Datasets:
ManuelAlv
/
Cancer

Dataset card Data Studio Files Community
1
input
stringlengths
600
32.7k
label
stringclasses
3 values
" in Japanese families [19]. A FTSJ2 locus in the genome gene amplification and mRNA over-expression were discovered in several non-small cell lung cancer (NSCLC) tissue samples [20] and FTSJ3 was revealed to function in pre-rRNA processing [21] [22]. However little is known about these three homologs in mammals. Thus in this study we used E. coli RrmJ as a starting point to construct a phylogenetic tree containing several typological species and mammals which showed that FTSJ2 is an ortholog of RrmJ. Based on the highly conserved FTSJ2 protein sequences within mammals we established the basic characteristics of FTSJ2 and its gene expression during the heat shock response in different porcine tissues and human cancer cells. Because previous studies have shown the abnormal expression of FTSJ2 in NSCLC we further investigated the functions of FTSJ2 in cell invasion and migration using human lung adenocarcinoma and rhabdomyosarcoma cell lines. Materials and Methods Phylogenetic Analysis of the E. coli RrmJ Homologs The RrmJ domain of 39 protein sequences and the three out-group proteins fibrillarin (PDB code: 1FBN) [10] [23] vaccinia VP39 (1AV6) [24] and catechol-O- methyltransferase (1VID) [25] which are structurally and functionally similar to E. coli RrmJ were used for the construction of a phylogenetic tree. The distance matrix was calculated using the JTT model. The minimum evolution (ME) method with 1000 bootstrap replicates was performed using the MEGA5 program (www.megasoftware.net/) [26]. The nodes of the tree with a bootstrapping support of >50% are shown. Database Search for RrmJ Homologs and the Multiple Sequence Alignment BLASTp was used to search the complete protein sequences in the non-redundant (nr) database at the National Center for Biotechnology Information (NCBI) website. Fourteen proteins from humans Methanococcus jannaschii and three invertebrate species were obtained using E. coli RrmJ as a query and an E-value of <3e-08 was defined as the cut-off value. Twenty-two vertebrate proteins were found using human FTSJ1 FTSJ2 and FTSJ3 as the queries and a 50% amino acid identity was defined as the cut-off value in this search. The putative RrmJ domains of the 38 protein sequences were aligned with that of E. coli RrmJ using ClustalW and were slightly adjusted according to their predicted secondary structures which were calculated using the PORTER query (distill.ucd.ie/porter/) [27]. The Animals and the Heat Stress Treatment Twelve three-month-old female Landrace—Yorkshire crossbred (LYC) piglets were purchased from the Animal Industry Division of the Livestock Research Institute of the Council of Agriculture (COA) (Tainan Taiwan). The procedures used in this study were approved by the Institutional Animal Care and Use Committee (IACUC) of the COA Livestock Research Institute (Approval No. 98021). The piglets (n?=?4) were raised at 25°C and 60% humidity in animal houses which were equipped for temperature and humidity control [28] [29]. For the heat stress treatment the piglets that were raised at room temperature (25°C) were exposed to heat shock temperatures of 30°C or 35°C and maintained at 60% humidity for 1 week. The piglets were then sacrificed and tissue samples from 11 ans were isolated for total RNA extraction. Cell Culture The cancer cell lines of HepaG2 (ATCC No. HB-8065) TE671 (ATCC No. CCL-136) and A549 (ATCC No. CCL-185) were purchased from American Type Culture Collection (ATCC; Manassas VA USA). The lung adenocarcinoma CL1 sublines CL1-0 and CL1-5 were kindly provided by Dr. Jeremy J.W. Chen National Chung Hsing University Taichung Taiwan [30]. All of the cell lines were grown in Dulbecco™s Modified Eagle™s Medium (DMEM; Invitrogen Corp. Grand Island NY USA) containing high glucose (4500 mg/L) and supplemented with 10% fetal bovine serum (FBS) at 37°C and 5% CO2. At 80% confluence the cells were subcultured at a ratio of 1?3 to 1?5 and the medium was changed every three days as described previously [31] [32]. Heat Shock Treatment of the Cells In our heat shock response analysis the cancer cells that grew at 37°C and 5% CO2 were subjected to heat shock at 42°C or 45°C and 5% CO2 for 1 hour. After this heat shock treatment the cells were transferred to 37°C for 0 3 or 6 hours and then harvested for total RNA extraction. Cell Transfection via Electroporation The 6.74-kb pCMV-hFTSJ2-IRES2-DsRed plasmid was constructed by inserting the full-length human FTSJ2 (hFTSJ2) protein coding sequence into the EcoRI restriction site of the pIRES2-DsRed2 vector (Clontech Laboratories Inc. Mountain View CA USA). The TE671 and HepG2 cell lines were transfected with this plasmid via electroporation with a BTX ECM2001 system (BTX Holliston MA USA). Briefly 6—106 TE671 or 2—107 HepG2 cells were suspended in 400 µL of DMEM which contained 5 µg or 50 µg of plasmid DNA respectively and then the cells were subjected to electroporation at 200 V for 4 msec or 100 V for 30 msec respectively. After electroporation the cells were grown in a culture medium containing 400 µg/mL of the antibiotic G418 for the selection of cells that were stably expressing hFTSJ2. Isolation of the Mitochondrial and Cytosolic Protein Fractions The mitochondrial and cytosolic proteins of the TE671 cell fractions were isolated using the reagent-based method of the Mitochondria Isolation Kit (Pierce Rockford IL USA) according to the manufacturer™s instructions. Western Blot Analysis To analyze the expression of hFTSJ2 stable expression colonies of the TE671-hFTSJ2 and HepG2-hFTSJ2 cells were collected homogenized in 300 µL of RIPA buffer (5 mM Tris-HCl [pH 7.4] 0.15 M NaCl 1% NP-40 0.25% sodium deoxycholate 5 mM EDTA [pH 8.0] and 1 mM EGTA) held on ice for 30 min and then centrifuged at 14000 rpm for 30 min. The supernatants were collected as the total protein lysate. The supernatants (20 µg) were then separated by SDS-PAGE in a 12% acrylamide gel (acryl:bis of 30?0.8) and transferred to a polyvinylidene difluoride (PVDF) membrane [33] [34]. The membrane was blocked with 5% BSA (filtered through a 0.22-µm membrane) and immunoblotted with anti-hFTSJ2 (1?1000) and anti-GAPDH (1?500) antibodies overnight at 4°C. After washing with phosphate-buffered saline containing Tween 20 (PBST) the membrane was incubated with the appropriate horseradish peroxidase-conjugated secondary antibody for 1 hour at 25°C and the protein bands were detected by enhanced chemiluminescence (PerkinElmer Waltham MA USA) and an ImageQuant LAS 4000 mini system (GE Healthcare Biosciences Pittsburgh PA USA). For immunoblotting of the mitochondrial and cytosolic protein fractions 5 µg of protein from each fraction was separated by SDS-PAGE and immunoblotted with anti-hFTSJ2 (1?1000) anti-VDAC (mitochondrial fraction control 1?1000) and/or anti-MEK-1 (cytosolic fraction control 1?1000) antibodies. Immunofluorescence Microscopy The TE671-hFTSJ2 and HepG2-hFTSJ2 cells were grown to 80% confluence in 24-well dishes. Then the cells were fixed with 4% paraformaldehyde for 20 min and permeabilized with 0.1“0.3% Triton X-100 for 5 min followed by three washes with PBS. The cells were blocked with horse serum for 1 hour and incubated with an anti-hFTSJ2 antibody (1?1000) overnight at 4°C and then with the appropriate fluorescein isothiocyanate (FITC)-conjugated antibody for 1 hour. The cells were counter-stained with MitoTracker Red CMXRos (Invitrogen Corp. Grand Island NY USA) to stain the mitochondria and DAPI to stain the nuclei and then mounted with glycerol. The cells were examined by laser scanning confocal fluorescence microscopy in which FITC was excited at 488 nm MitoTracker Red was excited at 580 nm and DAPI was excited at 358 nm. Real-time RT-PCR and Semi-quantitative RT-PCR The total RNA was isolated from the cell lines or the porcine tissues using the TRIzol reagent (Invitrogen Corp. Grand Island NY USA) according to the manufacturer™s instructions. The total RNA was treated with DNase I "
Lung_Cancer
"Although PLC may be present in liver carcinoma patients these patients might die as a result of other causes such as liver failure or hemorrhage due to cancer rupture before the typical symptoms of PLC manifest. On the basis of our experience and previous reports clinicians should exclude PLC when patients develop hypoxemia and interstitial pneumonia of unknown cause. PLC may cause significant deterioration of the patient™s condition. Thus only early identification diagnosis and treatment can prolong the survival of liver carcinoma patients with PLC. Conclusions Although PLC is rare in liver carcinoma patients cancer cells can migrate into the pulmonary lymphatic system. Early identification diagnosis and treatment are crucial to improving the survival of PLC patients. Combined use of CT PET-CT and pathologic examinations may significantly increase the PLC detection rate. In our patient immunosuppressive therapy after liver transplantation caused rapid progression of PLC. Although we discontinued immunosuppressive therapy employed strategies to improve the patient™s lung edema and administered antitumor therapy the efficacy of the treatment was still very poor. Consent Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Abbreviations LT: Liver transplantation; PET-CT: Positron emission tomography/computed tomography; PLC: Pulmonary lymphangitic carcinomatosis. Competing interests The authors declare that they have no competing interests. Authors™ contributions Li Zhuang carried out clinical data collection participated in the sequence alignment and drafted the manuscript. XL and CH carried out pathological analysis. Lin Zhang and GJ carried out clinical data collection JW and SZ carried out pathological analysis. All authors read and approved the final manuscript. Acknowledgements This work is supported by grants from the Zhejiang Medicines and Health Technologies Program (201350072) and the National Natural Science Foundation of China (NSFC 81000962). Grossman EJ Millis JM Liver transplantation for non-hepatocellular carcinoma malignancy: indications limitations and analysis of the current literature Liver Transpl 2010 16 930 942 10.1002/lt.22106 20677284 Bruce DM Heys SD Eremin O Lymphangitis carcinomatosa: a literature review J R Coll Surg Edinb 1996 41 7 13 8930034 Zhang K Huang Y [Clinical features and diagnosis of pulmonary lymphangitic carcinomatosis [in Chinese] Ai Zheng 2006 25 1127 1130 16965655 Otsubo K Kubo N Nakashima N Izumi M Nakamori M Koto H A juvenile case of pulmonary lymphangitic carcinomatosis caused by sigmoid colon cancer with a component of micropapillary carcinoma Intern Med 2011 50 2361 2365 10.2169/internalmedicine.50.5170 22001466 Wallach JB McGarry T Torres J Lymphangitic metastasis of recurrent renal cell carcinoma to the contralateral lung causing lymphangitic carcinomatosis and respiratory symptoms Curr Oncol 2011 18 e35 e37 21331270 Babu S Satheeshan B Geetha M Salih S A rare presentation of pulmonary lymphangitic carcinomatosis in cancer of lip: case report World J Surg Oncol 2011 9 77 10.1186/1477-7819-9-77 21756338 Katyal S Oliver JH 3rd Peterson MS Ferris JV Carr BS Baron RL Extrahepatic metastases of hepatocellular carcinoma Radiology 2000 216 698 703 10.1148/radiology.216.3.r00se24698 10966697 Molina DK Valente PT Lymphangitic spread of hepatocellular carcinoma Arch Pathol Lab Med 2003 127 e11 e13 12562285 Shin NY Hong YJ Kim AH Shim HS Nam JE Lee HJ Kim MJ Diffuse interstitial infiltrative lung metastasis of malignant melanoma: a case report Korean J Radiol 2011 12 252 255 10.3348/kjr.2011.12.2.252 21430944 Acikgoz G Kim SM Houseni M Cermik TF Intenzo CM Alavi A Pulmonary lymphangitic carcinomatosis (PLC): spectrum of FDG-PET findings Clin Nucl Med 2006 31 673 678"
Lung_Cancer
"The 24-week metrics (albeit with higher c-index point estimate) were not meaningfully better than the 12-week metrics. None of the metrics did particularly well for breast cancer. Conclusion Alternative cut points to RECIST standards provided no meaningful improvement in OS prediction. Metrics assessed at 12 weeks have good predictive performance. J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24787965 4132045 00005 10.1097/JTO.0000000000000157 Original s Translational Oncology A Comparison of Immunohistochemical Assays and FISH in Detecting the ALK Translocation in Diagnostic Histological and Cytological Lung Tumor Material Le Quesne John MA (Cantab) PhD MBBS FRCPath * Maurya Manisha PhD   Yancheva Slaveya G. FRCPath * O™Brien Mary MD ¡ Popat Sanjay FRCP PhD ¡ Wotherspoon Andrew C. MBBCh FRCPath § de Castro David Gonzalez PhD FRCPath   Nicholson Andrew G. MBBS DM FRCPath * *Department of Histopathology Royal Brompton and Harefield NHS Foundation Trust London;  Centre for Molecular Pathology The Royal Marsden Hospital Sutton Surrey; ¡Department of Oncology The Royal Marsden Hospital; and §Department of Histopathology Royal Marsden Hospital Chelsea London United Kingdom. Address for correspondence address: Andrew G. Nicholson MBBS DM FRCPath Department of Histopathology Royal Brompton Hospital Sydney St London SW3 6NP United Kingdom. E-mail: a.nicholsonrbht.nhs.uk. 6 2014 30 5 2014 9 6 769 774 Copyright 2014 by the International Association for the Study of Lung Cancer 2014 This is an open-access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: Detection of the ALK rearrangement in a solid tumor gives these patients the option of crizotinib as an oral form of anticancer treatment. The current test of choice is fluorescence in situ hybridization (FISH) but various cheaper and more convenient immunohistochemical (IHC) assays have been proposed as alternatives. Methods: Fifteen FISH-positive cases from patients seven with data on crizotinib therapy and clinical response were evaluated for the presence of ALK protein using three different commercially available antibodies: D5F3 using the proprietary automated system (Ventana) ALK1 (Dako) and 5A4 (Abcam). A further 14 FISH-negative and three uncertain (<15% rearrangement detected) cases were also retrieved. Of the total 32 specimens 17 were excisions and 15 were computed tomography-guided biopsies or cytological specimens. All three antibodies were applied to all cases. Antibodies were semiquantitatively scored on intensity and the proportion of malignant cells stained was documented. Cutoffs were set by receiver operating curve analysis for positivity to optimize correct classification. Results: All three IHC assays were 100% specific but sensitivity did vary: D5F3 86% ALK 79% 5A4 71%. Intensity was the most discriminating measure overall with a combination of proportion and intensity not improving the test. No FISH-negative IHC-positive cases were seen. Two FISH-positive cases were negative with all three IHC assays. One of these had been treated with crizotinib and had failed to show clinical response. The other harbored a second driving mutation in the EGFR gene. Conclusions: IHC with all three antibodies is especially highly specific (100%) although variably sensitive (71%-86%) specifically in cases with scanty material. D5F3 assay was most sensitive in these latter cases. Occasional cases are IHC-positive but FISH-negative suggesting either inaccuracy of one assay or occasional tumors with ALK rearrangement that do not express high levels of ALK protein. Pulmonary adenocarcinoma ALK Immunohistochemistry Fluorescence in situ hybridization Crizotinib OPEN-ACCESS TRUE Rearrangements of the anaplastic lymphoma kinase (ALK) gene drive the malignant phenotype in 3% to 7% of primary lung adenocarcinomas.1“5 The resulting fusion protein most often a fusion with echinoderm microtubule-associated protein-like 4 (ELM4) has a constitutively active tyrosine kinase domain. The small molecule drug crizotinib is a specific inhibitor of this kinase6 and cases with the rearrangement respond to crizotinib treatment.7 Therefore accurate rapid and inexpensive identification of tumors growing under the influence of translocated ALK is needed. Currently the only test approved by the FDA is fluorescence in situ hybridization (FISH) using œbreak-apart probes (Vysis Abbott Molecular Abbott Park IL). This test is regarded as the œgold standard for detection of re-arrangements and is recommended by CAP/International Association for the Study of Lung Cancer/AMP.8 However FISH is technically demanding expensive and many diagnostic laboratories lack either the expertise or the facilities to perform the test. Even in ideal circumstances the results are often difficult to interpret requiring the scrutiny of large numbers of individual cells by a highly experienced diagnostician. Furthermore there are rare circumstances (such as small intrachromosomal inversion) in which the FISH test is negative but the tumor nevertheless expresses EML4-ALK fusion protein.59“11 A cheaper and potentially more widely applicable method is immunohistochemistry (IHC); indeed overexpression of ALK protein has been used in the diagnosis of anaplastic large-cell lymphoma for many years. Although early studies in lung cancer lacked sensitivity45 more recent studies have shown greater specificity and sensitivity8“11 and recent international guidelines (CAP/International Association for the Study of Lung Cancer/AMP) have recommended that if clinically validated IHC may be used as a screening test for FISH testing.8 However there have been few comparative studies on the most appropriate antibody to use. The aim of this study was therefore to compare three different immunohistochemical assays two being routine methods using antibodies widely used in the diagnosis of lymphoma with the third being a proprietary system including signal amplification that is currently being promoted as an alternative to FISH (Ventana). We also evaluated the relationships between ALK rearrangement as detected by FISH IHC and patient response to therapy. MATERIALS AND METHODS Clinical Samples The diagnostic archives from the Royal Brompton and Harefield NHS Foundation Trust and Royal Marsden hospitals from 2007 onwards were reviewed to identify cases with a diagnosis of lung adenocarcinoma that tested positive for an ALK rearrangement (>15% positive cells) and a randomly selected complementary group of cases with a normal ALK locus for comparison. We had been testing all primary lung tumors regardless of stage as part of a feasibility study which led to a large number of early stage cases being included. More recently our current policy is only to test advanced cases of non-squamous non“small-cell carcinoma using IHC screening with confirmatory FISH as per recently published guidelines.8 The cases under study are summarized in . TABLE 1. Summary Data of All Cases Included in the Study Paraffin blocks from a total of 32 diagnostic cases were retrieved; 15 of these had tested positive for the ALK rearrangement by FISH three were uncertain (with <15% of cells showing rearrangement) and the remaining 14 cases were negative. All but two blocks dated from 2011 or later. Seventeen cases were blocks from tumor excisions (six of these were FISH positive) and the remainder were cytological or core biopsy/endobronchial ultrasound samples. Data on treatment with crizotinib and response were retrieved from patient records. Cases with at least partial response to treatment defined according to the Response Evaluation Criteria in Solid Tumors criteria12 (i.e. at least 30% decrease in the sum of the longest diameters of target lesions) were designated as œresponsive. The study was evaluated and classified as a service evaluation by the Imperial College Heads of Consortia and as such was exempt from Research Ethics Committee review. Fluorescent In Situ Hybridization Unstained 2 ?m FFPE sections were put through deparaffinization and protease pretreatment steps before being denatured and hybridized overnight with the commercially available Vysis ALK dual color break apart probe (Abbott Molecular). Tissue sections then underwent SSC washes and were mounted in 4'6-diamidino-2-phenylindole for nuclei counterstaining. Results were analyzed and interpreted in accordance with probe manufacturer™s instructions. Non-rearranged ALK showed as fused (yellow) signals. Rearranged ALK appeared as split 3? (red) and 5? (green) signals or an isolated 3? (red) signal. The recommended cutoff of 15% was used to interpret samples as positive or negative for ALK rearrangements in 200 nuclei. Immunohistochemistry An additional five sections were cut per case. Three were used for the immunohistochemical assays and the remaining two for negative controls. Immunohistochemical assays were optimized using the monoclonal antibodies D5F3 (Ventana) ALK1 (Dako) and 5A4 (Abcam). The D5F3 assay was performed using the Ventana autostainer and a tyramide amplification step as specified in the manufacturer™s protocol. The other assays were performed using a Dako autostainer with conventional polymer-based diaminobenzidine staining (no tyramide amplification). Details of the antibodies and conditions employed are given in Table 2. TABLE 2. Immunohistochemical Assay Conditions Used Scoring Immunohistochemically stained sections were examined without knowledge of FISH status by two pathologists independently. Scores for proportion and intensity of immunohistochemical staining were assigned by consensus. The predominant intensity of staining was recorded on a scale of 0“3 (0 = negative 1 = weak 2 = moderate 3 = strong). As the Ventana stain was more intense due at least partly to the signal amplification step the visual cutoffs for intensity scoring with this antibody were different (e.g. a œmoderate degree of intensity seen with the Ventana stain would usually be interpreted as œstrong on a section stained with 5A4). The proportion of malignant cells staining positive was recorded as per œAllred estrogen receptor scoring in breast cancer on a scale of 0“5 (0 = 0% 1 ? 1% 2 = 1“10% 3 = 11“33% 4 = 34“66% and 5 ? 66%). A composite score (intensity + proportion) was also derived. Statistical Analysis Statistical analyses were performed using the STATA/IC package. RESULTS Fluorescence In Situ Hybridization Slides were scored according to the manufacturer™s recommendations. Representative FISH images are shown in Figure 1A. The 15 positive cases all showed greater than 15% cells with rearranged ALK genes. Three cases were classified as œindeterminate; these were all scanty biopsy or cytological samples with 10% to 15% of positively rearranged FISH signals. Seventeen further cases were FISH negative. FIGURE 1. (A) Representative fluorescence in situ hybridization images showing normal fused signals (neg) and nuclei with multiple separated red signals (pos). (B) Three representative excision specimens of adenocarcinoma. Case 1 is negative with all three immunohistochemical assays; the D5F3 assay shows relatively high background presumably because of the tyramide signal amplification (TSA) step. Cases 2 and 3 are positive with all three immunohistochemical assays with clear cytoplasmic staining. The markedly reduced signal seen with the 5A4 and ALK1 assays in case 2 was typical and again probably related to the absence of tyramide amplification. Case 3 demonstrates that occasional cases show strong staining using the non-TSA assays. Immunohistochemistry No signal was observed in negative controls. The intensity of staining between the three antibodies varied (Fig. 1B). IHC was impossible to assess in three cases with very scanty material (two FISH negative and one FISH positive). "
Lung_Cancer
"E Nederlof P van Noesel C Prinsen CF Scheidel K van de Ven PM de Weger R Schuuring E Ligtenberg M 2011 EGFR and KRAS quality assurance schemes in pathology: generating normative data for molecular predictive marker analysis in targeted therapy J Clin Pathol 64 884 892 21947301 van Krieken JH Normanno N Blackhall F Boone E Botti G Carneiro F Celik I Ciardiello F Cree IA Deans ZC Edsjo A Groenen PJ Kamarainen O Kreipe HH Ligtenberg MJ Marchetti A Murray S Opdam FJ Patterson SD Patton S Pinto C Rouleau E Schuuring E Sterck S Taron M Tejpar S Timens W Thunnissen E van de Ven PM van Krieken JH Siebers AG Normanno N Quality Assurance for Molecular Pathology group 2013 European consensus conference for external quality assessment in molecular pathology Ann Oncol 24 1958 1963 23613479 Zhou C Wu YL Chen G Feng J Liu XQ Wang C Zhang S Wang J Zhou S Ren S Lu S Zhang L Hu C Hu C Luo Y Chen L Ye M Huang J Zhi X Zhang Y Xiu Q Ma J Zhang L You C 2011 Erlotinib versus chemotherapy as first-line treatment for patients with advanced EGFR mutation-positive non-small-cell lung cancer (OPTIMAL CTONG-0802): a multicentre open-label randomised phase 3 study Lancet Oncol 12 735 742 21783417 Supplementary Material Supplementary Information Click here for additional data file. Workflow of the EQA scheme process. Methodologies used in rounds 1 and 2. Scoring system Criteria Marks Scheme rounda (samples) Genotyping Correct genotype 2.00 A to C (all samples) Incorrect genotype (false positive or false negative) ?2.00 A to C (all samples) Genotype mispositioned or miscalled (e.g. incorrect base/amino acid detected) ?1.00 A to C (all samples) Error in the nomenclature that might lead to misinterpretation of the results ?0.50b A to C (all samples) Biological/clinical interpretation The mutation is predicted to be a sensitising mutation to EGFR TK inhibitors (TKI). Comment only B (1 4) The mutation is predicted to confer resistance to EGFR TK inhibitors (TKI). Comment only B (9) General Reference sequence and version indices not used incorrect or inconsistent. ?0.50b B (14 9) only No description of assay used and its limitations ?0.50b B (14 9) only Analytical failure giving no test result ?1.00 B (14 9) only No statement present on estimated percentage of tumour cells within the sample Comment only B (14 9) only Abbreviation: TK=tyrosine kinase. a Pilot round (A) second round (B) and third round (C). b Deduction applied only once. Validation of EQA materials Sample no. PCR/sequencing Therascreen Fragment analysis/real-time PCR Round no./sample no. a 1 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); p.(L858R) p.(T790M); p.(L858R) A1 2 c.2235_2249del p.(E746_A750del) p.(E746_A750del) p.(E746_A750del) A2 3 Wild type Wild type Wild type A3 4 Wild type Wild type Wild type A4 5 c.2235_2249del p.(E746_A750del) p.(E746_A750del) p.(E746_A750del) A5 6 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); p.(L858R) p.(T790M); p.(L858R) A6 7 c.2235_2249del p.(E746_A750del) p.(E746_A750del) p.(E746_A750del) A7 8 Wild type Wild type Wild type A8 9 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); p.(L858R) p.(T790M); p.(L858R) A9 10 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); p.(L858R) p.(T790M); p.(L858R) A10 11 c.2235_2249del p.(E746_A750del) p.(E746_A750del) p.(E746_A750del) B1 and C8 12 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); c.2573T>G p.(L858R) p.(T790M); c.2573T>G p.(L858R) B2 and C3 13 c.2235_2249del p.(E746_A750del) p.(E746_A750del) p.(E746_A750del) B3 and C9 14 Wild type Wild type Wild type B4 and C1 15 Wild type Wild type Wild type B5 and C4 16 Wild type Wild type Wild type B6 and C6 17 Wild type Wild type Wild type B7 and C7 18 c.2155G>A p.(G719S) p.(G719S) p.(G719S) B8 and C10 19 c.2369C>T p.(T790M); c.2573T>G p.(L858R) p.(T790M); p.(L858R) p.(T790M); p.(L858R) B9 and C5 20 c.2155G>A p.(G719S) p.(G719S) p.(G719S) B10 and C2 Abbreviation: EQA=external quality assessment. a EQA scheme rounds “ first (A) second (B) and third (C). Results from quantitative material validation Confirmed allelic frequency (%) b Sample no. EGFR mutation resulta Estimated allelic frequency (%) p.(G719S) p.(E746_A750del) p.(T790M) p.(L858R) B4 C1 Wild type 0 0 0 0 0 B10 C2 c.2155G>A p.(G719S) 25 19.5 0 0 0 B2 C3 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 10: 10 0 0 19.3 19.1 B5 C4 Wild type 0 0 0 0 0 B9 C5 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 50: 50 0 0 c c B6 C6 Wild type 0 0 0 0 0 B7 C7 Wild type 0 0 0 0 0 B1 C8 c.2235_2249del15 p.(E746_A750del) 25 0 41.2 0 0 B3 C9 c.2235_2249del15 p.(E746_A750del) 5 0 15.3 0 0 B8 C10 c.2155G>A p.(G719S) 10 8.3 0 0 0 a Exons 18“21. b Confirmed by droplet digital PCR. c Not measured due to insufficient material. EGFR testing methodological combinations used by labs in round 2 Methodological combinations Count Pyrosequencing+fragment length analysis 3 Pyrosequencing+high-resolution melting 1 Pyrosequencing+high-resolution melting+fragment length analysis+SNaPshot kit 1 Pyrosequencing+NextGen sequencing 1 Pyrosequencing+Therascreen kit 1 Sequencing+AmoyDx kit 1 Sequencing+denaturing capillary electrophoresis 1 Sequencing+fragment length analysis 4 Sequencing+fragment length analysis+high-resolution melt analysis+restriction fragment length polymorphism 1 Sequencing+fragment length analysis+high-resolution melt analysis+SNaPshot 1 Sequencing+fragment length analysis+restriction fragment length polymorphism 1 Sequencing+fragment length analysis+Taqman 1 Sequencing+high-resolution melting 4 Sequencing+MassArray analysis 1 Sequencing+pyrosequencing 1 Sequencing+pyrosequencing+high-resolution melting 2 Sequencing+restriction fragment length polymorphism 1 Sequencing+single-strand conformational analysis 1 Sequencing+Taqman+PNA clamp 1 Sequencing+Therascreen kit 5 Sequencing+Therascreen kit+CAST PCR 1 SNaPshot+single-strand conformational analysis 1 Therascreen kit+fragment length analysis+SNaPshot kit 1 Genotyping errors False positive False negative Sample no. EGFR mutation resulta Samples tested A a B a C a A a B a C a Total errors Error rate (%) Round 1 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 4 4 17.4 A1 2 c.2235_2249del p.(E746_A750del) 24 0 0 0 0.0 A2 3 Wild type 24 5 0 5 20.8 A3 4 Wild type 23 5 0 5 21.7 A4 5 c.2235_2249del p.(E746_A750del) 24 0 5 5 20.8 A5 6 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0 5 5 20.8 A6 7 c.2235_2249del p.(E746_A750del) 24 0 1 1 4.2 A7 8 Wild type 23 0 0 0 0.0 A8 9 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 23 0 0 0 0.0 A9 10 c.2369C>T p.(T790M); c.2573T>G p.(L858R) 24 0"
Lung_Cancer
"Phenothiazines elicit caspase-mediated and caspase-independent cell death To gain insight into the mechanistic basis of phenothiazine-associated cytotoxicity we analyzed in detail the mode by which these compounds induce cell death in human SCLC cells. While some studies have implicated apoptosis as a major cell death mode in phenothiazine-treated cells34 9 we found that the percentage of SCLC exhibiting nuclear morphologic changes typical of apoptosis such as chromatin condensation and fragmentation remained low (10%) even at the highest TFP concentrations where >98% of all cells lost the ability to exclude propidium iodide (PI; data not shown). Instead TFP-treated SCLC cells exhibited profoundly shrunken nuclei without concomitant chromatin condensation. TFP elicited poly (ADP-ribose) polymerase (PARP) cleavage in some but not all LC cell lines (Figures 3a and b). Importantly although the SCLC cells are sensitive to 10??M TFP treatment and respond with an approximately 60% decrease in cell viability this concentration of TFP only resulted in no or minor cleavage of PARP. Consistent with a non-essential requirement of caspase-mediated apoptotic response the pan-caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone (z-VAD-fmk) did not significantly protect either SCLC (H82) or NSCLC (U-1810) cells from TFP-induced cell death (c) emphasizing the involvement of non-caspase-mediated cell death in response to phenothiazines in SCLC. Phenothiazines induce lysosomal dysfunction in LC cells Phenothiazines are known to be lysosomotropic and accumulate within intracellular acidic compartments.12 13 We therefore examined whether phenothiazines may affect lysosomal functions in LC cells. We found that treatment with TFP and related phenothiazines (cis-flupenthixol dihydrochloride (cis-FPX) PZ chlorpromazine hydrochloride (CPZ) TFPZ and FPZ) caused a rapid increase in appearance of light chain 3 (LC3)-II a marker of autophagy in a dose- and time-dependent manner in both SCLC and NSCLC cells (Figures 4a“c). By contrast the level of p62/SQSTM1 a scaffold protein that target ubiquitinated polypeptide cargo for autophagic degradation did not show any consistent change in response to TFP in the examined SCLC and NSCLC cells (a). As accumulation of LC3-II can result from either increased autophagic flux or impaired autophagic degradation we used chemical probes to manipulate these two processes separately and then investigated the effect of phenothiazines on LC3 conversion. Notably blocking autophagic degradation with the lysosomal protease inhibitor E-64d in cells treated with survivable concentrations of TFP (5??M in H82 and 10??M in U-1810) caused further accumulation of LC3-II indicative of enhanced autophagic flux (d). Similar results were obtained at cytotoxic concentrations of TFP or when autophagosome maturation was suppressed by bafilomycin A1 (BafA1; data not shown). Under conditions where de novo protein synthesis was shut down by cycloheximide (CHX) LC3-II induced by TFP pre-treatment (0“24?h) was rapidly cleared upon removal of TFP (e compare lanes 2 and 4). This process became significantly slower if TFP was present during the recovery period (24“48?h) especially in H82 cells (e compare lanes 5 and 6) suggesting that phenothiazines may additionally antagonize autophagic degradation. These data show that TFP both induces LC3-II and prevents its clearance especially in the SCLC cells which is consistent with the notion that phenothiazines perturb lysosome homeostasis more severely and persistently in SCLC than in NSCLC. Overall these data demonstrate that phenothiazines can modulate lysosomal functions in human LC cells. Basal lysosomal mass and pH buffer capacity can predict sensitivity to phenothiazines The response to chemotherapy (CT) in human tumors is highly heterogenous and therefore there is an urgent need for the identification of biomarkers for prediction of treatment efficacy. As our data suggest that the lysosome is a potentially critical site of action for phenothiazines when used as single treatment of LC cells we therefore sought to determine whether lysosome-associated parameters could be used to predict sensitivity of human LC cells to phenothiazines. Indeed we found a statistically significant inverse correlation between the mean cytotoxicity index calculated from the average cytotoxicity of six phenothiazines at 10??M (a ) and cellular retention of LysoTracker at baseline (a). On the other hand neither basal lysosomal ?-galactosidase (?-gal) activity nor the baseline expression levels of the lysosomal markers LC3-II and lysosomal-associated membrane protein 1 (LAMP-1) correlated well with cellular phenothiazine sensitivity (Supplementary Figures S2A“C). "
Lung_Cancer
"The lower replication rate of adipose meQTLs in whole-blood samples6 might be explained by the heterogeneity of different cell types in whole blood and by their more liberal P-value threshold (8.6—10?4) which led to the identification of a large number of weak cis-meQTLs. Compared with cis-regulation trans-eQTL regulation is typically considered to be more complex has smaller effect sizes and is more difficult to be replicated even in the same tissue. However in our study the lung trans-meQTLs are highly reproducible in TCGA lung breast and kidney tissues. Notably this similarity allows mapping meQTLs with substantially improved power by borrowing strength across tissues51. meQTL SNPs are strongly associated with multiple epigenetic marks. Chromatin regulators play a role in maintaining genomic integrity and anization52. We found that meQTL SNPs were strongly enriched for DNase hypersensitive sites and sequences bound by CTCF or modified histones. SNPs could affect these epigenetic marks by several mechanisms such as by affecting the core recognition sequences (exemplified for rs2816057 on chromosome 1 for CTCF) causing loss or gain of a CpG within a binding region which when methylated could affect binding27 or altering the binding sequence for interacting factors53. CTCF could cause changes in epigenetic marks through its multiple key roles including genome anization through mediating intra- and inter-chromosomal contacts5455 the regulation of transcription by binding between enhancers and promoters5456 and the regulation of splicing which may impact tissue specificity during tissue development39. These changes can impact regulation of distant genes and not the genes proximal to the SNPs that would be typically investigated in eQTL studies. This may be one reason for the previously observed lack of correlation between eQTLs and meQTLs347. Future large studies integrating SNP profiles the DNA methylome and transcriptome data through tissue developmental stages will hopefully shed light on this possibility. There may be a myriad of other DNA-binding factors whose binding is directly or indirectly affected by SNPs. For example among the histone marks the strongest enrichment of meQTLs in our study was for H3K4me3 in both SAEC and hAEC cell types. As H3K4me3 is the chromatin mark primarily associated with regulatory elements at promoters and enhancers this suggests a strong influence of meQTLs on regulating gene activity. Unfortunately transcription factor binding data in SAEC or hAEC are not available so we could not test whether SNPs in their core sequence could affect the deposition of epigenetic marks e.g. by recruiting DNA methyltransferases57. It will be important to obtain ChIP data from relevant primary cells for numerous DNA-binding regulatory factors to further elucidate the mechanisms whereby meQTLs and other SNP-affected epigenetic marks arise. In we show here that genetic variation has a profound impact on the DNA methylome with implications for cancer risk tissue specificity and chromatin structure and anization. The meQTL data (Supplementary Data) attached to this manuscript provides an important resource for studying genetic-DNA methylation interactions in lung tissue. Methods Sample collection We assayed 244 fresh frozen paired tumor and non-involved lung tissue samples from Stage I to IIIA non-small cell lung cancer (NSCLC) cases from the Environment And Genetics in Lung cancer Etiology (EAGLE) study18. EAGLE includes 2100 incident lung cancer cases and 2120 population controls enrolled in 2002“2005 within 216 municipalities of the Lombardy region of Italy. Cases were newly diagnosed primary cancers of lung trachea and bronchus verified by tissue pathology (67.0%) cytology (28.0%) or review of clinical records (5.0%). They were 35?79 years of age at diagnosis and were recruited from 13 hospitals which cover over 80% of the lung cancer cases from the study area. The study was approved by local and NCI Institutional Review Boards and all participants signed an informed consent form. Lung tissue samples were snap-frozen in liquid nitrogen within 20 minutes of surgical resection. Surgeons and pathologists were together in the surgery room at the time of resection and sample collection to ensure correct sampling of tissue from the tumor the area adjacent to the tumor and an additional area distant from the tumor (1“5 cm). The precise site of tissue sampling was indicated on a lung drawing and the pathologists classified the samples as tumor adjacent lung tissue and distant non-involved lung tissue. For the current study we used lung tissue sampled from an area distant from the tumor to reduce the potential effects of field cancerization. DNA methylation profiling and data quality control Fresh frozen lung tissue samples remained frozen while approximately 30 mg was subsampled for DNA extraction into pre-chilled 2.0 ml microcentrifuge tubes. Lysates for DNA extraction were generated by incubating 30 mg of tissue in 1 ml of 0.2 mg/ml Proteinase K (Ambion) in DNA Lysis Buffer (10 mM Tris-Cl (pH 8.0) 0.1 M EDTA (pH 8.0) and 0.5% (w/v) SDS) for 24 hrs at 56°C with shaking at 850 rpm in Thermomixer R (Eppendorf). DNA was extracted from the generated lysate using the QIAamp DNA Blood Maxi Kit (Qiagen) according to the manufacturer™s protocol. Bisulfite treatment and Illumina Infinium HumanMethylation450 BeadChip assays were performed by the Southern California Genotyping Consortium at the University of California Los Angeles (UCLA) following Illumina™s protocols. This assay generates DNA methylation data for 485512 cytosine targets (482421 CpG and 3091 CpH) and 65 SNP probes for the purpose of data quality control. Raw methylated and unmethylated intensities were background corrected and dye-bias equalized to correct for technical variation in signal between arrays. For background correction we applied a normal-exponential convolution using the intensity of the Infinium I probes in the channel opposite their design to measure non-specific signal58. "
Lung_Cancer
"These studies demonstrate that RRM1 could be a predictive marker of the response to gemcitabine-based chemotherapy in patients with NSCLC [22]. The present study also showed that the DCR was higher in RRM1-positive patients that received docetaxel or vinorelbine rather than gemcitabine-based therapy. In addition docetaxel and vinorelbine each showed a longer PFS than gemcitabine-based therapy. Simon et al. used RRM1 and ERCC1 as molecular determinants and found that RRM1- and ERCC1-tailored selection of first-line therapy could improve response overall survival (OS) and PFS over standard treatments in patients with NSCLC [23]. These studies suggest that responses to cytotoxic chemotherapy vary greatly in patients with NSCLC and individualized therapy based on RRM1 expression may help improve the efficacy of chemotherapeutic agents [24]. Our research was performed retrospectively and this is the major limitation of the study. However the current results provide new information and further insight that can assist clinicians in selecting appropriate and individualized chemotherapy for patients with NSCLC based on RRM1 expression. Several molecular markers have been used as predictive markers of the response to chemotherapy in NSCLC patients. ERCC1 has been used for the prediction of platinum sensitivity in the treatment of NSCLC [6]“[8]. Park et al. analyzed 217 patients with NSCLC who had received gemcitabine- or taxane-based chemotherapy and found that taxane was associated with a higher response than gemcitabine treatment in patients with EGFR mutations [9]. Another study found that low thymidylate synthase (TS) expression is significantly associated with better clinical outcomes in non-squamous NSCLC patients who were treated with pemetrexed-based chemotherapy [25]. Therefore more prospectively designed studies with combined detection of these markers (RRM1 ERCC1 EGFR and TS) will provide valuable information that will ultimately be used to determine preferable therapeutic approaches for individual patients with NSCLC. In the results of this study suggest that negative RRM1 expression in advanced NSCLC is associated with a higher response rate to gemcitabine-based chemotherapy. Moreover RRM1 may be used as a predictive marker for conventional chemotherapy regimens involving gemcitabine docetaxel and vinorelbine. Additional prospective studies are needed to evaluate the effect of RRM1 expression on the response to various chemotherapeutic regimens in patients with NSCLC. References 1 SchillerJH HarringtonD BelaniCP LangerC SandlerA et al (2002) Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med346: 92“9811784875 2 PfisterDG JohnsonDH AzzoliCG SauseW SmithTJ et al (2003) American society of clinical oncology treatment of unresectable non-small-cell lung cancer guideline: update 2003. J Clin Oncol22: 330“35314691125 3 KellyK CrowleyJ BunnPAJr PresantCA GrevstadPK et al (2001) Randomized phase III trial of paclitaxel plus carboplatin versus vinorelbine plus cisplatin in the treatment of patients with advanced non-small-cell lung cancer: a Southwest Oncology Group trial. J Clin Oncol19: 3210“321811432888 4 ScagliottiGV De MarinisF RinaldiM Crin²L GridelliC et al (2002) Phase III randomized trial comparing three platinum-based doublets in advanced non small cell lung cancer. J Clin Oncol20: 4285“429112409326 5 SchillerJH HarringtonD BelaniCP LangerC SandlerA et al (2002) Comparison of four chemotherapy regimens for advanced non-small-cell lung cancer. N Engl J Med346: 92“9811784875 6 RothJA CarlsonJJ (2011) Prognostic role of ERCC1 in advanced non-small-cell lung cancer: a systematic review and meta-analysis. Clin Lung Cancer6: 393“40121723790 7 PapadakiC"
Lung_Cancer
"Treatment using a mixture of MTBHsp70 plus P4 scFv for ovarian tumor or malignant mesothelioma-bearing mice did not increase survival or enhance tumor-specific immune responses suggesting that only through fusion of the two elements is the immune system effectively activated. We also demonstrated that this approach does not induce inflammation in the abdominal or intestinal mesothelial tissues as a result of a bystander interaction with MSLN on normal mesothelial cells. Several properties of MTBHsp70 appear in this study to contribute to the generation of tumor-specific CD4+ and CD8+ T-cell immune responses. First it induces maturation of DCs. Although several previous studies suggested that MTBHsp70 had pro-inflammatory properties only when contaminated with LPS [2728] other studies have decisively demonstrated that MTBHsp70 alone while not LPS promotes DC maturation and innate immune responses [161729]. In our study we used a fusion protein generated from a mammalian cell expression system ensuring a minimal amount of LPS contamination. We also incubated DCs with the same amount of LPS as that found in the fusion protein and failed to replicate the effects observed with the fusion protein supporting the view that maturation of DCs can be attributed to the fusion protein rather than LPS. Secondly MTBHsp70 is capable of delivering epitopes for enhanced processing and MHC-I presentation by DCs to na¯ve CD8+ T cells a process known as cross-presentation [30]. Mycobacterial Hsp70 fusion proteins have been shown to elicit both CD4+ and CD8+ T-cell responses although priming of CD8+ T cells does not appear to require CD4+ T cells [3132]. We demonstrated in this study that the MSLN-targeted fusion protein elicited significant tumor-specific CD8+ T-cell immune responses in ovarian cancer-bearing mice and this adaptive antitumor response has an absolute requirement for tumor-specific CD8+ T cells. Although at the dosing schedule used in these studies tumor-specific T-cell responses did not eventually lead to rejection of the established tumors they significantly prolonged survival time in tumor-bearing mice. DCs are believed to play a pivotal role in the initiation and programming of tumor-specific T-cell responses and are becoming an essential target in efforts to generate therapeutic immunity against cancer [33]. Two main approaches are currently under consideration for providing DCs with tumor-specific antigens. One approach is to culture patient-derived DCs ex vivo with an adjuvant that induces DC maturation in the presence of tumor specific antigens followed by adoptive transfer into the patient [33]. This approach is fraught with technical and practical difficulties such as selection of a suitable antigenic target inappropriate maturation state of selected DCs and the difficulty of generating a sufficient number of DCs ex vivo. In addition a number of investigators have recently reported that ex vivo-derived DC vaccines have an insignificant role in the direct priming of T cells in vivo[33-35]. An alternative approach to generate tumor-specific antigen bearing DCs is to induce them to take up tumor-specific antigens in vivo. It has been shown that in vivo specific targeting of tumor antigens to DCs improves the induction of antigen-specific CD4+ and CD8+ T-cell immunity. In these studies an agonistic anti-CD40 monoclonal antibody was used to mature DCs and eliminate antigen-specific tolerance [36-39]. MTBHsp70 has also been shown to stimulate inflammation and DC maturation via an interaction with CD40 receptors on both DCs and monocytes thus acting as an alternative ligand to CD40L [2940]. In our study we showed the fusion protein up-regulates surface expression of phenotypic markers of DC maturation. Interestingly in addition to CD80 CD86 and MHC class II molecules the expression of CD40 is also enhanced indicating a possible positive feedback loop involving CD40 signaling components. Beyond promoting DC maturation the scFvMTBHsp70 fusion protein also targets tumor cells towards the matured DCs. We propose that binding of the fusion protein with both tumor cells and DCs improves phagocytosis of parts of tumor cells by DCs and therefore any tumor antigen can be processed and loaded on both MHC class II and MHC class I molecules and presented to CD4+ and CD8+ T cells. This could explain the observed augmentation of tumor antigen presentation and cross-presentation brought about by the fusion protein in vitro. This may also explain the observed increased anti-Her2/neu CD8+ T-cell responses in the scFvMTBHsp70-treated ovarian tumor bearing mice although Her2/neu is not directly targeted. We recapitulated these in vitro findings in an in vivo tumor cell immunogenicity study. We used the fusion protein to activate and mature DCs in the skin such as Langerhans cells. These DCs then captured tumor cells or tumor cell fragments through the connection established by the fusion protein and migrated to the draining lymphoid ans where they presented tumor antigens to na¯ve T cells. T cells recovered from the draining lymph node showed significantly enhanced responses to stimulation with a range of tumor antigens. Conclusion Our study provides preclinical evidence that supports a protein-based immunotherapy that induces anti-tumor immune responses which normally require dendritic cell-based approaches. The MSLN-targeted MTBHsp70 fusion protein binds MSLN on tumor cells recruits and activates APCs including DCs loads DCs in vivo with the broadest profile of naturally processed tumor antigens promotes tumor antigen presentation and cross-presentation and enhances tumor specific CD4+ and CD8+ T-cell responses (Figure 5). Our study supports the continued exploration of this novel fusion protein alone or in combination with immune checkpoint inhibitors following conventional surgical reduction and chemotherapy for MSLN-expressing cancers. This new approach could significantly increase time to recurrence and survival in humans with ovarian cancer and mesothelioma where effective second line treatment options are very limited. A schematic model showing that the scFvMTBHsp70 fusion protein binds with MSLN on tumor cells and activates antigen presenting cells (APCs) thus promoting uptake of tumor cells or tumor cell fragments and promoting tumor antigen presentation and cross-presentation as well as adjuvanting tumor specific CD4 + and CD8 + T-cell responses. Methods Production of proteins The plasmid pQE30-MTBhsp70 that encodes full length MTBHsp70 was a generous gift from Dr. Peter Sveshnikov (Moscow Medical Academy Russia). The plasmid pTOR2-scFv that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein [13] generated and purified from yeast were generous gifts from Dr. Nathalie Scholler (Penn Ovarian Cancer Research Center University of Pennsylvania). The DNA fragment corresponding to a 15 amino acid linker (GGGGSGGGGSGGGGS) was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under protocols that were approved by the Massachusetts General Hospital Subcommittee on Research Animal Care (SRAC). Treatment of na¯ve mice with experimental or control protein 6-week-old male C57BL/6 mice were injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. Seven days post the administration of the final treatment mice were sacrificed and abdominal wall and intestine were retrieved for histopathological studies of mesothelial tissues. Ex vivo assessment of tumor specific T-cell functions Single cell suspensions were prepared from spleens. Cells were plated in round-bottomed 96-well plates pulsed with a validated CD8+ T-cell Her2/neu peptide (PDSLRDLSVF 1 ?g/ml; EZBiolab) [2543] an in-house designed H2d-restricted MSLN Ld1 peptide (IPLSYLCDF 1 ?g/ml; EZBiolab) that did not induce ovarian cancer specific T-cell response in H-2q FVB mice or medium alone for 72 hours when Golgi Plug (BD Bioscience) was added for the last 5 hours as previously described [44] and then stained with fluorophore-conjugated anti-CD3 anti-CD4 anti-CD8 anti-IFN? (BD Pharmingen) and anti-Granzyme B (eBioscience) antibodies. Cells were then analyzed on a LSRII 4 laser (BD Biosciences). Depletion of CD8+ T cells in vivo FVB/NJ mice were injected i.p. with 200 ?g of anti-CD8 monoclonal antibody (mAb)(53“6.72 Bio X Cell) or an isotype-matched irrelevant rat IgG2a (2A3 Bio X Cell) 2 days before 1 day before and 1 day after i.p. inoculation with BR5FVB1 ovarian tumor cells. Depletion was continued once every week until 29 days after tumor inoculation. The mice were treated with scFvMTBHsp70 or saline as described above. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation. Generation and purification of bone marrow-derived DCs (BMDCs) CD11c+ DCs were generated from bone marrow cells of FVB/NJ mice as described [45-47] with minor modifications. Briefly erythrocyte-depleted mouse bone marrow cells from flushed marrow cavities were cultured in complete RPMI 1640 with 10 ng/ml GM-CSF and 1 ng/ml IL-4 at 1 — 106 cells/ml. Medium was changed on day 3. On day 7 DCs were harvested by gentle pipetting and purified with magnetic microbeads conjugated to a monoclonal antibody against CD11c (MiltenyiBiotec) as described [4648] according to the manufacturer™s recommended protocol. In vitro activation of BMDCs CD11c+ BMDCs were plated in a 24-well plate at a density of 2?—?106 cells/ml and incubated with 2 ?g/ml scFvMTBHsp70 (105 kDa) 1.3 ?g/ml MTBHsp70 (70 kDa) 1 ?g/ml LPS equivalent to 103 EU/ml endotoxin (InvivoGen San Diego CA) or 0.1 ng/ml (0.1 EU/ml) LPS equivalent to endotoxin found in 2 ?g/ml of proteins (since LPS level is less than 50 EU per mg of protein) for 24 h at 37°C in humidified atmosphere with 5% CO2. Cells were then placed on ice collected by vigorous pipetting washed and stained with the following fluorophore-conjugated antibodies: anti-CD11c and anti-CD40 (eBioscience) anti-CD80 (BD Horizon) anti-CD86 and anti-MHC class II (I-Aq) (BD Pharmingen). Afterwards the cells were analyzed on an LSRII 4 laser (BD Biosciences). In vitro tumor antigen presentation assay BR5FVB1 cells were harvested and treated with mitomycin C and plated in a 96-well round-bottomed plate with 20 ?g/ml scFvMTBHsp70 or 13 ?g/ml MTBHsp70. After pre-incubation at 4°C for 1 h CD11c+ BMDCs (ratio of tumor cells: DCs = 3: 1) were added to the wells and the plate was incubated at 37°C for 24 h. For generation of BR5FVB1 cell-primed T cells we inoculated FVB/NJ mice by i.p. injection with 107mitomycin C-treated BR5FVB1 cells and sacrificed the mice 60 days after the immunization according to the approved animal protocol. Splenocytes were then harvested and T cells were isolated using the Pan T-Cell Isolation Kit II (MiltenyiBiotec). BR5FVB1 cell-primed T cells were then added to the wells at a DC/T-cell ratio of 1:20. After a 24-hour co-culture of BR5FVB1 cell-pulsed DCs with BR5FVB1 cell-primed T cells the cells were harvested washed and resuspended in PBS with 5% FBS stained for CD3 CD4 CD8 and IFN? and analyzed on a LSRII 4 laser (BD Biosciences). In vivo immunization with mitomycin C-treated ovarian tumor cells BR5FVB1 ovarian tumor cells were harvested with enzyme-free cell-dissociation buffer and treated with mitomycin C as described above. Cells were then pre-incubated with scFvMTBHsp70 (10 ?g/106 cells) MTBHsp70 (6.5 ?g/106 cells) or PBS alone at 4°C for 1 h. 6-week-old FVB mice were shaved and depilated on both left and right flanks and then injected i.d. with 50 ?l of PBS or 1?—?106 tumor cells in 50 ?l of PBS with or without a pre-incubation with scFvMTBHsp70 or MTBHsp70 at both flanks. Histopathology Abdominal walls and intestines from mice were fixed for at least 24 h in PBS-buffered 10% formalin. Tissues were routinely embedded in paraffin. 5 ?m thick sections were stained routinely with H&E. For staining tumor-infiltrating T cells mice were perfused with 4% paraformaldehyde (PFA) in PBS and tumor nodules were fixed in 4% PFA/PBS for additional 2 hours washed and infiltrated with 30% sucrose/PBS at 4°C. 6 ?m thick frozen sections were stained with rat anti-mouse CD8 (BD Biosciences 1:100 dilution) or rat anti-mouse Foxp3 (eBioscience 1:12 dilution) followed by polyclonal rabbit anti-rat immunoglobulin/HRP (Dako 1:750 dilution). Signal was developed with diaminobenzidine (DAB Dako). Images were acquired on a Zeiss Axio A1 microscope. All histopathological and immunohistochemical samples were reviewed and the quantitation of the cellular infiltrate was performed in a blinded manner to the observer. Statistical analysis Statistical differences between three or more experimental groups were analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests when mean of each group is compared with that of every other group or followed by Dunnett™s multiple comparison tests when mean of each group is compared with that of a control group. Statistical differences between two experimental groups were analyzed using Student™s t-test. Survival was analyzed with the Log-rank test. Prism 6.0 software (GraphPad Software) was used for all the statistical analysis. Abbreviations DC: Dendritic cell; scFv: Single-chain antibody variable fragment; MSLN: Mesothelin; MTB: Mycobacterium tuberculosis; Hsp: Heat shock protein; i.p.: Intraperitoneal; i.d.: Intradermal; BMDCs: Bone marrow-derived dendritic cells; APCs: Antigen-presenting cells; PBMCs: Peripheral blood mononuclear cells; PBLs: Peripheral blood leukocytes; LPS: Lipopolysaccharide; H&E: Haematoxylin and eosin; PFA: Paraformaldehyde; DAB: Diaminobenzidine; mAb: monoclonal antibody. Competing interests The authors declare that they have no competing interests. Authors™ contributions JY played a role in the design of the experiments acquisition analysis and interpretation of the data and writing the manuscript. PR JN YY NHA MN GJ-M XT SK HC PU BF TC and PL participated in the performance of experiments. SK and TB were involved in design of the experiments. RB was involved in data analysis. ER was involved in setting up murine ovarian cancer model. SO provided the murine ovarian cancer model. NS provided the plasmid that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein. GD NS and SO gave constructive input on experimental design and data analysis. JG played a role in conception and design of the fusion protein. MP and JG were involved in the conceptualization and design of the study analysis and interpretation of datasets and in writing the manuscript. All authors read and approved the final manuscript. Supplementary Material Additional file 1: Figure S1 scFvMTBHsp70 binds to 40L mesothelioma cells. 40L cells were stained with scFvMTBHsp70 or MTBHsp70 followed by mouse anti-MTBHsp70 and Donkey anti-mouse Alexa Fluor 594. Cells were observed using a Nikon Eclipse TiE fluorescence microscope. A Representative pictures from three independent experiments. Scale bar 10 ?m. B Images were analyzed using the NIS-Elements AR Microscope Imaging Software. Mean Fluorescence Intensity was analyzed using ImageJ. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. ****p?<?0.0001. Click here for file Additional file 2: Figure S2 scFvMTBHsp70 or MTBHsp70 plus P4 scFv treatment does not lead to infiltration of inflammatory cells into abdominal or intestinal mesothelial tissues. Samples of abdominal wall and intestine were prepared from C57BL/6 mice that had previously received multiple i.p. injections of scFvMTBHsp70 MTBHsp70 plus P4 scFv or saline as described in the Methods section. Sections of these tissues were stained with H&E and images were acquired on a Zeiss Axio A1 microscope. Representative images from 3 animals per treatment group are shown. No detectable level of mononuclear cell or granulocyte infiltrate within mesothelial tissues was seen in any sampled tissues. Scale bar 20 ?m. Click here for file Additional file 3: Figure S3 scFvMTBHsp70 treatment does not affect numbers of tumor-infiltrating CD8+ or Foxp3+ T cells. (A) Representative images of intratumoral CD8+ and Foxp3+ T cells from saline (n?=?3) scFvMTBHsp70 (n?=?3) or MTBHsp70 plus P4 scFv (n?=?3) -treated mice. Mouse spleen sections were used as positive controls: CD8+ and Foxp3+ T cells are clearly evident in the sections. Scale bar 20 ?m. (B) Numbers of CD8+ and Foxp3+ cells were quantified from 3“5 randomized fields. Click here for file Additional file 4: Figure S4 Validation of in vivo depletion of CD8+ cells in FVB/NJ mice. Mice were injected i.p. with 200 ?g of anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a as described in Methods. All the mice were bled from the tail vein and the depletion of CD8+ cells was examined by flow cytometry analysis of peripheral blood cells stained with fluorophore-conjugated anti-CD8 on days 7 and 28 after tumor inoculation."
Lung_Cancer
" Based on the above analysis we speculated that there may be some interaction between p120ctn isoform 3A and snail which plays a role in suppressing EMT in lung cancer cells expressing cytoplasmic E-cadherin but this hypothesis requires further study. Importantly we also found that knockdown of p120ctn-1A in SPC cells with cytoplasmic E-cadherin resulted in decreased twist expression (B). Meanwhile transfection of LK2 cells which also showed cytoplasmic localization of E-cadherin with the p120ctn isoform 1A plasmid resulted in increased twist expression (B). However no changes in twist expression were observed in the rest of the experiments (A 4A). As a transcription factor and master gene regulator of EMT [39] [40] twist can downregulate E-cadherin expression [41] and upregulate N-cadherin and other mesenchymal biomarkers [42]. Increased twist expression in LK2 cells transfected with the p120ctn isoform 1A plasmid indicated that transcriptional activation took place and further suggested that the p120ctn isoform 1A may have translocated into the nucleus upon binding of E-cad/CTF2 in the cytoplasm consequently activating the Wnt signaling pathway to promote EMT. Decreased twist expression in SPC cells transfected with p120ctn-1A-siRNA indicated that transcriptional activity was downregulated and suggested that ablation of p120ctn isoform 1A resulted in the inhibtion of EMT by removing the stimulatory effect of the Wnt signaling activity by p120ctn isoform 1A. In the H460 and H1299 cells with E-cadherin localized in the membrane the unchanged twist expression confirmed that p120ctn isoforms 1A and 3A could bind to E-cadherin and maintain effective cell-cell adhesion in order to suppress EMT instead of affecting the Wnt/twist pathway. Intriguingly overexpression of p120ctn isoform 3A did not change twist expression in LK2 cells expressing cytoplasmic E-cadherin indicating that p120ctn isoform 3A did not activate transcription. Therefore we firmly believe in the above hypothesis that p120ctn isoform 3A may interact with snail in some manner to influence E-cadherin expression and suppress EMT in lung cancer cells carrying cytoplasmic E-cadherin. Previous studies have observed that p120ctn-1A restored the cytoplasmic expression of E-cadherin whereas p120ctn-3A could not [20] which seems to be contradictory with the results of this study. However the method in previous studies of knocking down p120ctn expression and then transfecting p120ctn isoforms 1A and 3A plasmids into cells is different from that in the current study in which cells were only transiently transfected with p120ctn isoforms 1A and 3A plasmids. Therefore the different research methods may have led to different effects on E-cadherin. We also noted that in previous studies decreased and almost undetectable levels of E-cadherin by ablation of p120ctn resulted in the failure of exogenous p120ctn-1A to translocate into the nucleus to activate the Wnt/b-catenin pathway and decrease E-cadherin expression due to the deletion of the binding partner E-cad/CTF2. However the LK2 and H1299 cell lines used in these experiments expressed E-cadherin in the present study. E-cadherin binds primarily to unphosphorylated p120ctn isoform 3A whereas tyrosine-phosphorylated p120ctn isoform 1A interacts exclusively with N-cadherin [23]. In the previous studies exogenous p120ctn isoform 3A was prevented from binding and stabilizing E-cadherin after its ablation while in the present study the exogenous p120ctn isoform 3A could stabilize E-cadherin expression directly on the membrane or indirectly by increasing its cytoplasmic expression via regulation of snail expression. Of course all of these findings will need to be further investigated. In we for the first time found that p120ctn isoforms 1A and 3A to have different functions in EMT of lung cancer cells with E-cadherin expressed in different subcellular locations. When E-cadherin was localized on the cell membrane p120ctn isoforms 1A and 3A both could inhibit EMT and reduce the cell invasiveness phenotype. When E-cadherin was localized in the cytoplasm p120ctn isoform 1A promoted EMT and enhanced cell invasion while p120ctn isoform 3A inhibited EMT and reduced cell invasiveness. We thank Dr. Albert B. Reynolds (Department of Cancer Biology Vanderbilt University School of Medicine TN USA) for kindly providing p120ctn isoforms 1A and 3A cDNA plasmids. References 1 ThieryJP SleemanJP (2006) Complex networks orchestrate epithelial-mesenchymal transitions. Nat Rev Mol Cell Biol7: 131“14216493418 2 ShookD KellerR (2003) Mechanisms mechanics and function of epithelial-mesenchymal transitions in early development. Mech Dev120: 1351“138314623443 3 StockingerA EgerA WolfJ BeugH FoisnerR (2001) E-cadherin regulates cell growth by modulating proliferation-dependent beta-catenin transcriptional activity. J Cell Biol154: 1185“119611564756 4 ValdesF AlvarezAM LocascioA VegaS HerreraB et al (2002) The epithelial mesenchymal transition confers resistance to the apoptotic effects of transforming growth factor Beta in fetal rat hepatocytes. Mol Cancer Res1: 68“7812496370 5 HuberMA KrautN BeugH (2005) Molecular requirements for epithelial-mesenchymal transition during tumor progression. Curr Opin Cell Biol17: 548“55816098727 6 WheelockMJ ShintaniY MaedaM FukumotoY JohnsonKR (2008) Cadherin switching. J Cell Sci121: 727“73518322269 7 PeinadoH OlmedaD CanoA (2007) Snail Zeb and bHLH factors in tumour progression: an alliance against the epithelial phenotype?Nat Rev Cancer7: 415“42817508028 8 PeinadoH PortilloF CanoA (2004) Transcriptional regulation of cadherins during development and carcinogenesis. Int J Dev Biol48: 365“37515349812 9 VandewalleC ComijnJ De CraeneB VermassenP BruyneelE et al (2005) SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions. Nucleic Acids Res33: 6566“657816314317 10 WarzechaCC SatoTK NabetB HogeneschJB CarstensRP (2009) ESRP1 and ESRP2 are epithelial cell-type-specific regulators of FGFR2 splicing. Mol Cell33: 591“60119285943 11 SlorachEM ChouJ WerbZ (2011) Zeppo1 is a novel metastasis promoter that represses E-cadherin expression and regulates p120-catenin isoform expression and localization. Genes Dev25: 471“48421317240 12 IshiyamaN LeeSH LiuS LiGY SmithMJ et al (2010) Dynamic and static interactions between p120 catenin and E-cadherin regulate the stability of cell-cell adhesion. Cell141: 117“12820371349 13 WangEH LiuY XuHT DaiSD LiuN et al (2006) Abnormal expression and clinicopathologic significance of p120-catenin in lung cancer. Histol Histopathol21: 841“84716691536 14 BellovinDI BatesRC MuzikanskyA RimmDL MercurioAM (2005) Altered localization of p120 catenin during epithelial to mesenchymal transition of colon carcinoma is prognostic for aggressive disease. Cancer Res65: 10938“1094516322241 15 JiangG WangY DaiS LiuY StoeckerM et al (2012) P120-catenin isoforms 1 and 3 regulate proliferation and cell cycle of lung cancer cells via beta-catenin and Kaiso respectively. PLoS One7: e3030322276175 16 LiuY DongQZ ZhaoY DongXJ MiaoY et al (2009) P120-catenin isoforms 1A and 3A differently affect invasion and proliferation of lung cancer cells. Exp Cell Res315: 890“89819150613 17 AhoS LevansuoL MontonenO KariC RodeckU et al (2002) Specific sequences in p120ctn determine subcellular distribution of its multiple isoforms involved in cellular adhesion of normal and malignant epithelial cells. J Cell Sci115: 1391“140211896187 18 SotoE YanagisawaM MarlowLA CoplandJA PerezEA et al (2008) p120 catenin induces opposing effects on tumor cell growth depending on E-cadherin expression. J Cell Biol183: 737“74919015320 19 YanagisawaM AnastasiadisPZ (2006) p120 catenin is essential for mesenchymal cadherin-mediated regulation of cell motility and invasiveness. J Cell Biol174: 1087“109616982802 20 YuJ MiaoY XuH LiuY JiangG et al (2012) N-terminal 1-54 amino acid sequence and Armadillo repeat domain are indispensable for P120-catenin isoform 1A in regulating E-cadherin. PLoS One7: e3700822615871 21 Travis WD Brambilla E Muller-Hermelink HK (2004) Pathology and Genetics: Tumours of the Lung Pleura Thymus and Heart. Lyon: IARC. 22 GoldstrawP (2011) Updated staging system for lung cancer. Surg Oncol Clin N Am20: 655“66621986263 23 SeidelB BraegS AdlerG WedlichD MenkeA (2004) E- and N-cadherin differ with respect to their associated p120ctn isoforms and their ability to suppress invasive growth in pancreatic cancer cells. Oncogene23: 5532“554215107817 24 KeirsebilckA BonneS StaesK van HengelJ NolletF et al (1998) Molecular cloning of the human p120ctn catenin gene (CTNND1): expression of multiple alternatively spliced isoforms. Genomics50: 129“1469653641 25 AhoS RothenbergerK UittoJ (1999) Human p120ctn catenin: tissue-specific expression of isoforms and molecular interactions with BP180/type XVII collagen. J Cell Biochem73: 390“39910321838 26 ReynoldsAB CarnahanRH (2004) Regulation of cadherin stability and turnover by p120ctn: implications in disease and cancer. Semin Cell Dev Biol15: 657“66315561585 27 CheungLW LeungPC WongAS (2010) Cadherin switching and activation of p120 catenin signaling are mediators of gonadotropin-releasing hormone to promote tumor cell migration and invasion in ovarian cancer. Oncogene29: 2427“244020118984 28 ThoresonMA AnastasiadisPZ DanielJM IretonRC WheelockMJ et al (2000) Selective uncoupling of p120(ctn) from E-cadherin disrupts strong adhesion. J Cell Biol148: 189“20210629228 29 BukholmIK NeslandJM Borresen-DaleAL (2000) Re-expression of E-cadherin alpha-catenin and beta-catenin but not of gamma-catenin in metastatic tissue from breast cancer patients [seecomments]. J Pathol190: 15“1910640987 30 PeiferM YapAS (2003) Traffic control: p120-catenin acts as a gatekeeper to control the fate of classical cadherins in mammalian cells. J Cell Biol163: 437“44014610049 31 DavisMA IretonRC ReynoldsAB (2003) A core function for p120-catenin in cadherin turnover. J Cell Biol163: 525“53414610055 32 MirandaKC JosephSR YapAS TeasdaleRD StowJL (2003) Contextual binding of p120ctn to E-cadherin at the basolateral plasma membrane in polarized epithelia. J Biol Chem278: 43480“4348812923199 33 teinhusenU WeiskeJ BadockV TauberR BommertK et al (2001) Cleavage and shedding of E-cadherin after induction of apoptosis. J Biol Chem276: 4972“498011076937 34 SpringCM KellyKF O'KellyI GrahamM CrawfordHC et al (2005) The catenin p120ctn inhibits Kaiso-mediated transcriptional repression of the beta-catenin/TCF target gene matrilysin. Exp Cell Res305: 253“26515817151 35 FerberEC KajitaM WadlowA TobianskyL NiessenC et al (2008) A role for the cleaved cytoplasmic domain of E-cadherin in the nucleus. J Biol Chem283: 12691“1270018356166 36 DiMeoTA AndersonK PhadkeP FanC PerouCM et al (2009) A novel lung metastasis signature links Wnt signaling with cancer cell self-renewal and epithelial-mesenchymal transition in basal-like breast cancer. Cancer Res69: 5364“537319549913 37 MiaoY LiuN ZhangY LiuY YuJH et al (2010) p120ctn isoform 1 expression significantly correlates with abnormal expression of E-cadherin and poor survival of lung cancer patients. Med Oncol27: 880“88619763914 38 YangJ ManiSA DonaherJL RamaswamyS ItzyksonRA et al (2004) Twist a master regulator of morphogenesis plays an essential role in tumor metastasis. Cell117: 927“93915210113 39 BerxG RaspeE ChristoforiG ThieryJP SleemanJP (2007) Pre-EMTing metastasis? Recapitulation of morphogenetic processes in cancer. Clin Exp Metastasis24: 587“59717978854 40 VernonAE LaBonneC (2004) Tumor metastasis: a new twist on epithelial-mesenchymal transitions. Curr Biol14: R719“72115341765 41 VesunaF van DiestP ChenJH RamanV (2008) Twist is a transcriptional repressor of E-cadherin gene expression in breast cancer. Biochem Biophys Res Commun367: 235“24118062917 42 AlexanderNR TranNL RekapallyH SummersCE GlackinC et al (2006) N-cadherin gene expression in prostate carcinoma is modulated by integrin-dependent nuclear translocation of Twist1. Cancer Res66: 3365“336916585154 43 AndreolasC KalogeropoulouM VoulgariA PintzasA (2008) Fra-1 regulates vimentin during Ha-RAS-induced epithelial mesenchymal transition in human colon carcinoma cells. Int J Cancer122: 1745“175618098284 44 KnirshR Ben-DrorI SpanglerB MatthewsGD KuphalS et al (2009) Loss of E-cadherin-mediated cell-cell contacts activates a novel mechanism for up-regulation of the proto-oncogene c-Jun. Mol Biol Cell20: 2121“212919193763 Stat Med Stat Med sim Statistics in Medicine 0277-6715 1097-0258 BlackWell Publishing Ltd Oxford UK 24027094 4098103 10.1002/sim.5963 Research Articles Modeling exposure“lag“response associations with distributed lag non-linear models Gasparrini Antonio *   Medical Statistics Department London School of Hygiene and Tropical Medicine London U.K. *Correspondence to: Antonio Gasparrini London School of Hygiene and Tropical Medicine Keppel Street London WC1E 7HT U.K.  E-mail: [email protected] 28 2 2014 12 9 2013 33 5 881 899 29 3 2012 10 8 2013 © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. 2013 This is an open access article under the terms of the Creative Commons Attribution License which permits use distribution and reproduction in any medium provided the original work is properly cited. In biomedical research a health effect is frequently associated with protracted exposures of varying intensity sustained in the past. The main complexity of modeling and interpreting such phenomena lies in the additional temporal dimension needed to express the association as the risk depends on both intensity and timing of past exposures. This type of dependency is defined here as exposure“lag“response association. In this contribution I illustrate a general statistical framework for such associations established through the extension of distributed lag non-linear models originally developed in time series analysis. This modeling class is based on the definition of a cross-basis obtained by the combination of two functions to flexibly model linear or nonlinear exposure-responses and the lag structure of the relationship respectively. The methodology is illustrated with an example application to cohort data and validated through a simulation study. This modeling framework generalizes to various study designs and regression models and can be applied to study the health effects of protracted exposures to environmental factors drugs or carcinogenic agents among others. © 2013 The Authors. Statistics in Medicine published by John Wiley & Sons Ltd. latency distributed lag models exposure“lag“response delayed effects splines 1. Introduction In biomedical research it is commonly appreciated that an exposure event produces effects lasting well beyond the exposure period with an increase in risk occurring from few hours to many years later depending on the physiological processes linking the exposure and the health outcome. The problem is made even more complicated in the presence of protracted time-varying exposures when the health effect measured at a given time can be described as the result of multiple exposure events of different intensities sustained in the past. This phenomenon common to various research fields has been associated for example with peak 1 or chronic exposures 2 to environmental stressors drug intake 34 or occupational exposures to carcinogenic substances 5. The main complexity of modeling and interpreting such dependencies lies in the additional temporal dimension needed to express the association beyond the usual exposure“response relationship as the risk depends on both intensity and timing of past exposures. Nonetheless the appropriate representation of the temporal pattern of risks may provide further insights on the association of interest in particular regarding the underlying pathophysiological mechanisms and prevent biases in estimates and predictions. Revising previous terminology 6 I define these dependencies as exposure“lag“response associations. In particular this issue has been debated in cancer epidemiology 7“9. Analytical approaches extend simple indices such as cumulative exposure in order to accommodate the temporal variation in risk because of protracted exposures. In particular the pioneering work by Thomas 106 helped develop sophisticated statistical methods on the basis of weighting past exposures through specific functions whose parameters are estimated by the data. Vacek 11 Langholz and colleagues 12 and Richardson 13 provided interesting applications in case-control studies with weights represented through simple parametric functions. The methodology was improved by Hauptmann and colleagues in a series of papers 14“16 by using flexible and smooth spline functions. Sylvestre and Abrahamowicz 17 and Abrahamowicz and colleagues 18 extended the spline methods to the analysis of time-to-event data with a cohort design and presented their applications in pharmaco-epidemiology. The main limitation of the statistical techniques described in these papers is the assumption of a linear exposure“response relationship. Models for nonlinear dependencies introduce further nontrivial complexities from both statistical and interpretational perspectives as the problem becomes inherently bidimensional. Abrahamowicz and Mackenzie 19 proposed a model for analyzing the nonlinear time-dependent effects of fixed exposures while Vacek 11 and Berhane and colleagues 20 extended this scheme to the case of protracted time-varying exposures. However the modeling techniques illustrated in these other papers still face some limitations as they are based on complex estimation routines with convergence issues and problems in producing uncertainty measures such as standard errors and confidence intervals. Interestingly equivalent approaches were previously established in time series analysis on the basis of distributed lag models (DLMs) a methodology originally formulated in econometrics 21 then applied in epidemiological research 22. These models involve the definition of a distributed lag function analogous to the weighting function described before. In particular Armstrong 23 generalized the method to distributed lag non-linear models (DLNMs) a class of models with different options for the functions applied to model nonlinearity and distributed lag effects. The theory of DLMs and DLNMs have been recently re-evaluated 24 offering a well-grounded statistical tool and a comprehensive scheme for interpretation. In this paper I aim to establish a general conceptual and statistical framework for modeling exposure“lag“response associations built upon the paradigm of DLMs and DLNMs. This modeling class extended beyond time series analysis provides a unified methodology applicable in different study designs data structures and regression models including most of the previous methods as specific cases. Also the statistical framework is defined by completely parametric functions and fitted through standard regression methods with measures of uncertainty and fit statistics easily available. The R package dlnm originally developed for time series data 25 is extended in parallel offering a easy-to-use implementation of the modeling approach. The manuscript is structured as follows. The development and algebraic definition of the modeling framework is described in Section 2. As an illustrative example in I apply the method for investigating the relationship between occupational exposure to radon and lung cancer mortality by using the data from the Colorado Plateau miners cohort. The modeling framework is then validated in a simulation study n. A final discussion is provided in. Information on data and software implementation is included in. The R code and data are included in the supporting information together with additional details making the results of the illustrative example and of the simulation study entirely reproducible. 2. Modeling framework The modeling skeleton is derived by extending the class of DLNMs beyond the time series context. This extension provides a neat algebraic representation and a comprehensive statistical definition. The focus is on a function here defined s(xt) which describes the dependency in terms of the exposure history to x evaluated at time t. The function s(xt) is commonly included in regression models in order to estimate the association while controlling for potential confounders. Although the regression model varies depending on the study design and the type of data the definition of s(xt) provided later and the related modeling framework generally apply. 2.1. Models for linear exposure“response relationships Previous studies on the topic have defined the function s(xt) by using slightly different algebraic formulae 1026111417. Assuming a linear exposure“response relationship a general notation can be given by (1a) (1b) (1c) In (1a) the increase in risk at time t is defined as the integral of the instantaneous exposure intensity xu over the period ?t = [t0t1] with t0 and t1 representing the times of the first and last relevant exposures. Here w(t ? u) is the weighting function previously described in which assigns weights to past exposures experienced at time t ? u on the basis of their contribution to the risk at time t. The model can be reparameterized as in (1b) where the risk is now expressed along the lag with ? ? [?0L]. Here L ? ?0 = t1 ? t0 is interpreted as the lag period over which an exposure to x is assumed to affect the risk at time t usually with ?0 = 0. This parameterization offers the advantage that the function w is now directly defined in the new dimension of lag ? and it is independent of the time axis chosen for t which may represent different time scales depending on the study design. The function w(?) termed from here on as the lag“response function models the lag“response curve associated with exposure x. Finally for computational purposes the integral is approximated in (1c) by a sum of terms derived by partitioning the lag interval in equally spaced discrete units and assuming the protracted exposure as a sequence of exposure events xt ? ? at lags ? = ?0 ¦ L. A statistical model for (1) can be defined by expressing the lag“response function w(?) as a linear combination of terms obtained through basis transformation with related parameters. By using matrix notation let the vector qxt of exposure history be defined by (2) Such exposure history changes along time depending on the time t at which the vector qxt is computed. Given (2) the cumulative function s(xt) in (1) can be written using a compact and general matrix notation as (3) The (L ? ?0 + 1) × v? matrix C is obtained from the transformation of the lag vector ? = [?0 ¦ ? ¦ L]T by choosing a specific basis with dimension v? for w(?) which defines the related basis functions. In this parameterization the function s(xt) representing the integral of x · w(?) over the interval [?0L] is defined as a lag“basis function with parameters ?. Interestingly the equation in (3) is almost identical to that defining DLMs 24 Eq. (4). The different indexing in the original version reflects the specific application in time series where the data are perfectly ordered in time and the matrix Q has a structure such that qt? ? qt + 1? + 1. However this is a specific case of the general representation in (2)“(3). The theory and software already developed for DLMs can be therefore extended in parallel. Alternative lag“basis functions for representing s(xt) are derived through different lag“response functions w(?) in (1). In particular the traditional index of unweighted cumulative exposure is a specific case of (3) where reduces to with w(?) equal to a constant c. This is obtained by specifying C as an (L ? ?0 + 1)-dimensional vector of 1's with v? = 1."
Lung_Cancer
"Moreover niclosamide could enhance antitumor immunity and inhibit lung metastasis by reducing the number of Gr1+/CD11b+ (MDSCs) in tumors. Therefore our studies provided strong evidence that niclosamide as a candidate of antibreast cancer drug is worth being further investigated. References 1 SiegelR NaishadhamD JemalA (2013) Cancer statistics 2013. CA Cancer J Clin63: 11“3023335087 2 DeSantisC SiegelR BandiP JemalA (2011) Breast cancer statistics 2011. CA Cancer J Clin61: 408“418 3 WiebeJP ZhangG WelchI Cadieux-PitreHAT (2013) Progesterone metabolites regulate induction growth and suppression of estrogen-and progesterone receptor-negative human breast cell tumors. Breast Cancer Res15: R3823663549 4 AndersonBO YipCH RamseySD BengoaR BraunS et al (2006) Breast cancer in limited-resource countries: health care systems and public policy. Breast J. 12: S54“S69 5 LiuMR CasimiroMC WangCG ShirleyLA JiaoXM et al (2009) p21CIP1 attenuates Ras-and c-Myc-dependent breast tumor epithelial mesenchymal transition and cancer stem cell-like gene expression in vivo. Proc Natl Acad Sci U S A106: 19035“1903919858489 6 Ottenhoff-KalffAE RijksenG Van BeurdenE HennipmanA MichelsA et al (1992) Characterization of protein tyrosine kinases from human breast cancer: involvement of the c-src oncogene product. Cancer Res52: 4773“47781380891 7 BrennanK BrownAM (2003) Is there a role for Notch signalling in human breast cancer? Breast Cancer Res5: 69“7512631384 8 CaiJC GuanHY FangLS YangY ZhuX et al (2013) MicroRNA-374a activates Wnt/?-catenin signaling to promote breast cancer metastasis. J Clin Invest123: 566“57923321667 9 HarrisonH SimµesBM RogersonL HowellSJ LandbergG et al (2013) Oestrogen increases the activity of oestrogen receptor negative breast cancer stem cells through paracrine EGFR and Notch signaling. Breast Cancer Res15: R2123497505 10 ZhangXL YuePB PageBD LiTS ZhaoW et al (2012) Orally bioavailable small-molecule inhibitor of transcription factor Stat3 regresses human breast and lung cancer xenografts. Proc Natl Acad Sci U S A109: 9623“962822623533 11 PageC HuangM JinX ChoK LiljaJ et al (2000) Elevated phosphorylation of AKT and Stat3 in prostate breast and cervical cancer cells. Int J Oncol17: 23“3110853013 12 CataldoL ChenNY YuanQ LiW RamamoorthyP et al (2000) Inhibition of oncogene STAT3 phosphorylation by a prolactin antagonist hPRL-G129R in T-47D human breast cancer cells. Int J Oncol17: 1179“126411078803 13 YuH JoveR (2004) The STATs of cancer-new molecular targets come of age. Nat Rev Cancer4: 97“10514964307 14 RenXM DuanL HeQ ZhangZ ZhouY et al (2010) Identification of Niclosamide as a New Small-Molecule Inhibitor of the STAT3 Signaling Pathway. ACS Med Chem Lett1: 454“459 15 HiranoT IshiharaK HibiM (2000) Roles of STAT3 in mediating the cell growth differentiation and survival signals relayed through the IL-6 family of cytokine receptors. Oncogene19: 2548“255610851053 16 SrivastavaK Kundumani-SridharanV ZhangBL BajpaiAK RaoGN (2007) 15 (S)-hydroxyeicosatetraenoic acid-induced angiogenesis requires STAT3-dependent expression of VEGF. Cancer Res67: 4328“433617483346 17 BollrathJ PhesseTJ von BurstinVA PutoczkiT BenneckeM et al (2009) gp130-mediated Stat3 activation in enterocytes regulates cell survival and cell-cycle progression during colitis-associated tumorigenesis. Cancer cell15: 91“10219185844 18 XinH HerrmannA ReckampK ZhangW PalS et al (2011) Antiangiogenic and antimetastatic activity of JAK inhibitor AZD1480. Cancer Res. 71: 6601“6610 19 LiR YouS HuZL ChenZG SicaGL et al (2013) Inhibition of STAT3 by niclosamide synergizes with erlotinib against head and neck cancer. PloS One8: e7467024019973 20 GarinJ DespeignesJ BillerauM (1964) Present treatment of taeniasis with niclosamide."
Lung_Cancer
"The protein encoded by DSC3 is a calcium-dependent glycoprotein (Desmocollin 3) that is required for cell adhesion and desmosome formation. The protein encoded by PKP1 may be involved in molecular recruitment and stabilization during desmosome formation. The protein encoded by CLCA2 belongs to the calcium sensitive chloride conductance protein family. It may serve as adhesion molecule for lung metastatic cancer cells. The above four genes (DSC3 DSG3 PKP1 and CLCA2) which are associated to desmosomes were found to be up-regulated in SCC compared to the AC subtype [26]. Concretely DSG3 showed high expression in SCC while low expression in AC [26]. DSC3 was also upregulated in SCC exclusively [27] [28]. In primary lung tumors DSC3 was a potential diagnostic marker for lung squamous cell carcinoma [29]. PKP1 showed a times greater level of expression in SCCs than in ACs and normal lung and thus may be useful in histopathological diagnosis [28]. CLCA2 has been inferred to be specifically overexpressed in SCC [30]. We found that subtype AC (SCC) was present (absent) if and only if NKX2-1 was expressed. It is inferred that the expression of NKX2-1 in the specimen of AC is much higher than that of SCC. NKX2-1 which is known as thyroid transcription factor 1 (TITF-1) is a homeodomain-containing transactivating factor and it expressed in the terminal lung bronchioles and lung periphery predominantly [31]. The presence of NKX2-1 protein was prevalent in AC while in SCC NKX2-1 was absent [13]. It is in accordance with our results. Examples of gene-subtype higher logic relationships The higher logic relationships between gene pairs and SCC were selected for further analysis. Gene pairs (GPX2 ITGB8) and (GPX2 SLC2A12) were related with SCC via an ˜AND™ logical relationship (higher logic relationship type ). It indicates that GPX2 ITGB8 and SLC2A12 were all expressed if the specimen was SCC. Moreover all of the genes GPX2 ITGB8 and SLC2A12 were not expressed if the specimen was AC. GPX2 was detected to have higher expression in SCC compared with AC and normal [32] [33]. We were unaware of evidence in the literature of the relationships between ITGB8 SLC2A12 and the subtypes of NSCLC. Our analysis generated several novel relationships. There are not enough evidences for higher logic relationships to distinguish the subtypes of NSCLC. Hence most of the relationships between gene pairs and the subtypes of NSCLC have not been confirmed. As the lack of knowledge about the regulation relationships between genes and subtypes the exact relationships between the common gene pairs and subtypes are deserved to be checked. Performance comparison We exacted the columns of binary probe data as well as those of phenotype profile data which correspond to the NSCLC specimens and normal specimens of GSE18842. The new binary probe data and phenotype profile data were formed by the exacted columns of binary probe data and phenotype profile data maintaining the relative positions of columns. The NSCLC and normal data comprised the new binary probe data and phenotype profile data. Application of the three methods We firstly applied the current method to the NSCLC and normal data. We set the and obtained probe-phenotype lower logic relationships. The significance and global significance of the discovered relationships were verified by statistic test. Next we applied the NMF method to the NSCLC and normal data. Rows with ˜s™ were filtered from the binary probe data to ensure the feasibility of the NMF method. The rest binary probe data contained rows and columns. Because two clusters of specimens (AC and SCC) were included in the binary probe data we chose as the dimensionality reduction parameter for the NMF method. Among the obtained two metagenes the second metagene had higher expression level in almost all (i.e. ) of the NSCLC specimens while lower expression level in almost all (i.e. ) of the normal specimens. The probes within the second metagene were sorted according to their activation levels (Table S4). The first probe represented the most closely related probe to the NSCLC phenotype while the last probe represented the least closely related probe. Finally we applied the RA method to the NSCLC and normal data. We sorted the probes by the mutual information between the probe profiles and NSCLC profiles. Note that the correlations between gene pairs and phenotypes could be measured by the current method but they could not be measured by the NMF and RA methods. Hence from this point of view the current method is superior to the two earlier methods. All of the three methods could find single genes closely related with phenotypes. Hence we just identified the gene-phenotype lower logic relationships by the current method and compared the results with those obtained by the two earlier methods. Performance comparison for the three methods We selected two datasets involved the genes which are related with NSCLC. One dataset contains high frequency genes on the mRNA level detected by Huang et al. (Table S5) [9]. It was showed that these genes belonged to the top dysfunctional gene sets with good discriminating ability. We chose the dataset because it was collected from GEO with the accession number GSE18842 which was also the source of the NSCLC and normal data in this work. The other dataset contains up-/down-regulated genes found by Urgard et al. where genes are down-regulated and genes are up-regulated in NSCLC compared to the normal tissue (Table S5) [34]. A total of genes were shared by the above two datasets. Because it is hard to validate the genes included in each dataset it is reasonable to consider these genes as the truth data to estimate the performance of different methods in this work. In order to estimate the performance of the current method and compare its performance with the two earlier methods (the NMF method and the RA method) we calculated a measure: the recall rate which was the ratio of the number of detected genes in the truth data to the total number of genes in the truth data. Note that the recall rate may be biased by the incomplete nature of the truth data. Further we evaluated the classification accuracy which evaluated the discriminating ability of resulted probes. Among all of the genes detected by probes obtained by the current method genes were in the truth data. Hence the recall rate of the current method was . To compare the recall rate of the current method with those of the two earlier methods we selected the top probes obtained by the NMF method and the RA method respectively. We found and zero of the genes in the truth data have been detected by the NMF method and the RA method respectively. Hence the recall rate of NMF and RA were and respectively. The current method had higher recall rate than NMF and RA. By Fig. 1 we found that the current method achieved higher classification accuracy than the NMF method and the RA method. Additionally the average classification accuracy of our method approached to (i.e. ) which means that the probes obtained by our method has a great classification ability. In the figure each curve was steady with little fluctuation. It indicates that the classification accuracy was little sensitive to the number of probes. .0094644.g001 The recall rate of genes obtained by three methods. According to each method we rank the genes in descending order by the coefficients of genes related with phenotypes. We selecte the top genes where . The classification accuracy is calculated based on the top genes. ˜RA™ ˜NMF™ and ˜U™ represent the relevance analysis method the non-negative matrix factorization method and the current method respectively. Biomarkers and key gene pairs Biomarkers inferred by gene-subtype lower logic relationships In previous research a total number of genes have been reported to be used to differentiate between AC and SCC and these genes are DSG3 [26] CLCA2 [30] DSC3 [27] PKP1 [28] NKX2-1 [35] GJB5 [26] KRT6B [36] SERPINB13 [36] TP63 [37] TRIM29 [38] KRT5 [28] NTRK2 [28] and DST [39]. We sorted the genes which were involved in the gene-AC/SCC lower logic relationships in descending order by their coefficients. Interestingly all of above genes were included in the top genes. It is suggested that a gene which has high uncertainty coefficient may clearly distinguish AC from SCC. To obtain a set of biomarkers we firstly selected the top ranked genes (Fig. 2). Because the molecular targets for targeted therapeutic agents play crucial roles for tumor the biomarkers for targeted therapy should have the distinct biological functions between NSCLC and normal. Next an intersection set was generated between top genes and the genes involved in gene-NSCLC lower logic relationships (the genes have been obtained in subsection ˜Performance comparison™). Finally intersect genes were regarded as the biomarkers for distinguishing "
Lung_Cancer
"A decrease of 50% or more from baseline urinary prostaglandin E2 metabolite after a 5-day open-label run-in period was used to select eligible patients. One hundred twenty patients (median age 64 years) were randomized (78 to AP/E and 42 to P/E). Overall median TTP was 1.8 months in the AP/E group and 2.1 months in the P/E group with a 12% objective response rate in both groups (intent-to-treat analysis). A subgroup analysis in patients aged 65 years or younger demonstrated a statistically significant TTP benefit for AP/E (hazard ratio 0.5 [95% confidence interval: not applicable“0.9]; p=0.018) and overall survival advantage at minimum 1-year follow-up (median 12.2 versus 4.0 months; hazard ratio=0.5; p=0.021). The most common adverse events were rash diarrhea fatigue and nausea. Toxicity contributed to early discontinuations in patients aged more than 65 years treated with AP/E. This is the first randomized placebo-controlled study of a COX-2 inhibitor in NSCLC to use a prospective patient-selection strategy. Although AP/E seemed to improve TTP and overall survival in a subset of patients aged 65 years or younger the primary endpoint of the trial was not met. Non“small-cell lung cancer Apricoxib Erlotinib Cyclooxygenase-2 inhibitor Prostaglandin E2 metabolite 0413066 2830 Cell Cell Cell 0092-8674 1097-4172 24630729 4040459 10.1016/j.cell.2014.02.031 NIHMS573682 Genetic and Clonal Dissection of Murine Small Cell Lung Carcinoma Progression by Genome Sequencing McFadden David G. 1 5 Papagiannakopoulos Thales 1 5 Taylor-Weiner Amaro 3 5 Stewart Chip 3 5 Carter Scott L. 3 5 Cibulskis Kristian 3 Bhutkar Arjun 1 McKenna Aaron 3 Dooley Alison 1 Vernon Amanda 1 Sougnez Carrie 3 Malstrom Scott 1 Heimann Megan 1 Park Jennifer 1 Chen Frances 1 Farago Anna F. 1 Dayton Talya 1 Shefler Erica 3 Gabriel Stacey 3 Getz Gad 3 4 * Jacks Tyler 1 2 * 1Koch Institute for Integrative Cancer Research and Department of Biology Massachusetts Institute of Technology Cambridge MA 02142 USA 2Howard Hughes Medical Institute Massachusetts Institute of Technology Cambridge MA 02142 USA 3Cancer Program Broad Institute of MIT and Harvard Cambridge MA 02142 USA 4Cancer Center and Department of Pathology Massachusetts General Hospital Boston MA 02114 USA *Correspondence: gadgetzbroadinstitute. (G.G.) tjacksmit.edu (T.J.) 5 Co-first author 6 5 2014 13 3 2014 13 3 2015 156 6 1298 1311 2014 Elsevier Inc. 2014 Summary Small cell lung carcinoma (SCLC) is a highly lethal smoking-associated cancer with few known targetable genetic alterations. Using genome sequencing we characterized the somatic evolution of a genetically engineered mouse model (GEMM) of SCLC initiated by loss of Trp53 and Rb1. We identified alterations in DNA copy number and complex genomic rearrangements and demonstrated a low somatic point mutation frequency in the absence of tobacco mutagens. Alterations targeting the tumor suppressor Pten occurred in the majority of murine SCLC studied and engineered Pten deletion accelerated murine SCLC and abrogated loss of Chr19 in Trp53; Rb1; Pten compound mutant tumors. Finally we found evidence for polyclonal and sequential metastatic spread of murine SCLC by comparative sequencing of families of related primary tumors and metastases. We propose a temporal model of SCLC tumorigenesis with implications for human SCLC therapeutics and the nature of cancer-genome evolution in GEMMs. J Natl Cancer Inst J. Natl. Cancer Inst jnci jnci.j JNCI Journal of the National Cancer Institute 0027-8874 1460-2105 Oxford University Press US 24317180 3906987 10.1093/jnci/djt338 Brief Communication Novel Germline Mutation in the Transmembrane Domain of HER2 in Familial Lung Adenocarcinomas Yamamoto Hiromasa Higasa Koichiro Sakaguchi Masakiyo Shien Kazuhiko Soh Junichi Ichimura Koichi Furukawa Masashi Hashida Shinsuke Tsukuda Kazunori Takigawa Nagio Matsuo Keitaro Kiura Katsuyuki Miyoshi Shinichiro Matsuda Fumihiko Toyooka Shinichi Affiliations of authors:Department of Thoracic Breast and Endocrinological Surgery (HY KS JS MF SH KT SM ST) Department of Clinical Genomic Medicine (KS ST) Department of Cell Biology (MS) Department of Pathology (KI) and Department of Hematology Oncology and Respiratory Medicine (KK) Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Okayama Japan; Center for Genomic Medicine Kyoto University School of Medicine Kyoto Japan (KH FM); Department of General Internal Medicine 4 Kawasaki Medical School Okayama Japan (NT); Department of Preventive Medicine Kyushu University Faculty of Medical Sciences Fukuoka Japan (KM). Correspondence to: Shinichi Toyooka MD PhD Okayama University Graduate School of Medicine Dentistry and Pharmaceutical Sciences Clinical Genomic Medicine/Thoracic Breast and Endocrinological Surgery 2-5-1 Shikata-cho Kita-ku Okayama Okayama 700“8558 Japan (e-mail: toyookamd.okayama-u.ac.jp). 1 2014 7 12 2013 7 12 2013 106 1 djt338 7 7 2013 14 10 2013 16 10 2013 The Author 2013. Published by Oxford University Press. 2013 This is an Open Access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs licence (http://creativecommons./licenses/by-nc-nd/3.0/) which permits non-commercial reproduction and distribution of the work in any medium provided the original work is not altered or transformed in any way and that the work is properly cited. For commercial re-use please contact journals.permissionsoup.com We encountered a family of Japanese descent in which multiple members developed lung cancer. Using whole-exome sequencing we identified a novel germline mutation in the transmembrane domain of the human epidermal growth factor receptor 2 (HER2) gene (G660D). A novel somatic mutation (V659E) was also detected in the transmembrane domain of HER2 in one of 253 sporadic lung adenocarcinomas. Because the transmembrane domain of HER2 is considered to be responsible for the dimerization and subsequent activation of the HER family and downstream signaling pathways we performed functional analyses of these HER2 mutants. Mutant HER2 G660D and V659E proteins were more stable than wild-type protein. Both the G660D and V659E mutants activated Akt. In addition they activated p38 which is thought to promote cell proliferation in lung adenocarcinoma. Our findings strongly suggest that mutations in the transmembrane domain of HER2 may be oncogenic causing hereditary and sporadic lung adenocarcinomas. Familial lung cancers are rare among human malignancies. Recent studies have reported that germline mutations in the epidermal growth factor receptor (EGFR) gene predispose the development of lung cancer. Reported familial lung adenocarcinomas with a germline EGFR mutation such as T790M carry secondary somatic EGFR mutations including exon 19 deletion and exon 21 L858R mutation (1“4). We encountered a family of Japanese descent in which multiple members developed lung cancer (). The proband (III-4) was a 53-year-old woman with multiple lung adenocarcinomas in bilateral lungs. She was a light smoker with a 1.2-pack-year history of smoking. She had undergone a left lower lobectomy for multiple lung adenocarcinomas at the age of 44 years. Her mother (II-4) a never smoker also had multiple lung adenocarcinomas. Partial pulmonary resections of two tumors were performed for II-4 for the purpose of diagnosis after pleural dissemination was found during surgery and multiple lesions were removed in a lobectomy or partial resections in III-4. A histological examination of the resected tumors in II-4 revealed nonmucinous adenocarcinoma in situ and nonmucinous minimally invasive adenocarcinoma whereas the histological findings of pleural dissemination indicated mucus-containing adenocarcinoma. Those of III-4 contained various subtypes of adenocarcinoma including nonmucinous and mucinous adenocarcinoma in situ and invasive mucinous adenocarcinoma. In addition normal-appearing lung parenchyma obtained from a lobectomy in III-4 revealed innumerable small preinvasive lesions implying the presence of precancerous changes throughout the lung (Supplementary available online). Sequencing analyses of EGFR exons 18 to 21 and KRAS as well as an immunohistochemical staining for ALK protein in the resected tumors indicated no genetic alterations in these genes. The pedigree chart suggested that lung cancer was inherited in an autosomal dominant manner. . Pedigree chart of a Japanese family in which multiple members developed lung cancer. The boxes and circles indicate men and women respectively. The numbers at the bottom of each member indicate the age at the time of death or the time of the analysis. An oblique line shows deceased family members. The proband (III-4) had multiple lung adenocarcinomas (arrow). "
Lung_Cancer
"Phenothiazines elicit caspase-mediated and caspase-independent cell death To gain insight into the mechanistic basis of phenothiazine-associated cytotoxicity we analyzed in detail the mode by which these compounds induce cell death in human SCLC cells. While some studies have implicated apoptosis as a major cell death mode in phenothiazine-treated cells34 9 we found that the percentage of SCLC exhibiting nuclear morphologic changes typical of apoptosis such as chromatin condensation and fragmentation remained low (10%) even at the highest TFP concentrations where >98% of all cells lost the ability to exclude propidium iodide (PI; data not shown). Instead TFP-treated SCLC cells exhibited profoundly shrunken nuclei without concomitant chromatin condensation. TFP elicited poly (ADP-ribose) polymerase (PARP) cleavage in some but not all LC cell lines (Figures 3a and b). Importantly although the SCLC cells are sensitive to 10??M TFP treatment and respond with an approximately 60% decrease in cell viability this concentration of TFP only resulted in no or minor cleavage of PARP. Consistent with a non-essential requirement of caspase-mediated apoptotic response the pan-caspase inhibitor benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone (z-VAD-fmk) did not significantly protect either SCLC (H82) or NSCLC (U-1810) cells from TFP-induced cell death (c) emphasizing the involvement of non-caspase-mediated cell death in response to phenothiazines in SCLC. Phenothiazines induce lysosomal dysfunction in LC cells Phenothiazines are known to be lysosomotropic and accumulate within intracellular acidic compartments.12 13 We therefore examined whether phenothiazines may affect lysosomal functions in LC cells. We found that treatment with TFP and related phenothiazines (cis-flupenthixol dihydrochloride (cis-FPX) PZ chlorpromazine hydrochloride (CPZ) TFPZ and FPZ) caused a rapid increase in appearance of light chain 3 (LC3)-II a marker of autophagy in a dose- and time-dependent manner in both SCLC and NSCLC cells (Figures 4a“c). By contrast the level of p62/SQSTM1 a scaffold protein that target ubiquitinated polypeptide cargo for autophagic degradation did not show any consistent change in response to TFP in the examined SCLC and NSCLC cells (a). As accumulation of LC3-II can result from either increased autophagic flux or impaired autophagic degradation we used chemical probes to manipulate these two processes separately and then investigated the effect of phenothiazines on LC3 conversion. Notably blocking autophagic degradation with the lysosomal protease inhibitor E-64d in cells treated with survivable concentrations of TFP (5??M in H82 and 10??M in U-1810) caused further accumulation of LC3-II indicative of enhanced autophagic flux (d). Similar results were obtained at cytotoxic concentrations of TFP or when autophagosome maturation was suppressed by bafilomycin A1 (BafA1; data not shown). Under conditions where de novo protein synthesis was shut down by cycloheximide (CHX) LC3-II induced by TFP pre-treatment (0“24?h) was rapidly cleared upon removal of TFP (e compare lanes 2 and 4). This process became significantly slower if TFP was present during the recovery period (24“48?h) especially in H82 cells (e compare lanes 5 and 6) suggesting that phenothiazines may additionally antagonize autophagic degradation. These data show that TFP both induces LC3-II and prevents its clearance especially in the SCLC cells which is consistent with the notion that phenothiazines perturb lysosome homeostasis more severely and persistently in SCLC than in NSCLC. Overall these data demonstrate that phenothiazines can modulate lysosomal functions in human LC cells. Basal lysosomal mass and pH buffer capacity can predict sensitivity to phenothiazines The response to chemotherapy (CT) in human tumors is highly heterogenous and therefore there is an urgent need for the identification of biomarkers for prediction of treatment efficacy. As our data suggest that the lysosome is a potentially critical site of action for phenothiazines when used as single treatment of LC cells we therefore sought to determine whether lysosome-associated parameters could be used to predict sensitivity of human LC cells to phenothiazines. Indeed we found a statistically significant inverse correlation between the mean cytotoxicity index calculated from the average cytotoxicity of six phenothiazines at 10??M (a ) and cellular retention of LysoTracker at baseline (a). On the other hand neither basal lysosomal ?-galactosidase (?-gal) activity nor the baseline expression levels of the lysosomal markers LC3-II and lysosomal-associated membrane protein 1 (LAMP-1) correlated well with cellular phenothiazine sensitivity (Supplementary Figures S2A“C). "
Lung_Cancer
"The DICER algorithm (24) seeks one pair of linked modules at a time. A pair of modules is defined as linked if the sum of weights WG between them is high enough. We call the approach of DICER ˜local™ as it finds one module pair at a time. The algorithm of Ulitsky et al. (17) aims to maximize the ˜global score™ namely the total sum of scores within modules in H plus the sum of scores of links in G. In addition to increasing the global score links between modules are accepted only if they pass a statistical significance test. We call the second approach ˜global™. Both methods identify the links and the modules simultaneously.D demonstrates the differences between the local and global approaches. Assume that in both graphs edge weights are 1 non-edge weights are ?1 and that the local approach uses a threshold of 0 on the sum of WG weights between two modules for reporting a link. In both approaches modules are clusters of nodes with high density in H. According to both approaches module 1 is linked to module 2: the local score is 4 (8 edges and 4 non-edges) the global analysis P-value for linkage is <0.05 and the total score for the module pair is 13 (module score 6 + 3 + link score 4). The sum of WG weight between modules 2 and 3 is ?4 (10 edges and 14 non-edges) and the local method rejects that link. However the global approach will also link module 2 and 3: the linkage P-value is significant (P = 0.039) and adding this link will improve the global map score to 24 [13 for the (12) pair +15 for module 3“4 for the (23) link]. This example illustrates the advantage of the global approach on sparse graphs in which large modules are not expected to be densely interconnected.AlgorithmsWe conducted a systematic study and developed further a family of two-phase algorithms for module map detection that find an initial solution (possibly consisting of many small modules) and then improve it. We call algorithms for the first phase initiators and algorithms for the second phase improvers. For simplicity we describe the algorithms assuming that edges with positive weight are considered heavy. For unweighted graphs we assume edge weights to be 1 and non-edge weights to be ?1. For weighted graphs all node pairs (edges) have weights so there are no non-edges.InitiatorsWe tested five different initiators: (i) DICER (24) which finds one pair of linked modules at a time (ii) hierarchical clustering of the graph H (25) which finds a set of modules (iii) a greedy node addition algorithm for finding modules in H (iv) DICERk a variant of DICER wherein the minimum module size is set to k and (v) an algorithm based on enumeration of maximal bicliques in G using an exhaustive solver (2627) followed by the cleaning process of DICER. We call the latter algorithm MBC-DICER see Supplementary Text and Supplementary Figure S1 for a full description of all initiators. Each initiator creates an initial module set but modules in the map constructed by clustering algorithms are not necessarily linked.ImproversThe ˜local improver™ (24) extends module map links by either adding a single node to a module or by merging two module map links. One drawback of this approach is that it cannot create new modules that are not represented in the initial solution. Another disadvantage is that it cannot merge a module whose two parts are linked to different modules that are unlinked. See Supplementary Figure S2 for examples."
Lung_Cancer
"The dust diseases silicosis and asbestosis were the first occupational diseases to have widespread impact on workers. Knowledge that asbestos and silica were hazardous to health became public several decades after the industry knew of the health concerns. This delay was largely influenced by the interests of Metropolitan Life Insurance Company (MetLife) and other asbestos mining and product manufacturing companies. Objectives: To understand the ongoing corporate influence on the science and politics of asbestos and silica exposure including litigation defense strategies related to historical manipulation of science. Methods: We examined previously secret corporate documents depositions and trial testimony produced in litigation; as well as published literature. Results: Our analysis indicates that companies that used and produced asbestos have continued and intensified their efforts to alter the asbestos“cancer literature and utilize dust-exposure standards to avoid liability and regulation. anizations of asbestos product manufacturers delayed the reduction of permissible asbestos exposures by covering up the link between asbestos and cancer. Once the decline of the asbestos industry in the US became inevitable the companies and their lawyers designed the state of the art (SOA) defense to protect themselves in litigation and to maintain sales to developing countries. Conclusions: Asbestos product companies would like the public to believe that there was a legitimate debate surrounding the dangers of asbestos during the twentieth century particularly regarding the link to cancer which delayed adequate regulation. The asbestos“cancer link was not a legitimate contestation of science; rather the companies directly manipulated the scientific literature. There is evidence that industry manipulation of scientific literature remains a continuing problem today resulting in inadequate regulation and compensation and perpetuating otherwise preventable worker and consumer injuries and deaths. asbestos mesothelioma state-of-the-art corporate corruption MetLife industry knowledge 9421547 4136 Hum Pathol Hum. Pathol. Human pathology 0046-8177 1532-8392 24746212 4271837 10.1016/j.humpath.2014.01.003 NIHMS648391 Y-chromosome status identification suggests a recipient origin of posttransplant non“small cell lung carcinomas: chromogenic in situ hybridization analysis??? Chen Wei MD PhD a Brodsky Sergey V. MD PhD a Zhao Weiqiang MD PhD a Otterson Gregory A. MD b Villalona-Calero Miguel MD b Satoskar Anjali A. MD a Hasan Ayesha MD b Pelletier Ronald MD c Ivanov Iouri MD PhD a Ross Patrick MD PhD c Nadasdy Tibor MD a Shilo Konstantin MD a * aDepartment of Pathology The Ohio State University Wexner Medical Center Columbus OH 43210 bDepartment of Medicine The Ohio State University Wexner Medical Center Columbus OH 43210 cDepartment of Surgery The Ohio State University Wexner Medical Center Columbus OH 43210 *Corresponding author. Department of Pathology The Ohio State University Wexner Medical Center E412 Doan Hall 450 West 10th Ave Columbus OH 43210. Konstantin.ShiloOSUMC.edu (K. Shilo) 13 12 2014 23 1 2014 5 2014 19 12 2014 45 5 1065 1070 2014 Elsevier Inc. All rights reserved. 2014 Summary Owing to the need of lifelong immunosuppression solid-an transplant recipients are known to have an increased risk of posttransplant malignancies including lung cancer. Posttransplant neoplastic transformation of donor-derived cells giving rise to hematopoietic malignancies Kaposi sarcoma and basal cell carcinoma in nongraft tissues has been reported. The goal of this study was to assess the cell origin (donor versus recipient derived) of posttransplant non“small cell lung carcinomas (NSCLCs) in kidney and heart transplant recipients. An institutional database search identified 2557 kidney and heart transplant recipients in 8 consecutive years. Among this cohort 20 (0.8%) renal and 18 (0.7%) heart transplant recipients developed NSCLC. The study cohort comprised 6 of 38 NSCLCs arising in donor-recipient sex-mismatched transplant patients. The tumor cell origin was evaluated by chromogenic in situ hybridization with Y-chromosome probe on formalin-fixed paraffin-embedded tissues. Y-chromosome was identified in 97% ± 1% (range from 92% to 99%) of all types of nucleated cells in male control tissues. In all 5 NSCLCs from male recipients of female donor an Y-chromosome was identified in 97% ± 2% (range from 92% to 100%) of tumor cells statistically equivalent to normal control (P < .001). No Y-chromosome was identified in NSCLC cells from a female recipient of male kidney. These findings suggest a recipient derivation of NSCLC arising in kidney and heart transplant recipients. A combination of histologic evaluation and chromogenic in situ hybridization with Y-chromosome analysis allows reliable determination of tissue origin in sex-mismatched solid-an transplant recipients and may aid in management of posttransplant malignancy in such cases. Post“solid-an transplantation lung cancer Chromogenic in situ hybridization for Y-chromosome 15030100R 648 Ann Thorac Surg Ann. Thorac. Surg. The Annals of thoracic surgery 0003-4975 1552-6259 24576597 4008142 10.1016/j.athoracsur.2013.12.043 NIHMS571118 Accuracy of FDG-PET within the clinical practice of the ACOSOG Z4031 trial to diagnose clinical stage I NSCLC Grogan Eric L. MD MPH a b c Deppen Stephen A. MA MS PhD b c * Ballman Karla V. f Andrade Gabriela M. b Verdial Francys C. b Aldrich Melinda C. b d Chen Chiu L. e Decker Paul A. f Harpole David H. MD g Cerfolio Rrobert J. MD h Keenan Robert J. MD i Jones David R. MD j D™Amico Thomas A. MD g Shrager Joseph B. MD k Meyers Bryan F. MD l Putnam Joe B. Jr. MD a b aVeterans Affairs Medical Center Nashville TN bDepartment of Thoracic Surgery; Department of Medicine Vanderbilt University Medical Center Nashville TN cInstitute for Medicine and Public Health Vanderbilt University Medical Center Nashville TN dDivision of Epidemiology Vanderbilt University Medical Center Nashville TN eCenter for Quantitative Sciences Vanderbilt University Medical Center Nashville TN fDivision of Biomedical Statistics and Informatics Mayo Clinic Rochester MN gDepartment of Surgery Duke University Durham NC hDepartment of Surgery University of Alabama Birmingham AL iDepartment of Surgery Allegheny General Hospital Pittsburgh PA jDepartment of Surgery University of Virginia Charlottesville VA kDepartment of Surgery Stanford University Stanford CA lDepartment of Surgery Washington University St. Louis MO Corresponding Author/Request for Reprints: Eric Grogan M.D. M.P.H. Department of Thoracic Surgery 609 Oxford House 1313 21st Ave. South Nashville TN 37232 Phone: 615-322-0064 Fax: 615-343-9194 eric.groganvanderbilt.edu * Equal shared co-first author 23 4 2014 25 2 2014 4 2014 01 4 2015 97 4 1142 1148 2014 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved. 2014 Background Fluoro-deoxyglucose positron emission tomography (FDG-PET) is recommended for diagnosis and staging of NSCLC. Meta-analyses of FDG-PET diagnostic accuracy demonstrated sensitivity and specificity of 96% and 78% respectively but were performed in select centers introducing potential bias. This study evaluates the accuracy of FDG-PET to diagnose NSCLC and examines differences across enrolling sites in the national ACOSOG Z4031 trial. Methods 959 eligible patients with clinical stage I (cT1-2N0M0) known or suspected NSCLC were enrolled between 2004 and 2006 in the Z4031 trial and 682 had a baseline FDG-PET. Final diagnosis was determined by pathological examination. FDG-PET avidity was categorized into four levels based on radiologist description or reported maximum standard uptake value (SUV). FDG-PET diagnostic accuracy was calculated for the entire cohort. Accuracy differences based on preoperative size and by enrolling site were examined. Results Preoperative FDG-PET results were available for 682 participants enrolled at 51 sites in 39 cities. Lung cancer prevalence was 83%. FDG-PET sensitivity was 82% (95% CI: 79“85) and specificity was 31% (95% CI: 23%“40%). Positive and negative predictive values were 85% and 26% respectively. Accuracy improved with lesion size. Of 80 false positive scans 69% were granulomas. False negative scans occurred in 101 patients with adenocarcinoma being the most frequent (64%) and eleven were ?10mm. The sensitivity varied from 68% to 91% (p=0.03) and the specificity ranged from 15% to 44% (p=0.72) across cities with > 25 participants. Conclusions In a national surgical population with clinical stage I NSCLC FDG-PET to diagnose lung cancer performed poorly compared to published studies. Tumour Biol Tumour Biol Tumour Biology 1010-4283 1423-0380 Springer Netherlands Dordrecht 24510347 4053595 1674 10.1007/s13277-014-1674-x Research The diagnostic and prognostic value of serum human kallikrein-related peptidases 11 in non-small cell lung cancer Xu Chun-Hua Zhang Yu Yu Li-Ke +86-25-8372-8558 +86-25-83728558 yulike_doctor163.com Department of Respiratory Medicine Nanjing Chest Hospital 215 Guangzhou Road Nanjing 210029 China Nanjing Clinical Center of Respiratory Diseases Nanjing China 9 2 2014 9 2 2014 6 2014 35 6 5199 5203 6 12 2013 22 1 2014 The Author(s) 2014 Open Access This is distributed under the terms of the Creative Commons Attribution License which permits any use distribution and reproduction in any medium provided the original author(s) and the source are credited. The aim of this study was to explore the diagnostic and prognostic value of serum human kallikrein-related peptidases 11 (KLK11) level in non-small cell lung cancer (NSCLC). Serum specimens from 138 patients with NSCLC and 40 healthy controls were collected. The concentration of KLK11 was measured by enzyme-linked immunosorbent assay (ELISA). The concentration of KLK11 in NSCLC was significantly higher compared to that in the controls (P?<?0.01). The serum KLK11 levels decreased with stage presence of lymph node and distant metastases regardless of histology age and sex. With a cutoff point of 1.05 ng/ml KLK11 showed a good diagnostic performance for NSCLC. Univariate analysis revealed that NSCLC patients with serum high KLK11 had a longer overall survival (OS) and progression-free survival (PFS) than those with low KLK11 (HR of 0.36 P?=?0.002; HR of 0.46 P?=?0.009). Cox multivariate analysis indicated that KLK11 was an independent prognostic indicator of PFS and OS (HR of 0.53 P?=?0.042; HR of 0.48 P?=?0.037). Kaplan“Meier survival curves further confirmed that patients with high KLK11 have longer PFS and OS (P?=?0.003 and P?=?0.018 respectively). In conclusion the measurement of KLK11 might be a useful diagnostic and prognostic test for NSCLC patients. Keywords Kallikrein-related peptidases 11 Non-small cell lung cancer Diagnosis Prognosis issue-copyright-statement International Society of Oncology and BioMarkers (ISOBM) 2014 Introduction Lung cancer is the leading cause of cancer-related death worldwide with more than 1.2 million deaths each year [1]. Non-small cell lung cancer (NSCLC) accounts for 80“85 % of total lung malignancies [2]. Although advances in noninvasive methods have improved our ability to detect lung cancer more than 75 % of lung cancer patients present an advanced stage of disease [3] and they have little prospect of effective and curative treatment with 5-year survival rates of less than 15 % [4]. Tumor markers play a key role in patient management for many malignancies. The potential uses of serum tumor markers include aiding early diagnosis determining prognosis prospectively predicting response or resistance to specific therapies and monitoring therapy in patients with advanced disease. Kallikrein-related peptidases 11 (KLK11) is a member of the human kallikrein gene family which localized on chromosome 19q13.4 [5]. Recent studies have reported that KLK11 has been expressed in many cancers including prostate cancer [6] ovarian cancer [7] gastric cancer [8] as well as rectal carcinoma [9]. An immunofluorometric assay study demonstrated that KLK11 expression in ovarian cancer tissues is a marker of favorable prognosis since patients with KLK-positive tumors exhibit a longer progression-free survival (PFS) and overall survival (OS) [10]. Additionally Sasaki et al. [11] reported that lower KLK11 mRNA expression in lung cancer is an indicator of poor prognosis in patients with lung cancer. However there seems to be a paucity of research concerned with serum KLK11 expression in NSCLC. For this reason the goal of the present study was to investigate the baseline serum levels of KLK11 in patients with NSCLC to determine its potential diagnostic and prognostic roles. Materials and methods Patients A total of 138 patients with NSCLC were examined at the Nanjing Chest Hospital between January 2006 and May 2008. The cohort of patients included 80 (58.0 %) male and 58 (42.0 %) female subjects with a median age of 56 years (range 45“68 years). The clinical features of the patients are summarized in Table 1. Follow-up lasted through December 2012 with a median follow-up period of 22 months for living patients (range 3“80 months). PFS was defined as the time interval between the date of diagnosis and the date of disease relapse. OS was defined as the time interval between the date of diagnosis and the date of death.Table 1Clinical characteristics of NSCLC patients and controlsVariablesNSCLCControl P valueSubject no.13840Age year57.8?±?10.254.6?±?7.80.614Male/Female80/5826/140.325Histology?AC78?SCC60 AC adenocarcinoma SCC squamous cell carcinoma The diagnosis of lung cancer was made using various methods: sputum cytology fine-needle aspiration or bronchoscopy as dictated by the patient™s presentation. Pathologists interpreted the cytology or histology of tissue biopsy. Lung cancer was staged using a widely used classification system and the staging procedure included a clinical examination; CT of the chest abdomen and brain; abdominal ultrasonography; bone scanning; and positron emission tomography. The study protocol was approved by the ethics committee of Nanjing Chest Hospital. All patients provided written informed consent before enrollment. Measurement of serum KLK11 levels Serum samples from each individual were obtained at the time of diagnosis before any therapeutic measures were started (surgery chemotherapy or radiation). Samples were centrifuged at 1500×g for 10 min at ?4 °C. The supernatant was stored at ?80 °C for assessment of the levels of KLK11. The KLK11 concentration was determined by ELISA with the commercial KLK11 ELISA Ready-SET-Go kit (eBioscience San Diego CA). All samples were blinded to the technologists running the assays and the code was broken to the statisticians after the database was constructed. Statistical analysis Statistical software (SPSS for Windows version 18) was used for the analysis. Differences between independent groups were examined by the Mann“Whitney U test. To determine the diagnostic accuracy of KLK11 receiver operating characteristic (ROC) curves were retrieved from logistic regression analysis and the area under the curve (AUC) was calculated. Univariate survival analysis was performed using the Kaplan“Meier method and the log-rank test. Multivariate analysis was conducted to determine an independent impact on survival using the Cox proportional hazard method. P?<?0.05 was considered statistically significant. Results Comparison of serum KLK11 levels between NSCLC patients and controls As shown in Fig. 1 the concentration of KLK11 was significantly higher in patients with NSCLC (2.04?±?0.86 ng/ml) than in those with the controls (0.93?±?0.52 ng/ml) (P?<?0.01).Fig. 1Levels of KLK11 in NSCLC. Among 138 NSCLC patients the serum levels of KLK11 were 2.04?±?0.86 ng/ml which were significantly higher than 0.93?±?0.52 ng/ml in healthy controls (P?<?0.01) Diagnostic value of KLK11 in NSCLC A ROC curve analysis was carried out to assess the value of KLK11 in NSCLC. The area under the ROC curve was 0.892 (confidence interval (95 % CI) 0.841“0.942). With a cutoff point of 1.05 ng/ml which was defined as the normal value based on the mean value plus two standard deviation obtained from healthy controls serum KLK11 has a sensitivity of 65.9 % (91/138) a specificity of 82.5 % (33/40) an accuracy of 69.7 % (124/178) a positive predictive value of 92.9 % (91/98) and a negative predictive value of 41.3 % (33/80) (Fig. 2).Fig. 2ROC of KLK11 for the diagnosis of NSCLC. Serum levels of KLK11 among 138 NSCLC patients and 40 healthy controls were determined. The diagnostic potentials of KLK11 were assessed by ROC curves. The AUC value was 0.892 Relationship between serum KLK11 levels and clinicopathologic factors The relationships between KLK11 levels and clinicopathologic factors of lung cancer patients are shown in Table 2. The serum KLK11 levels did not differ significantly with age (P?=?0.569) sex (P?=?0.505) or histology (P?=?0.713). The levels of KLK11 were significantly correlated with tumor-node-metastasis (TNM) stage (P?=?0.000) lymph node metastases (P?=?0.000) and distant metastases (P?=?0.000).Table 2The clinicopathological factors of NSCLC and the association with KLK11 levelsFactorsnKLk11 (ng/ml) P- valueAge year0.569??60622.07?±?0.77?<60762.12?±?0.66Gender0.505?Male802.16?±?0.82?Female581.99?±?0.53Histology0.713?AC782.05?±?0.85?SCC602.01?±?0.53TNM stage0.000?I“II882.51?±?0.61?III“IV501.76?±?0.63Lymph node metastases0.000?Absent682.41?±?0.64?Present701.65?±?0.57Distant metastases0.000?Absent982.38?±?0.59?Present401.89?±?0.71 AC adenocarcinoma SCC squamous cell carcinoma Association of serum KLK11 levels with survival Finally we determined whether the baseline serum concentration of KLK11 would be a prognostic marker in NSCLC. The cutoff point of 1.05 ng/ml was selected to categorize patients as KLK11-high or low. Univariate analysis showed that serum KLK11 level was significantly correlated OS (P?=?0.002) and PFS (P?=?0.009) (Table 3).Table 3Univariate and multivariate analysis of KLK11 status with regard to PFS and OSVariablesPFSOSHR95 % CI P valueHR95 % CI P valueUnivariate analysis?KLK11 (Low vs. High)0.460.25“0.820.0090.360.19“0.690.002?Age (?60 vs. <60)1.230.67“2.280.5061.180.59“2.130.792?Gender (Male vs. Female)1.320.71“1.820.7821.190.69“1.980.673?Histology (AC vs. SCC)1.830.59“2.130.7921.340.65“1.980.546?Stage (I“II vs. III“IV)1.330.65“2.210.0010.931.09“3.440.025?Lymph node metastases (absent vs. present)1.421.04“1.940.2711.770.32“1.660.347?Distant metastases (absent vs. present)1.981.03“3.010.0391.871.04“2.990.075Multivariate analysis?KLK11 (low vs. high)0.530.29-0.970.0420.480.24-0.950.037?Age (?60 vs. <60)0.980.52-1.940.8341.061.28-3.010.128?Gender (male vs. Female)1.280.67-1.890.6721.140.46-2.140.542?Histology (AC vs. SCC)1.371.04-2.330.3151.260.64-2.560.424?Stage (I“II vs. III“IV)1.250.56-2.260.0011.961.02-3.770.043?Lymph node metastases (absent vs. present)1.130.81-1.570.1481.840.33-1.720.334?Distant metastases (absent vs. present)1.440.85-1.970.0981.890.99-2.350.051 HR hazard ratio CI confidence interval In multivariate analysis high KLK11 was found to be significantly associated with a longer PFS and OS (HR 0.53 and 0.48; P?=?0.042 and P?=?0.037 respectively). Kaplan“Meier survival curves (Fig. 3) further demonstrate that lung cancer patients with high KLK11 have substantially longer PFS and OS (P?<?0.05) compared to those with low KLK11 cancer. As expected disease stage was found to be strongly associated with decreased PFS and OS in both univariate and multivariate analyses (P?<?0.05).Fig. 3Kaplan“Meier survival curves for PFS and OS in patients with KLK11-high and -low NSCLC. Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [14“16]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the Kaplan“Meier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In conclusion our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Boño CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Tropà C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Boño CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 mwoduke.edu phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 lkwradradiol.snu.ac.kr 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. "
Lung_Cancer
"Although de Torres et al. demonstrated by using a well-characterized cohort of patients with COPD that the incidence of dense lung cancers decreased as the severity of the airflow obstruction at baseline increased [23] the severity of COPD in Japanese patients with newly diagnosed lung cancer was classified mainly as GOLD grade 1 and 2 rather than as GOLD grade 3. Furthermore our data showed that most patients were newly classified with COPD (84.4%; 124/147 cases) compatible with the incidence of the severity of COPD shown above or previously [1323]. It should be noted that in comparing patients undergoing thoracic surgery COPD patients had an average postoperative stay that was 61% higher and a 100% greater need of prolonged oxygen therapy than patients without COPD indicating the clinical impact of the coexistence of COPD [14]. The prevalence of COPD might increase in Japanese patients with lung cancer whereas the impact of COPD-related systemic comorbidities is also increasingly recognized in clinical aspects of COPD [7]. Thus whether or not the decision-making process involved in proposing the therapeutic management of lung cancer might be independently affected by COPD in patients with lung cancer remains elusive. To address this issue we evaluated whether or not completion of clinical staging and proposal of thoracic surgery with curative intent might be affected by the coexistence of COPD. The percentage of patients in whom clinical staging had been not completed was significantly higher in the COPD group than in the non-COPD group. More than half of these patients were referred to other hospitals for further support while the others were patients with disease recurrence. The proportion of patients with each classification in the clinical staging was compatible with that reported in previous studies about thoracic surgery [24]. Clinical guidelines recommend the assessment of spirometry to evaluate the optimum selection of surgical procedure in view of the risks of mortality and postoperative complications [6825]. Therefore we analyzed data from 185 patients with lung cancer at stage 1A to 3A because these patients are generally eligible for thoracic surgery with curative intent [1726]. Even among these surgical candidates however the number of surgeries performed was significantly lower in the COPD group (64.1%; 59/92 cases) than in the non-COPD group (81.7%; 76/93 cases) (). Furthermore our data showing that COPD-related systemic comorbidities might not be independent factors for proposing thoracic surgery with curative intent was supported by previous data as described above [14]. Thus these data indicate that the decision-making process for the therapeutic management of Japanese lung cancer patients might be affected by the prevalence and severity of COPD. Finally we evaluated whether or not the severity of COPD classified by GOLD grade might be an independent factor affecting the proposal of thoracic surgery with curative intent. Multivariate analysis indicated that severity of COPD was a critical and independent factor for proposing thoracic surgery with curative intent to Japanese patients with lung cancer who underwent bronchoscopy. This finding might be supported by our previous study showing that in comparing patients undergoing thoracic surgery COPD patients with an FEV1/FVC below 0.70 had an average postoperative stay that was 61% higher and a 100% greater need of prolonged oxygen therapy (POT) than patients without COPD [14]. Some limitations of the present study deserve mention. First the reversibility test was performed in only 62.2% of patients (168/270 cases) although COPD was defined as a postpronchodilator FEV1/FVC below 0.7 [16]. This limitation is present in other studies that have evaluated the prevalence of COPD [91027]. The other explanation might be the preoperative pulmonary assessment based on the clinical guidelines in which the need to perform a reversibility test for assessment of airflow obstruction is not mentioned [825]. Although a recent study suggests that some COPD patients show relatively high reversibility for a short-acting beta2-agonist [28] only 1.2% of 168 cases showed significant reversibility in the present study indicating that Japanese patients with both lung cancer and COPD might have different characteristics from that population [27]. Second the present study retrospectively analyzed 270 out of a total of 320 cases with lung cancer in a single institution and therefore might be subject to selection bias. However analyzing the data from 84.4% of all patients in a single institution who were sequentially registered and underwent bronchoscopy from 2010 to 2012 might minimize the possible contribution of the selection bias for patients with lung cancer. Although many studies suggest that COPD remains underdiagnosed in the patients with lung cancer [1314] Zang et al. suggest that awareness of COPD might contribute the conformity to GOLD treatment guideline for stable condition and acute exacerbation of COPD in lung cancer patients during hospitalization [13]. When spirometry was performed at bronchoscopy the median time from the date of spirometry to thoracic surgery was 50 days in the present study. Therefore comprehensive assessment of COPD at bronchoscopy might allow us to implement the optimum management for lung cancer patients [2930]. Conclusions In the present study the high prevalence of COPD among Japanese patients with newly diagnosed lung cancer was shown. Although further investigation into the validity of the assessment of COPD at bronchoscopy from studies of patients with lung cancer from other institutions is warranted we conclude that appropriate risk stratification and comprehensive management of patients with lung cancer and COPD might be made by assessment of the coexistence and severity of COPD at the time of bronchoscopy. Competing interests The authors have declared that no conflict of interest exists. Authors™ contributions NH AM and YH had full access to all of the data in the study and are responsible for the integrity of the data and the accuracy of the data analysis"
Lung_Cancer
"These data indicate that HDAC3 knockdown induced BANCR increase may be due to the inhibition of HDAC3 enzymatic activity. BANCR inhibits NSCLC cell viability and induces apoptosis To assess the biological role of BANCR in NSCLC we investigated the effects of BANCR over-expression on the viability and apoptosis of SPCA1 or A549 cells. Our qPCR results revealed that BANCR expression was significantly upregulated compared with that in control cells (A). MTT assay results showed that the growth of SPC-A1 and A549 cells transfected with pCDNA-BANCR was impaired compared with that for control cells (B and C). Colony formation assay results revealed that clonogenic survival was inhibited following overexpression of BANCR in SPC-A1 and A549 cells (D). Flow cytometry analysis of SPC-A1 and A549 cells showed that upregulation of BANCR expression promoted apoptosis in comparison with that in control cells (E). Effects of BANCR on NSCLC cell viability and apoptosis in vitro. (A) SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (B C) MTT assays were used to determine the cell viability for pCDNA-BANCR-transfected SPC-A1 and A549 cells. Values represented the mean?±?s.d. from three independent experiments. (D) Colony-forming assays were conducted to determine the proliferation of pCDNA-BANCR-transfected SPC-A1 and A549 cells. (E) Apoptosis was determined by flow cytometry. UL necrotic cells; UR terminal apoptotic cells; LR early apoptotic cells. *P?<?0.05 and **P?<?0.01. BANCR inhibits migration and invasion of NSCLC cells The wound healing assay results showed that cells transfected with pCDNA-BANCR resulted in a slower closing of scratch wounds compared with that for control cells (A and B). We evaluated cancer cell invasion through matrigel and migration through transwells. Increased BANCR expression levels impeded the migration of SPC-A1 and A549 cells by approximately 64% compared with controls (C and D). Similarly invasion of SPC-A1 and A549 cells was also reduced by 59% following upregulation of BANCR expression. Effects of BANCR on NSCLC migration and invasion in vitro. SPC-A1 and A549 cells were transfected with pCDNA-BANCR. (A B) Wound-healing assays were used to investigate the migratory ability of NSCLC cells. (C D) Transwell assays were used to investigate the changes in migratory and invasive abilities of NSCLC cells. *P?<?0.05 and **P?<?0.01. Knockdown of BANCR expression promotes NSCLC cells invasion To determine whether inhibition of BANCR expression could promote NSCLC cells viability and invasion we performed targeted knockdown of BANCR expression using RNA interference (RNAi) in A549 cells (A). MTT assays revealed that downregulation of BANCR expression did not affect cell viability (data not shown). However decreased BANCR expression levels promoted A549 cell migration and invasion in vitro (B). Effects of BANCR overexpression on tumor metastasis in vivo. (A) BANCR expression levels were determined by qPCR following the treatment of A549 cells with si-BANCR. (B) Transwell assays were conducted to determine the migratory and invasive abilities of si-BANCR-transfected A549 cells. Analysis of an experimental metastasis animal model was performed by injecting BANCR-overexpressing SPC-A1 cells into nude mice. (C) Lungs from mice in each experimental group with the numbers of tumor nodules on lung surfaces were shown. (D) Visualization of the entire lung and HE-stained lung sections. **P?<?0.01. BANCR suppresses NSCLC cell metastasis in vivo To validate the effects of BANCR on the metastasis of NSCLC cells in vivo SPCA1 cells stably transfected with pCDNA-BANCR were injected into nude mice. Metastatic nodules on the surface of lungs were counted after 7 weeks. Ectopic overexpression of BANCR resulted in a reduction of the number of metastatic nodules compared with those in the control group (C). This difference was further confirmed following examination of the entire lungs and through hematoxylin and eosin (HE) staining of lung sections (D). Our in vivo data complemented the results of functional in vitro studies involving BANCR. BANCR influences NSCLC cell EMT We conducted qPCR and western blotting assays to detect the expression of EMT-induced markers (E-cadherin N-cadherin and Vimentin) in cells over-expressing BANCR. Our findings showed that increased BANCR expression levels induced E-cadherin expression while decreased N-cadherin Vimentin and MMP-2 expression (A). Simultaneously upregulation of BANCR expression led to decreased SNAIL1 SNAIL2 and SIP1 expression (B). Western blotting and immunofluorescence analysis also revealed that enhanced BANCR expression stimulated E-cadherin expression and reduced Vimentin expression in NSCLC cells (B and C). BANCR overexpression suppresses NSCLC cell invasion and metastasis by affecting EMT. (A B) Analysis of E-cadherin N-cadherin Vimentin MMP-2 MMP-9 SNAIL1 SNAIL2 TWIST and SIP1 expression in A549 cells treated with pCDNA-BANCR. (CD) Analysis of E-cadherin and Vimentin expression in A549 cells treated with pCDNA-BANCR by western blot and immunofluorescence. All experiments were performed in triplicate with three technical replicates. *P < 0.05 **P < 0.01. Discussion Recent evidence has shown that ncRNAs play an important role in cancer pathogenesis and could provide new insights into the biology of this disease [2122]. Over the past decade microRNAs (miRNAs) have moved to the forefront of ncRNA research in NSCLC. However lncRNAs in NSCLC are still an emerging field with only a handful of lncRNAs involved in NSCLC tumorigenesis. One of these lncRNAs is metastasis-associated lung adenocarcinoma transcript 1 (MALAT1)."
Lung_Cancer
"DCs with 0.1 ng/ml LPS which was the equivalent amount of endotoxin found in 2 ?g/ml scFvMTBHsp70. After a 24 h-incubation both scFvMTBHsp70 and MTBHsp70 induced DC maturation indicated by an increase in the expression of CD40 CD80 CD86 and MHC class II molecules in comparison to the control cultures in medium. The increased expression of these DC maturation markers were comparable to those on cells stimulated with 1 ?g/ml LPS. The contamination control showed that addition of 0.1 ng/ml LPS did not replicate the effects of scFvMTBHsp70 or MTBHsp70 allowing us to discriminate the scFvMTBHsp70- or MTBHsp70-specific effects from effects of LPS (Figure 4A and B). scFvMTBHsp70 induces DC maturation and promotes antigen presentation and cross-presentation. A CD11c+ BMDCs isolated form FVB/NJ mice were incubated for 24 h with 2 ?g/ml scFvMTBHsp70 1.3 ?g/ml MTBHsp70 1 ?g/ml LPS as positive control or 0.1 ng/ml LPS as contamination control (thick lines) or medium only (solid) stained for CD11c CD40 CD80 CD86 and MHC II and analyzed by flow cytometry. Histograms were gated on CD11c+ DCs. Data are representative of three independent experiments in duplicate wells. B Median fluorescence intensity (MFI) of LPS- or protein-stimulated BMDCs normalized to MFI of BMDCs maintained in medium. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. C BMDCs cultured from FVB/NJ mice were pulsed with BR5FVB1 cells alone (Column a) or BR5FVB1 cells pre-complexed with MTBHsp70 (Column b) or scFvMTBHsp70 (Column c) and then incubated with BR5FVB1 tumor cell-primed T cells. Intracellular granzyme B and IFN? expressions in CD3+CD4+ and CD3+CD8+ T cells were analyzed by flow cytometry. Data from three independent experiments in duplicate wells are pooled and analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests. Data are presented as mean?±?SEM. D Representative flow data are presented. E scFvMTBHsp70 enhanced tumor cell immunogenicity in vivo. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD4+ or CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01; ***p?<?0.001; ****p?<?0.0001. The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their antitumor therapeutic efficacy in vivo. To determine whether scFvMTBHsp70 promotes tumor specific T-cell responses by enhancing antigen presentation and cross-presentation by antigen presenting cells we co-cultured BR5FVB1 tumor cell-primed T cells with DCs that had been pulsed with BR5FVB1 tumor cells in the presence of scFv-MTBHsp70 MTBHsp70 or PBS. The scFvMTBHsp70/tumor cell-pulsed DCs induced significantly higher production of IFN-? and Granzyme B from both CD4+ and CD8+ tumor cell-primed T cells as compared with MTBHsp70 or PBS indicating that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs (Figure 4C and D). scFvMTBHsp70 enhances tumor cell immunogenicity in vivo Having demonstrated in vitro that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs we next explored whether scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs and consequently enhances tumor cell immunogenicity in vivo. It has been demonstrated that the high density of DCs at dermal sites facilitates the capture of tumor antigens and that local inflammation induces DC maturation and migration into draining lymph nodes where they present antigens to na¯ve T cells generating a tumor specific immune response [26]. We primed FVB mice with an intradermal (i.d.) injection of mitomycin C-treated BR5FVB1 tumor cells followed by a booster i.d. injection of BR5FVB1 tumor cells with or without scFvMTBHsp70 or MTBhsp70. After 20 days we dissociated skin-draining lymph nodes and re-stimulated lymph node lymphocytes with Her2/neu peptides mitomycin C-treated BR5FVB1 tumor cells or BR5FVB1 tumor cell lysate and performed flow cytometric analysis for the presence of Granzyme B-generating CD4+ and CD8+ T cells. As shown in Figure 4E we demonstrated that Granzyme B-generating CD4+ and CD8+ T cells were significantly enhanced in mice that were immunized with scFv-MTBHsp70-bound tumor cells as compared to those in the mice immunized with tumor cells alone MTBHsp70-bound tumor cells or saline. Discussion We have developed a novel protein-based immunotherapy consisting of a fusion of an anti-MSLN scFv of human origin and recombinant mycobacterial heat shock protein 70 that has the ability to adjuvant significant T-cell responses against specific tumor antigens. P4 scFv directed against MSLN a surface antigen overexpressed on several types of tumor cells is used as a means of targeting the immunotherapeutic agent. We have demonstrated that this bifunctional fusion protein effectively binds BR5FVB1 ovarian cancer cells or 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells. We found that the fusion protein significantly prolonged survival time in syngeneic mouse models of papillary ovarian cancer and malignant mesothelioma. Treatment with the fusion protein induced significant tumor-specific CD8+ T-cell immune responses in the splenocytes of ovarian tumor-bearing mice. Furthermore in vivo CD8+ T-cell depletion studies demonstrated that this protective antitumor effect is mainly mediated by tumor-specific CD8+ T cells. Treatment using a mixture of MTBHsp70 plus P4 scFv for ovarian tumor or malignant mesothelioma-bearing mice did not increase survival or enhance tumor-specific immune responses suggesting that only through fusion of the two elements is the immune system effectively activated. We also demonstrated that this approach does not induce inflammation in the abdominal or intestinal mesothelial tissues as a result of a bystander interaction with MSLN on normal mesothelial cells. Several properties of MTBHsp70 appear in this study to contribute to the generation of tumor-specific CD4+ and CD8+ T-cell immune responses. First it induces maturation of DCs. Although several previous studies suggested that MTBHsp70 had pro-inflammatory properties only when contaminated with LPS [2728] other studies have decisively demonstrated that MTBHsp70 alone while not LPS promotes DC maturation and innate immune responses [161729]. In our study we used a fusion protein generated from a mammalian cell expression system ensuring a minimal amount of LPS contamination. We also incubated DCs with the same amount of LPS as that found in the fusion protein and failed to replicate the effects observed with the fusion protein supporting the view that maturation of DCs can be attributed to the fusion protein rather than LPS. Secondly MTBHsp70 is capable of delivering epitopes for enhanced processing and MHC-I presentation by DCs to na¯ve CD8+ T cells a process known as cross-presentation [30]. Mycobacterial Hsp70 fusion proteins have been shown to elicit both CD4+ and CD8+ T-cell responses although priming of CD8+ T cells does not appear to require CD4+ T cells [3132]. We demonstrated in this study that the MSLN-targeted fusion protein elicited significant tumor-specific CD8+ T-cell immune responses in ovarian cancer-bearing mice and this adaptive antitumor response has an absolute requirement for tumor-specific CD8+ T cells. Although at the dosing schedule used in these studies tumor-specific T-cell responses did not eventually lead to rejection of the established tumors they significantly prolonged survival time in tumor-bearing mice. DCs are believed to play a pivotal role in the initiation and programming of tumor-specific T-cell responses and are becoming an essential target in efforts to generate therapeutic immunity against cancer [33]. Two main approaches are currently under consideration for providing DCs with tumor-specific antigens. One approach is to culture patient-derived DCs ex vivo with an adjuvant that induces DC maturation in the presence of tumor specific antigens followed by adoptive transfer into the patient [33]. This approach is fraught with technical and practical difficulties such as selection of a suitable antigenic target inappropriate maturation state of selected DCs and the difficulty of generating a sufficient number of DCs ex vivo. In addition a number of investigators have recently reported that ex vivo-derived DC vaccines have an insignificant role in the direct priming of T cells in vivo[33-35]. An alternative approach to generate tumor-specific antigen bearing DCs is to induce them to take up tumor-specific antigens in vivo. It has been shown that in vivo specific targeting of tumor antigens to DCs improves the induction of antigen-specific CD4+ and CD8+ T-cell immunity. In these studies an agonistic anti-CD40 monoclonal antibody was used to mature DCs and eliminate antigen-specific tolerance [36-39]. MTBHsp70 has also been shown to stimulate inflammation and DC maturation via an interaction with CD40 receptors on both DCs and monocytes thus acting as an alternative ligand to CD40L [2940]. In our study we showed the fusion protein up-regulates surface expression of phenotypic markers of DC maturation. Interestingly in addition to CD80 CD86 and MHC class II molecules the expression of CD40 is also enhanced indicating a possible positive feedback loop involving CD40 signaling components. Beyond promoting DC maturation the scFvMTBHsp70 fusion protein also targets tumor cells towards the matured DCs. We propose that binding of the fusion protein with both tumor cells and DCs improves phagocytosis of parts of tumor cells by DCs and therefore any tumor antigen can be processed and loaded on both MHC class II and MHC class I molecules and presented to CD4+ and CD8+ T cells. This could explain the observed augmentation of tumor antigen presentation and cross-presentation brought about by the fusion protein in vitro. This may also explain the observed increased anti-Her2/neu CD8+ T-cell responses in the scFvMTBHsp70-treated ovarian tumor bearing mice although Her2/neu is not directly targeted. We recapitulated these in vitro findings in an in vivo tumor cell immunogenicity study. We used the fusion protein to activate and mature DCs in the skin such as Langerhans cells. These DCs then captured tumor cells or tumor cell fragments through the connection established by the fusion protein and migrated to the draining lymphoid organs where they presented tumor antigens to na¯ve T cells. T cells recovered from the draining lymph node showed significantly enhanced responses to stimulation with a range of tumor antigens. Conclusion Our study provides preclinical evidence that supports a protein-based immunotherapy that induces anti-tumor immune responses which normally require dendritic cell-based approaches. The MSLN-targeted MTBHsp70 fusion protein binds MSLN on tumor cells recruits and activates APCs including DCs loads DCs in vivo with the broadest profile of naturally processed tumor antigens promotes tumor antigen presentation and cross-presentation and enhances tumor specific CD4+ and CD8+ T-cell responses (Figure 5). Our study supports the continued exploration of this novel fusion protein alone or in combination with immune checkpoint inhibitors following conventional surgical reduction and chemotherapy for MSLN-expressing cancers. This new approach could significantly increase time to recurrence and survival in humans with ovarian cancer and mesothelioma where effective second line treatment options are very limited. Figure 5 A schematic model showing that the scFvMTBHsp70 fusion protein binds with MSLN on tumor cells and activates antigen presenting cells (APCs) thus promoting uptake of tumor cells or tumor cell fragments and promoting tumor antigen presentation and cross-presentation as well as adjuvanting tumor specific CD4 + and CD8 + T-cell responses. Methods Production of proteins The plasmid pQE30-MTBhsp70 that encodes full length MTBHsp70 was a generous gift from Dr. Peter Sveshnikov (Moscow Medical Academy Russia). The plasmid pTOR2-scFv that encodes an scFv fragment specific to MSLN and the recombinant P4 scFv protein [13] generated and purified from yeast were generous gifts from Dr. Nathalie Scholler (Penn Ovarian Cancer Research Center University of Pennsylvania). The DNA fragment corresponding to a 15 amino acid linker (GGGGSGGGGSGGGGS) was connected to the scFv at its C-terminal using an overlap PCR approach. The PCR product scFv-linker was subcloned into pQE30-MTBhsp70 at the N-terminal of MTBhsp70. The DNA fragment for scFvMTBhsp70 was PCR amplified and cloned into pPMY5 (Promab) downstream of a human IgG1 Fc domain and separated from the Fc region by the signal cleavage sequence for Tobacco Etch Virus protease (TEV enzyme). scFvMTBHsp70 the MSLN-targeted fusion protein was generated from HEK293 cells and purified using Protein G resin (Pierce). The Fc region of the Protein G eluted protein was then cleaved from the fusion protein by TEV enzyme (Promab) digestion. MTBHsp70 was generated using the same expression system. The production and purification of these two proteins was accomplished by Promab Biotechnologies Inc. at Richmond CA. After purification and hIgG-Fc tag removal the integrity of scFv-MTBHsp70 and MTBHsp70 were determined by SDS-PAGE followed by staining with RAPIDstain (G-Bioscience). Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were determined by Limulus Amebocyte Lysate Assay (LAL-assay Cambrex). Cells The BR5FVB1 ovarian cancer cells a kind gift from Dr. Orsulic in Women™s Cancer Research Institute at Cedars-Sinai Medical Center [41] or 40L mesothelioma cells a kind gift from Dr. Kane in Department of Pathology and Laboratory Medicine at Brown University [42] were maintained at 37°C in DMEM with 2 mmol/L L-glutamine 10 units/ml penicillin 10 ?g/ml streptomycin and 10% fetal bovine serum in humidified atmosphere with 5% CO2. Cells were cultured until 80% confluent and harvested with enzyme-free cell-dissociation buffer (Gibco) for in vitro tumor cell binding assays and cross-presentation studies or harvested with Trypsin EDTA (Mediatech) for animal injections. Mouse PBLs were obtained from FVB mice via tail vein bleeds after lysis of erythrocytes using M-lyse buffer (R&D systems). Small pieces of parietal peritoneal membrane were taken from the mice and digested in enzyme-free cell-dissociation buffer to obtain mouse peritoneal mesothelial cells. To test whether scFvMTBHsp70 or MTBHsp70 binds to the MSLN-expressing tumor cells or non-cancerous cells we incubated BR5FVB1 ovarian tumor cells 40L mesothelioma cells or normal cells from FVB mice including PBLs splenocytes and peritoneal mesothelial cells with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 followed by anti-MTBHsp70 (IgG2a) (Biodesign International) biotinylated anti-IgG2a (BD Bioscience) and Streptavidin-APC (BioLegend) and then analyzed the tumor cells by flow cytometry. As controls cells were incubated with the reagents described above except scFvMTBHsp70 or MTBHsp70. To confirm that scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml of recombinant human MSLN (R&D Systems) for 30 min before adding to the cells. For fluorescence microscopy cells were cultured on coverslips until 50% confluent stained with 10 ?g/ml scFvMTBHsp70 or 6.5 ?g/ml MTBHsp70 followed by mouse anti-MTBHsp70 (1:500 dilution) and Donkey anti-mouse Alexa Fluor 594 (Invitrogen 1:500 dilution). Cells were observed using a Nikon Eclipse TiE fluorescence microscope. In some experiments tumor cells were treated with 20 ?g/ml mitomycin C at a concentration of 5 — 106/ml for 1 h in a 37°C water bath and washed with complete medium at least 3 times before use. Animal models and tumor treatment Ovarian cancer was established by i.p. injection of syngeneic cancer cells BR5FVB1 (107 cells per mouse) into 6-week-old female FVB/NJ mice as previously described [25]. All mice were purchased from Jackson laboratories. Intraperitoneal mesotheliomas were established by i.p. injection of syngeneic 40L cells (2?—?106 per mouse) into 6-week-old male C57BL/6 mice as previously described [42]. Mice with ovarian tumors were treated 7 days after BR5FVB1 tumor cell inoculation with i.p. injections of scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. This was followed by 3 further treatments at 4-day intervals. In the mesothelioma model C57BL/6 mice were treated 5 days after 40L tumor cell inoculation and injected i.p. with scFvMTBHsp70 (2 ?g per mouse) normal saline or an equimolar mixture of MTBHsp70 plus P4 scFv. Three subsequent doses were administered at 3-day intervals thereafter. For survival studies we observed the mice daily 3 weeks after inoculation of BR5FVB1 cells or 1 week after inoculation of 40L cells. Tumor generations were consistently first evident via abdominal distension secondary to malignant ascites and tumor-bearing mice were euthanized at the endpoint when there were signs of distress including fur ruffling rapid respiratory rate hunched posture reduced activity and progressive ascites formation as previously described [25]. For the investigation of anti-tumor T-cell responses all ovarian tumor-bearing mice were sacrificed 7 days after the final scheduled treatment. All studies were performed in a manner that was blinded to the observer under pro"
Lung_Cancer
"The occurrence of PLC is extremely rare in liver carcinoma. Herein we report the case of a patient with PLC after liver transplantation due to liver carcinoma. PLC was confirmed by clinical manifestations imaging studies and cytologic examination of exfoliated cells in the pleural effusion. Liver carcinoma Liver transplantation Metastasis Pulmonary lymphangitic carcinomatosis Background Primary liver carcinoma is a malignancy originating from hepatocytes and/or intrahepatic biliary epithelial cells. In China there are more than 90 million carriers of the hepatitis B virus (HBV) accounting for 40% to 45% of HBV carriers worldwide. The high prevalence of HBV in China is the underlying reason why liver carcinoma is the malignancy with the highest morbidity and mortality rates in China. Currently resection and liver transplantation are major strategies for the treatment of liver carcinoma. For patients with hepatic cirrhosis liver transplantation can cure both the cancer and liver cirrhosis. However liver carcinoma may recur or metastasize after resection or liver transplantation mainly via the hematogenous route. Although lymphatic metastasis can occur metastasis is usually found in the hepatic hilus upper abdomen and retroperitoneal lymph nodes [1]. Pulmonary lymphangitic carcinomatosis (PLC) is a special manifestation of metastatic cancer in the lymphatic vessels of the lung that is characterized by diffuse or focal growth. Most PLC cases originate from adenocarcinomas. PLC is rare in liver carcinoma patients. To the best of our knowledge no studies reported to date have described PLC after liver transplantation. Case presentation A 45-year-old man was admitted to our hospital with a complaint of repeated episodes of abdominal distension. He was diagnosed with HBV-induced hepatic cirrhosis and liver carcinoma (T3N0M0). He underwent liver transplantation without any metastasis before the operation. Pathological analysis identified a tumor (12 cm?—?8 cm?—?10 cm) in the right lobe of the liver within which the cancer cells were arranged in nests and pleomorphism was seen. These findings together with the results of immunohistochemistry demonstrated features of mixed liver carcinoma: ?-fetoprotein (+) hepatocytes (+) CD34 (+) CD19 (+) CD10 (focal +) synaptophysin (-) chromogranin A (-) and cytokeratin (pan +) (). The function of the graft liver was favorable. FK506 was used alone for antirejection therapy. Immunohistochemical staining of mixed liver carcinoma tissue specimens. (A) Cancer cells were arranged in nests and showed atypia. The interstitium was rich in sinusoids and invasive growth was noted. (B) Image showing cytokeratin 19 (CK19) (+). (C) Image showing CK7 (+). All three images are stained with hematoxylin and eosin and were scanned at 100— original magnification. Two months later the patient developed a dry cough of unknown etiology and his condition deteriorated 1 week later. Expectoration was occasionally present accompanied by chest tightness shortness of breath and hypoxemia (75 mmHg partial pressure of oxygen). Fever and chills were absent and the patient™s white blood cell count neutrophil count and inflammatory factors were normal. His sputum culture was negative. Lung computed tomography (CT) suggested infectious lesions in the lung which were characterized by interstitial changes. Right-sided pleural effusion and segmental atelectasis in the lower lobe of the right lung were noted. Several enlarged lymph nodes were identified in the mediastinum (A). Thoracentesis was immediately performed and approximately 2000 ml of light yellow fluid was collected. The patient™s chest tightness and shortness of breath improved significantly. Posttransplantation interstitial pneumonia was considered at first. FK506 was discontinued and methylprednisolone (40 mg every 12 hours) caspofungin sulfamethoxazole (SMZ) and aminophylline were administered. Computed tomography scans of the lungs. (A) Soon after the appearance of the patient™s respiratory symptoms a computed tomography (CT) scan revealed septal thickening of the peribronchovascular interstitium pleural effusion segmental atelectasis in the right lower lobe of the lung and several enlarged lymph nodes in the mediastinum. (B) Discontinuation of anti-infection therapy and 5 days after thoracentesis extensive involvement of the parenchyma with septal thickening was evident with reticulonodular densities in all lung fields. Five days later a lung CT scan showed reexpansion of the right lung and diffuse exudate in the interstitium. Multiple nodules were found in both lungs (B). Pulmonary function tests showed severe obstructive ventilatory dysfunction and moderate reduction in carbon monoxide diffusion capacity. Examination of exfoliated cells in the pleural effusion showed cancer cells (). Positron emission tomography (PET)-CT indicated multiple nodules and patchy or cloudy shadows with high density in both lungs (maximal standardized uptake value (SUV) approximately 6.27). Several enlarged lymph nodes were found in the mediastinum hepatic hilus and retroperitoneum (maximal SUV approximately 8.39). Moreover lesions with increased density were found in the left third rib the right upper femur and the left acetabulum which were accompanied by an increase in fluorodeoxyglucose. The patient was diagnosed with PLC after liver transplantation due to liver carcinoma. Cancer cells among the exfoliated cells in the pleural effusion are shown. All slides are stained with hematoxylin and eosin and were photographed under light microscope at 400 — original magnification. The treatment with steroid and aminophylline continued to improve the status of the patient™s interstitial lesions. Although antirejection therapy was stopped rejection did not occur and the function of the graft liver was stable. Oral capecitabine was administered but was not effective. The patient experienced increasing chest tightness and shortness of breath and he died as a result of respiratory failure 1 month later. Discussion PLC was first described by Troisier in 1873. About 30% to 40% of malignancies may present with metastasis to the lung and PLC accounts for approximately 6% to 8% of metastatic cancer in the lung. Most PLCs originate from adenocarcinomas and they are most often due to lung cancer followed by breast cancer and gastric cancer [23]. Patients with renal cancer cervical cancer thyroid cancer and melanoma rarely develop PLC [4-6]. The pathologic features of PLC include infiltration of cancer cells and interstitial edema in and around lymphatic vessels as well as infiltration of inflammatory cells caused by lymph node metastasis in the lung. The metastatic cancer in the mediastinal and pulmonary hilar lymph nodes may obstruct lymphatic drainage resulting in retrograde migration of cancer cells into terminal lung tissues via lymphatic vessels or anterograde migration of cancer cells in the pleura into the pulmonary hilar lymph nodes through intrapulmonary lymph vessels. In addition a cancer embolus may form in the terminal vessels of the lung due to hematogenous metastasis which can invade the surrounding lymphatic vessels. Thus hilar and mediastinal lymph node metastasis may be present or absent in PLC depending on the route of metastasis of the primary cancer. Extrahepatic metastasis of liver carcinoma is mostly found in the lung adrenal gland bone and central nervous system. Hematogenous spread is thought to be the most common extrahepatic metastatic route [78]. "
Lung_Cancer
"Competing interests The authors declare that they have no competing interests. Authors™ contributions JK PD and OR were responsible for the study design and implementation. JK and PD performed the data analysis. JK PD IC and OR contributed to the implementation and manuscript writing. All authors read and approved the final manuscript. Acknowledgement We thank Sarah Verlaan for thorough revision with regard to language. Tsao AS Wistuba I Roth JA Kindler HL Malignant pleural mesothelioma J Clin Oncol 2009 27 2081 2090 10.1200/JCO.2008.19.8523 19255316 Rusch VW Rosenzweig K Venkatraman E Leon L Raben A Harrison L Bains MS Downey RJ Ginsberg RJ A phase II trial of surgical resection and adjuvant high-dose hemithoracic radiation for malignant pleural mesothelioma J Thorac Cardiovasc Surg 2001 122 788 795 10.1067/mtc.2001.116560 11581615 Vogelzang NJ Rusthoven JJ Symanowski J Denham C Kaukel E Ruffie P Gatzemeier U Boyer M Emri S Manegold C Niyikiza C Paoletti P Phase III Study of Pemetrexed in Combination With Cisplatin Versus Cisplatin Alone in Patients With Malignant Pleural Mesothelioma J Clin Oncol 2003 21 2636 2644 10.1200/JCO.2003.11.136 12860938 Weder W Stahel R Bernhard J Bodis S Vogt P Ballabeni P Lardinois D Betticher D Schmid R Stupp R Ris HB Jermann M Mingrone W Roth AD Spiliopoulos A Swiss Group for Clinical Cancer Research Multicenter trial of neo-adjuvant chemotherapy followed by extrapleural pneumonectomy in malignant pleural mesothelioma Ann Oncol 2007 18 1196 1202 10.1093/annonc/mdm093 17429100 Treasure T Lang-Lazdunski L Waller D Bliss JM Tan C Snee M O™Brien M Thomas G Senan S O™Byrne K Kilburn LS Spicer J Landau D Edwards J Coombes G Darlison L Peto J MARS trialists Extra-pleural pneumonectomy versus no extra-pleural pneumonectomy for patients with malignant pleural mesothelioma: clinical outcomes of the Mesothelioma and Radical Surgery (MARS) randomised feasibility study Lancet Oncol 2011 12 763 772 10.1016/S1470-2045(11)70149-8 21723781 Janne PA Baldini E Patterns of failure following surgical resection for malignant pleural mesothelioma Thorac Surg Clin 2004 14 567 573 10.1016/j.thorsurg.2004.06.006 15559064 Krayenbuehl J Susann O Davis JB Ciernik IF Combined Photon and Electron 3D-Conformal versus Intensity Modulated Radiotherapy with an Integrated Boost for Adjuvant Treatment of Malignant Pleural Mesothelioma following Pleuropneumonectomy Int J Radiat Oncol Biol Phys 2007 69 1593 1599"
Lung_Cancer
"Survival curves of chimeric Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 250 and 167 days respectively. Survival curves of F1 Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 235 and 140 days respectively. Luciferase activity emitted from the thorax of 11 F1 invCAG-MycL1-Luc;Rb1F/F ;Trp53F/F mice. Each line represents measurements of an individual mouse. MycL1 copy number in SCLC tumors from three different genotypes determined by real-time PCR and aCGH. Each circle represents a primary SCLC tumor. All tumors with more than four copies (dotted line) were considered positive for MycL1 amplification. Note that overexpression of MycL1 by the transgene significantly reduces the frequency of genomic MycL1 amplifications in tumors as compared to the Rb1F/F ;Trp53F/F control ( P = 0.002 Fisher's Exact Test) and the invCAG-Luc;Rb1F/F ;Trp53F/F control ( P = 0.035 Fischer's Exact Test). In vivo validation of Mycl1 as a bona fide oncogene in SCLC Tumors of small cell lung cancer patients often show amplifications of genomic regions coding for either MYCL1 c-MYC or NMYC (Iwakawa et al 2013). In SCLC tumors of the Rb1F/F ;Trp53F/F model amplifications of the genomic region 4qD2.2 coding for Mycl1 are frequently observed (Calbo et al 2005; Dooley et al 2011). To confirm that the Mycl1 oncogene plays a causal role in the progression of SCLC we adapted our frt-invCAG-Luc construct by introducing the Mycl1 cDNA and an internal ribosomal entry site (IRES) upstream of the Luc gene (supplementary Fig S8A). This construct named frt-invCAG-Mycl1-Luc allows for simultaneous expression of both Mycl1 and Luc after Cre recombination and was introduced in the re-derived Col1a1-frt targeted Rb1F/F ;Trp53F/F ESC clone 1B1 (Fig 3) with high efficiency (supplementary Table S2). Two ESC clones were used to generate chimeras (supplementary Table S1 and Fig S8B). These chimeras were treated intratracheally with Ad5-Cre and developed neuroendocrine carcinomas in lung with a considerably shorter latency as compared to the invCAG-Luc;Rb1F/F ;Trp53F/F chimeras with a median survival of 167 days as opposed to 250 days (Fig 4C). This tumor acceleration was even more pronounced in the F1 cohorts which showed a median survival of 235 days for invCAG-Luc and 140 days for invCAG-Mycl1-Luc (Fig 4D) highlighting the importance of Mycl1 in SCLC development. This additional decrease in tumor latency is likely caused by the increase in target cell population in the F1 mice as compared to the chimeras especially since lung tissue showed the least contribution of GEMM-ESCs in chimeric mice (Fig 2C)."
Lung_Cancer
"Blood samples were stored at the Biobank of the University of Navarra and were processed following standard operating procedures approved by the Ethical and Scientific Committees. Tumor ORR to the treatment was assessed using computerized tomography (CT) scans every two pemetrexed-based chemotherapy cycles and categorized according to the Response Evaluation Criteria In Solid Tumors (RECIST) v1.1 as per institutional protocol. The toxicities recorded during pemetrexed-based treatment were graded according to the Common Terminology Criteria for Adverse Events (CTCAE) version 4.0. TS enhancer region genotyping analysis The genomic DNA was extracted from the peripheral leucocytes. The genotypes of the TSER (VNTR) and SNP were determined by polymerase chain reaction (PCR). The variable number tandem repeat (VNTR) of 28 bp polymorphism and the G???C SNP in the first and second repeat were analyzed. A DNA fragment was amplified using previously described PCR conditions and primers [17] and directly sequenced using an ABI PRISM 3100 Genetic Analyzer (Applied Biosystems Foster City CA USA). The forward primer 5?-CGTGGCTCCTGCGTTTCC-3? and the reverse primer 3?-GAGCCGGCCACAGGCAT-5? were used. A modification of conventional conditions was necessary. PCR was performed in a reaction mixture with dNTP: 0.35 ?l Buffer: 0.25 ?l MgCl2: 17.5 ?l Tap polymerase: 0.5 ?l H2O: 18 ?l primers 0.1?+?0.1 ?l DMSO: 1.25 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 30 cycles at 95°C for one minute then at 64°C for one minute and 72°C one minute and finally seven minutes at 72?ºC. Aliquots of amplified fragments were separated on a 3% agarose gel and the TS VNTR genotype was determined staining 2R (210 base pairs; bp) and 3R (238 bp) alleles. After that we performed a PCR-restriction fragment length polymorphisms (RFLP) by Hae III digestion. The mixture was PCR product: 10 ?l H2O: 7 ?l Buffer 2 ?l and Hae III: 1 ?l. After that we incubated the mixture at 37°C overnight. Aliquots of digested fragments were separated on 12% acrylamide gel and the SNP genotype was determined. The digestion of fragments showed the different genotypes 2RGC: 664746 44 and 7 bp 2RCC: 11346 44 and 7 bp 3RGGCC (3RG): 66474644 28 and 7 bp 3RGCC (3RC): 944746 44 and 7 bp. TS 3?UTR region genotyping analysis The 3?UTR polymorphisms were analyzed by Restriction Fragment Length Polymorphism (RFLP). A fragment containing the 6 bp deletion/insertion was amplified using the reverse primer 5?-CAGATAAGTGGCAGTACAGA-3?and the forward primer 3?-CAAATCTGAGGGAGCTGAGT-5? in 10 ul of reaction mixture with dNTP: 4 ?l Buffer: 5 ?l MgCl2: 4 ?l Tap polymerase: 0.5 ?l H2O: 26.5 ?l primers 4?+?4 ?l and DNA: 2 ?l. The cycling conditions were denaturation 95°C for 10 minutes and 35 cycles at 95°C for 30 minutes then at 57°C for 30 minutes and 72°C one minute and finally seven minutes at 72°C. The fragments were amplified on 2% agarose gel. Afterwards the products were digested with Dra I and the mixture of PCR product: 20 ?l BSA 10%: 0.5 ?l Buffer: 5 ?l H2O: 23.5 ?l and Dra I: 1 ?l. Posteriorly the product was incubated one hour at 37°C. The final digested product was separated in a 3% agarose gel. The different genotypes were deletion 6 bp/insertion 6 bp insertion 6 bp/insertion 6 bp and deletion 6 bp/deletion 6 bp. The expected fragment sizes by genotyping were deletion 6 bp/insertion 6 bp: 148142 88 and 60 bp insertion 6 bp/insertion 6 bp: 88 and 60 bp and deletion 6 bp/deletion 6 bp: 142 bp. We repeated the PCR three times to ensure final results. EGFR mutations analysis As per institutional protocol all patients with advanced NSCLC were tested for EGFR activating mutations before treatment initiation. In brief after having the samples fixed in alcohol and stained by Papanicolau stain DNA was extracted and amplified by PCR technique using EGFR gene exons 1819 20 and 21 specific primers. ABI PRISM® 310 Genetic Analyzer equipment was used for the analysis of the sequencing reactions with both forward and reverse primers. Statistical analysis Fisher™s exact test was used to investigate the correlation between each genotype and the response to the treatment and the toxicity presented. Kaplan-Meier curves and log-rank test or Tarone-Ware test when indicated were calculated to correlate each genotype with the survival outcomes (PFS and OS). For the subgroup analysis EGFR mutation status and smoking history were considered in order to analyze potential differences in clinical outcome measures (ORR PFS and OS). The SPSS 15.0 software (SPSS Inc. Chicago IL) was employed to perform the statistical analysis. Results Patients™ characteristics and treatment The clinical and pathological characteristics of the patients included are summarized in . In brief our cohort was mainly composed by males with a median age of 59 years and a past smoking history showing good performance status. Most of the patients showed adenocarcinoma histology (88%) and showed distant metastasis (M1) at onset (72%). Most of the patients received a pemetrexed-based regimen in first line (84%). After a median follow up of 21 months 80% of patients have already progressed and 52% of them have died due to disease progression (). Patients™ characteristics N pts % Gender ??Female 11 44 ??Male 14 56 Age ??<60 13 52 ??> r =60 12 48 ECOG ??0 9 36 ??1 15 60 ??2 1 4 Tobacco ??Current smoker 4 16 ??Never smoker 7 28 ??Former smoker 14 56 Histology ??Adenocarcinoma 22 88 ??Adenocarcinoma poorly differentiated 2 8 ??Adeno-squamous 1 4 T ??T1-2 12 48 ??T3-4 13 52 N ??N0 6 24 ??N+ 19 76 M ??M0 7 28 ??M1 18 72 Lung metastases ??Presence 7 28 ??Absence 18 72 Liver metastases ??Presence 2 8 ??Absence 23 92 Bone metastases ??Presence 10 40 ??Absence 15 60 Brain metastases ??Presence 8 32 ??Absence 17 68 EGFR ??Wild type 23 92 ??Mutant 1 4 ??Unknown 1 4 Line of treatment ??First/Induction (stage III) 2 8 ??First 21 84 ??Second 1 4 ??Third 1 4 Response ??Response 18 72 ??Progression?+?Stabilization 7 28 Maintenance ??No maintenance 18 72 ??Maintenance 7 28 Progression ??Not progressed 6 24 ??Progressed 19 76 Clinical status ??Alive 12 48 ??Dead 13 52 Eastern Cooperative Oncology Group (ECOG). Epidermal Growth Factor Receptor (EGFR). In addition in 8 out of the 18 subjects showing multiple brain metastases at onset conventional whole-brain radiotherapy (300 cGy) was administered between first and second chemotherapy cycles following our institutional treatment guidelines. Finally 4 out of the 7 patients showing no distant metastases at onset responded to the pemetrexed-based induction chemotherapy. As per institutional protocol all four subjects underwent a 3-D conformal radiotherapy program with concurrent chemotherapy as previously published [18]. Correlation between ORR to the treatment and polymorphisms We studied the potential correlation between the different polymorphisms observed and the response to the treatment obtained (). For this purpose any kind of radiological response (complete or partial response) was compared to no response to the treatment (disease stabilization or progression). "
Lung_Cancer
"The limitations of available data for cost effectiveness analysis are currently unknown so we are taking a practical approach in conducting an exploratory/pilot costing analysis as the first step. Recruitment for qualitative interviews is always challenging but we have identified a lead key informant at each site who will identify and link us with various health professionals and staff to achieve interviews. Interviews will be conducted with health professionals in various professional roles both internal and external to collaborating DAPs to enhance the depth and relevance of findings. Case study design triangulates data from multiple sources collected in multiple ways to generate in-depth information which will be further integrated and interpreted through ongoing interaction with collaborators. A variety of additional factors enhance the feasibility and successful conduct of the proposed research. The research team which has successfully collaborated on numerous previous studies includes individuals with training expertise and experience in case studies economic analyses and qualitative methods (interviews case studies) and experience in evaluating models of ICC. We were approached by project-specific partners to address their expressed information needs. This means they are interested in helping us to conduct the research and will use the findings. Multiple products and outcomes are expected. By interacting with various types of decision makers we will identify barriers of ICC and associated suggestions for improvement. This may reveal opportunities for unique structures interventions or tools that enable ICC apart from MCCs or DAPs that could be developed implemented and evaluated through future collaborations between researchers and decision-makers. This study will describe DAP evolution and the extent of DAP implementation in Ontario according to compliance with standards and feedback of stakeholders both internal and external to participating DAPs. This information will serve as a formative needs assessment to identify the nature of ongoing/required improvements which can be directly used by our decision-maker collaborators and as a framework by policy makers cancer system managers and DAP managers elsewhere to strategically plan for future services. Study findings will be shared with stakeholders representing difference professional roles and anizations from across Ontario to issue recommendations for DAP structure implementation and operation. Mechanisms by which to achieve ICC could then be better described in cancer guidelines and other tools that specify ICC. Cost-effectiveness analysis can establish a mechanism for evaluating the benefit of ICC as delivered by DAPs. Such modeling can be used by policy makers cancer system managers and DAP managers elsewhere. Our pilot costing exercise will be used to plan future cost-effectiveness studies. The study findings can be used to develop a theoretical framework of ICC since our review of conceptual literature revealed the need for further development of measures by which to evaluate ICC. We and others can use this in future research. By identifying gaps in knowledge we establish the need for additional primary investigation that describes current patterns of ICC and associated outcomes. By engaging with multiple stakeholders we develop relevant feasible and desirable interventions for enhancing DAP care and more effectively exchange ideas and transfer the findings of this research to policy and practice. Competing interests The authors declare that they have no competing interests. Authors™ contributions ARG conceptualized and designed this study and acquired funding. She will perform and/or oversee primary data collection analysis interpretation and report writing. TSM TKW DRM and JH provided important guidance for the design and execution of the study. FCW MCB JH MJD JG TSM TKW and DRM will participate in data analysis and interpretation. "
Lung_Cancer
"Immunostaining was performed by the streptavidin-peroxidase (S-P) method. The tissue sections were incubated with a p120ctn mouse monoclonal antibody (1?100 cat. 610134 BD Transduction Laboratories Lexington KY USA) E-cadherin rabbit monoclonal antibody (1?100 cat. SC-7870; Santa Cruz Biotechnology Santa Cruz CA USA) or vimentin rabbit monoclonal antibody (ready-to-use cat. RMA-0547 MaiXin Bio Fuzhou China) at 4°C overnight. PBS was used as a negative control. Biotinylated goat anti-mouse serum IgG or biotinylated goat anti-rabbit serum IgG (ready-to-use cat. KIT-9922 MaiXin Bio) was used as the secondary antibody. After washing the sections were incubated with streptavidin“biotin conjugated with horseradish peroxidase (Ultrasensitive MaiXin Bio) and then the peroxidase reaction was developed with 33-diaminobenzidine tetrahydrochloride (MaiXin Bio). Light counterstaining was performed with hematoxylin and then the sections were dehydrated in alcohol before being mounted. Two investigators independently examined all the tumor slides. Five random fields were examined per slide and 100 cells were observed per high magnification field (400—). The percentage of positive cells was scored as follows: 0?=?no staining; 1+?=?0“25%; 2+?=?26“50%; 3+?=?51“75%; and 4+?=?76“100%. The staining intensity was scored as follows: 0?=?no staining; 1?=?light yellow granules; 2?=?dark yellow or brown granules. The labeling score defined by multiplying the percentage of positive cells by the staining intensity was the final score for the section. When the total score was ?3 the case was defined as positive. When the total score was <3 the case was defined as negative. For scores greater than 3 points when more than 30% of the tumor cells stained strongly and continuously for p120ctn signal on the cell membrane the sample was defined as membrane positive. When fewer than 30% of the tumor cells displayed membrane expression but stained strongly and continuously for p120ctn in the cytoplasm the sample was defined as cytoplasm positive. Western blot analysis Fifty micrograms of proteins were separated by SDS-PAGE (10%). After transfer to a polyvinylidene fluoride (PVDF) membrane (Millipore Billerica MA USA) the proteins were incubated overnight at 4°C with antibodies to the following: p120ctn (1?500 cat. 610134) E-cadherin (1?300 cat. 610181) N-cadherin (1?1000 cat. 610920) (BD Transduction Laboratories Lexington KY USA) vimentin (1?1000 cat. 5741) snail (1?500 cat. 3879) (Cell Signaling Technology Boston MA USA) and twist (1?200 cat. sc-15193 Santa Cruz Biotechnology). After incubation with anti-mouse (1?2000 E030110-01) or anti-rabbit (1?2000 E030120-01) IgG (EarthOx LLC San Francisco CA USA) at 37°C for 2 h the protein bands were visualized using enhanced chemiluminescence (ECL Thermo Fisher Scientific Waltham MA USA) and quantified using BioImaging Systems (UVP Upland CA USA). Relative protein levels were calculated in reference to GAPDH as the loading control. Immunofluorescent staining Cells grown on glass coverslips were fixed with ice-cold 4% paraformaldehyde for 15 min followed by permeabilization with 0.2% Triton X-100 and incubation with normal goat serum for 30 min at 37°C. Cells were then incubated overnight with p120ctn mouse monoclonal antibody (1?200 cat. 610134; BD Transduction Laboratories Lexington KY USA) and E-cadherin rabbit polyclonal antibody (1?100 SC-7870; Santa Cruz Biotechnology). Primary antibodies were applied overnight at 4°C followed by incubation with a rhodamine/fluorescein-5-isothiocyanate (FITC)-labeled secondary antibody goat anti-mouse or TRITC-labeled goat anti-rabbit IgG (1?100 cat. E031210-01 and E031320-01 EarthOx San Francisco CA USA). The nuclei were counterstained with propidium iodide/4 6 diamidino-2-phenylin-dole. Epifluorescent microscopy was performed using an inverted Nikon TE300 microscope (Melville NY USA) and confocal microscopy was performed using a Radiance 2000 laser scanning confocal microscope (Carl Zeiss Thornwood NY USA). Matrigel cell invasion assay Matrigel cell invasion assays were performed according to the manufacturer's instructions (Corning Acton MA USA). A 100-?l cell suspension (5—105 cells) was added to the upper chamber while the lower chamber was filled with RPMI 1640 medium containing 10% fetal calf serum. Each upper and lower chamber was separated by a 8-?m porous polycarbonate membrane. The cells were incubated for 24 h at 37°C in a humid atmosphere with 5% CO2. After the medium was discarded the cells were fixed with methanol for 30 min and stained with hematoxylin (Sigma). For each filter the numbers of cells that invaded to the lower surface of the porous membrane in five different fields of 400— magnification were counted randomly using a Nikon E200 microscope. The mean was calculated from data obtained from each experiment repeated three times. Statistical analysis All statistical analyses were performed using SPSS 17.0 (SPSS Inc. Chicago IL USA) for Windows software. The chi-square test was used to analyze immunohistochemistry data. The independent samples T test was used to examine transwell experimental data. P values<0.05 were considered statistically significant. Results Membrane expression of p120ctn positively correlates with E-cadherin expression and negatively correlates with vimentin expression and lymph node metastasis Normal bronchial epithelial tissues showed p120ctn in the membrane (A) while the proportion of lung cancer tissues expressing p120ctn in the membrane was significantly lower (35% 27/78) than that with p120ctn cytoplasmic expression (65% 51/78). E-cadherin was expressed in the membrane in normal bronchial epithelium tissues (A) while the rate of positive expression was decreased (28% 22/78) and that of negative expression was significantly increased (72% 56/78) for E-cadherin in lung cancer tissues. Vimentin was negatively expressed in normal bronchial epithelial tissues (A) while the rate of positive expression was increased to 32% (25/78) in the lung cancer tissue. It appears lung cancer tissues with cytoplasmic/nuclear localization of p120ctn tended to express vimentin in comparison with those with the membranous localization (41.2% [21/51] versus 14.8 [4/27]).. Cytoplasmic/nuclear localization of p120ctn showed increased lymph node metastasis (29/51) in comparison with the membranous localization (8/27). Statistical analysis showed that the localization of p120ctn was closely related with E-cadherin expression vimentin expression and lymph node metastasis (P<0.05) (). In other words p120ctn membrane expression was positively correlated with E-cadherin expression and negatively correlated with vimentin expression and lymph node metastasis (B); meanwhile p120ctn cytoplasmic expression was negatively correlated with E-cadherin expression and positively correlated with vimentin expression and lymph node metastasis (C). .0088064.g001 Immunohistochemical analysis of p120ctn E-cadherin and vimentin localization in NSCLC. (A) E-cadherin and p120ctn were membrane positive and vimentin was negative in normal bronchial epithelial cells. "
Lung_Cancer
"All the experiments were repeated three times. The data are presented as means ± SEM. Colony formation assay Cells were seeded in triplicate at 300 cells/well in a 6-well plate. After 7 days of culture the cells were washed twice with NaCl (0.9%) stained with 2% gentian violet for 20 min washed with water and air-dried. Foci were counted by microscopy. The experiments were repeated three times and data are presented as means ± SEM. Soft-agar assay Cells (1000) were seeded into 6-well plates in 2 mL of growth medium containing 0.3% agar and used to overlay 1.4-mL layers of growth medium containing 0.6% agar. After 21 days of culture the colonies were counted. All the experiments were repeated three times. The data are presented as means ± SEM. Cell cycle analysis Cells were harvested washed with cold PBS twice and fixed in 70% ethanol at “20°C overnight. The cells were then centrifuged (1500 rpm 10 min) and washed twice using phosphate-buffered saline (PBS). Next the cells were resuspended in 0.5 mL of PBS containing 50 µg/mL RNase A for 1 h at 37°C. The cells were then loaded with 65 ?g/mL PI for 30 min in the dark at 4°C. The percentage of cells in different phases of the cell cycle was measured by flow cytometry (Beijing Determination of Traditional Chinese Medicine Research Institute). The experiments were repeated three times. The data are presented as means ± SEM. Western blotting Cells were digested with trypsin and centrifuged. The cell pellet was washed twice with PBS. Next the cells were disrupted in lysis buffer (10 mM Tris-HCl pH 7.4 1 mM EDTA 0.1% Triton X-100 0.1% SDS and 1— protease inhibitor cocktail) on ice for 15 min and centrifuged at 12000 rpm for 20 min. Insoluble material was removed and protein concentrations were determined using a bicinchoninic acid kit. For Western blot analysis cell lysates (30 ?g/well) were subjected to SDS-PAGE and transferred to nitrocellulose filter membranes. The membranes were incubated with primary antibodies (anti-PAX6 -ERK1/2 p38 -pERK -pp38 -cyclin D1 -RB or -RB S780 phosphorylation) overnight at 4°C. Secondary antibodies conjugated with horseradish peroxidase were subsequently used. Signals were detected using ECL and exposed to Kodak X-OMAT film. The results were scanned and analyzed using Alpha View Analysis Tools. Statistical analysis All values are expressed as the mean ± SEM. Through real-time RT-PCR MTS assay colony formation soft-agar assays cell cycle analysis and western-blot assay for comparison between means of 2 groups statistical differences were tested with unpaired Student t-tests. Statistical significance was tested using SPSS Statistics version 13.0. P<0.05 (*) was considered different; P<0.01 (**) was considered significantly different. Results PAX6 mRNA expression was inhibited in cells infected with the PAX6 shRNA lentiviral vector PAX6 mRNA expression was determined in this study. As shown in A PAX6 was highly expressed in most lung cancer cell lines. In contrast MRC-5 a normal human fetal lung fibroblast cell line did not express PAX6 (A). .0085738.g001 PAX6 mRNA was highly expressed in lung cancer cells and its expression was suppressed by pax6-shRNA. A Real-time PCR analysis for the PAX6 mRNA expression level in H460 A2 95C 95D H1299 H446 801 D A549 and L lung cancer lines as well as in the normal human fetal lung fibroblast cell line MRC-5. B -C Confirmation of PAX6 mRNA knockdown by real-time RT-PCR assays performed on total RNA isolated from A549 (B) and H1299 (C) cells infected with pax6-shRNA or a random shRNA. The PAX6 mRNA expression levels in A549 and H1299 cells were measured by quantitative real-time RT-PCR. The y-axis represents the normalized PAX6 mRNA expression relative to A549 (B) or H1299 (C) cells. **P < <0.01. D The protein levels of PAX6 were determined by western-blot and GAPDH expression level was used as a control. Quantification was made by determining the gray level of PAX6 protein which was normalized against GAPDH levels. Data are expressed as mean ±SEM of independent experiments (times of the experiments are listed above the histograms). "
Lung_Cancer
"These results have also been included in our supplementary material. A comparison of FDR curves based on three data sets. A comparison of false discovery rate (FDR) curve based on our proposed method for concordant integrative gene set enrichment analysis with the FDR curves based on the gene set analysis (GSA) for individual data sets. In each plot the black solid curve represents the results based on our method; the black dashed curve represents the results based on GSA for the Boston data; the black dotted curve represents the results based on GSA for the Michigan data; the black dot-dashed curve represents the results based on GSA for the Stanford data. The gray dotted lines represent three FDR levels: 0.05 0.1 and 0.2. Both up-regulated (a) and down-regulated (b) differential expression based analysis results are presented. Among the gene sets with FDR < 0.05 we observed many interesting pathways. Among these 74 identified based on down-regulated differential expression there were pathways related to immune system TCR signaling viral myocarditis BCR signaling cell survival WNT-?-catenin signaling cytokine PI3K VEGF signaling interleukins and GPCR signaling. Among these 99 identified based on up-regulated differential expression there were pathways related to different metabolism cell cycle checkpoints and related phases and transitions DNA replication synthesis damage and repair p53 glycolysis gluconeogenesis telomere maintenance and extension apoptosis TGF-? signaling tRNA aminoacylation gene expression lung cancer and PDGF signaling. Consistency between two application results We also investigated whether the inclusion of an additional data set to our previous integrative analysis of two data sets would still generate consistent results. (Notice that the number of common genes was much reduced from 5216 to 2865 when the Stanford data set was included. This would change the number of selected pathways as shown above.) shows the scatter plot for the paired CES calculated based on two data sets and CES calculated based on three data sets (separately for up-regulated and down-regulated differential expression). For each plot a clear correlation pattern can be observed. The Spearman correlation coefficients were both greater than 0.75 for these two plots (0.804 and 0.760). We also compared the listed of selected pathways with FDR < 0.05 (see above for details). For up-regulated differential expression there were 92 pathways in common (among 224 selected based on two data sets and 99 selected based on three data sets); for down-regulated differential expression there were 11 pathways in common (among 15 selected based on two data sets and 74 selected based on three data sets). If [(the number of commonly selected pathways)/(the number of smallest list of selected pathways)] was used as the overlap proportion then we would have 92/99 = 92.9% and 11/15 = 73.3% as the overlap proportions for up-regulated and down-regulated differential expression respectively. Therefore a satisfactory consistency between both results was also observed. A comparison of CESs based on two application results. A comparison of our concordant integrative gene set enrichment analysis results based on two data sets to the results based on three data sets. In each plot the gray dots represent the paired concordant enrichment scores (CESs) for all pathways in the Version 3.0 of the C2 canonical pathway collection and the black dots represent the paired CESs for pathways with FDR< 0.05 for both analysis results. Both up-regulated (a) and down-regulated (b) differential expression based analysis results are presented. About two pathways mentioned particularly in our first application there were two proteasome pathways in the Version 3.0 of the C2 canonical pathway collection: one given by BioCarta and the other given by KEGG. For both pathways their CESs and FDRs for up-regulated differential expression were consistently respectively > 0.999 and < 0.001 based on our integrative analysis of two data sets and these values were also consistently respectively > 0.95 and < 0.005 based on our integrative analysis of three data sets. There were also two BCR signaling pathways collected by KEGG and Signaling Gateway their CESs and FDRs for down-regulated differential expression were consistently respectively > 0.95 and < 0.01 based on our integrative analysis of three data sets. Based on our integrative analysis of two data sets the CES and FDR for the pathway by KEGG were respectively > 0.7 and < 0.2 and these two values for the pathway by Signaling Gateway were respectively > 0.9 and ~ 0.05. shows different paired z-scores from three data sets and the z-scores for these two pathways are highlighted for an illustration. Illustrative examples based on three data sets. Two illustrative examples for our proposed method for a concordant integrative gene set enrichment analysis of three data sets. In each plot the gray dots represent all paired z-scores for 2865 common human genes and the black dots represent the paired z-scores for the gene set specified in the title. KEGG cancer pathways There is a collection of cancer pathways in the database of Kyoto Encyclopedia of Genes and Genomes (KEGG with web link http://www.genome.jp/kegg/). According to the database updated on July 242013 17 pathways are associated with lung cancer and general cancer studies. lists 16 of these pathways that are also in the Version 3.0 of the C2 canonical pathway collection. (The KEGG PI3K-AKT signaling pathway is not included since it is not listed in the C2 collection. Notice that only pathways from KEGG are included. Pathways with same or similar names from other online databases like Reactome are not considered here. This ensures the consistency between the gene sets from the C2 collection and the gene sets mentioned in the KEGG cancer pathways.) Since a pathway could be enriched in either up-regulated or down-regulated differential expression we would choose the one with larger CES if the absolute difference of two CESs was greater than 0.1 (same results observed when this threshold value was set between 0.05 to 0.15) which was a conservative choice of threshold value. Otherwise we would not present any further analysis results for this pathway. For examples if these two CESs were 0.5 (up-regulated) and 0.45 (down-regulated) then no further analysis results would be presented for this pathway; if these two CESs were 0.8 (up-regulated) and 0.1 (down-regulated) then the analysis results based on up-regulated differential expression would be presented. For these 16 pathways listed in the results from the analysis described in our first and second applications were consistent. All the pathways except the TGF-? signaling pathway showed FDRs < 0.2 for at least one applications. Ten and eight pathways showed FDRs < 0.1 and FDRs < 0.05 respectively for at least one applications. Furthermore all sixteen pathways showed FDRs < 0.25 for at least one applications.An exploration of KEGG cancer pathways.Two data setsThree data sets KEGG cancer pathways U/D CES Diff. FDR CES Diff. FDR PPAR signaling *down0.671 >0.10.1940.563 >0.10.210MAPK signaling **down0.639 >0.10.2090.857 >0.10.063ERBB signaling *up0.629 >0.10.1190.581 >0.10.188Calcium signaling **down0.925 >0.10.0510.694 >0.10.153Cytokine-cytokine receptor interaction ***down0.717 >0.10.1720.943 >0.10.022Cell cycle ***up0.998 >0.1 <0.0010.959 >0.10.012p53 signaling ***up0.999 >0.1 <0.0010.944 >0.10.018MTOR signaling *down0.724 >0.10.1670.611 >0.10.193Apoptosis *down ? 0.10.776 >0.10.102WNT signaling ***down ? 0.10.888 >0.10.048TGF-? signalingdown ? 0.10.521 >0.10.236VEGF signaling ***down0.784 >0.10.1360.919 >0.10.033Focal adhesion ***up >0.999 >0.1 <0.0010.830 >0.10.077ECM receptor interaction ***up0.996 >0.1 <0.0010.977 >0.10.005Adherens junction *up0.646 >0.10.114 ? 0.1JAK-STAT signaling ***down0.875 >0.10.0820.901 >0.10.044Our application results for sixteen KEGG cancer pathways. ""Diff"" column presents the absolute difference between the CES based on up-regulated differential expression and the CES based on down-regulated differential expression. If ""Diff""? 0.1 then no further analysis results is presented. Otherwise the larger CES as well as the related FDR and differential expression direction (up or down) are presented in the ""CES"" ""FDR"" and ""U/D"" columns respectively. Both application results (an integrative analysis of two data sets and an integrative analysis of three data sets) are presented for the listed pathways. Pathways with symbols * ** or *** means that FDRs < 0.2 FDRs < 0.1 or FDRs < 0.05 are observed for at least one applications respectively. Conclusions In this study we proposed a mixture model based statistical method for the concordant integrative gene set enrichment analysis. "
Lung_Cancer
"Thirty micrograms of WCL were resolved by SDS-PAGE (NuPAGE Invitrogen). Immunoblotting was performed with primary antibodies recognizing PARP LAMP-1 (both Santa Cruz Biotechnology Santa Cruz CA USA) LC3B (Cell Signaling Technology Danvers MA USA) p62 (BD Transduction Laboratories San Jose CA USA) D2R (Abcam Cambridge UK) and GAPDH (Trevigen Gaithersburg MD USA). IR Dye-linked secondary antibodies (LI-COR Biosciences Bad Homburg Germany) were used to image bands on the Odyssey Sa Infrared Imaging System (LI-COR). Statistical analysis Unless otherwise stated all experiments were repeated three times. Data points are expressed as the mean±S.D. Statistical significance was tested by two-tailed unpaired Student's t-test. Asterisk indicates P<0.05. This research was supported by grants from the Swedish Cancer Society the Stockholm Cancer Society the Stockholm County Council the Swedish Research Foundation Swedish Board of National Health and Welfare the Karolinska Institutet and the European Union (EC FP-6 Chemores and FP-7 Apo-Sys). BafA1 bafilomycin A1 CaM calmodulin CFSE carboxyfluorescein diacetate N-succinimidyl ester CHX cycloheximide cis-FPX cis-flupenthixol dihydrochloride CNS central nervous system CPZ chlorpromazine hydrochloride CQ chloroquine CT chemotherapy D2R dopamine D2 receptor FBS fetal bovine serum FDG fluorescein di-?-D-galactopyranoside FPZ fluphenazine dihydrochloride GAPDH glyceraldehyde 3-phosphate dehydrogenase LAMP-1 lysosomal-associated membrane protein 1 LC lung cancer LC3 light chain 3 MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyl-tetrazolium bromide NH4Cl ammonium chloride NSCLC non-small cell lung carcinoma PARP poly (ADP-ribose) polymerase PI propidium iodide PZ promazine hydrochloride SCLC small cell lung carcinoma TFP trifluoperazine dihydrochloride TFPZ triflupromazine hydrochloride TMRE tetramethylrhodamine ethyl ester perchlorate TMX tamoxifen WCL whole-cell lysate z-VAD-fmk benzyloxycarbonyl-Val-Ala-Asp fluoromethylketone ?-gal ?-galactosidase Supplementary Information accompanies this paper on Cell Death and Disease website (http://www.nature.com/cddis) Edited by G Ciliberto The authors declare no conflict of interest. Shen WW A history of antipsychotic drug development Compr Psychiatry 1999 40 407 414 10579370 Roth BL Sheffler DJ Kroeze WK Magic shotguns versus magic bullets: selectively non-selective drugs for mood disorders and schizophrenia"
Lung_Cancer
"In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was performed to analysis the economic impact of maintenance gefitinib therapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations. Base case analyses of 1- 3- 6- and 10-year time horizon showed an unfavorable ICER of $184829 $19214 $19328 and $21308 per QALY gained respectively. OSA and PSA all revealed that the model we applied was robust to the results. Monte Carlo simulations of 1000 cases suggested that all ICERs for maintenance gefitinib therapy were higher than the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from Word Health anization (WHO). There are 31 province-level administrative units in Chinese mainland the per-capita GDP of which differs significantly. In 2011 for example it ranged from $2495 in Guizhou province to $13392 in Tianjin city [31]. According to the recommended threshold of WHO [25] the WTP threshold of different province-level administrative units extended from $7485 (3—$2495) to $40176 (3—$13392) per QALY gained which exceeded the sensitivity range of the WTP (about $17700 to $26300) obtained from PSA of the current study. Obviously local government could take fully into account covering maintenance gefitinib treatment following first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC with unknown EGFR mutations in accordance with local economic development level. Cost-effective probability for different economic level provinces displayed in could supply available information for local governments when gefitinib is approved by local governments™ finance before it has access to the directory of drugs for national basic medical insurance in China. .0088881.t004 The cost-effective probabilities of gefitinib arm for 31 provinces of Chinese mainland. Region Per-capita GDP ($) WTP (3—Per-capita GDP $) Cost-effective Probability Mainland China 5449.71 16349 0 More affluent regionsa >8767 >26300 1.00 Guangdong 7819 23457 0.932 Liaoning 7795 23385 0.926 Fujian 7344 22032 0.717 Shandong 7273 21819 0.655 Less affluent regionsb <5900 <17700 0 a Consist of Tianjin Shanghai Beijing Jiangsu Zhejiang and Inner Mongolia. b Consist of Jilin Chongqing Hubei Hebei Shanxi Ningxia Heilongjiang Shangxi Xinjiang Hunan Qinghai Henan Hainan Jiangxi Sichuan Guangxi Anhui Tibet Gansu Yuannan and Guizhou. A number of different survival models such as Weibull Exponential Log-logistic Gompertz et al can be used to perform extrapolation according to the observed trial data [32]. It is therefore very vital to choose the justifiable extrapolation approach to ensure the associated results of economic analysis confident to decision makers. In the current study after the deviance information criterion test (reported by Jackson et al [33] to alternative models introduced by Latimer [32] we chose Weibull and Log-logistic for PFS and OS respectively instead of Weibull for extrapolating both PFS and OS curves like the previous study undertaken by Zhu J et al [23]. In addition a hazard ration (HR) of PFS was applied to derive the PFS curve for the gefitinib strategy in the previous study [23]. Latimer however in the resent published paper pointed out that the HR used may cause bias because of the requirement of the assumptions“that is the HR was from a related model and was constant over time [34]. Obviously the bias should be considered especially if the HR impacts the results markedly. Unfortunately the HR of PFS was one of the two most influential parameters on the basis of one-way sensitivity analyses performed by Zhu J et al [23]. In view of the above cases independent parametric models were fitted to both control and experimental groups in our study. Utility of PFS played a great role in the results not only in the resent study [23] but also in the current study. Nafees et al [28] reviewed that all toxicities (diarrhoea rash nausea and vomiting neutropenia fatigue and hair loss) were related to pulling utility down significantly. Of the toxicities rash and diarrhoea were associated with maintenance gefitinib strategy as reported the clinical trial [15]. For higher accuracy we weighted the utility of PFS according to the risks of the rash and diarrhoea which were displayed in . In particularly one point revealed by one-way sensitivity analysis () should be highlighted that the price of gefitinib would be the most significant parameter that could reduce the ICER. With the gefitinib price reduction of 20% discount the ICER decreased to $16731 per QALY gained which is very close to the WTP threshold of $16349 per QALY. Therefore if the price of gefitinib decreases >20% maintenance gefitinib therapy after the standard chemotherapy in patients with locally advanced/metastatic NSCLC may be a cost-effectiveness strategy. There are some limitations in the present study. First using Weibull and Log-logistic distribution to extrapolate the survival curves beyond the time scope of the trial was an unavoidable limitation of this process. There is not enough survival data provided by the short follow-ups of the clinical trial to compare the long-term outcomes estimated by the model. Our results should be updated when long-term survival data are available. Another important limitation is that the utility weight parameters originated from the published literature that may not reflect Chinese patients™ trait. It is an inevitable limitation of the current analysis because utilities data are not yet available for China. Fortunately opinions from Chinese oncologists suggested that quality of life of locally advanced or metastatic NSCLC patients in China should not be of significant difference from abroad patients. Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although the current estimates were derived from just one study which is also the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search we believe that the analysis of our study based on a current Chinese phase III trial and the justifiable extrapolation approach can provide important reference information for decision makers in China. First of all the clinical study itself is a multicentre double-blind randomized controlled-trial (RCT) which represents the best evidence available and is deemed to be the most accepted scientific method of determining the benefit of a drug or a therapeutic procedure. Second the analysis method applied in our study was reliable and widely used in economic evaluations especially in the field of medical and health care. In addition the Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial satisfactorily () which shows that the model we constructed can mirror the effectiveness data of the trial commendably. And then direct medical costs related to each strategy were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Although the costs originated from our previous study [26] the published literature [27] or estimates according to local charges based on expert opinion all of them stemmed from a Chinese health care system perspective as well as in view of patients with advanced NSCLC which echoed the purpose of the current study. Last but not least to reflect substantial uncertainty of the input parameters the sensitivity analyses (including OSA and PSA) were conducted for each key parameter and all sensitivity analyses revealed that the model we applied was robust to the results. In conclusion according to the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from WHO maintenance gefitinib therapy after the standard chemotherapy of four chemotherapeutic cycles in locally advanced/metastatic NSCLC patients with unknown EGFR mutations is likely to be not cost-effective for Chinese mainland from the Chinese health care system perspective. Local governments with different economic level however could take fully into account covering maintenance gefitinib treatment. Because for rich regions (the per-capita GDP> $8767) the new strategy seems to be a reasonable option and if the per-capita GDP ranges from $5900 to $8767 the maintenance therapy may be favourable in terms of the different cost-effective probabilities. Decreasing the price of gefitinib the most significant parameter that could reduce the ICER should be considered to as a preferential factor for meeting widely treatment demands in China. Prof. L.B. Peng and J.H. Li are the guarantors for the overall content. The authors greatly thank many clinicians and the data managers who have recorded the initial data diligently of medicines over the years. In particular they thank Ouyang Lihui Wang Siying Zhao Ziying and Qiu Zhenhua for their help in the data collection and valuable discussions and advices. References 1 JemalA BrayF (2011) Center MM Ferlay J Ward E et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 2 FathiAT BrahmerJR (2008) Chemotherapy for advanced stage non-small cell lung cancer. Semin Thorac Cardiovasc Surg20: 210“21619038730 3 GovindanR PageN MenszternD ReadW TierneyR et al (2006) Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance epidemiologic and end results database. J Clin Oncol24: 4539“454417008692 4 Nation Comprehensive Cancer Network (2013) Non“small cell lung cancer (version 2.2014). Available: http://www.nccn./professionals/physician_gls/pdf/nscl.pdf Accessed 21 January 2014. 5 AzzoliCG BakerJS TeminS PaoW AliffT et al (2009) American Society of Clinical Oncology Clinical Practice Guideline update on chemotherapy for stage IV non-small-cell lung cancer. J Clin Oncol27: 6251“626619917871 6 D™Addario G Felip E (2009) Non-small-cell lung cancer: ESMO clinical recommendations for diagnosis treatment and follow-up. Ann Oncol (Suppl 4): 68“70. 7 BareschinoMA SchettinoC RossiA MaioneP SaccoPC et al (2011) Treatment of advanced non small cell lung cancer. J Thorac Dis3: 122“13322263075 8 BrodowiczT KrzakowskiM ZwitterM TzekovaV RamlauR et al (2006) Cisplatin and gemcitabine first-line chemotherapy followed by maintenance gemcitabine or best supportive care in advanced non-small cell lung cancer: a phase III trial. Lung Cancer52: 155“16316569462 9 FidiasPM DakhilSR LyssAP LoeschDM WaterhouseDM et al (2009) Phase III study of immediate compared with delayed docetaxel after front-line therapy with gemcitabine plus carboplatin in advanced non-small-cell lung cancer. J Clin Oncol27: 591“59819075278 10 CiuleanuT BrodowiczT ZielinskiC KimJH KrzakowskiM et al (2009) Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised double-blind phase 3 study. Lancet374: 1432“144019767093 11 CappuzzoF CiuleanuT StelmakhL CicenasS Szcz©snaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 521“52920493771 12 Paz-AresL de MarinisF DediuM ThomasM PujolJL et al (2012) Maintenance therapy with pemetrexed plus best supportive care versus placebo plus best supportive care after induction therapy with pemetrexed plus cisplatin for advanced non-squamous non-small-cell lung cancer (PARAMOUNT): a double-blind phase 3 randomized controlled trial. Lancet Oncol13: 247“25522341744 13 CohenMH JohnsonJR ChattopadhyayS TangS JusticeR et al (2010) Approval summary: erlotinib maintenance therapy of advanced/metastatic non-small cell lung cancer (NSCLC). Oncologist15: 1344“135121148614 14 CohenMH CortazarP JusticeR PazdurR (2010) Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC). Oncologist15: 1352“135821148615 15 ZhangL MaS SongX HanB ChengY et al (2012) Gefitinib versus placebo as maintenance therapy in patients with locally advanced or metastatic non-small-cell lung cancer (INFORM; C-TONG 0804): a multicentre double-blind randomised phase 3 trial. Lancet Oncol13: 466“47522512843 16 WalleserS RayJ BischoffH Vergnen¨greA RoseryH et al (2012) Maintenance erlotinib in advanced non-small cell lung cancer: cost-effectiveness in EGFR wild-type across Europe. Clinicoecon Outcomes Res4: 269“27523028234 17 Vergnen¨greA RayJA ChouaidC GrossiF BischoffHG et al (2012) Cross-market cost-effectiveness analysis of erlotinib as first-line maintenance treatment for patients with stable non-small cell lung cancer. Clinicoecon Outcomes Res4: 31“3722347803 18 GreenhalghJ McLeodC BagustA BolandA FleemanN et al (2010) Pemetrexed for the maintenance treatment of locally advanced or metastatic non-small cell lung cancer. Health Technol Assess14: 33“3921047489 19 KleinR WielageR MuehlenbeinC LiepaAM BabineauxS et al (2010) Cost-effectiveness of pemetrexed as first-line maintenance therapy for advanced nonsquamous non-small cell lung cancer. J Thor Oncol5: 1263“1272 20 TsuchiyaT FukudaT FuruiyeM KawabuchiK (2011) Pharmacoeconomic analysis of consolidation therapy with pemetrexed after first-line chemotherapy for non-small cell lung cancer. Lung Cancer74: 521“52921570734 21 Matter-WalstraK JoergerM K¼hnelU SzucsT PestalozziB et al (2012) Cost-Effectiveness of Maintenance Pemetrexed in Patients with Advanced Nonsquamous-Cell Lung Cancer from the Perspective of the Swiss Health Care System. Value Health15: 65“7122264973 22 ZengXH PengLB LiJH ChenGN TanCQ et al (2013) Cost-Effectiveness of Continuation Maintenance Pemetrexed after cisplatin and pemetrexed chemotherapy for Advanced Non-squamous Non-small-cell Lung Cancer: estimates from the Chinese Perspective of Health Care System. Clin Ther35: 54“6523328269 23 ZhuJ LiT WangXH YeM CaiJ et al (2013) Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis. BMC Cancer13: 3923360224 24 China Center for Health Economic Research. China Guidelines for Pharmacoeconomic Evaluations (Version 8) [in Chinese] (2010) Available: http://www.cpa..cn/Article/UploadFiles/201011/2010112509052247.pdfAccessed 21 January 2014. 25 WHO. Cost-effectiveness thresholds. Available: http://www.who.int/choice/costs/CER_thresholds/en/ Accessed 21 January 2014. 26 ZengXH KarnonJ WangSY WuB WanXM et al (2012) The cost of treating advanced non-small cell lung cancer: estimates from the Chinese experience. PLoS ONE7: e4832323118985 27 WuB ChenH ShenJ YeM (2011) Cost-effectiveness of adding rh-endostatin to first-line chemotherapy in patients with advanced non-small-cell lung cancer in China. Clin Ther33: 1446“145521992806 28 NafeesB StaffordM GavrielS BhallaS WatkinsJ (2008) Health state utilities for non small cell lung cancer. Health Qual Life Out6: 84 29 National Cancer Institute (2013) SEER Stat Fact Sheets: Lung and Bronchus Cancer. Available: http://seer.cancer.gov/statfacts/html/lungb.html Accessed 21 January 2014. 30 LiuQ WangB KongY ChengKK (2011) China™s primary health-care reform. Lancet377: 2064“206621453962 31 National Bureau of Statistics of China (2012) China statistical yearbook 2012. Available: http://www.stats.gov.cn/english/ Accessed 21 January 2014. 32 Latimer N (2011) NICE DSU Technical Support Document 14: Undertaking survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data. Available: http://www.nicedsu..uk Accessed 21 January 2014. 33 JacksonCH SharplesLD ThompsonSG (2010) Survival models in health economic evaluations: Balancing fit and parsimony to improve prediction. Int J Biostat6: 34 34 LatimerNR (2013) Survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data: inconsistencies limitations and a practical guide. Med Decis Making33: 743“75423341049 0374236 2771 Cancer Cancer Cancer 0008-543X 1097-0142 24711210 4219619 10.1002/cncr.28683 NIHMS637693 Article Guideline-Concordant Cancer Care and Survival Among American Indian/Alaskan Native Patients Javid Sara H. MD 1 Varghese Thomas K. MD MS 1 Morris Arden M. MD 2 Porter Michael P. MD MS 3 He Hao PhD 1 Buchwald Dedra MD 4 Flum David R. MD MPH 1 for the Collaborative to Improve Native Cancer Outcomes (CINCO) 1Department of Surgery Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 2Department of Surgery School of Medicine University of Michigan Ann 3Department of Urology Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 4Division of General Internal Medicine School of Medicine University of Washington Seattle Washington Corresponding author: Sara H. Javid MD University of Washington 1959 NE Pacific Street Box 356410 Seattle WA 98195; Fax: (206) 543-8136; [email protected] 27 10 2014 07 4 2014 15 7 2014 04 11 2014 120 14 2183 2190 © 2014 American Cancer Society. 2014 BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a retrospective cohort study of 338204 patients who were diagnosed at age ?65 years with breast colon lung or prostate cancer between 1996 and 2005 in the Surveillance Epidemiology and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. RESULTS Across cancer types AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ? .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P <.001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P <.001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR] 0.62) colon cancer (HR 0.74) prostate cancer (HR 0.52) and lung cancer (HR 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR 0.56) colon cancer (HR 0.59) or prostate cancer (HR 0.81; all 95% confidence intervals were <1.0). "
Lung_Cancer
"However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter and/or higher CRP levels. Abbreviations RCC: Renal cell carcinoma; TKI: Tyrosine kinase inhibitor; RECIST: Response evaluation criteria in solid tumors; CCRCC: Clear cell RCC; CTC-AE: Common Terminology criteria for Adverse Events; ROC: Receiver-operator curve; AUC: Area under the curve; CRP: C-reactive protein. Competing interests Norihiko Tsuchiya and Tomonori Habuchi received honoraria from Pfizer Japan Inc. Authors™ contributions NT TY JY and TH were involved in the conception and design of the study. TY KN MS and SM were involved in the provision of patients™ clinical data."
Lung_Cancer
"This approach discovered 3 nodules that were in different lobes than the primary tumor. Nodule fluorescence was independent of size metabolic activity histology tumor grade and vascularity. Conclusions This is the first-in-human demonstration of identifying pulmonary nodules during Thoracic surgery with NIR imaging without a priori knowledge of their location or existence. NIR imaging can detect pulmonary nodules during lung resections that are poorly visualized on computed tomography and difficult to discriminate on finger palpation. Mol Cancer Mol. Cancer Molecular Cancer 1476-4598 BioMed Central 24655544 3998010 1476-4598-13-68 10.1186/1476-4598-13-68 Research Downregulation of BRAF activated non-coding RNA is associated with poor prognosis for non-small cell lung cancer and promotes metastasis by affecting epithelial-mesenchymal transition Sun Ming 1 sunmingnjmu.edu.cn Liu Xiang-Hua 1 liuxianghuanjmu.edu.cn Wang Ke-Ming 2 422825636qq.com Nie Feng-qi 3 957714486qq.com Kong Rong 1 31815857qq.com Yang Jin-song 4 yangjinsongmedmail.com.cn Xia Rui 1 273459189qq.com Xu Tong-Peng 3 1034045558qq.com Jin Fei-Yan 1 759729211qq.com Liu Zhi-Jun 1 sm13776403108126.com Chen Jin-fei 4 1423594097qq.com Zhang Er-Bao 1 273459189qq.com De Wei 1 deweinjmu.edu.cn Wang Zhao-Xia 2 zhaoxiawang88hotmail.com 1Department of Biochemistry and Molecular Biology Nanjing Medical University Nanjing 210029 People™s Republic of China 2Department of Oncology Second Affiliated Hospital Nanjing Medical University Nanjing Jiangsu 210011 People™s Republic of China 3Department of Oncology First Affiliated Hospital Nanjing Medical University Nanjing People™s Republic of China 4Department of Oncology Nanjing First Hospital Nanjing Medical University Nanjing P. R. China 2014 21 3 2014 13 68 68 16 9 2013 13 3 2014 Copyright 2014 sun et al.; licensee BioMed Central Ltd. 2014 sun et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Recent evidence indicates that long noncoding RNAs (lncRNAs) play a critical role in the regulation of cellular processes such as differentiation proliferation and metastasis. These lncRNAs are found to be dysregulated in a variety of cancers. BRAF activated non-coding RNA (BANCR) is a 693-bp transcript on chromosome 9 with a potential functional role in melanoma cell migration. The clinical significance of BANCR and its™ molecular mechanisms controlling cancer cell migration and metastasis are unclear. Methods Expression of BANCR was analyzed in 113 non-small cell lung cancer (NSCLC) tissues and seven NSCLC cell lines using quantitative polymerase chain reaction (qPCR) assays. Gain and loss of function approaches were used to investigate the biological role of BANCR in NSCLC cells. The effects of BANCR on cell viability were evaluated by MTT and colony formation assays. Apoptosis was evaluated by Hoechst staining and flow cytometry. Nude mice were used to examine the effects of BANCR on tumor cell metastasis in vivo. Protein levels of BANCR targets were determined by western blotting and fluorescent immunohistochemistry. Results BANCR expression was significantly decreased in 113 NSCLC tumor tissues compared with normal tissues. Additionally reduced BANCR expression was associated with larger tumor size advanced pathological stage metastasis distance and shorter overall survival of NSCLC patients. Reduced BANCR expression was found to be an independent prognostic factor for NSCLC. Histone deacetylation was involved in the downregulation of BANCR in NSCLC cells. Ectopic expression of BANCR impaired cell viability and invasion leading to the inhibition of metastasis in vitro and in vivo. However knockdown of BANCR expression promoted cell migration and invasion in vitro. Overexpression of BANCR was found to play a key role in epithelial-mesenchymal transition (EMT) through the regulation of E-cadherin N-cadherin and Vimentin expression. Conclusion We determined that BANCR actively functions as a regulator of EMT during NSCLC metastasis suggesting that BANCR could be a biomarker for poor prognosis of NSCLC. Background Non-small cell lung cancers (NSCLCs) including adenocarcinomas and squamous cell carcinomas are the predominant forms of lung cancer and account for the majority of cancer deaths worldwide [1]. Despite recent advances in clinical and experimental oncology the prognosis of lung cancer remains poor with a 5-year overall survival rate of around 11% [2]. A continuing problem of NSCLC tumorigenesis is the metastasis of cancer cells which is the main cause of death in patients. Thus a detailed understanding of the mechanisms and molecular pathways activated in metastatic cells is crucial in identifying new treatment options for anticancer therapy that target metastasis. The invasion and metastasis of cancer cells are landmark events that involve many changes in cellular behavior and lead to different steps of the metastatic cascade [34]. One of the most crucial steps in the metastatic cascade is the acquisition of invasive capabilities including turnover of cell-cell junctions degradation of the cell matrix and activation of pathways that control cytoskeletal dynamics in cancer cells. This process is accompanied by multiple changes in gene expression such as the loss of epithelial markers and a gain in mesenchymal markers [56]. Over the past decade cell and tumor biologists have identified the key role of epithelial-mesenchymal transition (EMT) in cancer cell metastasis a biological process where epithelial cells lose their polarity and undergo transition into a mesenchymal phenotype [7]. EMT enhances tumor cell invasion in response to environmental triggers and augments invasive functions by promoting Rac-dependent mesenchymal migration and also contributes to cell growth and survival [89]. Important hallmarks of EMT include the loss of E-cadherin expression and increased expression of non-epithelial cadherins such as N-cadherin. The loss of E-cadherin expression is a fundamental event in EMT and a crucial step in the progression of papillomas to invasive carcinomas [10]. To date substantial effort has been devoted to understanding how EMT is regulated during cancer progression. It has been verified that EMT can be initiated by external signals such as hepatocyte growth factor (HGF) epidermal growth factor (EGF) transforming growth factor (TGF)-b and fibroblast growth factor (FGF) [11]. In addition to these signaling pathways triggered by membrane receptors recent studies have highlighted the importance of noncoding RNAs in the regulation of the epithelial phenotype by controlling EMT inducers. The miR-200 family has been found to control EMT by downregulating the expression of Zeb factors [12]. Furthermore the long noncoding RNA (lncRNA) MALAT-1 promoted EMT by regulating ZEB1 ZEB2 and Slug expression and activating Wnt signaling [13]. The lncRNAs are important new members of the ncRNA family that are greater than 200 nt and are unable to be translated into proteins. These lncRNAs are often expressed in a spatial- and temporal-specific pattern. Although very few lncRNAs have been characterized in detail they have been found to participate in a large range of biological processes including modulation of apoptosis and invasion reprogramming stem cell pluripotency and parental imprinting. These findings indicate that lncRNAs play a major role in the regulation of the eukaryotic genome [14-16]. Researchers have linked the dysregulation of lncRNAs with diverse human diseases in particular cancers [17-19]. Therefore identification of cancer-associated lncRNAs and investigation of their molecular and biological functions in controlling EMT are important in understanding the molecular biology of NSCLC metastasis and progression. BRAF-activated non-coding RNA (BANCR) an 693-bp lncRNA on chromosome 9 was firstly found by Ross J. Flockhart et.al via RNA-seq screen for transcripts affected by the expression of the oncogene BRAFV600E. BANCR is overexpressed in melanoma cells and crucial for melanoma cell migration [20]. In this study we investigated the effects of BANCR expression on NSCLC cell phenotypes in vitro and in vivo. Moreover we also showed that alteration of BANCR expression can influence E-cadherin N-cadherin and Vimentin protein levels which indicated that BANCR affected NSCLC cells invasion and metastasis partly via epithelial-mesenchymal transition. This study advances our understanding of the role of lncRNAs such as BANCR as a regulator of pathogenesis of NSCLC and facilitate the development of lncRNA-directed diagnostics and therapeutics. Results BANCR expression was downregulated and correlated with poor prognosis of NSCLC BANCR expression levels were investigated in 113 paired NSCLC samples and adjacent histologically normal tissues using quantitative polymerase chain reaction (qPCR) assays. BANCR expression was significantly downregulated (P?<?0.01) in 79% (89/113) of cancerous tissues compared with normal tissues (Figure 1A). BANCR expression levels in NSCLC were significantly correlated with tumor size (p?=?0.001) advanced pathological stage (p?<?0.001) and lymph node metastasis (p?=?0.001). However BANCR expression was not associated with other parameters such as gender (p?=?0.232) and age (p?=?0.616) in NSCLC (Table 1)."
Lung_Cancer
"the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (). b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of b) and H358 (bottom of b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3)."
Lung_Cancer
"Henry Ford Health System Detroit MI 48202 USA 7 2 2014 13 12 2013 6 1 2014 06 1 2015 59 1 173 188 The direct dose mapping (DDM) and energy/mass transfer mapping (EMT) are two essential algorithms for accumulating the dose from different anatomic phases to the reference phase when there is an motion or tumor/tissue deformation during the delivery of radiation therapy. DDM is based on interpolation of the dose values from one dose grid to another and thus lacks rigor in defining the dose when there are multiple dose values mapped to one dose voxel in the reference phase due to tissue/tumor deformation. On the other hand EMT counts the total energy and mass transferred to each voxel in the reference phase and calculates the dose by dividing the energy by mass. Therefore it is based on fundamentally sound physics principles. In this study we implemented the two algorithms and integrated them within the Eclipse TPS. We then compared the clinical dosimetric difference between the two algorithms for 10 lung cancer patients receiving stereotactic radiosurgery treatment by accumulating the delivered dose to the end-of-exhale (EE) phase. Specifically the respiratory period was divided into 10 phases and the dose to each phase was calculated and mapped to the EE phase and then accumulated. The displacement vector field (DVF) generated by Demons-based registration of the source and reference images was used to transfer the dose and energy. The DDM and EMT algorithms produced noticeably different cumulative dose in the regions with sharp mass density variations and/or high dose gradients. For the PTV and ITV minimum dose the difference was up to 11% and 4% respectively. This suggests that DDM might not be adequate for obtaining an accurate dose distribution of the cumulative plan instead EMT should be considered. BMC Genomics BMC Genomics BMC Genomics 1471-2164 BioMed Central London 24564564 4046697 5679 10.1186/1471-2164-15-S1-S6 Proceedings Concordant integrative gene set enrichment analysis of multiple large-scale two-sample expression data sets Lai Yinglei ylaigwu.edu Zhang Fanni fnzhanggwmail.gwu.edu Nayak Tapan K tapangwu.edu Modarres Reza rezagwu.edu Lee Norman H nhleegwu.edu McCaffrey Timothy A mccgwu.edu Department of Statistics The Gee Washington University 801 22nd St. NW. Rome Hall Room 553 Washington D.C 20052 USA Department of Pharmacology The Gee Washington University Medical Center Washington DC 20037 USA Department of Medicine Division of Genomic Medicine The Gee Washington University Medical Center Washington DC 20037 USA 24 1 2014 24 1 2014 2014 15 Suppl 1 S6 Lai et al.; licensee BioMed Central Ltd. 2014 This is published under license to BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Gene set enrichment analysis (GSEA) is an important approach to the analysis of coordinate expression changes at a pathway level. Although many statistical and computational methods have been proposed for GSEA the issue of a concordant integrative GSEA of multiple expression data sets has not been well addressed. Among different related data sets collected for the same or similar study purposes it is important to identify pathways or gene sets with concordant enrichment. Methods We categorize the underlying true states of differential expression into three representative categories: no change positive change and negative change. Due to data noise what we observe from experiments may not indicate the underlying truth. Although these categories are not observed in practice they can be considered in a mixture model framework. Then we define the mathematical concept of concordant gene set enrichment and calculate its related probability based on a three-component multivariate normal mixture model. The related false discovery rate can be calculated and used to rank different gene sets. Results We used three published lung cancer microarray gene expression data sets to illustrate our proposed method. One analysis based on the first two data sets was conducted to compare our result with a previous published result based on a GSEA conducted separately for each individual data set. This comparison illustrates the advantage of our proposed concordant integrative gene set enrichment analysis. Then with a relatively new and larger pathway collection we used our method to conduct an integrative analysis of the first two data sets and also all three data sets. Both results showed that many gene sets could be identified with low false discovery rates. A consistency between both results was also observed. A further exploration based on the KEGG cancer pathway collection showed that a majority of these pathways could be identified by our proposed method. Conclusions This study illustrates that we can improve detection power and discovery consistency through a concordant integrative analysis of multiple large-scale two-sample gene expression data sets. issue-copyright-statement BioMed Central Ltd 2014 Background The recent large-scale technologies like microarrays [1“3] and RNA-seq [4 5] allow us to collect genome-wide expression profiles for biomedical studies. Genes showing significant differential expression are potentially important biomarkers [6]. Furthermore a gene set enrichment analysis enables us to identify groups of genes (e.g. pathways) showing coordinate differential expression [7 8]. For some disease studies multiple gene expression data sets have been collected and the related integrative analysis of multiple data sets has been investigated [9]. Since microarray and sequencing based genome-wide expression data sets have been increasingly collected it is necessary to further develop the computational and statistical methods for integrative data analysis studies. Genes and gene sets showing consistent behavior among multiple related studies can be of great biological interest. However since the sample sizes are usually small but the numbers of genes are large it is difficult to identify truly differentially expressed genes and determine whether a gene or a gene set behaves concordantly among different related studies. Although the integrative analysis of multiple gene expression data sets has been well studied in recent years [10 11] the genome-wide concordance has not been well considered. Misleading results may be generated if the concordance among different data sets is not considered in an integrative analysis. Our purpose is to identify pathways or gene sets with concordant enrichment. Recently there are several methods published for meta gene set enrichment analysis of expression data [12 13]. However these methods have not been specifically developed for our study purpose. Statistically we need analysis methods that are consistent with the study purpose. There is still a lack of methods and software for the concordant integrative gene set enrichment analysis. For a gene set enrichment analysis an enriched gene set in one data set may also be enriched in another data set. However this gene set is not necessarily concordantly enriched in both data sets. For an illustration let us consider a simple artificial example: gene set S contains five genes with the first three genes strongly up-regulated in the first data set (the last two genes non-differentially expressed) and the last three genes strongly up-regulated in the second data set (the first two genes non-differentially expressed). Then in general gene set S is enriched in up-regulated differential expression in both data sets. However there is only one gene up-regulated in both data sets; the remaining genes are showing inconsistent behavior. Therefore unless the proportions of differentially expressed genes are small there is a lack of evidence to conclude that gene set S is concordantly enriched in both data sets. Since a gene set concordantly enriched in several similar studies may be of great importance it is necessary to develop statistical methods for detecting these gene sets. It has been shown that a mixture model based approach can be an efficient approach to the differential expression analysis [14]. Furthermore Lung_Cancer we have also demonstrated the usefulness of mixture models in concordant analysis of differential expression among large-scale expression data sets [15 16]. The advantage of the mixture model based approach is that the probability of a particular behavior (up-regulated or down-regulated) can be modeled and estimated for a given gene. Thus it is feasible to address how likely this gene shows a concordant behavior. In this study we develop a mixture model based method for a concordant integrative gene set enrichment analysis. Methods Concordant gene set enrichment In this study we consider multiple large-scale two-sample gene expression data sets. We use K to denote the number of these data sets and m to denote the number of common genes in these data sets. For each of these data sets we usually use a t-type test to evaluate the differential expression of each gene and a gene set enrichment analysis (GSEA) method to evaluate the enrichment level of a given gene set. In order to define and evaluate a concordant gene set enrichment when an integrative analysis is conducted for all K data sets we categorize differential expression in each data set into three underlying (unobserved) representative categories: no change positive change (or up-regulated differential expression) and negative change (or down-regulated differential expression). Due to data noise what we observe from experiments may not indicate the underlying truth. (For example a gene with slight down-regulated differential expression may show a small positive t-type test value.) Although these categories are not observed in practice they can be considered in a mixture model framework. To understand the concept of concordant gene set enrichment let us consider an artificial example. Given a pathway with 30 genes we know all the underlying behavior of these genes: 20 genes have positive changes consistently among all different data sets. Furthermore if we randomly select 30 genes we also know that the expected number of genes with consistent positive changes among different data sets is just 5. In this case we would conclude that the given gene set is concordantly enriched in up-regulated differential expression (because 30 is clearly larger than 5). However in practice all the underlying differential expression categories are not observed. Instead they can be considered in a mixture model framework. Then we need to develop a mathematical formula for the probability of concordant enrichment score (CES) of a given gene set S that contains mS genes: which can be useful for prioritizing different gene sets in practice. Before we derive the mathematical formula for the above probability we need to explain the term ""enriched"". As suggested by Efron and Tibshirani [17] unless the test statistic for a gene set enrichment analysis (GSEA) considers the genome-wide background patterns (e.g. the statistics proposed in the original GSEA [7 8]) it is necessary to consider the ""row randomization"" for genes in addition to the ""column permutation"" for samples. Therefore the term ""enriched"" means ""higher/better than expected"". Although many test statistics have been developed for GSEA with one large-scale expression data set we still need to develop a new approach for this study. The motivation is: we need to address the component information of the genes in a gene set. The component information is whether a gene is up-regulated down-regulated or non-differentially expressed. Most existing test statistics for the gene set enrichment analysis are either nonparametric or functions of z-score. But it is difficult to analyze the component information with these test statistics. Therefore based on the above discussion for the term ""enriched"" we propose the following probability for measuring concordant gene set enrichment: For a gene in a given gene set S an event of interest can be: (1) the gene is concordantly up-regulated; (2) the gene is concordantly down-regulated; or (3) the gene is concordantly differentially expressed (either up-regulated or down-regulated). Our analysis methods for these different types of enrichment analysis are almost mathematically identical. For a mathematical notation of the above CES we denote Ui the indicator that the i-th gene in gene set S satisfies the event of interest. Let D be the observed data and ? be the probability of event of interest if the gene is randomly sampled. Then we have In order to calculate CES practically we propose a three-component multivariate mixture model. In the model each component is a normal distribution. The model configuration for these three components is consistent with the differential expression categories as described above. This model is conceptually analog to a simple normal mixture approach to differential expression analysis proposed by McLachlan et al. [14]. The special feature of our model is that we focus on some specific combination of components from different dimensions. A bivariate version of this model has been used by us to evaluate the concordance and discordance between two large-scale experiments with two sample groups [15] and to integrate two microarray data sets in differential expression analysis [16]. Before the model description we need to describe the related data preprocessing and differential expression test scores as follows. Data preprocessing Because our proposed statistical method is developed based on the differential expression test scores we assume that the given gene expression data sets have been preprocessed appropriately [18]. For a concordant integrative analysis of multiple data sets we also need to select genes shared commonly by different data sets. This can be achieved using the genes' unique identifiers. Differential expression test scores For each of the two-sample gene expression data sets we screen individual genes with the traditional two-sample Student's t-test. Several modified t-tests such as SAM t-test [19] and the moderated t-test [20] have been widely used in the differential expression analysis of microarray data. These test statistics can generally improve the control of false positives by ""softly"" filtering out genes with relatively small expression variance. However we intend to consider all the genes equally important in the concordant integrative analysis of multiple data sets. Furthermore a given gene can show different levels of variance in different data sets which may make it difficult to use these modified t-tests. Therefore we still recommend the traditional two-sample t-test as the differential expression test statistic. (In practice other test statistics like SAM t-test or the moderated t-test can still be considered when there is a strong reason to do so.) Because the sample size of a high-throughput study is usually not large it is generally difficult to validate the normal distribution assumptions for the t-test. Therefore instead of the theoretical t-distribution we use the permutation procedure to compute the p-value of an observed t-test [21]. This approach has been widely adopted in the analysis of gene expression data [6]. For K two-sample gene expression data sets with m common genes we compute the one-sided upper-tailed p-value pik for gene Xi in the k-th data set i = 12 . . . m and k = 12 . . . K. Then we perform an inverse normal transformation to obtain a z-score: zik = ?-1(1 - pik) where ?(·) is the cumulative distribution function (c.d.f.) of the standard normal distribution. This transformation has been widely used to improve the fitting of a mixture model [14]. Our proposed statistical methods for the concordant integrative analyses of multiple data sets are developed based on these sets of z-scores. A mixture model For each individual data set we assume that a mixture of three normal distributions can well fit the z-scores. Let denote the probability density function (p.d.f.) of a normal distribution with mean µ and variance ?2. Three representative components are considered for the k-th data set (k = 12 . . . K): for genes non-differentially expressed (no change) for genes with up-regulated differential expression (positive change) and for genes with down-regulated differential expression (negative change). Notice that µ0k= 0 and (a z-score under the null hypothesis follows the standard normal distribution because its associated p-value follows a standard uniform distribution). This configuration has been suggested in the analysis of gene expression data [14] although more components can be considered to improve the data fitting. Mathematically we have the following density function: which is a type of well-known simple normal mixture model. When the above simple model is extended to accommodate the analysis of multiple data sets we need to consider the combination of components from different dimensions (data sets). Then there are 3K different combinations. We assume that different data sets are collected independently. For the i-th gene with a list of z-scores from different data sets if we know all the related component information then the join density of these z-scores is the product of marginal densities of individual z-scores. Therefore the following formula defines our basic mixture model for a concordant analysis:1 where is the probability for this gene being in a particular combination of different components (j1 j2 . . . jK) in different data sets . We call this model a partial concordance/discordance (PCD) model. Notice that a bivariate version of this model has been used to evaluate the overall concordance or discordance of two large-scale data sets and to conduct an integrative analysis of differential expression for two large-scale two-sample data sets [15 16]. Model estimation Our mixture model can be estimated by the well-developed E-M algorithm [22]. In the model the differential expression categories are considered as missing information. For any z-score vector (zi1 zi2 . . . ziK) i = 12 . . . m this information can be mathematically represented as if each zik is sampled from the jk-th component (jk = 0 1 or 2 and k = 12 . . . K) or zero otherwise. With only the observed data the likelihood can be calculated by the following formula: where ? represents the parameter space described previously. The ""complete likelihood"" based on the observed data and missing information can be calculated by the following formula: Then we can derive the following E-step formula: We can also derive the following M-step formulas: In the E-M algorithm we iterate E-step and M-step until a numerical convergence of likelihood (not the ""complete likelihood""). Let L(t) and L(t+1) be the likelihood values calculated after the t-th and (t + 1)-th iterations respectively. A numerical convergence is claimed if |L(t+1) ? L(t)| < 0.001. Concordant enrichment score Suppose that we are interested in gene sets with coordinate up-regulated differential expression (the CES formulas for the other events of interest can be derived similarly). Then we need to focus on the combination of different components with (j1 = 1 j2 = 1 . . . jK = 1). Based on the mixture model we can derive the following probability for a gene XSi in a given gene set S = {XSi : i = 12 . . . mS}: This probability uSi can be estimated as by plugging-in the estimated parameters in the PCD model. Let hSi be either 0 or 1. Under the assumption that z-scores {zik : i = 12 . . . m} from different genes are independent in each data set k k = 12 . . . K we can calculate the concordant enrichment score (CES) for a gene set S = {XSi : i = 12 . . . mS}:2 which is the PCD model based estimate for the probability Pr(gene set S is concordantly enriched | observed z-score matrix of gene set S). In the formula I(true statement) = 1 and I(false statement) = 0 (indicator function). Notice that the formula can be simplified to a well-known binomial tail probability if all are the same. However are usually different in practice."
Lung_Cancer
"Overall survival (OS) curves were delineated by the Kaplan-Meier method and compared with log-rank test. For all tests p-values less than 0.05 were considered to be significant. All p-values given were results of two-sided tests. Results PDGF-BB and VEGF-C coexpression in primary human NSCLC In primary human NSCLC tissues PDGF-BB (Figure 1A B) and VEGF-C (Figure 1C D) expression were mainly present in the cytoplasm of cancer cells. PDGF-BB was also found on cancer cell membrane. Occasional and weak expression of PDGF-BB and VEGF-C were found in both cancer stroma and paracancerous normal tissues. Among 109 cases PDGF-BB and VEGF-C overexpression was 66.97% (73/109) and 65.14% (71/109) respectively. A cohort of patients was classified into 4 groups according to the expression of PDGF-BB and VEGF-C in the same patient. As shown in Table 1 47.7% (52/109) had overexpressions of both PDGF-BB and VEGF-C ( P?+?V+); 19.3% (21/109) had overexpression of PDGF-BB but low expression of VEGF-C (P?+?V-); 17.4% (19/109) patients had overexpression of VEGF-C but low expression of PDGF-BB (P-V+); 15.6% (17/109) patients had low expressions of both PDGF-BB and VEGF-C (P-V-). PDGF-BB expression had a positive correlation with that of VEGF-C (r?=?0.451 p?=?0.034) ( Figure 2). Immunohistochemical staining for PDGF-BB VEGF-C and D2-40 in primary NSCLC tissues (—200). A: PDGF-BB overexpression in adenocarcinoma. B: PDGF-BB overexpression in squamous cell carcinoma. C: VEGF-C expression in adenocarcinoma. D: VEGF-C expression in squamous cell carcinoma. E: D2-40 expression in the lymphatic endothelial cells in adenocarcinoma. F: D2-40 expression in the lymphatic endothelial cells in squamous cell adenocarcinoma. Relationship between the expression of PDGF-BB and VEGF-C in all adenocarcinoma and squamous cell carcinomas in NSCLC patients. Among 44 specimens from cases with lymph node metastasis 29 had P?+?V+ 5P?+?V- 7 P-V+ and 3 P-V-. There was a significant association between P?+?V?+?and lymph node metastasis (p?=?0.006). In addition compared with the P-V- cases the cases with P?+?V?+?were younger (p?=?0.047) and also had larger tumor size (p?=?0.037) and worse histological differentiation (p?=?0.017). While the cases with P-V?+?patients had worse histological differentiation (p?=?0.027) no other clinicopathological factores were found to be related to P?+?V- or P-V?+?. Relationship between lymphangiogenesis and coexpression of both PDGF-BB and VEGF-C in primary human NSCLC D2-40 expression was strictly present in the lymphatic endothelial cells. D2-40 positive lymphatic vessels were almost exclusively found at the tumor™s invasion front within the tumor stroma. The peri-tumoral lymphatic vessels were dilated and occasional invasion of the cancer cells into the dilated lymph vessels was observed (Figure 1E F). The amount of LMVD (25.970 ± 14.9347) in specimens from cases with lymph node metastsis was much higher than those without lymph node metastasis (17.860 ± 6.5640) p?=?0.015 (Figure 3A). Comparison of LMVD between the patients (A) who had lymph node metastasis and who didn™t and among the patients (B) who had P?+?V+ P?+?V- P-V?+?and P-V-. LMVD was also observed to be linked to P?+?V+. The amount of LMVD was 24.727 ± 13.772 in specimens with P?+?V+ 19.860 ± 6.663 in P?+?V- 20.395 ± 10.137 in P-V+ and 13.453 ± 4.503 in P-V-. Compared with other three groups LMVD in P?+?V?+?was significantly increased p?=?0.004 (Figure 3B). Prognostic significance of PDGF-BB and VEGF-C coexpression in primary human NSCLC P?+?V?+?was correlated with poor overall survival (OS). The univariate survival analysis showed that cases with P?+?V?+?had shorter survival time (38.7 m ) compared with those with P-V- (45.8 m) p?=?0.015. However no significant relationship was observed between OS and P?+?V- or P-V?+?( Figure 4). Relationship between coexpression of VEGF-C and PDGF-BB and overall survival in primary NSCLC patients. Disscussion Today accumulating evidences show that tumor may establish not only their own new blood vessels supply but might also induce lymphangiogenesis to promote its spread [29]. So possible inhibition of those processes might be of benefit for cancer patients especially as recent data suggest that the process of lymphangiogenesis is not only limited to primary tumor but is also present in lymph node metastases resulting in further cancer cell spread [30]. In this study we found the disordered and dilated lymphatic vessels were almost exclusively in peri-tumoral lesions but not in intra-tumoral lesions. And the amount of LMVD in cases with lymph node metastasis was significantly higher than those without lymph node metastasis. The results showed lymphangiogenesis existed in NSCLC tissues and was associated with lymphatic metastasis which is consistent with previous reports [11] and might be explained by a rising interstitial pressure caused by an increase in the size of lesion or by the lack of intratumoral lymphangiogenesis in NSCLC [31]. Indicating that peri-tumoral lymphatic vessels are important for the process of metastatic spread while intra-tumoral lymphatic vessels are non-functional [3233]. Lymphangiogenesis may require the interaction of several tumor-derived growth factors. It is demonstrated that VEGF-C and PDGF-BB are both important growth factors contributing to lymphangiogenesis [22]. VEGF-C can activate the VEGFR-3 signaling pathway to induce the lymphatic enlargement and lymphangiogenesis [14]. A study demonstrated that PDGF-BB can promote lymphangiogenesis and lymphatic metastasis by a VEGFR-3 independent mechanism in the mouse cornea in vivo [19]. "
Lung_Cancer
"Sulindac is a ligand of the aryl hydrocarbon receptor (AhR) an xenobiotic-sensing nuclear receptor that can be activated by chemical structures containing planar aromatic hydrocarbons and thus evokes a cellular response that to detoxify xenobiotics. AhR activation leads to transcriptional upregulation of the NQO1 gene [62] [63]. In previous studies [30] [64] [65] sulindac and its two metabolites have been used to treat cancer cells at concentrations of 200 µM “1 mM i.e. the concentrations used in our present study. In addition to reducing the growth of polyps all three increase NQO1 activity and expression in colon cancer cells [28] and might therefore be good candidates to increase the cytotoxic effect of ?-lapachone against lung cancer cells. When two cancer cell lines CL1-1 and CL1-5 with low NQO1 expression and activity were co-incubated with sulindac or its metabolites and ?-lapachone much higher cell death was seen with the CL1-5 cells than the CL1-1 cells ( and 7). These results demonstrated that the effect of sulindac and its metabolites in upregulating NQO1 was greater in CL1-5 cells which has lower NQO1 level and activity than CL1-1 cells showing that sulindac and its metabolites can be used to increase the ?-lapachone sensitivity of cells with lower NQO1 levels. Many other compounds such as toxifolin [32] and resveratrol [66] can increase NQO1 expression or activity but are not FDA-approved. A search is underway for other compounds that can increase the activity or expression of NQO1 using high-throughput library screening and two compounds DMEBP and TRES were recently found to be potent NQO1 inducers with low toxicity [3]. These compounds may also be valuable in increasing ?-lapachone cytotoxicity for cancer cells with low NQO1 expression or activity. The NQO1 Inhibitor Dicoumarol or Transfection with NQO1 siRNA Inhibits the Effect of Sulindac on ?-lapachone Toxicity for Lung Cancer Cells Dicoumarol is widely used as a specific pharmacologic inhibitor of NQO1 and has been shown to inhibit both enzyme activity and expression [45] [67] [68]. NQO1 siRNA designed to specifically target NQO1 mRNA can lower the expression of NQO1 mRNA and protein. In our study both agents blocked the synergistic effect of sulindac or its metabolites and ?-lapachone on decreasing the survival of CL1-1 or CL1-5 cells. Although ?-lapachone is very toxic for many cancer cells cells with lower NQO1 levels are less sensitive. However from the present study we can conclude that sulindac and its metabolites increase NQO1 expression and enzyme activity and thus are potential synergistic drugs that might be used in combination with ?-lapachone to treat cancer cells with high resistance to ?-lapachone cytotoxicity. Supporting Information Figure S1 ?-lapachone causes cell death of CL1-1 and CL1-5 cells by decreasing the mitochondrial membrane potential. (A) Cells were left untreated or were incubated with 5 µM ?-lapachone for the indicated time and then the cell cycle distribution was analyzed using propidium iodide staining and flow cytometry. (B) Cells were incubated with 5 µM ?-lapachone for the indicated time then pro-caspase 3 and caspase 3 levels were analyzed by Western blotting. (C) Cells were incubated with 5 µM ?-lapachone for the indicated time then the mitochondrial membrane potential (MMP) was measured using the dye JC1 (Life Technology) and flow cytometry. (D) Cells were incubated with 5 µM ?-lapachone for the indicated time and then intracellular H2O2 levels were measured. (TIF) Click here for additional data file. Figure S2 zVAD-FMK ALLM and ALLN do not block the cytotoxicity of ?-lapachone. CL1-1 cells (A) or CL1-5 cells (B) were left untreated or were incubated for 1 h with the indicated concentration of the pan caspase inhibitor zVAD (left panels) or the calpain inhibitor ALLM (center panels) or ALLN (right panels) then 5 µM ?-lapachone was added for 12 or 24 h and cell viability measured using the MTT assay and expressed as percentage survival compared to the untreated cells. (TIF) Click here for additional data file. Figure S3 Dicoumarol an NQO1 inhibitor inhibits NQO1 activity and blocks the increase in intracellular calcium levels induced by ?-lapachone. (A) CL1-1 cells (left) or CL1-5 cells (right) were left untreated (CTL) or were incubated with 10 µM dicoumarol for 6 h then NQO1 activity was measured. (B) CL1-1 cells (top panel) or CL1-5 cells (bottom panel) were left untreated or were incubated with 10 µM dicoumarol and/or 5 µM ?-lapachone for 1 h then were stained with Fluo-4 and the intensity of the Fluo-4 fluorescence measured by flow cytometry. (TIF) Click here for additional data file. Figure S4 Sulindac and its metabolites do not affect survival of lung cancer cells. CL1-1 CL1-5 or A549 cells were left untreated or were incubated for 54 h with 100 or 250 µM sulindac (left panel) or sulindac sulfone (center panel) or for 12 h with 100 or 250 µM sulindac sulfide (right panel) then cell survival was measured by the MTT assay and expressed as percentage survival compared to the untreated cells. (TIF) Click here for additional data file. Figure S5 The cytotoxic effect of ?-lapachone on A549 cells is enhanced by sulindac and its metabolites. Two sets of cells were left untreated or were incubated for 6 h with the indicated concentration of sulindac sulindac sulfone or sulindac sulfide then 2 µM ?-lapachone was added to one set and incubation continued for 12 h when cell survival was measured using crystal violet staining and expressed as percentage survival compared to the untreated cells. (TIF) Click here for additional data file. Figure S6 NQO1 siRNA has no effect on cell morphology or cell growth. CL1-1 cells (top) and CL1-5 (bottom) were transfected with negative siRNA or NQO1 siRNA for 1 to 3 days then pictures were taken using a digital camera and phase contrast microscopy. The scale bar represents 50 µm. (TIF) Click here for additional data file. Figure S7 NQO1 RNA levels are decreased by siRNA targeting NQO1. A549 CL1-1 or CL1-5 cells were transfected for 48 h with siRNA targeting NQO1 (siNQO1) or control siRNA (siNeg) and then NQO1 mRNA levels were measured by realtime PCR and expressed as a fold change compared to the value for CL1-5 cells transfected with siNeg. * : p<0.05 compared to the result for the corresponding siNeg-transfected cells. (TIF) Click here for additional data file. Table S1 Primers used in the realtime PCR for actin and NQO1. (TIF) Click here for additional data file. Materials and Methods S1 (DOCX) Click here for additional data file. This work was supported by grants (NSC 101-2320-B-002-020-MY3 NSC 98-2320-B-715-001-MY3 (YPC) and NSC 101-2320-B-002-008) from the National Science Council Taiwan. References 1 PardeeAB LiYZ LiCJ (2002) Cancer therapy with beta-lapachone. Curr Cancer Drug Targets2: 227“24212188909 2 TagliarinoC PinkJJ ReinickeKE SimmersSM Wuerzberger-DavisSM et al (2003) Mu-calpain activation in beta-lapachone-mediated apoptosis. Cancer Biol Ther2: 141“15212750552 3 TanXL MarquardtG MassimiAB ShiM HanW et al (2012) High-throughput library screening identifies two novel NQO1 inducers in human lung cells. Am J Respir Cell Mol Biol46: 365“37122021338 4 MinamiT AdachiM KawamuraR ZhangY ShinomuraY et al (2005) Sulindac enhances the proteasome inhibitor bortezomib-mediated oxidative stress and anticancer activity. Clin Cancer Res11: 5248“525616033843 5 TeraiK DongGZ OhET ParkMT GuY et al (2009) Cisplatin enhances the anticancer effect of beta-lapachone by upregulating NQO1. "
Lung_Cancer
"However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) derived from human B cells that targets mesothelin. Mesothelin (MSLN) is a validated immunotherapy target that is highly overexpressed on the surface of common epithelial cancers including ovarian cancers epithelial malignant mesotheliomas ductal pancreatic adenocarcinomas and lung adenocarcinomas while expressed at relatively low levels only in mesothelial cells lining the pleura pericardium and peritoneum in healthy individuals [6-9]. Several therapeutic agents targeting MSLN are evaluated in preclinical and clinical studies such as the recombinant immunotoxin SS1P [9-11]. In our fusion protein the anti-MSLN scFv moiety was originally isolated from a yeast-display human scFv library [12] and demonstrated the ability to recognize both membrane-bound and soluble MSLNs and inhibit CA125/MSLN-dependent cell adhesion [13-15]. The recombinant MTBHsp70 protein provides immunostimulatory functions including the activation of monocytes and DCs to produce CC-chemokines that attract antigen processing and presenting DCs macrophages and effector T and B cells enhanced DC aggregation and maturation [1617] induction of the cytotoxic activity of natural killer cells [18] and improved cross-priming of T cells which is dependent on DCs [19]. The capabilities of MTBHsp70 as a potent immune adjuvant have been well characterized in cancer models including murine models of melanoma and lymphoma [1820-24]. While in these studies proteins or peptides fused with Hsp70 used for immunizations in mice were shown to generate humoral or cellular immune responses we expect that fusion of anti-MSLN scFv and MTBHsp70 takes advantage of the immune-activating action of MTBHsp70 and the tumor-targeting activity of the scFv which will yield anti-tumor responses against the broadest profile of tumor antigens. We evaluated the therapeutic efficacy of this MSLN-targeted fusion protein in syngeneic mouse models of ovarian cancer and mesothelioma and examined its mechanism of action in in vitro and in vivo cross-presentation assay systems. These studies demonstrate that this bifunctional fusion protein significantly enhances survival and slows tumor growth through the augmentation of tumor-specific cell-mediated immune responses. Results Expression of scFvMTBHsp70 fusion protein and MTBHsp70 The structure of scFvMTBHsp70 is shown in Figure 1A. VH and VL from anti-MSLN P4 scFv [13] are linked using a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker in between. As shown in Figure 1B only one protein band was observed with a molecular weight of approximately 100 kDa for scFvMTBHsp70 and one protein band with a molecular weight of 70 kDa for MTBHsp70 which match the expected molecular weights of these specific proteins. Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were found to be very low at less than 50 EU per mg of protein. Structure and analysis of scFvMTBHsp70 fusion protein. A anti-MSLN VH and VL are linked with a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker. B RAPIDstain based on Coomassie dye following purification and hIgG-Fc tag removal of MTBHsp70 and scFvMTBHsp70. C BR5FVB1 ovarian cancer cells and 40L mesothelioma cells were incubated with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 (blue line) or without either protein (solid) followed by anti-MTBHsp70 (IgG2a) biotinylated anti-IgG2a and Streptavidin-APC and then analyzed by flow cytometry. To confirm that the scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml recombinant human MSLN for 30 min (red line) before being added to the cells. Data are representative of three independent experiments in duplicate tubes. D Median fluorescence intensity (MFI) values of cells stained with scFvMTBHsp70 or MTBHsp70 normalized to cells stained without either protein. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01;ns non-significant. E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Thick line with incubation of scFvMTBHsp70; solid without incubation of scFvMTBHsp70. Data are representative of three independent experiments. scFvMTBHsp70 binds to BR5FVB1 ovarian cancer cells and 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells Binding of scFvMTBHsp70 or MTBHsp70 to BR5FVB1 ovarian cancer cells or 40L mesothelioma cells as determined by flow cytometry is shown in Figure 1C and D. Binding of scFvMTBHsp70 to MSLN-expressing tumor cells was almost completely inhibited by preincubation of scFvMTBHsp70 with recombinant human MSLN. Although MTBHsp70 also binds to these MSLN-expressing tumor cells the level of binding is not significantly different from background (p?=?0.187 for BR5FVB1 cells and p?=?0.086 for 40L cells). Furthermore the binding of MTBHsp70 to cancer cells cannot be blocked by recombinant MSLN. These data support the view that binding of scFvMTBHsp70 to these tumor cells occurred via the interaction of the scFv portion of the fusion protein with MSLN on the surface of tumor cells. Binding of these proteins with 40L mesothelioma cells was further compared using fluorescence microscopy. scFvMTBHsp70 shows significantly stronger binding intensity as compared to MTBHsp70 (Additional file 1: Figure S1A and B). In order to determine if scFvMTBHsp70 also binds to normal tissue in addition to tumor cells we incubated the fusion protein with peripheral blood leukocytes (PBLs) splenocytes or peritoneal mesothelial cells from healthy FVB/NJ mice and stained the cells using the same method as was used for staining tumor cells. As shown in Figure 1E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Since scFvMTBHsp70 may potentially target peritoneal mesothelial cells we also explored whether it could induce inflammation in peritoneal mesothelial tissues. We injected na¯ve mice with saline scFvMTBHsp70 or MTBHsp70 plus P4 scFv at the same doses as those used for tumor therapy described in Method sacrificed the mice 7 days post final treatments and examined haematoxylin and eosin (H&E) stained sections prepared from abdominal and intestinal peritoneum. Light microscopic examination revealed no evidence of inflammation and no infiltration of inflammatory cells such as macrophages or granulocytic cells around the mesothelial cells lining the abdominal and intestinal peritoneum of the actively treated or control animals. Representative microscopic images are shown in Additional file 2: Figure S2. scFvMTBHsp70 significantly prolongs ascites-free survival and overall survival in ovarian cancer- or mesothelioma-bearing mice To determine whether scFvMTBHsp70 can prolong survival in tumor-bearing mice we first evaluated the protein in a syngeneic mouse model of papillary ovarian cancer using immune-competent FVB/NJ mice. As shown in Figure 2A scFvMTBHsp70 prolonged both ascites-free and overall survival time compared with saline or the equimolar mixture of MTBHsp70 plus P4 scFv. To further support the efficacy of this fusion protein in prolonging survival in MSLN-expressing tumor-bearing mice we evaluated this protein in a second syngeneic mouse model of mesothelioma using immune-competent C57BL/6 mice. Animals treated with scFvMTBHsp70 showed significantly prolonged ascites-free and overall survival time compared with saline- or MTBHsp70 plus P4 scFv- treated mice (Figure 2B). A and B Kaplan-Meier survival curves of tumor-bearing mice following treatment with scFvMTBHsp70 control proteins or normal saline. A In a syngeneic mouse model of papillary ovarian cancer in immune-competent FVB/NJ mice scFvMTBHsp70 prolonged ascites-free survival time compared with saline (n?=?10 per group representative of two independent experiments; median survival (Med. sur.)?=?47 days vs. 37.5 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 39 days). scFvMTBHsp70 also prolonged overall survival time in the mice compared with saline (Med. sur. = 51.5 days vs. 43 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 43 days). B In a syngeneic mouse model of mesothelioma in immune-competent C57BL/6 mice the fusion protein prolonged ascites-free survival time compared with saline-treated mice (n?=?20 per group pooled from two independent experiments; Med. sur. = 28 days vs. 26 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 27 days). The fusion protein also prolonged overall survival time compared with saline (Med. sur. = 36 days vs. 31 days). P values were determined using the log-rank test. *p?<?0.05; **p?<?0.01; ***p?<?0.001. scFvMTBHsp70 enhances anti-tumor CD8+ T-cell responses in ovarian tumor-bearing mice To investigate whether the anti-tumor effects of scFvMTBHsp70 was associated with anti-tumor effector CD8+ T-cell responses we re-stimulated splenocytes from ovarian tumor-bearing FVB mice that received different treatments with the CD8+ T-cell Her2/neu epitope or MSLN Ld1 as a negative control ex vivo and analyzed the cells for production of IFN? and Granzyme B using flow cytometry. We previously showed that Her2/neu is expressed by BR5FVB1 cells [25]. Ld1 is an in-house designed H2d-restricted MSLN peptide that did not induce ovarian cancer specific T-cell response in H-2q FVB mice. We demonstrated significantly greater anti-Her2/neu CD8+ T-cell responses in splenocytes from scFvMTBHsp70-treated mice compared to mice treated with saline or a simple mixture of MTBHsp70 plus P4 scFv as measured by IFN? and Granzyme B production by CD8+ T cells (Figure 3A and B). This indicates that scFvMTBHsp70 enhances anti-tumor specific CD8+ T-cell responses in ovarian tumor-bearing mice. However no significant difference was seen in the number of tumor-infiltrating CD8+ T cells and no tumor-infiltrating Foxp3+ T cells were seen in tumors from mice in different treatment groups indicating that scFvMTBHsp70 may improve effector cell function rather than the number of intratumoral CD8+ T cells (Additional file 3: Figure S3A and B). Figure 3 Anti-tumor specific CD8+ T-cell functions in tumor-bearing mice following different treatments."
Lung_Cancer
"enough cancer cells etc. In this study two cores in TMAs were not identified with ALK+?in initial FISH analysis due to a lack of cancer cells. Similarly in biopsies the numbers of cancer cells is often very limited making an accurate FISH analysis difficult. With the IHC analysis in this study almost all of the cancer cells in the two cores showed ALK expression despite the fact that only a few ALK+?cells were revealed by FISH analysis. A <100% rate of cellular positivity in ALK+?tumors has been demonstrated to be due to the technical limitations of FISH analysis [13]. Therefore combining IHC and FISH analyses results in ALK status being more accurately evaluated in biopsies. IHC analysis using CST™s D5F3 antibody has been demonstrated with 100% sensitivity [1214-16] suggesting that IHC analysis is an effective way to prescreen patients for FISH analysis in the clinical diagnosis process [141517]. For IHC negative cases FISH analysis is not necessary. In strongly positive IHC cases FISH analysis also may not be necessary. Although there was one strongly positive IHC case which was shown with ALK- by FISH analysis the VENTANA ALK assay and qRT-PCR analysis revealed ALK expression and ALK fusion respectively. In addition it has been reported that the lung cancer patient with IHC-positive and FISH-negative ALK had a dramatic response to crizotinib [18]. Therefore the patient in our case may benefit from crizotinib. Weakly positive IHC cases must be carefully examined. In this study 7 out of 12 (58.3%) weakly positive cases were discordant with FISH analysis. Using the VENTANA ALK IHC assay three out of the seven weakly positive cases showed ALK expression and could be treated with crizotinib. Using qRT-PCR analysis five out of the seven weakly positive cases showed ALK fusion at the RNA level. Therefore there were two cases in which the qRT-PCR analysis result was discordant with the VENTANA ALK IHC assay. Compared to negatively expressed ALK cases without any staining (I) these two cases were indeed weakly stained in cancer cells using the VENTANA ALK IHC analysis (H). However according to the VENTANA ALK IHC assay scoring algorithm the weak staining in these two cases was regarded as unspecific and thus considered negative. Although qRT-PCR analysis demonstrated ALK fusion in these two cases it was detected in a very late stage of the qRT-PCR process. We speculated that the percentage of tumor cells with ALK fusion might be very low in these two cases. However with very high sensitivity (1 in 100 DNA) they would still be detected by qRT-PCR analysis. Whether these two patients would benefit from crizotinib was difficult to predict as no relevant study has been reported. Further study is required. Previous reports have shown that ALK+?lung cancers are characterized by younger patients non-smokers or light smokers when compared with ALK- patients [6719-23]. In this study the ALK+?patients were significantly younger and more likely to have lymph node metastasis compared to ALK- patients. However ALK+?and ALK- lung adenocarcinomas showed no difference in sex smoking habit tumor size pT M factors or pathologic TNM stage. The screening was limited in this study to the lung adenocarcinomas of Chinese patients. There may be an underlying difference in the subject population by race and clinical characteristics. In with advantages such as a low cost and 100% sensitivity IHC with CST™s D5F3 antibody can serve as a robust diagnostic tool with which to routinely screen lung adenocarcinoma patients with ALK+?in pathology labs that do not have access to VENTANA automated IHC platforms. For weakly expressed ALK cases qRT-PCR analysis especially when applied on FFPE samples is suggested as a diagnostic test for ALK fusion detection. Competing interest The author™s declared that they have no competing interest. Authors™ contributions Study concept and design: DL LS JY. Analysis and interpretation of data: LS FL LG XY. Drafting of the manuscript: LS FL DL. All authors have read and approved the final manuscript. Acknowledgment The authors thank Cell Signaling Technology for kindly providing ALK (D5F3) antibody for this research. Ferlay J Shin HR Bray F Forman D Mathers C Parkin DM International agency for research on cancer 2010 http://globocan.iarc.fr 2010 Jemal A Siegel R Ward E Hao Y Xu J Murray T Thun MJ Cancer statistics 2008 CA Cancer J Clin 2008 58 2 71 96 10.3322/CA.2007.0010 18287387 Rikova K Guo A Zeng Q Possemato A Yu J Haack H Nardone J Lee K Reeves C Li Y Global survey of phosphotyrosine signaling identifies oncogenic kinases in lung cancer Cell 2007 131 6 1190 203 10.1016/j.cell.2007.11.025 18083107 Soda M Choi YL Enomoto M Takada S Yamashita Y Ishikawa S Fujiwara S Watanabe H Kurashina K Hatanaka H Identification of the transforming EML4-ALK fusion gene in non-small-cell lung cancer Nature 2007 448 7153 561 6 10.1038/nature05945 17625570 Soda M Takada S Takeuchi K Choi YL Enomoto M Ueno T Haruta H Hamada T Yamashita Y Ishikawa Y A mouse model for EML4-ALK-positive lung cancer Proc Natl Acad Sci U S A 2008 105 50 19893 7 10.1073/pnas.0805381105 19064915 Rodig SJ Mino-Kenudson M Dacic S Yeap BY Shaw A Barletta JA Stubbs H Law K Lindeman N Mark E Unique clinicopathologic features characterize ALK-rearranged lung adenocarcinoma in the western population Clin Cancer Res 2009 15 16 5216 23 10.1158/1078-0432.CCR-09-0802 19671850 Inamura K Takeuchi K Togashi Y Hatano S Ninomiya H Motoi N Mun MY Sakao Y Okumura S Nakagawa K EML4-ALK lung cancers are characterized by rare other mutations a TTF-1 cell lineage an acinar histology and young onset Mod Pathol 2009 22 4 508 15 10.1038/modpathol.2009.2 19234440 Cui JJ Tran-Dube M Shen H Nambu M Kung PP Pairish M Jia L Meng J Funk L Botrous I Structure based drug design of crizotinib (PF-02341066) a potent and selective dual inhibitor of mesenchymal-epithelial transition factor (c-MET) kinase and anaplastic lymphoma kinase (ALK) J Med Chem 2011 54 18 6342 63 10.1021/jm2007613 21812414 Christensen JG Zou HY Arango ME Li Q Lee JH McDonnell SR Yamazaki S Alton GR Mroczkowski B Los G Cytoreductive antitumor activity of PF-2341066 a novel inhibitor of anaplastic lymphoma kinase and c-Met in experimental models of anaplastic large-cell lymphoma Mol Cancer Ther 2007 6 12 Pt 1 3314 22 18089725 Huang WT Chuang SS High MET gene copy number predicted poor prognosis in primary intestinal diffuse large B-cell lymphoma Diagn Pathol 2013 8 16 10.1186/1746-1596-8-16 23379953 Xiong Y Bai Y Leong N Laughlin TS Rothberg PG Xu H Nong L Zhao J Dong Y Li T Immunohistochemical detection of mutations in the epidermal growth factor receptor gene in lung adenocarcinomas using mutation-specific antibodies Diagn Pathol 2013 8 1 27 10.1186/1746-1596-8-27 23419122 Ying J Guo L Qiu T Shan L Ling Y Liu X Lu N Diagnostic value of a novel fully automated immunochemistry assay for detection of ALK rearrangement in primary lung adenocarcinoma Ann Oncol 2013 24 10 2589 93 10.1093/annonc/mdt295 23904459 Camidge DR Theodoro M Maxson DA Skokan M O™Brien T Lu X Doebele RC Baron AE Varella-Garcia M Correlations between the percentage of tumor cells showing an anaplastic lymphoma kinase (ALK) gene rearrangement ALK signal copy number and response to crizotinib therapy in ALK fluorescence in situ hybridization-positive nonsmall cell lung cancer Cancer 2012 118 18 4486 94 10.1002/cncr.27411 22282074 Conklin CM Craddock KJ Have C Laskin J Couture C Ionescu DN Immunohistochemistry is a reliable screening tool for identification of ALK rearrangement in non-small-cell lung carcinoma and is antibody dependent J Thorac Oncol 2013 8 1 45 51 23196275 Mino-Kenudson M Chirieac LR Law K Hornick JL Lindeman N Mark EJ Cohen DW Johnson BE Janne PA Iafrate AJ Rodig SJ A novel highly sensitive antibody allows for the routine detection of ALK-rearranged lung adenocarcinomas by standard immunohistochemistry Clin Cancer Res 2010 16 5 1561 71 10.1158/1078-0432.CCR-09-2845 20179225 Li Y Pan Y Wang R Sun Y Hu H Shen X Lu Y Shen L Zhu X Chen H ALK-rearranged lung cancer in chinese: a comprehensive assessment of clinicopathology IHC FISH and RT-PCR PLoS One 2013 8 7 e69016 10.1371/journal.pone.0069016 23922677 Martinez P Hernandez-Losa J Cedres S Castellvi J Martinez-Marti A Tallada N Murtra-Garrell N Navarro-Mendivill A Rodriguez-Freixinos V Canela M Fluorescence in situ hybridization and immunohistochemistry as diagnostic methods for ALK positive non-small cell lung cancer patients "
Lung_Cancer
"Methylnaltrexone was developed at the University of Chicago and licensed to Progenics Pharmaceuticals subsequently sub-licensed to Salix Pharmaceuticals. Dr. Moss was a paid consultant for Progenics Pharmaceuticals and currently is a paid consultant for Salix Pharmaceuticals. He receives royalties through the University of Chicago. There are no patent(s) or patent applications relating to material pertinent to this . This does not alter the authors' adherence to all PLOS ONE policies on sharing data and materials. Conceived and designed the experiments: FEL JM RS PAS. Performed the experiments: TM BM VAP FEL. Analyzed the data: JM PAS. Contributed reagents/materials/analysis tools: PAS JM. Wrote the paper: PAS. 2014 24 3 2014 9 3 e91577 16 9 2013 13 2 2014 2014 Lennon et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Recent epidemiologic studies implying differences in cancer recurrence based on anesthetic regimens raise the possibility that the mu opioid receptor (MOR) can influence cancer progression. Based on our previous observations that overexpression of MOR in human non-small cell lung cancer (NSCLC) cells increased tumor growth and metastasis this study examined whether MOR regulates growth factor receptor signaling and epithelial mesenchymal transition (EMT) in human NSCLC cells. We utilized specific siRNA shRNA chemical inhibitors and overexpression vectors in human H358 NSCLC cells that were either untreated or treated with various concentrations of DAMGO morphine fentanyl EGF or IGF. Cell function assays immunoblot and immunoprecipitation assays were then performed. Our results indicate MOR regulates opioid and growth factor-induced EGF receptor signaling (Src Gab-1 PI3K Akt and STAT3 activation) which is crucial for consequent human NSCLC cell proliferation and migration. In addition human NSCLC cells treated with opioids growth factors or MOR overexpression exhibited an increase in snail slug and vimentin and decrease ZO-1 and claudin-1 protein levels results consistent with an EMT phenotype. Further these effects were reversed with silencing (shRNA) or chemical inhibition of MOR Src Gab-1 PI3K Akt and STAT3 (p<0.05). Our data suggest a possible direct effect of MOR on opioid and growth factor-signaling and consequent proliferation migration and EMT transition during lung cancer progression. Such an effect provides a plausible explanation for the epidemiologic findings. Support was provided from institutional and/or departmental sources and National Institutes of Health grant CTSA UL1 TR000430. The funders had no role in the study design data collection and analysis decision to publish or preparation of the manuscript. Introduction The role of anesthesia and analgesia in the recurrence and metastatic rate of malignancies has recently received considerable attention [1] [2] [3] [4]. Retrospective studies have demonstrated a diminished incidence of cancer recurrence following regional anesthesia with lower doses of opioids following surgery for breast prostate colon cancer and melanoma although other studies have failed to detect significant differences [5] [6] [7] [8]. Some hypotheses to explain these differences in recurrence rates include immune suppressive effects and direct effects on tumor cell growth [9] [10] [11]. Our research has focused on the mu opioid receptor (MOR) and its role in directly regulating cellular changes leading to tumor growth and metastasis [4] [12] [13]. Effective therapeutic strategies for lung cancer the leading cause of cancer-associated mortality worldwide are extremely limited exemplifying the need for early diagnosis and novel therapeutic interventions [14] [15]. We have previously reported that the MOR is upregulated in several types of human non-small cell lung cancer (NSCLC) [12]. Further we have shown that overexpression of MOR in human NSCLC increases primary tumor growth and metastasis in xenograft models [13]. However the exact cellular changes regulated by MOR in NSCLC are incompletely defined [4]. For cancer cells to grow and metastasize there needs to be a loss of cell-cell adhesion (characterized by a reduction of epithelial cell adhesion proteins including the tight junction proteins ZO-1 and claudin-1) followed by acquisition of mesenchymal characteristics including a loss of baso-apical polarization cytoskeletal remodeling and increased cell motility (characterized by increases in specific cytoskeletal proteins (i.e. vimentin) and transcription factors (i.e. Slug and Snail) [16] [17] [18] [19]. This orchestrated oncogenic process is referred to as epithelial mesenchymal transition (EMT) [16] [17] [18] [19] [20] [21] [22]. Growth factor receptors including the epidermal growth factor receptor (EGFR) are often overexpressed and/or mutated in NSCLC and regulate oncogenic processes including tumor cell proliferation migration and EMT transition [23] [24] [25] [26] [27]. Several therapies targeting the EGFR in NSCLC exist including tyrosine kinase inhibitors (gefitinib erlotinib) and monoclonal antibodies (cetuximab)[28] [29] [30] [31]. However the overall survival rate for NSCLC remains low [32] [33] [34]. Recently Fujioka et al. have demonstrated that morphine can stimulate EGFR signaling pathways including the serine/threonine kinases Akt and MAP kinase in NSCLC suggesting a role for MOR inhibition as a potential therapeutic strategy for NSCLC [35]. Based on the recent interest of the effects of anesthesia and analgesia regimens on the recurrence and metastatic potential of various cancers [1] [2] [3] [4] our previous published data indicating the MOR is upregulated in lung tissue from patients with NSCLC [12] overexpression of MOR promotes tumor growth and metastasis in human NSCLC xenograft models [13] as well as data from Fujioka et al. demonstrating MOR regulation of EGF-induced signaling events in NSCLC [35] this study investigated the functional effects of MOR in the fundamental oncogenic processes of opioid and growth factor-induced human lung cell migration proliferation and epithelial mesenchymal transition (EMT)[16] [17] [18] [19] [20]. Since there is currently very little information on opioid and/or MOR regulation of EMT and the molecular mechanisms integrating cancer cell proliferation migration and EMT this study investigated the detailed molecular mechanisms for these events which can have potential clinical utility. Methods Cell Culture and Reagents The human NSCLC cell H358 was obtained from ATCC (Walkersville MD) and cultured in Roswell Park Memorial Institute complete medium (Cambrex East Rutherford NJ) at 37°C in a humidified atmosphere of 5% CO2 95% air with passages 6“10 used for experimentation. Unless otherwise specified reagents were obtained from Sigma (St. Louis MO). Reagents for SDS-PAGE electrophoresis were purchased from Bio-Rad (Richmond CA) and Immobilon-P transfer membrane was purchased from Millipore "
Lung_Cancer
"These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with stem-cell“like properties and high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. pancreatic ductal adenocarcinoma cell of origin Chest Chest chest Chest Chest 0012-3692 1931-3543 American College of Chest Physicians 25117058 4188148 chest.14-0477 10.1378/chest.14-0477 Original Research Critical Care Aggressiveness of Intensive Care Use Among Patients With Lung Cancer in the Surveillance Epidemiology and End Results-Medicare Registry ICU Use Among Elderly Patients With Lung Cancer Cooke Colin R. MD Feemster Laura C. MD Wiener Renda Soylemez MD O™Neil Maya E. PhD Slatore Christopher G. MD From the Division of Pulmonary and Critical Care Medicine (Dr Cooke) Center for Healthcare Outcomes and Policy Institute for Healthcare Innovation and Policy Michigan Center for Integrative Research in Critical Care University of Michigan Ann Arbor MI; the Division of Pulmonary and Critical Care Medicine (Dr Feemster) VA Puget Sound Healthcare System and University of Washington School of Medicine Seattle WA; Boston University School of Medicine (Dr Wiener) Boston MA; Edith Nourse Rogers Memorial VA Hospital (Dr Wiener) Bedford MA; Health Services Research and Development (Drs O™Neil and Slatore) and Section of Pulmonary and Critical Care Medicine (Dr Slatore) Portland VA Medical Center; and the Division of Pulmonary and Critical Care Medicine (Dr Slatore) Department of Medicine Oregon Health and Science University Portland OR. CORRESPONDENCE TO: Colin R. Cooke MD University of Michigan Center for Healthcare Outcomes and Policy 2800 Plymouth Rd Bldg 16 Room 127W Ann Arbor MI 48109; e-mail: cookecrumich.edu 10 2014 19 6 2014 1 10 2015 146 4 916 923 25 2 2014 14 5 2014 2014 AMERICAN COLLEGE OF CHEST PHYSICIANS 2014 BACKGROUND: Approximately 65% of elderly patients with lung cancer who are admitted to the ICU will die within 6 months. Efforts to improve end-of-life care for this population must first understand the patient factors that underlie admission to the ICU. METHODS: We performed a retrospective cohort study examining all fee-for-service inpatient claims in the Surveillance Epidemiology and End Results (SEER)-Medicare registry for elderly patients (aged > 65 years) who had received a diagnosis of lung cancer between 1992 and 2005 and who were hospitalized for reasons other than resection of their lung cancer. We calculated yearly rates of ICU admission per 1000 hospitalizations via room and board codes or International Classification of Diseases Ninth Revision Clinical Modification and diagnosis-related group codes for mechanical ventilation stratified the rates by receipt of mechanical ventilation and ICU type (medical/surgical/cardiac vs intermediate) and compared these rates over time. RESULTS: A total of 175756 patients with lung cancer in SEER were hospitalized for a reason other than surgical resection of their tumor during the study period49373 (28%) of whom had at least one ICU stay. The rate of ICU admissions per 1000 hospitalizations increased over the study period from 140.7 in 1992 to 201.7 in 2005 (P < .001). The majority of the increase in ICU admissions (per 1000 hospitalizations) between 1992 and 2005 occurred among patients who were not mechanically ventilated (118.2 to 173.3 P < .001) and among those who were in intermediate ICUs (20.0 to 61.9 P < .001) but increased only moderately in medical/surgical/cardiac units (120.7 to 139.9 P < .001). S: ICU admission for patients with lung cancer increased over time mostly among patients without mechanical ventilation who were largely cared for in intermediate ICUs. Cell Death Dis Cell Death Dis Cell Death & Disease 2041-4889 Nature Publishing Group 24481441 4040650 cddis2013550 10.1038/cddis.2013.550 Original Ibuprofen enhances the anticancer activity of cisplatin in lung cancer cells by inhibiting the heat shock protein 70 Ibuprofen and cisplatin-mediated apoptosis Endo H 1 2 Yano M 1 2 * Okumura Y 1 Kido H 1 1Division of Enzyme Chemistry Institute for Enzyme Research The University of Tokushima Tokushima Japan 2Department of Nutrition School of Human Cultures The University of Shiga Prefecture Shiga Japan *Department of Nutrition School of Human Cultures The University of Shiga Prefecture Hikone Shiga 522-8533 Japan. Tel: +81 749 28 8441; E-mail: yano.mshc.usp.ac.jp 01 2014 30 01 2014 1 1 2014 5 1 e1027 25 06 2013 27 11 2013 10 12 2013 Copyright 2014 Macmillan Publishers Limited 2014 Macmillan Publishers Limited This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License. To view a copy of this license visit http://creativecommons./licenses/by-nc-nd/3.0/ Hsp70 is often overexpressed in cancer cells and the selective cellular survival advantage that it confers may contribute to the process of tumour formation. Thus the pharmacological manipulation of Hsp70 levels in cancer cells may be an effective means of preventing the progression of tumours. We found that the downregulation of Hsp70 by ibuprofen in vitro enhances the antitumoural activity of cisplatin in lung cancer. Ibuprofen prominently suppressed the expression of Hsp70 in A549 cells derived from lung adenocarcinoma and sensitized them to cisplatin in association with an increase in the mitochondrial apoptotic cascade whereas ibuprofen alone did not induce cell death. The cisplatin-dependent events occurring up- and downstream of mitochondrial disruption were accelerated by treatment with ibuprofen. The increase in cisplatin-induced apoptosis caused by the depletion of Hsp70 by RNA interference is evidence that the increased apoptosis by ibuprofen is mediated by its effect on Hsp70. Our observations indicate that the suppression of Hsp70 by ibuprofen mediates the sensitivity to cisplatin by enhancing apoptosis at several stages of the mitochondrial cascade. Ibuprofen therefore is a potential therapeutic agent that might allow lowering the doses of cisplatin and limiting the many challenge associated with its toxicity and development of drug resistance. Hsp70 apoptosis ibuprofen The human Hsp70 family includes ?8 highly homologous members that differ from each other by their intracellular localization and expression patterns.1 Among them the major stress-inducible Hsp70 (also called Hsp72) has an essential role in cell survival under stressful conditions. Compared with its normal counterpart Hsp70 is often overexpressed in various cancer cells and is suspected to contribute to the development of tumours.2 3 Indeed the expression of Hsp70 in certain cancer types has been correlated with poor prognosis and resistance to chemotherapy.45 6 Tumour cells often express several proteins that when abnormally elevated render the tumour resistant to apoptosis.7 Previous studies have confirmed not only that Hsp70 is cytoprotective but also that it interferes effectively with cell death induced by a wide variety of stimuli including several cancer-related stresses. Hsp70 is a potent inhibitor of the stress-activated kinase pathway and apparently blocks apoptotic signals via interactions with JNK Ask1 and SEK1.8910 11 Hsp70 is also a negative regulator of the mitochondrial pathway of apoptosis. Much of the focus on the antiapoptotic function of Hsp70 has been on events that occur after the disruption of the mitochondria. Hsp70 prevents the recruitment of procaspase-9 to the apoptosome and its functional complex formation by direct interaction with apoptotic protease-activating factor 1 (Apaf-1).12 13 Furthermore Hsp70 inhibits the activation of caspase-3 and the cleavage of caspase-3 targets such as ICAD and GATA-1.14 15 On the other hand recent studies have reported that Hsp70 can prevent apoptosis upstream of the mitochondria by inhibiting events which ultimately permeabilize the mitochondrial outer membrane such as the activation of Bax.16 17 As a result of the inhibition by Hsp70 of the apoptosis induced by several anticancer drugs as well as by other stimuli we hypothesized that cancer cells would be sensitized to the induction of apoptosis by the neutralization of Hsp70. Hsp70 has been indeed targeted with pharmaceuticals such as triptolide quercetin and KNK437 which downregulate its expression.1819 20 Although they have prevented the progression of various cancer cells in vitro and in vivo21 22 the optimal clinical use of these small Hsp70 inhibitors singly or combined with other chemotherapeutics remains a challenge. Our overall objective was to pharmacologically control the levels of Hsp70 and increase the effectiveness of anticancer drugs. Several experimental and epidemiologic studies and clinical trials have observed a powerful chemopreventive activity exerted by nonsteroidal anti-inflammatory drugs (NSAIDs).23 24 The anti-carcinogenic properties of NSAID have been attributed to their inhibition of cyclooxygenase (COX) enzymes. However much higher doses of NSAID are needed to obtain an antitumoural effect than to inhibit COX25 suggesting that they also act via COX-independent mechanisms. On the other hand NSAIDs such as aspirin salicylate and sulindac sulphide inhibit the proliferation of cells and induce apoptosis in various cancer cell lines which is considered an important component of their antitumoural activity and increased sensitization of cancer cells to anticancer drugs.262728 29 There is currently interest in the ability of NSAID to directly lower the levels of antiapoptotic molecules such as the Bcl-2 family30 and 14-3-3 protein31 which inhibits the intrinsic mitochondria-dependent apoptosis in various cancer cells. Therefore the NSAID-induced dysfunction of antiapoptotic proteins prompted us to examine whether other antiapoptotic molecules including Hsp70 might also be targets in the prevention of tumour progression by NSAID. In this study we show that ibuprofen is a potent inhibitor of Hsp70 which significantly suppresses its expression by depleting heat shock factor 1 (HSF1) in lung adenocarcinoma-derived A549 cells. The downregulation of Hsp70 by ibuprofen sensitized the cells to cisplatin which was associated with the enhancement of cisplatin-induced apoptotic signalling. Ibuprofen did not only facilitate postmitochondrial events including the activation of cisplatin-induced caspase-9 but also the activation of Bax causing the release of cytochrome c. Besides the demonstration of a similar increase in the sensitivity of A549 cells to cisplatin conferred by Hsp70 knockdown and ibuprofen these observations indicate that ibuprofen accelerates cisplatin-mediated apoptosis at multiple steps of the mitochondrial apoptotic pathway via the inhibition of Hsp70. We conclude that ibuprofen is a potential chemotherapeutic agent which might enable (a) the use of lower less toxic does of cisplatin and (b) the design of a new combination treatment of lung cancer. Results Ibuprofen suppresses the expression of Hsp70 in lung adenocarcinoma cells To define the role of Hsp70 in promoting the formation of tumours we first examined its expression in human lung cancer cell lines. Compared with BEAS-2B a human non-malignant bronchial epithelial cell line the expression levels of Hsp70 in lung cancer cells such as A549 and H358 adenocarcinoma were notably higher (Figure 1a). As in previous studies which showed an increased expression of Hsp70 in various types of human cancers including breast pancreas and colon we found that Hsp70 is also dysregulated in lung cancer cells. In this study we screened conventional NSAID in search of a new pharmacologic inhibitor which neutralizes Hsp70 as they induce apoptosis in cancer cells by selectively downregulating antiapoptotic proteins. The expression of Hsp70 after the exposure of A549 cells to various NSAID in non-toxic concentrations was analyzed by immunoblot. Ibuprofen in a 400-?M concentration decreased the expression of Hsp70 by 23% in comparison with untreated cells whereas other NSAID had no effect (Table 1). Figure 1b shows the decrease in Hsp70 protein and mRNA levels in A549 cells after treatment with various concentrations of ibuprofen versus no apparent decreases in Hsc70 and Actin. Ibuprofen also decreased the expression of Hsp70 in H358 a human lung adenocarcinoma cell line in a dose-dependent manner (Figure 1c). These results suggest that ibuprofen decreases the expression of Hsp70 in various lung cancer cell lines. Ibuprofen enhances the apoptosis induced by cisplatin by suppressing Hsp70 As ibuprofen prominently inhibited the expression of Hsp70 we next examined its effect on the proliferation of cancer cells. We observed no significant change in the viability of A549 and H358 cells after the exposure to ?800??M concentrations of ibuprofen alone which downregulates Hsp70 (Figure 2a) while the exposure to 1.0?mM concentration of ibuprofen caused cell death. Combined these observations indicate that the downregulation of stress-inducible Hsp70 was insufficient to cause the death of A549 and H358 cells. There is evidence that the inhibition of anti-apoptotic molecules such as Hsp70 increases the sensitivity of tumour cells to anticancer drugs thus improving the outcomes of chemotherapy. To study the therapeutic potential of ibuprofen we examined whether its antitumoural effects are synergistic with those of cisplatin widely used in the treatment of lung adenocarcinoma. When we measured the survival of A549 (top of Figure 2b) and H358 (bottom of Figure 2b) cells exposed to increasing concentrations of cisplatin incubated in presence versus absence of ibuprofen the latter prominently magnified the apoptosis induced by cisplatin a synergistic effect confirmed by terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling (TUNEL) staining (Figure 2c). To ascertain the effects conferred by the expression of Hsp70 on cell death while excluding all effects of ibuprofen unrelated to Hsp70 we weakened the expression of Hsp70 by RNA interference (RNAi) (Figure 2d) and measured its effects on the apoptosis induced by cisplatin. The inhibition of Hsp70 decreased the viability of cisplatin-treated cells by approximately 20% (Figure 2e). Transfections with scrambled siRNA serving as a control showed no increase in cell death mediated by cisplatin. Cisplatin had no effect on the expression of Hsp70 (Figure 2g). We quantified the number of apoptotic cells in ibuprofen- and/or cisplatin-treated cultures using the CF488A-annexin V methods. Although cisplatin alone induced apoptosis in 10.2% of A549 cells the co-treatment with ibuprofen increased the percentage of apoptotic cells to 34.0% (Figure 2f). These observations suggest that ibuprofen sensitizes A549 cells to cisplatin by decreasing the expression of Hsp70. Ibuprofen decreases the expression of Hsp70 via transcriptional inactivation The reverse transcriptase-polymerase chain reaction (RT-PCR) analysis described earlier revealed a decrease in RNA level following treatment with ibuprofen suggesting that the expression of Hsp70 can be downregulated at the transcriptional level. After the recently discovered inhibition by its antagonists of the transcription of Hsp70 in cancer cells by blockade of the activation of HSF118 20 (which is often upregulated and constitutively activated in tumour formation) we studied the effects of ibuprofen on HSF1 in A549 cells. We first performed a ChIP assay to explore whether the inhibitory effect of ibuprofen is at the level of HSF1 DNA binding. As expected we found an unequivocal association between HSF1 and the Hsp70 gene promoter containing the HSE site in ibuprofen-untreated cells (Figure 3a). It is noteworthy that ibuprofen eliminated this binding (Figure 3a) suggesting that it inhibits the expression of Hsp70 via the action of HSF1. This also suggests that ibuprofen blocks the binding of HSF1 chromatin or the steps which precede in several processes needed to activate HSF1. Therefore we broadened our analysis to examine the effect of ibuprofen on the expression of HSF1. Compared with unexposed control cells the HSF1 mRNA level was significantly lower in cells exposed to ibuprofen (bottom of Figure 3b). Consistent with its effect on the expression of mRNA ibuprofen also decreased the expression of HSF1 protein in a dose-dependent fashion (top of Figure 3b). To confirm the inhibition of HSF1-mediated Hsp70 by ibuprofen we lowered the amounts of HSF1 present in A549 cells by RNAi and studied its effect on the expression of Hsp70. The treatment of cells with HSF1 dsRNA decreased the Hsp70 level compared with that measured in cells untreated with dsRNA (Figure 3c). Ibuprofen decreased the expression of HSF1 by 16% in comparison with untreated cells whereas other NSAID had no effect (Table 2). Overall these observations indicate that ibuprofen inhibited the expression of Hsp70 by depleting the HSF1 in A549 cells. Ibuprofen accelerates the mitochondrial apoptotic process induced by cisplatin Several studies have found that mitochondria might be a direct and important target of cisplatin in sensitive cells.32 33 We studied the effects of ibuprofen on the depolarization of mitochondrial membranes and the cytochrome c release induced by cisplatin. A549 cells with or without cisplatin were incubated in absence or presence of ibuprofen and stained with JC-1. Treatment with cisplatin and ibuprofen lowered the mitochondrial membrane potential manifest by an attenuated red and an enhanced green mitochondrial fluorescence (Figure 4a lower right panel) compared with that observed with cisplatin alone (Figure 4a upper right panel) while control (Figure 4a upper left panel) or ibuprofen alone (Figure 4a lower left panel) produced the red-dotted staining pattern of polarized mitochondria. The intensity of green mitochondrial fluorescence in cisplatin-treated cells is significantly increased (36.56 to 55.56%) by the co-treatment with ibuprofen. Ibuprofen also promoted the release of cytochrome c from the mitochondria induced by cisplatin (Figure 4b). These findings unequivocally indicated that in A549 cells ibuprofen enhanced the mitochondria-dependent apoptosis caused by cisplatin. Ibuprofen increases the activation of Bax induced by cisplatin The translocation of the pro-apoptotic protein Bax to the mitochondria is closely associated with the apoptosis induced by cisplatin. To explore the mechanisms by which ibuprofen promotes the apoptosis mediated by mitochondria in response to cisplatin we examined whether it was due to its ability to stimulate the translocation of Bax by cisplatin. We first monitored conformational changes in Bax as indicators of its activation. Western blot analysis of the immunoprecipitates with a conformation specific anti-Bax (6A7) antibody which only recognizes the active form revealed the presence of active Bax in A549 cells treated with cisplatin (Figure 5a lane 4) although not in untreated cells (Figure 5a lanes 1 and 2). Further exposure of the cisplatin-treated cells to ibuprofen caused a 1.5-fold increase in active Bax compared with incubation with cisplatin alone (Figure 5a lane 3). When we analyzed the effects conferred by ibuprofen on the translocation of Bax to mitochondria in cisplatin-treated cells we observed an approximately 1.3-fold increase in the amount of translocated Bax (Figure 5b). To exclude an effect of ibuprofen unrelated to the inhibition of Hsp70 we performed RNAi for a selective knock-down of Hsp70 and we studied its effects on the activation of Bax. Consistent with the earlier data presented for ibuprofen the depletion of Hsp70 increased the activation of Bax in cisplatin-treated cells although its extent was greater with Hsp70 RNAi than with ibuprofen (Figure 5c). These observations confirmed that (a) ibuprofen promotes the activation of Bax dependent on cisplatin and its translocation to the mitochondria in A549 cells and (b) its mechanism of action is mediated by the inhibition of Hsp70. Ibuprofen facilitates events occurring upstream and downstream of mitochondrial disruption in cisplatin-mediated apoptosis Previous studies have shown that Hsp70 can inhibit apoptosis by acting downstream of the mitochondria.121314 15 Hsp70 interacts directly with Apaf-1 to prevent the formation of cytochrome c-mediated apoptosome and subsequent activation of caspase-9. To examine whether ibuprofen also influences the downstream mitochondrial events we measured its effects on the cleavage of procaspase-9 in the apoptosis mediated by cisplatin. With an anti-active caspase-9 antibody fully processed caspase-9 was predominantly identified in cisplatin-treated A549 cells (Figure 6a lane 3) over untreated cells (Figure 6a lanes 1 and 2). It is noteworthy that treatment with ibuprofen increased >4-fold the amount of active caspase-9 in cells treated with cisplatin compared with cells incubated with cisplatin alone (Figure 6a lane 4). As as reported earlier the highest increases in the activation of Bax and release of cytochrome c by ibuprofen were <2-fold these observations suggest that ibuprofen also facilitates the post mitochondrial process taking place between the release of cytochrome c and the activation of caspase-9. To verify that this is a specific effect we studied the effect of Hsp70 knock-down on the activation of caspase-9 mediated by cisplatin. The caspase-9 activity in cells depleted of Hsp70 with cisplatin was fourfold greater than in control (scrambled) siRNA-treated cells (Figure 6b). We obtained similar results when we measured the activity of caspase-9 in cells treated with ibuprofen (Figure 6c) or siRNA against Hsp70 (Figure 6d) by a fluorometric assay using a synthetic substrate. Overall these observations confirmed unambiguously that ibuprofen intensified the apoptosis induced by cisplatin by its effects on the events occurring downstream of the mitochondria by inhibiting Hsp70 although whether it stimulated the formation of apoptosome (essential for the recruitment of procaspase-9) remains to be determined. We conclude that ibuprofen promotes the apoptosis induced by cisplatin at multiple stages of the mitochondrial cascade by attenuating the expression of Hsp70 in A549 cells. Discussion We found that compared with non-malignant bronchial epithelial cells human lung cancer cells overexpressed Hsp70. This is an important observation as targeting the expression or function of Hsp70 has been suggested as an effective treatment strategy in several cancers based on the hypothesis that higher levels of Hsp70 protect against cell death and increase the survival rate against modalities used in chemotherapy.11 15 In fact it is well documented that the expression of Hsp70 is significantly increased in cancer tissues and/or serums obtained from patients with non-small cell lung cancer (NSCLC)34353637 38 and its overexpression correlates with poor prognosis in NSCLC.36 Several reports have indicated that functionally related small molecules that inhibit Hsp70 decrease the viability of colo-rectal or pancreatic cancer cells by promoting apoptosis via the downregulation of Hsp70 and may be a promising new class of cancer chemotherapeutics.1921 22 We showed that ibuprofen a relatively non-toxic and widely used NSAID significantly decreased the expression of Hsp70 in lung adenocarcinoma cell lines. We also clearly demonstrated that the inhibitory mechanisms of ibuprofen on Hsp70 are due to a decrease in HSF1 expression. Although the fundamental mechanism behind the reduction in HSF-1 expression is unknown a previous study has indicated that the nuclear factor 1 family member NFIX which codes for site-specific DNA-binding proteins known to have multiple roles in replication signal transduction and transcription exerts a transcriptional repressive effect on the expression of HSF1 in cancer cells.39 Whether NFIX is indeed involved in the inhibition of HSF1 expression evoked by ibuprofen is applicable in further studies. To the best of our knowledge this is the first study of the inhibitory effects of NSAID on the cellular expression of Hsp70. In addition we showed that ibuprofen does not influence the cell viability without additional stimuli unlike its maximal effect on the expression of Hsp70. The lack of inhibitory efficacy of ibuprofen against tumours is consistent with a previous study which showed that low-dose ibuprofen did not induce apoptosis in mouse and human colorectal cancer cell lines.29 Similar observations were made following RNAi of Hsp70 suggesting that the attenuation of Hsp70 per se is insufficient to cause the death of A549 and perhaps other cells. It has been shown that the knockdown of Hsp70 has no effect on the viability of several cancer cell lines although sensitized them to anticancer drugs.40 41 Therefore the therapeutic potential of ibuprofen combined with chemotherapeutic agents needs to be explored. Cisplatin is one of most effective chemotherapeutic drugs against NSCLCs.42 It is noteworthy that damage to DNA caused by cisplatin enables apoptosis involving mitochondrial pathways which is negatively regulated by Hsp70. As ibuprofen prominently suppressed the expression of Hsp70 in A549 and H358 cells we examined the possible synergistic activity of ibuprofen and cisplatin against cancer. As expected ibuprofen potentiated synergistically the anti-proliferative effect of cisplatin in A549 and H358 cells. Despite its potent antitumoural properties the therapeutic use of cisplatin in oncology is seriously limited by dose-dependent adverse effects and frequent development of drug resistance.43 Therefore our findings may make useful contributions toward the development of new and less toxic chemotherapy against NSCLCs. We also examined the molecular mechanisms of these synergistic properties of ibuprofen. Hsp70 protects cells against mitochondria-dependent apoptosis at different levels although the precise mechanism remains hypothetical because of regular contradictory descriptions of Hsp70 function. Earlier reports have shown a protective effect of Hsp70 against cellular apoptosis by inhibition of the apoptosome function a protein complex comprising Apaf-1 and cytochrome c.12 13 However recent reports have questioned this repression of apoptosis downstream of the mitochondrial membrane permeabilization."
Lung_Cancer
"To identify these transformation-permissive cells we induced K-RasG12V expression in a very limited number of adult lung cells (0.2%) and monitored their fate by X-Gal staining a surrogate marker coexpressed with the K-RasG12V oncoprotein. Four weeks later 30% of these cells had proliferated to form small clusters. However only SPC+ alveolar type II (ATII) cells were able to form hyperplastic lesions some of which progressed to adenomas and adenocarcinomas. In contrast induction of K-RasG12V expression in lung cells by intratracheal infection with adenoviral-Cre ps generated hyperplasias in all regions except the proximal airways. Bronchiolar and bronchioalveolar duct junction hyperplasias were primarily made of CC10+ Clara cells. Some of them progressed to form benign adenomas. However only alveolar hyperplasias exclusively made up of SPC+ ATII cells progressed to yield malignant adenocarcinomas. Adenoviral infection induced inflammatory infiltrates primarily made of T and B cells. This inflammatory response was essential for the development of K-RasG12V“driven bronchiolar hyperplasias and adenomas but not for the generation of SPC+ ATII lesions. Finally activation of K-RasG12V during embryonic development under the control of a Sca1 promoter yielded CC10+ but not SPC+ hyperplasias and adenomas. These results taken together illustrate that different types of lung cells can generate benign lesions in response to K-Ras oncogenic signals. However in adult mice only SPC+ ATII cells were able to yield malignant adenocarcinomas. inflammation genetically engineered mouse model non-small cell lung cancer lung stem cells J Clin Oncol J. Clin. Oncol jco jco JCO Journal of Clinical Oncology 0732-183X 1527-7755 American Society of Clinical Oncology 24516033 3940541 S3019 10.1200/JCO.2013.52.3019 Bios3 Stat Statistics in Oncology Evaluation of Alternate Categorical Tumor Metrics and Cut Points for Response Categorization Using the RECIST 1.1 Data Warehouse Alternate Categorical Tumor Metrics Mandrekar Sumithra J. An Ming-Wen Meyers Jeffrey Grothey Axel Bogaerts Jan Sargent Daniel J. Sumithra J. Mandrekar Jeffrey Meyers Axel Grothey and Daniel J. Sargent Mayo Clinic Rochester MN; Ming-Wen An Vassar College Poughkeepsie NY; and Jan Bogaerts European anisation for Research and Treatment of Cancer Brussels Belgium. Corresponding author: Sumithra J. Mandrekar MD Division of Biomedical Statistics and Informatics Harwick 8 Mayo Clinic 200 First St SW Rochester MN 55905; e-mail: mandrekar.sumithramayo.edu. 10 3 2014 10 2 2014 10 3 2015 32 8 841 850 2014 by American Society of Clinical Oncology 2014 Purpose We sought to test and validate the predictive utility of trichotomous tumor response (TriTR; complete response [CR] or partial response [PR] v stable disease [SD] v progressive disease [PD]) disease control rate (DCR; CR/PR/SD v PD) and dichotomous tumor response (DiTR; CR/PR v others) metrics using alternate cut points for PR and PD. The data warehouse assembled to guide the Response Evaluation Criteria in Solid Tumors (RECIST) version 1.1 was used. Methods Data from 13 trials (5480 patients with metastatic breast cancer non“small-cell lung cancer or colorectal cancer) were randomly split (60:40) into training and validation data sets. In all 27 pairs of cut points for PR and PD were considered: PR (10% to 50% decrease by 5% increments) and PD (10% to 20% increase by 5% increments) for which 30% and 20% correspond to the RECIST categorization. Cox proportional hazards models with landmark analyses at 12 and 24 weeks stratified by study and number of lesions (fewer than three v three or more) and adjusted for average baseline tumor size were used to assess the impact of each metric on overall survival (OS). Model discrimination was assessed by using the concordance index (c-index). Results Standard RECIST cut points demonstrated predictive ability similar to the alternate PR and PD cut points. Regardless of tumor type the TriTR DiTR and DCR metrics had similar predictive performance. The 24-week metrics (albeit with higher c-index point estimate) were not meaningfully better than the 12-week metrics. None of the metrics did particularly well for breast cancer. Conclusion Alternative cut points to RECIST standards provided no meaningful improvement in OS prediction. Metrics assessed at 12 weeks have good predictive performance. J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24787965 4132045 00005 10.1097/JTO.0000000000000157 Original s Translational Oncology A Comparison of Immunohistochemical Assays and FISH in Detecting the ALK Translocation in Diagnostic Histological and Cytological Lung Tumor Material Le Quesne John MA (Cantab) PhD MBBS FRCPath * Maurya Manisha PhD   Yancheva Slaveya G. FRCPath * O™Brien Mary MD ¡ Popat Sanjay FRCP PhD ¡ Wotherspoon Andrew C. MBBCh FRCPath § de Castro David Gonzalez PhD FRCPath   Nicholson Andrew G. MBBS DM FRCPath * *Department of Histopathology Royal Brompton and Harefield NHS Foundation Trust London;  Centre for Molecular Pathology The Royal Marsden Hospital Sutton Surrey; ¡Department of Oncology The Royal Marsden Hospital; and §Department of Histopathology Royal Marsden Hospital Chelsea London United Kingdom. Address for correspondence address: Andrew G. Nicholson MBBS DM FRCPath Department of Histopathology Royal Brompton Hospital Sydney St London SW3 6NP United Kingdom. E-mail: a.nicholsonrbht.nhs.uk. 6 2014 30 5 2014 9 6 769 774 Copyright 2014 by the International Association for the Study of Lung Cancer 2014 This is an open-access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: Detection of the ALK rearrangement in a solid tumor gives these patients the option of crizotinib as an oral form of anticancer treatment. The current test of choice is fluorescence in situ hybridization (FISH) but various cheaper and more convenient immunohistochemical (IHC) assays have been proposed as alternatives. Methods: Fifteen FISH-positive cases from patients seven with data on crizotinib therapy and clinical response were evaluated for the presence of ALK protein using three different commercially available antibodies: D5F3 using the proprietary automated system (Ventana) ALK1 (Dako) and 5A4 (Abcam). A further 14 FISH-negative and three uncertain (<15% rearrangement detected) cases were also retrieved. Of the total 32 specimens 17 were excisions and 15 were computed tomography-guided biopsies or cytological specimens. All three antibodies were applied to all cases. Antibodies were semiquantitatively scored on intensity and the proportion of malignant cells stained was documented. Cutoffs were set by receiver operating curve analysis for positivity to optimize correct classification. Results: All three IHC assays were 100% specific but sensitivity did vary: D5F3 86% ALK 79% 5A4 71%. Intensity was the most discriminating measure overall with a combination of proportion and intensity not improving the test. No FISH-negative IHC-positive cases were seen. Two FISH-positive cases were negative with all three IHC assays. One of these had been treated with crizotinib and had failed to show clinical response. The other harbored a second driving mutation in the EGFR gene. Conclusions: IHC with all three antibodies is especially highly specific (100%) although variably sensitive (71%-86%) specifically in cases with scanty material. D5F3 assay was most sensitive in these latter cases. Occasional cases are IHC-positive but FISH-negative suggesting either inaccuracy of one assay or occasional tumors with ALK rearrangement that do not express high levels of ALK protein. Pulmonary adenocarcinoma ALK Immunohistochemistry Fluorescence in situ hybridization Crizotinib OPEN-ACCESS TRUE Rearrangements of the anaplastic lymphoma kinase (ALK) gene drive the malignant phenotype in 3% to 7% of primary lung adenocarcinomas.1“5 The resulting fusion protein most often a fusion with echinoderm microtubule-associated protein-like 4 (ELM4) has a constitutively active tyrosine kinase domain. The small molecule drug crizotinib is a specific inhibitor of this kinase6 and cases with the rearrangement respond to crizotinib treatment.7 Therefore accurate rapid and inexpensive identification of tumors growing under the influence of translocated ALK is needed. Currently the only test approved by the FDA is fluorescence in situ hybridization (FISH) using œbreak-apart probes (Vysis Abbott Molecular Abbott Park IL). This test is regarded as the œgold standard for detection of re-arrangements and is recommended by CAP/International Association for the Study of Lung Cancer/AMP.8 However FISH is technically demanding expensive and many diagnostic laboratories lack either the expertise or the facilities to perform the test. Even in ideal circumstances the results are often difficult to interpret requiring the scrutiny of large numbers of individual cells by a highly experienced diagnostician. Furthermore there are rare circumstances (such as small intrachromosomal inversion) in which the FISH test is negative but the tumor nevertheless expresses EML4-ALK fusion protein.59“11 A cheaper and potentially more widely applicable method is immunohistochemistry (IHC); indeed overexpression of ALK protein has been used in the diagnosis of anaplastic large-cell lymphoma for many years. Although early studies in lung cancer lacked sensitivity45 more recent studies have shown greater specificity and sensitivity8“11 and recent international guidelines (CAP/International Association for the Study of Lung Cancer/AMP) have recommended that if clinically validated IHC may be used as a screening test for FISH testing.8 However there have been few comparative studies on the most appropriate antibody to use. The aim of this study was therefore to compare three different immunohistochemical assays two being routine methods using antibodies widely used in the diagnosis of lymphoma with the third being a proprietary system including signal amplification that is currently being promoted as an alternative to FISH (Ventana). We also evaluated the relationships between ALK rearrangement as detected by FISH IHC and patient response to therapy. MATERIALS AND METHODS Clinical Samples The diagnostic archives from the Royal Brompton and Harefield NHS Foundation Trust and Royal Marsden hospitals from 2007 onwards were reviewed to identify cases with a diagnosis of lung adenocarcinoma that tested positive for an ALK rearrangement (>15% positive cells) and a randomly selected complementary group of cases with a normal ALK locus for comparison. We had been testing all primary lung tumors regardless of stage as part of a feasibility study which led to a large number of early stage cases being included. More recently our current policy is only to test advanced cases of non-squamous non“small-cell carcinoma using IHC screening with confirmatory FISH as per recently published guidelines.8 The cases under study are summarized in Table 1. TABLE 1. Summary Data of All Cases Included in the Study Paraffin blocks from a total of 32 diagnostic cases were retrieved; 15 of these had tested positive for the ALK rearrangement by FISH three were uncertain (with <15% of cells showing rearrangement) and the remaining 14 cases were negative. All but two blocks dated from 2011 or later. Seventeen cases were blocks from tumor excisions (six of these were FISH positive) and the remainder were cytological or core biopsy/endobronchial ultrasound samples. Data on treatment with crizotinib and response were retrieved from patient records. Cases with at least partial response to treatment defined according to the Response Evaluation Criteria in Solid Tumors criteria12 (i.e. at least 30% decrease in the sum of the longest diameters of target lesions) were designated as œresponsive. The study was evaluated and classified as a service evaluation by the Imperial College Heads of Consortia and as such was exempt from Research Ethics Committee review. Fluorescent In Situ Hybridization Unstained 2 ?m FFPE sections were put through deparaffinization and protease pretreatment steps before being denatured and hybridized overnight with the commercially available Vysis ALK dual color break apart probe (Abbott Molecular). Tissue sections then underwent SSC washes and were mounted in 4'6-diamidino-2-phenylindole for nuclei counterstaining. Results were analyzed and interpreted in accordance with probe manufacturer™s instructions. Non-rearranged ALK showed as fused (yellow) signals. Rearranged ALK appeared as split 3? (red) and 5? (green) signals or an isolated 3? (red) signal. The recommended cutoff of 15% was used to interpret samples as positive or negative for ALK rearrangements in 200 nuclei. Immunohistochemistry An additional five sections were cut per case. Three were used for the immunohistochemical assays and the remaining two for negative controls. Immunohistochemical assays were optimized using the monoclonal antibodies D5F3 (Ventana) ALK1 (Dako) and 5A4 (Abcam). The D5F3 assay was performed using the Ventana autostainer and a tyramide amplification step as specified in the manufacturer™s protocol. The other assays were performed using a Dako autostainer with conventional polymer-based diaminobenzidine staining (no tyramide amplification). Details of the antibodies and conditions employed are given in Table 2. TABLE 2. Immunohistochemical Assay Conditions Used Scoring Immunohistochemically stained sections were examined without knowledge of FISH status by two pathologists independently. Scores for proportion and intensity of immunohistochemical staining were assigned by consensus. The predominant intensity of staining was recorded on a scale of 0“3 (0 = negative 1 = weak 2 = moderate 3 = strong). As the Ventana stain was more intense due at least partly to the signal amplification step the visual cutoffs for intensity scoring with this antibody were different (e.g. a œmoderate degree of intensity seen with the Ventana stain would usually be interpreted as œstrong on a section stained with 5A4). The proportion of malignant cells staining positive was recorded as per œAllred estrogen receptor scoring in breast cancer on a scale of 0“5 (0 = 0% 1 ? 1% 2 = 1“10% 3 = 11“33% 4 = 34“66% and 5 ? 66%). A composite score (intensity + proportion) was also derived. Statistical Analysis Statistical analyses were performed using the STATA/IC package. RESULTS Fluorescence In Situ Hybridization Slides were scored according to the manufacturer™s recommendations. Representative FISH images are shown in Figure 1A. The 15 positive cases all showed greater than 15% cells with rearranged ALK genes. Three cases were classified as œindeterminate; these were all scanty biopsy or cytological samples with 10% to 15% of positively rearranged FISH signals. Seventeen further cases were FISH negative. FIGURE 1. (A) Representative fluorescence in situ hybridization images showing normal fused signals (neg) and nuclei with multiple separated red signals (pos). (B) Three representative excision specimens of adenocarcinoma. Case 1 is negative with all three immunohistochemical assays; the D5F3 assay shows relatively high background presumably because of the tyramide signal amplification (TSA) step. Cases 2 and 3 are positive with all three immunohistochemical assays with clear cytoplasmic staining. The markedly reduced signal seen with the 5A4 and ALK1 assays in case 2 was typical and again probably related to the absence of tyramide amplification. Case 3 demonstrates that occasional cases show strong staining using the non-TSA assays. Immunohistochemistry No signal was observed in negative controls. The intensity of staining between the three antibodies varied (Fig. 1B). IHC was impossible to assess in three cases with very scanty material (two FISH negative and one FISH positive). The Ventana assay using the D5F3 antibody gave the most intense cytoplasmic signal but this was accompanied by higher background staining which was especially noticeable in macrophages. The ALK1 and 5A4 antibody assays produced weaker staining but with less background. Of the two 5A4 had marginally more background staining especially in macrophages. The value of both intensity and proportion scores was assessed. Cutoffs for positivity were set using ROC analysis to optimize correct classification of ALK status using FISH results as the standard (Table 3). The intensity score alone was seen to outperform both proportion and the aggregate score. Therefore intensity scoring using the optimized cutoff was used in subsequent analyses. TABLE 3. Optimised Cutoff Values for Immunohistochemical Tests Concordance between FISH and IHC is shown in Table 4. No cases with negative FISH results and positive IHC were identified (100% specificity of IHC in these data). Sensitivity was the same (83%) for all three assays in excision specimens. In small biopsies and cytological specimens however the D5F3 antibody was the most sensitive. The ALK1 and 5A4 assays failed to identify a further one or two FISH-positive cases respectively. All three assays failed to stain the same two cases which contain rearranged ALK genes detectable by FISH. TABLE 4. Concordance of Immunohistochemistry (IHC) and Fluorescence In Situ Hybridization (FISH) Assays Response to Therapy Seven cases with ALK rearrangements detected by FISH went on to receive crizotinib therapy. All but one showed at least a partial response. This crizotinib-refractory case showed no detectable ALK expression by all three IHC assays. DISCUSSION We have compared three different antibody assays for the ALK kinase domain to the current standard FISH assay in a set of archival tumors including 15 FISH-positive cases. We found all three assays to be specific (100%) and sensitive (up to 86%) especially when a signal amplification technique is employed. Furthermore data on response to crizotinib therapy in seven treated cases showed all but one case responded. The case that failed to respond to therapy was negative by all three IHC assays. Of the three antibody methods compared the D5F3 antibody using a Ventana proprietary assay performed the best especially in scanty samples which is likely to be a consequence of the tyramide signal amplification step incorporated into the Ventana assay. It is possible that the other two antibodies would perform as well if a suitable signal amplification step were introduced. However an assay using the 5A4 without tyramide amplification has been successfully applied by To et al in a recent comparable assessment of IHC as a test for ALK rearrangement.5 In a set of 373 tumors that included 20 ALK rearrangements as detected by FISH their IHC assay was 99% specific and 100% sensitive. In contrast to this we find 100% specificity and (at best) 86% sensitivity; that is to say we identified rare FISH-positive IHC-negative cases whereas To et al found occasional FISH-negative IHC-positive cases which were proved to harbor EML4-ALK rearrangements by reverse transcription polymerase chain reaction (RT-PCR).5 It is unsurprising that we do not identify FISH-negative IHC-positive cases as we only examined 17 FISH-negative or indeterminate cases in comparison to the 356 examined by To et al.5 It is more notable that To et al.5 do not identify FISH-positive IHC-negative cases. This might be explained by their use of tissue microarrays for FISH which is even more technically demanding and hard to interpret than FISH using whole sections. This possible shortcoming of tissue microarray methods might be apparent in two other recent studies using tissue microarrays for a comparison of FISH with ALK1 5A4 and D5F3 antibodies.1314 Selinger et al.13 describe 100% sensitivity for all three antibody assays. Conklin et al.14 also find 100% sensitivity and a maximum specificity of 88% (again using the 5A4 antibody). Again it may be that in both these additional studies the approach used hampered the identification of FISH-positive IHC-negative cases because of the difficulty of applying FISH to TMAs especially when the primary test has been IHC and the FISH test is not œblind to the IHC result. Other recent studies compare various immunohistochemical assays and FISH for the detection of ALK rearrangements.1516 As in this study Sholl et al.15 identify occasional FISH-positive IHC-negative cases. They explain two cases by identifying co-existent mutations in other driving oncogenes (presumably thereby relieving the tumor œaddiction to ALK) and one by insufficient tumor material for accurate IHC assessment. Savic et al.16 compared an immunocytochemical assay using the 5A4 antibody to FISH in cytological specimens and achieved a sensitivity of 93% and specificity of 96% which is comparable with our findings in cytological and small biopsy cases (sensitivity 88% specificity 100%). In the current study we detected two œfalse-negative cases which were positive by FISH and negative by all three IHC assays. "
Lung_Cancer
"The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling. PLoS One8: e7099423923041 24 QuY WangJ RayPS GuoH HuangJ et al (2011) Thioredoxin-like 2 regulates human cancer cell growth and metastasis via redox homeostasis and NF-?B signaling. J Clin Invest121: 212“22521123948 25 YaoJ LiangL HuangS DingJ TanN et al (2010) MicroRNA-30d promotes tumor invasion and metastasis by targeting Galphai2 in hepatocellular carcinoma. Hepatology51: 846“85620054866 26 AiJ TangQ WuY XuY FengT et al (2011) The role of polymeric immunoglobulin receptor in inflammation-induced tumor metastasis of human hepatocellular carcinoma. J Natl Cancer Inst103: 1696“171222025622 27 MiraccoC CeveniniG FranchiA LuziP CosciE et al (2010) Beclin 1 and LC3 autophagic gene expression in cutaneous melanocytic lesions. Hum Pathol41: 503“51220004946 28 LeeYJ HaYJ KangKJ HwangJS ChungWJ et al (2013) The Autophagy-Related Marker LC3 Can Predict Prognosis in Human Hepatocellular Carcinoma. PLoS One8: e8154024282606 29 SchumackerPT (2006) Reactive oxygen species in cancer cells: live by the sword die by the sword. Cancer Cell10: 175“17616959608 30 QiuF LiZ HeL WangD (2013) HPLC-ESI-MS/MS analysis and pharmacokinetics of luteoloside a potential anticarcinogenic component isolated from Lonicera japonica in beagle dogs. Biomed Chromatogr27: 311“31722865633 31 TangH CaoW KasturiSP RavindranR NakayaHI et al (2010) The T helper type 2 response to cysteine proteases requires dendritic cell-basophil cooperation via ROS-mediated signaling. Nat Immunol11: 608“61720495560 32 BruchardM MignotG Derang¨reV ChalminF ChevriauxA et al (2013) Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nat Med19: 57“6423202296 33 ZhouR TardivelA ThorensB ChoiI TschoppJ (2010) Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat Immunol11: 136“14020023662 34 ChenK ZhangS JiY LiJ AnP et al (2013) Baicalein inhibits the invasion and metastatic capabilities of hepatocellular carcinoma cells via down-regulation of the ERK pathway. PLoS One8: e7292724039823 35 DaiZJ WangBF LuWF WangZD MaXB et al (2013) Total flavonoids of Scutellaria barbata inhibit invasion of hepatocarcinoma via MMP/TIMP in vitro. Molecules18: 934“95023344202 36 GhasemiR GhaffariSH MomenyM PirouzpanahS YousefiM et al (2013) Multitargeting and antimetastatic potentials of silibinin in human HepG-2 and PLC/PRF/5 hepatoma cells. Nutr Cancer65: 590“59923659451 37 MenonSG SarsourEH KalenAL VenkataramanS HitchlerMJ et al (2007) Superoxide signaling mediates N-acetyl-L-cysteine-induced G1 arrest: regulatory role of cyclin D1 and manganese superoxide dismutase. Cancer Res67: 6392“639917616699 38 DeNicolaGM KarrethFA HumptonTJ GopinathanA WeiC et al (2011) Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature475: 106“10921734707 39 TschoppJ SchroderK (2010) NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production?Nat Rev Immunol10: 210“21520168318 40 SorbaraMT GirardinSE (2011) Mitochondrial ROS fuel the inflammasome. Cell Res21: 558“56021283134 41 WenH GrisD LeiY JhaS ZhangL et al (2011) Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat Immunol12: 408“41521478880 42 ChowMT SceneayJ PagetC WongCS DuretH et al (2012) NLRP3 suppresses NK cell-mediated responses to carcinogen-induced tumors and metastases. Cancer Res72: 5721“573222986739 43 WangC PanY ZhangQY WangFM KongLD (2012) Quercetin and allopurinol ameliorate kidney injury in STZ-treated rats with regulation of renal NLRP3 inflammasome activation and lipid accumulation. PLoS One7: e3828522701621 44 HuQH ZhangX PanY LiYC KongLD (2012) Allopurinol quercetin and rutin ameliorate renal NLRP3 inflammasome activation and lipid accumulation in fructose-fed rats. Biochem Pharmacol84: 113“12522426011 45 ChuangSY YangCH ChouCC ChiangYP ChuangTH et al (2013) TLR-induced PAI-2 expression suppresses IL-1? processing via increasing autophagy and NLRP3 degradation. Proc Natl Acad Sci U S A110: 16079“1608424043792 46 GalluzziL VitaleI AbramsJM AlnemriES BaehreckeEH et al (2012) Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ19: 107“12021760595 47 WenS NiuY LeeSO ChangC (2014) Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis anoikis entosis necrosis and autophagic cell death. Cancer Treat Rev40: 31“4023993415 48 ZhangY ZhaoL LiX WangY YaoJ et al (2014) V8 a newly synthetic flavonoid induces apoptosis through ROS-mediated ER stress pathway in hepatocellular carcinoma. Arch Toxicol88: 97“10723835921 49 FengR WangSY ShiYH FanJ YinXM (2010) Delphinidin induces necrosis in hepatocellular carcinoma cells in the presence of 3-methyladenine an autophagy inhibitor. J Agric Food Chem58: 3957“396420025272 50 LongoL PlatiniF ScardinoA AlabisoO VasapolloG et al (2008) Autophagy inhibition enhances anthocyanin-induced apoptosis in hepatocellular carcinoma. Mol Cancer Ther7: 2476“248518723493 51 HuH LiZ ChenJ WangD MaJ et al (2011) P16 reactivation induces anoikis and exhibits antitumour potency by downregulating Akt/survivin signaling in hepatocellular carcinoma cells. Gut60: 710“72120971978 52 J¸rgensenHG AllanEK JordanidesNE MountfordJC HolyoakeTL (2007) Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells. Blood109: 4016“401917213283 53 PapeleuP LoyerP VanhaeckeT ElautG GeertsA et al (2003) Trichostatin A induces differential cell cycle arrests but does not induce apoptosis in primary cultures of mitogen-stimulated rat hepatocytes. J Hepatol39: 374“38212927923 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505400 3914905 PONE-D-13-19136 .0088122 Research Medicine Drugs and Devices Non-Clinical Medicine Oncology Sulindac Compounds Facilitate the Cytotoxicity of ?-Lapachone by Up-Regulation of NAD(P)H Quinone Oxidoreductase in Human Lung Cancer Cells Sulindac Assists the Effect of ?-Lap through NQO1 Kung Hsiu-Ni 1 * Weng Tsai-Yun 2 Liu Yu-Lin 2 Lu Kuo-Shyan 1 * Chau Yat-Pang 2 3 * 1 Department of Anatomy and Cell Biology College of Medicine National Taiwan University Taipei Taiwan 2 Institute of Anatomy and Cell Biology School of Medicine National Yang-Ming University Taipei Taiwan 3 Department of Medicine Mackay Medical College New Taipei City Taiwan Szakacs Gergely Editor Hungarian Academy of Sciences Hungary * E-mail: kunghsiunigmail.com (HK); leonchaummc.edu.tw (YC); lksntu.edu.tw (KL) Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HK YC. Performed the experiments: TW YL. Analyzed the data: HK TW YL. Wrote the paper: HK KL YC. 2014 5 2 2014 9 2 e88122 2 4 2013 5 1 2014 2014 Kung et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. ?-lapachone a major component in an ethanol extract of Tabebuia avellanedae bark is a promising potential therapeutic drug for various tumors including lung cancer the leading cause of cancer-related deaths worldwide. In the first part of this study we found that apoptotic cell death induced in lung cancer cells by high concentrations of ?-lapachone was mediated by increased activation of the pro-apoptotic factor JNK and decreased activation of the cell survival/proliferation factors PI3K AKT and ERK. In addition ?-lapachone toxicity was positively correlated with the expression and activity of NAD(P)H quinone oxidoreductase 1 (NQO1) in the tumor cells. In the second part we found that the FDA-approved non-steroidal anti-inflammatory drug sulindac and its metabolites sulindac sulfide and sulindac sulfone increased NQO1 expression and activity in the lung adenocarcinoma cell lines CL1-1 and CL1-5 which have lower NQO1 levels and lower sensitivity to ?-lapachone treatment than the A549 cell lines and that inhibition of NQO1 by either dicoumarol treatment or NQO1 siRNA knockdown inhibited this sulindac-induced increase in ?-lapachone cytotoxicity. In conclusion sulindac and its metabolites synergistically increase the anticancer effects of ?-lapachone primarily by increasing NQO1 activity and expression and these two drugs may provide a novel combination therapy for lung cancers. This work was supported by grants (NSC 101-2320-B-002-020-MY3 NSC 98-2320-B-715-001-MY3 (YPC) and NSC 101-2320-B-002-008) from the National Science Council Taiwan. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction ?-Lapachone a natural o-naphthoquinone originally obtained from lapacho trees in South America has promising anti-tumor activity on various tumor cells [1]-[6] and has been tested as an anti-tumor candidate drug in phase I/II/III clinical trials in combination with other chemotherapy drugs [1] [7]. Its anti-cancer activity is thought to be due to the two-electron reduction of ?-lapachone catalyzed by NAD(P)H : quinone oxidoreductase (NQO1 DT-diaphorase) using NAD(P)H or NADH as electron source [1] [8] [9]. In the presence of NQO1 ?-lapachone undergoes reduction to an unstable hydroquinone which rapidly undergoes a two-step oxidation back to the parent compound perpetuating a futile redox cycle and resulting in the generation of reactive oxygen species (ROS) including superoxides [8] [10]“[12]. These reactive species can oxidize thiol groups of the mitochondrial potential transition pore complex leading to increased mitochondrial inner membrane permeability reduced mitochondrial membrane depolarization and release of cytochrome c resulting in cell death [13] [14]. Because NQO1 is more highly expressed in various solid cancers than in normal tissues [15] ?-lapachone can selectively kill these cancer cells. In addition higher NQO1 expression or activity in cancer cells may make them more sensitive to ?-lapachone. In order to increase the clinical efficacy of ?-lapachone many methods have been examined to increase NQO1 expression or activity in cancer cells [3] [5] [16]“[19]. "
Lung_Cancer
"The cancer tissue used in this study was received from patients that had surgical resection of both the primary tumor and related metastases. None of the patients had received chemo- or radiotherapy before the resection of the primary tumor. Medical charts and pathology reports were reviewed to record clinical and pathological data. Glass slides were reviewed to determine the histological type according to the WHO classification [30]. Follow-up information including the patient outcome and the time interval between the date of surgical resection and death was collected. The cases lost to follow-up and deaths from causes other than CRC were considered censored data for the survival analysis. The median follow-up period was 37.9 months (range 0.8“104.6 months). Ethical statement All human specimens were obtained from the files of surgically resected cases examined at the Department of Pathology Seoul National University Bundang Hospital for the pathologic diagnosis. The retrospective study was performed using the stored samples after the pathologic diagnosis and all of the samples were anonymized before the study. The participants did not provide written informed consent in this study. The study was approved by the Institutional Review Board of Seoul National University Bundang Hospital under the condition of anonymization (reference: B-1109/136-302). Tissue array methods To evaluate the regional stromal differences samples were taken from each patient from four areas: the center and periphery of the primary cancer distant metastases and lymph node metastases. The distant metastatic sites for the tissue arrays were as follows: liver in 83 cases (45.9%) lung in 38 cases (21.0%) seedings in 38 cases (21.0%) distant lymph nodes in 6 cases (3.3%) and ovary in 16 cases (8.3%). The representative core tissue specimens (2 mm in diameter) were taken from individual paraffin blocks and rearranged in new tissue array blocks using a trephine apparatus (Superbiochips Laboratories Seoul South Korea) [31]. Immunohistochemistry Array slides were labelled by immunohistochemistry using antibodies for CD31 (1?100 DAKO Glostrup Denmark) D2-40 (1?100 DAKO) SMA (1?1000 Neomarkers Fremont CA USA) desmin (1?300 DAKO) and PTEN (1?80 Epitomics Burlingame CA USA) after a microwave antigen retrieval procedure except SMA. Non-reactive sites were blocked using 1% horse serum in Tris-buffered saline (pH 6.0) for 3 min. Primary antibodies were applied and antibody binding was detected with diaminobenzidine (DAB). Sections were counterstained with hematoxylin. The reactivity of PTEN in each tissue section was scored as negative faint or strong and the percentage of PTEN-positive fibroblasts was quantified. For the statistical analysis the sample was deemed PTEN-positive if 5% or more CAFs were scored as strong positives. Calculation of LVD MVD and CAFs using digital pathology Slides were concurrently evaluated by two pathologists (H.E.L and H.S.L) using light microscopy to improve the accuracy of the results (Fig. 1). CRC cells were considered as internal negative controls. Medium- to large-sized vessels were considered as internal positive controls for CD31 and D2-40. Intestinal muscular layer or medium- to large-sized vessels were considered as internal positive controls for desmin and SMA. Samples showing inappropriate staining in internal negative or positive controls were considered non-informative and were excluded from the analysis. Slides were scanned using an Aperio ScanScope® CS instrument (Aperio Technologies Inc. Vista CA) at 20— magnification. Subsequently they were analyzed in ImageScope„¢ using the Microvessel Analysis v1 algorithm (Aperio Technologies) and MVD and LVD were calculated. Because desmin-positive muscularis mucosa and propria are positive for SMA immunostaining the area of CAFs (mm2) was calculated by subtracting the areas of desmin staining from that of SMA staining (SMA - desmin). .0091811.g001 Representative sections from four tumor locations stained with CD31 D2-40 SMA or desmin antibodies (—100). Statistical analysis A chi-squared test or Fisher's exact test (2-sided) for non-continuous variables and Mann-Whitney or Kruskal-Wallis analysis for continuous variables were used to compare each parameter with respect to the CRC site and according to its clinicopathologic features. The correlation between continuous variables was analyzed using the Pearson correlation coefficient. To determine the best cut-offs of continuous variables for predicting patient survival the maximal chi-squared method was performed using R program (http://cran.r-project./). The overall survival curves were plotted using the Kaplan-Meier product-limit method and the significance of the differences between these curves was determined using the log-rank test. A univariate and multivariate regression analysis was performed using the Cox's proportional hazards model to determine hazard ratios (HRs). P-values of less than 0.05 were considered statistically significant. All statistical analysis excluding the maximal chi-squared test was performed with the IBM SPSS statistics 20 (Armonk NY USA). Results 1. Heterogeneity of cancer-associated stroma according to examined tumor locations The clinicopathological characteristics of the advanced CRC patients are described in . The CRC patients with synchronous metastases had aggressive features including larger tumor size more advanced pT and pN stage and the presence of perineural and venous invasion than the patients with metachronous metastasis (p<0.05). .0091811.t001 Clinicopathologic characteristics of advanced colorectal cancers. Parameters Total Metachronous Synchronous P value (n?=?181) (n?=?57) (n?=?124) Age (median range) 60.00 (28“93) 62.00 (36“79) 60.00 (28“93) 0.241 Sex 0.007 Male 97 39 (68.4%) 58 (46.8%) Female 84 18 (31.6%) 66 (53.2%) Location 0.055 Right colon 37 6 (10.5%) 31 (25.0%) Left colon 75 29 (50.9%) 46 (37.1%) Rectum 69 22 (38.6%) 47 (37.9%) Size of primary tumor 5.30 (2.0“13.0) 4.20 (2“9) 5.50 (2.5“13) <0.001 Histologic grade 0.227 Low grade 157 52 (91.2%) 105 (84.7%) High grade 24 5 (8.8%) 19 (15.3%) T stage <0.001 T1 0 0 0 T2 5 3 (5.3%) 2 (1.6%) T3 107 45 (78.9%) 62 (50.0%) T4 69 9 (15.8%) 60 (48.4%) N stage <0.001 N0 35 23 (40.4%) 12 (9.7%) N1 58 23 (40.4%) 35 (28.2%) N2 88 11 (19.3%) 77 (62.1%) Perineural invasion 0.011 Absent 89 36 (63.2%) 53 (42.7%) Present 92 21 (36.8%) 71 (57.3%) Venous invasion 0.028 Absent 126 46 (80.7%) 80 (64.5%) Present 55 11 (19.3%) 44 (35.5%) The heterogeneous values for LVD MVD and CAF area are shown in Fig 2. LVD was the highest in center of the primary cancers (median interquartile range (IQR); 37.00 10.50“81.00) than any other site (5.00 1.00“23.75 at the periphery; 2.50 1.00“15.00 in lymph node metastases; 3.00 1.00“20.00 in distant metastases). MVD was lower in distant metastases (median IQR; 641.50 428.00“1006.75) than at the periphery of the primary cancer (731.00 508.25“1049.75) and lymph node metastases (893.50 520.25“1275.25). The area occupied by CAFs was the lowest in the distant metastases (median IQR; 0.91 0.68“1.18) than any other site (1.12 0.88“1.41 in the center; 1.22 0.96“1.54 in the periphery1.4 1.00“1.71 in lymph node metastases). In addition the stromal characteristics varied in relation to the metastatic an examined. MVD and LVD were the higher in lung metastases than those in the liver peritoneum or lymph nodes (p<0.001; Fig. 3). However the amounts of CAFs were consistent among the different metastatic ans (p?=?0.180). .0091811.g002 Heterogeneity of lymphatic vessel density (LVD) microvessel density (MVD) and amount of cancer-associated fibroblasts (CAFs) with respect to tumor location. The LVD (A) MVD (B) and CAF area (C) was significantly different according to each tumor location. .0091811.g003 LVD MVD and CAF area at different distant metastasis sites. The characteristics of cancer-associated stroma differed with respect to the metastatic site. LVD (A) and MVD (B) were greater in the metastatic tumor samples collected from the lung than in samples collected from other metastatic sites (p<0.001). However the amount of CAFs was not significant different between metastatic sites (C). Despite the heterogeneity of stromal characteristics CRC cases with higher LVD MVD and CAFs in center of the primary cancers had a tendency of higher LVD MVD and CAFs in periphery (p<0.05; Table S1). However LVD in center and periphery of primary cancer were not correlated with LVD in related distant metastasis (Table S1). In addition the amount of microvasculature was significantly correlated with the amount of CAFs (Table S2). 2. Clinical significance of cancer-associated stroma in advanced CRCs The MVD LVD and amount of CAFs present at each tumor location were compared according to their clinicopathologic features (Table 2). High grade CRCs were associated with lower CAFs in samples taken from the central cancer site (p?=?0.041). When compared with synchronous metastases the patients with metachronous metastases had higher LVD in center and periphery of the primary cancer and had higher MVD in lymph node metastases. Most patients with metachronous metastases were treated by adjuvant chemotherapy before metastasectomy. LVD and MVD in the distant metastases were significantly higher in the patients who had received chemotherapy before metastasectomy than those who did not (p?=?0.011 and 0.048 respectively). .0091811.t002 Table 2 Clinicopathologic factor and LVD MVD and CAFs. Center (median) Periphery (median) LN metastasis (median) Distant metastasis (median) LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs LVD MVD CAFs Total 39 717 1.13 5 740 1.22 3 888 1.42 3 648 0.91 Histologic grade Low grade 40 717 1.15* 5 741 1.23 3 895 1.43 3 665 0.92 High grade 34 683.5 0.94* 6 643.5 1.18 2 656 1.32 6 498 0.82 pT stage pT2 34 758 1.15 16 870 1.48 6 772 0.73 pT3 47 737 1.19 5 803 1.22 2.5 884 1.43 3 724 0.92 pT4 33 639 1.09 4 630 1.22 3 895 1.41 3 520 0.93 LN metastasis Absent 49 602 1.15 8 712 1.42 4 772 0.94 Present 39 737.5 1.12 4 740 1.21 3 884 1.41 3 617 0.91 Perineural invasion Absent 41 738 1.12 6 772 1.32 5.5 931.5 1.42 4 687 0.94 Present 39 672 1.13 4 702 1.2 2 796 1.39 3 548.5 0.86 Metastasis Synchronous 34* 717.5 1.11 3.0* 741 1.21 3 797* 1.39 3 617 0.93 Metachronous 55* 716 1.21 8.0* 712 1.23 2 1117* 1.63 5 698 0.91 Chemotherapy  Not done 2.0* 597.5* 0.93 Done 10.0* 684* 0.91 * p<0.05; ** p<0.01;   chemotherapy prior to metastatectomy of distant metastasis. 3. Expression loss of PTEN in CAFs PTEN was expressed in cytoplasm and sometimes the nucleus of both cancer and non-neoplastic cells when examined using immunohistochemistry. Expression of PTEN was lost in 8 cases in the center 2 cases in the periphery 4 cases in lymph node metastases and 11 cases in distant metastases (Table S3). In all 11 distant metastases with PTEN loss PTEN expression was intact in both the center and periphery of primary cancer (data not shown). PTEN loss in distant metastasis was correlated with synchronous metastasis (p?=?0.018). 4. Cancer-associated stroma and patient prognosis By using the obtained cut-offs lower LVD MVD and CAFs in the center LVD and CAFs in the periphery and MVD and CAFs in distant metastases were all significantly correlated with lower survival (p<0.05; Fig. S1). Among other clinicopathologic features synchronous metastasis old age larger size high histologic grade advanced pT and pN stage and presence of perineural invasion were associated with a worse prognosis (Table 3). By multivariate Cox regression analysis the hazard ratio of synchronous versus metachronous was the highest (4.029) with the lowest p value (p<0.001). CAFs in distant metastasis LVD and MVD in the center LVD in the periphery age and perineural invasion also independently predicted patient survival. In addition loss of PTEN expression in CAFs in distant metastases was associated with a worse prognosis (p?=?0.042; Fig S2) but not in primary cancer or lymph node metastasis. .0091811.t003 Table 3 Univariate and multivariate survival analysis according to clinicopathologic features. Univariate survival analysis Multivariate survival analysis Factors HR (95% CI) P value HR (95% CI) P value Synchronous vs. Metachronous 4.617 (2.472“8.624) <0.001 3.762 (1.838“7.701) <0.001 Age 1.023 (1.004“1.044) 0.020 1.033 (1.011“1.056) 0.003 Sex (female vs. male) 1.428 (0.920“2.218) 0.113 ” ” Location (left vs. right) 0.503 (0.314“0.806) 0.004 0.700 (0.413“1.188) NS (0.186) Size 1.073 (1.005“1.146) 0.036 1.040 (0.903“1.198) NS (0.584) Histologic grade (high vs. low) 1.862 (1.061“3.269) 0.030 1.491 (0.763“2.912) NS (0.243) pT stage (pT4 vs. pT2/3) 2.341 (1.503“3.645) <0.001 1.137 (0.674“1.921) NS (0.630) pN stage (pN1/2 vs. pN0) 3.848 (1.760“8.411) 0.001 1.773 (0.758“4.146) NS (0.186) Perineural invasion 2.628 (1.640“4.211) <0.001 2.108 (1.265“3.513) 0.004 Venous invasion 1.217 (0.757“1.956) 0.418 ” Center LVD (high vs. low) 0.364 (0.158“0.836) 0.017 0.298 (0.118“0.753) 0.010 Center MVD (high vs. low) 0.391 (0.233“0.655) <0.001 0.437 (0.238“0.801) 0.007 Center CAFs (high vs. low) 0.579 (0.352“0.954) 0.032 1.038 (0.607“1.773) NS (0.892) Periphery LVD (high vs. low) 0.235 (0.086“0.644) 0.005 0.279 (0.096“0.809) 0.019 Periphery MVD (high vs. low) 1.456 (0.911“2.327) 0.117 ” Periphery CAFs (high vs. low) 0.524 (0.336“0.817) 0.004 0.813 (0.499“1.326) NS (0.406) LN LVD (high vs. low) 1.646 (0.874“3.100) 0.123 ” LN MVD (high vs. low) 0.597 (0.294“1.213) 0.154 ” LN CAFs (high vs. low) 0.717 (0.423“1.217) 0.218 ” Metastasis LVD (high vs. low) 0.569 (0.314“1.032) 0.063 ” Metastasis MVD (high vs. low) 0.579 (0.364“0.921) 0.021 1.262 (0.720“2.211) NS (0.417) Metastasis CAFs (high vs. low) 0.492 (0.271“0.894) 0.020 0.290 (0.144“0.582) 0.001 Metastasis PTEN (intact vs. loss) 0.454 (0.208“0.993) 0.048 0.575 (0.239“1.383) NS (0.217) Discussion Carcinoma cells in different tissue areas have distinct characteristics [32]. In central areas of the tumor carcinoma cells maintain an epithelial cell phenotype but carcinoma cells in the invasive front acquire a more malignant and mesenchymal phenotype and are thought to have an increased migratory capacity and contribute to metastatic diseases. These metastatic cells may restore the epithelial phenotype at metastatic sites [33]. In addition to carcinoma cells themselves microenvironment is suggested to be uneven within a given tumor because tumor formation and progression involve the co-evolution of cancer cells and microenvironments [34]. The present study demonstrated that the cancer-associated microenvironment also had distinct characteristics in different areas. Of the sites examined LVD was highest in the center of the primary cancer. MVD was slightly higher in center than at the periphery of the primary cancer but this difference was not statistically significant. Interestingly the amount of CAFs in distant metastases was significantly lower than in center and periphery of the primary cancer. We show that the stromal microenvironment has regional heterogeneity both within the primary tumor and between the primary site and its related metastases. Furthermore our data suggests that the stromal heterogeneity might be attributable to tumor heterogeneity. Therefore it would be beneficial to consider both stromal and tumor cell heterogeneity in order to manage CRC patients better. We evaluated the MVD LVD and amount of CAFs in metastatic tissues of various ans including the liver lung peritoneal seeding distant lymph nodes and ovary. Of the metastatic ans we examined both LVD and MVD were the highest in lung. In our previous study the KRAS discordance rate was also significantly higher in matched lung metastases than in other matched metastatic ans [35]. The underlying mechanism is not known. It could be that primary CRCs with high LVD and MVD have a tendency to produce lung metastases; however our results indicated that LVD and MVD in the center and at the periphery of the primary cancers were lower in the patients with lung metastases (data not shown). Alternatively it may be due to the physiological characteristics of metastatic ans interactions between cancer cells and microenvironment within the metastatic an or the characteristics of the cancer cell clones prone to lung metastasis. However technical or sampling errors also may be possible thus further large-scale studies are required. Although numerous studies have attempted to demonstrate an association between tumor microenvironment characteristics and survival the prognostic impacts of MVD and LVD are still controversial. Some studies have been presented that active angiogenesis and lymphangiogenesis represented by high MVD and LVD are associated with poor prognosis and aggressive clinicopathologic factors [36] [37]. Recent meta-analysis has demonstrated that LVD was significantly associated with disease-free survival but not overall survival [38]. Other studies have reported no statistical significance of MVD and LVD on survival [39]. Prall et al. has reported that high MVD and LVD are related with better survival in a consecutive series and liver metastases [40]. Our results were based on patients with advanced disease with distant metastasis and we showed that high MVD and LVD were related with improved survival. This might be because all the patients in this study had confirmed to have distant metastasis and microvasculatures could influence even delivery of the chemotherapeutic drug into the tumor. However our study had some limitations in terms of the survival analysis. We enrolled the CRC patients with available surgically resected cancer tissues from both primary tumors and corresponding metastatic tumors. Not all advanced CRC patients with metastatic diseases were included and far advanced cases were not enrolled because of their inoperability. Therefore unrecognized biases might have influenced our survival results. Some studies have demonstrated an anti-tumorigenic effect of fibroblasts [20] [21]. However it has become clear that CAFs contribute to the progression of cancer and their prognostic significance in various cancers also has been raised [41] and furthermore several studies have observed genetic alterations in CAFs [26] [27]. PTEN loss of CAFs has been observed in breast cancer and prognostic association of it has been suggested [27] [28]. "
Lung_Cancer
"Survival curves of chimeric Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 250 and 167 days respectively. Survival curves of F1 Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 235 and 140 days respectively. Luciferase activity emitted from the thorax of 11 F1 invCAG-MycL1-Luc;Rb1F/F ;Trp53F/F mice. Each line represents measurements of an individual mouse. MycL1 copy number in SCLC tumors from three different genotypes determined by real-time PCR and aCGH. Each circle represents a primary SCLC tumor. All tumors with more than four copies (dotted line) were considered positive for MycL1 amplification. Note that overexpression of MycL1 by the transgene significantly reduces the frequency of genomic MycL1 amplifications in tumors as compared to the Rb1F/F ;Trp53F/F control ( P = 0.002 Fisher's Exact Test) and the invCAG-Luc;Rb1F/F ;Trp53F/F control ( P = 0.035 Fischer's Exact Test). In vivo validation of Mycl1 as a bona fide oncogene in SCLC Tumors of small cell lung cancer patients often show amplifications of genomic regions coding for either MYCL1 c-MYC or NMYC (Iwakawa et al 2013). In SCLC tumors of the Rb1F/F ;Trp53F/F model amplifications of the genomic region 4qD2.2 coding for Mycl1 are frequently observed (Calbo et al 2005; Dooley et al 2011). To confirm that the Mycl1 oncogene plays a causal role in the progression of SCLC we adapted our frt-invCAG-Luc construct by introducing the Mycl1 cDNA and an internal ribosomal entry site (IRES) upstream of the Luc gene (supplementary Fig S8A). This construct named frt-invCAG-Mycl1-Luc allows for simultaneous expression of both Mycl1 and Luc after Cre recombination and was introduced in the re-derived Col1a1-frt targeted Rb1F/F ;Trp53F/F ESC clone 1B1 (Fig 3) with high efficiency (supplementary Table S2). Two ESC clones were used to generate chimeras (supplementary Table S1 and Fig S8B). These chimeras were treated intratracheally with Ad5-Cre and developed neuroendocrine carcinomas in lung with a considerably shorter latency as compared to the invCAG-Luc;Rb1F/F ;Trp53F/F chimeras with a median survival of 167 days as opposed to 250 days (Fig 4C). This tumor acceleration was even more pronounced in the F1 cohorts which showed a median survival of 235 days for invCAG-Luc and 140 days for invCAG-Mycl1-Luc (Fig 4D) highlighting the importance of Mycl1 in SCLC development. This additional decrease in tumor latency is likely caused by the increase in target cell population in the F1 mice as compared to the chimeras especially since lung tissue showed the least contribution of GEMM-ESCs in chimeric mice (Fig 2C)."
Lung_Cancer
"In one study the ferritin level was found to be higher in malignant pleural effusion than in benign pleural effusion [27]. An experimental study conducted in mesothelioma cases found raised copper levels in mesothelioma cells and reported copper as a possible marker of mesothelioma [28]. In our study the copper levels were similar in the asbestos and control groups; however MM group had a higher copper level as compared to the other two groups. Ceruloplasmin is a copper-carrying glycoprotein. It uses iron oxidase activity to prevent the occurrence of toxic iron products. In the present study ceruloplasmin level was higher in the asbestos group than in the control group while it was also higher in the MM group than in the asbestos group. One study investigated acute phase reactants in rats with asbestos exposure and found elevated ceruloplasmin concentrations [29]. In another study ceruloplasmin levels were observed to be high in lung cancer [30]. In a study in Finland high serum ceruloplasmin concentrations during the years prior to diagnosis were associated with an increased risk of cancer especially with lung cancer [31]. Determining markers that can predict MM development following environmental asbestos exposure are an important research field. Further prospective studies including long follow-up periods are needed to more clearly understand the predictive efficacy of inflammatory and oxidative markers. In the presence of higher transferrin lower ferritin and similar CRP levels in the asbestos group as compared to the control group shows the inflammation in the background. However we believe that elevated acute phase reactants and oxidative stress markers (TOL and OSI) in the MM group can be used as predictive markers for the development of asbestos-related malignancy. Conflict of Interests The authors declare that this paper has not been published anywhere previously and is not simultaneously being considered for any other publication. They are grateful to Dicle University DUBAP for their sponsorship about English editing of this paper. This study has not been published or submitted elsewhere and there is no conflict of interests for this study. 1 Mossman BT Churg A Mechanisms in the pathogenesis of asbestosis and silicosis American Journal of Respiratory and Critical Care Medicine 1998 157 5 1666 1680 2-s2.0-0031799746 9603153 2 Janssen YMW Marsh JP Absher MP Expression of antioxidant enzymes in rat lungs after inhalation of asbestos or silica The Journal of Biological Chemistry 1992 267 15 10625 10630 2-s2.0-0026658119 1316905 3 Sarban S Kocyigit A Yazar M Isikan UE Plasma total antioxidant capacity lipid peroxidation and erythrocyte antioxidant enzyme activities in patients with rheumatoid arthritis and osteoarthritis Clinical Biochemistry 2005 38 11 981 986 2-s2.0-27744591295 16150434 4 Blokhina O Fagerstedt KV Oxidative metabolism ROS and NO under oxygen deprivation Plant Physiology and Biochemistry 2010 48 5 359 373 2-s2.0-77953152723 20303775 5 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 6 Janssen YMW Marsh JP Absher MP Oxidant stress responses in human pleural mesothelial cells exposed to asbestos American Journal of Respiratory and Critical Care Medicine 1994 149 3 795 802 2-s2.0-0028343981 8118652 7 Erel O A new automated colorimetric method for measuring total oxidant status Clinical Biochemistry 2005 38 12 1103 1111 2-s2.0-29144527533 16214125 8 Coussens LM Werb Z Inflammation and cancer Nature 2002 420 6917 860 867 2-s2.0-0037180757 12490959 9 Philip M Rowley DA Schreiber H Inflammation as a tumor promoter in cancer induction Seminars in Cancer Biology 2004 14 6 433 439 2-s2.0-5444256371 15489136 10 Robinson SC Coussens LM Soluble mediators of inflammation during tumor development Advances in Cancer Research 2005 93 159 187 2-s2.0-19844373824 15797447 11 Federico A Millo F Tuccillo C Ciardiello F Loguercio C Chronic inflammation and oxidative stress in human carcinogenesis International Journal of Cancer 2007 121 11 2381 2386 2-s2.0-35648946229 12 Craighead JE Abraham JL Churg A The pathology of asbestos-associated diseases of the lungs and pleural cavities: diagnostic criteria and proposed grading schema. Report of the Pneumoconiosis Committee of the College of American Pathologists and the National Institute for Occupational Safety and Health Archives of Pathology and Laboratory Medicine 1982 106 11 544 596 2-s2.0-0020477738 6897166 13 Manning CB Vallyathan V Mossman BT Diseases caused by asbestos: mechanisms of injury and disease development International Immunopharmacology 2002 2 2-3 191 200 2-s2.0-0036147411 11811924 14 Kinnula VL Crapo JD Superoxide dismutases in the lung and human lung diseases American Journal of Respiratory and Critical Care Medicine 2003 167 12 1600 1619 2-s2.0-0038545583 12796054 15 Matsuzaki H Maeda M Lee S Asbestos-induced cellular and molecular alteration of immunocompetent cells and their relationship with chronic inflammation and carcinogenesis Journal of Biomedicine and Biotechnology 2012 2012 9 pages 492608 16 Osada H Takahashi T Genetic alterations of multiple tumor suppressors and oncogenes in the carcinogenesis and progression of lung cancer Oncogene 2002 21 48 7421 7434 2-s2.0-0037152635 12379883 17 Syslov¡ K Kacer P Kuzma M Rapid and easy method for monitoring oxidative stress markers in body fluids of patients with asbestos or silica-induced lung diseases Journal of Chromatography B 2009 877 24 2477 2486 18 Tanrikulu AC Abakay A Kaplan MA A Clinical radiographic and laboratory evaluation of prognostic factors in 363 patients with malignant pleural mesothelioma Respiration 2010 80 6 480 487 2-s2.0-78649327372 20881372 19 Abu-Youssef H Amin S Amin H Osman E Value of C-reactive protein in etiologic diagnos?s of pleural effusion The Egyptian Journal of Bronchology 2010 4 124 130 20 Nojiri S Gemba K Aoe K Survival and prognostic factors in malignant pleural mesothelioma: a retrospective study of 314 patients in the west part of Japan Japanese Journal of Clinical Oncology 2011 41 1 32 39 2-s2.0-78650794570 20798232 21 Chan ED Pott GB Silkoff PE Ralston AH Bryan CL Shapiro L Alpha-1-antitrypsin inhibits nitric oxide production Journal of leukocyte biology 2012 92 6 1251 1260 22975343 22 Huuskonen MS Rsnen JA Hrk¶nen H Asp S Asbestos exposure as a cause of immunological stimulation Scandinavian Journal of Respiratory Diseases 1978 59 6 326 332 2-s2.0-0018217639 311941 23 Kasprzyk M Dyszkiewicz W Zwaru? D Szydlik S Le?niewska K Krzyzanowski M The quantitative evaluation of the serum acute phase proteins (APP) of patients undergoing a curative resection for non-small cell lung cancer (NSCLC) Przeg?d Lekarski 2006 63 10 936 940 2-s2.0-33947492701 24 Wu C Chen C Yang Y Hao C Ni J Che D Relationship between the expression of alpha 1-antitrypsinase in bronchioalveolar carcinoma and clinical pathology Journal of Tongji Medical University 2000 20 1 26 28 2-s2.0-0642366560 12845749 25 Y?ld?r?m A Meral M Kaynar H Polat H U§ar EY Relationship between serum levels of some acute-phase proteins and stage of disease and performance status in patients with lung cancer Medical Science Monitor 2007 13 4 CR195 CR200 2-s2.0-34147180985 17392651 26 Milman N Pedersen LM The serum ferritin concentration is a significant prognostic indicator of survival in primary lung cancer Oncology Reports"
Lung_Cancer
"630±60?nm band pass filter) and green (?excitation: 470±40?nm band pass filter ?detection: 535±50?nm band pass filter) fluorescence channels. Flow cytometric analysis was assayed with the JC-1 Mitochondrial Membrane Potential Kit (AAT Bioquest Sunnyvale CA USA) according to the manufacturer's directions using a FACSCalibur and the results were analyzed by CellQuest software. In vitro casapse-9 activity determination Caspase-9 activity was measured by a fluorometric assay in whole-cell lysates using Ac-Leu-Glu-His-Asp-MCA substrate (Peptide International Inc. Louisville KY USA). A549 cell extracts were mixed with Ac-LEHD-MCA in ICE standard buffer (100?mM HEPES pH 7.5 10% sucrose 0.1% CHAPS 10?mM DTT 1?mM PMSF) and cleavage of the fluorogenic peptide substrate was monitored at 37?°C for 30?min by a SPECTRA max GEMINI EM (Molecular Device Sunnyvale CA USA) fluorometer with excitation at 370?nm and emission at 460?nm. This work was supported in part by a Grant-in-Aid (23591477) from the Ministry of Education Culture Sports Science and Technology of Japan. Apaf-1 apoptotic protease-activating factor 1 COX cyclooxygenase HSF-1 heat shock factor 1 MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazolium bromide NSAID nonsteroidal anti-inflammatory drug NSCLC non-small cell lung cancer PCR polymerase chain reaction RNAi RNA interference RT reverse transcriptase TUNEL terminal deoxynucleotidyl transferase-mediated dUTP nick and labelling Edited by G Raschell  The authors declare no conflict of interest. Tavaria M Gabriele T Kola I Anderson RL A hitchhiker's guide to the human Hsp70 family Cell Stress Chaperones 1996 1 23 28 9222585 Jaattela M Escaping cell death: survival proteins in cancer Exp Cell Res 1999 248 30 43 10094811 Aghdassi A Phillips P Dudeja V Dhaulakhandi D Sharif R Dawra R Heat shock protein 70 increases tumorigenicity and inhibits apoptosis in pancreas adenocarcinoma Cancer Res 2007 67 616 625 17234771 Ciocca DR Clark GM Tandon AK Fuqua SA Welch WJ McGuire WL Heat shock protein hsp70 in patients with axillary lymph node-negative breast cancer J Natl Cancer Inst 1993 85 570 574 8455204 Cornford PA Dodson AR Parsons KF Desmond AD Woolfenden A Fordham M Heat shock protein expression independently predicts clinical outcome in prostate cancer Cancer Res 2000 60 7099 7105 11156417 Vargas-Roig LM Gago FE Tello O Aznar JC Ciocca DR Heat shock protein expression and drug resistance in breast cancer patients treated with induction chemotherapy Int J Cancer 1998 79 468 475 9761114 Igney FH Krammer PH Death and anti-death: tumor resistance to apoptosis"
Lung_Cancer
"The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients and 470 cancer-free controls. Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression to evaluate the association of each tag SNP with NSCLC. Results Multivariate regression analysis indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. When stratified by smoking status the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.79) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65). When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year). Similarly GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). Conclusion CR1 rs7525160 G?>?C polymorphism was associated with an increased risk of developing NSCLC in Chinese population. The association displays a manner of gene-environmental interaction between CR1 rs7525160 tagSNP and smoking status. CR1 Polymorphism Tag SNPs Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other ans were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and "
Lung_Cancer
"However because data on the substantial prevalence of COPD and its severity in Asian lung cancer patients remain limited clinical impact of prevalence and severity of COPD among the population has not been fully evaluated. Furthermore patients with COPD often have comorbidities. Thus whether the decision-making process for therapeutic management of lung cancer patients might be independently affected by COPD remains elusive. Methods Clinical impact of prevalence and severity of COPD were evaluated in 270 Japanese patients with newly diagnosed lung cancer who were sequentially registered and underwent bronchoscopy from August 2010 to July 2012 at Nagoya University hospital. Furthermore to explore whether or not the severity of airflow obstruction might affect the decision to propose thoracic surgery with curative intent we evaluated data from patients with lung cancer at stage 1A to 3A who underwent spirometry and bronchoscopy. Results The prevalence rate of COPD was 54.4% among Japanese patients with lung cancer who underwent bronchoscopy. The incidence of Global Initiative for Chronic Obstructive Lung Disease (GOLD) grades 1 and 2 was significantly higher than that of GOLD grade 3. Although COPD-related comorbidities were not independent factors for proposing thoracic surgery the number of thoracic surgeries performed was significantly less in the COPD group than the non-COPD group. Multivariate analysis showed that more severe airway obstruction advanced clinical staging and higher age were independent factors associated with the decision on thoracic surgery. Conclusions We demonstrated a high prevalence of COPD among Japanese lung cancer patients. Based on the knowledge that severity of COPD is one of the most important factors in the therapeutic decision comprehensive assessment of COPD at bronchoscopy might allow us to implement the optimum management for lung cancer patients. Chronic obstructive lung disease Bronchoscopy Spirometry screening assessment Thoracic surgery Japanese population Background Chronic obstructive pulmonary disease (COPD) and lung cancer are projected to continue to increase the burden of disease worldwide until 2020 [12]. Many studies suggest that COPD might be independently related to a worse prognosis for lung cancer [3-6]. A recent review suggests more inclusive consideration for surgical resection with curative intent in lung cancer patients with COPD because limited surgical resections or nonsurgical therapeutic options might provide inferior survival compared with resection [6]. However because older patients with COPD are often known to have much lower pulmonary function as well as other comorbidities [78] whether or not the decision-making process for therapeutic management of lung cancer patients might be independently affected by the coexistence and severity of COPD remains elusive. Recent studies show that the prevalence of COPD is 40-70% of smokers diagnosed with lung cancer [910]. On the other hand many studies suggest that the increasing incidence of adenocarcinoma in Asian populations including the Japanese population might be associated with epidermal growth factor receptor (EGFR) mutation rather than with smoking [1112]. Zhang et al. show a low prevalence of COPD in hospitalized lung cancer patients in China (21.6%; 705/3263 cases) [13] whereas we recently demonstrated that the prevalence of COPD was more than 40% in Japanese patients undergoing thoracic surgery [14]. Because another therapeutic option besides surgery such as chemotherapy and/or radiation might be selected for the older lung cancer patients with COPD [8] substantial prevalence of COPD among Asian patients with newly diagnosed lung cancer might be higher than that in our study [14]. Thus data on the prevalence of COPD and its severity in Asian populations remain limited. Taken together clinical impact of prevalence and severity of COPD among Asian lung cancer patients should be determined. Bronchoscopy is performed for most patients with lung cancer before the decision is made for treatment of lung cancer. In the present study the association of COPD prevalence with lung cancer characteristics was evaluated by spirometry among 270 Japanese patients with lung cancer who underwent bronchoscopy. We also evaluated whether or not the prevalence and severity of COPD might independently affect the decision-making process for the treatment of lung cancer in this population. Methods Population Patients with lung cancer who underwent bronchoscopy at Nagoya University hospital from August 2010 to July 2012 were the subjects of this retrospective study. The study was approved by the Institutional Review Board of Nagoya University Graduate School of Medicine (No 27-2) [14]. Information about patient characteristics pathological diagnosis of lung cancers and clinical staging of lung cancers was obtained from hospital records as previously reported [14]. COPD-related systemic comorbidities were defined as diabetes hypertension hyperlipidemia or ischemic cardiac disease [7]. Spirometry screening assessment was performed on admission of the patients undergoing bronchoscopy. Spirometry was performed with a calibrated dry spirometer a FUDAC-77 (Fukuda Denshi Co. Ltd. Tokyo Japan) according to the American Thoracic Society (ATS) standards applied in our hospital [15]. Subjects were assigned to the COPD group if they had airflow obstruction as determined by an FEV1/FVC ratio was below 0.70 and the remaining subjects were assigned to the non-COPD group [910]. Reversibility for which an improvement of 200 ml in FEV1 and 12% in FEV1 from baseline was defined as positive was also evaluated 15 minutes after a short-acting beta2-agonist was given. Severity of airflow limitation in COPD was determined by using the Global Initiative for Chronic Obstructive Lung Disease (GOLD) grade [16]; that is grade 1 (%FEV1 predicted >80%) grade 2 (50%?<%FEV1 predicted <80%) grade 3 (30%?<%FEV1 predicted <50%) and grade 4 (%FEV1 predicted <30%). When the patients did not undergo spirometry as a screening assessment at a bronchoscopy data were collected from the preoperative pulmonary assessment for those undergoing thoracic surgery or from a spirometric assessment before the bronchoscopy. Information about the existence of emphysema from the chest computed tomography (CT) was obtained from radiological reports. Clinical staging of lung cancer was based on the tumor node metastasis (TNM) staging using the standards of the Union International Contre le Cancer (UICC) 7th edition [17]. Histological type of adenocarcinoma squamous cell carcinoma (Sq) large cell carcinoma (Large) small cell lung carcinoma (SCLC) and non-small cell lung carcinoma (NSCLC) was determined according to the World Health anization™s classification [18]. We also collected information about the status of EGFR mutation in lung cancers from patient records. Statistical analysis All data were checked for completeness and the analyzed variables were tested for normality of distribution by the Shapiro-Wilk test. Normally distributed variables were compared by the t test and non-normally distributed ones by the Mann-Whitney test between the COPD and non-COPD group or between the surgery and the non-surgery group. Comparisons between the percentages of patients with each GOLD grade or tumor type were made using the ?2 test or with Fisher™s exact test. Factors that were found to be predictive for relinquishing surgery in the above-mentioned univariate analyses were entered into a forward-and-backward stepwise logistic regression analysis to identify independent factors for the relinquishment of surgery. Statistical analyses were performed with PASW Statistics version 18.0 (SPSS Inc Chicago IL) and a P value of less than 0.05 was considered statistically significant. Results Demographic distribution of patient characteristics among the study population Data from 320 patients with lung cancer who were sequentially registered and underwent bronchoscopy from August 2010 to July 2012 were obtained from hospital records (). Fifty patients who had not undergone pulmonary assessment by spirometry were subsequently excluded from the study population. In total 234 patients with lung cancers underwent spirometry screening assessment at bronchoscopy. A further 36 patients with lung cancers did not undergo spirometry at bronchoscopy but received it at thoracic surgery or before bronchoscopy. Ultimately the study population included 270 patients who underwent spirometry and bronchoscopy among 320 patients with lung cancer (84.4%) (). Study profile. Schematic diagram showing the study profile. In the present population 54.4% of the patients who underwent bronchoscopy had COPD (147/270 cases). Table 1 shows a comparison of the patient characteristics among the study groups. Only 8.5% of the total study population had been managed as COPD. Overall the 147 patients in the COPD group were older and more likely to be male and to have a more extensive smoking history as compared with the 123 patients in the non-COPD group. When we evaluated the severity of airflow obstruction in the COPD group the incidence of GOLD grade 1 and 2 was significantly higher than that of GOLD grade 3 (Figure 2 and Table 2)."
Lung_Cancer
"Pathway-level statistics and significance testWe introduce five methods as candidates for iPAS. Each method is a modification of existing pathway analysis techniques enabling us to test an individual tumor sample™s pathway aberrance by using the nRef. A summary is provided in . .Modification of existing pathway analysis methods for iPASNote. Significance can be obtained against the null distribution generated from normal samples. All the collected normal samples for the nRef are one by one compared with the nRef to yield statistics of the null distribution. A statistic from a single cancer case is compared with this null distribution to yield P-value.Average ZStandardizing the gene expression by mean and standard deviation from datasets is often used in microarray analysis. A vector Z = (z1 z2 ¦ zn) denotes the expression status of a pathway where zi symbolizes the standardized expression value of i-th gene where the number of genes belonging to the pathway is n. In typical settings standardization is performed using the mean and SD of a given dataset mostly the cancer-only cohort data thus y¯/n indicates how much the given sample™s overall pathway gene expression deviates from the center of the cancer samples. We made the simple modification Z™ = (z1™ z2™ ¦ zn) where zi™ is derived from mean and SD of the nRef. In this case y'¯/n gives the samples deviation from the nRef. We believe this modification is biologically valid because every cancer starts its malignancy from normal cell. Thus the clinical characteristics of a single cancer can be captured by measuring the difference of it against common characteristic of normal cells which is represented by the nRef in our study.Fisher exact testWe generated a 2 — 2 contingency table for a given pathway (S) and DEGs (D) for the test. For individualized interpretation we define D by the ranking of z-value which is standardized gene expression for the mean and SD of the nRef. For each individual sample 5% (highest 2.5% and lowest 2.5%) of the total genes are defined as D. We applied a two-tailed test to detect alteration of pathways due to enrichment or depletion of differential genes. The result of this statistic can be interpreted as how many DEGs are enriched in the given pathway where the expression difference refers to how much a patient™s gene expression deviates from the nRef.Gene set enrichment analysisWe adopted the original version of gene set enrichment analysis (GSEA) proposed by Subramanian et al. (2005). Typically inputs for GSEA are generated by testing whole cohort samples using phenotype label; t-statistic correlation coefficients and fold changes are usually used. In the personalized analysis setting we use the z-value as an input for the GSEA algorithm which is standardized gene expression by mean and SD of the nRef. The GSEA output enrichment score reflects the degree to which a gene set in the pathway is overrepresented at the extremes (low or high) of the entire ranked list of z-values from a single patient.Non-parametric quadratic testGene expression in a pathway of a tumor sample is represented by vector Z = (z1 z2 ¦ zn) where zi is standardized expression level of i-th gene by mean and SD of the nRef where n is the number of genes belonged to the pathway. A pathway characteristic of an individual patient™s pathway can be represented by the averaged Euclidean distance (ZTZ/n). This gives the distance of a single patient from the center of the nRef due to the square of standardized expression difference and thus does not reflect increased or decreased expression only the extent of the expression difference. Genes in the pathway are usually functionally correlated; therefore use of the correlation structure of the normal samples may increase sensitivity enough to capture the aberrance of a single cancer case. We also consider the averaged Mahalanobis (ZTSZ/n) distance which uses the covariance matrix calculated from the nRef. This value describes the statistical distance from the center of normal samples taking into account correlation among normal samples. The covariance matrix S is calculated for each pathway from the nRef.3 RESULTS3.1 Pathway-based identification and validation of cancer survivalTo assess whether our method can sensitively detect pathway aberrances that are associated with a patient™s clinical outcome a known survival pathway that showed strong association with patient survival from Beer™s data was tested. Bryant et al. (2010) reported that the ˜cell cycle stimulatory™ pathway of 51 genes is significantly associated with patient survival (Cox proportional hazards model P = 0.000113). In that study pathway gene expression was represented as an average of z-values where the z-value indicates the standardized expression level by the mean and SD of all cancer samples. The high-risk group was defined as those in which pathway expressions were >0 and the pathway showed poor prognostic outcome. The association was significant with or without adjusted clinical covariates and thus the pathway alone is a strong indicator of cancer prognosis. This finding was also validated in the Japanese LUAD cohort (n = 87 survival data are not provided to public) in Bryant™s study. As studies have shown a clear association between the cell cycle pathway and cancer in terms of driving cancer proliferation we considered this pathway as a pathway that should be detected. All of the methods proposed as candidates for iPAS showed significant associations of the ˜cell cycle stimulatory™ pathway from Beer™s data (). The same pathway analyzed using GSE8894 (n = 61) data yielded significant associations in all proposed methods with the marginal exception of Mahalanobis (P = 0.0549). .Survival analysis of ˜cell cycle stimulatory™ pathway reported by Bryant et al. (2010)DatasetPathway statisticsCoefficientP-valueBeer (N = 432)"
Lung_Cancer
"Discussion A previous study on metastatic RCC by Yuasa et al. demonstrated that: 1) smaller initial tumor size predicted a good response to TKIs; 2) the greatest response was achieved in patients with lung lesions; and 3) there was no difference in tumor response between patients treated with sorafenib and sunitinib [6]. However these results raised several specific questions. First tumor histology and progression risk may affect the response to TKIs. TKIs are associated with a good response in patients with CCRCC but are less effective against non-CCRCC [10]. Similarly patients with favorable risk factors have a greater chance of a good tumor response than those with poorer risk factors. Second there is the possibility of bias in terms of the types of TKI selected; given that sunitinib showed a higher response rate than sorafenib [78] patients with larger or more rapidly-growing tumors may be allocated sunitinib rather than sorafenib in clinical practice. Third efficacy based on initial tumor size may differ between different ans; although the previous study compared mean lesion-size reductions between different ans they did not compare the effect of initial tumor size in individual ans. It is therefore unclear if the association between initial lesion size and tumor response was observed in each an or if the association could be attributed to the fact that most of the small lesions were lung metastases which showed a good response to TKIs. The current study only included CCRCC patients treated with sunitinib. We found that lung lesions showed the greatest response to sunitinib and detected a modest correlation between initial tumor diameter and reduction in lesion size while even small lesions in other ans failed to respond. However the number of extra-pulmonary tumors assessed was too small to determine statistical significance and further studies with larger numbers of tumors are needed to obtain conclusive results. Only lesions with an initial diameter?<?20 mm achieved a CR in this study indicating that a lung-tumor reduction of?>?50% might be limited to smaller lesions. The cut-off value of 16.5 mm for a?>?50% reduction in diameter was calculated using ROC analysis with a sensitivity of 67.0% and a specificity of 77.8%. Some physicians may prefer conservative therapies without TKIs or a watchful waiting strategy in CCRCC patients with only small lung metastatic lesions [11]. Furthermore cytokine therapies are still employed in CCRCC patients especially in Japan because of their low toxicity and ability to achieve long-term stable disease [12]. However the present results suggest that smaller lung lesions are associated with a greater chance of response to TKIs and it is therefore important not to miss the opportunity for early initiation of TKI treatment in patients with PD during watchful waiting periods or cytokine therapy. Several studies have investigated the response of primary kidney lesions to TKIs [13-15]. Kroon et al. reported that smaller primary lesions were more responsive to treatment and that tumors of 5“7 cm may benefit from neoadjuvant treatment followed by nephron-sparing surgery. In contrast our results showed that the response of kidney lesions to sunitinib was independent of initial tumor size and many smaller lesions exhibited no response. A possible explanation for this difference may be the selection of patients; most of the kidney lesions were investigated in the neoadjuvant setting in Kroon et al.™s study while all the patients with kidney lesions in the current study had an extensive metastatic tumor burden. The different patient backgrounds may have led to different responses to TKIs particularly in small kidney lesions. CRP is an acute phase protein produced by the liver in response to various conditions such as inflammation infection and malignancy [16]. In the cytokine era elevated serum CRP level has been suggested as a biomarker for predicting poor survival in RCC patients [17-19]. Yasuda et al. recently demonstrated that CRP was a significant predictive marker for prognosis in metastatic RCC patients treated with TKIs [20]. In the current study the size reduction of lung lesions in patients with high serum CRP levels was lower than that in patients with low CRP levels irrespective of the initial size. This lower response to sunitinib in patients with higher serum CRP levels may be attributed to an aggressive disease status reflected by higher CRP levels the acquisition of resistance to therapeutic agents through an increase in inflammatory mediators in the cancer-cell microenvironment or compromised drug metabolism induced by such mediators associated with CRP [21]. Tumor response to treatment is currently assessed by imaging based on RECIST criteria [22]. However although marked central necrosis is often detected in lesions with a small size reduction after treatment with TKIs RECIST only considers one-dimensional lesional size changes suggesting that it may substantially underestimate the actual tumor response. Several studies recently reported novel criteria which may improve response assessment by evaluating changes in tumor attenuation and morphology on contrast-enhanced computed tomography scans in addition to size changes [522-26]. The results of this study therefore need to be interpreted carefully because lesions in different ans may exhibit distinct response patterns in imaging. Moreover the current study did not demonstrate an association between tumor response and patient survival and it is possible that percent change in tumor size might not correlate directly with survival. Further studies are needed to determine the influence of an-specific response patterns to TKI treatment on survival. Conclusions The results suggest that tumor-size reduction depends on initial tumor size and the ans involved as well as systemic reaction to the lung tumor as indicated by CRP levels. CCRCC patients with lung metastatic lesions?<?20 mm in diameter and lower CRP levels may achieve greater reductions in tumor size with sunitinib therapy than those with extra-pulmonary lesions lung lesions???20 mm in diameter and/or higher CRP levels. Abbreviations RCC: Renal cell carcinoma; TKI: Tyrosine kinase inhibitor; RECIST: Response evaluation criteria in solid tumors; CCRCC: Clear cell RCC; CTC-AE: Common Terminology criteria for Adverse Events; ROC: Receiver-operator curve; AUC: Area under the curve; CRP: C-reactive protein. Competing interests Norihiko Tsuchiya and Tomonori Habuchi received honoraria from Pfizer Japan Inc. Authors™ contributions NT TY JY and TH were involved in the conception and design of the study. TY KN MS and SM were involved in the provision of patients™ clinical data. NT and TH drafted the manuscript. SN TI SS supported the manuscript writing. All authors have read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2490/14/26/prepub Acknowledgements There were no external sources of funding. Akaza H Kawai K Tsukamoto T Fujioka T Tomita Y Kitamura T Ozono S Miki T Naito S Zembutsu H Successful outcomes using combination therapy of interleukin-2 and interferon-alpha for renal cell carcinoma patients with lung metastasis Jpn J Clin Oncol 2010 40 7 684 689 10.1093/jjco/hyq027 20382632 Flanigan RC Salmon SE Blumenstein BA Bearman SI Roy V McGrath PC Caton JR Jr Munshi N Crawford ED Nephrectomy followed by interferon alfa-2b compared with interferon alfa-2b alone for metastatic renal-cell cancer N Engl J Med 2001 345 23 1655 1659 10.1056/NEJMoa003013 11759643 Albiges L Oudard S Negrier S Caty A Gravis G Joly F Duclos B Geoffrois L Rolland F Guillot A Laguerre B Legouffe E Kohser F Dietrich PY Theodore CA Escudier B Complete remission with tyrosine kinase inhibitors in renal cell carcinoma J Clin Oncol 2012 30 5 482 487 10.1200/JCO.2011.37.2516 22231040 Staehler M Haseke N Zilinberg E Stadler T Karl A Siebels M Durr HR Siegert S Jauch KW Bruns CJ Stief CG Complete remission achieved with angiogenic therapy in metastatic renal cell carcinoma including surgical intervention Urol Oncol 2010 28 2 139 144 10.1016/j.urolonc.2009.03.033 19576802 Krajewski KM Guo M Van den Abbeele AD Yap J Ramaiya N Jagannathan J Heng DY Atkins MB McDermott DF Schutz FA Pedrosa I Choueiri TK Comparison of four early posttherapy imaging changes (EPTIC; RECIST 1.0 tumor shrinkage computed tomography tumor density Choi criteria) in assessing outcome to vascular endothelial growth factor-targeted therapy in patients with advanced renal cell carcinoma Eur Urol 2011 59 5 856 862 10.1016/j.eururo.2011.01.038 21306819 Yuasa T Urakami S Yamamoto S Yonese J Nakano K Kodaira M Takahashi S Hatake K Inamura K Ishikwa Y Fukui I Tumor size is a potential predictor of response to tyrosine kinase inhibitors in renal cell cancer Urology 2011 77 4 831 835 10.1016/j.urology.2010.12.008 21316083 Motzer RJ Hutson TE Tomczak P Michaelson MD Bukowski RM Rixe O Oudard S Negrier S Szczylik C Kim ST Chen I Bycott PW Baum CM Figlin RA Sunitinib versus interferon alfa in metastatic renal-cell carcinoma N Engl J Med 2007 356 2 115 124 10.1056/NEJMoa065044 17215529 Escudier B Eisen T Stadler WM Szczylik C Oudard S Siebels M Negrier S Chevreau C Solska E Desai AA Rolland F Demkow T Hutson TE Gore M Freeman S Schwartz B Shan M Simantov R Bukowski RM Sorafenib in advanced clear-cell renal-cell carcinoma N Engl J Med 2007 356 2 125 134 10.1056/NEJMoa060655 17215530 Rini BI Escudier B Tomczak P Kaprin A Szczylik C Hutson TE Michaelson MD Gorbunova VA Gore ME Rusakov IG Negrier S Ou YC Castellano D Lim HY Uemura H Tarazi J Cella D Chen C Roosbrook B Kim S Motzer RJ Comparative effectiveness of axitinib versus sorafenib in advanced renal cell carcinoma (AXIS): a randomised phase 3 trial Lancet 2011 378 9807 1931 1939 10.1016/S0140-6736(11)61613-9 22056247 Tannir NM Plimack E Ng C Tamboli P Bekele NB Xiao L Smith L Lim Z Pagliaro L Araujo J Aparicio A Matin S Wood CG Jonasch E A phase 2 trial of sunitinib in patients with advanced Non-clear cell renal cell carcinoma Eur Urol 2012 62 6 1013 1019 10.1016/j.eururo.2012.06.043 22771265 Chin AI Lam JS Figlin RA Belldegrun AS Surveillance strategies for renal cell carcinoma patients following nephrectomy Rev Urol 2006 8 1 1 7 16985554 Fujioka T Obara W Evidence-based clinical practice guideline for renal cell carcinoma: the Japanese Urological Association 2011 update Int J Urol 2012 19 6 496 503 10.1111/j.1442-2042.2012.03031.x 22621218 van der Veldt AA Meijerink MR van den Eertwegh AJ Bex A de Gast G Haanen JB Boven E Sunitinib for treatment of advanced renal cell cancer: primary tumor response Clin Cancer Res 2008 14 8 2431 2436 10.1158/1078-0432.CCR-07-4089 18413834 Kroon BK de Bruijn R Prevoo W Horenblas S Powles T Bex A Probability of downsizing primary tumors of renal cell carcinoma by targeted therapies is related to size at presentation Urology 2012 81 1 111 115 23153934 Abel EJ Culp SH Tannir NM Tamboli P Matin SF Wood CG Early primary tumor size reduction is an independent predictor of improved overall survival in metastatic renal cell carcinoma patients treated with sunitinib Eur Urol 2011 60 6 1273 1279 10.1016/j.eururo.2011.07.008 21784574 Gabay C Kushner I Acute-phase proteins and other systemic responses to inflammation N Engl J Med 1999 340 6 448 454 10.1056/NEJM199902113400607 9971870 Bromwich E McMillan DC Lamb GW Vasey PA Aitchison M The systemic inflammatory response performance status and survival in patients undergoing alpha-interferon treatment for advanced renal cancer Br J Cancer 2004 91 7 1236 1238 10.1038/sj.bjc.6602152 15354220 Casamassima A Picciariello M Quaranta M Berardino R Ranieri C Paradiso A Lorusso V Guida M C-reactive protein: a biomarker of survival in patients with metastatic renal cell carcinoma treated with subcutaneous interleukin-2 based immunotherapy J Urol 2005 173 1 52 55 10.1097/01.ju.0000146713.50673.e5 15592024 Ramsey S Lamb GW Aitchison M Graham J McMillan DC Evaluation of an inflammation-based prognostic score in patients with metastatic renal cancer Cancer 2007 109 2 205 212 10.1002/cncr.22400 17149754 Yasuda Y Saito K Yuasa T Kitsukawa S Urakami S Yamamoto S Yonese J Takahashi S Fukui I Prognostic impact of pretreatment C-reactive protein for patients with metastatic renal cell carcinoma treated with tyrosine kinase inhibitors Int J Clin Oncol 2012 18 5 884 889 22886358 Slaviero KA Clarke SJ Rivory LP Inflammatory response: an unrecognised source of variability in the pharmacokinetics and pharmacodynamics of cancer chemotherapy Lancet Oncol 2003 4 4 224 232 10.1016/S1470-2045(03)01034-9 12681266 Eisenhauer EA Therasse P Bogaerts J Schwartz LH Sargent D Ford R Dancey J Arbuck S Gwyther S Mooney M Rubinstein L Shankar L Dodd L Kaplan R Lacombe D Verweij J New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1) Eur J Cancer 2009 45 2 228 247 10.1016/j.ejca.2008.10.026 19097774 Han KS Jung DC Choi HJ Jeong MS Cho KS Joung JY Seo HK Lee KH Chung J Pretreatment assessment of tumor enhancement on contrast-enhanced computed tomography as a potential predictor of treatment outcome in metastatic renal cell carcinoma patients receiving antiangiogenic therapy Cancer 2010 116 10 2332 2342 20225226 Nathan PD Vinayan A Stott D Juttla J Goh V CT response assessment combining reduction in both size and arterial phase density correlates with time to progression in metastatic renal cancer patients treated with targeted therapies Cancer Biol Ther 2010 9 1 15 19 10.4161/cbt.9.1.10340 20009542 Hittinger M Staehler M Schramm N Ubleis C Becker C Reiser M Berger F Course of size and density of metastatic renal cell carcinoma lesions in the early follow-up of molecular targeted therapy Urol Oncol 2012 30 5 695 703 10.1016/j.urolonc.2010.10.011 21865061 Choi H Charnsangavej C Faria SC Macapinlac HA Burgess MA Patel SR Chen LL Podoloff DA Benjamin RS Correlation of computed tomography and positron emission tomography in patients with metastatic gastrointestinal stromal tumor treated at a single institution with imatinib mesylate: proposal of new computed tomography response criteria J Clin Oncol 2007 25 13 1753 1759 10.1200/JCO.2006.07.3049 17470865 Oncol Rep Oncol. Rep Oncology Reports 1021-335X 1791-2431 D.A. Spandidos 24842630 4067423 10.3892/or.2014.3198 or-32-01-0033 Articles Identification of a novel HLA-A*02:01-restricted cytotoxic T lymphocyte epitope derived from the EML4-ALK fusion gene YOSHIMURA MAYUKO 1 2 TADA YOSHITAKA 1 3 OFUZI KAZUYA 1 YAMAMOTO MASAKAZU 2 NAKATSURA TETSUYA 1 3 1Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center Kashiwa Chiba 277-8577 Japan 2Department of Gastroenterological Surgery Tokyo Women™s Medical University Shinzyukuku Tokyo 162-8666 Japan 3Research Institute for Biomedical Sciences Tokyo University of Science Chiba 278-0022 Japan Correspondence to: Dr Tetsuya Nakatsura Division of Cancer Immunotherapy Exploratory Oncology Research and Clinical Trial Center National Cancer Center 6-5-1 Kashiwanoha Kashiwa Chiba 277-8577 Japan E-mail: [email protected] 7 2014 19 5 2014 19 5 2014 32 1 33 39 21 3 2014 23 4 2014 Copyright © 2014 Spandidos Publications 2014 This is an open-access article licensed under a Creative Commons Attribution-NonCommercial 3.0 Unported License. The article may be redistributed reproduced and reused for non-commercial purposes provided the original source is properly cited. Cancer immunotherapy is a promising new approach to cancer treatment. It has been demonstrated that a high number of tumor-specific cytotoxic T cells (CTLs) is associated with increased disease-specific survival in lung cancer patients. Identification of superior CTL epitopes from tumor antigens is essential for the development of immunotherapy for malignant tumors. The EML4-ALK fusion gene was recently identified in a subset of non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK"
Lung_Cancer
"Number of female samples with mutations (Mutation frequency in 36 female samples) Number of male samples with mutations (Mutation frequency in 40 male samples) ABL1 0(0.0%) 0(0.0%) 0(0.0%) AKT1 0(0.0%) 0(0.0%) 0(0.0%) ALK 0(0.0%) 0(0.0%) 0(0.0%) APC 0(0.0%) 0(0.0%) 0(0.0%) ATM 0(0.0%) 0(0.0%) 0(0.0%) BRAF 2(2.6%) 1(2.8%) 1(2.5%) CDH1 0(0.0%) 0(0.0%) 0(0.0%) CDKN2A 0(0.0%) 0(0.0%) 0(0.0%) CSF1R 0(0.0%) 0(0.0%) 0(0.0%) CTNNB1 3(3.9%) 3(8.3%) 0(0.0%) EGFR 32(42.1%) 22(61.1%) 10(25.0%) ERBB2 1(1.3%) 0(0.0%) 1(2.5%) ERBB4 0(0.0%) 0(0.0%) 0(0.0%) FBXW7 0(0.0%) 0(0.0%) 0(0.0%) FGFR1 0(0.0%) 0(0.0%) 0(0.0%) FGFR2 0(0.0%) 0(0.0%) 0(0.0%) FGFR3 0(0.0%) 0(0.0%) 0(0.0%) FLT3 0(0.0%) 0(0.0%) 0(0.0%) GNAS 0(0.0%) 0(0.0%) 0(0.0%) HNF1A 0(0.0%) 0(0.0%) 0(0.0%) HRAS 0(0.0%) 0(0.0%) 0(0.0%) IDH1 0(0.0%) 0(0.0%) 0(0.0%) JAK3 0(0.0%) 0(0.0%) 0(0.0%) KDR 0(0.0%) 0(0.0%) 0(0.0%) KIT 0(0.0%) 0(0.0%) 0(0.0%) KRAS 4(5.3%) 1(2.8%) 3(7.5%) MET 0(0.0%) 0(0.0%) 0(0.0%) MLH1 0(0.0%) 0(0.0%) 0(0.0%) MPL 0(0.0%) 0(0.0%) 0(0.0%) NOTCH1 0(0.0%) 0(0.0%) 0(0.0%) NPM1 0(0.0%) 0(0.0%) 0(0.0%) NRAS 0(0.0%) 0(0.0%) 0(0.0%) PDGFRA 0(0.0%) 0(0.0%) 0(0.0%) PIK3CA 2(2.6%) 0(0.0%) 2(5.0%) PTEN 1(1.3%) 1(2.8%) 0(0.0%) PTPN11 0(0.0%) 0(0.0%) 0(0.0%) RB1 0(0.0%) 0(0.0%) 0(0.0%) RET 0(0.0%) 0(0.0%) 0(0.0%) SMAD4 1(1.3%) 1(2.8%) 0(0.0%) SMARCB1 0(0.0%) 0(0.0%) 0(0.0%) SMO 0(0.0%) 0(0.0%) 0(0.0%) SRC 0(0.0%) 0(0.0%) 0(0.0%) STK11 0(0.0%) 0(0.0%) 0(0.0%) TP53 17(22.4%) 6(16.7%) 11(27.5%) VHL 0(0.0%) 0(0.0%) 0(0.0%) The sequenced data were processed and mutations identified using Ion Torrent Suite Software v3.0 with a plug-in œvariant caller. In order to eliminate error base calling three filtering steps were used to generate reliable variant calling as described in the Materials and Methods. The Sequence read distribution across 189 amplicons generated from 76 FFPE specimens were normalized to 300000 reads per sample (Fig. 1). Using a strict standard variant calling we identified mutations in the following genes as listed in : BRAF EGFR ERBB2 KRAS PIK3CA PTEN SMAD4 and TP53. .0095228.g001 Sequence read distribution across 189 amplicons generated from 76 FFPE specimens normalized to 300000 reads per sample. A. Distribution of average coverage of each amplicon. Data are showed as mean ±SD. B. Number of amplicons with a given read depth sorted in bins of 100 reads. (blue bars present number of target amplicons within read depth red line presents % of target amplicons >?=? read depth). The samples were classified based on their origin as lung adenocarcinoma lung large cell carcinoma lung squamous cell carcinoma and lung neuroendocrine carcinoma. The different stages the cancers have progressed to were scored based on ˜American Joint Committee on Cancer/Tumor size Lymph Nodes affected Metastases (AJCC/TNM) ' system (Ia Ib IIa IIb IIIa IIIb) and as metastasizing and non-metastasizing lung cancers. Also cancers were sorted out as from heavy smokers light-smokers and non-smokers to check the correlation of smoking with the accumulation of these mutations. The detailed list of missense point mutations insertions and deletions profiled on 737 loci of 76 lung cancer samples is provided in Table S1. Out of the mutations identified in our sample set BRAF (2.6%) EGFR (42.1%) ERBB2 (1.3%) KRAS (5.3%) PIK3CA (2.6%) PTEN (1.3%) SMAD4 (1.3%) and TP53 (22.4%) incurred the highest rates of mutations (). The mutation frequencies at their different differentiation levels () at different AJCC staging () of the metastatic and non-metastatic lung cancers () and from patients with different smoking habits () are outlined in the Tables. Detailed sequencing analysis in the exons and functional domains of these genes was hence performed. .0095228.t002 Mutations (including Missense point mutations/deletion/insertion) frequencies in 45 genes (737 loci) in lung adenocarcinoma (AC) lung large cell carcinoma lung squamous cell carcinoma and other two lung cancer samples (lung neuroendocrine carcinoma and unknown lung cancer). Genes Number of samples with mutations in 76 samples (Mutation frequency) Number of AC samples with mutations (Mutation frequency in 52 AC samples) Number of SC samples with mutations (Mutation frequency in 20 SC samples) Number of LCC samples with mutations (Mutation frequency in 2 LCC samples) Number of other samples with mutations (Mutation frequency in 2 other samples) ABL1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) AKT1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) ALK 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) APC 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) ATM 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) BRAF 2(2.6%) 1(1.9%) 1(5.0%) 0(0.0%) 0(0.0%) CDH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CDKN2A 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CSF1R 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CTNNB1 3(3.9%) 3(5.8%) 0(0.0%) 0(0.0%) 0(0.0%) EGFR 32(42.1%) 30(57.7%) 1(5.0%) 0(0.0%) 1(50.0%) ERBB2 1(1.3%) 1(1.9%) 0(0.0%) 0(0.0%) 0(0.0%) ERBB4 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FBXW7 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR2 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FLT3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) GNAS 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) HNF1A 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) HRAS 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) IDH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) JAK3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KDR 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KIT 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KRAS 4(5.3%) 4(7.7%) 0(0.0%) 0(0.0%) 0(0.0%) MET 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) MLH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) "
Lung_Cancer
" Clinics will be randomised to have the gene-based test for estimation of lung cancer risk or to act as controls groups. The primary endpoint will be smoking cessation at eight weeks and six months. Secondary outcomes will include ranking of the gene-based test with other smoking cessation motivators. Discussion The results will inform as to whether the gene-based test is both effective as motivator and acceptable to subjects recruited from primary care. Trial registration Registered with Clinical Trials.gov Registration number: NCT01176383. Smoking cessation Genetic test Lung cancer Background Gene testing in primary care is no longer limited by their exorbitant cost. The prices of genetic tests are dropping faster than Moore™s law for computing costs [1]. This leads the focus to shift from cost of genetic testing to the clinical value of individual gene tests. The recent development of gene-based tests that predicts the risk of lung cancer in smokers is an important example [2]. Despite the well accepted 10-15% probability of lung cancer in smokers 50% of smokers do not believe they are at significantly increased risk [3]. However over 80% of smokers would like to know their personal risk of lung cancer [4]. There is a plausible three way link between biomarkers for chronic obstructive pulmonary disease (COPD) a set of 20 single nucleotide polymorphisms (SNPs) associated with cancer risk and lung cancer [5-8] (). Research has shown a strong association between a high lung cancer susceptibility score derived from family history of cancer the 20 SNPs COPD history (Auckland formula) and the development of lung cancers whereas healthy smokers matched for age gender and lifetime smoking habits had a relatively low score (n?=?446 lung cancer subjects 484 healthy current smokers). The odds ratio for lung cancer risk varied from 0.2-3.2 depending on the genetic risk (p?<?0.001) [910]. The accuracy of the Auckland formula in estimating lung cancer risk for a score of >4 was: sensitivity 90% specificity 45% ( which also includes scores for 52 subjects who developed cancer from a six year prospective study of 1212 smokers and ex-smokers). The score for prediction of non-cancer was conducted with a follow up of just six years. It means that 45% of non-cancer subjects have a low cancer score and 55% have some degree of increased score. The 55% with increased scores have simply not been followed up long enough for lung cancers to develop yet. Notwithstanding this limitation there is now a 20 SNP gene test for prediction of lung cancer in smokers under the trade name Respiragene. Research that established the respiragene test. Distribution of the Respiragene score in a cross-sectional study of 484 control smokers (blue) and 446 with lung cancer (red) (Total?=?930) and from the prospective study of 52 lung cancer cases (green). Reference [8]. Two case-control studies showed a 5-10% increase in cessation with a single gene test of small effect [1112]. A small smoking cessation pilot study using spirometry results and explanations using the Fletcher-Peto diagram to explain risk demonstrated that patients find this is an acceptable method and the quit rate at 12 months was 27% [13]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just their forced expiratory volume in the first second (FEV1) without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group [14]. Data from a hospital outpatient cohort in Auckland suggest a larger increase in quit rate with Respiragene test and the Auckland formula (). Subjects who were current smokers in the pre-contemplative and contemplative stage were randomised into either the test group or control group and only the test group had the Respiragene test. Counselling and follow-up was done by telephone. Using Auckland formula to incorporate the results of the Respiragene test clinical data and family history a score ranging 1-12 with associated risk level (moderate risk high risk very high risk) was calculated and explained to test subjects. Neither group were involved in any formal smoking cessation programme. Indeed of the 13 subjects that had managed to stop smoking (28% of the gene-tested group) 48% quit without any medical assistance and only 52% had nicotine replacement therapy [1516]. When compared with previous studies using telephone counselling alone [17] () there is a 20-25% improvement in smoking cessation with the Respiragene test (). The improvement in intention to quit increases from 56% before testing to 67% in smokers with an average smokers risk of lung cancer or 89% in smokers with a high risk of lung cancer [18]. Respiragene study in Auckland NZ (n?=?43) Cancer susceptibility scale (compared with normal lifetime risk) Cancer susceptibility score Estimated lifetime risk of lung cancer Initial intention to quit Proportion that stopped smoking at 2-4 weeks Proportion still not smoking at 6 months Expected result for telephone counselling () - - 15% 41% 10-20% 9-12% Telephone counselling?+?Respiragene test 1-2.3 (10-35% risk) 2.3-6.7 (35-65% risk) 6.7-8 (65%-80% risk) 27 had average risk score 15% 67% 8/27 (30%) 8 (30%) 16 had high or very high risk score 30-50% (4-10 times average risk) 89% 10/16 (63%) 6 (37.5%) Smoking cessation after Respiragene testing and estimation of lung cancer risk with telephone counselling in a small pilot study in Auckland NZ (n?=?43) compared with expected quit rate. Efficacy of the variety of smoking cessation strategies. Percent increase of success for six months over unaided attempts for each type of quitting (chart from West & Shiffman based on Cochrane review data). Totally unaided smoking cessation has a 3-6% success rate. Therefore telephone support () increases success rate by 6% = 9-12% quit rate. A large hospital trial using Respiragene for calculating lung cancer susceptibility is currently underway in the USA [19] but there are no planned UK investigations. This study fills that gap and uses the NHS framework for smoking cessation. Other studies have taken place looking at how lung functioning testing in COPD might motivate smokers to quit suggesting that it is feasible to conduct this sort of study [131420]. This protocol describes a trial to evaluate a gene-based risk test (using genetic and clinical data) as a smoking cessation motivator in smokers wishing to participate in an NHS primary care smoking cessation clinic (in the action stage of change) alongside the usual counselling and prescribing protocol. It will differ from previous studies using gene testing as a motivator however in that the NHS primary care counselling and prescribing protocol will include several other motivators (CO breath testing saliva cotinine testing and intensive counselling) whereas the Auckland trial using the same gene test had none of these. Also the method of recruitment will differ in that primary care subjects will of necessity be different from the Auckland hospital outpatient cohort [1516]. Research question Can the Respiragene test combined with an estimation of lung cancer susceptibility be used to increase the uptake adherence to and success rate in an established smoking cessation programme in subjects who want to quit in a National Health Service United Kingdom (NHS UK) setting? Hypothesis Genetic testing and estimation of lung cancer susceptibility should increase œsmoking cessation outcomes at six months to >30% (or 1.5-2 fold greater than usual care) irrespective of the risk scores assigned to subjects [11]. Method/Design This protocol has been approved by Surrey Research Ethics Committee at the Royal Surrey County Hospital Guildford Surrey UK. 1/Recruitment Focus groups A number of focus groups of different aged smokers will be held to enable them to contribute to the design of the study 2/ Recruitment Subjects will be recruited from a large general practice in Surrey (practice population=?>?30000). Smokers aged 20-70 years will be identified from the practice records and contacted by post by their GP. Patients who reply stating that they wish to stop smoking will be randomised (stratified randomisation to ensure equivalent age and gender mix) to two clinics (Figure 3) only one of which will include the gene-based test. Previous trials of genetic testing in association with smoking cessation achieved 83-100% of participants opting for the test depending on the method of recruitment [821]. There will be two mailings with SAEs for recruitment with the aim of recruiting at least 30 subjects per clinic (see Power calculations under heading œstatistics). In the first letter the patient™s GP asks the patient to give permission for the researcher to contact him/her to ask about taking part in smoking cessation research (with possible genetic risk testing) and encloses fact sheet 1 and a stamped addressed envelope (SAE) for reply. Figure 3 Consort 2010 flow diagram for GeTTS recruitment. Mailing 2. The principal investigator mails patient with Letter 2 to ask him/her if they would like to attend an 8-week smoking cessation clinic and asks if they would be willing to have a test for genetic susceptibility to development of lung cancer and encloses SAE for reply. Mailing 3. The principal investigator mails Group B subjects and Group A test-concordant subjects to confirm dates of the smoking cessation sessions and full patient information leaflet and consent form enclosed. The information sheet will be slightly different for group A and B. Non-test concordant subjects within group A will be invited to attend the practice nurse for smoking cessation. 3/Inclusion and exclusion criteria i. Inclusion criteria: Aged 20-70 years smoking more than 10 cigarettes daily. ii. Exclusion criteria: Aged under 20 years or over 70 years smoking less than 10 cigarettes daily history of major depression and other psychiatric conditions dementias and serious or terminal illness (cancers etc.). Patients on warfarin would be excluded due to interactions between warfarin and varenicline as varenicline will be used as the modern treatment of choice for smoking cessation. Patients who smoke less than 10 cigarettes/day and patients who did not wish to have a genetic test or do not wish to take part in a research study will be referred to the practice nurse for smoking cessation. 4/Smoking cessation clinics For group A subjects only subjects who have expressed an interest in having a genetic test and gene-based estimation of susceptibility to lung cancer in mailing 2 will be invited to participate (see referral for decliners above). For group B subjects all subjects willing to participate are invited to do so. Uptake into smoking cessation programme (i.e. proportion of invitees who accept invitation and attend clinic of those mailed invitation) will be recorded. All subjects who attend the first session of the research clinic will be asked by the principal investigator JN to sign a consent form and will be invited to raise any concerns about the protocol (as explained in the full information sheet). The consent form will then be countersigned by JN. Group A clinics and Group B clinics will be held on different weekdays at the same health centre premises. Test Subjects who attend Clinic A will be offered a fact sheet on the health risks of smoking (including lung cancer) and the option of the gene-based test for calculation of lung cancer susceptibility whilst subjects who attend Clinic B will be given the same fact sheet on the health risks of smoking (including lung cancer) but without any reference to the gene-based test. The principal investigator will be responsible for handing out the fact sheets and administering the gene-based test in Clinic A and for handing out and explaining the fact sheet in Clinic B. NHS Surrey™s Smoking Cessation Practitioners will lead in-house smoking cessation clinics A and B using the NHS smoking cessation guidelines [22] under the supervision of the principal investigator at the medical centre. There will be: ¢Introductory session which includes a new near patient test for salivary cotinine (nicotine metabolite) “ trade name SmokeScreen [23]. ¢At session 2 patients will be given advice on therapies for smoking cessation. We expect that most patients will opt for a course of varenicline and they will be advised to contact their GP for a prescription. ¢This is followed by seven more weekly sessions and a follow-up session at six months (Figure 4). Uptake and adherence to smoking cessation will be monitored by weekly carbon monoxide exhalation measurements (breath test). The principal investigator will be involved in clinic A administering the gene-based test and determining if subjects have COPD from practice records and history in session 1. Participants who are heavy smokers have a smokers cough and use a salbutamol inhaler can be judged to have COPD even if this is not entered in their GP records (all Group A & B subjects will have spirometry at their 6-month follow-up). Subsequently the principal investigator will report back to clinic A patients with estimated lung cancer risks (session 3). To ensure balance in the control clinic the principal investigator will also attend Clinic B sessions 2 and 3 (see Figure 5 flow charts). ¢At the eight week clinic and the 6-month follow-up clinic smoking cessation status and carbon monoxide breath test score will be recorded and a feedback questionnaire used to assess efficacy of various components will be administered. Mailing 4. Telephone calls followed by letters to patients with invitation to 6-month follow-up session with NHS Smoking Cessation Practitioners and the principal investigator when cessation rate will be assessed and verified by repeating the carbon monoxide breath and salivary cotinine tests. “ for further details see Figure 5: flow charts Figure 4 Timeline of project. Figure 5 Flow chart for the duration of the trial. a. Flow chart of project from start to week 12. b. Flow chart of project to week 36. We anticipate good attendance at the eight week free smoking cessation clinic as would be expected if it were a regular NHS smoking cessation clinic but the attendance at the 6-month follow-up clinic may be more challenging. We consider this attendance essential and as attendance will take up an evening of their time study participants should be paid for their travel expenses (£20) and will receive up to three reminders. Group B subjects attending at the 6-month follow up who have been unable to quit will be offered the gene-based test at this stage. Technique for taking the respiragene test The test requires a Buccal swab and the subjects should not eat or drink within 15 minutes prior to supplying a sample (if has eaten or taken a drink within 15 minutes then rinse mouth with tap water). The nurse taking the sample should wear latex or plastic gloves and take care to avoid contact with the buccal swab collection tip to avoid DNA (deoxyribonucleic acid) contamination. Then: 1. Open buccal swab package at the handle end and carefully remove the swab. 2. Holding handle end of swab stick scrape the collection tip firmly against the inside of the cheek 5-6 times (about 10 seconds) being careful not to press the plunger that ejects the tip. 3. After taking the sample eject the swab tip into a labelled 2 ml microcentrifuge tube by firmly pressing the plunger at the end of the handle. 4. Complete and affix the sample tube label onto the microtube. The sample label requires the anonymised trial code for the subject. Storage of the respiragene test After sample collection tips can be kept at room temperature if they are posted immediately. If storage is necessary freeze the tubes containing the tips at -20°C. Packaging instructions for return of samples to Lab21 Ltd 1. Place absorbent material around the tube and then place tube in the plastic bag provided with the kit. Seal the plastic back as per the instructions on the bag 2. Place the plastic bag containing the sample tube into the shipping box. 3. Seal the box with the security seal supplied. 4. Using the Freepost service provided send the samples to: Lab 21 184 Cambridge Science Park Cambridge CB4 0GA. Patients will be asked to sign a disclaimer form that explains clearly that this test can only give an estimation of cancer risk and is a test that is still under development (one copy of form for investigators and one for patient). Interpretation of result of respiragene test Lung cancer susceptibility is calculated using the Respiragene test Auckland formula [7]: Lung cancer score?=?(number of susceptible genotypes) - (number of protective genotypes)?+?3 (for positive family history)?+?4 (for past history of COPD)?+?4 (for age?>?60 years old). The laboratory reports include the scores with an explanation of how the scores relate to a risk category (see ). When the subject is aged <60 years the report will also include the score and risk category that would apply if the subject is still a smoker at age 60 years or over. Follow-up questionnaires The questionnaires will be slightly different for groups A (questionnaire 2a) and B (questionnaire 2b) as only 2a will contain a direct reference to the gene-based test. Patients who fail to attend at eight weeks and six months will be contacted by telephone to remind them to complete their questionnaires and hand them in to the practice manager. They are designed to determine which subjects have quit smoking or cut down and which subjects who have failed to quit still plan to do so. There is a section that asks about general motivators and components of the smoking cessation programme. The subjects will be asked to score these motivators and smoking cessation aids for their efficacy in helping them to quit. The questions in this section are almost identical to a validated questionnaire [24]. There are also further questions on whether the subject would recommend the Respiragene test to a relative or friend and an open ended question for subjects to add their own comments about the concept of a test that predicts susceptibility to lung cancer in a smoker. Data quality assurance The study has been designed and will be reported in accordance with CONSORT (Consolidated Statement of Reporting Trials) [25]. Data will be controlled in accordance with data protection legislation institutional protocols of Sussex NHS Research Consortium and NHS policies for research and information governance for ensuring patient confidentiality [26]. Data will be analysed in SPSS (Statistical Package for Social Sciences) version 15 using an intention to treat approach. Outcome measures Primary endpoint Comparison of smoking cessation rates (7 day point abstinence and continuous abstinence) in Clinic A and Clinic B at 8 weeks and six months. Secondary endpoints A. Personal data: 1. Number of smokers still smoking who state that they still plan to stop. 2. Daily cigarette consumption of those still smoking. 3. Mean scores for ranking of smoking cessation aids (gene-based test - Clinic A only salivary cotinine lung cancer facts - controls in Clinic B only and general counselling from NHS smoking counsellors). B. Analyse questions about whether subjects would recommend the test to a member of family or a friend. C. Analyse last (open ended) question using qualitative research methodology. Statistics Primary end point The difference between smoking cessation between Clinic A and Clinic B will be estimated from the four week and six month follow up for the primary endpoint (smoking status confirmed by carbon monoxide breathalyser and salivary cotinine tests). If there is the expected higher rate of smoking cessation for Clinic A compared with Clinic B statistical significance will be demonstrated by the ?2 test. Since there are as yet no case-control studies that compare quit rate following the gene-based test versus quit rate without the test the expected difference in quit rate between Clinic A and Clinic B is difficult to estimate. Two case-control studies showing only a 5-10% increase in smoking cessation involved just a single gene of small effect [1112]. In a randomised control trial patients were given either a full explanation of the results of spirometry testing including an estimation of lung age or just the FEV1 without explanation (control group). The group of patients who were given the full explanation had a 7.2% higher quit rate than the control group. However data from Auckland suggest a larger uplift of quit rate with Respiragene. This can be explained by the superior predictive power of a 20-gene test combined with clinical history (personal history of COPD and family history of lung cancer) to give a rather more impressive estimate of cancer risk than anything previously available. The adequacy of sample size was tested using data from smoking cessation trials that showed: ¢30-40% smoking cessation at 6-months with similar protocols [2728]. ¢A 48% quit rate at 2-4 weeks in subjects with high and very high lung cancer risk scores but this difference shrinks to 27% at 6 months. ¢Data from Young et al [1518] (independently verified by McBride et al [11]) that even being given an average score for lung cancer susceptibility increases smoking cessation by approximately 10%. Therefore with a minimum sample sizes of 30 per group the following calculations based on these estimated quit rates apply (Table 2). Statistical power of 87.1% is generally acceptable for publication (for alpha error of 5% - i.e. 5% probability of incorrectly rejecting the null hypothesis that there is no difference in the percentage values). For further detailed statistical analysis refer to Additional file 1. Table 2 Summary of values from which the power of the study are estimated Control group expected quit rate as %ge Respiragene group expected quit rate as %ge ? 2 calculated from four-some table P value based on ? 2 Power calculations* 8 weeks Sample size 30/30* 70% 94% 5.9 <0.05 79.3% Sample size 60/60* 11.7 <0.01 96.9% 6 months Sample size 30/30** 35% 52% 1.7 NS 36.5% Sample size 60/60** 6.2 <0.05 87.1% *Telephone (alone) quit rate (see ) assumed to be 20%. **Telephone (alone) quit rate (see ) assumed to be 10-15%. Secondary outcome measures Similarly the significance of secondary endpoints on intention to stop smoking cigarette consumption uptake of invitation to cessation adherence to cessation course and self-reported smoking cessation will be calculated by the ?2 test but the p value for the ranking scores for information on lung cancer risk and other smoking cessation aids and motivators will be estimated from the unpaired student t-test. The open ended question: œHow do you feel now about having had a genetic test that estimates the probability that you will develop lung cancer at some future date? will have to be analysed by qualitative analysis to determine the main recurrent themes in responses. Discussion Overview Smoking cessation is one of the most cost effective interventions that can be achieved in primary care [29]. However many smokers are very reluctant to commit to a smoking cessation programme (precontemplative and contemplative) and about half of those that attend for smoking cessation intervention (action stage of change) are likely to drop out or give up trying. Therefore any methodology that increases motivation in both unmotivated and motivated smokers could be very valuable. The gene-based test we are offering has shown promise as a smoking cessation motivator in precontemplative-contemplative smokers in a hospital outpatient setting [1518] and now needs to be tested out as a motivator for improving adherence in a primary care smoking cessation clinic using a randomised controlled study. Strengths The main strengths of this study are that it is being carried out on subjects from a large primary care population and should therefore be more representative of the general population than previous studies recruited from hospital patients and other special groups. We also have the advantage of being able to carry out this research within the established framework of the local stop smoking service. Limitations and assumptions Although we have estimated based on previous smoking cessation work using this gene-based test that the primary endpoint will show that having the test improves quit rate by 20-25% this was based on a cohort of hospital outpatients in Auckland New Zealand and subjects recruited from primary care may respond differently. Although we plan to recruit a minimum of 60 subjects this may not be enough to balance unexpected and unknown confounding factors. What we might find We aim to recruit a minimum of 60 subjects to randomise 30 into group A (test group) and 30 into Group B (control group). The normal experience in NHS smoking cessation clinics is a drop-out rate of 40-50% [30-32]. We need therefore to attempt to recruit about 120 subjects in order to get a statistically significant result based on the assumptions in our power calculations. We may however have underestimated the 6-month quit rate using the NHS local stop smoking guidelines [22] which typically involves a multi-interventional programme which includes combinations of varenicline prescriptions breath carbon monoxide monitoring and intensive counselling giving a quit rate of 70-80% at 6-weeks.There are however no Surrey data for 6-month quit rate which we assume on the basis of similar smoking cessation data to be about half the 6-week figure [33] ? 35%. An unknown and unpredictable factor that could skew results significantly is the possibility that our multi-interventional approach could help to reinforce the health risk message equally for subjects in both groups. Also the Auckland study design involved recruitment of precontemplative-contemplative smokers from a hospital outpatient setting compared to this study that will involve primary care subjects who have volunteered to participate in a smoking cessation programme (ie smokers in the action stage of quitting). This population therefore could be sufficiently different to give unexpected results. However the results of this trial will inform as to the acceptability of this approach as well as its effectiveness. Abbreviations CONSORT: Consolidated statement of reporting trials; COPD: Chronic obstructive pulmonary disease; DNA: Deoxyribonucleic acid; NHS: National health service UK; SNP: Single nucleotide polymorphism; SAE: Stamped addresses envelope. Competing interests JN and PG are in receipt of research grants from Lab 21 Cambridge who are marketing the Respiragene test in the UK and Synergenz Bioscience Ltd. who financed the development of the test from its origins in New Zealand. We initially purchased SmokeScreen kits (for salivary cotinine estimation) from GFC Diagnostics Ltd. But they subsequently supplied 30 kits free of charge. Authors™ contributions JN and PG developed the idea of a control trial of the Respiragene test after discussions with Aino Telaranta-Keerie of Lab 21 Cambridge. WK was involved in helping to write the protocol and her experience in running smoking cessation clinics was very helpful. PW was our statistical adviser and SdeL helped us to write the protocol in accordance with CONSORT principles and in development of trial methodology. All authors read and approved the final manuscript. Authors™ information PG is a Visiting Professor of Primary Care at The University of Surrey. SdeL is Professor of Health Care and Clinical Informatics at The University of Surrey. JN is a primary care physician and visiting research fellow at The University of Surrey. WK is a visiting research fellow at The University of Surrey and an experienced smoking cessation nurse. PW is a Statistics Consultant in the Department of Mathematics at The University of Surrey. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2466/14/77/prepub Supplementary Material Additional file 1 Detailed statistical analysis. Click here for file Acknowledgements We are grateful for the help of Aino Telaranta-Keerie and the staff of Lab 21 for their support and for carrying out the Respiragene tests. We are also indebted to Kevin Murphy of Synergenz for his encouragement and support. Professor Robert Young and his team of Auckland New Zealand developed the Respiragene test and the risk score formula. His advice and guidance has been invaluable. Wetterstrand KA DNA Sequencing Costs Data from the NHGRI Large-Scale Genome Sequencing Program http://en.wikipedia.org/wiki/Personal_genomics#cite_note-18 Smerecnik C Grispen JEJ Quaak M Effectiveness of testing for genetic susceptibility to smoking-related diseases on smoking cessation outcomes: a systematic review and meta-analysis Tob Control 2012 21 3 347 354 10.1136/tc.2011.042739 21948804 Smith SM Campbell MC Macleod U Factors contributing to the time taken to consult with symptoms of lung cancer: a cross sectional study Thorax 2009 64 1953 531 Sanderson SC O™Neill SC White DB Bepler G Bastian L Lipkus IM McBride CM Responses to online GSTM1 genetic test results among smokers related to patients with lung cancer: a pilot study Cancer Epidemiol Biomarkers Prev 2009 18 7 1953 1961 10.1158/1055-9965.EPI-08-0620 19567511 Young RP Hopkins R Black PN Eddy C Wu L Gamble GD Mills GD Garrett JE Eaton TE Rees MI Functional variants of antioxidant genes in smokers with COPD and in those with normal lung function Thorax 2006 61 5 394 399 10.1136/thx.2005.048512 16467073 Young RP Hopkins RJ Christmas T Black PN Metcalf P Gamble GD COPD prevalence is increased in lung cancer independent of age sex and smoking history Eur Respir J 2009 34 2 380 386 10.1183/09031936.00144208 19196816 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD Lung cancer susceptibility model based on age family history and genetic variants PLoS ONE [Electronic Resource] 2009 4 4 e5302 10.1371/journal.pone.0005302 Young RP Hopkins RJ Hay BA Gamble GD GWAS And Candidate SNPs For COPD And Lung Cancer Combine To Identify Lung Cancer Susceptibility: Validation In A Prospective Study Am J Respir Crit Care Med 2010 181 A3738 Young RP Hopkins RJ Hay BA Epton MJ Mills GD Black PN Gardner HD Sullivan R Gamble GD A gene-based risk score for lung cancer susceptibility in smokers and ex-smokers Postgrad Med J 2009 85 515 524 10.1136/pgmj.2008.077107 19789190 Young RP Hopkins RJ Hay BA Epton MJ Black PN Gamble GD Lung cancer gene associated with COPD: triple whammy or possible confounding effect? Eur Respir J 2008 32 5 1158 1164 10.1183/09031936.00093908 18978134 McBride CM Bepler G Lipkus IM Lyna P Samsa G Albright J Datta S Rimer BK Incorporating genetic susceptibility feedback into a smoking cessation program for African-American smokers with low income Cancer Epidemiol Biomarkers Prev 2002 11 6 521 528 12050092 Sanderson SC Humphries SE Hubbart C Hughes E Jarvis MJ Wardle J Psychological and Behavioural Impact of Genetic Testing Smokers for Lung Cancer Risk: A Phase II Exploratory Trial J Health Psychol 2008 13 481 494 10.1177/1359105308088519 18420756 Wells S de Lusignan S Does screening for loss of lung function help smokers give up? Br J Nurs 2003 12 12 744 750 12829957 Parkes G Greenhalgh T Griffin M Dent R Effect on smoking quit rate of telling patients their lung age: The Step2quit randomised control trial BMJ 2008 336 598 600 10.1136/bmj.39503.582396.25 18326503 Hopkins RJ Young RP Hay B Gamble GD Lung cancer risk testing enhances NRT uptake and quit rates in randomly recruited smokers offered a gene based risk test Am J Respir Crit Care Med 2012 185 A2590 Hopkins RJ Young RP Hay B Gamble GD Gene-based lung cancer risk score triggers smoking cessation in randomly recruited smokers Am J Respir Crit Care Med 2011 183 A5441 West R Shiffman S McLean D Fast Facts: Smoking Cessation (Fast Facts series) “ Paperback 2007 London: Health Press Young RP Hopkins RJ Smith M Hogarth DK Smoking cessation: the potential role of risk assessment tools as motivational triggers [Review] Postgrad Med J 2010 86 1011 26 33 10.1136/pgmj.2009.084947 20065338 Cabebe E Recruitment details"
Lung_Cancer
"Testing bal. acc. (%) P value Cross-validation consistency rs Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG "
Lung_Cancer
"Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although the current estimates were derived from just one study which is also the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search we believe that the analysis of our study based on a current Chinese phase III trial and the justifiable extrapolation approach can provide important reference information for decision makers in China. First of all the clinical study itself is a multicentre double-blind randomized controlled-trial (RCT) which represents the best evidence available and is deemed to be the most accepted scientific method of determining the benefit of a drug or a therapeutic procedure. Second the analysis method applied in our study was reliable and widely used in economic evaluations especially in the field of medical and health care. In addition the Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial satisfactorily () which shows that the model we constructed can mirror the effectiveness data of the trial commendably. And then direct medical costs related to each strategy were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Although the costs originated from our previous study [26] the published literature [27] or estimates according to local charges based on expert opinion all of them stemmed from a Chinese health care system perspective as well as in view of patients with advanced NSCLC which echoed the purpose of the current study. Last but not least to reflect substantial uncertainty of the input parameters the sensitivity analyses (including OSA and PSA) were conducted for each key parameter and all sensitivity analyses revealed that the model we applied was robust to the results. In according to the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from WHO maintenance gefitinib therapy after the standard chemotherapy of four chemotherapeutic cycles in locally advanced/metastatic NSCLC patients with unknown EGFR mutations is likely to be not cost-effective for Chinese mainland from the Chinese health care system perspective. Local governments with different economic level however could take fully into account covering maintenance gefitinib treatment. Because for rich regions (the per-capita GDP> $8767) the new strategy seems to be a reasonable option and if the per-capita GDP ranges from $5900 to $8767 the maintenance therapy may be favourable in terms of the different cost-effective probabilities. Decreasing the price of gefitinib the most significant parameter that could reduce the ICER should be considered to as a preferential factor for meeting widely treatment demands in China. Prof. L.B. Peng and J.H. Li are the guarantors for the overall content. The authors greatly thank many clinicians and the data managers who have recorded the initial data diligently of medicines over the years. In particular they thank Ouyang Lihui Wang Siying Zhao Ziying and Qiu Zhenhua for their help in the data collection and valuable discussions and advices. References 1 JemalA BrayF (2011) Center MM Ferlay J Ward E et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 2 FathiAT BrahmerJR (2008) Chemotherapy for advanced stage non-small cell lung cancer. Semin Thorac Cardiovasc Surg20: 210“21619038730 3 GovindanR PageN MenszternD ReadW TierneyR et al (2006) Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance epidemiologic and end results database. J Clin Oncol24: 4539“454417008692 4 Nation Comprehensive Cancer Network (2013) Non“small cell lung cancer (version 2.2014). Available: http://www.nccn./professionals/physician_gls/pdf/nscl.pdf Accessed 21 January 2014. 5 AzzoliCG BakerJS TeminS PaoW AliffT et al (2009) American Society of Clinical Oncology Clinical Practice Guideline update on chemotherapy for stage IV non-small-cell lung cancer. "
Lung_Cancer
"We developed a novel immunotherapeutic agent that links a single-chain antibody variable fragment (scFv) targeting mesothelin (MSLN) which is overexpressed on ovarian cancer and mesothelioma cells to Mycobacterium tuberculosis (MTB) heat shock protein 70 (Hsp70) which is a potent immune activator that stimulates monocytes and DCs enhances DC aggregation and maturation and improves cross-priming of T cells mediated by DCs. Methods Binding of this fusion protein with MSLN on the surface of tumor cells was measured by flow cytometry and fluorescence microscopy. The therapeutic efficacy of this fusion protein was evaluated in syngeneic and orthotopic mouse models of papillary ovarian cancer and malignant mesothelioma. Mice received 4 intraperitoneal (i.p.) treatments with experimental or control proteins post i.p. injection of tumor cells. Ascites-free and overall survival time was measured. For the investigation of anti-tumor T-cell responses a time-matched study was performed. Splenocytes were stimulated with peptides and IFN?- or Granzyme B- generating CD3+CD8+ T cells were detected by flow cytometry. To examine the role of CD8+ T cells in the antitumor effect we performed in vivo CD8+ cell depletion. We further determined if the fusion protein increases DC maturation and improves antigen presentation as well as cross-presentation by DCs. Results We demonstrated in vitro that the scFvMTBHsp70 fusion protein bound to the tumor cells used in this study through the interaction of scFv with MSLN on the surface of these cells and induced maturation of bone marrow-derived DCs. Use of this bifunctional fusion protein in both mouse models significantly enhanced survival and slowed tumor growth while augmenting tumor-specific CD8+ T-cell dependent immune responses. We also demonstrated in vitro and in vivo that the fusion protein enhanced antigen presentation and cross-presentation by targeting tumor antigens towards DCs. Conclusions This new cancer immunotherapy has the potential to be cost-effective and broadly applicable to tumors that overexpress mesothelin. Mycobacterial Hsp70 Mesothelin Single chain variable fragment Cancer immunotherapy Murine tumor model Background The goal of cancer immunotherapy is to stimulate the immune system to destroy cancer cells. Numerous strategies that involve tumor antigen-specific and non-specific activation of the immune system have been developed. These include dendritic cell (DC) vaccines adoptive T-cell therapy and immune checkpoint blockade [1-3]. Antigen-specific active immunotherapy is expected to be the most attractive strategy because of its capacity to induce both therapeutic and protective T-cell immunity. Among various approaches DC vaccine is considered to be a promising treatment for advanced cancer based on the ability of DCs to orchestrate all of the elements of the immune system. DCs capture tumor antigens process these antigens into peptides as they move to the draining secondary lymphoid ans and present the peptides to na¯ve T cells thus inducing anti-tumor cellular immune responses. DCs can also activate B cells NK cells and NKT cells [1]. In pre-clinical and clinical studies that exploited DCs as a means to improve vaccine efficiency autologous DCs are loaded ex vivo with antigens and re-administered to the patient. For example Sipuleucel-T (Provenge) that consists of ex vivo activated autologous peripheral blood mononuclear cells (PBMCs) including antigen-presenting cells (APCs) has resulted in a significant survival benefit in Phase III trials for prostate cancer [4]. However the production and administration of these tailor-made DC vaccines are costly and labor-intensive [5]. As a next-step in the development of DC vaccines we designed a recombinant protein that contains a Mycobacterium tuberculosis heat shock protein 70 (MTBHsp70) fused to a single chain variable fragment (scFv) derived from human B cells that targets mesothelin. Mesothelin (MSLN) is a validated immunotherapy target that is highly overexpressed on the surface of common epithelial cancers including ovarian cancers epithelial malignant mesotheliomas ductal pancreatic adenocarcinomas and lung adenocarcinomas while expressed at relatively low levels only in mesothelial cells lining the pleura pericardium and peritoneum in healthy individuals [6-9]. Several therapeutic agents targeting MSLN are evaluated in preclinical and clinical studies such as the recombinant immunotoxin SS1P [9-11]. In our fusion protein the anti-MSLN scFv moiety was originally isolated from a yeast-display human scFv library [12] and demonstrated the ability to recognize both membrane-bound and soluble MSLNs and inhibit CA125/MSLN-dependent cell adhesion [13-15]. The recombinant MTBHsp70 protein provides immunostimulatory functions including the activation of monocytes and DCs to produce CC-chemokines that attract antigen processing and presenting DCs macrophages and effector T and B cells enhanced DC aggregation and maturation [1617] induction of the cytotoxic activity of natural killer cells [18] and improved cross-priming of T cells which is dependent on DCs [19]. The capabilities of MTBHsp70 as a potent immune adjuvant have been well characterized in cancer models including murine models of melanoma and lymphoma [1820-24]. While in these studies proteins or peptides fused with Hsp70 used for immunizations in mice were shown to generate humoral or cellular immune responses we expect that fusion of anti-MSLN scFv and MTBHsp70 takes advantage of the immune-activating action of MTBHsp70 and the tumor-targeting activity of the scFv which will yield anti-tumor responses against the broadest profile of tumor antigens. We evaluated the therapeutic efficacy of this MSLN-targeted fusion protein in syngeneic mouse models of ovarian cancer and mesothelioma and examined its mechanism of action in in vitro and in vivo cross-presentation assay systems. These studies demonstrate that this bifunctional fusion protein significantly enhances survival and slows tumor growth through the augmentation of tumor-specific cell-mediated immune responses. Results Expression of scFvMTBHsp70 fusion protein and MTBHsp70 The structure of scFvMTBHsp70 is shown in Figure 1A. VH and VL from anti-MSLN P4 scFv [13] are linked using a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker in between. As shown in Figure 1B only one protein band was observed with a molecular weight of approximately 100 kDa for scFvMTBHsp70 and one protein band with a molecular weight of 70 kDa for MTBHsp70 which match the expected molecular weights of these specific proteins. Endotoxin contamination levels in scFvMTBHsp70 and MTBHsp70 were found to be very low at less than 50 EU per mg of protein. Structure and analysis of scFvMTBHsp70 fusion protein. A anti-MSLN VH and VL are linked with a (G4S)3 linker and fused to full length MTBHsp70 with a (G4S)3 linker. B RAPIDstain based on Coomassie dye following purification and hIgG-Fc tag removal of MTBHsp70 and scFvMTBHsp70. C BR5FVB1 ovarian cancer cells and 40L mesothelioma cells were incubated with 40 ?g/ml scFvMTBHsp70 or 26 ?g/ml MTBHsp70 (blue line) or without either protein (solid) followed by anti-MTBHsp70 (IgG2a) biotinylated anti-IgG2a and Streptavidin-APC and then analyzed by flow cytometry. To confirm that the scFv portion of the fusion protein binds to MSLN on the surface of tumor cells scFvMTBHsp70 or MTBHsp70 was preincubated with 12 ?g/ml recombinant human MSLN for 30 min (red line) before being added to the cells. Data are representative of three independent experiments in duplicate tubes. D Median fluorescence intensity (MFI) values of cells stained with scFvMTBHsp70 or MTBHsp70 normalized to cells stained without either protein. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01;ns non-significant. E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Thick line with incubation of scFvMTBHsp70; solid without incubation of scFvMTBHsp70. Data are representative of three independent experiments. scFvMTBHsp70 binds to BR5FVB1 ovarian cancer cells and 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells Binding of scFvMTBHsp70 or MTBHsp70 to BR5FVB1 ovarian cancer cells or 40L mesothelioma cells as determined by flow cytometry is shown in Figure 1C and D. Binding of scFvMTBHsp70 to MSLN-expressing tumor cells was almost completely inhibited by preincubation of scFvMTBHsp70 with recombinant human MSLN. Although MTBHsp70 also binds to these MSLN-expressing tumor cells the level of binding is not significantly different from background (p?=?0.187 for BR5FVB1 cells and p?=?0.086 for 40L cells). Furthermore the binding of MTBHsp70 to cancer cells cannot be blocked by recombinant MSLN. These data support the view that binding of scFvMTBHsp70 to these tumor cells occurred via the interaction of the scFv portion of the fusion protein with MSLN on the surface of tumor cells. Binding of these proteins with 40L mesothelioma cells was further compared using fluorescence microscopy. scFvMTBHsp70 shows significantly stronger binding intensity as compared to MTBHsp70 (Additional file 1: Figure S1A and B). In order to determine if scFvMTBHsp70 also binds to normal tissue in addition to tumor cells we incubated the fusion protein with peripheral blood leukocytes (PBLs) splenocytes or peritoneal mesothelial cells from healthy FVB/NJ mice and stained the cells using the same method as was used for staining tumor cells. As shown in Figure 1E scFvMTBHsp70 binds with peritoneal mesothelial cells at a low level compared to ovarian cancer and mesothelioma cells. Binding of the fusion protein is at very low or undetectable levels on PBLs and splenocytes. Since scFvMTBHsp70 may potentially target peritoneal mesothelial cells we also explored whether it could induce inflammation in peritoneal mesothelial tissues. We injected na¯ve mice with saline scFvMTBHsp70 or MTBHsp70 plus P4 scFv at the same doses as those used for tumor therapy described in Method sacrificed the mice 7 days post final treatments and examined haematoxylin and eosin (H&E) stained sections prepared from abdominal and intestinal peritoneum. Light microscopic examination revealed no evidence of inflammation and no infiltration of inflammatory cells such as macrophages or granulocytic cells around the mesothelial cells lining the abdominal and intestinal peritoneum of the actively treated or control animals. Representative microscopic images are shown in Additional file 2: Figure S2. scFvMTBHsp70 significantly prolongs ascites-free survival and overall survival in ovarian cancer- or mesothelioma-bearing mice To determine whether scFvMTBHsp70 can prolong survival in tumor-bearing mice we first evaluated the protein in a syngeneic mouse model of papillary ovarian cancer using immune-competent FVB/NJ mice. As shown in Figure 2A scFvMTBHsp70 prolonged both ascites-free and overall survival time compared with saline or the equimolar mixture of MTBHsp70 plus P4 scFv. To further support the efficacy of this fusion protein in prolonging survival in MSLN-expressing tumor-bearing mice we evaluated this protein in a second syngeneic mouse model of mesothelioma using immune-competent C57BL/6 mice. Animals treated with scFvMTBHsp70 showed significantly prolonged ascites-free and overall survival time compared with saline- or MTBHsp70 plus P4 scFv- treated mice (Figure 2B). Figure 2 A and B Kaplan-Meier survival curves of tumor-bearing mice following treatment with scFvMTBHsp70 control proteins or normal saline. A In a syngeneic mouse model of papillary ovarian cancer in immune-competent FVB/NJ mice scFvMTBHsp70 prolonged ascites-free survival time compared with saline (n?=?10 per group representative of two independent experiments; median survival (Med. sur.)?=?47 days vs. 37.5 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 39 days). scFvMTBHsp70 also prolonged overall survival time in the mice compared with saline (Med. sur. = 51.5 days vs. 43 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 43 days). B In a syngeneic mouse model of mesothelioma in immune-competent C57BL/6 mice the fusion protein prolonged ascites-free survival time compared with saline-treated mice (n?=?20 per group pooled from two independent experiments; Med. sur. = 28 days vs. 26 days) or the mixture of MTBHsp70 plus P4 scFv (Med. sur. = 27 days). The fusion protein also prolonged overall survival time compared with saline (Med. sur. = 36 days vs. 31 days). P values were determined using the log-rank test. *p?<?0.05; **p?<?0.01; ***p?<?0.001. scFvMTBHsp70 enhances anti-tumor CD8+ T-cell responses in ovarian tumor-bearing mice To investigate whether the anti-tumor effects of scFvMTBHsp70 was associated with anti-tumor effector CD8+ T-cell responses we re-stimulated splenocytes from ovarian tumor-bearing FVB mice that received different treatments with the CD8+ T-cell Her2/neu epitope or MSLN Ld1 as a negative control ex vivo and analyzed the cells for production of IFN? and Granzyme B using flow cytometry. We previously showed that Her2/neu is expressed by BR5FVB1 cells [25]. Ld1 is an in-house designed H2d-restricted MSLN peptide that did not induce ovarian cancer specific T-cell response in H-2q FVB mice. We demonstrated significantly greater anti-Her2/neu CD8+ T-cell responses in splenocytes from scFvMTBHsp70-treated mice compared to mice treated with saline or a simple mixture of MTBHsp70 plus P4 scFv as measured by IFN? and Granzyme B production by CD8+ T cells (Figure 3A and B). This indicates that scFvMTBHsp70 enhances anti-tumor specific CD8+ T-cell responses in ovarian tumor-bearing mice. However no significant difference was seen in the number of tumor-infiltrating CD8+ T cells and no tumor-infiltrating Foxp3+ T cells were seen in tumors from mice in different treatment groups indicating that scFvMTBHsp70 may improve effector cell function rather than the number of intratumoral CD8+ T cells (Additional file 3: Figure S3A and B). Figure 3 Anti-tumor specific CD8+ T-cell functions in tumor-bearing mice following different treatments. A Splenocytes harvested from mice treated with scFvMTBHsp70 fusion protein equimolar mixture of MTBHsp70 plus P4 scFv or saline (n = 10 per group) were re-stimulated with Her2/neu peptide or MSLN Ld1 peptide. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. B Representative flow data are presented. C In vivo CD8+ T-cell depletion study. FVB/NJ mice were injected i.p. with anti-CD8 mAb or an isotype-matched irrelevant rat IgG2a and were treated with scFvMTBHsp70 or saline as described in the methods. CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70 treated BR5FVB1 tumor-bearing animals compared to non depleted actively treated (n = 10 per group representative of two independent experiments; Med. sur. = 32.5 days vs. 48 days) animals. After CD8+ T cells depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared with saline (Med. sur. = 32.5 days vs. 31.5 days; p = 0.5938). P values were determined using log-rank test. *p< 0.05; **p < 0.01 ***p < 0.001. scFvMTBHsp70 is able to prime an adaptive tumor-specific immune response that has an absolute requirement for tumor-specific CD8+ T cells To determine whether CD8+ T cells play a major role in the protective anti-tumor effects observed in mice treated with scFvMTBHsp70 we conducted in vivo CD8+ T-cell depletion experiments using monoclonal antibodies. The absence of circulating CD8+ cells in peripheral blood following depletion was confirmed by flow cytometry (Additional file 4: Figure S4A and B). As shown in Figure 3C CD8+ T-cell depletion significantly and negatively impacted ascites-free survival in the scFvMTBHsp70-treated BR5FVB1 tumor-bearing animals compared to non-depleted actively-treated animals. Following CD8+ T-cell depletion scFvMTBHsp70 treatment did not delay onset of disease (clinically evident ascites) compared to saline treatment. Therefore our data suggest that the priming of an adaptive tumor-specific immune response by scFvMTBHsp70 treatment is chiefly mediated by tumor-specific CD8+ T cells. scFvMTBHsp70 stimulates maturation of murine bone marrow-derived dendritic cells In order to investigate immunological mechanisms involved in the scFvMTBHsp70-enhanced anti-tumor immune response we first examined if the scFvMTBHsp70 or MTBHsp70 proteins used in our study could stimulate maturation of bone marrow-derived dendritic cells (BMDCs) as shown in previous studies [1617]. We stimulated CD11c+ BMDCs with 2 ?g/ml of scFvMTBHsp70 or an equimolar amount of MTBHsp70 (1.3 ?g/ml). 1 ?g/ml lipopolysaccharide (LPS) was used as positive control. To determine whether the BMDC maturation was attributable to LPS contamination of the recombinant proteins used in this study we also incubated BMDCs with 0.1 ng/ml LPS which was the equivalent amount of endotoxin found in 2 ?g/ml scFvMTBHsp70. After a 24 h-incubation both scFvMTBHsp70 and MTBHsp70 induced DC maturation indicated by an increase in the expression of CD40 CD80 CD86 and MHC class II molecules in comparison to the control cultures in medium. The increased expression of these DC maturation markers were comparable to those on cells stimulated with 1 ?g/ml LPS. The contamination control showed that addition of 0.1 ng/ml LPS did not replicate the effects of scFvMTBHsp70 or MTBHsp70 allowing us to discriminate the scFvMTBHsp70- or MTBHsp70-specific effects from effects of LPS (Figure 4A and B). Figure 4 scFvMTBHsp70 induces DC maturation and promotes antigen presentation and cross-presentation. A CD11c+ BMDCs isolated form FVB/NJ mice were incubated for 24 h with 2 ?g/ml scFvMTBHsp70 1.3 ?g/ml MTBHsp70 1 ?g/ml LPS as positive control or 0.1 ng/ml LPS as contamination control (thick lines) or medium only (solid) stained for CD11c CD40 CD80 CD86 and MHC II and analyzed by flow cytometry. Histograms were gated on CD11c+ DCs. Data are representative of three independent experiments in duplicate wells. B Median fluorescence intensity (MFI) of LPS- or protein-stimulated BMDCs normalized to MFI of BMDCs maintained in medium. Data are expressed as means?±?SEM in arbitrary units. P values were determined using One-Way ANOVA followed by Dunnett™s multiple comparison tests. C BMDCs cultured from FVB/NJ mice were pulsed with BR5FVB1 cells alone (Column a) or BR5FVB1 cells pre-complexed with MTBHsp70 (Column b) or scFvMTBHsp70 (Column c) and then incubated with BR5FVB1 tumor cell-primed T cells. Intracellular granzyme B and IFN? expressions in CD3+CD4+ and CD3+CD8+ T cells were analyzed by flow cytometry. Data from three independent experiments in duplicate wells are pooled and analyzed using One-Way ANOVA followed by Turkey™s multiple comparison tests. Data are presented as mean?±?SEM. D Representative flow data are presented. E scFvMTBHsp70 enhanced tumor cell immunogenicity in vivo. Results are reported as the difference between nonstimulated (media alone) and stimulated cells and expressed as the frequency of parent CD3+CD4+ or CD3+CD8+ cells. P values were determined using One-Way ANOVA followed by Turkey™s multiple comparison tests. *p?<?0.05; **p?<?0.01; ***p?<?0.001; ****p?<?0.0001. The scFvMTBHsp70 fusion protein increases tumor antigen presentation and cross-presentation by DC in vitro In the current study we demonstrated that splenic CD8+ T cells from scFvMTBHsp70-treated tumor-bearing mice could produce cytokines upon specific tumor antigen stimulation ex vivo which was associated with their antitumor therapeutic efficacy in vivo. To determine whether scFvMTBHsp70 promotes tumor specific T-cell responses by enhancing antigen presentation and cross-presentation by antigen presenting cells we co-cultured BR5FVB1 tumor cell-primed T cells with DCs that had been pulsed with BR5FVB1 tumor cells in the presence of scFv-MTBHsp70 MTBHsp70 or PBS. The scFvMTBHsp70/tumor cell-pulsed DCs induced significantly higher production of IFN-? and Granzyme B from both CD4+ and CD8+ tumor cell-primed T cells as compared with MTBHsp70 or PBS indicating that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs (Figure 4C and D). scFvMTBHsp70 enhances tumor cell immunogenicity in vivo Having demonstrated in vitro that scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs we next explored whether scFvMTBHsp70 enhances tumor antigen presentation and cross-presentation by DCs and consequently enhances tumor cell immunogenicity in vivo. It has been demonstrated that the high density of DCs at dermal sites facilitates the capture of tumor antigens and that local inflammation induces DC maturation and migration into draining lymph nodes where they present antigens to na¯ve T cells generating a tumor specific immune response [26]. We primed FVB mice with an intradermal (i.d.) injection of mitomycin C-treated BR5FVB1 tumor cells followed by a booster i.d. injection of BR5FVB1 tumor cells with or without scFvMTBHsp70 or MTBhsp70. After 20 days we dissociated skin-draining lymph nodes and re-stimulated lymph node lymphocytes with Her2/neu peptides mitomycin C-treated BR5FVB1 tumor cells or BR5FVB1 tumor cell lysate and performed flow cytometric analysis for the presence of Granzyme B-generating CD4+ and CD8+ T cells. As shown in Figure 4E we demonstrated that Granzyme B-generating CD4+ and CD8+ T cells were significantly enhanced in mice that were immunized with scFv-MTBHsp70-bound tumor cells as compared to those in the mice immunized with tumor cells alone MTBHsp70-bound tumor cells or saline. Discussion We have developed a novel protein-based immunotherapy consisting of a fusion of an anti-MSLN scFv of human origin and recombinant mycobacterial heat shock protein 70 that has the ability to adjuvant significant T-cell responses against specific tumor antigens. P4 scFv directed against MSLN a surface antigen overexpressed on several types of tumor cells is used as a means of targeting the immunotherapeutic agent. We have demonstrated that this bifunctional fusion protein effectively binds BR5FVB1 ovarian cancer cells or 40L mesothelioma cells through the interaction of scFv with MSLN on the surface of tumor cells. We found that the fusion protein significantly prolonged survival time in syngeneic mouse models of papillary ovarian cancer and malignant mesothelioma. Treatment with the fusion protein induced significant tumor-specific CD8+ T-cell immune responses in the splenocytes of ovarian tumor-bearing mice. Furthermore in vivo CD8+ T-cell depletion studies demonstrated that this protective antitumor effect is mainly mediated by tumor-specific CD8+ T cells."
Lung_Cancer
"Number of female samples with mutations (Mutation frequency in 36 female samples) Number of male samples with mutations (Mutation frequency in 40 male samples) ABL1 0(0.0%) 0(0.0%) 0(0.0%) AKT1 0(0.0%) 0(0.0%) 0(0.0%) ALK 0(0.0%) 0(0.0%) 0(0.0%) APC 0(0.0%) 0(0.0%) 0(0.0%) ATM 0(0.0%) 0(0.0%) 0(0.0%) BRAF 2(2.6%) 1(2.8%) 1(2.5%) CDH1 0(0.0%) 0(0.0%) 0(0.0%) CDKN2A 0(0.0%) 0(0.0%) 0(0.0%) CSF1R 0(0.0%) 0(0.0%) 0(0.0%) CTNNB1 3(3.9%) 3(8.3%) 0(0.0%) EGFR 32(42.1%) 22(61.1%) 10(25.0%) ERBB2 1(1.3%) 0(0.0%) 1(2.5%) ERBB4 0(0.0%) 0(0.0%) 0(0.0%) FBXW7 0(0.0%) 0(0.0%) 0(0.0%) FGFR1 0(0.0%) 0(0.0%) 0(0.0%) FGFR2 0(0.0%) 0(0.0%) 0(0.0%) FGFR3 0(0.0%) 0(0.0%) 0(0.0%) FLT3 0(0.0%) 0(0.0%) 0(0.0%) GNAS 0(0.0%) 0(0.0%) 0(0.0%) HNF1A 0(0.0%) 0(0.0%) 0(0.0%) HRAS 0(0.0%) 0(0.0%) 0(0.0%) IDH1 0(0.0%) 0(0.0%) 0(0.0%) JAK3 0(0.0%) 0(0.0%) 0(0.0%) KDR 0(0.0%) 0(0.0%) 0(0.0%) KIT 0(0.0%) 0(0.0%) 0(0.0%) KRAS 4(5.3%) 1(2.8%) 3(7.5%) MET 0(0.0%) 0(0.0%) 0(0.0%) MLH1 0(0.0%) 0(0.0%) 0(0.0%) MPL 0(0.0%) 0(0.0%) 0(0.0%) NOTCH1 0(0.0%) 0(0.0%) 0(0.0%) NPM1 0(0.0%) 0(0.0%) 0(0.0%) NRAS 0(0.0%) 0(0.0%) 0(0.0%) PDGFRA 0(0.0%) 0(0.0%) 0(0.0%) PIK3CA 2(2.6%) 0(0.0%) 2(5.0%) PTEN 1(1.3%) 1(2.8%) 0(0.0%) PTPN11 0(0.0%) 0(0.0%) 0(0.0%) RB1 0(0.0%) 0(0.0%) 0(0.0%) RET 0(0.0%) 0(0.0%) 0(0.0%) SMAD4 1(1.3%) 1(2.8%) 0(0.0%) SMARCB1 0(0.0%) 0(0.0%) 0(0.0%) SMO 0(0.0%) 0(0.0%) 0(0.0%) SRC 0(0.0%) 0(0.0%) 0(0.0%) STK11 0(0.0%) 0(0.0%) 0(0.0%) TP53 17(22.4%) 6(16.7%) 11(27.5%) VHL 0(0.0%) 0(0.0%) 0(0.0%) The sequenced data were processed and mutations identified using Ion Torrent Suite Software v3.0 with a plug-in œvariant caller. In order to eliminate error base calling three filtering steps were used to generate reliable variant calling as described in the Materials and Methods. The Sequence read distribution across 189 amplicons generated from 76 FFPE specimens were normalized to 300000 reads per sample (Fig. 1). Using a strict standard variant calling we identified mutations in the following genes as listed in : BRAF EGFR ERBB2 KRAS PIK3CA PTEN SMAD4 and TP53. .0095228.g001 Sequence read distribution across 189 amplicons generated from 76 FFPE specimens normalized to 300000 reads per sample. A. Distribution of average coverage of each amplicon. Data are showed as mean ±SD. B. Number of amplicons with a given read depth sorted in bins of 100 reads. (blue bars present number of target amplicons within read depth red line presents % of target amplicons >?=? read depth). The samples were classified based on their origin as lung adenocarcinoma lung large cell carcinoma lung squamous cell carcinoma and lung neuroendocrine carcinoma. The different stages the cancers have progressed to were scored based on ˜American Joint Committee on Cancer/Tumor size Lymph Nodes affected Metastases (AJCC/TNM) ' system (Ia Ib IIa IIb IIIa IIIb) and as metastasizing and non-metastasizing lung cancers. Also cancers were sorted out as from heavy smokers light-smokers and non-smokers to check the correlation of smoking with the accumulation of these mutations. The detailed list of missense point mutations insertions and deletions profiled on 737 loci of 76 lung cancer samples is provided in Table S1. Out of the mutations identified in our sample set BRAF (2.6%) EGFR (42.1%) ERBB2 (1.3%) KRAS (5.3%) PIK3CA (2.6%) PTEN (1.3%) SMAD4 (1.3%) and TP53 (22.4%) incurred the highest rates of mutations (). The mutation frequencies at their different differentiation levels () at different AJCC staging () of the metastatic and non-metastatic lung cancers () and from patients with different smoking habits () are outlined in the Tables. Detailed sequencing analysis in the exons and functional domains of these genes was hence performed. .0095228.t002 Mutations (including Missense point mutations/deletion/insertion) frequencies in 45 genes (737 loci) in lung adenocarcinoma (AC) lung large cell carcinoma lung squamous cell carcinoma and other two lung cancer samples (lung neuroendocrine carcinoma and unknown lung cancer). Genes Number of samples with mutations in 76 samples (Mutation frequency) Number of AC samples with mutations (Mutation frequency in 52 AC samples) Number of SC samples with mutations (Mutation frequency in 20 SC samples) Number of LCC samples with mutations (Mutation frequency in 2 LCC samples) Number of other samples with mutations (Mutation frequency in 2 other samples) ABL1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) AKT1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) ALK 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) APC 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) ATM 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) BRAF 2(2.6%) 1(1.9%) 1(5.0%) 0(0.0%) 0(0.0%) CDH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CDKN2A 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CSF1R 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) CTNNB1 3(3.9%) 3(5.8%) 0(0.0%) 0(0.0%) 0(0.0%) EGFR 32(42.1%) 30(57.7%) 1(5.0%) 0(0.0%) 1(50.0%) ERBB2 1(1.3%) 1(1.9%) 0(0.0%) 0(0.0%) 0(0.0%) ERBB4 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FBXW7 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR2 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FGFR3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) FLT3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) GNAS 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) HNF1A 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) HRAS 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) IDH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) JAK3 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KDR 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KIT 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) KRAS 4(5.3%) 4(7.7%) 0(0.0%) 0(0.0%) 0(0.0%) MET 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) MLH1 0(0.0%) 0(0.0%) 0(0.0%) 0(0.0%) "
Lung_Cancer
"Therefore gathering a complete profile of mutations in lung cancers for the application of personalized and tailored targeted therapy is critical to develop future cancer treatments. We believe a faster and cost effective genotyping tool such as Ion Torrent sequencing technology will be greatly beneficial for the assignment of such specific therapeutics in the near future use for lung cancers. Materials and Methods Ethics statement The study has been approved by the Human Research Ethics Committee of the First Affiliated Hospital of Dalian Medical University China. For Formalin fixed and paraffin embedded (FFPE) tumor samples from the tumor tissue bank at the Department of Pathology of the hospital the institutional ethics committee waived the need for consent. All samples and medical data used in this study have been irreversibly anonymized. Patient information Tumor samples used in the study were collected from the First Affiliated Hospital of Dalian Medical University China. A total of 76 FFPE tumor samples from lung cancer patients were analyzed. The mean age of the 76 patients was 61 years (range: 28“80 years). Of these 40 patients were male with a mean age of 61 years (range: 28“80 years) and 36 patients were female with a mean age of 61 (range: 36“75 years). Tumor samples used in the study were collected from the First Affiliated Hospital of Dalian Medical University China. A total of 76 FFPE tumor samples from lung cancer patients were analyzed. The mean age of the 76 patients was 61 years (range: 28“80 years). Of these 40 patients were male with a mean age of 61 years (range: 28“80 years) and 36 patients were female with a mean age of 61 (range: 36“75 years). 33 of the 76 patients (20 men 13 women) were graded as low pathologic differentiation; 27 (14 men 13 women) at mid 15 (6 men 9 women) at high and 1 women of unknown differentiation. AJCC cancer staging is as follows: 0 patients at I or Ia; 18 (10 men 8 women) at stage Ib; 3 (2 men 1 woman) at stage IIa; 9 (5 men 4 women) at stage IIb; 26 (14 men 12 women) at stage IIIa; 8 (4 men 4 women) at stage IIIb; 0 patients at stage IIIc; and 12 (5 men 7 women) at stage IV. Out of the total 76 patients 16 of the 40 men reported no history of smoking whereas none of the 36 women reported to be smokers; 6 men reported light smoking; 17 men reported heavy smoking and 1 man with an unknown smoking history. DNA preparation DNA was isolated from FFPE samples after deparaffinization and extraction of 3“5 µm thick paraffin sections in xylene using the QIAamp DNA Mini Kit (Qiagen) per the manufacturer's instructions. Ion torrent PGM library preparation and sequencing An Ion Torrent adapter-ligated library was made following the manufacturer's protocol for the Ion AmpliSeq Library Kit 2.0 (Life Technologies) (Part #4475345 Rev. A). Briefly 50 ng pooled amplicons were end-repaired and DNA ligase was used to ligate Ion Torrent adapters P1 and A. After purification with AMPure beads (Beckman Coulter Brea CA USA) adapter-ligated products were nick-translated and PCR-amplified for a total of 5 cycles. AMPure beads (Beckman Coulter) were used to purify the resulting library and an Agilent 2100 BioAnalyzer (Agilent Technologies) and Agilent BioAnalyzer DNA High-Sensitivity LabChip (Agilent Technologies) were used to determine the concentration and size of the library. Sample emulsion PCR emulsion breaking and enrichment were performed using the Ion PGM 200 Xpress Template Kit (Part #4474280 Rev. B) according to the manufacturer's instructions. Briefly an input concentration of one DNA template copy/Ion Sphere Ps (ISPs) was added to the emulsion PCR master mix and the emulsion generated using an IKADT-20 mixer (Life Technologies). Next ISPs were recovered and template-positive ISPs were enriched for use with Dynabeads MyOne Streptavidin C1 beads (Life Technologies). ISP enrichment was confirmed using the Qubit 2.0 fluorometer (Life Technologies)."
Lung_Cancer
"Materials and Methods Patient selection A total of 181 advanced CRC patients with synchronous or metachronous metastases who were treated at Seoul National University Bundang Hospital (Seongnam-si South Korea) between 2003 and 2009 were enrolled in this study. Synchronous metastases were defined as distant metastases occurring within six months of the primary diagnosis of CRC and metachronous metastases were those occurring after that time point [29]. The cancer tissue used in this study was received from patients that had surgical resection of both the primary tumor and related metastases. None of the patients had received chemo- or radiotherapy before the resection of the primary tumor. Medical charts and pathology reports were reviewed to record clinical and pathological data. Glass slides were reviewed to determine the histological type according to the WHO classification [30]. Follow-up information including the patient outcome and the time interval between the date of surgical resection and death was collected. The cases lost to follow-up and deaths from causes other than CRC were considered censored data for the survival analysis. The median follow-up period was 37.9 months (range 0.8“104.6 months). Ethical statement All human specimens were obtained from the files of surgically resected cases examined at the Department of Pathology Seoul National University Bundang Hospital for the pathologic diagnosis. The retrospective study was performed using the stored samples after the pathologic diagnosis and all of the samples were anonymized before the study. The participants did not provide written informed consent in this study. The study was approved by the Institutional Review Board of Seoul National University Bundang Hospital under the condition of anonymization (reference: B-1109/136-302). Tissue array methods To evaluate the regional stromal differences samples were taken from each patient from four areas: the center and periphery of the primary cancer distant metastases and lymph node metastases. The distant metastatic sites for the tissue arrays were as follows: liver in 83 cases (45.9%) lung in 38 cases (21.0%) seedings in 38 cases (21.0%) distant lymph nodes in 6 cases (3.3%) and ovary in 16 cases (8.3%). The representative core tissue specimens (2 mm in diameter) were taken from individual paraffin blocks and rearranged in new tissue array blocks using a trephine apparatus (Superbiochips Laboratories Seoul South Korea) [31]. Immunohistochemistry Array slides were labelled by immunohistochemistry using antibodies for CD31 (1?100 DAKO Glostrup Denmark) D2-40 (1?100 DAKO) SMA (1?1000 Neomarkers Fremont CA USA) desmin (1?300 DAKO) and PTEN (1?80 Epitomics Burlingame CA USA) after a microwave antigen retrieval procedure except SMA. Non-reactive sites were blocked using 1% horse serum in Tris-buffered saline (pH 6.0) for 3 min. Primary antibodies were applied and antibody binding was detected with diaminobenzidine (DAB). Sections were counterstained with hematoxylin. The reactivity of PTEN in each tissue section was scored as negative faint or strong and the percentage of PTEN-positive fibroblasts was quantified. For the statistical analysis the sample was deemed PTEN-positive if 5% or more CAFs were scored as strong positives. Calculation of LVD MVD and CAFs using digital pathology Slides were concurrently evaluated by two pathologists (H.E.L and H.S.L) using light microscopy to improve the accuracy of the results (Fig. 1). CRC cells were considered as internal negative controls. Medium- to large-sized vessels were considered as internal positive controls for CD31 and D2-40. Intestinal muscular layer or medium- to large-sized vessels were considered as internal positive controls for desmin and SMA. Samples showing inappropriate staining in internal negative or positive controls were considered non-informative and were excluded from the analysis. Slides were scanned using an Aperio ScanScope® CS instrument (Aperio Technologies Inc. Vista CA) at 20— magnification. Subsequently they were analyzed in ImageScope„¢ using the Microvessel Analysis v1 algorithm (Aperio Technologies) and MVD and LVD were calculated. Because desmin-positive muscularis mucosa and propria are positive for SMA immunostaining the area of CAFs (mm2) was calculated by subtracting the areas of desmin staining from that of SMA staining (SMA - desmin). .0091811.g001 Representative sections from four tumor locations stained with CD31 D2-40 SMA or desmin antibodies (—100). Statistical analysis A chi-squared test or Fisher's exact test (2-sided) for non-continuous variables and Mann-Whitney or Kruskal-Wallis analysis for continuous variables were used to compare each parameter with respect to the CRC site and according to its clinicopathologic features. The correlation between continuous variables was analyzed using the Pearson correlation coefficient. To determine the best cut-offs of continuous variables for predicting patient survival the maximal chi-squared method was performed using R program (http://cran.r-project./). The overall survival curves were plotted using the Kaplan-Meier product-limit method and the significance of the differences between these curves was determined using the log-rank test. A univariate and multivariate regression analysis was performed using the Cox's proportional hazards model to determine hazard ratios (HRs). P-values of less than 0.05 were considered statistically significant. All statistical analysis excluding the maximal chi-squared test was performed with the IBM SPSS statistics 20 (Armonk NY USA). Results 1. Heterogeneity of cancer-associated stroma according to examined tumor locations The clinicopathological characteristics of the advanced CRC patients are described in . The CRC patients with synchronous metastases had aggressive features including larger tumor size more advanced pT and pN stage and the presence of perineural and venous invasion than the patients with metachronous metastasis (p<0.05). .0091811.t001 Clinicopathologic characteristics of advanced colorectal cancers. Parameters Total Metachronous Synchronous P value (n?=?181) (n?=?57) (n?=?124) Age (median range) 60.00 (28“93) 62.00 (36“79) 60.00 (28“93) 0.241 Sex 0.007 Male 97 39 (68.4%) 58 (46.8%) Female 84 18 (31.6%) 66 (53.2%) Location 0.055 Right colon 37 6 (10.5%) 31 (25.0%) Left colon 75 29 (50.9%) 46 (37.1%) Rectum 69 22 (38.6%) 47 (37.9%) Size of primary tumor 5.30 (2.0“13.0) 4.20 (2“9) 5.50 (2.5“13) <0.001 Histologic grade 0.227 Low grade 157 52 (91.2%) 105 (84.7%) High grade 24 5 (8.8%) 19 (15.3%) T stage <0.001 T1 0 0 0 T2 5 3 (5.3%) 2 (1.6%) T3 107 45 (78.9%) 62 (50.0%) T4 69 9 (15.8%) 60 (48.4%) N stage <0.001 N0 35 23 (40.4%) 12 (9.7%) N1 58 23 (40.4%) 35 (28.2%) N2 88 11 (19.3%) 77 (62.1%) Perineural invasion 0.011 Absent 89 36 (63.2%) 53 (42.7%) Present 92 21 (36.8%) 71 (57.3%) Venous invasion 0.028 Absent 126 46 (80.7%) 80 (64.5%) Present 55 11 (19.3%) 44 (35.5%) The heterogeneous values for LVD MVD and CAF area are shown in Fig 2. LVD was the highest in center of the primary cancers (median interquartile range (IQR); 37.00 10.50“81.00) than any other site (5.00 1.00“23.75 at the periphery; 2.50 1.00“15.00 in lymph node metastases; 3.00 1.00“20.00 in distant metastases). MVD was lower in distant metastases (median IQR; 641.50 428.00“1006.75) than at the periphery of the primary cancer (731.00 508.25“1049.75) and lymph node metastases (893.50 520.25“1275.25). The area occupied by CAFs was the lowest in the distant metastases (median IQR; 0.91 0.68“1.18) than any other site (1.12 0.88“1.41 in the center; 1.22 0.96“1.54 in the periphery1.4 1.00“1.71 in lymph node metastases). In addition the stromal characteristics varied in relation to the metastatic an examined. MVD and LVD were the higher in lung metastases than those in the liver peritoneum or lymph nodes (p<0.001; Fig. 3). However the amounts of CAFs were consistent among the different metastatic ans (p?=?0.180)."
Lung_Cancer
"The DNA repair hub module is linked to a module associated with response to DNA damage. It contains five genes: CTF4 ESC4 MMS1 MMS22 and Rt101. The last four genes are part of the cullin-RING ubiquitin ligase complex (GO:0031461). The last three genes were shown to form a complex that stabilizes the replisome during replication stress (4647). The CTF4 gene is related to DNA repair and DNA replication initiation according to its GO annotations. The link suggests that this complex might work together with the DNA repair module for coping with damaged replication forks. Interestingly the two MMS genes were originally detected in MMS sensitivity tests but are not expected to be required for double-stranded repair (47). The RAD52 module (RAD51 RAD52 and RAD59) is related to double-stranded DNA damage repair (48) and is linked both to the DNA damage repair module and to the DNA damage response module suggesting these modules work together in the same pathway as a result of DNA damage to cope both with damaged replication forks and with double-stranded DNA breaks. The fourth linked module contains three genes of the SuperKiller (SKI) complex (SKI2 SKI5 and SKI7). These genes are involved in 3“5 RNA degradation in the cytoplasmatic exosome (4950). Our analysis suggests that this complex might also be involved in response to DNA damage. Previous studies have shown that RNA degradation cytoplasmatic genes might play a role in DNA damage response separately from their cytoplasmatic activity (5152). The suggested roles of RNA degradation genes in DNA damage response include DNA stability and telomere stability related functionality (51) mediating the assembly of multiprotein complexes in double-stranded breaks (52) and specific mRNA degradation on DNA damage (53). Hence our findings match prior studies and strengthen the role of the SKI complex in the response to DNA damage.Analysis of human co-expression and differential correlation networksWe applied ModMap on case-control gene expression data of NSCLC to reveal DC among highly correlated gene modules. The contribution of this part is two fold. First we show that DC among gene modules is reproducible in cross-validation tests. Second we analyze the map of DC patterns between gene modules discovered by ModMap.Given a data set of gene expression profiles from cases and controls we used the method of (24) to compute two scores for each gene pair: the CC score which is positive if the gene pair is consistently correlated across phenotypes and the DC score which is positive if the correlation difference between the cases and controls is higher than expected by chance. These scores were then used as edge weights in networks H and G respectively on which a module map was learned. The methodology was evaluated using cross-validation: given a module map constructed on a set of profiles (the ˜training set™) and a disjoint set of samples (the ˜test set™) the quality of the predicted map was evaluated on the test set by comparing the DC of links and of non-links using Wilcoxon rank-sum test where the null hypothesis is that there is no difference in DC between links and non-links. This measure is parameter-free and reflects all DC changes.We tested several variants of the algorithm using 2-fold cross-validation. The maps produced by the local improver received low P-values but suffered from low coverage. For example for the MBC-DICER initiator the local improver achieved a P-value of 4.43E-4 but the map covered only 197 genes. In contrast when applying ModMap (i.e. MBC-DICER with the global improver) the map covered 1289 genes with P-value of 1.54E-10. Supplementary Text contains further results of testing different parameters of the global improver and tests on Alzheimer™s disease (54) which got similar cross-validation results. The full results are shown in Supplementary Table S11 for lung cancer and in Supplementary Table S12 for Alzehimer's disease. Taken together ModMap produces large maps that are robust when tested on independent data sets.Next we analyzed the module map obtained by running ModMap on all samples of the NSCLC data. The map covered 1921 genes in 76 modules connected by 405 links (see Supplementary Tables S13 and S14 for details). To focus on strong changes in correlation between modules we compared the DC of each link in the map to the DC calculated between random gene sets of the same sizes in 200 repeats and calculated the fold-change between the real link and the best random link as proposed in (24). The link fold-change scores are given in Supplementary Table S14. In all 150 links had fold-change 1.5 with the top five links exceeding 2.3. This indicates that the DC of the linked modules is far stronger than expected by chance. We also analyzed the modules of the top links using pathway enrichment analysis and microRNA enrichment analysis (see Supplementary Table S15 for details). One of the links connected two modules related to immune response activation. The linked modules are shown in . In A we observe many high co-expression edges between the modules (gene pairs with r > 0.4) in the control class. Module 11 is enriched with B-cell receptor signaling pathway genes (6 genes P = 3.1E-8). Module 12 is enriched with T-cell receptor signaling pathway genes (4 genes P = 1.37E-4). B shows GeneMANIA analysis of these 10 genes (755) which confirms that they are connected by several types of interactions. C shows the co-expression of the same modules in the NSCLC class. Within each of the modules a strong level of co-expression is preserved but the co-expression between the modules is abolished suggesting that co-regulation of the different immune responses is lost in NSCLC. Finally module 11 is highly enriched with targets of microRNA 34-a b c family (red nodes in A) whose members are annotated as causal to NSCLC according to the mir-2-disease database (56). Taken together these results show the ability of our analysis to detect NSCLC-related functional modules without using any prior knowledge. .A pair of immune activation-related modules differentially correlated in NSCLC. (A) Two-linked modules which are a part of the constructed module map. Nodes are genes and edges represent correlation >0.4 between the genes in the expression patterns of control class. Edges here correspond to high co-expression between two genes and do not reflect the weights in the CC or DC networks. We observe strong co-expression both within and between the modules. Nodes with black frames are related to immune activation response (six T-cell activation genes in module 11 and four B-cell activation genes in module 12). Red nodes in module 11 are targets of mir-34 family. (B) GeneMANIA analysis of the T-cell and B-cell signaling pathway genes shows that the genes of both modules are expected to interact in healthy controls. (C) The same two modules and their co-expression network in the NSCLC class. As in A the genes within each module are highly co-expressed. In contrast to A co-expression between the modules is completely diminished.DISCUSSIONIn this we presented a methodology for joint analysis of two gene networks each representing a different type of omic relation between genes. The method identifies gene sets as modules and the complex structure of relations among them and summarizes the analysis in a module map. Modules correspond to interacting gene sets in the first network and links in the module map correspond to interacting modules in the second."
Lung_Cancer
"Log-rank test determined that the PFS and OS in high KLK11 group were significantly longer than those in the low KLK11 group (P?=?0.003; P?=?0.018) Discussion During the last few years numerous studies have been published which attempt to refine our understanding of determinants of prognosis in lung cancer by analyzing tumor-associated markers thought to be of biologic relevance in the carcinogenic process. Proteolytic enzymes of several catalytic classes have emerged as important prognostic factors in cancer [12]. Among these enzymes are many members of human tissue kallikrein family of secreted serine proteases including KLK11 a promising biomarker for lung cancer diagnosis and prognosis [1113]. In the present study serum KLK11 levels were significantly elevated in patients with lung cancer compared with control subjects making them potential adjunctive tools for diagnosis of lung cancer. Furthermore at a cutoff point of 1.05 ng/ml KLK11 had a sensitivity of 91.3 % and a specificity of 72.5 % for the prediction of lung cancer. Importantly the serum KLK11 levels did not differ significantly with age gender and histology. The levels of KLK11 were significantly correlated with TNM stage the presence of lymph node and distant metastases. Several previous studies have reported an association between kallikrein mRNA expression and cancer prognosis [14“16]. KLK5 and KLK4 have been associated with poor prognosis in ovarian cancer and KLK5 has also been shown to be associated with poor prognosis in breast cancer [1718]. In contrast KLK8 and KLK9 expression have been reported to be favorable prognosis in ovarian cancer [1920]. In addition KLK12 is reported to be an independent and favorable prognostic marker for breast cancer [21]. Sasaki et al. [11] have indicated that there is a significant correlation between decreased KLK11 mRNA expression level and poor prognosis in lung cancer. This study supports the increasing body of literature demonstrating the expression of kallikrein family gene involvement in the prognosis of human cancers. The most striking association we observed in NSCLC patients was a significant correlation between increased KLK11 level and favorable prognosis. We have demonstrated that high KLK11 was significantly associated with an increased PFS and OS in univariate analysis. This relationship was further illustrated in the Kaplan“Meier survival curves. Multivariate analysis also indicated that KLK11 was an independent indicator of PFS and OS. In our data suggest that serum KLK11 may be a useful diagnostic biomarker and shows a promising potential as prognostic marker in NSCLC patients. More large-scale prospective studies are warranted to confirm the findings. Conflicts of interest None. References 1. Chen Z Wang T Cai L Su C Zhong B Lei Y Clinicopathological significance of non-small cell lung cancer with high prevalence of Oct-4 tumor cells J Exp Clin Cancer Res 2012 31 10 10.1186/1756-9966-31-10 22300949 2. Smith RA Cokkinides V Brawley OW Cancer screening in the United States 2009: a review of current American Cancer Society guidelines and issues in cancer screening CA Cancer J Clin 2009 59 27 41 10.3322/caac.20008 19147867 3. Oguz A Unal D Tasdemir A Karahan S Aykas F Mutlu H Lack of any association between blood groups and lung cancer independent of histology Asian Pac J Cancer Prev. 2013 14 453 456 10.7314/APJCP.2013.14.1.453 23534772 4. Jemal A Siegel R Xu J Ward E Cancer statistics 2010 CA Cancer J Clin 2010 60 277 300 10.3322/caac.20073 20610543 5. Sano A Sangai T Maeda H Nakamura M Hasebe T Ochiai A Kallikrein 11 expressed in human breast cancer cells releases insulin-like growth factor through degradation of IGFBP-3 Int J Oncol 2007 30 1493 1498 17487371 6. Luo LY Shan SJ Elliott MB Soosaipillai A Diamandis EP Purification and characterization of human Kallikrein 11 a candidate prostate and ovarian cancer biomarker from seminal plasma Clin Cancer Res 2006 12 742 750 10.1158/1078-0432.CCR-05-1696 16467084 7. McIntosh MW Liu Y Drescher C Urban N Diamandis EP Validation and characterization of human Kallikrein-11 as a serum marker for diagnosis of ovarian carcinoma Clin Cancer Res 2007 13 4422 4428 10.1158/1078-0432.CCR-06-2224 17671125 8. Unal D Tasdemir A Oguz A Eroglu C Cihan YB Turak EE Is human Kallikrein-11 in gastric cancer treated with surgery and adjuvant chemoradiotherapy associated with survival? Pathol Res Pract 2013 209 779 783 10.1016/j.prp.2013.09.004 24169449 9. Yu X Tang HY Li XR He XW Xiang KM Overexpression of human kallikrein 11 is associated with poor prognosis in patients with low rectal carcinoma Med Oncol 2010 27 40 44 10.1007/s12032-009-9167-2 19184568 10. Diamandis EP Bo±o CA Scorilas A Harbeck N Dorn J Schmitt M Human kallikrein 11: an indicator of favorable prognosis in ovarian cancer patients Clin Biochem 2004 37 823 829 10.1016/j.clinbiochem.2004.04.009 15329323 11. Sasaki H Kawano O Endo K Suzuki E Haneda H Yukiue H Decreased Kallikrein 11 messenger RNA expression in lung cancer Clin Lung Cancer 2006 8 45 48 10.3816/CLC.2006.n.032 16870045 12. Lei KF Liu BY Zhang XQ Jin XL Guo Y Ye M Development of a survival prediction model for gastric cancer using serine proteases and their inhibitors Exp Ther Med 2012 3 109 116 10.1084/jem.20110399 22969854 13. Planque C Li L Zheng Y Soosaipillai A Reckamp K Chia D A multiparametric serum kallikrein panel for diagnosis of non-small cell lung carcinoma Clin Cancer Res 2008 14 1355 1362 10.1158/1078-0432.CCR-07-4117 18316555 14. Alexopoulou DK Papadopoulos IN Scorilas A Clinical significance of kallikrein-related peptidase (KLK10) mRNA expression in colorectal cancer Clin Biochem 2013 46 1453 1461 10.1016/j.clinbiochem.2013.03.002 23499583 15. Talieri M Alexopoulou DK Scorilas A Kypraios D Arnogiannaki N Devetzi M Expression analysis and clinical evaluation of kallikrein-related peptidase 10 (KLK10) in colorectal cancer Tumour Biol 2011 32 737 744 10.1007/s13277-011-0175-4 21487810 16. Patsis C Yiotakis I Scorilas A Diagnostic and prognostic significance of human kallikrein 11 (KLK11) mRNA expression levels in patients with laryngeal cancer Clin Biochem 2012 45 623 630 10.1016/j.clinbiochem.2012.03.005 22429520 17. Xi Z Kaern J Davidson B Klokk TI Risberg B Trop C Kallikrein 4 is associated with paclitaxel resistance in ovarian cancer Gynecol Oncol 2004 94 80 85 10.1016/j.ygyno.2004.03.044 15262123 18. Yousef GM Scorilas A Kyriakopoulou LG Rendl L Diamandis M Ponzone R Human kallikrein gene 5 (KLK5) expression by quantitative PCR: an independent indicator of poor prognosis in breast cancer Clin Chem 2002 48 1241 1250 12142380 19. Kountourakis P Psyrri A Scorilas A Markakis S Kowalski D Camp RL Expression and prognostic significance of kallikrein-related peptidase 8 protein levels in advanced ovarian cancer by using automated quantitative analysis Thromb Haemost 2009 101 541 546 19277417 20. Bo±o CA Kishi T Scorilas A Harbeck N Dorn J Schmalfeldt B Human kallikrein 8 protein is a favorable prognostic marker in ovarian cancer Clin Cancer Res 2006 12 1487 1493 10.1158/1078-0432.CCR-05-2106 16533772 21. Talieri M Devetzi M Scorilas A Pappa E Tsapralis N Missitzis I Human kallikrein-related peptidase 12 (KLK12) splice variants expression in breast cancer and their clinical impact Tumour Biol 2012 33 1075 1084 10.1007/s13277-012-0347-x 22351561 9502500 8794 Clin Cancer Res Clin. Cancer Res. Clinical cancer research : an official journal of the American Association for Cancer Research 1078-0432 24423612 4136748 10.1158/1078-0432.CCR-13-2195 NIHMS556385 HEDGEHOG-GLI signaling inhibition suppresses tumor growth in squamous lung cancer Huang Lingling 1 Walter Vonn 2 Hayes D. Neil 2 Onaitis Mark 1 1Duke University Department of Surgery 2University of North Carolina Department of Medicine Corresponding Author: Mark Onaitis DUMC Box 3305 Durham NC 27710 mwoduke.edu phone: 919-684-6974 fax: 919-684-8508 4 4 2014 14 1 2014 15 3 2014 15 3 2015 20 6 1566 1575 Purpose Lung squamous cell carcinoma (LSCC) currently lacks effective targeted therapies. Previous studies reported overexpression of HEDGEHOG (HH)-GLI signaling components in LSCC. However they addressed neither the tumor heterogeneity nor the requirement for HH-GLI signaling. Here we investigated the role of HH-GLI signaling in LSCC and studied the therapeutic potential of HH-GLI suppression. Experimental Design Gene expression datasets of two independent LSCC patient cohorts were analyzed to study the activation of HH-GLI signaling. Four human LSCC cell lines were examined for HH-GLI signaling components. Cell proliferation and apoptosis were assayed in these cells after blocking the HH-GLI pathway by lentiviral-shRNA knockdown or small molecule inhibitors. Xenografts in immunodeficient mice were used to determine the in vivo efficacy of GLI inhibitor GANT61. Results In both cohorts activation of HH-GLI signaling was significantly associated with the classical subtype of LSCC. In cell lines genetic knockdown of SMO produced minor effects on cell survival while GLI2 knockdown significantly reduced proliferation and induced extensive apoptosis. Consistently the SMO inhibitor GDC-0449 resulted in limited cytotoxicity in LSCC cells whereas the GLI inhibitor GANT61 was very effective. Importantly GANT61 demonstrated specific in vivo anti-tumor activity in xenograft models of GLI-positive cell lines. Conclusion Our studies demonstrate an important role for GLI2 in LSCC and suggest GLI inhibition as a novel and potent strategy to treat a subset of LSCC patients. Squamous cell lung cancer HEDGEHOG GLI J Korean Med Sci J. Korean Med. Sci JKMS Journal of Korean Medical Science 1011-8934 1598-6357 The Korean Academy of Medical Sciences 24431917 3890464 10.3346/jkms.2014.29.1.129 Original Medical Imaging Computed Tomography Guided Percutaneous Injection of a Mixture of Lipiodol and Methylene Blue in Rabbit Lungs: Evaluation of Localization Ability for Video-Assisted Thoracoscopic Surgery Jin Kwang Nam 1 Lee Kyung Won 2 Kim Tae Jung 2 Song Yong Sub 3 Kim Dong Il 4 1Department of Radiology Seoul Metropolitan Government-Seoul National University Boramae Medical Center Seoul Korea. 2Department of Radiology Seoul National University Bundang Hospital Seongnam Korea. 3Department of Radiology Seoul National University Hospital Seoul Korea. 4Department of Pathology Green Cross Laboratories Yongin Korea. Address for Correspondence: Kyung Won Lee MD. Department of Radiology Seoul National University Bundang Hospital 82 Gumi-ro 173beon-gil Bundang-gu Seongnam 463-707 Korea. Tel: +82.31-787-7604 Fax: +82.31-787-4011 lkwradradiol.snu.ac.kr 1 2014 26 12 2013 29 1 129 136 13 5 2013 22 10 2013 2014 The Korean Academy of Medical Sciences. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Preoperative localization is necessary prior to video assisted thoracoscopic surgery for the detection of small or deeply located lung nodules. We compared the localization ability of a mixture of lipiodol and methylene blue (MLM) (0.6 mL 1:5) to methylene blue (0.5 mL) in rabbit lungs. CT-guided percutaneous injections were performed in 21 subjects with MLM and methylene blue. We measured the extent of staining on freshly excised lung and evaluated the subjective localization ability with 4 point scales at 6 and 24 hr after injections. For MLM radio-opacity was evaluated on the fluoroscopy. We considered score 2 (acceptable) or 3 (excellent) as appropriate for localization. The staining extent of MLM was significantly smaller than methylene blue (0.6 vs 1.0 cm P<0.001). MLM showed superior staining ability over methylene blue (2.8 vs 2.2 P=0.010). Excellent staining was achieved in 17 subjects (81%) with MLM and 8 (38%) with methylene blue (P=0.011). An acceptable or excellent radio-opacity of MLM was found in 13 subjects (62%). An appropriate localization rate of MLM was 100% with the use of the directly visible ability and radio-opacity of MLM. MLM provides a superior pulmonary localization ability over methylene blue. Lung Ethiodized Oil Methylene Blue Tomography X-Ray Computed Radiology Interventional Seoul National University College of Medicine 800-20120036 INTRODUCTION Preoperative localization is necessary for video-assisted thoracoscopic surgery (VATS) when pulmonary nodules are too small or distant from the visceral pleura to be detected (1-3). A failure to localize nodules disturbs the success of the thoracoscopic resection and leads to conversion to thoracotomy (4 5). "
Lung_Cancer
"The rates of assignment of patients to observation (22%) and chemotherapy (78%) were as expected. S Gene expression analysis for treatment assignment is feasible. Survival results are encouraging and require future validation. Real-time performance of quantitative in situ ERCC1 and RRM1 analysis requires further development. lung cancer adjuvant therapy personalized medicine ERCC1 (excision repair cross-complementing group 1) RRM1 (ribonucleotide reductase M1) INTRODUCTION After publication of the International Adjuvant Lung Cancer Trial in 2004 adjuvant chemotherapy containing a platinum agent has become the standard of care for patients with a complete surgical resection of American Joint Committee on Cancer stage II to III (version 6) non-small cell lung cancer (NSCLC).1 The trial included patients with stage I to III disease and demonstrated an absolute 4.1% improvement in overall survival (OS) and a subgroup analysis indicated that the OS benefit increased with stage: the hazards ratio (HR) for death among patients receiving adjuvant chemotherapy compared with controls was approximately 0.98 for patients with stage I disease 0.88 for patients with stage II disease and 0.79 for patients with stage III disease.1 The data were confirmed by the National Cancer Institute of Canada Clinical Trials Group JBR.10 trial in 2005 which included patients with stage IB and stage II disease.2 A third trial Cancer and Leukemia Group B (CALGB) 9633 which included only patients with stage IB disease was terminated early and also reported a therapeutic benefit for adjuvant chemotherapy.3 However a final analysis of mature data revealed no statistically significant OS benefit (HR 0.83) but demonstrated a benefit for patients with tumor diameters of ??4 cm (HR 0.69).4 During the same time period an increasing number of correlative biomarker analyses demonstrated that the efficacy of platinum agents was associated with intratumoral levels of the excision repair cross-complementing group 1 (ERCC1) gene with high levels indicating resistance.5“9 Similarly high intratumoral levels of the regulatory subunit of ribonucleotide reductase M1 (RRM1) were reported to be predictive of resistance to gemcitabine.9“13 Finally both biomarkers had also been reported to be prognostic of survival in patients who had not received chemotherapy or radiation with high levels indicating longer survival.814“16 Based on these data we designed an adjuvant trial in 2007. The underlying hypothesis was that patients with high intratumoral levels of ERCC1 and RRM1 would not benefit from chemotherapy and would have a good prognosis because of a less aggressive tumor phenotype. In contrast patients with low levels of ERCC1 and RRM1 would have tumors that were sensitive to chemotherapy but with a more aggressive phenotype. Because a biomarker-driven adjuvant chemotherapy selection trial had not been performed in patients with NSCLC we focused on demonstrating the feasibility of such an approach before launching a phase 3 trial. In addition because adjuvant chemotherapy had quickly become the standard of care for patients with stage II/IIIA disease we focused our efforts on patients with stage I disease. After discussions within the SWOG (formerly the Southwest Oncology Group) lung cancer working group and the National Cancer Institute (NCI)'s Cancer Therapy Evaluation Program and after peer review by a National Institutes of Health study section the consensus was to focus this feasibility trial on patients with stage I disease and tumor diameters of ?2 cm. MATERIALS AND METHODS Trial Design and Treatment Plan The trial (NCT00792701 SWOG-0720) complied with the Declaration of Helsinki and was approved by the Institutional Review Boards of the study institutions. Eligibility criteria included a diagnosis of NSCLC; stage I disease (according to version 6 of the American Joint Committee on Cancer staging manual) with a tumor diameter ??2?cm; a complete surgical resection by lobectomy bilobectomy or pneumonectomy; surgical staging of the mediastinum through sampling of at least 2 lymph node stations; a positron emission tomography scan; a computed tomographic scan of the chest and abdomen; adequate bone marrow liver and renal function; a Zubrod performance status of 0 or 1; and willingness to provide a smoking history. Patients with a prior malignancy prior radiation to the chest or other significant illnesses according to good medical practice were excluded. Patients had to be registered on the trial within 35 days of surgery. Tumor specimens were then retrieved and shipped to a central laboratory. They were analyzed for in situ tumor levels of ERCC1 and RRM1 using an immunofluorescence-based automated quantitative analysis method.17 Prespecified cutoff levels that had been determined in 187 patients with stage I disease (??65 for ERCC1 and ??40 for RRM1) were used to categorize specimens as high or low expressors for each marker (Fig. 1).16 The appropriate therapeutic assignment was then passed on to the statistical center and the participating therapeutic center; however specific protein levels were not communicated to the treatment center. Therapeutic assignment was based solely on biomarker categories and no other stratification parameters were used. CONSORT (Consolidated Standards Of Reporting Trials) diagram of the trial is shown. Patients with high levels of both biomarkers received active surveillance and patients with low levels of one or both biomarkers received 4 cycles of cisplatin (at a dose of 80 mg/m2 on day 1) and gemcitabine (at a dose of 1 g/m2 on days 1 and 8) every 21 days. The protocol included provisions for dose reductions or treatment delays. The addition of other targeted or cytotoxic agents during therapy or as maintenance was not permitted. Specimen Collection Processing and Gene Expression Analysis The study required the collection and shipment of formalin-fixed and paraffin-embedded tumor blocks before therapy. However if local policies did not permit submission of a tissue block 10 serial unstained sections could be submitted. Processing was done in a reference laboratory by 1 of 2 investigators (V.O. and Z.Z.). Sections measuring 5 ?m in thickness were placed on frosted glass slides and in situ quantification was performed by the automated quantitative analysis method (PM-2000 [version 1] HistoRx Inc New Haven CT) as previously described.91618 The primary antibody for the detection of ERCC1 was clone 8F1 (product code NB500-704 lots G412 and H347 from Novus Biologicals [Littleton Colo]) and the antiserum for RRM1 was R1AS-6 (generated in a rabbit in 2003 against a keyhole limpet hemocyanin [KLH]-conjugated 21-aminoacid peptide specific to the N-terminal of RRM1 column purification lot 09-2008). Slides were scanned with SpotGrabber (HistoRx New Haven Conn.) and image data were captured with a digital camera and fluorescence microscope and analyzed. Scores were adjusted to range from 1 to 255. Because full sections were evaluated for each specimen multiple spots with diameters of 0.6 mm were analyzed to obtain a representative level of protein expression. The number of spots was dependent on suitable areas with tumor cells and it ranged from 5 to 25 spots (median 10 spots) for both targets. Runs included a tissue microarray of 15 control specimens in triplicate for control purposes. Statistical Analysis The primary objective of the current study was the feasibility of a biomarker-based treatment assignment in the cooperative group setting. If the true success rate were ??75% then a biomarker-based treatment assignment would not be considered feasible but if the true success rate were ??90% it would be feasible. If ??47 of 55 eligible patients (85%) were successfully assigned to treatment or active monitoring within 84 days from surgery this would be considered evidence of feasibility. The design had 91% power using an exact binomial test with a 1-sided type I error of 5%. Secondary objectives included estimating the collective 2-year disease-free survival (DFS) for patients who accepted their treatment assignment and in the subset of patients who received adjuvant chemotherapy. However there would be no comparison made between treatment arms. "
Lung_Cancer
"Thus luteoloside exerts its inhibitory effect on proliferation invasion and metastasis of HCC cells through inhibition of NLRP3 inflammasome. Our results indicate that luteoloside can be a potential therapeutic agent not only as an adjuvant therapy for HCC but also in the control and prevention of metastatic HCC. This work was supported by the Priority Academic Program Development of Jiangsu Higher Education Institutions the Natural Science Foundation for Colleges and Universities in Jiangsu Province (12KJB320001) the National Natural Science Foundation of China (8117101281271225 and 30950031). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Hepatocellular carcinoma (HCC) is the third leading cause of cancer-induced death worldwide and patients have a very poor prognosis [1] [2]. Usually HCC is treated by surgical resection or liver transplantation which curative options for the patients when the disease is diagnosed at an early stage. However approximately 70% of patients are inoperable because of tumor metastasis [3]. The current therapeutic options for HCC are not very effective because it is resistant to chemotherapy. Furthermore many anti-cancer drugs have toxicity and side effects for the patients. Thus novel therapeutic strategies are needed to decrease the incidence and severity associated with this cancer [4]. Therefore there is a pressing need for new therapeutic drugs with increased efficacy and decreased toxicity. Natural products continue to provide promising lead compounds and drug candidates in modern antitumor drug discovery. Flavonoids are a heterogeneous group of polyphenolic compounds found ubiquitously in a wide variety of plants. Our recent reports show that they display a wide range of pharmacological properties e.g. anti-inflammatory and antioxidative activities [5] [6]. The anti-tumor activity of flavonoid has recently attracted much attention [7]“[9]. Luteoloside (luteolin-7-O-glucoside; cynaroside; CAS 5373-11-5) a flavone subclass of flavonoids possesses potential anti-inflammatory [10] free radical scavenging [11] and antibacterial [12]. Although it is reported that luteoloside could inhibit the proliferation of colon cancer cells [13] the exact mechanism remains unclear. Furthermore the precise impact of luteoloside on cancer migration and invasion is still unreported. NLR family pyrin domain containing 3 (NLRP3; also known as NALP3 or cryopyrin) is a member of the nucleotide-binding domain and leucine-rich repeat containing gene family of intracellular sensors. When activated NLRP3 forms a protein complex called the inflammasome [14]. The inflammasome combines NLRP3 with the adaptor molecule ASC/PYCARD/TMS/CARD5 Cardinal and pro-caspase-1 to form a multimer. The result is the proteolytic maturation of caspase-1 which cleaves and activates proIL-1? to mature and active IL-1? [14]“[16]. NLRP3 inflammasome plays an important role in the development of many cancer types including melanoma [17] intestinal cancer [18] nasopharyngeal carcinoma [19] skin cancer [20] colorectal cancer [21]. However Whether NLRP3 inflammasome plays an important role in the process of HCC to our knowledge is still unknown. In the present study we demonstrate that luteoloside is a potent agent against human hepatoma cells both in vitro and in vivo and NLRP3 inflammasome might be involved in the signaling of luteoloside-induced suppression of proliferation migration and invasion. Our data provide the mechanistic insight into the role of luteoloside in inhibition of HCC cell proliferation migration and invasion. Materials and Methods Cell Lines and Reagents The human HCC cell lines (Hep3B and SNU-449) were purchased from the American Type Culture Collection. Human hepatoma cells (Huh-7) was purchased from Japanese Collection of Research Bioresources (JCRB Tokyo Japan). The human hepatoma cell line SMMC-7721 was purchased from the Committee on Type Culture Collection of Chinese Academy of Sciences (Shanghai China). The human HCC cell lines (MHCC-LM3 and MHCC97-H) were obtained from the Liver Cancer Institute of Zhongshan Hospital Fudan University (Shanghai China). Luteoloside (Fig. 1A Batch Number: 025-120622 Purity?=?99.7% purchased from Chengdu Herbpurify Co. Ltd. Chengdu China) a naturally occurring flavonoid isolated from the medicinal plant Gentiana macrophylla was dissolved at a concentration of 20 mM in 100% DMSO as a stock solution stored at ?20°C and diluted with medium before each experiment. The final DMSO concentration did not exceed 0.1% throughout the study. .0089961.g001 Luteoloside inhibits proliferation of HCC cells. (A) HPLC analysis of the purity of luteoloside used in the present study. Insert: The chemical structure of luteoloside. (B)“(C) comparative dose- and time-dependent effect of luteoloside on the proliferation potential of HCC cells. The percentage of cell viability in different treatment groups was determined using Cell Counting Kit-8 assay. * P<0.05; ** P<0.01; *** P<0.001; NS not significant (P>0.05) versus non-luteoloside-treated control group. Caspase-3/7 Activity Assay The caspase-3/7 activity assay was conducted as previously described by us [22]. 2.3. DNA Fragmentation Assay DNA from Huh-7 and SMMC-7721 cells (2—106 cells) treated with 0 or 50 µM luteoloside for 24 hours was extracted by using a DNA extraction kit (Beyotime China). "
Lung_Cancer
"A. Proliferation assay in Mero-14 cells. The graph shows the effect of the treatments with 5 µM cisplatin and 40 nM siMSLN-1 used as single agents or in combination. On day 6 MANOVA shows a statistically significant effect both for cisplatin (P?=?0.0168) and siMSLN-1 (P<10?4) in reducing proliferation. However the interaction term for the effect of both agents in combination is not statistically significant (P?=?0.145). Error bars represent SEM of three independent experiments each performed in quadruplicate. B. Flow cytometry analysis. The graph shows the percentage of cells in phase S+G2+M in Mero-14 cells treated with 40 nM of the siCtrl or siMSLN-1 in combination with imatinib (25 µM) or gemcitabine (1 µM) (alone) or imatinib+gemcitabine (10 µM and 1 µM respectively). The transfection with siMSLN-1 was accompanied with a marked decrease of cells in S+G2+M phase as compared with the respective cultures transfected with siCtrl irrespectively of the drugs employed (P?=? 0.00033). Error bars represent SEM of two independent experiments. C. Caspase activity measured on Mero-14 cells transfected with 40 nM of siCtrl or siMSLN-1 with or without cisplatin 5 µM. A marked increase in apoptosis is observed when siMSLN-1 and cisplatin are administered together compared to cultures treated with cisplatin and transfected with siCtrl (*P?=?0.018) suggesting a synergistic effect. Error bars represent SEM of three independent experiments each performed in triplicate. D. Western blotting analysis of MSLN p53 and PARP under different combinations of siRNAs and cisplatin (at 5 10 and 20 µM). ?-actin was used as reference. The protein levels were confirmed with three independent experiments. Legend to figure 5: Dark line: cells trated with siCtrl; gray line and triangles: cells treated with siCtrl plus cisplatin; gray line and dark spots: cells treated with siMSLN plus cisplatin; dark line and white spots: cells treated with siMSLN-1. Role of MSLN in cell cycle progression and apoptosis following treatments with chemotherapeutic drugs Following flow cytometry analysis Mero-14 cells treated with siMSLN-1 in combination with cisplatin or imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine showed a statistically significant decreased share of cells in S+G2+M phase as compared to their respective cultures where siMSLN-1 were replaced with siCtrl (B). This finding further confirmed the activity of siMSLN-1 in slowing the progression through cell cycle. In treatments where siRNA was combined with chemotherapeutic drugs activities of caspases-3 and -7 were measured as markers for apoptosis. The addition of siMSLN-1 in cultures treated with imatinib or gemcitabine (each as a single agent) or imatinib+gemcitabine was not associated with an increased rate of apoptosis as compared to cultures treated with the chemotherapeutic drugs together with siCtrl. Interestingly a synergistic effect was observed when cisplatin was used in combination with siMSLN-1. In fact siMSLN-1 or cisplatin alone did not induce apoptosis whereas they markedly (and in a statistically significant way) induced increased apoptosis rates when used together (C). This observation was further corroborated by the induction of p53 and by the cleavage of PARP both additional markers for apoptosis (D). The effect was dose-dependent and visible from 5 µM of cisplatin. Discussion The present work provides evidence on the importance of MSLN for cell growth and invasiveness in MPM. The transient MSLN-silencing caused a decrease in the proliferation rate of the MSLN-overexpressing cell line Mero-14. These data are in agreement with those observed on PC cells [24]. Similar findings were also reported by Wang et al. in the MSLN-overexpressing MPM cell lines H2373 [25]. As with the H2373 MPM cells the substantial arrest of the proliferation rate observed in the Mero-14 cells was underlined by the shift of the phosphorylation status of AKT and ERK (used as a marker of proliferation). The results on MPM cells were in agreement with the findings observed in PC and OC cells [25] suggesting that all the MSLN-expressing cancer cells show a significant loss of viability upon MSLN depletion. In addition to the reduced proliferation Mero-14 cells also showed a reduced capacity of sphere formation in a three-dimensional context. Concerning the cell cycle a significant increase (50%) of MPM H2373 cells in the S-phase was observed portraying a blockade in progression from S to G2 phase [25]. The results obtained in Mero-14 cells were different since a reduction of cells in S-phase was observed paralleling an increase of cells in G1 phase. The differences could be ascribed to the different methods of siRNA administration (electroporation in H2373 versus chemical transfection in Mero-14) involving different time of observation (48 versus 72 hours respectively). However the overall decrease of cells in G2/M was consistent in both cell lines. Moreover a significant reduction in invasiveness was observed in both Mero-14 and H2373 cells in the trans-well assay. With regard to apoptosis no assays were reported for H2373. In general MPM cell lines are quite refractory to undergo apoptosis and this was also observed in Mero-14 cells after MSLN depletion or a treatment with cisplatin. By contrast MSLN silencing was able to promote apoptosis in PC AsPC-1 Capan-1 and Capan-2 cells [24]. However MSLN depletion triggered a marked increase in apoptosis in Mero-14 cells when used in combination with cisplatin thereby suggesting a synergistic effect. In Mero-14 cells the activation of caspases-3 and 7 was associated with the induction of p53 and with the cleavage of PARP both markers of a pro-apoptotic activity. In summary paralleling previous studies our findings confirm that MSLN should not be regarded only as an interesting diagnostic marker for MPM or a promising target for immunotherapies. Despite the limited knowledge on the biological role of MSLN in normal and cancer cells MSLN should also be considered a key molecular target for novel gene-based targeted therapies of cancer. Supporting Information Table S1 Genes analysed for their mRNA expression in the present work. The table reports in the order the gene name the gene bank ID code the ID numbers of the TaqMan® assays the melting temperatures (in C°) and the lengths of the amplicons. (DOC) Click here for additional data file. Table S2 Silencing-RNAs tested in the present work. The table reports in the order the targeted gene the siRNAs codes and the targeted sequences. (DOC) Click here for additional data file. The authors thank Prof. Antonio Lucacchini and Prof. Maria Rosa Mazzoni (Department of Pharmacy University of Pisa) and Dr. Roberto Favoni (IRCCS A.O.U. San Martino-IST Laboratory of Gene Transfer) for the donation of the cell lines. The authors wish to thank Sandra Lindon for the proofreading of the . References 1 YamaguchiN HattoriK Oh-edaM KojimaT ImaiN et al (1994) A novel cytokine exhibiting megakaryocyte potentiating activity from a human pancreatic tumor cell line HPC-Y5. . J Biol Chem. 269(2): 805“88288629 2 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. . Proc Natl Acad Sci U S A. 93(1): 136“408552591 3 HassanR BeraT PastanI (2004) Mesothelin: a new target for immunotherapy. . Clin Cancer Res. 10(12 Pt 1): 3937“4215217923 4 HassanR HoM (2008) Mesothelin targeted cancer immunotherapy. . Eur J Cancer. 44(1): 46“5317945478 5 ArganiP Iacobuzio-DonahueC RyuB RostyC GogginsM et al (2001) Mesothelin is overexpressed in the vast majority of ductal adenocarcinomas of the pancreas: identification of a new pancreatic cancer marker by serial analysis of gene expression (SAGE). . Clin Cancer Res. 7(12): 3862“811751476 6 ChangK PastanI (1996) Molecular cloning of mesothelin a differentiation antigen present on mesothelium mesotheliomas and ovarian cancers. Proc Natl Acad Sci USA93: 136“408552591 7 SapedeC GauvritA BarbieuxI PadieuM CellerinL et al (2008) Aberrant splicing and protease involvement in mesothelin release from epithelioid mesothelioma cells. . Cancer Sci. 99(3): 590“418167128 8 RobinsonBW CreaneyJ LakeR NowakA MuskAW et al (2003) Mesothelin-family proteins and diagnosis of mesothelioma. Lancet362: 1612“1614630441 9 HassanR RemaleyAT SampsonML ZhangJ CoxDD et al (2006) Detection and quantitation of serum mesothelin a tumor marker for patients with mesothelioma and ovarian cancer. Clin Cancer Res12: 447“5316428485 10 GrigoriuBD ScherpereelA DevosP ChahineB LetourneuxM et al (2007) Utility of osteopontin and serum mesothelin in malignant pleural mesothelioma diagnosis and prognosis assessment. Clin Cancer Res13: 2928“3517504993 11 BeraTK PastanI (2000) Mesothelin is not required for normal mouse development or reproduction. . Mol Cell Biol. 20(8): 2902“610733593 12 RumpA MorikawaY TanakaM MinamiS UmesakiN et al (2004) Binding of ovarian cancer antigen CA125/MUC16 to mesothelin mediates cell adhesion. J Biol Chem279: 9190“919814676194 13 ChenSH HungWC WangP PaulC KonstantopoulosK (2013) Mesothelin binding to CA125/MUC16 promotes pancreatic cancer cell motility and invasion via MMP-7 activation. Sci Rep. 3: 187023694968 14 BharadwajU LiM ChenC YaoQ (2008) Mesothelin-induced pancreatic cancer cell proliferation involves alteration of cyclin E via activation of signal transducer and activator of transcription protein 3. Mol Cancer Res6: 1755“176519010822 15 TangZ QianM HoM (2013) The role of mesothelin in tumor progression and targeted therapy. . Anticancer Agents Med Chem. 13(2): 276“8022721387 16 HassanR VinerJL WangQC MarguliesI KreitmanRJ et al (2000) Anti-tumor activity of K1-LysPE38QQR an immunotoxin targeting mesothelin a cell-surface antigen overexpressed in ovarian cancer and malignant mesothelioma. . J Immunother. 23(4): 473“910916757 17 HungCF CalizoR TsaiYC HeL WuTC (2007) A DNA vaccine encoding a single-chain trimer of HLA-A2 linked to human mesothelin peptide generates anti-tumor effects against human mesothelin-expressing tumors. . Vaccine. 25(1): 127“3516930783 18 HungCF TsaiYC HeL WuTC (2007) Control of mesothelin-expressing ovarian cancer using adoptive transfer of mesothelin peptide-specific CD8+ T cells. . Gene Ther. 14(12): 921“917377599 19 BreidenbachM ReinDT EvertsM GlasgowJN WangM et al (2005) Mesothelin-mediated targeting of adenoviral vectors for ovarian cancer gene therapy. . Gene Ther. 12(2): 187“9315526007 20 YuL FengM KimH PhungY KleinerDE et al (2010) Mesothelin as a potential therapeutic target in human cholangiocarcinoma. . J Cancer. 1: 141“920922056 21 TangZ FengM GaoW PhungY ChenW et al (2013) A human single-domain antibody elicits potent antitumor activity by targeting an epitope in mesothelin close to the cancer cell surface. . Mol Cancer Ther. 12(4): 416“2623371858 22 HassanR EbelW RouthierEL PatelR KlineJB et al (2007) Preclinical evaluation of MORAb-009 a chimeric antibody targeting tumor-associated mesothelin. . Cancer Immun. 7: 2018088084 23 ImamuraO OkadaH TakashimaY ZhangD KobayashiT et al (2008) siRNA-mediated Erc gene silencing suppresses tumor growth in Tsc2 mutant renal carcinoma model. . Cancer Lett. 268(2): 278“8518490101 24 ZhengC JiaW TangY ZhaoH JiangY et al (2012) Mesothelin regulates growth and apoptosis in pancreatic cancer cells through p53-dependent and -independent signal pathway. . J Exp Clin Cancer Res. 31: 8423034174 25 WangK BodempudiV LiuZ Borrego-DiazE YamoutpoorF et al (2012) Inhibition of mesothelin as a novel strategy for targeting cancer cells. PLOS ONE7(4): e3321422485139 26 VersnelMA HoogstedenHC HagemeijerA BoutsMJ van der KwastTH et al (1989) Characterization of three human malignant mesothelioma cell lines. Cancer Genet Cytogenet. 42(1): 115“282790740 27 OrengoAM SpoletiniL ProcopioA FavoniRE De CupisA et al (1999) Establishment of four new mesothelioma cell lines: characterization by ultrastructural and immunophenotypic analysis. Eur Respir J. 13(3): 527“3410232421 28 VandesompeleJ De PreterK PattynF PoppeB Van RoyN et al (2002) Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol3(7): RESEARCH003412184808 29 VichaiV KirtikaraK (2006) Sulforhodamine B colorimetric assay for cytotoxicity screening. Nat Protoc1: 1112“111617406391 30 De LucaA MaielloMR D'AlessioA PergamenoM NormannoN (2012) The RAS/RAF/MEK/ERK and the PI3K/AKT signalling pathways: role in cancer pathogenesis and implications for therapeutic approaches. Expert Opin Ther Targets16 Suppl 2S17“2722443084 31 LiangCC ParkAY GuanJL (2007) In vitro scratch assay: a convenient and inexpensive method for analysis of cell migration in vitro. Nat Protoc2: 329“33317406593 32 MarshallJ (2011) Transwell(®) invasion assays. Methods Mol Biol769: 97“11021748672 Radiat Oncol Radiat Oncol Radiation Oncology (London England) 1748-717X BioMed Central 24479954 3922961 1748-717X-9-41 10.1186/1748-717X-9-41 Research Pretreatment SUVmax predicts progression-free survival in early-stage non-small cell lung cancer treated with stereotactic body radiation therapy Horne Zachary D 1 [email protected] Clump David A 1 [email protected] Vargo John A 1 [email protected] Shah Samir 1 [email protected] Beriwal Sushil 1 [email protected] Burton Steven A 1 [email protected] Quinn Annette E 1 [email protected] Schuchert Matthew J 2 [email protected] Landreneau Rodney J 2 [email protected] Christie Neil A 2 [email protected] Luketich James D 2 [email protected] Heron Dwight E 1 [email protected] 1Department of Radiation Oncology University of Pittsburgh Cancer Institute 5230 Centre Ave Pittsburgh PA 15232 USA 2Division of Thorcic and Foregut Surgery Department of Cardiothoracic Surgery University of Pittsburgh Medical Center 200 Lothrop St Suite C-816 Pittsburgh PA 15213 USA 2014 30 1 2014 9 41 41 24 9 2013 2 1 2014 Copyright © 2014 Horne et al.; licensee BioMed Central Ltd. 2014 Horne et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background This retrospective study aims to assess the usefulness of SUVmax from FDG-PET imaging as a prognosticator for primary biopsy-proven stage I NSCLC treated with SBRT. Methods This study includes 95 patients of median age 77 years with primary biopsy-confirmed peripheral stage IA/IB NSCLC. All patients were treated with 60Gy in 3 fractions with a median treatment time of six days. Local regional and distant failures were evaluated independently according to the terms of RTOG1021. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. Cox proportional hazards regression was performed to determine whether SUVmax age KPS gender tumor size/T stage or smoking history influenced outcomes. SUVmax was evaluated as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5. Results Median follow-up for the cohort was 16 months. Median OS and PFS were 25.3 and 40.3 months respectively. SUV with a cutoff value of 5 predicted for OS and PFS (p?=?.024 for each) but did not achieve significance for LC (p?=?.256). On Cox univariate regression analysis SUV as a dichotomous variable predicted for both OS and PFS (p?=?.027 and p?=?.030 respectively). Defined as a continuous variable SUVmax continued to predict for OS and PFS (p?=?.032 and p?=?.003) but also predicted LC (p?=?.045) and trended toward significance for DC (p?=?.059). SUVmax did not predict for OS as a dichotomous or continuous variable. It did however predict for PFS as a continuous variable (p?=?.008) neared significance for local control (p?=?.057) and trended towards significance for distant control (p?=?.092). Conclusions SUVmax appears to be a statistically and clinically significant independent prognostic marker for progression-free survival in patients with stage I NSCLC treated with SBRT. Prospective studies to more accurately define the role of tumor FDG uptake in the prognosis of NSCLC are warranted. Introduction [18?F]-Fluorodeoxyglucose positron emission tomography (FDG-PET) is an important tool in the initial staging and subsequent assessment of patients diagnosed and treated for non-small cell lung cancer (NSCLC) [12]. FDG-PET imaging relies on the functional properties that define malignancies including increased glucose metabolism. This uptake is linked to tumor proliferation and metastatic potential and recent investigations demonstrate the usefulness of PET imaging as a prognosticator for eventual outcomes. The International Association for the Study of Lung Cancer (IASLC) reviewed 21 studies that assessed the utility of the maximum standardized uptake value (SUVmax) in NSCLC and determined that tumors with higher SUVmax have poorer prognoses [3]. Other recent studies have attempted to determine the utility of SUVmax under a more narrow scope including that of early-stage NSCLC treated with stereotactic body radiation therapy (SBRT) an emerging technique typically reserved for patients who are medically-inoperable or who refuse surgery [45]. Multiple studies demonstrate that pretreatment SUVmax predicts for clinical outcomes in patients with early-stage NSCLC treated with SBRT [6-8]. To the contrary studies from Cleveland Clinic and Indiana University failed to find a correlation between pre-treatment SUVmax and survival [910]. As early-stage NSCLC is a potentially curable disease with SBRT here an SUVmax cutoff that predicts for more aggressive disease in patients with solitary peripheral primary stage I NSCLC is identified. Methods and materials Patients and workup This study includes 95 non-consecutive patients treated for biopsy-confirmed peripheral stage IA/IB between October 2005 and May 2011 [11]. This research was determined to have exemption status by our Institutional Review Board. All patients were staged according to the 7th edition of the AJCC criteria. No tumor was located within 2 cm of the proximal bronchial tree and no patient was previously treated for lung cancer. All patients had a pre-SBRT FDG-PET-CT scan with a documented SUVmax. Of these patients 14 were operable candidates but refused surgical therapy while the remaining 81 patients had significant pulmonary or cardiac comorbidity that precluded definitive surgical management (Table 1). As a part of the staging all patients underwent a PET-CT scan. The SUVmax was obtained from review of the formally dictated radiology report. Table 1 Patient characteristics n?=?95 Median Age 77 (48-91) years Sex Male 49 (51.6%) Female 46 (48.4%) Operable 14 (14.7%) Inoperable 81 (85.3%) KPS 80-100 63 (66.3%) <70 32 (32.7%) Clinical follow-up 16.33 (1.13-64.2) months Simulation and treatment Each patient was positioned supine with arms raised above the head for the CT simulation. A thin-slice 4-D high resolution CT (2.5 mm) and 1.25 mm helical CT with intravenous contrast was obtained while the patient was immobilized in a custom BodyFIX vacuum bag (Electa). For patients treated with CyberKnife„¢ Synchrony Respiratory Tracking System (Accuray Inc Sunnyvale CA) was utilized in conjunction with the 4D-CT to ensure fiducial movement in sync with the GTV. For Trilogy„¢ and Trubeam„¢ patients image-guided respiratory cycle motion was accounted for via Varian Real-Time Position Management System (Varian Medical Systems Palo Alto CA). Respiratory gating was incorporated for patients with tumor motion?>?0.5 cm. The acquired images were then transferred to the treatment planning workstation using either Accuray MulitPLAN„¢ (Accuray Inc Sunnyvale CA) or Varian Eclipse„¢ (Varian Medical Systems Palo Alto CA). The AAA planning algorithm was utilized for patients treated on Trilogy„¢ and Trubeam„¢ and the pencil beam algorithm for patients treated on CyberKnife„¢. The tumor volume and any surrounding critical structures including the spinal cord heart esophagus brachial plexus and normal lung were manually delineated by a radiosurgical team consisting of a radiation oncologist a medical physicist and a thoracic surgeon. The gross tumor volume (GTV) was defined as the tumor alone. To account for setup error and residual motion detected on end-exhalation 4D-CT a minimum expansion of 5 mm margin was added to create the planning target volume (PTV). An additional margin based on motion assessment was added to create an internal target volume (ITV) to be used with gating. Dose-volume histograms were calculated for the target volume and nearby critical structures to select the optimal treatment plan which provided at least 95% of the prescription dose to the PTV while sparing surrounding organs-at-risk. If surrounding organs-at-risk were deemed to be at excess risk for toxicity a plan with lower PTV coverage was accepted. SBRT was performed using CyberKnife„¢ Robotic Radiosurgery System (Accuray Inc Sunnyvale CA for 39 patients Trilogy„¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 54 patients and Trubeam„¢ Radiosurgery System (Varian Medical Systems Palo Alto CA) for 2 patients. All lesions were treated with heterogeneity correction to 60 Gy in 3 fractions every other day with a median of 6 elapsed days from beginning of treatment to end (range 3-21 days). For patients treated on the Trilogy„¢ and Trubeam „¢ platforms cone-beam CT (CBCT) was performed daily to separate setup error from tumor reposition error. The treating physician checked and modified the alignment based on target relocalization in the fused imaging. Disease assessment and clinical follow-Up After treatment patients were scheduled to have either a CT or PET/CT scan every 3 months with a clinical evaluation. Response to treatment was evaluated by the RECIST v1.1 criteria and documented as a complete response partial response (greater than 30% decrease in the longest axis) progressive disease (greater than 20% increase in the longest axis) or stable disease (neither partial response nor progressive disease) [12]. Follow-up imaging was re-evaluated to classify local regional and distant failures similar to the definitions of RTOG 1021 [13]. Local failures were defined as recurrence within the originally involved lobe or within 2 cm of the initial primary but located outside the originally involved lobe. Regional failure included non-involved ipsilateral lobes as well as ipsilateral hilar mediastinal and subcarinal lymph nodes. Distant failures enveloped ipsilateral supraclavicular and contralateral lymph nodes and all other distant sites. Progression-free survival was defined as the time to a specified recurrence and was measured from the last day of treatment to that event. Death was not included as an endpoint for PFS. Local regional and distant control overall- and progression-free survival were estimated by the Kaplan-Meier method. The ANOVA test was utilized to determine correlations between SUVmax tumor histology and stage. Forward conditional Cox proportional hazards regression was performed to determine whether SUVmax (continuous/dichotomous) age (continuous) KPS (continuous) gender tumor T stage tumor histology or smoking pack years (continuous) influenced outcomes. SUVmax was evaluated in univariate and multivariate analyses as both a continuous and as a dichotomous variable using a cutoff of <5 and ?5 as described in previous reports [691415]. All statistics were completed using SPSS version 20 (IBM Corp Armonk NY). Significance was set at p???0.05. Results A total of 95 patients with a median age 77 years (range: 48-91 years) were identified between October 2005 and May 2011 (Table 1). All patients had biopsy-confirmed NSCLC with 38 (40%) having squamous cell carcinoma and 33 (34.7%) having adenocarcinoma. "
Lung_Cancer
"The innate immunity adaptor SARM translocates to the nucleus to stabilize lamins and prevent DNA fragmentation in response to pro-apoptotic signaling. PLoS One8: e7099423923041 24 QuY WangJ RayPS GuoH HuangJ et al (2011) Thioredoxin-like 2 regulates human cancer cell growth and metastasis via redox homeostasis and NF-?B signaling. J Clin Invest121: 212“22521123948 25 YaoJ LiangL HuangS DingJ TanN et al (2010) MicroRNA-30d promotes tumor invasion and metastasis by targeting Galphai2 in hepatocellular carcinoma. Hepatology51: 846“85620054866 26 AiJ TangQ WuY XuY FengT et al (2011) The role of polymeric immunoglobulin receptor in inflammation-induced tumor metastasis of human hepatocellular carcinoma. J Natl Cancer Inst103: 1696“171222025622 27 MiraccoC CeveniniG FranchiA LuziP CosciE et al (2010) Beclin 1 and LC3 autophagic gene expression in cutaneous melanocytic lesions. Hum Pathol41: 503“51220004946 28 LeeYJ HaYJ KangKJ HwangJS ChungWJ et al (2013) The Autophagy-Related Marker LC3 Can Predict Prognosis in Human Hepatocellular Carcinoma. PLoS One8: e8154024282606 29 SchumackerPT (2006) Reactive oxygen species in cancer cells: live by the sword die by the sword. Cancer Cell10: 175“17616959608 30 QiuF LiZ HeL WangD (2013) HPLC-ESI-MS/MS analysis and pharmacokinetics of luteoloside a potential anticarcinogenic component isolated from Lonicera japonica in beagle dogs. Biomed Chromatogr27: 311“31722865633 31 TangH CaoW KasturiSP RavindranR NakayaHI et al (2010) The T helper type 2 response to cysteine proteases requires dendritic cell-basophil cooperation via ROS-mediated signaling. Nat Immunol11: 608“61720495560 32 BruchardM MignotG Derang¨reV ChalminF ChevriauxA et al (2013) Chemotherapy-triggered cathepsin B release in myeloid-derived suppressor cells activates the Nlrp3 inflammasome and promotes tumor growth. Nat Med19: 57“6423202296 33 ZhouR TardivelA ThorensB ChoiI TschoppJ (2010) Thioredoxin-interacting protein links oxidative stress to inflammasome activation. Nat Immunol11: 136“14020023662 34 ChenK ZhangS JiY LiJ AnP et al (2013) Baicalein inhibits the invasion and metastatic capabilities of hepatocellular carcinoma cells via down-regulation of the ERK pathway. PLoS One8: e7292724039823 35 DaiZJ WangBF LuWF WangZD MaXB et al (2013) Total flavonoids of Scutellaria barbata inhibit invasion of hepatocarcinoma via MMP/TIMP in vitro. Molecules18: 934“95023344202 36 GhasemiR GhaffariSH MomenyM PirouzpanahS YousefiM et al (2013) Multitargeting and antimetastatic potentials of silibinin in human HepG-2 and PLC/PRF/5 hepatoma cells. Nutr Cancer65: 590“59923659451 37 MenonSG SarsourEH KalenAL VenkataramanS HitchlerMJ et al (2007) Superoxide signaling mediates N-acetyl-L-cysteine-induced G1 arrest: regulatory role of cyclin D1 and manganese superoxide dismutase. Cancer Res67: 6392“639917616699 38 DeNicolaGM KarrethFA HumptonTJ GopinathanA WeiC et al (2011) Oncogene-induced Nrf2 transcription promotes ROS detoxification and tumorigenesis. Nature475: 106“10921734707 39 TschoppJ SchroderK (2010) NLRP3 inflammasome activation: The convergence of multiple signalling pathways on ROS production?Nat Rev Immunol10: 210“21520168318 40 SorbaraMT GirardinSE (2011) Mitochondrial ROS fuel the inflammasome. Cell Res21: 558“56021283134 41 WenH GrisD LeiY JhaS ZhangL et al (2011) Fatty acid-induced NLRP3-ASC inflammasome activation interferes with insulin signaling. Nat Immunol12: 408“41521478880 42 ChowMT SceneayJ PagetC WongCS DuretH et al (2012) NLRP3 suppresses NK cell-mediated responses to carcinogen-induced tumors and metastases. Cancer Res72: 5721“573222986739 43 WangC PanY ZhangQY WangFM KongLD (2012) Quercetin and allopurinol ameliorate kidney injury in STZ-treated rats with regulation of renal NLRP3 inflammasome activation and lipid accumulation. PLoS One7: e3828522701621 44 HuQH ZhangX PanY LiYC KongLD (2012) Allopurinol quercetin and rutin ameliorate renal NLRP3 inflammasome activation and lipid accumulation in fructose-fed rats. Biochem Pharmacol84: 113“12522426011 45 ChuangSY YangCH ChouCC ChiangYP ChuangTH et al (2013) TLR-induced PAI-2 expression suppresses IL-1? processing via increasing autophagy and NLRP3 degradation. Proc Natl Acad Sci U S A110: 16079“1608424043792 46 GalluzziL VitaleI AbramsJM AlnemriES BaehreckeEH et al (2012) Molecular definitions of cell death subroutines: recommendations of the Nomenclature Committee on Cell Death 2012. Cell Death Differ19: 107“12021760595 47 WenS NiuY LeeSO ChangC (2014) Androgen receptor (AR) positive vs negative roles in prostate cancer cell deaths including apoptosis anoikis entosis necrosis and autophagic cell death. Cancer Treat Rev40: 31“4023993415 48 ZhangY ZhaoL LiX WangY YaoJ et al (2014) V8 a newly synthetic flavonoid induces apoptosis through ROS-mediated ER stress pathway in hepatocellular carcinoma. Arch Toxicol88: 97“10723835921 49 FengR WangSY ShiYH FanJ YinXM (2010) Delphinidin induces necrosis in hepatocellular carcinoma cells in the presence of 3-methyladenine an autophagy inhibitor. J Agric Food Chem58: 3957“396420025272 50 LongoL PlatiniF ScardinoA AlabisoO VasapolloG et al (2008) Autophagy inhibition enhances anthocyanin-induced apoptosis in hepatocellular carcinoma. Mol Cancer Ther7: 2476“248518723493 51 HuH LiZ ChenJ WangD MaJ et al (2011) P16 reactivation induces anoikis and exhibits antitumour potency by downregulating Akt/survivin signaling in hepatocellular carcinoma cells. Gut60: 710“72120971978 52 J¸rgensenHG AllanEK JordanidesNE MountfordJC HolyoakeTL (2007) Nilotinib exerts equipotent antiproliferative effects to imatinib and does not induce apoptosis in CD34+ CML cells. Blood109: 4016“401917213283 53 PapeleuP LoyerP VanhaeckeT ElautG GeertsA et al (2003) Trichostatin A induces differential cell cycle arrests but does not induce apoptosis in primary cultures of mitogen-stimulated rat hepatocytes. J Hepatol39: 374“38212927923 PLoS One one 1932-6203 Public Library of Science San Francisco USA 24505400 3914905 PONE-D-13-19136 .0088122 Research Medicine Drugs and Devices Non-Clinical Medicine Oncology Sulindac Compounds Facilitate the Cytotoxicity of ?-Lapachone by Up-Regulation of NAD(P)H Quinone Oxidoreductase in Human Lung Cancer Cells Sulindac Assists the Effect of ?-Lap through NQO1 Kung Hsiu-Ni 1 * Weng Tsai-Yun 2 Liu Yu-Lin 2 Lu Kuo-Shyan 1 * Chau Yat-Pang 2 3 * 1 Department of Anatomy and Cell Biology College of Medicine National Taiwan University Taipei Taiwan 2 Institute of Anatomy and Cell Biology School of Medicine National Yang-Ming University Taipei Taiwan 3 Department of Medicine Mackay Medical College New Taipei City Taiwan Szakacs Gergely Editor Hungarian Academy of Sciences Hungary * E-mail: kunghsiunigmail.com (HK); leonchaummc.edu.tw (YC); lksntu.edu.tw (KL) Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: HK YC. Performed the experiments: TW YL. Analyzed the data: HK TW YL. Wrote the paper: HK KL YC. 2014 5 2 2014 9 2 e88122 2 4 2013 5 1 2014 2014 Kung et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. ?-lapachone a major component in an ethanol extract of Tabebuia avellanedae bark is a promising potential therapeutic drug for various tumors including lung cancer the leading cause of cancer-related deaths worldwide. In the first part of this study we found that apoptotic cell death induced in lung cancer cells by high concentrations of ?-lapachone was mediated by increased activation of the pro-apoptotic factor JNK and decreased activation of the cell survival/proliferation factors PI3K AKT and ERK. In addition ?-lapachone toxicity was positively correlated with the expression and activity of NAD(P)H quinone oxidoreductase 1 (NQO1) in the tumor cells. In the second part we found that the FDA-approved non-steroidal anti-inflammatory drug sulindac and its metabolites sulindac sulfide and sulindac sulfone increased NQO1 expression and activity in the lung adenocarcinoma cell lines CL1-1 and CL1-5 which have lower NQO1 levels and lower sensitivity to ?-lapachone treatment than the A549 cell lines and that inhibition of NQO1 by either dicoumarol treatment or NQO1 siRNA knockdown inhibited this sulindac-induced increase in ?-lapachone cytotoxicity. In conclusion sulindac and its metabolites synergistically increase the anticancer effects of ?-lapachone primarily by increasing NQO1 activity and expression and these two drugs may provide a novel combination therapy for lung cancers. This work was supported by grants (NSC 101-2320-B-002-020-MY3 NSC 98-2320-B-715-001-MY3 (YPC) and NSC 101-2320-B-002-008) from the National Science Council Taiwan. The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction ?-Lapachone a natural o-naphthoquinone originally obtained from lapacho trees in South America has promising anti-tumor activity on various tumor cells [1]-[6] and has been tested as an anti-tumor candidate drug in phase I/II/III clinical trials in combination with other chemotherapy drugs [1] [7]. Its anti-cancer activity is thought to be due to the two-electron reduction of ?-lapachone catalyzed by NAD(P)H : quinone oxidoreductase (NQO1 DT-diaphorase) using NAD(P)H or NADH as electron source [1] [8] [9]. In the presence of NQO1 ?-lapachone undergoes reduction to an unstable hydroquinone which rapidly undergoes a two-step oxidation back to the parent compound perpetuating a futile redox cycle and resulting in the generation of reactive oxygen species (ROS) including superoxides [8] [10]“[12]. These reactive species can oxidize thiol groups of the mitochondrial potential transition pore complex leading to increased mitochondrial inner membrane permeability reduced mitochondrial membrane depolarization and release of cytochrome c resulting in cell death [13] [14]. Because NQO1 is more highly expressed in various solid cancers than in normal tissues [15] ?-lapachone can selectively kill these cancer cells. In addition higher NQO1 expression or activity in cancer cells may make them more sensitive to ?-lapachone. In order to increase the clinical efficacy of ?-lapachone many methods have been examined to increase NQO1 expression or activity in cancer cells [3] [5] [16]“[19]. "
Lung_Cancer
"DNA whole exome sequencing (DNA-WES) is currently the most popular technology; however this yields low sensitivity in low purity tumors. RNA sequencing (RNA-seq) covers the expressed exome with depth proportional to expression. We hypothesized that integrating DNA-WES and RNA-seq would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method called UNCeqR that detects somatic mutations by integrating patient-matched RNA-seq and DNA-WES. In simulation the integrated DNA and RNA model outperformed the DNA-WES only model. Validation by patient-matched whole genome sequencing demonstrated superior performance of the integrated model over DNA-WES only models including a published method and published mutation profiles. Genome-wide mutational analysis of breast and lung cancer cohorts (n = 871) revealed remarkable tumor genomics properties. Low purity tumors experienced the largest gains in mutation detection by integrating RNA-seq and DNA-WES. RNA provided greater mutation signal than DNA in expressed mutations. Compared to earlier studies on this cohort UNCeqR increased mutation rates of driver and therapeutically targeted genes (e.g. PIK3CA ERBB2 and FGFR2). In summary integrating RNA-seq with DNA-WES increases mutation detection performance especially for low purity tumors. cover-date 2014 INTRODUCTION Somatically acquired sequence mutations (nucleotide substitutions insertions and deletions) fuel the initiation and progression of cancer (1). Knowledge of mutations in patient specimens informs therapeutic management (23) and in large patient cohorts provides the basis to assess recurrently altered genes that may drive molecular pathogenesis (14“5). DNA whole exome sequencing (DNA-WES) is currently the popular technology to sequence cancer genomes and has led to an abundance of discoveries in many cancer types (46“8). However detecting somatic mutations by DNA-WES with high sensitivity and specificity remains a challenge (79“10) as evidenced by validation rates of 73% in repeated sequencing and by large inter-rater disagreement among different groups analyzing the same sequencing data (710). The biggest challenge is high quality mutation detection in low purity tumors (2911) which are prevalent in widespread cancer types such as breast and lung (12). Advances in somatic mutation detection could improve cancer genome characterization and lead to new diagnostic and therapeutic targets. Somatic mutation detection is dependent on tumor features the sequencing technology and the method of statistical modeling (8“913“17). To detect somatic mutations algorithms compare tumor and patient-matched germline sequencing based on a variety of models (46“7913“17). A tumor's degree of normal contamination and clonal heterogeneity decrease tumor purity. Low purity affects the fraction of mutated DNA observed out of all DNA at a genomic site the mutant allele fraction (MAF) (812). MAF is not often 100% can be slightly above zero in low purity tumors and varies across the genome depending on the prevalence of clones possessing a given mutation and on copy number alterations (7912). DNA-WES targets roughly 200 000 exonic regions and in practice can yield depths of 100X or greater over targeted regions (46). DNA-WES has limitations including variable capture-efficiency and incomplete exome coverage (718). In cases of high MAF mutation detection is straightforward as only a small number of reads are needed to detect the mutation with confidence. The combination of low depth and low MAF make mutation detection very difficult because of low statistical power a result of the scant sample size in which to observe and detect the low prevalence mutation. Increased mutation detection sensitivity and specificity could be achieved by statistical improvements by increasing sequencing quantity or by increasing sequencing quality. In cancer profiling projects such as The Cancer Genome Atlas (TCGA) (46) and in clinical sequencing (219) DNA-WES is utilized for mutation detection while RNA sequencing (RNA-seq) (20) is performed for gene expression fusion transcript and splicing analyses. Beyond those applications RNA-seq provides an observation of the underlying tumor DNA sequence via transcription and can be used to detect sequence variants (21). In fact we have previously used RNA-seq to confirm mutations from DNA-WES (4). A few earlier studies have used RNA-seq alone for genome-wide identification of somatic mutations (22“25) and germline variants (2627). However RNA-seq has challenges including dependency on gene expression which limits the genes that can be measured for sequence mutations and quality control requirements which when not considered result in abundant false positive variants (112128“30). For these reasons RNA-seq has not been the standard for somatic mutation detection. Herein we posed the original hypothesis that integrating patient-matched tumor RNA-seq and tumor DNA-WES would enable superior mutation detection versus DNA-WES alone. We developed a first-of-its-kind method UNCeqR that simultaneously analyzes DNA-WES and patient-matched RNA-seq to detect somatic mutations genome-wide. UNCeqR was applied to large breast and lung cancer cohorts and evaluated with respect to simulation and whole genome sequencing validation. Subsequently genome-wide analysis of UNCeqR mutations led to novel discoveries in tumor genomics. MATERIALS AND METHODS Data sources DNA-WES and RNA-seq alignments in BAM (31) format for 176 lung squamous cell carcinoma cases and for 695 breast cancer cases were acquired from TCGA at ://cghub.ucsc.edu (Supplementary Table S1). RNA-seq were paired 50 nt read from Illumina HiSeq aligned by MapSplice (432). DNA-WES were paired 76“100 nt reads from Illumina Genome Analyzer aligned by BWA (33). All lung and breast cancer cases had germline DNA-WES tumor DNA-WES and tumor RNA-seq and were referred to as the triplet cohorts. A subset of 12 lung and 91 breast tumors also had germline RNA-seq available and were referred to as the quadruplet cohorts. DNA whole genome sequencing (DNA-WGS) was acquired from TCGA for tumors in this cohort (breast: n = 43 lung: n = 17) which consisted of BWA alignments of paired 100 nt reads. Exonic coordinates were extracted from the TCGA Genome Annotation File (http://tcga-data.nci.nih.gov/docs/GAF/GAF.hg19.June2011.bundle/outputs/TCGA.hg19.June2011.gaf) and padded with 10 flanking positions for a total of 222 055 exons. Published mutations (lung: LUSC_Paper_v8.aggregated.tcga.somatic.maf breast: genome.wustl.edu_BRCA.IlluminaGA_DNASeq.Level_2.5.1.0.somatic.maf) expression subtypes DNA copy number calls and tumor purity calls (12) were obtained when available from TCGA. Numerical purity calls of 1 with an incongruent ˜Low purity™ categorical call were censored. Sequencing quality filtering The high quality data filter applies to alignments and genomic positions similar to earlier studies (914). High quality sequenced bases from tumor alignments had base quality ?20 and occurred in a parent alignment with the following properties: mapping quality ? 20 sum of reference mismatches insertions and deletions ?2 a proper pair orientation not a marked duplicate or qc-failure not within the terminal two bases and the singular best alignment. All bases from germline alignments were accepted. High quality genomic positions were those with germline depth ?10 tumor high quality depth ?5 in RNA or DNA no homopolymer > 4 on either side of the site proportion of high quality bases ?0.25 in RNA or DNA and without an insertion or deletion event at 10% allele fraction within 50 positions in germline sequencing. The high quality data filter was applied prior to detecting to tumor variant alleles. The high quality variant filter passes DNA or RNA variant alleles without significant strand bias compared to germline alleles (chi-square P < 0.01) with at least one read on both strands for indel variants with major variant allele prevalence (the proportion of major variant reads out of all variant reads) ?0.75 and a MAD of distance to the end of its aligned read sequence ?1. Somatic mutation detection The UNCeqR algorithm detected somatic mutations within exons based on input of tumor and patient-matched germline sequence alignments. The algorithm applied the following steps to each genomic site within exons: filter for high quality data;identify germline alleles from germline reads that have at least 2% allele prevalence; add population polymorphisms and mapping artifact alleles to germline alleles (see following section ˜Population polymorphisms and mapping artifacts™).Using tumor sequences: let g be the number of reads matching germline allelesdetermine most frequent allele that does not match germline alleleslet k be the number of reads with this major variant allelelet n = k + g.If major variant allele is insertion or deletion re-align nearby indel alleles: scan 20 neighboring sites to find site s with maximum k and same major variant alleleif current site is not s. Move major variant read count from current site to s by incrementing k at s and decrementing g at s by current site's major variant read count.Continue to next site.If high quality variant filter is passed apply statistical test otherwise P = 1 if k = 0 else P = NA.. A set of mutation detection models applied the algorithm with different inputs and statistical models. UNCeqRDNA takes tumor DNA-WES as input and models the corresponding read counts by a beta-binomial distribution. For a variant site with read count \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$k_{{\rm DNA}}$\end{document} the P-value to assess whether this variant allele is a somatic mutation was calculated by \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{} \begin{equation*} P_{{\rm DNA}} = 1 - \sum\limits_{i = 0}^{k - 1} {\left( {\begin{array}{*{20}c} {n_{{\rm DNA}} } \\ i \\ \end{array}} \right)} \frac{{B\left( {i + \alpha _{{\rm DNA}} n_{{\rm DNA}} - i + \beta _{{\rm DNA}} } \right)}}{{B(\alpha _{{\rm DNA}} \beta _{{\rm DNA}} )}} \end{equation*} \end{document}where B is the beta function and ?DNA and ?DNA are parameters of the null distribution where the variant allele is not a somatic mutation. Specifically ?DNA and ?DNA are estimated using randomly sampled sites until 50 000 have passed the high quality data filter in both tumor DNA-WES and tumor RNA-seq. In real data analysis these sampled sites may include real somatic mutations and thus the estimates of ? and ? are conservative which may lead to conservative P-value estimates. However based on mutation rates reported in prior studies (8 mutations per 1 000 000 sites (4)) less than one mutation is expected in these sampled sites and thus our estimates of ? and ? would be good approximations of the estimates from a set of non-somatic mutation sites. The UNCeqRRNA model is identical to UNCeqRDNA substituting tumor RNA-seq for tumor DNA-WES. The UNCeqRMETA model combines P-values from UNCeqRDNA and UNCeqRRNA if RNA and DNA have the same major variant allele irrespective of filtering; otherwise the UNCeqRMETA P-value is set to that of UNCeqRDNA. In effect this condition precludes sites with only RNA variant evidence that are suggestive of RNA-editing (3435) from being called somatic mutations. UNCeqRMETA combines P-values by the Stouffer method (36“38) with weights of the root of their sample size (read depth at the site) as follows: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{} \begin{eqnarray*} &&P_{{\rm META}} = 1 - \\ &&\varPhi\left({\frac{{\varPhi ^{ - 1} \left( {1 - P_{{\rm DNA}} } \right)\sqrt {n_{{\rm DNA}} } + \varPhi ^{ - 1} \left( {1 - P_{{\rm RNA}} } \right)\sqrt {n_{{\rm RNA}} } }}{{\sqrt {n_{{\rm DNA}}^{} + n_{{\rm RNA}}^{} } }}} \right) \end{eqnarray*}\end{document}where \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi$\end{document} is the standard normal cdf and \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi ^{ - 1}$\end{document} is the inverse of \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document} }{}$\varPhi$\end{document} i.e. the quantile function of the standard normal distribution. If the RNA major variant equals the DNA major variant and PDNA = NA PMETA is set to PRNA. DNA and RNA variant read counts among putative false positives were unassociated supporting the usage of Stouffer's method (Supplementary Figure S1). Due to possible ambiguity around insertions and deletions (˜indels™) between DNA and RNA alignments high quality variant sites with an insertion or deletion major variant allele in one alignment and with the same variant allele (insertion or deletion) occurring within 20 sites as the major variant allele in the other alignment were merged to have the same genomic position prior to statistical testing. This indel merge allowed indel variants sites between DNA and RNA that represent the same variant to be recorded at the same site and allowed UNCeqRMETA to combine this DNA and RNA evidence despite slightly different representation in the sequence alignments. UNCeqR software consisted of modified samtools (31) Perl R and VGAM (39). The total number of applied statistical tests is reported in UNCeqR output to provide interested users the possibility of multiple testing adjustment. Population polymorphisms and mapping artifacts Population-level polymorphisms were acquired from dbSNP common version 137 via the UCSC genome browser (40). Variant alleles caused by ambiguous mapping artifacts were calculated by BlackOps (41) using 2 × 50 paired-end reads aligned by MapSplice. UNCeqR was applied to 45 TCGA RNA-seq of matched normal tissue specimens (not part of the lung or breast cohorts) to detect non-reference sequence variants representing further germline polymorphic and alignment artifact alleles. "
Lung_Cancer
"Anchorage of tissue cells to their physical environment is an obligate requirement for survival which is lost in mature hematopoietic and in transformed epithelial cells. Here we find that a lymphocyte lineage-restricted transcription factor Aiolos is frequently expressed in lung cancers and predicts markedly reduced patient survival. Aiolos decreases expression of a large set of adhesion-related genes disrupting cell-cell and cell-matrix interactions. Aiolos also reconfigures chromatin structure within the SHC1 gene causing isoform-specific silencing of the anchorage reporter p66Shc and blocking anoikis in vitro and in vivo. In lung cancer tissues and single cells p66Shc expression inversely correlates with that of Aiolos. Together these findings suggest that Aiolos functions as an epigenetic driver of lymphocyte mimicry in metastatic epithelial cancers. Int J Clin Exp Pathol Int J Clin Exp Pathol ijcep International Journal of Clinical and Experimental Pathology 1936-2625 e-Century Publishing Corporation 24427333 3885467 Original Activation of AKT/ERK confers non-small cell lung cancer cells resistance to vinorelbine Fan Da-Ping Zhang Yi-Mei Hu Xiao-Chen Li Jing-Jing Zhang Wei Department of Respiratory Medicine First Clinical Medical College Affiliated to Harbin Medical University Harbin China Address correspondence to: Dr. Wei Zhang Department of Respiratory Medicine First Clinical Medical College Affiliated to Harbin Medical University No. 23 Youzheng Street Harbin Heilongjiang Province China. Tel: 0451-85552560; 86-13030052121; E-mail: zhangwei_harbinyeah.net 2014 15 12 2013 7 1 134 143 30 10 2013 10 12 2013 IJCEP Copyright 2014 2014 Vinorelbine is a semi-synthetic vinca-alkaloid approved for the treatment of non-small cell lung cancer (NSCLC). However the lower objective response rate and higher adverse effects of vinorelbine hinder its wide use in treatment of advanced NSCLC. Therefore it is of great interest to uncover the biomarkers for sensitivity of NSCLC cells to vinorelbine to allow the identification of patients most likely to benefit from vinorelbine-based chemotherapy and to improve the therapy. In present work four NSCLC cell lines were divided into vinorelbine-sensitive (VS) group and vinorelbine-resistant (VR) group according to their sensitivities to vinorelbine. And then the gene expression profiles of these two groups was compared the differentially expressed genes (expression difference higher than 100% and p<0.05 totally 496 genes) were applied to Ingenuity Pathway Analysis (IPA). IPA results showed that NF-?B and PTEN signaling were predicted to be inactivated in VR cell lines which was partially validated by quantitative PCR or western blotting experiments. The higher expression of RAF1 mRNA and the activation of AKT/ERK proteins in VR NSCLC cell lines may confer resistance to vinorelbine. Our work may provide potential pathway signature for vinorelbine sensitivity and some therapeutic targets for combined therapy. Non-small cell lung cancer vinorelbine NF-?B signaling PTEN signaling AKT ERK Proc Natl Acad Sci U S A Proc. Natl. Acad. Sci. U.S.A pnas pnas PNAS Proceedings of the National Academy of Sciences of the United States of America 0027-8424 1091-6490 National Academy of Sciences 24550494 3948305 201319911 10.1073/pnas.1319911111 Biological Sciences Cell Biology Analysis of the tumor-initiating and metastatic capacity of PDX1-positive cells from the adult pancreas PDX1-positive cells from adult pancreas Ischenko Irene a Petrenko Oleksi b 1 Hayman Michael J. a 1 Departments of aMolecular Genetics and Microbiology and bPathology Stony Brook University Stony Brook NY 11794 1To whom correspondence may be addressed. E-mail: alexei.petrenkostonybrook.edu or michael.haymanstonybrook.edu. Edited by Douglas R. Lowy National Cancer Institute Bethesda MD and approved January 22 2014 (received for review October 22 2013) Author contributions: O.P. and M.J.H. designed research; I.I. and O.P. performed research; I.I. and O.P. contributed new reagents/analytic tools; O.P. and M.J.H. analyzed data; and O.P. and M.J.H. wrote the paper. 4 3 2014 18 2 2014 111 9 3466 3471 Significance Pancreatic cancer is characterized by aggressive growth and a high propensity for metastatic spread. Despite growing understanding of the genetic causes of pancreatic cancer the mechanism and timing of cancer metastasis the main cause of deaths in pancreatic cancer patients remain relatively unexplored. In this study we used experimental mouse models of pancreatic carcinogenesis to show that hyperactivation of the Ras/MAPK/ERK pathway and stabilization of the MYC protein are the two main driving forces behind the development of pancreatic cancer cells with high metastatic potential. Our results suggest that pancreatic cells bearing Kras mutation can be induced to differentiate into quasi-normal cells with suppressed tumorigenicity by selective inhibition of the MAPK/ERK/MYC signaling cascade. These findings may have important therapeutic implications. Pancreatic cancer is one of the deadliest human malignancies. A striking feature of pancreatic cancer is that activating Kras mutations are found in ?90% of cases. However apart from a restricted population of cells expressing pancreatic and duodenal homeobox 1 (PDX1) most pancreatic cells are refractory to Kras-driven transformation. In the present study we sought to determine which subsets of PDX1+ cells may be responsible for tumor growth. Using the Lox-Stop-Lox“KrasG12D genetic mouse model of pancreatic carcinogenesis we isolated a population of KrasG12D-expressing PDX1+ cells with an inherent capacity to metastasize. This population of cells bears the surface phenotype of EpCAM+CD24+CD44+CD133“SCA1? and is closer in its properties to stem-like cells than to more mature cell types. We further demonstrate that the tumorigenic capacity of PDX1+ cells is limited becoming progressively lost as the cells acquire a mature phenotype. These data are consistent with the hypothesis that the adult pancreas harbors a dormant progenitor cell population that is capable of initiating tumor growth under conditions of oncogenic stimulation. We present evidence that constitutive activation of the mitogen-activated protein kinase (MAPK/ERK) signaling and stabilization of the MYC protein "
Lung_Cancer
"This approach discovered 3 nodules that were in different lobes than the primary tumor. Nodule fluorescence was independent of size metabolic activity histology tumor grade and vascularity. Conclusions This is the first-in-human demonstration of identifying pulmonary nodules during Thoracic surgery with NIR imaging without a priori knowledge of their location or existence. NIR imaging can detect pulmonary nodules during lung resections that are poorly visualized on computed tomography and difficult to discriminate on finger palpation. Mol Cancer Mol. Cancer Molecular Cancer 1476-4598 BioMed Central 24655544 3998010 1476-4598-13-68 10.1186/1476-4598-13-68 Research Downregulation of BRAF activated non-coding RNA is associated with poor prognosis for non-small cell lung cancer and promotes metastasis by affecting epithelial-mesenchymal transition Sun Ming 1 sunmingnjmu.edu.cn Liu Xiang-Hua 1 liuxianghuanjmu.edu.cn Wang Ke-Ming 2 422825636qq.com Nie Feng-qi 3 957714486qq.com Kong Rong 1 31815857qq.com Yang Jin-song 4 yangjinsongmedmail.com.cn Xia Rui 1 273459189qq.com Xu Tong-Peng 3 1034045558qq.com Jin Fei-Yan 1 759729211qq.com Liu Zhi-Jun 1 sm13776403108126.com Chen Jin-fei 4 1423594097qq.com Zhang Er-Bao 1 273459189qq.com De Wei 1 deweinjmu.edu.cn Wang Zhao-Xia 2 zhaoxiawang88hotmail.com 1Department of Biochemistry and Molecular Biology Nanjing Medical University Nanjing 210029 People™s Republic of China 2Department of Oncology Second Affiliated Hospital Nanjing Medical University Nanjing Jiangsu 210011 People™s Republic of China 3Department of Oncology First Affiliated Hospital Nanjing Medical University Nanjing People™s Republic of China 4Department of Oncology Nanjing First Hospital Nanjing Medical University Nanjing P. R. China 2014 21 3 2014 13 68 68 16 9 2013 13 3 2014 Copyright 2014 sun et al.; licensee BioMed Central Ltd. 2014 sun et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Recent evidence indicates that long noncoding RNAs (lncRNAs) play a critical role in the regulation of cellular processes such as differentiation proliferation and metastasis. These lncRNAs are found to be dysregulated in a variety of cancers. BRAF activated non-coding RNA (BANCR) is a 693-bp transcript on chromosome 9 with a potential functional role in melanoma cell migration. The clinical significance of BANCR and its™ molecular mechanisms controlling cancer cell migration and metastasis are unclear. Methods Expression of BANCR was analyzed in 113 non-small cell lung cancer (NSCLC) tissues and seven NSCLC cell lines using quantitative polymerase chain reaction (qPCR) assays. Gain and loss of function approaches were used to investigate the biological role of BANCR in NSCLC cells. The effects of BANCR on cell viability were evaluated by MTT and colony formation assays. Apoptosis was evaluated by Hoechst staining and flow cytometry. Nude mice were used to examine the effects of BANCR on tumor cell metastasis in vivo. Protein levels of BANCR targets were determined by western blotting and fluorescent immunohistochemistry. Results BANCR expression was significantly decreased in 113 NSCLC tumor tissues compared with normal tissues. Additionally reduced BANCR expression was associated with larger tumor size advanced pathological stage metastasis distance and shorter overall survival of NSCLC patients. Reduced BANCR expression was found to be an independent prognostic factor for NSCLC. Histone deacetylation was involved in the downregulation of BANCR in NSCLC cells. Ectopic expression of BANCR impaired cell viability and invasion leading to the inhibition of metastasis in vitro and in vivo. However knockdown of BANCR expression promoted cell migration and invasion in vitro. Overexpression of BANCR was found to play a key role in epithelial-mesenchymal transition (EMT) through the regulation of E-cadherin N-cadherin and Vimentin expression. Conclusion We determined that BANCR actively functions as a regulator of EMT during NSCLC metastasis suggesting that BANCR could be a biomarker for poor prognosis of NSCLC. Background Non-small cell lung cancers (NSCLCs) including adenocarcinomas and squamous cell carcinomas are the predominant forms of lung cancer and account for the majority of cancer deaths worldwide [1]. Despite recent advances in clinical and experimental oncology the prognosis of lung cancer remains poor with a 5-year overall survival rate of around 11% [2]. A continuing problem of NSCLC tumorigenesis is the metastasis of cancer cells which is the main cause of death in patients. Thus a detailed understanding of the mechanisms and molecular pathways activated in metastatic cells is crucial in identifying new treatment options for anticancer therapy that target metastasis. The invasion and metastasis of cancer cells are landmark events that involve many changes in cellular behavior and lead to different steps of the metastatic cascade [34]. One of the most crucial steps in the metastatic cascade is the acquisition of invasive capabilities including turnover of cell-cell junctions degradation of the cell matrix and activation of pathways that control cytoskeletal dynamics in cancer cells. This process is accompanied by multiple changes in gene expression such as the loss of epithelial markers and a gain in mesenchymal markers [56]. Over the past decade cell and tumor biologists have identified the key role of epithelial-mesenchymal transition (EMT) in cancer cell metastasis a biological process where epithelial cells lose their polarity and undergo transition into a mesenchymal phenotype [7]. EMT enhances tumor cell invasion in response to environmental triggers and augments invasive functions by promoting Rac-dependent mesenchymal migration and also contributes to cell growth and survival [89]. Important hallmarks of EMT include the loss of E-cadherin expression and increased expression of non-epithelial cadherins such as N-cadherin. The loss of E-cadherin expression is a fundamental event in EMT and a crucial step in the progression of papillomas to invasive carcinomas [10]. To date substantial effort has been devoted to understanding how EMT is regulated during cancer progression. It has been verified that EMT can be initiated by external signals such as hepatocyte growth factor (HGF) epidermal growth factor (EGF) transforming growth factor (TGF)-b and fibroblast growth factor (FGF) [11]. In addition to these signaling pathways triggered by membrane receptors recent studies have highlighted the importance of noncoding RNAs in the regulation of the epithelial phenotype by controlling EMT inducers. The miR-200 family has been found to control EMT by downregulating the expression of Zeb factors [12]. Furthermore the long noncoding RNA (lncRNA) MALAT-1 promoted EMT by regulating ZEB1 ZEB2 and Slug expression and activating Wnt signaling [13]. The lncRNAs are important new members of the ncRNA family that are greater than 200 nt and are unable to be translated into proteins. These lncRNAs are often expressed in a spatial- and temporal-specific pattern. Although very few lncRNAs have been characterized in detail they have been found to participate in a large range of biological processes including modulation of apoptosis and invasion reprogramming stem cell pluripotency and parental imprinting. These findings indicate that lncRNAs play a major role in the regulation of the eukaryotic genome [14-16]. Researchers have linked the dysregulation of lncRNAs with diverse human diseases in particular cancers [17-19]. Therefore identification of cancer-associated lncRNAs and investigation of their molecular and biological functions in controlling EMT are important in understanding the molecular biology of NSCLC metastasis and progression. BRAF-activated non-coding RNA (BANCR) an 693-bp lncRNA on chromosome 9 was firstly found by Ross J. Flockhart et.al via RNA-seq screen for transcripts affected by the expression of the oncogene BRAFV600E. BANCR is overexpressed in melanoma cells and crucial for melanoma cell migration [20]. In this study we investigated the effects of BANCR expression on NSCLC cell phenotypes in vitro and in vivo. Moreover we also showed that alteration of BANCR expression can influence E-cadherin N-cadherin and Vimentin protein levels which indicated that BANCR affected NSCLC cells invasion and metastasis partly via epithelial-mesenchymal transition. This study advances our understanding of the role of lncRNAs such as BANCR as a regulator of pathogenesis of NSCLC and facilitate the development of lncRNA-directed diagnostics and therapeutics. Results BANCR expression was downregulated and correlated with poor prognosis of NSCLC BANCR expression levels were investigated in 113 paired NSCLC samples and adjacent histologically normal tissues using quantitative polymerase chain reaction (qPCR) assays. BANCR expression was significantly downregulated (P?<?0.01) in 79% (89/113) of cancerous tissues compared with normal tissues (Figure 1A). BANCR expression levels in NSCLC were significantly correlated with tumor size (p?=?0.001) advanced pathological stage (p?<?0.001) and lymph node metastasis (p?=?0.001). However BANCR expression was not associated with other parameters such as gender (p?=?0.232) and age (p?=?0.616) in NSCLC (Table 1)."
Lung_Cancer
"clinic of the Department of Pulmonary Diseases Radboud University Nijmegen Medical Centre (RUNMC) by a nurse practitioner and the attending physician. Patients and partners are invited to participate together but both are welcome to participate on their own if they do not have a partner or their partner is not willing to participate. Patients and/or partners who are interested are provided with an information leaflet. If they are willing to participate they are invited for a research interview in which in- and exclusion criteria are assessed and informed consent is taken. At other participating hospitals (Department of Pulmonary Diseases Canisius-Wilhelmina Hospital Nijmegen; Department of Pulmonary Medicine Rijnstate Arnhem; Department of Oncology Elkerliek Hospital Helmond; Department of Pulmonary Medicine Jeroen Bosch Hospital; Department of Pulmonary Diseases Maas hospital Pantein Boxmeer) patients and their partners will be sent a letter with the invitation to participate in the study. One week later the researcher calls the patients to answer possible questions and asks whether the patient and partner are interested in participation. If so they are invited for a research interview at the RUNMC. Eligibility We include patients and/or partners of patients who are (a) diagnosed with cytologically or histologically proven non-small cell lung cancer or small cell lung cancer and (b) have received or are still under treatment. Exclusion criteria for both patient and partner include: (a) being under 18 years of age (b) not being able to understand or use the Dutch language (c) former participation in MBSR or Mindfulness-Based Cognitive Therapy (MBCT) (d) current and regular treatment by psychologist or psychiatrist (e) current participation in other psychosocial programme and (f) physical or cognitive (<26 on the Mini-Mental State Examination (MMSE)) impairments hampering participation in MBSR training or completion of questionnaires. Baseline Patients and partners are interviewed to obtain demographics and clinical characteristics after which they are screened for cognitive impairments with the MMSE [33]. After that baseline questionnaires including the Distress Thermometer (DT) [3435] are administered followed by randomization. shows the assessment instruments and time points at which the questionnaires are administered to patients and partners. Measurements and corresponding time points for patient and partner Measure Target T0 T1 T2 pt pr pt pr pt pr MMSE Cognitive impairments x x DT General distress x x HADS Psychological distress x x x x x x QLQ-C30 Quality of life x x x QLQ-LC13 Quality of life x x x SIP Impact of sickness x x x SPPIC Caregiver burden x x x CRA-SE Caregiver self-esteem x x x IMS-S Relationship satisfaction x x x x x x MIS Communication about cancer x x x x x x SAIL Spirituality x x x x x x FFMQ Mindfulness skills x x x x x x SCS Self-compassion x x x x x x RRS-EXT Rumination x x x x x x IES Psychological stress reaction x x x x x x Diary Health care use work absence Monthly during study period for pt Calendar Mindfulness adherence Monthly during study period for pt and pr Note. T0 = Baseline measurement; T1 = Post-intervention measurement; T2= 3-month follow-up measurement; pt = Patient; pr = Partner; MMSE = Mini Mental State Examination; DT = Distress Thermometer; HADS = Hospital Anxiety and Depression Scale; QLQ-C30 = Quality of Life “ Cancer; QLQ-LC13 = Quality of Life “ Lung Cancer; SIP = Sickness Impact Profile; SPPIC = Self-Perceived Pressure from Informal Care; CRA-SE = Caregiver Reaction Assessment “ Care-Derived Self-Esteem; IMS-S = Investment Model Scale-Satisfaction; MIS = Mutuality and Interpersonal Sensitivity; SAIL = Spiritual Attitude and Involvement List; FFMQ = Five Facet Mindfulness Questionnaire; SCS = Self-Compassion Scale; RRS-EXT = Rumination Response Scale “ Extended Version; IES = Impact of Event Scale. Randomization Randomization is stratified according to setting and minimized for (a) stage of disease (curative versus palliative) (b) baseline level of anxiety and depressive symptoms (anxiety or depression subscale score of Hospital Anxiety and Depression Scale (HADS) <8 versus ?8) (c) treatment during MBSR (no treatment versus chemo- and/or radiotherapy) and (d) participation (patient alone versus partner alone versus patient and partner together). Randomization is computerized using a randomization website specifically designed for this study on which the researcher can fill out the required data. The researcher communicates treatment allocation to the nurse practitioner who informs the patient and/or partner. Follow-up assessments Follow-up assessments take place post intervention and at three-month follow-up. Participants who have access to the internet and have an email address receive the questionnaires online. If not they receive the questionnaires on paper along with a reply envelope. In case of drop-out the researcher tries to contact the participant by phone to complete a minimum set of outcome measures and to identify the main reason for drop-out. Intervention The MBSR curriculum used is primarily based on the Mindfulness-Based Stress Reduction programme as developed by Kabat-Zinn [28] but contains some elements of the MBCT programme by Segal Williams and Teasdale [29] like psycho-education on the interrelatedness of feelings and thoughts. Moreover some modifications have been made to make the intervention more suitable for patients with lung cancer and their partners such as psycho-education about grief [36]. In addition a mindful communication exercise in which partners talk with each other about the cancer was added. The programme consists of 8 weekly 2.5-hour sessions a silent day between session six and seven and home practice assignments of about 45 minutes 6 days per week. Participants receive a set of CDs with guided mindfulness meditation exercises for home practice and a folder with information and home practice instructions for the forthcoming week. shows the content of the MBSR programme per session. The MBSR courses are taught by mindfulness teachers with extensive training in MBSR. They all fulfil the advanced criteria of the Center for Mindfulness of the University of Massachusetts Medical School [37] and maintain a regular personal meditation practice. Teachers were trained supervised and assessed to ensure their competency levels met the qualification criteria to instruct the MBSR classes. During the trial teachers will receive weekly supervision and a number of sessions will be videotaped to evaluate competence and adherence with the Mindfulness-Based Interventions “ Teaching Assessment Criteria [38]. Content of MBSR programme per session Theme of session Meditation exercise Didactic teaching Homework 1. Automatic pilot - Bodyscan - Intention of participating - Bodyscan - Raisin exercise - Eating one meal mindfully - Attention for routine activity 2. Mindfulness of the breath - Bodyscan - Imagery exercise to demonstrate relationship between thoughtsand feelings - Bodyscan - Sitting mediation with focus on breath - Attention for breath - Awareness of pleasant events - Attention for routine activity 3. Observing limits - Yoga while lying down - Seeing exercise to demonstrate difference between observation and interpretation - Bodyscan or yoga - 3-min breathing space - Sitting meditation - Awareness of unpleasant events - 3-min breathing space 4. Opening up to distress - Sitting mediation with focus on breath body and sound - Interrelatedness of feelings thoughts and bodily sensations - Bodyscan or yoga - Sitting meditation - 3-min breathing space - Psychoeducation about grief - Awareness of stress reactions - 3-min breathing space 5. Responding to distress - Sitting mediation with focus on breath body sound thoughts difficulty - Reacting versus responding - Meditation by choice - Coping with grief - Awareness of reaction in difficult situation - Walking meditation - Awareness of communication difficulties - 3-min breathing space - 3-min breathing space 6. Mindful communication - Yoga in standing position - Mindful communication exercise about effect of lung cancer with their own partner - Sitting meditation or yoga - 3-min breathing space - Awareness of communication - 3-min breathing space during stress Silent day - Varying meditation exercises - Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbach™s ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearson™s r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European Organisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy “ Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness."
Lung_Cancer
"CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in . The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other organs were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and extension primers for each SNP. Primer information for selected tag SNPs was listed in Table 5. Table 5 Primers used in this study SNP_ID Alleles 1st-PCR primer sequences 2nd-PCR primer sequences UEP sequences rs7525160 G/C ACGTTGGATGCAAAATCAAGGTTTAAAGTC ACGTTGGATGTTCTGACATGTACTGCCTGC CCCTGTTGCCTGGGTTTTTCT rs3886100 G/A ACGTTGGATGGGCCTCAGATCCTCAAAATC ACGTTGGATGTGAGCTGTTTCAGCCAAGAG GAGCCAAGAGGACACTTAG rs11118167 T/C ACGTTGGATGATGTGTGTAGTCACTTAGCC ACGTTGGATGATAATGGCAGATTTAAGGGC CAATGATAAATGAATACTGTGTTCTATC rs9429782 G/T ACGTTGGATGACACGCGGGATCCATCGGAA ACGTTGGATGAACGAGTTTCGCTGGCAGAG GGTGCAGCAGCAGAG rs10494885 C/T ACGTTGGATGGTGTAATGCCACAGACATGC ACGTTGGATGCCAGCCAACTGACCTTTATG CTTCTGATTTTCTTTCCTGTTAC rs7542544 C/A ACGTTGGATGGCTAAGAGCCATTAGTGTGC ACGTTGGATGAACGTGGTGGTGCCCAAACA CCATGACCCCAAAGC rs6691117 A/G ACGTTGGATGAGAGTACCAGGAAACAGGAG ACGTTGGATGACCCTACCATGACAAACCCG CCGGGCTGACATCTAAATCTGA rs6656401 G/A ACGTTGGATGAAAGGACACACACAGAGGAG ACGTTGGATGCGTTGATGTTCCTTGGCTTG CTCTGTCTCCATCTTCTC rs2296160 C/T ACGTTGGATGCCAGAATTCCTCAGCAAAAC ACGTTGGATGCCAGAGTGATGTTTTGTGAC CGTGCCTTTTGTCTTCCTTTTAGGT rs9429942 T/C"
Lung_Cancer
"In our newly developed approach for the fast generation of tumor cohorts we have overcome this obstacle as exemplified for three GEMMs; two lung cancer models and one mesothelioma model. Three elements are central for this system; (i) The efficient derivation of authentic Embryonic Stem Cells (ESCs) from established GEMMs (ii) the routine introduction of transgenes of choice in these GEMM-ESCs by Flp recombinase-mediated integration and (iii) the direct use of the chimeric animals in tumor cohorts. By applying stringent quality controls the GEMM-ESC approach proofs to be a reliable and effective method to speed up cancer gene assessment and target validation. As proof-of-principle we demonstrate that MycL1 is a key driver gene in Small Cell Lung Cancer. cancer chimeras embryonic stem cells mouse models MycL1 Introduction The toolbox for generating genetically engineered mouse models (GEMMs) has been steadily growing over the last couple of years. Most of the new technologies deal with genetic modification methods of embryonic stem cells (ESCs) for instance using a recombinase or an integrase to introduce genetic elements in predefined loci (Belteki et al 2003; Beard et al 2006; Seibler et al 2007) or Zinc finger TAL effector and RNA-guided nucleases to create mutant alleles with high flexibility and ease (Urnov et al 2010; Miller et al 2011; Cong et al 2013). Although these technologies increase versatility they provide minor time gains as the time spent to genetically engineer ESCs is often dwarfed by the time required to cross the resulting mice to existing GEMMs in order to obtain the final experimental cohort. This is particularly an issue in cancer research as spontaneous tumor development in GEMMs often requires the (in)activation of multiple genetically modified oncogenes and tumor suppressor alleles. For instance we have developed GEMMs for Small Cell Lung Cancer (SCLC) and mesothelioma that have four and six conditional alleles respectively (Meuwissen et al 2003; Jongsma et al 2008). This genetic complexity has hampered the use of GEMMs to study additional candidate cancer genes for their role in tumor initiation and progression. This problem will only become more pressing now genome-wide association studies and genetic screens result in the identification of an increasing number of candidate genes whose roles in tumorigenesis need confirmation in relevant in vivo models (Chin et al 2011). One strategy to accelerate target gene validation in mouse models is to apply the CRISPR/Cas system in zygotes for the one-step generation of animals carrying mutations in multiple genes (Wang et al 2013). Though extremely powerful this technique needs to be further developed to allow for the controlled introduction of transgenes and/or conditional alleles. Also off-target effects are likely to occur and need to be taken into account (Fu et al 2013). We and others have presented an alternative and well-controlled strategy by re-deriving ESCs from well-established and validated GEMMs and use these GEMM-ESCs as the basis for further genetic engineering either by classic gene targeting gene editing or recombinase-mediated transgene integration (Nichols et al 2009; Huijbers et al 2011; Premsrirut et al 2011). These GEMM-ESCs contain the same genetic modifications as present in the original model plus the newly introduced genetic modification for instance a frequently observed point mutation in a tumor suppressor gene or a transgene with conditional expression of an oncogene that is often amplified or otherwise overexpressed in a particular tumor type. These modified GEMM-ESCs can be used to generate high quality chimeras that are likely equally susceptible to tumor induction as the original GEMM and serve as a defined experimental cohort differing only by the introduced modification. Main advantages of this approach are speed and flexibility as it permits comparative analysis of phenotypic consequences of different genes and allelic series in a particular GEMM. Instead of crossing the chimeric mice to the desired strain and genetic background ready-to-use GEMMs can now be produced on-demand. This reduces both costs and total number of mice needed per experiment as establishing and maintaining a large breeding colony is expensive and always leads to surplus animals that cannot be used in experiments. Furthermore genetic drift is prevented as the same GEMM-ESCs lie at the basis of each experimental cohort for a particular cancer type. This approach also allows for the establishment of a GEMM-ESC bank for distribution ESCs with complex genotypes; a resource that likely gives a new impulse to the generation of custom-made mouse models either for preclinical use or cancer gene validation. The feasibility of the GEMM-ESC production approach depends on reliable procedures and robust quality controls including (i) ESC culture procedures that guarantee maintenance of pluripotency; (ii) monitoring of the genomic stability of ESCs; (iii) procedures for routine production of chimeras with a major contribution of the GEMM-ESCs to different tissues. The chimeric lines should also be germline-competent to facilitate the production of permanent lines if desirable. Here we present the performance of the GEMM-ESC approach based on three different GEMMs two models for lung cancer and one for mesothelioma. We employed the Flp-mediated integration technology (Flp-in) as proof-of-concept for genetic engineering of GEMM-ESCs. Finally we apply the GEMM-ESC approach to validate Mycl1 as a bona fide oncogene in SCLC. Results ESC culture and pluripotency The first step in the GEMM-ESC approach is the derivation of ESC from the desired GEMMs which are often backcrossed to a specific strain background such as C57BL/6J (black coat color) or FVB/n (white coat color). Using classical culture conditions ESC derivation can be achieved for permissive strains such as 129 and C57BL/6N but various strains are thought to be non-permissive (Kawase et al 1994; Schoonjans et al 2003). New culture protocols now permit the derivation of ESCs from refractory strains (Ying et al 2008). In these protocols culture media containing fetal bovine serum (FBS) and feeder cells are replaced by defined N2B27 medium supplemented with two inhibitors (2i): the MEK1 inhibitor PD0325901 which effectively blocks MEK/ERK signaling thereby preventing ESC differentiation and the GSK3 inhibitor CHIR99021 which acts as a Wnt agonist thereby stimulating growth of ESCs. We used this 2i medium to derive ESCs from wild-type C57BL/6J and FVB/n strains and obtained 4 and 12 ESC clones respectively (). Culturing of ESCs in 2i medium improved their overall quality. Expression analysis of the core ESC transcription factors Nanog Oct4 (also known as Pou5f1) and Sox2 in wild-type 129/Ola ESCs showed a higher percentage of na¯ve Nanogpos;Oct4pos;Sox2pos ESCs under the new culture conditions as compared to the classic conditions (supplementary Fig S1). These results demonstrate that 2i medium is more effective in maintaining ESCs in a na¯ve undifferentiated state. ESC derivation. Genotype Strain Embryos ICM ESC clones Efficiencya(%) Male Female Wt C57LB/6J 30 17 4 13.3 4 0 Wt FVB/n 35 22 12 34.3 6 6 Kras LSL-G12D C57BL/6J 57 24 8 14.0 8 0 Rb1F/F ;Trp53F/F FVB/n;129/Ola 145 63 13 8.9 13 0 Nf2F/F ;Trp53F/F ;Cdkn2a*/* FVB/n;129/Ola 65 31 5 7.7 5 0 Rb1F/F ;Trp53F/F ;Col1A1-frt FVB/n;129/Ola 32 26 5 15.6 3 2 a ESC derivation efficiency: percentage of isolated embryos resulting in established ESC clones. Quality controls of derived ESCs The quality of derived ESCs was assessed on the basis of three criteria: expression of stem cell markers chimeric contribution and germline transmission. The first criterion was determined by FACS profiling. ESC clones from either C57BL/6J (clone 1.4) or FVB/n (clone 1.3) showed robust expression of Nanog Oct4 and Sox2 in the majority of cells (Fig 1A and B). To test chimeric contribution of the derived ESCs each clone was injected into host blastocysts or morulae to generate chimeric animals that were scored for their coat-color chimerism. When ˜black™ C57BL/6J ESCs were injected in ˜white™ FVB/n hosts the coat color of the resulting chimeras was scored for the absence of white fur and vice versa. We compared three injection strategies for the wild-type C57BL/6J ESC clone: (i) blastocysts injected with 12“15 cells with direct implantation into foster mothers; (ii) morulae injected with 4“8 cells with direct implantation; (iii) morulae injected with 4“8 cells with implantation after overnight culture of the embryos in embryo culture medium (Fig 1C). Based on the coat color contribution the latter strategy clearly outperformed the other two with 100% coat color contribution for several mice. Similar results were obtained for a wild-type FVB/n ESC clone (Fig 1D). The increase in coat color contribution came at a price as the number of liveborn chimeras relative to the total number of implanted embryos was lower for the morula injections than for the blastocyst injections (Fig 1E and F and supplementary Table S1). This drop in viability is likely the result of aberrant embryonic development leading to resorption in utero or in milder cases the birth of runted animals. In addition some foster mice implanted with morulae injected with FVB/n or FVB/n;129/Ola ESCs were unable to give natural birth and caesarean section was required. To ensure a practical workflow we decided to inject C57BL/6J ESC clones into morulae (FVB/n) as for this background the benefit of improved chimerism outweighed the complications. In case of FVB/n or mixed FVB/n;129/Ola ESC clones we used more fail-safe blastocyst injections (C57BL/6N). Figure 1 Optimization of ESC culture and injection procedures. A FACS profile of three core ESC transcription factors Nanog Oct4 and Sox2 in C57BL/6J ESC clone 1.4cultured in 2i medium (Blue). Red population represents the isotype control. B BFACS profile of three core ESC transcription factors Nanog Oct4 and Sox2 in FVB/n ESC clone 1.3 cultured in 2i medium (Blue). Red population represents the isotype control. C Three ESC injection procedures for C57BL/6J ESC clone 1.4 were evaluated on basis of chimeric contribution. Injecting 4“8 ESC per FVB/n morula followed by overnight culture in KSOM medium provided the best chimeras with nine mice showing 100% coat color contribution (entirely black). male female n.d. D Two ESC injection procedures for FVB/n ESC clone 1.3 were evaluated on basis of chimeric contribution. Blastocyst injections resulted in reasonable chimeras whereas ESC injections into morulae in combination with overnight culture improved chimerism with three out of four live borns showing 100% chimerism (entirely white). The 80% chimera was a runt and died before weaning. male female n.d. EF Efficiency of ESC injection procedures shown in (C) and (D) based on number of viable chimeras born compared to the total number of implanted embryos for C57BL/6J ESC clone 1.4 (E) and FVB/n ESC clone 1.3 (F). Note for both ESC clones fewer chimeras were observed relative to the total number of implanted embryos when comparing ESC injected morulae to ESC injected blastocysts. "
Lung_Cancer
" The median time to distant metastases was 18.4 ± 10.7 months in HCRT group and 16.7 ± 7.7 months in 3DCRT group (p?=?0.7). In the HCRT group distant metastases involved only the contralateral chest in three patients (30%) and only the abdominal cavity in three patients (30%). Both sites were affected by distant metastases in four further patients (40%). Discussion We demonstrate in a retrospective analysis of patients with MPM and treated at our institution with trimodality therapy that the use of postoperative highly conformal radiation techniques (HCRT) reduces local recurrence in comparison to 3DCRT. A recurrence analysis showed that in the case of 3DCRT 4 of 25 patients (16%) had a local recurrence in regions that were clearly underdosed according to current radiation protocols (doses???45 Gy are recommended e.g. SAKK 17/04) in contrast to 0% of patients treated with HCRT. This supports the hypothesis that HCRT should improve local control in comparison to 3DCRT by improving target volume coverage. In our study patients treated with HCRT showed a tendency for improved progression free survival and local relapse free survival but did not benefit in terms of overall survival due to the high rates of distant relapses. Local control is important in patients with MPM for symptom control but also because some patients might benefit in terms of improved overall survival. Better local control after HCRT did not translate into improved overall survival in our patient series. Remarkably the rate of death due to intercurrent disease most often cardiac events was higher after HCRT (29%) in comparison to 3DCRT (4%). Since cardiac sparing is rather improved with HCRT the most likely explanation for this difference is patient selection. The urgent research question if postoperative radiotherapy impacts on overall survival after EPP is addressed by a randomized study currently conducted in Switzerland SAKK 1704. Patient accrual for this study was terminated in 2012 and the results are awaited. Even after trimodality treatment local recurrence remains high in some patient series. In a retrospective series of 49 patients treated with 3D-conformal RT after EPP and chemotherapy 67% of all recurrences included the ipsilateral hemithorax and 25% of all recurrences were local only [12]. Therefore improvement of radiotherapy is mandatory. In recent years radiotherapy has made enormous technical advances. More sophisticated highly conformal radiation techniques (HCRT) such as IMRT or rotational RT (VMAT) have become available and substituted for the older 3DCRT technique. The use of HCRT enables improvement in the dose distribution and target volume coverage. This is because with HCRT even complex target volumes such as the tumor bed of the costodiaphragmatic recess or the pericardium can be treated without or with little dose compromise and at the same time with optimal sparing of the normal tissue due to a steeper dose fall-off. Thus the use of HCRT should intuitively improve treatment outcome in terms of local tumor control. Our data suggest indeed that the use of HCRT bears considerable potential to improve on hemi-thoracic tumor control rates most likely due to improved target volume coverage. The poor local control rates and high rates of in-field recurrences following 3DCRT in our cohort may be due to suboptimal dose coverage or the restriction of the target volume to avoid critical ans both limitations inherent to the technique. After 3DCRT 4/24 (16.6%) in-field recurrences occurred in regions covered with only 30“43 Gy. In the case of 3DCRT mixed beams of photons and electrons were used to optimize dose coverage. The match of these beams often causes cold and hot spots of dose coverage. Poor matching during daily treatment can result in >20% dose inhomogeneity in the junction area [7]. In addition as the spinal cord is blocked when the tolerance dose of 45 Gy is reached insufficient dose delivery to parts of the mediastinum has been observed resulting in underdosage to the tumor bed [7]. Favorable tumor control after IMRT as part of a trimodality therapy has previously been reported by Rice et al. [13]. The median overall survival of their 61 patients treated was 14.2 months with a locoregional recurrence rate of 13% and only 5% local in-field recurrences reported. The median dose prescribed was only 45 Gy and half of all patients received doses even less than 45 Gy. The reason for the comparatively higher local control rate reported by Rice et al. in comparison to our study remains unclear. It may be explained by patient selection and the comparatively short median overall survival of 14.2 months in comparison to 20.8 months in the present series and by the retrospective study design. The shorter median overall survival reported by Rice et al. could be caused by more advanced tumor stages (40 T3 8 T4 26 N2) more aggressive subtypes (14 biphasic 4 sarcomatoid) and the fact that neoadjuvant chemotherapy was not routinely administered. With regard to toxicity the major dose limiting an for postoperative radiotherapy of MPM is the contralateral lung. Lung complications such as radiation pneumonitis are likely to be higher with multi-field techniques such as IMRT or VMAT in comparison to 3DCRT where opposed beams from 0 and 180 degrees are usually used thereby optimally sparing the contralateral lung. With regard to dose escalation and lung sparing surgery protons might prove superior to IMRT/VMAT. Severe complications of the lung with grade 4 and 5 pneumonitis after IMRT have been reported [712]. Since then special attention to the contralateral lung dose has been given during the treatment planning process and pneumonitis rates should be lower today. Intuitively the use of HCRT should reduce toxicity and complication probabilities of esophagus heart liver and kidney however no data with regard to these toxicity endpoints comparing both treatment techniques are available. In recent years the need for extensive surgery has been questioned and less radical surgery has been advocated such as pleurectomy/decortication. In the context of reduced surgery the anatomical situation makes it difficult for RT to be applied to the entire pleural space however it can still be considered as a targeted local postoperative option in case of incomplete resection. Future clinical studies are required to define the role of radiotherapy in combination with lung sparing surgery. Conclusions In summary the use of HCRT for treatment of patients with MPM after EPP is likely to improve local control rates. The local control improvement did not improve the overall survival due to the high rates of distant relapses in this series. Further improvement of trimodal or systemic therapy is required to tackle the high risk of distant recurrences. "
Lung_Cancer
"In summary the addition of RNA-seq to DNA-WES substantially boosted mutation sensitivity for low purity tumors. . Example of somatic mutation only detectable by RNA and DNA integration. Mutation detected by UNCeqRMETAP = 1e-16. Read alignment display from integrative genomics viewer (43) for a low purity breast tumor at the major mutational hotspot of PIK3CA (47). Increased mutation rates of driver and therapeutically-targeted genes To determine if UNCeqRMETA made new mutation discoveries in patients™ tumor genomes UNCeqRMETA mutations were compared to previously published patient mutation profiles on the triplet cohorts (46). Specifically tumors™ non-silent mutations (those that change protein sequence and can contribute to cancer development) of UNCeqRMETA that were novel compared to published profiles were tabulated within genes known to be relevant in cancer development (187 genes from the Cancer Gene Census (49) and published driver genes (46)). Five hundred and sixty-seven novel mutations were detected covering 67% of these cancer-relevant genes. 69% of these novel mutations had DNA-WES and RNA-seq evidence indicating that the addition of RNA contributed to the vast majority of these novel mutations. Grouped by patients 44% of patients™ tumors had an increase of at least one new mutation in this cancer-relevant gene set and among patient tumors with zero published mutations in this gene set 42% had at least one new mutation discovered by UNCeqRMETA. Grouped by gene many of these novel mutations comprised large gains in absolute counts and in percent increase (A and B) including MAP3K1 and GATA3 in breast cancer and NOTCH2 and CDKN2A in lung cancer. These gains spanned all nucleotide mutation types (substitution insertion and deletion) and protein coding impacts; for instance novel GATA3 mutations had abundant novel frameshift insertion frameshift deletion non-synonymous and nonsense mutations (Supplementary Figure S8). Notably mutation rates for genes targeted by drugs were increased by UNCeqRMETA specifically PIK3CA FGFR2 and ERBB2. Therefore UNCeqRMETA largely advanced published state-of-the-art mutation profiles with cancer-relevant mutations by utilizing the integration of RNA-seq and DNA-WES. . Novel mutation discoveries in cancer-relevant genes. Increases in mutation absolute count versus relative increase are displayed for selected genes (A and B). Percentage increase is the number of novel UNCeqRMETA mutations over the number of published mutations (46)for a gene. Absolute counts for select genes among breast (C) and lung (D) cancer expression subtypes. Breast cancer subtypes (48) were previously found to have distinct rates of mutations across four genes (TP53 GATA3 MAP3K1 and PIK3CA) and in combination with other evidence such as pathway alterations are understood to be driven by their distinct somatic alterations (6). Across these four genes novel mutations detected by UNCeqRMETA occurred most frequently in tumors of the same expression subtype as had been previously reported. Specifically the greatest number of novel mutations occurred in the following subtypes: TP53 in Basal MAP3K1 in Luminal A PIK3CA in Luminal A and GATA3 in Luminal A and Luminal B (C). In lung cancer there were appreciable increases in NOTCH1 and NOTCH2. The largest numbers of novel UNCeqRMETA NOTCH1 and NOTCH2 mutations occurred in different lung cancer expression subtypes (50) of Classical and Basal respectively (D). Combining novel UNCeqR non-silent mutations with those previously reported both of these genes now had significant association with expression subtype (NOTCH1 Fisher's test P < 0.02; NOTCH2 Fisher's test P < 0.03). Therefore the advance of UNCeqRMETA over published mutation profiles included new subtype-specific driving mutations new putative subtype-specific driver genes and new patients with mutations in driver genes. DISCUSSION Herein we sought to determine if adding patient-matched RNA-seq to DNA-WES would improve somatic mutation detection. To this end we developed UNCeqR a first-of-its-kind method that integrates RNA-seq and DNA-WES to detect somatic mutations. By simulation and validation in whole genome sequencing the UNCeqRMETA model that integrates DNA and RNA had significantly superior performance to models based on DNA alone (UNCeqRDNA Strelka and published mutation profiles). Then we applied UNCeqR to large breast and lung cohorts (n = 871) and analyzed their integrated RNA and DNA mutations resulting in several novel characterizations of tumor genomics. We report for the first time a remarkable finding that low purity tumors experience the largest gains in total mutations and in mutation signal (MAF) when adding RNA-seq to DNA-WES. Also we originally report that that MAF tends to be elevated in RNA versus DNA among expressed genes and that this phenomenon is cancer-specific. Based on these observations we conclude that rare cancerous cells within a tumor may exhibit over-expression relative to the tumor's normal cells which increases the concentration of cancer cell's mutations in a locus™ expressed transcripts thus boosting the RNA mutation signal. In contrast low purity tumors™ DNA mutation signal even if copy number altered may be drowned out by the normal cell DNA and cannot achieve the magnitude of the RNA mutation signal. High purity tumors™ smaller increases in RNA mutant allele signal versus DNA could be caused by mutant allele-specific expression or the presence of minor cancer clones within the tumor. In summary RNA-seq when added to DNA-WES is particularly useful for mutation detection in low purity tumors."
Lung_Cancer
"The same procedures were repeated at a distance of 1 cm creating parallel lesions in order to analyse the lung tissue in between the lesions for thermal damage. In addition two implanted capsules in the lung tissue simulating a lung nodule were resected with either the laser or the monopolar cutter. The resection surfaces were then examined by magnetic resonance imaging and histology for tissue damage. Finally we created a 2-cm wide mark on the lung surface to test the resection capacity of both instruments within 1 min. RESULTS The laser created sharply delineated lesions with a vaporization and coagulation zone without thermal damage of the surrounding lung tissue. With lowering the working speed each zone was extended. At a working speed of 10 mm/s the mean vaporization depth using the laser was 1.74 ± 0.1 mm and the mean coagulation depth was 1.55 ± 0.09 mm. At the same working speed the monopolar cutter demonstrated a greater cutting effect (mean vaporization depth 2.7 ± 0.11 mm; P < 0.001) without leaving much coagulation on the resection surface (mean coagulation depth 1.25 ± 0.1 mm; P = 0.002). In contrast to the laser the monopolar cutter caused thermal damage of the adjacent lung tissue. The adjacent tissue injury was detected in histological examination as well as in the MRI findings. Adjacent lung tissue after lung metastasectomy using the monopolar cutter was hyper-intensive in T2-weighted MR imaging indicating a severe tissue damage. No significant changes in signal intensity were observed in T2-weighted imaging of the adjacent lung tissue after using the laser for lung resection. One minute of laser applied at a 100-watt output penetrated a lung surface area of 3.8 ± 0.4 cm2 compared with 4.8 ± 0.6 cm2 of surface after application of the monopolar cutter (P = 0.001). S The monopolar cutter possesses indeed a greater cutting capacity than the laser but it also causes more adjacent tissue injury. Thus laser resection might be preferred for lung metastasectomy. Electrosurgical scalpel Laser Lung metastases Lung resection Tissue damage BMC Urol BMC Urol BMC Urology 1471-2490 BioMed Central 24612599 3975282 1471-2490-14-26 10.1186/1471-2490-14-26 Research an-specific and tumor-size-dependent responses to sunitinib in clear cell renal cell carcinoma Tsuchiya Norihiko 1 tsuchiyamed.akita-u.ac.jp Yuasa Takeshi 2 takeshi.yuasajfcr.or.jp Maita Shinya 1 yamightyyahoo.co.jp Narita Shintaro 1 narishindoc.med.akita-u.ac.jp Inoue Takamitsu 1 takamitudoc.med.akita-u.ac.jp Numakura Kazuyuki 1 numakuradoc.med.akita-u.ac.jp Saito Mitsuru 1 mitsaitomed.akita-u.ac.jp Satoh Shigeru 1 shigerusdoc.med.akita-u.ac.jp Yonese Junji 2 jyonesejfcr.or.jp Habuchi Tomonori 1 thabuchidoc.med.akita-u.ac.jp 1Department of Urology Akita University Graduate School of Medicine Akita Japan 2Department of Urology Cancer Institute Hospital Japanese Foundation for Cancer Research Tokyo Japan 2014 11 3 2014 14 26 26 20 7 2013 28 2 2014 Copyright 2014 Tsuchiya et al.; licensee BioMed Central Ltd. 2014 Tsuchiya et al.; licensee BioMed Central Ltd. This is an Open Access distributed under the terms of the Creative Commons Attribution License (http://creativecommons./licenses/by/2.0) which permits unrestricted use distribution and reproduction in any medium provided the original work is properly credited. Background Tyrosine kinase inhibitors (TKIs) have been used as standard therapy for patients with advanced renal cell carcinoma (RCC). However information on factors predicting response to treatment with TKIs is lacking. This study aimed to assess the association between initial tumor size involved ans pre-treatment C-reactive protein (CRP) levels and reduction in tumor size in patients with clear cell RCC (CCRCC) treated with sunitinib. Methods Patients with advanced CCRCC with target lesions with a maximum diameter???10 mm treated with sunitinib were evaluated. The tumor diameter representing the best overall response was designated as the post-treatment tumor diameter. Results A total of 179 lesions in 38 patients were analyzed. an-specific analysis demonstrated that pre-treatment diameter of lung metastatic lesions had a moderate inverse association with percent reduction in post-treatment tumor diameter (R?=?0.341). Lung lesions showed significantly greater percent reductions in diameter than liver and kidney lesions (P?=?0.007 and 0.002 respectively). Furthermore based on a CRP cut-off level of 2.0 mg/dl mean tumor size reduction was significantly greater in patients with low CRP levels than in patients with high CRP levels in lesions with diameters?<?20 mm (P?=?0.002). CRP level had no effect on mean size reduction in lesions with a diameter???20 mm. Conclusions Patients with CCRCC with smaller lung metastatic lesions and lower CRP levels may achieve greater percent reductions in tumor size with sunitinib therapy than patients with extra-pulmonary lesions large lung lesions and/or higher CRP levels. Advanced renal cell carcinoma Sunitinib Tumor size Tumor response C-reactive protein Background In the era of cytokine therapy tumor response to treatment in advanced or metastatic renal cell carcinoma (RCC) has been reported to vary according to the ans involved [12]. Longer overall survival and a higher response rate to therapy with interferon-? or a combination of interleukin-2 and interferon-? were observed in patients with only lung metastasis compared with those with extra-pulmonary metastasis [12]. Complete remission (CR) after treatment with tyrosine kinase inhibitors (TKIs) which mainly target vascular endothelial growth factor receptors remains a rare event but most patients who do achieve CR have either lung metastasis alone or only lymph node involvement [34]. However most cancer clinical trials evaluate tumor response using the response evaluation criteria in solid tumors (RECIST) in which the longest diameters of target lesions in multiple ans are summed. Tumor response in individual metastatic lesions in specific ans has not been delineated. A reduction in tumor size >10% calculated as the sum of the longest diameter of the target lesions was significantly associated with both time to treatment failure and overall survival suggesting that size reduction of target lesions may predict the outcome of treatment with TKIs [5]. In addition Yuasa et al. recently demonstrated that a smaller initial tumor size predicted a good response to TKIs and that the maximum response was achieved in lung lesions [6]. TKIs have shown significant clinical benefit in advanced clear cell RCC (CCRCC) in large randomized trials [7-9]. However the reported objective responses vary according to the different types of TKIs and a recent phase II trial failed to demonstrate any clinical efficacy of sunitinib in non-CCRCC [10]. Tumor size reduction may thus be affected by many factors including initial tumor size involved ans tumor histology tumor aggressiveness or type of TKI used. In this study we evaluated the association between initial tumor size of individual lesions in specific ans and reduction in tumor size in patients with CCRCC treated with sunitinib. Methods Patients and tumor measurement A total of 38 patients with advanced CCRCC who received at least two cycles of sunitinib at Akita University Hospital and at the Cancer Institute Hospital of the Japanese Foundation for Cancer Research were enrolled in this institutional review-board-approved retrospective study. Pathological diagnosis was made by radical nephrectomy in 30 patients and by percutaneous biopsy in eight patients who were not indicated for surgical treatment because of a significantly higher total volume of metastatic lesions compared with the primary lesion. The initial dose of sunitinib was 50 mg/day which was reduced to 37.5 mg/day based on the patient™s physique age and performance status. Sunitinib was initiated on a 28 days on/14 days off schedule and a dose reduction to 25 mg/day or complete cessation was considered in the event of grade 3 or higher toxicity according to the Common Terminology Criteria for Adverse Events (CTC-AE). All lesions were evaluated using a multidetector computed tomography scanner and lesions???10 mm in diameter were considered target lesions. The maximum diameter of each target lesion was measured before treatment with sunitinib (pre-treatment tumor diameter) and every 2“3 months thereafter. The tumor diameter at the point when best overall response was achieved based on the RECIST version 1.0 was adopted as the post-treatment tumor diameter. In this study the most common metastatic ans including lung liver and lymph nodes as well as the kidney were subjected to analysis. Statistical analysis The association between pre-treatment tumor diameter and percent change between pre- and post-treatment tumor diameters for each lesion was assessed by Pearson™s correlation coefficient. The Kruskal Wallis test was used to compare differences in percent change in tumor diameter between the four different ans. The Mann“Whitney U test was used to compare differences between two groups. A receiver-operator curve (ROC) was constructed to find the pre-treatment tumor diameter predicting tumor response to sunitinib treatment. A value of P?<?0.05 was considered statistically significant. Results Patients and target lesions The patients included 30 men and eight women with a median age of 62 years (range 27“81 years). The patients™ characteristics are listed in Table 1. The best response to sunitinib treatment was CR in one patient (3%) partial response (PR) in 11 (29%) stable disease (SD) in 23 (61%) and progressive disease (PD) in three (8%). The objective response rate was 32% and the clinical benefit rate (CR?+?PR?+?SD for at least 3 months) was 92%. A total of 179 lesions ranging from 10 to 106 mm were measured and analyzed in 38 patients. These lesions were localized as follows: 124 in the lung 12 in the liver 24 in the lymph nodes and 19 in the kidney. Of the 15 patients with kidney tumors seven who underwent nephrectomy had target lesions in the contralateral kidney including two patients with multiple lesions. The remaining eight patients had primary kidney tumors that were diagnosed by percutaneous needle biopsy. Table 1 Patients™ characteristics Characteristic No. of patients (%) Sex ??Male 30 (78.9) ??Female 8 (21.1) Age y ??Median [range] 62 [27“81] ECOG performance status ??0 25 (65.8) ??1 7 (18.4) ??> 1 6 (15.8) MSKCC risk category ??Favorable 8 (21.1) ??Intermediate 20 (52.6) ??Poor 10 (26.3) Target ans ??Lung 31 (81.6) ??Liver 6 (15.8) ??Lymph node 11 (28.9) ??Kidney 15 (39.5) Nephrectomy ??Yes 30 (78.9) ??No (biopsy) 8 (21.1) Prior treatments ??None 27 (71.1) ??Cytokines alone 4 (10.5) ??Sorafenib?±?cytokines 7 (18.4) Associations between pre-treatment tumor diameter and percent change in target lesion size in different ans The associations between pre-treatment tumor diameter and percent change in size of each target lesion in each of four ans were analyzed separately."
Lung_Cancer
"Our group demonstrated that the sensitivity and specificity of the VENTANA ALK assay were 100% and 98% respectively [12]. The VENTANA ALK (D5F3) IHC assay was approved to detect ALK rearrangement in pathology practice in the EU and some Asian countries including China and Japan. However the application of the VENTAMA ALK IHC assay requires a VENTANA automated platform which is not available in most pathology labs. In this study we applied IHC analysis using CST™s D5F3 antibody to detect ALK rearrangement in a Chinese lung adenocarcinoma patient cohort to assess the sensitivity and specificity of IHC analysis. In the third detection method a qRT-PCR assay (Amoy Diagnostics Xiamen China) approved by European Conformity (CE marking) and the China Food and Drug Administration (CFDA) was applied on formalin-fixed paraffin embedded (FFPE) samples to analyze the discordant cases of IHC and FISH. Materials and method Clinical materials and tissue microarray (TMA) construction This study included 297 FFPE samples with lung adenocarcinoma diagnosed at the Cancer Institute and Hospital Chinese Academy of Medical Sciences (CICAMS) in Beijing between January 2009 and March 2012. Among the 297 cases 218 were unselected and 79 cases were not effectively treated using conventional treatment. Among the 218 unselected cases 178 (with enough tissue) were constructed onto seven TMAs to represent biopsies. A 1.5 mm diameter core was taken from the cancer area based on hematoxylin and eosin (H&E)-stained sections of each sample. The remaining 39 unselected cases (without enough tissue) and 79 selected cases were cut into tissue sections. In the cases where tissue sections/cores fell off the slides during FISH or IHC analysis tissue sections were re-cut. The collection of these specimens was approved by the National Cancer Center Ethics Committee. The patients™ medical records were reviewed to obtain their clinicopathological parameters including age at diagnosis sex smoking history tumor size histological classification and pathological TNM stage. IHC Immunohistochemical staining was performed on 4 ?m-thick FFPE tissue sections or TMAs. Briefly the slides were deparaffinized and antigen retrieval was then performed in a steam cooker for 1.5 minutes in 1 mM EDTA pH 9.0 (Maixin Biological Techology Co. Ltd. Fuzhou China). ALK (D5F3) rabbit monoclonal (Cell Signaling Technology Danvers MA USA) was applied at 1:150 in SigalStain antibody diluent (Cell Signaling Technology Danvers MA USA) for 1 h. Universal secondary antibody (DAKO) was applied for 15 min. Diaminobenzidine or 3-amino-9-ethylcarbazole was used as chromogens and slides were counterstained with haematoxylin before mounting. The criteria for scoring ALK were as follows. First the intensity was graded as 0 negative; 1 weak (light brown); 2 moderate (brown); and 3 strong (dark brown). Second the proportion of positive tumor cells was graded: 0 no positive cells; 1 <10%; 2 11%-30%; 3 31%-50%; 4 51-70%; and 5 >70%. A final score was derived by adding the two primary scores. Final scores of 0 were defined as œnegative expression (?); scores of 2“5 as œweakly positive expression (+); and scores of 6“8 as œstrongly positive expression (++). Fully automated VENTANA ALK (D5F3) IHC analysis was performed as previously described [12]. According to the manufacture™s scoring algorithm a binary scoring system (positive or negative for ALK status) was adopted to evaluate the staining results. The presence of strong granular cytoplasmic staining in tumor cells (any percentage of positive tumor cells) was considered to be ALK positive while the absence of strong granular cytoplasmic staining in tumor cells was deemed to be ALK negative. FISH FISH was performed on 3 ?m-thick FFPE tumor tissues using a break-apart probe specific to the ALK locus (Vysis LSI ALK Dual Color Break Apart Rearrangement Probe; Abbott Molecular Abbott Park Illinois USA) according to the manufacturer™s instructions. Tumor cells the nuclei of which had one or more FISH signals of each color were enumerated. A positive cell was defined as one in which the nucleus had split signals (two or more signal diameters apart) or a single orange signal (deleted green signal) in addition to fused and/or split signals. A sample was considered positive if >25 cells out of 50 were positive. If a sample had 5 to 25 positive cells (10 to 50%) another 50 tumor cells were counted. If the average percentage of positive cells in 100 tumor cells was <15% (<15/100) the sample was considered negative. If the average percentage of positive cells was ?15% (?15/100) the sample was considered positive. TMA cores with high backgrounds or very weak signals that affected the signal assessment were excluded from the analysis. Real-time quantitative reverse transcription PCR (qRT-PCR) The EML4-ALK fusion mRNA was detected by qRT-PCR using an AmoyDx EML4-ALK Fusion Gene Detection Kit (Amoy Diagnostics Xiamen China). Briefly total RNA was extracted with an AmoyDx FFPE RNA Kit (Spin Column) from 5“10 ?m-thick FFPE sections with over 70% tumor cells. For each sample 100“500 ng of extracted RNA was used for reverse transcription into cDNA at 42°C for 1 h. Real-time PCR was then carried out in each of the four reactions of the EML4-ALK Fusion Gene Detection Kit according to the manufacturer™s protocol. Reaction 1 amplifies EML4-ALK variants 12 3a and 3b (variants 1/2/3a/3b); reaction 2 amplifies EML4-ALK variants 4 and 4?; reaction 3 amplifies EML4-ALK variants 5a 5b 5? and 8 (variants 5a/5b/5?/8); and reaction 4 amplifies the reference gene beta-actin. All of the assays were performed on an Agilent Mx3000P QPCR instrument (Agilent Technologies Santa Clara CA). The following PCR procedure was used: an initial denaturation at 95°C for 5 min followed by 95°C for 25 s 64°C for 20 s and 72°C for 20 s to ensure the specificity and 31 cycles of 93°C for 25 s 60°C for 35 s and 72°C for 20 s to perform the data collection. The quantitative judgment was according to the fusion fluorescence signal. Assay reactions achieving Ct values of ?30 cycles were considered positive for one of the variants detected by that reaction mixture. A housekeeping gene (beta-actin) was used to control the integrity of the RNA. Statistical analysis The statistical analysis of the tumors™ size and age was carried out using Student™s t tests. The values are shown as mean?±?SD. The relationship between ALK+?and clinicopathological variables was analyzed with the chi-square test. Statistical significance was defined as p?<?0.05. Results Concordance of ALK IHC and FISH Using the newly developed antibody ALK (D5F3) we analyzed ALK expression in 297 lung adenocarcinoma cases. The cases with strongly or weakly positive ALK expression showed readily appreciable cytoplasmic staining (Figures 1A and 1B). In contrast the cases with negative expression did not show any discernable staining (C). Strong ALK expression was identified in 32 cases weak expression in 12 cases and no expression in 253 cases (). Representative cases of IHC staining FISH and qRT-PCR analysis in lung adenocarcinoma. (A-C) ALK IHC staining using CST™s D5F3 antibody. (A) Cytoplasmic reactivity of strong intensity in tumor cells (original magnification x40). (B) Weak to moderate cytoplasmic reactivity in tumor cells (original magnification x100). (C) No staining in tumor cells (original magnification x200). (D-F) FISH analysis using Vysis ALK Break-Apart probes. (D) The ALK+ case in which the majority of cells contained more than one copy of a single green signal without a corresponding orange signal in addition to fused signals using FISH analysis. Green arrow represents more than one copy of a single green signal red arrow represents single red or split red-green signals indicative of ALK-rearrangement and yellow arrow represents touching red-green signals not indicative of ALK-rearrangement. (E)ALK+ case with split red-green signals. (F) NSCLC case without ALK rearrangement. (G-I) VENTANA ALK (D5F3) IHC assay revealed no expression in ALK- patients and strong expression in ALK+ patients. (G) Strong ALK expression (original magnification x20). (H) Unspecific staining (original magnification x40). (I) No ALK expression (original magnification x20). (G-L) Graphs from qRT“PCR showing change in the normalized reporter signal (delta Rn) against PCR cycle number. (J)ALK fusion was detected at around 14 cycles of qRT-PCR analysis in a case with strong ALK expression. (K)ALK fusion was detected at around 28 cycles in a case with weak ALK expression. (L) No ALK fusion was detected with endogenous control gene beta-actin expressed normally. Correlation of IHC and FISH IHC Total ++ a + b - c FISH+ 31(96.9%) 5(41.7%) 0(0%) 36 FISH- 1(3.1%) 7(58.3%) 242(100%) 250 Total 32 12 242 286 astrongly positive ALK expression. b weakly positive ALK expression. cnegative ALK expression. FISH analysis was performed on the 297 cases to evaluate ALK gene rearrangement status. Two hundred and eighty-six out of 297 cases were informative for FISH analysis and 33 cases were identified with ALK+?(E). Thirty of the 33 ALK+?cases showed strong ALK expression and the other 3 showed weak ALK expression. Therefore there were 11 cases that showed ALK expression but were ALK-. We re-reviewed the FISH slides of the 11 discordant cases (2 cases with strong and 9 cases with weak ALK expression) and 3 cases (1 with strong and 2 with weak ALK expression) were identified as ALK+?while 8 (1 case with strong and 7 with weak ALK expression) were still ALK- ( F). Regarding the 3 ALK+?cases which were not identified by the original FISH analysis a case-by-case analysis revealed the following: Case 1 The dominant FISH signal pattern in this case was more than one copy of a single green signal without a corresponding orange signal in addition to fused signals (D). According to the ALK signal enumeration guide this indicated a deletion of the orange portion of the ALK probe which targeted the drug targeting area. Therefore we initially considered this case as negative. After re-reviewing the FISH analysis we found there were some areas containing scattered ALK+?cells with one or more copies of single green signals in addition to fused signals and a single red signal. The first 50 cells counted revealed 8 ALK+?cells. The second and third cell count in another 100 cells by different readers revealed 6 and 7 ALK+?cells respectively. If the first and third 50-cell count was considered the average percentage of positive cells reached 15%. Therefore this sample should be considered positive. Case 1 and 3 For these two cases originally constructed on TMA and IHC analysis showed strongly positive staining in one core and weakly positive staining in the other. After re-reviewing the FISH slides we found that there was indeed a small area of each core with a few cells containing subtle break-apart signals. As cell counts were difficult to perform in small areas containing not many cancer cells we cut the tissue sections. The IHC analysis still demonstrated strongly and weakly positive ALK expression respectively. The FISH analysis in the tissue sections showed ALK+. According to the final result of FISH analysis 36 out of the 286 lung adenocarcinoma cases were identified with ALK+. None of IHC negative cases were ALK+ demonstrating 100% sensitivity. Eight IHC-positive cases (1 strongly and 7 weakly positive cases) did not show ALK gene rearrangement resulting in 81.8% specificity. The concordance rate of IHC and FISH is 97.2% (). qRT-PCR and VENTANA ALK IHC analysis of discordant cases To further identify whether eight discordant cases of IHC and FISH carried ALK fusion at the RNA level a qRT-PCR analysis was applied. Positive qRT-PCR results were observed in 5 cases (1 strongly and 4 weakly positive cases) (Table 2). Among the 5 cases 3 (1 strongly and 2 weakly positive cases) were shown to have ALK expression using VENTANA ALK IHC analysis (G). The ALK fusion in these 3 cases was detected at around 14 of 30 qRT-PCR cycles (J). Regarding the other two cases although weak staining in cancer cells could be observed (H) they were considered negative according to the manufacturer™s scoring algorithm (details in Materials and Method section). The ALK fusion in these 2 cases was detected at around 28 of 30 qRT-PCR cycles (K). The remaining 3 of the 8 discordant cases showed neither VENTANA ALK staining nor ALK fusion (Figures 1I and 1L). Table 2 VENTANA IHC and qRT-PCR analysis of all weakly positive and discordant cases detected by CST ALK (D5F3) Sample ID FISH IHC (CST) IHC (VENTANA) qRT-PCR Variant type 9 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 37 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 67 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 94 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 98 Positive 1+ Positive EML4-ALK variant 1/2/3a/3b 28 Negative 2+ Positive EML4-ALK variant 1/2/3a/3b 171 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 203 Negative 1+ Positive EML4-ALK variant 1/2/3a/3b 21 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 36 Negative 1+ Negative EML4-ALK variant 1/2/3a/3b 41 Negative 1+ Negative Negative 39 Negative 1+ Negative Negative 74 Negative 1+ Negative Negative VENTANA ALK IHC and qRT-PCR assays were also applied to the remaining 5 of the 12 ALK weakly expressed cases which were concordant with FISH analysis. These 5 cases were shown to have ALK expression detected by VENTANA ALK IHC and ALK fusion revealed by qRT-PCR analysis (Table 2). Clinicopathological characteristics of patients with ALK+ Using FISH analysis as a standard detection method the clinicopathological characteristics of the ALK+?and ALK- patients were compared and the results are shown in Table 3. As the median ages of the positive and negative groups were 48 and 58 years respectively the ALK+ patients were significantly younger (p <0.001). Patients with ALK+ were more likely to have lymph node metastasis compared to ALK- patients (p = 0.002). No correlation was observed between ALK+ and ALK- cases in terms of sex smoking habit tumor size pT M factors or pathologic TNM stage. Table 3 Clinicopathologic comparisons between EML4“ALK fusion-positive and fusion-negative lung adenocarcinomas Overall EML4“ALK(+) EML4“ALK(?) n?=?287 n?=?37 (%) n?=?250 (%) P value Age Mean?±?SD 48.16?±?11.529 58.17?±?10.03 <0.001 Median 48 58 Range 24-70 25-81 Sex Male 20(13.1) 133(86.9) 0.999 Female 17(13.1) 113(86.9) Nonavailable 0 4 Smoking Never smoker 22(13.8) 138(86.2) 0.239 Ever smoker 9(8.9) 92(91.1) Nonavailable 6 20 Tumor size(mm) Mean?±?SD 38.42?±?24.263 37.59?±?16.837 0.872 Median 32.50 35.00 Range 7-100 10-90 pT status pT1 4(13.8) 25(86.2) 0.350 pT2 14(8.3) 154(91.7) pT3-T4 5(15.6) 27(84.4) Nonavailable 14 44 pN status pN0 2(2.0) 100(98.0) 0.002 pN1 11(16.7) 55(83.3) pN2-3 7(13.5) 45(86.5) Nonavailable 17 50 pTNM stages pStage I 2(2.5) 79(97.5) 0.028 pStage II 9(12.2) 65(87.8) pStage III 9(14.3) 54(85.7) Nonavailable 17 52 Discussion In this study we applied IHC and FISH analyses using CST™s D5F3 antibody in a Chinese lung adenocarcinoma sample cohort. An accurate FISH analysis depends on multiple factors including fine equipment skilled personnel well-preserved FFPE samples enough cancer cells etc. In this study two cores in TMAs were not identified with ALK+?in initial FISH analysis due to a lack of cancer cells. Similarly in biopsies the numbers of cancer cells is often very limited making an accurate FISH analysis difficult. With the IHC analysis in this study almost all of the cancer cells in the two cores showed ALK expression despite the fact that only a few ALK+?cells were revealed by FISH analysis. A <100% rate of cellular positivity in ALK+?tumors has been demonstrated to be due to the technical limitations of FISH analysis [13]. Therefore combining IHC and FISH analyses results in ALK status being more accurately evaluated in biopsies. IHC analysis using CST™s D5F3 antibody has been demonstrated with 100% sensitivity [1214-16] suggesting that IHC analysis is an effective way to prescreen patients for FISH analysis in the clinical diagnosis process [141517]. For IHC negative cases FISH analysis is not necessary. In strongly positive IHC cases FISH analysis also may not be necessary. Although there was one strongly positive IHC case which was shown with ALK- by FISH analysis the VENTANA ALK assay and qRT-PCR analysis revealed ALK expression and ALK fusion respectively. In addition it has been reported that the lung cancer patient with IHC-positive and FISH-negative ALK had a dramatic response to crizotinib [18]. Therefore the patient in our case may benefit from crizotinib. Weakly positive IHC cases must be carefully examined. In this study 7 out of 12 (58.3%) weakly positive cases were discordant with FISH analysis. Using the VENTANA ALK IHC assay three out of the seven weakly positive cases showed ALK expression and could be treated with crizotinib. Using qRT-PCR analysis five out of the seven weakly positive cases showed ALK fusion at the RNA level. Therefore there were two cases in which the qRT-PCR analysis result was discordant with the VENTANA ALK IHC assay. Compared to negatively expressed ALK cases without any staining (I) these two cases were indeed weakly stained in cancer cells using the VENTANA ALK IHC analysis (H). "
Lung_Cancer
" Patient characteristics in the thoracic surgery and non-thoracic surgery groups All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Cases 100 (185) 27.0 (50) 73.0 (135) 0.0001 # Age years a 70.3 (39“88) 74.6 (62“80) 68.7 (39“86) 0.0001 # Sex male 72.4 (134) 76.0 (38) 71.1 (96) 0.581 History of smoking 78.9 (213) 82.0 (41) 77.0 (104) 0.549 COPD diagnosed b 49.7 (92) 66.0 (33) 43.7 (59) 0.012 # COPD managed c 9.2 (17) 20.0 (10) 5.2 (7) 0.004 # COPD-related systemic comorbidities 57.3 (106) 60.0 (30) 56.3 (76) 0.739 Diabetes 20.0 (37) 30.0 (15) 16.3 (22) 0.061 Ischemic disease 7.6 (14) 10.0 (5) 6.7 (9) 0.532 Hypertension 40.5 (75) 40.0 (20) 40.7 (55) 1.000 Hyperlipidemia 11.4 (21) 10.0 (5) 11.8 (16) 0.799 n indicates number. aData are shown as mean (range). bindicates the patients who were firstly diagnosed as COPD at bronchoscopy. cindicates the patients who had been diagnosed as COPD before bronchoscopy. All other data are shown as% (numbers). #p?<?0.05. COPD: chronic obstructive pulmonary disease. Physical assessment variables among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value BMI (kg/m 2 ) a 22.2 (3.0) 22.3 (2.4) 22.1 (3.2) 0.760 Spirometric variables %VC a 108.8 (20.6) 104.5 (20.4) 110.4 (19.6) 0.031 FEV1 (ml) a 2126 (612) 1810 (591) 2242 (580) 0.0001 # FEV1/FVC a 67.6 (13.0) 62.7 (17.0) 69.5 (10.7) 0.01 # %FEV1 predicted a 101.4 (25.5) 93.7 (28.7) 104.3 (23.7) 0.020 # %IC a 87.8 (18.9) 85.3 (19.7) 88.7 (18.6) 0.314 Severity of airway obstruction 0.002 # Non-COPD 50.2 (93) 34.0 (17) 56.3 (76) ## GOLD grade 1 34.6 (64) 44.0 (22) 31.1 (42) GOLD grade 2 10.8 (20) 10.0 (5) 11.1 (15) GOLD grade 3 4.3 (8) 12.0 (6) 1.5 (2) ## GOLD grade 4 0 (0) 0 (0) 0 (0) Chest CT finding Emphysema 30.8 (57) 36.0 (18) 28.9 (39) 0.374 n indicates number. aData are shown as mean (SD). All other data are shown as% (numbers). #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. BMI: body mass index; VC: vital capacity; FEV1: forced expiratory volume in 1 second; FVC: forced vital capacity; IC: inspiratory capacity; GOLD: the Global Initiative for Chronic Obstructive Lung Disease. Characteristics of lung cancer among patients having thoracic surgery and non-thoracic surgery All cases (n?=?185) Non-surgery (n?=?50) Surgery (n?=?135) p value Lung cancer histology 0.028 # Adenocarcinoma 58.4 (108) 44.0 (22) 63.7 (86) ## Sq 30.8 (57) 38.0 (19) 28.1 (38) NSCLC 5.4 (10) 10.0 (5) 7.4 (10) SCLC 3.2 (6) 8.0 (4) 1.5 (2) ## Large 2.2 (4) 0 (0) 3.0 (4) Clinical stage 0.0001 # 1A 37.3 (69) 26.0 (13) 41.5 (56) 1B 19.4 (36) 14.0 (7) 21.5 (29) 2A 14.6 (27) 10.0 (5) 16.3(22) 2B 11.4 (21) 8.0 (4) 12.6 (17) 3A 17.3 (32) 42.0 (21) 8.1 (11) ## EGFR status 0.0001 # Yes 16.2 (30) 8.0 (4) 19.3 (26) No 61.6 (114) 28.0 (14) 74.1 (100) ## ND 22.2 (41) 64.0 (32) 6.7 (9) ## n indicates number. aData are shown as mean (range). bData are shown as mean (SD). All other data are shown as% (numbers). ND indicates œnot determined. #p?<?0.05. ##indicates a significant difference compared with the non-surgery group. Sq: squamous cell carcinoma; NSCLC: non-small cell lung carcinoma; SCLC: small cell lung carcinoma; Large: large cell carcinoma; EGFR: epidermal growth factor receptor. Multivariate analysis of independent factors in decision-making process for proposing thoracic surgery with curative intent Variables Odds ratio 95% CI p value Severity of airflow obstruction 0.002 # Non-COPD versus GOLD grade 1 0.920 0.370“2.289 0.858 Non-COPD versus GOLD grade 2 1.085 0.268“4.386 0.909 Non-COPD versus GOLD grade 3 0.025 0.004“0.167 <0.0001 # Clinical staging <0.0001 # Stage 1A versus stage 1B 1.084 0.326“3.602 0.895 Stage 1A versus stage 2A 0.679 0.185“2.491 0.559 Stage 1A versus stage 2B 0.705 0.172“2.895 0.628 Stage 1A versus stage 3A 0.062 0.019“0.202 <0.0001 # Age (per one year) 0.858 0.802“0.917 <0.0001 # #p?<?0.05. Discussion This is the first study to evaluate the clinical impact of the prevalence and severity of COPD on a large cohort of Japanese patients with lung cancer who underwent bronchoscopy. Mounting evidence suggests that there is a close association between COPD and lung cancer [91013]. For example a case-control study by Young et al. demonstrated a high prevalence of COPD in patients with newly diagnosed lung cancer [10]; however their study population comprised only Caucasian ancestry and nonsmokers with lung cancer were also excluded [10]. Although many lines of evidence suggest that EGFR mutations are more common among women never-smokers patients with adenocarcinoma-type lung cancer and patients of East Asian ethnicity including Japanese [1119] the association of COPD prevalence with EGFR mutations has not been fully evaluated. Indeed 21.1% of our Japanese study population was non-smokers 42.1% of whom had adenocarcinoma with EGFR mutation. Compatible with the distribution of pathological findings there was significantly higher rate of EGFR mutation in the non-COPD group than in the COPD group (). Although a recent study by Loganathan et al. also showed that 67% of 436 patients with newly diagnosed lung cancer had undergone spirometry prior to receiving treatment [9] our study analyzed the prevalence of COPD and its severity in 84.4% of patients with newly diagnosed lung cancer mainly by performing spirometry at bronchoscopy. Furthermore almost 50% of Loganathan et al.™s population were women [9] whereas only 26.7% of our population were women. Epidemiologic surveys of cancers in Japan and the United States of America might support the different proportion of women patients with lung cancer between our study and their studies [2021]. Although we previously demonstrated that 43.2% of the patients undergoing major lung resection had COPD (178/412 cases) [14] here the prevalence of COPD was found to be 54.4% in Japanese patients with lung cancer who underwent bronchoscopy. In the present population 61.3% of men had COPD (122/199 cases) whereas only 35.2% of women had COPD (25/71 cases). In addition 95.5% of men had a history of smoking in our population whereas 67.6% of women were non-smokers. In contrast the percentage of non-smokers among women with lung cancer was only 10.5% in the study of Loganathan et al. Thus the lower prevalence of COPD in women with lung cancer might be explained by the high rate of non-smokers among women in our Japanese population [1322]."
Lung_Cancer
"Median PFS in patients with EGFR mutation?positive tumors was 18 weeks based on 26 patients with 21 (81%) achieving PFS events; this median was longer than that seen in the overall population. The 6 patients with documented T790M had a median PFS of 7 weeks which was similar to that of patients with EGFR wild?type tumors (8 weeks). Kaplan?Meier curves show (A) progression?free survival and (B) overall survival by arm (all patients). CI indicates confidence interval. image Overall Survival At the time of data cutoff 47 patients (71%) had died and median OS was 37 weeks in the overall population 45 weeks in patients with adenocarcinoma and 27 weeks in patients with nonadenocarcinoma (Fig. 3B). Of the 26 patients with EGFR mutation?positive tumors (both arms) median OS was 57 weeks OS6M was 81% and OS12M was 59%. Safety and Tolerability The majority of treatment?related AEs were of grade 1 or 2 severity () and were manageable with standard supportive care. Common events included diarrhea (85%) dermatitis acneiform (68%) dry skin (38%) fatigue (38%) exfoliative rash (24%) stomatitis (24%) decreased appetite (23%) and pruritus (23%). One patient experienced treatment?related grade 4 AEs of dyspnea and pulmonary embolism considered by the investigator to be possibly related to study drug; 18 patients (27%) experienced treatment?related AEs with a maximum severity of grade 3. The majority of patients (n?=?44 67%) did not require a dose reduction and interruption of daily dosing was seen in 33% for evaluation and management of AEs. Of the 22 patients who did require dose reduction 17 patients had 1 dose reduction and 5 had 2 dose reductions. AEs resulting in dose modification were predominantly dermatologic or gastrointestinal. Six patients permanently discontinued dacomitinib due to treatment?related AEs which included grade 4 dyspnea (day 8) and grade 4 pulmonary embolism (day 9) (both in a single patient); grade 3 fatigue (day 14); grade 3 exfoliative rash (day 134); grade 2 allergic dermatitis (day 3); grade 2 fatigue (day 85); and grade 1 fatigue (day 43). Twelve deaths occurred within 28 days following the last dose of dacomitinib and were reported as serious AEs; none was considered to be treatment?related. Treatment?Related Adverse Events Occurring in ?10% of Patients in the Overall Population (N?=?66) and Hematologic Laboratory Values by Maximum CTCAE Grade (All Cycles; N?=?66) Adverse Event Grade 1/2n (%) Grade 3n (%) Total n (%) Any adverse events 46 (69.7) 18 (27.3)a 65 (98.5) Diarrhea 48 (72.7) 8 (12.1) 56 (84.8) Dermatitis acneiform 41 (62.1) 4 (6.1) 45 (68.2) Dry skin 25 (37.9) 0 25 (37.9) Fatigue 23 (34.8) 2 (3.0) 25 (37.9) Exfoliative rash 14 (21.2) 2 (3.0) 16 (24.2) Stomatitis 15 (22.7) 1 (1.5) 16 (24.2) Decreased appetite 15 (22.7) 0 15 (22.7) Pruritus 12 (18.2) 3 (4.5) 15 (22.7) Nausea 13 (19.7) 0 13 (19.7) Vomiting 8 (12.1) 1 (1.5) 9 (13.6) Aspartate aminotransferase increased 8 (12.1) 0 8 (12.1) Mucosal inflammation 7 (10.6) 0 7 (10.6) Hematologic Laboratory Values Grade 1/2n (%) Grade 3n (%) Total n (%) Hemoglobin 36 (54.5) 1 (1.5) 50 (75.8) Lymphopenia 10 (15.2) 12 (18.2)b 40 (60.6) Neutropenia 2 (3.0) 1 (1.5) 4 (6.1) Thrombocytopenia 4 (6.1) 1 (1.5)c 5 (7.6) Leukopenia 10 (15.2) 0 11 (16.7) a Includes two grade 4 events (dyspnea and pulmonary embolism) both experienced by the same patient. b Includes 2 patients with grade 4 events. c Grade 4. Patient?Reported Outcomes Completion rates for the EORTC QLQ?C30/?LC13 and DLQI questionnaires were high throughout the study (generally?>90% of patients answered at least one question). Patients with radiographic disease control reported improvement in lung cancer symptoms of dyspnea cough pain in chest and pain in arm/shoulder relative to baseline scores first observed after 3 weeks on therapy (Supporting Fig. 1A). Diarrhea was the most commonly reported class?related AE; diarrhea peaked at cycle 3 day 1 (week 6) and remained stable over time (Supporting Fig. 1B). With a score of 0?=?no symptoms and 100?=?most symptoms patients on dacomitinib reported scores that were at the midpoint in the range at their worst. The impact of dacomitinib on PRO for NSCLC symptoms and dermatologic toxicity has been previously presented and will be subsequently reported in full (Campbell AK et al; unpublished data). Pharmacokinetics PK parameters (overall and by histology) following a single dose (cycle 1 day 1) and mean Ctrough values after multiple doses for dose?compliant patients (Supporting ) were consistent with those previously reported.5 Pharmacodynamics Soluble HER2 and EGFR levels were slightly decreased on day 1 of most cycles compared with baseline for most patients. One patient with nonadenocarcinoma demonstrating HER2 amplification had elevated baseline soluble HER2 that significantly declined to population normal baseline levels upon treatment with dacomitinib. This patient's tumor also demonstrated a PR.16 Discussion In this phase 2 trial dacomitinib demonstrated an overall response rate of 5% but the primary endpoint of this study was not met. Three PRs were observed 2 in patients with EGFR mutation?positive tumors and 1 in a patient whose tumor was EGFR wild?type with HER2 amplification.16 In contrast patients with known EGFR T790M did not respond to dacomitinib therapy despite efficacy in preclinical models. These observations could be due to the presence of concurrent drug resistance mechanisms (such as MET amplification)18 or to the inability of dacomitinib to fully inhibit EGFR in tumors harboring EGFR T790M at the doses currently under clinical investigation.5 Strategies to improve EGFR inhibition in EGFR T790M cancers include the combination of irreversible EGFR inhibitors with the EGFR?directed antibody cetuximab (as reported for afatinib plus cetuximab)19; the development of more potent and specific inhibitors of EGFR T790M2021; and the use of intermittent but high doses of existing irreversible EGFR inhibitors.18 In contrast where resistance is mediated by compensatory signaling pathways or tumors harbor more than one concomitant drug resistance mechanism combination strategies with targeted agents in appropriately selected patients will be necessary to treat such cancers (eg inhibition of the MET pathway). In the absence of a known oncogene addiction patients with wild?type EGFR may still benefit from EGFR?directed therapy in the absence of a RECIST?defined radiographic response; endpoints such as PFS and patient report of HRQoL and symptom relief have become increasingly important in a noncurative setting.22 This is demonstrated in the BR21 trial of erlotinib versus placebo where the ORR was low and yet was associated with improvements versus placebo in OS and NSCLC symptoms.10 In the current study in refractory NSCLC 10 of 36 patients with SD as BOR derived prolonged clinical benefit (SD???6 months) with dacomitinib; patients also reported a rapid onset of improvement in key lung cancer symptoms with symptomatic improvements remaining durable over the course of therapy. Common AEs were typically gastrointestinal or dermatologic and consistent with targeting EGFR.24 By patient report both gastrointestinal and dermatologic symptoms peaked early in treatment and stabilized or improved over time (Campbell AK et al; unpublished data). The benefits seen in this study may reflect dacomitinib's broader mode of action in targeting all kinase?active HER family members irreversible binding to the tyrosine kinase domain retreatment in some of those patients with an EGFR?driven tumor following a period off treatment after a prior selective EGFR TKI or other as yet to be determined factors. Data from this and other phase 1 and 2 studies in post?EGFR TKI settings5 and from a head?to?head trial comparing dacomitinib with erlotinib in the second?line setting8 suggest that dacomitinib has clinically relevant activity in patients with NSCLC who do not harbor KRAS mutations. However in the absence of a control arm it remains unclear if this degree of benefit seen here could be due to patient selection or favorable prognostic factors. A phase 3 trial is underway to determine the efficacy and safety of dacomitinib compared with erlotinib in patients with KRAS wild?type NSCLC for whom first?line chemotherapy has failed (ARCHER 1009; ClinicalTrials.gov identifier NCT01360554). FUNDING SUPPORT This study was sponsored by Pfizer Inc. CONFLICT OF INTEREST DISCLOSURE Drs. Ruiz?Garcia Liang Taylor Gernhardt and O'Connell are employees of Pfizer and own Pfizer stock. Stephen Letrent and an immediate family member are employees of Pfizer and own Pfizer stock. Dr. Reckamp received research funding from Pfizer. Dr. Camidge served Pfizer in an advisory role. Dr. Engelman received honoraria from Genentech/Roche and received research funding from Novartis. He also received remuneration from Pfizer for use of cell lines for which he is a coinventor and has an EGFR/MET patent that has been licensed by Ventana and owned by Roche (no compensation to date). Dr. Koczywas received honoraria from Pfizer and Genentech. Dr. Gadgeel received honoraria from Pfizer. Alicyn K. Campbell and an immediate family member were previously employed by Pfizer (neither hold current employment with Pfizer). Dr. Campbell is currently employed by Genentech a member of the Roche Group. Dr. Jänne has been a consultant for Boehringer?Ingelheim Genentech/Roche AstraZeneca and Pfizer. Drs. Giaccone Khuri and Rajan have no conflicts of interest to disclose. Supplementary Material Additional Supporting Information may be found in the online version of this article. Supplementary information Click here for additional data file. Supplementary information Figure 1. Click here for additional data file. Supplementary information Table 1. Click here for additional data file. REFERENCES 1 Hynes NE Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 2005;5:341?354 15864276 2 Roberts PJ Stinchcombe TE Der CJ Socinski MA. Personalized medicine in non?small?cell lung cancer: is KRAS a useful marker in selecting patients for epidermal growth factor receptor?targeted therapy?J Clin Oncol. 2010;28:4769?4777 20921461 3 Engelman JA Zejnullahu K Gale CM et al. PF00299804 an irreversible pan?ERBB inhibitor is effective in lung cancer models with EGFR and ERBB2 mutations that are resistant to gefitinib. Cancer Res. 2007;67:11924?11932 18089823 4 Gonzales AJ Hook KE Althaus IW et al. Antitumor activity and pharmacokinetic properties of PF?00299804 a second?generation irreversible pan?erbB receptor tyrosine kinase inhibitor. Mol Cancer Ther. 2008;7:1880?1889 18606718 5 Jänne PA Boss DS Camidge DR et al. Phase I dose?escalation study of the pan?HER inhibitor PF299804 in patients with advanced malignant solid tumors. Clin Cancer Res. 2011;17:1131?1139 21220471 6 Takahashi T Boku N Murakami H. Phase I and pharmacokinetic study of dacomitinib (PF?00299804) an oral irreversible small molecule inhibitor of human epidermal growth factor receptor?1 ?2 and ?4 tyrosine kinases in Japanese patients with advanced solid tumors. Invest New Drugs. 2012;30:2352?2363 22249430 7 Park K Heo DS Cho BC et al. Updated safety and efficacy results of a phase 1/2 study of PF?00299804 in Korean patients with NSCLC who experienced disease progression on platinum?based chemotherapy plus gefitinib or erlotinib. Presented at the 4th Asia Pacific Lung Cancer Conference (APLCC) Seoul Korea December 2?4 2010. J Thorac Oncol. 2010;5:S371?S423 Abstract O?018. 8 Ramalingam SS Blackhall F Krzakowski M et al. Randomized phase II study of dacomitinib (PF?00299804) an irreversible pan?human epidermal growth factor receptor inhibitor versus erlotinib in patients with advanced non?small?cell lung cancer. J Clin Oncol. 2012;30:3337?3344 22753918 9 Mok T Spigel DR Park K et al. Efficacy and safety of PF?00299804 as first?line treatment of patients with advanced NSCLC selected for activating mutation of epidermal growth factor receptor (EGFR). Ann Oncol. 2010;21(suppl 8): Abstract LBA18 10 Shepherd FA Rodrigues PJ Ciuleanu T et al. Erlotinib in previously treated non?small?cell lung cancer. N Engl J Med. 2005;353:123?132 16014882 11 Thatcher N Chang A Parikh P et al. Gefitinib plus best supportive care in previously treated patients with refractory advanced non?small?cell lung cancer: results from a randomised placebo?controlled multicentre study (Iressa Survival Evaluation in Lung Cancer). Lancet. 2005;366:1527?1537 16257339 12 Therasse P Arbuck SG Eisenhauer EA et al. New guidelines to evaluate the response to treatment in solid tumors. European Organization for Research and Treatment of Cancer National Cancer Institute of the United States National Cancer Institute of Canada. J Natl Cancer Inst. 2000;92:205?216 10655437 13 Aaronson NK Ahmedzai S Bergman B et al. The European Organization for Research and Treatment of Cancer QLQ?C30: a quality?of?life instrument for use in international clinical trials in oncology. J Natl Cancer Inst"
Lung_Cancer
"The most stringent quality control for ESC lines is the ability of the chimeras to give germline transmission (GLT). Although strictly speaking not required for an approach in which chimeras serve as an endpoint we decided to maintain this quality control as a means to identify ESC clones with impaired germline-competence caused by loss of pluripotency or the acquisition of genetic defects during culture and manipulation. We observed efficient GLT for chimeras obtained from both the C57BL/6J and the FVB/n ESC clones regardless of the injection procedure (supplementary Table S1). Derivation of germline-competent ESCs from mouse models with complex genotypes Two GEMMs of human lung cancer were selected for the derivation of ESCs: the KrasLSL-G12D non small cell lung cancer (NSCLC) model and the Rb1F/F ;Trp53F/F small cell lung cancer (SCLC) model (Jackson et al 2001; Meuwissen et al 2003). These mice develop lung tumors after switching of the conditional alleles by a Cre recombinase introduced in the target cells via adenovirus (Ad5-Cre) intubation in the lung. ESCs were also derived from Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice which carry”in addition to conditional Nf2 and Trp53 alleles”a homozygous mutation in Cdkn2a that results in loss of p16Ink4a expression but retention of the alternative reading frame protein p19Arf (Krimpenfort et al 2001). Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice develop invasive mesotheliomas after intrathoracic Ad5-Cre injection due to loss of Nf2 and p53 in the mesothelial lining (Jongsma et al 2008). The NSCLC model was maintained on a C57BL/6J background whereas the SCLC and mesothelioma models were on a mixed FVB/n;129/Ola background. As expected the efficiency of ESC derivation was similar between genotypes and comparable to the two wild-type strains (). The gender of the derived ESC clones was determined by Y-chromosome specific PCR. We observed a strong bias towards male ESC clones () which was likely caused by reduced morphological appearance and growth of female ESC clones resulting in their discontinuation early in the derivation process. Only in cases where we decided to expand all clones e.g. wild-type FVB/n we obtained both male and female clones. At later passage these female ESC clones caught up and were indistinguishable from male ESC clones on basis of growth and morphology. However we restricted ourselves to male ESC clones as it has been reported that female lines derived from inbred strains often loose one of the two X chromosomes during expansion (Barakat & Gribnau 2010). Three Rb1F/F ;Trp53F/F ESC clones two Nf2F/F ;Trp53F/F ;Cdkn2a*/* clones and one KrasLSL-G12D clone were tested for their contribution to chimeras. All clones gave reasonable numbers of chimeric animals relative to the implanted embryos and as expected most of the chimeras were males (supplementary Table S1). Most chimeras were of high quality showing coat-color chimerism of more than 70% (Fig 2A and B supplementary Fig S2A) and efficient GLT in the first litter (supplementary Table S1). Validation of chimeras. AB Three Rb1F/F ;Trp53F/F ESC clones (A) and two Nf2F/F ;Trp53F/F ;Cdkn2a*/* ESC clones (B) were injected into C57BL/6N blastocysts and scored for their chimeric contribution. All ESC clones gave reasonable numbers of chimeric animals relative to the implanted embryos (supplementary Table S1) and as expected most of the chimeras were males as we exclusively used male ESC clones. male female n.d. CD Comparison between chimeric contribution estimated on basis of coat-color versus genetic chimerism tested in various tissues. Southern blot analysis was performed with a probe that distinguishes between a wild-type Trp53 allele or the floxed Trp53 allele reflecting the contribution by the host ESCs or cultured ESCs respectively (example in supplementary Fig S3). Controls are wild-type spleen (0% chimerism expected) and F1 offspring of chimeras (50% chimerism expected). (C) Genetic chimerism of Rb1F/F ;Trp53F/F chimeras with coat color chimerism ranging from 70 to 100% (average 84% n = 7). (D) Genetic chimerism of Nf2F/F ;Trp53F/F ;Cdkn2a*/* chimeras with coat color chimerism ranging from 85 to 100% (average 95% n = 4). E Survival curves of Rb1F/F ;Trp53F/F mice intratracheally injected with Ad5-Cre. Black line conventional mice; red line chimeras. F Survival curves of Nf2F/F ;Trp53F/F ;Cdkn2a*/* mice intrathoracically injected with Ad5-Cre. Black line: conventional mice; Red line: chimeras. G Typical example of a neuroendocrine carcinoma (Small Cell Lung Cancer) in the lung (left panel) and a metastatic lesion in the liver (right panel). H Typical example of a mesotheliomatous lesion in the thoracic cavity. Tumor cells are either spindle sarcomatoid cells (left panel) or vacuolated epithelioid cells (right panel). Contribution of derived ESCs to various ans of chimeric mice is extensive and allows for efficient tumor induction One of the key features of the GEMM-ESC approach is the ability to directly evaluate tumor phenotypes in chimeric mice bypassing the need for any breeding. The success of this approach depends on the contribution of cultured ESCs to the various tissues in the chimeric mice. To assess this we performed Southern blot analysis on genomic DNA extracted from multiple tissues of chimeric mice from two independent GEMMs. To determine the level of genetic chimerism we used a probe that distinguishes between a wild-type Trp53 allele and the floxed Trp53F2-10 allele (Jonkers et al 2001) reflecting the contribution by the host ESCs or cultured ESCs respectively (supplementary Fig S3). The contribution of the cultured ESCs was comparable for most ans with the exceptions of the lung and brain which consistently scored the lowest (Fig 2C and D). In general the percentage of coat-color chimerism was scored higher than the genetic chimerism. A potential limitation of the GEMM-ESC approach is that chimeric mice have a smaller target cell population for oncogenic transformation. To determine whether this influences tumor type latency and incidence a comparison was made between conventional mice and chimeras for the three GEMMs (Fig 2E and F and supplementary Fig S2B). For the SCLC and mesothelioma models the tumor type incidence and latency was identical between the conventional and the chimeric mice (Fig 2E“H). All chimeric mice from the SCLC model developed lung neuroendocrine carcinomas resembling SCLC often with invasion to the mediastinum and metastases to the liver (Fig 2G). All chimeric mice from the mesothelioma model developed epithelioid sarcomatoid or biphasic mesotheliomas that were highly invasive into nearby tissues (Fig 2H). In the NSCLC model the incidence and tumor types in the chimeric mice was again identical to the incidence and tumor types observed in the original strain. All NSCLC chimeras developed multiple lesions in the lung ranging from adenomatous or bronchioalveolar hyperplasia to bronchioalveolar adenomas adenocarcinomas and papillary carcinomas (supplementary Fig S2B and C). Surprisingly the tumor latency was shorter for the NSCLC chimeras than for the conventional mice. It is possible that host-derived FVB/n cells in the lung create a tumor-permissive or pro-tumorigenic microenvironment. Alternatively as the NSCLC chimeric cohort was produced from a single ESC clone an unidentified genetic lesion might have been acquired during the re-derivation process that leads to accelerated tumor growth. Combined these data illustrate that tumor induction in chimeras is as efficient as in animals carrying the conditional lesions in all of their cells. The GEMM-ESC approach is therefore a very effective strategy to swiftly generate cohorts of mice for in vivo tumor studies. Targeting of GEMM-ESCs under 2i culture conditions is efficient but requires genetic and phenotypic quality control The second step in the GEMM-ESC approach involves targeting of GEMM-ESCs with a Flp-in module just after the 3?UTR of the Col1a1 locus (Beard et al 2006). This module named Col1a1-frt serves as a docking site for introduction of transgene-coding plasmids by Flp recombinase-mediated integration."
Lung_Cancer
"The 24-week metrics (albeit with higher c-index point estimate) were not meaningfully better than the 12-week metrics. None of the metrics did particularly well for breast cancer. Conclusion Alternative cut points to RECIST standards provided no meaningful improvement in OS prediction. Metrics assessed at 12 weeks have good predictive performance. J Thorac Oncol J Thorac Oncol JTO Journal of Thoracic Oncology 1556-0864 1556-1380 Lippincott Williams & Wilkins 24787965 4132045 00005 10.1097/JTO.0000000000000157 Original s Translational Oncology A Comparison of Immunohistochemical Assays and FISH in Detecting the ALK Translocation in Diagnostic Histological and Cytological Lung Tumor Material Le Quesne John MA (Cantab) PhD MBBS FRCPath * Maurya Manisha PhD   Yancheva Slaveya G. FRCPath * O™Brien Mary MD ¡ Popat Sanjay FRCP PhD ¡ Wotherspoon Andrew C. MBBCh FRCPath § de Castro David Gonzalez PhD FRCPath   Nicholson Andrew G. MBBS DM FRCPath * *Department of Histopathology Royal Brompton and Harefield NHS Foundation Trust London;  Centre for Molecular Pathology The Royal Marsden Hospital Sutton Surrey; ¡Department of Oncology The Royal Marsden Hospital; and §Department of Histopathology Royal Marsden Hospital Chelsea London United Kingdom. Address for correspondence address: Andrew G. Nicholson MBBS DM FRCPath Department of Histopathology Royal Brompton Hospital Sydney St London SW3 6NP United Kingdom. E-mail: a.nicholsonrbht.nhs.uk. 6 2014 30 5 2014 9 6 769 774 Copyright 2014 by the International Association for the Study of Lung Cancer 2014 This is an open-access distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivitives 3.0 License where it is permissible to download and share the work provided it is properly cited. The work cannot be changed in any way or used commercially. Introduction: Detection of the ALK rearrangement in a solid tumor gives these patients the option of crizotinib as an oral form of anticancer treatment. The current test of choice is fluorescence in situ hybridization (FISH) but various cheaper and more convenient immunohistochemical (IHC) assays have been proposed as alternatives. Methods: Fifteen FISH-positive cases from patients seven with data on crizotinib therapy and clinical response were evaluated for the presence of ALK protein using three different commercially available antibodies: D5F3 using the proprietary automated system (Ventana) ALK1 (Dako) and 5A4 (Abcam). A further 14 FISH-negative and three uncertain (<15% rearrangement detected) cases were also retrieved. Of the total 32 specimens 17 were excisions and 15 were computed tomography-guided biopsies or cytological specimens. All three antibodies were applied to all cases. Antibodies were semiquantitatively scored on intensity and the proportion of malignant cells stained was documented. Cutoffs were set by receiver operating curve analysis for positivity to optimize correct classification. Results: All three IHC assays were 100% specific but sensitivity did vary: D5F3 86% ALK 79% 5A4 71%. Intensity was the most discriminating measure overall with a combination of proportion and intensity not improving the test. No FISH-negative IHC-positive cases were seen. Two FISH-positive cases were negative with all three IHC assays. One of these had been treated with crizotinib and had failed to show clinical response. The other harbored a second driving mutation in the EGFR gene. Conclusions: IHC with all three antibodies is especially highly specific (100%) although variably sensitive (71%-86%) specifically in cases with scanty material. D5F3 assay was most sensitive in these latter cases. Occasional cases are IHC-positive but FISH-negative suggesting either inaccuracy of one assay or occasional tumors with ALK rearrangement that do not express high levels of ALK protein. Pulmonary adenocarcinoma ALK Immunohistochemistry Fluorescence in situ hybridization Crizotinib OPEN-ACCESS TRUE Rearrangements of the anaplastic lymphoma kinase (ALK) gene drive the malignant phenotype in 3% to 7% of primary lung adenocarcinomas.1“5 The resulting fusion protein most often a fusion with echinoderm microtubule-associated protein-like 4 (ELM4) has a constitutively active tyrosine kinase domain. The small molecule drug crizotinib is a specific inhibitor of this kinase6 and cases with the rearrangement respond to crizotinib treatment.7 Therefore accurate rapid and inexpensive identification of tumors growing under the influence of translocated ALK is needed. Currently the only test approved by the FDA is fluorescence in situ hybridization (FISH) using œbreak-apart probes (Vysis Abbott Molecular Abbott Park IL). This test is regarded as the œgold standard for detection of re-arrangements and is recommended by CAP/International Association for the Study of Lung Cancer/AMP.8 However FISH is technically demanding expensive and many diagnostic laboratories lack either the expertise or the facilities to perform the test. Even in ideal circumstances the results are often difficult to interpret requiring the scrutiny of large numbers of individual cells by a highly experienced diagnostician. Furthermore there are rare circumstances (such as small intrachromosomal inversion) in which the FISH test is negative but the tumor nevertheless expresses EML4-ALK fusion protein.59“11 A cheaper and potentially more widely applicable method is immunohistochemistry (IHC); indeed overexpression of ALK protein has been used in the diagnosis of anaplastic large-cell lymphoma for many years. Although early studies in lung cancer lacked sensitivity45 more recent studies have shown greater specificity and sensitivity8“11 and recent international guidelines (CAP/International Association for the Study of Lung Cancer/AMP) have recommended that if clinically validated IHC may be used as a screening test for FISH testing.8 However there have been few comparative studies on the most appropriate antibody to use. The aim of this study was therefore to compare three different immunohistochemical assays two being routine methods using antibodies widely used in the diagnosis of lymphoma with the third being a proprietary system including signal amplification that is currently being promoted as an alternative to FISH (Ventana). We also evaluated the relationships between ALK rearrangement as detected by FISH IHC and patient response to therapy. MATERIALS AND METHODS Clinical Samples The diagnostic archives from the Royal Brompton and Harefield NHS Foundation Trust and Royal Marsden hospitals from 2007 onwards were reviewed to identify cases with a diagnosis of lung adenocarcinoma that tested positive for an ALK rearrangement (>15% positive cells) and a randomly selected complementary group of cases with a normal ALK locus for comparison. We had been testing all primary lung tumors regardless of stage as part of a feasibility study which led to a large number of early stage cases being included. More recently our current policy is only to test advanced cases of non-squamous non“small-cell carcinoma using IHC screening with confirmatory FISH as per recently published guidelines.8 The cases under study are summarized in . TABLE 1. Summary Data of All Cases Included in the Study Paraffin blocks from a total of 32 diagnostic cases were retrieved; 15 of these had tested positive for the ALK rearrangement by FISH three were uncertain (with <15% of cells showing rearrangement) and the remaining 14 cases were negative. All but two blocks dated from 2011 or later. Seventeen cases were blocks from tumor excisions (six of these were FISH positive) and the remainder were cytological or core biopsy/endobronchial ultrasound samples. Data on treatment with crizotinib and response were retrieved from patient records. Cases with at least partial response to treatment defined according to the Response Evaluation Criteria in Solid Tumors criteria12 (i.e. at least 30% decrease in the sum of the longest diameters of target lesions) were designated as œresponsive. The study was evaluated and classified as a service evaluation by the Imperial College Heads of Consortia and as such was exempt from Research Ethics Committee review. Fluorescent In Situ Hybridization Unstained 2 ?m FFPE sections were put through deparaffinization and protease pretreatment steps before being denatured and hybridized overnight with the commercially available Vysis ALK dual color break apart probe (Abbott Molecular). Tissue sections then underwent SSC washes and were mounted in 4'6-diamidino-2-phenylindole for nuclei counterstaining. Results were analyzed and interpreted in accordance with probe manufacturer™s instructions. Non-rearranged ALK showed as fused (yellow) signals. Rearranged ALK appeared as split 3? (red) and 5? (green) signals or an isolated 3? (red) signal. The recommended cutoff of 15% was used to interpret samples as positive or negative for ALK rearrangements in 200 nuclei. Immunohistochemistry An additional five sections were cut per case. Three were used for the immunohistochemical assays and the remaining two for negative controls. Immunohistochemical assays were optimized using the monoclonal antibodies D5F3 (Ventana) ALK1 (Dako) and 5A4 (Abcam). The D5F3 assay was performed using the Ventana autostainer and a tyramide amplification step as specified in the manufacturer™s protocol. The other assays were performed using a Dako autostainer with conventional polymer-based diaminobenzidine staining (no tyramide amplification). Details of the antibodies and conditions employed are given in Table 2. TABLE 2. Immunohistochemical Assay Conditions Used Scoring Immunohistochemically stained sections were examined without knowledge of FISH status by two pathologists independently. Scores for proportion and intensity of immunohistochemical staining were assigned by consensus. The predominant intensity of staining was recorded on a scale of 0“3 (0 = negative 1 = weak 2 = moderate 3 = strong). As the Ventana stain was more intense due at least partly to the signal amplification step the visual cutoffs for intensity scoring with this antibody were different (e.g. a œmoderate degree of intensity seen with the Ventana stain would usually be interpreted as œstrong on a section stained with 5A4). The proportion of malignant cells staining positive was recorded as per œAllred estrogen receptor scoring in breast cancer on a scale of 0“5 (0 = 0% 1 ? 1% 2 = 1“10% 3 = 11“33% 4 = 34“66% and 5 ? 66%). A composite score (intensity + proportion) was also derived. Statistical Analysis Statistical analyses were performed using the STATA/IC package. RESULTS Fluorescence In Situ Hybridization Slides were scored according to the manufacturer™s recommendations. Representative FISH images are shown in Figure 1A. The 15 positive cases all showed greater than 15% cells with rearranged ALK genes. Three cases were classified as œindeterminate; these were all scanty biopsy or cytological samples with 10% to 15% of positively rearranged FISH signals. Seventeen further cases were FISH negative. FIGURE 1. (A) Representative fluorescence in situ hybridization images showing normal fused signals (neg) and nuclei with multiple separated red signals (pos). (B) Three representative excision specimens of adenocarcinoma. Case 1 is negative with all three immunohistochemical assays; the D5F3 assay shows relatively high background presumably because of the tyramide signal amplification (TSA) step. Cases 2 and 3 are positive with all three immunohistochemical assays with clear cytoplasmic staining. The markedly reduced signal seen with the 5A4 and ALK1 assays in case 2 was typical and again probably related to the absence of tyramide amplification. Case 3 demonstrates that occasional cases show strong staining using the non-TSA assays. Immunohistochemistry No signal was observed in negative controls. The intensity of staining between the three antibodies varied (Fig. 1B). IHC was impossible to assess in three cases with very scanty material (two FISH negative and one FISH positive). "
Lung_Cancer
"Using fluorescence microscopy we identified apoptotic cells by the presence of highly condensed or fragmented nuclei. Apoptotic cells were counted in 5 different fields under microscopic observation. Western blot analysis The detailed protocol for the Western blot analysis is described in Method S1. It was performed under conventional conditions using the following antibodies: rabbit anti-human REIC/Dkk-3 antibody raised in our laboratory [11]; rabbit anti-human GRP78/BiP (GRP78) (ab21685; Abcam Cambridge MA); rabbit anti-human SAPK/JNK (#9252) and rabbit anti-human phospho-SAPK/JNK (Thr183/Tyr185; #9251) (Cell Signaling Technology Beverly MA); rabbit anti-human coxsackievirus and adenovirus receptor (CAR) (HPA030411; Atlas antibodies Stockholm Sweden); and mouse anti-actin (MAB1501; Millipore Billerica MA). The following secondary antibodies were used: goat anti-rabbit or anti-mouse IgG-conjugated horseradish peroxidase (Santa Cruz Biotechnology Santa Cruz CA). To detect the specific signals the membranes were examined using ECL plus Western Blotting Detection Reagents (Amersham Biosciences UK Limited Buckinghamshire UK). In addition the band intensities for GRP78 CAR and actin representing their expression levels were measured using ImageQuant TL software (GE Healthcare Bioscience) and quantified by GRP78 or CAR/actin ratio. Tumor growth assay in vivo A549 cells (5—106 in 50 µL of phosphate buffered saline [PBS]) mixed with 50 µL of Matrigel (BD Biosciences San Jose CA) were subcutaneously injected into the right flank of adult female BALB/c nu/nu mice (CLEA Japan Tokyo Japan). The tumor volume was calculated using the empirical formula V?=?1/2—[(the shortest diameter)2—(the longest diameter)]. When the tumors had reached approximately 50“100 mm3 mice (n?=?15) were randomly divided into 3 treatment groups: (a) PBS; (b) Ad-LacZ; and (c) Ad-REIC. Viruses (1—109 pfu) in 100 µL of serum-free medium were administered intratumorally. At the end of experiments mice were sacrificed after 24-days after the viral injection and tumors were harvested measured and photographed. Statistical analyses All data were analyzed using STATA ver.12 (STATA Corp. College Station TX). Fisher's exact test was applied when appropriate. For a comparison of induction of apoptosis between Ad-REIC-treated and Ad-LacZ-treated A549 cells a Cochran-Mantel-Haenszel statistics was applied for comparing. Repeated measurement ANOVA was applied for the comparison of xenotransplanted NSCLC tumor sizes among PBS Ad-LacZ and Ad-REIC. P<0.05 was considered significant. All tests were two-sided. Results Effect of Ad-REIC on NSCLC cell lines We examined the inhibition of cell viability using Ad-REIC and an MTS assay. In 13 (52%) of 25 NSCLC cell lines Ad-REIC treatment at 20 MOI inhibited the cell viability (40%“60% inhibition) compared with Ad-LacZ treatment ( ). These cell lines were regarded as highly sensitive to Ad-REIC. In contrast 12 cell lines (48%) were not inhibited by Ad-REIC treatment at 20 MOI and were regarded as resistant cells. OUMS-24 was not inhibited at 20 or 200 MOI of Ad-REIC. Of note Ad-REIC treatment at 100 and 200 MOI improved the inhibition of cell viability (100 MOI: 15%“59% inhibition 200 MOI: 40%“78% inhibition) compared with Ad-LacZ treatment (). Thus we defined 20 MOI as a low MOI value and 200 MOI as a high MOI value. For comparison Ad-REIC treatment was also performed in the human mesothelioma cell line 211H which we previously reported to be Ad-REIC-sensitive [14]. The 211H was not inhibited at 20 MOI but was inhibited at 200 MOI of Ad-REIC (). "
Lung_Cancer
"ssed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life “ cancer; QLQ-LC13: Quality of life “ lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment “ care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale “ extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors™ contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe d™HuZes and the Dutch Cancer Society (Grant number KUN 2011“5077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease J Hosp Palliat Nurs 2009 11 2 82 90 10.1097/NJH.0b013e31819974f9 Pinquart M Duberstein PR Optimism pessimism and depressive symptoms in spouses of lung cancer patients Psychol Health 2005 20 5 565 578 10.1080/08870440412331337101 Kim Y Duberstein PR Sorensen S Larson MR Levels of depressive symptoms in spouses of people with lung cancer: effects of personality social support and caregiving burden Psychosomatics 2005 46 2 123 130 10.1176/appi.psy.46.2.123 15774950 Mosher CE Jaynes HA Hanna N Ostroff JS Distressed family caregivers of lung cancer patients: an examination of psychosocial and practical challenges Support Care Cancer 2013 21 2 431 437 10.1007/s00520-012-1532-6 22797839 Mosher CE Bakas T Champion VL Physical health mental health and life changes among family caregivers of patients with lung cancer Oncol Nurs Forum 2013 40 1 53 61 10.1188/13.ONF.53-61 23269770 Ostlund U Wennman-Larsen A Persson C Gustavsson P Wengstrom Y Mental health in significant others of patients dying from lung cancer Psychooncology 2010 19 1 29 37 10.1002/pon.1433 19253315 Wennman-Larsen A Persson C Ostlund U Wengstrom Y Gustavsson JP Development in quality of relationship between the significant other and the lung cancer patient as perceived by the significant other Eur J Oncol Nurs 2008 12 5 430 435 10.1016/j.ejon.2008.07.004 18845476 Siminoff LA Wilson-Genderson M Baker S Jr Depressive symptoms in lung cancer patients and their family caregivers and the influence of family environment Psychooncology 2010 19 12 1285 1293 10.1002/pon.1696 20119935 Manne S Badr H Intimacy processes and psychological distress among couples coping with head and neck or lung cancers Psychooncology 2010 19 9 941 954 10.1002/pon.1645 19885852 Badr H Taylor CLC Effects of relationship maintenance on psychological distress and dyadic adjustment among couples coping with lung cancer Health Psychol 2008 27 5 616 627 18823188 Buccheri G Depressive reactions to lung cancer are common and often followed by a poor outcome Eur Respir J 1998 11 1 173 178 10.1183/09031936.98.11010173 9543289 Walker J Sawhney A Hansen CH Symeonides S Martin P Murray G Sharpe M Treatment of depression in people with lung cancer: a systematic review Lung Cancer 2013 79 1 46 53 10.1016/j.lungcan.2012.09.014 23102652 Follwell M Burman D Le LW Wakimoto K Seccareccia D Bryson J Rodin G Zimmermann C Phase II study of an outpatient palliative care intervention in patients with metastatic cancer J Clin Oncol 2009 27 2 206 213 10.1200/JCO.2008.17.7568 19064979 Jordhoy MS Fayers P Loge JH Ahlner-Elmqvist M Kaasa S Quality of life in palliative cancer care: results from a cluster randomized trial J Clin Oncol 2001 19 18 3884 3894 11559726 Gustafson DH DuBenske LL Namkoong K Hawkins R Chih M-Y Atwood AK Johnson R Bhattacharya A Carmack CL Traynor AM An eHealth system supporting palliative care for patients with non“small cell lung cancer Cancer 2013 119 9 1744 1751 10.1002/cncr.27939 23355273 Greer JA Pirl WF Jackson VA Muzikansky A Lennes IT Heist RS Gallagher ER Temel JS Effect of early palliative care on chemotherapy use and end-of-life care in patients with metastatic non-small-cell lung cancer J Clin Oncol 2012 30 4 394 400 10.1200/JCO.2011.35.7996 22203758 Kabat-zinn J Full catastrophe living: using the wisdom of your body and mind to face stress pain and illness 1990 New York: Delacourt Segal ZV Williams JMG Teasdale JD Mindfulness-Based Cognitive Therapy for depression: a new approach to preventing relapse 2002 New York: Guilford Press Piet J Wurtzen H Zachariae R The effect of Mindfulness-Based Therapy on symptomps of anxiety and depression in adult cancer patients and survivors: a systematic review and meta-analysis J Consult Clin Psychol 2012 80 6 1007 1020 22563637 Birnie K Garland SN Carlson LE Psychological benefits for cancer patients and their partners participating in Mindfulness-Based Stress Reduction (MBSR) Psychooncology 2010 19 9 1004 1009 10.1002/pon.1651 19918956 Hagedoorn M Sanderman R Bolks HN Tuinstra J Coyne JC Distress in couples coping with cancer: a meta-analysis and critical review of role and gender effects Psychol Bull 2008 134 1 1 30 18193993 Folstein MF Folstein SE McHugh PR Mini-mental state: practical method for grading cognitive state of patiens for clinician J Psychiatr Res 1975 12 3 189 198 10.1016/0022-3956(75)90026-6 1202204 Roth AJ Kornblith AB Batel-Copel L Peabody E Scher HI Holland JC Rapid screening for psychologic distress in men with prostate carcinoma Cancer 1998 82 10 1904 1908 10.1002/(SICI)1097-0142(19980515)82:10<1904::AID-CNCR13>3.0.CO;2-X 9587123 Tuinman MA Gazendam-Donofrio SM Hoekstra-Weebers JE Screening and referral for psychosocial distress in oncologic practice Cancer 2008 113 4 870 878 10.1002/cncr.23622 18618581 Kübler-Ross E On death and dying 1969 New York: Macmillan MBSR teacher certification pathway: complete checklist http://www.umassmed.edu/uploadedFiles/cfm2/training/MBSR%20Teacher%20Certification%20Pathway%20Complete%20Checklist[1].pdf Crane RS Kuyken W Williams JMG Hastings RP Cooper L Fennell MJV Competence in teaching mindfulness-based courses: concepts development and assessment Mindfulness 2012 3 76 84 10.1007/s12671-011-0073-2 23293683 Zigmond AS Snaith RP The H"
Lung_Cancer
"Division of Anatomic and Molecular Pathology Division of Laboratory and Genomic Medicine 660 Euclid Ave. #8118 St. Louis MO 63110. eduncavagepath.wustl.edu 1 7 2015 7 2014 16 4 405 417 6 3 2014 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved. 2014 American Society for Investigative Pathology and the Association for Molecular Pathology This document may be redistributed and reused subject to certain conditions. The identification of recurrent gene rearrangements in the clinical laboratory is the cornerstone for risk stratification and treatment decisions in many malignant tumors. Studies have reported that targeted next-generation sequencing assays have the potential to identify such rearrangements; however their utility in the clinical laboratory is unknown. We examine the sensitivity and specificity of ALK and KMT2A (MLL) rearrangement detection by next-generation sequencing in the clinical laboratory. We analyzed a series of seven ALK rearranged cancers six KMT2A rearranged leukemias and 77 ALK/KMT2A rearrangement“negative cancers previously tested by fluorescence in situ hybridization (FISH). Rearrangement detection was tested using publicly available software tools including Breakdancer ClusterFAST CREST and Hydra. Using Breakdancer and ClusterFAST we detected ALK rearrangements in seven of seven FISH-positive cases and KMT2A rearrangements in six of six FISH-positive cases. Among the 77 ALK/KMT2A FISH-negative cases no false-positive identifications were made by Breakdancer or ClusterFAST. Further we identified one ALK rearranged case with a noncanonical intron 16 breakpoint which is likely to affect its response to targeted inhibitors. We report that clinically relevant chromosomal rearrangements can be detected from targeted gene panel“based next-generation sequencing with sensitivity and specificity equivalent to that of FISH while providing finer-scale information and increased efficiency for molecular oncology testing. Biomed Res Int Biomed Res Int BMRI BioMed Research International 2314-6133 2314-6141 Hindawi Publishing Corporation 24524077 3913339 10.1155/2014/485067 Research Investigating the Feasibility of Rapid MRI for Image-Guided Motion Management in Lung Cancer Radiotherapy http://orcid./0000-0002-3275-4160 Sawant Amit 1 * Keall Paul 2 Pauly Kim Butts 3 Alley Marcus 3 Vasanawala Shreyas 3 Loo Jr. Billy W. 3 Hinkle Jacob 4 Joshi Sarang 4 1University of Texas Southwestern Medical Center Dallas TX 75235 USA 2University of Sydney Sydney NSW 2006 Australia 3Stanford University Stanford CA 95305 USA 4University of Utah Salt Lake City UT 84112 USA *Amit Sawant: amit.sawantutsouthwestern.edu Academic Editor: Jack Yang 2014 12 1 2014 2014 485067 17 4 2013 6 11 2013 7 11 2013 Copyright 2014 Amit Sawant et al. 2014 This is an open access distributed under the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited. Cycle-to-cycle variations in respiratory motion can cause significant geometric and dosimetric errors in the administration of lung cancer radiation therapy. A common limitation of the current strategies for motion management is that they assume a constant reproducible respiratory cycle. In this work we investigate the feasibility of using rapid MRI for providing long-term imaging of the thorax in order to better capture cycle-to-cycle variations. Two nonsmall-cell lung cancer patients were imaged (free-breathing no extrinsic contrast and 1.5?T scanner). A balanced steady-state-free-precession (b-SSFP) sequence was used to acquire cine-2D and cine-3D (4D) images. In the case of Patient 1 (right midlobe lesion ~40?mm diameter) tumor motion was well correlated with diaphragmatic motion. In the case of Patient 2 (left upper-lobe lesion ~60?mm diameter) tumor motion was poorly correlated with diaphragmatic motion. Furthermore the motion of the tumor centroid was poorly correlated with the motion of individual points on the tumor boundary indicating significant rotation and/or deformation. These studies indicate that image quality and acquisition speed of cine-2D MRI were adequate for motion monitoring. However significant improvements are required to achieve comparable speeds for truly 4D MRI. Despite several challenges rapid MRI offers a feasible and attractive tool for noninvasive long-term motion monitoring. 1. Introduction Respiratory motion causes significant uncertainties in tumor delineation radiotherapy (RT) dose calculations and delivery particularly in the case of thoracic tumors (e.g. lung liver) [1]. The management of respiratory motion has been an active area of research over the last decade. Several investigational as well as clinically implemented respiratory motion management strategies have been described in the literature [1]. However a common limitation of most of these strategies is that they rely on image-guidance techniques that make simplifying assumptions about respiratory motion and do not adequately capture cycle-to-cycle variations which invariably occur in all patients. Modern motion-managed radiotherapy typically uses four-dimensional computed tomography (4DCT) as the tool of choice for pretreatment anatomic imaging (also termed as œCT simulation or œCT-sim in the literature). In this technique Lung_Cancer CT projections are acquired over several respiratory cycles from successive œslabs in the body. At the same time an external surrogate (e.g. an optical marker) records the amplitude of respiration. Based on the surrogate motion trace the reconstructed slices are sorted into 6“10 volumes over a single respiratory average cycle where each volume represents a specific phase of respiration (inhalation through exhalation) [2“4]. This retrospectively reconstructed œmovie of a single respiratory cycle serves as the anatomical ground truth for all subsequent stages of radiotherapy (contouring treatment planning and dose delivery). It is well recognized however that respiratory motion is far more complex than can be characterized by a single average cycle. Cycle-to-cycle variations such as baseline shifts and changes in the amplitude and/or frequency of the respiratory waveform are inadequately accounted for in 4DCT-based planning and can lead to significant geometric and therefore dosimetric errors [5]. Furthermore binning CT projection data acquired over several cycles into a single cycle leads to severe image artifacts. For example Yamamoto et al. found that 45 of 50 patients had at least one artifact with mean magnitude of 11.6?mm (range: 4.4“56.0?mm) [6]. In a separate study Persson et al. found that 4DCT artifacts caused significant uncertainties in the delineation of the gross tumor volume (GTV) in 16 out of 19 patients [7]. Finally the equivalent dose for 4DCT is quite high (29“40?mSv) about 4 times higher than that for 3DCT (3“10?mSv) [8]. Such high imaging dose discourages long-term monitoring and frequent imaging. Due to these limitations 4DCT-based image guidance provides an incomplete picture of respiration-induced spatial and temporal changes in the thoracic anatomy. The aim of this work is to investigate the feasibility of using rapid magnetic resonance imaging (MRI) as a nonionizing imaging modality to capture long-term and/or frequent information about respiratory motion and its effects on the movement and deformation of lung tumors and surrounding critical ans. The fundamental difference and therefore advantage of cine MRI are that unlike 4DCT the MR image (i.e. slice or volume) is acquired prospectively thereby capturing an actual instance of the patient anatomy which is closer to reality compared to an average estimate of the anatomical state that is represented by 4DCT. Prospective acquisition also enables MRI to overcome the two main challenges that limit the utility of 4DCT images namely the ability to capture cycle-to-cycle variations and elimination of binning-related image artifacts. In addition due to the fact that MRI does not involve ionizing radiation there is no dose penalty for repeated imaging (as opposed to 4DCT). The use of rapid cine-2D as well as 4D MRI for radiotherapy guidance has been previously reported in the literature. In cine-2D MRI a slice of the anatomy is selected at arbitrary orientation and imaged repeatedly in time. 4D MRI is conceptually similar except that in this case an entire volume is selected and imaged. Plathow et al. have reported cine-2D imaging of lung cancer patients at ~3 frames per second (fps) [9] and 4D imaging of malignant pleural mesothelioma patients at ~1 volume/s [10] under slow-breathing conditions using a 1.5?T scanner. Von Siebenthal et al. have reported on a 4D MR imaging technique using retrospective stacking of cine-2D slices [11]. Biederer et al. report 4D MRI of a ventilated chest phantom that uses porcine lung with embedded agarose nodules to simulate tumors [12]. More recently Cai et al. have reported a 4D MRI study of a moving phantom using a technique that uses retrospective sorting of cine-2D slices [13]. To our knowledge there has been no systematic study of rapid lung MRI in the context of image-guided radiotherapy (IGRT) motion management under realistic (prospective acquisition free-breathing human subjects) conditions. In this work we present a pilot investigation of prospective rapid cine-2D and cine-3D (commonly termed as œ4D in radiotherapy and the MRI literature) MRI of two nonsmall-cell lung cancer (NSCLC) patients under free-breathing conditions without externally administered contrast. Subsequently we compute and analyze the motion trajectories of tumors and structures of interest. Our current goal is to demonstrate the feasibility and the utility of rapid MR imaging to monitor respiratory motion over multiple cycles and obtain guidance information about the motion deformation and the interplay between lung tumors and surrounding critical ans. Our long-term goal (beyond the current scope) is to use the information obtained from rapid MRI to augment and potentially correct 4DCT images. 2. Methods 2.1. Imaging of NSCLC Patients Two NSCLC patients were imaged following informed consent. Patient number 1 was a 67-year old female with an ~40?mm diameter right midlobe tumor. Patient number 2 was an 80-year old male with an ~60?mm diameter left upper-lobe tumor. Both patients were scanned on a 1.5?T scanner (GE Signa). Both patients were scanned in the supine position under free-breathing conditions and without externally administered contrast. For each patient a 4-channel cardiac coil was centered around the tumor. cine-2D time series in the coronal and sagittal planes were acquired using a balanced steady-state free precession (b-SSFP) sequence and the images were reconstructed using the vendor's in-built software. In all cases except one (Patient number 1 coronal series) half-Fourier acquisition was used in order to achieve higher imaging speed. In the case of Patient number 2 an additional 3D+t (4D) scan of a tumor-inclusive coronal slab (8 slices each 5?mm thick) was acquired using the b-SSFP sequence in the 3D mode and in conjunction with parallel imaging (acceleration = 4). The 4D images were reconstructed using the autocalibrating reconstruction for Cartesian imaging (ARC) algorithm [14]. Table 1 summarizes the image acquisition parameters for the cine-2D and the 4D acquisitions. 2.2. Motion Analysis For each time series from Table 1 the motion trajectories of the tumor and structures of interest were determined as follows. A fluid-flow-based deformable image registration previously validated for RT applications [15“17] was applied to each time series to compute deformation vector fields (DVFs) across the temporal dimension. In order to reduce errors and achieve high computation speed (i.e. fewer iterations) the registration was performed in two stages-rigid registration which accounted for gross translation and affine transformations of the tumor and ans followed by deformable registration which accounted mainly for tumor and an deformation. For each time series a reference image was selected (typically at mid-inhale) and ~15 points each on the tumor boundary and the diaphragm were manually selected. Subsequently the motion trajectory of each pixel on a contour was determined from the DVFs. The validity of using diaphragmatic motion as a surrogate for tumor motion was examined by calculating the correlation between the average motion trajectory of the pixels comprising the diaphragm boundary with the average trajectory of the pixels comprising the tumor boundary. The presence of complex motion such as tumor rotation and/or deformation was tested by comparing the motion trajectory of the tumor centroid with those of the selected points on the tumor boundary. 3. Results and Discussion Figure 1 shows MR images acquired from Patient number 1 (Figures 1(a) and 1(b)) and Patient number 2 (Figures 1(c) and 1(d)). The acquisition times per image ranged from ~0.15 to 0.27?s”speeds adequate for monitoring most respiratory motion. In each case the tumor mass (indicated by an arrow) can be clearly delineated against the background of lung parenchyma."
Lung_Cancer
"A SNP is determined to be related with a regulatory region if the SNP or any LD-related SNP (r2?0.8) resides in the ChIP-Seq peaks of the regulatory regions. Enrichment for cis-meQTL SNPs without trans effects (œcis only) trans-meQTL SNPs without cis effects (œtrans only) and SNPs with both trans and cis effects (œcis+trans). The baseline proportion (control set) was calculated based on SNPs not associated with meQTLs and with minor allele frequencies and local CpG probe density matching to the meQTL SNPs. The fold changes were calculated using the control set as baseline. PLoS One one 1932-6203 Public Library of Science San Francisco USA 24454925 3893268 PONE-D-13-29217 .0085738 Research Biology Genetics Gene Expression RNA interference Cancer Genetics Molecular Cell Biology Gene Expression RNA interference Medicine Oncology Cancers and Neoplasms Lung and Intrathoracic Tumors Non-Small Cell Lung Cancer Basic Cancer Research Downregulation of PAX6 by shRNA Inhibits Proliferation and Cell Cycle Progression of Human Non-Small Cell Lung Cancer Cell Lines PAX6 in NSCLC Zhao Xiaoting Yue Wentao * Zhang Lina Ma Li Jia Wenyun Qian Zhe Zhang Chunyan Wang Yue Department of Cellular Biology Beijing TB and Thoracic Tumor Research Institute/Beijing Chest Hospital Capital Medical University Beijing China Addison Christina Lynn Editor Ottawa Hospital Research Institute Canada * E-mail: yue.wentaogmail.com Competing Interests: The authors have declared that no competing interests exist. Conceived and designed the experiments: WY. Performed the experiments: XZ WJ ZQ CZ YW. Analyzed the data: LZ LM. Contributed reagents/materials/analysis tools: CZ YW. Wrote the paper: WY XZ. 2014 15 1 2014 9 1 e85738 16 7 2013 1 12 2013 2014 Zhao et al This is an open-access distributed under the terms of the Creative Commons Attribution License which permits unrestricted use distribution and reproduction in any medium provided the original author and source are credited. Background The transcription factor PAX6 is primarily expressed in embryos. PAX6 is also expressed in several tumors and plays an oncogenic role. However little is known about the role of PAX6 in lung cancer. Methods The function of PAX6 in lung cancer cells was evaluated by small interfering RNA-mediated depletion of the protein followed by analyses of cell proliferation anchorage-independent growth and cell cycle arrest. The changes of cyclin D1 pRB ERK1/2 p38 expression caused by PAX6 inhibition were detected using western-blotting. The PAX6 mRNA level in 52 pairs of tumors and corresponding matched adjacent normal tissues from non-small cell lung cancer patients and lung cancer cell lines was detected by real-time PCR. Results Suppression of PAX6 expression inhibited cell growth and colony formation in A549 and H1299 cells. The percentage of cells in G1-phase increased when PAX6 expression was inhibited. The cyclin D1 protein level as well as the pRB phosphorylation level decreased as a result of PAX6 down-regulation. The activity of ERK1/2 and p38 was also suppressed in PAX6 knock-down cells. The PAX6 mRNA was highly expressed in lung cancer tissue and lung cancer cell lines. In most patients (about 65%) the relative ratio of PAX6 mRNA in primary NSCLC versus adjacent tissues exceeded 100. Conclusions Our data implicated that PAX6 accelerates cell cycle progression by activating MAPK signal pathway. PAX6 mRNA levels were significantly elevated in primary lung cancer tissues compared to their matched adjacent tissues. This work was supported by Beijing Novel Program grant (No. 2006B34); Beijing Research Foundation for Excellent Talents (No. 20061D03); Beijing Cultivation Project for Key Technical and Medicine Product (No. Z101100055610030); the Scientific Research Common Program of Beijing Municipal Commission of Education (No. KM201210025024). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction A recent overview on global cancer statistics showed that lung cancer was the most commonly diagnosed cancer as well as the leading cause of cancer death [1]. Early detection and targeted therapy is a potential method for lung cancer prevention and therapy [2]. It is important to find which pathways or proteins are active in lung tumor progression [3]. On the basis of the ""cancer stem cell hypothesis tumors are thought to originate through tissue-specific stem cell expression [4]“[6]; in other words tumors are attributed to stem cell factor overexpression [3] [5] [7]. Paired-box 6 (Pax6) is an important transcription factor during embryogenesis and a stem cell factor [3]. Hence PAX6 may play an important role in tumorigenesis. PAX6 belongs to the PAX gene family which encodes a group of nine paired-box transcription factors with important roles in development and disease [3]. PAX6 is an important transcription factor in development of the eyes pancreas and central nervous system [3] [8]. "
Lung_Cancer
"In current study a semi-Markov model along with two-parametric Weibull and Log-logistic distribution were used for measuring the time-dependency transition probabilities and calculating the direct medical costs LYGs and QALYs gained of the practice presented in the trial [15]. A cost-effectiveness evaluation was performed to analysis the economic impact of maintenance gefitinib therapy for patients with locally advanced/metastatic NSCLC with unknown EGFR mutations. Base case analyses of 1- 3- 6- and 10-year time horizon showed an unfavorable ICER of $184829 $19214 $19328 and $21308 per QALY gained respectively. OSA and PSA all revealed that the model we applied was robust to the results. Monte Carlo simulations of 1000 cases suggested that all ICERs for maintenance gefitinib therapy were higher than the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from Word Health anization (WHO). There are 31 province-level administrative units in Chinese mainland the per-capita GDP of which differs significantly. In 2011 for example it ranged from $2495 in Guizhou province to $13392 in Tianjin city [31]. According to the recommended threshold of WHO [25] the WTP threshold of different province-level administrative units extended from $7485 (3—$2495) to $40176 (3—$13392) per QALY gained which exceeded the sensitivity range of the WTP (about $17700 to $26300) obtained from PSA of the current study. Obviously local government could take fully into account covering maintenance gefitinib treatment following first-line platinum-based chemotherapy for locally advanced/metastatic NSCLC with unknown EGFR mutations in accordance with local economic development level. Cost-effective probability for different economic level provinces displayed in could supply available information for local governments when gefitinib is approved by local governments™ finance before it has access to the directory of drugs for national basic medical insurance in China. .0088881.t004 The cost-effective probabilities of gefitinib arm for 31 provinces of Chinese mainland. Region Per-capita GDP ($) WTP (3—Per-capita GDP $) Cost-effective Probability Mainland China 5449.71 16349 0 More affluent regionsa >8767 >26300 1.00 Guangdong 7819 23457 0.932 Liaoning 7795 23385 0.926 Fujian 7344 22032 0.717 Shandong 7273 21819 0.655 Less affluent regionsb <5900 <17700 0 a Consist of Tianjin Shanghai Beijing Jiangsu Zhejiang and Inner Mongolia. b Consist of Jilin Chongqing Hubei Hebei Shanxi Ningxia Heilongjiang Shangxi Xinjiang Hunan Qinghai Henan Hainan Jiangxi Sichuan Guangxi Anhui Tibet Gansu Yuannan and Guizhou. A number of different survival models such as Weibull Exponential Log-logistic Gompertz et al can be used to perform extrapolation according to the observed trial data [32]. It is therefore very vital to choose the justifiable extrapolation approach to ensure the associated results of economic analysis confident to decision makers. In the current study after the deviance information criterion test (reported by Jackson et al [33] to alternative models introduced by Latimer [32] we chose Weibull and Log-logistic for PFS and OS respectively instead of Weibull for extrapolating both PFS and OS curves like the previous study undertaken by Zhu J et al [23]. In addition a hazard ration (HR) of PFS was applied to derive the PFS curve for the gefitinib strategy in the previous study [23]. Latimer however in the resent published paper pointed out that the HR used may cause bias because of the requirement of the assumptions“that is the HR was from a related model and was constant over time [34]. Obviously the bias should be considered especially if the HR impacts the results markedly. Unfortunately the HR of PFS was one of the two most influential parameters on the basis of one-way sensitivity analyses performed by Zhu J et al [23]. In view of the above cases independent parametric models were fitted to both control and experimental groups in our study. Utility of PFS played a great role in the results not only in the resent study [23] but also in the current study. Nafees et al [28] reviewed that all toxicities (diarrhoea rash nausea and vomiting neutropenia fatigue and hair loss) were related to pulling utility down significantly. Of the toxicities rash and diarrhoea were associated with maintenance gefitinib strategy as reported the clinical trial [15]. For higher accuracy we weighted the utility of PFS according to the risks of the rash and diarrhoea which were displayed in . In particularly one point revealed by one-way sensitivity analysis () should be highlighted that the price of gefitinib would be the most significant parameter that could reduce the ICER. With the gefitinib price reduction of 20% discount the ICER decreased to $16731 per QALY gained which is very close to the WTP threshold of $16349 per QALY. Therefore if the price of gefitinib decreases >20% maintenance gefitinib therapy after the standard chemotherapy in patients with locally advanced/metastatic NSCLC may be a cost-effectiveness strategy. There are some limitations in the present study. First using Weibull and Log-logistic distribution to extrapolate the survival curves beyond the time scope of the trial was an unavoidable limitation of this process. There is not enough survival data provided by the short follow-ups of the clinical trial to compare the long-term outcomes estimated by the model. Our results should be updated when long-term survival data are available. Another important limitation is that the utility weight parameters originated from the published literature that may not reflect Chinese patients™ trait. It is an inevitable limitation of the current analysis because utilities data are not yet available for China. Fortunately opinions from Chinese oncologists suggested that quality of life of locally advanced or metastatic NSCLC patients in China should not be of significant difference from abroad patients. Finally because there is no head-to-head clinical trial comparing maintenance gefitinib with other maintenance drugs (eg erlotinib) after the standard chemotherapy of four chemotherapeutic cycles we have not conducted a cost-effectiveness analysis of gefitinib in comparison with other maintenance therapies. Although the current estimates were derived from just one study which is also the only phase III trial compared maintenance gefitinib treatment in patients with locally advanced/metastatic NSCLC according to our literature search we believe that the analysis of our study based on a current Chinese phase III trial and the justifiable extrapolation approach can provide important reference information for decision makers in China. First of all the clinical study itself is a multicentre double-blind randomized controlled-trial (RCT) which represents the best evidence available and is deemed to be the most accepted scientific method of determining the benefit of a drug or a therapeutic procedure. Second the analysis method applied in our study was reliable and widely used in economic evaluations especially in the field of medical and health care. In addition the Log-logistic and two parameters Weibull model matched the survival curves of the clinical trial satisfactorily () which shows that the model we constructed can mirror the effectiveness data of the trial commendably. And then direct medical costs related to each strategy were estimated including maintenance gefitinib therapy treatment of major adverse events routine follow-up treatment for patients without progression follow-up treatment in PS state and terminal-phase cost. Although the costs originated from our previous study [26] the published literature [27] or estimates according to local charges based on expert opinion all of them stemmed from a Chinese health care system perspective as well as in view of patients with advanced NSCLC which echoed the purpose of the current study. Last but not least to reflect substantial uncertainty of the input parameters the sensitivity analyses (including OSA and PSA) were conducted for each key parameter and all sensitivity analyses revealed that the model we applied was robust to the results. In conclusion according to the recommended WTP threshold (3—per-capita GDP) of cost-effectiveness guidelines from WHO maintenance gefitinib therapy after the standard chemotherapy of four chemotherapeutic cycles in locally advanced/metastatic NSCLC patients with unknown EGFR mutations is likely to be not cost-effective for Chinese mainland from the Chinese health care system perspective. Local governments with different economic level however could take fully into account covering maintenance gefitinib treatment. Because for rich regions (the per-capita GDP> $8767) the new strategy seems to be a reasonable option and if the per-capita GDP ranges from $5900 to $8767 the maintenance therapy may be favourable in terms of the different cost-effective probabilities. Decreasing the price of gefitinib the most significant parameter that could reduce the ICER should be considered to as a preferential factor for meeting widely treatment demands in China. Prof. L.B. Peng and J.H. Li are the guarantors for the overall content. The authors greatly thank many clinicians and the data managers who have recorded the initial data diligently of medicines over the years. In particular they thank Ouyang Lihui Wang Siying Zhao Ziying and Qiu Zhenhua for their help in the data collection and valuable discussions and advices. References 1 JemalA BrayF (2011) Center MM Ferlay J Ward E et al (2011) Global cancer statistics. CA Cancer J Clin61: 69“9021296855 2 FathiAT BrahmerJR (2008) Chemotherapy for advanced stage non-small cell lung cancer. Semin Thorac Cardiovasc Surg20: 210“21619038730 3 GovindanR PageN MenszternD ReadW TierneyR et al (2006) Changing epidemiology of small-cell lung cancer in the United States over the last 30 years: analysis of the surveillance epidemiologic and end results database. J Clin Oncol24: 4539“454417008692 4 Nation Comprehensive Cancer Network (2013) Non“small cell lung cancer (version 2.2014). Available: http://www.nccn./professionals/physician_gls/pdf/nscl.pdf Accessed 21 January 2014. 5 AzzoliCG BakerJS TeminS PaoW AliffT et al (2009) American Society of Clinical Oncology Clinical Practice Guideline update on chemotherapy for stage IV non-small-cell lung cancer. J Clin Oncol27: 6251“626619917871 6 D™Addario G Felip E (2009) Non-small-cell lung cancer: ESMO clinical recommendations for diagnosis treatment and follow-up. Ann Oncol (Suppl 4): 68“70. 7 BareschinoMA SchettinoC RossiA MaioneP SaccoPC et al (2011) Treatment of advanced non small cell lung cancer. J Thorac Dis3: 122“13322263075 8 BrodowiczT KrzakowskiM ZwitterM TzekovaV RamlauR et al (2006) Cisplatin and gemcitabine first-line chemotherapy followed by maintenance gemcitabine or best supportive care in advanced non-small cell lung cancer: a phase III trial. Lung Cancer52: 155“16316569462 9 FidiasPM DakhilSR LyssAP LoeschDM WaterhouseDM et al (2009) Phase III study of immediate compared with delayed docetaxel after front-line therapy with gemcitabine plus carboplatin in advanced non-small-cell lung cancer. J Clin Oncol27: 591“59819075278 10 CiuleanuT BrodowiczT ZielinskiC KimJH KrzakowskiM et al (2009) Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised double-blind phase 3 study. Lancet374: 1432“144019767093 11 CappuzzoF CiuleanuT StelmakhL CicenasS Szcz©snaA et al (2010) Erlotinib as maintenance treatment in advanced non-small-cell lung cancer: a multicentre randomised placebo-controlled phase 3 study. Lancet Oncol11: 521“52920493771 12 Paz-AresL de MarinisF DediuM ThomasM PujolJL et al (2012) Maintenance therapy with pemetrexed plus best supportive care versus placebo plus best supportive care after induction therapy with pemetrexed plus cisplatin for advanced non-squamous non-small-cell lung cancer (PARAMOUNT): a double-blind phase 3 randomized controlled trial. Lancet Oncol13: 247“25522341744 13 CohenMH JohnsonJR ChattopadhyayS TangS JusticeR et al (2010) Approval summary: erlotinib maintenance therapy of advanced/metastatic non-small cell lung cancer (NSCLC). Oncologist15: 1344“135121148614 14 CohenMH CortazarP JusticeR PazdurR (2010) Approval summary: pemetrexed maintenance therapy of advanced/metastatic nonsquamous non-small cell lung cancer (NSCLC). Oncologist15: 1352“135821148615 15 ZhangL MaS SongX HanB ChengY et al (2012) Gefitinib versus placebo as maintenance therapy in patients with locally advanced or metastatic non-small-cell lung cancer (INFORM; C-TONG 0804): a multicentre double-blind randomised phase 3 trial. Lancet Oncol13: 466“47522512843 16 WalleserS RayJ BischoffH Vergnen¨greA RoseryH et al (2012) Maintenance erlotinib in advanced non-small cell lung cancer: cost-effectiveness in EGFR wild-type across Europe. Clinicoecon Outcomes Res4: 269“27523028234 17 Vergnen¨greA RayJA ChouaidC GrossiF BischoffHG et al (2012) Cross-market cost-effectiveness analysis of erlotinib as first-line maintenance treatment for patients with stable non-small cell lung cancer. Clinicoecon Outcomes Res4: 31“3722347803 18 GreenhalghJ McLeodC BagustA BolandA FleemanN et al (2010) Pemetrexed for the maintenance treatment of locally advanced or metastatic non-small cell lung cancer. Health Technol Assess14: 33“3921047489 19 KleinR WielageR MuehlenbeinC LiepaAM BabineauxS et al (2010) Cost-effectiveness of pemetrexed as first-line maintenance therapy for advanced nonsquamous non-small cell lung cancer. J Thor Oncol5: 1263“1272 20 TsuchiyaT FukudaT FuruiyeM KawabuchiK (2011) Pharmacoeconomic analysis of consolidation therapy with pemetrexed after first-line chemotherapy for non-small cell lung cancer. Lung Cancer74: 521“52921570734 21 Matter-WalstraK JoergerM K¼hnelU SzucsT PestalozziB et al (2012) Cost-Effectiveness of Maintenance Pemetrexed in Patients with Advanced Nonsquamous-Cell Lung Cancer from the Perspective of the Swiss Health Care System. Value Health15: 65“7122264973 22 ZengXH PengLB LiJH ChenGN TanCQ et al (2013) Cost-Effectiveness of Continuation Maintenance Pemetrexed after cisplatin and pemetrexed chemotherapy for Advanced Non-squamous Non-small-cell Lung Cancer: estimates from the Chinese Perspective of Health Care System. Clin Ther35: 54“6523328269 23 ZhuJ LiT WangXH YeM CaiJ et al (2013) Gene-guided Gefitinib switch maintenance therapy for patients with advanced EGFR mutation-positive Non-small cell lung cancer: an economic analysis. BMC Cancer13: 3923360224 24 China Center for Health Economic Research. China Guidelines for Pharmacoeconomic Evaluations (Version 8) [in Chinese] (2010) Available: http://www.cpa..cn/Article/UploadFiles/201011/2010112509052247.pdfAccessed 21 January 2014. 25 WHO. Cost-effectiveness thresholds. Available: http://www.who.int/choice/costs/CER_thresholds/en/ Accessed 21 January 2014. 26 ZengXH KarnonJ WangSY WuB WanXM et al (2012) The cost of treating advanced non-small cell lung cancer: estimates from the Chinese experience. PLoS ONE7: e4832323118985 27 WuB ChenH ShenJ YeM (2011) Cost-effectiveness of adding rh-endostatin to first-line chemotherapy in patients with advanced non-small-cell lung cancer in China. Clin Ther33: 1446“145521992806 28 NafeesB StaffordM GavrielS BhallaS WatkinsJ (2008) Health state utilities for non small cell lung cancer. Health Qual Life Out6: 84 29 National Cancer Institute (2013) SEER Stat Fact Sheets: Lung and Bronchus Cancer. Available: http://seer.cancer.gov/statfacts/html/lungb.html Accessed 21 January 2014. 30 LiuQ WangB KongY ChengKK (2011) China™s primary health-care reform. Lancet377: 2064“206621453962 31 National Bureau of Statistics of China (2012) China statistical yearbook 2012. Available: http://www.stats.gov.cn/english/ Accessed 21 January 2014. 32 Latimer N (2011) NICE DSU Technical Support Document 14: Undertaking survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data. Available: http://www.nicedsu..uk Accessed 21 January 2014. 33 JacksonCH SharplesLD ThompsonSG (2010) Survival models in health economic evaluations: Balancing fit and parsimony to improve prediction. Int J Biostat6: 34 34 LatimerNR (2013) Survival analysis for economic evaluations alongside clinical trials“extrapolation with patient-level data: inconsistencies limitations and a practical guide. Med Decis Making33: 743“75423341049 0374236 2771 Cancer Cancer Cancer 0008-543X 1097-0142 24711210 4219619 10.1002/cncr.28683 NIHMS637693 Article Guideline-Concordant Cancer Care and Survival Among American Indian/Alaskan Native Patients Javid Sara H. MD 1 Varghese Thomas K. MD MS 1 Morris Arden M. MD 2 Porter Michael P. MD MS 3 He Hao PhD 1 Buchwald Dedra MD 4 Flum David R. MD MPH 1 for the Collaborative to Improve Native Cancer Outcomes (CINCO) 1Department of Surgery Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 2Department of Surgery School of Medicine University of Michigan Ann 3Department of Urology Surgical Outcomes Research Center School of Medicine University of Washington Seattle Washington 4Division of General Internal Medicine School of Medicine University of Washington Seattle Washington Corresponding author: Sara H. Javid MD University of Washington 1959 NE Pacific Street Box 356410 Seattle WA 98195; Fax: (206) 543-8136; [email protected] 27 10 2014 07 4 2014 15 7 2014 04 11 2014 120 14 2183 2190 © 2014 American Cancer Society. 2014 BACKGROUND American Indians/Alaskan Natives (AI/ANs) have the worst 5-year cancer survival of all racial/ethnic groups in the United States. Causes for this disparity are unknown. The authors of this report examined the receipt of cancer treatment among AI/AN patients compared with white patients. METHODS This was a retrospective cohort study of 338204 patients who were diagnosed at age ?65 years with breast colon lung or prostate cancer between 1996 and 2005 in the Surveillance Epidemiology and End Results-Medicare database. Nationally accepted guidelines for surgical and adjuvant therapy and surveillance were selected as metrics of optimal guideline-concordant care. Treatment analyses compared AI/ANs with matched whites. RESULTS Across cancer types AI/ANs were less likely to receive optimal cancer treatment and were less likely to undergo surgery (P ? .025 for all cancers). Adjuvant therapy rates were significantly lower for AI/AN patients with breast cancer (P <.001) and colon cancer (P = .001). Rates of post-treatment surveillance also were lower among AI/ANs and were statistically significantly lower for AI/AN patients with breast cancer (P = .002) and prostate cancer (P <.001). Nonreceipt of optimal cancer treatment was associated with significantly worse survival across cancer types. Disease-specific survival for those who did not undergo surgery was significantly lower for patients with breast cancer (hazard ratio [HR] 0.62) colon cancer (HR 0.74) prostate cancer (HR 0.52) and lung cancer (HR 0.36). Survival rates also were significantly lower for those patients who did not receive adjuvant therapy for breast cancer (HR 0.56) colon cancer (HR 0.59) or prostate cancer (HR 0.81; all 95% confidence intervals were <1.0). "
Lung_Cancer
"We concluded that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor was effective in suppressing the growth of gefitinib-resistant tumors caused by EGFR T790M mutation MET amplification and KRAS/PIK3CA mutation. These findings represent a promising strategy for the treatment of gefitinib-resistant NSCLC and provide a strong basis for the design of clinical trials for this purpose. Competing interests The authors declare that they have no competing interests. Authors™ contributions YQQ conceived and designed the experiments. XXW YHY YY and HL performed the experiments. XXW YHY and DDM analyzed the data. XXW YHY and HL wrote the paper. YQQ supervised the whole experimental work and revised the manuscript. All authors read and approved the manuscript. She J Yang P Hong Q Bai C Lung cancer in China: challenges and interventions Chest 2013 143 1117 1126 23546484 Weir HK Thun MJ Hankey BF Ries LA Howe HL Wingo PA Jemal A Ward E Anderson RN Edwards BK Annual report to the nation on the status of cancer "
Lung_Cancer
" Replication of these findings supports the robustness of these markers for CMH and suggests that they are useful in defining a subset of subjects with CMH who could benefit from computed tomography (CT) screening for lung cancer [46]. Indeed low cost gene-specific methylation screening assays could be incorporated into clinical practices for patients suspected to be at risk for lung cancer. Conclusions Especially male former smokers with persistent chronic mucous hypersecretion have markedly increased promoter methylation of lung cancer risk genes in cell obtained by sputum collection. These smokers may be at increased risk of lung cancer and may benefit from further tests for lung cancer such as CT screening. Competing interests The authors declare that they have no competing interests. Authors™ contributions YT SB and HP made substantial contributions to conception and design; SB JW JS HP SB and MP made substantial contributions to acquisition of data or analysis and interpretation of data. All authors made substantial contributions to drafting the or revising it critically for important intellectual content and final approval of the version to be published. Supplementary Material Additional file 1: Table S1 Select variables by CMH status in the combined cohorts. Table S2. Select variables by high and low methylation tertile in combined cohorts. Table S3. Select variables by CMH in males from the LSC and PLuSS. Table S4. Select variables by CMH in females from the LSC and PLuSS. Figure S1. ROC curves comparing the sensitivity and specificity of the 3-gene methylation panels for classifying CMH. ROC curves were generated by applying logistic regression models to male former smokers independently in the PLuSS (n?=?52) and LSC (n?=?87). The covariates included age pack years education and COPD. AUC is indicated in parentheses. "
Lung_Cancer
"Silent lunch and tea break 7. Taking care of yourself - Sitting meditation ending in choiceless awareness - Exercise on taking care of yourself by examining how to improve balance in life - Meditation without CD - Yoga or walking meditation - Reflect on training - 3-min breathing space 8. The rest of your life - Bodyscan - Reflection on training - Further sources of information - Short sitting meditation - Maintaining practice Outcome measures Primary outcome measure Psychological distress The primary outcome measure is the total score on the HADS [39-41] which is developed to measure psychological distress in somatic patient populations. It consists of a 7-item anxiety (HADS-A) and 7-item depression (HADS-D) subscale. The HADS shows good psychometric properties in the general medical population including oncology patients [42]. Internal consistency as measured with Cronbach™s ? varied from .84 to .90 [4042].Test-retest reliability was good as Pearson™s r > .80 were obtained [4043]. Though the cut-off scores of the HADS vary among populations [44] in lung cancer patients they have found to be <8 versus ?8 on the HADS-A or HADS-D [45]. The HADS has been shown to be highly correlated with the Beck Depression Inventory [42]. It has previously been used in intervention studies of mindfulness and shown to be sensitive to change (e.g. [46]). Secondary outcome measures Quality of life (only for patients) The European anisation for Research and Treatment of Cancer (EORTC) Core Quality of Life Questionnaire (QLQ-C30) [47] is included along with the supplemental Lung Cancer questionnaire module (QLQ-LC13) [48]. The QLQ-C30 is designed to use in clinical trials on physical treatments for cancer patients. It incorporates five functional scales (physical role cognitive emotional social) three symptom scales (fatigue pain nausea and vomiting) a global health and quality of life scale and an array of single-item symptom measures. After revisions in the role functioning global health and physical functioning scale internal consistency of the subscales varied between .65 and .94 except for the cognitive functioning scale with ? varying from .56 to .63 [474950]. Test-retest reliability varied from .63 to .86 [51]. The lung cancer questionnaire module is designed to supplement the core questionnaire and comprises specific symptoms associated with lung cancer (coughing haemoptysis dyspnoea pain) and side-effects from conventional chemo- and radiotherapy (hair loss neuropathy sore mouth dysphagia). While the multi-item dyspnoea scale showed high internal consistency the pain subscale did not. When combined with the dyspnoea and pain items of the core questionnaire both the dyspnoea (? = .86) and pain (? = .71) subscale showed high internal consistency. Since the QLQ-C30 and QLQ-LC13 are mainly focused on physical symptoms we added the items Social Interaction and Alertness Behavior of the Sickness Impact Profile (SIP) [52]. Internal consistency was .94 and test-retest reliability was .92. The SIP correlated with self-assessed sickness and dysfunction [52]. Caregiver appraisal (only for partners) We use the 9-item Self-Perceived Pressure from Informal Care (SPPIC) [53] to assess the extent to which caregiving is experienced as burdensome. To also measure positive aspects of caregiving the 9-item subscale Care-Derived Self-Esteem of the Caregiver Reaction Assessment (CRA-SE) [54] is included. Internal consistency of the SPPIC was .79 and of the CRA-SE was .73. The SPPIC and CRA-SE were unrelated to each other [55]. Relationship quality To measure relationship satisfaction we included the 10-item Satisfaction subscale of the Investment Model Scale (IMS-S) [56]. The IMS-S starts with 5 items that measure concrete examplars of satisfaction to enhance the comprehensibility of the global items which are utilized to form the construct. Internal consistency varied from .79 to .95 and the IMS-S was related to the Dyadic Adjustment Scale. Also the Mutual Interpersonal Sensitivity scale (MIS) [57] is included to measure communication between partners about the cancer. It contains 18 items and is divided into two scales: open communication and avoiding negative thoughts about the cancer. Spirituality is measured with the Spiritual Attitude and Involvement List (SAIL) [58] and consists of 26 items divided into the subscales meaningfulness trust acceptance caring for others connectedness with nature transcendent experiences and spiritual activities. The internal consistency varied from .74 to .88 and test-retest reliability varied from .77 to .92. All subscales except for connectedness with nature were related with the Functional Assessment of Chronic Illness Therapy “ Spiritual Well-Being Scale. Costs (only for patients) The cost-effectiveness evaluation is carried out from a societal perspective considering direct as well as indirect health costs. Data on costs are collected prospectively using a diary in which participants register a) health care utilization: the type of care and its duration and b) cancer-related absence from work. Unit cost estimates are derived from the national manual for cost prices in the health care sector [59]. Costs of reduced ability to work are estimated using the friction costs method which results in a more realistic estimate than the human capital approach [60]. Treatment costs of MBSR are calculated using activity-based-costing methods thus measuring actual resources (time of therapist time of patients facilities) used. All unit cost prices are adjusted to 2013 prices. Unit cost estimates are combined with resource utilization data to obtain a net cost per patient over the entire follow-up period. Process measures Mindfulness skills are examined with the 39-item Five Facet Mindfulness Questionnaire (FFMQ) [6162]. The FFMQ is based on an exploratory factor analysis of five mindfulness measures which allowed items from different instruments to form factors providing an empirical integration of these independent attempts to operationalize mindfulness. This led to the following five subscales: observing describing acting with awareness non-judging of inner experience and non-reactivity to inner experience. Internal consistency varied from .72 to .93 among the different subscales. Most subscales were related to meditation experience Psychological Well-Being scales and psychological symptoms including the Brief Symptom Inventory [61]. FFMQ is sensitive to change in mindfulness-based interventions and is found to mediate the relationship between mindfulness practice and improvements in psychological symptoms (e.g. [63]). Self-compassion is assessed with the Self Compassion Scale (SCS) [6465] which has 26 items and is divided into six subscales: self-kindness versus self-judgment common humanity versus isolation and mindfulness versus over-identification. Internal consistency of the different subscales varied from .75 to .81 and test-retest reliability varied from .80 to .93. SCS correlated moderately with self-esteem measures including the Rosenberg Self-Esteem Scale. Furthermore whereas the self-esteem measures correlated significantly with the Narcissistic Personality Inventory the SCS was unrelated to narcissism [64]. SCS is sensitive to change through mindfulness-based interventions and is found to mediate MBCT™s treatment effects [66]. To measure rumination we administered the extended version of the Ruminative Response Scale (RRS-EXT) [67] Raes and Hermans: The revised version of the Dutch Ruminative Response Scale unpublished instrument]. The RRS-EXT contains 26 items in which a more adaptive thinking style (i.e. reflection) is distinguished from a more maladaptive one (i.e. brooding). Internal consistency varied from .72 to .77 and test-retest reliability varied from .60 to .62 for the brooding and reflection subscales. The concept of rumination seems to be sensitive to change through mindfulness-based interventions and has been shown to mediate the effect of MBSR on depressive symptoms in oncology patients [68]. The psychological stress reaction is measured with the 15-item Impact of Event Scale (IES) [6970] which assesses two categories of responses: intrusive experiences and avoidance of thoughts and images associated with the event. Internal consistency varied from .65 to .92 [71] and test-retest reliability varied from .79 to .87 among the subscales [69]. IES correlated with anxiety and depression subscales of the General Health Questionaire. Adherence to MBSR is assessed during the entire study period with a calendar on which participants in the MBSR condition fill out on a daily basis whether they adhere to the mindfulness exercises: either formal practice (e.g. meditation exercise like the bodyscan) informal practice (e.g. activity with awareness) or no exercise. Adherence to MBSR has been shown to mediate the effects of MBCT on depressive symptoms [72]. Statistical analysis plan Sample size To determine the required sample size first the sample size was calculated that would be needed for a simple t-test and subsequently it was corrected for clustering repeated measurements and baseline. A two-sided t-test on the total HADS score [3940] (i.e. our primary outcome measure examining psychological distress (HADS-total) anxiety symptoms (HADS-A) and depressive symptoms (HADS-D)) would require 64 participants in each group to have 80% power to detect a medium-sized difference (effect size = 0.5) with alpha = 0.05. To correct for clustering we multiplied this sample size of 64 with the design factor (1 + (n ? 1) * ICC) where n denotes the cluster size and where ICC denotes the intra-cluster correlation. In our study the treatment groups will consist of 14 people of whom about 7 will be patients. With n = 7 and an estimated ICC = 0.01. [72] the correction factor equals 1.06. To correct for repeated measurements and the use of the baseline measurement as a covariate we multiplied the required sample size by the design factor 1+?/2??02 where ? denotes the correlation between the post-treatment HADS measurements and ?0 denotes the correlation between the baseline HADS with the post-treatment HADS measurements. With ? = 0.8 and ? = 0.5 as conservative estimates the second design factor equals 0.65. Consequently after correction for clustering and covariates we arrived at a required sample size of 0.65 * 1.06 * 64 = 44 patients per arm. So 88 patients with lung cancer would be required for the study. Based on our pilot study [van den Hurk Schellekens Molema Speckens and van der Drift in preparation] we expect a 20% drop-out rate. Therefore we intend to include 110 patients and 110 partners. Primary analyses The samples of lung cancer patients and partners will be analyzed separately. Baseline characteristics of the population will be compared between MBSR and control group to ensure that key variables were evenly distributed by randomization. First analyses will be based on the intention-to-treat approach. Next we will perform per-protocol analyses with the treatment-adherent sample (i.e. in the MBSR condition participants have to attend at least four of the eight MBSR sessions [73] and in the TAU condition participants do not attend a mindfulness-based programme). We will use linear mixed models to analyze all outcome variables (i.e. psychological distress quality of life (only for patient) caregiver appraisal (only for partner) relationship quality and spirituality) with treatment as fixed factor baseline measurement as covariate and a random intercept based on MBSR group. This procedure will use all observed data in our analyses. In addition Cohen™s d effect size [74] will be reported based on the difference between the group means on baseline and follow-up scores divided by the pooled standard deviation at baseline and follow-up. Secondary analyses Cost effectiveness The quality of life measures (i.e. QLQ-C30; QLQ-LC13) will be used to calculate Quality of Adjusted Life Years (QALYs) for each individual. Costs and effects (in terms of QALYs) will be combined in the incremental cost-effectiveness ratio (ICER). The ICER expresses cost-effectiveness in terms of incremental costs per QALY gained. To estimate confidence intervals for the mean of the ICER a non-parametric bootstrapping method will be used performing 1000 replications of the original data. In order to express the implications of the cost-effectiveness results more clearly a cost-acceptability curve will be constructed. In case of dominance a full cost analysis will be conducted to estimate the mean savings per patient per year. Mediation analyses To examine the possible underlying mechanisms of change in MBSR mediation analyses will be conducted. Only the data of the treatment-adherent sample will be included in these analyses. By means of a multiple mediation model suggested by Preacher and Hayes [75] we will test the mediating effect of mindfulness skills self-compassion rumination and adherence to MBSR on psychological distress quality of life (only in patients) caregiver appraisal (only in partners) relationship quality and spirituality. Discussion In the last ten years MBSR has not only proven to be a feasible and acceptable intervention in cancer patients [76] but it also seems to be effective in reducing psychological distress [30]. However the generalization of these results is limited because most participants were female patients with breast cancer. A large part of lung cancer patients already have advanced cancer at time of diagnosis and are confronted with a poor prognosis and low health status. Consequently they more often report psychological distress than patients with other diagnoses of cancer [89]. Hence it is not yet clear whether MBSR is a feasible acceptable and effective intervention in patients with lung cancer. Moreover little is known about the effectiveness of MBSR in partners of cancer patients [30] though they also often report psychological distress. Our pilot study of 19 lung cancer patients and 16 partners participating in an MBSR course provides preliminary evidence that MBSR is feasible and acceptable in this population (van den Hurk Schellekens Molema Speckens and van der Drift in preparation). The current trial will answer the question whether MBSR is effective in patients with lung cancer and their partners. We started enrolment of participants in February 2012. At the moment we think recruiting a sufficient number of patients and partners will be a challenge due to rapidly fluctuating health status and sudden changes in cancer treatment [77]. The main reasons for declining participation in patients is ˜being too ill™ or that it is ˜too much of a burden during chemo and/or radiotherapy™. Furthermore no perceived need or motivation for the training is commonly mentioned. Among partners participation is highly depending on whether the patient is willing to participate. Although partners can take part separately partners who are interested do often not participate when the patients decline participation. Considering the difficulty of studying lung cancer patients and their partners [77] our trial will offer valuable information on whether MBSR as one of the few available psychosocial care programmes contributes to the alleviation of their psychological distress. Abbreviations MBSR: Mindfulness-based stress reduction; RCT: Randomized controlled trial; RUNMC: Radboud University Nijmegen Medical Centre; MBCT: Mindfulness-based cognitive therapy; MMSE: Mini mental state examination; DT: Distress thermometer; HADS: Hospital anxiety and depression scale; QLQ-C30: Quality of life “ cancer; QLQ-LC13: Quality of life “ lung cancer; SIP: Sickness impact profile; SPPIC: Self-perceived pressure from informal care; CRA-SE: Caregiver reaction assessment “ care-derived self-esteem; IMS-S: Investment model scale-satisfaction; MIS: Mutuality and interpersonal sensitivity; SAIL: Spiritual attitude and involvement list; FFMQ: Five facet mindfulness questionnaire; SCS: Self-compassion scale; RRS-EXT: Rumination response scale “ extended version; IES: Impact of event scale. Competing interests The authors declare that they have no competing interests. Authors™ contributions All authors contributed to the design of the study. AS MD and JP are the principal investigators of the study. MS drafted the paper which was modified and supplemented by all other authors. DH MS and MD are involved in recruiting participants while MS and DH take care of the logistics of the study and data collection. RD contributed specifically to the statistical analysis plan and WW contributed specifically to the design of the cost-effectiveness evaluation. All authors read and approved the final manuscript. Pre-publication history The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2407/14/3/prepub Acknowledgements This research is funded by Foundation Alpe d™HuZes and the Dutch Cancer Society (Grant number KUN 2011“5077 awarded to Prof. dr. Anne E. M. Speckens Dr. Miep A. van der Drift and Prof. dr. Judith B. Prins). Jemal A Bray F Center MM Ferlay J Ward E Forman D Global cancer statistics CA Cancer J Clin 2011 61 2 69 90 10.3322/caac.20107 21296855 Akechi T Okamura H Nishiwaki Y Uchitomi Y Psychiatric disorders and associated and predictive factors in patients with unresectable nonsmall cell lung carcinoma: a longitudinal study Cancer 2001 92 10 2609 2622 10.1002/1097-0142(20011115)92:10<2609::AID-CNCR1614>3.0.CO;2-K 11745196 Uchitomi Y Mikami I Kugaya A Akizuki N Nagai K Nishiwaki Y Akechi T Okamura H Depression after successful treatment for nonsmall cell lung carcinoma: a 3-month follow-up study Cancer 2000 89 5 1172 1179 10.1002/1097-0142(20000901)89:5<1172::AID-CNCR27>3.0.CO;2-U 10964348 Montazeri A Milroy R Hole D McEwen J Gillis CR Anxiety and depression in patients with lung cancer before and after diagnosis: findings from a population in Glasgow Scotland J Epidemiol Community Health 1998 52 3 203 204 10.1136/jech.52.3.203 9616429 Hyodo I Eguchi K Takigawa N Segawa Y Hosokawa Y Kamejima K Inoue R Psychological impact of informed consent in hospitalized cancer patients: a sequential study of anxiety and depression using the Hospital Anxiety and Depression scale Support Care Cancer 1999 7 6 396 399 10.1007/s005200050299 10541981 Turner NJ Muers MF Haward RA Mulley GP Psychological distress and concerns of elderly patients treated with palliative radiotherapy for lung cancer Psychooncology 2007 16 8 707 713 10.1002/pon.1109 17115458 Hopwood P Stephens RJ Depression in patients with lung cancer: prevalence and risk factors derived from quality-of-life data J Clin Oncol 2000 18 4 893 903 10673533 Zabora J Brintzenhofeszoc K Curbow B Hooker C Piantadosi S The prevalence of psychological distress by cancer site Psychooncology 2001 10 1 19 28 10.1002/1099-1611(200101/02)10:1<19::AID-PON501>3.0.CO;2-6 11180574 Carlson LE Angen M Cullum J Goodey E Koopmans J Lamont L MacRae JH Martin M Pelletier G Robinson J High levels of untreated distress and fatigue in cancer patients Br J Cancer 2004 90 12 2297 2304 15162149 Temel JS Greer JA Muzikansky A Gallagher ER Admane S Jackson VA Dahlin CM Blinderman CD Jacobsen J Pirl WF Early Palliative Care for Patients with Metastatic Non-Small-Cell Lung Cancer N Engl J Med 2010 363 8 733 742 10.1056/NEJMoa1000678 20818875 Abernethy AD Chang HT Seidlitz L Evinger JS Duberstein PR Religious coping and depression among spouses of people with lung cancer Psychosomatics 2002 43 6 456 463 10.1176/appi.psy.43.6.456 12444228 Thielemann PA Conner NE Social support as a mediator of depression in caregivers of patients with end-stage disease "
Lung_Cancer
"Upon CT examination all lung nodules showed a similar appearance with heterogeneous density consisting of a hypoattenuating center (Fig. 2Fig. 2.CT images of the dog. In pre-contrast CT images (A D and G) at soft tissue window setting (window level=40 window width=400) all lung nodules (arrows) showed heterogeneous density consisting of hypoattenuating center (c). In pre-contrast CT images (B and E) at lung window setting (window level= ?600 window width=1200) the pleural indentations (arrows) were found in the right cranial and left caudal nodules (m). On post contrast CT images (C F and H) partial contrast enhancement (arrows) occurred from peripheral parenchyma of nodules (m) (window level=40 window width=400). The size of the right caudal nodule the largest one was 3.2 — 2.7 cm in diameter. In reconstructed dorsal planes note the obstruction of right caudal bronchus (arrow) by the right caudal nodule (m) in (I) and the cranial deviation of right cranial bronchus (arrow) by the right cranial nodule (m) in (J). The left side of the image is the right side of the dog.). The mean density of lung nodules was 27.28 ± 6.19 HU. The size of each nodule was 2.2 — 2.0 cm (right cranial nodule) 3.2 — 2.7 cm (right caudal nodule) 1.0 — 1.0 cm (left cranial nodule) and 2.7 — 2.0 cm (left caudal nodule) respectively. Only the peripheral parenchyma of nodules was partially enhanced after an iodine contrast injection (iohexol Omnihexol 300 Korea United Pharm Co. Seoul Korea). Thus most of the parenchyma was considered to have undergone an ischemic or necrotic lesion. PET-CT (Discovery 600 PET/CT system GE Healthcare Wauwatosa WI U.S.A.) using FDG was performed at 47 min after the administration of 11.1 MBq/kg of FDG intravenously. The increased FDG uptake was observed from the peripheral region of each nodule and the maximum standardized uptake values were as follows; 6.4 of the right cranial nodule 4.3 of the right caudal nodule 3.8 of the left cranial nodule and 4.7 of the left caudal nodule respectively (Figs. 3 and 4Fig. 3.Positron emission tomography (PET) images using 18F-fluorodeoxyglucose (FDG). Maximum intensity projection (MIP) view showed four hypermetabolic lesions in both lungs and no significant FDG uptake was found from other regions (including mammary gland) except for several physiologic uptakes (esp. brain heart kidneys intestine urinary bladder and so on). B=brain H=heart K=kidney I=intestine U=urinary bladder S=injection site. The left side of the image is the right side of the dog.Fig. 4.Axial view of positron emission tomography and computed tomography (PET-CT) fusion images using 18F-fluorodeoxyglucose (FDG). Each image corresponds to the dashed line of Fig. 3 in order from top to bottom. It shows the increased FDG uptake mainly from the peripheral region of each nodule (arrows) which probably resulted from central necrosis (A“C). H=heart L=liver. The left side of the image is the right side of the dog.). There was no evidence of FDG uptake from other regions including the mammary gland nodules. None other than four pulmonary nodules were detected on CT and PET-CT. Ultrasound guided tru-cut biopsy was performed for the right and left caudal lung nodules. However histopathological diagnosis was not possible due to extensive necrosis of the sample. Multiple lung nodules in the dog were tentatively diagnosed as a primary lung tumor because there was no evidence of an unknown primary tumor on the basis of the diagnostic imaging. "
Lung_Cancer
"Thus novel approaches to effectively managing this disease at the molecular level could identify patients who have a higher or lower risk of relapse following surgery and provide biomarkers for the prediction of patient survival. In this regard the use of serum miRNAs as potential biomarkers for diagnosing and predicting prognosis of lung cancers has been reported [7] [10]. Indeed several studies have identified miRNA signatures that differ between normal and cancerous tissues for the classification of cancer types and for tumor diagnosis and prognosis. It may also be possible to use miRNA expression as a biomarker to monitor treatment efficacy or predict cancer progression [11]“[12]. However to date most studies have focused on tumor tissue and changes in circulating serum miRNAs levels and the relationship between these changes and the tissue at disease onset remain controversial [7]. Moreover the usefulness of many circulating miRNAs has been demonstrated in the diagnosis of NSCLC but few circulating miRNAs showed diagnostic value for early stage NSCLC [13] [14]. However further verification in different populations is needed. Thus in this study we analyzed levels of three miRNAs (miR-29c miR-93 and miR-429) in non-small cell lung cancer (NSCLC) tissues and compared them to those in serum samples of NSCLC patients and healthy controls particularly their expression levels in early stage NSCLC patients. Meanwhile we analyzed the data by comparison with carcinoma embryonic antigen (CEA) which is a widely used marker in the diagnosis of NSCLC [15]. We then investigated associations between their expression and clinicopathological and survival data from NSCLC patients. Materials and Methods Ethics Statement This study was approved by the Ethical Review Committee of Zhoushan Municipal Government of China and all biological samples were obtained with patients' written informed consent. Patient samples In this study we recruited 70 patients with surgically resected NSCLC and matched distant noncancerous tissues from Zhoushan Hospital Zhejiang China between January 2008 and May 2009. There were 56 male and 14 female patients with NSCLC including 34 patients younger than 60 years and 36 older than 60 years. Meanwhile sera from all NSCLC patients and 48 healthy volunteers matched according to sex and age were also collected. None of the patients enrolled in this study had received any chemotherapy or radiotherapy before surgery. For tissue sample collection upon removal of the surgical specimens the tissues were immediately transported to the Pathology Laboratory and the samples were placed in a cryovial snap-frozen in liquid nitrogen for 30 min and stored at ?80°C until use. All tissue samples were reviewed by two pathologists and the diagnosis was made according to the National Comprehensive Cancer Network (NCCN) criteria. There were 34 lung adenocarcinomas and 36 lung squamous cell carcinomas and 46 tumors were moderately to highly differentiated whereas 24 were poorly differentiated. Moreover 18 NSCLC patients had a tumor less than 3 cm in size whereas 52 patients with a tumor larger than 3 cm. Lymph node metastasis was found in 32 patients and 36 patients had stage I NSCLC and 34 patients had stage II III or IV NSCLC (). In addition serum levels of CEA were measured using chemiluminescence as part of routine clinical tests and reference value was acquired from the clinical database at Zhoushan Hospital. .0087780.t001 Clinicopathological features of 70 NSCLC patients. Clinical features n Mean age (years) 59 <60 34 ?60 36 Gender Male 56 Female 14 Tumor size 0“3 cm 18 >3 cm 52 Histological classification Adenocarcinoma 34 SCC 36 Differentiation Moderate“well 46 Poor 24 Lymph node Negative 38 Positive 32 Stage classification Stage I 36 Stage II III and IV 34 RNA isolation and quantitative RT-PCR Total cellular RNA was isolated from 100 mg lung tissue or 600 µl serum samples using a miRNAs isolation kit or mirVana PARIS RNA isolation kit (Applied Biosystems Foster City CA USA) according to the manufacturer's protocol. RNA concentration was determined using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Wilmington DE USA) and RNA quality was measured using a denaturing 15% polyacrylamide gel. The reverse transcription reaction was carried out using the TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's instructions in a total reaction volume of 7.5 µl. qPCR was performed in triplicate using TaqMan 2— Universal PCR Master Mix without AmpErase UNG (Applied Biosystems) in an ABI 7500 Real-Time PCR system (Applied Biosystems) with the following conditions: 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. The cycle threshold (Ct) values were calculated using SDS 2.0.1 software (Applied Biosystems). Template-free controls for both RT and PCR were included in each experiment to ensure target-specific amplification. The average levels of miRNA expression in tissues and sera were normalized relative to the average amounts of U6 snRNA and U48 snRNA using the 2???Ct method [16]“[17]. "
Lung_Cancer
"Background Compared with FISH and qRT-PCR analyses immunohistochemistry (IHC) is the preferred screening test in most pathology practices for ALK-rearrangement detection. With 100% sensitivity and 98% specificity the VENTANA ALK (D5F3) IHC assay has been approved in the EU and some Asian countries for ALK-rearrangement detection. However an automated Ventana IHC platform is not available in most pathology labs. In this study we evaluated the applicability of conventional IHC with D5F3 antibody in routine pathological practice and proposed detection methods and procedures that ensure that patients with ALK+?are not missed. Methods FISH and IHC analyses were performed on 297 lung adenocarcinoma cases. VENTANA IHC and qRT-PCR assay were applied to evaluate ALK-fusion status in the discordant cases of FISH and IHC. The association of ALK+?with clinicopathological characteristics was statistically analyzed. Results IHC had 100% sensitivity and 81.8% specificity for detecting ALK+. Eight ALK-expressed cases were ALK- five of which had ALK fusion detected by qRT-PCR analysis. Three of these five cases showed ALK expression using VENTANA IHC assay. ALK+ was associated with younger age and lymph node metastasis in this Chinese lung adenocarcinoma patient cohort. Conclusions The advantages of low cost and 100% sensitivity allow conventional IHC to serve as a robust diagnostic tool for screening patients with ALK+ especially in pathology labs without a VENTANA IHC platform. For cases in which ALK is weakly expressed qRT-PCR is necessary as a diagnostic test for ALK-fusion detection. Virtual slides The virtual slide(s) for this can be found here: http://www.diagnosticpathology.diagnomx.eu/vs/2269448351088278. Immunohistochemistry Fluorescence in situ hybridization qRT-PCR ALK rearrangement D5F3 antibody Lung adenocarcinoma Introduction Lung cancer is the most common cause of cancer death worldwide estimated to be responsible for nearly 1.38 million cancer deaths per year [1]. Despite improvements in the prevention and treatment of lung cancer the overall 5-year survival rate remains at 15% [2]. Efforts have been made to develop new treatment strategies. In recent years rearrangements of the anaplastic large cell kinase (ALK) gene have been discovered in approximately 5% of lung adenocarcinomas resulting in the constitutive expression of a fusion protein - most commonly EML4-ALK - with oncogenic activity [3-7]. Crizotinib a potent and specific small molecule inhibitor of both ALK and c-MET tyrosine kinases [8-10] was approved by the Food and Drug Administration (FDA) for the treatment of non-small-cell lung cancer (NSCLC) patients with ALK gene rearrangement (ALK+). The FDA-approved Vysis ALK Break Apart FISH Probe Kit (Abbott Molecular) was mandated for ALK+?testing in crizotinib trials which in a sense indicates that FISH analysis has been clinically validated. However the FISH detection of ALK gene rearrangement in routine surgical pathology practice remains impractical due to financial and technical problems. Theoretically reverse transcriptase-polymerase chain reaction (RT-PCR) is a standard method for determining the fusion genes but the requirement of fresh frozen tissue samples for extracting RNA has limited its application in clinical practice. IHC is relatively inexpensive and faster and is performed routinely in most surgical pathology practices. Mutation-specific IHC has been demonstrated as a reliable prescreening test for detecting EGFR mutations in lung adenocarcinoma [11]. Recently a fully automated VENTANA ALK (D5F3) assay was developed using D5F3 primary antibody (commercialized by Cell Signaling Technology or CST) and VENTANA OptiView DAB detection for use with VENTANA automated platforms. Our group demonstrated that the sensitivity and specificity of the VENTANA ALK assay were 100% and 98% respectively [12]. The VENTANA ALK (D5F3) IHC assay was approved to detect ALK rearrangement in pathology practice in the EU and some Asian countries including China and Japan. However the application of the VENTAMA ALK IHC assay requires a VENTANA automated platform which is not available in most pathology labs. In this study we applied IHC analysis using CST™s D5F3 antibody to detect ALK rearrangement in a Chinese lung adenocarcinoma patient cohort to assess the sensitivity and specificity of IHC analysis. In the third detection method a qRT-PCR assay (Amoy Diagnostics Xiamen China) approved by European Conformity (CE marking) and the China Food and Drug Administration (CFDA) was applied on formalin-fixed paraffin embedded (FFPE) samples to analyze the discordant cases of IHC and FISH. Materials and method Clinical materials and tissue microarray (TMA) construction This study included 297 FFPE samples with lung adenocarcinoma diagnosed at the Cancer Institute and Hospital Chinese Academy of Medical Sciences (CICAMS) in Beijing between January 2009 and March 2012. Among the 297 cases 218 were unselected and 79 cases were not effectively treated using conventional treatment. Among the 218 unselected cases 178 (with enough tissue) were constructed onto seven TMAs to represent biopsies. A 1.5 mm diameter core was taken from the cancer area based on hematoxylin and eosin (H&E)-stained sections of each sample. The remaining 39 unselected cases (without enough tissue) and 79 selected cases were cut into tissue sections. In the cases where tissue sections/cores fell off the slides during FISH or IHC analysis tissue sections were re-cut. The collection of these specimens was approved by the National Cancer Center Ethics Committee. The patients™ medical records were reviewed to obtain their clinicopathological parameters including age at diagnosis sex smoking history tumor size histological classification and pathological TNM stage. IHC Immunohistochemical staining was performed on 4 ?m-thick FFPE tissue sections or TMAs. Briefly the slides were deparaffinized and antigen retrieval was then performed in a steam cooker for 1.5 minutes in 1 mM EDTA pH 9.0 (Maixin Biological Techology Co. Ltd. Fuzhou China). ALK (D5F3) rabbit monoclonal (Cell Signaling Technology Danvers MA USA) was applied at 1:150 in SigalStain antibody diluent (Cell Signaling Technology Danvers MA USA) for 1 h. Universal secondary antibody (DAKO) was applied for 15 min. Diaminobenzidine or 3-amino-9-ethylcarbazole was used as chromogens and slides were counterstained with haematoxylin before mounting. The criteria for scoring ALK were as follows. First the intensity was graded as 0 negative; 1 weak (light brown); 2 moderate (brown); and 3 strong (dark brown). Second the proportion of positive tumor cells was graded: 0 no positive cells; 1 <10%; 2 11%-30%; 3 31%-50%; 4 51-70%; and 5 >70%. A final score was derived by adding the two primary scores. Final scores of 0 were defined as œnegative expression (?); scores of 2“5 as œweakly positive expression (+); and scores of 6“8 as œstrongly positive expression (++). Fully automated VENTANA ALK (D5F3) IHC analysis was performed as previously described [12]. According to the manufacture™s scoring algorithm a binary scoring system (positive or negative for ALK status) was adopted to evaluate the staining results. The presence of strong granular cytoplasmic staining in tumor cells (any percentage of positive tumor cells) was considered to be ALK positive while the absence of strong granular cytoplasmic staining in tumor cells was deemed to be ALK negative. FISH FISH was performed on 3 ?m-thick FFPE tumor tissues using a break-apart probe specific to the ALK locus (Vysis LSI ALK Dual Color Break Apart Rearrangement Probe; Abbott Molecular Abbott Park Illinois USA) according to the manufacturer™s instructions. Tumor cells the nuclei of which had one or more FISH signals of each color were enumerated. A positive cell was defined as one in which the nucleus had split signals (two or more signal diameters apart) or a single orange signal (deleted green signal) in addition to fused and/or split signals. A sample was considered positive if >25 cells out of 50 were positive. If a sample had 5 to 25 positive cells (10 to 50%) another 50 tumor cells were counted. If the average percentage of positive cells in 100 tumor cells was <15% (<15/100) the sample was considered negative. If the average percentage of positive cells was ?15% (?15/100) the sample was considered positive. TMA cores with high backgrounds or very weak signals that affected the signal assessment were excluded from the analysis. Real-time quantitative reverse transcription PCR (qRT-PCR) The EML4-ALK fusion mRNA was detected by qRT-PCR using an AmoyDx EML4-ALK Fusion Gene Detection Kit (Amoy Diagnostics Xiamen China). Briefly total RNA was extracted with an AmoyDx FFPE RNA Kit (Spin Column) from 5“10 ?m-thick FFPE sections with over 70% tumor cells. For each sample 100“500 ng of extracted RNA was used for reverse transcription into cDNA at 42°C for 1 h. Real-time PCR was then carried out in each of the four reactions of the EML4-ALK Fusion Gene Detection Kit according to the manufacturer™s protocol. Reaction 1 amplifies EML4-ALK variants 12 3a and 3b (variants 1/2/3a/3b); reaction 2 amplifies EML4-ALK variants 4 and 4?; reaction 3 amplifies EML4-ALK variants 5a 5b 5? and 8 (variants 5a/5b/5?/8); and reaction 4 amplifies the reference gene beta-actin. All of the assays were performed on an Agilent Mx3000P QPCR instrument (Agilent Technologies Santa Clara CA). The following PCR procedure was used: an initial denaturation at 95°C for 5 min followed by 95°C for 25 s 64°C for 20 s and 72°C for 20 s to ensure the specificity and 31 cycles of 93°C for 25 s 60°C for 35 s and 72°C for 20 s to perform the data collection. The quantitative judgment was according to the fusion fluorescence signal. Assay reactions achieving Ct values of ?30 cycles were considered positive for one of the variants detected by that reaction mixture. A housekeeping gene (beta-actin) was used to control the integrity of the RNA. Statistical analysis The statistical analysis of the tumors™ size and age was carried out using Student™s t tests. The values are shown as mean?±?SD. The relationship between ALK+?and clinicopathological variables was analyzed with the chi-square test. Statistical significance was defined as p?<?0.05. Results Concordance of ALK IHC and FISH Using the newly developed antibody ALK (D5F3) we analyzed ALK expression in 297 lung adenocarcinoma cases. The cases with strongly or weakly positive ALK expression showed readily appreciable cytoplasmic staining (Figures 1A and 1B). In contrast the cases with negative expression did not show any discernable staining (Figure 1C). Strong ALK expression was identified in 32 cases weak expression in 12 cases and no expression in 253 cases (Table 1). Figure 1 Representative cases of IHC staining FISH and qRT-PCR analysis in lung adenocarcinoma. (A-C) ALK IHC staining using CST™s D5F3 antibody. (A) Cytoplasmic reactivity of strong intensity in tumor cells (original magnification x40). (B) Weak to moderate cytoplasmic reactivity in tumor cells (original magnification x100). (C) No staining in tumor cells (original magnification x200). (D-F) FISH analysis using Vysis ALK Break-Apart probes. (D) The ALK+ case in which the majority of cells contained more than one copy of a single green signal without a corresponding orange signal in addition to fused signals using FISH analysis. Green arrow represents more than one copy of a single green signal red arrow represents single red or split red-green signals indicative of ALK-rearrangement and yellow arrow represents touching red-green signals not indicative of ALK-rearrangement. (E)ALK+ case with split red-green signals. (F) NSCLC case without ALK rearrangement. (G-I) VENTANA ALK (D5F3) IHC assay revealed no expression in ALK- patients and strong expression in ALK+ patients. (G) Strong ALK expression (original magnification x20). (H) Unspecific staining (original magnification x40). (I) No ALK expression (original magnification x20). (G-L) Graphs from qRT“PCR showing change in the normalized reporter signal (delta Rn) against PCR cycle number. (J)ALK fusion was detected at around 14 cycles of qRT-PCR analysis in a case with strong ALK expression. (K)ALK fusion was detected at around 28 cycles in a case with weak ALK expression. (L) No ALK fusion was detected with endogenous control gene beta-actin expressed normally. Table 1 Correlation of IHC and FISH IHC Total ++ a + b - c FISH+ 31(96.9%) 5(41.7%) 0(0%) 36 FISH- 1(3.1%) 7(58.3%) 242(100%) 250 Total 32 12 242 286 astrongly positive ALK expression. b weakly positive ALK expression. cnegative ALK expression. "
Lung_Cancer
"The Creative Commons Public Domain Dedication waiver (http://creativecommons./publicdomain/zero/1.0/) applies to the data made available in this unless otherwise stated. Background Complement receptor 1 (CR1) the receptor for C3b/C4b complement peptides plays a crucial role in carcinogenesis. However the association of genetic variants of CR1 with susceptibility to lung cancer remains unexplored. Methods This case-control study included 470 non-small cell lung cancer (NSCLC) patients and 470 cancer-free controls. Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs. Odds ratios (ORs) and 95% confidence intervals (CIs) were computed by logistic regression to evaluate the association of each tag SNP with NSCLC. Results Multivariate regression analysis indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. When stratified by smoking status the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.79) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65). When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year). Similarly GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). Conclusion CR1 rs7525160 G?>?C polymorphism was associated with an increased risk of developing NSCLC in Chinese population. The association displays a manner of gene-environmental interaction between CR1 rs7525160 tagSNP and smoking status. CR1 Polymorphism Tag SNPs Lung cancer Background The complement system plays a critical role in the process of carcinogenesis. Despite of significant research controversial viewpoints remain on the exact relationship of complement system with cancer. Classically the complement system fights against cancer by exerting the effects of immunosurveillance in the immunologic microenvironment of tumors [1]. Recently it was found that complement may contribute to tumor growth by a wide variety of mechanisms including dysregulation of mitogenic signaling pathways sustained cellular proliferation angiogenesis insensitivity to apoptosis invasion and migration and escape from complement cytotoxicity [2]. This suggested complement just like a double-edged sword plays a dual role in carcinogenesis. In particular component C3 and its receptors have been demonstrated to be a key link between innate and adaptive immunity [3]. Complement receptor type 1 (CR1 CD35) is a multifunctional polymorphic glycoprotein which binds to C3b fragment of C3 and to C4b with lower affinity [45]. CR1 belongs to the regulators of complement activation (RCA) family of proteins and is expressed in a wide spectrum of cells and involved in T-cell and B-cell mediated immune regulation [67]. CR1 also modulates the complement cascade activation by preventing formation of classical and alternative pathway convertases and by acting as a cofactor for factor I mediated inactivation of C3b and C4b [89]. It has been demonstrated that chronic inflammation can predispose to cancer development and spread [10] as a fundamental component of innate immunity the complement cascade consists of potential proinflammatory molecules especially C3 and C5. Moreover complement activation and abnormal expression in tumor tissues has been demonstrated [11]. Considering the important role of CR1 in complement activation innate immunity and chronic inflammation CR1 has emerged as a molecule of immense interest in gaining insight into the susceptibility to cancer. CR1 gene is located on the Chromosome 1 at the locus 1q32 [12]. Various polymorphisms have been studied including the intronic and exonic density polymorphism for their ability to alter the density of erythrocyte CR1 on the cell membranes [13-15]. There are also the molecular weight variants due to insertion-deletion polymorphisms [16]. Up to now there have been very few studies on the association of genetic variants of CR1 with susceptibility to autoimmune and inflammatory diseases. It has been proposed that genetic variant at CR1 gene (rs6656401) might influence the susceptibility to late-onset Alzheimer™s disease [17]. CR1 expression in Peripheral Blood Mononuclear Cells (PBMCs) may be a new biomarker for prognosis of nasopharyngeal carcinoma and a potential therapeutic target [18]. Recently it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However the association of genetic variants of CR1 with risk of lung cancer remains unexplored. Worldwide lung cancer is the most common cancer in terms of both incidence and mortality [20]. NSCLC is the most common subtype of lung cancer and less aggressive and metastic than SCLC. Although cigarette smoking is the predominant risk factor for lung cancer inherited genetic characteristics are presumed to account in part for this interindividual variation in lung cancer susceptibility. Recently several genome-wide association studies have demonstrated the common genetic variations associated with susceptibility to lung cancer [21-24]. Given the involvement of the complement system in coordinating innate immunity and inflammatory response [25] further examination of the potential association between genetic variation of CR1 genes and lung cancer is warranted. In the current study we conducted a case-control study to investigate the association of tag SNPs in CR1 gene with the risk of NSCLC and effect of the interaction of gene-environment on the risk of NSCLC. Results Subject characteristics The frequency distributions of select characteristics in cases and control subjects were shown in . The mean age (±SD) was 59.6?±?10.5 years for the cancer patients and 57.2?±?13.3 years for the controls. No significant difference was found in the mean age between cases and controls (P?=?0.470). There was no significant difference in proportion of sex and smoking status between cases and controls (P?=?0.832 and P?=?0.321 respectively). However there was significant difference between cases and controls when compared by pack-year smoked (P = 0.001). The heavy smokers (?25 pack-year) accounted for 61.5% in cases but only 45.5% in controls which suggested that cigarette smoking was a prominent contributor to the risk of lung cancer. Of the 470 case patients 178 (37.9%) were diagnosed as adenocarcinoma 238 (50.6%) as squamous cell carcinoma and 100 (%) as other types including large cell carcinoma (n?=?49) and mixed cell carcinoma (n?=?5). Distributions of select characteristics in cases and control subjects Variables ???Cases (n?=?470) ???Controls (n?=?470) No (%) No (%) P a ???Sex 0.832 ???Male 324 68.9 328 69.8 ???Female 146 31.1 142 30.2 ???Age 0.470 ???<50 84 17.9 96 20.4 ???50-59 177 37.7 187 39.8 ???60-69 129 27.4 111 23.6 ????70 80 17.0 76 16.2 ???Smoking status 0.321 ???Non-smoker 265 56.4 281 59.8 ???Smoker 205 43.6 189 40.2 ???Pack-year smoked 0.001 ???<25 75 36.6 96 50.8 ????25 130 63.4 93 49.2 aTwo-sided ?2 test. Association of CR1 tag SNP with NSCLC risk Total 13 selected tag SNPs of CR1 in HapMap database among Chinese population were analyzed. Except for rs9429782 polymorphism the genotype distributions of other SNPs in controls were consistent to Hardy-Weinberg equilibrium. Therefore we excluded the rs9429782 from further analysis. In order to screen the genetic variants that confer the susceptibility to lung cancer 12 candidate tagSNPs were genotyped in a case-control study consisting of 470 lung cancer patients and 470 cancer-free controls as shown in . Importantly genotype frequency of one intronic SNP (rs7525160 G?>?C) in cases was found to be significantly different from those of controls (?2?=?6.339 P=0.042). Further multivariate regression model with adjustment for age gender and smoking status was used to assess the association between rs7525160 G?>?C polymorphism and the risk of NSCLC. The results indicated that the rs7525160 CC genotype was associated with an increased risk of developing NSCLC with OR (95% CI) of 1.52 (1.02-2.28) compared with the GG genotype. Other tagSNPs of CR1 were not significantly associated with the risk of NSCLC in our study population (P >0.05). Genotype frequencies of CRI among cases and controls and their association with non-small cell lung cancers CRI Genotypes ??Controls (n?=?470) ??Cases (n?=?470) OR (95% CI ) * P No (%) No (%) rs7525160 ??GG 176 37.5 139 29.6 1.00 (ref.) ??CG 228 48.5 256 54.5 1.38 (1.04-1.85) 0.041 ??CC 66 14.0 75 15.9 1.52 (1.02-2.28) 0.028 rs3886100 ??GG 117 24.9 105 22.4 1.00 (ref.) ??AG 223 47.4 253 53.8 1.33 (0.97-1.81) 0.078 ??AA 130 27.7 112 23.8 1.06 (0.73-1.54) 0.755 rs11118167 ??TT 348 74.1 353 75.1 1.00 (ref.) ??CT 111 23.6 102 21.7 0.89 (0.65-1.21) 0.457 ??CC 11 2.3 15 3.2 1.35 (0.61-3.01) 0.461 rs9429782 ??GG 250 53.2 261 55.5 1.00 (ref.) ??GT 220 46.8 209 44.5 0.89 (0.69-1.16) 0.388 rs10494885 ??CC 178 37.9 164 34.9 1.00 (ref.) ??CT 224 47.6 232 49.4 1.11 (0.83-1.47) 0.490 ??TT 68 14.5 74 15.7 1.20 (0.81-1.78) 0.365 rs7542544 ??CC 128 27.2 108 23.0 1.00 (ref.) ??AC 223 47.5 252 53.6 1.21 (0.88-1.67) 0.239 ??AA 119 25.3 110 23.4 0.90 (0.62-1.30) 0.897 rs6691117 ??AA 324 68.9 327 69.6 1.00 (ref.) ??AG 131 27.9 128 27.2 0.98 (0.73-1.31) 0.888 ??GG 15 3.2 15 3.2 0.96 (0.46-2.02) 0.923 rs6656401 ??GG 436 92.8 447 95.1 1.00 (ref.) ??AG 34 7.2 23 4.9 0.68 (0.39-1.18) 0.174 ??AA 0 0.0 0 0.0 NC§ rs2296160 ??CC 185 39.4 194 41.3 1.00 (ref.) ??CT 226 48.1 220 46.8 0.91 (0.69-1.21) 0.521 ??TT 59 12.5 56 11.9 0.90 (0.59-1.37) 0.606 rs9429942 ??TT 452 96.2 457 97.2 1.00 (ref.) ??CT 18 3.8 13 2.8 0.77 (0.37-1.61) 0.482 ??CC 0 0.0 0 0.0 NC§ rs4844600 ??GG 171 36.4 179 38.1 1.00 (ref.) ??AG 230 48.9 228 48.5 0.92 (0.70-1.22) 0.571 ??AA 69 14.7 63 13.4 0.87 (0.58-1.31) 0.513 rs3818361 ??CC 187 39.8 188 40.0 1.00 (ref.) ??CT 224 47.7 224 47.7 0.98 (0.74-1.29) 0.868 ??TT 59 12.5 58 12.3 0.96 (0.63-1.46) 0.848 rs17048010 ??TT 301 64.0 286 60.8 1.00 (ref.) ??CT 154 32.8 164 34.9 1.09 (0.82-1.43) 0.556 ??CC 15 3.2 20 4.3 1.40 (0.70-2.79) 0.343 *Adjusted by age sex and smoking status; §NC not calculated. Table 3 Summary of MDR gene-gene interaction results Models Training bal. acc. (%) Testing bal. acc. (%) P value Cross-validation consistency rs7525160 54.03 50.53 0.828 7/10 rs4844600 rs10494885 55.45 49.32 0.989 3/10 rs4844600 rs10494885 rs7525160 57.60 48.48 0.623 6/10 Generalized Multifactor Dimensionality Reduction (GMDR) was used to evaluate gene-gene interaction. The summary of gene-gene interaction models is listed in Table 3. The SNP rs7525160 in CR1 had the highest testing balanced accuracy among 12 SNPs. The three-way interaction model among rs4844600 rs10494885 and rs7525160 showed high testing balance accuracy and cross validation consistency but the testing balanced accuracy was lower than the two-way gene-gene interaction in NSCLC. For each model the interaction was not significant (P?>?0.05). Table 4 Risk of CR1 genotypes with NSCLC by smoking status Smoking status CR1 genotype GG * OR (95% CI) § P value CG?+?CC * OR (95% CI) § P value Non-smoker 84/99 1.00 (reference) 181/182 1.15 (0.81-1.65) 0.440 Smoker 55/77 0.86 (0.54-1.38) 0.528 150/112 1.72 (1.15-2.59) 0.009 <25 pack-years 19/41 0.59 (0.31-1.10) 0.099 56/55 1.32 (0.81-2.61) 0.266 ?25 pack-years 36/36 1.18 (0.67-2.08) 0.562 94/57 2.01 (1.26-3.20) 0.003 *Number of cases/number of controls. §Data were calculated by logistic regression and adjusted for age and gender. Interaction of CR1 SNP with smoking Cigarette smoking is a well-known risk for lung cancer so stratification by smoking status was performed to investigate the association of rs7525160 G?>?C variant with the risk of NSCLC. As shown in Table 4 the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) suggesting that the CR1 rs7525160 G?>?C polymorphism is a smoking-modifying risk factor for susceptibility to NSCLC. When the interaction between smoking status and rs7525160 G?>?C variant was analyzed with cumulative smoking dose (pack-year) consistently GC or CC genotype carriers have increased risk of NSCLC among heavy smokers (pack-year???25) with OR (95% CI) of 2.01 (1.26-3.20) but not among light smokers (pack-year <25) with OR (95% CI) of 1.32 (0.81-2.16). The P value for heterogeneity of the stratification analysis by smoking status is 0.015. However the P value for interaction between rs7525160 polymorphism and smoking is 0.172 and the power for the interaction is 0.49. Discussion The chronic airway inflammation and dysfunctional immune system might promote pulmonary carcinogenesis. Implicated in the immune and inflammatory responses the complement cascade plays a pivotal role in the development of cancer. Thus it is likely that the genetic variants of CR1 in the complement system confer the susceptibility to lung cancer. In this study we have for the first time demonstrated that one intronic SNP (rs7525160 G?>?C) out of 13 tag SNPs of CR1 was associated with the risk of NSCLC in Chinese population. Notably the rs7525160 CC genotype was associated with an increased risk of developing NSCLC (OR?=?1.52 95% CI?=?1.02-2.28; P?=?0.028) compared with the GG genotype. MDR analysis also showed that there was no gene-gene interaction among 12 tag SNPs in CR1 gene. Moreover the risk of NSCLC was associated with the rs7525160 C allele carriers in smokers with OR (95% CI) of 1.72 (1.15-2.59) but not in non-smokers with OR (95% CI) of 1.15 (0.81-1.65) indicating this SNP is a smoking-modifying risk factor for susceptibility to NSCLC. To the best of our knowledge this study shed new insight into the interplay of genetic variation of CR1 with lung cancer risk. More importantly it highlights the potential gene-environmental interaction influences the susceptibility to lung cancer. The complement system has been proposed to get involved in innate immunity with the ability to œcomplement antibody-mediated elimination of immune complex and foreign pathogens [26]. Upon complement activation the biologically active peptides C5a and C3a elicit a lot of pro-inflammatory effects and could be closely associated with tumorigenesis [27]. Complement proteins play a dual role in the tumor microenvironment. On one hand they exert a defensive effect against tumor through complement or antibody-dependent cytotoxicity [128]. On the other hand they may escape from immunosurveillance and facilitate carcinogenesis [2]. Specifically a number of experimental evidence has suggested an association between complement activation and tumor growth [2930] which provides a strong biologically link between the abnormal expression and activity of complement cascade and carcinogenesis. Till now a few studies have been carried out to demonstrate the association of genetic variants in complement proteins with susceptibility to cancer. A significant association of CR2 SNP (rs3813946) with the development of nasopharyngeal carcinoma was indicated in Cantonese population [31] and the genetic variations of complement system genes C5 and C9 plays a potential role in susceptibility to non-Hodgkin lymphoma (NHL) [32]. Recently it has been shown that complement factor H Y402H polymorphism interact with cigarette smoking to confer the susceptibility to lung cancer [33]. Furthermore it has been indicated that CR1 A3650G (His1208Arg) polymorphism plays a critical role in conferring genetic susceptibility to gallbladder cancer in north Indian population [19]. However whether the genetic variants of CR1 are related to the risk of lung cancer remains unknown. In this case-control study we found an intronic SNP (rs7525160 G?>?C) with CC genotype was significantly associated with an increased risk of NSCLC. Consistently our results were in accordance with the study that genetic polymorphisms in innate immunity genes may play a role in the carcinogenesis of lung cancer [34]. It is likely that some genetic variations in strong link disequilibrium with this intronic SNP (rs7525160 G?>?C) are functional which provides a new insight into the hallmarks in susceptibility to lung cancer and further functional experiments are warranted to address the proposal. Functionally human CR1 exists on the surface of almost all peripheral blood cells and plays a key role in immune complex clearance and complement inhibition at the cell surface by binding to activated products C3b and C4b [435]. CR1 also possesses cofactor activity for the serum protease factor I and is thus involved in the generation of further fragments of C3/4b with the activation of complement cascade and the cellular immune response [4]. In our study the association of CR1 polymorphism with lung cancer is biologically plausible in that the intronic polymorphism could affect the density of CR1 molecules on the cell surface thereby contributing to autoimmune disorders and neoplasm. Tobacco smoking is an established risk factor for susceptibility to lung cancer. However not all people who suffer from lung cancer are smokers. Lung cancer in non-smokers can be induced by second hand smoke air pollutants and diesel exhaust [36-39]. Our present data showed significant difference of pack-year smoked but not smoking status between NSCLC cases and controls which suggested the important role of other environmental factors in the development of NSCLC. Tobacco could induce chronic and sustained inflammation in lung microenvironment contributing to pulmonary carcinogenesis in smokers [40]. Support also comes from the epidemiologic data regarding inflammation and lung cancer [41]. CR1 an important molecule implicated in immunity and inflammation could protect the host from invasion of exogenous chemicals derived from cigarette smoking. Genetic variant of CR1 could alter gene function and result in deregulation of the inflammatory and immune responses thereby modulating the susceptibility to lung cancer. More importantly we observed a potential interaction of this SNP (rs7525160 G?>?C) with smoking status suggesting the gene-environmental interaction plays a prominent role in the susceptibility to lung cancer. Our present study has its limitation. Our patients may not be representative of total NSCLC patients at large because they were recruited from only one hospital. In addition due to the relatively small sample size further case-control studies are still needed to replicate and extend our findings. Conclusion We conducted a case-control study in Chinese subjects and found an intronic SNP (rs7525160 G?>?C) of CR1 was significantly associated with lung cancer risk. To the best of our knowledge this study provides the first evidence that genetic variant of CR1 (rs7525160 G?>?C) was a smoking-modifying contributor to the development of lung cancer. Methods Study subjects This case-control study consisted of 470 patients with histopathologically confirmed NSCLC and 470 cancer-free controls. All subjects were genetic unrelated ethnic Han Chinese. Patients were recruited between January 2008 and December 2012 at Tangshan Gongren Hospital (Tangshan China). There were no age gender or stage restrictions however patients with previous malignancy or metastasized cancer from other ans were excluded. The response rate for patients was 94%. The controls were randomly selected from a pool of a cancer-free population from a nutritional survey conducted in the same region. The selection criteria for control subjects included: i) no individual history of cancer; ii) frequency matched to cases according to gender age (±5 years); iii) the residential region; and iv) the time period for blood sample collection. At recruitment informed consent was obtained from each subject and each participant was then interviewed to collect detailed information on demographic characteristics. This study was approved by the institutional review board of Hebei United University. Tag SNPs selection and genotyping Based on the Chinese population data from HapMap database we used Haploview 4.2 program to select candidate tag SNPs with an r2 threshold of 0.80 and minor allele frequency (MAF) greater than 1%. Furthermore we also added two potential functional polymorphisms rs9429942 and rs6691117 [4243]. Therefore we included 13 SNPs in our study which represents common genetic variants in Chinese population. Genotyping was performed at Bomiao Tech (Beijing China) using iPlex Gold Genotyping Asssy and Sequenom MassArray (Sequenom San Diego CA USA). Sequenom™s MassArray Designer was used to design PCR and "
Lung_Cancer
"This study was supported by grants from National Basic Research Program of China (973 Program No. 2012CB967003 to S. Shao) Natural Science Foundation of China (NO. 20935004 81071784 to S. Shao and 81172028 to Z. Hou). The funders had no role in study design data collection and analysis decision to publish or preparation of the manuscript. Introduction Squamous cell carcinoma (SCC) is the second most common type of lung cancer accounting for about 30% of all lung cancers [1]. When diagnosed early lung SCC (LSCC) is well curable by surgical excision. However most of LSCC patients encounter high rate of recurrence for metastasis and resistance to existing chemotherapeutic agents after resection. Therefore in order to reduce mortality of LSCC it is necessary to identify molecular markers for early diagnosis and elucidate the biochemical mechanism governing the processes of recurrence and metastasis as well as therapeutic resistance. A proteomic approach using fluorescent dye-labeled proteins coupled with two-dimensional gel electrophoresis (2-DIGE) and mass spectrometric (MS) analysis has been widely applied to identify differentially expressed proteins between normal and tumor specimens [2]. These differentially expressed proteins could either serve as molecular markers for diagnosis or lead to understanding the molecular mechanisms of metastasis and therapeutic resistance. By employing the 2-DIGE and MS approaches we compared the protein profiles between clinical metastatic non-metastastic LSCC tissues and adjacent normal lung tissues and identified a number of differentially expressed proteins participating in many biological functions such as cell signaling regulation carbohydrate metabolism molecular chaperones and protein synthesis. Among these protein candidates we were particularly interested in fructose-bisphosphate aldolase A (ALDOA) an key enzyme in glycolysis responsible for catalyzing the reversible conversion of fructose-16-bisphosphate to glyceraldehydes-3-phosphate and dihydroxyacetone phosphate [3]. ALDOA is one of the three aldolase isozymes (A B and C) encoded by three different genes. These aldolases are differentially expressed during development. ALDOA is highly expressed in the developing embryo and in adult muscle [3]. ALDOA contributes to various cellular functions and biological process related to muscle maintenance regulation of cell shape and mobility striated muscle contraction actin filament anization and ATP biosynthetic process [4]“[13]. ALDOA deficiency is associated with myopathy and hemolytic anemia [14]“[16]. Notably ALDOA has been found highly expressed in a variety of malignant cancers including human lung squamous [17]“[18] renal cell [19] and hepatocellular carcinomas [20]. However none of these reports examined the involvement of ALDOA in LSCC progression and metastasis. In this study we reported that ALDOA is highly expressed in LSCC and its expression level is correlated with LSCC metastasis. Further we demonstrated that depletion of ALDOA in lung cancer cells reduces its tumorigenicity and capability of migration. These observations suggest that ALDOA is a potential biomarker of LSCC metastasis and play important role in LSCC progression and metastasis. Materials and Methods Samples Preparation and Proteomic Analysis Seven pairs of matched primary LSCC samples (6 male and 1 female aging from 36 to 67 years old with an average age of 55 years old) were obtained from the Department of Thoracic Surgery of the First Affiliated Hospital of Dalian Medical University China. Three pairs are non-metastatic and 4 pairs are metastatic. No patients received preoperative radiotherapy and chemotherapy. The study was approved by the Ethic and Research Committees of Dalian Medical University and was conducted in accordance with the Declaration of Helsinki Principles. The patients thoroughly understood the collecting process and purpose of using the specimens and signed œinformed consents-specimen collection. The fresh samples from tumor and normal tissues (>5 cm away from the lesion) were snap-frozen and stored at ?80°C. The pathological diagnosis was done to confirm that tumor specimens were real SCC tissues. Surgery follow-ups were conducted to each patient at an interval of 12 months for 3 years. To prepare protein extracts the tissues were homogenized in buffer containing 7 M urea 2 M thiourea 4% CHAPS 30 mM Tris and a cocktail of protease inhibitors (GE Healthcare) and the supernatants were collected by centrifugation at 12000 g for 15 min at 4°C. 50 ug of pooled protein extracts was labeled with Cy2 as the internal standard control Cy3 and Cy5 were used to label experimental samples. The resulting samples were resolved bi-dimensionally on 12.5% SDS-PAGE gels. Images were acquired using the fluorescence scanner (GE Healthcare) at excitation wavelengths of 488/520 nm 532/580 nm or 633/670 nm respectively. The image analysis was processed using DeCyder 6.5 (GE Healthcare). BVA software module was used for matching spots between gels and average abundance and statistics calculation. The protein abundance was represented by the volume ratio of samples versus standards and the proteins of interest with an average ratio more than 1.50 or less than ?1.50 were selected for mass spectrometry analysis. Western Blot immunofluorecence and LSCC tissue microarrays Protein extracts (50 µg) were resolved on 12% SDS-PAGE gels transferred to nitrocellulose membranes (0.45 µm) and immunoblotted with rabbit anti-human ALDOA antibody (HPA004177 Sigma; 1?1500) or mouse anti-human ?-actin monoclonal antibody (1?4000)."
Lung_Cancer
" Successful examples of this include the co-development (and co-approval) of the BRAF inhibitor vemurafenib and its companion diagnostic BRAF V600E mutation assay for BRAF-mutant metastatic melanoma[1] and the ALK inhibitor crizotinib and its companion diagnostic ALK fusion gene test in advanced ALK-fusion positive non-small cell lung cancer (NSCLC) patients.[2] [3] [4] However in some cases predictive biomarkers for a targeted therapy are not recognized until after the drug is first approved. As an example the anti-EGFR antibody cetuximab was first approved in the US for the treatment of metastatic colorectal cancer in 2004. Numerous retrospective and prospective trials subsequently revealed that tumors harboring KRAS mutations were very unlikely to respond to cetuximab. In July 2009 FDA required labeling changes for cetuximab and another anti-EGFR antibody panitumumab requiring that the indications and usage state there was no treatment benefit with the drugs for patients whose tumors had KRAS mutations in codon 12 or 13 at a time when there were no FDA-approved diagnostic assays for KRAS mutations.[5] Only later in July 2012 did a KRAS mutation assay receive FDA approval based on the results of a prospective randomized trial highlighting the challenges of retrospectively validating a companion diagnostic assay after the pivotal drug trials have been completed.[6] The anti-EGFR TKI erlotinib was initially approved for all patients with advanced NSCLC who had progressed on first-line chemotherapy. A number of subsequent studies determined that patients with EGFR-mutant NSCLC had a high likelihood of responding to these TKI leading to trials in the first-line setting for EGFR-mutant cancer.[7] [8] [9] [10] [11] [12] [13] Four prospective randomized clinical trials studied in Asian populations demonstrated that erlotinib and gefitinib resulted in improved progression-free survival compared to chemotherapy for first line therapy in NSCLC patients with EGFR mutations.[7] [8] [9] [13] Other clinical studies in mixed ethnicity cohorts have concluded with similar results.[10][12] The EURTAC trial was a randomized phase 3 trial to assess the safety and efficacy of erlotinib compared with standard platinum-based chemotherapy for first-line treatment of a patient population with advanced EGFR-mutation detected NSCLC in a largely Caucasian population of European patients. Erlotinib-treated patients experienced significant improvements in median PFS (9.7 months vs. 5.2 months) compared to chemotherapy. Patients on the erlotinib arm also had a considerably higher percentage of responses (58% vs. 15%) in the intent-to-treat population.[11] This trial has been submitted for first line indication of erlotinib in EGFR mutated NSCLC patients. The majority of activating EGFR mutations are located in exons 19 (45%) and 21 (40“45%).[14] [15] [16] [17] [18] [19] [20] Guidelines from anizations such as ASCO CAP/AMP and NCCN recommend the use of anti-EGFR TKIs as first-line therapy in patients with EGFR-mutant advanced NSCLC based on the results of these pivotal clinical trials. [21] [22] [23] Recent recommendations by CAP/IASLC/AMP advise the identification of EGFR mutations present at >1% of which exon 19 deletions and an exon 21 mutation (L858R) account for greater than 90% of all mutations.[24] None of the guidelines specify the testing method to be used however the cobas EGFR Mutation test is CE-IVD approved and is recently FDA approved.[25] Here we present the retrospective analysis of a clinical validation study of the EGFR PCR test on a subset of lung cancer specimens from patients screened for the EURTAC trial. The EGFR PCR test demonstrated improved sample workflow relative to the LDTs used in the EURTAC trial enabling EGFR mutation screening in a single assay with a one-day turn-around time. The EGFR PCR test showed superior sensitivity and specificity compared with conventional Sanger sequencing. Methods The major study objectives were 1) to correlate the clinical outcomes (PFS BORR) from the subgroup of available samples tested by the EGFR PCR test to the results from the entire EURTAC population and 2) to compare the analytic performance of the EGFR PCR test to that of the original LDT and Sanger sequencing using massively parallel pyrosequencing (MPP) to resolve discrepancies observed between the other 3 testing methods. In the EURTAC trial1044 patients from hospitals in France Italy and Spain were screened using the LDT. For this study all samples were retrospectively analyzed under IRB approval from Copernicus IRB (00001313). Site specific IRB approval from each clinical site and written consent from all patients was obtained prior to the study conduct phase of NCT00446225.[11] [26] In 487 cases residual specimens were available for retesting with the EGFR PCR test (). A single 5 µm section with at least 10% tumor content from each of the 487 specimens was used for the EGFR PCR test. Genomic DNA from existing eluate or extracted from additional sections was tested on Sanger sequencing and MPP. lists the demographics of the patients screened for the EURTAC trial by the LDT sub-categorized by patients tested or not tested by the EGFR PCR test. Patients enrolled in the EURTAC trial were selected using a laboratory-developed test validated by the Laboratory of Oncology (ICO-Hospital Germans Trias i Pujol Badalona Spain) consisting of three methodologies.[26] In this study a single PCR-based assay for detecting EGFR mutations was used. Details of the analytical performance of this assay have been described previously.[27] .0089518.g001 Flow of samples through the study. E1 samples: tumor block not available for analysis. E2 samples: tumor material insufficient for analysis. LDT ?=? laboratory-developed test. .0089518.t001 Demographics of the patient cohort screened for EURTAC trial. SLCG LDT MD SLCG LDT MND EGFR PCR tested EGFR PCRnot tested EGFR PCR tested EGFR PCR not tested Total 172 53 303 489 Age (years) mean ± SD 64.1±10.4 62.9±10.4 61.7±10.6 61.7±10.6 Sex n (%) Male 41 (23.8) 14 (26.4) 179 (59.1) 281 (57.5) Female 131 (76.2) 39 (73.6) 124 (40.9) 208 (42.5) Race/ethnicity n (%) Caucasian 168 (97.7) 52 (98.1) 296 (97.7) 481 (98.4) Other* 4 (2.3) 1 (1.9) 7 (2.3) 8 (1.6) Smoking status n (%) Never smoked 124 (72.1) 31 (58.5) 74 (24.4) 133 (27.2) Past/currentsmoker 47 (27.3) 22 (41.5) 219 (72.3) 339 (69.3) Unknown 1 (0.6) 0 (0.0) 10 (3.3) 17 (3.5) Stage IIIB 13 (7.6) 2 (3.8) 17 (5.6) 40 (8.2) Stage IV 157 (91.3) 50 (94.3) 277 (91.4) 432 (88.3) Other* 2 (1.2) 1 (1.9) 9 (3.0) 17 (3.5) Histology n (%) Adenocarcinoma 156 (90.7) 47 (88.7) 266 (87.8) 407 (83.2) BronchioalveolarCarcinoma 1 (0.6) 2 (3.8) 5 (1.7) 16 (3.3) Other* 15 (8.7) 4 (7.5) 32 (10.6) 66 (13.5) *Other includes subjects with no information available. LDT ?=? laboratory-developed test; MD ?=? mutation detected; MND ?=? mutation not detected. SLCG inconclusive (n?=?27) data not shown. Statistical considerations Mutation Detected (MD) was defined as the presence of either an exon 19 deletion or L858R mutation. Mutation Not Detected (MND) was defined as the absence of both exon 19 deletions and the L858R mutation. SAS/STAT® software was used for all data analysis. Clinical outcome study statistics Kaplan-Meier survival curves were used to assess the PFS by treatment method (chemotherapy or erlotinib) among patients who were enrolled in the EURTAC trial and screened with the LDT as well as the subset of patients who were determined to be mutation-positive by the EGFR PCR test. Nonparametric log-rank test was performed to assess PFS between patients who were randomized to chemotherapy or erlotinib. The hazard ratio (chemotherapy vs. erlotinib) relative to PFS was also calculated. Best overall response was the best response recorded from the start of treatment until disease progression and BORR (Best overall response rate) was summarized with 95% confidence limits according to Pearson-Clopper methods based on investigators assessment for each treatment arm. Analytical performance statistics For analytical performance an agreement analysis was performed between the EGFR PCR test result and the LDT test. Mutation detection of exon 19 deletions and L858R mutations were analyzed in aggregate. Separately the EGFR PCR test was also compared to Sanger sequencing and MPP by a CLIA-certified laboratory. For the agreement analyses the positive percent agreement (PPA) negative percent agreement (NPA) and overall percent agreement (OPA) with their corresponding 95% confidence intervals (CIs) were calculated. In addition 3-way analyses using MPP as a second reference method was performed to resolve the discrepancy results. Mutation testing methods EGFR PCR Test The EGFR PCR test (cobas EGFR Mutation Test Roche Molecular Systems Inc Branchburg NJ USA) is a CE-IVD marked multiplex allele-specific PCR-based assay designed to detect 41 mutations in exons 181920 and 21 in FFPET specimens of human NSCLC.[28] DNA is isolated using the cobas DNA Sample Preparation Kit (Roche Molecular Systems Branchburg NJ). [29] A minimum of 150 ng of genomic DNA is required for PCR amplification which can typically be isolated from a single 5 µm FFPET section. The EGFR PCR test software version used in this study was designed to detect 29 deletions in exon 19 and 2 L858R variants in exon 21. Macrodissection is only recommended if tumor content is less than 10%; laser capture microdissection is not required. The EGFR PCR test was performed per manufacturer's package insert and results were automatically analyzed and reported. The limit of detection has been validated to 5% mutant alleles. The workflow from DNA isolation to results reporting can be performed in one 8 hour period.[27] LDT Patients in the EURTAC study were screened using a combination of methods developed by Laboratory of Oncology ICO-Hospital Germans Trias i Pujol Barcelona Spain.[11] In short EGFR activating mutations in exons 19 and 21 were initially identified by Sanger sequencing and confirmed by fragment length analysis for exon 19 deletions (FAM-labelled primer in an ABI prism 3130 DNA analyser (Applied Biosystems Foster City CA USA) and by Taqman assay for exon 21 (L858R) mutation. All tumor specimens were from the original biopsy taken prior to any treatment and before randomization. Testing was performed on ? 2mm2 of tissue obtained from one to three slides of 4-micron tissue sections which were subjected to laser capture microdissection to enrich for the presence of tumor cells. DNA was extracted using a standard laboratory protocol and tested at a single site in Spain in Laboratory of Oncology for EGFR activating mutations in exon 19 and 21 using a previously described method. The average turnaround time was approximately 5 days.[26] Bi-directional Sanger sequencing All samples tested by the EGFR PCR test were also tested by Sanger sequencing using DNA from FFPET specimens prepared by the cobas DNA Sample Preparation Kit and sequenced with 2× bidirectional Sanger sequencing by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol. Repeat Sanger sequencing was performed to compare the detection of EGFR mutations from adjacent sections of tissue to minimize any impact of tissue heterogeneity used for the EGFR PCR test relative to the original LDT results. Also sequencing protocols vary by laboratory in terms of the percent tumor content/sample that requires macrodissection. DNA isolated with the cobas DNA Sample Preparation Kit and used for sequencing required ?10% tumor content. Average turnaround time to results was 7 days. The estimated limit of detection is approximately 20% mutant alleles.[30] Massively parallel pyrosequencing (MPP) Samples with valid EGFR PCR test results with adequate DNA remaining from the initial extraction were tested by a MPP method (454 GS Titanium 454 Life Sciences Branford CT USA) by a CLIA-certified laboratory (SeqWright Houston TX USA) using a validated protocol.[31] This method is a 5“7 day process that involves amplicon generation pooling ligation emulsion PCR amplification and massively parallel pyrosequencing with manual data analysis. The estimated limit of detection for the assay is 1.25% mutant alleles. [27] The MPP method was used to demonstrate performance of the EGFR PCR test to a more sensitive method and as an arbiter for discrepant cases observed between the LDT or the repeat Sanger sequencing. In order to preserve patient privacy associated with tested clinical samples raw MPP sequencing results were anonymized and presented in Table S1. Results Specimen demographics 487 (47%) of 1044 specimens screened for the EURTAC trial using LDTs were available for testing using the EGFR PCR test. The flow of samples through the study is shown in . Patient demographics and baseline tumor characteristics for all patients by LDT status are shown in . There were no significant differences between subsets of patients tested and patients not tested by the EGFR PCR test (p>0.05) for each LDT status (mutation detected mutation not detected) with the exception of country of the screening clinic. Clinical outcomes for patients based on the EGFR PCR test results Of the 174 patients enrolled in EURTAC trial specimens from 134 (77%) patients were available for testing using the EGFR PCR test. Excluding 11 patients with invalid EGFR PCR test results and 7 patients with a result of EGFR mutation not detected a total of 116 (67%) patients were mutation detected by the EGFR PCR test and evaluable for clinical outcome analysis (57 patients in the chemotherapy arm and 59 in the erlotinib arm). Clinical outcomes (PFS BORR and OS) are presented in Table 2. Among EGFR PCR test positive patients those treated with erlotinib had a significantly prolonged PFS when compared to patients treated with chemotherapy (p-value <0.0001 log-rank test); the median PFS was 10.4 months (95% CI: 8.0 to 13.8 months) and 5.4 months (95% CI: 4.4 to 6.8 months) for patients treated with erlotinib or chemotherapy respectively (Figure 2). The HR based on the Cox proportional hazards model was reduced by 66% (HR 0.34; [95% CI: 0.21 to 0.54]) for patients in the erlotinib versus chemotherapy arm. One year after randomization a higher percentage of patients in the erlotinib compared with the chemotherapy arm were event-free (45% [95% CI: 32% to 59% versus 6% [95% CI: 0% to 15%] respectively). .0089518.g002 Figure 2 Kaplan-Meier curves of progression-free survival (PFS) for different treatments in treatment-naïve patients with non“small-cell lung cancer and EGFR mutation detected by the EGFR PCR test and LDT. .0089518.t002 Table 2 Summary of Clinical Outcome Analysis among EGFR PCR test positive patients in the EURTAC trial. Chemotherapy (N?=?57) Erlotinib (N?=?59) PFS (Investigator) Patients with event 37 (64.9%) 47 (79.7%) Patients without eventa 20 (35.1%) 12 (20.3%) ?Time to event (months) ?Medianb (95%CI) 5.4 [4.4; 6.8] 10.4 [8.0; 13.8] ?p-Value (Log-Rank Test) <0.0001 ?Hazard Ratio (95% CI) 0.34 [0.21; 0.54] ?1 year estimate ?Patients remaining at risk 2 24 ?Event-free Rateb (95%CI) 6% [0%; 15%] 45% [32%; 59%] Best Overall Analysis Response rates (95% CI) 14.0% [ 6.3%; 25.8%] 59.3%[ 45.7%; 71.9%] Difference in Response Rates (%) 45.29% [ 28.8%; 61.7%] ?p-Value (Chi-squared Test) <.0001 Odds Ratio (95% CI) 8.93 [3.59; 22.19] OS Patients with event 35 (61.4%) 36 (61.0%) Patients without eventa 22 (38.6%) 23 (39.0%) ?Time to event (months) ?Medianb (95%CI) 20.8 [17.3; 29.4] 25.8 [16.1; 30.0] ?p-Value (Log-Rank Test) 0.5381 ?Hazard Ratio (95% CI) 0.86 [0.54; 1.38] ?2 - year estimate ?Patients remaining at risk 16 23 ?Event-free Rateb (95% CI) 43% [29%; 57%] 51% [38%; 64%] Note: All eligible patients enrolled in study ML20650 were determined as EGFR mutation detected by the LDT. Among those patients with EGFR mutation confirmed by the EGFR PCR test were included in this table. Event ?=? Death or progression free whichever comes first for PFS analysis and event?=?death for OS analysis. a censored. b Kaplan-Meier estimates. C including censored observations. BORR were higher in patients in the erlotinib arm (59.3% [95% CI: 45.7% to 71.9%]) compared to the chemotherapy arm (14.0% [95% CI: 6.3% to 25.8%]). Patients in the erlotinib arm were much more likely to respond to therapy than patients in the chemotherapy arm (odds ratio of 8.93 [95% CI: 3.59 to 22.19]). There was no significant difference in OS between the treatment arms (25.8 months in the erlotinib arm (95% CI: 16.1 to 30.0) and 20.8 months in the chemotherapy arm (95% CI: 17.3 to 29.4) (log-rank test p-value ?=?0.5381)). PFS BORR and OS results for EGFR PCR test positive patients did not differ significantly from those obtained in all patients enrolled in the EURTAC trial which suggests that the EGFR PCR test positive patients are representative of all EURTAC enrolled patients. For the 7 cases where the EGFR PCR test result was mutation not detected and discrepant with the LDT two cases resolved in favor of the LDT by MPP three cases resolved in favor of the EGFR PCR test and one sample was invalid for both Sanger and MPP and the other was in agreement between the EGFR PCR test and Sanger but not MPP (Table S2). Anecdotally 6 of the 7 patients were treated with erlotinib and only one patient achieved greater than or equal to median PFS based on the LDT or the EGFR PCR test. Comparison of EGFR PCR test and LDT results Among 432 specimens with valid results from both the EGFR PCR test and LDT the PPA NPA and OPA were 94.2% (146/155 CI: 89.3% 96.9%) 97.5% (270/277 CI: 94.9% 98.8%) and 96.3% (416/432 CI: 94.1% 97.7%) respectively (Table 3). Thus there was a high concordance between the original LDT and EGFR PCR test results. Among sixteen specimens with discordant results the EGFR PCR test result was confirmed by MPP in 68.8% (11/16) cases (Table S3). .0089518.t003 Table 3 Agreement analysis between EGFR PCR test and LDT. SLCG LDT Total N?=?432 Mutation detected Mutation not detected EGFR PCR test Mutation detected 146 7 153 Mutation not detected 9 270 279 Total 155 277 432* ¢12 samples with inconclusive LDT results and 43 samples with invalid EGFR PCR test results were excluded. Positive percent agreement ?=?94.2% (95% CI [89.3“96.9%]). Negative percent agreement ?=?97.5% (95% CI [94.9“98.8%]). Overall percent agreement ?=?96.3% (95% CI [94.1“97.7%]). Comparison of the EGFR PCR test results with Sanger Sequencing Of 487 specimens tested using the EGFR PCR test and Sanger sequencing 406 gave valid results by both methods (38 were invalid by both methods five were invalid by EGFR PCR test and 38 were invalid by Sanger sequencing). The PPA NPA and OPA for EGFR PCR test compared with Sanger sequencing were 96.6% (112/116 CI: 91.7% 98.7%) 88.3% (256/290 CI: 84.1% 91.5%) and 90.6% (368/406 CI: 87.4% 93.1%; Table 4) respectively. Among 38 discordant results between the EGFR PCR test and Sanger sequencing MPP agreed with the EGFR PCR test result in 30 (78.9%) cases (Table S4). Sanger sequencing detected one L858R not detected by MPP and failed to detect 22 exon 19 deletions and 7 L858R mutations confirmed by MPP. Four MPP results were invalid and the remaining four results agreed with Sanger. The range of percent mutant alleles of the cases missed by Sanger was 3% to 60% with several specimens (n?=?16) under the estimated limit of detection for Sanger. .0089518.t004 Table 4 Agreement analysis between EGFR PCR test and Sanger sequencing. Sanger sequencing Total N?=?406 Mutation detected Mutation not detected EGFR PCR test Mutation detected 112 34 146 Mutation not detected 4 256 260 Total 116 290 406 *81 samples with invalid EGFR PCR test or Sanger sequencing results were excluded. Positive percent agreement ?=?96.6% (95% CI [91.5“98.7%]). Negative percent agreement ?=?88.3% (95% CI [84.1“91.5%]). Overall percent agreement ?=?90.6% (95% CI [87.4“93.1%]). Discussion This study supports the feasibility of performing a retrospective clinical validation of a companion diagnostic from prospective therapeutic clinical trials. The EGFR PCR test results were highly concordant (>96%) with the LDT results used to select patients for the EURTAC trial. As a consequence PFS and BORR of the subset of patients with EGFR mutations detected with the EGFR PCR test were comparable to the full cohort of patients enrolled in the EURTAC trial thus validating the use of the EGFR PCR test to select patients for treatment with anti-EGFR TKIs such as erlotinib. Median PFS survival was 9.7 versus 10.4 months for the erlotinib group and 5.2 versus 5.4 months for the LDTs and EGFR PCR test respectively. The BORR was 58% versus 59.3% months for the erlotinib group and 15% versus 14.0% for the LDTs and EGFR PCR test respectively. Among the 16 discordant specimens between the EGFR PCR test and LDTs a third mutation testing method agreed with the EGFR PCR test result in 11 cases. Of seven cases that were mutation detected by the EGFR PCR test and mutation not detected by the LDT 5 were confirmed by MPP. These patients could have potentially benefited from anti-EGFR TKI therapy. The EGFR PCR test had a number of technical advantages over the LDT used in the EURTAC trial. The LDT required laser capture microdissection of multiple tissue sections and involved 3 separate assays with a median turnaround time of 4.5 days. By comparison the EGFR PCR test required macrodissection only if the tumor content was <10% and can be performed in one day using a single 5 µm section. Furthermore the EGFR PCR test is a commercially available kit-based assay that provides an automated result rather than a manual process subject to interpretation and which can be performed by any qualified clinical laboratory. "
Lung_Cancer
"55% were male 86% Caucasian and 50% had Eastern Cooperative Oncology Group performance status (ECOG PS)=0. A median of four cycles of ziv-aflibercept was administered. The most common treatment-emergent adverse events (TEAEs) of any grade were nausea (69%) and fatigue (67%) with hypertension (36%) as the most common grade 3/4 TEAE. Of the 38 evaluable patients ORR was 26% and median PFS was 5 months. Conclusion: Cases of RPLS had been observed in other studies in the ziv-aflibercept clinical development programme but the rate observed in this study was higher than previously observed. This might be related to declining renal function and/or hypertension. Although ORR and PFS were in accordance with most historical first-line NSCLC studies this combination of ziv-aflibercept/cisplatin/pemetrexed will not be further explored in NSCLC. ziv-aflibercept non-small cell lung cancer reversible posterior leukoencephalopathy syndrome anti-angiogenesis Cancer growth is dependent upon angiogenesis to maintain a source of nutrition and oxygen (Folkman 1995) and vascular endothelial growth factor (VEGF) has a key role in tumour angiogenesis (Ferrara and Davis-Smyth 1997). Non-small cell lung cancer (NSCLC) produces VEGF and high serum levels of VEGF are correlated with poor prognosis (Korpanty et al 2010). Anti-angiogenic therapy thus aims to disrupt blood supply to tumours and has proven clinical benefit in non-squamous NSCLC (Jain 2001). Combination chemotherapy is used for the first-line treatment of advanced/metastatic NSCLC (Schiller et al 2002). The addition of the anti-VEGF antibody bevacizumab to carboplatin/paclitaxel in this setting improved response rate progression-free survival (PFS) and overall survival (OS; Sandler et al 2006). Similarly bevacizumab improved PFS when added to cisplatin/gemcitabine although OS was not significantly prolonged as a secondary end point in this case (Reck et al 2009). For non-squamous histology cisplatin/pemetrexed is a very active combination chemotherapy (Scagliotti et al 2008) and thus combinations of platinum/pemetrexed with bevacizumab or other anti-angiogenics are of strong interest for the first-line treatment of advanced/metastatic non-squamous NSCLC (Patel et al 2009b). Ziv-aflibercept (ZALTRAP Sanofi Bridgewater NJ USA and Regeneron Pharmaceuticals Tarrytown NY USA) is a recombinant fusion protein consisting of portions of human VEGF receptor extracellular domains fused to the Fc portion of human immunoglobulin (Gaya and Tse 2012). Ziv-aflibercept binds VEGF-A by acting as a high-affinity ligand trap to prevent binding to its endogenous receptor VEGFR-2 thereby inhibiting VEGF-induced angiogenesis in preclinical models (Lassoued et al 2010). Endothelial cells expressing high levels of VEGFR-2 were highly susceptible to blockade by ziv-aflibercept (Sitohy et al 2011). In addition ziv-aflibercept binds PIGF (placental growth factor) and VEGF-B which could potentially inhibit cancer invasion (Dowlati 2010). Studies have investigated ziv-aflibercept as a single agent or in combination with other chemotherapeutic agents in treatment of various types of cancers (Lockhart et al 2010; Tew et al 2010; de Groot et al 2011; Isambert et al 2012). In August 2012 ziv-aflibercept was approved by the US FDA for use in metastatic colorectal cancer based on the results of VELOUR trial (Van Cutsem et al 2012). A phase II study using ziv-aflibercept as monotherapy demonstrated objective responses in heavily pretreated patients with advanced adenocarcinoma of the lung (Leighl et al 2010) and improvement in response and PFS (but not OS) was observed in combination with docetaxel as second-line treatment of NSCLC (Ramlau et al 2012). We report the results of a phase II trial of ziv-aflibercept in combination with cisplatin and pemetrexed in patients with advanced or metastatic non-squamous NSCLC. This study was conducted after a phase I trial using the same regimen of ziv-aflibercept/cisplatin/pemetrexed (Diaz-Padilla et al 2012). That phase I trial determined the recommended dose of ziv-aflibercept (6?mg?kg?1 every 21 days) to be used in the current phase II trial which aimed to evaluate the efficacy and safety of ziv-aflibercept in combination with cisplatin and pemetrexed in the first-line treatment of advanced/metastatic NSCLC. Materials and methods Eligibility Patients eligible for this study had histologically/cytologically confirmed untreated locally advanced/metastatic NSCLC and they had to have measurable disease as per the Response Evaluation Criteria in Solid Tumors (RECIST) criteria (Therasse et al 2000). Patients with squamous histology and/or cavitating lesions were excluded. Patients were 18 years of age or older and had an Eastern Cooperative Oncology Group performance status (ECOG PS) of 0 or 1 with adequate bone marrow renal and hepatic functions and calculated creatinine clearance (CrCL) ?60?ml?min?1. Patients were excluded from the study if they had brain or central nervous system metastases; systolic blood pressure (BP) >150?mm?Hg and/or diastolic blood pressure >100?mm?Hg; bleeding diathesis or evidence of active bleeding; or recent significant cardiovascular cerebrovascular or thromboembolic conditions. "
Lung_Cancer
"These observations clearly demonstrate that acetylation of peptide's N-terminus is an efficient way to reduce the nonspecific kidney accumulation and optimize the in vivo kinetics of peptide-based imaging probes. To our surprise the apparent stability profile of all three divalent probes (64Cu-(M10)2 64Cu-D10 and 64Cu-AcD10) measured in rat serum out to 24 h were almost identical. This indicates that the in vivo properties of the divalent probe were improved as the result of its positive charge reduction. However we cannot rule out the possibility that acetylation improves the in vivo stability in mice. It is important to note that the previous PET studies with A20FMDV2 also used a capped N-terminus and the kidney uptake varied greatly. Similarly the ?v?6-binding cysteine knot probes showed persistent kidney retention. Therefore simple capping of the N-terminus does not abrogate kidney retention for all ?v?6 PET probes. Additionally it should be noted that multimerization of other peptidic ligands has also lead to a significant increase in kidney accumulation 30 48. Kidney retention of peptidic probes is a complicated multifactorial issue and involves numerous factors including peptide stability charge hydrophobicity choice of radiolabel peptide sequence and chemical modifications of the peptide 50-52. Due to their size peptides are filtered by glomeruli and excreted; however a small percentage of the peptide or peptide fragments are reabsorbed by the proximal tubules and retained. Although unlikely to induce substantial renal toxicity within the context of imaging retention of the radiolabel can affect detection of tumors within or around the kidneys. However kidney accumulation can be problematic for therapeutic applications in which the peptide is used to deliver radiopharmaceuticals or chemotherapeutics. As such efforts to reduce peptidic retention in the kidneys is of key importance. Minor changes in the charge and/or chemical structure of a peptide have been shown to dramatically affect renal uptake. Pre-dosing animals with polycationic species or Gelofusine prior to administering radiolabeled peptides has been observed to reduce kidney retention. PEGylation of peptides has also been shown to improve tumor-to-kidney uptake ratio. Although we have shown significant reduction of kidney retention by acetylating the peptide we are performing further empirical studies to minimize kidney accumulation of the radiolabeled peptidic probes. Integrins are commonly found in tumor cells as well as in angiogenic tumor vasculature. As previously mentioned the H2009.1-10mer peptide sequence contains an RGD moiety which is an overlapping ligand for various integrins such as ?v?3 integrin. Although in vitro data support the specificity of the H2009-10mer peptide for ?v?6 one may question whether our imaging results indeed reflect the ?v?6 expression in tumor. To answer this question we performed an imaging study in the same tumor models using our recently reported conjugate (64Cu-CB-TE2A-(c(RGDyK))2) built on the same BFCS which specifically targets the ?v?3 integrin. The cRGDyX peptide is widely used as an ?v?3-specific ligand for both molecular imaging of angiogenic tumor vasculature and anti-angiogenic therapies 53. Unlike H2009.1-10mer conjugates the 64Cu-CB-TE2A-(c(RGDyK))2 showed virtually identical uptake in H2009 and H460 tumors out to 24 h p.i. (1.8 %ID/g at 1h p.i.; 0.7 %ID/g at 24 h p.i.). Lack of specificity of 64Cu-CB-TE2A-(c(RGDyK))2 can be attributed to ubiquitous expression of ?v?3 integrin in angiogenic vessels as well as in tumor cells. Unlike 64Cu-CB-TE2A-(c(RGDyK))2 the specific imaging of H2009 tumor by 64Cu-(M10)2 64Cu-D10 or 64Cu-AcD10 is primarily due to the restrictive expression of ?v?6 integrin in H2009 tumor. These results clearly demonstrate the potential use of our designed probes for molecular profiling of ?v?6+ NSCLC. Conclusions Imparting multivalency is an effective way to improve biopotency of a phage selected peptide. The designed multivalent probes showed enhanced binding affinity which was utilized for PET signal enhancement in ?v?6+ tumor imaging. Significantly multivalent probes maintained the desired specificity to image ?v?6+ H2009 tumor while low signal was observed in ?v?6- H460 tumor. We showed that N-terminus acetylated probe (64Cu- AcD10) provided drastic uptake reduction in kidney and other non-target ans while maintaining tumor uptake. Further evaluation of this methodology is under way to realize its full potential in imaging probe design by utilizing existing ligands selected from combinatorial library screening. Overall the selective tumor uptake of 64Cu-AcD10 along with its favorable distribution in major ans makes it an ideal candidate to be developed for specific imaging of ?v?6+ expression. Additionally 67Cu can be used for radiotherapy opening the possibility of using this probe as a therapeutic as well. This work was partially supported by a small animal imaging research program grant (SAIRP) from the National Institute of Cancer (U24 CA126608 XS) the Welch Foundation (I-1622 KCB) and the National Institute of Biomedical Imaging and Bioengineering (1R01EB014244-01 XS and KCB). "
Lung_Cancer
"Toxicity and tumor markers were not associated with response. Grade 2 or greater skin rash and low pMAPK were associated with improved survival. Conclusions Overall survival was similar in this trial compared to first-line chemotherapy in this unselected patient population. Dose escalation to the development of grade 2 skin rash was associated with improved survival in this patient population. Bioinformatics Bioinformatics bioinformatics bioinfo Bioinformatics 1367-4803 1367-4811 Oxford University Press 25161229 4147902 10.1093/bioinformatics/btu449 btu449 Eccb 2014 Proceedings Papers Committee Original Papers Pathways and Molecular Networks Personalized identification of altered pathways in cancer using accumulated normal tissue data Ahn TaeJin 1 2 3 Lee Eunjin 1 2 Huh Nam 1 * Park Taesung 3 4 * 1Samsung Advanced Institute of Technology130 Suwon-si Gyeonggi-do 443-803 Korea 2Samsung Genome Institute Seoul 135-710 Korea 3Interdisciplinary Program in Bioinformatics and 4Department of Statistics Seoul National University Seoul South Korea *To whom correspondence should be addressed. 01 9 2014 22 8 2014 22 8 2014 30 17 i422 i429 The Author 2014. Published by Oxford University Press. 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/4.0/) which permits non-commercial re-use distribution and reproduction in any medium provided the original work is properly cited. For commercial re-use please contact journals.permissionsoup.com Motivation: Identifying altered pathways in an individual is important for understanding disease mechanisms and for the future application of custom therapeutic decisions. Existing pathway analysis techniques are mainly focused on discovering altered pathways between normal and cancer groups and are not suitable for identifying the pathway aberrance that may occur in an individual sample. A simple way to identify individual™s pathway aberrance is to compare normal and tumor data from the same individual. However the matched normal data from the same individual are often unavailable in clinical situation. Therefore we suggest a new approach for the personalized identification of altered pathways making special use of accumulated normal data in cases when a patient™s matched normal data are unavailable. The philosophy behind our method is to quantify the aberrance of an individual sample's pathway by comparing it with accumulated normal samples. We propose and examine personalized extensions of pathway statistics overrepresentation analysis and functional class scoring to generate individualized pathway aberrance score. Results: Collected microarray data of normal tissue of lung and colon mucosa are served as reference to investigate a number of cancer individuals of lung adenocarcinoma (LUAD) and colon cancer respectively. Our method concurrently captures known facts of cancer survival pathways and identifies the pathway aberrances that represent cancer differentiation status and survival. It also provides more improved validation rate of survival-related pathways than when a single cancer sample is interpreted in the context of cancer-only cohort. In addition our method is useful in classifying unknown samples into cancer or normal groups. Particularly we identified ˜amino acid synthesis and interconversion™ pathway is a good indicator of LUAD (Area Under the Curve (AUC) 0.982 at independent validation). Clinical importance of the method is providing pathway interpretation of single cancer even though its matched normal data are unavailable. Availability and implementation: The method was implemented using the R software available at our Web site: http://bibs.snu.ac.kr/ipas. Contact: tsparkstat.snu.ac.kr or namhuhsamsung.com Supplementary information: Supplementary data are available at Bioinformatics online. 1 INTRODUCTIONCancer arises from normal cells and can evolve to become malignant metastatic and/or resistant to therapy. The analysis of altered pathways in an individual cancer patient may help to understand the disease status and suggest customized anticancer therapies.It is straightforward to compare the molecular profile of an individual™s tumor and normal cells to discover molecular aberrances specific to his/her cancer. However it may not be feasible in the current clinical practice environment to perform a metastatic tumor biopsy at the time of treatment resistance in patients with advanced cancer (Dancey et al. 2012). A case study of custom-tailored medicine based on an individual™s genome and transcriptome highlights this limitation (Jones et al. 2010). A patient™s tumor had metastasized to the lung after surgery at the primary site. A biopsy from his lung tumor was analyzed by mutation and transcription profiling; however the patient™s normal lung tissue was not biopsied. Because there was no matched normal tissue messenger RNA (mRNA) expression in the patient™s own blood and information collected from various normal tissues were used to identify differentially expressed genes (DEGs). The results of pathway analysis based on DEGs integrated copy number variation and mutation information led the doctor to change the patient™s drug treatment and the disease was stabilized for 3 months.Although the personalized interpretation of pathways can be demanding most current pathway analyses have been developed to investigate deregulated pathways between two phenotype groups. Khatri et al. (2012) classified these methods into three types: overrepresentation analysis (ORA) functional class scoring (FCS) and a pathway topology (PT)-based approach.ORA approaches typically apply an arbitrary threshold value (e.g. fold change >2 or P < 0.05) on gene expression to assess whether the number of genes beyond threshold are significantly over- or underrepresented in the given pathway. There are two drawbacks to ORA. First it uses only the most significant genes and discards others thus resulting in information loss for marginally significant genes (Breitling et al. 2004). Second it considers only the number of genes and does not consider the magnitude of expression changes leading to information loss regarding the importance of genes (e.g. a gene with a fold change of 2.01 and a gene with a fold change of 4 are considered equally). Unlike ORA FCS methods do not discard genes with an arbitrary threshold but use all available genes which is an improvement over ORA (Tian et al. 2005). PT methods are essentially based on FCS methods with the addition that they consider network topology information. They compensate for the common limitation of ORA and FCS in reporting false-positive gene sets due to sets of overlapping genes. In our we focus on ORA and FCS methods extending and implementing each for personalized pathway analysis.There are two exceptional studies examining individualized pathway analysis (Drier et al. 2013; Vaske et al. 2010). PARADIGM is a tool that infers a pathway status by using known functional structures. The method models the functional structure of pathway as a set of interconnected variables where the variables are omic objects such as DNA mRNA and protein where the interaction between variables describes the functional status of a pathway. PARADIGM may perform better with multiple omics as it uses known functional relationships between a gene or inter-gene DNA and protein. Hence it might not perform well with single layer omic data such as from mRNA microarrays.Drier et al. (2013) proposed a personal pathway deregulation score (PDS) which represents the distance of a single cancer sample from the median of normal samples on the principal curve. To calculate PDS they reduced the dimensions by principal component analysis and found the best principal curve using entire cohort samples containing both normal and/or different stages of cancers. Drier™s method performs better than PARADIGM in the mRNA only datasets of brain and colon cancers. Calculating PDS requires data dependent preprocessing steps including selecting the number of principal components to be used and filtering out noisy gene data to obtain optimized principal curves. PDS fully uses whole cohort data to interpret an individual™s pathway which can be a drawback in that it requires a number of cohort data to extract principal curve to interpret a single patient data. It has a limitation to interpret a single sample such as a patient™s recurrent tumor that is not accompanied with cohort dataset to extract the principal curve.Our proposed method is based on the comparison of one cancer sample with many accumulated normal samples (we use ˜nRef™ to refer to the accumulated normal samples) that is different from the previous studies in following sense. The proposed method is suitable to adopt single-layer omics data and expendable to interpret a patient in the context of many published or user-defined pathway gene sets. PARADIGM has less freedom in terms of data and gene sets as it prefers multi-layered omics data and requires predefined functional structure among omics objects. Unlike PDS which extracts the principal curve from entire cohort data our method does not assume an individual sample belongs to a cohort. We introduce using accumulated normal tissue data as a reference. This is a simple and biologically intuitive guideline in such a case to interpret a single sample that lack cohort data.Our method provides a series of analysis steps which consists of four parts: data processing gene-level statistics individualized pathway aberrance score (iPAS) and a significance test. To discover the most feasible method for iPAS we extend existing pathway analysis techniques namely ORA and FCS to properly reflect the nature of testing one cancer to many normal samples.To demonstrate that iPAS captures biologically and clinically relevant information in a sensible valid and useful manner we apply it to samples of lung and colon adenocarcinoma. We show that our representation generates clinically relevant stratifications and outcome predictors which would not have been achieved when the same data are analyzed by the conventional method that does not use accumulated normal data.Our empirical study suggests two different strategies depending on the biological question that iPAS is focused on. In the case of cancer diagnosis a method that uses the inter-gene correlation structure of the accumulated normal samples performs best. In the case of cancer prognosis a simple averaging of all member genes™ standardized gene expression values performs best.2 METHODS AND MATERIALS2.1 Gene expression dataWe built nRef by the manual curation of data obtained from NCBI GEO (Barrett et al. 2012). Microarray data of adjacent normal tissues obtained from patients undergoing surgery were selected to serve as the nRef. Data from biopsied samples primary cultures of normal tissues and post-mortem donors were not included in the nRef. We collected 120 nRef for lung 60 from GSE19804 (Lu et al. 2011) 27 from GSE7670 (Su et al. 2007) and 33 from GSE10072 (Landi et al. 2008). Samples came from individuals with variable smoking histories and different ethnic backgrounds. We collected 101 nRef™ for colon concentrating on normal mucosa tissue samples from six datasets available at GEO. To evaluate the effectiveness of our method in survival analysis we used Beer™s data of 442 lung adenocarcinomas (LUADs) (Beer et al. 2002) to discover survival-related pathways and validated the associations of 61 LUAD samples of GSE8894 (Lee et al. 2008). The pathway based identification of LUAD were tested on 120 cancers and 120 normal samples of GSE19804 GSE7670 and GSE10071. Further validation was conducted with 48 cancers and 35 normal samples collected from GSE19188 (Hou et al. 2010) and GSE31547. For patient stratification by colon cancer differentiation status we used 566 microarrays of GSE39582 (Marisa et al. 2013) which provided in a separate manner 443 for discovery 123 for validation. GSE17536 (Smith et al. 2010) was also used for validation.2.2 Pathway dataInformation from gene sets representing biological pathways were obtained from REACTOME (Croft et al. 2011) which are also provided in the Molecular Signature Database (Subramanian et al. 2005). Pathways with small number of genes are more easily understood by human experts. We decided to filter out pathways of which gene set size is >97. The cutoff covers at least 80% of contents of each public pathway resources. Of 674 pathways in REACTOME 583 pathways (86.7%) remained after filtering by the gene set size.2.3 Individualized analysis using the nRefThe aim of our approach is to identify altered pathways in an individual by making use of the nRef. A schematic diagram of our method of individualized pathway analysis is described in Figure 1 and the following sections describe each step. Fig. 1.Schematic description of individualized pathway analysis using accumulated normal data (nRef). An individual™s tumor data are normalized with the nRef. Gene expression is standardized by mean and SD of the nRef. The iPAS is calculated from standardized gene expression values in the pathway. Null distribution calculated from the nRef provides significance2.3.1 Data preprocessing and gene-level statisticsExpression level was defined by using the robust multichip average (Irizarry et al. 2003). For datasets using different microarrays only those with probes in common from Affymetrix U133A to Affymetrix U133Plus 2.0 were used for further analysis. For individual tumor cases we performed quantile normalization (Bolstad et al. 2003) after combining the single tumor microarray with all nRef samples. In cases of genes with multiple probes gene expression level was summarized by averaging probe-level expression. Individual tumor sample gene expression was standardized using the mean and standard deviation of the reference.2.3.2 Pathway-level statistics and significance testWe introduce five methods as candidates for iPAS. Each method is a modification of existing pathway analysis techniques enabling us to test an individual tumor sample™s pathway aberrance by using the nRef. A summary is provided in Table 1. Table 1.Modification of existing pathway analysis methods for iPASNote. Significance can be obtained against the null distribution generated from normal samples. All the collected normal samples for the nRef are one by one compared with the nRef to yield statistics of the null distribution. A statistic from a single cancer case is compared with this null distribution to yield P-value.Average ZStandardizing the gene expression by mean and standard deviation from datasets is often used in microarray analysis. A vector Z = (z1 z2 ¦ zn) denotes the expression status of a pathway where zi symbolizes the standardized expression value of i-th gene where the number of genes belonging to the pathway is n. In typical settings standardization is performed using the mean and SD of a given dataset mostly the cancer-only cohort data thus y¯/n indicates how much the given sample™s overall pathway gene expression deviates from the center of the cancer samples. We made the simple modification Z™ = (z1™ z2™ ¦ zn) where zi™ is derived from mean and SD of the nRef. In this case y'¯/n gives the samples deviation from the nRef. We believe this modification is biologically valid because every cancer starts its malignancy from normal cell. Thus the clinical characteristics of a single cancer can be captured by measuring the difference of it against common characteristic of normal cells which is represented by the nRef in our study.Fisher exact testWe generated a 2 × 2 contingency table for a given pathway (S) and DEGs (D) for the test. For individualized interpretation we define D by the ranking of z-value which is standardized gene expression for the mean and SD of the nRef. For each individual sample 5% (highest 2.5% and lowest 2.5%) of the total genes are defined as D. We applied a two-tailed test to detect alteration of pathways due to enrichment or depletion of differential genes. The result of this statistic can be interpreted as how many DEGs are enriched in the given pathway where the expression difference refers to how much a patient™s gene expression deviates from the nRef.Gene set enrichment analysisWe adopted the original version of gene set enrichment analysis (GSEA) proposed by Subramanian et al. (2005). Typically inputs for GSEA are generated by testing whole cohort samples using phenotype label; t-statistic correlation coefficients and fold changes are usually used. In the personalized analysis setting we use the z-value as an input for the GSEA algorithm which is standardized gene expression by mean and SD of the nRef. The GSEA output enrichment score reflects the degree to which a gene set in the pathway is overrepresented at the extremes (low or high) of the entire ranked list of z-values from a single patient.Non-parametric quadratic testGene expression in a pathway of a tumor sample is represented by vector Z = (z1 z2 ¦ zn) where zi is standardized expression level of i-th gene by mean and SD of the nRef where n is the number of genes belonged to the pathway. A pathway characteristic of an individual patient™s pathway can be represented by the averaged Euclidean distance (ZTZ/n). This gives the distance of a single patient from the center of the nRef due to the square of standardized expression difference and thus does not reflect increased or decreased expression only the extent of the expression difference. Genes in the pathway are usually functionally correlated; therefore use of the correlation structure of the normal samples may increase sensitivity enough to capture the aberrance of a single cancer case. We also consider the averaged Mahalanobis (ZTSZ/n) distance which uses the covariance matrix calculated from the nRef. This value describes the statistical distance from the center of normal samples taking into account correlation among normal samples. The covariance matrix S is calculated for each pathway from the nRef.3 RESULTS3.1 Pathway-based identification and validation of cancer survivalTo assess whether our method can sensitively detect pathway aberrances that are associated with a patient™s clinical outcome a known survival pathway that showed strong association with patient survival from Beer™s data was tested. Bryant et al. (2010) reported that the ˜cell cycle stimulatory™ pathway of 51 genes is significantly associated with patient survival (Cox proportional hazards model P = 0.000113). In that study pathway gene expression was represented as an average of z-values where the z-value indicates the standardized expression level by the mean and SD of all cancer samples. The high-risk group was defined as those in which pathway expressions were >0 and the pathway showed poor prognostic outcome. The association was significant with or without adjusted clinical covariates and thus the pathway alone is a strong indicator of cancer prognosis. This finding was also validated in the Japanese LUAD cohort (n = 87 survival data are not provided to public) in Bryant™s study. As studies have shown a clear association between the cell cycle pathway and cancer in terms of driving cancer proliferation we considered this pathway as a pathway that should be detected. All of the methods proposed as candidates for iPAS showed significant associations of the ˜cell cycle stimulatory™ pathway from Beer™s data (Table 2). The same pathway analyzed using GSE8894 (n = 61) data yielded significant associations in all proposed methods with the marginal exception of Mahalanobis (P = 0.0549). Table 2.Survival analysis of ˜cell cycle stimulatory™ pathway reported by Bryant et al. (2010)DatasetPathway statisticsCoefficientP-valueBeer (N = 432) Bryant et al. Overall survivalAverage Za0.370.00011Beer (N = 442) Overall survivalAverage Zb0.620.00003Fisher0.500.00068GSEA0.650.00001Euclidean0.650.00001Mahalanobis0.670.00001GSE8894 (N = 61) Recurrent free survivalAverage Zb0.900.01163Fisher0.910.01076GSEA0.780.02899Euclidean0.870.01544Mahalanobis0.680.05485aDerived from mean and SD of all cancer samples in the dataset bDerived by mean and SD of the nRef.Prognostic gene expression signatures for Stages II and III colon cancers have been reported in seven papers yielding 207 genes in total (Bandres et al. 2007; Barrier et al.2006 2007; Eschrich et al. 2005; Kopetz and Abbruzzese 2009; Lin et al. 2007; Wang et al. 2004). The genes are enriched in 32 REACTOME pathways (False Discovery Rate (FDR) < 0.05 pathway size < 96). We assumed the 32 pathways were valid as ground truth to be identified and analyzed in the colon cancer dataset GSE39585 (Stages II and III were only considered). Average Z provided best performer (sensitivity = 0.88) with 28 pathways deemed as significant. GSEA Fisher Euclidean and Mahalanobis gave the following values0.780.66 0.06 and 0.03 respectively.These results satisfied us that our approach captures the fundamental knowledge of cancer thus it is reasonably considered as iPAS.To investigate which of the candidates for iPAS most robustly reflect phenotype association we evaluated the proposed methods by determining whether survival-associated pathways are validated in datasets never used for discovery using LUAD and colon cancer [LUAD: Beer™s set n = 442 for discovery GSE8894 (n = 61) GSE3141 (n = 58) for validation; colon cancer: GSE39582d (n = 443) for discovery GSE39582v (n = 123) and GSE17536 (n = 109) for validation logrank P < 0.05 comparing tumors in the top 50th percentile of aberrance scores to those in the bottom 50th percentile]. Validation rates varied depending on the dataset and these were possibly affected by the small sample size compared with that of the discovery set. In these cases we were not able to determine a superior method that outperformed the others. Average Z gave the highest validation rate in three of four dataset with validation rates of GSE8894 (43.6% 92/211) GSE3141 (13.3% 28/211) and GSE17536 (10.7% 24/224). When validation rates from four datasets are averaged Average Z gave the highest validation rate (21.9% Fig. 2 blue bars). Pathways validated as significantly associated with patient survival for each cancer are listed in the Supplementary Materials (Supplementary Tables S1 and S2). Fig. 2.Averaged validation rate of discovered survival-related pathway at four datasets. Proposed approach using nRef (blue) versus conventional approach that standardizes individual sample by mean and SD of entire cohort dataset (red)We also investigated the validation rate of iPAS candidates under the conditions where the same data are not standardized by the nRef but instead standardized by the mean and SD of the cohort dataset which consists of only cancers (Fig. 2 red bars). It is noteworthy that use of the nRef increased the validation rate for every iPAS candidate investigated. This implies that the strategy of using accumulated normal samples as a reference is beneficial in terms of pathway-based survival analysis.3.2 Identification of clinical importanceCluster analysis of using Average Z as the iPAS method on Beer™s data identified 12 pathway clusters (denoted by 1?12 in Fig. 3) and 3 sample clusters (S2?S4; S1 is from the nRef; Fig. 3). Sample clusters S2 and S4 represent well the differentiation status of LUAD (Fisher exact test P < 4.65 × 10?15). Well-differentiated adenocarcinoma resembles the normal glandular structure; therefore it is a reasonable result that cluster S2 is close to the nRef. The survival outcome of S2 and S4 are significantly different (P < 0.0028) and this assures us that unbiased clustering-based iPAS has enough sensitivity to capture clinically important associations. This finding is concordant with prior knowledge that well-differentiated LUAD patients are likely to have better prognosis (Barletta et al. 2010). Pathway cluster P9 is distinguished as commonly upregulated in tumor samples. The pathways are transfer RNA aminoacylation amino acid or purine synthesis DNA elongation and the extension of telomeres. Fig. 3.Clustered iPAS of LUAD dataset. Pathways (n = 583) and samples (n = 442) are clustered according to iPAS. Normal samples are clustered at left (S1). Tumors (S2?S4) deviate from normal in both up- and downregulated directions (darker red and blue respectively). Sample clusters are well-representing histopathological differentiation status (S2: for well-differentiated LUAD P < 4.65 × 10?15) and overall survivalUnbiased pathway-based clustering of colon cancer data also captures clinically important associations by revealing sample clusters that are survival related (S2 and S3 P = 0.0037 Supplementary Fig. S1). It is important to note that iPAS is not only sensitive enough to identify clinically meaningful substructure of patients but also reveals common characteristics of a cancer at the same time. For example pathways commonly up- or downregulated in all cancer samples for example P9 or P2 would have not been discovered if the analysis had been performed by a conventional approach that does not make use of ˜nRef™ (Supplementary Fig. S2).3.3 Pathway-based identification of cancerCancer develops unique mechanisms for malignancy. Therefore it is reasonable to believe that identifying the unique molecular aberrances of cancer will aid in cancer diagnosis. Our empirical study of iPAS-based clustering of LUAD revealed several pathways commonly up- or downregulated in all of the cancer samples. Further analysis was performed to determine whether iPAS could be successfully used in the accurate identification of cancer. We tested this in a simple unsupervised way by judging whether an unknown sample is significantly different against the nRef as a tumor if not as normal. We performed a 5-fold cross-validation one hundred times with the LUAD dataset which consisted of 120 cancers and 120 normal samples. Microarray data from the normal samples was randomly divided into five groups and four of the five served as the reference group. The remaining group was used as the true normal set for the test of pathway-based identification of cancer. To build true cancer set for the test the same number of cancer sample was randomly picked. We considered 583 pathways in REACTOME giving 293 500 (583 pathways × 5-fold × 100 repeats) AUCs and accuracy values. We averaged AUCs and accuracies from the five candidate methods for iPAS and used this as a representative AUC and accuracy of a given pathway.By ranking the pathways by AUC top pathways that marked averagely high performance by all iPAS candidates are listed (Supplementary Table S3). The ˜amino acid synthesis and interconversion and transamination™ pathway showed the highest classification performance. Unsurprisingly this pathway was one of the commonly upregulated pathways in the analysis of the Beer™s data (Fig. 3 pathway cluster P9). Among the tested iPAS candidates for this pathway Mahalanobis yielded the highest AUC (0.980) while Average Z gave 0.936 and Fisher™s exact test gave the lowest value (0.914). The standardized gene expression pattern for this pathway differed between tumor and normal. Many of the genes deviated from mean of the nRef by more than two orders of sigma contributing to its best performance out of all iPAS candidate methods including ORA method like Fisher™s exact test (Fig. 4a). Fig. 4.(a) Expression pattern of genes in the pathway. Each line represents sample. (gray: normal red: tumor). Dashed line represents expression value deviated 1.96? from the mean expression value of normal tissues. (b). Performance of classification of cancer by ˜amino acid synthesis and interconversion and transamination™. AUC of 0.980 has marked in discovery set (95% confidence interval provided as error bar) independent validation set results AUC of 0.982 (Validation 1: normal samples in validation set served as reference) and 0.982 (Validation 2: normal samples in discovery set served as reference)We also analyzed the influence of using the subset of normal samples as nRef. We compared the pathway-based cancer identification results using the full set of normal samples (n = 120) against 100 different runs using 75% (n = 90) 50% (n = 60) of randomly chosen normal samples. Among the pathways that marked averagely high performance in the identification of cancer the best and the second best pathways are considered ˜amino acid synthesis and interconversion and transamination™ and ˜unwind of DNA™ respectively. The result shows little loss of performance even though only a half of normal samples were used for the test (Fig. 5a and b). Fig. 5.Performance of pathway-based identification of cancer (AUC) when only a subset of normal samples are served as nRef. (a) ˜amino acid synthesis and interconversion and transamination™ (b) ˜unwind of DNA™3.4 Validation of the discovered pathwayThe ˜amino acid synthesis and interconversion and transamination™ pathway consists of 17 genes involved in three major reactions as it is described at REACTOME. The pathways are responsible for (i) synthesis of three amino acids (aspartate asparagine glutamate) (ii) the synthesis of glucose under fasting conditions by using carbon atoms from these four amino acids and (iii) conversion of amino acids to their corresponding alpha-keto acids coupled to their conversion to glutamate which is the first step in the catabolism of most amino acids.This function makes sense in terms of the ˜glutamine addiction™ of cancer cells. The nutrients glucose and glutamine are specifically required by cancer cells as metabolites for growth and for production of adenosine triphosphate (Munoz-Pinedo et al. 2012). Myc and p53 have been revealed to be associated with this ˜addiction™ by upregulating glutamine synthesis in cancer cells. Thus our finding is in accordance with prior knowledge regarding the upregulation of glutamine synthetase.We further validated our findings with an independent set that were not used in the discovery set. We collected two more LUAD gene expression datasets with normal data at GEO (GSE19188 GSE31547). Aggregated datasets of 48 microarrays from tumor tissues and 35 microarrays from normal tissues were used for independent validation. The pathway was also altered in a cancer-specific way in a validation set yielding an AUC of 0.982 by Mahalanobis-based iPAS (Fig. 4b Validation 1). We also assessed the same validation set in a different manner by using the nRef from the discovery set. Normal sample microarrays from the discovery sets (GSE10082 GSE7670 GSE10072) served as the nRef to classify samples in the independent validation set. The resulting AUC was 0.982 by the Mahalanobis method (Fig. 4b Validation 2).In our experiments using LUAD samples the Mahalanobis distance which used a pre-calculated covariance matrix from the ˜nRef™ gave the best performance. The usage of covariance matrix empowers Mahalanobis to consider a cancer sample as an outlier delivering higher accuracy in terms of pathway-based identification of cancer than other methods. One caution of using Mahalanobis method is that it requires a large number of normal samples to guarantee the estimation of covariance matrix. For a small sample size a structured covariance matrix would be desirable to avoid the estimation issue.The biological role of this identified pathway is to supply nutrients and energy to cancer cells. "
Lung_Cancer
"non-small cell lung cancers (NSCLCs). In this study we searched for HLA-A*02:01- and HLA-A*24:02-restricted epitopes derived from EML4-ALK by screening predicted EML4-ALK-derived candidate peptides for the induction of tumor-reactive CTLs. Nine EML4-ALK-derived peptides were selected by a computer algorithm based on a permissive HLA-A*02:01 or HLA-A*24:02 binding motif. One of the nine peptides induced peptide-specific CTLs from human peripheral blood mononuclear cells. We were able to generate a peptide-specific CTL clone. This CTL clone specifically recognized peptide-pulsed T2 cells and H2228 cells expressing HLA-A*02:01 and EML4-ALK that had been treated with IFN-? 48 h prior to examination. CTL activity was inhibited by an anti-HLA-class I monoclonal antibody (W6/32) consistent with a class I-restricted mechanism of cytotoxicity. These results suggest that this peptide (RLSALESRV) is a novel HLA-A*02:01-restricted CTL epitope and that it may be a new target for antigen-specific immunotherapy against EML4-ALK-positive cancers. EML4-ALK peptide vaccine CTL clone lung cancer Introduction Lung cancer is one of the main causes of cancer-related mortality. Approximately 85% of lung cancers are diagnosed as non-small cell lung cancer (NSCLC) and the overall survival (OS) rate for advanced NSCLC is poor. The 5-year survival rate is 5% for stage IIIb NSCLC and <1% for stage IV NSCLC (1). Treatment for NCSLC is determined by the patient™s clinical and tumor characteristics performance status (PS) the histological subtype and tumor genotype/phenotype. Recently there have been many studies concerning agents that target molecular changes such as mutations in the epidermal growth factor receptor (EGFR) and the fusion oncogene EML4-ALK in which the echinoderm microtubule-associated protein-like 4 (EML4) is fused with the intracellular domain of anaplastic kinase (ALK) (2“4). Although significant advances have been made in the treatment of NSCLC using molecular targeted therapies such as erlotinib and crizotinib the median OS for patients with advanced NSCLC remains low (56) and acquired resistance to target agents is a major clinical problem. Therefore the development of novel therapies is needed (7). Immunotherapy manipulates the immune system to control and eradicate cancer. Many recent studies provide evidence suggesting that immunotherapeutic manipulations are viable in many tumor types including lung cancer. Numerous trials of peptide vaccines autologous cellular therapy T cell-directed antibody therapy and monoclonal antibody therapy for lung cancer have been carried out around the world (8“10) and some of them have shown favorable results (11“13). The EML4-ALK fusion gene was identified in NSCLC patients by a team led by Professor H. Mano. This fusion gene was formed as the result of a small inversion within the short arm of chromosome 2 that joins differing portions of the EML4 gene with a portion of the ALK gene (1415). As a result of this fusion constant dimerization of the kinase domain of ALK is induced and its catalytic activity increases consequently. The EML4-ALK fusion gene is mainly identified in young never/former light smokers with NSCLC (16). It is estimated that approximately 5% of all NSCLC cases have this fusion gene. A few reports have also identified EML4-ALK in other cancers namely breast cancer and colorectal cancer (1718). For the most part the EML4-ALK fusion gene and other mutations such as those in EGFR and KRAS are mutually exclusive (19). The chromosomal inversion does not always occur in the same location and multiple EML4-ALK variants have been identified (19). At least 11 variants have been reported. The most common variants are E13;A20 (variant 1) and E6a/b;A20 (variant 3a/b) which have been detected in 33% and 29% of NSCLC patients respectively (14). PF-02341066 (crizotinib) is an ALK inhibitor currently under clinical development. Kwak et al conducted an open-label multi-center two-part phase I trial and found a remarkable 57% overall response rate and a 72% 6-month progression-free survival rate (20). In spite of the marked antitumor activity of crizotinib ALK-positive cancers invariably gain resistance to crizotinib. In the case of ALK-positive cancers as well as EGFR-mutant lung cancer resistance develops on average within the first 2 years of therapy (21). The main resistance mutations are L1196M a gatekeeper mutation and C1156M. In addition to ALK mutations other known mechanisms for acquired resistance include ALK amplification (2122) and EGFR activation (2324). To overcome resistance new ALK inhibitors are currently in early phase studies (25). Novel combinatorial strategies to overcome crizotinib resistance and further improve the clinical outcome are needed. We focused on this new fusion array as a novel target of immunotherapy. There are several methods to detect EML4-ALK NSCLC including polymerase chain reaction (PCR) immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) (19). These methods detect high-level EML4-ALK fusion gene expression. Passoni et al identified two HLA-A*02:01-restricted ALK-derived peptides that induce peptide-specific CTL lines (26). We focused on the EML4 array as a novel epitope of immunotherapy. We identified a candidate 9- or 10-amino acid array of novel epitopes using the Bioinformatics and Molecular Analysis Section (BIMAS) software and analyzed its potential as a new immunotherapy epitope with respect to its ability to induce anticancer activity. We then induced and generated a peptide-specific CTL clone from peripheral blood lymphocytes of HLA-A*02:01-positive healthy donors. We report here that an EML4-ALK-derived peptide-specific human CTL clone recognized peptide-pulsed T2 cells and HLA-A*02:01-positive and EML4-ALK-positive tumor cells pretreated with IFN-?. Furthermore we showed that immunotherapy with this novel epitope peptide has potential for treatment of EML4-ALK-positive NSCLC. Materials and methods Peptides Human EML4-ALK-derived peptides carrying binding motifs for HLA-A*02:01-/HLA-A*24:02-encoded molecules were identified by HLA-peptide binding predictions using the BIMAS program (http://bimas.dcrt.nih.gov/molbio/hla_bind/index.html). We purchased a total of seven EML4-ALK-derived peptides carrying HLA-A*02:01 binding motifs and two peptides carrying HLA-A*24:02 binding motifs from Geneworld (Tokyo Japan). Cell lines The H2228 human lung adenocarcinoma cell line and EML4-ALK fusion protein variant 3 (E6; A20) were kindly provided by Professor S. Yano (Kanazawa University). T2 is a lymphoblastoid cell line that lacks TAP function and has HLA-A*02:01 molecules that can easily be loaded with exogenous peptides. T2A24 is the same cell line but with HLA-A*24:02 instead. T2 and T2A24 cells were cultured in RPMI medium supplemented with 10% heat-inactivated FBS. HLA-A*02:01/HLA-A*24:02 binding assay In order to determine the binding ability of the predicted peptides to HLA-A*02:01/HLA-A*24:02 molecules an in vitro cellular binding assay was performed as reported previously (27). Briefly after incubation of the T2/T2A24 cells in culture medium at 26°C for 18 h cells were washed with PBS and suspended in 1 ml Opti-MEM (Invitrogen Carlsbad CA USA) with or without 100 ?g peptide and then incubated at 26°C for 3 h and at 37°C for 3 h. After washing with PBS HLA-A*02:01/HLA-A*24:02 expression was measured by flow cytometry using a FITC-conjugated and HLA-A*02:01-/HLA-A*24:02-specific monoclonal antibody (mAb) and the mean fluorescence intensity was recorded. Generation of dendritic cells CD14+ cells were isolated from human peripheral blood mononuclear cells (PBMCs) using human CD14 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). Immature dendritic cells (DCs) were generated from CD14+ cells using interleukin (IL)-4 (10 ng/ml; PeproTech Inc. Rocky Hill NJ USA) and granulocyte-macrophage colony-stimulating factor (GM-CSF; 10 ng/ml; PeproTech) in RPMI-1640 medium supplemented with 10% FBS. Maturation of DCs was induced by prostaglandin E2 (PGE2; 1 ?g/ml; Sigma St. Louis MO USA) and tumor necrosis factor (TNF-)-? (10 ng/ml; PeproTech). Induction of EML4-ALK-derived peptide-specific CTLs from PBMCs CD8+ cells were isolated from PBMCs using human CD8 microbeads (Miltenyi Biotec Bergisch Gladbach Germany). CD8+ cells (2×106) were stimulated by peptide-pulsed irradiated autologous mature DCs (1×105). Autologous DCs were prepared from a limited supply; artificial antigen presenting cells (aAPCs) (K562/A2 or A24/CD80/CD83) were alternatively used for further examination. After 1 week these cells were stimulated twice per week by peptide-pulsed irradiated artificial APC-A2 or artificial APC-A24 cells (1×105). Supplementation with 10 IU/ml IL-2 (Proleukin; Novartis Pharmaceuticals Basel Switzerland) and 10 ng/ml IL-15 (PeproTech) was performed every 3 to 4 days between stimulations (28). IFN-? ELISPOT assay Specific secretion of IFN-? from human CTLs in response to stimulator cells was assayed using the IFN-? ELISPOT kit (BD Biosciences) according to the manufacturer™s instructions. Stimulator cells were pulsed with peptide for 2 h at room temperature and then washed. Responder cells were incubated with stimulator cells for 20 h. The resulting spots were counted using an ELIPHOTO counter (Minerva Tech Tokyo Japan). HIV-gag (77“85) (SLYNTYATL) was used as an irrelevant peptide in the CTL assay. Generation of CTL clones Cultured cells were incubated with peptide-pulsed T2/T2A24 cells at a ratio of 2:1 for 3.5 h at 37°C. CD107a-specific antibodies (BioLegend San Diego CA USA) were included in the mixture during the incubation period. CD8+CD107a+ cells were sorted using a FACSAria II cell sorter (BD Biosciences). Sorted CTLs were stimulated and the CTL clones were established as described previously (29). Flow cytometry H2228 cells with or without pretreatment with 100 U/ml IFN-? (PeproTech) for 48 h were harvested and stained with anti-HLA-A2 Ab-FITC (MBL Japan) and analyzed using a FACSCanto II flow cytometer (BD Biosciences). Flow cytometry data were analyzed using FlowJo software. Cytotoxicity assay The cytotoxic capacity was analyzed using the Terascan VPC system (Minerva Tech Tokyo). The CTL clone was used as the effector cell type. Target cells treated with 100 U/ml IFN-? (PeproTech) 42 h previously were labeled through incubation in calcein-AM solution for 30 min at 37°C. The labeled cells (1×104) were then co-cultured with the effector cells for 4“6 h. Fluorescence intensity was measured before and after the culture period and specific cytotoxic activity was calculated as described previously (29). HLA-A*02:01 blocking of T-cell activity was tested by pre-incubating the target cells with anti-HLA-A -B -C mAb (W6/32) or an isotype control mAb (mIgG2a?; BioLegend San Diego CA USA). Results Identification of HLA-A*02:01-/HLA-A*24:02-restricted EML4-ALK-derived peptides As candidate EML4-ALK- derived and HLA-A*02:01-/HLA-A*24:02-restricted CTL epitopes we selected nine peptides with highly predicted scores for HLA-A*02:01/HLA-A*24:02 binding calculated using BIMAS software (Tables I and II) and evaluated their ability to bind to HLA-A*02:01/HLA-A*24:02 molecules. All nine peptides were able to bind HLA-A*02:01/HLA-A*24:02 molecules (Fig. 1). Generation of an EML4-ALK-derived peptide-specific CTL clone from human PBMCs We next assessed the capacity of EML4-ALK-derived peptides to generate peptide-specific CTLs in vitro from human PBMCs of HLA-A*02:01/HLA-A*24:02 healthy donors. CTLs were induced by three stimulations with DCs or artificial APCs loaded with the EML4-ALK-derived peptides. CTLs were tested for specificity for each peptide using the IFN-? ELISPOT assay. Peptides A B and C could induce peptide-specific CTLs that were able to specifically recognize T2 cells pulsed with each peptide but not T2 cells without peptides (Fig. 2). Peptides B and C were able to induce CTLs from only one donor (healthy donor 3 for peptide B and healthy donor 4 for peptide C) but peptide A was able to induce CTLs in three of four donors (healthy donors 2 3 and 4). Based on this result we used peptide A for further examinations. Next we obtained one CTL clone from peptide A-specific CTLs that was able to specifically recognize T2 cells pulsed with peptide A but not T2 cells pulsed with an irrelevant HIV-gag peptide using single cell sorting with a CD107a antibody. The population of CD8+CD107a+ cells represented 0.984% of all stimulated cells (Fig. 3A). These cells were sorted as single cells in each well of a 96-well plate. "
Lung_Cancer
"These results indicate the importance of RrmJ and the methylation of U2552. In our phylogenetic analysis in this study the RrmJ homologs clustered into the following three groups in Eukaryota: FTSJ1/Trm7p FTSJ2/Mrm2p and FTSJ3/Spb1p (). In a comparison of the divergent distance between RrmJ and the ancestral roots of each group FTSJ2/Mrm2p showed the closest relation to RrmJ. In the FTSJ2/Mrm2p protein group S. cerevisiae Mrm2p has been studied extensively. In the mitochondrial rRNA of S. cerevisiae only three nucleotides are modified including the U2791 of the 21S rRNA which is 2?-O-ribose-methylated by Mrm2p. It has been proposed that Mrm2p is the mitochondrial RrmJ ortholog in S. cerevisiae according to the equivalent catalytic positions of Um2791 in the S. cerevisiae mitochondrial 21S rRNA and Um2552 in the E. coli 23S rRNA [6] [12]. However mammalian FTSJ2 remains uncharacterized. Thus we performed a sequence alignment of human FTSJ2 with RrmJ Mrm2p and FtsJ2 in M. jannaschii and three typological invertebrate species () and we compared the 3D structures of RrmJ human FTSJ2 and porcine FTSJ2 (Figure S1). A previous study showed the highly conserved catalytic tetrad K-D-K-E in site-specific 2?-O-ribose MTases [10] and this catalytic tetrad was also present in our sequence alignment. Furthermore a sequence alignment revealed the highly conserved amino acids involved in SAM binding. However interestingly the 3D structure of human FTSJ2 showed a different orientation for the first residue of the catalytic tetrad (lysine) compared with RrmJ. This difference may indicate a different A-loop structure of the rRNA substrate or a different catalytic mechanism of the FTSJ2/Mrm2p protein in mammals. Because S. cerevisiae Mrm2p is localized in the mitochondria [12] we hypothesized that hFTSJ2 is a mitochondrial protein. We used immunofluorescence and Western blot analysis to verify that hFTSJ2 was predominantly located in the mitochondria but not in the nucleus or cytoplasm (Figures 3C and 3D). In addition E. coli RrmJ is well known as a heat shock protein. The rrmJ mRNA expression increases over 20-fold after heat shock [3] and the rrmJ deletion strain fails to adapt to heat shock temperatures [7]. In S. cerevisiae the growth of the mrm2 deletion strain at 37°C is slightly reduced on glucose-containing medium and severely reduced on glycerol-containing medium [12]. Thus to evaluate the heat shock response of the RrmJ ortholog in mammals we tested the heat shock response of piglets at 30°C or 35°C. The large intestine lung and bladder showed an up-regulated expression of Ftsj2 mRNA at temperatures of 30°C and 35°C but only the lung tissue demonstrated a simultaneous heat shock response with the up-regulation of Hsp70.2 mRNA (). This finding in the lung may have been caused by the direct exposure of this tissue to the increased temperature through the inhalation of hot air. However under these heat shock treatments for the piglets only 5 (small intestine muscle lung kidney and liver) of the 11 tissues showed an up-regulation tendency of Hsp70.2 expression possibly because of the systemic effect of the response of the warm-blooded piglets to the heat shock stress. Furthermore to eliminate this systemic effect and to confirm the FTSJ2 mRNA up-regulation in the lung a human lung adenocarcinoma cell line (A549) was subjected to heat shock for 1 hour and allowed to recover at 37°C. The results of this experiment showed a 1.5-fold increase in the hFTSJ2 expression at both 42°C and 45°C and then a gradual return to its normal level after the recovery period (). Although the exact role of FTSJ2 in the heat shock response in mammals is unknown these results indicate that FTSJ2 inherited the HSP characteristics of its orthologs in E. coli and S. cerevisiae. In the previous studies of HSPs such as HSP70 and HSP90 it has been demonstrated that the heat shock responses are highly conserved during evolution. From Prokaryota to Eukaryota and Protozoa to Metazoa the HSPs represented the universal protein structures and similar physiological functions and following evolution the HSPs diverged and translocated into different anelles [1] [2] [38]“[40]. These characteristics are in alignment with the results of the RrmJ phylogenic analysis and the conservation of the heat shock response properties in mammals. In addition to certain small HSPs (i.e. HSP32 HSP25 and HSP22) most of the HSPs are expressed in all types of tissues [2] [41] and our results showed that Ftsj2 was expressed in all of the 13 normal piglet tissues (Figure S2). These results indicated that FTSJ2 was not only involved in the heat shock response but also might be necessary for mitochondrial functions under normal condition according to the mitochondrial localization of FTSJ2. In addition previous functional studies have shown that the HSPs (i.e. HSP70 and HSP90) are involved in tumorigenesis and the inhibition of apoptosis in cancer cells [40] [42]“[44]. Similarly the amplification of the genetic locus of FTSJ2 has been discovered in several NSCLC clinical samples and was considered as a novel oncogenic locus [20]. In our study the expression of FTSJ2 was also shown in different cancer cells (hepatocarcinoma lung adenocarcinoma and rhabdomyosarcoma cells). However in the human lung adenocarcinoma cell sublines CL1-0 and CL1-5 [45] we found that hFTSJ2 mRNA was decreased in the more invasive CL1-5 cells compared with the less invasive CL1-0 cells. Moreover the TE671-hFTSJ2 cells which over-expressed the hFTSJ2 protein showed a decrease in cell migration and invasion (). These results indicate that the mitochondrial hFTSJ2 protein exhibits an additional function to suppress cancer cell metastasis. Previous reports have suggested that hFTSJ2 functions in the mitochondria. Thus it is reasonable that FTSJ2 is required for extensive ATP production through respiration in the mitochondria of proliferating cancer cells [46]“[48]. In contrast according to recent studies a mitochondrial complex I and NAD+/NADH imbalance enhances the metastasis of breast cancer cell lines [49] and the dynamics of mitochondrial fusion or fission also regulates cell migration and invasion [50] [51]. These results indicate that the invasiveness of cells is affected by the condition and state of their mitochondria. In we characterized FTSJ2 as an ortholog of the E. coli 23S rRNA 2?-O-ribose MTase and showed that it functions in the mitochondria. We also provided evidence that FTSJ2 is a novel heat shock protein that is over-expressed after heat shock treatment in both piglet lung and lung adenocarcinoma cells. Surprisingly FTSJ2 may also be involved in the inhibition of cancer cell migration and invasion by influencing the mitochondrial functions. Accession Numbers The GenBank accession numbers of the protein sequences which were used in the phylogenetic tree construction and the protein sequences alignment are labeled in and . The protein coding regions of the porcine Ftsj1 and Ftsj2 mRNA were first sequenced in this study and the GenBank accession numbers of the corresponding porcine Ftsj1 and Ftsj2 mRNA are EU694401 and EU694400 respectively and the porcine FTSJ1 and FTSJ2 proteins are ACH57153 and ACH57152 respectively. Supporting Information Figure S1 Three-dimensional protein structures of E. coli RrmJ"
Lung_Cancer
"Transfection of all cells with expression vectors was done using Lipofectamine 2000 (Invitrogen) according to the manufacturer's directions. Reverse transcription-polymerase chain reaction (RT-PCR) and stem-loop RT-PCR Total RNA was isolated using the Trizol reagent (Invitrogen) and 3 ?g of RNA were reverse-transcribed using the Superscript III enzyme (Invitrogen). PCR was then performed on cDNA with gene-specific primers: Sp1 F 5'-TGC AGC AGA ATT GAG TCA CC-3' and R 5'-CAC AAC ATA CTG CCC ACC AG-3'; FOXO3 F 5'-GCA AGC ACA GAG TTG GAT GA-3' and R 5'-CAG GTC GTC CAT GAG GTT TT-3'; GAPDH F 5'-GAG TCA ACG GAT TTG GTC GT-3' and R 5'-TTG ATT TTG GAG GGA TCT CG-3'; and U6 F 5'-CGC TTC GGC AGC ACA TAT AC-3' and R 5'-AGG GGC CAT GCT AAT CTT CT-3'. The protocol for the detection of mature miRNAs using a stem-loop gene-specific reverse transcription primer was performed as described previously [49]. Stem-loop primers (miR-182 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GTG TG-3'; miR-96 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GCA AA-3'; and miR-183 5'-GTC GTA TCC AGT GCA GGG TCC GAG GTA TTC GCA CTG GAT ACG ACA GTG AA-3') were designed to specifically reverse transcribe the mature miRNA of interest. The primers for PCR were as follows: miR-182 F 5'-CGG CGG TTT GGC AAT GGT AGA ACT-3'; miR-96 F 5'-CGG CGG TTT GGC ACT AGC ACA TTT-3'; miR-183 F 5'-CGG CGG TAT GGC ACT GGT AGA ATT-3'; and R 5'-CCA GTG CAG GGT CCG AGG TAT-3'. PCR products were analyzed by ethidium bromide-containing agarose gel electrophoresis. Western blotting Cell lysates were prepared from the indicated cell lines for SDS-polyacrylamide gel electrophoresis (SDS-PAGE) which was then transferred to a polyvinylidene difluoride membrane (Millipore Billerica MA) by using a transfer apparatus according to the manufacturer's protocols. Membranes were blocked with 3% nonfat milk in TBST buffer (10 mM Tris-HCl pH 8.0 150 mM NaCl and 0.05% Tween 20) for 1 h washed in the same buffer and incubated with antibodies against Sp1 (Millipore) GFP (Clontech Palo Alto CA) FOXO3 (Genetex Hsinchu Taiwan) tubulin (Sigma-Aldrich St. Louis MO) N-cadherin (Cell Signaling Technology Beverly MA) ?-catenin (Cell Signaling Technology) and vimentin (Epitomics Burlingame CA) at 4? overnight. Membranes were washed three times for 10 min and incubated with the secondary antibody (goat anti-rabbit or anti-mouse immunoglobulin G linked with horse radish peroxidase (Millipore)) for 1 h at room temperature. After three more washes the protein bands were detected with the ECL Western blotting Detection System (Millipore) and recorded with the FluorChem image analysis system (Alpha Innotech San Leandro CA). Band intensities were quantified with Scion image software (Scion Frederick MD). Luciferase reporter assay Cells were transiently cotransfected with reporter plasmids (pGL2-miR-182 pGL2-miR-182 mutants pGL3-FOXO3-3'UTR or pGL2-FOXO3) and expression plasmids of interest using Lipofectamine 2000. Luciferase activity in cell lysates was determined by luminometer (LB9506; Berthold Technologies Bad Wildbad Germany) and normalized to total protein concentration. For construction genomic DNA of A431 cells were prepared. The miR-182 promoter (-1000/+50) was produced by PCR using primers: F 5'-GGG CAG GCA GCC TGC ACC CT-3' and R 5'-CAC CAG TGT GAG TTC TAC CAT TGC-3'. The FOXO3 (-1000/+50) promoter was produced by PCR using primers: F 5'-ACG CGT CGA GCT GAC AGG CGG TTC-3' and R 5'-AGA TCT CGC CCC CCG GCC AGG CCG-3'. After amplification and purification the DNA fragments were ligated to pGL2 vector using restriction enzymes KpnI and BglII for pGL2-miR-182 MluI and BglII for pGL2-FOXO3 (New England Biolabs Ipswich MA). For construction of pGL3-FOXO3-3'UTR cDNA of H1299 cells was prepared. The FOXO3 3'UTR was produced by PCR using primers: F 5'-TCT AGA AGG ATC ACT GAG GAA GGG-3' and R 5'-TCT AGA TCT GCA AAG CAA AAC AGG-3'. After amplification and purification the DNA fragments were ligated to pGL3 vector using restriction enzymes XbaI. For construction of pGL2-miR-182 mutants the pGL2-miR-182 plasmid was used as the template for mutagenesis of Sp1-binding sites. Primers for mutations of site 1 (-433C/-434G to?433A/-434A): F 5'-CTT AGT AAA TAG CAA AAC CCA AAC CAC ATT AGC CAT CTC TTC CC-3' and R 5'- GGG AAG AGA TGG CTA ATG TGG TTT GGG TTT TGC TAT TTA CTA AG-3'; and for site 2 (-398C/-399G to?398A/-399A): F 5''-CCA GCG CCC AGG GAA AGG GCT CTC TGG C-3' and R 5'- GCC AGA GAG CCC TTT CCC TGG GCG CTG G?3'. Mutagenesis was performed by PCR using plaque-forming unit DNA polymerase (Agilent Technologies Santa Clara CA). Chromatin immunoprecipitation (ChIP) assay The protocol for ChIP was performed as described previously [23]. Briefly formaldehyde-fixed DNA“protein complex was immunoprecipitated with 5 mg of normal rabbit IgG anti-acetyl-Histone H3 (Millipore) or anti-Sp1 antibodies. Immunoprecipitated DNA was analyzed by PCR. The primer sequences for promoter of miR-182 in PCR analyses were as follows: F 5'-ACT TCC CTC TCT CCC TTT GG-3' and R 5'-CAC CTG ACA GCA GGG ACT CA-3'. The primer sequences for promoter of miR-212 in PCR analyses were as follows: F 5'-AGC GGA GCT GTC CTC TCA G-3' and R 5'-CCG GGC AGT AAG CAG TCT A-3'. The primer sequences for promoter of p21 in PCR analyses were as follows: F 5'- ACC AAC GCA GGC GAG GGA CT-3' and R 5'- CCG GCT CCA CAA GGA ACT GA?3'. DNA affinity precipitation assay (DAPA) The DNA oligonucleotides (miR-182 5'-AAA ACC CAG CCC ACA TTA GCC ATC TCT TCC CCA GCG CCC AGG GGC AGG GCT CT-3'; miR-212 5'-GAC CGG GGG GGC GGG GCC TCC CAG GTC CCG CCC CGC CCC CAC GCC CCC GCC GG-3'; and p21 5'- CCC GCC TCC TTG AGG CGG GCC CGG GCG GGG CGG-3') were biotinylated at 5' end and then annealed with their complementary strands. The assay was performed by incubating 1 ?g of biotin-labeled probe with cell extract in 1 ml of DAPA buffer (60 mM KCl 12 mM HEPES pH 7.9 4 mM Tris-HCl 5% glycerol 0.5 mM EDTA and 1 mM dithiothreitol). After incubation for 1 h at 4? DNA“protein complexes were then incubated with 20 ?l of streptavidin-agarose (Sigma-Aldrich) for 1 h at 4?. DNA“protein complexes were then washed three times in the DAPA buffer. Clinical specimens of patients with lung adenocarcinoma Human clinical specimens used in this study were approved by the Clinical Research Ethics Committee at the Medical Center of National Cheng Kung University (Tainan Taiwan). After surgical resection at National Cheng Kung University Hospital specimens of patients with lung adenocarcinomas were collected for immunohistochemical analysis RT-PCR or Western blotting. shRNA lentivirus production We purchased scramble Sp1 and FOXO3 shRNA from National RNAi Core Facility in Academia Sinica of Taiwan (Taipei Taiwan) and miRZip and miRZip-182 from SBI (System Biosciences CA). The lentiviruses were obtained from RNAi Core of Research Center of Clinical Medicine National Cheng Kung University Hospital. (The protocol is described below-293T cells were cotransfected with 5 ?g of packaging plasmid (pCMV?R8.91) 0.5 ?g of envelop plasmid (pMD.G) and 5 ?g of pLKO.1 shRNA using Lipofectamine 2000 for 6 h. After 24 h incubation the supernatants containing viral ps were harvested and filtered through 0.45 mm filters.) Fluorescence-activated cell sorting (FACS) The miRZip and miRZip-182 stable expression H1299 cells were washed with PBS and fixed in cold 70% ethanol overnight at 4 Cells were then washed with cold PBS and permeabilized with 0.1% Triton X-100 for 10 min. After treatment with 10 ?g/ml RNase A (Qiagen Germantown MD) at 37 for 1 h cells were stained with 50 ?g/ml propidium iodide (Sigma-Aldrich) at room temperature for 2 h. Finally cells were analyzed by flow cytometer on the FACSCalibur (BD Biosciences Franklin Lakes NJ). Xenograft study The animal experiment was approved by the Institutional Animal Care and Use Committee at National Cheng Kung University. Female SCID mice were purchased from National Laboratory Animal Center in Taiwan. The miRZip and miRZip-182 stable expression H1299 cells (106 cells) were suspended in 100 ?l of PBS and implanted into the back of SCID mice. Immunohistochemistry (IHC) The experimental process of IHC was performed as described in our previous study [32]. Briefly blocked histological sections were stained with the anti-Sp1 or anti-FOXO3 antibodies."
Lung_Cancer
"Purpose Although the EGF receptor tyrosine kinase inhibitors (EGFR-TKI) gefitinib have shown dramatic effects against EGFR mutant lung cancer patients become resistant by various mechanisms including gatekeeper EGFR-T790M mutation MET amplification and KRAS mutation thereafter relapsing. AZD6244 is a potent selective and orally available MEK1/2 inhibitor. In this study we evaluated the therapeutic efficacy of AZD6244 alone or with BEZ235 an orally available potent inhibitor of phosphatidylinositol 3“kinase (PI3K) and mammalian target of rapamycin (mTOR) in gefitinib-resistant non-small cell lung carcinoma (NSCLC) models. Experimental design NCI-H1975 with EGFR-T790M mutation NCI-H1993 with MET amplification and NCI-H460 with KRAS/PIK3CA mutation human NSCLC cells were subcutaneous injected into the athymic nude mice respectively. Mice were randomly assigned to treatment with AZD6244 BEZ235 AZD6244 plus BEZ235 or control for 3 weeks then all mice were sacrificed and tumor tissues were subjected to western blot analyses and immunohistochemical staining. Results AZD6244 could inhibit the tumor growth of NCI-H1993 but slightly inhibit the tumor growth of NCI-1975 and NCI-H460. Combining AZD6244 with BEZ235 markedly enhanced their antitumor effects and without any marked adverse events. Western blot analysis and immunohistochemical staining revealed that AZD6244 alone reduced ERK1/2 phosphorylation angiogenesis and tumor cell proliferation. Moreover MEK1/2 inhibition resulted in decreased AKT phosphorylation in NCI-H1993 tumor model. BEZ235 also inhibited AKT phosphorylation as well as their downstream molecules in all three tumor models. The antiangiogenic effects were substantially enhanced when the agents were combined which may due to the reduced expression of matrix metallopeptidase-9 in tumor tissues (MMP-9). Conclusions In this study we evaluated therapy directed against MEK and PI3K/mTOR in distinct gefitinib-resistant NSCLC xenograft models. Combining AZD6244 with BEZ235 enhanced their antitumor and antiangiogenic effects. We concluded that the combination of a selective MEK inhibitor and a PI3K/mTOR inhibitor was effective in suppressing the growth of gefitinib-resistant tumors caused by EGFR T790M mutation MET amplification and KRAS/PIK3CA mutation. This new therapeutic strategy may be a practical approach in the treatment of these patients. AZD6244 BEZ235 Tyrosine kinase inhibitor Non-small cell lung cancer Introduction Lung cancer is the leading cause of cancer-related death in many countries including the China [1]. Non-small cell lung cancer (NSCLC) accounts for up to 80% of all lung cancer cases; patients typically present with advanced disease at the time of diagnosis. The prognosis of patients with advanced lung cancer remains poor and recent studies show that conventional therapies may have reached a therapeutic plateau as evidenced by the 5-year survival rate for NSCLCs which remains at 15% [23]. The EGF receptor tyrosine kinase inhibitors (EGFR-TKIs) gefitinib and erlotinib have shown marked therapeutic effects against NSCLCs with EGFR activating mutations such as exon 19 deletions and L858R point mutations [4]. Almost all tumors however acquire resistance to EGFR-TKIs after varying periods of time. Common mechanisms for acquired resistance include emergence of an EGFR gatekeeper mutation (T790M) and MET gene amplification [56]. In addition PIK3CA mutations as well as KRAS mutations have been found to contribute to EGFR-TKIs resistance in a subpopulation of tumors [78]. The limited therapeutic options currently available for patients with advanced lung cancer create a pressing need to identify new therapeutic strategy. Selumetinib (AZD6244) is an oral non-ATP competitive inhibitor and highly specific for extracellular signal-regulated kinase (ERK) kinase (MEK)1/2 a key enzyme in the RAS-RAF-MEK-ERK pathway. AZD6244 had minimal effects on the p38 c-Jun-NH2-kinase PI3K and MEK5/ERK5 pathways and is currently in phase II clinical trial in KRAS-mutant NSCLC [910]. In vivo AZD6244 could inhibit the tumor growth in HT-29 xenograft model which is a colorectal tumor model carrying a BRAF mutation at a dose of 100 mg/kg and the tumor growth inhibition of AZD6244 is better than gemcitabine [11]. However the inhibition of MEK signaling alone may not be sufficient in patients with gefitinib-resistant NSCLC and negative feedback mechanisms in PI3K pathway may be problematic when it is used alone [12]. By contrast combined blockade of both pathways was able to overcome the reciprocal pathway activation induced by inhibitor-mediated release of negative feedback loops and resulted in a significant tumor growth inhibition. Thus coinhibition of both pathways has shown use in reducing tumor growth in a variety of xenograft models [1314] and clinical trials of such combinations are under way in adults. BEZ235 is an orally available dual inhibitor of PI3K and mTOR that is being evaluated in phase I/II trials [15]. With the aim of developing effective therapeutic strategy for treatment gefitinib-resistant NSCLCs we have initially evaluated the antitumor activity of AZD6244 alone or combination with BEZ235 in a panel of three human NSCLC cell lines which were selected according to their different mutation status for EGFR-T790M MET and KRAS/PIK3CA genes. We hypothesized that targeting the MEK pathway in combination with selective inhibitors of PI3K/mTOR signaling could overcome gefitinib-resistant NSCLC and enhance the antitumor efficacy. Methods Reagents AZD6244 and BEZ235 were purchased from Sellech Chemicals (Houston TX USA) all drugs were dissolved in sterile dimethylsulfoxide (DMSO) and a 10 mM working solution was prepared and stored in aliquots at -22°C. Working concentrations were diluted in culture medium just before each experiment. RPMI1640 media and fetal bovine serum (FBS) were purchased from Invitrogen (Carlsbad CA USA). Fibronectin and 3-(4 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide (MTT) were obtained from Sigma (St. Louis MO USA). Phospho-AKT (Ser473 p-AKT) phospho-S6 (Ser240/244 p-S6) phospho-4E-BP1 (Ser 65 p-4E-BP1) phospho-ERK1/2 (Thr202/Tyr204 p-ERK1/2) phospho-MEK1/2 (Ser217/221 p-MEK1/2) AKT S6 4E-BP1 MEK1/2 and ERK1/2 antibodies were purchased from Santa Cruz Biotechnology Inc (Santa Cruz CA USA). CD31 and Ki-67 antibodies for IHC were purchased from Cell Signaling Technology (Danvers MA USA). All other chemicals used in this study were of analytical reagent grade. Cell lines The NCI-H1975 EGFR T790M mutation [16] NCI-H460 KRAS/PIK3CA mutation and NCI-H1993 MET amplification [1718] human NSCLC cell lines were obtained from American Type Culture Collection (ATCC) (Manassas VA USA). The cells were cultured in RPMI1640 medium supplemented with 10% FBS 100 mg/L streptomycin 100 IU/mL penicillin and 0.03% L-glutamine (Hyclone Logan UT USA) and maintained at 37°C with 5% CO2 in a humidified atmosphere. Cell viability assay Cell viability was measured using the MTT [3-(45-dimethylthiazol-2-yl)-25-diphenyl tetrazolium] dye reduction method. Tumor cells (1?—?104 cells/100 mL/well) in RPMI1640 medium with 10% FBS were plated into 96-well plates and cultured with indicated compounds for 72 h followed by the addition of 50 mL of MTT solution (2 mg/mL; Sigma St. Louis MO) to each well and further incubation for 2 h. The medium was removed and the dark blue crystals in each well were dissolved in 100 mL dimethyl sulfoxide. The absorbance of the wells was measured with a microplate reader at test and reference wavelengths of 490 nm respectively. Percent growth was reported relative to untreated controls. Each experiment contained at least triplicate samples and was performed at least three times. Efficacy study in vivo BALB/C nude mice (female 6-7 weeks old) were obtained from Vital River (Beijing China). Mice were maintained under super pathogen-free conditions and housed in barrier facilities on a 12-h light/dark cycle with food and water ad libitum. All animal experiments were performed in accordance with protocols approved by the Shandong University Experimental Animal Care and Use Committee. Mice were injected subcutaneous (s.c.) with 5?—?106 NCI-H1993 NCI-H1975 and NCI-H460 cells that had been resuspended in 200 ?L of matrigel (BD Biosciences Milan IT). AZD6244 solubilized in a methocel/polysorbate buffer was injected by oral gavage twice daily at the dose of 25 mg/kg for 3 weeks [19]. BEZ235 was reconstituted in NMP (1-methyl-2 pyrrolidone) and PEG300 and injected by oral gavage once daily at the dose of 20 mg/kg for 3 weeks [20]. When the mean volumes of tumors were between 150 and 200 mm3 mice were randomly divided in four groups (ten mice per group). The tumor volume and body weight in each group were balanced. The animals were ear-punched for identification during the study. Two orthogonal diameters of the tumor are measured with digital vernier calipers and individual animal weights were weighed and recorded twice a week. Tumor volume (TV) are measured and recorded during treatment period by the formula: TV?=?Length?—?Width2/2. Growth inhibition from the start of treatment was assessed by comparison of the differences in tumor volume between control and treated groups. Tumor growth inhibition T/C ratio is calculated by the following equations: T/C ratio?=?(Vt?-?V0)Compound treated/(Vt?-?V0)Control?—?100?%. Western blot analysis The expressions of p-ERK1/2 p-AKT p-S6 p-MEK1/2 and p-4E-BP1 in tumor tissues were examined by Western Blotting. Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study. Tumor tissues were lysed by lysis buffer (50 mM HEPES [pH 7.4] 150 mM NaCl 10% glycerol 1% Triton X-100 1.5 mM MgCl2 1 mM EDTA [pH 8.0] 100 mM NaF 1 mM phenylmethylsulfonyl fluoride 1 mM sodium orthovanadate 10 ?g/mL aprotinin 50 ?g/mL leupeptin and 1 ?g/mL pepstatin A). The resected tumor samples were homogenized with lysis buffer containing 25 mM b-glycerophosphate and 0.5% (v / v) phosphatase inhibitor cocktail 2 (Sigma-Aldrich St. Louis MO USA) at 4°C. Cellular debris was removed by centrifugation at 17 860?g for 20 min at 4°C. Aliquots of the supernatants containing 5“20 ?g of protein were subjected to SDS-PAGE under reducing conditions. The protein concentration of the supernatant was determined by Bio-Rad protein assay reagent (Bio-Rad CA USA). Equal amounts of protein were separated by sodium dodecyl sulfate/polyacrylamidegel electrophoresis (SDS/PAGE) on 10% gels blotted on polyvinylidene difluoride (PVDF) and probed with p-ERK1/2 p-AKT p-S6 p-MEK1/2 p-4E-BP1 MMP2 MMP9 ERK1/2 AKT S6 MEK1/2 and 4E-BP1 rabbit monoclonal antibody and subsequently with goatanti-rabbit (HRP) and detected by chemiluminescence. To measure protein loading antibodies directed against ?-actin were used. Immunohistochemical analysis Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study fixing in formalin and embedding the tumor tissue. Cutting and mounting the section. Immunocytochemical analysis was performed according to the method described on the commercial kits to examine the expressions of CD31 and Ki-67 (Cell Signaling Technology Danvers MA USA). Caspase activity assay The apoptotic markers activity of caspase-3-8 and -9 were measured by using caspase colorimetric protease kits (Abnova Walnut CA USA). Fresh tumors in each group were resected after last treatment with AZD6244 and/or BEZ235 for 2 h on Day 21 of the efficacy study and then tumor lysis containing 200 ?g of protein was incubated with 5 ?L of 4 mM pNA-conjugated substrate (DEVD-pNA IETD-pNA and LEHD-pNA) at 37°C for 2 h. The amount of pNA released was measured at 405 nm using a microplate reader. Statistical analysis of the data All results and data were confirmed in at least three separate experiments. Data are expressed as means?±?SD and were analyzed by ANOVA using Statistics Package for Social Science (SPSS) software (version 13.0; SPSS Chicago IL USA). Test article can be demonstrated as an effective compound until T/C ratio???42% and a value of P?<?0.05 was indicated to be statistically significance on tumor volume calculation. Results Effect of AZD6244 and BEZ235 on viability of gefitinib-resistant NSCLC in vitro Before evaluating the effect of AZD6244 BEZ235 and AZD6244 plus BEZ235 treatment on gefitinib-resistant NSCLC xenograft models in nude mice the sensitivity of cell lines to compounds was evaluated in vitro. Cell proliferation was analyzed by MTT assay in cells treated with 00.010.11 10 and 100 ?M of AZD6244 or BEZ235 for 72 h. The results showed that AZD6244 significantly suppressed the growth of NCI-H1993 with a low micromolar IC50 value of 5.6 ?M (Figure 1A). Moreover AZD6244 alone mildly inhibited cell growth with IC50 values of 37.5 ?M and 26.8 ?M in NCI-H1975 and NCI-H460 cells respectively (Figure 1A). BEZ235 alone also suppressed the growth of three cell lines with slightly high IC50 values of 23.5 67.8 and 16.8 ?M in NCI-H1993 NCI-H1975 and NCI-H460 cells respectively (Figure 1B). Figure 1 Anti-proliferative effects of AZD6244 and BEZ235 in NCI-H1993 NCI-H1975 and NCI-H460 gefitinib-resistant cell lines. Cells were treated with varying concentrations of AZD6244 (A) or BEZ235 (B) alone for 72 h. Doses ranged from 0.01 ?M to 100 ?M. Mean?±?SD n?=?5. Concurrent inhibition of MEK and PI3K/mTOR has a synergistic effect on gefitinib-resistant NSCLC cell lines growth in vitro The anti-proliferative effect of combining a MEK and PI3K/mTOR inhibitor was measured in NCI-H1993 NCI-H1975 and NCI-H460 cells by calculating the combination index (CI) according to the Chou-Talalay method [21] using a fixed dose ratio. Both AZD6244 and BEZ235 were introduced to cell cultures at 0.25— 0.5— 1— 2— and 4— their respective IC50s in NCI-H1993 NCI-H1975 and NCI-H460 cell lines for 72 h. Cell growth in all cell lines was markedly decreased following combination treatment at multiple paired concentrations when compared with either single agent alone. The cells viability data were processed to get the CI under the corresponding effective dose (ED) in NCI-H1993 NCI-H1975 and NCI-H460 cell lines (Figure 2) by CalcuSyn software. For the NCI-H1993 cell line the following CI value was obtained: 0.4101 (ED50). For NCI-H1975 and NCI-H460 cell line the CI values were 0.02052 (ED50) and 0.0440 (ED50) respectively. The CI results suggested that AZD6244 and BEZ235 worked synergistically to produce an anti-proliferative effect in NCI-H1993 NCI-H1975 and NCI-H460 cell lines (Figures 2A-C). Figure 2 Synergistic effects of AZD6244-BEZ235 combination therapy on cell viability. NCI-H1993 (A) NCI-H1975 (B) and NCI-H460 (C) cells were treated with AZD6244 alone BEZ235 alone or AZD6244-BEZ235 in combination for 72 h. Results were analyzed according to the Chou-Talalay method [19]. The combination index (CI) values were calculated by using CalcuSyn software. Mean?±?SD n?=?5. Tumor growth inhibition effect of MEK and PI3K/mTOR inhibitors in gefitinib-resistant NSCLC tumor models In order to investigate tumor growth inhibition effect of AZD6244 and/or BEZ235 in vivo we used AZD6244 BEZ235 and AZD6244 plus BEZ235 to treat NCI-H1993 NCI-H1975 and NCI-H460 subcutaneous tumor models respectively for 3 weeks. As shown in Figure 3A-C treatment with AZD6244 for 3 weeks was able to inhibit tumor growth of NCI-H1993 (T/C value 40%) but slightly inhibit tumor growth in both NCI-H1975 and NCI-H460 subcutaneous tumor models (T/C values 60% and 65%) whereas BEZ235 treatment caused an approximately 50% reduction in tumor growth in all three subcutaneous tumor models. In contrast the combined treatments with the two drugs almost completely inhibited NCI-H1993 NCI-H1975 and NCI-H460 tumor growth at the end of the 3 weeks of therapy (Figure 3A-D). "
Lung_Cancer
"Then 1—106 freshly prepared cells were suspended in 100 µl PBS and stained with combination of fluorochrome-coupled antibodies to CD11b and Gr1. Cells were collected by FCM. Data were analyzed with FlowJo software. Western Blot Analysis The western blot analysis was performed as described previously with some modifications [33]. Briefly 4T1 cells were treated with niclosamide in designed concentration for 24 hours then cells were washed with cold PBS twice and lysed in RIPA buffer. Protein concentrations were measured using the Lowry method and equalized before loading. Equal amounts of total protein from each sample was applied to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred onto polyvinylidene difluoride (PVDF) membranes (Amersham Bioscience Piscataway NJ). After electrophoresis the membranes were blocked for 2 h at 37°C and incubated with specific primary antibodies overnight at 4°C followed by the secondary antibody conjugated to horseradish peroxidase. The reactive bands were detected using a commercially available enhanced chemiluminescence kit (Amersham Piscataway NJ). Boyden Chamber Migration and Invasion Assay Boyden chamber (8 µm pore size) migration assay was performed as previously described with some modification [34]. Briefly 5—104 4T1 cells or MDA-MB-231 cells in 100 µl serum-free medium were added in the top chamber then 600 µl of medium with 10% FBS was added to the bottom chamber. Different concentrations of niclosamide were added in both chambers. Cells were allowed to migrate for 20 hours. Non-migrated cells in the top chamber were removed. The migrated cells were fixed in 4% paraformaldehyde and stained with 0.5% crystal violet. Migrated cells were counted and photographed under a light microscope. Invasion assay was conducted according to previous study [34]. Briefly the upper surface of the transwell plate was coated with 60 µl Matrigel (BD Biosciences). After Matrigel polymerization the bottom chambers were filled with 500 µl medium containing 10% FBS. 5—104 4T1 cells or MDA-MB-231 cells in 100 µl serum-free medium were added in the upper part of each transwell and treated with different concentrations of niclosamide. After incubation for 20 hours non-migrated cells on the top side of the filter were removed and migrated cells were fixed with 100% methanol and stained with 0.5% crystal violet then migrated cells were counted and photographed under a light microscope. Percentage of migrated cells inhibited by niclosamide was quantified. Mice and Tumor Model All animal experiments were approved and conducted by the Institutional Animal Care and Treatment Committee of Sichuan University in China (Permit Number: 20121101). Female BALB/c mice (Six- to eight-week-old) used in this study were obtained from Beijing HFK bioscience CO. Ltd Beijing China. Briefly 100 µL 4T1 tumor cell suspension containing 1.0—106 cells were injected subcutaneously in the right flank of BALB/c mice. About seven days after inoculation tumor cells the tumor-bearing mice were randomized into three groups (8 mice per group) and received intraperitoneally injection (i.p.) of niclosamide 20 mg/kg 10 mg/kg or vehicle respectively once daily for 21 days. Tumor volumes and body weight were assessed every three days. The tumor size was calculated according to the formula: Tumor volume (mm3)?=?0.52—L—W2 where L is the length and W is the width. Moreover when all animals were euthanized by cervical dislocation the lungs were harvested total number of lung metastases was counted. Immunohistochemistry Immunohistochemistry staining of tumor sections were described previously [18]. One part of paraffin tumor sections was stained with hematoxylin and eosin (H&E). The other part was stained with Ki67 cleaved casepase-3 VEGF antibodies using immunohistochemistry staining to investigate tumor cell proliferation and apoptosis respectively. In addition paraffin-embeded tumor sections were stained with an anti-CD31 antibody to examine blood vessel density. Images were taken with Leica microscope (Leica DM4000B). Toxicity Evaluation To test potential side effects or toxicity on mice during the treatment all the animals were observed continuously for relevant indexes such as body weight anorexia diarrhea and other clinical symptoms. At the 28th day all animals were euthanized by cervical dislocation after taking blood from eyeball. Blood was obtained for blood routine analysis by Nihon Kohden MEK-5216K Automatic Hematology Analyzer. The tissues of heart lung spleen liver and kidney were stained with H&E for histopathologic examination. Statistical Analysis Data represented as means±SD of three independent experiments. The statistical comparisons were made by Student™s T test and statistically significant p values were labeled as follows: *P<0.05; **P<0.01; ***P<0.001. Results The Anti-proliferation Effects of Niclosamide against Breast Cancer Cells In order to investigate whether niclosamide has direct effects on breast cancer cells we tested the proliferation inhibition caused by niclosamide treatment on different breast cancer cell lines by MTT. After exposure to niclosamide for 72 h the IC50 of MDA-MB-231 MCF-7 MDA-MB-468 were 0.95 µM 1.05 µM and 1.88 µM respectively (A). Exposure of 4T1 cells to niclosamide for 24 h 48 h and 72 h respectively resulted in decrease of the cell proliferation (B). Therefore these results demonstrated that niclosamide inhibited breast cancer cells proliferation in a time- and concentration-dependent manner. Thus we chose 4T1 and MDA-MB-231 cell lines for further experiments. .0085887.g001 The effect of niclosamide on breast cancer cells viability. (A) Proliferation of MDA-MB-231 MCF-7 MDA-MB-468 cells treated with various concentrations (0“10 µM) of niclosamide for 72 hours respectively. Cell viability was detected by MTT assay. The data are expressed as the means ± SD from three independent experiments. (B) MTT assays showed niclosamide inhibited 4T1 breast cancer cells proliferation concentration- and time-dependently. Values represented means ± SD from three experiments (*p<0.05; **p<0.01; ***p<0.001). (C) The effects of niclosamide (a-f:0“1.25 µM) on colony formation in 4T1 cells 12 days the statistic results of colony formation assays presented as surviving colonies. Data are expressed as means ± SD from three experiments (*p<0.05; **p<0.01). (D) The fluorescence microscopic appearance of Hoechst 33342 staining nuclei of 4T1 cells with various concentration niclosamide for 24 h (40—). Data are the representative from three parallel experiments. To further determine whether niclosamide could inhibit the proliferation of 4T1 we conducted colony formation assay after niclosamide treatment. As shown in C clonogenic assay clearly showed that clone formation of 4T1 cells was reduced in a concentration-dependent manner after exposure to niclosamide. Furthermore the size of the colonies treated with niclosamide was significantly smaller than the control. Induction of Apoptosis by Niclosamide As D indicates the 4T1 cells exhibited features of apoptosis as showed by Hoechst 33342 staining such as bright-blue fluorescent condensed nuclei nuclear fragmentation and reduction of cell volume. To further confirm the induction of apoptosis in 4T1 cells with niclosamide treatment we also investigated the levels of apoptosis using the AnnexinV-FITC/PI dual-labeling technique by FCM. As shown in A and B after niclosamide treatment for 24 h the apoptosis induction effect was apparently observed. When the 4T1 cells were treated with 1.25 µM niclosamide the apoptosis rate was 13.7% whereas the apoptosis cells increased to 19.0% 25.5% and 31.3% when cells were treated with 2.5 µM 5 µM and 10 µM niclosamide respectively. Moreover we examined Bcl-2 Mcl-1 Survivin and cleaved caspase-3 expression levels in 4T1 cells after niclosamide-treated for 24 h by western blotting analysis. The expression of Bcl-2 Mcl-1 and Survivin significantly decreased while that of cleaved caspase-3 increased in a concentration-dependent manner (C) which was coincident with the results of Hoechst 33342 staining and FCM assays. .0085887.g002 Niclosamid induces 4T1 breast cancer cells apoptosis. (A) 4T1 cells were treated with niclosamide at indicated doses for 24 hours and the level of apoptosis was evaluated using the Annexin V/PI dual-labeling technique as determined by FCM. Data shown are representative of three independent experiments. (B) Statistic results of apoptosis assays 4T1 cells positive for both Annexin V and PI were considered apoptotic. Data are expressed as means ± SD from three independent experiments (*p<0.05; **p<0.01). (C) Western blot analyses of 4T1 cells treated (24 h) with different concentrations of niclosamide to evaluate protein expression of Bcl-2 Mcl-1 Cleaved caspase-3 Survivin and ?-actin was employed as a standard. Niclosamide Suppresses Breast Cancer Cell Migration and Invasion Breast cancer metastasis poses a predominant threat to cancer related mortality. Moreover one of the key steps in successful cancer metastasis is tumor cell migration and invasion [34] [35]. Therefore in order to examine whether niclosamide could inhibit breast cancer cell migration and invasion we performed transwell migration and invasion assays on 4T1 and MDA-MB-231 cell lines. As shown in Figure 3A niclosamide-treated groups showed reduced migrated cell numbers on 4T1 cells similar results was obtained in invasion assay (Figure 3B). Meanwhile niclosamide obviously inhibited MDA-MB-231 migration and invasion were also observed (Figure 3C). Moreover we also investigated whether Stat3 Focal Adhesion Kinase (FAK) and Src which are considered to be related with cell migration and invasion are involved in niclosamide-mediated migration and invasion [34]. As Figure 3D indicates niclosamide treatment decreased the expression of phosphorylated-STAT3 (Tyr705) phosphorylated-FAK (Tyr925) and phosphorylated-Src (Tyr416) without affecting their total expression level. Taken together these results suggested that niclosamide could suppress breast cancer cell migration and invasion in a concentration-dependent manner. .0085887.g003 Figure 3 Niclosamide inhibits breast cancer cell 4T1 and MDA-MB-231 migration and invasion and inhibits FAK-involved pathway. (A) A total of 5—104 4T1 cells were seeded in the top chamber of transwell with serum-free medium and treated with different concentration of niclosamide. After 20 hours migrated cells were stained photographed (10—) and quantified. (B) A total of 5—104 4T1 cells were treated with various concentration of niclosamide and allowed to invade through Matrigel and Transwell membrance Invaded cell number was stained photographed (20—) and counted. (C) Niclosamide inhibited MDA-MB-231 migation and invasion. The number of migrated cells and invaded cells was counted respectively. Data represent means ±SD. (n?=?3 in triplicate; *p<0.05; **p<0.01; ***p<0.001). (D) 4T1 cells were treated with different concentration of niclosamide (0“5 µM). After 24 hours cell lysates were blotted with spectfic antibodies (anti-phospho-STAT3 anti-phospho-FAK anti-phospho-Src STAT3 FAK and Src) ?-actin was the loading control. Anti-tumor Efficacy of Niclosamide in 4T1 Mouse Mammary Tumor Model To study the antitumor activity of niclosamide in vivo 4T1 tumor-bearing mice were treated with niclosamide at the dose of 10 mg/kg and 20 mg/kg. From the results (Figure 4A) it was found that the tumor growth of the niclosamide groups become slowed 7 days after treatment. After 21 days treatment niclosamide substantially suppressed tumor growth in a dose-dependent manner compared with the control. Moreover after treatment with niclosamide for 21 days body weight of the mice were statisticed and no significant differences in body weight were found among the three groups (Figure 4B). Furthermore previous studies have showed that 4T1 mouse breast cancer have a high metastatic potential and spontaneously metastasize to secondary foci from the primary sites and one of the fatal metastatic organs is lung as early as 2 weeks after inoculation [36] [37]. In the present study we seek to evaluate whether treatment of niclosamide could reduce the occurrence of lung metastasis. The data in Figure 4C and D showed that niclosamide-treated at 20 mg/kg resulted in significant reduction in the number of lung metastases compared with other groups. In addition histological analyses proved that the number of micrometastatic nodules per field in the niclosamide-treated at 20 mg/kg group was also significant fewer than other groups (Figure 4C). These results further indicated that high dose of niclosamide could inhibit tumor metastasis in breast cancer. .0085887.g004 Figure 4 Effect of niclosamide treatment on primary tumor growth and pulmonary metastasis. (A) 4T1 tumor-bearing female BALB/c mice were treated as described with vehicle niclosamide at 10 and 20 mg/kg the mean tumor volumes ± SD of six mice per every group. (B) After 28 days of tumor cell inoculation the body weight of the niclosamide treatment and vehicle groups were statisticed and there were no significant difference among the groups. (C) Lung metastatic nodules were visualized to show the inhibitory effect of niclosamide on 4T1 tumor 21 days after treatment. Arrow indicated metastatic nodules (up) The H&E staining of lungs from each group (10—). (D) The mean lung metastasis nodules of each group the treatment with niclosamide at 20 mg/kg resulted in significant inhibition of lung metastasis versus vehicle control. "
Lung_Cancer
"lung cancer patients undergoing radiation therapy. Before 4DCT-ventilation can be implemented clinically it needs to be validated against an established imaging modality. The purpose of this work was to compare 4DCT-ventilation to nuclear medicine ventilation using clinically relevant global metrics and radiologist observations. Methods and Materials Fifteen lung cancer patients with 16 sets of 4DCT and nuclear medicine ventilation-perfusion (VQ) images were used for the study. The VQ-ventilation images were acquired in planar mode using Tc-99m-labeled diethylenetriamine-pentaacetic acid aerosol inhalation. 4DCT data spatial registration and a density-change-based model were used to compute a 4DCT-based ventilation map for each patient. The percent ventilation was calculated in each lung and each lung third for both the 4DCT and VQ-ventilation scans. A nuclear medicine radiologist assessed the VQ and 4DCT scans for the presence of ventilation defects. The VQ and 4DCT-based images were compared using regional percent ventilation and radiologist clinical observations. Results Individual patient examples demonstrate good qualitative agreement between the 4DCT and VQ-ventilation scans. The correlation coefficients were 0.68 and 0.45 using the percent ventilation in each individual lung and lung third respectively. Using radiologist-noted presence of ventilation defects and receiver operating characteristic analysis the sensitivity specificity and accuracy of the 4DCT-ventilation were 90%0.64 and 81% respectively. Conclusions The current work compared 4DCT with VQ-based ventilation using clinically relevant global metrics and radiologist observations. We found good agreement between the radiologist™s assessment of the 4DCT and VQ-ventilation images as well as the percent ventilation in each lung. The agreement lessened when the data were analyzed on a regional level. Our study presents an important step for the integration of 4DCT-ventilation into thoracic clinical practice. Korean J Radiol Korean J Radiol KJR Korean Journal of Radiology 1229-6929 2005-8330 The Korean Society of Radiology 24642766 3955798 10.3348/kjr.2014.15.2.295 Thoracic Imaging Case Report A Rare Case of Diffuse Pulmonary Lymphangiomatosis in a Middle-Aged Woman Lim Hyun-ju MD 1 Han Joungho MD 2 Kim Hong Kwan MD 3 Kim Tae Sung MD 1 1Department of Radiology and Center for Imaging Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 2Department of Pathology Sungkyunkwan University School of Medicine Seoul 135-710 Korea. 3Department of Thoracic Surgery Sungkyunkwan University School of Medicine Seoul 135-710 Korea. Corresponding author: Joungho Han MD Department of Pathology Samsung Medical Center Sungkyunkwan University School of Medicine 81 Irwon-ro Gangnam-gu Seoul 135-710 Korea. Tel: (822) 3410-2765 Fax: (822) 3410-0025 joungho.hansamsung.com Mar-Apr 2014 07 3 2014 15 2 295 299 03 1 2013 13 12 2013 Copyright 2014 The Korean Society of Radiology 2014 This is an Open Access distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons./licenses/by-nc/3.0/) which permits unrestricted non-commercial use distribution and reproduction in any medium provided the original work is properly cited. Diffuse pulmonary lymphangiomatosis (DPL) is a rare lymphatic disorder characterized by lymphatic channel proliferation. It is mostly reported in children and young adults. Here we report a case involving a 52-year-old asymptomatic woman who presented with increased interstitial markings as seen on a chest radiograph. Diffuse interstitial septal thickening was found on a serial follow-up chest computed tomography scan and lymphangitic metastasis was the primary radiologic differential diagnosis. However histologic sections of wedge resected lung revealed diffuse pleural and interlobular septal lymphatic proliferation characteristic of DPL. Lymphangiomatosis Interstitial Lung Computed tomography INTRODUCTION Diffuse pulmonary lymphangiomatosis (DPL) is a diffuse lymphatic disease characterized by the proliferation of lymphatic vessels. DPL mostly affects children and young adults with an equal gender prevalence. DPL is a very rare disease and so far only five cases have been reported in middle-aged patients in the English-language literature to our knowledge (1-5). Computed tomography (CT) findings for DPL include increased interlobular septal thickening peribronchovascular thickening patchy ground glass opacities pleural thickening pleural effusion and mediastinal soft tissue infiltration (5). Possible radiologic differential diagnoses include pulmonary edema pulmonary veno-occlusive disease Erdheim-Chester disease lymphangiectasis lymphangitic carcinomatosis sarcoidosis and pulmonary lymphoma. An increase in the size and the number of anastomosing lymphatic channels in interlobular septa or subpleural areas is seen histopathologically (2). Patients with DPL present with various clinical manifestations and usually have a progressive clinical course (2). Here we describe a middle-aged woman with DPL in whom clinical suspicion of lymphangitic metastasis was raised preoperatively. CASE REPORT A 52-year-old woman with abnormal chest radiographs was referred to our hospital. She was asymptomatic and denied having any cough wheezing or hemoptysis. Her past medical history was unremarkable. The findings of a physical examination were normal. Laboratory examination revealed a hemoglobin level of 14.1 g/dL a white blood cell count of 8160/µL (61.7% neutrophils 31.1% lymphocytes 2.6% eosinophils 4.4% monocytes and 0.2% basophils) and a platelet count of 209000/µL. Urine analysis findings blood chemistry findings and erythrocyte sedimentation rates were normal. Posteroanterior chest radiograph showed increased interstitial markings in both lungs (Fig. 1A). Diffuse smooth and nodular interlobular septal thickening and minimal amounts of bilateral pleural effusion were demonstrated on CT scan (Fig. 1B C). Low-density infiltration of mediastinal fat and lymph node enlargement were noted in the right anterior diaphragmatic area of a mediastinal window (Fig. 1D). Although the patient was asymptomatic these imaging findings persisted on the follow-up CT scan taken one month later. Our primary radiologic impression was that this was a case of lymphangitic carcinomatosis. Pulmonary edema sarcoidosis and lymphoma were included in the differential diagnosis. "
Lung_Cancer
"Survival curves of chimeric Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 250 and 167 days respectively. Survival curves of F1 Rb1F/F ;Trp53F/F mice containing either the invCag-Luc (black line) or the invCag-MycL1-Luc (red line) transgene intratracheally injected with Ad5-Cre. Median survival indicated by the dotted line was 235 and 140 days respectively. Luciferase activity emitted from the thorax of 11 F1 invCAG-MycL1-Luc;Rb1F/F ;Trp53F/F mice. Each line represents measurements of an individual mouse. MycL1 copy number in SCLC tumors from three different genotypes determined by real-time PCR and aCGH. Each circle represents a primary SCLC tumor. All tumors with more than four copies (dotted line) were considered positive for MycL1 amplification. Note that overexpression of MycL1 by the transgene significantly reduces the frequency of genomic MycL1 amplifications in tumors as compared to the Rb1F/F ;Trp53F/F control ( P = 0.002 Fisher's Exact Test) and the invCAG-Luc;Rb1F/F ;Trp53F/F control ( P = 0.035 Fischer's Exact Test). In vivo validation of Mycl1 as a bona fide oncogene in SCLC Tumors of small cell lung cancer patients often show amplifications of genomic regions coding for either MYCL1 c-MYC or NMYC (Iwakawa et al 2013). In SCLC tumors of the Rb1F/F ;Trp53F/F model amplifications of the genomic region 4qD2.2 coding for Mycl1 are frequently observed (Calbo et al 2005; Dooley et al 2011). To confirm that the Mycl1 oncogene plays a causal role in the progression of SCLC we adapted our frt-invCAG-Luc construct by introducing the Mycl1 cDNA and an internal ribosomal entry site (IRES) upstream of the Luc gene (supplementary Fig S8A). This construct named frt-invCAG-Mycl1-Luc allows for simultaneous expression of both Mycl1 and Luc after Cre recombination and was introduced in the re-derived Col1a1-frt targeted Rb1F/F ;Trp53F/F ESC clone 1B1 (Fig 3) with high efficiency (supplementary Table S2). Two ESC clones were used to generate chimeras (supplementary Table S1 and Fig S8B). These chimeras were treated intratracheally with Ad5-Cre and developed neuroendocrine carcinomas in lung with a considerably shorter latency as compared to the invCAG-Luc;Rb1F/F ;Trp53F/F chimeras with a median survival of 167 days as opposed to 250 days (Fig 4C). This tumor acceleration was even more pronounced in the F1 cohorts which showed a median survival of 235 days for invCAG-Luc and 140 days for invCAG-Mycl1-Luc (Fig 4D) highlighting the importance of Mycl1 in SCLC development. This additional decrease in tumor latency is likely caused by the increase in target cell population in the F1 mice as compared to the chimeras especially since lung tissue showed the least contribution of GEMM-ESCs in chimeric mice (Fig 2C)."
Lung_Cancer