File size: 2,360 Bytes
e894332 44646c0 e894332 44646c0 e894332 |
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 |
---
license: cc-by-nc-sa-4.0
widget:
- text: AGTCCAGTGGACGACCAGCCACGGCTCCGGTCTGTAGAACCATCGCGGAAACGGCTCGCAAAACTCTAAACAGCGCAAACGATGCGCGCGCCGAAGCAACCCGGCTCTACTTATAAAAACGTCCAACGGTGAGCACCGAGCAGCTACTACTCGTACTCCCCCCACCGATC
tags:
- DNA
- biology
- genomics
---
# Plant foundation DNA large language models
The plant DNA large language models (LLMs) contain a series of foundation models based on different model architectures, which are pre-trained on various plant reference genomes.
All the models have a comparable model size between 90 MB and 150 MB, BPE tokenizer is used for tokenization and 8000 tokens are included in the vocabulary.
**Developed by:** zhangtaolab
### Model Sources
- **Repository:** [Plant DNA LLMs](https://github.com/zhangtaolab/plant_DNA_LLMs)
- **Manuscript:** [Versatile applications of foundation DNA large language models in plant genomes]()
### Architecture
The model is trained based on the InstaDeepAI/agro-nucleotide-transformer-1b model.
This model is fine-tuned for predicting promoter strength in maize protoplasts system.
### How to use
Install the runtime library first:
```bash
pip install transformers
```
Here is a simple code for inference:
```python
from transformers import AutoModelForSequenceClassification, AutoTokenizer, pipeline
model_name = 'agront-1b-promoter_strength_protoplast'
# load model and tokenizer
model = AutoModelForSequenceClassification.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
tokenizer = AutoTokenizer.from_pretrained(f'zhangtaolab/{model_name}', trust_remote_code=True)
# inference
sequences = ['TACTCTAATCGTATCAGCTGCACTTGCGTACAGGCTACCGGCGTCCTCAGCCACGTAAGAAAAGGCCCAATAAAGGCCCAACTACAACCAGCGGATATATATACTGGAGCCTGGCGAGATCACCCTAACCCCTCACACTCCCATCCAGCCGCCACCAGGTGCAGAGTGTT',
'ATTTCAAAACTAGTTTTCTATAAACGAAAACTTATATTTATTCCGCTTGTTCCGTTTGATCTGCTGATTCGACACCGTTTTAACGTATTTTAAGTAAGTATCAGAAATATTAATGTGAAGATAAAAGAAAATAGAGTAAATGTAAAGGAAAATGCATAAGATTTTGTTGA']
pipe = pipeline('text-classification', model=model, tokenizer=tokenizer,
trust_remote_code=True, function_to_apply="none")
results = pipe(sequences)
print(results)
```
### Training data
We use EsmForSequenceClassification to fine-tune the model.
Detailed training procedure can be found in our manuscript.
#### Hardware
Model was trained on a NVIDIA RTX4090 GPU (24 GB).
|