide (JC-1; Molecular Probes Invitrogen Carlsbad CA USA) in the dark. The cells were subsequently washed with assay buffer according to the manufacturer's protocol and immediately imaged using a fluorescence microscope (Keyence Corporation Osaka Japan) with the red (?excitation: 560±40?nm band pass filter ?detection"
Lung_Cancer
"Immunostaining was performed by the streptavidin-peroxidase (S-P) method. The tissue sections were incubated with a p120ctn mouse monoclonal antibody (1?100 cat. 610134 BD Transduction Laboratories Lexington KY USA) E-cadherin rabbit monoclonal antibody (1?100 cat. SC-7870; Santa Cruz Biotechnology Santa Cruz CA USA) or vimentin rabbit monoclonal antibody (ready-to-use cat. RMA-0547 MaiXin Bio Fuzhou China) at 4°C overnight. PBS was used as a negative control. Biotinylated goat anti-mouse serum IgG or biotinylated goat anti-rabbit serum IgG (ready-to-use cat. KIT-9922 MaiXin Bio) was used as the secondary antibody. After washing the sections were incubated with streptavidin“biotin conjugated with horseradish peroxidase (Ultrasensitive MaiXin Bio) and then the peroxidase reaction was developed with 33-diaminobenzidine tetrahydrochloride (MaiXin Bio). Light counterstaining was performed with hematoxylin and then the sections were dehydrated in alcohol before being mounted. Two investigators independently examined all the tumor slides. Five random fields were examined per slide and 100 cells were observed per high magnification field (400—). The percentage of positive cells was scored as follows: 0?=?no staining; 1+?=?0“25%; 2+?=?26“50%; 3+?=?51“75%; and 4+?=?76“100%. The staining intensity was scored as follows: 0?=?no staining; 1?=?light yellow granules; 2?=?dark yellow or brown granules. The labeling score defined by multiplying the percentage of positive cells by the staining intensity was the final score for the section. When the total score was ?3 the case was defined as positive. When the total score was <3 the case was defined as negative. For scores greater than 3 points when more than 30% of the tumor cells stained strongly and continuously for p120ctn signal on the cell membrane the sample was defined as membrane positive. When fewer than 30% of the tumor cells displayed membrane expression but stained strongly and continuously for p120ctn in the cytoplasm the sample was defined as cytoplasm positive. Western blot analysis Fifty micrograms of proteins were separated by SDS-PAGE (10%). After transfer to a polyvinylidene fluoride (PVDF) membrane (Millipore Billerica MA USA) the proteins were incubated overnight at 4°C with antibodies to the following: p120ctn (1?500 cat. 610134) E-cadherin (1?300 cat. 610181) N-cadherin (1?1000 cat. 610920) (BD Transduction Laboratories Lexington KY USA) vimentin (1?1000 cat. 5741) snail (1?500 cat. 3879) (Cell Signaling Technology Boston MA USA) and twist (1?200 cat. sc-15193 Santa Cruz Biotechnology). After incubation with anti-mouse (1?2000 E030110-01) or anti-rabbit (1?2000 E030120-01) IgG (EarthOx LLC San Francisco CA USA) at 37°C for 2 h the protein bands were visualized using enhanced chemiluminescence (ECL Thermo Fisher Scientific Waltham MA USA) and quantified using BioImaging Systems (UVP Upland CA USA). Relative protein levels were calculated in reference to GAPDH as the loading control. Immunofluorescent staining Cells grown on glass coverslips were fixed with ice-cold 4% paraformaldehyde for 15 min followed by permeabilization with 0.2% Triton X-100 and incubation with normal goat serum for 30 min at 37°C. Cells were then incubated overnight with p120ctn mouse monoclonal antibody (1?200 cat. 610134; BD Transduction Laboratories Lexington KY USA) and E-cadherin rabbit polyclonal antibody (1?100 SC-7870; Santa Cruz Biotechnology). Primary antibodies were applied overnight at 4°C followed by incubation with a rhodamine/fluorescein-5-isothiocyanate (FITC)-labeled secondary antibody goat anti-mouse or TRITC-labeled goat anti-rabbit IgG (1?100 cat. E031210-01 and E031320-01 EarthOx San Francisco CA USA). The nuclei were counterstained with propidium iodide/4 6 diamidino-2-phenylin-dole. Epifluorescent microscopy was performed using an inverted Nikon TE300 microscope (Melville NY USA) and confocal microscopy was performed using a Radiance 2000 laser scanning confocal microscope (Carl Zeiss Thornwood NY USA). Matrigel cell invasion assay Matrigel cell invasion assays were performed according to the manufacturer's instructions (Corning Acton MA USA). A 100-?l cell suspension (5—105 cells) was added to the upper chamber while the lower chamber was filled with RPMI 1640 medium containing 10% fetal calf serum. Each upper and lower chamber was separated by a 8-?m porous polycarbonate membrane. The cells were incubated for 24 h at 37°C in a humid atmosphere with 5% CO2. After the medium was discarded the cells were fixed with methanol for 30 min and stained with hematoxylin (Sigma). For each filter the numbers of cells that invaded to the lower surface of the porous membrane in five different fields of 400— magnification were counted randomly using a Nikon E200 microscope. The mean was calculated from data obtained from each experiment repeated three times. Statistical analysis All statistical analyses were performed using SPSS 17.0 (SPSS Inc. Chicago IL USA) for Windows software. The chi-square test was used to analyze immunohistochemistry data. The independent samples T test was used to examine transwell experimental data. P values<0.05 were considered statistically significant. Results Membrane expression of p120ctn positively correlates with E-cadherin expression and negatively correlates with vimentin expression and lymph node metastasis Normal bronchial epithelial tissues showed p120ctn in the membrane (A) while the proportion of lung cancer tissues expressing p120ctn in the membrane was significantly lower (35% 27/78) than that with p120ctn cytoplasmic expression (65% 51/78). E-cadherin was expressed in the membrane in normal bronchial epithelium tissues (A) while the rate of positive expression was decreased (28% 22/78) and that of negative expression was significantly increased (72% 56/78) for E-cadherin in lung cancer tissues. Vimentin was negatively expressed in normal bronchial epithelial tissues (A) while the rate of positive expression was increased to 32% (25/78) in the lung cancer tissue. It appears lung cancer tissues with cytoplasmic/nuclear localization of p120ctn tended to express vimentin in comparison with those with the membranous localization (41.2% [21/51] versus 14.8 [4/27]).. Cytoplasmic/nuclear localization of p120ctn showed increased lymph node metastasis (29/51) in comparison with the membranous localization (8/27). Statistical analysis showed that the localization of p120ctn was closely related with E-cadherin expression vimentin expression and lymph node metastasis (P<0.05) (). In other words p120ctn membrane expression was positively correlated with E-cadherin expression and negatively correlated with vimentin expression and lymph node metastasis (B); meanwhile p120ctn cytoplasmic expression was negatively correlated with E-cadherin expression and positively correlated with vimentin expression and lymph node metastasis (C). .0088064.g001 Immunohistochemical analysis of p120ctn E-cadherin and vimentin localization in NSCLC. (A) E-cadherin and p120ctn were membrane positive and vimentin was negative in normal bronchial epithelial cells. "
Lung_Cancer
"non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK peptide vaccine CTL clone lung cancer Introduction Lung cancer is one of the main causes of cancer-related mortality. Approximately 85% of lung cancers are diagnosed as non-small cell lung cancer (NSCLC) and the overall survival (OS) rate for advanced NSCLC is poor. The 5-year survival rate is 5% for stage IIIb NSCLC and <1% for stage IV NSCLC (1). Treatment for NCSLC is determined by the patient™s clinical and tumor characteristics performance status (PS) the histological subtype and tumor genotype/phenotype. Recently there have been many studies concerning agents that target molecular changes such as mutations in the epidermal growth factor receptor (EGFR) and the fusion oncogene EML4-ALK in which the echinoderm microtubule-associated protein-like 4 (EML4) is fused with the intracellular domain of anaplastic kinase (ALK) (2“4). Although significant advances have been made in the treatment of NSCLC using molecular targeted therapies such as erlotinib and crizotinib the median OS for patients with advanced NSCLC remains low (56) and acquired resistance to target agents is a major clinical problem. Therefore the development of novel therapies is needed (7). Immunotherapy manipulates the immune system to control and eradicate cancer. Many recent studies provide evidence suggesting that immunotherapeutic manipulations are viable in many tumor types including lung cancer. Numerous trials of peptide vaccines autologous cellular therapy T cell-directed antibody therapy and monoclonal antibody therapy for lung cancer have been carried out around the world (8“10) and some of them have shown favorable results (11“13). The EML4-ALK fusion gene was identified in NSCLC patients by a team led by Professor H. Mano. This fusion gene was formed as the result of a small inversion within the short arm of chromosome 2 that joins differing portions of the EML4 gene with a portion of the ALK gene (1415). As a result of this fusion constant dimerization of the kinase domain of ALK is induced and its catalytic activity increases consequently. The EML4-ALK fusion gene is mainly identified in young never/former light smokers with NSCLC (16). It is estimated that approximately 5% of all NSCLC cases have this fusion gene. A few reports have also identified EML4-ALK in other cancers namely breast cancer and colorectal cancer (1718). For the most part the EML4-ALK fusion gene and other mutations such as those in EGFR and KRAS are mutually exclusive (19). The chromosomal inversion does not always occur in the same location and multiple EML4-ALK variants have been identified (19). At least 11 variants have been reported. The most common variants are E13;A20 (variant 1) and E6a/b;A20 (variant 3a/b) which have been detected in 33% and 29% of NSCLC patients respectively (14). PF-02341066 (crizotinib) is an ALK inhibitor currently under clinical development. Kwak et al conducted an open-label multi-center two-part phase I trial and found a remarkable 57% overall response rate and a 72% 6-month progression-free survival rate (20). In spite of the marked antitumor activity of crizotinib ALK-positive cancers invariably gain resistance to crizotinib. In the case of ALK-positive cancers as well as EGFR-mutant lung cancer resistance develops on average within the first 2 years of therapy (21). The main resistance mutations are L1196M a gatekeeper mutation and C1156M. In addition to ALK mutations other known mechanisms for acquired resistance include ALK amplification (2122) and EGFR activation (2324). To overcome resistance new ALK inhibitors are currently in early phase studies (25). Novel combinatorial strategies to overcome crizotinib resistance and further improve the clinical outcome are needed. We focused on this new fusion array as a novel target of immunotherapy. There are several methods to detect EML4-ALK NSCLC including polymerase chain reaction (PCR) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) (19). These methods detect high-level EML4-ALK fusion gene expression. Passoni et al identified two HLA-A*02:01-restricted ALK-derived peptides that induce peptide-specific CTL lines (26). We focused on the EML4 array as a novel epitope of immunotherapy. We identified a candidate 9- or 10-amino acid array of novel epitopes using the Bioinformatics and Molecular Analysis Section (BIMAS) software and analyzed its potential as a new immunotherapy epitope with respect to its ability to induce anticancer activity. We then induced and generated a peptide-specific CTL clone from peripheral blood lymphocytes of HLA-A*02:01-positive healthy donors. We report here that an EML4-ALK-derived peptide-specific human CTL clone recognized peptide-pulsed T2 cells and HLA-A*02:01-positive and EML4-ALK-positive tumor cells pretreated with IFN-?. Furthermore we showed that immunotherapy with this novel epitope peptide has potential for treatment of EML4-ALK-positive NSCLC. Materials and methods Peptides Human EML4-ALK-derived peptides carrying binding motifs for HLA-A*02:01-/HLA-A*24:02-encoded molecules were identified by HLA-peptide binding predictions using the BIMAS program (http://bimas.dcrt.nih.gov/molbio/hla_bind/index.html). We purchased a total of seven EML4-ALK-derived peptides carrying HLA-A*02:01 binding motifs and two peptides carrying HLA-A*24:02 binding motifs from Geneworld (Tokyo Japan). Cell lines The H2228 human lung adenocarcinoma cell line and EML4-ALK fusion protein variant 3 (E6; A20) were kindly provided by Professor S. Yano (Kanazawa University). T2 is a lymphoblastoid cell line that lacks TAP function and has HLA-A*02:01 molecules that can easily be loaded with exogenous peptides. T2A24 is the same cell line but with HLA-A*24:02 instead. T2 and T2A24 cells were cultured in RPMI medium supplemented with 10% heat-inactivated FBS. HLA-A*02:01/HLA-A*24:02 binding assay In order to determine the binding ability of the predicted peptides to HLA-A*02:01/HLA-A*24:02 molecules an in vitro cellular binding assay was performed as reported previously (27). Briefly after incubation of the T2/T2A24 cells in culture medium at 26°C for 18 h cells were washed with PBS and suspended in 1 ml Opti-MEM (Invitrogen Carlsbad CA USA) with or without 100 ?g peptide and then incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS HLA-A*02:01/HLA-A*24:02 expression was measured by flow cytometry using a FITC-conjugated and HLA-A*02:01-/HLA-A*24:02-specific monoclonal antibody (mAb) and the mean fluorescence intensity was recorded. Generation of dendritic cells CD14+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using human CD14 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). Immature dendritic cells (DCs) were generated from CD14+ cells using interleukin (IL)-4 (10 ng/ml; PeproTech Inc. Rocky Hill NJ USA) and granulocyte-macrophage colony-stimulating factor (GM-CSF; 10 ng/ml; PeproTech) in RPMI-1640 medium supplemented with 10% FBS. Maturation of DCs was induced by prostaglandin E2 (PGE2; 1 ?g/ml; Sigma St. Louis MO USA) and tumor necrosis factor (TNF-)-? (10 ng/ml; PeproTech). Induction of EML4-ALK-derived peptide-specific CTLs from PBMCs CD8+ cells were isolated from PBMCs using human CD8 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). CD8+ cells (2×106) were stimulated by peptide-pulsed irradiated autologous mature DCs (1×105). Autologous DCs were prepared from a limited supply; artificial antigen presenting cells (aAPCs) (K562/A2 or A24/CD80/CD83) were alternatively used for further examination. After 1 week these cells were stimulated twice per week by peptide-pulsed irradiated artificial APC-A2 or artificial APC-A24 cells (1×105). Supplementation with 10 IU/ml IL-2 (Proleukin; Novartis Pharmaceuticals Basel Switzerland) and 10 ng/ml IL-15 (PeproTech) was performed every 3 to 4 days between stimulations (28). IFN-? ELISPOT assay Specific secretion of IFN-? from human CTLs in response to stimulator cells was assayed using the IFN-? ELISPOT kit (BD Biosciences) according to the manufacturer™s instructions. Stimulator cells were pulsed with peptide for 2 h at room temperature and then washed. Responder cells were incubated with stimulator cells for 20 h. The resulting spots were counted using an ELIPHOTO counter (Minerva Tech Tokyo Japan). HIV-gag (77“85) (SLYNTYATL) was used as an irrelevant peptide in the CTL assay. Generation of CTL clones Cultured cells were incubated with peptide-pulsed T2/T2A24 cells at a ratio of 2:1 for 3.5 h at 37°C. CD107a-specific antibodies (BioLegend San Diego CA USA) were included in the mixture during the incubation period. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter (BD Biosciences). Sorted CTLs were stimulated and the CTL clones were established as described previously (29). Flow cytometry H2228 cells with or without pretreatment with 100 U/ml IFN-? (PeproTech) for 48 h were harvested and stained with anti-HLA-A2 Ab-FITC (MBL Japan) and analyzed using a FACSCanto II flow cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo software. Cytotoxicity assay The cytotoxic capacity was analyzed using the Terascan VPC system (Minerva Tech Tokyo). The CTL clone was used as the effector cell type. Target cells treated with 100 U/ml IFN-? (PeproTech) 42 h previously were labeled through incubation in calcein-AM solution for 30 min at 37°C. The labeled cells (1×104) were then co-cultured with the effector cells for 4“6 h. Fluorescence intensity was measured before and after the culture period and specific cytotoxic activity was calculated as described previously (29). HLA-A*02:01 blocking of T-cell activity was tested by pre-incubating the target cells with anti-HLA-A -B -C mAb (W6/32) or an isotype control mAb (mIgG2a?; BioLegend San Diego CA USA). Results Identification of HLA-A*02:01-/HLA-A*24:02-restricted EML4-ALK-derived peptides As candidate EML4-ALK- derived and HLA-A*02:01-/HLA-A*24:02-restricted CTL epitopes we selected nine peptides with highly predicted scores for HLA-A*02:01/HLA-A*24:02 binding calculated using BIMAS software (Tables I and II) and evaluated their ability to bind to HLA-A*02:01/HLA-A*24:02 molecules. All nine peptides were able to bind HLA-A*02:01/HLA-A*24:02 molecules (Fig. 1). Generation of an EML4-ALK-derived peptide-specific CTL clone from human PBMCs We next assessed the capacity of EML4-ALK-derived peptides to generate peptide-specific CTLs in vitro from human PBMCs of HLA-A*02:01/HLA-A*24:02 healthy donors. CTLs were induced by three stimulations with DCs or artificial APCs loaded with the EML4-ALK-derived peptides. CTLs were tested for specificity for each peptide using the IFN-? ELISPOT assay. Peptides A B and C could induce peptide-specific CTLs that were able to specifically recognize T2 cells pulsed with each peptide but not T2 cells without peptides (Fig. 2). Peptides B and C were able to induce CTLs from only one donor (healthy donor 3 for peptide B and healthy donor 4 for peptide C) but peptide A was able to induce CTLs in three of four donors (healthy donors 2 3 and 4). Based on this result we used peptide A for further examinations. Next we obtained one CTL clone from peptide A-specific CTLs that was able to specifically recognize T2 cells pulsed with peptide A but not T2 cells pulsed with an irrelevant HIV-gag peptide using single cell sorting with a CD107a antibody. The population of CD8+CD107a+ cells represented 0.984% of all stimulated cells (Fig. 3A). These cells were sorted as single cells in each well of a 96-well plate. "
Lung_Cancer
"Identifiability and constraints The tensor product structure of the cross-basis defined in (5)“(7) poses some identifiability issues. In particular each of the vx basis variables in R is multiplied by each of the v? basis variables in C. If an intercept is included in f(x) the related matrix of cross-basis variables W is not of full rank and the parameters of the regression model are not identifiable even when a common intercept is not included. Therefore the cross-basis in (7) should always be defined without an intercept in the basis functions for x. Also these basis functions can be centered on a specific exposure value x0 which will represent the reference for the risk summaries computed by (8)“(10). The bidimensional shape of the exposure“lag“response can be constrained to follow a prespecified pattern. In particular a priori assumptions on the lag structure can be imposed through functional constraints on the basis for the space of ?. Left and right constraints on the extremes of the supporting interval ?0“L are particularly meaningful for smooth functions. A left constraint can be imposed by excluding the intercept from the basis. This step will force the lag“response curve to predict a null risk at the beginning of the lag period. A right constraint on a B-splines basis can be produced by excluding specific basis variables as previously described for linear exposure“response relationships 17. The constraint produces a smooth dependency which approaches a null risk at the end of the lag period. Such constraints are particularly useful in the presence of sparse data in order to limit the flexibility of the model under specific assumptions about the lag“response curve. However biases can be introduced if these assumptions are not met. Additional information is provided in Section D1 of the supporting information. The functional constraints discussed in this section can be specified without introducing customized optimization methods for estimating the parameters ? in (3)“(7). More sophisticated methods are required for example to constrain the lag“response curve to be non-negative in the whole lag period L. These approaches have been previously proposed for linear dependencies 141718 and introduce further complexities in the bidimensional context of DLNMs. This development is not pursued here. 2.5. Model selection and inferential procedures The framework described in Sections 2.1“2.2 includes a fairly large number of models defined by different functions for each of the two dimensions and by different choices regarding each function such as number and location of knots in splines. This raises the issue of selecting the optimal model for describing the exposure“lag“response association. Previous studies on temporal dependencies have proposed selection procedures on the basis of profile likelihood 15 AIC 141620 or BIC 17. Simulation studies seems to indicate a better performance of AIC when compared with BIC in this context 18 a result consistent with unpublished simulations performed on time series data for DLNMs. Inference on the models illustrated in the previous sections primarily focuses on the specification of confidence intervals for the risk measures in Section 2.3 and on the definition of tests for a set of null hypotheses. Confidence intervals for lag“response curves exposure“response curves and cumulative risks obtained through and can be easily derived from the diagonal of the related (co)variance matrices in (8)“(10) assuming a multivariate normal distribution of the estimators. Regarding hypothesis testing two null hypotheses are particularly relevant in this framework. The first one postulates a linear exposure“response relationship namely H0 : f(x) = x. The second one assumes a constant risk namely H0 : w(?) = c. Tests on constrained models can be also defined. The assumption of independency is not easily tested as the form in (4) cannot be expressed as a model linear in its parameters. However defining general inferential procedures in this setting is not straightforward. First the null hypotheses H0 : f(x) = x and H0 : w(?) = c are not independent and an incorrect assumption about the association in one dimension may bias the test estimator for the hypothesis related to the other space as previously reported 19. In addition estimates are usually conditional on a posteriori selection of a best-fitting model based on the selection methods discussed before. Under these conditions the estimators for the (co)variance matrices in (8)“(10) are likely to underestimate the true sampling (co)variance and the distribution of the test statistics may be different from that assumed unconditional on the selection procedure. This may generate undercoverage of confidence intervals and inflated type I error for tests 1727. Given these complexities a general framework for hypothesis testing embedded in the model selection procedure is not provided here. An assessment through simulations of the performance of estimators generated by AIC and BIC-selected models will be presented in. Specifically simulations will provide an empirical evaluation of the ability of the information criteria to identify the correct model between those defining the null or alternative hypotheses about linearity and constant effects and measures of performance such as bias coverage and root mean square error. 3. An application The conceptual and statistical framework of DLNMs described in extended beyond time series data is general and applicable in different study designs. As an illustrative example I propose here an application in survival analysis of time-to-event data. This represents one of the most complex settings as the temporal pattern of risk is produced by exposure histories that vary during the follow-up of each subject. Specifically the methodology is used to investigate the association between occupational exposure to radon and mortality for lung cancer. The analysis is based on data from the Colorado Plateau uranium miners cohort already used in previous methodological contributions 121520. Section A of the supporting information provides a list of the main steps to replicate the analysis in other real-life examples. 3.1. Data The cohort data used in this example were collected by the National Institute for Occupational Safety and Health. Detailed information on the cohort is given elsewhere 12. Briefly subjects were eligible to enter the cohort if they worked in mines within the Colorado Plateau area between 1950 and 1960 and provided demographic personal and occupational information during their working period. Vital status and cause of death were ascertained by linkage with different sources. The data used in this example refer to the follow-up of the cohort on December 311982 including 3347 subjects and 258 lung cancer deaths. Exposure data available in the data set include cumulative measures of radon and smoking in 5-year age intervals. The radon exposure history for each subject expressed in working-level months (WLM) was reconstructed by linking employment information with measured or predicted levels in each mine in each year. The smoking history expressed in the number of cigarettes packs — 100 was reported by each subject during his working period and assumed constant after the last reporting age. A summary of the data is provided in Table I. Table I Descriptive statistics of the Colorado Plateau uranium miners cohort. The data included here refer to the follow-up on December 31 1982. Exposure to radon is measured in working level months (WLM) while smoking is reported as packs of cigarettes/100 Full cohort Lung cancer cases N % N % Subjects 3347 100.0 258 7.7 Deaths (%) 1258 37.6 258 100.0 Ever smokers (%) 2656 79.4 238 92.2 Median Min 25th 75th Max Median Min 25th 75th Max Age at entry 34.0 15.8 25.8 44.0 80.0 41.6 18.6 34.3 48.0 63.9 Follow-up time (years) 23.9 0.1 19.6 25.5 32.5 18.3 0.3 12.9 22.0 30.8 Exposure to radon Exposure period (years) 6.7 0.1 2.7 11.8 53.0 12.8 0.1 7.8 17.6 39.5 Total cumulative exposure (WLM/year) 429.0 0.0 153.5 1016.8 10000.0 1231.9 8.0 553.7 2528.6 10000.0 Yearly exposure (WLM/year) All 60.2 0.1 26.7 122.2 3245.3 81.6 1.0 42.3 165.4 1295.7 Lag 0“9 52.4 0.1 23.8 102.5 2994.0 61.4 3.9 31.3 144.7 1110.8 Lag 10“19 53.8 0.1 24.3 112.5 3245.3 78.3 1.0 42.9 164.0 1295.7 Lag 20“29 74.0 0.1 33.0 141.7 3245.3 104.7 4.1 52.2 180.0 1295.7 Lag 30“40 95.7 0.2 48.0 151.6 2994.0 104.7 5.5 60.0 175.3 860.2 Smoking Exposure period (years) 38.0 5.0 31.0 46.0 75.0 40.0 14.0 33.0 48.0 72.0 Total cumulative exposure (packs — 100) 131.6 0.4 94.5 174.5 676.3 147.4 21.8 109.5 188.1 567.2 Yearly exposure (packs — 100) 3.6 0.0 2.5 3.6 24.4 3.6 0.0 3.5 4.2 13.4 3.2. Modeling strategy For this illustrative example the analysis is performed through a Cox proportional-hazard model with time-varying covariates by using age as the time axis. Effect measures are reported as a hazard ratio (HR). The model is represented by the following: (11) where the log-hazard log [h(t)] is expressed as a sum of baseline log-hazard log [h0(t)] and contributions of additional covariates. These comprise cross-basis functions sx(xt) and sz(zt) for radon and smoking respectively as defined in (1)“(7) and a linear term for calendar time u in order to control for secular trends in lung cancer risk not accounted for by the delayed effects of the two exposures."
Lung_Cancer
"ne 78-diol 910-epoxide (BPDE) which involved in inducing DNA adducts and thus made a predisposition to lung adenocarcinoma [32]“[34]. Besides the method of cooking and throat or eyes irritation the interviewers also asked each woman the information on cooking oil fumes exposure such as the types of cooking oils she used the frequency she used stir frying or deep frying to prepare food ventilation conditions and the use of a fume extractor. Increasing epidemiological studies have reported cooking method and types of cooking oils on lung cancer susceptibility among Chinese females. Seow et al.[35]found that women who reported that they stir fried daily had a significantly increased risk of lung cancer (OR?=?2.0 95%CI 1.0“3.8) and risk was enhanced for those who stir fried meat daily (OR?=?2.7 95%CI 1.3“5.5). The elevated lung cancer risk might be attributed to heterocyclic amines generated during frying of meats. In addition the frequency of stir frying seemed to be related with lung cancer susceptibility. Gao et al. [36]investigated the association between the frequency of stir frying and lung cancer risk in Chinese females they observed that stir frying more than 30 dishes per week was associated with high risk of lung cancer (OR?=?2.6 95%CI 1.3“5.0). In a case-control study in northeast China Wu-Williams et al.[37] found that women who deep fried twice per month had a 2.1-fold increased risk of developing lung cancer than those who never used deep frying method. And there was a significant trend in risk with increasing number of meals cooked by deep frying. Also this kind of correlation was found in both non-smokers and lung adenocarcinoma population. For types of cooking oils Zhong et al.[38] reported that soybean oil was most commonly used in Shanghai and the use of rapeseed oil was associated with a higher risk of lung cancer (OR?=?1.84 95%CI 1.12“3.03). In this study we observed that ATM rs189037 AA genotype carriers were more susceptible to lung adenocarcinoma than GA or GG genotype carriers in a recessive model. This might not give direct support for AA genotype as a risk factor for lung adenocarcinoma. But the results reflected that G allele might be a protective factor for lung adenocarcinoma. So we compared AA genotype with GA genotype and our data showed that women who were AA genotype carriers had an elevated risk of lung adenocarcinoma (OR?=?1.74 95%CI 1.10“2.74 P?=?0.018). In other words GA genotype might be protective for developing lung adenocarcinoma. In the stratified analysis of cooking oil fumes exposure we also found that AA genotype carriers had a predisposition to lung adenocarcinoma in women who had no exposure of cooking oil fumes (OR?=?1.89 95%CI 1.03“3.49). Considering that G allele might be a protective factor for lung adenocarcinoma we then compared AA genotype with GA genotype to further validate our previous results. And it turned out that in the non-exposed group women who were AA genotype carriers had a higher risk of lung adenocarcinoma than those GA genotype carriers (OR?=?1.98 95%CI 1.15“3.40 P?=?0.014) which was in accordance with our previous data that G allele might be a protective factor for lung adenocarcinoma. But in the combined analysis of interaction of cooking oil fumes exposure and rs189037 polymorphism no significant association was found. We have described the distribution of any possible factors such as age passive smoking status fuel smoke exposure family history of cancer between cooking oil fumes exposed group and non-exposed group that might affect the association but none of these seemed to be different between exposed group and non-exposed group (). As tumor is a multifactorial disease we could infer that there might be other risk factors playing a role in the development of lung adenocarcinoma. We tended to believe that there might be other host genetic susceptibility or unknown risk factors caused the results. .0096911.t005 Comparisons of distribution of risk factors between cooking oil fumes exposed group and non-exposed group. Variable Exposed(%) Non-exposed(%) P value Mean age (±S.D.) 56.3±11.7 56.1±11.1 0.871a Fuel smoke exposure 44(28.2%) 98(27.0%) 0.777b Passive smoking exposure 96(61.5%) 203(55.9%) 0.235b Family history of cancer 19(12.2%) 37(10.2%) 0.504b a Student's t-test was used to compare the frequency distribution of demographic variables between the exposed group and non-exposed group. b Peason's chi square was used to compare the frequency distribution of demographic variables fuel smoke exposure family history of cancer passive smoking between the exposed group and non-exposed group. There are several limitations in the current study. First hospital-based studies are likely to include some controls with non-malignant lung diseases especially those associated with chronic inflammatory processes are suspected to have predisposing factors for lung cancer. The ORs we found may be underestimated. Second the statistical power of the study may be limited by the relatively small sample size of subjects. In addition other SNPs in ATM gene and in this pathway may be involved in the risk of lung adenocarcinoma gene-gene interaction and haplotypes may offer more clues to clarity the association between host genetic susceptibility and lung adenocarcinoma risk. But it is noteworthy that our study investigated the association between ATM rs189037 polymorphism and lung adenocarcinoma risk in a non-smoking females population for the first time. Meanwhile we explored the combined effects of cooking oil fumes exposure and ATM rs189037 polymorphism on lung adenocarcinoma risk. As our small sample size and only one SNP genotyped large-scale studies with gene-gene and gene-environment interactions in different races and population are required to validate our findings. Conclusions In summary this hospital-based case-control study showed that ATM rs189037 might be associated with the risk of lung adenocarcinoma in Chinese non-smoking females. Furthermore ATM rs189037 AA genotype might be a risk factor affecting lung adenocarcinoma among females without cooking oil fume exposure. References 1 MattsonME PollackES CullenJW (1987) What are the odds that smoking will kill you?American journal of public health77: 425“4313826460 2 WeiQ ChengL HongWK SpitzMR (1996) Reduced DNA repair capacity in lung cancer patients. Cancer Res56: 4103“41078797573 3 SpitzMR WeiQ DongQ AmosCI WuX (2003) Genetic susceptibility to lung cancer: the role of DNA damage and repair. Cancer Epidemiol Biomarkers Prev12: 689“69812917198 4 KurzEU Lees-MillerSP (2004) DNA damage-induced activation of ATM and ATM-dependent signaling pathways. DNA Repair (Amst)3: 889“90015279774 5 PetriniJH StrackerTH (2003) The cellular response to DNA double-strand breaks: defining the sensors and mediators. Trends Cell Biol13: 458“46212946624 6 LavinMF KozlovS (2007) ATM activation and DNA damage response. Cell Cycle6: 931“94217457059 7 SavitskyK Bar-ShiraA GiladS RotmanG ZivY et al (1995) A single ataxia telangiectasia gene with a product similar to PI-3 kinase. Science268: 1749“17537792600 8 KastanMB LimDS (2000) The many substrates and functions of ATM. Nat Rev Mol Cell Biol1: 179“18611252893 9 KastanMB BartekJ (2004) Cell-cycle checkpoints and cancer. Nature432: 316“32315549093 10 TaulanM LopezE GuittardC ReneC BauxD et al (2007) First functional polymorphism in CFTR promoter that results in decreased transcriptional activity and Sp1/USF binding. Biochem Biophys Res Commun361: 775“78117678620 11 SchultzJ LorenzP IbrahimSM KundtG GrossG et al (2009) The functional -443T/C osteopontin promoter polymorphism influences osteopontin gene expression in melanoma cells via binding of c-Myb transcription factor. Mol Carcinog48: 14“2318459127 12 MenzaghiC ParoniG De BonisC SoccioT MarucciA et al (2006) The -318 C>G single-nucleotide polymorphism in GNAI2 gene promoter region impairs transcriptional activity through specific binding of Sp1 transcription factor and is associated with high blood pressure in Caucasians from Italy. J Am Soc Nephrol17: S115“11916565233 13 FreyUH HaunerH JockelKH MantheyI BrockmeyerN et al (2008) A novel promoter polymorphism in the human gene GNAS affects binding of transcription factor upstream stimulatory factor 1 Galphas protein expression and body weight regulation. Pharmacogenet Genomics18: 141“15118192900 14 GiladS ChessaL KhosraviR RussellP GalantyY et al (1998) Genotype-phenotype relationships in ataxia-telangiectasia and variants. Am J Hum Genet62: 551“5619497252 15 TeraokaSN TelatarM Becker-CataniaS LiangT OnengutS et al (1999) Splicing defects in the ataxia-telangiectasia gene ATM: underlying mutations and consequences. Am J Hum Genet64: 1617“163110330348 16 ZhangL YangM BiN FangM SunT et al (2010) ATM polymorphisms are associated with risk of radiation-induced pneumonitis. Int J Radiat Oncol Biol Phys77: 1360“136820171797 17 XuL MorariEC WeiQ SturgisEM WardLS (2012) Functional variations in the ATM gene and susceptibility to differentiated thyroid carcinoma. J Clin Endocrinol Metab97: 1913“192122438227 18 BauD-T ChangC-H TsaiM-H ChiuC-F TsouY-A et al (2010) Association Between DNA Repair Gene ATM Polymorphisms and Oral Cancer Susceptibility. Laryngoscope120: 2417“242221108427 19 WangH-C ChangW-S TsaiR-Y TsaiC-W LiuL-C et al (2010) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Breast Cancer in Taiwanese Females. Anticancer Research30: 5217“522121187516 20 WangC-H WuK-H YangY-L PengC-T TsaiF-J et al (2011) Association between Ataxia Telangiectasia Mutated Gene Polymorphisms and Childhood Leukemia in Taiwan. Chinese Journal of Physiology54: 413“41822229509 21 WangHM ShiYS LiQS LiuY ZhengXK (2011) [Association between single nucleotide polymorphism locus rs189037 in the promoter of ATM gene and nasopharyngeal carcinoma susceptibility in Cantonese]. Nan Fang Yi Ke Da Xue Xue Bao31: 1863“186622126766 22 ZhaoP ZouP ZhaoL YanW KangC et al (2013) Genetic polymorphisms of DNA double-strand break repair pathway genes and glioma susceptibility. BMC Cancer13: 23423663450 23 LoYL HsiaoCF JouYS ChangGC TsaiYH et al (2010) ATM polymorphisms and risk of lung cancer among never smokers. Lung Cancer69: 148“15420004998 24 HsiaTC TsaiCW LiangSJ ChangWS LinLY et al (2013) Effects of ataxia telangiectasia mutated (ATM) genotypes and smoking habits on lung cancer risk in Taiwan. Anticancer Res33: 4067“407124023351 25 KimJH KimH LeeKY ChoeKH RyuJS et al (2006) Genetic polymorphisms of ataxia telangiectasia mutated affect lung cancer risk. Hum Mol Genet15: 1181“118616497724 26 BelaniCP MartsS SchillerJ SocinskiMA (2007) Women and lung cancer: epidemiology tumor biology and emerging trends in clinical research. Lung Cancer55: 15“2317084482 27 ThomasL DoyleLA EdelmanMJ (2005) Lung cancer in women: emerging differences in epidemiology biology and therapy. Chest128: 370“38116002959 28 ZangEA WynderEL (1996) Differences in lung cancer risk between men and women: examination of the evidence. J Natl Cancer Inst88: 183“1928632492 29 ShiH HeQ DaiX ZhouB (2005) [Study on risk factors of lung cancer in non-smoking women]. Zhongguo Fei Ai Za Zhi8: 279“28221108882 30 KoYC ChengLS LeeCH HuangJJ HuangMS et al (2000) Chinese food cooking and lung cancer in women nonsmokers. Am J Epidemiol151: 140“14710645816 31 ChenT DongB LuZ TianB ZhangJ et al (2010) A functional single nucleotide polymorphism in promoter of ATM is associated with longevity. Mech Ageing Dev131: 636“64020816691 32 ChiangTA WuPF KoYC (1999) Identification of carcinogens in cooking oil fumes. Environ Res81: 18“2210361022 33 ChenH YangM YeS (1992) A study on genotoxicity of cooking fumes from rapeseed oil. Biomed Environ Sci5: 229“2351449658 34 YangSC JenqSN KangZC LeeH (2000) Identification of benzo[a]pyrene 78-diol 910-epoxide N2-deoxyguanosine in human lung adenocarcinoma cells exposed to cooking oil fumes from frying fish under domestic conditions. Chem Res Toxicol13: 1046“105011080053 35 SeowA PohWT TehM EngP WangYT et al (2000) Fumes from meat cooking and lung cancer risk in Chinese women. Cancer Epidemiol Biomarkers Prev9: 1215“122111097230 36 GaoYT BlotWJ ZhengW ErshowAG HsuCW et al (1987) Lung cancer among Chinese women. International Journal of Cancer40: 604“609 37 Wu-WilliamsAH DaiXD BlotW XuZY SunXW et al (1990) Lung cancer among women in north-east China. Br J Cancer62: 982“9872257230 38 ZhongL GoldbergMS GaoYT JinF (1999) Lung cancer and indoor air pollution arising from Chinese-style cooking among nonsmoking women living in Shanghai China. Epidemiology (Cambridge Mass)10: 488“494 PLoS One PLoS ONE plos plosone PLoS ONE 1932-6203 Public Library of Science San Francisco USA 24586842 3934888 PONE-D-13-30257 .0089518 Research Article Biology Genetics Genetic mutation Mutation types Cancer genetics Medicine Clinical research design Retrospective studies Diagnostic medicine Pathology Clinical pathology Test evaluation Oncology Cancer detection and diagnosis Cancer screening Cancer treatment Chemotherapy and drug treatment Clinical trials (cancer treatment) Cancers and neoplasms Lung and intrathoracic tumors Non-small cell lung cancer Oncology agents Clinical Validation of a PCR Assay for the Detection of EGFR Mutations in Non“Small-Cell Lung Cancer: Retrospective Testing of Specimens from the EURTAC Trial EGFR Mutation Testing in NSCLC in EURTAC Trial Benlloch Susana 1 * Botero Maria Luisa 1 Beltran-Alamillo Jordi 1 Mayo Clara 1 Gimenez-Capitán Ana 1 de Aguirre Itziar 2 Queralt Cristina 2 Ramirez Jose Luis 2 Cajal Santiago Ramón y. 1 6 Klughammer Barbara 3 Schlegel Mariette 3 Bordogna Walter 3 Chen David 4 Zhang Guili 5 Kovach Barbara 5 7 Shieh Felice 5 7 Palma John F. 5 Wu Lin 5 Lawrence H. Jeffrey 5 7 Taron Miquel 1 2 1 Pangaea Biotech SL Barcelona Spain 2 Medical Oncology Service-ICO Hospital Germans Trias i Pujol Badalona Spain 3 F. Hoffmann-La Roche Basel Switzerland 4 Genentech South San Francisco California United States of America 5 Roche Molecular Systems Pleasanton California United States of America 6 Pathology Department Vall d'Hebron University Hospital Universidad Autónoma de Barcelona Barcelona Spain 7 Roche Molecular Systems Pleasanton California United States of America Minna John D. Editor Univesity of Texas Southwestern Medical Center at Dallas United States of America * E-mail: [email protected] Competing Interests: BK MS WB DC GZ JFP LW are all current employees of Roche. BK DC JFP and LW have stock holdings in Roche. BK and HJL are former Roche employees and HJL has stock in Roche and has served as a paid consultant. FS was a paid consultant to Roche. SB JBA CM AGC are current employees of Pangaea Biotech. MLB is a former Pangaea employee. MT and SRyC have stock holdings in Pangaea Biotech. IdA CQ JLR are current employees of Medical Oncology Service-ICO Hospital Germans Trias i Pujol. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: MT HJL. Performed the experiments: CM AGC JBA IdA CQ JLR. Analyzed the data: SB DC GZ CM AGC JBA IdA CQ JLR FS LW JFP HJL MT. Contributed reagents/materials/analysis tools: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. Wrote the paper: SB MLB JBA CM AGC IdA CQ JLR SRyC BK MS WB DC GZ BK FS LW JFP HJL MT. 2014 25 2 2014 9 2 e89518 23 7 2013 21 1 2014 2014 Benlloch et al This is an open-access article distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. The EURTAC trial demonstrated that the tyrosine kinase inhibitor (TKI) erlotinib was superior to chemotherapy as first-line therapy for advanc"
Lung_Cancer
"Background Although dendritic cell (DC) vaccines are considered to be promising treatments for advanced cancer their production and administration is costly and labor-intensive. We developed a novel immunotherapeutic agent that links a single-chain antibody variable fragment (scFv) targeting mesothelin (MSLN) which is overexpressed on ovarian cancer and mesothelioma cells to Mycobacterium tuberculosis (MTB) heat shock protein 70 (Hsp70) which is a potent immune activator that stimulates monocytes and DCs enhances DC aggregation and maturation and improves cross-priming of T cells mediated by DCs. Methods Binding of this fusion protein with MSLN on the surface of tumor cells was measured by flow cytometry and fluorescence microscopy. The therapeutic efficacy of this fusion protein was evaluated in syngeneic and orthotopic mouse models of papillary ovarian cancer and malignant mesothelioma. Mice received 4 intraperitoneal (i.p.) treatments with experimental or control proteins post i.p. injection of tumor cells. Ascites-free and overall survival time was measured. For the investigation of anti-tumor T-cell responses a time-matched study was performed. Splenocytes were stimulated with peptides and IFN?- or Granzyme B- generating CD3+CD8+ T cells were detected by flow cytometry. To examine the role of CD8+ T cells in the antitumor effect we performed in vivo CD8+ cell depletion. We further determined if the fusion protein increases DC maturation and improves antigen presentation as well as cross-presentation by DCs. Results We demonstrated in vitro that the scFvMTBHsp70 fusion protein bound to the tumor cells used in this study through the interaction of scFv with MSLN on the surface of these cells and induced maturation of bone marrow-derived DCs. Use of this bifunctional fusion protein in both mouse models significantly enhanced survival and slowed tumor growth while augmenting tumor-specific CD8+ T-cell dependent immune responses. We also demonstrated in vitro and in vivo that the fusion protein enhanced antigen presentation and cross-presentation by targeting tumor antigens towards DCs. Conclusions This new cancer immunotherapy has the potential to be cost-effective and broadly applicable to tumors that overexpress mesothelin. Mycobacterial Hsp70 Mesothelin Single chain variable fragment Cancer immunotherapy Murine tumor model Background The goal of cancer immunotherapy is to stimulate the immune system to destroy cancer cells. Numerous strategies that involve tumor antigen-specific and non-specific activation of the immune system have been developed. These include dendritic cell (DC) vaccines adoptive T-cell therapy and immune checkpoint blockade [1-3]. Antigen-specific active immunotherapy is expected to be the most attractive strategy because of its capacity to induce both therapeutic and protective T-cell immunity. Among various approaches DC vaccine is considered to be a promising treatment for advanced cancer based on the ability of DCs to orchestrate all of the elements of the immune system. DCs capture tumor antigens process these antigens into peptides as they move to the draining secondary lymphoid ans and present the peptides to na¯ve T cells thus inducing anti-tumor cellular immune responses. DCs can also activate B cells NK cells and NKT cells [1]. In pre-clinical and clinical studies that exploited DCs as a means to improve vaccine efficiency autologous DCs are loaded ex vivo with antigens and re-administered to the patient. For example Sipuleucel-T (Provenge) that consists of ex vivo activated autologous peripheral blood mononuclear cells (PBMCs) including antigen-presenting cells (APCs) has resulted in a significant survival benefit in Phase III trials for prostate cancer [4]. However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) derived from human B cells that targets mesothelin. Mesothelin (MSLN) is a validated immunotherapy target that is highly overexpressed on the surface of common epithelial cancers including ovarian cancers epithelial malignant mesotheliomas ductal pancreatic adenocarcinomas and lung adenocarcinomas while expressed at relatively low levels only in mesothelial cells lining the pleura pericardium and peritoneum in healthy individuals [6-9]. Several therapeutic agents targeting MSLN are evaluated in preclinical and clinical studies such as the recombinant immunotoxin SS1P [9-11]. In our fusion protein the anti-MSLN scFv moiety was originally isolated from a yeast-display human scFv library [12] and demonstrated the ability to recognize both membrane-bound and soluble MSLNs and inhibit CA125/MSLN-dependent cell adhesion [13-15]. The recombinant MTBHsp70 protein provides immunostimulatory functions including the activation of monocytes and DCs to produce CC-chemokines that attract antigen processing and presenting DCs macrophages and effector T and B cells enhanced DC aggregation and maturation [1617] induction of the cytotoxic activity of natural killer cells [18] and improved cross-priming of T cells which is dependent on DCs [19]. The capabilities of MTBHsp70 as a potent immune adjuvant have been well characterized in cancer models including murine models of melanoma and lymphoma [1820-24]. While in these studies proteins or peptides fused with Hsp70 used for immunizations in mice were shown to generate humoral or cellular immune responses we expect that fusion of anti-MSLN scFv and MTBHsp70 takes advantage of the immune-activating action of MTBHsp70 and the tumor-targeting activity of the scFv which will yield anti-tumor responses against the broadest profile of tumor antigens. We evaluated the therapeutic efficacy of this MSLN-targeted fusion protein in syngeneic mouse models of ovarian cancer and mesothelioma and examined its mechanism of action in in vitro and in vivo cross-presentation assay systems. These studies demonstrate that this bifunctional fusion protein significantly enhances survival and slows tumor growth through the augmentation of tumor-specific cell-mediated immune responses. Results Expression of scFvMTBHsp70 fusion protein and MTBHsp70 The structure of scFvMTBHsp70 is shown in Figure 1A. VH and VL from anti-MSLN P4 scFv [13] are linked using a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker in between. As shown in Figure 1B only one protein band was observed with a molecular weight of approximately 100 kDa for scFvMTBHsp70 and one protein band with a molecular weight of 70 kDa for MTBHsp70 which match the expected molecular weights of these specific proteins. Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were found to be very low at less than 50 EU per mg of protein. Structure and analysis of scFvMTBHsp70 fusion protein. A anti-MSLN VH and VL are linked with a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker. B RAPIDstain based on Coomassie dye following purification and hIgG-Fc tag removal of MTBHsp70 and scFvMTBHsp70. C BR5FVB1 ovarian cancer cells and 40L mesothelioma cells were incubated with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 (blue line) or without either protein (solid) followed by anti-MTBHsp70 (IgG2a) biotinylated anti-IgG2a and Streptavidin-APC and then analyzed by flow cytometry. To confirm that the scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml recombinant human MSLN for 30 min (red line) before being added to the cells. Data are representative of three independent experiments in duplicate tubes. D Median fluorescence intensity (MFI) values of cells stained with scFvMTBHsp70 or MTBHsp70 normalized to cells stained without either protein. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01;ns non-significant. E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Thick line with incubation of scFvMTBHsp70; solid without incubation of scFvMTBHsp70. Data are representative of three independent experiments. scFvMTBHsp70 binds to BR5FVB1 ovarian cancer cells and 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells Binding of scFvMTBHsp70 or MTBHsp70 to BR5FVB1 ovarian cancer cells or 40L mesothelioma cells as determined by flow cytometry is shown in Figure 1C and D. Binding of scFvMTBHsp70 to MSLN-expressing tumor cells was almost completely inhibited by preincubation of scFvMTBHsp70 with recombinant human MSLN. Although MTBHsp70 also binds to these MSLN-expressing tumor cells the level of binding is not significantly different from background (p?=?0.187 for BR5FVB1 cells and p?=?0.086 for 40L cells). Furthermore the binding of MTBHsp70 to cancer cells cannot be blocked by recombinant MSLN. These data support the view that binding of scFvMTBHsp70 to these tumor cells occurred via the interaction of the scFv portion of the fusion protein with MSLN on the surface of tumor cells. Binding of these proteins with 40L mesothelioma cells was further compared using fluorescence microscopy. scFvMTBHsp70 shows significantly stronger binding intensity as compared to MTBHsp70 (Additional file 1: Figure S1A and B). In order to determine if scFvMTBHsp70 also binds to normal tissue in addition to tumor cells we incubated the fusion protein with peripheral blood leukocytes (PBLs) splenocytes or peritoneal mesothelial cells from healthy FVB/NJ mice and stained the cells using the same method as was used for staining tumor cells. As shown in Figure 1E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Since scFvMTBHsp70 may potentially target peritoneal mesothelial cells we also explored whether it could induce inflammation in peritoneal mesothelial tissues. We injected na¯ve mice with saline scFvMTBHsp70 or MTBHsp70 plus P4 scFv at the same doses as those used for tumor therapy described in Method sacrificed the mice 7 days post final treatments and examined haematoxylin and eosin (H&E) stained sections prepared from abdominal and intestinal peritoneum. Light microscopic examination revealed no evidence of inflammation and no infiltration of inflammatory cells such as macrophages or granulocytic cells around the mesothelial cells lining the abdominal and intestinal peritoneum of the actively treated or control animals. Representative microscopic images are shown in Additional file 2: Figure S2. scFvMTBHsp70 significantly prolongs ascites-free survival and overall survival in ovarian cancer- or mesothelioma-bearing mice To determine whether scFvMTBHsp70 can prolong survival in tumor-bearing mice we first evaluated the protein in a syngeneic mouse model of papillary ovarian cancer using immune-competent FVB/NJ mice. As shown in Figure 2A scFvMTBHsp70 prolonged both ascites-free and overall survival time compared with saline or the equimolar mixture of MTBHsp70 plus P4 scFv. To further support the efficacy of this fusion protein in prolonging survival in MSLN-expressing tumor-bearing mice we evaluated this protein in a second syngeneic mouse model of mesothelioma using immune-competent C57BL/6 mice. Animals treated with scFvMTBHsp70 showed significantly prolonged ascites-free and overall survival time compared with saline- or MTBHsp70 plus P4 scFv- treated mice (Figure 2B). Figure 2 A and B Kaplan-Meier survival curves of tumor-bearing mice following treatment with scFvMTBHsp70 control proteins or normal saline. A In a syngeneic mouse model of papillary ovarian cancer in immune-competent FVB/NJ mice scFvMTBHsp70 prolonged ascites-free survival time compared with saline (n?=?10 per group representative of two independent experiments; median survival (Med. sur.)?=?47 days vs. 37.5 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 39 days). scFvMTBHsp70 also prolonged overall survival time in the mice compared with saline (Med. sur. = 51.5 days vs. 43 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 43 days). B In a syngeneic mouse model of mesothelioma in immune-competent C57BL/6 mice the fusion protein prolonged ascites-free survival time compared with saline-treated mice (n?=?20 per group pooled from two independent experiments; Med. sur. = 28 days vs. 26 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 27 days). The fusion protein also prolonged overall survival time compared with saline (Med. sur. = 36 days vs. 31 days). P values were determined using the log-rank test. *p?<?0.05; **p?<?0.01; ***p?<?0.001. scFvMTBHsp70 enhances anti-tumor CD8+ T-cell responses in ovarian tumor-bearing mice To investigate whether the anti-tumor effects of scFvMTBHsp70 was associated with anti-tumor effector CD8+ T-cell responses we re-stimulated splenocytes from ovarian tumor-bearing FVB mice that received different treatments with the CD8+ T-cell Her2/neu epitope or MSLN Ld1 as a negative control ex vivo and analyzed the cells for production of IFN? and Granzyme B using flow cytometry. We previously showed that Her2/neu is expressed by BR5FVB1 cells [25]. Ld1 is an in-house designed H2d-restricted MSLN peptide that did not induce ovarian cancer specific T-cell response in H-2q FVB mice. We demonstrated significantly greater anti-Her2/neu CD8+ T-cell responses in splenocytes from scFvMTBHsp70-treated mice compared to mice treated with saline or a simple mixture of MTBHsp70 plus P4 scFv as measured by IFN? and Granzyme B production by CD8+ T cells (Figure 3A and B). This indicates that scFvMTBHsp70 enhances anti-tumor specific CD8+ T-cell responses in ovarian tumor-bearing mice. However no significant difference was seen in the number of tumor-infiltrating CD8+ T cells and no tumor-infiltrating Foxp3+ T cells were seen in tumors from mice in different treatment groups indicating that scFvMTBHsp70 may improve effector cell function rather than the number of intratumoral CD8+ T cells (Additional file 3: Figure S3A and B). Figure 3 Anti-tumor specific CD8+ T-cell functions in tumor-bearing mice following different treatments. A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. B Representative flow data are presented. C In vivo CD8+ T-cell depletion study. FVB/NJ mice were injected i.p. with anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a and were treated with scFvMTBHsp70 or saline as described in the methods. CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70 treated BR5FVB1 tumor-bearing animals compared to non depleted actively treated (n = 10 per group representative of two independent experiments; Med. sur. = 32.5 days vs. 48 days) animals. After CD8+ T cells depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared with saline (Med. sur. = 32.5 days vs. 31.5 days; p = 0.5938). P values were determined using log-rank test. *p< 0.05; **p < 0.01 ***p < 0.001. scFvMTBHsp70 is able to prime an adaptive tumor-specific immune response that has an absolute requirement for tumor-specific CD8+ T cells To determine whether CD8+ T cells play a major role in the protective anti-tumor effects observed in mice treated with scFvMTBHsp70 we conducted in vivo CD8+ T-cell depletion experiments using monoclonal antibodies. The absence of circulating CD8+ cells in peripheral blood following depletion was confirmed by flow cytometry (Additional file 4: Figure S4A and B). As shown in Figure 3C CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70-treated BR5FVB1 tumor-bearing animals compared to non-depleted actively-treated animals. Following CD8+ T-cell depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared to saline treatment. Therefore our data suggest that the priming of an adaptive tumor-specific immune response by scFvMTBHsp70 treatment is chiefly mediated by tumor-specific CD8+ T cells. scFvMTBHsp70 stimulates maturation of murine bone marrow-derived dendritic cells In order to investigate immunological mechanisms involved in the scFvMTBHsp70-enhanced anti-tumor immune response we first examined if the scFvMTBHsp70 or MTBHsp70 proteins used in our study could stimulate maturation of bone marrow-derived dendritic cells (BMDCs) as shown in previous studies [1617]. We stimulated CD11c+ BMDCs with 2 ?g/ml of scFvMTBHsp70 or an equimolar amount of MTBHsp70 (1.3 ?g/ml). 1 ?g/ml lipopolysaccharide (LPS) was used as positive control. To determine whether the BMDC maturation was attributable to LPS contamination of the recombinant proteins used in this study we also incubated BMDCs with 0.1 ng/ml LPS which was the equivalent amount of endotoxin found in 2 ?g/ml scFvMTBHsp70. After a 24 h-incubation both scFvMTBHsp70 and MTBHsp70 induced DC maturation indicated by an increase in the expression of CD40 CD80 CD86 and MHC class II molecules in comparison to the control cultures in medium. The increased expression of these DC maturation markers were comparable to those on cells stimulated with 1 ?g/ml LPS. The contamination control showed that addition of 0.1 ng/ml LPS did not replicate the effects of scFvMTBHsp70 or MTBHsp70 allowing us to discriminate the scFvMTBHsp70- or MTBHsp70-specific effects from effects of LPS (Figure 4A and B). Figure 4 scFvMTBHsp70 induces DC maturation and promotes antigen presentation and cross-presentation. A CD11c+ BMDCs isolated form FVB/NJ mice were incubated for 24 h with 2 ?g/ml scFvMTBHsp70 1.3 ?g/ml MTBHsp70 1 ?g/ml LPS as positive control or 0.1 ng/ml LPS as contamination control (thick lines) or medium only (solid) stained for CD11c CD40 CD80 CD86 and MHC II and analyzed by flow cytometry. Histograms were gated on CD11c+ DCs. Data are representative of three independent experiments in duplicate wells. B Median fluorescence intensity (MFI) of LPS- or protein-stimulated BMDCs normalized to MFI of BMDCs maintained in medium. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. C BMDCs cultured from FVB/NJ mice were pulsed with BR5FVB1 cells alone (Column a) or BR5FVB1 cells pre-complexed with MTBHsp70 (Column b) or scFvMTBHsp70 (Column c) and then incubated with BR5FVB1 tumor cell-primed T cells. Intracellular granzyme B and IFN? expressions in CD3+CD4+ and CD3+CD8+ T cells were analyzed by flow cytometry. Data from three independent experiments in duplicate wells are pooled and analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests. Data are presented as mean?±?SEM. D Representative flow data are presented. E scFvMTBHsp70 enhanced tumor cell immunogenicity in vivo. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD4+ or CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01; ***p?<?0.001; ****p?<?0.0001. The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their antitumor therapeutic efficacy in vivo. To determine whether scFvMTBHsp70 promotes tumor specific T-cell responses by enhancing antigen presentation and cross-presentation by antigen presenting cells we co-cultured BR5FVB1 tumor cell-primed T cells with DCs that had been pulsed with BR5FVB1 tumor cells in the presence of scFv-MTBHsp70 MTBHsp70 or PBS. The scFvMTBHsp70/tumor cell-pulsed DCs induced significantly higher production of IFN-? and Granzyme B from both CD4+ and CD8+ tumor cell-primed T cells as compared with MTBHsp70 or PBS indicating that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs (Figure 4C and D). scFvMTBHsp70 enhances tumor cell immunogenicity in vivo Having demonstrated in vitro that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs we next explored whether scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs and consequently enhances tumor cell immunogenicity in vivo. It has been demonstrated that the high density of DCs at dermal sites facilitates the capture of tumor antigens and that local inflammation induces DC maturation and migration into draining lymph nodes where they present antigens to na¯ve T cells generating a tumor specific immune response [26]. We primed FVB mice with an intradermal (i.d.) injection of mitomycin C-treated BR5FVB1 tumor cells followed by a booster i.d. injection of BR5FVB1 tumor cells with or without scFvMTBHsp70 or MTBhsp70. After 20 days we dissociated skin-draining lymph nodes and re-stimulated lymph node lymphocytes with Her2/neu peptides mitomycin C-treated BR5FVB1 tumor cells or BR5FVB1 tumor cell lysate and performed flow cytometric analysis for the presence of Granzyme B-generating CD4+ and CD8+ T cells. As shown in Figure 4E we demonstrated that Granzyme B-generating CD4+ and CD8+ T cells were significantly enhanced in mice that were immunized with scFv-MTBHsp70-bound tumor cells as compared to those in the mice immunized with tumor cells alone MTBHsp70-bound tumor cells or saline. Discussion We have developed a novel protein-based immunotherapy consisting of a fusion of an anti-MSLN scFv of human origin and recombinant mycobacterial heat shock protein 70 that has the ability to adjuvant significant T-cell responses against specific tumor antigens. P4 scFv directed against MSLN a surface antigen overexpressed on several types of tumor cells is used as a means of targeting the immunotherapeutic agent. We have demonstrated that this bifunctional fusion protein effectively binds BR5FVB1 ovarian cancer cells or 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells. We found that the fusion protein significantly prolonged survival time in syngeneic mouse models of papillary ovarian cancer and malignant mesothelioma. Treatment with the fusion protein induced significant tumor-specific CD8+ T-cell immune responses in the splenocytes of ovarian tumor-bearing mice. Furthermore in vivo CD8+ T-cell depletion studies demonstrated that this protective antitumor effect is mainly mediated by tumor-specific CD8+ T cells. Treatment using a mixture of MTBHsp70 plus P4 scFv for ovarian tumor or malignant mesothelioma-bearing mice did not increase survival or enhance tumor-specific immune responses suggesting that only through fusion of the two elements is the immune system effectively activated. We also demonstrated that this approach does not induce inflammation in the abdominal or intestinal mesothelial tissues as a result of a bystander interaction with MSLN on normal mesothelial cells. Several properties of MTBHsp70 appear in this study to contribute to the generation of tumor-specific CD4+ and CD8+ T-cell immune responses. First it induces maturation of DCs. Although several previous studies suggested that MTBHsp70 had pro-inflammatory properties only when contaminated with LPS [2728] other studies have decisively demonstrated that MTBHsp70 alone while not LPS promotes DC maturation and innate immune responses [161729]. In our study we used a fusion protein generated from a mammalian cell expression system ensuring a minimal amount of LPS contamination. We also incubated DCs with the same amount of LPS as that found in the fusion protein and failed to replicate the effects observed with the fusion protein supporting the view that maturation of DCs can be attributed to the fusion protein rather than LPS. Secondly MTBHsp70 is capable of delivering epitopes for enhanced processing and MHC-I presentation by DCs to na¯ve CD8+ T cells a process known as cross-presentation [30]. Mycobacterial Hsp70 fusion proteins have been shown to elicit both CD4+ and CD8+ T-cell responses although priming of CD8+ T cells does not appear to require CD4+ T cells [3132]."
Lung_Cancer
"The formal evaluation consists in the computation of different ?ci at each ith iteration given an exposure history qhi evaluated at a random time t between 41 and 100 for a random individual among the ns subjects. Indices of relative bias coverage and relative RMSE are derived from the following: (13) where I is an indicator function and ?? 1(1 ? ?) is the quantile function of the cumulative normal distribution related to probability 1 ? ? with ? = 0.05. The effect summary ?ci corresponds to the true effect from while is estimated from the best fitting model selected by AIC and BIC by using given the specific exposure history qhi of the random subject at the random time. This approach assures that the performance indicators in (13) are evaluated on the whole range of simulated exposure histories and do not depend on a specific choice. A visual inspection of performance is also provided by computing from the best-fitting models the grid of risk contributions defined in (9) composing the exposure“lag“response surface. Bias is then assessed across the surface by comparing the average fit of the the m = 500 models with the true exposure“lag“response relationship. A bidimensional display of coverage is also provided for each scenario. The performance of the AIC and BIC are also evaluated through their empirical rejection rate for the hypotheses of linearity or constant effect namely the proportion of times the selection procedure favors a model with a non-linear term for fe(x) and a non-constant term for we(?). When H0 is true namely fs(x) = x or ws(?) = c the rejection rate is an estimate of the probability of error of the selection criteria which wrongly select unnecessarily complex models. When H0 is false namely fs(x) ? x or ws(?) ? c the rejection rate is an estimate of the power of the selection criteria for identifying non-linearity and constant lag structures. In a formal hypothesis testing setting these measures would be interpreted as the type I error and the power of the test. 4.3. Results of the simulation study The results of simulations under the nine scenarios with ns = 400 producing approximately 300 uncensored events are summarized in tables in graphs. Table IV reports the formal evaluation of performance on the synthetic risk summary ?c in terms of relative bias coverage and relative RMSE. A visual assessment for three scenarios is provided in each column of the multi-panel . The true simulated exposure“lag response associations are displayed in the top panels while the other panels offer a comparison of the true lag“response and exposure“response curves at specific values with the average of the estimates from AIC and BIC-selected models together with a sample of 25 individual curves. Table IV Synthetic indices of relative bias coverage and relative root mean square error (RSME) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Bias Coverage RMSE f(x) ? w(?) AIC BIC AIC BIC AIC BIC Linear-constant 0.01 0.01 0.91 0.94 0.07 0.04 Linear-decay 0.00 0.00 0.93 0.94 0.07 0.05 Linear-peak 0.01 0.01 0.92 0.90 0.08 0.07 Plateau-constant 0.06 0.13 0.84 0.72 0.08 0.09 Plateau-decay 0.04 0.14 0.90 0.74 0.09 0.13 Plateau-peak 0.07 0.21 0.87 0.62 0.11 0.18 Exponential-constant 0.01 0.03 0.90 0.80 0.09 0.09 Exponential-decay 0.05 0.04 0.93 0.87 0.12 0.13 Exponential-peak 0.00 0.17 0.91 0.75 0.12 0.17 Generally AIC-selected models offer a better performance with a lower relative bias and a coverage of confidence intervals closer to the 95% nominal value. The values of relative RMSE suggest that the higher variability of AIC-based estimators is often balanced by the higher bias affecting BIC. At least part of the bias can be attributed to lack of fit due to the insufficient flexibility of quadratic spline functions when used to fit logarithmic or exponential shapes. This phenomenon appears quite relevant for the plateau-type exposure response characterized by the highest relative bias in the order of 4“7% for AIC but up to 21% for BIC (see Table IV and second column). This pattern is confirmed by the results in Table V showing the average df in each dimension and the empirical rejection rates for the hypotheses of linearity and constant risk. The AIC selection is affected by moderate overfitting sometimes suggesting flexible models in scenarios of linear and/or constant risk. In contrast BIC shows severe underfitting often selecting simple models for complex exposure“lag“response associations in particular regarding linearity. Table V Average df in each dimension for the best fitting models selected through AIC and BIC (left part) and empirical rejection rate for the AIC and BIC-based selection for the hypotheses of linearity and constant risk (right part) for the nine scenarios of exposure“lag“response associations. Results from m = 500 simulated data sets with ns = 400 subjects Average df Empirical rejection rate f(x) w(?) H0 : f(x) = x H0 : w(?) = c f(x) ? w(?) AIC BIC AIC BIC AIC BIC AIC BIC Linear-constant 1.50 1.03 1.57 1.02 0.29* 0.03* 0.23* 0.01* Linear-decay 1.26 1.00 3.60 3.17 0.18* 0.00* 1.00 1.00 Linear-peak 1.22 1.00 4.02 3.72 0.15* 0.00* 1.00 0.98 Plateau-constant 2.26 1.54 1.47 1.00 0.82 0.47 0.19* 0.00* Plateau-decay 2.53 1.55 3.49 3.10 0.97 0.54 1.00 1.00 Plateau-peak 2.18 1.21 4.01 3.56 0.85 0.19 1.00 0.93 Exponential-onstant 2.20 1.56 1.43 1.00 0.83 0.52 0.16* 0.00* Exponential-decay 2.36 1.81 3.58 3.12 0.99 0.80 1.00 1.00 Exponential-peak 2.15 1.29 4.05 3.69 0.90 0.27 1.00 0.93 * H0 is true The undercoverage of confidence intervals as shown in Table IV can be attributed to both lack of fit and a posteriori model selection. The latter as discussed in Section 2.5 may generate undercoverage through the underestimation of the true sampling (co)variance. A comparison of the importance of the two sources can be provided by the assessment of undercoverage in the first scenario where linear and constant functions are actually among the options of the selection procedure and the underlying simulated association can be potentially recovered with no lack of fit. In this scenario AIC-selected models affected by overfitting show a coverage of 91% very close to the nominal value as illustrated in Table IV. The under-coverage seems to be proportional to the bias as confirmed by with a lower coverage corresponding to sections of the bidimensional space characterized by worse fit. Empirical coverage across the risk surfaces for three scenarios of exposure“lag“response associations (linear-constant plateau-decay and exponential-peak in each column). Results from m = 500 simulated data sets with ns = 400 subjects. The simulated examples with ns = 200 and ns = 800 generate approximately 150 and 600 uncensored events respectively. The versions of Tables IV“V and for these examples are reported in Tables S2“S5 and Figures S9“S10 of the supporting information. The comparison suggests that varying the sample size does not dramatically affect the performance of the AIC-based test apart from the expected different power in identifying nonlinear and noncostant exposure“time“response associations. Consistently AIC-based selection seems to perform well across the range of number of subjects included in the analysis with a small bias and reasonable coverage. The results of this simulation study are consistent with previous findings on one-dimensional models for exposure“lag“response associations assuming a linear exposure“response relationship 18. 5. Discussion In this contribution I illustrate a statistical framework for modeling temporal dependencies with time-varying exposures defined here as exposure“lag“response associations. The approach is based on the extension of distributed lag non-linear models a modeling class previously proposed in time series analysis 2324. The extended DLNM methodology brings together and extends previous methodological developments on the topic as summarized in. Briefly it provides a unified framework for different study designs and regression methods and is applicable to time series cross-sectional case-control survival and longitudinal data. A major advantage is the possibility to describe the lag structure of either linear or nonlinear exposure“response relationships through the choice of two functions that define the association along the dimensions of the predictor and lags including most of the previous approaches as special cases. The example in illustrates how such flexibility is important for obtaining correct estimates of the association. Model specification easily accounts for previous knowledge on the association and incorporates assumptions on the phenomenon to be investigated through the choice of specific functions lag period and constraints. Interpretation of complex exposure“lag“response associations is aided by the definition of simple summary measures of effect and prediction and by graphical representation. The modeling framework is defined through a neat and compact algebraic representation including the derivation of measures of uncertainty such as standard errors and confidence intervals. Estimation is carried out with standard regression models which do not require specialized optimization procedures and may include terms for multiple exposure“lag“response dependencies as shown for radon and smoking here. The parameterization prediction and graphical representation are carried out with few general functions implemented in a freely available and documented software as discussed in. A key issue of the DLNM methodology is about selecting the appropriate model among different options for modeling the bidimensional exposure“lag“response relationship. The simulation study in indicates that AIC-based selection performs reasonably well over a range of 150“600 uncensored events while the strong penalty of BIC induces the selection of models too simple to recover the underlying dependency. The overfitting characterizing AIC-selected models in scenarios of simple exposure“lag“response dependencies does not seriously affect its performance a result in line with previous findings 18. However AIC-selected models also suffer from bias and undercoverage of confidence intervals to some extent. Part of this seems to be related to the limited flexibility of the functions applied in the simulation study and may be described as a smoothing problem rather that an inherent limitation of the estimators. It should also be noted that the simulation study only evaluates a limited set of exposure“response and lag“response shapes simulated under the assumption of independency. Different functions such as cubic splines and more complex exposure“lag“response surfaces will be assessed in future simulation studies. Also an extension of DLNMs with penalized splines characterized by higher flexibility can be explored as well exploiting previous research on bivariate smoothing techniques 3031. A related problem is about the inferential procedures being conditional on a posteriori selection of the best-fitting model. Previous studies on unidimensional models have proposed a correction for the inflation of type I errors in tests on a constant effect along lags 1727. However this approach is not easily extended to the bidimensional setting of exposure“lag“response associations and the definition of a hypothesis testing procedure for DLNMs is left to future developments. Although a posteriori selection may also be a source of undercoverage of confidence intervals its impact seems to be limited if compared with that associated with lack of fit at least in the simple scenarios investigated in the simulation study. Another limitation is the lack of a formal testing procedure on the hypothesis of independency. As suggested in Section 3.4 a graphical assessment of the proportionality of exposure“response and lag“response curves such as those in Figure 3 can help investigating the issue. Further research is needed to provide more consistent inferential procedures in this setting. The analysis of the temporal evolution of the risk associated with protracted time-varying exposures has straightforward applications in different research fields. For example the DLNM methodology may be used to characterize the risk of chronic exposures to occupational or environmental factors to differentiate the role of exposures sustained at different ages in life course studies or to define the temporal frame of beneficial or adverse effects of drugs in clinical trials and pharmaco-epidemiology. The development of this methodology and software implementation provide a promising analytical tool for biomedical research. 6. Software and data All the analyses presented in this paper were performed using the R software version 3.0.1 32. The DLNM modeling framework is fully implemented in the package dlnm 25 by using the expressly extended version 2.0.0. The permutational algorithm for simulating time-to-event data in the presence of time-varying exposures is implemented in the package PermAlgo 29 version 1.0. Both packages are available through R from its central repository. The data of the Colorado Plateau uranium miners cohort in the form of a comma-separated values file is included in the supporting information¡ together with the R scripts for the analysis performed in the example and the simulation study of Sections 3“4 which are entirely reproducible. In particular the script example.R provides a short illustration of the modeling framework. Versions of the scripts updated to future versions of the dlnm package will be available at http://www.ag-myresearch.com. Distributed lag non-linear models were originally conceived and developed for describing temperature“health associations in time series data by Ben Armstrong. The data from the Colorado Plateau uranium miners cohort were collected by the researchers of National Institute for Occupational Safety and Health. I am grateful to Bryan Langholz for kindly making data and documentation available. The simulation study was performed using the high-processing computing system at the London School of Hygiene and Tropical Medicine. The final version of this article has been substantially improved following the comments of an unknown reviewer. This research was supported by a Methodology Research fellowship by Medical Research Council-UK (grant ID G1002296). References 1 Goodman PG Dockery DW Clancy L Cause-specific mortality and the extended effects of particulate pollution and temperature exposure Environmental Health Perspectives 2004 112 2 179 185 14754572 2 Elliott P Shaddick G Wakefield JC de Hoogh C Briggs DJ Long-term associations of outdoor air pollution with mortality in Great Britain Thorax 2007 62 12 1088 1094 17666438 3 Collet JP Sharpe C Belzile E Boivin JF Hanley J Abenhaim L Colorectal cancer prevention by non-steroidal anti-inflammatory drugs: effects of dosage and timing British Journal of Cancer 1999 81 1 62 8 10487613 4 Abrahamowicz M Bartlett G Tamblyn R du Berger R Modeling cumulative dose and exposure duration provided insights regarding the associations between benzodiazepines and injuries Journal of Clinical Epidemiology 2006 59 4 393 403 16549262 5 Checkoway H Pearce N Hickey JL Dement JM Latency analysis in occupational epidemiology Archives of Environmental Health 1990 45 2 95 100 2334237 6 Thomas DC Models for exposure-time-response relationships with applications to cancer epidemiology Annual Review of Public Health 1988 9 451 482 7 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 232 271 The desing and analysis of cohort studies chap. 6: Modelling the relationship between risk dose and time 8 Thomas DC Brown CC Chu KC Goldsmith DF Saracci R Proceedings of a symposium on time-related factors in cancer epidemiology Journal of Chronic Diseases 1987 40 Suppl. 2 1S 211S 9 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press 279 300 chap. 13: Mechanistic models 10 Thomas DC Statistical methods for analyzing effects of temporal patterns of exposure on cancer risks Scandinavian Journal of Work Environment & Health 1983 9 4 353 366 11 Vacek PM Assessing the effect of intensity when exposure varies over time Statistics in Medicine 1997 16 5 505 513 9089959 12 Langholz B Thomas D Xiang A Stram D Latency analysis in epidemiologic studies of occupational exposures: application to the Colorado Plateau uranium miners cohort American Journal of Industrial Medicine 1999 35 3 246 256 9987557 13 Richardson DB Latency models for analyses of protracted exposures Epidemiology 2009 20 3 395 399 19262389 14 Hauptmann M Wellmann J Lubin JH Rosenberg PS Kreienbrock L Analysis of exposure-time-response relationships using a spline weight function Biometrics 2000 56 4 1105 1108 11129467 15 Hauptmann M Berhane K Langholz B Lubin J Using splines to analyse latency in the Colorado Plateau uranium miners cohort Journal of Epidemiology and Biostatistics 2001 6 6 417 424 11831677 16 Hauptmann M Pohlabeln H Lubin JH Jockel KH Ahrens W Bruske-Hohlfeld I Wichmann HE The exposure-time-response relationship between occupational asbestos exposure and lung cancer in two German case-control studies American Journal of Industrial Medicine 2002 41 2 89 97 11813213 17 Sylvestre MP Abrahamowicz M Flexible modeling of the cumulative effects of time-dependent exposures on the hazard Statistics in Medicine 2009 28 27 3437 3453 19708037 18 Abrahamowicz M Beauchamp ME Sylvestre MP Comparison of alternative models for linking drug exposure with adverse effects Statistics in Medicine 2012 31 11-12 1014 1030 22095719 19 Abrahamowicz M MacKenzie TA Joint estimation of time-dependent and non-linear effects of continuous covariates on survival Statistics in Medicine 2007 26 2 392 408 16479552 20 Berhane K Hauptmann M Langholz B Using tensor product splines in modeling exposure-time-response relationships: Application to the Colorado Plateau Uranium Miners cohort Statistics in Medicine 2008 27 26 5484 5496 18613262 21 Almon S The distributed lag between capital appropriations and expenditures Econometrica 1965 33 178 196 22 Schwartz J The distributed lag between air pollution and daily deaths Epidemiology 2000 11 3 320 326 10784251 23 Armstrong B Models for the relationship between ambient temperature and daily mortality Epidemiology 2006 17 6 624 631 17028505 24 Gasparrini A Armstrong B Kenward MG Distributed lag non-linear models Statistics in Medicine 2010 29 21 2224 2234 20812303 25 Gasparrini A Distributed lag linear and non-linear models in R: the package dlnm Journal of Statistical Software 2011 43 8 1 20 22003319 26 Thomas DC Statistical Methods in Environmental Epidemiology 2009 New York Oxford University Press chap. 6: Modelling exposure-time-response relationships 27 Mahmud M Abrahamowicz M Leffondré K Chaubey Y Selecting the optimal transformation of a continuous covariate in Cox's regression: Implications for hypothesis testing Communications in Statistics: Simulation and Computation 2006 35 1 27 45 28 Breslow NL Day NE Statistical Methods in Cancer Research 1987 II Lyon International Agency for Reasearch on Cancer (IARC) 178 231 The desing and analysis of cohort studies chap. 5: Fitting models to continuous data 29 Sylvestre MP Abrahamowicz M Comparison of algorithms to generate event times conditional on time-dependent covariates Statistics in Medicine 2008 27 14 2618 2634 17918753 30 Wood SN Generalized Additive Models: an Introduction with R 2006 Chapman & Hall/CRC 31 Eilers PHC Currie ID Durban M Fast and compact smoothing on large multidimensional grids Computational Statistics and Data Analysis 2006 50 1 61 76 32 R Development Core Team R: A Language and Environment for Statistical Computing R Foundation for Statistical Computing Vienna Austria 2013. http://www.R-project.org/ Supplementary material 9005373 1697 Eur J Cancer Eur. J. Cancer European journal of cancer (Oxford England : 1990) 0959-8049 1879-0852 24246704 3991133 10.1016/j.ejca.2013.10.006 NIHMS541404 Article Dosing to Rash: A Phase II Trial of the First-Line Erlotinib for Patients with Advanced Non-Small-Cell Lung Cancer an Eastern Cooperative Oncology Group Study (E3503) Brahmer JR M.D. M.Sc. 1 Lee JW Ph.D. 2 Traynor AM M.D. 3 Hidalgo MM M.D. Ph.D. 4 Kolesar JM Pharm.D. 3 Siegfried JM Ph.D. 5 Guaglianone PP M.D. 6 Patel JD M.D. 7 Keppen MD M.D. 8 Schiller JH M.D. 9 1Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Baltimore Maryland 2Dana-Farber Cancer Institute Boston Massachusetts 3University of Wisconsin Madison Wisconsin 4Spain 5University of Pittsburgh Pittsburgh Pennsylvania 6Decatur Memorial Hospital Decatur Illinois 7Northwestern University Chicago Illinois 8Sanford Cancer Center Sioux Falls South Dakota 9University of Texas Southwestern Medical Center Dallas Texas Corresponding Author Julie R. Brahmer M.D. M.Sc. Sidney Kimmel Comprehensive Cancer Center at Johns Hopkins Bunting Blaustein Cancer Research Building Room G94 1650 Orleans Street Baltimore MD 21287-0013 Office phone: 410-502-7159; Fax 410-614-9334; [email protected] 2 4 2014 15 11 2013 1 2014 01 1 2015 50 2 302 308 © 2013 Published by Elsevier Ltd. 2013 Background The development of a rash has been retrospectively associated with increased response and improved survival when treated with erlotinib at the standard dose of 150 mg per day. The objective of this trial was to evaluate the association of the activity of erlotinib in the first-line setting in patients with advanced non-small-cell lung cancer (NSCLC) with the development of a tolerable rash via dose escalation of erlotinib or tumor characteristics. Methods Patients with advanced NSCLC without prior systemic therapy were treated with erlotinib 150 mg orally per day. The dose was increased by 25 mg every two weeks until the development of grade 2/tolerable rash or other dose limiting toxicity. Tumor biopsy specimens were required for inclusion. Results The study enrolled 137 patients 135 were evaluable for safety and 124 were eligible and evaluable for response. Only 73 tumor samples were available for analysis. Erlotinib dose escalation occurred in 69/124 patients. Erlotinib was well tolerated with 70% of patients developing a grade 1/2 rash and 10% developing grade 3 rash. Response rate and disease control rate were 6.5% and 41.1% respectively. Median overall survival was 7.7 months. Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 © The Author 2014. Published by Oxford University Press. 2014 This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact [email protected] Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: [email protected] or [email protected] Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our article we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense."
Lung_Cancer
"The DNA (1500-ng aliquots) was resolved by electrophoresis on a 1.5% agarose gel containing 0.5 µg/mL ethidium bromide and was visualized under ultraviolet light [23]. ROS Assay The generation of ROS was assessed in Huh-7 or SMMC-7721 cells with the 2?7?-dichlorofluorescein diacetate (DCFH-DA) (Invitrogen) probe which is hydrolyzed within cells to non-fluorescent 2?7?-dichlorodihydrofluorescin (DCFH). DCFH can be oxidized to the fluorescent 2?7?-dichlorofluorescein (DCF) by hydroxyl radicals peroxynitrite and nitric oxide. Briefly Huh-7 or SMMC-7721 cells were seeded in a 96-well plate. Overnight the cells were incubated with different concentration of luteoloside for 8 h then reacted with 10 µM DCFH-DA at 37°C for 20 min. Or the cells were incubated with NAC (10 mM) H2O2 (100 µM) diamide (10 mM) or BSO (100 µM) for 4 h followed by 50 µM luteoloside for 4 h [24]. DCF was determined at ?ex?=?490 and ?em?=?520 nm on a Synergy H4 microplate reader (BioTek Winooski VT). Furthermore ROS were measured with a Leica DMI4000B inverted fluorescence (Leica Wetzlar Germany). Protein Extraction and Western Blotting The proteins were separated by SDS-PAGE and transferred to nitrocellulose membrane (Bio-Rad Hercules CA). The membrane was blocked with 5% non-fat milk and incubated with rabbit anti-LC3 polyclonal antibody (pAb) (Novus Biologicals) (2 µg/ml) rabbit anti-Beclin 1 pAb (Abcam) (3 µg/ml) rabbit anti-NLRP3 pAb (Novus Biologicals) (1?1000) rabbit anti-caspase-1 (p10) pAb (Santa Cruz Biotechnology) (1?1000) rabbit anti-IL-1? pAb (Santa Cruz Biotechnology) (1?1000) or rabbit anti-?-actin pAb (Bioworld Technology) (1?5000). The proteins were detected with enhanced chemiluminescence reagents (Pierce). Cell Proliferation Assay The cell proliferation assay was conducted as previously described by us [22]. Scratch-wound Assay Scratch-wound assay was conducted as previously described by us [22]. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system (Yokogawa Electronic Tokyo Japan) with an Olympus UPLSApo 10—2 10—/0.4 Dry ?/0.17/26.5 WD 3.1 plan super apochromat objective lens. The images were acquired every 0.5 hour for 48 hours (or every hour for 72 hours). The images shown represent 0 and 48 hour (or 0 and 72 hour). In Vitro Migration and Invasion Assays Assays were performed as described previously by Yao et al [25]. Xenograft Model and Treatments Two different mouse models were used to observe in vivo effect of Luteoloside on HCC cells. For the subcutaneous model the mice (male BALB/c-nu/nu 6 weeks old) were anesthetized using 1% sodium pentobarbital (0.2 ml/20 g body weight Sigma Chemical) as described by us previously [22]. The SMMC-7721 cells (2—106 cells) were suspended in 200 µl serum-free DMEM and subcutaneously injected into the right upper flank of each mouse. Two weeks after the cells were injected when tumors were observable the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received luteoloside (2 mg/kg body weight; equivalent to a dose of 6.5 mg/m2 in patients) in vehicle respectively for 4 weeks. Body weight was measured every 4 days to adjust the drug dosage. The tumors were measured using digital calipers every 3 to 4 days after they reached a volume of 100 mm3 and tumor volumes were calculated as described: V (cm3)?=?Width2 (cm2)—Length (cm)/2. At the termination of the experiment the mice were sacrificed by cervical dislocation and the tumors were weighed immediately after dissection. For lung metastasis experiments 1—106 SMMC-7721 cells were suspended in 100 µl PBS and injected into the tail veins of each mouse (male BALB/c-nu/nu 6 weeks old) [26]. Then the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received Luteoloside (2 mg/kg body weight) in vehicle respectively for 8 weeks. Body weight was measured every 4 days to adjust the drug dosage. At the termination of the experiment the mice were sacrificed by cervical dislocation and their lungs were removed and subjected to hematoxylin & eosin (H&E) staining. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. The protocol was approved by the Committee on the Ethics of Animal Experiments of the University of Jiangsu Normal University (Permit Number: 13-0221). All surgery was performed under sodium pentobarbital anesthesia and all efforts were made to minimize suffering. Statistical Analysis Data are presented as means ± SEM and comparisons were made using Student™s t test. A probability of 0.05 or less was considered statistically significant. Results Luteoloside Inhibits the Proliferation of HCC Cells in vitro We first determined whether luteoloside inhibits the proliferation of human HCC cells. We found that luteoloside significantly inhibited cell proliferation in all six-cell lines in a dose- and time-dependent manner (Fig. 1B 1C). The results suggest that luteoloside has promising antihepatoma activity. Luteoloside Inhibits the Migration and Invasion of HCC Cells in vitro Luteoloside significantly decreased the migration of Huh-7 and SMMC-7721 cells compared with the control groups (Fig. 2A“2H; Supplementary Movies 1“4). Transwell assays without Matrigel demonstrated that luteoloside could significantly inhibit migration of Huh-7 cells when compared with control groups (Fig. 2I 2J 2M). Transwell assays with Matrigel showed that the invasive capacities of Huh-7 cells which were treated with luteoloside were significantly inhibited compared with the control cells (Fig. 3K 3L 3N). These results indicate that luteoloside can significantly inhibit HCC cells migration and invasion in vitro. .0089961.g002 Luteoloside inhibits migration and invasion of HCC cells. The migration of cells into the wound was monitored in multiple wells using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours (Huh-7 cells) or every hour for 72 hours (SMMC-7721 cells) (see Supplemental Movies 1“4). The images shown represent 0 hour (A B E F) 48 hours (C D) and 72 hours (G H). The distance between the two edges of the scratch in the luteoloside-treated cells (D or H) was greater than that of the control (C or G). (I“N) Transwell migration and invasion assays of Huh-7 cells. For the transwell migration assay 5—104 cells were placed on the top chamber of each insert with the noncoated membrane. For the invasion assay 1—105 cells were placed on the upper chamber of each insert coated with 150 µg Matrigel (BD Biosciences MA). Cells in both assays were trypsinized and resuspended in DMEM and 700“900 µL of medium supplemented with 10% fetal bovine serum was injected into the lower chambers. Representative images are shown on the left (I J K L) and the quantification of five randomly selected fields is shown on the right (M N). The values shown are expressed as the mean ± SEM. ** P<0.01 versus non-luteoloside-treated control group. Scale bar: 100 µm. .0089961.g003 Luteoloside decreases intracellular ROS. ROS levels were measured using the ROS assay with DCFH-DA fluorescence dye. (A“B) Cells were treated with luteoloside at the indicated concentration for 8 h then reacted with 10 µM DCFH-DA for 20 min. DCF fluorescence was determined on a Synergy H4 microplate reader. Cells were incubated with NAC (C) H2O2 (D) diamide (E) or BSO (F) for 4 h followed by 50 µM luteoloside for 4 h. DCF was determined on a microplate reader. (G) DCFH-DA fluorescence (green) imaging of ROS in Huh-7 cells. Scale bar: 25 µm. Luteoloside has no Apoptotic Effects on HCC Cells Huh-7 and SMMC-7721 cells were treated with luteoloside for 24 h and caspase-3/7 was measured. The results showed that caspase-3/7 activity was not significantly different between luteoloside-treated cells and control cells when added 5102050100 150 or 200 µM luteoloside respectively (Fig. S1A S1B). Similar results were obtained by analyzing changes in nuclear fragmentation (Fig. S1C) and condensation (Fig. S1D) in cells. These results indicated that luteoloside has no apoptotic effects on Huh-7 and SMMC-7721 cells. Luteoloside does not Affect Autophagy Autophagic cell death (also known as Type II programmed cell death to distinguish it from apoptosis or Type I programmed cell death) has been described as a distinct form of cell death that differs from other death mechanism such as apoptosis and necrosis. Next we investigated whether luteoloside can induce autophagy in HCC cells. Beclin 1 and LC3 (microtubule-associated protein 1A/1B-light chain 3) play a pivotal role in mammalian autophagy. Beclin 1 is involved in both the signaling pathway activating autophagy and in the initial step of autophagosome formation [27]. LC3 comprises both a soluble LC3-I and a lapidated form called LC3-II. LC3-II correlates with autophagy being recruited into autophagosomes. Various types of stressors up-regulate LC3 and promote the conjugation of its cytosolic form LC3-I to phosphatidylethanolamine to constitute the autophagosome-specific LC3-II which is so far considered the most reliable marker of autophagy [27] [28]. Huh-7 and SMMC-7721 cells were treated with luteoloside for 48 h and the levels of LC3 and Beclin 1 proteins of different treatment groups were determined. The results showed that LC3 protein level was not significantly different between luteoloside-treated cells and control cells when added 25 µM or 50 µM luteoloside respectively. Similar results were obtained by analyzing changes in levels of Beclin 1 (Fig. S2). These results indicated that luteoloside has no autophagic effects on Huh-7 and SMMC-7721 cells. Luteoloside Reduces Intracellular ROS Accumulation ROS and cellular oxidant stress have long been associated with cancer [29]. Flavonoids are well known as ROS scavengers. As luteoloside is a kind of flavonoid isolated from Chinese herb [30] we investigated whether the intracellular ROS is part of the mechanism by which luteoloside suppress the proliferation migration and invasion potential of HCC cells. We found that luteoloside could significantly decrease the ROS level of Huh-7 and SMMC-7721 cells in a dose-dependent manner (Fig. 3A 3B). N-acetyl-cysteine (NAC) is a ROS-specific inhibitor [31]. NAC was shown to be capable of suppressing the ROS production in Huh-7 and SMMC-7721 cells (Fig. 3C). When the cells were pretreated with 10 mM NAC for 4 h then treated with 50 µM luteoloside for 4 h the ROS level was significantly lower than the cells which treated with 10 mM NAC only (Huh-7 cells P?=?0.0208; SMMC-7721 cell P?=?0.0224). H2O2 diamide and BSO are all ROS inducers [4]. Treatment with 100 µM H2O2 10 mM diamide or 100 µM BSO showed similar effects resulted in an increase in ROS levels compared with control (Fig. 3D“3F). The results showed that H2O2 diamide and BSO could significantly increase the ROS level of Huh-7 and SMMC-7721 cells compared the control group (Fig. 3D“3F). However after a prolonged time when the cells were treated with 50 µM luteoloside for 4 h the amount of ROS could significantly decrease (Fig. 3D“3F). Furthermore the ROS in Huh-7 cells were monitored using a fluorescence microscope. We also found that luteoloside could significantly decrease the ROS level of Huh-7 cells (Fig. 3G). Luteoloside Downregulates the Expression Level of NLRP3 Caspase-1 (p10) and IL-1? The NLRP3 inflammasome functions as a positive regulator of tumor cells proliferation and metastasis [17] [32]. "
Lung_Cancer
"of erythrocytes in systemic lupus erythematosus: analysis of the stability of the defect and of a restriction fragment length polymorphism of the CR1 gene J Immunol 1987 138 2708 2710 2881967 Xiang L Rundles JR Hamilton DR Wilson JG Quantitative alleles of CR1: coding sequence analysis and comparison of haplotypes in two ethnic groups J Immunol 1999 163 4939 4945 10528197 Birmingham DJ Chen W Liang G Schmitt HC Gavit K Nagaraja HN A CR1 polymorphism associated with constitutive erythrocyte CR1 levels affects binding to C4b but not C3b Immunology 2003 108 531 538 10.1046/j.1365-2567.2003.01579.x 12667215 Holers VM Chaplin DD Leykam JF Gruner BA Kumar V Atkinson JP Human complement C3b/C4b receptor (CR1) mRNA polymorphism that correlates with the CR1 allelic molecular weight polymorphism Proc Natl Acad Sci U S A 1987 84 2459 2463 10.1073/pnas.84.8.2459 3031685 Zhang Q Yu JT Zhu QX Zhang W Wu ZC Miao D Tan L Complement receptor 1 polymorphisms and risk of late-onset Alzheimer™s disease Brain Res 2010 1348 216 221 20558149 He JR Xi J Ren ZF Qin H Zhang Y Zeng YX Mo HY Jia WH Complement receptor 1 expression in peripheral blood mononuclear cells and the association with clinicopathological features and prognosis of nasopharyngeal carcinoma Asian Pac J Cancer Prev 2012 13 6527 6531 10.7314/APJCP.2012.13.12.6527 23464487 Srivastava A Mittal B Complement receptor 1 (A3650G RsaI and intron 27 HindIII) polymorphisms and risk of gallbladder cancer in north Indian population Scand J Immunol 2009 70 614 620 10.1111/j.1365-3083.2009.02329.x 19906204 Ferreira CG Lung cancer in developing countries Am Soc Clin Oncol Educ Book 2013 327 331 PMID:23714537 23714537 Amos CI Wu X Broderick P Gorlov IP Gu J Eisen T Dong Q Zhang Q Gu X Vijayakrishnan J Sullivan K Matakidou A Wang Y Mills G Doheny K Tsai YY Chen WV Shete S Spitz MR Houlston RS Genome-wide association scan of tag SNPs identifies a susceptibility locus for lung cancer at 15q25.1 Nat Genet 2008 40 616 622 10.1038/ng.109 18385676 Hung RJ McKay JD Gaborieau V Boffetta P Hashibe M Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V Chen C Goodman G Field JK Liloglou T Xinarianos G Cassidy A McLaughlin J Liu G Narod S Krokan HE Skorpen F Elvestad MB Hveem K Vatten L Linseisen J A susceptibility locus for lung cancer maps to nicotinic acetylcholine receptor subunit genes on 15q25 Nature 2008 452 633 637 10.1038/nature06885 18385738 Wang Y Broderick P Webb E Wu X Vijayakrishnan J Matakidou A Qureshi M Dong Q Gu X Chen WV Spitz MR Eisen T Amos CI Houlston RS Common 5p15.33 and 6p21.33 variants influence lung cancer risk Nat Genet 2008 40 1407 1409 10.1038/ng.273 18978787 McKay JD Hung RJ Gaborieau V Boffetta P Chabrier A Byrnes G Zaridze D Mukeria A Szeszenia-Dabrowska N Lissowska J Rudnai P Fabianova E Mates D Bencko V Foretova L Janout V McLaughlin J Shepherd F Montpetit A Narod S Krokan HE Skorpen F Elvestad MB Vatten L Nj¸lstad I Axelsson T Chen C Goodman G Barnett M Loomis MM Lung cancer susceptibility locus at 5p15.33 Nat Genet 2008 40 1404 1406 10.1038/ng.254 18978790 Markiewski MM Lambris JD The role of complement in inflammatory diseases from behind the scenes into the spotlight Am J Pathol 2007 171 715 727 10.2353/ajpath.2007.070166 17640961 Ricklin D Lambris JD Complement-targeted therapeutics Nat Biotechnol 2007 25 1265 1275 10.1038/nbt1342 17989689 Hugli TE Biochemistry and biology of anaphylatoxins Complement 1986 3 111 127 3542363 Ostrand-Rosenberg S Cancer and complement Nat Biotechnol 2008 26 1348 1349 10.1038/nbt1208-1348 19060872 Markiewski MM DeAngelis RA Benencia F Ricklin-Lichtsteiner SK Koutoulaki A Gerard C Coukos G Lambris JD Modulation of the antitumor immune response by complement Nat Immunol 2008 9 1225 1235 10.1038/ni.1655 18820683 Markiewski MM Lambris JD Is complement good or bad for cancer patients? A new perspective on an old dilemma Trends Immunol 2009 30 286 292 10.1016/j.it.2009.04.002 19428302 Fan Q He JF Wang QR Cai HB Sun XG Zhou XX Qin HD Shugart YY Jia WH Functional polymorphism in the 5?-UTR of CR2 is associated with susceptibility to nasopharyngeal carcinoma Oncol Rep 2013 30 11 16 23612877 Cerhan JR Novak AJ Fredericksen ZS Wang AH Liebow M Call TG Dogan A Witzig TE Ansell SM Habermann TM Kay NE Slager SL Risk of non-Hodgkin lymphoma in association with germline variation in complement genes Br J Haematol 2009 145 614 623 10.1111/j.1365-2141.2009.07675.x 19344414 Zhang Z Yu D Yuan J Guo Y Wang H Zhang X Cigarette smoking strongly modifies the association of complement factor H variant and the risk of lung cancer Cancer Epidemiol 2012 36 e111 e115 10.1016/j.canep.2011.11.004 22197220 Shen M Vermeulen R Rajaraman P Menashe I He X Chapman RS Yeager M Thomas G Burdett L Hutchinson A Yuenger J Chanock S Lan Q Polymorphisms in innate immunity genes and lung cancer risk in Xuanwei China Environ Mol Mutagen 2009 50 285 290 10.1002/em.20452 19170196 Fearon DT Identification of the membrane glycoprotein that is the C3b receptor of the human erythrocyte polymorphonuclear leukocyte B lymphocyte and monocyte J Exp Med 1980 152 20 30 10.1084/jem.152.1.20 6967510 Besaratinia A Pfeifer GP Second-hand smoke and human lung cancer Lancet Oncol 2008 9 657 666 10.1016/S1470-2045(08)70172-4 18598930 Coyle YM Minahjuddin AT Hynan LS Minna JD An ecological study of the association of metal air pollutants with lung cancer incidence in Texas J Thorac Oncol 2006 1 654 661 10.1097/01243894-200609000-00009 17409932 Garshick E Laden F Hart JE Rosner B Smith TJ Dockery DW Speizer FE Lung cancer in railroad workers exposed to diesel exhaust Environ Health Perspect 2004 112 1539 1543 10.1289/ehp.7195 15531439 Brennan P Buffler PA Reynolds P Wu AH Wichmann HE Agudo A Pershagen G Jockel KH Benhamou S Greenberg RS Merletti F Winck C Fontham ET Kreuzer M Darby SC Forastiere F Simonato L Boffetta P Secondhand smoke exposure in adulthood and risk of lung cancer among never smokers: a pooled analysis of two large studies Int J Cancer 2004 109 125 131 10.1002/ijc.11682 14735478 Lee G Walser TC Dubinett SM Chronic inflammation chronic obstructive pulmonary disease and lung cancer Curr Opin Pulm Med 2009 15 303 307 10.1097/MCP.0b013e32832c975a 19417670 Engels EA Inflammation in the development of lung cancer: epidemiological evidence Expert Rev Anticancer Ther 2008 8 605 615 10.1586/14737140.8.4.605 18402527 Kullo IJ Ding K Shameer K McCarty CA Jarvik GP Denny JC Ritchie MD Ye Z Crosslin DR Chisholm RL Manolio TA Chute CG Complement receptor 1 gene variants are associated with erythrocyte sedimentation rate Am J Hum Genet 2011 89 131 138 10.1016/j.ajhg.2011.05.019 21700265 Teeranaipong P Ohashi J Patarapotikul J Kimura R Nuchnoi P Hananantachai H Naka I Putaporntip C Jongwutiwes S Tokunaga K A functional single-nucleotide polymorphism in the CR1 promoter region contributes to protection against cerebral malaria J Infect Dis 2008 198 1880 1891 10.1086/593338 18954261 Chen GB Xu Y Xu HM Li MD Zhu J Lou XY Practical and theoretical considerations in study design for detecting gene-gene interactions using MDR and GMDR approaches PLoS One 2011 6 e16981 .0016981 21386969 Lou XY Chen GB Yan L Ma JZ Zhu J Elston RC Li MD A generalized combinatorial approach for detecting gene-by-gene and gene-by-environment interactions with application to nicotine dependence Am J Hum Genet 2007 80 1125 1137 10.1086/518312 17503330 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24416392 3887046 PONE-D-13-33822 .0085329 Research Mathematics Statistics Biostatistics Statistical Methods Medicine Clinical Research Design Meta-Analyses Oncology Basic Cancer Research Metastasis Cancers and Neoplasms Lung and Intrathoracic Tumors Pulmonology Surgery Thoracic Surgery Evaluation of Video-Assisted Thoracoscopic Surgery for Pulmonary Metastases: A Meta-Analysis VATS for Pulmonary Metastases Dong Siyuan Zhang Lin * Li Wenya Du Jiang Liu Xiangli Chen Xitao Department of Thoracic Surgery First Hospital of China Medical University Shenyang Liaoning Province People's Republic of China Arnold Paul Editor University of Kansas United States of America * E-mail: [email protected] Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: SYD LZ. Performed the experiments: SYD LZ WYL JD XLL XTC. Analyzed the data: SYD LZ WYL JD XLL XTC. Contributed reagents/materials/analysis tools: SYD LZ WYL JD XLL XTC. Wrote the paper: SYD LZ. 2014 9 1 2014 9 1 e85329 16 8 2013 25 11 2013 2014 Dong et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background To evaluate the evidence comparing video-assisted thoracic surgery (VATS) and open thoracotomy in the treatment of metastatic lung cancer using meta-analytical techniques. Methods A literature search was undertaken until July 2013 to identify the comparative studies evaluating disease-free survival rates and survival rates. The pooled odds ratios (OR) and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect models. Results Six retrospective studies were included in our meta-analysis. These studies included a total of 546 patients: 235 patients were treated with VATS and 311 patients were treated with open thoracotomy. The VATS and the thoracotomy did not demonstrate a significant difference in the 1-3-5-year survival rates and the 1-year disease-free survival rate. There were significant statistical differences between the 3-year disease free survival rate (p?=?0.04) which favored open thoracotomy. Conclusions The VATS approach is a safe and feasible treatment in terms of the survival rate for metastatic lung cancer compared with the thoracotomy. The 3-year disease-free survival rate in the VATS group is inferior to that of open thoracotomy. The VATS approach could not completely replace open thoracotomy. The authors have no support or funding to report. Introduction Metastasectomy is considered a beneficial treatment for a patient with metastatic lung cancer whose primary tumor has been well controlled[1].After surgery 5-year survival rates of 30% to 50% could be achieved depending on the underlying primary cancer[2]“[4].In practice the surgical approaches to pulmonary metastases are variable. Video-assisted thoracoscopic surgery (VATS) is an emerging technique; many procedures that had previously required a thoracotomy have been performed with the minimally invasive VATS. VATS has been used for the treatment of pulmonary metastases. The routine use of VATS for the treatment of respectable metastatic lung cancer remains controversial. Critics of the VATS approach have argued that it might not be an equivalent oncological operation[5] [6]. A prospective study by Cerfolio[7]found that 22% of the nodules that could be detected by thoracotomy were missing by VATS.Whether the VATS approach can provide a satisfactory outcome is unknown. An evidenced-based investigation of the VATS approach is needed we undertook this meta-analysis to achieve a more objective assessment of the published studies and to provide a more accurate comparison between VATS and thoracotomy for metastatic lung cancer. Methods Search Strategy Electronic searches were of the MEDLINECochrane Controlled Trial Register (CENTRAL) Ovid MEDILINE PubMed and Embase databases were performed until July 2013.The following MeSH search headings were used: œmetastatic lung cancer œpulmonary metastases œvideo-assisted thoracic surgery œthoracotomy and œcomparative study.We searched the reference lists of relevant studies reviews editorials lettersand meeting abstracts. We used the Science Citation Index to cross-reference for further studies that met our criteria. Study Selection The studies included in this meta-analysis were based on our predetermined criteria as follows: (1) clinical trials that include the full text of the paper published in peer-reviewed English journals or reports of presentations at major thoracic surgery meetings; (2) comparison of the efficacy of VATS to that of thoracotomy in patients with metastatic lung cancer; and (3) similarity in the patients' baseline characteristics. Data extraction and quality assessment Two independent reviewers (Siyuan and Wenya) assessed the quality and the risk of bias of the included trials as follows: (1) the studies that did not include a comparative group with surgery as a form of intervention were excluded; (2) the trials focusing on patients undergoing surgery for primary lung cancer were excluded; (3) the studies on robotic video-assisted thoracic surgery were excluded; (4) if there was an overlap between authors centers or patient cohorts evaluated in the published literature only the most recent report was included; (5) studies published more than 20 years ago were excluded because of the significant technological changes that has occurred. The s were evaluated with the Downs and Black quality assessment method[8]. Discrepancies between the two investigators were resolved by discussion and consensus with a senior investigator. The final results were reviewed by two senior investigators (Lin and Jiang).The disease-free survival was defined as the date of the initial metastasectomy until the date of a recurrence. Statistical and sensitivity analyses The meta-analysis was performed using the RevMan 5.1.0. software package. The odds ratio (OR) or the mean difference with 95% confidence intervals (95% CI) was calculated for the dichotomous outcomes and the continuous outcomes respectively. A P value<0.05 was considered a significant difference in the value between the two groups. We used the I2 statistic to investigate the heterogeneity among the studies.The heterogeneity was explored by X2 and I2; I2<25% and I2>50% reflect a small and large inconsistency respectively. P<0.05 was considered significant. If there were a statistical difference in terms of the heterogeneity (P?0.05) a random-effect model was selected to pool the data. Otherwise a fixed-effect model was used. Taking into account the presence of different sample sizes of the included studies a sensitivity analysis was performed to compare the of 1-year survival rate and the 3-year disease free survival rate between VATS and open thoracotomy. Publication bias A funnel plot was used to explore bias. Asymmetry in the funnel plot of trial size against treatment effect was used to assess the risk of bias. Results Description of the studies Six retrospective cohort studies the met our criteria were included in this meta-analysis. A total of 546 patients were included in the six studies;235 patients were allocated to the VATS group whereas 311 were allocated to the open thoracotomy group to evaluate their survival rate.The search algorithm results of the search strategies and selection criteria are shown in Fig 1. The patient characteristics and evaluation index are shown in Table 1. .0085329.g001 Figure 1 Identification of studies for inclusion. .0085329.t001 Table 1 Study Design Country NO(V/O) Gender (M/F) Mean age (years) Assessment score Nakajima2001[28] OC Japan 45/55 V59/41 O34/21 V55±15 O55±14 13 Mutsaerts2002[29] OC Netherlands 8/12 NR NR 19 Nakas2009[30] OC UK 25/27 V16/9 O 19/8 V69 O66 16 Carballo2009[31] OC USA 36/135 V18/18 O82/53 V58.5 O49 15 Gossot2009[32] OC France 31/29 V21/10 O13/16 V43 O40 18 Chao2012[33] OC Taiwan 90/53 V49/41 O35/18 NR 13 V VATS; O Open thoracotomy; NR Not reported; OC observational cohort. Assessment of Recurrence and Survival Six studies documented the 1-year survival rateand there was no significant heterogeneity among the six studies (x2?=?3.79 P?=?0.58I2?=?0%).A fixed effect model was used.The combined result is shown in Fig 2(OR?=?1.15; 95%CI 0.72“1.84; p?=?0.58). Because of the heterogeneity in sample size the sensitivity analyses were conducted using larger sample sizes. There was no difference between the two surgical methods with an OR of 1.00(95%CI 0.55“1.79) and with heterogeneity(?2?=?3.23P?=?0.07 I2?=?69%). Five studies reported the 3-year survival rate and heterogeneity was identified through the five studies (x2?=?11.32P?=?0.02I2?=?65%); and a random effect model was adopted (OR?=?1.07; 95%CI 0.50“2.27; p?=?0.86) (Fig 3). Three studies compared the 5-year survival rate (OR?=?0.96; 95%CI 0.34“2.71; p?=?0.93) with certain heterogeneity(x2?=?8.86P?=?0.01I2?=?77%) (Fig 4). .0085329.g002 Figure 2 1-year survival rate. Forest plot of the Odds Ratio(OR) of the 1-year survival rate following VATS versus open thoracotomy for metastatic lung cancer.The estimate of the OR of each individual trial corresponds to the middle of the squares and horizontal line gives the 95% CI.On each linethe numbers of events as a fraction of the total number randomized are shown for both treatment groups.For each subgroupthe sum of the statistics along with the summary OR is represented by the middle of the solid diamonds.A test of heterogeneity between the trials within a subgroup is given below the summary statistics. .0085329.g003 Figure 3 3-year survival rate. Forest plot of the Odds Ratio(OR) of the 3-year survival rate following VATS versus open thoracotomy for metastatic lung cancer."
Lung_Cancer
"Activation of the NLRP3 inflammasome is dependent on the generation of ROS [33]. Verifying the inhibitory effect of luteoloside on the proliferation and metastasis of HCC cells was accomplished by inhibiting the NLRP3 inflammasome; the levels of NLRP3 inflammasome protein of different treatment groups were determined. The results showed a significant decrease in the expression of NLRP3 of Huh-7 and SMMC-7721 cells treated with luteoloside (25 µM and 50 µM) compared with the non-treated control cells (Fig. 4A line 1; 4B). Caspase-1 is a family member of intracellular cysteine proteases and they are first synthesized as inactive pro-caspase-1. Upon stimulation pro-caspase-1 zymogen is self activated by proteolytic cleavage into the enzymatically active heterodimer composed of two 10- and 20-kDa subunits. Inflammasome elicits the proteolytic maturation and secretion of interleukin-1? (IL-1?) and IL-18 through caspase-1 activity [17] which was also assessed in luteoloside treated Huh-7 and SMMC-7721 HCC cells. The results from this experiment suggests that luteoloside decreases the proteolytic cleavage of pro-caspase-1 in both Huh-7 and SMMC-7721 HCC cells in a dose-dependent fashion compared with non-treated control cells (Fig. 4A line 2; 4C). Furthermore treatment of luteoloside decreased the expression level of IL-1? in both Huh-7 and SMMC-7721 HCC cells (Fig. 4A line 3; 4D). The results indicate that luteoloside suppresses the proliferation and metastasis of HCC cells by inhibition of NLRP3 inflammasome (Fig. 4E). .0089961.g004 Luteoloside suppresses the NLRP3 inflammasome activation. (A) Western blot analyses of NLRP3 Caspase-1 (p10) and IL-1? protein expression in Huh-7 and SMMC-7721 cells exposed two different concentrations of luteoloside for 48 h. (B“D) Relative quantitation of NLRP3 Caspase-1 (p10) and IL-1?. (E) A hypothetical cascade pathway of NLRP3 inflammasome suppressed by luteoloside. * P<0.05; ** P<0.01; *** P<0.001 versus non-luteoloside-treated control group. Luteoloside Inhibits in vivo Proliferation and Metastasis of HCC Cells The results obtained from in vitro studies showed that treatment of HCC cells with luteoloside inhibits the proliferation migration and invasion capacity of these cells. To determine the in vivo effects of luteoloside we performed in vivo proliferation and metastasis study. The average size and weight of xenografts in the luteoloside-treated group were dramatically smaller and lighter than those of the control group (P?=?0.0026 and P?=?0.0417 respectively). (Fig. 5c 5d). Therefore the luteoloside treatment significantly inhibited the growth of the xenograft with inhibition rates (versus the control volume and weight of the tumors) of 44.1 and 53.1% respectively. Furthermore we injected SMMC-7721 cells into the lateral tail veins of nude mice (n?=?10) and evaluated the metastatic growth of cells in the lung. After 8 weeks the luteoloside-treated mice displayed a statistically significantly lower number of lung metastases than the control group mice (P?=?0.0003) indicative of extravasation and tumor growth in the lung (Fig. 5e). When lungs underwent hematoxylin and eosin staining lung metastases were observed in all ten mice intravenously injected SMCC-7721 cells only whereas no obvious lung metastases were observed in the mice intravenously injected SMMC-7721 cells with luteoloside treated (Fig. 5f 5g). It is worth noting that no difference in mouse weight was observed between the treatment group and the control group suggesting that luteoloside has no adverse effects on mouse growth. .0089961.g005 Luteoloside inhibits tumorigenic and spontaneous lung metastatic capabilities of SMMC-7721 cells. (A) Subcutaneous injection of SMMC-7721 cells plus luteoloside treatment in nude mice inhibited tumor growth. (B) Tail vein injection of SMMC-7721 cells plus luteoloside treatment in nude mice inhibited the metastasis of SMMC-7721 cells. (a) 2—106 SMMC-7721 cells were subcutaneously injected into the right upper flank of each mouse. When tumors were observable the animals were equally divided into two groups (ten per group). The first group received only 0.2 ml of vehicle material by gavage daily and served as a control group. The second group of animals received luteoloside (2 mg/kg body weight) in vehicle respectively for 4 weeks. At the termination of the experiment the mice were sacrificed and the tumors were weighed immediately after dissection. The yellow arrow shows the tumor. (b) The photo of tumors isolated from killed nude mice of the indicated groups. (c-d) The volume and weight of the tumors. (e) Number of metastatic nodules on the surface of the lungs of mice injected with SMMC-7721 (n?=?10 mice in per group) are presented as the means and SEM. (f-g) Representative pictures of lungs with or without metastatic nodules are shown (H&E staining). * P<0.05; ** P<0.01; *** P<0.001 versus non-luteoloside-treated control group. Scale bar: 30 µm. Discussion HCC is a rapidly fatal disease with a life expectancy of about 6 months from the time of the diagnosis. Therapeutic strategies employed to date have significantly improved the prognosis for patients with unresectable HCC. This emphasizes the need for investigating the molecular mechanisms responsible for HCC development and seeking effective and non-cytotoxic chemical agents for chemoprevention and treatment. However few synthetic antineoplastic compounds have been identified to be effective for the treatment of this disease [3]. In this respect more and more researchers paid much attention to natural active compounds for cancer chemoprevention and treatment. In the present study luteoloside which was previously found to exert antineoplastic effect was clearly demonstrated to inhibit the proliferation of all six human hepatoma cell lines (Fig. 1B 1C). In in vivo experiments we obtained the same results (Fig. 5A). Invasion and metastasis two of the most important hallmarks of cancer are the leading lethal factors for malignant cancer especially for HCC [34]. The long-term survival of HCC patients after curative resection is still confronted by the major obstacle of a high recurrence rate which is mainly due to the spread of intrahepatic metastases [25]. Therefore the identification of metastatic factors and an understanding of the underlying molecular pathways that are involved in the progression of metastasis become critical issues. Evidences are accumulating that some flavonoids could significantly inhibit the invasion and metastasis of HCC cells [35] [36]. In this study luteoloside was shown to dramatically inhibit HCC cell migration invasion and metastasis both in vitro (Fig. 2; Movies S1“S4) and in vivo (Fig. 5B). ROS such as superoxide (O2?) and hydrogen peroxide (H2O2) are constantly produced during metabolic processes in all living species. Under normal physiological conditions cellular ROS generation is counterbalanced by the action of antioxidant enzymes and other redox molecules. The balance between O2? generation and elimination is important for maintaining proper cellular redox states. Recent evident suggests that a moderate increase in ROS can stimulate cell proliferation invasion and metastasis [37] [38]. However the precise molecular signaling events of such a regulation are not yet well characterized. In this study we found that luteoloside could significantly decrease the ROS level of HCC cells such as Huh-7 and SMMC-7721 cells (Fig. 3). NLRP3 was recently identified to form a cytoplasmic complex known as the NLRP3 inflammasome which potently modulates innate immune function by regulating the maturation and secretion of pro-inflammatory cytokines such as interleukin-1? (IL-1?) [39]. Activation of the NLRP3 inflammasome is dependent on the generation of ROS [40] [41]. In fact all known NLRP3 activators generate ROS and conversely inhibitors of ROS block inflammasome activation [33]. The NLRP3 inflammasome functions as a positive regulator of tumor cells proliferation and metastasis [17] [32] [42]. Several studies have demonstrated that some flavonoids were found to suppress NLRP3 inflammasome activation [43] [44]. Our results showed that luteoloside could significantly decrease the expression of NLRP3 protein of Huh-7 and SMMC-7721 HCC cells (Fig. 4A lane 1; 4B). Furthermore luteoloside also decreased the expression level of caspase-1 (p10) (Fig. 4A lane 2; 4C) and IL-1? (Fig. 4A lane 3; 4D). Based on the results of the present study the mechanisms by which luteoloside inhibits HCC cells is summarized in Fig. 4E. In addition we found that luteoloside had no significantly effect on the cell apoptosis (Figure S1). Earlier studies have shown that induction of autophagy could result in decreases in mitochondrial ROS generation NLRP3 protein level and pro-IL-1? processing [45]. However in this study we found that luteoloside had no significantly effect on the protein levels of LC3 and Beclin 1 (Figure S2) two important autophagy markers. The new classification of cell death established by the Nomenclature Committee on Cell Death (NCCD) was based on molecular features [46] [47]. According to this classification cell deaths can be roughly divided into: apoptosis (caspase dependent extrinsic apoptosis and caspase-independent intrinsic apoptosis) necrosis autophagy cell death and other tentative definitions of cell death modalities including anoikis entosis pyroptosis netosis and cornification. In HCC at least four types of cell death pathways have been observed and studied including apoptosis [48] necrosis [49] autophagy [50] anoikis [51] None of the above described cell deaths contribute to HCC proliferation and metastasis equally and HCC progression is not dependent entirely on any single cell death pathway. In this study we found that luteoloside had no significantly effects on the cell apoptosis or autophagy. Further study is underway to explore whether luteoloside has significantly effects on other kinds of cell death. Luteoloside significantly inhibited the proliferation of HCC cells in vitro and in vivo. But luteoloside had no significantly effect on the cell apoptosis or autophagy. J¸rgensen et al have shown that the predominant effect of nilotinib a kind of tyrosine kinase inhibitor is antiproliferative rather than proapoptotic. They further suggested that combining nilotinib with other drugs should be carefully considered from the point of view of merely inducing G0/G1 block without apoptosis [52]. Papeleu et al found Trichostatin A a drug candidate for cancer therapy could inhibit cell proliferation at different steps of the cell cycle. But they also found Trichostatin A did not induce apoptosis in cells. Their finding supports its use in the treatment of proliferative disorders [53]. So from another perspective perhaps the predominant effect of luteoloside is antiproliferative rather than an œexecutor of cell death. Further studies are required to explore this possibility. To the best of our knowledge this is the first to show that luteoloside a flavone subclass of flavonoids inhibits the proliferation invasion and metastasis of HCC cells through inhibition of NLRP3 inflammasome. Our findings provide an important basis for a further exploration towards understanding the action mechanisms of luteoloside and possibly its beneficial effect in the prevention of tumor proliferation invasion and metastasis. Supporting Information Figure S1 Luteoloside does not affect the apoptosis rate of Huh-7 and SMMC-7721 cells. (A“B) The effect of luteoloside on caspase activity. Cells were plated in a 96-well plate. Overnight the cells were incubated with different concentrations of luteoloside. After 24 hours caspase-3/7 activity was measured using the Caspase-Glo® 3/7 Assay (Promega Madison WI). The caspase-3/7 activity was proportionate to the produced luminescence intensity. (C) Detection of DNA ladder formation in Huh-7 and SMMC-7721 cells after treatment with luteoloside for 24 hours. (D) Hoechst 33342 staining. The cells treated with luteoloside and stained with Hoechst 33342. Arrows show apoptotic small bodies. NS not significant (P>0.05). Scale bars: 1 µm. (TIF) Click here for additional data file. Figure S2 Luteoloside does not affect autophagy. Western blot analyses of LC3 and Beclin 1 protein expression in Huh-7 and SMMC-7721 cells exposed two different concentrations of luteoloside for 48 h. (TIF) Click here for additional data file. Movie S1 The migration of non-luteoloside-treated SMMC-7721 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every hour for 72 hours. (MP4) Click here for additional data file. Movie S2 The migration of luteoloside-treated SMMC-7721 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every hour for 72 hours. (MP4) Click here for additional data file. Movie S3 The migration of non-luteoloside-treated Huh-7 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours. (MP4) Click here for additional data file. Movie S4 The migration of luteoloside-treated Huh-7 cells into the wound was monitored using a CellVoyager CV1000 confocal scanner system. The images were acquired every 0.5 hour for 48 hours. (MP4) Click here for additional data file. We thank Dr. Sheng Zhao for assistance in the preparation of this manuscript. References 1 SiegelR NaishadhamD JemalA (2013) Cancer statistics 2013. CA Cancer J Clin63: 11“3023335087 2 El-SeragHB (2011) Hepatocellular carcinoma. N Engl J Med365: 1118“112721992124 3 LiS DongP WangJ ZhangJ GuJ et al (2010) Icariin a natural flavonol glycoside induces apoptosis in human hepatoma SMMC-7721 cells via a ROS/JNK-dependent mitochondrial pathway. Cancer Lett298: 222“23020674153 4 SahasrabuddheVV GunjaMZ GraubardBI TrabertB SchwartzLM et al (2012) Nonsteroidal anti-inflammatory drug use chronic liver disease and hepatocellular carcinoma. J Natl Cancer Inst104: 1808“181423197492 5 FanSH ZhangZF ZhengYL LuJ WuDM et al (2009) Troxerutin protects the mouse kidney from D-galactose-caused injury through anti-inflammation and anti-oxidation. Int Immunopharmacol9: 91“9619000936 6 FanSH ZhangZF WangYY ZhengYL LuJ et al (2012) Purple sweet potato color attenuates D-galactose-induced renal injury in mice by inhibiting the expression of NF-?B-dependent inflammatroy genes. J Med Plants Res6: 3694“3704 7 Zamora-RosR FedirkoV TrichopoulouA Gonz¡lezCA BamiaC et al (2013) Dietary flavonoid lignan and antioxidant capacity and risk of hepatocellular carcinoma in the European prospective investigation into cancer and nutrition study. Int J Cancer133: 2429“244323649669 8 WalterA Etienne-SelloumN BrasseD KhalloufH BronnerC et al (2010) Intake of grape-derived polyphenols reduces C26 tumor growth by inhibiting angiogenesis and inducing apoptosis. FASEB J24: 3360“336920442318 9 IorioF BosottiR ScacheriE BelcastroV MithbaokarP et al (2010) Discovery of drug mode of action and drug repositioning from transcriptional responses. Proc Natl Acad Sci U S A107: 14621“1462620679242 10 HuC KittsDD (2004) Luteolin and luteolin-7-O-glucoside from dandelion flower suppress iNOS and COX-2 in RAW264.7 cells. Mol Cell Biochem265: 107“11315543940 11 SunX SunGB WangM XiaoJ SunXB (2011) Protective effects of cynaroside against H2O2-induced apoptosis in H9c2 cardiomyoblasts. J Cell Biochem112: 2019“202921445859 12 XiongJ LiS WangW HongY TangK et al (2013) Screening and identification of the antibacterial bioactive compounds from Lonicera japonica Thunb. leaves. Food Chem138: 327“33323265495 13 BaskarAA IgnacimuthuS MichaelGP Al NumairKS (2011) Cancer chemopreventive potential of luteolin-7-O-glucoside isolated from Ophiorrhiza mungos Linn. Nutr Cancer63: 130“13821161823 14 van DeventerHW BurgentsJE WuQP WoodfordRM BrickeyWJ et al (2010) The inflammasome component NLRP3 impairs antitumor vaccine by enhancing the accumulation of tumor-associated myeloid-derived suppressor cells. Cancer Res70: 10161“1016921159638 15 AndersonOA FinkelsteinA ShimaDT (2013) A2E induces IL-1? production in retinal pigment epithelial cells via the NLRP3 inflammasome. PLoS One8: e6726323840644 16 HuaKF ChouJC LamY TasiYL ChenA et al (2013) Polyenylpyrrole Derivatives Inhibit NLRP3 Inflammasome Activation and Inflammatory Mediator Expression by Reducing Reactive Oxygen Species Production and Mitogen-Activated Protein Kinase activation. PLoS One8: e7675424116148 17 AhmadI MuneerKM TamimiIA ChangME AtaMO et al (2013) Thymoquinone suppresses metastasis of melanoma cells by inhibition of NLRP3 inflammasome. Toxicol Appl Pharmacol270: 70“7623583630 18 ChenGY Nº±ezG (2011) Inflammasomes in intestinal inflammation and cancer. Gastroenterology141: 1986“199922005480 19 ChenLC WangLJ TsangNM OjciusDM ChenCC et al (2012) Tumour inflammasome-derived IL-1? recruits neutrophils and improves local recurrence-free survival in EBV-induced nasopharyngeal carcinoma. EMBO Mol Med4: 1276“129323065753 20 ChowMT TschoppJ M¶llerA SmythMJ (2012) NLRP3 promotes inflammation-induced skin cancer but is dispensable for asbestos-induced mesothelioma. Immunol Cell Biol90: 983“98623010873 21 Ungerb¤ckJ BelenkiD Jawad ul-HassanA FredriksonM Frans©nK et al (2012) Genetic variation and alterations of genes involved in NF?B/TNFAIP3- and NLRP3-inflammasome signaling affect susceptibility and outcome of colorectal cancer. Carcinogenesis33: 2126“213422843550 22 FanS NiuY TanN WuZ WangY et al (2013) LASS2 enhances chemosensitivity of breast cancer by counteracting acidic tumor microenvironment through inhibiting activity of V-ATPase proton pump. Oncogene32: 1682“169022580606 23 SethmanCR HawigerJ (2013)"
Lung_Cancer
"Dye-bias equalization used a global scaling factor computed from the ratio of the average red and green fluorescing normalization control probes. Both methods were conducted using the methylumi package in Bioconductor version 2.11. For each probe DNA methylation level is summarized as a ?-value estimated as the fraction of signal intensity obtained from the methylated beads over the total signal intensity. Probes with detection P-values of >0.05 were considered not significantly different from background noise and were labeled as missing. Methylation probes were excluded from meQTL analysis if any of the following criteria was met: on X/Y chromosome annotated in repetitive genomic regions annotated to harbor SNPs missing rate>5%. Because the ?-values for the 65 SNP probes are expected to be similar in matched pair of normal and tumor tissues we performed principal component analysis (PCA) using these 65 SNP probes to confirm the labeled pairs. We then performed PCA using the 5000 most variable methylation probes with var>0.02 and found that the normal tissues were clustered together and well separated from the tumor tissues. We further excluded 5 normal tissues that were relatively close to the tumor cluster. From the remaining 239 normal tissue samples we analyzed 210 with genotype data from a previous GWAS of lung cancer20. Genotype data and genetic association analysis The blood samples were genotyped using the Illumina HumanHap550K SNP arrays in EAGLE GWAS20. The SNPs with call rate >99% minor allele frequency (MAF) >3% and Hardy-Weinberg Equilibrium (HWE) P-value >10?5 were included for analysis. Prior to meQTL analysis each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits. The genetic association testing was performed using PLINK and R adjusted for the top three PCA scores based on GWAS SNPs to control for potential population stratification. Identification of cis-meQTLs For each CpG methylation probe the cis region was defined as being less than 500kb upstream and downstream from the target CpG-site (1Mb total). A methylation trait was detected to harbor a cis-meQTL if any SNP in the cis region had a SNP-CpG nominal association P-value less than P0 where P0 was chosen to control FDR at 5% by permutations. Here we describe a permutation procedure to choose P0 to control FDR at 5%. For a given P0 let N(P0) be the total number of CpG probes with detected cis-meQTLs and N0(P0) the expected number of CpG probes falsely determined to have cis-meQTLs. FDR is defined as N0(P0)/N(P0). The key is to estimate N0(P0) under the global null hypothesis that no CpG probe has cis-meQTLs. We randomly permuted the genotypes across subjects for 100 times keeping the correlation structure of the 338456 methylation traits in each permutation. Then N0(P0) was estimated as the average number of methylation traits that were detected to harbor cis-meQTL SNPs with nominal P<P0. Control FDR at 5% requires P0=4.0—10?5. The same procedure was applied to detect secondary independently associated cis-meQTL SNPs. With our sample size h2>0.12 is required to detect cis-meQTLs with power greater than 0.8. We note that although we excluded all CpG probes annotated with SNPs there is still the possibility that rare not annotated variants could be associated with the cis-meQTL SNPs. However since common variants and rare variants are known to be poorly correlated and rare variants are uncommon by definition we do not expect this event to be frequent. Identification of trans-meQTLs For each CpG probe the trans region was defined as being more than 500kb from the target CpG-site in the same chromosome or on different chromosomes. For the kth methylation trait with m SNPs in the trans region let (qk1?qkm) be the P-values for testing the marginal association between the trait and the m SNPs. Let pk=min(qk1?qkm) be the minimum P-value for m SNPs and converted pk into genome-wide P-value Pk by performing one million permutations for SNPs in the trans region. Because a cis region is very short (~1M) compared to the whole genome (~3000M) Pk computed based on SNPs in trans regions is very close to that based on permutations using genome-wide SNPs. Thus we use the genome-wide p-value computed based on all SNPs to approximate Pk. Furthermore all quantile-normalized traits follow the same standard normal distribution N(01); thus the permutation-based null distributions are the same for all traits. We then applied the Benjamini-Hochberg procedure to (P1?PN) to identify trans-meQTLs by controlling FDR at 5%. With our sample size h2 >0.24 is required to detect trans-meQTLs with power greater than 0.8. Replication of meQTLs in TCGA samples The replication was performed in TCGA histologically normal tissue samples that had genome-wide genotype (Affymetrix Genome-Wide Human SNP Array 6.0) and methylation profiling (Illumina Infinium HumanMethylation450 BeadChip). We downloaded genotype (level 2) and methylation data (level 3) from the TCGA website22. We also downloaded methylation data for tumor tissue samples and performed PCA analysis to confirm that normal tissue samples were separated from tumor tissue samples. Autosomal SNPs with MAF >3% calling rate >0.99 and HWE P-value > 10?5 were included for imputation using IMPUTE259 and reference haplotypes in the 1000 Genome Project60 (version 2012/03). We only included samples of European ancestry based on EIGENSTRAT analysis. The replication set had 65 lung 87 breast and 142 kidney histologically normal tissue samples after QC. Again each methylation trait was regressed against sex age batches and PCA scores based on methylation profiles. The regression residues were then quantile-normalized to the standard normal distribution N(01) as traits for meQTL analysis. The associations were tested between the quantile-normalized methylation traits and imputed genotypic dosages adjusting for sex age and PCA scores based on SNPs. A genetic association detected in EAGLE lung data was considered replicated if the association had the same direction and FDR<0.05 based on single-sided P-values. Testing genetic associations with methylation and gene expression traits We downloaded gene expression data (level 3) from RNA-seq analysis of 59 histologically normal tissue samples from NSCL patients from TCGA. All samples also had genome-wide genotype data and 28 samples had additional methylation data from Illumina Infinium HumanMethylation450 BeadChips."
Lung_Cancer
"Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. More than 80% of the specimens tested in this study were small biopsy specimens. The overall invalid rate for Sanger sequencing was 15.6% (76/487) compared to the EGFR PCR assay at 9% (43/487). However the invalid rate for the subset of specimens derived from resected specimens was 0% (0/109) likely because of sufficient tissue availability. Thus the assay is extremely robust when performed on resected tumor specimens and has an approximately 90% success rate on biopsy specimens which are often the only tumor sample available for testing in NSCLC. Sanger sequencing has been widely used to detect EGFR mutations.[30] [32] Similar to the overall invalid rates for the 134 EGFR mutation detected LDT samples enrolled in the EURTAC trial Sanger sequencing had a higher invalid rate (15.7%) compared to 8.2% for the EGFR PCR test. There were also 30 mutation not detected results for Sanger sequencing (22.4%) and 7 mutation not detected results for the EGFR PCR test (5.2%). With 21 invalid results and 30 mutation not detected results Sanger sequencing would have misclassified 38% of patients enrolled in the EURTAC trial. Similar invalid rates have been reported in three other studies suggesting that this methodology has limitations when applied to DNA from FFPET samples.[33] [34] [35] In addition Sanger sequencing has shown poor sensitivity in samples containing less than 20“25% mutant alleles.[35] [36] [37] When we compared the agreement between valid results for the EGFR PCR test with Sanger sequencing (n?=?406) there were 38 discordant cases of which 30 were confirmed by MPP. Twenty-nine of the 30 cases resulted in mutation detected status by the EGFR PCR test and would make these patients eligible for anti-EGFR therapy. Poor sensitivity of Sanger sequencing thus explains the relatively low NPA compared to EGFR PCR test observed in this study. Given the criticality of EGFR mutation testing in selecting specific therapies for life-threatening cancers such as advanced NSCLC robust and accurate assays with rapid turnaround time are preferred. Recent quality assurance studies to ascertain the mutation status of a standard panel of tumors have shown that different clinical laboratories do not correctly identify the mutation status of 100% of the panel members even when they are using the same or similar testing methodologies.[38] [39] For assays that involve mutation analysis of tumor samples important factors contributing to the assay performance include analytic standardization validation of reagents and methodology laboratory experience and the appropriate involvement of the pathologist. In results of the present study indicate that the cobas EGFR mutation test is a highly robust and highly accurate companion diagnostic assay to select patients for treatment with anti-EGFR therapies such as erlotinib. Supporting Information Table S1 Listing of MPP Result. (PDF) Click here for additional data file. Table S2 Outcome from samples discrepant between the cobas EGFR PCR test and LDT that were enrolled in the clinical trial (cobas MND/LDT MD). (PDF) Click here for additional data file. Table S3 Agreement results between discordant EGFR PCR and LDT tests. (PDF) Click here for additional data file. Table S4 MPP results from resolution analysis of discordant specimens between EGFR PCR test and Sanger sequencing. (PDF) Click here for additional data file. We would like to acknowledge Patrick O'Donnell and Karen Yu for their contributions to this study. References 1 ChapmanPB HauschildA RobertC HaanenJB AsciertoP et al (2011) Improved survival with vemurafenib in melanoma with BRAF V600E mutation. N Engl J Med364: 2507“251621639808 2 OuSH BartlettCH Mino-KenudsonM CuiJ IafrateAJ (2012) Crizotinib for the treatment of ALK-rearranged non-small cell lung cancer: a success story to usher in the second decade of molecular targeted therapy in oncology. Oncologist17: 1351“1375 3 O'BryantCL WengerSD KimM ThompsonLA (2013) Crizotinib: a new treatment option for ALK-positive non-small cell lung cancer. Annals Pharmacotherapy47: 189“197 4 SunJM ChoiYL WonJK HirschFR AhnJS et al (2012) A dramatic response to crizotinib in a non-small-cell lung cancer patient with IHC-positive and FISH-negative ALK. J Thorac Oncol7: e36“3823154564 5 Administration USFaD (2010) Class Labeling Changes to anti-EGFR monoclonal antibodies cetuximab (Erbitux) and panitumumab (Vectibix): KRAS Mutations. 6 HarbisonCT HorakCE LedeineJM MukhopadhyayP MaloneDP et al (2012) Validation of Companion Diagnostic for Detection of Mutations in Codons 12 and 13 of the KRAS Gene in Patients with Metastatic Colorectal Cancer: Analysis of the NCIC CTG CO.17 Trial. Arch Pathol Lab Med137: 820“82723030695 7 MaemondoM InoueA KobayashiK SugawaraS OizumiS et al (2010) Gefitinib or chemotherapy for non“small-cell lung cancer with mutated EGFR. N Engl J Med362: 2380“2388 8 MokTS WuYL ThongprasertS YangCH ChuDT et al (2009) Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma. N Engl J Med361: 947“95719692680 9 ZhouC WuYL ChenG FengJ LiuXQ et al (2011) Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study. "
Lung_Cancer
"Our method was first applied to two published lung cancer microarray gene expression data sets. As shown in gene sets like the proteasome and BCR signaling pathways were identified by our method. These gene sets were not identified in the previous study [8] since the differential gene expression among these gene sets were relatively weak. However the concordant enrichment of these gene sets was detected by our method. This comparison illustrated the advantage of our proposed concordant integrative gene set enrichment analysis. The analysis results from our second application (a concordant integrative analysis of three data sets) also showed that many gene sets could be identified with low false discovery rates. A consistency between both results was also observed. A further exploration based on the KEGG cancer pathway collection demonstrated the practical usefulness of our proposed method. Overall this study illustrates that we can improve detection power and discovery consistency through a concordant integrative analysis of multiple large-scale two-sample gene expression data sets. There are several advantages for our proposed method. The genome-wide concordance can be statistically tested before the integrative analysis. The mixture model is estimated based on the maximum likelihood estimation procedure. Furthermore our integrative analysis of gene sets is based on a probabilistic framework which can be conveniently used for the calculation of false discovery rates. However there are also limitations. Our proposed mixture model is simple and it contains only three components. Normal distributions are assumed for these components. Furthermore we assume that different genes behave independently (Gold et al. [32] have showed that the independence assumption can be acceptable in practice). These limitations should be considered when our method is used in practice. For our future research it will be useful to extend our proposed method for an integrative analysis of data with multiple sample groups. This will be particularly useful for studying diseases with different progression stages. Although a major proportion of gene expression data have been collected for binary outcomes (e.g. normal vs. abnormal) data with other types of responses (e.g. survival data) have also been collected. It will also be useful to extend our method for these data. Furthermore when our proposed method is used for an integrative analysis of more than 3 data sets it is desirable to simplify the mixture model so that the number of model parameters (particularly for ) can be reduced to achieve statistical efficiency. Furthermore we would also like to consider more robust approaches "
Lung_Cancer
"RNA Interference The cells were transfected with non-targeting control siRNA (siNeg) or siRNA targeting NQO1 (siNQO1) (Applied Biosystems) using XtremeGene siRNA transfection reagent (Roche) then levels of the indicated transcripts and proteins were examined by realtime PCR (using the primers listed in Table S1) RT-PCR and Western blotting and the cells were then used in experiments. Reverse Transcription-PCR Total RNA was extracted with Trizol (invitrogen) and reverse-transcribed to cDNA using a SuperScript II reverse transcription kit (Invitrogen) then PCR was performed using the following primers: NQO1 (F TCCTCAGAGTGGCATTCTGC;R TCTCCTCATCCTGTACCTCT) or GAPDH (F CAACTACATGGTTTACATGTTC;R GCCAGTGGACTCCACGAC). NQO1 Activity Assay To measure endogenous NQO1 activity in cell extracts cells were washed with PBS and sonicated in lysis buffer (25 mM Tris pH 7.5 1 mM EDTA 0.1 mM DTT). The assay reaction mixture (final volume 200 µl) contained 25 mM Tris pH 7.5 0.01% Tween 20 0.7 mg/ml of BSA 40 µM 26-dichloroindophenol (DCPIP; Sigma) 5 µM FAD 200 µM NADH 50 µg of cell extract and either 10 µM dicoumarol or medium. The decrease in DCPIP absorbance at 600 nm in the absence or presence of dicoumarol was measured at 5 sec intervals for 60 sec and the activity expressed as relative activity with the control activity given a value of 1. Statistical Analysis All quantitative data are presented as the mean ± SEM for at least three separate experiments. Differences between groups were examined using one-way ANOVA with Scheffe™s test with p<0.05 (* or #) p<0.005 (**) or p<0.001 (***) being considered statistically significant. Results NQO1 Expression and Activity in Lung Cancer Cells Correlate with ?-lapachone Toxicity To compare the cytotoxicity of ?-lapachone for various lung cancer cells three cell lines CL1-1 CL1-5 and A549 were incubated for 12 h with ?-lapachone (0 to 10 µM) then cell survival was measured by crystal violet staining. As shown in A using 1-5 µM ?-lapachone the A549 cells showed a significantly lower percentage survival than the CL1-1 and CL1-5 cells but there was no significant difference between the different cells using 10 µM ?-lapachone. Since NQO1 activity has been positively correlated with ?-lapachone cytotoxicity in breast cancer cell lines [8] [9] [44] we examined whether the sensitivity of the different lung cancer cell lines to ?-lapachone toxicity was associated with intracellular NQO1 expression. Figures 1B-D showed NQO1 activity (Fig. 1B) NQO1 RNA levels (Fig. 1C) and NQO1 protein levels (Fig. 1D) in CL1-1 CL1-5 and A549 cells and showed that under normal culture conditions all three values were highest in A549 cells and lowest in CL1-5 cells. We then compared the sensitivity of A549 CL1-1 and CL1-5 cells to treatment with 0“10 µM ?-lapachone for 3612 or 24 h using crystal violet staining and found that the percentage survival of CL1-5 cells was higher than that of CL1-1 cells at all 4 time points and that A549 cells showed the lowest percentage survival (E). These results corresponded well with the intracellular NQO1 levels in the three cell lines as the sensitivity to ?-lapachone was higher in cells with higher NQO1 levels. These data showed that NQO1 level or activity plays a key role in ?-lapachone cytotoxicity for lung cancer cell lines. .0088122.g001 ?-lapachone-induced cell death is associated with NQO1 expression levels. (A) Percentage survival of the lung cancer cell lines CL1-1 CL1-5 and A549. Cells were treated with 0“10 µM ?-lapachone for 12 h then cell viability was determined by crystal violet staining assay and expressed as a percentage of the value for cultures with no ?-lapachone. (B“D) NQO1 activity levels (B) NQO1 RNA expression levels (C) and NQO1 protein expression levels (D) in the three lung cancer cell lines grown under normal culture conditions. (E) Percentage survival of A549 cells (left panel) CL1-1 cells (center panel) and CL1-5 cells (right panel) incubated with the indicated concentration of ?-lapachone for 3612 or 24 h examined by crystal violet staining and expressed as percentage survival compared to the untreated cells. The results are the mean ± SD for 3 independent experiments each in triplicate. In subsequent experiments since ?-lapachone alone was very effective at killing A549 cells and we wished to examine whether sulindac or its metabolites had a synergistic effect with ?-lapachone we concentrated on CL1-1 and CL1-5 cells. In addition since the largest difference in survival of CL1-1 and CL1-5 cells was seen at ?-lapachone concentrations of 2 to 5 µM we used 5 µM ?-lapachone to study the effect of ?-lapachone alone and 2 µM ?-lapachone to study synergistic effects of sulindac and ?-lapachone. Identification of the Apoptotic Signaling Pathway Triggered by ?-lapachone To investigate the underlying mechanism involved in ?-lapachone toxicity 5 µM ?-lapachone was used to explore the apoptotic signaling pathway activated by ?-lapachone in CL1-1 and CL1-5 cells. Using Annexin V staining cell death in ?-lapachone-treated CL1-1 and CL1-5 was demonstrated to occur by apoptosis (A). Cell cycle analysis also showed that the sub G0/G1 ratio (apoptotic cells) increased in a time-dependent manner (Figure S1A). In studies measuring intracellular calcium levels an increase was seen after 1 or 2 h of ?-lapachone treatment in both CL1-1 and CL1-5 cells (B arrow) as seen during activation of the apoptotic pathway by ?-lapachone [6] [45]. The percentage cell survival measured using the MTT assay was only partially restored by addition of 0-10 µM BAPTA (Molecular Probes) an intracellular calcium chelator during incubation for 24 h with 5 µM ?-lapachone (C) showing that increased intracellular calcium levels was not the only factor involved in the ?-lapachone-induced cell death of these cells. Although calpain and caspase 3 components of the apoptotic signaling pathway were activated by treatment with 5 µM ?-lapachone for 0“9 h (Figure S1B) as shown in Supplementary caspases and calpain were not involved in the lung cancer cell death induced by ?-lapachone as 1 h pretreatment with the pan caspase inhibitor zVAD or the calpain inhibitor ALLM or ALLN (all from Sigma) did not inhibit the effect (Figure S2). In both cell lines the mitochondrial membrane potential (MMP) was decreased by treatment for 36 or 9 h with ?-lapachone (Figure S1C) but intracellular H2O2 levels were not changed by ?-lapachone treatment for 3 or 6 h (Figure S1D). These results shown that ?-lapachone causes apoptosis of both CL1-1 and CL1-5 cells by decreasing the MMP. .0088122.g002 The ?-lapachone-induced apoptosis of CL1-1 and CL1-5 cells is partly due to an intracellular calcium increase. (A) CL1-1 cells (left panel) or CL1-5 cells (right panel) were incubated with 5 µM ?-lapachone for 036 or 9 h then were examined for apoptosis using Annexin V. (B) CL1-1 cells (left panel) or CL1-5 cells (right panel) were incubated with 5 µM ?-lapachone for the indicated time then intracellular calcium levels were measured using Fluo-4 staining and flow cytometry. The intensity of Fluo-4 staining was increased by ?-lapachone treatment especially at 1 h (arrows). (C) CL1-1 cells (left panel) or CL1-5 cells (right panel) were left untreated or were incubated for 24 h with the indicated concentration of BAPTA-AM an intracellular calcium chelator and/or 5 µM ?-lapachone then cell survival was measured by the MTT assay and expressed as percentage survival compared to the untreated cells. * p<0.05 ** p<0.01 as compared to ?-lapachone alone. To determine the signaling pathways activated in ?-lapachone-induced lung cancer cell death levels of the phosphorylated forms of PI3K AKT and the MAPKs ERK and JNK in CL1-1 and CL1-5 cells were examined. ?-lapachone treatment for 10“180 min increased JNK phosphorylation but decreased phosphorylation of ERK (A) and of PI3K and AKT (B). "
Lung_Cancer
"P=0.055 active treatment”intervention vs controls. Intervention n=31 trusts control n=47 trusts and non-intervention (control and non-participants combined) n=66 trusts. Abbreviations: CNS clinical nurse specialist; MDT multidisciplinary team; SCLC small-cell lung cancer. Total patient questionnaire scores by the multidisciplinary team in the intervention group at baseline (pre) and at the end of the study (post). A low score indicates better experience. Each symbol represents the mean score for each trust in the intervention group. The maximum possible score for the questionnaire is 11. Quality improvement plan themes Quality improvement plan theme Number of plans Multidisciplinary team effectiveness 31 Diagnostic pathways 13 Treatment pathways 9 Access to clinical nurse specialists 8 Clinical trial recruitment 4 Patient experience 2 Baseline (2009) national lung cancer audit indicators Control ( n =47) Intervention ( n =31) Excluded ( n =67) P -value Mean (%) s.e.m. Mean (%) s.e.m. Mean (%) s.e.m. Control vs intervention vs non-participant control vs intervention Case ascertainment 158.1 38.6 122.0 7.2 107.4 3.6 0.220 0.455 Discussed at the MDT meeting 95.2 0.7 93.7 1.7 90.9 1.9 0.155 0.370 Histological confirmation rate 75.7 1.2 76.4 1.8 78.4 1.6 0.409 0.739 Active treatment 59.5 1.2 55.9 2.2 59.5 1.5 0.305 0.131 Surgery (all cases) 13.4 0.6 13.0 0.8 14.2 0.7 0.469 0.648 SCLC (chemo) 65.1 2.2 66.5 3.9 63.3 2.7 0.746 0.733 Seen by CNS 70.3 3.8 76.6 3.2 58.3 4.2 0.007 0.243 CNS present diagnosis 44.0 3.8 49.4 5.4 38.7 3.8 0.237 0.403 Abbreviations: CNS=clinical nurse specialist; MDT=mulitdisciplinary team; SCLC=small-cell lung cancer. Data are shown as mean and s.e. proportion of patients. BMC Cancer BMC Cancer BMC Cancer 1471-2407 BioMed Central 24386906 3893473 1471-2407-14-3 10.1186/1471-2407-14-3 Study Protocol Study protocol of a randomized controlled trial comparing Mindfulness-Based Stress Reduction with treatment as usual in reducing psychological distress in patients with lung cancer and their partners: the MILON study Schellekens Melanie PJ 1 Melanie.Schellekensradboudumc.nl van den Hurk Desiree GM 2 Desiree.vandenHurkradboudumc.nl Prins Judith B 3 Judith.Prinsradboudumc.nl Molema Johan 2 Johan.Molemaradboudumc.nl Donders A Rogier T 4 Rogier.Dondersradboudumc.nl Woertman Willem H 4 Willem.Woertmanradboudumc.nl van der Drift Miep A 2 Miep.vanderDriftradboudumc.nl Speckens Anne EM 1 Anne.Speckensradboudumc.nl 1Department of Psychiatry Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 3Department of Medical Psychology Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 4Department of Epidemiology Biostatistics and Health Technology Assessment Radboud University Nijmegen Medical Centre Nijmegen The Netherlands 2014 3 1 2014 14 3 3 28 6 2013 19 12 2013 Copyright 2014 Schellekens et al.; licensee BioMed Central Ltd. 2014 Schellekens et al.; licensee BioMed Central Ltd. This is an open access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Background Lung cancer is the leading cause of cancer death worldwide and characterized by a poor prognosis. It has a major impact on the psychological wellbeing of patients and their partners. Recently it has been shown that Mindfulness-Based Stress Reduction (MBSR) is effective in reducing anxiety and depressive symptoms in cancer patients. The generalization of these results is limited since most participants were female patients with breast cancer. Moreover only one study examined the effectiveness of MBSR in partners of cancer patients. Therefore in the present trial we study the effectiveness of MBSR versus treatment as usual (TAU) in patients with lung cancer and their partners. Methods/Design A parallel group randomized controlled trial is conducted to compare MBSR with TAU. Lung cancer patients who have received or are still under treatment and their partners are recruited. Assessments will take place at baseline post intervention and at three-month follow-up. The primary outcome is psychological distress (i.e. anxiety and depressive symptoms). Secondary outcomes are quality of life (only for patients) caregiver appraisal (only for partners) relationship quality and spirituality. In addition cost-effectiveness ratio (only in patients) and several process variables are assessed. Discussion This trial will provide information about the clinical and cost-effectiveness of MBSR compared to TAU in patients with lung cancer and their partners. Trial registration ClinicalTrials.gov NCT01494883. Mindfulness-based stress reduction Lung cancer patients Partners Psychological distress Randomized controlled trial Background With an estimated 1.4 million deaths per year lung cancer is the leading cause of death by cancer worldwide. Even with the best available treatment five-year survival is merely 16% and about 60 to 70% of patients die within the first year after diagnosis [1]. This poor prognosis is often caused by a late diagnosis as the presentation usually occurs when the lung cancer is advanced. Patients may develop burdensome symptoms like pain dyspnoea fatigue and cough and they may undergo radical treatment including surgery chemo- and radiotherapy. Not surprisingly lung cancer has a major impact on the psychological wellbeing of patients and their family. Akechi and colleagues [2] showed that 19% of patients with advanced lung cancer meets the criteria of psychiatric disorders especially depressive and adjustment disorders. Of patients who had been successfully treated for lung cancer 15% met the criteria for a minor or major depressive disorder [3]. The prevalence rate of depressive and anxiety symptoms among lung cancer patients ranges from 20 to 47% [4-7]. Compared to patients with other cancer diagnoses lung cancer patients report the highest rates of distress (43 to 58%) [89] resulting in a lower quality of life [10]. Family friends and especially partners of patients with lung cancer also have to deal with its psychological impact [11-14]. Partners not only provide emotional and practical support they also have to cope with their own concerns including the uncertainty regarding the course of the illness and the fear of losing their partner [15]. More than 50% of partners of lung cancer patients report negative emotional effects of caregiving [16]. Around 40% of partners of patients with advanced lung cancer report high levels of distress [17]. The relationship between patient and partner can also be affected by the cancer. It has been shown that some partners report a lower quality of their relationship after the diagnosis of lung cancer [18]. Though numerous studies examined the psychological distress of lung cancer patients and their partners [2-22] not much research is done on how to alleviate distress in these groups [23]. In addition the available studies on managing the psychosocial care needs of cancer patients and their families have focused on care at the very end of life (e.g. [24-26]). Recently studies have demonstrated that palliative care initiated early in treatment improves the quality of life and depressive symptoms of lung cancer patients [1027]. This stresses the importance of integrating psychosocial care for lung cancer patients and their partners early in the treatment rather than instigating it once life-prolonging therapies fail. In the past ten years MBSR has become a promising psychosocial intervention for cancer patients. Mindfulness is defined as intentionally paying attention to moment-by-moment experiences in a non-judgmental way [28]."
Lung_Cancer
"The Center for Functional Cancer Epigenetics Dana-Farber Cancer Institute Boston MA 02215 14USC Epigenome Center and USC/Norris Comprehensive Cancer Center Los Angeles CA 90089 USA Correspondence: landimmail.nih.gov 4 4 2014 27 2 2014 27 8 2014 5 3365 3365 The genetic regulation of the human epigenome is not fully appreciated. Here we describe the effects of genetic variants on the DNA methylome in human lung based on methylation-quantitative trait loci (meQTL) analyses. We report 34304 cis- and 585 trans-meQTLs a genetic-epigenetic interaction of surprising magnitude including a regulatory hotspot. These findings are replicated in both breast and kidney tissues and show distinct patterns: cis-meQTLs mostly localize to CpG sites outside of genes promoters and CpG islands (CGIs) while trans-meQTLs are over-represented in promoter CGIs. meQTL SNPs are enriched in CTCF binding sites DNaseI hypersensitivity regions and histone marks. Importantly 4 of the 5 established lung cancer risk loci in European ancestry are cis-meQTLs and in aggregate cis-meQTLs are enriched for lung cancer risk in a genome-wide analysis of 11587 subjects. Thus inherited genetic variation may affect lung carcinogenesis by regulating the human methylome. Introduction DNA methylation plays a central role in epigenetic regulation. Twin studies have suggested that DNA methylation at specific CpG sites can be heritable12; however the genetic effects on DNA methylation have been investigated only in brain tissues34 adipose tissues56 and lymphoblastoid cell lines (LCL)7. Most studies were based on the Illumina HumanMethylation27 array which has a low density and mainly focuses on CpG-sites mapping to gene promoter regions. While the functional role of DNA methylation in non-promoter or non-CpG Island (CGI) regions remains largely unknown evidence shows roles in regulating gene splicing8 and alternative promoters9 silencing of intragenic repetitive DNA sequences10 and predisposing to germline and somatic mutations that could contribute to cancer development1112. Notably a recent study13 suggests that most DNA methylation alterations in colon cancer occur outside of promoters or CGIs in so called CpG island shores and shelves and the Cancer Genome Project has reported high mutation rates in CpG regions outside CGI in multiple cancers14. Although expression QTLs (eQTLs) have been extensively studied in different cell lines and tissues15 the minimal overlap observed between cis-acting meQTLs and eQTLs (?5“10%)347 emphasizes the necessity of mapping meQTLs that may function independently of nearby gene expression. This might reveal novel mechanisms for genetic effects on cancer risk particularly since many of the established cancer susceptibility SNPs map to non-genic regions. Lung diseases constitute a significant public health burden. About 10 million Americans had chronic obstructive pulmonary disease in 201216 and lung cancer continues to be the leading cancer-related cause of mortality worldwide17. To provide functional annotation of SNPs particularly those relevant to lung diseases and traits we systematically mapped meQTLs in 210 histologically normal human lung tissues using Illumina Infinium HumanMethylation450 BeadChip arrays which provide a comprehensive platform to interrogate the DNA methylation status of 485512 cytosine targets with excellent coverage in both promoter and non-promoter regions (Fig. 1a) CGI and non-CGI regions (Fig. 1b) and gene and non-gene regions. Thus our study enables the characterization of genetic effects across the methylome in unprecedented detail. Moreover since DNA methylation exhibits tissue specific features18 we investigated whether similar meQTLs could be identified in other tissues. Results Identification of cis-acting meQTLs We profiled DNA methylation for 244 fresh-frozen histologically normal lung samples from non-small cell lung cancer (NSCLC) patients from the Environment and Genetics in Lung cancer Etiology (EAGLE) study19. A subset of 210 tissue samples that passed quality control and had germline genotype data from blood samples20 was used for meQTL analysis. The analysis was restricted to 338456 autosomal CpG probes after excluding those annotated in repetitive genomic regions or that harbored genetic variants. The distribution of methylation levels differed strongly across distinct types of genomic regions (Supplementary Fig. 1ab). Consistent with previous studies21 CpG sites in promoter or CGI regions were largely unmethylated while those in other regions were largely methylated (Supplementary Fig. 1ab). We performed cis-meQTL analysis for each methylation trait by searching for SNPs within 500kb of the target CpG-site in each direction (1Mb overall). The genetic association was tested under an additive model between each SNP and each normalized methylation probe adjusting for sex age plate population stratification and methylation-based principal component analysis (PCA) scores. Controlling FDR at 5% (P=4.0—10?5) we detected cis-meQTLs for 34304 (10.1% of 338456) CpG probes (Supplementary ) mapping to 9330 genes. A more stringent threshold (P=6.0—10?6) at FDR=1% detected cis-meQTLs for 27043 CpG probes mapping to 8479 genes. Moreover with a 200kb window (100kb from both sides) instead than 1Mb we detected 40650 cis-meQTLs (P=2.0—10?4) controlling for FDR=5%. The methylation distribution in CpG sites detected with meQTLs differed substantially from those without meQTLs (Supplementary Fig. 1ab). The peak SNPs were equally distributed on either side of the target CpG-sites with a median distance (?) of 11.8 kb. The proportion of explained phenotypic variance (h2) ranged from 7.7% to 79.8% (Supplementary Fig. 1c) and inversely depended on ? (Supplementary Fig. 1d). We detected strong cis-meQTLs for DNMT1 a gene known for establishment and regulation of tissue-specific patterns of methylated cytosine residues and for DNMT3A/B two genes involved in de novo methylation in mammals but not for MTHFR which affects global methylation (Supplementary Fig. 1e). The likelihood of detecting cis-meQTLs varied across CpG regions and strongly depended on the variability of the methylation levels (Fig. 1d e). CpG probes in non-CGI regions were twice as likely to harbor cis-meQTLs than CpG probes in CGI regions (11.5% v.s. 4.8% t-test P<10?100); similarly CpG probes located in CGI of non-gene regions were twice as likely to harbor cis meQTL than those in gene regions (14.6% v.s. 6.6% t-test P<10?100). To verify the cis-meQTLs we analyzed data from The Cancer Genome Atlas (TCGA)22 NSCLC patients (n=65) for whom both DNA methylation data from llumina HumanMethylation450 BeadChip of histologically normal lung tissue and germline genotypes from Affymetrix Genome-Wide Human SNP Array 6.0 were available. Genetic associations were tested using the imputed genotypic dosages. EAGLE findings were strongly replicated in TCGA lung data: for the 34304 associations detected in EAGLE32128 (93.8%) had the same direction and 22441 (65.4%) had FDR<0.05 based on single-sided P-values (). For 34304 CpG probes detected with cis-meQTLs we searched for secondary independently associated SNPs in cis regions by conditioning on the primary cis-meQTL SNPs. We detected secondary cis-meQTL SNPs for 3546 CpG probes (FDR=5% P=4—10?5) 61.5% of which were replicated in TCGA lung data. Identification of trans-acting meQTLs Identification of trans-meQTLs was performed by searching for SNPs that were on different chromosomes from the target CpG-sites or on the same chromosome but more than 500kb away. We detected 615 CpG-probes with trans-meQTLs (FDR=5% P=2.5—10?10) including 438 interchromosomal and 177 intrachromosomal trans-meQTLs. Among 177 intrachromosomal trans-associations 30 lost significance after conditioning on the corresponding cis-regulating SNPs suggesting that these trans-associations were caused by cis-acting regulations through long range linkage disequilibrium (LD). Thus we detected 585 traits with œtrue trans-meQTLs (Fig. 2a) mapping to 373 genes. The number of trans-meQTLs was reduced to 500 if controlling for FDR=1% (P=4.0—10?11). We replicated 79.8% of the 585 trans-associations in TCGA lung data. Interestingly trans-meQTLs were strongly enriched in CGI sites in contrast to the observation that cis-meQTLs were strongly enriched in non-CGI sites (Fig. 2b). CpG dinucleotides in 3™UTR regions where microRNA target sites are typically located showed an opposite trend in both cis- and trans-meQTLs (Fig. 2b). In 62.8% of the trans-associations the SNPs involved were also detected to have cis-acting effects. We investigated whether trans-associations were mediated by these cis-regulated proximal CpG sites (Fig. 2cd). We found that 30 and 166 trans-associations had full and partial mediation respectively while 389 had no significant mediation. The trans-associations involving SNPs in gene desert regions are less likely to be mediated by proximal CpG probes (15.7% v.s. 34.3%; P=0.0067 Fisher™s exact test). To obtain mechanistic insight into the trans-associations showing mediation effects (n=196) we used the DAVID tool23 to characterize the function of genes harboring the mediating cis-CpG probes. The analysis was performed for 115 genes after excluding the major histocompatibility complex (MHC) region because of long range complex LD patterns. The GO analysis revealed three top gene categories with nominal significance involved in DNA methylation regulation including GTPase-activity related genes (P=0.004 Fisher™s exact test) genes regulating transcription (P=0.02) and genetic imprinting (P=0.04 Fisher™s exact test Supplementary Table 2). Notably 106 trans SNPs with P<2.5—10?10 were associated with multiple distal CpG probes suggesting that they are multi-CpG regulators. In particular we detected one master regulatory SNP rs12933229 located at 16p11.2 in a very large intron of the NPIPL1 gene which was associated with the methylation of CpG sites annotated to five genes on different chromosomes (Fig. 2a Supplementary Fig. 2 and Supplementary Table 3). These associations were partially mediated by a proximal CpG probe cg06871736. All five trans-associations were replicated in TCGA. The trans-associations show a consistent direction with the ˜C™ allele associated with higher methylation levels. All five regulated target sites are in CGIs and three are in gene promoter regions. We evaluated the association with gene expression for these three CpG probes using 28 TCGA histologically normal lung tissue samples with RNA sequencing data. Based on this limited sample size two of the target genes PABPC4 and STARD3 showed decreased expression with increased methylation (FDR=10%). Enrichment of meQTLs in DNA regulatory regions SNPs associated with complex diseases in GWAS or with eQTLs have been reported to be enriched in ENCODE-annotated regulatory regions2425. These include DNaseI hypersensitivity sites CCTC-binding factor (CTCF) binding sites and regions enriched in- active and repressive histone modification marks. The large number of meQTLs detected in our study both cis and trans enabled us to systematically investigate their enrichment in regulatory regions. We performed enrichment analysis using Chip-Seq data in small airway epithelial cells (SAEC) from the ENCODE project for histone marks26 CTCF occupancy27 and DNaseI hypersensitivity sites28; and histone marks in primary human alveolar epithelial cells (hAEC) from our own laboratory29. Compared to the œcontrol SNP set not associated with the methylation of CpG sites (with minor allele frequency and CpG probe density matched with meQTL SNPs) the meQTL SNPs were strongly enriched for sites of CTCF DNaseI hypersensitivity and histone marks (H3K4me3 H3K9-14Ac and H3K36me3) associated with active promoters enhancers and active transcription and to a lesser extent for the repressive mark H3K27me3 (Table 2). Enrichment of all regulatory regions became stronger with increasing significance of association with the exception of the H3K27me3 repressive mark (Fig. 3). Using SAEC CTCF ChIP data we found that meQTL SNPs or associated SNPs in high LD located within CTCF consensus sequences can affect allele-specific binding of CTCF (see two examples in Supplementary Fig. 3 and 4). Lung cancer risk SNPs affect methylation in human lung tissue To determine whether the identified meQTLs might provide functional annotation to the established genetic associations with lung cancer risks we examined SNPs in five genomic regions reported to be associated with lung cancer risk in genome-wide association studies (GWAS) of populations of European ancestry: 15q25.130“32 (CHRNA5-CHRNA3-CHRNB4) 5p15.33203334 6p21.3333 (BAT3 most strongly associated with squamous cell carcinoma or SQ) 12p13.335 (RAD52 for SQ) and 9p21.336 (CDKN2A/CDKN2B particularly for SQ). The GWAS SNPs at 15q25.1 were reported to be associated with total expression levels and multiple isoforms of CHRNA5 in normal lung tissue samples3738. The GWAS SNPs at the other four loci have not been reported to be associated with the total expression of nearby genes. Consistently we did not observe an association in RNA-seq data from TCGA lung normal tissue samples (n=59) although a detailed investigation of alternative promoters splice sites and allele-specific gene expression in larger studies is warranted. Here we investigated whether these SNPs contributed to lung cancer risk with epigenetic regulation by examining their associations with DNA methylation levels. The top GWAS SNPs located at 15q25.1 5p15.33 6p21.33 and 12p13.3 were all strongly associated with the methylation of the nearby CpG probes and the associations were replicated in TCGA lung data (Fig. 4). Importantly five of the six GWAS SNPs at these loci excluding the RAD52 locus were also the SNPs with the strongest association with the corresponding CpG probes. For the cg22937753 probe located in the RAD52 locus another SNP rs724709 with weak correlation with the GWAS SNP (r2=0.1) had the strongest association with meQTL. All involved CpG sites are located within gene bodies (which may affect gene splicing39) or the 3™UTR regions. No meQTL was detected for 9p21.3 (Supplementary Fig. 5) possibly because of fewer CpG dinucleotide probes available in this gene region on the Illumina platform. The location of these lung cancer GWAS-associated CpG sites might identify which genes within the relevant regions are more likely associated with the risk SNPs something that is particularly important for regions with complex LD structure as the MHC region on 6p21. In MHC two GWAS SNPs in complete LD (r2=1) rs3117582 (BAT3) and rs3131379 (MSH5) were most strongly associated with the methylation of CpG sites located nearby of MSH5 (involved in DNA mismatch repair and meiotic recombination process) suggesting that MSH5 (P=5.4—10?13 t-test) is more likely to be involved in lung carcinogenesis than BAT3 (P=8.8—10?5 t-test) or that the SNP closer to MSH5 (rs3131379) is more likely to be the SNP most responsible of the GWAS association with lung cancer risk (Fig. 4b). Our meQTL data also show that rs3131379 trans-regulated the methylation level of CpG probe cg12093005 located in the body of FBRSL1 at 12q24 (PEAGLE=4.0—10?9 PTCGA=7.2—10?4 and Pcombined=5. 4—10?11 t-test). Thus this known GWAS locus might affect lung cancer risk through a gene located on a different chromosome. Of note on the 15q25.1 locus two independent lung cancer risk SNPs rs2036534 and rs1051730 were associated with CpG probes not linked with CHRNA5 expression. In Supplementary Fig. 6 we show that the two SNPs jointly regulated another methylation probe cg22563815 within the CHRNA5 promoter which is associated with CHRNA5 expression. This extends and further confirms the complex regulatory pattern with multiple SNPs previously observed for this locus35. Most subjects in the analyses were smokers (n=206). Adjustment for smoking status (former and current) or intensity (pack/years) did not change the results. cis-meQTLs are enriched in lung squamous cell carcinoma risk We investigated whether the identified cis-meQTL SNPs were enriched in the National Cancer Institute (NCI) lung cancer GWAS including 5739 cases and 5848 controls of European ancestry19. To focus on potentially new genetic risk associations we excluded the top lung cancer GWAS SNPs mentioned above and their surrounding regions. We tested the enrichment by examining whether the GWAS P-values for the LD-pruned cis-meQTL SNPs deviated from the uniform distribution i.e. no enrichment. When all cis-meQTL SNPs were analyzed together we detected a strong enrichment for overall lung cancer risk (P<10?4 based on 10000 permutations) which was primarily driven by the enrichment in SQ (P<10?4 based on 10000 permutations) (Fig. 5a). The genomic control ?-values based on genome-wide SNPs showed that the type-I error rates of our enrichment test were not inflated (?=1.01 and 1.00 for overall lung cancer and SQ respectively). Stratified analyses further refined the enrichment to the cis-meQTL SNPs regulating CpG-sites mapping to north shore (Fig. 5b) and gene body (Fig. 5c) regions (see Supplementary Fig. 7 for the quantile-quantile plot). These gene bodies and north shores were enriched for genes involved in cancer pathways (P=2.5—10?4 Fisher™s exact test) and particularly those in NSCLC pathway (e.g. AKT1 MAPK1 RASSF5 etc. Supplementary Table 4). In contrast cis-meQTLs related with CGI regions or promoters were not enriched with the risk of overall lung cancer or any lung cancer subtype further emphasizing the need to comprehensively study the methylome to identify functional mechanisms for GWAS findings and identify new genetic loci. "
Lung_Cancer
"Methods: We updated a case“cohort study nested within a cohort of 267?400 female textile workers in Shanghai China. We compared exposure histories of 1456 incident lung cancers cases diagnosed during 1989“2006 with those of a reference subcohort of 3022 workers who were free of lung cancer at the end of follow-up. We applied Cox proportional hazards modelling to estimate exposure“response trends adjusted for age and smoking for cumulative exposures lagged by 010 and 20 years and separately for time windows of ?15 and >15 years since first exposure. Results: We observed no associations between cumulative exposure and lung cancer irrespective of lag interval. In contrast analyses by exposure time windows revealed modestly elevated but not statistically significant relative risks (?1.27) at the highest three exposure quintiles for exposures that occurred >15 years since first exposure. Conclusions: The findings do not support a protective effect of endotoxin but are suggestive of possible lung cancer promotion with increasing time since first exposure. endotoxin lipopolysaccharide lung cancer epidemiology textile industry occupational health Br J Cancer Br. J. Cancer British Journal of Cancer 0007-0920 1532-1827 Nature Publishing Group 24651386 3992504 bjc2014146 10.1038/bjc.2014.146 Clinical Study A multicentre randomised controlled trial of reciprocal lung cancer peer review and supported quality improvement: results from the improving lung cancer outcomes project Improving lung cancer outcomes project results Russell G K 1 Jimenez S 1 Martin L 1 Stanley R 2 Peake M D 1 3 Woolhouse I 1 4 * 1Clinical Standards Department Royal College of Physicians London NW14LE UK 2Clinical Audit Support Unit NHS Information Centre for Health and Social Care Leeds LS16AE UK 3Department of Respiratory Medicine Glenfield Hospital Leicester LE39QP UK 4Department of Respiratory Medicine Queen Elizabeth Hospital Birmingham Birmingham B152WB UK *E-mail: ian.woolhouseuhb.nhs.uk 15 04 2014 20 03 2014 110 8 1936 1942 19 12 2013 11 02 2014 24 02 2014 Copyright 2014 Cancer Research UK 2014 Cancer Research UK From twelve months after its original publication this work is licensed under the Creative Commons Attribution-NonCommercial-Share Alike 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-sa/3.0/ Background: Results from the National Lung Cancer Audit demonstrate unexplained variation in outcomes. Peer review with supported quality improvement has been shown to reduce variation in other areas of health care but has not been formally tested in cancer multidisciplinary teams. The aim of the current study is to assess the impact of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working on lung cancer process and outcome measures. Methods: English lung cancer teams were randomised to usual care or facilitated reciprocal peer review visits followed by 12 months of supported quality improvement. The primary outcome was change in the following national audit indicators; mulitdisciplinary team discussion histological confirmation active treatment surgical resection small-cell chemotherapy and specialist nurse review. Patient experience was measured using a new lung cancer patient questionnaire in the intervention group. Results: Thirty teams (31 trusts) entered the intervention group and 29 of these submitted a total of 67 quality improvement plans. Active treatment increased in the intervention group (n=31) by 5.2% compared with 1.2% in the control group (n=48 mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining audit indicators improved similarly in all groups. Mean patient experience scores in the intervention group did not change significantly during the study but a significant improvement was seen in the scores for the five teams with the worst baseline scores (0.86 to 0.22 P<0.001). Conclusions: Reciprocal peer review with supported quality improvement was feasible and effective in stimulating quality improvement activity but resulted in only modest improvements in lung cancer treatment rates and patient experience. lung cancer multidisciplinary quality improvement peer Lung cancer is the commonest cause of cancer death in England and Wales with around 38?000 cases diagnosed each year and ?35?000 deaths. Data from the National Lung Cancer Audit (NLCA) demonstrate significant variation in process and outcome measures across England. In 2009 there was a three-fold difference in survival and active treatment rates which persisted following case mix adjustment (Beckett et al 2012). Furthermore reported lung cancer outcomes in the UK are worse than other comparable European countries (Walters et al 2013) and have improved little in recent years (Khakwani et al 2013). It has been estimated that if survival rates were increased to that of the best in Europe around 1300 lives could be saved each year in the United Kingdom (Abdel-Rahman et al 2009). Variation in health care is not unique to lung cancer and addressing unwarranted variation is challenging (Wise 2010). Although external regulation may have a role in some areas this approach is more difficult to apply to the complex pathways involved in lung cancer diagnosis and treatment. Peer review with supported quality improvement offers a promising alternative but the evidence for its effectiveness is limited. The Washington State's Surgical Care and Outcomes Assessment Program utilised a peer support programme to share the best practice which led to a significant reduction in post-operative complications (Kwon et al 2012). Within the United Kingdom the national COPD resources and outcomes project demonstrated that reciprocal peer-to-peer review led to only limited quantitative differences in the quality of services offered (Roberts et al 2012). A qualitative analysis of this study identified a number of barriers to improvement including difficulties in establishing effective working relationships funding changes and service re-design. In 2003 the Institute for Healthcare Improvement described the collaborative model to achieve a breakthrough improvement (Institute for Healthcare Improvement 2003). Collaboratives allow teams working on the same issue to share good practice and innovation permitting others to take these ideas and implement them in the context of their own anisation resources and case mix. Pronovost et al (2006) successfully employed this collaborative approach together with supported quality improvement to implement five evidence-based interventions on the intensive care unit resulting in the reduction in catheter-related bloodstream infections to zero. These studies offer a persuasive proof of concept but the absence of a control group or of patient-specific outcomes measures limits their implementation in other disease areas such as cancer. The aim of the current study is to determine whether a programme of reciprocal peer-to-peer review visits with supported quality improvement and collaborative working can significantly improve lung cancer process and outcome measures and thus reduce unwarranted variation in outcomes. Materials and methods Study design We conducted a prospective randomised controlled trial. Study population One hundred and sixty-two English NHS trusts were identified from the 2008 NLCA annual report. Centres only providing treatment (not diagnostics) orthopaedic hospitals and ambulance trusts were excluded. Invitations to participate were sent to the remaining 152 trusts. Trusts who agreed to participate and who had 2008 NLCA case ascertainment rates of > 50% expected were paired before randomisation on the basis of contrasting results for four key indicators from the NLCA. The indicators were active treatment rates surgical resection rates median survival and the proportion of patients assessed by a clinical nurse specialist. Each trust was colour coded for each indicator red if below the national average and green if above. By placing each trust with its colour-coded indicators on a map we were able to pair trusts on the basis of a contrasting mixture of red and green indicators and a travel time between centres of around 2?h. On the basis of data from the national COPD resources and outcomes project we determined that we would be able to complete 30 peer review visits during the lifetime of the project thus allowing 30 lung cancer multidisciplinary teams (15 pairs) to be randomised into the intervention arm. Randomisation was performed in a blinded fashion by assigning a random number to each pair of trusts and then allocating pairs numbered 1“15 to the intervention group. The remaining trusts formed either the control group (if they had agreed to participate) or the non-participant group and had no further contact with the study team but continued to submit data to the NLCA as usual. Intervention The study timeline is shown in Figure 1. Following introductory workshops the multidisciplinary teams within each pair undertook facilitated reciprocal site visits. The visits consisted of observation of the host team's multidisciplinary team meeting three discussion sessions focusing on the functioning of the mulitdisciplinary team meeting the host team's NLCA data and patient experience questionnaire results. The final session aimed to identify the focus of improvement work to be undertaken by the host team. The quality improvement facilitator introduced a structured template for the quality improvement plans and provided a short introduction to using the model of improvement to guide implementation of the plans. Over the next 12 months the quality improvement facilitator provided support via electronic mail telephone and follow-up visits where required. Teams within the intervention group supported each other via mini-collaboratives in the form of web-based teleconferences and two face-to-face workshops. Outcomes Changes in process and outcome were assessed using data from local quality-improving plans and the following indicators from the NLCA: the proportion of patients discussed at a multidisciplinary team meeting histological confirmation rate active treatment rate surgical resection rate the proportion of patients with small-cell lung cancer receiving chemotherapy and the proportion of patients seen by a lung cancer nurse specialist. Patient experience was assessed in the intervention group using a new lung cancer-specific patient experience questionnaire designed in collaboration with the Roy Castle Lung Cancer Foundation. The questionnaire included 11 questions selected with permission from the previously validated 2004 national cancer patient survey. The questions covered the following domains: communication privacy respect and dignity and three free text questions (see Appendix I). Participating teams were asked to distribute 30 questionnaires to patients recently seen in their services. The clinical nurse specialists distributed the questionnaires to patients who anonymously returned them to the Royal College of Physicians. An independent qualitative ethnographic evaluation of the study was undertaken by the Social Science Applied to Healthcare Improvement Research Group at the University of Leicester. Statistical methods Data were tested for normality using the Shapiro“Wilk test. Baseline NLCA indicators were taken from the 2009 NLCA report and the intervention control and non-participant groups were compared using a ?2- test. The changes in NLCA indicators from 2009 to 2011 were compared using an independent t-test. Patient experience questionnaire responses for each question were labelled and re-coded to separate them into the worst patient experience category (score 1) vs all other responses (score 0). These scores were then summated to create a domain and a total patient experience score with a possible range of 0“11 whereby a higher score indicates a worse patient experience. Analyses were performed using the statistical software package SPSS (International Business Machines Corp. Armonk NY USA). Funding and ethics The study was funded by a ˜Closing the Gap' grant from the Health Foundation. The National Research Ethics Service confirmed that the study was service evaluation and quality improvement and did not require ethical review. Results One hundred trusts (66%) replied to the invitation to participate and 91 (61%) agreed to participate in the study. Eighty-one trusts had 2008 NLCA data of sufficient quality to allow pairing. Two trusts provided a joint multidisciplinary team allowing 40 pairs of multidisciplinary teams to be created. One pair agreed to act as a pilot and was excluded from further analysis. Of the remaining 39 pairs 15 pairs (31 trusts) were randomised to the intervention group. The remaining 24 pairs formed the control group. During the study two trusts in the control group amalgamated to form one trust so the total number of trusts in the control group was 47 (Figure 2). Quality improvement plans Two hundred and thirty medical professionals from 31 trusts participated in the review visits. Twenty-nine teams submitted a total of 67 quality improvement plans. The issues identified in the quality improvement plans are shown in Table 1. Eighteen teams collected local data to measure impact. An example of such data is shown in Figure 3. This trust identified small-cell lung cancer chemotherapy as an area for improvement. They introduced a number of changes to their diagnostic and treatment pathways including prioritisation of small-cell pathology reporting faxing of the results to the multidisciplinary team coordinator and lung nurse specialist to allow early booking of oncology appointments. These changes were monitored using a run chart that demonstrated a reduction in the time from multidisciplinary team meeting to chemotherapy treatment and an increase in the proportion of small-cell lung cancer patients receiving chemotherapy from 60% in 2009 to 71% in 2011. National lung cancer audit indicators Baseline (2009) NLCA indicators for the intervention control and non-participant groups were similar (Table 2). The mean change for each NLCA indicator from baseline to 2011 in the intervention and control group is shown in Figure 4. The proportion of patients receiving active anti-cancer treatment in the intervention group increased by 5.2% compared with 1.2% in the controls (mean difference 4.1% 95% CI ?0.1 to 8.2% P=0.055). The remaining NLCA indicators improved similarly both in the intervention and control groups. Patient experience In the intervention group patient experience questionnaires were returned by 438 patients from 30 multidisciplinary teams at baseline (return rate 49%) and 372 patients from 27 trusts following the intervention (return rate 41%). Baseline total scores were low (0“1.31) indicating high levels of patient satisfaction with the care received although there was a statistically significant (P<0.001) variation in results by the multidisciplinary team (Figure 5). In particular the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' varied significantly by 57%“100% (P<0.001). The total questionnaire scores did not change significantly during the study (0.22“0.17 P=0.377) however the variation by the multidisciplinary team reduced (Figure 5). Given that the study aimed to bring the standard of the lower performing trusts to that of the best we performed a post hoc analysis for the five trusts with the worst baseline patient experience scores. This demonstrated that the mean total score improved significantly for these trusts from 0.86 to 0.22 P<0.001. The biggest improvement in this group was seen in the proportion of patients responding yes to the question ˜did you find that the person who told you about your diagnosis did so with sufficient sensitivity/care?' which increased from 75% to 90% (P=0.05). One multidisciplinary team in this group achieved this improvement by using their baseline questionnaire results as a lever to encourage attendance at an advanced communications skills course. "
Lung_Cancer
"Human Genome Variation Society (HGVS) (Human Genome Variation Society (HGVS) 2014). For example we considered that it was not acceptable to report the amino acid change only as redundancy in the genetic code means that different changes at the nucleotide level can result in the same change at the amino acid level. In the results of this EQA scheme suggest that the technical quality of EGFR mutational analysis could be improved as evidenced from a high level of diagnostic errors. Overall the standard of reporting was acceptable. These findings also underline the importance of EQA as a mechanism to reveal errors in methodology and to ensure an adequate quality of molecular testing. Regular participation in EQA should be seen as a routine part of the diagnostic testing process for all labs helping to improve and standardise their processes. We have established a model for a robust and scalable EQA that can contribute to global optimisation and improvements in the overall quality of EGFR testing for patients with NSCLC. We thank the laboratories for their participation in this study. We also thank AstraZeneca for the provision of an unrestricted grant to allow the development to the scheme; and Horizon Diagnostics for their support in quantitative validation of the materials. Dr Normanno is supported by a grant from Associazione Italiana per la Ricerca sul Cancro (AIRC). Supplementary Information accompanies this paper on British Journal of Cancer website (http://www.nature.com/bjc) The authors declare no conflict of interest. Angulo B Garcia-Garcia E Martinez R Suarez-Gauthier A Conde E Hidalgo M Lopez-Rios F 2010 A commercial real-time PCR kit provides greater sensitivity than direct sequencing to detect KRAS mutations: a morphology-based approach in colorectal carcinoma J Mol Diagn 12 292 299 20203003 Bellon E Ligtenberg MJ Tejpar S Cox K de Hertogh G de Stricker K Edsjo A Goulis V Hofler G Jung A Kotsinas A Laurent-Puig P Lopez-Rios F Hansen TP Rouleau E Vandenberghe P van Krieken JJ Dequeker E 2011 External quality assessment for KRAS testing is needed: setup of a European program and report of the first joined regional quality assessment rounds Oncologist 16 467 478 21441573 Deans ZC Bilbe N O'Sullivan B Lazarou LP de Castro DG Parry S Dodson A Taniere P Clark C Butler R 2013 Improvement in the quality of molecular analysis of EGFR in non-small-cell lung cancer detected by three rounds of external quality assessment J Clin Pathol 66 319 325 23378269 Deans ZC Tull J Beighton G Abbs S Robinson DO Butler R 2011 Molecular genetics external quality assessment pilot scheme for KRAS analysis in metastatic colorectal cancer Genet Test Mol Biomarkers 15 777 783 21851273 De Luca A Normanno N 2010 Predictive biomarkers to tyrosine kinase inhibitors for the epidermal growth factor receptor in non-small-cell lung cancer Curr Drug Targets 11 851 864 20388064 European Molecular Genetics Quality Network (EMQN)2014EMQN home page. Available at http://www.emqn. (accessed 18 January 2014). Fukuoka M Wu YL Thongprasert S Sunpaweravong P Leong SS Sriuranpong V Chao TY Nakagawa K Chu DT Saijo N Duffield EL Rukazenkov Y Speake G Jiang H Armour AA To KF Yang JC Mok TS 2011 Biomarker analyses and final overall survival results from a phase III randomized open-label first-line study of gefitinib versus carboplatin/paclitaxel in clinically selected patients with advanced non-small-cell lung cancer in Asia (IPASS) J Clin Oncol 29 2866 2874 21670455 Hindson BJ Ness KD Masquelier DA Belgrader P Heredia NJ Makarewicz AJ Bright IJ Lucero MY Hiddessen AL Legler TC Kitano TK Hodel MR Petersen JF Wyatt PW Steenblock ER Shah PH Bousse LJ Troup CB Mellen JC Wittmann DK Erndt NG Cauley TH Koehler RT So AP Dube S Rose KA Montesclaros L Wang S Stumbo DP Hodges SP Romine S Milanovich FP White HE Regan JF Karlin-Neumann GA Hindson CM Saxonov S Colston BW 2011 High-throughput droplet digital PCR system for absolute quantitation of DNA copy number Anal Chem 83 8604 8610 22035192 Human Genome Variation Society (HGVS)2014Nomenclature for the description of sequence variants. Available at http://www.hgvs./mutnomen/ (accessed 18 January 2014). International anisation for Standardization (ISO)2012ISO 15189:2012 Medical laboratories”requirements for quality and competence. Available at http://www.iso./iso/home/store/catalogue_ics/catalogue_detail_ics.htm?csnumber=56115 (accessed 18 January 2014). Linardou H Dahabreh IJ Kanaloupiti D Siannis F Bafaloukos D Kosmidis P Papadimitriou CA Murray S 2008 Assessment of somatic k-RAS mutations as a mechanism associated with resistance to EGFR-targeted agents: a systematic review and meta-analysis of studies in advanced non-small-cell lung cancer and metastatic colorectal cancer Lancet Oncol 9 962 972 18804418 Lopez-Rios F Angulo B Gomez B Mair D Martinez R Conde E Shieh F Tsai J Vaks J Current R Lawrence HJ Gonzalez de Castro D 2013 Comparison of molecular testing methods for the detection of EGFR mutations in formalin-fixed paraffin-embedded tissue specimens of non-small cell lung cancer J Clin Pathol 66 381 385 23386666 Maemondo M Inoue A Kobayashi K Sugawara S Oizumi S Isobe H Gemma A Harada M Yoshizawa H Kinoshita I Fujita Y Okinaga S Hirano H Yoshimori K Harada T Ogura T Ando M Miyazawa H Tanaka T Saijo Y Hagiwara K Morita S Nukiwa T 2010 Gefitinib or chemotherapy for non-small-cell lung cancer with mutated EGFR N Engl J Med 362 2380 2388 20573926 Mitsudomi T Morita S Yatabe Y Negoro S Okamoto I Tsurutani J Seto T Satouchi M Tada H Hirashima T Asami K Katakami N Takada M Yoshioka H Shibata K Kudoh S Shimizu E Saito H Toyooka S Nakagawa K Fukuoka M 2010 Gefitinib versus cisplatin plus docetaxel in patients with non-small-cell lung cancer harbouring mutations of the epidermal growth factor receptor (WJTOG3405): an open label randomised phase 3 trial Lancet Oncol 11 121 128 20022809 Mok TS Wu YL Thongprasert S Yang CH Chu DT Saijo N Sunpaweravong P Han B Margono B Ichinose Y Nishiwaki Y Ohe Y Yang JJ Chewaskulyong B Jiang H Duffield EL Watkins CL Armour AA Fukuoka M 2009 Gefitinib or carboplatin-paclitaxel in pulmonary adenocarcinoma N Engl J Med 361 947 957 19692680 Normanno N De Luca A Bianco C Strizzi L Mancino M Maiello MR Carotenuto A De Feo G Caponigro F Salomon DS 2006 Epidermal growth factor receptor (EGFR) signaling in cancer Gene 366 2 16 16377102 Normanno N Pinto C Taddei G Gambacorta M Castiglione F Barberis M Clemente C Marchetti A 2013 Results of the First Italian External Quality Assurance Scheme for somatic EGFR mutation testing in non-small-cell lung cancer J Thorac Oncol 8 773 778 23575414 Rosell R Carcereny E Gervais R Vergnenegre A Massuti B Felip E Palmero R Garcia-Gomez R Pallares C Sanchez JM Porta R Cobo M Garrido P Longo F Moran T Insa A De Marinis F Corre R Bover I Illiano A Dansin E de Castro J Milella M Reguart N Altavilla G Jimenez U Provencio M Moreno MA Terrasa J Munoz-Langa J Valdivia J Isla D Domine M Molinier O Mazieres J Baize N Garcia-Campelo R Robinet G Rodriguez-Abreu D Lopez-Vivanco G Gebbia V Ferrera-Delgado L Bombaron P Bernabe R Bearz A Artal A Cortesi E Rolfo C Sanchez-Ronco M Drozdowskyj A Queralt C de Aguirre I Ramirez JL Sanchez JJ Molina MA Taron M Paz-Ares L 2012 Erlotinib versus standard chemotherapy as first-line treatment for European patients with advanced EGFR mutation-positive non-small-cell lung cancer (EURTAC): a multicentre open-label randomised phase 3 trial Lancet Oncol 13 239 246 22285168 Sharma SV Bell DW Settleman J Haber DA 2007 Epidermal growth factor receptor mutations in lung cancer Nat Rev Cancer 7 169 181 17318210 Thunnissen E Bovee JV Bruinsma H van den Brule AJ Dinjens W Heideman DA Meulemans "
Lung_Cancer
" In another study by the same group a set of different miRNAs could be used to differentiate hepatocellular carcinomas from metastatic tumors in the liver [25]. miRNA expression differs between tumor types within the same tumor type in different patients and between primary tumors and metastases. Hence it may not be surprising to find miR-182 to have divergent impact in different stages of NSCLC. Increasing evidence demonstrate that adenocarcinomas and SCC of the lung are separate lung cancer entities have dissimilar features and may respond differently to therapy. Targeted drugs with specific effects in certain histological subgroups have been developed. Certain miRNA-signatures can differentiate SCC from non-SCC and may facilitate the distinction between them [26]. Demonstrating a significant prognostic effect by miR-182 in SCC and not in adenocarcinomas underscores the diversity between the histological subgroups. In a previous published paper from our group [27] we explored the impact of miR-155 in the same cohort. We found this miRNA to be very stage- and tissue specific with a significant impact on survival only in node positive SCC patients. miR-182 has been regarded as an oncogene in most contexts. In a cohort of 253 glioma patients high miR-182 expression was found to be a negative prognostic factor [12]. In melanoma cell lines Segura and coworkers showed that high miR-182 expression stimulated migration and survival. The same group treated liver metastases in mice with anti-miR-182 and obtained a lower tumor burden and a lower mir-182-level than in untreated mice [1328]. Also in breast tumors and cervical cancers miR-182 seems to have an oncogenic impact [2930]. There are other studies that have identified miR-182 as a tumor suppressor. Kong et al. found miR-182 to be underexpressed in human gastric cancer cell lines. They showed that the oncogene cAMP responsive element binding protein 1 (CREB1) is a target of miR-182 and that high levels of miR-182 leads to lower levels of CREB1 and suppressed gastric adenocarcinoma cell growth [31]. In melanoma cell lines Poell et al. found miR-182 to be a strong inhibitor of cell proliferation [14]. Yan and coworkers found similar effects in uveal melanoma cells where they identified MITF BCL2 and cyclin D2 as potential targets of miR-182. Transfection of miR-182 into cultured uveal melanoma cells led to a significant decrease in cell growth migration and invasiveness [16]. In lung cancer data on miR-182 have been conflicting regarding its prognostic role. In 70 lung cancer tissue samples Zhu and coworkers observed an association between high expression of the members of the miR-183 family (miR-96 miR-182 and miR-183) and poor overall survival [11]. In contrast two in vitro studies using cell lines did not support the notion of miR-182 exerting an oncogene role in lung cancer. Sun et al. found miR-182 through regulation of RGS17 to suppresses lung tumorigenesis [15]. Consistently Zhang and coworkers reported miR-182 to inhibit proliferation and invasion of human lung adenocarcinoma cells via its effect on human cortical actin-associated protein (CTTN) [32]. miR-182 has a number of target genes and it is evident that the regulation of these genes can result in both inhibition and stimulation of tumorigenesis. In NSCLC our results suggest that tumor inhibiting miR-182 features dominate and thus make this miRNA a favorable prognostic factor. Based on the association with angiogenesis suggested from the GSEA [17] we investigated the correlation between miR-182 and a set of angiogenesis-related protein markers. There was a negative correlation between miR-182 and FGF2. Our group has published data on FGF2 which identify this marker as an independent negative prognostic factor in lung cancer cells [22]. Fibroblast growth factor receptor substrate 2 (FRS2) is a downstream mediator of the fibroblast growth factor pathway and is a target gene of miR-182. FRS2 is thought to induce tumor progression through stimulation of angiogenesis [1733]. In our total NSCLC cohort the coexpression between miR-182 and FGF2 showed an independent significantly worse prognosis for low miR-182/high FGF2 than for high miR-182/low FGF2 (P?=?0.015 ). A correlation was also detected between miR-182 and MMP-7. In a previous paper our group found high MMP-7 expression to be an independent favorable prognostic factor in this same NSCLC cohort [23]. When examining coexpression of the two variables those with high miR-182 and high MMP-7 expression had an independently better survival than those with low miR-182/low MMP-7 expression (HR 0.49 P?=?0.015). When stratifying on histology the SCC patients with high/high expression had a remarkably better prognosis than the rest of the groups (HR 0.26 P?=?0.012 ). To our knowledge there are no published data linking miR-182 and MMP-7. Few studies have described the connection between FGF2 and MMP-7 [3435]. Based on our strong results from the co-variations between miR-182 and particularly MMP-7 it would be interesting to see functional studies exploring potential relations between these two markers. In our previous pilot study on miRNA signatures [17] miR-182 appeared as an oncogene since it was up-regulated in short vs long term NSCLC survivors and in NSCLC vs normal tissues. In our large unselected NSCLC cohort presented herein we surprisingly observed that high miR-182 expression is associated with improved survival at least in subgroups of patients with NSCLC. It has to be kept in mind that the explorative study was based on a small sample only 20 NSCLC cases and 10 normal lung tissues. Hence the contrasting results may be due at least in part to selection bias in the explorative study. Besides in the present study the favorable prognostic impact by miR-182 was seen in subgroups of NSCLC patients and assessments were tissue specific (only in tumor cells) using in situ hybridization and not real time qPCR as in the pilot study [17]. When using qPCR a contribution from the stromal compartment will influence the result and the stromal expression of miR-182 may be different from that of the tumor cells. Conclusion In miR-182 tended to be a favorable prognostic factor in the total NSCLC cohort. Moreover in stage II and in SCC patients we found miR-182 to have tumor suppressor properties. Nevertheless our study must be regarded as hypotheses generating and needs to be confirmed in other cohorts and functional studies. We found a weak but significant association between mir-182 and the angiogenesis related markers FGF2 and MMP-7. It would be interesting to see further studies exploring these associations. Competing interests The authors declare that they have no competing interests. Authors™ contributions HS participated in the design of the study contributed to the clinical and demographic database did the statistical analysis and drafted the manuscript. TD SA and SAS contributed to the clinical and demographic database and SAS in making the TMAs. TD and SA contributed to the statistical analysis. SAS and HS scored the cores. RMB and LTB supervised and participated in the study design result interpretation and writing. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/138/prepub Acknowledgements The study was solely funded by the Northern Norway Regional Health Authority (Helse Nord RHF) which is responsible for the public hospitals in northern Norway. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. The authors thank the engineers Mona I Pedersen and Marta Uso who carried out the ISH-procedures. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 Drilon A Rekhtman N Ladanyi M Paik P Squamous-cell carcinomas of the lung: emerging biology controversies and the promise of targeted therapy Lancet Oncol "
Lung_Cancer
"Results Exceptional response to an IGF-1R inhibitor A 50 year-old female with stage IV lung adenocarcinoma received standard first line platinum-based chemotherapy. She then enrolled in a clinical trial of erlotinib followed at progression by erlotinib plus an IGF-1R monoclonal antibody (MAb). At the time of enrollment her tumor mutation status was unknown. She developed progressive disease after 1 month of erlotinib (Fig. 1ab). Per protocol the IGF-1R MAb was added and she then experienced a partial response lasting 17 months (Fig. 1c). She remained on this treatment longer than any other patient enrolled in the trial. At the time of progression on erlotinib plus the IGF-1R MAb her tumor was sent for molecular profiling. As expected based on the lack of response to erlotinib the tumor did not contain an EGFR mutation (Supplementary ); surprisingly it was found to harbor an ALK rearrangement. Subsequently she enrolled in the phase III trial of crizotinib versus chemotherapy and was randomized to pemetrexed. After four cycles she had disease progression (Fig. 1e) was started on crizotinib per protocol and had a partial response (Fig. 1f). Previous studies have reported a 0% response rate for ALK+ lung cancer patients treated with erlotinib alone8. Thus we hypothesized that in this patient either the combination of erlotinib plus the IGF-1R inhibitor was synergistic against ALK+ lung cancer or the IGF-1R inhibitor alone was somehow responsible for the tumor response. To address this hypothesis we treated H3122 cells which harbor an EML4-ALK E13;A20 fusion with erlotinib an IGF-1R inhibitor or the combination. We observed no therapeutic synergism between erlotinib and the IGF-1R inhibitors (Supplementary Fig. 1ab) suggesting that this patient's tumor response was more likely due to the IGF-1R antibody. Based on this clinical observation we hypothesized that there is cross-talk between IGF-1R and ALK which may be exploited therapeutically to improve anti-tumor responses. Therapeutic synergism between ALK and IGF-1R inhibitors We tested the ability of IGF-1R inhibitors alone or in combination with ALK inhibitors to impede the growth of ALK+ lung cancer cells. The IGF-1R specific MAb MAb391 had modest but reproducible single agent activity in H3122 cells. However MAb391 sensitized H3122 cells to the anti-proliferative effects of crizotinib (Fig. 2a). When IGF-1R was inhibited with MAb391 sensitivity to crizotinib was also enhanced in STE-1 (EML4-ALK E13;A20) cells a novel lung adenocarcinoma cell line we developed from a patient with ALK+ lung cancer (Supplementary Fig. 1c). Similar results were also seen when H3122 cells were treated with the dual IGF-1R/insulin receptor TKI OSI-906 plus crizotinib (Fig. 2b). We extended this finding to other ALK+ lung cancer cell lines including H2228 (EML4-ALK E6a/b;A20) (Fig. 2c) and STE-1 (Fig. 2d). Co-treatment with an ALK TKI plus an IGF-1R TKI also induced better anti-tumor responses in SUDHL-1 lymphoma cells which harbor an NPM-ALK fusion suggesting that this effect is not specific to ALK-mutant lung cancer (Supplementary Fig. 1e). The combination of crizotinib plus OSI-906 was confirmed to be synergistic using the Mix-Low method9 (Supplementary Fig. 1d). OSI-906 has no off-target activity against ALK at the doses used in these experiments10. Compared to crizotinib alone the combination of crizotinib plus OSI-906 resulted in increased levels of apoptosis (Fig. 2e) and decreased phosphorylation of downstream targets (Fig. 2f). Furthermore the combination of crizotinib plus MAb391 was more effective at delaying the growth of ALK+ xenografts (Supplementary Fig. 1f). Collectively these data show that the combination of ALK plus IGF-1R inhibitors results in an enhanced anti-tumor response in ALK+ lung cancer cells. To ascertain the specificity of this effect we examined whether inhibitors of other tyrosine kinases could produce analogous results. Neither the EGFR inhibitor erlotinib (Supplementary Fig. 1g) nor the dual HER2/EGFR inhibitor lapatinib (Supplementary Fig. 1h) was able to sensitize H3122 cells to the effects of crizotinib. These data suggest that the synergistic anti-proliferative effect described above is specific to IGF-1R blockade. To assess if ligand induced activation of IGF-1R could influence the anti-proliferative effects of ALK blockade we treated H3122 cells with crizotinib alone or in combination with IGF-1. Addition of IGF-1 induced resistance to the growth inhibitory effects of crizotinib (Fig. 3a). IGF-1 ligand stimulated phosphorylation of IGF-1R but not ALK (Fig. 3b and Supplementary Fig. 2a) suggesting no direct cross-talk between the two kinases. When cells pre-treated with crizotinib were stimulated with IGF-1 ALK phosphorylation was inhibited; however downstream signaling was sustained as evidenced by continued phosphorylation of AKT (Fig. 3b). OSI-906 was able to inhibit this response. Taken together these data suggest that signaling through IGF-1R may be a compensatory mechanism for the growth inhibitory effects of ALK inhibitor therapy. IRS-1 knock-down impedes growth of ALK+ lung cancer cells We investigated molecular mechanisms underlying the cooperative anti-tumor response between ALK and IGF-1R inhibitors. IRS-1 is a well-known substrate and adaptor protein for IGF-1R11 and IRS-1 has been demonstrated to be a primary adaptor for PI3K activation in H3122 cells12. However the precise mechanism whereby ALK fusion proteins link to effector pathways remains undefined. We observed that IRS-1 levels decreased with crizotinib treatment (Fig. 3b). Using lysates from H3122 cells we found that ALK and IRS-1 co-immunoprecipitated and that the interaction decreased after the addition of crizotinib (Fig. 3c). We also validated that this interaction occurs in vivo using tissue from two different EML4-ALK E13;A20 transgenic mice13 (Fig. 3d). Next we hypothesized that if IRS-1 is an adaptor protein for ALK then knock-down of IRS-1 would sensitize cells to the effects of ALK inhibition. Consistent with our hypothesis IRS-1 knock-down sensitized STE-1 cells to the effects of crizotinib (Fig. 3e). Levels of phosphorylated AKT S6 and ERK were lower in IRS-1 siRNA transfected crizotinib treated cells compared to crizotinib treated controls. Finally IRS-1 knockdown impaired the proliferation of STE-1 cells in the absence of crizotinib and also sensitized these cells to the anti-proliferative effects of ALK inhibition (Fig. 3fg). Analogous results were seen in H2228 cells (Supplementary Fig. 3ab). Taken together these data suggest that IRS-1 is an adaptor protein which links both IGF-1R and ALK to downstream signaling pathways. IGF-1R pathway up-regulation in ALK TKI resistant cells Starting with drug sensitive (˜parental™) cells we derived H3122 cells that were resistant to crizotinib (Fig. 4a) or to X-376 (Fig. 4b) a more potent and more specific ALK inhibitor14. Notably a derivative of X-376 (X-396) is currently in phase I clinical trials (NCT01625234). We analyzed these resistant cell lines by a variety of methods. H3122 crizotinib-resistant cells (˜H3122 CR™) displayed amplification of the EML4-ALK E13;A20 fusion by ALK FISH (Supplementary Fig. 4ab) as previously described15. These cells did not have any ˜second-site™ ALK kinase domain mutations (data not shown). H3122 X376-resistant cells (˜H3122 XR™) harbored neither ALK amplification (Supplementary Fig. 4c) nor second-site mutations. However H3122 XR cells maintained phosphorylation of AKT S6 and ERK even in the continued presence of X-376 (Fig. 4c). We hypothesized that an alternative upstream kinase(s) must be activated in these cells in order to maintain signaling. Phospho-RTK arrays revealed an increase in IGF-1R phosphorylation (Supplementary Fig. 4d). Indeed IGF-1R phosphorylation and total protein levels were elevated in the ALK-TKI resistant compared to the ALK-TKI sensitive (i.e. ˜parental™) cells (Fig. 4c). H3122 XR cells also exhibited increased phosphorylation and total protein levels of IRS-1. Overall these results suggest that the IGF-1R/IRS-1 pathway plays a role in maintaining downstream signaling in the presence of continuous ALK inhibition and therefore may represent a mechanism whereby cells evade ALK blockade. Finally we sought to determine how IGF-1 signaling is up-regulated in ALK TKI resistant cells. IGF-1 ligand levels were increased in the conditioned media from H3122 XR cells (Supplementary Fig. 4d). Gene expression profiling revealed that IGF binding protein 3 (IGFBP3) was down regulated in resistant versus parental cells (Supplementary Tables 2 and 3). "
Lung_Cancer