YAML Metadata Warning: empty or missing yaml metadata in repo card (https://huggingface.co/docs/hub/model-cards#model-card-metadata)
A T5-large model
Trained from scratch on a mixed dataset of DNA, protein sequences, and English text
import torch
import numpy as np
from transformers import AutoTokenizer, AutoModelForSeq2SeqLM, Seq2SeqTrainer, Seq2SeqTrainingArguments
from datasets import load_dataset
tokenizer = AutoTokenizer.from_pretrained("dnagpt/t5-gene-eng-small")
print(tokenizer.tokenize("ATCGGAAGGTAAGGGAAAGCG"))
from transformers import AutoModelForSeq2SeqLM
model = AutoModelForSeq2SeqLM.from_pretrained("dnagpt/t5-gene-eng-small", from_flax=True)
print(model.config)
- Downloads last month
- 3
Inference Providers NEW
This model isn't deployed by any Inference Provider. 🙋 Ask for provider support